Identification of Mungbean yellow mosaic India virus infecting Vigna mungo var. silvestris L.

Directory of Open Access Journals (Sweden)

Kamaal NAIMUDDIN

2011-05-01

Full Text Available Normal 0 14 false false false IT ZH-TW X-NONE MicrosoftInternetExplorer4 /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Tabella normale"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-qformat:yes; mso-style-parent:""; mso-padding-alt:0cm 5.4pt 0cm 5.4pt; mso-para-margin-top:0cm; mso-para-margin-right:0cm; mso-para-margin-bottom:10.0pt; mso-para-margin-left:0cm; line-height:115%; mso-pagination:widow-orphan; font-size:11.0pt; font-family:"Calibri","sans-serif"; mso-ascii-font-family:Calibri; mso-ascii-theme-font:minor-latin; mso-hansi-font-family:Calibri; mso-hansi-theme-font:minor-latin; mso-bidi-font-family:"Times New Roman"; mso-bidi-theme-font:minor-bidi;} Yellow mosaic of Vigna mungo var.  silvestris, a wild relative of blackgram (Vigna mungo [L.] Hepper, was noticed at the Indian Institute of Pulses Research, Kanpur, India during 2008–2010, with an incidence of 100 per cent. The observed symptoms, consisting of veinal yellowing and scattered bright yellow spots, were suggestive of infection with a begomovirus. To characterize the virus, several sets of primer pairs were designed to amplify the targeted DNA fragments of the causal virus. The sequence data revealed that the coat protein (AV1 gene of the begomovirus under study contained a single open reading frame with 774 nucleotides, coding for 257 amino acids. Comparative analysis of the coat protein (AV1 gene of the virus under study (FJ821189 showed a 97 and 99% similarity with Mungbean yellow mosaic India virus (MYMIV-Mungbean strain at the nucleotide and the amino acid levels respectively. Sequence homology of different genes (AC1, AC2, AC3 and AC4 of the isolate under study (FJ663015 with MYMIV-Mungbean (EU523045 was 94–97% for the nucleotides and 91–99% for the amino acids sequence. Therefore, the begomovirus infecting V. mungo var. silvestris at Kanpur is to be considered a strain of MYMIV and is

Evidence of Oxidative Shielding of Offspring in a Wild Mammal

Directory of Open Access Journals (Sweden)

Emma I. K. Vitikainen

2016-05-01

Full Text Available Oxidative damage has been proposed as a potential mechanism underlying a life history tradeoff between survival and reproduction. However, evidence that reproduction is associated with increased oxidative damage is equivocal, and some studies have found that breeding females exhibit reduced, rather than elevated, levels of oxidative damage compared to equivalent non-breeders. Recently it was hypothesized that oxidative damage could have negative impacts on developing offspring, and that mothers might down-regulate oxidative damage during reproduction to shield their offspring from such damage. We tested this hypothesis through a longitudinal study of adult survival, reproduction, and oxidative damage in wild banded mongooses (Mungos mungo in Uganda. High levels of oxidative damage as measured by malondialdehyde (MDA were associated with reduced survival in both sexes. Levels of protein carbonyls were not linked to survival. Mothers showed reduced levels of MDA during pregnancy, and individuals with higher MDA levels gestated fewer offspring and had lower pup survival. These results suggest that maternal oxidative damage has transgenerational costs, and are consistent with the idea that mothers may attempt to shield their offspring from particularly harmful types of oxidative damage during pregnancy. We suggest that further advance in understanding of life history variation could benefit from theoretical and empirical exploration of the potential transgenerational costs of reproduction.

Endemic Marsh Mongoose Herpestes palustris (Carnivora: Herpestidae of East Kolkata Wetlands, India: a status report

Directory of Open Access Journals (Sweden)

J.K. Mallick

2009-04-01

Full Text Available Marsh Mongoose Herpestes palustris is the only extant endemic mammal of the East Kolkata wetlands, which has been declared a RAMSAR site in 2002. Since its first description by the scientists of the Zoological Survey of India, the population of this species has dwindled to an alarming state due to reclamation of the Salt Lake City and Rajarhat expansion, as well as from other anthropogenic causes. Recently, during a field survey only a small population of this endangered mongoose was found in a single location. Immediate conservation measures are required to be taken by the concerned authorities to stop its probable extinction in the near future.

First report of natural infection of Vigna mungo var. silvestris L. by Groundnut bud necrosis virus, a tospovirus

Directory of Open Access Journals (Sweden)

Mohammad AKRAM

2010-09-01

Full Text Available In the autumn of 2008, Vigna mungo var. silvestris growing in the experimental field of the Indian Institute of Pulses Research, Kanpur, India, showed chlorosis around some lateral veins and vein branches (mainly near the leaflet margin, downward curling of the leaf margins, necrosis of the stems and petioles, and twisting of the leaflets. Disease incidence was 20%. Symptoms indicated that the cause was Groundnut bud necrosis virus. The virus was identified on the basis of the symptoms on the diagnostic host, and the reverse transcription polymerase chain reaction (RT-PCR using specific primers of the NSm and NP genes. To our knowledge this is the first report of Groundnut bud necrosis virus on V. mungo var. silvestris.

The tropics and the rise of the British Empire: Mungo Park's perspective on Africa in the late eighteenth century.

Science.gov (United States)

Viana, Larissa

2011-03-01

The young Scottish physician Mungo Park, aged 23, arrived in Africa in 1795 with a mission as specific as it was complex in those bygone days, namely to travel the entire length of the River Niger. In 1799, the story of this journey was published in a book that sold 1500 copies in the first month alone, with two further editions published that same year, as well as the translation of the work into French and German the following year. In this article, the narrative of Mungo Park is examined by taking due consideration of the relationship between the tropics, science and travel in the early days of British expansionism into the heart of Africa.

Thermoluminescence dates for the Lake Mungo aboriginal fireplaces and the implications for radiocarbon dating

International Nuclear Information System (INIS)

Bell, W.T.

1991-01-01

During the Quaternary period in Australia large areas of western New South Wales and northern Victoria were covered by hundreds of lakes, both large and small. Nearly all are dry today but some may still be recognized by the long low dunes that follow the eastern shorelines. Many traces of early human occupation have been found along the shorelines of nearly all the major lakes and some of the best exposures have occurred on the lunette along the eastern shore of Lake Mungo. This lunette, has suffered massive erosion in recent times and this has uncovered the sites of many ancient fireplaces. Charcoal from some of these fireplaces has been dated by Barbetti and Polach (1973) using the radiocarbon method and the ages place the lakeside dwellers at Mungo in an area of Australian prehistory around 30 000 years ago. The baked sediment from below the fireplaces appears to have been heated to a temperature in excess of 400 o C according to archaeomagnetic studies carried out by Barbetti (1973) and this indicated that the fireplaces might lend themselves to the technique of thermoluminescence (TL) dating. The results of the TL dating programme are described elsewhere. (author)

Thermoluminescence dates for the Lake Mungo aboriginal fireplaces and the implications for radiocarbon dating

Energy Technology Data Exchange (ETDEWEB)

Bell, W T [Australian National Univ., Canberra (Australia)

1991-02-01

During the Quaternary period in Australia large areas of western New South Wales and northern Victoria were covered by hundreds of lakes, both large and small. Nearly all are dry today but some may still be recognized by the long low dunes that follow the eastern shorelines. Many traces of early human occupation have been found along the shorelines of nearly all the major lakes and some of the best exposures have occurred on the lunette along the eastern shore of Lake Mungo. This lunette, has suffered massive erosion in recent times and this has uncovered the sites of many ancient fireplaces. Charcoal from some of these fireplaces has been dated by Barbetti and Polach (1973) using the radiocarbon method and the ages place the lakeside dwellers at Mungo in an area of Australian prehistory around 30 000 years ago. The baked sediment from below the fireplaces appears to have been heated to a temperature in excess of 400{sup o}C according to archaeomagnetic studies carried out by Barbetti (1973) and this indicated that the fireplaces might lend themselves to the technique of thermoluminescence (TL) dating. The results of the TL dating programme are described elsewhere. (author).

Initial experience with the 3.3 Fr Mongoose® pigtail catheter for aortic angiography during patent ductus arteriosus closure in small patients.

Science.gov (United States)

Hena, Zachary; Sutton, Nicole J; Gates, Gregory J; Taragin, Benjamin H; Pass, Robert H

2017-01-01

Smaller femoral arterial sheaths may be associated with fewer vascular complications. The 3.3 Fr Mongoose ® Pediavascular pigtail catheter is a catheter that allows higher flow rates, potentially resulting in improved angiographic quality. We reviewed our experience with this small catheter during patent ductus arteriosus (PDA) closure. Review of patients ≤20 kg in whom the Mongoose ® catheter was used during PDA closure from 12/13 to 4/15. Angiographic efficacy and procedural details were compared to ten 4 Fr catheter cases. Comparisons were performed using Mann-Whitney U-test; P closure in small children.

Snapshot of Viral Infections in Wild Carnivores Reveals Ubiquity of Parvovirus and Susceptibility of Egyptian Mongoose to Feline Panleukopenia Virus

Science.gov (United States)

Duarte, Margarida D.; Henriques, Ana Margarida; Barros, Sílvia Carla; Fagulha, Teresa; Mendonça, Paula; Carvalho, Paulo; Monteiro, Madalena; Fevereiro, Miguel; Basto, Mafalda P.; Rosalino, Luís Miguel; Barros, Tânia; Bandeira, Victor; Fonseca, Carlos; Cunha, Mónica V.

2013-01-01

The exposure of wild carnivores to viral pathogens, with emphasis on parvovirus (CPV/FPLV), was assessed based on the molecular screening of tissue samples from 128 hunted or accidentally road-killed animals collected in Portugal from 2008 to 2011, including Egyptian mongoose (Herpestes ichneumon, n = 99), red fox (Vulpes vulpes, n = 19), stone marten (Martes foina, n = 3), common genet (Genetta genetta, n = 3) and Eurasian badger (Meles meles, n = 4). A high prevalence of parvovirus DNA (63%) was detected among all surveyed species, particularly in mongooses (58%) and red foxes (79%), along with the presence of CPV/FPLV circulating antibodies that were identified in 90% of a subset of parvovirus-DNA positive samples. Most specimens were extensively autolysed, restricting macro and microscopic investigations for lesion evaluation. Whenever possible to examine, signs of active disease were not present, supporting the hypothesis that the parvovirus vp2 gene fragments detected by real-time PCR possibly correspond to viral DNA reminiscent from previous infections. The molecular characterization of viruses, based on the analysis of the complete or partial sequence of the vp2 gene, allowed typifying three viral strains of mongoose and four red fox’s as feline panleukopenia virus (FPLV) and one stone marten’s as newCPV-2b type. The genetic similarity found between the FPLV viruses from free-ranging and captive wild species originated in Portugal and publicly available comparable sequences, suggests a closer genetic relatedness among FPLV circulating in Portugal. Although the clinical and epidemiological significance of infection could not be established, this study evidences that exposure of sympatric wild carnivores to parvovirus is common and geographically widespread, potentially carrying a risk to susceptible populations at the wildlife-domestic interface and to threatened species, such as the wildcat (Felis silvestris) and the critically

Purification, crystallization and preliminary crystallographic studies of haemoglobin from mongoose (Helogale parvula) in two different crystal forms induced by pH variation.

Science.gov (United States)

Mohamed Abubakkar, M; Saraboji, K; Ponnuswamy, M N

2013-02-01

Haemoglobin (Hb) is a respiratory pigment; it is a tetrameric protein that ferries oxygen from the lungs to tissues and transports carbon dioxide on the return journey. The oxygen affinity of haemoglobin is regulated by the concentration of oxygen surrounding it and several efforts have revealed the shapes of Hb in different states and with different functions. However, study of the molecular basis of Hbs from low-oxygen-affinity species is critically needed in order to increase the understanding of the mechanism behind oxygen adaptation. The present study reports the preliminary crystallographic study of low-oxygen-affinity haemoglobin from mongoose, a burrowing mammal. Haemoglobin from mongoose was purified by anion-exchange chromatography, crystallized using the hanging-drop vapour-diffusion method and diffraction data sets were collected from monoclinic (2.3 Å resolution) and orthorhombic (2.9 Å resolution) crystal forms obtained by pH variation. The monoclinic and orthorhombic asymmetric units contained half and a whole biological molecule, respectively.

Structural characterization of silver nanoparticles phyto-mediated by a plant waste, seed hull of Vigna mungo and their biological applications

Science.gov (United States)

Varadavenkatesan, Thivaharan; Vinayagam, Ramesh; Selvaraj, Raja

2017-11-01

Nanobiotechnology has rapidly become a critical facet of nanotechnology. The green synthesis of silver nanoparticles, making use of the hull of black gram (Vigna mungo), paves the way for a simple and eco-friendly utilization of a domestic waste to a product with antioxidant and anticoagulant activities. The emergence of silver nanoparticles was characterized by a variety of methods UV-visible spectrophotometry, scanning electron microscopy added to energy dispersive spectroscopy, X-ray diffractometry, particle size distribution and FT-IR spectroscopy analyses. A discrete band at 421 nm was obtained from UV-visible spectroscopy of the silver nanoparticle suspension. The extract sourced from the hull of black gram showed evidence of the presence of a variety of functional moieties of phytochemicals using FTIR spectroscopy. These were also deemed responsible for maintaining the stability of silver nanoparticles. SEM and EDAX techniques combined, proved that the zero-valent silver nanoparticles were lesser than 100 nm in size. The crystallinity of the nanoparticles was confirmed, as deduced by the (1 1 1) plane, from XRD analysis. The potential of the phytochemicals in maintaining the steadiness of nanoparticles was implied by the zeta potential value that stood at -30.3 mV. In the current study, we have endeavored to comprehend the antioxidant and anticoagulant nature of the green-synthesized benign silver nanoparticles.

Screening and Identification of putative long non coding RNAs from transcriptome data of a high yielding blackgram (Vigna mungo, Cv. T9

Directory of Open Access Journals (Sweden)

Pankaj Kumar Singh

2018-04-01

Full Text Available Blackgram (Vigna mungo is one of primary legumes cultivated throughout India, Cv.T9 being one of its common high yielding cultivar. This article reports RNA sequencing data and a pipeline for prediction of novel long non-coding RNAs from the sequenced data. The raw data generated during sequencing are available at Sequence Read Archive (SRA of NCBI with accession number- SRX1558530 Keywords: Blackgram, Long non-coding RNA, Legumes, RNA sequencing data

Structural characterization of neutral and acidic oligosaccharides in the milks of strepsirrhine primates: greater galago, aye-aye, Coquerel's sifaka and mongoose lemur.

Science.gov (United States)

Taufik, Epi; Fukuda, Kenji; Senda, Akitsugu; Saito, Tadao; Williams, Cathy; Tilden, Chris; Eisert, Regina; Oftedal, Olav; Urashima, Tadasu

2012-04-01

The structures of milk oligosaccharides were characterized for four strepsirrhine primates to examine the extent to which they resemble milk oligosaccharides in other primates. Neutral and acidic oligosaccharides were isolated from milk of the greater galago (Galagidae: Otolemur crassicaudatus), aye-aye (Daubentoniidae: Daubentonia madagascariensis), Coquerel's sifaka (Indriidae: Propithecus coquereli) and mongoose lemur (Lemuridae: Eulemur mongoz), and their chemical structures were characterized by (1)H-NMR spectroscopy. The oligosaccharide patterns observed among strepsirrhines did not appear to correlate to phylogeny, sociality or pattern of infant care. Both type I and type II neutral oligosaccharides were found in the milk of the aye-aye, but type II predominate over type I. Only type II oligosaccharides were identified in other strepsirrhine milks. α3'-GL (isoglobotriose, Gal(α1-3)Gal(β1-4)Glc) was found in the milks of Coquerel's sifaka and mongoose lemur, which is the first report of this oligosaccharide in the milk of any primate species. 2'-FL (Fuc(α1-2)Gal(β1-4)Glc) was found in the milk of an aye-aye with an ill infant. Oligosaccharides containing the Lewis x epitope were found in aye-aye and mongoose lemur milk. Among acidic oligosaccharides, 3'-N-acetylneuraminyllactose (3'-SL-NAc, Neu5Ac(α2-3)Gal(β1-4)Glc) was found in all studied species, whereas 6'-N-acetylneuraminyllactose (6'-SL-NAc, Neu5Ac(α2-6)Gal(β1-4)Glc) was found in all species except greater galago. Greater galago milk also contained 3'-N-glycolylneuraminyllactose (3'-SL-NGc, Neu5Gc(α2-3)Gal(β1-4)Glc). The finding of a variety of neutral and acidic oligosaccharides in the milks of strepsirrhines, as previously reported for haplorhines, suggests that such constituents are ancient rather than derived features, and are as characteristic of primate lactation is the classic disaccharide, lactose.

The effect of sodium chloride salinity on germination and productivity of mung bean (Vigna Mungo Linn.)

International Nuclear Information System (INIS)

Jabeen, M.; Azim, F.; Ibrar, M.; Hussain, F.; Ilahi, I.

2003-01-01

The germination was significantly declined at salinity levels of 5.0 dSm/sup -1/ and above in the laboratory experiment while in the pot experiment germination significantly reduced at salinity levels of 7.5 dSm/sup -1/ and above. Radicle and plumule lengths were also significantly reduced at 5.0 dSm/sup -1/ and higher levels of NaCl. Plant height, number of branches and number of leaves significantly decreased at 10.0 dSm/sup -1/ and higher levels of salinity. The number of seeds was significantly dwindled at 7.5 dSm/sup -1/ and above. Similarly, chlorophyll contents were also significantly low at 7.5 dSm/sup -1/ and higher concentrations. It was concluded that Vigna mungo might not show promising growth and productivity in saline habitats. However, under mild saline conditions it might be grown not only to supplement the crop yield, but also as a source of fodder and soil reclamation measure. (author)

Biofertilizing efficiency of Sargassum polycystum extract on growth and biochemical composition of Vigna radiata and Vigna mungo

Directory of Open Access Journals (Sweden)

B Bharath

2018-01-01

Full Text Available Objective: To evaluate the effect of marine brown alga Sargassum polycystum extract on growth and biochemical parameters of Vigna radiata and Vigna mungo.Methods: Different concentrations of algal extracts (0.5%, 1.0%, 2.0%, 3.0%, 4.0%, and 5.0% were prepared and applied to the crops at every 10-day intervals under natural conditions. After 30 d, the plants were harvested to evaluate the growth and biochemical parameters.Results: Seaweed liquid fertilizers treated seedlings showed maximum growth in 3.0% concentration when compared to the untreated seedlings. Similarly, biochemical parameters such as photosynthetic pigments, protein, reducing sugar, total sugar and amino acids exhibited increases in 3.0% concentration seaweed extract. Decreases in growth and biochemical parameters were noticed in concentrations higher than 3.0%.Conclusions: Presence of micronutrients and growth regulating substances in the liquid extract help healthier and faster productivity of the crop.

Molecular cytogenetic characterisation and phylogenetic analysis of the seven cultivated Vigna species (Fabaceae).

Science.gov (United States)

She, C-W; Jiang, X-H; Ou, L-J; Liu, J; Long, K-L; Zhang, L-H; Duan, W-T; Zhao, W; Hu, J-C

2015-01-01

The genomic organisation of the seven cultivated Vigna species, V. unguiculata, V. subterranea, V. angularis, V. umbellata, V. radiata, V. mungo and V. aconitifolia, was determined using sequential combined PI and DAPI (CPD) staining and dual-colour fluorescence in situ hybridisation (FISH) with 5S and 45S rDNA probes. For phylogenetic analyses, comparative genomic in situ hybridisation (cGISH) onto somatic chromosomes and sequence analysis of the internal transcribed spacer (ITS) of 45S rDNA were used. Quantitative karyotypes were established using chromosome measurements, fluorochrome bands and rDNA FISH signals. All species had symmetrical karyotypes composed of only metacentric or metacentric and submetacentric chromosomes. Distinct heterochromatin differentiation was revealed by CPD staining and DAPI counterstaining after FISH. The rDNA sites among all species differed in their number, location and size. cGISH of V. umbellata genomic DNA to the chromosomes of all species produced strong signals in all centromeric regions of V. umbellata and V. angularis, weak signals in all pericentromeric regions of V. aconitifolia, and CPD-banded proximal regions of V. mungo var. mungo. Molecular phylogenetic trees showed that V. angularis and V. umbellata were the closest relatives, and V. mungo and V. aconitifolia were relatively closely related; these species formed a group that was separated from another group comprising V. radiata, V. unguiculata ssp. sesquipedalis and V. subterranea. This result was consistent with the phylogenetic relationships inferred from the heterochromatin and cGISH patterns; thus, fluorochrome banding and cGISH are efficient tools for the phylogenetic analysis of Vigna species. © 2014 German Botanical Society and The Royal Botanical Society of the Netherlands.

Effect of simulated acid rain (sar) on some morphochemical aspects of mash (vigna mungo l.)

International Nuclear Information System (INIS)

Imran, H.A.; Hussain, M.; Hussain, S.

2014-01-01

The studies were conducted to evaluate the effect of simulated acid rain (SAR) at early plant growth on some morphochemical characters of two varieties of Mash (Vigna mungo L.) namely Mash 97 and Var. 95009. Different pH values were made by using H/sub 2/SO/sub 4/, HNO/sub 3/, and combination of both. The data revealed that low pH (3.5) of either sulphuric acid or the combination of H/sub 2/SO/sub 4/ and HNO/sub 3/ affected more severely at all parameters including number of leaves, shoot: root ratio, water contents of shoot and Potassium ion concentration. Whereas for a few parameters like plant height and number of branches the simulated acid rain of solution of pH 4.5 and 3.5 by using HNO/sub 3/ proved a bit better for plant growth, the root length was increased in case of SAR of solution of pH 3.5 by using H/sub 2/SO/sub 4/+HNO/sub 3/. Foliar application of SAR of solution of pH greater than 4.5 showed some improvement in crop growth due to fertilizer effect of solution's components. (author)

Bruchid egg induced transcript dynamics in developing seeds of black gram (Vigna mungo.

Directory of Open Access Journals (Sweden)

Indrani K Baruah

Full Text Available Black gram (Vigna mungo seeds are a rich source of digestible proteins, however, during storage these seeds are severely damaged by bruchids (Callosobruchus spp., reducing seed quality and yield losses. Most of the cultivated genotypes of black gram are susceptible to bruchids, however, few tolerant genotypes have also been identified but the mechanism of tolerance is poorly understood. We employed Suppression Subtractive Hybridization (SSH to identify specifically, but rarely expressed bruchid egg induced genes in black gram. In this study, Suppression Subtractive Hybridization (SSH library was constructed to study the genes involved in defense response in black gram against bruchid infestation. An EST library of 277 clones was obtained for further analyses. Based on CAP3 assembly, 134 unigenes were computationally annotated using Blast2GOPRO software. In all, 20 defense related genes were subject to quantitative PCR analysis (qPCR out of which 12 genes showed up-regulation in developing seeds of the pods oviposited by bruchids. Few major defense genes like defensin, pathogenesis related protein (PR, lipoxygenase (LOX showed high expression levels in the oviposited population when compared with the non-oviposited plants. This is the first report on defense related gene transcript dynamics during the bruchid-black gram interaction using SSH library. This library would be useful to clone defense related gene(s such as defensin as represented in our library for crop improvement.

Spectrum and frequency of chlorophyll mutations in urdbean (Vigna mungo L. Hepper) induced by EMS and gamma rays

International Nuclear Information System (INIS)

Sharma, A.K.; Singh, V.P.; Sarma, M.K.

2006-01-01

In mutation breeding experiment, plants with altered characteristics such as chlorophyll changes, sterility, plant lethality etc. could be the marker of the mutability of a variety. In fact, spectrum and frequency of chlorophyll mutations have been studied in the great detail. The chlorophyll mutation is the clear-cut indication of non-directional nature of mutation and possibility of induction of useful mutations. The spectrum and frequency of chlorophyll mutation was estimated by using gamma rays (100, 200, 300 and 400 Gy doses), EMS (0.2, 0.4, 0.6 and 0.8%) and combination of gamma rays (100, 200, 300 400 Gy) with 0.2 % concentration EMS on two cultivars, namely, Pant Urd-19 and Pant Urd-30 of urdbean ( Vigna mungo L. Hepper). Five different types of chlorophyll mutations viz., albina, xantha, viridis, chlorina and maculata were identified in both the cultivars. Almost all the combination treatments produced maximum frequency and wider spectrum of chlorophyll mutations followed by single treatment of gamma rays or EMS. The frequency of chlorophyll mutation increased with higher doses of mutagens but decreased at highest dose. Proc. Nat. Acad. Sci. India. 76(8), I, 2006. 64-68. (author)

MGS Esmeralda: new large seed mungbean cultivar MGS Esmeralda: nova cultivar de mungo-verde de sementes grandes

Directory of Open Access Journals (Sweden)

Rogério Faria Vieira

2008-06-01

Full Text Available Mungbean cultivar MGS Esmeralda was developed by Asian Vegetable Research and Development Center (Shanhua, Taiwan, as a result of crossing between the lines VC 1973A and VC 2768A. In ten trials conducted in the State of Minas Gerais, Brazil, it produced 13.5% more grains than 'Ouro Verde MG-2' (control cultivar, and its highest yield was 2,550 kg ha-1. The cultivar MGS Esmeralda is more susceptible to lodging, and its pods mature more uniformly than Ouro Verde MG-2 pods. One hundred-seed mass of 'MGS Esmeralda' ranged between 5.5 and 6.8 g. Both cultivars are susceptible to powdery mildew and cercospora leaf spot.A cultivar de mungo-verde MGS Esmeralda foi criada pelo Asian Vegetable Research and Development Center, localizado em Shanhua, Formosa. Ela é resultado do cruzamento entre as linhagens VC 1973A e VC 2768A. Em dez ensaios conduzidos em Minas Gerais, ela produziu 13,5% mais grãos do que a cultivar Ouro Verde MG-2 (testemunha, e sua produtividade mais alta foi 2.550 kg ha-1. A cultivar MGS Esmeralda é mais suscetível ao acamamento do que a Ouro Verde MG-2, mas suas vagens amadurecem mais uniformemente. A massa de 100 grãos da 'MGS Esmeralda' varia de 5,5 a 6,8 g. Ambas as cultivares são suscetíveis ao oídio e à cercosporiose.

Cowpox Virus in Llama, Italy

Science.gov (United States)

Brozzi, Alberto; Eleni, Claudia; Polici, Nicola; D’Alterio, Gianlorenzo; Carletti, Fabrizio; Scicluna, Maria Teresa; Castilletti, Concetta; Capobianchi, Maria R.; Di Caro, Antonino; Autorino, Gian Luca; Amaddeo, Demetrio

2011-01-01

Cowpox virus (CPXV) was isolated from skin lesions of a llama on a farm in Italy. Transmission electron microscopy showed brick-shaped particles consistent with orthopoxviruses. CPXV-antibodies were detected in llama and human serum samples; a CPXV isolate had a hemagglutinin sequence identical to CPXV-MonKre08/1–2-3 strains isolated from banded mongooses in Germany. PMID:21801638

Genetic Parameters and Combining Ability Effects of Parents for Seed Yield and other Quantitative Traits in Black Gram [Vigna mungo (L. Hepper

Directory of Open Access Journals (Sweden)

Supriyo CHAKRABORTY

2010-06-01

Full Text Available Line x tester analysis was carried out in black gram [Vigna mungo (L. Hepper], an edible legume, to estimate the gca (general combining ability effects of parents (3 lines and 3 testers and the SCA (specific combining ability effects of 9 crosses for seed yield and other eleven quantitative traits. Though additive and nonadditive gene actions governed the expression of quantitative traits, the magnitude of nonadditive gene action was higher than that of additive gene action for each quantitative trait. Two parents viz. UG157 and DPU915 were good general combiners. Two crosses namely PDB 88-31/DPU 915 and PLU 277/KAU7 had high per se performance along with positive significant SCA effect for seed yield/plant. The degree of dominance revealed overdominance for all the traits except clusters/plant with partial dominance. The predictability ratio also revealed the predominant role of nonadditive gene action in the genetic control of quantitative traits. Narrow sense heritability was also low for each trait. Recurrent selection or biparental mating followed by selection which can exploit both additive and nonadditive gene actions would be of interest for yield improvement in black gram. Due to presence of high magnitude of nonadditive gene action, heterosis breeding could also be attempted to develop low cost hybrid variety using genetic male sterility system in black gram.

Genetic Parameters and Combining Ability Effects of Parents for Seed Yield and other Quantitative Traits in Black Gram [Vigna mungo (L. Hepper

Directory of Open Access Journals (Sweden)

Supriyo CHAKRABORTY

2010-06-01

Full Text Available Line x tester analysis was carried out in black gram [Vigna mungo (L. Hepper], an edible legume, to estimate the gca (general combining ability effects of parents (3 lines and 3 testers and the SCA (specific combining ability effects of 9 crosses for seed yield and other eleven quantitative traits. Though additive and nonadditive gene actions governed the expression of quantitative traits, the magnitude of nonadditive gene action was higher than that of additive gene action for each quantitative trait. Two parents viz. �UG157� and �DPU915� were good general combiners. Two crosses namely �PDB 88-31�/�DPU 915� and �PLU 277�/�KAU7� had high per se performance along with positive significant SCA effect for seed yield/plant. The degree of dominance revealed overdominance for all the traits except clusters/plant with partial dominance. The predictability ratio also revealed the predominant role of nonadditive gene action in the genetic control of quantitative traits. Narrow sense heritability was also low for each trait. Recurrent selection or biparental mating followed by selection which can exploit both additive and nonadditive gene actions would be of interest for yield improvement in black gram. Due to presence of high magnitude of nonadditive gene action, heterosis breeding could also be attempted to develop low cost hybrid variety using genetic male sterility system in black gram.

Comparison of G protein sequences of South African street rabies viruses showing distinct progression of the disease in a mouse model of experimental rabies.

Science.gov (United States)

Seo, Wonhyo; Servat, Alexandre; Cliquet, Florence; Akinbowale, Jenkins; Prehaud, Christophe; Lafon, Monique; Sabeta, Claude

Rabies is a fatal zoonotic disease and infections generally lead to a fatal encephalomyelitis in both humans and animals. In South Africa, domestic (dogs) and the wildlife (yellow mongoose) host species maintain the canid and mongoose rabies variants respectively. In this study, pathogenicity differences of South African canid and mongoose rabies viruses were investigated in a murine model, by assessing the progression of clinical signs and survivorship. Comparison of glycoprotein gene sequences revealed amino acid differences that may underpin the observed pathogenicity differences. Cumulatively, our results suggest that the canid rabies virus may be more neurovirulent in mice than the mongoose rabies variant. Copyright © 2017 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

Leaf crinkle disease in urdbean (Vigna mungo L. Hepper): An overview on causal agent, vector and host.

Science.gov (United States)

Gautam, Narinder Kumar; Kumar, Krishna; Prasad, Manoj

2016-05-01

Urdbean leaf crinkle disease (ULCD) is an economically significant widespread and devastating disease resulting in extreme crinkling, puckering and rugosity of leaves inflicting heavy yield losses annually in major urdbean-producing countries of the world. This disease is caused by urdbean leaf crinkle virus (ULCV). Urdbean (Vigna mungo L. Hepper) is relatively more susceptible than other pulses to leaf crinkle disease. Urdbean is an important and useful crop cultivated in various parts of South-East Asia and well adapted for cultivation under semi-arid and subtropical conditions. Aphids, insects and whiteflies have been reported as vectors of the disease. The virus is also transmitted through sap inoculation, grafting and seed. The loss in seed yield in ULCD-affected urdbean crop ranges from 35 to 81%, which is dependent upon type of genotype location and infection time. The diseased material and favourable climatic conditions contribute for the widespread viral disease. Anatomical and biochemical changes take place in the affected diseased plants. Genetic variations have been reported in the germplasm screening which suggest continuous screening of available varieties and new germplasm to search for new traits (new genes) and identify new sources of disease resistance. There are very few reports on breeding programmes for the development and release of varieties tolerant to ULCD. Mostly random amplified polymorphic DNA (RAPD) as well as inter-simple sequence repeat (ISSR) molecular markers have been utilized for fingerprinting of blackgram, and a few reports are there on sequence-tagged micro-satellite site (STMS) markers. There are so many RNA viruses which have also developed strategies to counteract silencing process by encoding suppressor proteins that create hindrances in the process. But, in the case of ULCV, there is no report available indicating which defence pathway is operating for its resistance in the plants and whether same silencing suppression

Comparative nutritional analysis between Vigna radiata and Vigna ...

African Journals Online (AJOL)

Vigna radiata (mung bean) and Vigna mungo (mash bean) of the family Fabaceae are among staple food in Pakistan. The experiments were conducted on these beans to determine the proximate composition such as moisture, ash, fibre, fat and protein content. The protein isolates from V. radiata and V. mungo was ...

The hierarchically organized splitting of chromosome bands into sub-bands analyzed by multicolor banding (MCB).

Science.gov (United States)

Lehrer, H; Weise, A; Michel, S; Starke, H; Mrasek, K; Heller, A; Kuechler, A; Claussen, U; Liehr, T

2004-01-01

To clarify the nature of chromosome sub-bands in more detail, the multicolor banding (MCB) probe-set for chromosome 5 was hybridized to normal metaphase spreads of GTG band levels at approximately 850, approximately 550, approximately 400 and approximately 300. It could be observed that as the chromosomes became shorter, more of the initial 39 MCB pseudo-colors disappeared, ending with 18 MCB pseudo-colored bands at the approximately 300-band level. The hierarchically organized splitting of bands into sub-bands was analyzed by comparing the disappearance or appearance of pseudo-color bands of the four different band levels. The regions to split first are telomere-near, centromere-near and in 5q23-->q31, followed by 5p15, 5p14, and all GTG dark bands in 5q apart from 5q12 and 5q32 and finalized by sub-band building in 5p15.2, 5q21.2-->q21.3, 5q23.1 and 5q34. The direction of band splitting towards the centromere or the telomere could be assigned to each band separately. Pseudo-colors assigned to GTG-light bands were resistant to band splitting. These observations are in concordance with the recently proposed concept of chromosome region-specific protein swelling. Copyright 2003 S. Karger AG, Basel

SINGLE-BAND, TRIPLE-BAND, OR MULTIPLE-BAND HUBBARD MODELS

NARCIS (Netherlands)

ESKES, H; SAWATZKY, GA

1991-01-01

The relevance of different models, such as the one-band t-J model and the three-band Emery model, as a realistic description of the electronic structure of high-T(c) materials is discussed. Starting from a multiband approach using cluster calculations and an impurity approach, the following

De novo Assembly, Characterization of Immature Seed Transcriptome and Development of Genic-SSR Markers in Black Gram [Vigna mungo (L. Hepper].

Directory of Open Access Journals (Sweden)

J Souframanien

Full Text Available Black gram [V. mungo (L. Hepper] is an important legume crop extensively grown in south and south-east Asia, where it is a major source of dietary protein for its predominantly vegetarian population. However, lack of genomic information and markers has become a limitation for genetic improvement of this crop. Here, we report the transcriptome sequencing of the immature seeds of black gram cv. TU94-2, by Illumina paired end sequencing technology to generate transcriptome sequences for gene discovery and genic-SSR marker development. A total of 17.2 million paired-end reads were generated and 48,291 transcript contigs (TCS were assembled with an average length of 443 bp. Based on sequence similarity search, 33,766 TCS showed significant similarity to known proteins. Among these, only 29,564 TCS were annotated with gene ontology (GO functional categories. A total number of 138 unique KEGG (Kyoto Encyclopedia of Genes and Genomes pathways were identified, of which majority of TCS are grouped into purine metabolism (678 followed by pyrimidine metabolism (263. A total of 48,291 TCS were searched for SSRs and 1,840 SSRs were identified in 1,572 TCS with an average frequency of one SSR per 11.9 kb. The tri-nucleotide repeats were most abundant (35% followed by di-nucleotide repeats (32%. PCR primer pairs were successfully designed for 933 SSR loci. Sequences analyses indicate that about 64.4% and 35.6% of the SSR motifs were present in the coding sequences (CDS and untranslated regions (UTRs respectively. Tri-nucleotide repeats (57.3% were preferentially present in the CDS. The rate of successful amplification and polymorphism were investigated using selected primers among 18 black gram accessions. Genic-SSR markers developed from the Illumina paired end sequencing of black gram immature seed transcriptome will provide a valuable resource for genetic diversity, evolution, linkage mapping, comparative genomics and marker-assisted selection in black gram.

De novo Assembly, Characterization of Immature Seed Transcriptome and Development of Genic-SSR Markers in Black Gram [Vigna mungo (L.) Hepper

Science.gov (United States)

Souframanien, J.; Reddy, Kandali Sreenivasulu

2015-01-01

Black gram [V. mungo (L.) Hepper] is an important legume crop extensively grown in south and south-east Asia, where it is a major source of dietary protein for its predominantly vegetarian population. However, lack of genomic information and markers has become a limitation for genetic improvement of this crop. Here, we report the transcriptome sequencing of the immature seeds of black gram cv. TU94-2, by Illumina paired end sequencing technology to generate transcriptome sequences for gene discovery and genic-SSR marker development. A total of 17.2 million paired-end reads were generated and 48,291 transcript contigs (TCS) were assembled with an average length of 443 bp. Based on sequence similarity search, 33,766 TCS showed significant similarity to known proteins. Among these, only 29,564 TCS were annotated with gene ontology (GO) functional categories. A total number of 138 unique KEGG (Kyoto Encyclopedia of Genes and Genomes) pathways were identified, of which majority of TCS are grouped into purine metabolism (678) followed by pyrimidine metabolism (263). A total of 48,291 TCS were searched for SSRs and 1,840 SSRs were identified in 1,572 TCS with an average frequency of one SSR per 11.9 kb. The tri-nucleotide repeats were most abundant (35%) followed by di-nucleotide repeats (32%). PCR primer pairs were successfully designed for 933 SSR loci. Sequences analyses indicate that about 64.4% and 35.6% of the SSR motifs were present in the coding sequences (CDS) and untranslated regions (UTRs) respectively. Tri-nucleotide repeats (57.3%) were preferentially present in the CDS. The rate of successful amplification and polymorphism were investigated using selected primers among 18 black gram accessions. Genic-SSR markers developed from the Illumina paired end sequencing of black gram immature seed transcriptome will provide a valuable resource for genetic diversity, evolution, linkage mapping, comparative genomics and marker-assisted selection in black gram. PMID

L-band brightness temperature disaggregation for use with S-band and C-band radiometer data for WCOM

Science.gov (United States)

Yao, P.; Shi, J.; Zhao, T.; Cosh, M. H.; Bindlish, R.

2017-12-01

There are two passive microwave sensors onboard the Water Cycle Observation Mission (WCOM), which includes a synthetic aperture radiometer operating at L-S-C bands and a scanning microwave radiometer operating from C- to W-bands. It provides a unique opportunity to disaggregate L-band brightness temperature (soil moisture) with S-band C-bands radiometer data. In this study, passive-only downscaling methodologies are developed and evaluated. Based on the radiative transfer modeling, it was found that the TBs (brightness temperature) between the L-band and S-band exhibit a linear relationship, and there is an exponential relationship between L-band and C-band. We carried out the downscaling results by two methods: (1) downscaling with L-S-C band passive measurements with the same incidence angle from payload IMI; (2) downscaling with L-C band passive measurements with different incidence angle from payloads IMI and PMI. The downscaling method with L-S bands with the same incident angle was first evaluated using SMEX02 data. The RMSE are 2.69 K and 1.52 K for H and V polarization respectively. The downscaling method with L-C bands is developed with different incident angles using SMEX03 data. The RMSE are 2.97 K and 2.68 K for H and V polarization respectively. These results showed that high-resolution L-band brightness temperature and soil moisture products could be generated from the future WCOM passive-only observations.

A Novel Ku-Band/Ka-Band and Ka-Band/E-Band Multimode Waveguide Couplers for Power Measurement of Traveling-Wave Tube Amplifier Harmonic Frequencies

Science.gov (United States)

Wintucky, Edwin G.; Simons, Rainee N.

2015-01-01

This paper presents the design, fabrication and test results for a novel waveguide multimode directional coupler (MDC). The coupler, fabricated from two dissimilar frequency band waveguides, is capable of isolating power at the second harmonic frequency from the fundamental power at the output port of a traveling-wave tube (TWT) amplifier. Test results from proof-of-concept demonstrations are presented for a Ku-band/Ka-band MDC and a Ka-band/E-band MDC. In addition to power measurements at harmonic frequencies, a potential application of the MDC is in the design of a satellite borne beacon source for atmospheric propagation studies at millimeter-wave (mm-wave) frequencies (Ka-band and E-band).

Reward banding to determine reporting rate of recovered mourning dove bands

Science.gov (United States)

Tomlinson, R.E.

1968-01-01

Reward bands placed on the other leg of certain regularly banded immature mourning doves (Zenaidura macroura) were used to develop information on reporting rates of recovered dove bands. Reports from 15 widely separated sections of the United States showed considerable variation in recovery rate of doves both with and without reward bands. The overall percentages of banded doves that were reported as recovered were 9.69% for those with reward bands and 3.83% for controls. The bandreporting rate for states influenced by publicity was 66%; that for states not influenced was 32%.

Dual-band frequency selective surface with large band separation and stable performance

Science.gov (United States)

Zhou, Hang; Qu, Shao-Bo; Peng, Wei-Dong; Lin, Bao-Qin; Wang, Jia-Fu; Ma, Hua; Zhang, Jie-Qiu; Bai, Peng; Wang, Xu-Hua; Xu, Zhuo

2012-05-01

A new technique of designing a dual-band frequency selective surface with large band separation is presented. This technique is based on a delicately designed topology of L- and Ku-band microwave filters. The two band-pass responses are generated by a capacitively-loaded square-loop frequency selective surface and an aperture-coupled frequency selective surface, respectively. A Faraday cage is located between the two frequency selective surface structures to eliminate undesired couplings. Based on this technique, a dual-band frequency selective surface with large band separation is designed, which possesses large band separation, high selectivity, and stable performance under various incident angles and different polarizations.

SHARPENDING OF THE VNIR AND SWIR BANDS OF THE WIDE BAND SPECTRAL IMAGER ONBOARD TIANGONG-II IMAGERY USING THE SELECTED BANDS

Directory of Open Access Journals (Sweden)

Q. Liu

2018-04-01

Full Text Available The Tiangong-II space lab was launched at the Jiuquan Satellite Launch Center of China on September 15, 2016. The Wide Band Spectral Imager (WBSI onboard the Tiangong-II has 14 visible and near-infrared (VNIR spectral bands covering the range from 403–990 nm and two shortwave infrared (SWIR bands covering the range from 1230–1250 nm and 1628–1652 nm respectively. In this paper the selected bands are proposed which aims at considering the closest spectral similarities between the VNIR with 100 m spatial resolution and SWIR bands with 200 m spatial resolution. The evaluation of Gram-Schmidt transform (GS sharpening techniques embedded in ENVI software is presented based on four types of the different low resolution pan band. The experimental results indicated that the VNIR band with higher CC value with the raw SWIR Band was selected, more texture information was injected the corresponding sharpened SWIR band image, and at that time another sharpened SWIR band image preserve the similar spectral and texture characteristics to the raw SWIR band image.

Dual-band frequency selective surface with large band separation and stable performance

International Nuclear Information System (INIS)

Zhou Hang; Qu Shao-Bo; Lin Bao-Qin; Wang Jia-Fu; Ma Hua; Zhang Jie-Qiu; Peng Wei-Dong; Bai Peng; Wang Xu-Hua; Xu Zhuo

2012-01-01

A new technique of designing a dual-band frequency selective surface with large band separation is presented. This technique is based on a delicately designed topology of L- and Ku-band microwave filters. The two band-pass responses are generated by a capacitively-loaded square-loop frequency selective surface and an aperture-coupled frequency selective surface, respectively. A Faraday cage is located between the two frequency selective surface structures to eliminate undesired couplings. Based on this technique, a dual-band frequency selective surface with large band separation is designed, which possesses large band separation, high selectivity, and stable performance under various incident angles and different polarizations. (electromagnetism, optics, acoustics, heat transfer, classical mechanics, and fluid dynamics)

Fenólicos totais e atividade antioxidante do extrato aquoso de broto de feijão-mungo (Vigna radiata L. Total phenolics and antioxidant activity of the aqueous extract of mung bean sprout (Vigna radiata L.

Directory of Open Access Journals (Sweden)

Vera Lúcia Arroxelas Galvão de Lima

2004-03-01

Full Text Available OBJETIVO: Considerando a importância dos compostos fenólicos em alimentos e que o broto de feijão-mungo vem sendo incluído na culinária brasileira, este estudo teve como objetivo quantificar o teor de fenólicos totais deste vegetal e avaliar a ação antioxidante do seu extrato aquoso. MÉTODOS: Os compostos fenólicos foram extraídos por quatro sistemas de solventes e dois métodos de extração, os quais foram diferenciados no tempo (2 e 1h e número de extrações (2 e 3 extrações. Os fenólicos totais dos extratos foram quantificados por método espectrofotométrico. RESULTADOS: Os extratos obtidos com água à temperatura ambiente (28ºC, nos dois métodos de extração, foram os que apresentaram maior quantidade de fenólicos totais, sem contudo apresentar diferença significativa entre eles. O método II, que consistiu de três extrações em 1h, pode ser considerado o melhor por ter utilizado menor tempo de extração. O extrato aquoso em sistema modelo b-caroteno/ácido linoléico exibiu ação antioxidante (48,07% de inibição da oxidação, entretanto foi inferior ao padrão BHT. CONCLUSÃO: O broto de feijão-mungo possui considerável quantidade de fenólicos totais, compostos responsáveis por sua ação antioxidante, cujo consumo pode proporcionar efeitos benéficos à saúde.OBJECTIVE: Considering the importance of phenolic compounds in foods and the increasing consumption of mung bean sprouts in Brazil, this study had the objective of quantifying the total phenolic content in this vegetable and to assess the antioxidant activity of its aqueous extract. METHODS: The phenolic compounds were extracted by four solvent systems and two extraction methods, which were different in time (2 and 1h and in number of extractions (2 and 3 extractions. The total phenolic content of the extracts were quantified by the spectrophotometric method. RESULTS: The extracts obtained with water at room temperature (28ºC in both extraction

Band structure of semiconductors

CERN Document Server

Tsidilkovski, I M

2013-01-01

Band Structure of Semiconductors provides a review of the theoretical and experimental methods of investigating band structure and an analysis of the results of the developments in this field. The book presents the problems, methods, and applications in the study of band structure. Topics on the computational methods of band structure; band structures of important semiconducting materials; behavior of an electron in a perturbed periodic field; effective masses and g-factors for the most commonly encountered band structures; and the treatment of cyclotron resonance, Shubnikov-de Haas oscillatio

The phylogeography of rabies in Grenada, West Indies, and implications for control.

Directory of Open Access Journals (Sweden)

Ulrike Zieger

2014-10-01

Full Text Available In Grenada, West Indies, rabies is endemic, and is thought to be maintained in a wildlife host, the small Indian mongoose (Herpestes auropunctatus with occasional spillover into other hosts. Therefore, the present study was undertaken to improve understanding of rabies epidemiology in Grenada and to inform rabies control policy. Mongooses were trapped island-wide between April 2011 and March 2013 and examined for the presence of Rabies virus (RABV antigen using the direct fluorescent antibody test (dFAT and PCR, and for serum neutralizing antibodies (SNA using the fluorescent antibody virus neutralization test (FAVN. An additional cohort of brain samples from clinical rabies suspects submitted between April 2011 and March 2014 were also investigated for the presence of virus. Two of the 171 (1.7% live-trapped mongooses were RABV positive by FAT and PCR, and 20 (11.7% had SNAs. Rabies was diagnosed in 31 of the submitted animals with suspicious clinical signs: 16 mongooses, 12 dogs, 2 cats and 1 goat. Our investigation has revealed that rabies infection spread from the northeast to the southwest of Grenada within the study period. Phylogenetic analysis revealed that the viruses from Grenada formed a monophyletic clade within the cosmopolitan lineage with a common ancestor predicted to have occurred recently (6-23 years ago, and are distinct from those found in Cuba and Puerto Rico, where mongoose rabies is also endemic. These data suggest that it is likely that this specific strain of RABV was imported from European regions rather than the Americas. These data contribute essential information for any potential rabies control program in Grenada and demonstrate the importance of a sound evidence base for planning interventions.

Atomic-Monolayer MoS2 Band-to-Band Tunneling Field-Effect Transistor

KAUST Repository

Lan, Yann Wen

2016-09-05

The experimental observation of band-to-band tunneling in novel tunneling field-effect transistors utilizing a monolayer of MoS2 as the conducting channel is demonstrated. Our results indicate that the strong gate-coupling efficiency enabled by two-dimensional materials, such as monolayer MoS2, results in the direct manifestation of a band-to-band tunneling current and an ambipolar transport.

Band-notched spiral antenna

Science.gov (United States)

Jeon, Jae; Chang, John

2018-03-13

A band-notched spiral antenna having one or more spiral arms extending from a radially inner end to a radially outer end for transmitting or receiving electromagnetic radiation over a frequency range, and one or more resonance structures positioned adjacent one or more segments of the spiral arm associated with a notch frequency band or bands of the frequency range so as to resonate and suppress the transmission or reception of electromagnetic radiation over said notch frequency band or bands.

Congenital Constriction Band Syndrome

OpenAIRE

Rajesh Gupta, Fareed Malik, Rishabh Gupta, M.A.Basit, Dara Singh

2008-01-01

Congenital constriction bands are anomalous bands that encircle a digit or an extremity. Congenitalconstriction band syndrome is rare condition and is mostly associated with other musculoskeletaldisorders.We report such a rare experience.

Report of isolations of unusual lyssaviruses (rabies and Mokola virus identified retrospectively from Zimbabwe : short communication

Directory of Open Access Journals (Sweden)

J. Bingham

2001-07-01

Full Text Available Rabies isolates that had been stored between 1983 and 1997 were examined with a panel of anti-lyssavirus nucleocapsid monoclonal antibodies. Out of 56 isolates from cats and various wild carnivore species, 1 isolate of Mokola virus and 5 other non-typical rabies viruses were identified. The Mokola virus isolate was diagnosed as rabies in 1993 from a cat. Genetic analysis of this isolate suggests that it falls in a distinct subgroup of the Mokola virus genotype. The 5 non-typical rabies viruses were isolated from honey badgers (Mellivora capensis, African civets (Civettictis civetta and an unidentified mongoose (Herpestidae. These isolates are representatives of rarely-reported wildlife-associated strains of rabies, probably maintained by the slender mongoose (Galerella sanguinea. These findings indicate that both Mokola virus and the mongoose-associated variant may be more common in Zimbabwe than is apparent from routine surveillance.

Single-Band and Dual-Band Infrared Detectors

Science.gov (United States)

Ting, David Z. (Inventor); Gunapala, Sarath D. (Inventor); Soibel, Alexander (Inventor); Nguyen, Jean (Inventor); Khoshakhlagh, Arezou (Inventor)

2017-01-01

Bias-switchable dual-band infrared detectors and methods of manufacturing such detectors are provided. The infrared detectors are based on a back-to-back heterojunction diode design, where the detector structure consists of, sequentially, a top contact layer, a unipolar hole barrier layer, an absorber layer, a unipolar electron barrier, a second absorber, a second unipolar hole barrier, and a bottom contact layer. In addition, by substantially reducing the width of one of the absorber layers, a single-band infrared detector can also be formed.

Band Edge Dynamics and Multiexciton Generation in Narrow Band Gap HgTe Nanocrystals.

Science.gov (United States)

Livache, Clément; Goubet, Nicolas; Martinez, Bertille; Jagtap, Amardeep; Qu, Junling; Ithurria, Sandrine; Silly, Mathieu G; Dubertret, Benoit; Lhuillier, Emmanuel

2018-04-11

Mercury chalcogenide nanocrystals and especially HgTe appear as an interesting platform for the design of low cost mid-infrared (mid-IR) detectors. Nevertheless, their electronic structure and transport properties remain poorly understood, and some critical aspects such as the carrier relaxation dynamics at the band edge have been pushed under the rug. Some of the previous reports on dynamics are setup-limited, and all of them have been obtained using photon energy far above the band edge. These observations raise two main questions: (i) what are the carrier dynamics at the band edge and (ii) should we expect some additional effect (multiexciton generation (MEG)) as such narrow band gap materials are excited far above the band edge? To answer these questions, we developed a high-bandwidth setup that allows us to understand and compare the carrier dynamics resonantly pumped at the band edge in the mid-IR and far above the band edge. We demonstrate that fast (>50 MHz) photoresponse can be obtained even in the mid-IR and that MEG is occurring in HgTe nanocrystal arrays with a threshold around 3 times the band edge energy. Furthermore, the photoresponse can be effectively tuned in magnitude and sign using a phototransistor configuration.

Noise exposure in marching bands

Science.gov (United States)

Keefe, Joseph

2005-09-01

Previous studies involving orchestras have shown that music ensembles can produce hazardous noise levels. There are no similar data for marching bands and pep bands. In order to evaluate the noise levels produced by marching and pep bands, 1/3-octave-band sound-pressure levels were measured while these groups rehearsed and performed. Data were collected while marching with the bands to ensure a realistic environment. Comparing these data to OSHA and NIOSH criteria, marching and pep band exposures often exceed safe values. For typical exposures, OSHA doses range from 11% to 295%, while NIOSH doses range from 35% to 3055%. Exposures that would be considered hazardous in the workplace are common in marching and pep bands; students and band directors should take steps to recognize the risk posed by various instruments and various locations, and should implement hearing conservation efforts.

B(M1) values in the band-crossing of shears bands in 197Pb

Science.gov (United States)

Krücken, R.; Cooper, J. R.; Beausang, C. W.; Novak, J. R.; Dewald, A.; Klug, T.; Kemper, G.; von Brentano, P.; Carpenter, M.; Wiedenhöver, I.

We present details of the band crossing mechanism of shears bands using the example of 197Pb. Absolute reduced matrix elements B(M1) were determined by means of a RDM lifetime measurement in one of the shears bands in 197Pb. The experiment was performed using the New Yale Plunger Device (NYPD) in conjunction with the Gammasphere array. Band mixing calculations on the basis of the semi-classical model of the shears mechanism are used to describe the transition matrix elements B(M1) and energies throughout the band-crossing regions. Good agreement with the data was obtained and the detailed composition of the states in the shears band are discussed.

Precipitation Estimation Using L-Band and C-Band Soil Moisture Retrievals

Science.gov (United States)

Koster, Randal D.; Brocca, Luca; Crow, Wade T.; Burgin, Mariko S.; De Lannoy, Gabrielle J. M.

2016-01-01

An established methodology for estimating precipitation amounts from satellite-based soil moisture retrievals is applied to L-band products from the Soil Moisture Active Passive (SMAP) and Soil Moisture and Ocean Salinity (SMOS) satellite missions and to a C-band product from the Advanced Scatterometer (ASCAT) mission. The precipitation estimates so obtained are evaluated against in situ (gauge-based) precipitation observations from across the globe. The precipitation estimation skill achieved using the L-band SMAP and SMOS data sets is higher than that obtained with the C-band product, as might be expected given that L-band is sensitive to a thicker layer of soil and thereby provides more information on the response of soil moisture to precipitation. The square of the correlation coefficient between the SMAP-based precipitation estimates and the observations (for aggregations to approximately100 km and 5 days) is on average about 0.6 in areas of high rain gauge density. Satellite missions specifically designed to monitor soil moisture thus do provide significant information on precipitation variability, information that could contribute to efforts in global precipitation estimation.

Evaluación de diez leguminosas con dos niveles de tecnología en un suelo ácido

Directory of Open Access Journals (Sweden)

Muñoz F. Jaime E.

1990-12-01

Full Text Available El trabajo se realizó durante dos semestres en la zona de Santander de Quilichao, con la finalidad de estudiar el comportamiento agronómico de diez leguminosas en suelos ácidos y sin riego; se empleó un diseño experimental de bloques al azar con arreglo en parcelas divididas con 10 tratamientos y 3 repeticiones. El análisis de varianza y la diferencia mínima significativa (DMS , permitieron comparar dos modalidades de tecnología: el manejo del agricultor y ligeras modificaciones en la fertilización. En los dos ensayos efectuados, no hubo diferencia entre tecnologías, el material de mejor comportamiento en rendimiento fue Caupí TV U 289-46, la menor variabilidad en los rendimientos la presentó el mungo PI 376873; existió mejor comportamiento de los materiales caupí y mungo, respecto a los Phaseolus en suelos ácidos.The present study was carried out during two halfyears at town of Santander de Quilichao (Cauca in order to study agronomic behaviour of ten leguminous in acid soils with and without watering; the experimental design used was the randomized blocks with an arrangement in split plots with 3 replications. The variance analysis and least significant difference aIlowed to compare 2 ways of technology: farmer management and slight modifications in the fertilizations. In two assays done, there were not differences between technologies, the material of best behaviour in yield was TUV 289- 46 cowpea,the smaIIest variability was observed in PI 376873 mungo; a better behaviour was observed in two Cowpea and mungo materials in relation with phaseolus in acid soils.

ISM band to U-NII band frequency transverter and method of frequency transversion

Science.gov (United States)

Stepp, Jeffrey David [Grandview, MO; Hensley, Dale [Grandview, MO

2006-09-12

A frequency transverter (10) and method for enabling bi-frequency dual-directional transfer of digitally encoded data on an RF carrier by translating between a crowded or otherwise undesirable first frequency band, such as the 2.4 GHz ISM band, and a less-crowded or otherwise desirable second frequency band, such as the 5.0 GHz 6.0 GHz U-NII band. In a preferred embodiment, the transverter (10) connects between an existing data radio (11) and its existing antenna (30), and comprises a bandswitch (12); an input RF isolating device (14); a transmuter (16); a converter (18); a dual output local oscillator (20); an output RF isolating device (22); and an antenna (24) tuned to the second frequency band. The bandswitch (12) allows for bypassing the transverter (10), thereby facilitating its use with legacy systems. The transmuter (14) and converter (16) are adapted to convert to and from, respectively, the second frequency band.

Design of a side-band-separating heterodyne mixer for band 9 of ALMA

NARCIS (Netherlands)

Baryshev, AM; Kooi, J; Mena, FR; Lodewijk, CRJ; Wild, W

2005-01-01

A side-band-separating (SBS) heterodyne mixer has been designed for the Atacama Large Millimeter Array (ALMA) 602-720 GHz band, as it will present a great improvement over the current double-side-band configuration under development at the moment. Here we present design details and the results of

Collapse and revival in inter-band oscillations of a two-band Bose-Hubbard model

Energy Technology Data Exchange (ETDEWEB)

Ploetz, Patrick; Wimberger, Sandro [Institut fuer Theoretische Physik, Universitaet Heidelberg, Philosophenweg 19, 69120 Heidelberg (Germany); Madronero, Javier, E-mail: ploetz@thphys.uni-heidelberg.d [Physik Department, Technische Universitaet Muenchen, James-Franck-Str. 1, 85748 Garching (Germany)

2010-04-28

We study the effect of a many-body interaction on inter-band oscillations in a two-band Bose-Hubbard model with an external Stark force. Weak and strong inter-band oscillations are observed, where the latter arise from a resonant coupling of the bands. These oscillations collapse and revive due to a weak two-body interaction between the atoms. Effective models for oscillations in and out of resonance are introduced that provide predictions for the system's behaviour, particularly for the time scales for the collapse and revival of the resonant inter-band oscillations. (fast track communication)

Side-band-separating heterodyne mixer for band 9 of ALMA.

NARCIS (Netherlands)

Mena, F. P.; Baryshev, A. M.; Kooi, J.; Lodewijk, C. F. J.; Gerlofsma, G.; Hesper, R.; Wild, W.; Shen, XC; Lu, W; Zhang, J; Dou, WB

2006-01-01

Here we present the realization of a side-band-separating (2SB) heterodyne mixer for the frequency range from 602 to 720 GHz (corresponding to ALMA band 9). The mixer, in brief, consists of a quadrature hybrid, two LO injectors, two SIS junctions, and three dumping loads. All the parts were modeled

The DSS-14 C-band exciter

Science.gov (United States)

Rowan, D. R.

1989-01-01

The development and implementation of a C-band exciter for use with the Block IV Receiver-Exciter Subsystem at Deep Space Station 14 (DSS-14) has been completed. The exciter supplements the standard capabilities of the Block IV system by providing a drive signal for the C-band transmitter while generating coherent translation frequencies for C-band (5-GHz) to S-band (2.2- to 2.3-GHz) Doppler extraction, C-band to L-band (1.6-GHz) zero delay measurements, and a level calibrated L-band test signal. Exciter functions are described, and a general explanation and description of the C-band uplink controller is presented.

Transport in bilayer and trilayer graphene: band gap engineering and band structure tuning

Science.gov (United States)

Zhu, Jun

2014-03-01

Controlling the stacking order of atomically thin 2D materials offers a powerful tool to control their properties. Linearly dispersed bands become hyperbolic in Bernal (AB) stacked bilayer graphene (BLG). Both Bernal (ABA) and rhombohedral (ABC) stacking occur in trilayer graphene (TLG), producing distinct band structures and electronic properties. A symmetry-breaking electric field perpendicular to the sample plane can further modify the band structures of BLG and TLG. In this talk, I will describe our experimental effort in these directions using dual-gated devices. Using thin HfO2 film deposited by ALD as gate dielectric, we are able to apply large displacement fields D > 6 V/nm and observe the opening and saturation of the field-induced band gap Eg in bilayer and ABC-stacked trilayer graphene, where the conduction in the mid gap changes by more than six decades. Its field and temperature dependence highlights the crucial role played by Coulomb disorder in facilitating hopping conduction and suppressing the effect of Eg in the tens of meV regime. In contrast, mid-gap conduction decreases with increasing D much more rapidly in clean h-BN dual-gated devices. Our studies also show the evolution of the band structure in ABA-stacked TLG, in particular the splitting of the Dirac-like bands in large D field and the signatures of two-band transport at high carrier densities. Comparison to theory reveals the need for more sophisticated treatment of electronic screening beyond self-consistent Hartree calculations to accurately predict the band structures of trilayer graphene and graphenic materials in general.

Advances in X-Band and S-Band Linear Accelerators for Security, NDT, and Other Applications

CERN Document Server

Mishin, Andrey V

2005-01-01

At AS&E High Energy Systems Division, we designed several new advanced high energy electron beam and X-ray sources. Our primary focus has always been in building the world's most portable commercial X-band accelerators. Today, our X-band systems frequently exceed performance of the similar S-band machines, while they are more portable compared to the latter. The new designs of the X-band accelerators in the most practical energy range from 1 MeV to 6 MeV have been tested delivering outstanding results. Seventy 6 MeV X-band linacs systems have been produced. The most compact linac for security is used by AS&E in a self-shielded, Shaped Energy™ cargo screening system. We pioneered using the X-band linear accelerators for CT, producing high quality images of oil pipes and wood logs. An X-band linear accelerator head on a robotic arm has been used for electron beam radiation curing of an odd-shaped graphite composite part. We developed the broad-range 4 MeV to over 10 MeV energy-regulated X-band ...

Band gap and band offset of (GaIn)(PSb) lattice matched to InP

Science.gov (United States)

Köhler, F.; Böhm, G.; Meyer, R.; Amann, M.-C.

2005-07-01

Metastable (GaxIn1-x)(PySb1-y) layers were grown on (001) InP substrates by gas source molecular beam epitaxy. Low-temperature photoluminescence spectroscopy was applied to these heterostructures and revealed spatially indirect band-to-band recombination of electrons localized in the InP with holes in the (GaxIn1-x)(PySb1-y). In addition, samples with layer thicknesses larger than 100nm showed direct PL across the band gap of (GaxIn1-x)(PySb1-y). Band-gap energies and band offset energies of (GaxIn1-x)(PySb1-y) relative to InP were derived from these PL data. A strong bowing parameter was observed.

Vigna mungo L. Hepper

African Journals Online (AJOL)

satyam

2013-03-13

Mar 13, 2013 ... Genetic engineering allows these genes to be transferred to cultivated varieties in order to enhance the tolerance to various stresses and hence stabilize .... primer: 5'. AATATCACGGGTAGCCAACG 3' and reverse primer 5'.

Vigna mungo (L.) Hepper

African Journals Online (AJOL)

PRECIOUS

2009-11-02

Nov 2, 2009 ... Available online at http://www.academicjournals.org/AJB .... g/100 g, Trifolium alexandrianum green manure (GM) @ 4 g/100 g. (on dry weight ... MN-S with concentrated sugar solution as an ad- ..... as an alternative fertilizer.

Dual-band infrared camera

Science.gov (United States)

Vogel, H.; Schlemmer, H.

2005-10-01

Every year, numerous accidents happen on European roads due to bad visibility (fog, night, heavy rain). Similarly, the dramatic aviation accidents of year 2001 in Milan and Zurich have reminded us that aviation safety is equally affected by reduced visibility. A dual-band thermal imager was developed in order to raise human situation awareness under conditions of reduced visibility especially in the automotive and aeronautical context but also for all transportation or surveillance tasks. The chosen wavelength bands are the Short Wave Infrared SWIR and the Long Wave Infrared LWIR band which are less obscured by reduced visibility conditions than the visible band. Furthermore, our field tests clearly show that the two different spectral bands very often contain complementary information. Pyramidal fusion is used to integrate complementary and redundant features of the multi-spectral images into a fused image which can be displayed on a monitor to provide more and better information for the driver or pilot.

Decay of superdeformed bands

International Nuclear Information System (INIS)

Carpenter, M.P.; Khoo, T.L.; Lauritsen, T.

1995-01-01

One of the major challenges in the study of superdeformation is to directly connect the large number of superdeformed bands now known to the yrast states. In this way, excitation energies, spins and parities can be assigned to the levels in the second well which is essential to establish the collective and single-particle components of these bands. This paper will review some of the progress which has been made to understand the decay of superdeformed bands using the new arrays including the measurement of the total decay spectrum and the establishment of direct one-step decays from the superdeformed band to the yrast line in 194 Hg. 42 refs., 5 figs

Ouro Verde MG 2: nova cultivar de mungo-verde para Minas Gerais Ouro Verde MG 2: new mungbean cultivar for Minas Gerais State, Brazil

Directory of Open Access Journals (Sweden)

Rogério F. Vieira

2002-03-01

Full Text Available Dentre várias linhagens introduzidas do "Asian Vegetable Research and Development Center" (AVRDC, sobressaiu a linhagem VC 3984-B-2-B-4-1-B, que recebeu o nome de Ouro Verde MG 2. Suas sementes são verde-brilhantes e o peso de 1000 unidades varia de 43 a 51 g. O início da floração ocorre em torno de 33 dias após a emergência e a primeira vagem madura surge entre 23 e 33 dias. Por se tratar de espécie de maturação desuniforme, podem ser necessárias duas a quatro colheitas. As plantas podem atingir 95 cm de altura. As vagens são marrom-escuras e concentram-se na parte superior da planta. É suscetível a duas doenças que geralmente aparecem no final do ciclo de vida do mungo-verde: míldio-pulverulento (Erysiphe polygoni e mancha-foliar-de-cercospora (Cercospora canescens. A 'Ouro Verde MG 2' é resistente ao acamamento, e o seu rendimento, em três ensaios instalados em dezembro, janeiro e fevereiro, variou de 1,5 a 2,0 t/ha. Esses rendimentos foram, em média, 12% superior ao da cultivar Ouro Verde.Among many accessions introduced from Asian Vegetable Research and Development Center (AVRDC, the VC 3984-B-2-B-4-1-B stood out and was named 'Ouro Verde MG 2'. The seeds are bright green and 1000-seed weight ranges from 43 to 51 g. Flowering starts approximately 33 days after emergence and the first pod ripens between 23 and 33 days later. As mungbean is a non-uniform maturation species, two to four harvests could be necessary. The plant can reach 95 cm high. The pods are dark brown and concentrated in the upper canopy. This cv. is susceptible to two diseases which generally appear late in the crop: powdery mildew (Erysiphe polygoni and cercospora leaf spot (Cercospora canescens. 'Ouro Verde MG 2' is resistant to lodging. The yield measured in three experiments carried out in December, January, and February, ranged from 1.5 to 2.0 t/ha. In average, these yields were 12% superior than the achieved by the cultivar 'Ouro Verde'.

50 MW C-band pulse klystron; 50MW C band pulse klystron

Energy Technology Data Exchange (ETDEWEB)

NONE

1999-03-01

C-band pulse klystron E3746 with an output of 50 MW class was developed jointly with the High-Energy Accelerator Research Organization in the Ministry of Education as the klystron for a linear accelerator. For a large-sized linear accelerator in the next generation, a klystron with higher operating frequency has been required to obtain a compact and efficient accelerator. In E3746, the problem of power resistance during high-frequency operation was solved by mounting a traveling-wave multi-cell output circuit. Moreover, stable operation in the pulse width of 2.5 {mu}s and the output of 54 MW was performed at the same operation efficiency (44%) as the conventional S-band tube by using the frequency (in a C-band frequency band) that is two times as high as the conventional general accelerator. (translated by NEDO)

Hazard banding in compliance with the new Globally Harmonised System (GHS) for use in control banding tools.

Science.gov (United States)

Arnone, Mario; Koppisch, Dorothea; Smola, Thomas; Gabriel, Stefan; Verbist, Koen; Visser, Remco

2015-10-01

Many control banding tools use hazard banding in risk assessments for the occupational handling of hazardous substances. The outcome of these assessments can be combined with advice for the required risk management measures (RMMs). The Globally Harmonised System of Classification and Labelling of Chemicals (GHS) has resulted in a change in the hazard communication elements, i.e. Hazard (H) statements instead of Risk-phrases. Hazard banding schemes that depend on the old form of safety information have to be adapted to the new rules. The purpose of this publication is to outline the rationales for the assignment of hazard bands to H statements under the GHS. Based on this, this publication proposes a hazard banding scheme that uses the information from the safety data sheets as the basis for assignment. The assignment of hazard bands tiered according to the severity of the underlying hazards supports the important principle of substitution. Additionally, the set of assignment rules permits an exposure-route-specific assignment of hazard bands, which is necessary for the proposed route-specific RMMs. Ideally, all control banding tools should apply the same assignment rules. This GHS-compliant hazard banding scheme can hopefully help to establish a unified hazard banding strategy in the various control banding tools. Copyright © 2015 Elsevier Inc. All rights reserved.

Band parameters of phosphorene

DEFF Research Database (Denmark)

Lew Yan Voon, L. C.; Wang, J.; Zhang, Y.

2015-01-01

Phosphorene is a two-dimensional nanomaterial with a direct band-gap at the Brillouin zone center. In this paper, we present a recently derived effective-mass theory of the band structure in the presence of strain and electric field, based upon group theory. Band parameters for this theory...... are computed using a first-principles theory based upon the generalized-gradient approximation to the density-functional theory. These parameters and Hamiltonian will be useful for modeling physical properties of phosphorene....

Computational Design of Flat-Band Material

Science.gov (United States)

Hase, I.; Yanagisawa, T.; Kawashima, K.

2018-02-01

Quantum mechanics states that hopping integral between local orbitals makes the energy band dispersive. However, in some special cases, there are bands with no dispersion due to quantum interference. These bands are called as flat band. Many models having flat band have been proposed, and many interesting physical properties are predicted. However, no real compound having flat band has been found yet despite the 25 years of vigorous researches. We have found that some pyrochlore oxides have quasi-flat band just below the Fermi level by first principles calculation. Moreover, their valence bands are well described by a tight-binding model of pyrochlore lattice with isotropic nearest neighbor hopping integral. This model belongs to a class of Mielke model, whose ground state is known to be ferromagnetic with appropriate carrier doping and on-site repulsive Coulomb interaction. We have also performed a spin-polarized band calculation for the hole-doped system from first principles and found that the ground state is ferromagnetic for some doping region. Interestingly, these compounds do not include magnetic element, such as transition metal and rare-earth elements.

Multi-band Modelling of Appearance

DEFF Research Database (Denmark)

Stegmann, Mikkel Bille; Larsen, Rasmus

2003-01-01

the appearance of both derived feature bands and an intensity band. As a special case of feature-band augmented appearance modelling we propose a dedicated representation with applications to face segmentation. The representation addresses a major problem within face recognition by lowering the sensitivity...

Multi-band Modelling of Appearance

DEFF Research Database (Denmark)

Stegmann, Mikkel Bille; Larsen, Rasmus

2002-01-01

the appearance of both derived feature bands and an intensity band. As a special case of feature-band augmented appearance modelling we propose a dedicated representation with applications to face segmentation. The representation addresses a major problem within face recognition by lowering the sensitivity...

Systematic study of β-band and correlation with g- band using power law and soft rotor formula

International Nuclear Information System (INIS)

Katoch, Vikas; Kaushik, Reetu; Sharma, S.; Gupta, J.B.

2014-01-01

The nuclear structure of even Z even N medium mass transitional nuclei consist of ground state band, K π =0 1 β-band, K π =2 1 γ- band and other higher bands. As we move away from closed shell, energy levels are low lying from spherical to deformed nuclei and energy deviated from ideal rotor behavior. The energy of these transitional nuclei in ground band can also be studied using Bohr Mottelson energy expression, Soft Rotor Formula (SRF), Power Law (PL) etc. Recently, Gupta et al. (2013) modified SRF for non zero band head K π =2 1 γ-band and reproduced the level energies. Here same formula applied for K π =0 1 β-band and the level energies are reproduced and compared with experimental energies. The power law is also used for recalculation of level energies and for useful comparison

Table of members of quasi-bands

International Nuclear Information System (INIS)

Sakai, Mitsuo.

1984-04-01

The probable members of the quasi-bands in even-even nuclei for Z between 6 and 100 are listed in this table. The terms quasi-bands have been introduced in the so-called spherical regions as the counter parts of the collective bands in the deformed regions. In the present compilation, the data for deformed nuclei are classified for convenience under the same titles, Quasi-Ground Band, Quasi-Beta Band and Quasi-Gamma Band, as are used for other nuclear regions. The present edition covers the literature through September, 1983. Fifteen newly discovered nuclides are included. The classification of energy level into quasi-bands is made on the basis of the systematic trend in the data over large groups of nuclei. (Kato, T.)

Band parameters of phosphorene

International Nuclear Information System (INIS)

Lew Yan Voon, L C; Wang, J; Zhang, Y; Willatzen, M

2015-01-01

Phosphorene is a two-dimensional nanomaterial with a direct band-gap at the Brillouin zone center. In this paper, we present a recently derived effective-mass theory of the band structure in the presence of strain and electric field, based upon group theory. Band parameters for this theory are computed using a first-principles theory based upon the generalized-gradient approximation to the density-functional theory. These parameters and Hamiltonian will be useful for modeling physical properties of phosphorene. (paper)

Amniotic constriction bands

Science.gov (United States)

... Supplements Videos & Tools Español You Are Here: Home → Medical Encyclopedia → Amniotic band sequence URL of this page: //medlineplus.gov/ency/ ... birth. The baby should be delivered in a medical center that has specialists experienced in caring for babies ... or partial loss of function of a body part. Congenital bands affecting large parts of the body cause the ...

Hetero-gate-dielectric double gate junctionless transistor (HGJLT) with reduced band-to-band tunnelling effects in subthreshold regime

International Nuclear Information System (INIS)

Ghosh, Bahniman; Mondal, Partha; Akram, M. W.; Bal, Punyasloka; Salimath, Akshay Kumar

2014-01-01

We propose a hetero-gate-dielectric double gate junctionless transistor (HGJLT), taking high-k gate insulator at source side and low-k gate insulator at drain side, which reduces the effects of band-to-band tunnelling (BTBT) in the sub-threshold region. A junctionless transistor (JLT) is turned off by the depletion of carriers in the highly doped thin channel (device layer) which results in a significant band overlap between the valence band of the channel region and the conduction band of the drain region, due to off-state drain bias, that triggers electrons to tunnel from the valence band of the channel region to the conduction band of the drain region leaving behind holes in the channel. These effects of band-to-band tunnelling increase the sub-threshold leakage current, and the accumulation of holes in the channel forms a parasitic bipolar junction transistor (n–p–n BJT for channel JLT) in the lateral direction by the source (emitter), channel (base) and drain (collector) regions in JLT structure in off-state. The proposed HGJLT reduces the subthreshold leakage current and suppresses the parasitic BJT action in off-state by reducing the band-to-band tunnelling probability. (semiconductor devices)

47 CFR 90.531 - Band plan.

Science.gov (United States)

2010-10-01

... 47 Telecommunication 5 2010-10-01 2010-10-01 false Band plan. 90.531 Section 90.531...-805 MHz Bands § 90.531 Band plan. This section sets forth the band plan for the 763-775 MHz and 793... and portables subject to Commission-approved regional planning committee regional plans. Transmitter...

Two-band superconductor magnesium diboride

International Nuclear Information System (INIS)

Xi, X X

2008-01-01

This review focuses on the most important features of the 40 K superconductor MgB 2 -the weakly interacting multiple bands (the σ and π bands) and the distinct multiple superconducting energy gaps (the σ and π gaps). Even though the pairing mechanism of superconductor MgB 2 is the conventional electron-phonon coupling, the prominent influence of the two bands and two gaps on its properties sets it apart from other superconductors. It leads to markedly different behaviors in upper critical field, vortex structure, magnetoresistance and many other superconducting and normal-state properties in MgB 2 from single-band superconductors. Further, it gives rise to new physics that does not exist in single-band superconductors, such as the internal Josephson effects between the two order parameters. These unique phenomena depend sensitively on scattering inside and between the two bands, and the intraband and interband scattering can be modified by chemical substitution and irradiation. MgB 2 has brought unprecedented attention to two-band superconductivity, which has been found to exist in other old and new superconductors. The legacy of MgB 2 will be long lasting because of this, as well as the lessons it teaches in terms of the search for new phonon-mediated higher T c superconductors

Comparison of band-to-band tunneling models in Si and Si—Ge junctions

International Nuclear Information System (INIS)

Jiao Yipeng; Wang Taihuan; Wei Kangliang; Du Gang; Liu Xiaoyan

2013-01-01

We compared several different band-to-band tunneling (BTBT) models with both Sentaurus and the two-dimensional full-band Monte Carlo simulator in Si homo-junctions and Si—Ge hetero-junctions. It was shown that in Si homo-junctions, different models could achieve similar results. However, in the Si—Ge hetero-junctions, there were significant differences among these models at high reverse biases (over 2 V). Compared to the nonlocal model, the local models in Sentaurus underrated the BTBT rate distinctly, and the Monte Carlo method was shown to give a better approximation. Additionally, it was found that in the Si region near the interface of the Si—Ge hetero-junctions, the direct tunneling rates increased largely due to the interaction of the band structures of Si and Ge. (semiconductor physics)

Deep-Space Ka-Band Flight Experience

Science.gov (United States)

Morabito, D. D.

2017-11-01

Lower frequency bands have become more congested in allocated bandwidth as there is increased competition between flight projects and other entities. Going to higher frequency bands offers significantly more bandwidth, allowing for the use of much higher data rates. However, Ka-band is more susceptible to weather effects than lower frequency bands currently used for most standard downlink telemetry operations. Future or prospective flight projects considering deep-space Ka-band (32-GHz) telemetry data links have expressed an interest in understanding past flight experience with received Ka-band downlink performance. Especially important to these flight projects is gaining a better understanding of weather effects from the experience of current or past missions that operated Ka-band radio systems. We will discuss the historical flight experience of several Ka-band missions starting from Mars Observer in 1993 up to present-day deep-space missions such as Kepler. The study of historical Ka-band flight experience allows one to recommend margin policy for future missions. Of particular interest, we will review previously reported-on flight experience with the Cassini spacecraft Ka-band radio system that has been used for radio science investigations as well as engineering studies from 2004 to 2015, when Cassini was in orbit around the planet Saturn. In this article, we will focus primarily on the Kepler spacecraft Ka-band link, which has been used for operational telemetry downlink from an Earth trailing orbit where the spacecraft resides. We analyzed the received Ka-band signal level data in order to characterize link performance over a wide range of weather conditions and as a function of elevation angle. Based on this analysis of Kepler and Cassini flight data, we found that a 4-dB margin with respect to adverse conditions ensures that we achieve at least a 95 percent data return.

Elastic band prediction equations for combined free-weight and elastic band bench presses and squats.

Science.gov (United States)

Shoepe, Todd C; Ramirez, David A; Almstedt, Hawley C

2010-01-01

Elastic bands added to traditional free-weight techniques have become a part of suggested training routines in recent years. Because of the variable loading patterns of elastic bands (i.e., greater stretch produces greater resistance), it is necessary to quantify the exact loading patterns of bands to identify the volume and intensity of training. The purpose of this study was to determine the length vs. tension properties of multiple sizes of a set of commonly used elastic bands to quantify the resistance that would be applied to free-weight plus elastic bench presses (BP) and squats (SQ). Five elastic bands of varying thickness were affixed to an overhead support beam. Dumbbells of varying weights were progressively added to the free end while the linear deformation was recorded with each subsequent weight increment. The resistance was plotted as a factor of linear deformation, and best-fit nonlinear logarithmic regression equations were then matched to the data. For both the BP and SQ loading conditions and all band thicknesses tested, R values were greater than 0.9623. These data suggest that differences in load exist as a result of the thickness of the elastic band, attachment technique, and type of exercise being performed. Facilities should adopt their own form of loading quantification to match their unique set of circumstances when acquiring, researching, and implementing elastic band and free-weight exercises into the training programs.

Solid State KA-Band, Solid State W-Band and TWT Amplifiers, Phase I

Data.gov (United States)

National Aeronautics and Space Administration — Phase I of the proposal describes plans to develop a state of the art transmitter for the W-Band and KA -Band Cloud Radar system. Our focus will be concentrated in...

The dynamics of a shear band

Science.gov (United States)

Giarola, Diana; Capuani, Domenico; Bigoni, Davide

2018-03-01

A shear band of finite length, formed inside a ductile material at a certain stage of a continued homogeneous strain, provides a dynamic perturbation to an incident wave field, which strongly influences the dynamics of the material and affects its path to failure. The investigation of this perturbation is presented for a ductile metal, with reference to the incremental mechanics of a material obeying the J2-deformation theory of plasticity (a special form of prestressed, elastic, anisotropic, and incompressible solid). The treatment originates from the derivation of integral representations relating the incremental mechanical fields at every point of the medium to the incremental displacement jump across the shear band faces, generated by an impinging wave. The boundary integral equations (under the plane strain assumption) are numerically approached through a collocation technique, which keeps into account the singularity at the shear band tips and permits the analysis of an incident wave impinging a shear band. It is shown that the presence of the shear band induces a resonance, visible in the incremental displacement field and in the stress intensity factor at the shear band tips, which promotes shear band growth. Moreover, the waves scattered by the shear band are shown to generate a fine texture of vibrations, parallel to the shear band line and propagating at a long distance from it, but leaving a sort of conical shadow zone, which emanates from the tips of the shear band.

Retrospective biodosimetry with small tooth enamel samples using K-Band and X-Band

International Nuclear Information System (INIS)

Gomez, Jorge A.; Kinoshita, Angela; Leonor, Sergio J.; Belmonte, Gustavo C.; Baffa, Oswaldo

2011-01-01

In an attempt to make the in vitro electron spin resonance (ESR) retrospective dosimetry of the tooth enamel a lesser invasive method, experiments using X-Band and K-Band were performed, aiming to determine conditions that could be used in cases of accidental exposures. First, a small prism from the enamel was removed and ground with an agate mortar and pestle until particles reach a diameter of approximately less than 0.5 mm. This enamel extraction process resulted in lower signal artifact compared with the direct enamel extraction performed with a diamond burr abrasion. The manual grinding of the enamel does not lead to any induced ESR signal artifact, whereas the use of a diamond burr at low speed produces a signal artifact equivalent to the dosimetric signal induced by a dose of 500 mGy of gamma irradiation. A mass of 25 mg of enamel was removed from a sound molar tooth previously irradiated in vitro with a dose of 100 mGy. This amount of enamel was enough to detect the dosimetric signal in a standard X-Band spectrometer. However using a K-Band spectrometer, samples mass between 5 and 10 mg were sufficient to obtain the same sensitivity. An overall evaluation of the uncertainties involved in the process in this and other dosimetric assessments performed at our laboratory indicates that it is possible at K-Band to estimate a 100 mGy dose with 25% accuracy. In addition, the use of K-Band also presented higher sensitivity and allowed the use of smaller sample mass in comparison with X-Band. Finally, the restoration process performed on a tooth after extraction of the 25 mg of enamel is described. This was conducted by dental treatment using photopolymerizable resin which enabled complete recovery of the tooth from the functional and aesthetic viewpoint showing that this procedure can be minimally invasive.

Retrospective biodosimetry with small tooth enamel samples using K-Band and X-Band

Energy Technology Data Exchange (ETDEWEB)

Gomez, Jorge A. [Departamento de Fisica, FFCLRP, Universidade de Sao Paulo, 14040-901 Ribeirao Preto, Sao Paulo (Brazil); Kinoshita, Angela [Departamento de Fisica, FFCLRP, Universidade de Sao Paulo, 14040-901 Ribeirao Preto, Sao Paulo (Brazil); Universidade Sagrado Coracao - USC, 17011-160 Bauru, Sao Paulo (Brazil); Leonor, Sergio J. [Departamento de Fisica, FFCLRP, Universidade de Sao Paulo, 14040-901 Ribeirao Preto, Sao Paulo (Brazil); Belmonte, Gustavo C. [Universidade Sagrado Coracao - USC, 17011-160 Bauru, Sao Paulo (Brazil); Baffa, Oswaldo, E-mail: baffa@usp.br [Departamento de Fisica, FFCLRP, Universidade de Sao Paulo, 14040-901 Ribeirao Preto, Sao Paulo (Brazil)

2011-09-15

In an attempt to make the in vitro electron spin resonance (ESR) retrospective dosimetry of the tooth enamel a lesser invasive method, experiments using X-Band and K-Band were performed, aiming to determine conditions that could be used in cases of accidental exposures. First, a small prism from the enamel was removed and ground with an agate mortar and pestle until particles reach a diameter of approximately less than 0.5 mm. This enamel extraction process resulted in lower signal artifact compared with the direct enamel extraction performed with a diamond burr abrasion. The manual grinding of the enamel does not lead to any induced ESR signal artifact, whereas the use of a diamond burr at low speed produces a signal artifact equivalent to the dosimetric signal induced by a dose of 500 mGy of gamma irradiation. A mass of 25 mg of enamel was removed from a sound molar tooth previously irradiated in vitro with a dose of 100 mGy. This amount of enamel was enough to detect the dosimetric signal in a standard X-Band spectrometer. However using a K-Band spectrometer, samples mass between 5 and 10 mg were sufficient to obtain the same sensitivity. An overall evaluation of the uncertainties involved in the process in this and other dosimetric assessments performed at our laboratory indicates that it is possible at K-Band to estimate a 100 mGy dose with 25% accuracy. In addition, the use of K-Band also presented higher sensitivity and allowed the use of smaller sample mass in comparison with X-Band. Finally, the restoration process performed on a tooth after extraction of the 25 mg of enamel is described. This was conducted by dental treatment using photopolymerizable resin which enabled complete recovery of the tooth from the functional and aesthetic viewpoint showing that this procedure can be minimally invasive.

Dust bands in the asteroid belt

International Nuclear Information System (INIS)

Sykes, M.V.; Greenberg, R.; Dermott, S.F.; Nicholson, P.D.; Burns, J.A.

1989-01-01

This paper describes the original IRAS observations leading to the discovery of the three dust bands in the asteroid belt and the analysis of data. Special attention is given to an analytical model of the dust band torus and to theories concerning the origin of the dust bands, with special attention given to the collisional equilibrium (asteroid family), the nonequilibrium (random collision), and the comet hypotheses of dust-band origin. It is noted that neither the equilibrium nor nonequilibrium models, as currently formulated, present a complete picture of the IRAS dust-band observations. 32 refs

Thematic mapper studies band correlation analysis

Science.gov (United States)

Ungar, S. G.; Kiang, R.

1976-01-01

Spectral data representative of thematic mapper candidate bands 1 and 3 to 7 were obtained by selecting appropriate combinations of bands from the JSC 24 channel multispectral scanner. Of all the bands assigned, only candidate bands 4 (.74 mu to .80 mu) and 5 (.80 mu to .91 mu) showed consistently high intercorrelation from region to region and time to time. This extremely high correlation persisted when looking at the composite data set in a multitemporal, multilocation domain. The GISS investigations lend positive confirmation to the hypothesis, that TM bands 4 and 5 are redundant.

Modeling direct band-to-band tunneling: From bulk to quantum-confined semiconductor devices

Science.gov (United States)

Carrillo-Nuñez, H.; Ziegler, A.; Luisier, M.; Schenk, A.

2015-06-01

A rigorous framework to study direct band-to-band tunneling (BTBT) in homo- and hetero-junction semiconductor nanodevices is introduced. An interaction Hamiltonian coupling conduction and valence bands (CVBs) is derived using a multiband envelope method. A general form of the BTBT probability is then obtained from the linear response to the "CVBs interaction" that drives the system out of equilibrium. Simple expressions in terms of the one-electron spectral function are developed to compute the BTBT current in two- and three-dimensional semiconductor structures. Additionally, a two-band envelope equation based on the Flietner model of imaginary dispersion is proposed for the same purpose. In order to characterize their accuracy and differences, both approaches are compared with full-band, atomistic quantum transport simulations of Ge, InAs, and InAs-Si Esaki diodes. As another numerical application, the BTBT current in InAs-Si nanowire tunnel field-effect transistors is computed. It is found that both approaches agree with high accuracy. The first one is considerably easier to conceive and could be implemented straightforwardly in existing quantum transport tools based on the effective mass approximation to account for BTBT in nanodevices.

Modeling direct band-to-band tunneling: From bulk to quantum-confined semiconductor devices

International Nuclear Information System (INIS)

Carrillo-Nuñez, H.; Ziegler, A.; Luisier, M.; Schenk, A.

2015-01-01

A rigorous framework to study direct band-to-band tunneling (BTBT) in homo- and hetero-junction semiconductor nanodevices is introduced. An interaction Hamiltonian coupling conduction and valence bands (CVBs) is derived using a multiband envelope method. A general form of the BTBT probability is then obtained from the linear response to the “CVBs interaction” that drives the system out of equilibrium. Simple expressions in terms of the one-electron spectral function are developed to compute the BTBT current in two- and three-dimensional semiconductor structures. Additionally, a two-band envelope equation based on the Flietner model of imaginary dispersion is proposed for the same purpose. In order to characterize their accuracy and differences, both approaches are compared with full-band, atomistic quantum transport simulations of Ge, InAs, and InAs-Si Esaki diodes. As another numerical application, the BTBT current in InAs-Si nanowire tunnel field-effect transistors is computed. It is found that both approaches agree with high accuracy. The first one is considerably easier to conceive and could be implemented straightforwardly in existing quantum transport tools based on the effective mass approximation to account for BTBT in nanodevices

Modeling direct band-to-band tunneling: From bulk to quantum-confined semiconductor devices

Energy Technology Data Exchange (ETDEWEB)

Carrillo-Nuñez, H.; Ziegler, A.; Luisier, M.; Schenk, A. [Integrated Systems Laboratory ETH Zürich, Gloriastrasse 35, 8092 Zürich (Switzerland)

2015-06-21

A rigorous framework to study direct band-to-band tunneling (BTBT) in homo- and hetero-junction semiconductor nanodevices is introduced. An interaction Hamiltonian coupling conduction and valence bands (CVBs) is derived using a multiband envelope method. A general form of the BTBT probability is then obtained from the linear response to the “CVBs interaction” that drives the system out of equilibrium. Simple expressions in terms of the one-electron spectral function are developed to compute the BTBT current in two- and three-dimensional semiconductor structures. Additionally, a two-band envelope equation based on the Flietner model of imaginary dispersion is proposed for the same purpose. In order to characterize their accuracy and differences, both approaches are compared with full-band, atomistic quantum transport simulations of Ge, InAs, and InAs-Si Esaki diodes. As another numerical application, the BTBT current in InAs-Si nanowire tunnel field-effect transistors is computed. It is found that both approaches agree with high accuracy. The first one is considerably easier to conceive and could be implemented straightforwardly in existing quantum transport tools based on the effective mass approximation to account for BTBT in nanodevices.

Superdeformed bands in 64147Gd83, a possible test of the existence of octupole correlations in superdeformed bands

International Nuclear Information System (INIS)

Zuber, K.; Balouka, D.; Beck, F.A.; Byrski, T.; Curien, D.; Duchene, G.; Gehringer, C.; Haas, B.; Merdinger, J.C.; Romain, P.; Santos, D.; Styczen, J.; Vivien, J.P.; Dudek, J.; Szymanski, Z.; Werner, T.

1990-01-01

Two discrete superdeformed bands (SD) have been identified in the nucleus 147 Gd. The transitions energies of the SD yrast band lie halfway between the γ-ray energies of the yrast SD band in 146 Gd while the transition energies of the excited band lie half way between the transition energies of the yrast SD band in 148 Gd. These two bands are shown to exhibit the presence of the pseudo SU(3) symmetry and also indicate the possible existence of octupole correlations at large elongations and high spins. (orig.)

Band-to-Band Misregistration of the Images of MODIS Onboard Calibrators and Its Impact on Calibration

Science.gov (United States)

Wang, Zhipeng; Xiong, Xiaoxiong

2017-01-01

The Moderate Resolution Imaging Spectroradiometer (MODIS) instruments aboard Terra and Aqua satellites are radiometrically calibrated on-orbit with a set of onboard calibrators (OBCs), including a solar diffuser, a blackbody, and a space view port through which the detectors can view the dark space. As a whisk-broom scanning spectroradiometer, thirty-six MODIS spectral bands are assembled in the along-scan direction on four focal plane assemblies (FPAs). These bands capture images of the same target sequentially with the motion of a scan mirror. Then the images are coregistered onboard by delaying the appropriate band-dependent amount of time, depending on the band locations on the FPA. While this coregistration mechanismis functioning well for the far-field remote targets such as earth view scenes or the moon, noticeable band-to-band misregistration in the along-scan direction has been observed for near field targets, particularly in OBCs. In this paper, the misregistration phenomenon is presented and analyzed. It is concluded that the root cause of the misregistration is that the rotating element of the instrument, the scan mirror, is displaced from the focus of the telescope primary mirror. The amount of the misregistrationis proportional to the band location on the FPA and is inversely proportional to the distance between the target and the scan mirror. The impact of this misregistration on the calibration of MODIS bands is discussed. In particular, the calculation of the detector gain coefficient m1of bands 8-16 (412 nm 870 nm) is improved by up to 1.5% for Aqua MODIS.

Infrared diffuse interstellar bands

Science.gov (United States)

Galazutdinov, G. A.; Lee, Jae-Joon; Han, Inwoo; Lee, Byeong-Cheol; Valyavin, G.; Krełowski, J.

2017-05-01

We present high-resolution (R ˜ 45 000) profiles of 14 diffuse interstellar bands in the ˜1.45 to ˜2.45 μm range based on spectra obtained with the Immersion Grating INfrared Spectrograph at the McDonald Observatory. The revised list of diffuse bands with accurately estimated rest wavelengths includes six new features. The diffuse band at 15 268.2 Å demonstrates a very symmetric profile shape and thus can serve as a reference for finding the 'interstellar correction' to the rest wavelength frame in the H range, which suffers from a lack of known atomic/molecular lines.

Analysis of optical band-gap shift in impurity doped ZnO thin films by using nonparabolic conduction band parameters

International Nuclear Information System (INIS)

Kim, Won Mok; Kim, Jin Soo; Jeong, Jeung-hyun; Park, Jong-Keuk; Baik, Young-Jun; Seong, Tae-Yeon

2013-01-01

Polycrystalline ZnO thin films both undoped and doped with various types of impurities, which covered the wide carrier concentration range of 10 16 –10 21 cm −3 , were prepared by magnetron sputtering, and their optical-band gaps were investigated. The experimentally measured optical band-gap shifts were analyzed by taking into account the carrier density dependent effective mass determined by the first-order nonparabolicity approximation. It was shown that the measured shifts in optical band-gaps in ZnO films doped with cationic dopants, which mainly perturb the conduction band, could be well represented by theoretical estimation in which the band-gap widening due to the band-filling effect and the band-gap renormalization due to the many-body effect derived for a weakly interacting electron-gas model were combined and the carrier density dependent effective mass was incorporated. - Highlights: ► Optical band-gaps of polycrystalline ZnO thin films were analyzed. ► Experimental carrier concentration range covered from 10 16 to 10 21 cm −3 . ► Nonparabolic conduction band parameters were used in theoretical analysis. ► The band-filling and the band-gap renormalization effects were considered. ► The measured optical band-gap shifts corresponded well with the calculated ones

Modelling band-to-band tunneling current in InP-based heterostructure photonic devices

NARCIS (Netherlands)

van Engelen, J.P.; Shen, L.; van der Tol, J.J.G.M.; Smit, M.K.; Kockaert, P.; Emplit, P.; Gorza, S.-P.; Massar, S.

2015-01-01

Some semiconductor photonic devices show large discontinuities in the band structure. Short tunnel paths caused by this band structure may lead to an excessive tunneling current, especially in highly doped layers. Modelling of this tunnelling current is therefore important when designing photonic

Change in optimum genetic algorithm solution with changing band discontinuities and band widths of electrically conducting copolymers

Science.gov (United States)

Kaur, Avneet; Bakhshi, A. K.

2010-04-01

The interest in copolymers stems from the fact that they present interesting electronic and optical properties leading to a variety of technological applications. In order to get a suitable copolymer for a specific application, genetic algorithm (GA) along with negative factor counting (NFC) method has recently been used. In this paper, we study the effect of change in the ratio of conduction band discontinuity to valence band discontinuity (Δ Ec/Δ Ev) on the optimum solution obtained from GA for model binary copolymers. The effect of varying bandwidths on the optimum GA solution is also investigated. The obtained results show that the optimum solution changes with varying parameters like band discontinuity and band width of constituent homopolymers. As the ratio Δ Ec/Δ Ev increases, band gap of optimum solution decreases. With increasing band widths of constituent homopolymers, the optimum solution tends to be dependent on the component with higher band gap.

Band connectivity for topological quantum chemistry: Band structures as a graph theory problem

Science.gov (United States)

Bradlyn, Barry; Elcoro, L.; Vergniory, M. G.; Cano, Jennifer; Wang, Zhijun; Felser, C.; Aroyo, M. I.; Bernevig, B. Andrei

2018-01-01

The conventional theory of solids is well suited to describing band structures locally near isolated points in momentum space, but struggles to capture the full, global picture necessary for understanding topological phenomena. In part of a recent paper [B. Bradlyn et al., Nature (London) 547, 298 (2017), 10.1038/nature23268], we have introduced the way to overcome this difficulty by formulating the problem of sewing together many disconnected local k .p band structures across the Brillouin zone in terms of graph theory. In this paper, we give the details of our full theoretical construction. We show that crystal symmetries strongly constrain the allowed connectivities of energy bands, and we employ graph theoretic techniques such as graph connectivity to enumerate all the solutions to these constraints. The tools of graph theory allow us to identify disconnected groups of bands in these solutions, and so identify topologically distinct insulating phases.

Wide Band to ''Double Band'' upgrade

International Nuclear Information System (INIS)

Kasper, P.; Currier, R.; Garbincius, P.; Butler, J.

1988-06-01

The Wide Band beam currently uses electrons obtained from secondary photon conversions to produce the photon beam incident on the experimental targets. By transporting the positrons produced in these conversions as well as the electrons it is possible to almost double the number of photons delivered to the experiments per primary beam proton. 11 figs

Thermal evolution of the band edges of 6H-SiC: X-ray methods compared to the optical band gap

International Nuclear Information System (INIS)

Miedema, P.S.; Beye, M.; Könnecke, R.; Schiwietz, G.; Föhlisch, A.

2014-01-01

Highlights: • Conduction band minima (CBM) of 6H-SiC are estimated with Si 2p XAS. • Valence band maxima (VBM) of 6H-SiC are estimated with non-resonant Si 2p XES. • Temperature-dependent VBM and CBM of 6H-SiC show asymmetric band gap closing. • XAS, XES and RIXS band gap estimates are compared with the optical band gap. • XAS + XES versus optical band gap provides core-excitonic screening energies. - Abstract: The band gap of semiconductors like silicon and silicon carbide (SiC) is the key for their device properties. In this research, the band gap of 6H-SiC and its temperature dependence were analyzed with silicon 2p X-ray absorption spectroscopy (XAS), X-ray emission spectroscopy (XES) and resonant inelastic X-ray scattering (RIXS) allowing for a separate analysis of the conduction-band minimum (CBM) and valence-band maximum (VBM) components of the band gap. The temperature-dependent asymmetric band gap shrinking of 6H-SiC was determined with a valence-band slope of +2.45 × 10 −4 eV/K and a conduction-band slope of −1.334 × 10 −4 eV/K. The apparent asymmetry, e.g., that two thirds of the band-gap shrinking with increasing temperature is due to the VBM evolution in 6H-SiC, is similar to the asymmetry obtained for pure silicon before. The overall band gap temperature-dependence determined with XAS and non-resonant XES is compared to temperature-dependent optical studies. The core-excitonic binding energy appearing in the Si 2p XAS is extracted as the main difference. In addition, the energy loss of the onset of the first band in RIXS yields to values similar to the optical band gap over the tested temperature range

UWB Filtering Power Divider with Two Narrow Notch-bands and Wide Stop-band

Science.gov (United States)

Wei, Feng; Wang, Xin-Yi; Zou, Xin Tong; Shi, Xiao Wei

2017-12-01

A compact filtering ultra-wideband (UWB) microstrip power divider (PD) with two sharply rejected notch-bands and wide stopband is analyzed and designed in this paper. The proposed UWB PD is based on a conventional Wilkinson power divider, while two stub loaded resonators (SLRs) are coupled into two symmetrical output ports to achieve a bandpass filtering response. The simplified composite right/left-handed (SCRLH) resonators are employed to generate the dual notched bands. Defected ground structure (DGS) is introduced to improve the passband performance. Good insertion/return losses, isolation and notch-band rejection are achieved as demonstrated in both simulation and experiment.

Band-type microelectrodes for amperometric immunoassays

Energy Technology Data Exchange (ETDEWEB)

Lee, Ga-Yeon; Chang, Young Wook; Ko, Hyuk [Department of Materials Science and Engineering, Yonsei University, 134 Shinchon-dong, Seodaemun-gu, Seoul, 120-749 (Korea, Republic of); Kang, Min-Jung [Korea Institute of Science and Technology (KIST), Seoul (Korea, Republic of); Pyun, Jae-Chul, E-mail: jcpyun@yonsei.ac.kr [Department of Materials Science and Engineering, Yonsei University, 134 Shinchon-dong, Seodaemun-gu, Seoul, 120-749 (Korea, Republic of)

2016-07-20

A band-type microelectrode was made using a parylene-N film as a passivation layer. A circular-type, mm-scale electrode with the same diameter as the band-type microelectrode was also made with an electrode area that was 5000 times larger than the band-type microelectrode. By comparing the amperometric signals of 3,5,3′,5′-tetramethylbenzidine (TMB) samples at different optical density (OD) values, the band-type microelectrode was determined to be 9 times more sensitive than the circular-type electrode. The properties of the circular-type and the band-type electrodes (e.g., the shape of their cyclic voltammograms, the type of diffusion layer used, and the diffusion layer thickness per unit electrode area) were characterized according to their electrode area using the COMSOL Multiphysics software. From these simulations, the band-type electrode was estimated to have the conventional microelectrode properties, even when the electrode area was 100 times larger than a conventional circular-type electrode. These results show that both the geometry and the area of an electrode can influence the properties of the electrode. Finally, amperometric analysis based on a band-type electrode was applied to commercial ELISA kits to analyze human hepatitis B surface antigen (hHBsAg) and human immunodeficiency virus (HIV) antibodies. - Highlights: • A band-type microelectrode was made using a parylene-N film as a passivation layer. • The band-type microelectrode was 14-times more sensitive than circular-type electrode. • The influence of geometry on microelectrode properties was simulated using COMSOL. • The band-type electrode was applied to ELISA kits for hHBsAg and hHIV-antibodies.

Convex Banding of the Covariance Matrix.

Science.gov (United States)

Bien, Jacob; Bunea, Florentina; Xiao, Luo

2016-01-01

We introduce a new sparse estimator of the covariance matrix for high-dimensional models in which the variables have a known ordering. Our estimator, which is the solution to a convex optimization problem, is equivalently expressed as an estimator which tapers the sample covariance matrix by a Toeplitz, sparsely-banded, data-adaptive matrix. As a result of this adaptivity, the convex banding estimator enjoys theoretical optimality properties not attained by previous banding or tapered estimators. In particular, our convex banding estimator is minimax rate adaptive in Frobenius and operator norms, up to log factors, over commonly-studied classes of covariance matrices, and over more general classes. Furthermore, it correctly recovers the bandwidth when the true covariance is exactly banded. Our convex formulation admits a simple and efficient algorithm. Empirical studies demonstrate its practical effectiveness and illustrate that our exactly-banded estimator works well even when the true covariance matrix is only close to a banded matrix, confirming our theoretical results. Our method compares favorably with all existing methods, in terms of accuracy and speed. We illustrate the practical merits of the convex banding estimator by showing that it can be used to improve the performance of discriminant analysis for classifying sound recordings.

Band-to-band transitions, selection rules, effective mass, and excitonic contributions in monoclinic β -Ga2O3

Science.gov (United States)

Mock, Alyssa; Korlacki, Rafał; Briley, Chad; Darakchieva, Vanya; Monemar, Bo; Kumagai, Yoshinao; Goto, Ken; Higashiwaki, Masataka; Schubert, Mathias

2017-12-01

We employ an eigenpolarization model including the description of direction dependent excitonic effects for rendering critical point structures within the dielectric function tensor of monoclinic β -Ga2O3 yielding a comprehensive analysis of generalized ellipsometry data obtained from 0.75-9 eV. The eigenpolarization model permits complete description of the dielectric response. We obtain, for single-electron and excitonic band-to-band transitions, anisotropic critical point model parameters including their polarization vectors within the monoclinic lattice. We compare our experimental analysis with results from density functional theory calculations performed using the Gaussian-attenuation-Perdew-Burke-Ernzerhof hybrid density functional. We present and discuss the order of the fundamental direct band-to-band transitions and their polarization selection rules, the electron and hole effective mass parameters for the three lowest band-to-band transitions, and their excitonic contributions. We find that the effective masses for holes are highly anisotropic and correlate with the selection rules for the fundamental band-to-band transitions. The observed transitions are polarized close to the direction of the lowest hole effective mass for the valence band participating in the transition.

Intruder bands in Z = 51 nuclei

International Nuclear Information System (INIS)

LaFosse, D.R.

1993-01-01

Recent investigations of h 11/2 proton intruder bands in odd 51 Sb nuclei are reported. In addition to experiments performed at SUNY Stony Brook and Chalk River, data from Early Implementation of GAMMASPHERE (analysis in progress) are presented. In particular, the nuclei 109 Sb and 111 Sb are discussed. Rotational bands based on the πh 11/2 orbital coupled to a 2p2h deformed state of the 50 Sn core have been observed. These bands have been observed to high spin, and in the case of 109 Sb to a rotational frequency of 1.4 MeV, the highest frequency observed in a heavy nucleus. The dynamic moments of inertia in these bands decrease slowly with frequency, suggesting a gradual band termination. The systematics of such bands in 109-119 Sb will be discussed

Band 3 in aging and neurological disease.

Science.gov (United States)

Kay, M M

1991-01-01

Senescent cell antigen appears on old cells and marks them for death by initiating the binding of IgG autoantibody and subsequent removal by phagocytes in mammals and other vertebrates. We have created a synthetic aging antigen that blocks binding of IgG to senescent cells in vitro. Synthetic senescent cell antigen might be effective in preventing cellular destruction in vivo in certain diseases, and can be used to manipulate cellular life span in situ. Senescent cell antigen is generated by the modification of an important structural and transport membrane molecule, protein band 3. Band 3 is present in cellular, nuclear, Golgi, and mitochondrial membranes as well as in cell membranes. Band 3 proteins in nucleated cells participate in cell surface patching and capping. Band 3 maintains acid-base balance by mediating the exchange of anions (e.g., chloride, bicarbonate), and is the binding site for glycolytic enzymes. It is responsible for CO2 exchange in all tissues and organs. Thus, it is the most heavily used anion transport system in the body. Band 3 is a major transmembrane structural protein which attaches the plasma membrane to the internal cell cytoskeleton by binding to band 2.1 (ankyrin). Oxidation generates senescent cell antigen in situ. Band 3 is present in the central nervous system, and differences have been described in band 3 between young and aging brain tissue. One autosomal recessive neurological disease, choreoacanthocytosis, is associated with band 3 abnormalities. The 150 residues of the carboxyl terminus segment of band 3 appear to be altered. In brains from Alzheimer's disease patients, antibodies to aged band 3 label the amyloid core of classical plaques and the microglial cells located in the middle of the plaque in tissue sections, and an abnormal band 3 in immunoblots. Band 3 protein(s) in mammalian brain performs the same functions as that of erythroid band 3. These functions is anion transport, ankyrin binding, and generation of

Energy correlations for mixed rotational bands

International Nuclear Information System (INIS)

Doessing, T.

1985-01-01

A schematic model for the mixing of rotational bands above the yrast line in well deformed nuclei is considered. Many-particle configurations of a rotating mean field form basis bands, and these are subsequently mixed due to a two body residual interaction. The energy interval over which a basis band is spread out increases with increasing excitation energy above the yrast line. Conversely, the B(E2) matrix element for rotational decay out of one of the mixed band states is spread over an interval which is predicted to become more narrow with increasing excitation energy. Finally, the implication of band mixing for γ-ray energy correlations is briefly discussed. (orig.)

Enhancement of computer program SPECTRAN to provide optional synthesis of 1/12 octave-band and critical-band spectra from 1/3 octave-band spectra

Energy Technology Data Exchange (ETDEWEB)

Chang, Young-Soo [Argonne National Lab., IL (United States); Liebich, R.E. [Raytheon Environmental Services Company, Cambridge, MA (United States)

1997-07-01

This paper describes greatly enhanced version of the computer program SPECTRAN, which was initially presented in Paper No. 96-RA104.01, at the A&WMA 89th Annual Meeting in June 1996. The program has had three basic upgrades since that time. The first is provision of an option to use either batch-mode input from previously prepared data files or a {open_quotes}user-friendly{close_quotes} interactive input routine. The latter is primarily for first-time users and those having only one, or very few, spectra to process. The second improvement is the synthesis of 1/12 octave-band spectra from 1/3 octave-band spectra, with {open_quotes}tone correction,{close_quotes} in a manner similar to that used in the original version of the program. The third fundamental improvement is addition of a unique new capability to synthesize classic {open_quotes}critical-band{close_quotes} spectra from 1/3 octave-band input spectra. Critical-band spectra are also termed {open_quotes}equivalent-rectangular-bandwidth (ERB){close_quotes} and {open_quotes}equal-contribution-to-speech (ECS){close_quotes} spectra.

Band Subset Selection for Hyperspectral Image Classification

Directory of Open Access Journals (Sweden)

Chunyan Yu

2018-01-01

Full Text Available This paper develops a new approach to band subset selection (BSS for hyperspectral image classification (HSIC which selects multiple bands simultaneously as a band subset, referred to as simultaneous multiple band selection (SMMBS, rather than one band at a time sequentially, referred to as sequential multiple band selection (SQMBS, as most traditional band selection methods do. In doing so, a criterion is particularly developed for BSS that can be used for HSIC. It is a linearly constrained minimum variance (LCMV derived from adaptive beamforming in array signal processing which can be used to model misclassification errors as the minimum variance. To avoid an exhaustive search for all possible band subsets, two numerical algorithms, referred to as sequential (SQ and successive (SC algorithms are also developed for LCMV-based SMMBS, called SQ LCMV-BSS and SC LCMV-BSS. Experimental results demonstrate that LCMV-based BSS has advantages over SQMBS.

The Low Band Observatory (LOBO): Expanding the VLA Low Frequency Commensal System for Continuous, Broad-band, sub-GHz Observations

Science.gov (United States)

Kassim, Namir E.; Clarke, Tracy E.; Helmboldt, Joseph F.; Peters, Wendy M.; Brisken, Walter; Hyman, Scott D.; Polisensky, Emil; Hicks, Brian

2015-01-01

The Naval Research Laboratory (NRL) and the National Radio Astronomy Observatory (NRAO) are currently commissioning the VLA Low Frequency Ionosphere and Transient Experiment (VLITE) on a subset of JVLA antennas at modest bandwidth. Its bounded scientific goals are to leverage thousands of JVLA on-sky hours per year for ionospheric and transient studies, and to demonstrate the practicality of a prime-focus commensal system on the JVLA. Here we explore the natural expansion of VLITE to a full-antenna, full-bandwidth Low Band Observatory (LOBO) that would follow naturally from a successful VLITE experience. The new Low Band JVLA receivers, coupled with the existing primary focus feeds, can access two frequency bands: 4 band (54 - 86 MHz) and P band (236-492 MHz). The 4 band feeds are newly designed and now undergoing testing. If they prove successful then they can be permanently mounted at the primary focus, unlike their narrow band predecessors. The combination of Low Band receivers and fixed, primary-focus feeds could provide continuous, broad-band data over two complimentary low-frequency bands. The system would also leverage the relatively large fields-of-view of ~10 degrees at 4 band, and ~2.5 degrees at P band, coupling an excellent survey capability with a natural advantage for serendipitous discoveries. We discuss the compelling science case that flows from LOBO's robust imaging and time domain capabilities coupled with thousands of hours of wide-field, JVLA observing time each year. We also touch on the possibility to incorporate Long Wavelength Array (LWA) stations as additional 'dishes' through the LOBO backend, to improve calibration and sensitivity in LOBO's 4 band.

Decreasing patient identification band errors by standardizing processes.

Science.gov (United States)

Walley, Susan Chu; Berger, Stephanie; Harris, Yolanda; Gallizzi, Gina; Hayes, Leslie

2013-04-01

Patient identification (ID) bands are an essential component in patient ID. Quality improvement methodology has been applied as a model to reduce ID band errors although previous studies have not addressed standardization of ID bands. Our specific aim was to decrease ID band errors by 50% in a 12-month period. The Six Sigma DMAIC (define, measure, analyze, improve, and control) quality improvement model was the framework for this study. ID bands at a tertiary care pediatric hospital were audited from January 2011 to January 2012 with continued audits to June 2012 to confirm the new process was in control. After analysis, the major improvement strategy implemented was standardization of styles of ID bands and labels. Additional interventions included educational initiatives regarding the new ID band processes and disseminating institutional and nursing unit data. A total of 4556 ID bands were audited with a preimprovement ID band error average rate of 9.2%. Significant variation in the ID band process was observed, including styles of ID bands. Interventions were focused on standardization of the ID band and labels. The ID band error rate improved to 5.2% in 9 months (95% confidence interval: 2.5-5.5; P error rates. This decrease in ID band error rates was maintained over the subsequent 8 months.

Interpolation of band-limited discrete-time signals by minimising out-of-band energy

NARCIS (Netherlands)

Janssen, A.J.E.M.; Vries, L.B.

1984-01-01

An interpolation method for restoring burst errors in discrete—time, band—limited signals is presented. The restoration is such that the restored signal has minimal out—of—band energy. The filter coefficients depend Only on the burst length and on the size of the band to which the signal is assumed

Band-gap and band-edge engineering of multicomponent garnet scintillators from first principles

Czech Academy of Sciences Publication Activity Database

Yadav, S.K.; Uberuaga, B.P.; Nikl, Martin; Jiang, C.; Stanek, C.R.

2015-01-01

Roč. 4, č. 5 (2015), "054012-1"-"054012-9" ISSN 2331-7019 R&D Projects: GA ČR GAP204/12/0805 Institutional support: RVO:68378271 Keywords : scintillator * electronic band gap structure * garnets * band gap engineering Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 4.061, year: 2015

Treatment of Patellar Lower Pole Fracture with Modified Titanium Cable Tension Band Plus Patellar Tibial Tunnel Steel "8" Reduction Band.

Science.gov (United States)

Li, Jiaming; Wang, Decheng; He, Zhiliang; Shi, Hao

2018-01-08

To determine the efficacy of modified titanium tension band plus patellar tendon tunnel steel 8 "reduction band" versus titanium cable tension band fixation for the treatment of patellar lower pole fracture. 58 patients with lower patella fracture were enrolled in this study, including 30 patients treated with modified titanium cable tension band plus patellar tibial tunnel wire "8" tension band internal fixation (modified group), and 28 patients with titanium cable tension band fixation. All patients were followed up for 9∼15 months with an average of 11.6 months. Knee flexion was significantly improved in the modified group than in the titanium cable tension band group (111.33 ± 13 degrees versus 98.21 ± 21.70 degrees, P = 0.004). The fracture healing time showed no significant difference. At the end of the follow-up, the improvement excellent rate was 93.33% in the modified group, and 82.14% in the titanium cable tension band group. Titanium cable tension band internal fixation loosening was found in 2 cases, including 1 case of treatment by two surgeries without loose internal fixation. The modified titanium cable tension band with "8" tension band fixation showed better efficacy for lower patella fractures than titanium cable tension band fixation.

A UWB Band-Pass Antenna with Triple-Notched Band Using Common Direction Rectangular Complementary Split-Ring Resonators

Directory of Open Access Journals (Sweden)

Bo Yan

2013-01-01

Full Text Available A novel ultrawideband (UWB antenna which has a triple-band notch function is presented. The proposed antenna can block interfering signals from C-band satellite communication systems, IEEE802.11a, and HIPERLAN/2 WLAN systems for example. The antenna is excited by using novel common direction rectangular complementary split-ring resonators (CSRR fabricated on radiating patch of the dielectric substrate with coplanar waveguide (CPW feed strip line. The voltage standing wave ratio (VSWR of the proposed antenna is less than 2.0 in the frequency band from 2.8 to 12 GHz, while showing a very sharp band-rejection performance at 3.9 GHz, 5.2 GHz, and 5.9 GHz. The measurement results show that the proposed antenna provides good omnidirectional field pattern over its whole frequency band excluding the rejected band, which is suitable for UWB applications.

Band-to-Band Misregistration of the Images of MODIS On-Board Calibrators and Its Impact to Calibration

Science.gov (United States)

Wang, Zhipeng; Xiong, Xiaoxiong

2017-01-01

The MODIS instruments aboard Terra and Aqua satellites are radiometrically calibrated on-orbit with a set of onboard calibrators (OBC) including a solar diffuser (SD), a blackbody (BB) and a space view (SV) port through which the detectors can view the dark space. As a whisk-broom scanning spectroradiometer, thirty-six MODIS spectral bands are assembled in the along-scan direction on four focal plane assemblies (FPA). These bands capture images of the same target sequentially with the motion of a scan mirror. Then the images are co-registered on board by delaying appropriate band dependent amount of time depending on the band locations on the FPA. While this co-registration mechanism is functioning well for the "far field" remote targets such as Earth view (EV) scenes or the Moon, noticeable band-to-band misregistration in the along-scan direction has been observed for near field targets, in particular the OBCs. In this paper, the misregistration phenomenon is presented and analyzed. It is concluded that the root cause of the misregistration is that the rotating element of the instrument, the scan mirror, is displaced from the focus of the telescope primary mirror. The amount of the misregistration is proportional to the band location on the FPA and is inversely proportional to the distance between the target and the scan mirror. The impact of this misregistration to the calibration of MODIS bands is discussed. In particular, the calculation of the detector gain coefficient m1 of bands 8-16 (412 nm 870 nm) is improved by up to 1.5% for Aqua MODIS.

47 CFR 15.713 - TV bands database.

Science.gov (United States)

2010-10-01

... 47 Telecommunication 1 2010-10-01 2010-10-01 false TV bands database. 15.713 Section 15.713... TV bands database. (a) Purpose. The TV bands database serves the following functions: (1) To... databases. (b) Information in the TV bands database. (1) Facilities already recorded in Commission databases...

X-Band CubeSat Communication System Demonstration

Science.gov (United States)

Altunc, Serhat; Kegege, Obadiah; Bundick, Steve; Shaw, Harry; Schaire, Scott; Bussey, George; Crum, Gary; Burke, Jacob C.; Palo, Scott; O'Conor, Darren

2015-01-01

Today's CubeSats mostly operate their communications at UHF- and S-band frequencies. UHF band is presently crowded, thus downlink communications are at lower data rates due to bandwidth limitations and are unreliable due to interference. This research presents an end-to-end robust, innovative, compact, efficient and low cost S-band uplink and X-band downlink CubeSat communication system demonstration between a balloon and a Near Earth Network (NEN) ground system. Since communication systems serve as umbilical cords for space missions, demonstration of this X-band communication system is critical for successfully supporting current and future CubeSat communication needs. This research has three main objectives. The first objective is to design, simulate, and test a CubeSat S- and X-band communication system. Satellite Tool Kit (STK) dynamic link budget calculations and HFSS Simulations and modeling results have been used to trade the merit of various designs for small satellite applications. S- and X-band antennas have been tested in the compact antenna test range at Goddard Space Flight Center (GSFC) to gather radiation pattern data. The second objective is simulate and test a CubeSat compatible X-band communication system at 12.5Mbps including S-band antennas, X-band antennas, Laboratory for Atmospheric and Space Physics (LASP) /GSFC transmitter and an S-band receiver from TRL-5 to TRL-8 by the end of this effort. Different X-band communication system components (antennas, diplexers, etc.) from GSFC, other NASA centers, universities, and private companies have been investigated and traded, and a complete component list for the communication system baseline has been developed by performing analytical and numerical analysis. This objective also includes running simulations and performing trades between different X-band antenna systems to optimize communication system performance. The final objective is to perform an end-to-end X-band CubeSat communication system

High-energy band structure of gold

DEFF Research Database (Denmark)

Christensen, N. Egede

1976-01-01

The band structure of gold for energies far above the Fermi level has been calculated using the relativistic augmented-plane-wave method. The calculated f-band edge (Γ6-) lies 15.6 eV above the Fermi level is agreement with recent photoemission work. The band model is applied to interpret...

Construct and Concurrent Validation of a New Resistance Intensity Scale for Exercise with Thera-Band® Elastic Bands

Directory of Open Access Journals (Sweden)

Juan C. Colado, Xavier Garcia-Masso, N. Travis Triplett, Joaquin Calatayud, Jorge Flandez, David Behm, Michael E. Rogers

2014-12-01

Full Text Available The construct and concurrent validity of the Thera-Band Perceived Exertion Scale for Resistance Exercise with elastic bands (EB was examined. Twenty subjects performed two separate sets of 15 repetitions of both frontal and lateral raise exercise over two sessions. The criterion variables were myoelectric activity and heart rate. One set was performed with an elastic band grip width that permitted 15 maximum repetitions in the selected exercise, and another set was performed with a grip width 50% more than the 15RM grip. Following the final repetition of each set, active muscle (AM and overall body (O ratings of perceived exertion (RPE were collected from the Thera-Band® resistance exercise scale and the OMNI-Resistance Exercise Scale of perceived exertion with Thera-Band® resistance bands (OMNI-RES EB. Construct validity was established by correlating the RPE from the OMNI-RES EB with the Thera-Band RPE scale using regression analysis. The results showed significant differences (p ≤ 0.05 in myoelectric activity, heart rate, and RPE scores between the low- and high-intensity sets. The intraclass correlation coefficient for active muscles and overall RPE scale scores was 0.67 and 0.58, respectively. There was a positive linear relationship between the RPE from the OMNI-RES EB and the Thera-Band scale. Validity coefficients for the RPE AM were r2 = 0.87 and ranged from r2 = 0.76 to 0.85 for the RPE O. Therefore, the Thera-Band Perceived Exertion Scale for Resistance Exercise can be used for monitoring elastic band exercise intensity. This would allow the training dosage to be better controlled within and between sessions. Moreover, the construct and concurrent validity indicates that the OMNI-RES EB measures similar properties of exertion as the Thera-Band RPE scale during elastic resistance exercise.

Design of Dual-Band Two-Branch-Line Couplers with Arbitrary Coupling Coefficients in Bands

Directory of Open Access Journals (Sweden)

I. Prudyus

2014-12-01

Full Text Available A new approach to design dual-band two-branch couplers with arbitrary coupling coefficients at two operating frequency bands is proposed in this article. The method is based on the usage of equivalent subcircuits input reactances of the even-mode and odd-mode excitations. The exact design formulas for three options of the dual-band coupler with different location and number of stubs are received. These formulas permit to obtain the different variants for each structure in order to select the physically realizable solution and can be used in broad range of frequency ratio and power division ratio. For verification, three different dual-band couplers, which are operating at 2.4/3.9 GHz with different coupling coefficients (one with 3/6 dB, and 10/3 dB two others are designed, simulated, fabricated and tested. The measured results are in good agreement with the simulated ones.

The marginal band system in nymphalid butterfly wings.

Science.gov (United States)

Taira, Wataru; Kinjo, Seira; Otaki, Joji M

2015-01-01

Butterfly wing color patterns are highly complex and diverse, but they are believed to be derived from the nymphalid groundplan, which is composed of several color pattern systems. Among these pattern systems, the marginal band system, including marginal and submarginal bands, has rarely been studied. Here, we examined the color pattern diversity of the marginal band system among nymphalid butterflies. Marginal and submarginal bands are usually expressed as a pair of linear bands aligned with the wing margin. However, a submarginal band can be expressed as a broken band, an elongated oval, or a single dot. The marginal focus, usually a white dot at the middle of a wing compartment along the wing edge, corresponds to the pupal edge spot, one of the pupal cuticle spots that signify the locations of color pattern organizing centers. A marginal band can be expressed as a semicircle, an elongated oval, or a pair of eyespot-like structures, which suggest the organizing activity of the marginal focus. Physical damage at the pupal edge spot leads to distal dislocation of the submarginal band in Junonia almana and in Vanessa indica, suggesting that the marginal focus functions as an organizing center for the marginal band system. Taken together, we conclude that the marginal band system is developmentally equivalent to other symmetry systems. Additionally, the marginal band is likely a core element and the submarginal band a paracore element of the marginal band system, and both bands are primarily specified by the marginal focus organizing center.

Block 3 X-band receiver-exciter

Science.gov (United States)

Johns, C. E.

1987-01-01

The development of an X-band exciter, for use in the X-Band Uplink Subsystem, was completed. The exciter generates the drive signal for the X-band transmitter and also generates coherent test signals for the S- and X-band Block 3 translator and a Doppler reference signal for the Doppler extractor system. In addition to the above, the exciter generates other reference signals that are described. Also presented is an overview of the exciter design and some test data taken on the prototype. A brief discussion of the Block 3 Doppler extractor is presented.

Fluctuation diamagnetism in two-band superconductors

Science.gov (United States)

Adachi, Kyosuke; Ikeda, Ryusuke

2016-04-01

Anomalously large fluctuation diamagnetism around the superconducting critical temperature has been recently observed in iron selenide (FeSe) [Kasahara et al. (unpublished)]. This indicates that superconducting fluctuations (SCFs) play a more significant role in FeSe, which supposedly has a two-band structure, than in the familiar single-band superconductors. Motivated by the data on FeSe, SCF-induced diamagnetism is examined in a two-band system, on the basis of a phenomenological approach with a Ginzburg-Landau functional. The obtained results indicate that the SCF-induced diamagnetism may be more enhanced than that in a single-band system due to the existence of two distinct fluctuation modes. Such enhancement of diamagnetism unique to a two-band system seems consistent with the large diamagnetism observed in FeSe, though still far from a quantitative agreement.

U-shaped Relation between Prestimulus Alpha-band and Poststimulus Gamma-band Power in Temporal Tactile Perception in the Human Somatosensory Cortex.

Science.gov (United States)

Wittenberg, Marc André; Baumgarten, Thomas J; Schnitzler, Alfons; Lange, Joachim

2018-04-01

Neuronal oscillations are a ubiquitous phenomenon in the human nervous system. Alpha-band oscillations (8-12 Hz) have been shown to correlate negatively with attention and performance, whereas gamma-band oscillations (40-150 Hz) correlate positively. Here, we studied the relation between prestimulus alpha-band power and poststimulus gamma-band power in a suprathreshold tactile discrimination task. Participants received two electrical stimuli to their left index finger with different SOAs (0 msec, 100 msec, intermediate SOA, intermediate SOA ± 10 msec). The intermediate SOA was individually determined so that stimulation was bistable, and participants perceived one stimulus in half of the trials and two stimuli in the other half. We measured neuronal activity with magnetoencephalography (MEG). In trials with intermediate SOAs, behavioral performance correlated inversely with prestimulus alpha-band power but did not correlate with poststimulus gamma-band power. Poststimulus gamma-band power was high in trials with low and high prestimulus alpha-band power and low for intermediate prestimulus alpha-band power (i.e., U-shaped). We suggest that prestimulus alpha activity modulates poststimulus gamma activity and subsequent perception: (1) low prestimulus alpha-band power leads to high poststimulus gamma-band power, biasing perception such that two stimuli were perceived; (2) intermediate prestimulus alpha-band power leads to low gamma-band power (interpreted as inefficient stimulus processing), consequently, perception was not biased in either direction; and (3) high prestimulus alpha-band power leads to high poststimulus gamma-band power, biasing perception such that only one stimulus was perceived.

Electron correlations in narrow band systems

International Nuclear Information System (INIS)

Kishore, R.

1983-01-01

The effect of the electron correlations in narrow bands, such as d(f) bands in the transition (rare earth) metals and their compounds and the impurity bands in doped semiconductors is studied. The narrow band systems is described, by the Hubbard Hamiltonian. By proposing a local self-energy for the interacting electron, it is found that the results are exact in both atomic and band limits and reduce to the Hartree Fock results for U/Δ → 0, where U is the intra-atomic Coulomb interaction and Δ is the bandwidth of the noninteracting electrons. For the Lorentzian form of the density of states of the noninteracting electrons, this approximation turns out to be equivalent to the third Hubbard approximation. A simple argument, based on the mean free path obtained from the imaginary part of the self energy, shows how the electron correlations can give rise to a discontinous metal-nonmetal transition as proposed by Mott. The band narrowing and the existence of the satellite below the Fermi energy in Ni, found in photoemission experiments, can also be understood. (Author) [pt

InfiniBand-Experiences at the Forschungszentrum Karlsruhe

International Nuclear Information System (INIS)

Schwickerath, Ulrich; Heiss, Andreas

2006-01-01

The Institute for Scientific Computing (IWR) at the Forschungszentrum Karlsruhe has been evaluating the InfiniBand [InfiniBand Trade Association, InfiniBand Architecture Specification, Release 1.0, October 24, 2000] technology since end of the year 2002. The performance of the interconnect has been tested on different platforms and architectures using MPI. Sequential file transfer performance was measured with the RFIO protocol running on native InfiniBand [Ulrich Schwickerath, Andreas Heiss, Nucl. Instr. and Meth. A 534 (2004) 130, http://www.fzk.de/infiniband], and a newly developed InfiniBand-enabled version of the XROOTD

Band head spin assignment of superdeformed bands in 133Pr using two-parameter formulae

Science.gov (United States)

Sharma, Honey; Mittal, H. M.

2018-03-01

The two-parameter formulae viz. the power index formula, the nuclear softness formula and the VMI model are adopted to accredit the band head spin (I0) of four superdeformed rotational bands in 133Pr. The technique of least square fitting is used to accredit the band head spin for four superdeformed rotational bands in 133Pr. The root mean deviation among the computed transition energies and well-known experimental transition energies are attained by extracting the model parameters from the two-parameter formulae. The determined transition energies are in excellent agreement with the experimental transition energies, whenever exact spins are accredited. The power index formula coincides well with the experimental data and provides minimum root mean deviation. So, the power index formula is more efficient tool than the nuclear softness formula and the VMI model. The deviation of dynamic moment of inertia J(2) against the rotational frequency is also examined.

New results on the superdeformed {sup 196}Pb nucleus: The decay of the excited bands to the yrast band

Energy Technology Data Exchange (ETDEWEB)

Bouneau, S.; Azaiez, F.; Duprat, J. [IPN, Orsay (France)] [and others

1996-12-31

The study of the superdeformed (SD) {sup 196}Pb nucleus has been revisited using the EUROGAM phase 2 spectrometer. In addition to the known yrast and two lowest excited SD bands, a third excited SD band has been seen. All of the three excited bands were found to decay to the yrast SD band through, presumably, E1 transitions, allowing relative spin and excitation energy assignments. Comparisons with calculations using the random-phase approximation suggest that all three excited bands can be interpreted as octupole vibrational structures.

S-band and X-band integrated PWT photoelectron linacs

International Nuclear Information System (INIS)

Yu, D.; Newsham, D.; Zeng, J.; Rosenzweig, J.

2001-01-01

A compact high-energy injector, which has been developed by DULY Research Inc., will have wide scientific, industrial, and medical applications. The new photoelectron injector integrates the photocathode directly into a multicell linear accelerator. By focusing the beam with solenoids or permanent magnets, and producing high current with low emittance, high brightness and low energy spread are achieved. In addition to providing a small footprint and improved beam quality in an integrated structure, the compact system considerably simplifies external subsystems required to operate the photoelectron linac, including rf power transport, beam focusing, vacuum and cooling. The photoelectron linac employs an innovative Plane-Wave-Transformer (PWT) design, which provides strong cell-to-cell coupling, relaxes manufacturing tolerances and facilitates the attachment of external ports to the compact structure with minimal field interference. DULY Research Inc. under the support of the DOE Small Business Innovation Research (SBIR) program, has developed, constructed and installed a 20-MeV, S-band compact electron source at UCLA. Cold test results for this device are presented. DULY Research is also actively engaged in the development of an X-band photoelectron linear accelerator in a SBIR project. When completed, the higher frequency structure will be approximately three times smaller. Design considerations for this device are discussed following the S-band cold test results

Warm-Up Activities of Middle and High School Band Directors Participating in State-Level Concert Band Assessments

Science.gov (United States)

Ward, Justin P.; Hancock, Carl B.

2016-01-01

The purpose of this study was to examine the warm-ups chosen by concert band directors participating in state-level performance assessments. We observed 29 middle and high school bands and coded the frequency and duration of warm-up activities and behaviors. Results indicated that most bands rehearsed music and played scales, long tones, and…

Does the chromatic Mach bands effect exist?

Science.gov (United States)

Tsofe, Avital; Spitzer, Hedva; Einav, Shmuel

2009-06-30

The achromatic Mach bands effect is a well-known visual illusion, discovered over a hundred years ago. This effect has been investigated thoroughly, mainly for its brightness aspect. The existence of Chromatic Mach bands, however, has been disputed. In recent years it has been reported that Chromatic Mach bands are not perceived under controlled iso-luminance conditions. However, here we show that a variety of Chromatic Mach bands, consisting of chromatic and achromatic regions, separated by a saturation ramp, can be clearly perceived under iso-luminance and iso-brightness conditions. In this study, observers' eye movements were recorded under iso-brightness conditions. Several observers were tested for their ability to perceive the Chromatic Mach bands effect and its magnitude, across different cardinal and non-cardinal Chromatic Mach bands stimuli. A computational model of color adaptation, which predicted color induction and color constancy, successfully predicts this variation of Chromatic Mach bands. This has been tested by measuring the distance of the data points from the "achromatic point" and by calculating the shift of the data points from predicted complementary lines. The results suggest that the Chromatic Mach bands effect is a specific chromatic induction effect.

In-Sample Confidence Bands and Out-of-Sample Forecast Bands for Time-Varying Parameters in Observation Driven Models

NARCIS (Netherlands)

Blasques, F.; Koopman, S.J.; Lasak, K.A.; Lucas, A.

2016-01-01

We study the performances of alternative methods for calculating in-sample confidence and out-of-sample forecast bands for time-varying parameters. The in-sample bands reflect parameter uncertainty, while the out-of-sample bands reflect not only parameter uncertainty, but also innovation

Robust and adaptive band-to-band image transform of UAS miniature multi-lens multispectral camera

Science.gov (United States)

Jhan, Jyun-Ping; Rau, Jiann-Yeou; Haala, Norbert

2018-03-01

Utilizing miniature multispectral (MS) or hyperspectral (HS) cameras by mounting them on an Unmanned Aerial System (UAS) has the benefits of convenience and flexibility to collect remote sensing imagery for precision agriculture, vegetation monitoring, and environment investigation applications. Most miniature MS cameras adopt a multi-lens structure to record discrete MS bands of visible and invisible information. The differences in lens distortion, mounting positions, and viewing angles among lenses mean that the acquired original MS images have significant band misregistration errors. We have developed a Robust and Adaptive Band-to-Band Image Transform (RABBIT) method for dealing with the band co-registration of various types of miniature multi-lens multispectral cameras (Mini-MSCs) to obtain band co-registered MS imagery for remote sensing applications. The RABBIT utilizes modified projective transformation (MPT) to transfer the multiple image geometry of a multi-lens imaging system to one sensor geometry, and combines this with a robust and adaptive correction (RAC) procedure to correct several systematic errors and to obtain sub-pixel accuracy. This study applies three state-of-the-art Mini-MSCs to evaluate the RABBIT method's performance, specifically the Tetracam Miniature Multiple Camera Array (MiniMCA), Micasense RedEdge, and Parrot Sequoia. Six MS datasets acquired at different target distances and dates, and locations are also applied to prove its reliability and applicability. Results prove that RABBIT is feasible for different types of Mini-MSCs with accurate, robust, and rapid image processing efficiency.

Prenatal diagnosis of amniotic band syndrome

Directory of Open Access Journals (Sweden)

Laxmi Devi Padmanabhan

2016-01-01

Full Text Available Amniotic band can cause a broad spectrum of anomalies ranging from simple band constrictions to major craniofacial and visceral defects. It can cause significant neonatal morbidity. Accurate diagnosis will help in the management of the present pregnancy and in counseling with regard to future pregnancies. Here we report three cases of amniotic band syndrome detected in the prenatal period.

Emission bands of phosphorus and calculation of band structure of rare earth phosphides

International Nuclear Information System (INIS)

Al'perovich, G.I.; Gusatinskij, A.N.; Geguzin, I.I.; Blokhin, M.A.; Torbov, V.I.; Chukalin, V.I.; AN SSSR, Moscow. Inst. Novykh Khimicheskikh Problem)

1977-01-01

The method of x-ray emission spectroscopy has been used to investigate the electronic structure of monophosphides of rare-earth metals (REM). The fluorescence K bands of phosphorus have been obtained in LaP, PrP, SmP, GdP, TbP, DyP, HoP, ErP, TmP, YbP, and LuP and also the Lsub(2,3) bands of phosphorus in ErP, TmP, YbP, and LuP. Using the Green function technique involving the muffin-tin potential, the energy spectrum for ErP has been calculated in the single-electron approximation. The hystogram of electronic state distribution N(E) is compared with the experimental K and Lsub(2,3) bands of phosphorus in ErP. The agreement between the main details of N(E) and that of x-ray spectra allows to state that the model used provides a good description of the electron density distribution in crystals of REM monophosphides. In accordance with the character of the N(E) distribution the compounds under study are classified as semimetals or semiconductors with a very narrow forbidden band

A comparison of L-band and C-band rf guns as sources for inline-injection systems

International Nuclear Information System (INIS)

Gallardo, J.C.; Kirk, H.G.; Meyerer, T.

1994-12-01

We consider the beam dynamics associated with installing a BNL type 1 1/2 cell L-band or C-band rf gun before two TESLA L-band cryomodules. This system will deliver a 25 MeV electron beam with peak currents on the order of 100 A suitable for further magnetic compression. evaluate the injection systems utilizing the electron beam dynamic code PARMELA from the point of view of minimizing the transverse invariant emittance

Mars Global Surveyor Ka-Band Frequency Data Analysis

Science.gov (United States)

Morabito, D.; Butman, S.; Shambayati, S.

2000-01-01

The Mars Global Surveyor (MGS) spacecraft, launched on November 7, 1996, carries an experimental space-to-ground telecommunications link at Ka-band (32 GHz) along with the primary X-band (8.4 GHz) downlink. The signals are simultaneously transmitted from a 1.5-in diameter parabolic high gain antenna (HGA) on MGS and received by a beam-waveguide (BWG) R&D 34-meter antenna located in NASA's Goldstone Deep Space Network (DSN) complex near Barstow, California. The projected 5-dB link advantage of Ka-band relative to X-band was confirmed in previous reports using measurements of MGS signal strength data acquired during the first two years of the link experiment from December 1996 to December 1998. Analysis of X-band and Ka-band frequency data and difference frequency (fx-fka)/3.8 data will be presented here. On board the spacecraft, a low-power sample of the X-band downlink from the transponder is upconverted to 32 GHz, the Ka-band frequency, amplified to I-W using a Solid State Power Amplifier, and radiated from the dual X/Ka HGA. The X-band signal is amplified by one of two 25 W TWTAs. An upconverter first downconverts the 8.42 GHz X-band signal to 8 GHz and then multiplies using a X4 multiplier producing the 32 GHz Ka-band frequency. The frequency source selection is performed by an RF switch which can be commanded to select a VCO (Voltage Controlled Oscillator) or USO (Ultra-Stable Oscillator) reference. The Ka-band frequency can be either coherent with the X-band downlink reference or a hybrid combination of the USO and VCO derived frequencies. The data in this study were chosen such that the Ka-band signal is purely coherent with the X-band signal, that is the downconverter is driven by the same frequency source as the X-band downlink). The ground station used to acquire the data is DSS-13, a 34-meter BWG antenna which incorporates a series of mirrors inside beam waveguide tubes which guide the energy to a subterranean pedestal room, providing a stable environment

Adhesives for fixed orthodontic bands.

Science.gov (United States)

Millett, Declan T; Glenny, Anne-Marie; Mattick, Rye Cr; Hickman, Joy; Mandall, Nicky A

2016-10-25

Orthodontic treatment involves using fixed or removable appliances (dental braces) to correct the positions of teeth. It has been shown that the quality of treatment result obtained with fixed appliances is much better than with removable appliances. Fixed appliances are, therefore, favoured by most orthodontists for treatment. The success of a fixed orthodontic appliance depends on the metal attachments (brackets and bands) being attached securely to the teeth so that they do not become loose during treatment. Brackets are usually attached to the front and side teeth, whereas bands (metal rings that go round the teeth) are more commonly used on the back teeth (molars). A number of adhesives are available to attach bands to teeth and it is important to understand which group of adhesives bond most reliably, as well as reducing or preventing dental decay during the treatment period. To evaluate the effectiveness of the adhesives used to attach bands to teeth during fixed appliance treatment, in terms of:(1) how often the bands come off during treatment; and(2) whether they protect the banded teeth against decay during fixed appliance treatment. The following electronic databases were searched: Cochrane Oral Health's Trials Register (searched 2 June 2016), Cochrane Central Register of Controlled Trials (CENTRAL; 2016, Issue 5) in the Cochrane Library (searched 2 June 2016), MEDLINE Ovid (1946 to 2 June 2016) and EMBASE Ovid (1980 to 2 June 2016). We searched ClinicalTrials.gov and the World Health Organization International Clinical Trials Registry Platform for ongoing trials. No restrictions were placed on the language or date of publication when searching the electronic databases. Randomised and controlled clinical trials (RCTs and CCTs) (including split-mouth studies) of adhesives used to attach orthodontic bands to molar teeth were selected. Patients with full arch fixed orthodontic appliance(s) who had bands attached to molars were included. All review authors

Snake-venom resistance as a mammalian trophic adaptation: lessons from didelphid marsupials.

Science.gov (United States)

Voss, Robert S; Jansa, Sharon A

2012-11-01

Mammals that prey on venomous snakes include several opossums (Didelphidae), at least two hedgehogs (Erinaceidae), several mongooses (Herpestidae), several mustelids, and some skunks (Mephitidae). As a group, these taxa do not share any distinctive morphological traits. Instead, mammalian adaptations for ophiophagy seem to consist only in the ability to resist the toxic effects of snake venom. Molecular mechanisms of venom resistance (as indicated by biochemical research on opossums, mongooses, and hedgehogs) include toxin-neutralizing serum factors and adaptive changes in venom-targeted molecules. Of these, toxin-neutralizing serum factors have received the most research attention to date. All of the toxin-neutralizing serum proteins discovered so far in both opossums and mongooses are human α1B-glycoprotein homologs that inhibit either snake-venom metalloproteinases or phospholipase A(2) myotoxins. By contrast, adaptive changes in venom-targeted molecules have received far less attention. The best-documented examples include amino-acid substitutions in mongoose nicotinic acetylcholine receptor that inhibit binding by α-neurotoxins, and amino-acid substitutions in opossum von Willebrand factor (vWF) that are hypothesized to weaken the bond between vWF and coagulopathic C-type lectins. Although multiple mechanisms of venom resistance are known from some species, the proteomic complexity of most snake venoms suggests that the evolved biochemical defences of ophiophagous mammals are likely to be far more numerous than currently recognized. Whereas most previous research in this field has been motivated by the potential for medical applications, venom resistance in ophiophagous mammals is a complex adaptation that merits attention from comparative biologists. Unfortunately, evolutionary inference is currently limited by ignorance about many relevant facts that can only be provided by future research. © 2012 The Authors. Biological Reviews © 2012 Cambridge

Super rigid nature of super-deformed bands

International Nuclear Information System (INIS)

Sharma, Neha; Mittal, H.M.; Jain, A.K.

2012-01-01

The phenomenon of high-spin super-deformation represents one of the most remarkable discoveries in nuclear physics. A large number of SD bands have been observed in A = 60, 80, 130, 150, 190 mass regions. The cascades of SD bands are known to be connected by electric quadruple E2 transitions. Because of absence of linking transitions between superdeformed (SD) and normal deformed (ND) levels, the spin assignments of most of these bands carry a minimum uncertainty ≈ 1-2ħ. It was found in an analysis of SD bands in the context of semi classical approach that moment of inertia comes close to the rigid body value in most of the cases. Lack of knowledge of spins has led to an emphasis on the study of dynamical moment of inertia of SD bands and systematic of kinematic moment of inertia has not been examined so far. In this paper, we extract the band moment of inertia J 0 and softness parameter (σ) of all the SD bands corresponding to axes ratio (x) = 1.5 and present their systematic

Design of an S band narrow-band bandpass BAW filter

Science.gov (United States)

Gao, Yang; Zhao, Kun-li; Han, Chao

2017-11-01

An S band narrowband bandpass filter BAW with center frequency 2.460 GHz, bandwidth 41MHz, band insertion loss - 1.154 dB, the passband ripple 0.9 dB, the out of band rejection about -42.5dB@2.385 GHz; -45.5dB@2.506 GHz was designed for potential UAV measurement and control applications. According to the design specifications, the design is as follows: each FBAR's stack was designed in BAW filter by using Mason model. Each FBAR's shape was designed with the method of apodization electrode. The layout of BAW filter was designed. The acoustic-electromagnetic cosimulation model was built to validate the performance of the designed BAW filter. The presented design procedure is a common one, and there are two characteristics: 1) an A and EM co-simulation method is used for the final BAW filter performance validation in the design stage, thus ensures over-optimistic designs by the bare 1D Mason model are found and rejected in time; 2) An in-house developed auto-layout method is used to get compact BAW filter layout, which simplifies iterative error-and-try work here and output necessary in-plane geometry information to the A and EM cosimulation model.

Location of the valence band maximum in the band structure of anisotropic 1 T'-ReSe2

Science.gov (United States)

Eickholt, P.; Noky, J.; Schwier, E. F.; Shimada, K.; Miyamoto, K.; Okuda, T.; Datzer, C.; Drüppel, M.; Krüger, P.; Rohlfing, M.; Donath, M.

2018-04-01

Transition-metal dichalcogenides (TMDCs) are a focus of current research due to their fascinating optical and electronic properties with possible technical applications. ReSe2 is an interesting material of the TMDC family, with unique anisotropic properties originating from its distorted 1 T structure (1 T '). To develop a fundamental understanding of the optical and electric properties, we studied the underlying electronic structure with angle-resolved photoemission (ARPES) as well as band-structure calculations within the density functional theory (DFT)-local density approximation (LDA) and GdW approximations. We identified the Γ ¯M¯1 direction, which is perpendicular to the a axis, as a distinct direction in k space with the smallest bandwidth of the highest valence band. Using photon-energy-dependent ARPES, two valence band maxima are identified within experimental limits of about 50 meV: one at the high-symmetry point Z , and a second one at a non-high-symmetry point in the Brillouin zone. Thus, the position in k space of the global valence band maximum is undecided experimentally. Theoretically, an indirect band gap is predicted on a DFT-LDA level, while quasiparticle corrections lead to a direct band gap at the Z point.

8-band and 14-band kp modeling of electronic band structure and material gain in Ga(In)AsBi quantum wells grown on GaAs and InP substrates

Energy Technology Data Exchange (ETDEWEB)

Gladysiewicz, M.; Wartak, M. S. [Faculty of Fundamental Problems of Technology, Wroclaw University of Technology, Wybrzeze Wyspianskiego 27, 50-370 Wroclaw (Poland); Department of Physics and Computer Science, Wilfrid Laurier University, Waterloo, Ontario N2L 3C5 (Canada); Kudrawiec, R. [Faculty of Fundamental Problems of Technology, Wroclaw University of Technology, Wybrzeze Wyspianskiego 27, 50-370 Wroclaw (Poland)

2015-08-07

The electronic band structure and material gain have been calculated for GaAsBi/GaAs quantum wells (QWs) with various bismuth concentrations (Bi ≤ 15%) within the 8-band and 14-band kp models. The 14-band kp model was obtained by extending the standard 8-band kp Hamiltonian by the valence band anticrossing (VBAC) Hamiltonian, which is widely used to describe Bi-related changes in the electronic band structure of dilute bismides. It has been shown that in the range of low carrier concentrations n < 5 × 10{sup 18 }cm{sup −3}, material gain spectra calculated within 8- and 14-band kp Hamiltonians are similar. It means that the 8-band kp model can be used to calculate material gain in dilute bismides QWs. Therefore, it can be applied to analyze QWs containing new dilute bismides for which the VBAC parameters are unknown. Thus, the energy gap and electron effective mass for Bi-containing materials are used instead of VBAC parameters. The electronic band structure and material gain have been calculated for 8 nm wide GaInAsBi QWs on GaAs and InP substrates with various compositions. In these QWs, Bi concentration was varied from 0% to 5% and indium concentration was tuned in order to keep the same compressive strain (ε = 2%) in QW region. For GaInAsBi/GaAs QW with 5% Bi, gain peak was determined to be at about 1.5 μm. It means that it can be possible to achieve emission at telecommunication windows (i.e., 1.3 μm and 1.55 μm) for GaAs-based lasers containing GaInAsBi/GaAs QWs. For GaInAsBi/Ga{sub 0.47}In{sub 0.53}As/InP QWs with 5% Bi, gain peak is predicted to be at about 4.0 μm, i.e., at the wavelengths that are not available in current InP-based lasers.

The complex band structure for armchair graphene nanoribbons

International Nuclear Information System (INIS)

Zhang Liu-Jun; Xia Tong-Sheng

2010-01-01

Using a tight binding transfer matrix method, we calculate the complex band structure of armchair graphene nanoribbons. The real part of the complex band structure calculated by the transfer matrix method fits well with the bulk band structure calculated by a Hermitian matrix. The complex band structure gives extra information on carrier's decay behaviour. The imaginary loop connects the conduction and valence band, and can profoundly affect the characteristics of nanoscale electronic device made with graphene nanoribbons. In this work, the complex band structure calculation includes not only the first nearest neighbour interaction, but also the effects of edge bond relaxation and the third nearest neighbour interaction. The band gap is classified into three classes. Due to the edge bond relaxation and the third nearest neighbour interaction term, it opens a band gap for N = 3M − 1. The band gap is almost unchanged for N = 3M + 1, but decreased for N = 3M. The maximum imaginary wave vector length provides additional information about the electrical characteristics of graphene nanoribbons, and is also classified into three classes

Band to Band Tunneling (BBT) Induced Leakage Current Enhancement in Irradiated Fully Depleted SOI Devices

Science.gov (United States)

Adell, Phillipe C.; Barnaby, H. J.; Schrimpf, R. D.; Vermeire, B.

2007-01-01

We propose a model, validated with simulations, describing how band-to-band tunneling (BBT) affects the leakage current degradation in some irradiated fully-depleted SOI devices. The dependence of drain current on gate voltage, including the apparent transition to a high current regime is explained.

Formation of Degenerate Band Gaps in Layered Systems

Directory of Open Access Journals (Sweden)

Alexey P. Vinogradov

2012-06-01

Full Text Available In the review, peculiarities of spectra of one-dimensional photonic crystals made of anisotropic and/or magnetooptic materials are considered. The attention is focused on band gaps of a special type—the so called degenerate band gaps which are degenerate with respect to polarization. Mechanisms of formation and properties of these band gaps are analyzed. Peculiarities of spectra of photonic crystals that arise due to the linkage between band gaps are discussed. Particularly, it is shown that formation of a frozen mode is caused by linkage between Brillouin and degenerate band gaps. Also, existence of the optical Borrmann effect at the boundaries of degenerate band gaps and optical Tamm states at the frequencies of degenerate band gaps are analyzed.

Study of rotational band in 111Sn

International Nuclear Information System (INIS)

Ganguly, S.; Banerjee, P.; Ray, I.; Kshetri, R.; Raut, R.; Goswami, A.; Saha Sarkar, M.; Bhattacharya, S.; Mukherjee, A.; Mukherjee, G.; Basu, S.K.; Mukhopadhyay, S.

2006-01-01

The motivation of the present work is to study the negative-parity rotational band in 111 Sn. Study of the lifetimes of the states of the rotational band is expected to provide information on their structures as well as the band termination phenomenon

Synthesis and design of waveguide band-stop filters without out-of-band spurious responses for plasma diagnosis

Energy Technology Data Exchange (ETDEWEB)

Montejo-Garai, Jose R., E-mail: jr@etc.upm.es [Departamento de Electromagnetismo y Teoria de Circuitos, Universidad Politecnica de Madrid, Ciudad Universitaria s/n, Madrid 20840 (Spain); Leal-Sevillano, Carlos A. [Departamento de Electromagnetismo y Teoria de Circuitos, Universidad Politecnica de Madrid, Ciudad Universitaria s/n, Madrid 20840 (Spain); Ruiz-Cruz, Jorge A. [Escuela Politecnica Superior, Universidad Autonoma de Madrid, C/Fco. Tomas y Valiente 11, Madrid 28409 (Spain); Rebollar, Jesus M. [Departamento de Electromagnetismo y Teoria de Circuitos, Universidad Politecnica de Madrid, Ciudad Universitaria s/n, Madrid 20840 (Spain); Estrada, Teresa [T. Laboratorio Nacional de Fusion, Asociacion Euratom-CIEMAT, Madrid 28040 (Spain)

2012-09-15

Highlights: Black-Right-Pointing-Pointer A rigorous systematic design process based on circuit synthesis is proposed for band-stop filters. Black-Right-Pointing-Pointer The new compact E-plane waveguide structure reduces drastically the unwanted resonances in a very large pass band. Black-Right-Pointing-Pointer The manufacturing process together with the computation effort is significantly reduced. Black-Right-Pointing-Pointer Experimental results validate the state-of-art electrical responses. - Abstract: Band-stop or notch filters play a crucial role in plasma diagnosis systems to protect receivers from the stray radiation. In this work, a rigorous design process based on circuit synthesis in addition to an extremely compact E-plane waveguide structure is proposed for this kind of filters. On the one hand, the transfer function verifying the rejection specification is analytically obtained, fixing the minimum number of required cavities. On the other hand, a coupling structure that reduces drastically the unwanted resonances in filters with a very large pass band requirement, is presented. This coupling between the rejection cavities and the main rectangular waveguide has additional advantages; (a) unlike typical inductive irises, large coupling coefficients can be implemented (b) a pure E-plane configuration is achieved, which simplifies the manufacturing and also reduces significantly the computational effort. Experimental validation is demonstrated by two pseudo-elliptic fifth-order band-stop filters fabricated and measured in Ka and V bands. In both cases, the filters are free of spurious resonances in their total operation bands.

Synthesis and design of waveguide band-stop filters without out-of-band spurious responses for plasma diagnosis

International Nuclear Information System (INIS)

Montejo-Garai, José R.; Leal-Sevillano, Carlos A.; Ruiz-Cruz, Jorge A.; Rebollar, Jesús M.; Estrada, Teresa

2012-01-01

Highlights: ► A rigorous systematic design process based on circuit synthesis is proposed for band-stop filters. ► The new compact E-plane waveguide structure reduces drastically the unwanted resonances in a very large pass band. ► The manufacturing process together with the computation effort is significantly reduced. ► Experimental results validate the state-of-art electrical responses. - Abstract: Band-stop or notch filters play a crucial role in plasma diagnosis systems to protect receivers from the stray radiation. In this work, a rigorous design process based on circuit synthesis in addition to an extremely compact E-plane waveguide structure is proposed for this kind of filters. On the one hand, the transfer function verifying the rejection specification is analytically obtained, fixing the minimum number of required cavities. On the other hand, a coupling structure that reduces drastically the unwanted resonances in filters with a very large pass band requirement, is presented. This coupling between the rejection cavities and the main rectangular waveguide has additional advantages; (a) unlike typical inductive irises, large coupling coefficients can be implemented (b) a pure E-plane configuration is achieved, which simplifies the manufacturing and also reduces significantly the computational effort. Experimental validation is demonstrated by two pseudo-elliptic fifth-order band-stop filters fabricated and measured in Ka and V bands. In both cases, the filters are free of spurious resonances in their total operation bands.

Review of wide band-gap semiconductors technology

Directory of Open Access Journals (Sweden)

Jin Haiwei

2016-01-01

Full Text Available Silicon carbide (SiC and gallium nitride (GaN are typical representative of the wide band-gap semiconductor material, which is also known as third-generation semiconductor materials. Compared with the conventional semiconductor silicon (Si or gallium arsenide (GaAs, wide band-gap semiconductor has the wide band gap, high saturated drift velocity, high critical breakdown field and other advantages; it is a highly desirable semiconductor material applied under the case of high-power, high-temperature, high-frequency, anti-radiation environment. These advantages of wide band-gap devices make them a hot spot of semiconductor technology research in various countries. This article describes the research agenda of United States and European in this area, focusing on the recent developments of the wide band-gap technology in the US and Europe, summed up the facing challenge of the wide band-gap technology.

Band-Structure of Thallium by the LMTO Method

DEFF Research Database (Denmark)

Holtham, P. M.; Jan, J. P.; Skriver, Hans Lomholt

1977-01-01

by an energy gap. The 6d and 7s bands were found to be far above the Fermi level and the 5d states were found to be far below it. Fermi surface properties and the electronic specific heat are computed and compared with experiment. The joint density of states has also been computed and is in reasonable...... and p bands for the HCP structure. Energy bands have been evaluated both with and without spin-orbit coupling which is particularly large in thallium. Energy bands close to the Fermi level were found to be mainly 6p like in character. The 6s states lay below the 6p bands and were separated from them......The relativistic band structure of thallium has been calculated using the linear muffin-tin orbital (LMTO) method. The positions and extents of the bands were found to follow the Wigner-Seitz rule approximately, and the origin of the dispersion of the bands was established from the canonical s...

Complex band structure and electronic transmission eigenchannels

DEFF Research Database (Denmark)

Jensen, Anders; Strange, Mikkel; Smidstrup, Soren

2017-01-01

and complex band structure, in this case individual eigenchannel transmissions and different complex bands. We present calculations of decay constants for the two most conductive states as determined by complex band structure and standard DFT Landauer transport calculations for one semi-conductor and two...

The Keenan and Wing bands in S stars

International Nuclear Information System (INIS)

Lambert, D.L.; Clegg, R.E.S.

1980-01-01

New observations of the near infrared spectra of S stars are presented as part of a survey of the unidentified Keenan and Wing bands. Bandhead wavelengths accurate to 0.5 A are presented. A new band is found at 9014 A. The bands are not present in normal M giants and dwarfs. Laboratory spectroscopy of heavy element oxides is reported. Several new identifications are proposed. The 10 300 A Wing band is identified with the Δv = - 1 sequence of the ZrO 9300 A Δv = 0 bands. The ZrO B 1 PI-A 1 Δ (Δv = 0) system may be responsible for either the 9736 A or the 10 515 A Wing bands. Two new bands in the near infrared at 8219 and 8235 A are provided by CeO. A new band with heads at 7503 and 7509 A in a spectrum of R And is tentatively attributed to YS. A band at 8268 A in M stars is the TiO delta(2-1) head. The 8610 A Keenan band is not due to CrH. Potential carriers of the Keenan and Wing bands are reviewed. It is suggested that the heavy element sulphides and, perhaps, chlorides are leading candidates. Identification of YS in R And may provide the first evidence for these sulphides. ZrS is a leading candidate for which laboratory spectroscopy is needed. (author)

Exact folded-band chaotic oscillator.

Science.gov (United States)

Corron, Ned J; Blakely, Jonathan N

2012-06-01

An exactly solvable chaotic oscillator with folded-band dynamics is shown. The oscillator is a hybrid dynamical system containing a linear ordinary differential equation and a nonlinear switching condition. Bounded oscillations are provably chaotic, and successive waveform maxima yield a one-dimensional piecewise-linear return map with segments of both positive and negative slopes. Continuous-time dynamics exhibit a folded-band topology similar to Rössler's oscillator. An exact solution is written as a linear convolution of a fixed basis pulse and a discrete binary sequence, from which an equivalent symbolic dynamics is obtained. The folded-band topology is shown to be dependent on the symbol grammar.

Fade Mitigation Techniques at Ka-Band

Science.gov (United States)

Dissanayake, Asoka (Editor)

1996-01-01

Rain fading is the dominant propagation impairment affecting Ka-band satellite links and rain fade mitigation is a key element in the design of Ka-band satellite networks. Some of the common fade mitigation techniques include: power control, diversity, adaptive coding, and resource sharing. The Advanced Communications Technology Satellite (ACTS) provides an excellent opportunity to develop and test Ka-band rain impairment amelioration techniques. Up-link power control and diversity are discussed in this paper.

47 CFR 15.715 - TV bands database administrator.

Science.gov (United States)

2010-10-01

... 47 Telecommunication 1 2010-10-01 2010-10-01 false TV bands database administrator. 15.715 Section... Band Devices § 15.715 TV bands database administrator. The Commission will designate one or more entities to administer a TV bands database. Each database administrator shall: (a) Maintain a database that...

Differential population responses of native and alien rodents to an invasive predator, habitat alteration and plant masting.

Science.gov (United States)

Fukasawa, Keita; Miyashita, Tadashi; Hashimoto, Takuma; Tatara, Masaya; Abe, Shintaro

2013-12-22

Invasive species and anthropogenic habitat alteration are major drivers of biodiversity loss. When multiple invasive species occupy different trophic levels, removing an invasive predator might cause unexpected outcomes owing to complex interactions among native and non-native prey. Moreover, external factors such as habitat alteration and resource availability can affect such dynamics. We hypothesized that native and non-native prey respond differently to an invasive predator, habitat alteration and bottom-up effects. To test the hypothesis, we used Bayesian state-space modelling to analyse 8-year data on the spatio-temporal patterns of two endemic rat species and the non-native black rat in response to the continual removal of the invasive small Indian mongoose on Amami Island, Japan. Despite low reproductive potentials, the endemic rats recovered better after mongoose removal than did the black rat. The endemic species appeared to be vulnerable to predation by mongooses, whose eradication increased the abundances of the endemic rats, but not of the black rat. Habitat alteration increased the black rat's carrying capacity, but decreased those of the endemic species. We propose that spatio-temporal monitoring data from eradication programmes will clarify the underlying ecological impacts of land-use change and invasive species, and will be useful for future habitat management.

What band rocks the MTB? (Invited)

Science.gov (United States)

Kind, J.; García-Rubio, I.; Gehring, A. U.

2013-12-01

Magnetotactic bacteria (MTB) are a polyphyletic group of bacteria that have been found in marine and lacustrine environments and soils [e.g. 1]. The hallmark of MTB is their intracellular formation of magnetosomes, single-domain ferrimagnetic particles that are aligned in chains. The chain configuration generates a strong magnetic dipole, which is used as magnetic compass to move the MTB into their favorable habit. The term band corresponds to a frequency window of microwaves in the gigahertz (GHz) range. Ferromagnetic resonance (FMR) spectroscopy uses the microwave absorption in a magnetic field to analyze the anisotropy properties and the domain state of magnetic materials. Specific microwave frequency causes absorption in a characteristic magnetic field range. For the investigation of MTB we use S-band (4.02 GHz), X-band (9.47 GHz), and Q-band (34.16 GHz). Experiments on cultured MTB and on sediment samples of Holocene age showed that absorption in X- and Q-band occurs when the sample is in a saturated or nearly saturated state [2, 3]. By contrast, absorption in the S-band appears in lower magnetic fields, where the sample is far from saturation. All FMR spectra show two distinct low-field features that can be assigned to magnetite particles in chains, aligned parallel and perpendicular to the external magnetic field. The detailed separation of the parallel and perpendicular components in the bulk samples is hampered, because of the random orientation of the chains in the sample. The comparison of S-, X-, and Q-band shows that the lower the frequency the better the separation of the components. In the S-band FMR spectroscopy, the separation of chains parallel to the external magnetic field is supported by the internal field of the sample. This field is caused by the remanence that contributes to the external magnetic field to fulfill the resonance condition [3,4]. Considering the different FMR responses, it can be postulated that a lower microwave frequency

Head and hand detuning effect study of narrow-band against wide-band mobile phone antennas

DEFF Research Database (Denmark)

Bahramzy, Pevand; Pedersen, Gert Frølund

2014-01-01

Wide-band (WB) and narrow-band (NB) antennas in terms of performance are compared, when interacting with the user’s right head and hand (RHH). The investigations are done through experimental measurements, using standardised head phantom and hand. It is shown that WB antennas detune more than NB ...

Workshop: Western hemisphere network of bird banding programs

Science.gov (United States)

Celis-Murillo, A.

2007-01-01

Purpose: To promote collaboration among banding programs in the Americas. Introduction: Bird banding and marking provide indispensable tools for ornithological research, management, and conservation of migratory birds on migratory routes, breeding and non-breeding grounds. Many countries and organizations in Latin America and the Caribbean are in the process of developing or have expressed interest in developing national banding schemes and databases to support their research and management programs. Coordination of developing and existing banding programs is essential for effective data management, reporting, archiving and security, and most importantly, for gaining a fuller understanding of migratory bird conservation issues and how the banding data can help. Currently, there is a well established bird-banding program in the U.S.A. and Canada, and programs in other countries are being developed as well. Ornithologists in many Latin American countries and the Caribbean are interested in using banding and marking in their research programs. Many in the ornithological community are interested in establishing banding schemes and some countries have recently initiated independent banding programs. With the number of long term collaborative and international initiatives increasing, the time is ripe to discuss and explore opportunities for international collaboration, coordination, and administration of bird banding programs in the Western Hemisphere. We propose the second ?Western Hemisphere Network of Bird Banding Programs? workshop, in association with the SCSCB, to be an essential step in the progress to strengthen international partnerships and support migratory bird conservation in the Americas and beyond. This will be the second multi-national meeting to promote collaboration among banding programs in the Americas (the first meeting was held in October 8-9, 2006 in La Mancha, Veracruz, Mexico). The Second ?Western Hemisphere Network of Bird Banding Programs

Effect of Spindle Parameters of Woodworking Band Saw on the AE Value of Crack Band Saw Blade in Compound Material Processing (1)

Science.gov (United States)

Gao, Jin-gui; Jiang, Zhao-fang; Luo, Lai-peng

2017-04-01

Taking the MJ3210A motion band saw as the research object, the AE value of the band saw blade vibration was obtained by analyzing the VIBSYS vibration signal acquisition and analysis software system in Beijing, and the change of the AE value of the band saw and the crack was found out. The experimental results show that in the MJ3210A sports car sawing machine, the band saw blade with width of 130 mm is used, and the AE value of the cracked band saw blade is well in the high band saw blade AE value. Under the best working condition of the band saw, the band saw blade AE If the value exceeds 104.7 dB (A) above, it means that the band saw blade has at least one crack length greater than 1.38 mm for the crack defect and the need to replace the band saw blade in time. Different species with saw blade of the AE value is different, white pine wood minimum, the largest oak wood; according to a variety of wood processing AE instrument value to determine the band saw blade crack to the situation; so as to fully rational use of band saw blade, The failure and the degree of development to find a new method.

The effect of density-of-state tails on band-to-band tunneling: Theory and application to tunnel field effect transistors

Science.gov (United States)

Sant, S.; Schenk, A.

2017-10-01

It is demonstrated how band tail states in the semiconductor influence the performance of a Tunnel Field Effect Transistor (TFET). As a consequence of the smoothened density of states (DOS) around the band edges, the energetic overlap of conduction and valence band states occurs gradually at the onset of band-to-band tunneling (BTBT), thus degrading the sub-threshold swing (SS) of the TFET. The effect of the band tail states on the current-voltage characteristics is modelled quantum-mechanically based on the idea of zero-phonon trap-assisted tunneling between band and tail states. The latter are assumed to arise from a 3-dimensional pseudo-delta potential proposed by Vinogradov [1]. This model potential allows the derivation of analytical expressions for the generation rate covering the whole range from very strong to very weak localization of the tail states. Comparison with direct BTBT in the one-band effective mass approximation reveals the essential features of tail-to-band tunneling. Furthermore, an analytical solution for the problem of tunneling from continuum states of the disturbed DOS to states in the opposite band is found, and the differences to direct BTBT are worked out. Based on the analytical expressions, a semi-classical model is implemented in a commercial device simulator which involves numerical integration along the tunnel paths. The impact of the tail states on the device performance is analyzed for a nanowire Gate-All-Around TFET. The simulations show that tail states notably impact the transfer characteristics of a TFET. It is found that exponentially decaying band tails result in a stronger degradation of the SS than tail states with a Gaussian decay of their density. The developed model allows more realistic simulations of TFETs including their non-idealities.

Higher superdeformed band members in {sup 190}Hg. Evidence for a band interaction

Energy Technology Data Exchange (ETDEWEB)

Bearden, I G; Daly, P J [Purdue Univ., Lafayette, IN (United States); Janssens, V F; Carpenter, M P; Ahmad, I; Khoo, T L; Lauritsen, T; Liang, Y [Argonne National Lab., IL (United States); Drigert, M W [Idaho National Engineering Lab., Idaho Falls, ID (United States); Garg, U; Reviol, W [Notre Dame Univ., IN (United States); Wyss, R [Joint Inst. for Heavy Ion Research, Oak Ridge, TN (United States)

1992-08-01

The superdeformed band of {sup 190}Hg has been traced up to a frequency {Dirac_h}{omega} {>=} 0.4 MeV by combining data from several experiments. A distinct change in the slope of the dynamic moment of inertia J{sup (2)} vs {Dirac_h}{omega} is observed at {Dirac_h}{omega} 0.32 MeV. This result is interpreted as evidence for a band interaction at the highest frequencies. Possible interpretations are reviewed. (author) 14 refs., 3 figs.

Generalized seniority scheme for bands in odd-A nuclei

International Nuclear Information System (INIS)

Gai, M.; Arima, A.; Strottman, D.

1980-01-01

The microscopic generalized seniority scheme is applied for the description of bands in odd-A nuclei. A perturbation expansion in terms of the core-particle interaction is performed. The first-order correction for the band head and the first member of the band is discussed. The specific band structure of a given nucleus, as well as the systematic trend of bands, is described in an explicit N-dependent analytical formula. This formula involves a linear dependence on N which arises from the first-order perturbation expansion. This term is shown responsible for the large deviation of the 11/2 - ΔJ=2 band spacing in I isotopes from the spacing of the Te core. All observed band structures of an odd-A nucleus arise from one simple core-particle coupling. Hence decoupled-E2 bands and strongly coupled ΔJ=1 bands, particle or hole bands of low-spin or high-spin orbits, all follow one simple N-dependence. This uniformity of bands is manifested in E2 bands in 53 I isotopes and deltaJ=1 bands in 51 Sb that have the same 52 Te cores. For the calculations a particle-particle force with a large contribution from a g delta force is used with a coupling constant that is deduced from 210 Pb. 1 figure

Present status of intermediate band solar cell research

International Nuclear Information System (INIS)

Cuadra, L.; Marti, A.; Luque, A.

2004-01-01

The intermediate band solar cell is a theoretical concept with the potential for exceeding the performance of conventional single-gap solar cells. This novel photovoltaic converter bases its superior theoretical efficiency over single-gap solar cells by enhancing its photogenerated current, via the two-step absorption of sub-band gap photons, without reducing its output voltage. This is achieved through a material with an electrically isolated and partially filled intermediate band located within a higher forbidden gap. This material is commonly named intermediate band material. This paper centres on summarising the present status of intermediate band solar cell research. A number of attempts, which aim to implement the intermediate band concept, are being followed: the direct engineering of the intermediate band material, its implementation by means of quantum dots and the highly porous material approach. Among other sub-band gap absorbing proposals, there is a renewed interest on the impurity photovoltaic effect, the quantum well solar cells and the particularly promising proposal for the use of up- and down-converters

Band excitation method applicable to scanning probe microscopy

Science.gov (United States)

Jesse, Stephen [Knoxville, TN; Kalinin, Sergei V [Knoxville, TN

2010-08-17

Methods and apparatus are described for scanning probe microscopy. A method includes generating a band excitation (BE) signal having finite and predefined amplitude and phase spectrum in at least a first predefined frequency band; exciting a probe using the band excitation signal; obtaining data by measuring a response of the probe in at least a second predefined frequency band; and extracting at least one relevant dynamic parameter of the response of the probe in a predefined range including analyzing the obtained data. The BE signal can be synthesized prior to imaging (static band excitation), or adjusted at each pixel or spectroscopy step to accommodate changes in sample properties (adaptive band excitation). An apparatus includes a band excitation signal generator; a probe coupled to the band excitation signal generator; a detector coupled to the probe; and a relevant dynamic parameter extractor component coupled to the detector, the relevant dynamic parameter extractor including a processor that performs a mathematical transform selected from the group consisting of an integral transform and a discrete transform.

Amniotic band syndrome: A clinical brief

Directory of Open Access Journals (Sweden)

Dasaradha Ramireddy Malireddy

2017-01-01

Full Text Available Amniotic band syndrome (ABS results from bands of amnion entangling fetal parts. They may manifest as constriction rings or complex congenital anomalies resulting in stillbirth. Karyotyping is important for exclusion of inherited disorders and proper counseling. Two case reports one stillbirth and the other with constriction ring of fingers and mild hydronephrosis are presented. The aim of this paper is to make awareness and stress the need for doing thorough work-up in all cases of constriction bands.

Absorption band Q model for the earth

International Nuclear Information System (INIS)

Anderson, D.L.; Given, J.W.

1982-01-01

Body wave, surface wave, and normal mode data are used to place constraints on the frequency dependence of Q in the mantle. With a simple absorption band model it is possible to satisfy the shear sensitive data over a broad frequency range. The quality factor Q/sub s/(ω) is proportional to ω/sup α/ in the band and to ω and ω -1 at higher and lower frequencies, respectively, as appropriate for a relaxation mechanism with a spectrum of relaxation time. The parameters of the band are Q(min) = 80, α = 0.15, and width, 5 decades. The center of the band varies from 10 1 seconds in the upper mantle, to 1.6 x 10 3 seconds in the lower mantle. The shift of the band with depth is consistent with the expected effects of temperature, pressure and stress. High Q, regions of the mantle are attributed to a shift of the absorption band to longer periods. To satisfy the gravest fundamental spheroidal modes and the ScS data, the absorption band must shift back into the short-period seismic band at the base of the mantle. This may be due to a high temperature gradient or high shear stresses. A preliminary attempt is also made to specify bulk dissipation in the mantle and core. Specific features of the absorption band model are low Q in the body wave band at both the top and the base of the mantle, low Q for long-period body waves in the outer core, an inner core Q 2 that increases with period, and low Q/sub p//Q/sub s/ at short periods in the middle mantel. The short-period Q/sub s/ increases rapidly at 400 km and is relatively constant from this depth to 2400 km. The deformational Q of the earth at a period of 14 months is predicted to be 463

Thermoelectric band engineering: The role of carrier scattering

Science.gov (United States)

Witkoske, Evan; Wang, Xufeng; Lundstrom, Mark; Askarpour, Vahid; Maassen, Jesse

2017-11-01

Complex electronic band structures, with multiple valleys or bands at the same or similar energies, can be beneficial for thermoelectric performance, but the advantages can be offset by inter-valley and inter-band scattering. In this paper, we demonstrate how first-principles band structures coupled with recently developed techniques for rigorous simulation of electron-phonon scattering provide the capabilities to realistically assess the benefits and trade-offs associated with these materials. We illustrate the approach using n-type silicon as a model material and show that intervalley scattering is strong. This example shows that the convergence of valleys and bands can improve thermoelectric performance, but the magnitude of the improvement depends sensitively on the relative strengths of intra- and inter-valley electron scattering. Because anisotropy of the band structure also plays an important role, a measure of the benefit of band anisotropy in the presence of strong intervalley scattering is presented.

Infrared radiation parameterizations for the minor CO2 bands and for several CFC bands in the window region

Science.gov (United States)

Kratz, David P.; Chou, Ming-Dah; Yan, Michael M.-H.

1993-01-01

Fast and accurate parameterizations have been developed for the transmission functions of the CO2 9.4- and 10.4-micron bands, as well as the CFC-11, CFC-12, and CFC-22 bands located in the 8-12-micron region. The parameterizations are based on line-by-line calculations of transmission functions for the CO2 bands and on high spectral resolution laboratory measurements of the absorption coefficients for the CFC bands. Also developed are the parameterizations for the H2O transmission functions for the corresponding spectral bands. Compared to the high-resolution calculations, fluxes at the tropopause computed with the parameterizations are accurate to within 10 percent when overlapping of gas absorptions within a band is taken into account. For individual gas absorption, the accuracy is of order 0-2 percent. The climatic effects of these trace gases have been studied using a zonally averaged multilayer energy balance model, which includes seasonal cycles and a simplified deep ocean. With the trace gas abundances taken to follow the Intergovernmental Panel on Climate Change Low Emissions 'B' scenario, the transient response of the surface temperature is simulated for the period 1900-2060.

Superdeformed bands in sub 64 sup 147 Gd sub 83 , a possible test of the existence of octupole correlations in superdeformed bands

Energy Technology Data Exchange (ETDEWEB)

Zuber, K.; Balouka, D.; Beck, F.A.; Byrski, T.; Curien, D.; Duchene, G.; Gehringer, C.; Haas, B.; Merdinger, J.C.; Romain, P.; Santos, D.; Styczen, J.; Vivien, J.P.; Dudek, J.; Szymanski, Z.; Werner, T. (Strasbourg-1 Univ., 67 (France). Centre de Recherches Nucleaires)

1990-12-24

Two discrete superdeformed bands (SD) have been identified in the nucleus {sup 147}Gd. The transitions energies of the SD yrast band lie halfway between the {gamma}-ray energies of the yrast SD band in {sup 146}Gd while the transition energies of the excited band lie half way between the transition energies of the yrast SD band in {sup 148}Gd. These two bands are shown to exhibit the presence of the pseudo SU(3) symmetry and also indicate the possible existence of octupole correlations at large elongations and high spins. (orig.).

CdSe/CdTe interface band gaps and band offsets calculated using spin-orbit and self-energy corrections

Energy Technology Data Exchange (ETDEWEB)

Ribeiro, M. [Centro de Pesquisas Avancadas Wernher von Braun, Av. Alice de Castro P.N. Mattosinho 301, CEP 13098-392 Campinas, SP (Brazil); Ferreira, L.G. [Departamento de Fisica dos Materiais e Mecanica, Instituto de Fisica, Universidade de Sao Paulo, 05315-970 Sao Paulo, SP (Brazil); Fonseca, L.R.C. [Center for Semiconductor Components, State University of Campinas, R. Pandia Calogeras 90, 13083-870 Campinas, SP (Brazil); Ramprasad, R. [Department of Chemical, Materials and Biomolecular Engineering, Institute of Materials Science, University of Connecticut, 97 North Eagleville Road, Storrs, CT 06269 (United States)

2012-09-20

We performed ab initio calculations of the electronic structures of bulk CdSe and CdTe, and their interface band alignments on the CdSe in-plane lattice parameters. For this, we employed the LDA-1/2 self-energy correction scheme to obtain corrected band gaps and band offsets. Our calculations include the spin-orbit effects for the bulk cases, which have shown to be of importance for the equilibrium systems and are possibly degraded in these strained semiconductors. Therefore, the SO showed reduced importance for the band alignment of this particular system. Moreover, the electronic structure calculated along the transition region across the CdSe/CdTe interface shows an interesting non-monotonic variation of the band gap in the range 0.8-1.8 eV, which may enhance the absorption of light for corresponding frequencies at the interface between these two materials in photovoltaic applications.

The Novel Microwave Stop-Band Filter

Directory of Open Access Journals (Sweden)

R. E. Chernobrovkin

2008-01-01

Full Text Available The stop-band filter with the new band-rejection element is proposed. The element is a coaxial waveguide with the slot in the centre conductor. In the frame of this research, the numerical and experimental investigations of the amplitude-frequency characteristics of the filter are carried out. It is noted that according to the slot parameters the two typical resonances (half-wave and quarter-wave can be excited. The rejection band of the single element is defined by the width, depth, and dielectric filling of the slot. Fifth-order Chebyshev filter utilizing the aforementioned element is also synthesized, manufactured, and tested. The measured and simulated results are in good agreement. The experimental filter prototype exhibits the rejection band 0.86 GHz at the level −40 dB.

Deep space propagation experiments at Ka-band

Science.gov (United States)

Butman, Stanley A.

1990-01-01

Propagation experiments as essential components of the general plan to develop an operational deep space telecommunications and navigation capability at Ka-band (32 to 35 GHz) by the end of the 20th century are discussed. Significant benefits of Ka-band over the current deep space standard X-band (8.4 GHz) are an improvement of 4 to 10 dB in telemetry capacity and a similar increase in radio navigation accuracy. Propagation experiments are planned on the Mars Observer Mission in 1992 in preparation for the Cassini Mission to Saturn in 1996, which will use Ka-band in the search for gravity waves as well as to enhance telemetry and navigation at Saturn in 2002. Subsequent uses of Ka-band are planned for the Solar Probe Mission and the Mars Program.

Dosimetry of narrow band UVB treatments

International Nuclear Information System (INIS)

Goode, D.H.; Mannering, D.M.

1996-01-01

Full text: For many years psoriasis has been treated with broad band UVB lamps. These lamps have a bell shaped spectrum which peaks at 305 nm and extends from 280 nm to 350 nm. However research with monochromatic UV radiation has shown that wavelengths between 300 nm and 320 nm are the most efficacious for clearing psoriasis while wavelengths below 305 nm are most effective for producing the undesirable side effect of erythema (sunburn). In response to these findings Philips developed a narrow band UVB tube in which a large fraction of the output was confined to a narrow peak (bandwidth 2.5 nm) situated at 311 nm. Christchurch Hospital replaced broad band UVB with narrow band treatments in August 1995 and as this required UV exposures to be substantially increased new protocols had to be developed. Three aspects needed to be addressed. These were translating the dose from broad band to narrow band for current patients, determining the initial dose for new patients and developing a formula for increasing subsequent exposures to both types of patient. To translate doses the spectral irradiance (μW/cm 2 /nm) that would fall on the patient was measured in both the old broad band and the new narrow band treatment units and from this UV doses were calculated. All doses were expressed in mJ/cm 2 of unweighted UV over the range 250 nm to 400 nm. The erythemal effectiveness of the two units were compared by using the CIE 1987 curve to express doses in terms of the equivalent exposure of monochromatic 297 nm radiation. It was found that an exposure of 3.96 mJ/cm 2 from the broad band FS40 tubes and 12.79 mJ/cm 2 from the narrow band TL/01 tubes were both equivalent to 1.00 mJ/cm 2 of monochromatic 297 nm radiation so when transferring patients all broad band doses needed to be increased by a factor of 3.2. Before transferring any patients this factor was confirmed by conducting two minimal erythema dose (MED) tests on a normal subject, one in each unit. For new patients a

Band-engineering of TiO2 as a wide-band gap semiconductor using organic chromophore dyes

Science.gov (United States)

Wahyuningsih, S.; Kartini, I.; Ramelan, A. H.; Saputri, L. N. M. Z.; Munawaroh, H.

2017-07-01

Bond-engineering as applied to semiconductor materials refers to the manipulation of the energy bands in order to control charge transfer processes in a device. When the device in question is a photoelectrochemical cell, the charges affected by drift become the focus of the study. The ideal band gap of semiconductors for enhancement of photocatalyst activity can be lowered to match with visible light absorption and the location of conduction Band (CB) should be raised to meet the reducing capacity. Otherwise, by the addition of the chromofor organic dyes, the wide-band gab can be influences by interacation resulting between TiO2 surface and the dyes. We have done the impruvisation wide-band gap of TiO2 by the addition of organic chromophore dye, and the addition of transition metal dopand. The TiO2 morphology influence the light absorption as well as the surface modification. The organic chromophore dye was syntesized by formation complexes compound of Co(PAR)(SiPA)(PAR)= 4-(2-piridylazoresorcinol), SiPA = Silyl propil amine). The result showed that the chromophore groups adsorbed onto TiO2 surface can increase the visible light absorption of wide-band gab semiconductor. Initial absorption of a chromophore will affect light penetration into the material surfaces. The use of photonic material as a solar cell shows this phenomenon clearly from the IPCE (incident photon to current conversion efficiency) measurement data. Organic chromophore dyes of Co(PAR)(SiPA) exhibited the long wavelength absorption character compared to the N719 dye (from Dyesol).

Band structures in near spherical 138Ce

Science.gov (United States)

Bhattacharjee, T.; Chanda, S.; Bhattacharyya, S.; Basu, S. K.; Bhowmik, R. K.; Das, J. J.; Pramanik, U. Datta; Ghugre, S. S.; Madhavan, N.; Mukherjee, A.; Mukherjee, G.; Muralithar, S.; Singh, R. P.

2009-06-01

The high spin states of N=80138Ce have been populated in the fusion evaporation reaction 130Te( 12C, 4n) 138Ce at E=65 MeV. The γ transitions belonging to various band structures were detected and characterized using an array of five Clover Germanium detectors. The level scheme has been established up to a maximum spin and excitation energy of 23 ℏ and 9511.3 keV, respectively, by including 53 new transitions. The negative parity ΔI=1 band, developed on the 6536.3 keV 15 level, has been conjectured to be a magnetic rotation band following a semiclassical analysis and comparing the systematics of similar bands in the neighboring nuclei. The said band is proposed to have a four quasiparticle configuration of [πgh]⊗[. Other band structures are interpreted in terms of multi-quasiparticle configurations, based on Total Routhian Surface (TRS) calculations. For the low and medium spin states, a shell model calculation using a realistic two body interaction has been performed using the code OXBASH.

Observation of band gaps in the gigahertz range and deaf bands in a hypersonic aluminum nitride phononic crystal slab

Science.gov (United States)

Gorisse, M.; Benchabane, S.; Teissier, G.; Billard, C.; Reinhardt, A.; Laude, V.; Defaÿ, E.; Aïd, M.

2011-06-01

We report on the observation of elastic waves propagating in a two-dimensional phononic crystal composed of air holes drilled in an aluminum nitride membrane. The theoretical band structure indicates the existence of an acoustic band gap centered around 800 MHz with a relative bandwidth of 6.5% that is confirmed by gigahertz optical images of the surface displacement. Further electrical measurements and computation of the transmission reveal a much wider attenuation band that is explained by the deaf character of certain bands resulting from the orthogonality of their polarization with that of the source.

Identical bands in Ba-Dy, N < 104 space

International Nuclear Information System (INIS)

Mittal, H.M.; Vidya Devi; Gupta, J.B.

2008-01-01

The recognition of the existence of identical bands, in even-even, odd-even and odd-odd nuclei, in normal deformed bands and superdeformed bands has become the subject of great interest in recent years. Here the search have been taken for such bands for the normal deformed, even-Z, even-N nuclei of Ba and Dy for 82< N<104 major shell space

New Kronig-Penney equation emphasizing the band edge conditions

International Nuclear Information System (INIS)

Szmulowicz, Frank

2008-01-01

The Kronig-Penney problem is a textbook example for discussing band dispersions and band gap formation in periodic layered media. For example, in photonic crystals, the behaviour of bands next to the band edges is important for further discussions of such effects as inhibited light emission, slow light and negative index of refraction. However, the standard Kronig-Penney equation does not explicitly state the band edge conditions. This paper derives a new solution for the Kronig-Penney problem that explicitly displays the band edge conditions as well as contains all other essential physics of band formation. Therefore, the present exposition should show the student that the band edge conditions are not simply special cases of the familiar Kronig-Penney equation but, instead, are an integral part of the band theory. For the computationally minded student, the new equation is particularly convenient for calculating the positions of closely spaced band edges. The present results can be taught alongside the Kronig-Penney equation in advanced undergraduate or beginning graduate quantum mechanics, solid state theory and photonics courses dealing with wave propagation through periodic layered media

Search for positive parity bands in 117Xe

International Nuclear Information System (INIS)

Liu, Z.; Sun, X.; Zhou, X.; Lei, X.; Zhang, Y.; Jin, H.; Pan, Q.; Guo, Y.; Chen, X.; Luo, Y.; Wen, S.; Yuan, G.; Yang, C.; Luo, W.; Chen, Y.S.; Xing, Z.; Chen, X.Q.

1995-01-01

Excited states of 117 Xe were populated via the reaction 28 Si+ 92 Mo at 100-120MeV. More than 40 new γ-transitions and three new positive parity bands have been observed by means of in-beam γ-ray spectroscopy. The previously known νh 11/2 bands were confirmed, and the νg 7/2 favored band was extended up to 47/2 + in which two bandcrossings have been observed at hω=0.33 and 0.44MeV, respectively. The band structures have been discussed by means of TRS and CSM calculations. A newly observed rotational band consisting of five γ-transitions has been considered as the πh 11/2 band of 117 Cs. ((orig.))

Resonant enhancement of band-to-band tunneling in in-plane MoS2/WS2 heterojunctions

Science.gov (United States)

Kuroda, Tatsuya; Mori, Nobuya

2018-04-01

The band-to-band (BTB) tunneling current J through in-plane MoS2/WS2 heterojunctions is calculated by the nonequilibrium Green function method combined with tight-binding approximation. Types A and B of band configurations are considered. For type-A (type-B) heterojunctions, a potential notch exists (or is absent) at the heterointerface. Both type-A and type-B MoS2/WS2 heterojunctions can support a higher BTB current than MoS2 and WS2 homojunctions. For type-A heterojunctions, the resonant enhancement of J occurs resulting in a significantly higher BTB tunneling current.

ANALISIS TIPOGRAFI PADA LOGOTYPE BAND FORGOTTEN

Directory of Open Access Journals (Sweden)

Atang Riyan Isnandar

2016-12-01

Full Text Available Abstrak Forgotten merupakan band asal kota Bandung yang beraliran death metal. Band ini telah memiliki beberapa album yang cukup sukses. Salah satu faktor yang turut berperan penting dalam album-album Forgotten adalah desain sampul album. Sampul album merupakan identitas dan pesan dari musik yang dibawakan oleh Forgotten. Dalam sampul album, terdapat salah satu elemen visual yaitu Tipografi. Salah satu peran tipografi dalam sampul album Forgotten adalah sebagai logotype dari band. Yang menarik, dari lima album yang telah dirilis Forgotten yaitu “Future Syndrome” (1997, “Obsesi Mati” (2000, “Tuhan Telah Mati” (2001, “Tiga Angka Enam” (2003 dan “Laras Perlaya” (2011 adalah tampilan logotype band yang selalu berbeda. Perubahan logotype Forgotten disebabkan oleh beberapa faktor seperti adanya perubahan selera, transformasi musik dan pergantian personil yang dialami oleh band Forgotten. Perubahan ini berakibat pada munculnya kesan visual yang berbeda-beda dari masing-masing logotype di setiap sampul albumnya. Apalagi logotype band dengan genre death metal memiliki kecendrungan yang unik, dekoratif, bahkan sulit untuk dibaca. Oleh karena itu untuk mengetahui kesan visual yang dimunculkan oleh setiap logotype akan dilakukan penelitian dengan pendekatan tipografi. Tujuan dari penelitian ini adalah selain untuk mengetahui perubahan logotype dari kelima sampul album yang telah dirilis oleh Forgotten juga ingin mengetahui kesan visual terhadap tipografi terkait dengan prinsip kejelasan (legibility, keterbacaan (readability dan kemampuannya untuk dilihat pada jarak tertentu (visibility. Kata Kunci: Sampul Album, Tipografi, Logotype, Forgotten Abstract Forgotten is a band from Bandung, the death metal genre. The band has had some fairly successful album. One of important factor in albums Forgotten is the album cover design. The album cover are the identity and the message of the music performed by the Forgotten. In the cover of the album

Report from the banding lab

Science.gov (United States)

Tautin, J.

1995-01-01

Mr. Tautin reported on the seemingly everchanging structure of biological science units within the Interior Department. Current Congressional proposals would either change the name of the Bird Banding Lab's parent agency or make it part of the Geological Survey. The current Congress has not looked favorably on science budgets within the Interior Department, and the Banding Lab's budget is being squeezed ever tighter.

Superdeformed bands in 130Ce

International Nuclear Information System (INIS)

Paul, E.S.; Semple, A.T.; Boston, A.J.; Joss, D.T.; Nolan, P.J.; Shepherd, S.L.

1997-01-01

Four superdeformed bands have been assigned to 130 Ce following a high-statistics γ-ray study using the EUROGAM II spectrometer. The strongest band exhibits two distinct backbends which, in one scenario, may be interpreted as crossings between high-j N = 6 neutron orbitals (νi 13/2 ) and low-j N = 4 orbitals (νd 3/2 ) in an unpaired system. (author)

Ferritin associates with marginal band microtubules

International Nuclear Information System (INIS)

Infante, Anthony A.; Infante, Dzintra; Chan, M.-C.; How, P.-C.; Kutschera, Waltraud; Linhartova, Irena; Muellner, Ernst W.; Wiche, Gerhard; Propst, Friedrich

2007-01-01

We characterized chicken erythrocyte and human platelet ferritin by biochemical studies and immunofluorescence. Erythrocyte ferritin was found to be a homopolymer of H-ferritin subunits, resistant to proteinase K digestion, heat stable, and contained iron. In mature chicken erythrocytes and human platelets, ferritin was localized at the marginal band, a ring-shaped peripheral microtubule bundle, and displayed properties of bona fide microtubule-associated proteins such as tau. Red blood cell ferritin association with the marginal band was confirmed by temperature-induced disassembly-reassembly of microtubules. During erythrocyte differentiation, ferritin co-localized with coalescing microtubules during marginal band formation. In addition, ferritin was found in the nuclei of mature erythrocytes, but was not detectable in those of bone marrow erythrocyte precursors. These results suggest that ferritin has a function in marginal band formation and possibly in protection of the marginal band from damaging effects of reactive oxygen species by sequestering iron in the mature erythrocyte. Moreover, our data suggest that ferritin and syncolin, a previously identified erythrocyte microtubule-associated protein, are identical. Nuclear ferritin might contribute to transcriptional silencing or, alternatively, constitute a ferritin reservoir

Lunar Noise-Temperature Increase Measurements at S-Band, X-Band, and Ka-Band Using a 34-Meter-Diameter Beam-Waveguide Antenna

Science.gov (United States)

Morabito, D. D.

2006-08-01

The Moon radiates energy at infrared and microwave wavelengths, in addition to reflecting sunlight at optical wavelengths. As a result, an antenna pointed at or near the Moon will cause an increase in receiver noise temperature that needs to be accounted for in telemetry, radio science, or ranging link budgets. The Deep Space Network may be required to use its antennas in future lunar robotic or human missions, and thus it is important to understand the nature of this temperature increase as a function of observing frequency, lunar phase, and angular offset of the antenna beam from the center of the lunar disk. This article quantifies such a set of measurements acquired at DSS 13, a 34-m-diameter research and development beam-waveguide antenna located at Goldstone, California, at three different telecommunication frequencies, S-band (2.3 GHz), X-band (8.4 GHz), and Ka-band (32 GHz), over a wide range of lunar phase, for both disk-centered and limb-centered positions of the antenna beam.

Ultra wide band antennas

CERN Document Server

Begaud, Xavier

2013-01-01

Ultra Wide Band Technology (UWB) has reached a level of maturity that allows us to offer wireless links with either high or low data rates. These wireless links are frequently associated with a location capability for which ultimate accuracy varies with the inverse of the frequency bandwidth. Using time or frequency domain waveforms, they are currently the subject of international standards facilitating their commercial implementation. Drawing up a complete state of the art, Ultra Wide Band Antennas is aimed at students, engineers and researchers and presents a summary of internationally recog

Band head spin assignment of superdeformed bands in Hg isotopes through power index formula

Science.gov (United States)

Sharma, Honey; Mittal, H. M.

2018-05-01

The power index formula has been used to obtain the band head spin (I 0) of all the superdeformed (SD) bands in Hg isotopes. A least squares fitting approach is used. The root mean square deviations between the determined and the observed transition energies are calculated by extracting the model parameters using the power index formula. Whenever definite spins are available, the determined and the observed transition energies are in accordance with each other. The computed values of dynamic moment of inertia J (2) obtained by using the power index formula and its deviation with the rotational frequency is also studied. Excellent agreement is shown between the calculated and the experimental results for J (2) versus the rotational frequency. Hence, the power index formula works very well for all the SD bands in Hg isotopes expect for 195Hg(2, 3, 4).

First-principles determination of band-to-band electronic transition energies in cubic and hexagonal AlGaInN alloys

Directory of Open Access Journals (Sweden)

F. L. Freitas

2016-08-01

Full Text Available We provide approximate quasiparticle-corrected band gap energies for quaternary cubic and hexagonal AlxGayIn1–x–yN semiconductor alloys, employing a cluster expansion method to account for the inherent statistical disorder of the system. Calculated values are compared with photoluminescence measurements and discussed within the currently accepted model of emission in these materials by carrier localization. It is shown that bowing parameters are larger in the cubic phase, while the range of band gap variation is bigger in the hexagonal one. Experimentally determined transition energies are mostly consistent with band-to-band excitations.

First-principles determination of band-to-band electronic transition energies in cubic and hexagonal AlGaInN alloys

Energy Technology Data Exchange (ETDEWEB)

Freitas, F. L., E-mail: felipelopesfreitas@gmail.com; Marques, M.; Teles, L. K. [Grupo de Materiais Semicondutores e Nanotecnologia, Instituto Tecnológico de Aeronáutica, 12228-900 São José dos Campos, SP (Brazil)

2016-08-15

We provide approximate quasiparticle-corrected band gap energies for quaternary cubic and hexagonal Al{sub x}Ga{sub y}In{sub 1–x–y}N semiconductor alloys, employing a cluster expansion method to account for the inherent statistical disorder of the system. Calculated values are compared with photoluminescence measurements and discussed within the currently accepted model of emission in these materials by carrier localization. It is shown that bowing parameters are larger in the cubic phase, while the range of band gap variation is bigger in the hexagonal one. Experimentally determined transition energies are mostly consistent with band-to-band excitations.

A Compact UWB Band-Pass Filter Using Embedded Circular Slot Structures for Improved Upper Stop-band Performance

DEFF Research Database (Denmark)

Shen, Ming; Ren, Jian; Mikkelsen, Jan Hvolgaard

2016-01-01

structures into the ring resonator. This is different from conventional designs using cascaded bandstop/low-pass filters for stop-band response suppression, which usually leads to big circuit sizes. And hence the proposed approach can reduce the circuit size significantly. A prototype filter with a compact...... size (13.6 mm×6.75 mm) has been implemented for experimental validation. The measured results show a −3 dB frequency band from 3.4 GHz to 11.7 GHz and > 20 dB upper stop-band suppression from 12.5 GHz to 20GHz....

Gain flattened L-band EDFA based on upgraded C-band EDFA using forward ASE pumping in an EDF section

DEFF Research Database (Denmark)

Buxens Azcoaga, Alvaro Juan; Poulsen, Henrik Nørskov; Clausen, Anders

2000-01-01

A novel method is presented for implementing an L-band erbium doped fibre amplifier (EDFA) making use of forward amplified spontaneous emission pumping, from a commercially available c-band EDFA, in an erbium doped fibre. Tuning of the length of erbium doped fibre enables a flat gain characteristic...... to be obtained with a low noise figure over the entire L-band window....

A Compact Printed Quadruple Band-Notched UWB Antenna

Directory of Open Access Journals (Sweden)

Xiaoyin Li

2013-01-01

Full Text Available A novel compact coplanar waveguide- (CPW- fed ultrawideband (UWB printed planar volcano-smoke antenna (PVSA with four band-notches for various wireless applications is proposed and demonstrated. The low-profile antenna consists of a C-shaped parasitic strip to generate a notched band at 8.01~8.55 GHz for the ITU band, two C-shaped slots, and an inverted U-shaped slot etched in the radiator patch to create three notched bands at 5.15~5.35 GHz, 5.75~5.85 GHz, and 7.25~7.75 GHz for filtering the WLAN and X-band satellite signals. Simulated and measured results both confirm that the proposed antenna has a broad bandwidth of 3.1~12 GHz with VSWR < 2 and good omnidirectional radiation patterns with four notched-bands.

Surface correlation effects in two-band strongly correlated slabs.

Science.gov (United States)

Esfahani, D Nasr; Covaci, L; Peeters, F M

2014-02-19

Using an extension of the Gutzwiller approximation for an inhomogeneous system, we study the two-band Hubbard model with unequal band widths for a slab geometry. The aim is to investigate the mutual effect of individual bands on the spatial distribution of quasi-particle weight and charge density, especially near the surface of the slab. The main effect of the difference in band width is the presence of two different length scales corresponding to the quasi-particle profile of each band. This is enhanced in the vicinity of the critical interaction of the narrow band where an orbitally selective Mott transition occurs and a surface dead layer forms for the narrow band. For the doped case, two different regimes of charge transfer between the surface and the bulk of the slab are revealed. The charge transfer from surface/center to center/surface depends on both the doping level and the average relative charge accumulated in each band. Such effects could also be of importance when describing the accumulation of charges at the interface between structures made of multi-band strongly correlated materials.

Confidence bands for inverse regression models

International Nuclear Information System (INIS)

Birke, Melanie; Bissantz, Nicolai; Holzmann, Hajo

2010-01-01

We construct uniform confidence bands for the regression function in inverse, homoscedastic regression models with convolution-type operators. Here, the convolution is between two non-periodic functions on the whole real line rather than between two periodic functions on a compact interval, since the former situation arguably arises more often in applications. First, following Bickel and Rosenblatt (1973 Ann. Stat. 1 1071–95) we construct asymptotic confidence bands which are based on strong approximations and on a limit theorem for the supremum of a stationary Gaussian process. Further, we propose bootstrap confidence bands based on the residual bootstrap and prove consistency of the bootstrap procedure. A simulation study shows that the bootstrap confidence bands perform reasonably well for moderate sample sizes. Finally, we apply our method to data from a gel electrophoresis experiment with genetically engineered neuronal receptor subunits incubated with rat brain extract

Simultaneous confidence bands for the integrated hazard function

OpenAIRE

Dudek, Anna; Gocwin, Maciej; Leskow, Jacek

2006-01-01

The construction of the simultaneous confidence bands for the integrated hazard function is considered. The Nelson--Aalen estimator is used. The simultaneous confidence bands based on bootstrap methods are presented. Two methods of construction of such confidence bands are proposed. The weird bootstrap method is used for resampling. Simulations are made to compare the actual coverage probability of the bootstrap and the asymptotic simultaneous confidence bands. It is shown that the equal--tai...

Observations of banding in first-year Arctic sea ice

Science.gov (United States)

Cole, David M.; Eicken, Hajo; Frey, Karoline; Shapiro, Lewis H.

2004-08-01

Horizontal banding features, alternating dark and bright horizontal bands apparent in ice cores and stratigraphic cross sections have long been observed in first-year sea ice and are frequently associated with bands of high and low brine or gas porosity. Observations on the land-fast ice near Barrow, Alaska, in recent years have revealed particularly striking banding patterns and prompted a study of their macroscopic and microscopic characteristics. The banding patterns are quantified from photographs of full-depth sections of the ice, and examples are presented from the Chukchi Sea and Elson Lagoon. Statistics on band spacing are presented, and the growth records for three seasons are employed to estimate their time of formation. These data provide insight into the periodicity of the underlying phenomena. Micrographs are used to examine the microstructural variations associated with various banding features and to quantify the geometry of the constituent brine inclusions associated with high- and low-porosity bands. The micrography revealed that the area fraction of brine inclusions varied by a factor of nearly 3 through the more pronounced high- and low-porosity bands. Vertical micrographs obtained shortly after the materials' removal from the ice sheet showed that significantly larger inclusions form abruptly at the start of the high-porosity bands and frequently terminate abruptly at the end of the band. Crystallographic observations indicated that the high-porosity bands supported the nucleation and growth of crystals having substantially different orientations from the very well aligned columnar structure that characterized the bulk of the sheet.

Multi-Band (K- Q- and E-Band) Multi-Tone Millimeter-Wave Frequency Synthesizer for Radio Wave Propagation Studies

Science.gov (United States)

Simons, Rainee N.; Wintucky, Edwin G.

2014-01-01

This paper presents the design and test results of a multi-band multi-tone millimeter-wave frequency synthesizer, based on a solid-state frequency comb generator. The intended application of the synthesizer is in a space-borne transmitter for radio wave atmospheric studies at K-band (18 to 26.5 GHz), Q-band (37 to 42 GHz), and E-band (71 to 76 GHz). These studies would enable the design of robust multi-Gbps data rate space-to-ground satellite communication links. Lastly, the architecture for a compact multi-tone beacon transmitter, which includes a high frequency synthesizer, a polarizer, and a conical horn antenna, has been investigated for a notional CubeSat based space-to-ground radio wave propagation experiment.

Transistorized wide band pulse amplifier; Amplificateur d'impulsions a large bande et a transistors

Energy Technology Data Exchange (ETDEWEB)

Girard, J; Savinelli, H [Commissariat a l' Energie Atomique, Saclay (France).Centre d' Etudes Nucleaires; Hazoni, Y [Atomic Energy Commission (Israel)

1960-07-01

A simple wide band amplifier is described below, having a stability better than 1{sup 0}/00 deg{sup -1} centigrade, a current gain of 10{sup 3}, bandwidth of 30 MHz, and a signal to noise current ratio of about 100. This amplifier has been studied to answer the necessity of a fast transistor head amplifier for nuclear detectors, having in mind pile up and overloading problems. (author) [French] Un amplificateur simple, a large bande, est decrit ci-apres, il a une stabilite meilleure que le 0/00 par degre centigrade, un gain en courant de 10{sup 3} une largeur de bande de 30 MHz, et un rapport signal sur bruit en courant d'environ 100. Cet amplificateur a ete etudie pour repondre a la necessite de l'amplification des impulsions provenant de detecteurs nucleaires, ayant a l'esprit les problemes d'empilement et de saturation. (auteur)

Model Development for MODIS Thermal Band Electronic Crosstalk

Science.gov (United States)

Chang, Tiejun; Wu, Aisheng; Geng, Xu; Li, Yonghonh; Brinkman, Jake; Keller, Graziela; Xiong, Xiaoxiong

2016-01-01

MODerate-resolution Imaging Spectroradiometer (MODIS) has 36 bands. Among them, 16 thermal emissive bands covering a wavelength range from 3.8 to 14.4 m. After 16 years on-orbit operation, the electronic crosstalk of a few Terra MODIS thermal emissive bands developed substantial issues that cause biases in the EV brightness temperature measurements and surface feature contamination. The crosstalk effects on band 27 with center wavelength at 6.7 m and band 29 at 8.5 m increased significantly in recent years, affecting downstream products such as water vapor and cloud mask. The crosstalk effect is evident in the near-monthly scheduled lunar measurements, from which the crosstalk coefficients can be derived. The development of an alternative approach is very helpful for independent verification.In this work, a physical model was developed to assess the crosstalk impact on calibration as well as in Earth view brightness temperature retrieval. This model was applied to Terra MODIS band 29 empirically to correct the Earth brightness temperature measurements. In the model development, the detectors nonlinear response is considered. The impact of the electronic crosstalk is assessed in two steps. The first step consists of determining the impact on calibration using the on-board blackbody (BB). Due to the detectors nonlinear response and large background signal, both linear and nonlinear coefficients are affected by the crosstalk from sending bands. The second step is to calculate the effects on the Earth view brightness temperature retrieval. The effects include those from affected calibration coefficients and the contamination of Earth view measurements. This model links the measurement bias with crosstalk coefficients, detector non-linearity, and the ratio of Earth measurements between the sending and receiving bands. The correction of the electronic cross talk can be implemented empirically from the processed bias at different brightness temperature. The implementation

47 CFR 90.1213 - Band plan.

Science.gov (United States)

2010-10-01

... 47 Telecommunication 5 2010-10-01 2010-10-01 false Band plan. 90.1213 Section 90.1213 Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED) SAFETY AND SPECIAL RADIO SERVICES PRIVATE LAND... § 90.1213 Band plan. The following channel center frequencies are permitted to be aggregated for...

Phosphoinositolphosphate (PIP) cascade induction by hypertonic stress of plant tissue

International Nuclear Information System (INIS)

Srivastava, A.; Jacoby, B.

1989-01-01

Inositol 1,4,5-trisphosphate (IP 3 ) was determined by competition with [ 3 H]-IP 3 for binding to an IP 3 specific protein. A hypertonic mannitol, sorbitol or lactose shock induced an increase in the rate of K + uptake and raised the IP 3 content of Beta vulgaris slices, excised Vigna mungo and Sorghum bicolor roots, as well as attached V. mungo roots. Increased K + uptake could also be induced by compounds that artificially induce the PIP cascade, or mimic it's products. A hypertonic shock, administered to intact B. vulgaris slices, further enhanced the phosphorylation of a 20 kD protein in the plasmalemma. Maximal IP 3 content was found 10 min after hypertonic induction and maximal K + uptake was obtained 10 min later. The effect of a continuous hypertonic treatment on IP 3 content, but not on K + uptake, was transient. Li + decreased the rate of IP 3 metabolism

Integrated wide-band low-background amplifiers

International Nuclear Information System (INIS)

Il'yushchenko, I.I.

1980-01-01

Ways of increasing stability and reproduction of characteristics of wide-band integral amplifiers that would to the least extent increase their background noises, are discussed. Considered are some certain flowsheets of integral wide-band amplifiers with low background noise of foreign production which differ from one another by construction of inlet cascades as well as by the applied feedback type. The principal flowsheets of the amplifiers and their main performances are presented. The analysis of the data obtained has revealed that microcircuits made of cascades with a common emitter and local combined feedback are most wide-band among all the considered microcircuits [ru

SPECTRUM AGGREGATION WITH OPTIMAL MULTI-BAND SCHEDULING

DEFF Research Database (Denmark)

Mihovska, Albena D.

2010-01-01

This paper seeks to explore the integration of spectrum and network resource management functionalities to the benefit of achieving higher performance and capacity gains in an International Mobile Telecommunications-Advanced (IMT-A) scenario. In particular, we investigate the allocation of users...... over two frequency bands (i.e., 2 GHz and 5 GHz) for a single operator scenario. The same type of Radio Access Technology (RAT) is considered for both frequency bands. It is assumed that the operator has gained access to a non-shared 2 GHz band and to part (or all) of the frequency pool band at 5 GHz....... The performance gain is analyzed in terms of higher data throughput. The performance is heavily dependent on the channel quality for each user in the considered bands which, in turn, is a function of the path loss and the distance from the Base Station (BS). The operator will have relevant improvements when...

Excited negative parity bands in 160Yb

Science.gov (United States)

Saha, A.; Bhattacharjee, T.; Curien, D.; Dedes, I.; Mazurek, K.; Banerjee, S. R.; Rajbanshi, S.; Bisoi, A.; de Angelis, G.; Bhattacharya, Soumik; Bhattacharyya, S.; Biswas, S.; Chakraborty, A.; Das Gupta, S.; Dey, B.; Goswami, A.; Mondal, D.; Pandit, D.; Palit, R.; Roy, T.; Singh, R. P.; Saha Sarkar, M.; Saha, S.; Sethi, J.

2018-03-01

Negative parity rotational bands in {} 70160Yb{}90 nucleus have been studied. They were populated in the 148Sm(16O, 4n)160Yb reaction at 90 MeV. The gamma-coincidence data have been collected using Indian National Gamma Array composed of twenty Compton suppressed clover germanium (Ge) detectors. Double gating on triple gamma coincidence data were selectively used to develop the decay scheme for these negative parity bands by identifying and taking care of the multiplet transitions. The even- and odd-spin negative parity bands in 160Yb have been studied by comparing the reduced transition probability ratios with the similar bands in neighbouring even-even rare earth nuclei. It is concluded that the concerned odd-spin and even-spin bands are not signature partners and that their structures are compatible with those of the ‘pear-shape’ and ‘pyramid-shape’ oscillations, respectively, the octupole shapes superposed with the quadrupole shape of the ground-state.

Dipole Bands in 196Hg

International Nuclear Information System (INIS)

Lawrie, J. J.; Lawrie, E. A.; Newman, R. T.; Sharpey-Schafer, J. F.; Smit, F. D.; Msezane, B.; Benatar, M.; Mabala, G. K.; Mutshena, K. P.; Federke, M.; Mullins, S. M.; Ncapayi, N. J.; Vymers, P.

2011-01-01

High spin states in 196 Hg have been populated in the 198 Pt(α,6n) reaction at 65 MeV and the level scheme has been extended. A new dipole band has been observed and a previously observed dipole has been confirmed. Excitation energies, spins and parities of these bands were determined from DCO ratio and linear polarization measurements. Possible quasiparticle excitations responsible for these structures are discussed.

Development of softcopy environment for primary color banding visibility assessment

Science.gov (United States)

Min, Byungseok; Pizlo, Zygmunt; Allebach, Jan P.

2008-01-01

Fine-pitch banding is one of the most unwanted artifacts in laser electrophotographic (EP) printers. It is perceived as a quasiperiodic fluctuation in the process direction. Therefore, it is essential for printer vendors to know how banding is perceived by humans in order to improve print quality. Monochrome banding has been analyzed and assessed by many researchers; but there is no literature that deals with the banding of color laser printers as measured from actual prints. The study of color banding is complicated by the fact that the color banding signal is physically defined in a three-dimensional color space, while banding perception is described in a one-dimensional sense such as more banding or less banding. In addition, the color banding signal arises from the independent contributions of the four primary colorant banding signals. It is not known how these four distinct signals combine to give rise to the perception of color banding. In this paper, we develop a methodology to assess the banding visibility of the primary colorant cyan based on human visual perception. This is our first step toward studying the more general problem of color banding in combinations of two or more colorants. According to our method, we print and scan the cyan test patch, and extract the banding profile as a one dimensional signal so that we can freely adjust the intensity of banding. Thereafter, by exploiting the pulse width modulation capability of the laser printer, the extracted banding profile is used to modulate a pattern consisting of periodic lines oriented in the process direction, to generate extrinsic banding. This avoids the effect of the halftoning algorithm on the banding. Furthermore, to conduct various banding assessments more efficiently, we also develop a softcopy environment that emulates a hardcopy image on a calibrated monitor, which requires highly accurate device calibration throughout the whole system. To achieve the same color appearance as the hardcopy

A comparative cepstral based analysis of simulated and measured S-band and X-band radar Doppler spectra of human motion

CSIR Research Space (South Africa)

Van Eeden, WD

2015-10-01

Full Text Available targets. It is also shown that, whereas the motion of most body parts of a human target can be observed in the X-band data, only the main torso sway can be observed at S-band. This implies that X-band data is well suited to cepstrum based human motion...

Introduction to the viewpoint set on shear bands

International Nuclear Information System (INIS)

Hutchinson, J.W.

1984-01-01

Recent work aimed at improving our understanding of shear banding and flow localization as modes of deformation and failure is summarized in the six viewpoint articles which follow. For the most part, the emphasis here is on the observation and analysis of shear banding in metals, but active efforts are also underway to understand the role of shear bands in the deformation and failure of soils and rocks. There is a tendency to regard shear bands as a failure mode, as indeed they often are. But extensive straining under highly constrained conditions such as rolling can give rise to profuse flow localization into shear bands which can be regarded as microscopic in the sense that their extent is on the scale of the grains rather than the overall dimensions of the block of material being deformed. Hatherly and Malin describe in detail the observation of such bands and emphasize that they should be considered as a mode of deformation under these circumstances. They relate the formation of the bands to microstructural aspects and discuss their role in the development of recrystallization textures. It will be clear from reading the articles in this viewpoint set that the beginnings of a quantitative theory of shear banding is in place. Continued progress will require parallel developments in constitutive theory and experimental observation. Moreover, basic questions remain to be explored related to the spatial development of the shear bands, their mutual interaction, their development into a failure mode, and how these are influenced by factors such as overall deformational constraint, rate of straining, and temperature

Band structures in fractal grading porous phononic crystals

Science.gov (United States)

Wang, Kai; Liu, Ying; Liang, Tianshu; Wang, Bin

2018-05-01

In this paper, a new grading porous structure is introduced based on a Sierpinski triangle routine, and wave propagation in this fractal grading porous phononic crystal is investigated. The influences of fractal hierarchy and porosity on the band structures in fractal graidng porous phononic crystals are clarified. Vibration modes of unit cell at absolute band gap edges are given to manifest formation mechanism of absolute band gaps. The results show that absolute band gaps are easy to form in fractal structures comparatively to the normal ones with the same porosity. Structures with higher fractal hierarchies benefit multiple wider absolute band gaps. This work provides useful guidance in design of fractal porous phononic crystals.

The Noisiness of Low Frequency Bands of Noise

Science.gov (United States)

Lawton, B. W.

1975-01-01

The relative noisiness of low frequency 1/3-octave bands of noise was examined. The frequency range investigated was bounded by the bands centered at 25 and 200 Hz, with intensities ranging from 50 to 95 db (SPL). Thirty-two subjects used a method of adjustment technique, producing comparison band intensities as noisy as 100 and 200 Hz standard bands at 60 and 72 db. The work resulted in contours of equal noisiness for 1/3-octave bands, ranging in intensity from approximately 58 to 86 db (SPL). These contours were compared with the standard equal noisiness contours; in the region of overlap, between 50 and 200 Hz, the agreement was good.

Exciter For X-Band Transmitter And Receiver

Science.gov (United States)

Johns, Carl E.

1989-01-01

Report describes developmental X-band exciter for X-band uplink subsystem of Deep Space Network. X-band transmitter-exciting signal expected to have fractional frequency stability of 5.2 X 10 to negative 15th power during 1,000-second integration period. Generates coherent test signals for S- and X-band Block III translator of Deep Space Network, Doppler-reference signal for associated Doppler-extractor system, first-local-oscillator signal for associated receiver, and reference signal for associated ranging subsystem. Tests of prototype exciter show controlling and monitoring and internal phase-correcting loops perform according to applicable design criteria. Measurements of stability of frequency and of single-sideband noise spectral density of transmitter-exciting signal made subsequently.

Band-to-Band Tunneling-Dominated Thermo-Enhanced Field Electron Emission from p-Si/ZnO Nanoemitters.

Science.gov (United States)

Huang, Zhizhen; Huang, Yifeng; Xu, Ningsheng; Chen, Jun; She, Juncong; Deng, Shaozhi

2018-06-13

Thermo-enhancement is an effective way to achieve high performance field electron emitters, and enables the individually tuning on the emission current by temperature and the electron energy by voltage. The field emission current from metal or n-doped semiconductor emitter at a relatively lower temperature (i.e., current saturation was observed in the thermo-enhanced field emission measurements. The emission current density showed about ten-time enhancement (from 1.31 to 12.11 mA/cm 2 at 60.6 MV/m) by increasing the temperature from 323 to 623 K. The distinctive performance did not agree with the interband excitation mechanism but well-fit to the band-to-band tunneling model. The strong thermo-enhancement was proposed to be benefit from the increase of band-to-band tunneling probability at the surface portion of the p-Si/ZnO nanojunction. This work provides promising cathode for portable X-ray tubes/panel, ionization vacuum gauges and low energy electron beam lithography, in where electron-dose control at a fixed energy is needed.

The design and application of a multi-band IR imager

Science.gov (United States)

Li, Lijuan

2018-02-01

Multi-band IR imaging system has many applications in security, national defense, petroleum and gas industry, etc. So the relevant technologies are getting more and more attention in rent years. As we know, when used in missile warning and missile seeker systems, multi-band IR imaging technology has the advantage of high target recognition capability and low false alarm rate if suitable spectral bands are selected. Compared with traditional single band IR imager, multi-band IR imager can make use of spectral features in addition to space and time domain features to discriminate target from background clutters and decoys. So, one of the key work is to select the right spectral bands in which the feature difference between target and false target is evident and is well utilized. Multi-band IR imager is a useful instrument to collect multi-band IR images of target, backgrounds and decoys for spectral band selection study at low cost and with adjustable parameters and property compared with commercial imaging spectrometer. In this paper, a multi-band IR imaging system is developed which is suitable to collect 4 spectral band images of various scenes at every turn and can be expanded to other short-wave and mid-wave IR spectral bands combination by changing filter groups. The multi-band IR imaging system consists of a broad band optical system, a cryogenic InSb large array detector, a spinning filter wheel and electronic processing system. The multi-band IR imaging system's performance is tested in real data collection experiments.

Electron band theory 1952-1962

International Nuclear Information System (INIS)

Lomer, W.M.

1980-01-01

Work undertaken by the Theoretical Physics Division between 1952 and 1965 to obtain an understanding of electrons in metals, with uranium and the actinides and the structurally-important transition metals as the main targets is examined. A main result of that period was a conviction that the majority of the physical properties of all metals, except the 4f rare-earth series and the actinides beyond uranium, were dominated by band effects which could be described well enough for most purposes by simple one-electron calculations with simple self-consistent fields. The period from 1960 on showed increasingly clearly the necessity of incorporating relativistic spin-orbit coupling terms in the heavy metals, and some 'local exchange field' correction to the fields close to nuclei. The problems of the non-local interaction of spins - highly important for alloy theory and for antiferromagnetic instability -required the evolution of computers large enough to produce wave-functions at all wave-vectors for all bands so that the susceptibility at arbitrary wave-vector could be computed. This work has not proved to be very illuminating so far, and much interest again focusses today on heuristic arguments that give qualitative descriptions of band structures, such as canonical d-bands to account for crystal structure. (UK)

A programmable ultra-low noise X-band exciter.

Science.gov (United States)

MacMullen, A; Hoover, L R; Justice, R D; Callahan, B S

2001-07-01

A programmable ultra-low noise X-band exciter has been developed using commercial off-the-shelf components. Its phase noise is more than 10 dB below the best available microwave synthesizers. It covers a 7% frequency band with 0.1-Hz resolution. The X-band output at +23 dBm is a combination of signals from an X-band sapphire-loaded cavity oscillator (SLCO), a low noise UHF frequency synthesizer, and special-purpose frequency translation and up-conversion circuitry.

Multiple band structure in 156Er

International Nuclear Information System (INIS)

Sunyar, A.W.; Der Mateosian, E.; Kistner, O.C.; Johnson, A.; Lumpkin, A.H.; Thieberger, P.

1976-01-01

The 142 Nd( 18 O,4n) 156 Er reaction at 90-95 MeV was used to study 156 Er high-spin states to spin 24. In addition to the background ground-state band, two well developed off-spin side bands, one of each parity, were observed. (Auth.)

Gastric band tubing-related complication during pregnancy.

Science.gov (United States)

Ongso, Yuni F; Beh, Han N

2017-11-01

In the past few decades, laparoscopic adjustable gastric banding is one of the most common bariatric procedures performed to treat morbid obesity. Device-related complication such as connection-tubing problem is rare. Here we present a case of gastric band tubing complication during pregnancy. This case illustrates the need to maintain high index of suspicion of gastric band device-related complication during pregnancy and early referral for bariatric surgical assessment is recommended.

47 CFR 15.714 - TV bands database administration fees.

Science.gov (United States)

2010-10-01

... 47 Telecommunication 1 2010-10-01 2010-10-01 false TV bands database administration fees. 15.714... Television Band Devices § 15.714 TV bands database administration fees. (a) A TV bands database administrator may charge a fee for provision of lists of available channels to fixed and personal/portable TVBDs and...

Reduction in pediatric identification band errors: a quality collaborative.

Science.gov (United States)

Phillips, Shannon Connor; Saysana, Michele; Worley, Sarah; Hain, Paul D

2012-06-01

Accurate and consistent placement of a patient identification (ID) band is used in health care to reduce errors associated with patient misidentification. Multiple safety organizations have devoted time and energy to improving patient ID, but no multicenter improvement collaboratives have shown scalability of previously successful interventions. We hoped to reduce by half the pediatric patient ID band error rate, defined as absent, illegible, or inaccurate ID band, across a quality improvement learning collaborative of hospitals in 1 year. On the basis of a previously successful single-site intervention, we conducted a self-selected 6-site collaborative to reduce ID band errors in heterogeneous pediatric hospital settings. The collaborative had 3 phases: preparatory work and employee survey of current practice and barriers, data collection (ID band failure rate), and intervention driven by data and collaborative learning to accelerate change. The collaborative audited 11377 patients for ID band errors between September 2009 and September 2010. The ID band failure rate decreased from 17% to 4.1% (77% relative reduction). Interventions including education of frontline staff regarding correct ID bands as a safety strategy; a change to softer ID bands, including "luggage tag" type ID bands for some patients; and partnering with families and patients through education were applied at all institutions. Over 13 months, a collaborative of pediatric institutions significantly reduced the ID band failure rate. This quality improvement learning collaborative demonstrates that safety improvements tested in a single institution can be disseminated to improve quality of care across large populations of children.

THE subfossil occurrence and paleoecological significance of small mammals at ankilitelo cave, southwestern Madagascar

Science.gov (United States)

Muldoon, K.M.; De Blieux, D. D.; Simons, E.L.; Chatrath, P.S.

2009-01-01

Small mammals are rarely reported from subfossil sites in Madagascar despite their importance for paleoenvironmental reconstruction, especially as it relates to recent ecological changes on the island. We describe the uniquely rich subfossil small mammal fauna from Ankilitelo Cave, southwestern Madagascar. The Ankilitelo fauna is dated to the late Holocene (???500 years ago), documenting the youngest appearances of the extinct giant lemur taxa Palaeopropithecus, Megaladapis, and Archaeolemur, in association with abundant remains of small vertebrates, including bats, tenrecs, carnivorans, rodents, and primates. The Ankilitelo fauna is composed of 34 mammalian species, making it one of the most diverse Holocene assemblages in Madagascar. The fauna comprises the 1 st report of the short-tailed shrew tenrec (Microgale brevicaudata) and the ring-tailed mongoose (Galidia elegans) in southwestern Madagascar. Further, Ankilitelo documents the presence of southwestern species that are rare or that have greatly restricted ranges today, such as Nasolo's shrew tenrec (M. nasoloi), Grandidier's mongoose (Galidictis grandidieri), the narrow-striped mongoose (Mungotictis decemlineata), and the giant jumping rat (Hypogeomys antimena). A simple cause for the unusual small mammal occurrences at Ankilitelo is not obvious. Synergistic interactions between climate change, recent fragmentation and human-initiated degradation of forested habitats, and community-level processes, such as predation, most likely explain the disjunct distributions of the small mammals documented at Ankilitelo. ?? 2009 American Society of Mammalogists.

Visible bands of ammonia: band strengths, curves of growth, and the spatial distribution of ammonia on Jupiter

International Nuclear Information System (INIS)

Lutz, B.L.; Owen, T.

1980-01-01

We report room-temperature laboratory studies of the 5520 A (6ν 1 ) and 6475 A (5ν 1 ) bands of self-broadened ammonia at column densities ranging from 1.7--435.7 meter-amagats (m-am). Detailed equivalent-width measurements at 24 different pressure-pathlength combinations corresponding to four pressures between 44 and 689 torr and pathlengths between 32 and 512 m are used to determin curves of growth and integrated band strengths. The band strengths for the 6ν 1 and 5ν 1 overtones are 5520 A: S=0.096 +- 0.005 cm -1 (m-am) -1 and 6475 A: S=0.63 +- 0.03 cm -1 (m-am) -1 , respectively.Using these band strengths and curves of growth, we analyze new spatially resolved spectra of Jupiter showing a nonhomogeneous distribution of ammonia in the Jovian atmosphere. The observed variations in the CH 4 /NH 3 mixing ratio are interpreted as evidence of altitude-dependent depletion of ammonia in the atmosphere

Structural Evolution of a Warm Frontal Precipitation Band During GCPEx

Science.gov (United States)

Colle, Brian A.; Naeger, Aaron; Molthan, Andrew; Nesbitt, Stephen

2015-01-01

A warm frontal precipitation band developed over a few hours 50-100 km to the north of a surface warm front. The 3-km WRF was able to realistically simulate band development, although the model is somewhat too weak. Band genesis was associated with weak frontogenesis (deformation) in the presence of weak potential and conditional instability feeding into the band region, while it was closer to moist neutral within the band. As the band matured, frontogenesis increased, while the stability gradually increased in the banding region. Cloud top generating cells were prevalent, but not in WRF (too stable). The band decayed as the stability increased upstream and the frontogenesis (deformation) with the warm front weakened. The WRF may have been too weak and short-lived with the band because too stable and forcing too weak (some micro issues as well).

New Kronig-Penney Equation Emphasizing the Band Edge Conditions

Science.gov (United States)

Szmulowicz, Frank

2008-01-01

The Kronig-Penney problem is a textbook example for discussing band dispersions and band gap formation in periodic layered media. For example, in photonic crystals, the behaviour of bands next to the band edges is important for further discussions of such effects as inhibited light emission, slow light and negative index of refraction. However,…

Photodensitometric tracing of Mach bands and its significance

International Nuclear Information System (INIS)

Yoo, Shi Joon; Cho, Kyung Sik; Kang, Heung Sik; Cho, Byung Jae

1984-01-01

Mach bands, a visual phenomenon resulting from lateral inhibitory impulses in the retina, are recognized as lucent or dense lines at the borders of different radiographic densities. A number of clinical situations have been described in which Mach bands may cause difficulty in radiographic diagnosis. Photodensitometric measurement of the film can differentiate the true change in film density from the Mach band which is an optical illusion. Authors present several examples of photodensitometric tracings of Mach bands, with the brief review of the mechanism of their production

Variety identification and genetic relationships of mungbean and ...

African Journals Online (AJOL)

Genetic diversity and relatedness were measured in 17 mungbean (Vigna radiata (L.) Wilczek) and 5 blackgram (Vigna mungo (L.) Hepper) genotypes by means of inter-simple sequence repeat (ISSR) analysis and morphological characters. Unweighted pair-group method arithmetic average (UPGMA) analysis of 19 ...

Abrikosov flux-lines in two-band superconductors with mixed dimensionality

International Nuclear Information System (INIS)

Tanaka, K; Eschrig, M

2009-01-01

We study vortex structure in a two-band superconductor, in which one band is ballistic and quasi-two-dimensional (2D), and the other is diffusive and three-dimensional (3D). A circular cell approximation of the vortex lattice within the quasiclassical theory of superconductivity is applied to a recently developed model appropriate for such a two-band system (Tanaka et al 2006 Phys. Rev. B 73 220501(R); Tanaka et al 2007 Phys. Rev. B 75 214512). We assume that superconductivity in the 3D diffusive band is 'weak', i.e. mostly induced, as is the case in MgB 2 . Hybridization with the 'weak' 3D diffusive band has significant and intriguing influence on the electronic structure of the 'strong' 2D ballistic band. In particular, the Coulomb repulsion and the diffusivity in the 'weak' band enhance suppression of the order parameter and enlargement of the vortex core by magnetic field in the 'strong' band, resulting in reduced critical temperature and field. Moreover, increased diffusivity in the 'weak' band can result in an upward curvature of the upper critical field near the transition temperature. A particularly interesting feature found in our model is the appearance of additional bound states at the gap edge in the 'strong' ballistic band, which are absent in the single-band case. Furthermore, coupling with the 'weak' diffusive band leads to reduced bandgaps and van Hove singularities of energy bands of the vortex lattice in the 'strong' ballistic band. We find these intriguing features for parameter values appropriate for MgB 2 .

Identical high- K three-quasiparticle rotational bands

Energy Technology Data Exchange (ETDEWEB)

Kaur, Harjeet; Singh, Pardeep [Guru Nanak Dev University, Department of Physics, Amritsar (India)

2016-12-15

A comprehensive study of high-K three-quasiparticle rotational bands in odd-A nuclei indicates the similarity in γ-ray energies and dynamic moment of inertia I{sup (2)}. The extent of the identicality between the rotational bands is evaluated by using the energy factor method. For nuclei pairs exhibiting identical bands, the average relative change in the dynamic moment of inertia I{sup (2)} is also determined. The identical behaviour shown by these bands is attributed to the interplay of nuclear structure parameters: deformation and the pairing correlations. Also, experimental trend of the I(ℎ) vs. ℎω (MeV) plot for these nuclei pairs is shown to be in agreement with Tilted-Axis Cranking (TAC) model calculations. (orig.)

Silicone rubber band for laparoscopic tubal sterilization.

Science.gov (United States)

Ansari, A H; Sealey, R M; Gay, J W; Kang, I

1977-12-01

In 1974, Yoon and associates (Am J Obstet Gynecol 120:132, 1974) described a new approach in which laparoscopic tubal occlusion was accomplished by utilizing the silicone rubber band technique. Recognizing the great advantages of the new technique in eliminating potential thermal injury associated with electrocoagulation, the authors have utilized the Yoon silicone rubber band technique in these institutions over the past 20 months. Thus far the procedure has been performed in 304 patients without any major complications. In the hope of eliminating and/or reducing possible pregnancy-failure rates, in 110 cases. In addition to application of the silicone band, the tube within the band was transected with non-electrical Seigler biopsy forceps. This, we believe, should provide an interesting long-term comparative study.

Anomalies in the 1D Anderson model: Beyond the band-centre and band-edge cases

Science.gov (United States)

Tessieri, L.; Izrailev, F. M.

2018-03-01

We consider the one-dimensional Anderson model with weak disorder. Using the Hamiltonian map approach, we analyse the validity of the random-phase approximation for resonant values of the energy, E = 2 cos(πr) , with r a rational number. We expand the invariant measure of the phase variable in powers of the disorder strength and we show that, contrary to what happens at the centre and at the edges of the band, for all other resonant energies the leading term of the invariant measure is uniform. When higher-order terms are taken into account, a modulation of the invariant measure appears for all resonant values of the energy. This implies that, when the localisation length is computed within the second-order approximation in the disorder strength, the Thouless formula is valid everywhere except at the band centre and at the band edges.

Controllable Absorption and Dispersion Properties of an RF-driven Five-Level Atom in a Double-Band Photonic-Band-Gap Material

International Nuclear Information System (INIS)

Ding Chunling; Li Jiahua; Yang Xiaoxue

2011-01-01

The probe absorption-dispersion spectra of a radio-frequency (RF)-driven five-level atom embedded in a photonic crystal are investigated by considering the isotropic double-band photonic-band-gap (PBG) reservoir. In the model used, the two transitions are, respectively, coupled by the upper and lower bands in such a PBG material, thus leading to some curious phenomena. Numerical simulations are performed for the optical spectra. It is found that when one transition frequency is inside the band gap and the other is outside the gap, there emerge three peaks in the absorption spectra. However, for the case that two transition frequencies lie inside or outside the band gap, the spectra display four absorption profiles. Especially, there appear two sharp peaks in the spectra when both transition frequencies exist inside the band gap. The influences of the intensity and frequency of the RF-driven field on the absorptive and dispersive response are analyzed under different band-edge positions. It is found that a transparency window appears in the absorption spectra and is accompanied by a very steep variation of the dispersion profile by adjusting system parameters. These results show that the absorption-dispersion properties of the system depend strongly on the RF-induced quantum interference and the density of states (DOS) of the PBG reservoir. (electromagnetism, optics, acoustics, heat transfer, classical mechanics, and fluid dynamics)

Strain gradient drives shear banding in metallic glasses

Science.gov (United States)

Tian, Zhi-Li; Wang, Yun-Jiang; Chen, Yan; Dai, Lan-Hong

2017-09-01

Shear banding is a nucleation-controlled process in metallic glasses (MGs) involving multiple temporal-spatial scales, which hinders a concrete understanding of its structural origin down to the atomic scale. Here, inspired by the morphology of composite materials, we propose a different perspective of MGs as a hard particle-reinforced material based on atomic-scale structural heterogeneity. The local stable structures indicated by a high level of local fivefold symmetry (L5FS) act as hard "particles" which are embedded in the relatively soft matrix. We demonstrate this concept by performing atomistic simulations of shear banding in CuZr MG. A shear band is prone to form in a sample with a high degree of L5FS which is slowly quenched from the liquid. An atomic-scale analysis on strain and the structural evolution reveals that it is the strain gradient effect that has originated from structural heterogeneity that facilitates shear transformation zones (STZs) to mature shear bands. An artificial composite model with a high degree of strain gradient, generated by inserting hard MG strips into a soft MG matrix, demonstrates a great propensity for shear banding. It therefore confirms the critical role strain gradient plays in shear banding. The strain gradient effect on shear banding is further quantified with a continuum model and a mechanical instability analysis. These physical insights might highlight the strain gradient as the hidden driving force in transforming STZs into shear bands in MGs.

Micromachined millimeter-wave photonic band-gap crystals

International Nuclear Information System (INIS)

Oezbay, E.; Michel, E.; Tuttle, G.; Biswas, R.; Sigalas, M.; Ho, K.

1994-01-01

We have developed a new technique for fabricating three-dimensional photonic band-gap crystals. Our method utilizes an orderly stacking of micromachined (110) silicon wafers to build the periodic structure. A structure with a full three-dimensional photonic band gap centered near 100 GHz was measured, with experimental results in good agreement with theoretical predictions. This basic approach described should be extendable to build structures with photonic band-gap frequencies ranging from 30 GHz to 3 THz

Microscopic mechanism of identical multi-quasiparticle bands

International Nuclear Information System (INIS)

Lei Yian; Zhao Enguang; Zeng Jinyan

1997-01-01

Identical one-quasiparticle and two-quasiparticle bands in neighboring odd-and even-mass nuclei are recognized; The intrinsic structure of identical bands is demonstrated by using the particle-number-conserving (PNC) treatment. The occurrence of almost identical moments of inertia is the result of competition among the shell effect (including shape variation), pairing (anti-alignment) effect and blocking (anti-pairing) effect. The observed moments of inertia of identical multi-quasiparticle bands are reproduced quite well by the PNC calculation

Intrinsic properties of high-spin band structures in triaxial nuclei

Science.gov (United States)

Jehangir, S.; Bhat, G. H.; Sheikh, J. A.; Palit, R.; Ganai, P. A.

2017-12-01

The band structures of 68,70Ge, 128,130,132,134Ce and 132,134,136,138Nd are investigated using the triaxial projected shell model (TPSM) approach. These nuclei depict forking of the ground-state band into several s-bands and in some cases, both the lowest two observed s-bands depict neutron or proton character. It was discussed in our earlier work that this anomalous behaviour can be explained by considering γ-bands based on two-quasiparticle configurations. As the parent band and the γ-band built on it have the same intrinsic structure, g-factors of the two bands are expected to be similar. In the present work, we have undertaken a detailed investigation of g-factors for the excited band structures of the studied nuclei and the available data for a few high-spin states are shown to be in fair agreement with the predicted values.

The 3 micron ice band

International Nuclear Information System (INIS)

Greenberg, J.M.; Bult, C.E.P.M. van de

1984-01-01

Ever since it was proposed that H 2 O could be a dominant constituent of interstellar grains, its detection, or lack thereof, has played a large role in theories of grains and their evolution. It now appears possible to provide a basic theoretical structure for the evolution of grains in molecular clouds based on current observational evidence and laboratory experiments on the ice band. Both band strengths and shapes can be reasonably predicted by grain models. (U.K.)

Laparoscopic gastric banding

Science.gov (United States)

... eat by making you feel full after eating small amounts of food. After surgery, your doctor can adjust the band ... You will feel full after eating just a small amount of food. The food in the small upper pouch will ...

Chiral topological excitons in a Chern band insulator

Science.gov (United States)

Chen, Ke; Shindou, Ryuichi

2017-10-01

A family of semiconductors called Chern band insulators are shown to host exciton bands with nonzero topological Chern integers and chiral exciton edge modes. Using a prototypical two-band Chern insulator model, we calculate a cross-correlation function to obtain the exciton bands and their Chern integers. The lowest exciton band acquires Chern integers such as ±1 and ±2 in the electronic Chern insulator phase. The nontrivial topology can be experimentally observed both by a nonlocal optoelectronic response of exciton edge modes and by a phase shift in the cross-correlation response due to the bulk mode. Our result suggests that magnetically doped HgTe, InAs/GaSb quantum wells, and (Bi,Sb)2Te3 thin films are promising candidates for a platform of topological excitonics.

K-Band Traveling-Wave Tube Amplifier

Science.gov (United States)

Force, Dale A.; Simons, Rainee N.; Peterson, Todd T.; Spitsen, Paul C.

2010-01-01

A new space-qualified, high-power, high-efficiency, K-band traveling-wave tube amplifier (TWTA) will provide high-rate, high-capacity, direct-to-Earth communications for science data and video gathered by the Lunar Reconnaissance Orbiter (LRO) during its mission. Several technological advances were responsible for the successful demonstration of the K-band TWTA.

Microbial processes in banded iron formation deposition

DEFF Research Database (Denmark)

Posth, Nicole; Konhauser, Kurt; Kappler, Andreas

2013-01-01

, remains unresolved. Evidence of an anoxic Earth with only localized oxic areas until the Great Oxidation Event ca 2·45 to 2·32 Ga makes the investigation of O2-independent mechanisms for banded iron formation deposition relevant. Recent studies have explored the long-standing proposition that Archean......Banded iron formations have been studied for decades, particularly regarding their potential as archives of the Precambrian environment. In spite of this effort, the mechanism of their deposition and, specifically, the role that microbes played in the precipitation of banded iron formation minerals...... banded iron formations may have been formed, and diagenetically modified, by anaerobic microbial metabolisms. These efforts encompass a wide array of approaches including isotope, ecophysiological and phylogeny studies, molecular and mineral marker analysis, and sedimentological reconstructions. Herein...

Building blocks of topological quantum chemistry: Elementary band representations

Science.gov (United States)

Cano, Jennifer; Bradlyn, Barry; Wang, Zhijun; Elcoro, L.; Vergniory, M. G.; Felser, C.; Aroyo, M. I.; Bernevig, B. Andrei

2018-01-01

The link between chemical orbitals described by local degrees of freedom and band theory, which is defined in momentum space, was proposed by Zak several decades ago for spinless systems with and without time reversal in his theory of "elementary" band representations. In a recent paper [Bradlyn et al., Nature (London) 547, 298 (2017), 10.1038/nature23268] we introduced the generalization of this theory to the experimentally relevant situation of spin-orbit coupled systems with time-reversal symmetry and proved that all bands that do not transform as band representations are topological. Here we give the full details of this construction. We prove that elementary band representations are either connected as bands in the Brillouin zone and are described by localized Wannier orbitals respecting the symmetries of the lattice (including time reversal when applicable), or, if disconnected, describe topological insulators. We then show how to generate a band representation from a particular Wyckoff position and determine which Wyckoff positions generate elementary band representations for all space groups. This theory applies to spinful and spinless systems, in all dimensions, with and without time reversal. We introduce a homotopic notion of equivalence and show that it results in a finer classification of topological phases than approaches based only on the symmetry of wave functions at special points in the Brillouin zone. Utilizing a mapping of the band connectivity into a graph theory problem, we show in companion papers which Wyckoff positions can generate disconnected elementary band representations, furnishing a natural avenue for a systematic materials search.

Detection Range Estimation of UV Spectral Band Laser Radar

Directory of Open Access Journals (Sweden)

V. A. Gorodnichev

2014-01-01

Full Text Available Recently, has come into existence an interest in the systems operating in the ultra-violet (UF band of wavelengths, which use other spectral information (coefficients of reflection or radiation in UF range about location objects, than laser systems in the visible, near or average infrared bands. Thus, a point is not only to receive additional (in another spectral range information on location objects. Laser radiation in the UF spectral band of 0.315 – 0.4 microns is safer than laser radiation with the wavelengths of 0.38 – 1.4 microns.The work presents a comparative estimation of the detection systems range of laser radars in the UV and visible spectral bands for the following wavelengths of radiation:- UF band: 0.266 microns (the fourth harmonic of YAG-laser activated by neodymium ions, 0.308 microns (the XeCl-excimer laser, 0.355 microns (the third harmonic of YAG-laser activated by neodymium ions;- visible band: 0.532 microns (the second harmonic of YAG-laser activated by neodymium ions.Results of calculations show that for the horizontal pathway in the terrestrial atmosphere at the selected radiation wavelengths a detection range is in the range of 2510m – 5690 m.The maximum range of detection corresponds to the visible spectral band. A sweep range decreases with transition to the UF band. This is caused by the fact that with transition to the UF band there is a rise of atmosphere attenuation (generally, because of absorption by ozone, this effect being smoothed by reducing background radiation.In the UF band a wavelength of 0.355 microns is the most acceptable. For this wavelength a detection range is about 1,5 times less (in comparison with the visible band of 0.532 microns. However, this is the much more eye-safe wavelength. With transition to the UV band a detection range decreases not that much and can be compensated by changing parameters of transmitting or receiving channels of laser radar.

Conservation of topological quantum numbers in energy bands

International Nuclear Information System (INIS)

Chang, L.N.; Liang, Y.

1988-01-01

Quantum systems described by parametrized Hamiltinians are studied in a general context. Within this context, the classification scheme of Avron-Seiler-Simon for non-degenerate energy bands is extended to cover general parameter spaces, whole their sum rule is generalized to cover cases with degenerate bands as well. Additive topological quantum numbers are defined, and these are shown to be conserved in energy band ''collisions''. The conservation laws dictate that when some invariants are non-vanishing, no energy gap can develop in a set of degenerate bands. This gives rise to a series of splitting rules

Species of the genus Uromyces (Basidiomycota: Pucciniales) from ...

African Journals Online (AJOL)

During a survey of rust fungi from Leepa Valley, Azad Jammu and Kashmir (AJ and K), Pakistan, four species of Uromyces were found parasitizing four plant species. These include Uromyces appendiculatus on Vigna mungo, Uromyces capitatus on Desmodium elegans, Uromyces penniseti on Pennisetum lanatum and ...

Exploration of indigenous agrowastes for cellulase production by ...

African Journals Online (AJOL)

Regional agrowastes such as Vigna mungo, Saccharum spontaneum and Brassica campestris were collected and biohydrolysis of these substrates for cellulase production were carried out by Aspergillus niger. Proximate composition of each agrowastes was analyzed based on dry weight, to have an insight view of their ...

An efficient atomistic quantum mechanical simulation on InAs band-to-band tunneling field-effect transistors

Energy Technology Data Exchange (ETDEWEB)

Wang, Zhi [State Key Laboratory for Superlattices and Microstructures, Institute of Semiconductors, Chinese Academy of Sciences, P.O. Box 912, Beijing 100083 (China); Jiang, Xiang-Wei; Li, Shu-Shen [State Key Laboratory for Superlattices and Microstructures, Institute of Semiconductors, Chinese Academy of Sciences, P.O. Box 912, Beijing 100083 (China); Synergetic Innovation Center of Quantum Information and Quantum Physics, University of Science and Technology of China, Hefei, Anhui 230026 (China); Wang, Lin-Wang, E-mail: lwwang@lbl.gov [Material Sciences Division, Lawrence Berkeley National Laboratory, Berkeley, California 94720 (United States)

2014-03-24

We have presented a fully atomistic quantum mechanical simulation method on band-to-band tunneling (BTBT) field-effect transistors (FETs). Our simulation approach is based on the linear combination of bulk band method with empirical pseudopotentials, which is an atomist method beyond the effective-mass approximation or k.p perturbation method, and can be used to simulate real-size devices (∼10{sup 5} atoms) efficiently (∼5 h on a few computational cores). Using this approach, we studied the InAs dual-gate BTBT FETs. The I-V characteristics from our approach agree very well with the tight-binding non-equilibrium Green's function results, yet our method costs much less computationally. In addition, we have studied ways to increase the tunneling current and analyzed the effects of different mechanisms for that purpose.

An efficient atomistic quantum mechanical simulation on InAs band-to-band tunneling field-effect transistors

International Nuclear Information System (INIS)

Wang, Zhi; Jiang, Xiang-Wei; Li, Shu-Shen; Wang, Lin-Wang

2014-01-01

We have presented a fully atomistic quantum mechanical simulation method on band-to-band tunneling (BTBT) field-effect transistors (FETs). Our simulation approach is based on the linear combination of bulk band method with empirical pseudopotentials, which is an atomist method beyond the effective-mass approximation or k.p perturbation method, and can be used to simulate real-size devices (∼10 5 atoms) efficiently (∼5 h on a few computational cores). Using this approach, we studied the InAs dual-gate BTBT FETs. The I-V characteristics from our approach agree very well with the tight-binding non-equilibrium Green's function results, yet our method costs much less computationally. In addition, we have studied ways to increase the tunneling current and analyzed the effects of different mechanisms for that purpose

Band-selective filter in a zigzag graphene nanoribbon.

Science.gov (United States)

Nakabayashi, Jun; Yamamoto, Daisuke; Kurihara, Susumu

2009-02-13

Electric transport of a zigzag graphene nanoribbon through a steplike potential and a barrier potential is investigated by using the recursive Green's function method. In the case of the steplike potential, we demonstrate numerically that scattering processes obey a selection rule for the band indices when the number of zigzag chains is even; the electrons belonging to the "even" ("odd") bands are scattered only into the even (odd) bands so that the parity of the wave functions is preserved. In the case of the barrier potential, by tuning the barrier height to be an appropriate value, we show that it can work as the "band-selective filter", which transmits electrons selectively with respect to the indices of the bands to which the incident electrons belong. Finally, we suggest that this selection rule can be observed in the conductance by applying two barrier potentials.

Drosophila polytene chromosome bands formed by gene introns.

Science.gov (United States)

Zhimulev, I F; Boldyreva, L V; Demakova, O V; Poholkova, G V; Khoroshko, V A; Zykova, T Yu; Lavrov, S A; Belyaeva, E S

2016-01-01

Genetic organization of bands and interbands in polytene chromosomes has long remained a puzzle for geneticists. It has been recently demonstrated that interbands typically correspond to the 5'-ends of house-keeping genes, whereas adjacent loose bands tend to be composed of coding sequences of the genes. In the present work, we made one important step further and mapped two large introns of ubiquitously active genes on the polytene chromosome map. We show that alternative promoter regions of these genes map to interbands, whereas introns and coding sequences found between those promoters correspond to loose grey bands. Thus, a gene having its long intron "sandwiched" between to alternative promoters and a common coding sequence may occupy two interbands and one band in the context of polytene chromosomes. Loose, partially decompacted bands appear to host large introns.

Tensile-strain effect of inducing the indirect-to-direct band-gap transition and reducing the band-gap energy of Ge

Energy Technology Data Exchange (ETDEWEB)

Inaoka, Takeshi, E-mail: inaoka@phys.u-ryukyu.ac.jp; Furukawa, Takuro; Toma, Ryo; Yanagisawa, Susumu [Department of Physics and Earth Sciences, Faculty of Science, University of the Ryukyus, 1 Senbaru, Nishihara, Okinawa 903-0213 (Japan)

2015-09-14

By means of a hybrid density-functional method, we investigate the tensile-strain effect of inducing the indirect-to-direct band-gap transition and reducing the band-gap energy of Ge. We consider [001], [111], and [110] uniaxial tensility and (001), (111), and (110) biaxial tensility. Under the condition of no normal stress, we determine both normal compression and internal strain, namely, relative displacement of two atoms in the primitive unit cell, by minimizing the total energy. We identify those strain types which can induce the band-gap transition, and evaluate the critical strain coefficient where the gap transition occurs. Either normal compression or internal strain operates unfavorably to induce the gap transition, which raises the critical strain coefficient or even blocks the transition. We also examine how each type of tensile strain decreases the band-gap energy, depending on its orientation. Our analysis clearly shows that synergistic operation of strain orientation and band anisotropy has a great influence on the gap transition and the gap energy.

Photonic band edge assisted spontaneous emission enhancement from all Er3+ 1-D photonic band gap structure

Science.gov (United States)

Chiasera, A.; Meroni, C.; Varas, S.; Valligatla, S.; Scotognella, F.; Boucher, Y. G.; Lukowiak, A.; Zur, L.; Righini, G. C.; Ferrari, M.

2018-06-01

All Er3+ doped dielectric 1-D Photonic Band Gap Structure was fabricated by rf-sputtering technique. The structure was constituted by of twenty pairs of SiO2/TiO2 alternated layers doped with Er3+ ions. The scanning electron microscopy was used to check the morphology of the structure. Transmission measurements put in evidence the stop band in the range 1500 nm-1950 nm. The photoluminescence measurements were obtained by optically exciting the sample and detecting the emitted light in the 1.5 μm region at different detection angles. Luminescence spectra and luminescence decay curves put in evidence that the presence of the stop band modify the emission features of the Er3+ ions.

Decay from the superdeformed bands in 194Hg

International Nuclear Information System (INIS)

Henry, R.G.; Khoo, T.L.; Carpenter, M.P.

1995-01-01

Superdeformed bands in 194 H g were studied using the early implementation of Gammasphere. The response functions for the Ge detectors were measured for the first time as part of this experiment. Experiments were performed with both a backed target (where the residue stopped in the Au backing) and a thin target (where the residue recoiled into vacuum). This will permit measurements of the decay times of the quasicontinuum γrays. The spectrum in coincidence with the yrast SD band in 194 Hg reveals the same features as found in the quasicontinuum structure in 192 Hg. These features include: statistical γrays feeding the SD band, a pronounced E2 peak from transitions feeding the SD band, a Ml/E2 bump at low energies that is associated with the last stages of feeding of the superdeformed band, and a quasicontinuous distribution from γrays linking SD and normal states, including a sizable clustering of strength around 1.7 MeV. The remarkable similarity of the spectra coincident with SD bands in 192,194 Hg provides additional support for a statistical process for decay out of the SD states. This similarity contrasts with differences observed in the spectrum coincident with the SD band in the odd-even 191 Hg, confirming the predictions about the role of pairing (in normal states) in influencing the shape of the decay-out spectrum

Efectos de la suplementación alimenticia sobre la producción de gallinas de patio

Directory of Open Access Journals (Sweden)

Eduberto Sánchez Sevilla

2000-06-01

Full Text Available El presente artículo expone los resultados de una investigación experimental realizada en las comunidades de San Andrés de la Palanca y La Ceiba, del municipio de Mateare, departamento de Managua. El estudio es parte de las actividades desarrolladas en el marco del Proyecto de Desarrollo Rural, ejecutado por el Programa de Desarrollo Agrario y Agronomía (ADAA-UCA. Se analizaron los efectos de la implementación de dos dietas compuestas de Maíz y Frijol Mungo (Maíz Zea mays L + Mungo Vigna radi@ta y de Maíz y Frijol Gandul (Maíz + Gandul Çqjanusaian, como suplementos proteicos para "gallinas de patio". El objetivo de este experimento fue mejorar la condición física de las gallinas de patio, principal fuente de alimentos (huevo y carne de que disponen las familias rurales de las mencionadas comunidades.

Ka-band waveguide rotary joint

KAUST Repository

Yevdokymov, Anatoliy

2013-04-11

The authors present a design of a waveguide rotary joint operating in Ka-band with central frequency of 33 GHz, which also acts as an antenna mount. The main unit consists of two flanges with a clearance between them; one of the flanges has three circular choke grooves. Utilisation of three choke grooves allows larger operating clearance. Two prototypes of the rotary joint have been manufactured and experimentally studied. The observed loss is from 0.4 to 0.8 dB in 1.5 GHz band.

First experience with the InfiniBand interconnect

International Nuclear Information System (INIS)

Schwickerath, Ulrich; Heiss, Andreas

2004-01-01

A test cluster of dual Intel-Xeon processor server nodes has been equipped with 10 GBit/s InfiniBand interconnect. Capabilities of this new technique were tested and compared to Gigabit-Ethernet (GE) with respect to both High-Performance Computing (MPI-based parallel computing applications) and High-Throughput Computing (HTC). RFIO, a protocol for fast and efficient file transfers, has been ported to make immediate use of InfiniBand, utilizing the remote direct memory access (RDMA) capabilities of the InfiniBand hardware. The performance is compared to Gigabit-Ethernet

Band mixing in /sup 160/Dy

Energy Technology Data Exchange (ETDEWEB)

Hasiza, M L; Singh, K; Sahota, H S [Punjabi Univ., Patiala (India). Dept. of Physics

1982-11-01

The intensities of the gamma transitions in /sup 160/Dy have been measured precisely by a 45 cc Ge(Li) detector. Unequal quadrupole moments for the ground and gamma vibrational bands have been proposed in order to remove the inconsistencies in the values of band mixing parameter Z sub(gamma) for this doubly even deformed nucleus of /sup 160/Dy.

Spectral band selection for classification of soil organic matter content

Science.gov (United States)

Henderson, Tracey L.; Szilagyi, Andrea; Baumgardner, Marion F.; Chen, Chih-Chien Thomas; Landgrebe, David A.

1989-01-01

This paper describes the spectral-band-selection (SBS) algorithm of Chen and Landgrebe (1987, 1988, and 1989) and uses the algorithm to classify the organic matter content in the earth's surface soil. The effectiveness of the algorithm was evaluated comparing the results of classification of the soil organic matter using SBS bands with those obtained using Landsat MSS bands and TM bands, showing that the algorithm was successful in finding important spectral bands for classification of organic matter content. Using the calculated bands, the probabilities of correct classification for climate-stratified data were found to range from 0.910 to 0.980.

Ka Band Phase Locked Loop Oscillator Dielectric Resonator Oscillator for Satellite EHF Band Receiver

Directory of Open Access Journals (Sweden)

S. Coco

2008-01-01

Full Text Available This paper describes the design and fabrication of a Ka Band PLL DRO having a fundamental oscillation frequency of 19.250 GHz, used as local oscillator in the low-noise block of a down converter (LNB for an EHF band receiver. Apposite circuital models have been created to describe the behaviour of the dielectric resonator and of the active component used in the oscillator core. The DRO characterization and measurements have shown very good agreement with simulation results. A good phase noise performance is obtained by using a very high Q dielectric resonator.

Band structures in the nematic elastomers phononic crystals

Energy Technology Data Exchange (ETDEWEB)

Yang, Shuai [Department of Mechanics, School of Civil Engineering, Beijing Jiaotong University, Beijing 100044 (China); School of Civil Engineering and Architecture, Anyang Normal University, Anyang 455000 (China); Liu, Ying, E-mail: yliu5@bjtu.edu.cn [Department of Mechanics, School of Civil Engineering, Beijing Jiaotong University, Beijing 100044 (China); Liang, Tianshu [Department of Mechanics, School of Civil Engineering, Beijing Jiaotong University, Beijing 100044 (China)

2017-02-01

As one kind of new intelligent materials, nematic elastomers (NEs) represent an exciting physical system that combines the local orientational symmetry breaking and the entropic rubber elasticity, producing a number of unique physical phenomena. In this paper, the potential application of NEs in the band tuning is explored. The band structures in two kinds of NE phononic crystals (PCs) are investigated. Through changing NE intrinsic parameters, the influence of the porosity, director rotation and relaxation on the band structures in NE PCs are analyzed. This work is a meaningful try for application of NEs in acoustic field and proposes a new intelligent strategy in band turning.

Band structures in the nematic elastomers phononic crystals

International Nuclear Information System (INIS)

Yang, Shuai; Liu, Ying; Liang, Tianshu

2017-01-01

As one kind of new intelligent materials, nematic elastomers (NEs) represent an exciting physical system that combines the local orientational symmetry breaking and the entropic rubber elasticity, producing a number of unique physical phenomena. In this paper, the potential application of NEs in the band tuning is explored. The band structures in two kinds of NE phononic crystals (PCs) are investigated. Through changing NE intrinsic parameters, the influence of the porosity, director rotation and relaxation on the band structures in NE PCs are analyzed. This work is a meaningful try for application of NEs in acoustic field and proposes a new intelligent strategy in band turning.

Left regular bands of groups of left quotients

International Nuclear Information System (INIS)

El-Qallali, A.

1988-10-01

A semigroup S which has a left regular band of groups as a semigroup of left quotients is shown to be the semigroup which is a left regular band of right reversible cancellative semigroups. An alternative characterization is provided by using spinned products. These results are applied to the case where S is a superabundant whose set of idempotents forms a left normal band. (author). 13 refs

Band-to-band tunneling distance analysis in the heterogate electron–hole bilayer tunnel field-effect transistor

Energy Technology Data Exchange (ETDEWEB)

Padilla, J. L., E-mail: jose.padilladelatorre@epfl.ch [Nanoelectronic Devices Laboratory, École Polytechnique Fédérale de Lausanne, Lausanne CH-1015 (Switzerland); Departamento de Electrónica y Tecnología de los Computadores, Universidad de Granada, Avda. Fuentenueva s/n, 18071 Granada (Spain); Palomares, A. [Departamento de Matemática Aplicada, Universidad de Granada, Avda. Fuentenueva s/n, 18071 Granada (Spain); Alper, C.; Ionescu, A. M. [Nanoelectronic Devices Laboratory, École Polytechnique Fédérale de Lausanne, Lausanne CH-1015 (Switzerland); Gámiz, F. [Departamento de Electrónica y Tecnología de los Computadores, Universidad de Granada, Avda. Fuentenueva s/n, 18071 Granada (Spain)

2016-01-28

In this work, we analyze the behavior of the band-to-band tunneling distance between electron and hole subbands resulting from field-induced quantum confinement in the heterogate electron–hole bilayer tunnel field-effect transistor. We show that, analogously to the explicit formula for the tunneling distance that can be easily obtained in the semiclassical framework where the conduction and valence band edges are allowed states, an equivalent analytical expression can be derived in the presence of field-induced quantum confinement for describing the dependence of the tunneling distance on the body thickness and material properties of the channel. This explicit expression accounting for quantum confinement holds valid provided that the potential wells for electrons and holes at the top and bottom of the channel can be approximated by triangular profiles. Analytical predictions are compared to simulation results showing very accurate agreement.

Reliability of flipper-banded penguins as indicators of climate change.

Science.gov (United States)

Saraux, Claire; Le Bohec, Céline; Durant, Joël M; Viblanc, Vincent A; Gauthier-Clerc, Michel; Beaune, David; Park, Young-Hyang; Yoccoz, Nigel G; Stenseth, Nils C; Le Maho, Yvon

2011-01-13

In 2007, the Intergovernmental Panel on Climate Change highlighted an urgent need to assess the responses of marine ecosystems to climate change. Because they lie in a high-latitude region, the Southern Ocean ecosystems are expected to be strongly affected by global warming. Using top predators of this highly productive ocean (such as penguins) as integrative indicators may help us assess the impacts of climate change on marine ecosystems. Yet most available information on penguin population dynamics is based on the controversial use of flipper banding. Although some reports have found the effects of flipper bands to be deleterious, some short-term (one-year) studies have concluded otherwise, resulting in the continuation of extensive banding schemes and the use of data sets thus collected to predict climate impact on natural populations. Here we show that banding of free-ranging king penguins (Aptenodytes patagonicus) impairs both survival and reproduction, ultimately affecting population growth rate. Over the course of a 10-year longitudinal study, banded birds produced 41% [corrected] fewer chicks and had a survival rate 16 percentage points [corrected] lower than non-banded birds, demonstrating a massive long-term impact of banding and thus refuting the assumption that birds will ultimately adapt to being banded. Indeed, banded birds still arrived later for breeding at the study site and had longer foraging trips even after 10 years. One of our major findings is that responses of flipper-banded penguins to climate variability (that is, changes in sea surface temperature and in the Southern Oscillation index) differ from those of non-banded birds. We show that only long-term investigations may allow an evaluation of the impact of flipper bands and that every major life-history trait can be affected, calling into question the banding schemes still going on. In addition, our understanding of the effects of climate change on marine ecosystems based on flipper-band

Effects of the intrinsic layer width on the band-to-band tunneling current in p-i-n GaN-based avalanche photodiodes

International Nuclear Information System (INIS)

Wang, Ling; Bao, Xichang; Zhang, Wenjing; Li, Chao; Yuan, Yonggang; Xu, Jintong; Zhang, Yan; Li, Xiangyang

2009-01-01

Dark current is critical for GaN-based avalanche photodiodes because it significantly increases the noise current and limits the multiplication factor. It has been found that the band-to-band tunneling current is the dominant origin of the dark current for avalanche photodiodes at the onset of breakdown voltage. Experimentally, for GaN-based avalanche photodiodes with a thinner intrinsic layer, the dark current increases nearly exponentially with the applied voltage even at a lower bias voltage. In this paper, the intrinsic layer (i-layer) width of GaN-based avalanche photodiodes has been varied to study its effect on the band-to-band tunneling current. A widely used equation was used to calculate the band-to-band tunneling current of avalanche photodiodes with different i-layer widths (i-layer 0.1 µm, 0.2 µm and 0.4 µm). At −40 V, the band-to-band tunneling current significantly reduces by a magnitude of 10 −15 A with an increase in the i-layer width from 0.1 µm to 0.2 µm, and a magnitude of 10 −29 A with an increase in the i-layer width from 0.2 µm to 0.4 µm. Then, GaN-based avalanche photodiodes (i-layer 0.1 µm, 0.2 µm and 0.4 µm) with different-sized mesa were fabricated. Also, the measurement of dark current of all three different structures was performed, and their multiplication factors were given

47 CFR 18.303 - Prohibited frequency bands.

Science.gov (United States)

2010-10-01

... 47 Telecommunication 1 2010-10-01 2010-10-01 false Prohibited frequency bands. 18.303 Section 18.303 Telecommunication FEDERAL COMMUNICATIONS COMMISSION GENERAL INDUSTRIAL, SCIENTIFIC, AND MEDICAL EQUIPMENT Technical Standards § 18.303 Prohibited frequency bands. Operation of ISM equipment within the...

Low band gap polymers for organic photovoltaics

DEFF Research Database (Denmark)

Bundgaard, Eva; Krebs, Frederik C

2007-01-01

Low band gap polymer materials and their application in organic photovoltaics (OPV) are reviewed. We detail the synthetic approaches to low band gap polymer materials starting from the early methodologies employing quinoid homopolymer structures to the current state of the art that relies...

True photonic band-gap mode-control in VCSEL structures

DEFF Research Database (Denmark)

Romstad, F.; Madsen, M.; Birkedal, Dan

2003-01-01

Photonic band-gap mode confinement in novel nano-structured large area VCSEL structures is confirmed by the amplified spontaneous emission spectrum. Both guide and anti-guide VCSEL structures are experimentally characterised to verify the photonic band-gap effect.......Photonic band-gap mode confinement in novel nano-structured large area VCSEL structures is confirmed by the amplified spontaneous emission spectrum. Both guide and anti-guide VCSEL structures are experimentally characterised to verify the photonic band-gap effect....

Experimental study on the adiabatic shear bands

International Nuclear Information System (INIS)

Affouard, J.

1984-07-01

Four martensitic steels (Z50CDV5 steel, 28CND8 steel, 35NCDV16 steel and 4340 steel) with different hardness between 190 and 600 Hsub(B) (Brinell hardness), have been studied by means of dynamic compressive tests on split Hopkinson pressure bar. Microscopic observations show that the fracture are associated to the development of adiabatic shear bands (except 4340 steel with 190 Hsub(B) hardness). By means of tests for which the deformation is stopped at predetermined levels, the measurement of shear and hardness inside the band and the matrix indicates the chronology of this phenomenon: first the localization of shear, followed by the formation of adiabatic shear band and ultimatly crack initiation and propagation. These results correlated with few simulations by finite elements have permitted to suggest two mecanisms of deformation leading to the formation of adiabatic shear bands in this specific test [fr

Enhancement of phononic band gaps in ternary/binary structure

International Nuclear Information System (INIS)

Aly, Arafa H.; Mehaney, Ahmed

2012-01-01

Based on the transfer matrix method (TMM) and Bloch theory, the interaction of elastic waves (normal incidence) with 1D phononic crystal had been studied. The transfer matrix method was obtained for both longitudinal and transverse waves by applying the continuity conditions between the consecutive unit cells. Dispersion relations are calculated and plotted for both binary and ternary structures. Also we have investigated the corresponding effects on the band gaps values for the two types of phononic crystals. Furthermore, it can be observed that the complete band gaps are located in the common frequency stop-band regions. Numerical simulations are performed to investigate the effect of different thickness ratios inside each unit cell on the band gap values, as well as unit cells thickness on the central band gap frequency. These phononic band gap materials can be used as a filter for elastic waves at different frequencies values.

Real-space description of semiconducting band gaps in substitutional systems

International Nuclear Information System (INIS)

Magri, R.; Zunger, A.

1991-01-01

The goal of ''band-gap engineering'' in substitutional lattices is to identify atomic configurations that would give rise to a desired value of the band gap. Yet, current theoretical approaches to the problems, based largely on compilations of band structures for various latice configurations, have not yielded simple rules relating structural motifs to band gaps. We show that the band gap of substitutional AlAs/GaAs lattices can be usefully expanded in terms of a hierarchy of contributions from real-space ''atomic figures'' (pairs, triplets, quadruplets) detemined from first-principles band-structure calculations. Pair figures (up to fourth neighbors) and three-body figures are dominant. In analogy with similar cluster expansions of the total energy, this permits a systematic search among all lattice configurations for those having ''special'' band gaps. This approach enables the design of substitutional systems with certain band-gap properties by assembling atomic figures. As an illustration, we predict that the [0 bar 12]-oriented (AlAs) 1 /(GaAs) 4 /(AlAs) 1 /(GaAs) 2 superlattice has the largest band gap among all Al 0.25 Ga 0.75 As lattices with a maximum of ten cations per unit cell

Mesentero-axial gastric volvulus after removal of laparoscopic adjustable gastric band.

Science.gov (United States)

Pirmadjid, N; Pournaras, D J; Huan, S; Sujendran, V

2017-02-01

Despite the decreasing popularity of gastric banding, a large number of patients still have a band in situ. Although immediate postoperative complications are relatively rare, long-term complications of gastric banding are more common but are not reported to occur after band removal. We report a case of gastric volvulus and subsequent ischaemic perforation in a patient shortly after band removal, resulting in emergency laparotomy and total gastrectomy. Severe continuing pain persisting after band deflation and even gastric band removal should be treated as an emergency and urgent investigation should not be delayed.

Avirulent mutants of Macrophomina phaseolina and Aspergillus ...

Indian Academy of Sciences (India)

A human pathogen, Aspergillus fumigatus was also able to infect germinating seeds of P. mungo in the presence of 5 g/ml concentration of phaseolinone. Phaseolinone seemed to facilitate infection by A. fumigatus, which is not normally phytopathogenic, by reducing the immunity of germinating seedlings in a nonspecific ...

Effect of Dodonaea viscosa Jacq. residues on growth and yield of ...

African Journals Online (AJOL)

This study was to evaluate the effect of Dodonaea viscosa Jacq. residues on mungbean (Vigna mungo L.Hepper) local cultivar. An experiment [using randomized complete block design (RCBD) design] with three replications was conducted in 2010. The trial comprised of four treatments such as mulching, incorporation into ...

Effectiveness of various sterilization methods of contaminated post-fitted molar band

Directory of Open Access Journals (Sweden)

Anggia Tridianti

2013-06-01

Full Text Available Background: Molar band as anchoring device may be contaminated during the fitting process. Thus, decontamination process is essential to prevent cross-infection between patients. Purpose: The objective of this research was to determine the amount of bacteria in molar band post-fitted on the patient teeth, after previously undergone pre-sterilization using alcohol and ultrasonic cleaning bath followed by sterilization using dry heat oven and steam autoclave, in order to find the best method in decontamination of post-fitted molar band. Methods: Four molar bands which already fitted on one patient then divided evenly into two groups. The first group was pre-sterilized using alcohol. One of the bands then sterilized using dry heat oven, while the other one was sterilized using steam autoclave. The second group was pre-sterilized using ultrasonic cleaning bath. One band from this group then sterilized using dry heat oven and the other was sterilized using steam autoclave. The next step was to immerse all the bands in a phosphate-buffered saline solution. Using micropipette, the solution was retrieved and dropped upon a petri dish containing Brain Heart Infusion broth. The dish was then stored in an incubator for 24 hours, prior to counting the number of bacteria existed. The same methods were used to the rest of the patients, with total 128 molar bands from 32 patients. Results: There was a profound difference in numbers of bacteria found between those methods of sterilization. However, there was a non significant difference between the two groups which were at the alcohol-steam autoclave group and at the ultrasonic cleaning bath-steam autoclave group. Conclusion: This study showed that steam autoclave is better than for sterilizing molar band, as it left the minimal amount of bacteria in post-fitted molar band.Latar belakang: Molar band merupakan suatu alat penjangkaran yang dapat mengalami kontaminasi selama proses fitting band, sehingga perlu

Hole energy and momentum distributions in valence bands

International Nuclear Information System (INIS)

Laan, G. van der.

1982-01-01

In order to understand the electrical and magnetic properties of solids, the knowledge of the density of states and the dispersion relation of the valence bands is indispensable. This thesis offers some alternative methods to obtain information about the nature of the valence band. Part A deals with the energy distribution of the photoelectrons. A simple model, which explains the core hole satellite structure in compounds with large correlation effects between the valence band holes and the created photo-hole, is outlined. CuCl, CuX 2 (X = F Cl and Br) are studied, by photoemission and Auger electron spectroscopies in determining the valence band properties. Part B deals with the simultaneous measurement of the energy and the wave vector of the emitted electrons. A practical example is given for the determination of the dispersion relation in copper. The measurements of a surface resonance band and the distribution of the secondary electrons are also reported. (Auth.)

Optimal wavelength band clustering for multispectral iris recognition.

Science.gov (United States)

Gong, Yazhuo; Zhang, David; Shi, Pengfei; Yan, Jingqi

2012-07-01

This work explores the possibility of clustering spectral wavelengths based on the maximum dissimilarity of iris textures. The eventual goal is to determine how many bands of spectral wavelengths will be enough for iris multispectral fusion and to find these bands that will provide higher performance of iris multispectral recognition. A multispectral acquisition system was first designed for imaging the iris at narrow spectral bands in the range of 420 to 940 nm. Next, a set of 60 human iris images that correspond to the right and left eyes of 30 different subjects were acquired for an analysis. Finally, we determined that 3 clusters were enough to represent the 10 feature bands of spectral wavelengths using the agglomerative clustering based on two-dimensional principal component analysis. The experimental results suggest (1) the number, center, and composition of clusters of spectral wavelengths and (2) the higher performance of iris multispectral recognition based on a three wavelengths-bands fusion.

Strongly correlated impurity band superconductivity in diamond: X-ray spectroscopic evidence

Directory of Open Access Journals (Sweden)

G. Baskaran

2006-01-01

Full Text Available In a recent X-ray absorption study in boron doped diamond, Nakamura et al. have seen a well isolated narrow boron impurity band in non-superconducting samples and an additional narrow band at the chemical potential in a superconducting sample. We interpret the beautiful spectra as evidence for upper Hubbard band of a Mott insulating impurity band and an additional metallic 'mid-gap band' of a conducting 'self-doped' Mott insulator. This supports the basic framework of a recent theory of the present author of strongly correlated impurity band superconductivity (impurity band resonating valence bond, IBRVB theory in a template of a wide-gap insulator, with no direct involvement of valence band states.

The Marvels of Electromagnetic Band Gap (EBG) Structures

Science.gov (United States)

2003-11-01

terminology of "Electromagnetic conference papers and journal articles dealing with Band- gaps (EBG)". Recently, many researchers the characterizations...Band Gap (EBG) Structures 9 utilized to reduce the mutual coupling between Structures: An FDTD/Prony Technique elements of antenna arrays. based on the...Band- Gap of several patents. He has had pioneering research contributions in diverse areas of electromagnetics,Snteructure", Dymposiget o l 21 IE 48

Asymmetric acoustic transmission in multiple frequency bands

Energy Technology Data Exchange (ETDEWEB)

Sun, Hong-xiang, E-mail: jsdxshx@ujs.edu.cn [Research Center of Fluid Machinery Engineering and Technology, Jiangsu University, Zhenjiang 212013 (China); Laboratory of Modern Acoustics, Institute of Acoustics, Collaborative Innovation Center of Advanced Microstructures, Nanjing University, Nanjing 210093 (China); State Key Laboratory of Acoustics, Institute of Acoustics, Chinese Academy of Sciences, Beijing 100190 (China); Yuan, Shou-qi, E-mail: Shouqiy@ujs.edu.cn [Research Center of Fluid Machinery Engineering and Technology, Jiangsu University, Zhenjiang 212013 (China); Zhang, Shu-yi [Laboratory of Modern Acoustics, Institute of Acoustics, Collaborative Innovation Center of Advanced Microstructures, Nanjing University, Nanjing 210093 (China)

2015-11-23

We report both experimentally and numerically that the multi-band device of the asymmetric acoustic transmission is realized by placing two periodic gratings with different periods on both sides of two brass plates immersed in water. The asymmetric acoustic transmission can exist in four frequency bands below 1500 kHz, which arises from the interaction between various diffractions from the two gratings and Lamb modes in the brass plates immersed in water. The results indicate that the device has the advantages of multiple band, broader bandwidth, and simpler structure. Our finding should have great potential applications in ultrasonic devices.

Asymmetric acoustic transmission in multiple frequency bands

International Nuclear Information System (INIS)

Sun, Hong-xiang; Yuan, Shou-qi; Zhang, Shu-yi

2015-01-01

We report both experimentally and numerically that the multi-band device of the asymmetric acoustic transmission is realized by placing two periodic gratings with different periods on both sides of two brass plates immersed in water. The asymmetric acoustic transmission can exist in four frequency bands below 1500 kHz, which arises from the interaction between various diffractions from the two gratings and Lamb modes in the brass plates immersed in water. The results indicate that the device has the advantages of multiple band, broader bandwidth, and simpler structure. Our finding should have great potential applications in ultrasonic devices

Thin-film intermediate band chalcopyrite solar cells

International Nuclear Information System (INIS)

Fuertes Marron, D.; Marti, A.; Luque, A.

2009-01-01

Chalcopyrite-based solar cells currently lead the efficiency tables of thin-film photovoltaic technologies. Further improvements are foreseen upon implementation of an intermediate band in the absorber layers. We present a theoretical analysis of the efficiency limit for this type of device as a function of factors such as the gap of the host, the relative position of the intermediate band with respect to the band edge and the level of light concentration used as illumination. We have also considered the impact of non-idealities on the performance of the device, particularly the effect of electronic losses related to non-radiative recombination

Broad-band hard X-ray reflectors

DEFF Research Database (Denmark)

Joensen, K.D.; Gorenstein, P.; Hoghoj, P.

1997-01-01

Interest in optics for hard X-ray broad-band application is growing. In this paper, we compare the hard X-ray (20-100 keV) reflectivity obtained with an energy-dispersive reflectometer, of a standard commercial gold thin-film with that of a 600 bilayer W/Si X-ray supermirror. The reflectivity...... of the multilayer is found to agree extraordinarily well with theory (assuming an interface roughness of 4.5 Angstrom), while the agreement for the gold film is less, The overall performance of the supermirror is superior to that of gold, extending the band of reflection at least a factor of 2.8 beyond...... that of the gold, Various other design options are discussed, and we conclude that continued interest in the X-ray supermirror for broad-band hard X-ray applications is warranted....

Design studies of the Ku-band, wide-band Gyro-TWT amplifier

Science.gov (United States)

Jung, Sang Wook; Lee, Han Seul; Jang, Kwong Ho; Choi, Jin Joo; Hong, Yong Jun; Shin, Jin Woo; So, Jun Ho; Won, Jong Hyo

2014-02-01

This paper reports a Ku-band, wide band Gyrotron-Traveling-wave-tube(Gyro-TWT) that is currently being developed at Kwangwoon University. The Gyro-TWT has a two stage linear tapered interaction circuit to obtain a wide operating bandwidth. The linearly-tapered interaction circuit and nonlinearly-tapered magnetic field gives the Gyro-TWT a wide operating bandwidth. The Gyro-TWT bandwidth is 23%. The 2d-Particle-in-cell(PIC) and MAGIC2d code simulation results are 17.3 dB and 24.34 kW, respectively for the maximum saturated output power. A double anode MIG was simulated with E-Gun code. The results were 0.7 for the transvers to the axial beam velocity ratio (=alpha) and a 2.3% axial velocity spread at 50 kV and 4 A. A magnetic field profile simulation was performed by using the Poisson code to obtain the grazing magnetic field of the entire interaction circuit with Poisson code.

Ultrawide band gap amorphous oxide semiconductor, Ga–Zn–O

Energy Technology Data Exchange (ETDEWEB)

Kim, Junghwan, E-mail: JH.KIM@lucid.msl.titech.ac.jp [Materials and Structures Laboratory, Tokyo Institute of Technology, Mailbox R3-4, 4259 Nagatsuta, Midori-ku, Yokohama (Japan); Miyokawa, Norihiko; Sekiya, Takumi; Ide, Keisuke [Materials and Structures Laboratory, Tokyo Institute of Technology, Mailbox R3-4, 4259 Nagatsuta, Midori-ku, Yokohama (Japan); Toda, Yoshitake [Materials Research Center for Element Strategy, Tokyo Institute of Technology, Mailbox SE-6, 4259 Nagatsuta, Midori-ku, Yokohama (Japan); Hiramatsu, Hidenori; Hosono, Hideo; Kamiya, Toshio [Materials and Structures Laboratory, Tokyo Institute of Technology, Mailbox R3-4, 4259 Nagatsuta, Midori-ku, Yokohama (Japan); Materials Research Center for Element Strategy, Tokyo Institute of Technology, Mailbox SE-6, 4259 Nagatsuta, Midori-ku, Yokohama (Japan)

2016-09-01

We fabricated amorphous oxide semiconductor films, a-(Ga{sub 1–x}Zn{sub x})O{sub y}, at room temperature on glass, which have widely tunable band gaps (E{sub g}) ranging from 3.47–4.12 eV. The highest electron Hall mobility ~ 7 cm{sup 2} V{sup −1} s{sup −1} was obtained for E{sub g} = ~ 3.8 eV. Ultraviolet photoemission spectroscopy revealed that the increase in E{sub g} with increasing the Ga content comes mostly from the deepening of the valence band maximum level while the conduction band minimum level remains almost unchanged. These characteristics are explained by their electronic structures. As these films can be fabricated at room temperature on plastic, this achievement extends the applications of flexible electronics to opto-electronic integrated circuits associated with deep ultraviolet region. - Highlights: • Incorporation of H/H{sub 2}O stabilizes the amorphous phase. • Ultrawide band gap (~ 3.8 eV) amorphous oxide semiconductor was fabricated. • The increase in band gap comes mostly from the deepening of the valence band maximum level. • Donor level is more likely aligned to the valence band maximum level.

Border Structure of Intercalary Heterochromatin Bands of Drosophila melanogaster Polytene Chromosomes.

Science.gov (United States)

Khoroshko, V A; Zykova, T Yu; Popova, O O; Zhimulev, I F

2018-03-01

The precise genomic localization of the borders of 62 intercalary heterochromatin bands in Drosophila polytene chromosomes was determined. A new type of bands containing chromatin of different states was identified. This type is a combination of the gray band and the intercalary heterochromatin band, creating a genetic structure that with a light microscope is identified as a continuous band. The border structure of such bands includes the coding regions of genes with ubiquitous activity.

Phenomenological descriptions of the Yrast bands in sup(160,162,164,166)Yb nuclei band crossings and moments of inertia

International Nuclear Information System (INIS)

El Zaiki, M.I.; Nafie, H.O.; Abd El Mageed, K.E.

1992-01-01

Two methods of calculations have been used to fit the previously presented data on rotationally aligned quasiparticle bands in sup(160,162,164,166)Yb. Backbendings of moment of inertia of the Yrast states can be reproduced reasonably well. The energy levels and the effective moment of inertia for both gs and s-band are calculated and compared with the experimental data. Band crossing interpretations are discussed for each nucleus. The interaction strength calculations are presented. (author). 17 refs., 7 figs., 4 tabs

Focus: Nucleation kinetics of shear bands in metallic glass.

Science.gov (United States)

Wang, J Q; Perepezko, J H

2016-12-07

The development of shear bands is recognized as the primary mechanism in controlling the plastic deformability of metallic glasses. However, the kinetics of the nucleation of shear bands has received limited attention. The nucleation of shear bands in metallic glasses (MG) can be investigated using a nanoindentation method to monitor the development of the first pop-in event that is a signature of shear band nucleation. The analysis of a statistically significant number of first pop-in events demonstrates the stochastic behavior that is characteristic of nucleation and reveals a multimodal behavior associated with local spatial heterogeneities. The shear band nucleation rate of the two nucleation modes and the associated activation energy, activation volume, and site density were determined by loading rate experiments. The nucleation activation energy is very close to the value that is characteristic of the β relaxation in metallic glass. The identification of the rate controlling kinetics for shear band nucleation offers guidance for promoting plastic flow in metallic glass.

The behaviour of the moment of inertia curve in a recrossing of the ground state band and the super band in 158Er

International Nuclear Information System (INIS)

Dracoulis, G.D.

1978-11-01

The recrossing of the ground state band with the super band as an explanation for the second anomaly in 158 Er is examined in terms of the moment of inertia. A two band mixing calculation does not reproduce the experimenal moment of inertia curve

Band structure, band offsets, substitutional doping, and Schottky barriers of bulk and monolayer InSe

Science.gov (United States)

Guo, Yuzheng; Robertson, John

2017-09-01

We present a detailed study of the electronic structure of the layered semiconductor InSe. We calculate the band structure of the monolayer and bulk material using density functional theory, hybrid functionals, and G W . The band gap of the monolayer InSe is calculated to be 2.4 eV in screened exchange hybrid functional, close to the experimental photoluminescence gap. The electron affinities and band offsets are calculated for vertical stacked-layer heterostructures, and are found to be suitable for tunnel field effect transistors (TFETs) in combination with WS e2 or similar. The valence-band edge of InSe is calculated to lie 5.2 eV below the vacuum level, similar to that for the closed shell systems HfS e2 or SnS e2 . Hence InSe would be suitable to act as a p -type drain in the TFET. The intrinsic defects are calculated. For Se-rich layers, the Se adatom (interstitial) is found to be the most stable defect, whereas for In-rich layers, the Se vacancy is the most stable for the neutral state. Antisites tend to have energies just above those of vacancies. The Se antisite distorts towards a bond-breaking distortion as in the EL2 center of GaAs. Both substitutional donors and acceptors are calculated to be shallow, and effective dopants. They do not reconstruct to form nondoping configurations as occurs in black phosphorus. Finally, the Schottky barriers of metals on InSe are found to be strongly pinned by metal induced gap states (MIGS) at ˜0.5 eV above the valence-band edge. Any interfacial defects would lead to a stronger pinning at a similar energy. Overall, InSe is an effective semiconductor combining the good features of 2D (lack of dangling bonds, etc.) with the good features of 3D (effective doping), which few others achieve.

Life with a Gastric Band. Long-Term Outcomes of Laparoscopic Adjustable Gastric Banding-a Retrospective Study.

Science.gov (United States)

Kowalewski, Piotr K; Olszewski, Robert; Kwiatkowski, Andrzej; Gałązka-Świderek, Natalia; Cichoń, Krzysztof; Paśnik, Krzysztof

2017-05-01

Laparoscopic adjustable gastric banding (LAGB) is the third most popular bariatric procedure worldwide. Various authors present ambivalent long-term follow up results. We revised records of the patients who underwent LAGB between 2003 and 2006 along with history of additional check-ins. Patients with outdated details were tracked with the national health insurance database and social media (Facebook). An online survey was sent. The patients who did not have their band removed were included in this study. We calculated the percent total weight loss (%TWL) and percent excess weight loss (%EWL), along with changes in body mass index (ΔBMI). Satisfactory weight loss was set at >50% EWL (for BMI = 25 kg/m 2 ). Since eight patients gained weight, we decided to include negative values of %TWL, %EWL, and ΔBMI. One hundred seven patients underwent LAGB from 2003 to 2006. The mean follow-up time was 11.2 (±1.2) years. Eleven percent of patients were lost to follow up (n = 12). There was one perioperative death. Fifty-four of the patients (n = 57) had their band removed. Thirty-seven patients still have the band (39%) and were included in the study. The mean %EWL was 27% (-56-112%) and %TWL was 11% (-19-53%). Twelve patients achieved %EWL > 50% (32%). Thiry-two patients still suffer from obesity, with BMI over 30 kg/m 2 . Eight patients (22%) gained additional weight. Patients with %EWL > 50% suffered less from gastroesophageal reflux disease symptoms than those with EWL < 50% (p < 0.05). Out of 107 cases, only 11.2% of patients with gastric band (n = 12) achieved satisfactory %EWL. Twenty-two percent of patients regained their weight or even exceeded it. Overall results suggest that LAGB is not an effective bariatric procedure in long term observation.

Band width and multiple-angle valence-state mapping of diamond

International Nuclear Information System (INIS)

Jimenez, I.; Terminello, L.J.; Sutherland, D.G.J.

1997-01-01

The band width may be considered the single most important parameter characterizing the electronic structure of a solid. The ratio of band width and Coulomb repulsion determines how correlated or delocalized an electron system is. Some of the most interesting solids straddle the boundary between localized and delocalized, e.g. the high-temperature superconductors. The bulk of the band calculations available today is based on local density functional (DF) theory. Even though the Kohn-Sham eigenvalues from that theory do not represent the outcome of a band-mapping experiment, they are remarkably similar to the bands mapped via photoemission. Strictly speaking, one should use an excited state calculation that takes the solid's many-body screening response to the hole created in photoemission into account. Diamond is a useful prototype semiconductor because of its low atomic number and large band width, which has made it a long-time favorite for testing band theory. Yet, the two experimental values of the band width of diamond have error bars of ±1 eV and differ by 3.2 eV. To obtain an accurate valence band width for diamond, the authors use a band-mapping method that collects momentum distributions instead of the usual energy distributions. This method has undergone extensive experimental and theoretical tests in determining the band width of lithium fluoride. An efficient, imaging photoelectron spectrometer is coupled with a state-of-the-art undulator beam line at the Advanced Light Source to allow collection of a large number of data sets. Since it takes only a few seconds to take a picture of the photoelectrons emitted into a 84 degrees cone, the authors can use photon energies as high as 350 eV where the cross section for photoemission from the valence band is already quite low, but the emitted photoelectrons behave free-electron-like. This make its much easier to locate the origin of the inter-band transitions in momentum space

Band width and multiple-angle valence-state mapping of diamond

Energy Technology Data Exchange (ETDEWEB)

Jimenez, I.; Terminello, L.J.; Sutherland, D.G.J. [Lawrence Berkeley National Lab., CA (United States)] [and others

1997-04-01

The band width may be considered the single most important parameter characterizing the electronic structure of a solid. The ratio of band width and Coulomb repulsion determines how correlated or delocalized an electron system is. Some of the most interesting solids straddle the boundary between localized and delocalized, e.g. the high-temperature superconductors. The bulk of the band calculations available today is based on local density functional (DF) theory. Even though the Kohn-Sham eigenvalues from that theory do not represent the outcome of a band-mapping experiment, they are remarkably similar to the bands mapped via photoemission. Strictly speaking, one should use an excited state calculation that takes the solid`s many-body screening response to the hole created in photoemission into account. Diamond is a useful prototype semiconductor because of its low atomic number and large band width, which has made it a long-time favorite for testing band theory. Yet, the two experimental values of the band width of diamond have error bars of {+-}1 eV and differ by 3.2 eV. To obtain an accurate valence band width for diamond, the authors use a band-mapping method that collects momentum distributions instead of the usual energy distributions. This method has undergone extensive experimental and theoretical tests in determining the band width of lithium fluoride. An efficient, imaging photoelectron spectrometer is coupled with a state-of-the-art undulator beam line at the Advanced Light Source to allow collection of a large number of data sets. Since it takes only a few seconds to take a picture of the photoelectrons emitted into a 84{degrees} cone, the authors can use photon energies as high as 350 eV where the cross section for photoemission from the valence band is already quite low, but the emitted photoelectrons behave free-electron-like. This make its much easier to locate the origin of the inter-band transitions in momentum space.

VIBRONIC PROGRESSIONS IN SEVERAL DIFFUSE INTERSTELLAR BANDS

International Nuclear Information System (INIS)

Duley, W. W.; Kuzmin, Stanislav

2010-01-01

A number of vibronic progressions based on low-energy vibrational modes of a large molecule have been found in the diffuse interstellar band (DIB) spectrum of HD 183143. Four active vibrational modes have been identified with energies at 5.18 cm -1 , 21.41 cm -1 , 31.55 cm -1 , and 34.02 cm -1 . The mode at 34.02 cm -1 was previously recognized by Herbig. Four bands are associated with this molecule, with origins at 6862.61 A, 6843.64 A, 6203.14 A, and 5545.11 A (14589.1 cm -1 , 14608.08 cm -1 , 16116.41 cm -1 , and 18028.9 cm -1 , respectively). The progressions are harmonic and combination bands are observed involving all modes. The appearance of harmonic, rather than anharmonic, terms in these vibronic progressions is consistent with torsional motion of pendant rings, suggesting that the carrier is a 'floppy' molecule. Some constraints on the type and size of the molecule producing these bands are discussed.

X-band RF power sources for accelerator applications

International Nuclear Information System (INIS)

Kirshner, Mark F.; Kowalczyk, Richard D.; Wilsen, Craig B.; True, Richard B.; Simpson, Ian T.; Wray, John T.

2011-01-01

The majority of medical and industrial linear accelerators (LINACs) in use today operate at S-band. To reduce size and weight, these systems are gradually migrating toward X-band. The new LINACs will require suitable RF components to power them. In anticipation of this market, L-3 Communications Electron Devices Division (EDD) has recently developed a suite of RF sources operating at 9.3 GHz to complement our existing S-band product line. (author)

Identical gamma-vibrational bands in {sup 165}Ho

Energy Technology Data Exchange (ETDEWEB)

Radford, D.C.; Galindo-Uribarri, A.; Janzen, V.P. [Chalk River Labs., Ontario (Canada)] [and others

1996-12-31

The structure of {sup 165}Ho at moderate spins has been investigated by means of Coulomb excitation. Two {gamma}-vibrational bands (K{sup {pi}} = 11/2{sup {minus}} and K{sup {pi}} = 3/2{sup {minus}}) are observed, with very nearly identical in-band {gamma}-ray energies. Gamma-ray branching ratios are analyzed to extract information on Coriolis mixing, and the role of the K quantum number in identical bands is discussed.

Band mapping of surface states vs. adsorbate coverage

International Nuclear Information System (INIS)

Rotenberg, E.; Kevan, S.D.; Denlinger, J.D.; Chung, Jin-Wook

1997-01-01

The theory of electron bands, which arises from basic quantum mechanical principles, has been the cornerstone of solid state physics for over 60 years. Simply put, an energy band is an electron state in a solid whose energy varies with its momentum (similar to, but with a more complicated dependence than, how a free electron's energy is proportional to its momentum squared). Much attention over the last 15 years has been given to the study of band structure of surfaces and interfaces, especially as the applications of these two-dimensional systems have become increasingly important to industry and science. The ultraESCA endstation at beamline 7.01 at the Advanced Light Source was developed for very high-energy - (∼50 meV) and angular - ( 12 photons/sec) makes the detailed study of the evolution of bands possible. The authors are interested in learning how, when one forms a chemical bond between a metal and an overlaying atom or molecule, the resulting charge transfer to or from the adsorbate affects the surface bands. In some cases of interest, intermediate coverages lead to different band structure than at the extremes of clean and saturated surfaces. Surfaces of tungsten are particularly interesting, as their atomic geometry has been shown to be exquisitely sensitive to both the surface vibrational and electronic properties. In this study, the authors looked at the surface bands of tungsten ((110) surface), as a function both of coverage and mass of overlaying atoms. The adsorbed atoms were hydrogen and the alkali atoms lithium and cesium

Silicon rich nitride ring resonators for rare - earth doped telecommunications-band amplifiers pumped at the O-band.

Science.gov (United States)

Xing, P; Chen, G F R; Zhao, X; Ng, D K T; Tan, M C; Tan, D T H

2017-08-22

Ring resonators on silicon rich nitride for potential use as rare-earth doped amplifiers pumped at 1310 nm with amplification at telecommunications-band are designed and characterized. The ring resonators are fabricated on 300 nm and 400 nm silicon rich nitride films and characterized at both 1310 nm and 1550 nm. We demonstrate ring resonators exhibiting similar quality factors exceeding 10,000 simultaneously at 1310 nm and 1550 nm. A Dysprosium-Erbium material system exhibiting photoluminescence at 1510 nm when pumped at 1310 nm is experimentally demonstrated. When used together with Dy-Er co-doped particles, these resonators with similar quality factors at 1310 nm and 1550 nm may be used for O-band pumped amplifiers for the telecommunications-band.

Wild Band Edges: The Role of Bandgap Grading and Band-Edge Fluctuations in High-Efficiency Chalcogenide Devices: Preprint

Energy Technology Data Exchange (ETDEWEB)

Repins, Ingrid; Mansfield, Lorelle; Kanevce, Ana; Jensen, Soren A.; Kuciauskas, Darius; Glynn, Stephen; Barnes, Teresa; Metzger, Wyatt; Burst, James; Jiang, Chun-Sheng; Dippo, Patricia; Harvey, Steve; Teeter, Glenn; Perkins, Craig; Egaas, Brian; Zakutayev, Andriy; Alsmeier, J.-H.; Lussky, T.; Korte, L.; Wilks, R. G.; Bar, M.; Yan, Y.; Lany, Stephan; Zawadzki, Pawel; Park, Ji-Sang; Wei, Suhuai

2016-06-16

Band-edge effects -- including grading, electrostatic fluctuations, bandgap fluctuations, and band tails -- affect chalcogenide device efficiency. These effects now require more careful consideration as efficiencies increase beyond 20%. Several aspects of the relationships between band-edge phenomena and device performance for NREL absorbers are examined. For Cu(In,Ga)Se2 devices, recent increases in diffusion length imply changes to optimum bandgap profile. The origin, impact, and modification of electrostatic and bandgap fluctuations are also discussed. The application of the same principles to devices based on CdTe, kesterites, and emerging absorbers (Cu2SnS3, CuSbS2), considering differences in materials properties and defect formation energies, is examined.

Design and experimental verification of a dual-band metamaterial filter

Science.gov (United States)

Zhu, Hong-Yang; Yao, Ai-Qin; Zhong, Min

2016-10-01

In this paper, we present the design, simulation, and experimental verification of a dual-band free-standing metamaterial filter operating in a frequency range of 1 THz-30 THz. The proposed structure consists of periodically arranged composite air holes, and exhibits two broad and flat transmission bands. To clarify the effects of the structural parameters on both resonant transmission bands, three sets of experiments are performed. The first resonant transmission band shows a shift towards higher frequency when the side width w 1 of the main air hole is increased. In contrast, the second resonant transmission band displays a shift towards lower frequency when the side width w 2 of the sub-holes is increased, while the first resonant transmission band is unchanged. The measured results indicate that these resonant bands can be modulated individually by simply optimizing the relevant structural parameters (w 1 or w 2) for the required band. In addition, these resonant bands merge into a single resonant band with a bandwidth of 7.7 THz when w 1 and w 2 are optimized simultaneously. The structure proposed in this paper adopts different resonant mechanisms for transmission at different frequencies and thus offers a method to achieve a dual-band and low-loss filter. Project supported by the Doctorate Scientific Research Foundation of Hezhou University, China (Grant No. HZUBS201503), the Promotion of the Basic Ability of Young and Middle-aged Teachers in Universities Project of Guangxi Zhuang Autonomous Region, China (Grant No. KY2016YB453), the Guangxi Colleges and Universities Key Laboratory Symbolic Computation, China, Engineering Data Processing and Mathematical Support Autonomous Discipline Project of Hezhou University, China (Grant No. 2016HZXYSX01).

Comportamento de linhagens de feijão-mungo(Vigna radiata L. em Santa Catarina Behaviour of mungbean (Vigna radiata L. in Santa Catarina

Directory of Open Access Journals (Sweden)

Shong Lin Shiow

2002-08-01

Full Text Available Foram conduzidos três experimentos na fazenda experimental do Centro de Ciências Agrárias da Universidade Federal de Santa Catarina, Florianópolis, SC, Brasil. A finalidade do trabalho foi avaliar o comportamento de 29 linhagens de feijão mungo provenientes do "Asian Vegetable Research and Development Center" (AVRDC. Avaliaram-se as características agronômicas (formacão da primeira flor, primeiro legume maduro, estatura da planta, o peso de mil sementes e o rendimento. As linhagens foram testadas em blocos ao acaso, com quatro repetições. Cada parcela foi constituída por 4 linhas de 6m de comprimento, espaçadas de 50cm, com vinte sementes por metro de sulco. A floração inicial das linhagens ocorreu entre os 33 e 49 dias após o plantio, enquanto a maturação do primeiro legume se deu entre os 70 e 78 dias após a semeadura. A estatura das plantas e o peso de mil sementes variaram entre 22,5 e 63,8cm e 33,0 e 76,4g respectivamente. As linhagens mais produtivas foram: VC 3890B, VC 1973C e VC 2764B com rendimento acima de 1140kg.ha-1. Estas linhagens apresentaram peso de mil sementes e estatura de planta boas para cultivo e um ciclo biológico médio. A colheita foi feita em uma única operação, entre 80 e 85 dias após a semeadura no primeiro e segundo experimentos. No terceiro experimento, a colheita foi feita em duas vezes, aos 80 e 85 dias e aos 95 e 100 dias, sendo que na primeira colheita foram colhidos 78% dos legumes; os restantes 22% foram colhidos 15 dias após a primeira.Three experiments were conducted at the experimental farm of the Agricultural Science Center, Federal University of Santa Catarina, Ressacada, Florianópolis, SC. Brazil. Twenty nine lines of mungbean from the Asian Vegetable Research and Development Center (AVRDC, Taiwan, Republic of China were evaluated about their agronomic characters (first flower formation, first legume mature, plant height, thousand seeds weight and yield. The experimental design

Research on low-frequency band gap property of a hybrid phononic crystal

Science.gov (United States)

Dong, Yake; Yao, Hong; Du, Jun; Zhao, Jingbo; Chao, Ding; Wang, Benchi

2018-05-01

A hybrid phononic crystal has been investigated. The characteristic frequency of XY mode, transmission loss and displacement vector have been calculated by the finite element method. There are Bragg scattering band gap and local resonance band gap in the band structures. We studied the influence factors of band gap. There are many flat bands in the eigenfrequencies curve. There are many flat bands in the curve. The band gap covers a large range in low frequency. The band gaps cover more than 95% below 3000 Hz.

Electronic band structure of lithium, sodium and potassium fluorides

International Nuclear Information System (INIS)

Jouanin, C.; Albert, J.P.; Gout, C.

1975-01-01

A mixed tight-binding, pseudopotential method is proposed to calculate the energy band structure of large-gap crystals and is tested here on LiF, NaF and KF. Three-centre terms are included in the determination of the valence bands by the tight-binding method and for the conduction bands we use a pseudopotential model proposed by Bassani and Giuliano, modified for the positive ions. By taking into account the polarization corrections, transitions calculated from the energy band structures are compared with experimental data and the agreement is generally good

Multiple superdeformed bands in Sr, Y, and Zr nuclei

International Nuclear Information System (INIS)

Reviol, W.; Sarantites, D.G.; Lerma, F.; Devlin, M.; LaFosse, D.R.; Chiara, C.J.; Wyss, R.; Baktash, C.; Jin, H.-Q.; Tabor, S.L.; Soltysik, D.; Clark, R.M.; Lee, I.Y.; Macchiavelli, A.O.; MacLeod, R.W.

2003-01-01

Multiple superdeformed bands in the nuclei 80-83Sr, 82-84Y, and 83,84Zr have been studied in a backed-target experiment using the Gammasphere and Microball detector arrays. For 15 bands in these nuclei, average transition quadrupole moments (Qt) have been measured accurately. Among those are two pairs of 'isospectral' bands and the Qt values obtained in each case are nearly identical. The measured Qt values and dynamical moments of inertia place stringent conditions on configuration assignments for the bands obtained from mean field calculations

Picosecond thermometer in the amide I band of myoglobin

DEFF Research Database (Denmark)

Austin, R.H.; Xie, A.; Meer, L. van der

2005-01-01

The amide I and II bands in myoglobin show a heterogeneous temperature dependence, with bands at 6.17 and 6.43 mu m which are more intense at low temperatures. The amide I band temperature dependence is on the long wavelength edge of the band, while the short wavelength side has almost...... can be used to determine the time it takes vibrational energy to flow into the hydration shell. We determine that vibrational energy flow to the hydration shell from the amide I takes approximately 20 ps to occur....

CSF oligoclonal banding - slideshow

Science.gov (United States)

... this page: //medlineplus.gov/ency/presentations/100145.htm CSF oligoclonal banding - series—Normal anatomy To use the ... 5 out of 5 Overview The cerebrospinal fluid (CSF) serves to supply nutrients to the central nervous ...

Lifetimes of an excited superdeformed band in {sup 192}Hg

Energy Technology Data Exchange (ETDEWEB)

Ahmad, I.; Blumenthal, D.; Carpenter, M.P. [and others

1995-08-01

An excited superdeformed band was identified in {sup 192}Hg and the lifetimes of its levels measured with the Doppler-shift attenuation method from data taken with the Eurogam spectrometer. The band is proposed to be based on the two-quasineutron (v[642]3/2 [512]5/2) configuration, which after a band crossing, becomes the (v[642]3/2 [752]5/2) configuration. The transition quadrupole moment Q{sub t} of the excited band is the same as that of the yrast SD band, within experimental errors. This suggests that the deformation of the SD minimum is robust with respect to quasiparticle excitation, despite the occupation of the deformation-driving v[752]5/2 level (from the j{sub 15/2} shell) after the band crossing.

Development of a Control Banding Tool for Nanomaterials

OpenAIRE

Riediker, M.; Ostiguy, C.; Triolet, J.; Troisfontaine, P.; Vernez, D.; Bourdel, G.; Thieriet, N.; Cadène, A.

2012-01-01

Control banding (CB) can be a useful tool for managing the potential risks of nanomaterials. The here proposed CB, which should be part of an overall risk control strategy, groups materials by hazard and emission potential. The resulting decision matrix proposes control bands adapted to the risk potential levels and helps define an action plan. If this plan is not practical and financially feasible, a full risk assessment is launched. The hazard banding combines key concepts of nanomaterial t...

Kπ=0+ band moment of inertia anomaly

International Nuclear Information System (INIS)

Zeng, J.Y.; Wu, C.S.; Cheng, L.; Lin, C.Z.; China Center of Advanced Science and Technology

1990-01-01

The moments of inertia of K π =0 + bands in the well-deformed nuclei are calculated by a particle-number-conserving treatment for the cranked shell model. The very accurate solutions to the low-lying K π =0 + bands are obtained by making use of an effective K truncation. Calculations show that the main contribution to the moments of inertia comes from the nucleons in the intruding high-j orbits. Considering the fact that no free parameter is involved in the calculation and no extra inert core contribution is added, the agreement between the calculated and the observed moments of inertia of 0 + bands in 168 Er is very satisfactory

Theta band activity in response to emotional expressions and its relationship with gamma band activity as revealed by MEG and advanced beamformer source imaging

Directory of Open Access Journals (Sweden)

Qian eLuo

2014-02-01

Full Text Available Neuronal oscillations in the theta and gamma bands have been shown to be important for cognition. Here we examined the temporal and spatial relationship between the two frequency bands in emotional processing using Magnetoencephalography and an advanced dynamic beamformer source imaging method called Synthetic Aperture Magnetometry. We found that areas including the amygdala, visual and frontal cortex showed significant event-related synchronization (ERS in both bands, suggesting a functional association of neuronal oscillations in the same areas in the two bands. However, while the temporal profile in both bands was similar in the amygdala, the peak in gamma band power was much earlier within both visual and frontal areas. Our results do not support a traditional view that the localizations of lower and higher frequencies are spatially distinct. Instead, they suggest that in emotional processing, neuronal oscillations in the gamma and theta bands may reflect, at least in visual and frontal cortex either different but related functional processes or, perhaps more probably, different computational components of the same functional process.

RRI-GBT MULTI-BAND RECEIVER: MOTIVATION, DESIGN, AND DEVELOPMENT

International Nuclear Information System (INIS)

Maan, Yogesh; Deshpande, Avinash A.; Chandrashekar, Vinutha; Chennamangalam, Jayanth; Rao, K. B. Raghavendra; Somashekar, R.; Ezhilarasi, M. S.; Sujatha, S.; Kasturi, S.; Sandhya, P.; Duraichelvan, R.; Amiri, Shahram; Aswathappa, H. A.; Sarabagopalan, G.; Ananda, H. M.; Anderson, Gary; Bauserman, Jonah; Beaudet, Carla; Bloss, Marty; Barve, Indrajit V.

2013-01-01

We report the design and development of a self-contained multi-band receiver (MBR) system, intended for use with a single large aperture to facilitate sensitive and high time-resolution observations simultaneously in 10 discrete frequency bands sampling a wide spectral span (100-1500 MHz) in a nearly log-periodic fashion. The development of this system was primarily motivated by need for tomographic studies of pulsar polar emission regions. Although the system design is optimized for the primary goal, it is also suited for several other interesting astronomical investigations. The system consists of a dual-polarization multi-band feed (with discrete responses corresponding to the 10 bands pre-selected as relatively radio frequency interference free), a common wide-band radio frequency front-end, and independent back-end receiver chains for the 10 individual sub-bands. The raw voltage time sequences corresponding to 16 MHz bandwidth each for the two linear polarization channels and the 10 bands are recorded at the Nyquist rate simultaneously. We present the preliminary results from the tests and pulsar observations carried out with the Robert C. Byrd Green Bank Telescope using this receiver. The system performance implied by these results and possible improvements are also briefly discussed.

RRI-GBT MULTI-BAND RECEIVER: MOTIVATION, DESIGN, AND DEVELOPMENT

Energy Technology Data Exchange (ETDEWEB)

Maan, Yogesh; Deshpande, Avinash A.; Chandrashekar, Vinutha; Chennamangalam, Jayanth; Rao, K. B. Raghavendra; Somashekar, R.; Ezhilarasi, M. S.; Sujatha, S.; Kasturi, S.; Sandhya, P.; Duraichelvan, R.; Amiri, Shahram; Aswathappa, H. A.; Sarabagopalan, G.; Ananda, H. M. [Raman Research Institute, Bangalore (India); Anderson, Gary; Bauserman, Jonah; Beaudet, Carla; Bloss, Marty [National Radio Astronomy Observatory, P.O. Box 2, Green Bank, WV (United States); Barve, Indrajit V. [Indian Institute of Astrophysics, Bangalore (India); and others

2013-01-15

We report the design and development of a self-contained multi-band receiver (MBR) system, intended for use with a single large aperture to facilitate sensitive and high time-resolution observations simultaneously in 10 discrete frequency bands sampling a wide spectral span (100-1500 MHz) in a nearly log-periodic fashion. The development of this system was primarily motivated by need for tomographic studies of pulsar polar emission regions. Although the system design is optimized for the primary goal, it is also suited for several other interesting astronomical investigations. The system consists of a dual-polarization multi-band feed (with discrete responses corresponding to the 10 bands pre-selected as relatively radio frequency interference free), a common wide-band radio frequency front-end, and independent back-end receiver chains for the 10 individual sub-bands. The raw voltage time sequences corresponding to 16 MHz bandwidth each for the two linear polarization channels and the 10 bands are recorded at the Nyquist rate simultaneously. We present the preliminary results from the tests and pulsar observations carried out with the Robert C. Byrd Green Bank Telescope using this receiver. The system performance implied by these results and possible improvements are also briefly discussed.

Comparison and fit of the two and six band k.p models for the band edge structure of Pbsub(1-x)Snsub(x)Te

International Nuclear Information System (INIS)

Weissman, Y.

1975-10-01

The band edge structure of Pbsub(1-x)Snsub(x)Te is derived in detail using a two band ellipsoidal model and compared with a more rigorous calculation based on six bands. A quantitative comparison is made for two values of the energy gap, corresponding to the cases where x=0 and x=0.17. It was found that, for the occupied states in nondegenerate materials, both models are practically equivalent. Discrepancies may occur only in high degeneracies or deep inversion layers. The agreement between both models was significantly improved by introducing an effective energy gap in the two band model. It is suggested that the use of the effective energy gap may improve the agreement between the two band model and experiment whenever the details of the band edge structure enter the interpretation of the experimental results. (author)

Deformation bands in porous sandstones their microstructure and petrophysical properties

Energy Technology Data Exchange (ETDEWEB)

Torabi, Anita

2007-12-15

Deformation bands are commonly thin tabular zones of crushed or reorganized grains that form in highly porous rocks and sediments. Unlike a fault, typically the slip is negligible in deformation bands. In this dissertation the microstructure and petrophysical properties of deformation bands have been investigated through microscopy and numerical analysis of experimental and natural examples. The experimental work consists of a series of ring-shear experiments performed on porous sand at 5 and 20 MPa normal stresses and followed by microscopic examination of thin sections from the sheared samples. The results of the ring-shear experiments and comparison of them to natural deformation bands reveals that burial depth (level of normal stress in the experiments) and the amount of shear displacement during deformation are the two significant factors influencing the mode in which grains break and the type of shear zone that forms. Two end-member types of experimental shear zones were identified: (a) Shear zones with diffuse boundaries, which formed at low levels of normal stress and/or shear displacement; and (b) Shear zones with sharp boundaries, which formed at higher levels of normal stress and/or shear displacement. Our interpretation is that with increasing burial depth (approximately more than one kilometer, simulated in the experiments by higher levels of normal stress), the predominant mode of grain fracturing changes from flaking to splitting; which facilitates the formation of sharp-boundary shear zones. This change to grain splitting increases the power law dimension of the grain size distribution (D is about 1.5 in sharp boundary shear zones). Based on our observations, initial grain size has no influence in the deformation behavior of the sand at 5 MPa normal stresses. A new type of cataclastic deformation band is described through outcrop and microscopic studies; here termed a 'slipped deformation band'. Whereas previously reported cataclastic

Band gap effects of hexagonal boron nitride using oxygen plasma

International Nuclear Information System (INIS)

Sevak Singh, Ram; Leong Chow, Wai; Yingjie Tay, Roland; Hon Tsang, Siu; Mallick, Govind; Tong Teo, Edwin Hang

2014-01-01

Tuning of band gap of hexagonal boron nitride (h-BN) has been a challenging problem due to its inherent chemical stability and inertness. In this work, we report the changes in band gaps in a few layers of chemical vapor deposition processed as-grown h-BN using a simple oxygen plasma treatment. Optical absorption spectra show a trend of band gap narrowing monotonically from 6 eV of pristine h-BN to 4.31 eV when exposed to oxygen plasma for 12 s. The narrowing of band gap causes the reduction in electrical resistance by ∼100 fold. The x-ray photoelectron spectroscopy results of plasma treated hexagonal boron nitride surface show the predominant doping of oxygen for the nitrogen vacancy. Energy sub-band formations inside the band gap of h-BN, due to the incorporation of oxygen dopants, cause a red shift in absorption edge corresponding to the band gap narrowing

Effect of correlation on the band structure of α-cerium

International Nuclear Information System (INIS)

Rao, R.S.; Singh, R.P.

1975-01-01

The electronic band structure of f.c.c. phase of the rare earth metal cerium (α-cerium) has been calculated using a formulation of the crystal potential where correlation also has been included in addition to exchange. The Green's function method of Korringa-Kohn and Rostoker has been used due to obvious advantages in calculation. The calculations indicate that the s-d bands are hybridized with the f-levels but the f-bands are fairly narrow and lie slightly above the Fermi level. The structure of the bands is qualitatively similar to those of calculations by others except for a general shift of the entire set of bands by about 0.1 Ryd. Thd density of states has also been calculated from the bands obtained. The spin susceptibility of α-cerium has also been calculated using the Kohn-Sham method. However, the calculated additional contributions to the band structure values cannot still explain the large experimental values reported in the literature. (author)

Band gap effects of hexagonal boron nitride using oxygen plasma

Energy Technology Data Exchange (ETDEWEB)

Sevak Singh, Ram; Leong Chow, Wai [School of Electrical and Electronic Engineering, Nanyang Technological University, 50 Nanyang Avenue, Singapore 639798 (Singapore); Yingjie Tay, Roland [School of Electrical and Electronic Engineering, Nanyang Technological University, 50 Nanyang Avenue, Singapore 639798 (Singapore); Temasek Laboratories-NTU, 50 Nanyang Avenue, Singapore 639798 (Singapore); Hon Tsang, Siu [Temasek Laboratories-NTU, 50 Nanyang Avenue, Singapore 639798 (Singapore); Mallick, Govind [Temasek Laboratories-NTU, 50 Nanyang Avenue, Singapore 639798 (Singapore); Weapons and Materials Research Directorate, U.S. Army Research Laboratory, Aberdeen Proving Ground, Maryland 21005 (United States); Tong Teo, Edwin Hang, E-mail: htteo@ntu.edu.sg [School of Electrical and Electronic Engineering, Nanyang Technological University, 50 Nanyang Avenue, Singapore 639798 (Singapore); School of Materials Science and Engineering, Nanyang Technological University, 50 Nanyang Avenue, Singapore 639798 (Singapore)

2014-04-21

Tuning of band gap of hexagonal boron nitride (h-BN) has been a challenging problem due to its inherent chemical stability and inertness. In this work, we report the changes in band gaps in a few layers of chemical vapor deposition processed as-grown h-BN using a simple oxygen plasma treatment. Optical absorption spectra show a trend of band gap narrowing monotonically from 6 eV of pristine h-BN to 4.31 eV when exposed to oxygen plasma for 12 s. The narrowing of band gap causes the reduction in electrical resistance by ∼100 fold. The x-ray photoelectron spectroscopy results of plasma treated hexagonal boron nitride surface show the predominant doping of oxygen for the nitrogen vacancy. Energy sub-band formations inside the band gap of h-BN, due to the incorporation of oxygen dopants, cause a red shift in absorption edge corresponding to the band gap narrowing.

Multislot microstrip antenna for ultra-wide band applications

Directory of Open Access Journals (Sweden)

Noor M. Awad

2018-01-01

Full Text Available In this paper designs of both planar ultra-wide band (UWB antenna and UWB antenna with two rejected bands are given. The antenna consists of a rectangular patch etched on FR4-substrate with 50 Ω feed line. The rectangular patch has one round cut at each corner with one slot in the ground plane. The simulated bandwidth with return loss (RL ⩾ 10 dB is 3.42–11.7 GHz. The rejected bands are the WLAN and X-bands, achieved by inserting slots in the patch and the feed. The simulated results of the proposed antenna indicate higher gain at the passbands while a sharp drop at the rejected bands is seen. The radiation pattern is of dipole shape in the E-plane and almost omnidirectional in the H-plane. The high frequency structure simulator (HFSS is used to design and simulate the antennas behavior over the different frequency ranges. Measurements confirm the antenna characteristic as predicted in the simulation with a slight shift in frequencies.

W-Band Transmission MeasurementS and X-Band Dielectric Properties Measurements for a Radome Material Sample

Science.gov (United States)

Cravey, Robin L.; Tiemsin, Pacita I.

1997-01-01

This paper describes measurements which were performed on a sample of radome material in the Electromagnetic Properties Measurements Laboratory (EPML). The purpose of the measurements described in this paper was to determine the one-way transmission loss through the flat panel of radome material for a frequency range of 84 to 94 GHz, for varying incidence angles. The panel, which was manufactured by Norton Performance Plastics Corporation, was provided to the EPML by TRW. The size of the panel is 40 in x 36 in x 0.422 in and consists of a foam material with one side coated with a smooth white coating (this side will be referred to as the front side). The dielectric properties of the foam material from the inside of the panel were also determined at X-band (8.2-12.4 GHz). The W-band free space measurements are presented first, followed by the X-band dielectric properties measurements.

Band Gap Engineering of Titania Systems Purposed for Photocatalytic Activity

Science.gov (United States)

Thurston, Cameron

Ab initio computer aided design drastically increases candidate population for highly specified material discovery and selection. These simulations, carried out through a first-principles computational approach, accurately extrapolate material properties and behavior. Titanium Dioxide (TiO2 ) is one such material that stands to gain a great deal from the use of these simulations. In its anatase form, titania (TiO2 ) has been found to exhibit a band gap nearing 3.2 eV. If titania is to become a viable alternative to other contemporary photoactive materials exhibiting band gaps better suited for the solar spectrum, then the band gap must be subsequently reduced. To lower the energy needed for electronic excitation, both transition metals and non-metals have been extensively researched and are currently viable candidates for the continued reduction of titania's band gap. The introduction of multicomponent atomic doping introduces new energy bands which tend to both reduce the band gap and recombination loss. Ta-N, Nb-N, V-N, Cr-N, Mo-N, and W-N substitutions were studied in titania and subsequent energy and band gap calculations show a favorable band gap reduction in the case of passivated systems.

Deflation of gastric band balloon in pregnancy for improving outcomes.

Science.gov (United States)

Jefferys, Amanda E; Siassakos, Dimitrios; Draycott, Tim; Akande, Valentine A; Fox, Robert

2013-04-30

In line with the rise in the prevalence of obesity, an increasing number of women of childbearing age are undergoing laparoscopic adjustable gastric banding (LAGB), resulting in an increasing number of pregnancies with a band in place. Currently, there is no consensus on optimal band management in pregnancy. Some clinicians advocate leaving the band balloon inflated to reduce gestational weight gain and associated adverse perinatal outcomes. However, there are concerns that maintaining balloon inflation during pregnancy might increase the risk of band complications and adversely affect fetal development and/or growth as a result of reduced nutritional intake. To compare maternal and perinatal outcomes for elective gastric band balloon deflation versus intention to maintain balloon inflation during pregnancy. We searched the Cochrane Pregnancy and Childbirth Group's Trials Register (30 September 2012) and the Web of Science database (1940 to September 2012). Randomised-controlled trials comparing elective deflation of the gastric band balloon with intention to maintain balloon inflation in pregnant women who have undergone LAGB. Two review authors independently assessed studies for inclusion. No studies met the criteria for inclusion in the review. To date no randomised controlled trials exist that compare elective deflation of the gastric band balloon in pregnancy versus intention to maintain balloon inflation. Further research is needed to define the optimum management of the gastric band balloon in pregnancy.

Band-to-band tunneling in Γ valley for Ge source lateral tunnel field effect transistor: Thickness scaling

Science.gov (United States)

Jain, Prateek; Rastogi, Priyank; Yadav, Chandan; Agarwal, Amit; Chauhan, Yogesh Singh

2017-07-01

The direct and indirect valleys in Germanium (Ge) are separated by a very small offset, which opens up the prospect of direct tunneling in the Γ valley of an extended Ge source tunnel field effect transistor (TFET). We explore the impact of thickness scaling of extended Ge source lateral TFET on the band to band tunneling (BTBT) current. The Ge source is extended inside the gate by 2 nm to confine the tunneling in Ge only. We observe that as the thickness is scaled, the band alignment at the Si/Ge heterojunction changes significantly, which results in an increase in Ge to Si BTBT current. Based on density functional calculations, we first obtain the band structure parameters (bandgap, effective masses, etc.) for the Ge and Si slabs of varying thickness, and these are then used to obtain the thickness dependent Kane's BTBT tunneling parameters. We find that electrostatics improves as the thickness is reduced in the ultra-thin Ge film ( ≤ 10 nm). The ON current degrades as we scale down in thickness; however, the subthreshold slope ( S S AVG ) improves remarkably with thickness scaling due to subsurface BTBT. We predict that 8 nm thin devices offer the best option for optimized ON current and S S AVG .

Terra MODIS Band 27 Electronic Crosstalk Effect and Its Removal

Science.gov (United States)

Sun, Junqiang; Xiong, Xiaoxiong; Madhavan, Sriharsha; Wenny, Brian

2012-01-01

The MODerate-resolution Imaging Spectroradiometer (MODIS) is one of the primary instruments in the NASA Earth Observing System (EOS). The first MODIS instrument was launched in December, 1999 on-board the Terra spacecraft. MODIS has 36 bands, covering a wavelength range from 0.4 micron to 14.4 micron. MODIS band 27 (6.72 micron) is a water vapor band, which is designed to be insensitive to Earth surface features. In recent Earth View (EV) images of Terra band 27, surface feature contamination is clearly seen and striping has become very pronounced. In this paper, it is shown that band 27 is impacted by electronic crosstalk from bands 28-30. An algorithm using a linear approximation is developed to correct the crosstalk effect. The crosstalk coefficients are derived from Terra MODIS lunar observations. They show that the crosstalk is strongly detector dependent and the crosstalk pattern has changed dramatically since launch. The crosstalk contributions are positive to the instrument response of band 27 early in the mission but became negative and much larger in magnitude at later stages of the mission for most detectors of the band. The algorithm is applied to both Black Body (BB) calibration and MODIS L1B products. With the crosstalk effect removed, the calibration coefficients of Terra MODIS band 27 derived from the BB show that the detector differences become smaller. With the algorithm applied to MODIS L1B products, the Earth surface features are significantly removed and the striping is substantially reduced in the images of the band. The approach developed in this report for removal of the electronic crosstalk effect can be applied to other MODIS bands if similar crosstalk behaviors occur.

Amniotic band-like structures | Govender | Obstetrics and ...

African Journals Online (AJOL)

Intra-amniotic band-like structures are seen fairly commonly on routine obstetric scans, especially during the first and second trimesters of pregnancy. It is important to establish the cause for such findings in order to determine their clinical significance and to assess prognosis. The vast majority of band-like structures are ...

Band-to-band and inner shell excitation VIS-UV photoluminescence of quaternary InAlGaN alloys

International Nuclear Information System (INIS)

Fukui, K.; Naoe, S.; Okada, K.; Hamada, S.; Hirayama, H.

2006-01-01

Visible and ultraviolet photoluminescence and photoluminescence excitation spectra of quaternary InAlGaN alloys were measured. The excitation photon energy covers from band edge to 180 eV, near both nitrogen K (∝400 eV) and aluminium K (∝1.5 keV) inner shell energy region. From photoluminescence excitation spectra photoluminescence intensity per incident photon number varies in proportion to incident photon energy. This result implies that many conduction band electron - valence band hole pairs which are responsible for photoluminescence are produced by high energy excitation. Time resolved decay curves were also measured in the same energy region. No effect of high energy excitation on time resolved decay measurements suggests a role of indium on the photoluminescence mechanism in InAlGaN system. (copyright 2006 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)

O2 atmospheric band measurements with WINDII: Performance of a narrow band filter/wide angle Michelson combination in space

International Nuclear Information System (INIS)

Ward, W.E.; Hersom, C.H.; Tai, C.C.; Gault, W.A.; Shepherd, G.G.; Solheim, B.H.

1994-01-01

Among the emissions viewed by the Wind Imaging Interferometer (WINDII) on the Upper Atmosphere Research Satellite (UARS) are selected lines in the (0-0) transition of the O2 atmospheric band. These lines are viewed simultaneously using a narrow band filter/wide-angle Michelson interferometer combination. The narrow band filter is used to separate the lines on the CCD (spectral-spatial scanning) and the Michelson used to modulate the emissions so that winds and rotational temperatures may be measured from the Doppler shifts and relative intensities of the lines. In this report this technique will be outlined and the on-orbit behavior since launch summarized

Partially filled intermediate band of Cr-doped GaN films

International Nuclear Information System (INIS)

Sonoda, S.

2012-01-01

We investigated the band structure of sputtered Cr-doped GaN (GaCrN) films using optical absorption, photoelectron yield spectroscopy, and charge transport measurements. It was found that an additional energy band is formed in the intrinsic band gap of GaN upon Cr doping, and that charge carriers in the material move in the inserted band. Prototype solar cells showed enhanced short circuit current and open circuit voltage in the n-GaN/GaCrN/p-GaN structure compared to the GaCrN/p-GaN structure, which validates the proposed concept of an intermediate-band solar cell.

Plasmon band gap generated by intense ion acoustic waves

International Nuclear Information System (INIS)

Son, S.; Ku, S.

2010-01-01

In the presence of an intense ion acoustic wave, the energy-momentum dispersion relation of plasmons is strongly modified to exhibit a band gap structure. The intensity of an ion acoustic wave might be measured from the band gap width. The plasmon band gap can be used to block the nonlinear cascading channel of the Langmuir wave decay.

A Printed Monopole Antenna for Triple-Band WLAN/WiMAX Applications

Directory of Open Access Journals (Sweden)

Huiqing Zhai

2015-01-01

Full Text Available A new compact design of monopole antenna for triple-band WLAN/WiMAX applications with two band-notches based on broadband antenna is presented. By introducing a stub loaded ground and two new paper clip structures etched on radiation patch, a compact overall dimension 31 mm × 33 mm × 1 mm and three separated operating bands effectively covering 2.4/5.2/5.8 GHz WLAN bands and 2.5/3.5/5.5 GHz WiMAX bands can be achieved. Compared with familiar U type slot, the introduced compact paper clip structure can save about 37% of dimension regions, which could effectively improve efficiency of band-notch formation. Simulated and measured results demonstrate that the proposed antenna has good dipole-like radiation characteristics with appreciable gain across the operating bands. Besides, main parameters of the two etched paper clip structures are investigated to control the positions and bandwidths of the two stop-bands, respectively, on basis of which the three working bands can be adjusted independently.

Sub-band/transform compression of video sequences

Science.gov (United States)

Sauer, Ken; Bauer, Peter

1992-01-01

The progress on compression of video sequences is discussed. The overall goal of the research was the development of data compression algorithms for high-definition television (HDTV) sequences, but most of our research is general enough to be applicable to much more general problems. We have concentrated on coding algorithms based on both sub-band and transform approaches. Two very fundamental issues arise in designing a sub-band coder. First, the form of the signal decomposition must be chosen to yield band-pass images with characteristics favorable to efficient coding. A second basic consideration, whether coding is to be done in two or three dimensions, is the form of the coders to be applied to each sub-band. Computational simplicity is of essence. We review the first portion of the year, during which we improved and extended some of the previous grant period's results. The pyramid nonrectangular sub-band coder limited to intra-frame application is discussed. Perhaps the most critical component of the sub-band structure is the design of bandsplitting filters. We apply very simple recursive filters, which operate at alternating levels on rectangularly sampled, and quincunx sampled images. We will also cover the techniques we have studied for the coding of the resulting bandpass signals. We discuss adaptive three-dimensional coding which takes advantage of the detection algorithm developed last year. To this point, all the work on this project has been done without the benefit of motion compensation (MC). Motion compensation is included in many proposed codecs, but adds significant computational burden and hardware expense. We have sought to find a lower-cost alternative featuring a simple adaptation to motion in the form of the codec. In sequences of high spatial detail and zooming or panning, it appears that MC will likely be necessary for the proposed quality and bit rates.

Home-use cancer detecting band aid

Science.gov (United States)

Zalevsky, Zeev; Rudnitsky, Arkady; Sheinman, Victor; Tzoy, Andrey; Toktosunov, Aitmamat; Adashov, Arkady

2016-03-01

In this paper we present a novel concept in which special band aid is developed for early detection of cancer. The band aid contains an array of micro needles with small detection array connected to each needle which inspects the color of the surface of the skin versus time after being pinched with the needles. We were able to show in pre-clinical trials that the color varies differently if the skin is close to tumor tissue.

Active Multispectral Band Selection and Reflectance Measurement System

National Research Council Canada - National Science Library

Rennich, Bradley

1999-01-01

.... To aid in the selection of these bands, a novel multispectral band selection technique is presented based on the cross-correlation of the material class reflectance spectra over a wavelength range of 1 - 5 microns...

Opening complete band gaps in two dimensional locally resonant phononic crystals

Science.gov (United States)

Zhou, Xiaoling; Wang, Longqi

2018-05-01

Locally resonant phononic crystals (LRPCs) which have low frequency band gaps attract a growing attention in both scientific and engineering field recently. Wide complete locally resonant band gaps are the goal for researchers. In this paper, complete band gaps are achieved by carefully designing the geometrical properties of the inclusions in two dimensional LRPCs. The band structures and mechanisms of different types of models are investigated by the finite element method. The translational vibration patterns in both the in-plane and out-of-plane directions contribute to the full band gaps. The frequency response of the finite periodic structures demonstrate the attenuation effects in the complete band gaps. Moreover, it is found that the complete band gaps can be further widened and lowered by increasing the height of the inclusions. The tunable properties by changing the geometrical parameters provide a good way to open wide locally resonant band gaps.

Microscopic description of the three major bands in transitional nuclei

International Nuclear Information System (INIS)

Pineda S, R.L.

1986-01-01

The author has extended the Coherent Phonon Model to the description of the three major bands in medium heavy transitional nuclei. The model assumes an axially symmetric deformed ground intrinsic state for the description of the low lying yrast levels of the ground band, while the excited bands are generated by intrinsic excitations of the ground band. Good angular momentum states are generated by the Peierls-Yoccoz angular momentum projection method

Designing broad phononic band gaps for in-plane modes

Science.gov (United States)

Li, Yang Fan; Meng, Fei; Li, Shuo; Jia, Baohua; Zhou, Shiwei; Huang, Xiaodong

2018-03-01

Phononic crystals are known as artificial materials that can manipulate the propagation of elastic waves, and one essential feature of phononic crystals is the existence of forbidden frequency range of traveling waves called band gaps. In this paper, we have proposed an easy way to design phononic crystals with large in-plane band gaps. We demonstrated that the gap between two arbitrarily appointed bands of in-plane mode can be formed by employing a certain number of solid or hollow circular rods embedded in a matrix material. Topology optimization has been applied to find the best material distributions within the primitive unit cell with maximal band gap width. Our results reveal that the centroids of optimized rods coincide with the point positions generated by Lloyd's algorithm, which deepens our understandings on the formation mechanism of phononic in-plane band gaps.

[Gastric band erosion: Alternative management].

Science.gov (United States)

Echaverry-Navarrete, Denis José; Maldonado-Vázquez, Angélica; Cortes-Romano, Pablo; Cabrera-Jardines, Ricardo; Mondragón-Pinzón, Erwin Eduardo; Castillo-González, Federico Armando

2015-01-01

Obesity is a public health problem, for which the prevalence has increased worldwide at an alarming rate, affecting 1.7 billion people in the world. To describe the technique employed in incomplete penetration of gastric band where endoscopic management and/or primary closure is not feasible. Laparoscopic removal of gastric band was performed in five patients with incomplete penetrance using Foley catheterization in the perforation site that could lead to the development of a gastro-cutaneous fistula. The cases presented include a leak that required surgical lavage with satisfactory outcome, and one patient developed stenosis 3 years after surgical management, which was resolved endoscopically. In all cases, the penetration site closed spontaneously. Gastric band erosion has been reported in 3.4% of cases. The reason for inserting a catheter is to create a controlled gastro-cutaneous fistula, allowing spontaneous closure. Various techniques have been described: the totally endoscopic, hybrid techniques (endoscopic/laparoscopic) and completely laparoscopic. A technique is described here that is useful and successful in cases where the above-described treatments are not viable. Copyright © 2015. Published by Masson Doyma México S.A.

Nonequilibrium Green's function formulation of quantum transport theory for multi-band semiconductors

International Nuclear Information System (INIS)

Zhao, Peiji; Horing, Norman J.M.; Woolard, Dwight L.; Cui, H.L.

2003-01-01

We present a nonequilibrium Green's function formulation of many-body quantum transport theory for multi-band semiconductor systems with a phonon bath. The equations are expressed exactly in terms of single particle nonequilibrium Green's functions and self-energies, treating the open electron-hole system in weak interaction with the bath. A decoupling technique is employed to separate the individual band Green's function equations of motion from one another, with the band-band interaction effects embedded in ''cross-band'' self-energies. This nonequilibrium Green's function formulation of quantum transport theory is amenable to solution by parallel computing because of its formal decoupling with respect to inter-band interactions. Moreover, this formulation also permits coding the simulator of an n-band semiconductor in terms of that for an (n-1)-band system, in step with the current tendency and development of programming technology. Finally, the focus of these equations on individual bands provides a relatively direct route for the determination of carrier motion in energy bands, and to delineate the influence of intra- and inter-band interactions. A detailed description is provided for three-band semiconductor systems

Secular trends in Cherokee cranial morphology: Eastern vs Western bands.

Science.gov (United States)

Sutphin, Rebecca; Ross, Ann H; Jantz, Richard L

2014-01-01

The research objective was to examine if secular trends can be identified for cranial data commissioned by Boas in 1892, specifically for cranial breadth and cranial length of the Eastern and Western band Cherokee who experienced environmental hardships. Multiple regression analysis was used to test the degree of relationship between each of the cranial measures: cranial length, cranial breadth and cephalic index, along with predictor variables (year-of-birth, location, sex, admixture); the model revealed a significant difference for all craniometric variables. Additional regression analysis was performed with smoothing Loess plots to observe cranial length and cranial breadth change over time (year-of-birth) separately for Eastern and Western Cherokee band females and males born between 1783-1874. This revealed the Western and Eastern bands show a decrease in cranial length over time. Eastern band individuals maintain a relatively constant head breadth, while Western Band individuals show a sharp decline beginning around 1860. These findings support negative secular trend occurring for both Cherokee bands where the environment made a detrimental impact; this is especially marked with the Western Cherokee band.

Statistical study of auroral omega bands

Directory of Open Access Journals (Sweden)

N. Partamies

2017-09-01

Full Text Available The presence of very few statistical studies on auroral omega bands motivated us to test-use a semi-automatic method for identifying large-scale undulations of the diffuse aurora boundary and to investigate their occurrence. Five identical all-sky cameras with overlapping fields of view provided data for 438 auroral omega-like structures over Fennoscandian Lapland from 1996 to 2007. The results from this set of omega band events agree remarkably well with previous observations of omega band occurrence in magnetic local time (MLT, lifetime, location between the region 1 and 2 field-aligned currents, as well as current density estimates. The average peak emission height of omega forms corresponds to the estimated precipitation energies of a few keV, which experienced no significant change during the events. Analysis of both local and global magnetic indices demonstrates that omega bands are observed during substorm expansion and recovery phases that are more intense than average substorm expansion and recovery phases in the same region. The omega occurrence with respect to the substorm expansion and recovery phases is in a very good agreement with an earlier observed distribution of fast earthward flows in the plasma sheet during expansion and recovery phases. These findings support the theory that omegas are produced by fast earthward flows and auroral streamers, despite the rarity of good conjugate observations.

Effect of hydrogenation on the band gap of graphene nano-flakes

International Nuclear Information System (INIS)

Tachikawa, Hiroto; Iyama, Tetsuji; Kawabata, Hiroshi

2014-01-01

The effects of hydrogenation on the band gap of graphene have been investigated by means of density functional theory method. It is generally considered that the band gap increases with increasing coverage of hydrogen atom on the graphene. However, the present study shows that the band gap decreases first with increasing hydrogen coverage and reaches the lowest value at finite coverage (γ = 0.3). Next, the band gap increases to that of insulator with coverage from 0.3 to 1.0. This specific feature of the band gap is reasonably explained by broken symmetry model and the decrease of pi-conjugation. The electronic states of hydrogenated graphene are discussed. - Highlights: • Density functional theory calculations were carried out for hydrogen on graphene • Effects of hydrogenation on the band gap of graphene were examined. • The band gap showed a minimum at a finite coverage. • Mechanism of specific band gap feature was discussed

Microleakage under orthodontic bands cemented with nano-hydroxyapatite-modified glass ionomer.

Science.gov (United States)

Enan, Enas T; Hammad, Shaza M

2013-11-01

To estimate the in vivo effect of nano-hydroxyapatite (HA) modification of banding glass-ionomer cement on microleakage under orthodontic bands. Eighty noncarious premolars scheduled for extraction in 20 orthodontic patients were randomly divided into four groups. Grouping was based on the ratio of nano-HA (0%, 5%, 10%, 15% by weight) added to the luting glass-ionomer cement (GIC) Ketac-Cem, which was used for cementation of prefabricated micro-etched orthodontic bands. Dye penetration method was used for microleakage evaluation at the cement-band and cement-enamel interfaces. Statistical evaluation was performed with a Kruskal-Wallis test and a Mann-Whitney U-test, and a Bonferroni-adjusted significance level was calculated. Bands cemented with conventional GIC showed the highest microleakage scores in comparison to those cemented with nano-HA-modified GIC. No significant difference was found between teeth banded with 10% and 15% modified GIC. Modification of the banding GIC with 15% nano-HA revealed a positive effect on reducing microleakage around orthodontic bands.

Table of superdeformed nuclear bands and fission isomers

International Nuclear Information System (INIS)

Firestone, R.B.; Singh, B.

1994-06-01

A minimum in the second potential well of deformed nuclei was predicted and the associated shell gaps are illustrated in the harmonic oscillator potential shell energy surface calculations shown in this report. A strong superdeformed minimum in 152 Dy was predicted for β 2 -0.65. Subsequently, a discrete set of γ-ray transitions in 152 DY was observed and, assigned to the predicted superdeformed band. Extensive research at several laboratories has since focused on searching for other mass regions of large deformation. A new generation of γ-ray detector arrays is already producing a wealth of information about the mechanisms for feeding and deexciting superdeformed bands. These bands have been found in three distinct regions near A=l30, 150, and 190. This research extends upon previous work in the actinide region near A=240 where fission isomers were identified and also associated with the second potential well. Quadrupole moment measurements for selected cases in each mass region are consistent with assigning the bands to excitations in the second local minimum. As part of our committment to maintain nuclear structure data as current as possible in the Evaluated Nuclear Structure Reference File (ENSDF) and the Table of Isotopes, we have updated the information on superdeformed nuclear bands. As of April 1994, we have complied data from 86 superdeformed bands and 46 fission isomers identified in 73 nuclides for this report. For each nuclide there is a complete level table listing both normal and superdeformed band assignments; level energy, spin, parity, half-life, magneto moments, decay branchings; and the energies, final levels, relative intensities, multipolarities, and mixing ratios for transitions deexciting each level. Mass excess, decay energies, and proton and neutron separation energies are also provided from the evaluation of Audi and Wapstra

Table of superdeformed nuclear bands and fission isomers

Energy Technology Data Exchange (ETDEWEB)

Firestone, R.B. [Lawrence Berkeley Lab., CA (United States); Singh, B. [McMaster Univ., Hamilton, ON (Canada)

1994-06-01

A minimum in the second potential well of deformed nuclei was predicted and the associated shell gaps are illustrated in the harmonic oscillator potential shell energy surface calculations shown in this report. A strong superdeformed minimum in {sup 152}Dy was predicted for {beta}{sub 2}-0.65. Subsequently, a discrete set of {gamma}-ray transitions in {sup 152}DY was observed and, assigned to the predicted superdeformed band. Extensive research at several laboratories has since focused on searching for other mass regions of large deformation. A new generation of {gamma}-ray detector arrays is already producing a wealth of information about the mechanisms for feeding and deexciting superdeformed bands. These bands have been found in three distinct regions near A=l30, 150, and 190. This research extends upon previous work in the actinide region near A=240 where fission isomers were identified and also associated with the second potential well. Quadrupole moment measurements for selected cases in each mass region are consistent with assigning the bands to excitations in the second local minimum. As part of our committment to maintain nuclear structure data as current as possible in the Evaluated Nuclear Structure Reference File (ENSDF) and the Table of Isotopes, we have updated the information on superdeformed nuclear bands. As of April 1994, we have complied data from 86 superdeformed bands and 46 fission isomers identified in 73 nuclides for this report. For each nuclide there is a complete level table listing both normal and superdeformed band assignments; level energy, spin, parity, half-life, magneto moments, decay branchings; and the energies, final levels, relative intensities, multipolarities, and mixing ratios for transitions deexciting each level. Mass excess, decay energies, and proton and neutron separation energies are also provided from the evaluation of Audi and Wapstra.

Search for superdeformed bands in {sup 154}Dy

Energy Technology Data Exchange (ETDEWEB)

Nisius, D.; Janssens, R.V.F.; Khoo, T.L. [and others

1995-08-01

The island of superdeformation in the vicinity of the doubly magic {sup 152}Dy yrast superdeformed (SD) band is thought to be well understood in the framework of cranked mean field calculations. In particular, the calculations suggested that in {sup 154}Dy there should be no yrast or near yrast SD minimum in the 40-60 h spin range, where SD bands in this mass region are thought to be {sup 153}Dy nucleus, it is populated. However, with the presence of five SD bands in the neighboring necessary to ascertain if the addition of one single neutron diminishes the importance of shell effects to the extent that superdeformation can no longer be sustained. In an experiment utilizing the increased resolving power of the early implementation phase of Gammasphere, the reaction {sup 122}Sn({sup 36}S,4n) at 165 MeV was employed to populate high spin states in {sup 154}Dy. In a four-day run with 36 detectors, over one billion triple and higher fold coincidence events were recorded. One new SD band was identified and was assigned to {sup 154}Dy. From comparisons with the Im{sup (2)} moments of inertia of the SD bands in {sup 152}Dy and {sup 153}Dy, a configuration based on (514)9/2{sup 2} neutrons coupled to the {sup 152}Dy SD core was proposed. One unexpected and as yet unexplained feature of this new SD band is that the transition energies are almost identical to those of an excited SD band in {sup 153}Dy. It is also worth noting that the feeding of the yrast states is similar to that achieved by the deexcitation from the ensemble of all entry states in the reaction. This observation emphasizes the statistical nature of the decay-out process. A paper reporting these results was accepted for publication.

Studying NASA's Transition to Ka-Band Communications for Low Earth Orbit

Science.gov (United States)

Chelmins, David T.; Reinhart, Richard C.; Mortensen, Dale; Welch, Bryan; Downey, Joseph; Evans, Michael

2014-01-01

As the S-band spectrum becomes crowded, future space missions will need to consider moving command and telemetry services to Ka-band. NASA's Space Communications and Navigation (SCaN) Testbed provides a software-defined radio (SDR) platform that is capable of supporting investigation of this service transition. The testbed contains two S-band SDRs and one Ka-band SDR. Over the past year, SCaN Testbed has demonstrated Ka-band communications capabilities with NASAs Tracking and Data Relay Satellite System (TDRSS) using both open- and closed-loop antenna tracking profiles. A number of technical areas need to be addressed for successful transition to Ka-band. The smaller antenna beamwidth at Ka-band increases the criticality of antenna pointing, necessitating closed loop tracking algorithms and new techniques for received power estimation. Additionally, the antenna pointing routines require enhanced knowledge of spacecraft position and attitude for initial acquisition, versus an S-band antenna. Ka-band provides a number of technical advantages for bulk data transfer. Unlike at S-band, a larger bandwidth may be available for space missions, allowing increased data rates. The potential for high rate data transfer can also be extended for direct-to-ground links through use of variable or adaptive coding and modulation. Specific examples of Ka-band research from SCaN Testbeds first year of operation will be cited, such as communications link performance with TDRSS, and the effects of truss flexure on antenna pointing.

Infectivity analysis of two variable DNA B components of Mungbean ...

Indian Academy of Sciences (India)

Unknown

of Mungbean yellow mosaic virus-Vigna in Vigna mungo and Vigna radiata; J. Biosci. 29 297–308]. 1. Introduction. Yellow mosaic disease (YMD), which affects five impor- tant pulse crops, blackgram, mungbean, French bean, pigeon pea and soybean, causes an annual yield loss of about. $ 300 million (Varma et al 1992).

Research Paper ISSN 0189-6016©2009

African Journals Online (AJOL)

hole udder. Buffalo, Cow, Goat. Bombax ceiba. (Semal-Bombaceae). Bark of Bombax ceiba mixed with seeds of Glycine max and grind with water to eat. Vigna mungo. (Kali dal-Fabaceae). Seed powders mixed with ... (Pyaj-Liliaceae). Bulb is grinded and mixed with black salt and used to drink with water. Zingiber officinale.

Magnetism and magnetostriction in a degenerate rigid band

International Nuclear Information System (INIS)

Kulakowski, K.; Barbara, B.

1990-09-01

We investigate the influence of the spin-orbit coupling on the magnetic and magnetoelastic phenomena in ferromagnetic band systems. The description is within the Stoner model of a degenerate rigid band, for temperature T = O. (author). 14 refs

Band gap engineering for graphene by using Na+ ions

International Nuclear Information System (INIS)

Sung, S. J.; Lee, P. R.; Kim, J. G.; Ryu, M. T.; Park, H. M.; Chung, J. W.

2014-01-01

Despite the noble electronic properties of graphene, its industrial application has been hindered mainly by the absence of a stable means of producing a band gap at the Dirac point (DP). We report a new route to open a band gap (E g ) at DP in a controlled way by depositing positively charged Na + ions on single layer graphene formed on 6H-SiC(0001) surface. The doping of low energy Na + ions is found to deplete the π* band of graphene above the DP, and simultaneously shift the DP downward away from Fermi energy indicating the opening of E g . The band gap increases with increasing Na + coverage with a maximum E g ≥0.70 eV. Our core-level data, C 1s, Na 2p, and Si 2p, consistently suggest that Na + ions do not intercalate through graphene, but produce a significant charge asymmetry among the carbon atoms of graphene to cause the opening of a band gap. We thus provide a reliable way of producing and tuning the band gap of graphene by using Na + ions, which may play a vital role in utilizing graphene in future nano-electronic devices.

Complete theory of symmetry-based indicators of band topology.

Science.gov (United States)

Po, Hoi Chun; Vishwanath, Ashvin; Watanabe, Haruki

2017-06-30

The interplay between symmetry and topology leads to a rich variety of electronic topological phases, protecting states such as the topological insulators and Dirac semimetals. Previous results, like the Fu-Kane parity criterion for inversion-symmetric topological insulators, demonstrate that symmetry labels can sometimes unambiguously indicate underlying band topology. Here we develop a systematic approach to expose all such symmetry-based indicators of band topology in all the 230 space groups. This is achieved by first developing an efficient way to represent band structures in terms of elementary basis states, and then isolating the topological ones by removing the subset of atomic insulators, defined by the existence of localized symmetric Wannier functions. Aside from encompassing all earlier results on such indicators, including in particular the notion of filling-enforced quantum band insulators, our theory identifies symmetry settings with previously hidden forms of band topology, and can be applied to the search for topological materials.Understanding the role of topology in determining electronic structure can lead to the discovery, or appreciation, of materials with exotic properties such as protected surface states. Here, the authors present a framework for identifying topologically distinct band-structures for all 3D space groups.

Band Gap Modulated by Electronic Superlattice in Blue Phosphorene.

Science.gov (United States)

Zhuang, Jincheng; Liu, Chen; Gao, Qian; Liu, Yani; Feng, Haifeng; Xu, Xun; Wang, Jiaou; Zhao, Jijun; Dou, Shi Xue; Hu, Zhenpeng; Du, Yi

2018-05-22

Exploring stable two-dimensional materials with appropriate band gaps and high carrier mobility is highly desirable due to the potential applications in optoelectronic devices. Here, the electronic structures of phosphorene on a Au(111) substrate are investigated by scanning tunneling spectroscopy, angle-resolved photoemission spectroscopy (ARPES), and density functional theory (DFT) calculations. The substrate-induced phosphorene superstructure gives a superlattice potential, leading to a strong band folding effect of the sp band of Au(111) on the band structure. The band gap could be clearly identified in the ARPES results after examining the folded sp band. The value of the energy gap (∼1.1 eV) and the high charge carrier mobility comparable to that of black phosphorus, which is engineered by the tensile strain, are revealed by the combination of ARPES results and DFT calculations. Furthermore, the phosphorene layer on the Au(111) surface displays high surface inertness, leading to the absence of multilayer phosphorene. All these results suggest that the phosphorene on Au(111) could be a promising candidate, not only for fundamental research but also for nanoelectronic and optoelectronic applications.

New edge-centered photonic square lattices with flat bands

Science.gov (United States)

Zhang, Da; Zhang, Yiqi; Zhong, Hua; Li, Changbiao; Zhang, Zhaoyang; Zhang, Yanpeng; Belić, Milivoj R.

2017-07-01

We report a new class of edge-centered photonic square lattices with multiple flat bands, and consider in detail two examples: the Lieb-5 and Lieb-7 lattices. In these lattices, there are 5 and 7 sites in the unit cell and in general, the number is restricted to odd integers. The number of flat bands m in the new Lieb lattices is related to the number of sites N in the unit cell by a simple formula m =(N - 1) / 2. The flat bands reported here are independent of the pseudomagnetic field. The properties of lattices with even and odd number of flat bands are different. We consider the localization of light in such Lieb lattices. If the input beam excites the flat-band mode, it will not diffract during propagation, owing to the strong mode localization. In the Lieb-7 lattice, the beam will also oscillate during propagation and still not diffract. The period of oscillation is determined by the energy difference between the two flat bands. This study provides a new platform for investigating light trapping, photonic topological insulators, and pseudospin-mediated vortex generation.

Multi-band phase shifter design using modified slotline configuration

Science.gov (United States)

Kulandhaisamy, Indhumathi; Rajendran, Dinesh Babu; Kanagasabai, Malathi; Gurusamy, Gunasekaran; Moorthy, Balaji; George, Jithila V.; Lawrance, Livya

2017-01-01

In this paper, an analog multiband phase shifter using slotline configuration is proposed. To implement the design, a pair of modified Split Ring Resonator (SRR) is employed. The periodic property of SRR provides multiband characteristics, whether the coupling slot gives the phase variations over the bands. The operation is well explained with an equivalent circuit model and its characteristics have been studied both in simulation and measurement. The prototype operates in 1.77-2.16, 3.5-3.97, 5.08-5.33, 6.43-6.93, and 8.01-8.59 GHz frequency bands which can be utilized for GSM, GPS, WLAN, C-band, and X-band applications, respectively.

Measurement of the band gap by reflection electron energy loss spectroscopy

Energy Technology Data Exchange (ETDEWEB)

Vos, Maarten, E-mail: maarten.vos@anu.edu.au [Electronic Materials Engineering Department, Research School of Physics and Engineering, The Australian National University, Canberra 0200 (Australia); King, Sean W. [Logic Technology Development, Intel Corporation, Hillsboro, OR 97124 (United States); French, Benjamin L. [Ocotillo Materials Laboratory, Intel Corporation, Chandler, AZ 85248 (United States)

2016-10-15

Highlights: • Semiconductors are measured (without surface preparation) using REELS. • At low beam energies it is difficult to measure band gap due to surface impurities. • At very high energies it is difficult to measure band gap due to recoil effect. • At intermediate energies (around 5 keV) one obtains a good estimate of the band gap. - Abstract: We investigate the possibilities of measuring the band gap of a variety of semiconductors and insulators by reflection electron energy loss spectroscopy without additional surface preparation. The band gap is a bulk property, whereas reflection energy loss spectroscopy is generally considered a surface sensitive technique. By changing the energy of the incoming electrons, the degree of surface sensitivity can be varied. Here, we present case studies to determine the optimum condition for the determination of the band gap. At very large incoming electron energies recoil effects interfere with the band gap determination, whereas at very low energies surface effects are obscuring the band gap without surface preparation. Using an incoming energy of 5 keV a reasonable estimate of the band gap is obtained in most cases.

Measurement of the band gap by reflection electron energy loss spectroscopy

International Nuclear Information System (INIS)

Vos, Maarten; King, Sean W.; French, Benjamin L.

2016-01-01

Highlights: • Semiconductors are measured (without surface preparation) using REELS. • At low beam energies it is difficult to measure band gap due to surface impurities. • At very high energies it is difficult to measure band gap due to recoil effect. • At intermediate energies (around 5 keV) one obtains a good estimate of the band gap. - Abstract: We investigate the possibilities of measuring the band gap of a variety of semiconductors and insulators by reflection electron energy loss spectroscopy without additional surface preparation. The band gap is a bulk property, whereas reflection energy loss spectroscopy is generally considered a surface sensitive technique. By changing the energy of the incoming electrons, the degree of surface sensitivity can be varied. Here, we present case studies to determine the optimum condition for the determination of the band gap. At very large incoming electron energies recoil effects interfere with the band gap determination, whereas at very low energies surface effects are obscuring the band gap without surface preparation. Using an incoming energy of 5 keV a reasonable estimate of the band gap is obtained in most cases.

Surface band structures on Nb(001)

International Nuclear Information System (INIS)

Fang, B.; Lo, W.; Chien, T.; Leung, T.C.; Lue, C.Y.; Chan, C.T.; Ho, K.M.

1994-01-01

We report the joint studies of experimental and theoretical surface band structures of Nb(001). Angle-resolved photoelectron spectroscopy was used to determine surface-state dispersions along three high-symmetry axes bar Γ bar M, bar Γ bar X, and bar M bar X in the surface Brillouin zone. Ten surface bands have been identified. The experimental data are compared to self-consistent pseudopotential calculations for the 11-layer Nb(001) slabs that are either bulk terminated or fully relaxed (with a 12% contraction for the first interlayer spacing). The band calculations for a 12% surface-contracted slab are in better agreement with the experimental results than those for a bulk-terminated slab, except for a surface resonance near the Fermi level, which is related to the spin-orbit interaction. The charge profiles for all surface states or resonances have been calculated. Surface contraction effects on the charge-density distribution and the energy position of surface states and resonances will also be discussed

Frequency Arrangement For 700 MHz Band

Directory of Open Access Journals (Sweden)

Ancans G.

2015-02-01

Full Text Available The 694-790 MHz (700 MHz band was allocated by the 2012 World Radiocommunication Conference (WRC-12 in ITU Region 1 (Europe included, to the mobile service on a co-primary basis with other services to which this band was allocated on the primary basis and identified for the International Mobile Telecommunications (IMT. At the same time, the countries of Region 1 will be able also to continue using these frequencies for their broadcasting services if necessary. This allocation will be effective immediately after 2015 World Radiocommunication Conference (WRC-15. In order to make the best possible use of this frequency band for mobile service, a worldwide harmonized frequency arrangement is to be prepared to allow for large economies of scale and international roaming as well as utilizing the available spectrum in the best possible way, minimizing possible interference between services, facilitating deployment and cross-border coordination. The authors analyze different possible frequency arrangements and conclude on the frequency arrangement most suitable for Europe.

Surface Resonance Bands on (001)W: Experimental Dispersion Relations

DEFF Research Database (Denmark)

Willis, R. F.; Feuerbacher, B.; Christensen, N. Egede

1977-01-01

A band of unbound surface states (resonances), located in an energy region above the vacuum threshold corresponding to an energy band gap in the electron states of the bulk crystal, has been observed by angle-resolved secondary-electron-emission spectroscopy. The experimental dispersion behavior...... is in agreement with the two-dimensional band structure of a clean (001)W surface recently proposed by Smith and Mittheiss....

77 FR 33098 - Unlicensed Operation in the TV Broadcast Band

Science.gov (United States)

2012-06-05

...] Unlicensed Operation in the TV Broadcast Band AGENCY: Federal Communications Commission. ACTION: Correcting... matter of ``Unlicensed Operation in the TV Broadcast Band Approval.'' This document contains corrections... of this correction relate to ``Unlicensed Operation in the TV Broadcast Band Approval'' under Sec. 15...

Microbial control of Asian longhorned beetles - what are fungal bands?

Science.gov (United States)

Ann E. Hajek; Thomas Dubois; Jennifer Lund; Ryan Shanley; Leah Bauer; Michael Smith; Peng Fan; Huang Bo; Hu Jiafu; Zengzhi Li

2007-01-01

In Japan, the entomopathogenic fungus Beauveria brongniartii is grown in nonwoven fiber bands that are placed around trunks of orchard trees for control of numerous cerambycid pests, including Anoplophora chinensis (= A. malasiaca). The Japanese company producing bands, Nitto Denko in Osaka, markets bands...

Non-equilibrium and band tailing in organic conductors

Indian Academy of Sciences (India)

. Non-equilibrium ... Introduction. Study of organic conductors and semiconductors continues to generate interest with the ... Band tailing reduces band gap or the acti- ..... (9), we can identify Eg(0) with the focal point and is proportional to P2. 1 .

Band Structure Characteristics of Nacreous Composite Materials with Various Defects

Science.gov (United States)

Yin, J.; Zhang, S.; Zhang, H. W.; Chen, B. S.

2016-06-01

Nacreous composite materials have excellent mechanical properties, such as high strength, high toughness, and wide phononic band gap. In order to research band structure characteristics of nacreous composite materials with various defects, supercell models with the Brick-and-Mortar microstructure are considered. An efficient multi-level substructure algorithm is employed to discuss the band structure. Furthermore, two common systems with point and line defects and varied material parameters are discussed. In addition, band structures concerning straight and deflected crack defects are calculated by changing the shear modulus of the mortar. Finally, the sensitivity of band structures to the random material distribution is presented by considering different volume ratios of the brick. The results reveal that the first band gap of a nacreous composite material is insensitive to defects under certain conditions. It will be of great value to the design and synthesis of new nacreous composite materials for better dynamic properties.

Banded all-optical OFDM super-channels with low-bandwidth receivers.

Science.gov (United States)

Song, Binhuang; Zhu, Chen; Corcoran, Bill; Zhuang, Leimeng; Lowery, Arthur James

2016-08-08

We propose a banded all-optical orthogonal frequency division multiplexing (AO-OFDM) transmission system based on synthesising a number of truncated sinc-shaped subcarriers for each sub-band. This approach enables sub-band by sub-band reception and therefore each receiver's electrical bandwidth can be significantly reduced compared with a conventional AO-OFDM system. As a proof-of-concept experiment, we synthesise 6 × 10-Gbaud subcarriers in both conventional and banded AO-OFDM systems. With a limited receiver electrical bandwidth, the experimental banded AO-OFDM system shows 2-dB optical signal to noise ratio (OSNR) benefit over conventional AO-OFDM at the 7%-overhead forward error correction (FEC) threshold. After transmission over 800-km of single-mode fiber, ≈3-dB improvement in Q-factor can be achieved at the optimal launch power at a cost of increasing the spectral width by 14%.

Signature effects in 2-qp rotational bands

International Nuclear Information System (INIS)

Jain, A.K.; Goel, A.

1992-01-01

The authors briefly review the progress in understanding the 2-qp rotational bands in odd-odd nuclei. Signature effects and the phenomenon of signature inversion are discussed. The Coriolis coupling appears to have all the ingredients to explain the inversion. Some recent work on signature dependence in 2-qp bands of even-even nuclei is also discussed; interesting features are pointed out

Band gaps for the relativistic Mathieu potential

International Nuclear Information System (INIS)

Clerk, G.J.; McKellar, B.H.J.

1992-01-01

A study of the band structure of a massless particle in a cosine potential is made via the Dirac equation. It is shown that every alternate band gap disappears as a consequence of a periodicity of the potential combined with a peculiar symmetry of the Dirac equation. This basic potential is then used to study a simple one-dimensional model of the nucleus from which it is ascertained that modelling the mean field of the quarks in the nucleus via a pure scalar potential is unsatisfactory. A simple extension involving a combined scalar and vector potential is then proposed as a possible solution to this problem. The effect of the addition of this vector component to the band structure is also investigated. 32 refs

Band structure analysis in SiGe nanowires

Energy Technology Data Exchange (ETDEWEB)

Amato, Michele [' Centro S3' , CNR-Istituto Nanoscienze, via Campi 213/A, 41100 Modena (Italy); Dipartimento di Scienze e Metodi dell' Ingegneria, Universita di Modena e Reggio Emilia, via Amendola 2 Pad. Morselli, I-42100 Reggio Emilia (Italy); Palummo, Maurizia [European Theoretical Spectroscopy Facility (ETSF) (Italy); CNR-INFM-SMC, Dipartimento di Fisica, Universita di Roma, ' Tor Vergata' , via della Ricerca Scientifica 1, 00133 Roma (Italy); Ossicini, Stefano, E-mail: stefano.ossicini@unimore.it [' Centro S3' , CNR-Istituto Nanoscienze, via Campi 213/A, 41100 Modena (Italy) and Dipartimento di Scienze e Metodi dell' Ingegneria, Universita di Modena e Reggio Emilia, via Amendola 2 Pad. Morselli, I-42100 Reggio Emilia (Italy) and European Theoretical Spectroscopy Facility - ETSF (Italy) and Centro Interdipartimentale ' En and Tech' , Universita di Modena e Reggio Emilia, via Amendola 2 Pad. Morselli, I-42100 Reggio Emilia (Italy)

2012-06-05

One of the main challenges for Silicon-Germanium nanowires (SiGe NWs) electronics is the possibility to modulate and engine their electronic properties in an easy way, in order to obtain a material with the desired electronic features. Diameter and composition constitute two crucial ways for the modification of the band gap and of the band structure of SiGe NWs. Within the framework of density functional theory we present results of ab initio calculations regarding the band structure dependence of SiGe NWs on diameter and composition. We point out the main differences with respect to the case of pure Si and Ge wires and we discuss the particular features of SiGe NWs that are useful for future technological applications.

Band structure analysis in SiGe nanowires

International Nuclear Information System (INIS)

Amato, Michele; Palummo, Maurizia; Ossicini, Stefano

2012-01-01

One of the main challenges for Silicon-Germanium nanowires (SiGe NWs) electronics is the possibility to modulate and engine their electronic properties in an easy way, in order to obtain a material with the desired electronic features. Diameter and composition constitute two crucial ways for the modification of the band gap and of the band structure of SiGe NWs. Within the framework of density functional theory we present results of ab initio calculations regarding the band structure dependence of SiGe NWs on diameter and composition. We point out the main differences with respect to the case of pure Si and Ge wires and we discuss the particular features of SiGe NWs that are useful for future technological applications.

Anomalous electromagnetically induced transparency in photonic-band-gap materials

International Nuclear Information System (INIS)

Singh, Mahi R.

2004-01-01

The phenomenon of electromagnetically induced transparency has been studied when a four-level atom is located in a photonic band gap material. Quantum interference is introduced by driving the two upper levels of the atom with a strong pump laser field. The top level and one of the ground levels are coupled by a weak probe laser field and absorption takes place between these two states. The susceptibility due to the absorption for this transition has been calculated by using the master equation method in linear response theory. Numerical simulations are performed for the real and imaginary parts of the susceptibility for a photonic band gap material whose gap-midgap ratio is 21%. It is found that when resonance frequencies lie within the band, the medium becomes transparent under the action of the strong pump laser field. More interesting results are found when one of the resonance frequencies lies at the band edge and within the band gap. When the resonance frequency lies at the band edge, the medium becomes nontransparent even under a strong pump laser field. On the other hand, when the resonance frequency lies within the band gap, the medium becomes transparent even under a weak pump laser field. In summary, we found that the medium can be transformed from the transparent state to the nontransparent state just by changing the location of the resonance frequency. We call these two effects anomalous electromagnetically induced transparency

Decay from the superdeformed bands in {sup 194}Hg

Energy Technology Data Exchange (ETDEWEB)

Henry, R.G.; Khoo, T.L.; Carpenter, M.P. [and others

1995-08-01

Superdeformed bands in {sup 194}H g were studied using the early implementation of Gammasphere. The response functions for the Ge detectors were measured for the first time as part of this experiment. Experiments were performed with both a backed target (where the residue stopped in the Au backing) and a thin target (where the residue recoiled into vacuum). This will permit measurements of the decay times of the quasicontinuum {gamma}rays. The spectrum in coincidence with the yrast SD band in {sup 194}Hg reveals the same features as found in the quasicontinuum structure in {sup 192}Hg. These features include: statistical {gamma}rays feeding the SD band, a pronounced E2 peak from transitions feeding the SD band, a Ml/E2 bump at low energies that is associated with the last stages of feeding of the superdeformed band, and a quasicontinuous distribution from {gamma}rays linking SD and normal states, including a sizable clustering of strength around 1.7 MeV. The remarkable similarity of the spectra coincident with SD bands in {sup 192,194}Hg provides additional support for a statistical process for decay out of the SD states. This similarity contrasts with differences observed in the spectrum coincident with the SD band in the odd-even {sup 191}Hg, confirming the predictions about the role of pairing (in normal states) in influencing the shape of the decay-out spectrum.

Experimental study of ΔI=1 bands in In111

Science.gov (United States)

Banerjee, P.; Ganguly, S.; Pradhan, M. K.; Sharma, H. P.; Muralithar, S.; Singh, R. P.; Bhowmik, R. K.

2011-02-01

The two ΔI=1 bands in In111, built upon the 3461.0 and 4931.8 keV states, have been studied. The bands were populated in the reaction Mo100(F19,α4nγ) at a beam energy of 105 MeV. Mean lifetimes of nine states, four in the first and five in the second band, have been determined for the first time from Doppler shift attenuation data. The deduced B(M1) rates and their behavior as a function of level spin support the interpretation of these bands within the framework of the shears mechanism. The geometrical model of Machiavelli has been used to derive the effective gyromagnetic ratios for the two bands.

A K/Ka band radiating element for Tx/Rx phased array

KAUST Repository

Sandhu, Ali Imran; Arnieri, E.; Amendola, G.; Boccia, L.; Meniconi, E.; Ziegler, V.

2017-01-01

The paper presents a K/Ka band radiating element for TX/RX phased arrays. Dual band operations is obtained using a single radiating surface: a novel radiator is adopted and placed in a configuration in which dual band and single band elements are interleaved. The array elements are optimized to scan the beam in excess of 50° in both bands. A subarray with 49 Rx elements and 105 Tx elements was built and measured confirming the results obtained in simulations.

Identification of the unfavored N=7 superdeformed band in 191Hg

International Nuclear Information System (INIS)

Carpenter, M.P.; Janssens, R.V.F.; Cederwall, B.; Crowell, B.; Ahmad, I.; Becker, J.A.; Brinkman, M.J.; Deleplanque, M.A.; Diamond, R.M.; Fallon, P.; Farris, L.P.; Garg, U.; Gassmann, D.; Henry, E.A.; Henry, R.G.; Hughes, J.R.; Khoo, T.L.; Lauritsen, T.; Lee, I.Y.; Machiavelli, A.O.; Moore, E.F.; Nisius, D.; Stephens, F.S.

1995-01-01

A new superdeformed band has been identified in 191 Hg bringing the total number of bands observed in this nucleus to four. The new band has properties similar to those of a superdeformed band reported recently in 193 Hg. Both bands are believed to be built on the unfavored signature of the j 15/2 intruder configuration. Comparisons between the data and cranked Woods-Saxon calculations highlight the strengths and weaknesses of theory in describing high-N orbitals at large deformation

A K/Ka band radiating element for Tx/Rx phased array

KAUST Repository

Sandhu, Ali Imran

2017-01-20

The paper presents a K/Ka band radiating element for TX/RX phased arrays. Dual band operations is obtained using a single radiating surface: a novel radiator is adopted and placed in a configuration in which dual band and single band elements are interleaved. The array elements are optimized to scan the beam in excess of 50° in both bands. A subarray with 49 Rx elements and 105 Tx elements was built and measured confirming the results obtained in simulations.

High macro rubber band ligature

Directory of Open Access Journals (Sweden)

José A. Reis Neto

2013-07-01

Full Text Available Purpose: The goal of a rubber band ligature is to promote fibrosis of the submucosa with subsequent fixation of the anal epithelium to the underlying sphincter. Following this principle, a new technique of ligature was developed based on two aspects: 1. macro banding: to have a better fibrosis and fixation by banding a bigger volume of mucosa and 2. higher ligature: to have this fixation at the origin of the hemorrhoidal cushion displacement. Methods: 1634 patients with internal hemorrhoidal disease grade II or III were treated by the technique called high macro rubber band. There was no distinction as to age, gender or race. To perform this technique a new hemorrhoidal device was specially designed with a larger diameter and a bigger capacity for mucosal volume aspiration. It is recommended to utilize a longer and wider anoscope to obtain a better view of the anal canal, which will facilitate the injection of submucosa higher in the anal canal and the insertion of the rubber band device. The hemorrhoidal cushion must be banded higher in the anal canal (4 cm above the pectinate line. It is preferable to treat all the hemorrhoids in one single session (maximum of three areas banded. Results: The analysis was retrospective without any comparison with conventional banding. The period of evaluation extended from one to twelve years. The analysis of the results showed perianal edema in 1.6% of the patients, immediate tenesmus in 0.8%, intense pain (need for parenteral analgesia in 1.6%, urinary retention in 0.1% of the patients and a symptomatic recurrence rate of 4.2%. All patients with symptomatic recurrence were treated with a new session of macro rubber banding. None of the patients developed anal or rectal sepsis. Small post-ligature bleeding was observed only in 0.8% of the patients. Conclusions: The high macro rubber banding technique represents an alternative method for the treatment of hemorrhoidal disease grades II or III, with good

Determination of conduction and valence band electronic structure ...

Indian Academy of Sciences (India)

shifts in the rutile Ti d-band to lower energy with respect to anatase, i.e., ... requires excitation with UV light due to its wide band ... RIXS maps were compared to the theoretical results .... optical methods are insufficient, such as dark samples.

Robust flat bands in RCo5 (R=rare earth) compounds

OpenAIRE

Ochi, Masayuki; Arita, Ryotaro; Matsumoto, Munehisa; Kino, Hiori; Miyake, Takashi

2014-01-01

The mechanism to realize the peculiar flat bands generally existing in RCo5 (R=rare earth) compounds is clarified by analyzing the first-principles band structures and the tight-binding model. These flat bands are constructed from the localized eigenstates, the existence of which is guaranteed by the partial cancelation between the intersite hopping amplitudes among the Co-3d states at the Kagome sites and those between the Kagome and honeycomb sites. Their relative positions to other bands c...

Band structures in Sierpinski triangle fractal porous phononic crystals

International Nuclear Information System (INIS)

Wang, Kai; Liu, Ying; Liang, Tianshu

2016-01-01

In this paper, the band structures in Sierpinski triangle fractal porous phononic crystals (FPPCs) are studied with the aim to clarify the effect of fractal hierarchy on the band structures. Firstly, one kind of FPPCs based on Sierpinski triangle routine is proposed. Then the influence of the porosity on the elastic wave dispersion in Sierpinski triangle FPPCs is investigated. The sensitivity of the band structures to the fractal hierarchy is discussed in detail. The results show that the increase of the hierarchy increases the sensitivity of ABG (Absolute band gap) central frequency to the porosity. But further increase of the fractal hierarchy weakens this sensitivity. On the same hierarchy, wider ABGs could be opened in Sierpinski equilateral triangle FPPC; whilst, a lower ABG could be opened at lower porosity in Sierpinski right-angled isosceles FPPCs. These results will provide a meaningful guidance in tuning band structures in porous phononic crystals by fractal design.

Development of shear bands in amorphous-crystalline metallic alloys

International Nuclear Information System (INIS)

Pozdnyakov, V.A.

2004-01-01

A theoretical study is made into conditions of shear band evolution in amorphous-crystalline alloys with various morphological types of structural constituents. The condition of shear band evolution in thin amorphous alloys in the interior of the crystalline matrix is obtained. It is shown that a scale effect exists which manifests itself in suppression of the process of localized plastic flow with amorphous alloy thickness decreasing down to the limit. The analysis of the condition for shear band evolution in an amorphous alloy with nanocrystalline inclusions is accomplished. The relationship of a critical stress of shear band evolution to a volume fraction of disperse crystal inclusions is obtained. A consideration is also given to the evolution of shear bands in the material containing amorphous and crystalline areas of micro meter size. For the alloy with the structure of this type conditions for propagation of localized flows by a relay race type mechanism are determined [ru

Band structures in Sierpinski triangle fractal porous phononic crystals

Energy Technology Data Exchange (ETDEWEB)

Wang, Kai; Liu, Ying, E-mail: yliu5@bjtu.edu.cn; Liang, Tianshu

2016-10-01

In this paper, the band structures in Sierpinski triangle fractal porous phononic crystals (FPPCs) are studied with the aim to clarify the effect of fractal hierarchy on the band structures. Firstly, one kind of FPPCs based on Sierpinski triangle routine is proposed. Then the influence of the porosity on the elastic wave dispersion in Sierpinski triangle FPPCs is investigated. The sensitivity of the band structures to the fractal hierarchy is discussed in detail. The results show that the increase of the hierarchy increases the sensitivity of ABG (Absolute band gap) central frequency to the porosity. But further increase of the fractal hierarchy weakens this sensitivity. On the same hierarchy, wider ABGs could be opened in Sierpinski equilateral triangle FPPC; whilst, a lower ABG could be opened at lower porosity in Sierpinski right-angled isosceles FPPCs. These results will provide a meaningful guidance in tuning band structures in porous phononic crystals by fractal design.

Electronic transport properties of Ti-impurity band in Si

Energy Technology Data Exchange (ETDEWEB)

Olea, J; Gonzalez-Diaz, G; Pastor, D; Martil, I [Departamento de Fisica Aplicada III (Electricidad y Electronica), Facultad de Ciencias, Fisicas, Universidad Complutense, E-28040 Madrid (Spain)

2009-04-21

In this paper we show that pulsed laser melted high dose implantation of Ti in Si, above the Mott transition, produces an impurity band (IB) in this semiconductor. Using the van der Pauw method and Hall effect measurements we find strong laminated conductivity at the implanted layer and a temperature dependent decoupling between the Ti implanted layer (TIL) and the substrate. The conduction mechanism from the TIL to the substrate shows blocking characteristics that could be well explained through IB theory. Using the ATLAS code we can estimate the energetic position of the IB at 0.36 eV from the conduction band, the density of holes in this band which is closely related to the Ti atomic density and the hole mobility in this band. Band diagrams of the structure at low and high temperatures are also simulated in the ATLAS framework. The simulation obtained is fully coherent with experimental results.

Electronic transport properties of Ti-impurity band in Si

International Nuclear Information System (INIS)

Olea, J; Gonzalez-Diaz, G; Pastor, D; Martil, I

2009-01-01

In this paper we show that pulsed laser melted high dose implantation of Ti in Si, above the Mott transition, produces an impurity band (IB) in this semiconductor. Using the van der Pauw method and Hall effect measurements we find strong laminated conductivity at the implanted layer and a temperature dependent decoupling between the Ti implanted layer (TIL) and the substrate. The conduction mechanism from the TIL to the substrate shows blocking characteristics that could be well explained through IB theory. Using the ATLAS code we can estimate the energetic position of the IB at 0.36 eV from the conduction band, the density of holes in this band which is closely related to the Ti atomic density and the hole mobility in this band. Band diagrams of the structure at low and high temperatures are also simulated in the ATLAS framework. The simulation obtained is fully coherent with experimental results.

Banded vs Bonded Space Maintainers: Finding Better Way Out.

Science.gov (United States)

Setia, Vikas; Kumar Pandit, Inder; Srivastava, Nikhil; Gugnani, Neeraj; Gupta, Monika

2014-05-01

Of this in vivo study was to evaluate various space maintainers in terms of survival rate, gingival health and presence of caries. A total of 60 extraction sites in the age group of 4 to 9 years were divided into four groups and different space maintainers were placed in them viz (conventional band and loop, prefabricated band with custom made loop, Ribbond, Super splint). Prefabricated bands with custom made loop showed maximum success rates (84.6%), while super splint (33.33%) was found to be least successful. In terms of gingival health, prefabricated band with custom made loop reported minimum cases with poor gingival health (27.2%), while maximum cases with poor gingival health (50%) were reported with Super splint. None of the space maintainers developed caries at the end of 9 months. How to cite this article: Setia v, Pandit IK, Srivastava N, Gugnani N, Gupta M. Banded vs Bonded Space Maintainers: Finding Better Way Out. Int J Clin Pediatr Dent 2014;7(2):97-104.

Attractive electron correlation in wide band gap semiconductors by electron-photon interaction

International Nuclear Information System (INIS)

Takeda, Hiroyuki; Yoshino, Katsumi

2004-01-01

We theoretically demonstrate attractive electron correlation in wide band gap semiconductors by electron-photon interaction. At low temperature, wavevectors of electromagnetic waves absorbed in wide band gap semiconductors cannot be neglected for wavevectors of electron waves; that is, electromagnetic waves affect the movements of electrons. In particular, attractive interaction occurs between two electrons when one electron changes from a valence band to a conduction band and the other electron changes from a conduction band to a valence band

Long-term effects of flipper bands on penguins

Science.gov (United States)

Gauthier-Clerc, M.; Gendner, J.-P.; Ribic, C.A.; Fraser, William R.; Woehler, Eric J.; Descamps, S.; Gilly, C.; Le, Bohec C.; Le, Maho Y.

2004-01-01

Changes in seabird populations, and particularly of penguins, offer a unique opportunity for investigating the impact of fisheries and climatic variations on marine resources. Such investigations often require large-scale banding to identify individual birds, but the significance of the data relies on the assumption that no bias is introduced in this type of long-term monitoring. After 5 years of using an automated system of identification of king penguins implanted with electronic tags (100 adult king penguins were implanted with a transponder tag, 50 of which were also flipper banded), we can report that banding results in later arrival at the colony for courtship in some years, lower breeding probability and lower chick production. We also found that the survival rate of unbanded, electronically tagged king penguin chicks after 2-3 years is approximately twice as large as that reported in the literature for banded chicks. ?? 2004 The Royal Society.

Coloured leg bands affect male mate-guarding behaviour in the bluethroat

Science.gov (United States)

Johnsen; Lifjeld; Rohde

1997-07-01

Artificial traits such as coloured leg bands may affect an individual's mating success, as shown for some birds. One explanation is that colour-matching with a sexual ornament affects the individual's sexual attractiveness. This study reports a colour-band experiment with free-living bluethroats, Luscinia s. svecicaa species where males have a distinct blue and chestnut throat and upper breast. There was no apparent difference in pairing success between males with ornament-matching colour bands (blue and orange) and males with non-ornamental colour bands. However, males with ornamental bands guarded their mates less intensely and spent more time singing, performing song flights and intruding into neighbours' territories than males with non-ornamental bands. We conclude that colour bands affect the trade-off between mate guarding and advertisement behaviour in a way that is consistent with the hypothesis that bands with ornamental colours improve a male's attractiveness. The results are in concordance with a previous study of the same population, showing that males with experimentally reduced attractiveness guarded their mates more closely and advertised less for additional mates, than non-manipulated males.

Stability of the split-band solution and energy gap in the narrow-band region of the Hubbard model

International Nuclear Information System (INIS)

Arai, T.; Cohen, M.H.

1980-01-01

By inserting quasielectron energies ω calculated from the fully renormalized Green's function of the Hubbard model obtained in the preceding paper into the exact expression of Galitskii and Migdal, the ground-state energy, the chemical potential, and the dynamic- and thermodynamic-stability conditions are calculated in the narrow-band region. The results show that as long as the interaction energy I is finite, electrons in the narrow-band region do not obey the Landau theory of Fermi liquids, and a gap appears between the lowest quasielectron energy ω and the chemical potential μ for any occupation n, regardless of whether the lower band is exactly filled or not. This unusual behavior is possible because, when an electron is added to the system of N electrons, the whole system relaxes due to the strong interaction, introducing a relaxation energy difference between the two quantities. We also show that all previous solutions which exhibit the split-band structure, including Hubbard's work, yield the same conclusion that electrons do not behave like Landau quasiparticles. However, the energy gap is calculated to be negative at least for some occupations n, demonstrating the dynamic instability of those solutions. They also exhibit thermodynamic instability for certain occupations, while the fully renormalized solution, having sufficient electron correlations built in, satisfies the dynamic and thermodynamic stability conditions for all occupations. When the lower band is nearly filled, the nature of the solution is shown to change, making the coherent motion of electrons with fixed k values more difficult. In the pathological limit where I=infinity, however, the gap vanishes, yielding a metallic state

Identical and shifted identical bands

International Nuclear Information System (INIS)

Dodder, R.S; Jones, E.F.; Hamilton, J.H.

1997-01-01

Spontaneous fission of 252 Cm was studied with 72 large Compton suppressed Ge detectors in Gamma sphere. New isotopes 160 Sm and 162 Gd were identified. Through X-ray-γ and γ-γ-γ) coincidence measurements, level energies were established to spins 14 + to 20 + in 152 , 154 156 60 Nd 92 94 96 , 156 , 158 , 160 62 Sm 94 , 96 , 98 , and 160 , 162 64 Gd 96 , 98 . These nuclei exhibit a remarkable variety of identical bands and bands where the energies and moments of inertia are shifted by the same constant amount for every spin state from 2 + to 12 + for various combinations of nuclei differing by 2n, 4n, 2p, 4p, and α

Terahertz spectroscopy of three-dimensional photonic band-gap crystals

International Nuclear Information System (INIS)

Oezbay, E.; Michel, E.; Tuttle, G.; Biswas, R.; Ho, K.M.; Bostak, J.; Bloom, D.M.

1994-01-01

We have fabricated and built three-dimensional photonic band-gap crystals with band-gap frequencies larger than 500 GHz. We built the crystals by stacking micromachined (110) silicon wafers. The transmission and dispersion characteristics of the structures were measured by an all-electronic terahertz spectroscopy setup. The experimental results were in good agreement with theoretical calculations. To our knowledge, our new crystal has the highest reported photonic band-gap frequency

Panchromatic cooperative hyperspectral adaptive wide band deletion repair method

Science.gov (United States)

Jiang, Bitao; Shi, Chunyu

2018-02-01

In the hyperspectral data, the phenomenon of stripe deletion often occurs, which seriously affects the efficiency and accuracy of data analysis and application. Narrow band deletion can be directly repaired by interpolation, and this method is not ideal for wide band deletion repair. In this paper, an adaptive spectral wide band missing restoration method based on panchromatic information is proposed, and the effectiveness of the algorithm is verified by experiments.

Glucose Absorption by the Bacillary Band of Trichuris muris.

Directory of Open Access Journals (Sweden)

Tina V A Hansen

2016-09-01

Full Text Available A common characteristic of Trichuris spp. infections in humans and animals is the variable but low efficacy of single-dose benzimidazoles currently used in mass drug administration programmes against human trichuriasis. The bacillary band, a specialised morphological structure of Trichuris spp., as well as the unique partly intracellular habitat of adult Trichuris spp. may affect drug absorption and perhaps contribute to the low drug accumulation in the worm. However, the exact function of the bacillary band is still unknown.We studied the dependency of adult Trichuris muris on glucose and/or amino acids for survival in vitro and the absorptive function of the bacillary band. The viability of the worms was evaluated using a motility scale from 0 to 3, and the colorimetric assay Alamar Blue was utilised to measure the metabolic activity. The absorptive function of the bacillary band in living worms was explored using a fluorescent glucose analogue (6-NBDG and confocal microscopy. To study the absorptive function of the bacillary band in relation to 6-NBDG, the oral uptake was minimised or excluded by sealing the oral cavity with glue and agarose.Glucose had a positive effect on both the motility (p < 0.001 and metabolic activity (p < 0.001 of T. muris in vitro, whereas this was not the case for amino acids. The 6-NBDG was observed in the pores of the bacillary band and within the stichocytes of the living worms, independent of oral sealing.Trichuris muris is dependent on glucose for viability in vitro, and the bacillary band has an absorptive function in relation to 6-NBDG, which accumulates within the stichocytes. The absorptive function of the bacillary band calls for an exploration of its possible role in the uptake of anthelmintics, and as a potential anthelmintic target relevant for future drug development.

Bands and chromosome arrangement in interphase nuclei

International Nuclear Information System (INIS)

Bianchi, N.O.; Bianchi, M.A.; Matayoshi, T.

1977-01-01

Chromosomes from the vole mouse Akodon dolores and from laboratory mouse showed the presence of G-bands after 3 minutes digestion with trypsin and Giemsa stain. Simultaneously, 30- to 40% of the interphase nuclei exhibited a dark ring parallel to the nuclear contour and a radial array of the chromatin in the internal and external regions of the ring. The origin and meaning of this ring image was analyzed by combining progressive trypsinizations with other methods such as C-banding procedures, autoradiography with 3 HTdR, staining with quinacrine mustard and 33258 Hoechst fluorochromes. Moreover, the presence of the dark ring was also investigated in cells treated with actinomycin and in control cells not subjected to any treatment. The results obtained allowed to assume that in interphase nuclei the chromosomes have chromatin bridges which connect the dark G-bands and that these bridges are probably involved in maintaining an ordered architecture of the nucleus with fixed chromosome positions in regard to the nuclear envelope and in regard to other chromosomes. Trypsinization produces a disruption of the interphase chromatin arrangement and the subsequent appearance of a dark ring formed by the combination of constitutive heterochromatin and dark G-bands. (auth.)

Pair correlation of super-deformed rotation band

International Nuclear Information System (INIS)

Shimizu, Yoshio

1989-01-01

The effect of pair correlation, one of the most important residual interactions associated with the super-deformed rotation band, is discussed in terms of the characteristics of the rotation band (its effect on the moment of inertia in particular), and the tunneling into an normal deformed state in relation to its effect on the angular momentum dependence of the potential energy plane as a function of the deformation. The characteristics of the rotation band is discussed in terms of the kinematic and dynamic momenta of inertia. It is shown that the pair correlation in a super-deformed rotation band acts to decrease the former and increase the latter momentum mainly due to dynamic pair correlation. A theoretical approach that takes this effect into account can provide results that are consistent with measured momenta, although large differences can occur in some cases. Major conflicts include a large measured kinetic momentum of inertia compared to the theoretical value, and the absence of the abnormality (shape increase) generally seen in low-spin experiments. The former seems likely to be associated with the method of measuring the angular momentum. (N.K.)

An enhanced narrow-band imaging method for the microvessel detection

Science.gov (United States)

Yu, Feng; Song, Enmin; Liu, Hong; Wan, Youming; Zhu, Jun; Hung, Chih-Cheng

2018-02-01

A medical endoscope system combined with the narrow-band imaging (NBI), has been shown to be a superior diagnostic tool for early cancer detection. The NBI can reveal the morphologic changes of microvessels in the superficial cancer. In order to improve the conspicuousness of microvessel texture, we propose an enhanced NBI method to improve the conspicuousness of endoscopic images. To obtain the more conspicuous narrow-band images, we use the edge operator to extract the edge information of the narrow-band blue and green images, and give a weight to the extracted edges. Then, the weighted edges are fused with the narrow-band blue and green images. Finally, the displayed endoscopic images are reconstructed with the enhanced narrow-band images. In addition, we evaluate the performance of enhanced narrow-band images with different edge operators. Experimental results indicate that the Sobel and Canny operators achieve the best performance of all. Compared with traditional NBI method of Olympus company, our proposed method has more conspicuous texture of microvessel.

Alpha-band rhythm suppression during memory recall reflecting memory performance.

Science.gov (United States)

Yokosawa, Koichi; Kimura, Keisuke; Chitose, Ryota; Momiki, Takuya; Kuriki, Shinya

2016-08-01

Alpha-band rhythm is thought to be involved in memory processes, similarly to other spontaneous brain rhythms. Ten right-handed healthy volunteers participated in our proposed sequential short-term memory task that provides a serial position effect in accuracy rate. We recorded alpha-band rhythms by magnetoencephalography during performance of the task and observed that the amplitude of the rhythm was suppressed dramatically in the memory recall period. The suppressed region was estimated to be in the occipital lobe, suggesting that alpha-band rhythm is suppressed by activation of the occipital attentional network. Additionally, the alpha-band suppression reflected accuracy rate, that is, the amplitude was suppressed more when recalling items with higher accuracy rate. The sensors with a significant correlation between alpha-band amplitude and accuracy rate were located widely from the frontal to occipital regions mainly in the right hemisphere. The results suggests that alpha-band rhythm is involved in memory recall and can be index of memory performance.

Effective Ginzburg–Landau free energy functional for multi-band isotropic superconductors

International Nuclear Information System (INIS)

Grigorishin, Konstantin V.

2016-01-01

Highlights: • The intergradient coupling of order parameters in a two-band superconductor plays important role and cannot be neglected. • A two-band superconductor must be characterized with a single coherence length and a single Ginzburg–Landau parameter. • Type-1.5 superconductors are impossible. • The free energy functional for a multi-band superconductor can be reduced to the effective single-band Ginzburg–Landau functional. - Abstract: It has been shown that interband mixing of gradients of two order parameters (drag effect) in an isotropic bulk two-band superconductor plays important role – such a quantity of the intergradients coupling exists that the two-band superconductor is characterized with a single coherence length and a single Ginzburg–Landau (GL) parameter. Other quantities or neglecting of the drag effect lead to existence of two coherence lengths and dynamical instability due to violation of the phase relations between the order parameters. Thus so-called type-1.5 superconductors are impossible. An approximate method for solving of set of GL equations for a multi-band superconductor has been developed: using the result about the drag effect it has been shown that the free-energy functional for a multi-band superconductor can be reduced to the GL functional for an effective single-band superconductor.

Shifted identical bands: A new phenomenon

International Nuclear Information System (INIS)

Jones, E.F.; Lima, A.P. de; Gore, P.M.; Hamilton, J.H.; Ramayya, A.V.; Dodder, R.S.; Kormicki, J.; Hwang, J.K.; Beyer, C.J.; Zhang, X.Q.; Zhu, S.J.; Ter-Akopian, G.M.; Oganessian, Yu.Ts.; Daniel, A.V.; Rasmussen, J.O.; Lee, I.Y.; Cole, J.D.; Drigert, M.W.; Ma, W.-C.

2001-01-01

The levels in 162 Gd were identified in spontaneous fission studies. Its transition energies are remarkably similar to those in 160 Gd. From that work, an analysis of yrast bands in even-even proton to neutron-rich Ba to Pb nuclei led to the discovery of a new phenomenon, shifted identical bands (SIB). SIBs are yrast bands in neighboring nuclei (a, b) with moments of inertia which are identical when shifted by a constant amount κ, so J 1a (1 + κ) = J 1b , from 2 + to 8 + and higher to 16 + . Out of over 700 comparisons, 55 SIBs were found from stable to the most neutron-rich Ce-W nuclei with |κ-bar| between 1.5% and 13%, where the spread in κ is less than ± 1%, and only four identical bands (κ-bar congruent with 0). As examples, we found for 158 Sm- 160 Gd, κ-bar (-3.2 +0.1 -0.2 )% (where the ± is the total spread in κ from -3.1 to -3.4); 156 Nd- 160 Gd, (-10.6 +0.4 -0.2 )%; 158 Sm- 160 Sm, (3.4 +0.5 -0.3 )%. The J 1 values were fitted to a variable moment of inertia model with parameters J 0 and C whose values correlate with the SIB J 1 values. The SIBs are not correlated either with deformation or with the N p N n product of the IBA model

Spins of superdeformed rotational bands in Tl isotopes

Energy Technology Data Exchange (ETDEWEB)

Dadwal, Anshul; Mittal, H.M. [Dr. B.R. Ambedkar National Institute of Technology, Jalandhar (India)

2017-01-15

The two-parameter model defined for even-even nuclei viz. soft-rotor formula is used to assign the band-head spin of the 17 rotational bands in Tl isotopes. The least-squares fitting method is employed to obtain the spins of these bands in the A ∝ 190 mass region. The calculated transition energies are found to depend sensitively on the proposed spin. Whenever a correct spin assignment is made, the calculated and experimental transition energies coincide very well. The dynamic moment of inertia is also calculated and its variation with rotational frequency is explored. (orig.)

#MarchOnRome: Of Alterity, Social Media, and Marching Bands

Science.gov (United States)

Abramo, Joseph

2016-01-01

In this online ethnography, I studied marching band identity by examining marching band enthusiasts' and music educators' responses on music teacher professional forums, Twitter, blogs, and other online media, to sports commentator Jim Rome's tweets describing marching band members as "dorks." Using a framework of alterity--or the…

Designing Phononic Crystals with Wide and Robust Band Gaps

Science.gov (United States)

Jia, Zian; Chen, Yanyu; Yang, Haoxiang; Wang, Lifeng

2018-04-01

Phononic crystals (PnCs) engineered to manipulate and control the propagation of mechanical waves have enabled the design of a range of novel devices, such as waveguides, frequency modulators, and acoustic cloaks, for which wide and robust phononic band gaps are highly preferable. While numerous PnCs have been designed in recent decades, to the best of our knowledge, PnCs that possess simultaneous wide and robust band gaps (to randomness and deformations) have not yet been reported. Here, we demonstrate that by combining the band-gap formation mechanisms of Bragg scattering and local resonances (the latter one is dominating), PnCs with wide and robust phononic band gaps can be established. The robustness of the phononic band gaps are then discussed from two aspects: robustness to geometric randomness (manufacture defects) and robustness to deformations (mechanical stimuli). Analytical formulations further predict the optimal design parameters, and an uncertainty analysis quantifies the randomness effect of each designing parameter. Moreover, we show that the deformation robustness originates from a local resonance-dominant mechanism together with the suppression of structural instability. Importantly, the proposed PnCs require only a small number of layers of elements (three unit cells) to obtain broad, robust, and strong attenuation bands, which offer great potential in designing flexible and deformable phononic devices.

Modeling charged defects inside density functional theory band gaps

International Nuclear Information System (INIS)

Schultz, Peter A.; Edwards, Arthur H.

2014-01-01

Density functional theory (DFT) has emerged as an important tool to probe microscopic behavior in materials. The fundamental band gap defines the energy scale for charge transition energy levels of point defects in ionic and covalent materials. The eigenvalue gap between occupied and unoccupied states in conventional DFT, the Kohn–Sham gap, is often half or less of the experimental band gap, seemingly precluding quantitative studies of charged defects. Applying explicit and rigorous control of charge boundary conditions in supercells, we find that calculations of defect energy levels derived from total energy differences give accurate predictions of charge transition energy levels in Si and GaAs, unhampered by a band gap problem. The GaAs system provides a good theoretical laboratory for investigating band gap effects in defect level calculations: depending on the functional and pseudopotential, the Kohn–Sham gap can be as large as 1.1 eV or as small as 0.1 eV. We find that the effective defect band gap, the computed range in defect levels, is mostly insensitive to the Kohn–Sham gap, demonstrating it is often possible to use conventional DFT for quantitative studies of defect chemistry governing interesting materials behavior in semiconductors and oxides despite a band gap problem

Designing Phononic Crystals with Wide and Robust Band Gaps

Energy Technology Data Exchange (ETDEWEB)

Chen, Yanyu [National Renewable Energy Laboratory (NREL), Golden, CO (United States); Jia, Zian [State University of New York at Stony Brook; Yang, Haoxiang [State University of New York at Stony Brook; Wang, Lifeng [State University of New York at Stony Brook

2018-04-16

Phononic crystals (PnCs) engineered to manipulate and control the propagation of mechanical waves have enabled the design of a range of novel devices, such as waveguides, frequency modulators, and acoustic cloaks, for which wide and robust phononic band gaps are highly preferable. While numerous PnCs have been designed in recent decades, to the best of our knowledge, PnCs that possess simultaneous wide and robust band gaps (to randomness and deformations) have not yet been reported. Here, we demonstrate that by combining the band-gap formation mechanisms of Bragg scattering and local resonances (the latter one is dominating), PnCs with wide and robust phononic band gaps can be established. The robustness of the phononic band gaps are then discussed from two aspects: robustness to geometric randomness (manufacture defects) and robustness to deformations (mechanical stimuli). Analytical formulations further predict the optimal design parameters, and an uncertainty analysis quantifies the randomness effect of each designing parameter. Moreover, we show that the deformation robustness originates from a local resonance-dominant mechanism together with the suppression of structural instability. Importantly, the proposed PnCs require only a small number of layers of elements (three unit cells) to obtain broad, robust, and strong attenuation bands, which offer great potential in designing flexible and deformable phononic devices.

Reconfigurable dual-band metamaterial antenna based on liquid crystals

Science.gov (United States)

Che, Bang-Jun; Meng, Fan-Yi; Lyu, Yue-Long; Wu, Qun

2018-05-01

In this paper, a novel reconfigurable dual-band metamaterial antenna with a continuous beam that is electrically steered in backward to forward directions is first proposed by employing a liquid crystal (LC)-loaded tunable extended composite right-/left-handed (E-CRLH) transmission line (TL). The frequency-dependent property of the E-CRLH TL is analyzed and a compact unit cell based on the nematic LC is proposed to realize the tunable dual band characteristics. The phase constant of the proposed unit cell can be dynamically continuously tuned from negative to positive values in two operating bands by changing the bias voltage of the loaded LC material. A resulting dual band fixed-frequency beam steering property has been predicted by numerical simulations and experimentally verified. The measured results show that the fabricated reconfigurable antenna features an electrically controlled continuous beam steering from backward  ‑16° to forward  +13° at 7.2 GHz and backward  ‑9° to forward  +17° at 9.4 GHz, respectively. This electrically controlled beam steering range turns out to be competitive with the previously reported single band reconfigurable antennas. Besides, the measured and simulated results of the proposed reconfigurable dual-band metamaterial antenna are in good agreement.

Modulational-instability gain bands in quasi-phase-matched materials

International Nuclear Information System (INIS)

Corney, J.F.; Bang, O.

2002-01-01

Full text: Quadratically nonlinear materials are of significant technological interest in optics because of their strong and fast cascaded nonlinearities, which are accessed most efficiently with quasi-phase-matching (QPM) techniques. We study the gain spectra of modulational instabilities (Ml) in quadratic materials where the linear and nonlinear properties are modulated with QPM gratings. The periods and intensity-dependence of the Ml can now be measured in the laboratory. Using an exact Floquet theory, we find that novel low- and high-frequency bands appear in the gain spectrum (gain versus transverse spatial frequency). The high-frequency gain bands are a general feature of gain spectra for QPM gratings. They form part of an extensive series of bands that correspond to Ml in the non-phase-matched, quickly varying components of the fields. The low-frequency bands correspond to Ml in the phase-matched DC components of the fields and are accurately predicted by a simple average theory. This theory includes the effect of the quickly varying components as induced cubic terms, which can be strong enough to suppress the low-frequency bands, in which case dark solitons and other broad beams may be effectively stable, since the high-frequency bands are typically small

Design and analysis of X-band femtosecond linac

Energy Technology Data Exchange (ETDEWEB)

Uesaka, M; Kozawa, T; Takeshita, A; Kobayashi, T; Ueda, T; Miya, K [Tokyo Univ., Tokai, Ibaraki (Japan). Nuclear Engineering Research Lab.

1997-03-01

Femtosecond quantum phenomena research project is proposed at Nuclear Engineering Research Laboratory, University of Tokyo. The research facility consists of an X-band (11.424GHz) femtosecond electron linac, a femtosecond wavelength tunable laser, two S-band (2.856GHz) picosecond electron linacs and measuring equipments. Especially, we aim to generate a 100 fs (FWHM) electron single bunch with more than 1 nC at the X-band femtosecond linac. Ultrafast processes in radiation physics, chemistry, material science and microscopic electromagnetic phenomena are going to be analyzed there. Here the design and analysis of an X-band femtosecond linac is presented. The simulation of electron dynamics is carried out including magnetic pulse compression by using PARMELA and SUPERFISH. It is found by the simulation that the 600 ps (tail-to-tail) electron emission from a 200 kV thermionic gun can be bunched and compressed to 110 fs (FWHM) with the charge of 0.8 nC which gives 7.3 kA. We plan to use one high power X-band klystron which can supply 60 MW with more than 200 ns pulse duration. The flatness of plateau of the pulse should be 0.2% for stable ultrashort bunch generation. (author)

Development of a Control Banding Tool for Nanomaterials

Directory of Open Access Journals (Sweden)

M. Riediker

2012-01-01

Full Text Available Control banding (CB can be a useful tool for managing the potential risks of nanomaterials. The here proposed CB, which should be part of an overall risk control strategy, groups materials by hazard and emission potential. The resulting decision matrix proposes control bands adapted to the risk potential levels and helps define an action plan. If this plan is not practical and financially feasible, a full risk assessment is launched. The hazard banding combines key concepts of nanomaterial toxicology: translocation across biological barriers, fibrous nature, solubility, and reactivity. Already existing classifications specific to the nanomaterial can be used “as is.” Otherwise, the toxicity of bulk or analogous substances gives an initial hazard band, which is increased if the substance is not easily soluble or if it has a higher reactivity than the substance. The emission potential bands are defined by the nanomaterials' physical form and process characteristics. Quantities, frequencies, and existing control measures are taken into account during the definition of the action plan. Control strategies range from room ventilation to full containment with expert advice. This CB approach, once validated, can be easily embedded in risk management systems. It allows integrating new toxicity data and needs no exposure data.

Tunable band structures in digital oxides with layered crystal habits

Science.gov (United States)

Shin, Yongjin; Rondinelli, James M.

2017-11-01

We use density functional calculations to show that heterovalent cation-order sequences enable control over band-gap variations up to several eV and band-gap closure in the bulk band insulator LaSrAlO4. The band-gap control originates from the internal electric fields induced by the digital chemical order, which induces picoscale band bending; the electric-field magnitude is mainly governed by the inequivalent charged monoxide layers afforded by the layered crystal habit. Charge transfer and ionic relaxations across these layers play secondary roles. This understanding is used to construct and validate a descriptor that captures the layer-charge variation and to predict changes in the electronic gap in layered oxides exhibiting antisite defects and in other chemistries.

Experimental study of ΔI=1 bands in 111In

International Nuclear Information System (INIS)

Banerjee, P.; Pradhan, M. K.; Ganguly, S.; Sharma, H. P.; Muralithar, S.; Singh, R. P.; Bhowmik, R. K.

2011-01-01

The two ΔI=1 bands in 111 In, built upon the 3461.0 and 4931.8 keV states, have been studied. The bands were populated in the reaction 100 Mo( 19 F, α4nγ) at a beam energy of 105 MeV. Mean lifetimes of nine states, four in the first and five in the second band, have been determined for the first time from Doppler shift attenuation data. The deduced B(M1) rates and their behavior as a function of level spin support the interpretation of these bands within the framework of the shears mechanism. The geometrical model of Machiavelli et al. has been used to derive the effective gyromagnetic ratios for the two bands.

The development for C-band whole sealed vacuum accelerating tuber

International Nuclear Information System (INIS)

Zhou Wenzhen; Zhang Xiangyang; Ding Shulin; Hu Jinquan; Yang Zhenyuan

1999-01-01

S-Band standing wave electron linacs have got wide-ranging application for industry nondestructive testing and formed varied kinds of products. X-band electron linac for NDT has been developed by Schonberg Company USA in 1985. Because of bigger structure of S-band linac and difficult machining of X-Band linac, an C-band portable linac for NDT has been developed in CIAE at present, a whole sealed vacuum accelerating tuber will be given here. It consists of 4 cavities, the phase velocity of the first two cavities is 0.5 and 0.9, respectively, and that of the second two cavities is 1. The high power testing proved that the design of the accelerating tuber is good for 1.5 MeV electron linac for NDT

Band alignment of type I at (100ZnTe/PbSe interface

Directory of Open Access Journals (Sweden)

Igor Konovalov

2016-06-01

Full Text Available A junction of lattice-matched cubic semiconductors ZnTe and PbSe results in a band alignment of type I so that the narrow band gap of PbSe is completely within the wider band gap of ZnTe. The valence band offset of 0.27 eV was found, representing a minor barrier during injection of holes from PbSe into ZnTe. Simple linear extrapolation of the valence band edge results in a smaller calculated band offset, but a more elaborate square root approximation was used instead, which accounts for parabolic bands. PbSe was electrodeposited at room temperature with and without Cd2+ ions in the electrolyte. Although Cd adsorbs at the surface, the presence of Cd in the electrolyte does not influence the band offset.

Photonic band structures in one-dimensional photonic crystals containing Dirac materials

International Nuclear Information System (INIS)

Wang, Lin; Wang, Li-Gang

2015-01-01

We have investigated the band structures of one-dimensional photonic crystals (1DPCs) composed of Dirac materials and ordinary dielectric media. It is found that there exist an omnidirectional passing band and a kind of special band, which result from the interaction of the evanescent and propagating waves. Due to the interface effect and strong dispersion, the electromagnetic fields inside the special bands are strongly enhanced. It is also shown that the properties of these bands are invariant upon the lattice constant but sensitive to the resonant conditions

Band theory of metals the elements

CERN Document Server

Altmann, Simon L

1970-01-01

Band Theory of Metals: The Elements focuses on the band theory of solids. The book first discusses revision of quantum mechanics. Topics include Heisenberg's uncertainty principle, normalization, stationary states, wave and group velocities, mean values, and variational method. The text takes a look at the free-electron theory of metals, including heat capacities, density of states, Fermi energy, core and metal electrons, and eigenfunctions in three dimensions. The book also reviews the effects of crystal fields in one dimension. The eigenfunctions of the translations; symmetry operations of t

Antifungal activity of essential oils against selected terverticillate penicillia

Directory of Open Access Journals (Sweden)

Soňa Felšöciová

2015-02-01

Full Text Available The aim of this study was to screen 15 essential oils of selected plant species, viz. Lavandula angustifolia, Carum carvi, Pinus mungo var. pulmilio, Mentha piperita, Chamomilla recutita L., Pinus sylvestris, Satureia hortensis L., Origanum vulgare L., Pimpinella anisum, Rosmarinus officinalis L., Salvia officinalis L., Abietis albia etheroleum, Chamomilla recutita, L. Rausch, Thymus vulgaris L., Origanum vulgare L. for antifungal activity against five Penicillium species: Penicillium brevicompactum, Penicillium citrinum, Penicillium crustosum, Penicillium expansum and Penicillium griseofulvum. The method used for screening included the disc diffusion method. The study points out the wide spectrum of antifungal activity of essential oils against Penicillium fungi. There were five essential oils of the 15 mentioned above which showed a hopeful antifungal activity: Pimpinella anisum, Chamomilla recutita L., Thymus vulgaris, Origanum vulgare L. The most hopeful antifungal activity and killing effect against all tested penicillia was found to be Origanum vulgare L. and Pimpinella anisum. The lowest level of antifungal activity was demonstrated by the oils Pinus mungo var. pulmilio, Salvia officinalis L., Abietis albia etheroleum, Chamomilla recutita L. Rausch, Rosmarinus officinalis.

Simplicial band depth for multivariate functional data

KAUST Repository

López-Pintado, Sara

2014-03-05

We propose notions of simplicial band depth for multivariate functional data that extend the univariate functional band depth. The proposed simplicial band depths provide simple and natural criteria to measure the centrality of a trajectory within a sample of curves. Based on these depths, a sample of multivariate curves can be ordered from the center outward and order statistics can be defined. Properties of the proposed depths, such as invariance and consistency, can be established. A simulation study shows the robustness of this new definition of depth and the advantages of using a multivariate depth versus the marginal depths for detecting outliers. Real data examples from growth curves and signature data are used to illustrate the performance and usefulness of the proposed depths. © 2014 Springer-Verlag Berlin Heidelberg.

The quasiparticle band structure of zincblende and rocksalt ZnO.

Science.gov (United States)

Dixit, H; Saniz, R; Lamoen, D; Partoens, B

2010-03-31

We present the quasiparticle band structure of ZnO in its zincblende (ZB) and rocksalt (RS) phases at the Γ point, calculated within the GW approximation. The effect of the p-d hybridization on the quasiparticle corrections to the band gap is discussed. We compare three systems, ZB-ZnO which shows strong p-d hybridization and has a direct band gap, RS-ZnO which is also hybridized but includes inversion symmetry and therefore has an indirect band gap, and ZB-ZnS which shows a weaker hybridization due to a change of the chemical species from oxygen to sulfur. The quasiparticle corrections are calculated with different numbers of valence electrons in the Zn pseudopotential. We find that the Zn(20+) pseudopotential is essential for the adequate treatment of the exchange interaction in the self-energy. The calculated GW band gaps are 2.47 eV and 4.27 eV respectively, for the ZB and RS phases. The ZB-ZnO band gap is underestimated compared to the experimental value of 3.27 by ∼ 0.8 eV. The RS-ZnO band gap compares well with the experimental value of 4.5 eV. The underestimation for ZB-ZnO is correlated with the strong p-d hybridization. The GW band gap for ZnS is 3.57 eV, compared to the experimental value of 3.8 eV.

Wurtzite gallium phosphide has a direct-band gap

NARCIS (Netherlands)

Assali, S.; Zardo, I.; Plissard, S.; Verheijen, M.A.; Haverkort, J.E.M.; Bakkers, E.P.A.M.

2013-01-01

Gallium Phosphide (GaP) with the normal cubic crystal structure has an indirect band gap, which severely limits the emission efficiency. We report the fabrication of GaP nanowires with pure hexagonal crystal structure and demonstrate the direct nature of the band gap. We observe strong

Deformation potentials for band-to-band tunneling in silicon and germanium from first principles

Science.gov (United States)

Vandenberghe, William G.; Fischetti, Massimo V.

2015-01-01

The deformation potentials for phonon-assisted band-to-band tunneling (BTBT) in silicon and germanium are calculated using a plane-wave density functional theory code. Using hybrid functionals, we obtain: DTA = 4.1 × 108 eV/cm, DTO = 1.2 × 109 eV/cm, and DLO = 2.2 × 109 eV/cm for BTBT in silicon and DTA = 7.8 × 108 eV/cm and DLO = 1.3 × 109 eV/cm for BTBT in germanium. These values agree with experimentally measured values and we explain why in diodes, the TA/TO phonon-assisted BTBT dominates over LO phonon-assisted BTBT despite the larger deformation potential for the latter. We also explain why LO phonon-assisted BTBT can nevertheless dominate in many practical applications.

Notes on basis band-pass circuits; Notes sur les circuits de base passe-bande

Energy Technology Data Exchange (ETDEWEB)

Ailloud, J [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires

1959-07-01

Resistor load amplifier stages, basic band-pass RC networks, conventional single-tuned circuits, have the same transfer function. Common properties and differences because diverse magnitude of parameters with proposed problems are exposed. Next the case of several cascaded stages (or networks) is examined when there is no reaction ones to another. (author) [French] Les etages amplificateurs a resistances, les circuits passe-bande RC elementaires, le circuit resonnant classique possedent la meme fonction de transfert. On fait ressortir les proprietes communes et les differences de comportement dues aux ordres de grandeur qu'il est possible de donner aux parametres en fonction des problemes a resoudre. On examine ensuite le cas de plusieurs etages (ou de plusieurs circuits) en cascade lorsqu'ils ne reagissent pas les uns sur les autres. (auteur)

Prospective Identification of Oligoclonal/Abnormal Band of the Same Immunoglobulin Type as the Malignant Clone by Differential Location of M-Spike and Oligoclonal Band.

Science.gov (United States)

Vyas, Shikhar G; Singh, Gurmukh

2017-10-01

Serum and urine protein electrophoreses and immunofixation electrophoreses are the gold standards in diagnosing monoclonal gammopathy. Identification of oligoclonal bands in post-treatment patients has emerged as an important issue and recording the location of the malignant monoclonal peak may facilitate prospective identification of a new "monoclonal" spike as being distinct from the malignant peak. We recorded the locations of monoclonal spikes in descriptive terms, such as being in the cathodal region, mid-gamma region, anodal region, and beta region. The location of monoclonal or restricted heterogeneity bands in subsequent protein electrophoreses was compared to the location of the original malignant spike. In a patient with plasma cell myeloma, the original monoclonal IgG kappa band was located at the anodal end of gamma region. Post-treatment, an IgG kappa band was noted in mid-gamma region and the primary malignant clone was not detectable by serum protein immunofixation electrophoresis (SIFE) in post-treatment sample. Even though the κ/λ ratio remained abnormal, we were able to recognize stringent complete response by noting the different location of the new IgG kappa band as a benign regenerative process. Recording the location of the malignant monoclonal spike facilitates the identification of post-treatment oligoclonal bands, prospectively. Recognizing the regenerative, benign, bands in post-transplant patients facilitates the determination of stringent complete response despite an abnormal κ/λ ratio.

Self-consistent, relativistic, ferromagnetic band structure of gadolinium

International Nuclear Information System (INIS)

Harmon, B.N.; Schirber, J.; Koelling, D.D.

1977-01-01

An initial self-consistent calculation of the ground state magnetic band structure of gadolinium is described. A linearized APW method was used which included all single particle relativistic effects except spin-orbit coupling. The spin polarized potential was obtained in the muffin-tin form using the local spin density approximation for exchange and correlation. The most striking and unorthodox aspect of the results is the position of the 4f spin-down ''bands'' which are required to float just on top of the Fermi level in order to obtain convergence. If the 4f states (l = 3 resonance) are removed from the occupied region of the conduction bands the magnetic moment is approximately .75 μ/sub B//atom; however, as the 4f spin-down states are allowed to find their own position they hybridize with the conduction bands at the Fermi level and the moment becomes smaller. Means of improving the calculation are discussed

Engineering design and fabrication of X-Band components

CERN Document Server

Filippova, M; Solodko, A; Riddone, G; Syratchev, I

2011-01-01

The CLIC RF frequency has been changed in 2008 from the initial 30 GHz to the European X-band 11.994 GHz permitting beam independent power production using klystrons for the accelerating structure testing. X-band klystron test facilities at 11.424 GHz are operated at SLAC and at KEK [1], and they are used by the CLIC study in the framework of the X-band structure collaboration for testing accelerating structures scaled to that frequency [2]. CERN is currently building a klystron test-stand operating at 11.994 GHz. In addition X-FEL projects at PSI and Sincrotrone Trieste operate at 11.4 GHz. Therefore several RF components accommodating frequencies from 11.424 to 11.994 GHz are required. The engineering design of these RF components (high power and compact loads, bi-directional couplers, X-band splitters, hybrids, phase shifters, variable power attenuators) and the main fabrication processes are presented here.

Polarimetric and Structural Properties of a Boreal Forest at P-Band and L-Band

Science.gov (United States)

Tebaldini, S.; Rocca, F.

2010-12-01

With this paper we investigate the structural and polarimetric of the boreal forest within the Krycklan river catchment, Northern Sweden, basing on multi-polarimetric and multi-baseline SAR surveys at P-Band and L-Band collected in the framework of the ESA campaign BioSAR 2008. The analysis has been carried out by applying the Algebraic Synthesis (AS) technique, recently introduced in literature, which provides a theoretical framework for the decomposition of the backscattered signal into ground-only and volume-only contributions, basing on both baseline and polarization diversity. The availability of multiple baselines allows the formation of a synthetic aperture not only along the azimuth direction but also in elevation. Accordingly, the backscattered echoes can be focused not only in the slant range, azimuth plane, but in the whole 3D space. This is the rationale of the SAR Tomography (T-SAR) concept, which has been widely considered in the literature of the last years. It follows that, as long as the penetration in the scattering volume is guaranteed, the vertical profile of the vegetation layer is retrieved by separating backscatter contributions along the vertical direction, which is the main reason for the exploitation of Tomographic techniques at longer wavelengths. Still, the capabilities of T-SAR are limited to imaging the global vertical structure of the electromagnetic scattering in a certain polarization. It then becomes important to develop methodologies for the investigation of the vertical structure of different Scattering Mechanisms (SMs), such as ground and volume scattering, in such a way as to derive information that can be delivered also outside the field of Radar processing. This is an issue that may become relevant at longer wavelengths, such as P-Band, where the presence of multiple scattering arising from the interaction with terrain could hinder the correct reconstruction of the forest structure. The availability of multiple polarizations

The amniotic band syndrome: antenatal sonographic diagnosis and potential pitfalls.

Science.gov (United States)

Mahony, B S; Filly, R A; Callen, P W; Golbus, M S

1985-05-01

Amniotic band syndrome causes a variety of fetal malformations involving the limbs, craniofacial region, and trunk. Six prenatally diagnosed cases of amniotic band syndrome are discussed. The diagnosis was based on sonographic visualization of either amniotic sheets or bands associated with fetal deformation or deformities in nonembryologic distributions known to characterize the amniotic band syndrome. Seven additional cases are considered in which an aberrant sheet of tissue with a free edge was visualized within the amniotic cavity but no restriction of fetal motion or subsequent deformity was demonstrated.

Tunable band structures of polycrystalline graphene by external and mismatch strains

Institute of Scientific and Technical Information of China (English)

Jiang-Tao Wu; Xing-Hua Shi; Yu-Jie Wei

2012-01-01

Lacking a band gap largely limits the application of graphene in electronic devices.Previous study shows that grain boundaries (GBs) in polycrystalline graphene can dramatically alter the electrical properties of graphene.Here,we investigate the band structure of polycrystalline graphene tuned by externally imposed strains and intrinsic mismatch strains at the GB by density functional theory (DFT) calculations.We found that graphene with symmetrical GBs typically has zero band gap even with large uniaxial and biaxial strain.However,some particular asymmetrical GBs can open a band gap in graphene and their band structures can be substantially tuned by external strains.A maximum band gap about 0.19 eV was observed in matched-armchair GB (5,5) | (3,7) with a misorientation of θ =13° when the applied uniaxial strain increases to 9％.Although mismatch strain is inevitable in asymmetrical GBs,it has a small influence on the band gap of polycrystalline graphene.

A Unifying Perspective on Oxygen Vacancies in Wide Band Gap Oxides.

Science.gov (United States)

Linderälv, Christopher; Lindman, Anders; Erhart, Paul

2018-01-04

Wide band gap oxides are versatile materials with numerous applications in research and technology. Many properties of these materials are intimately related to defects, with the most important defect being the oxygen vacancy. Here, using electronic structure calculations, we show that the charge transition level (CTL) and eigenstates associated with oxygen vacancies, which to a large extent determine their electronic properties, are confined to a rather narrow energy range, even while band gap and the electronic structure of the conduction band vary substantially. Vacancies are classified according to their character (deep versus shallow), which shows that the alignment of electronic eigenenergies and CTL can be understood in terms of the transition between cavity-like localized levels in the large band gap limit and strong coupling between conduction band and vacancy states for small to medium band gaps. We consider both conventional and hybrid functionals and demonstrate that the former yields results in very good agreement with the latter provided that band edge alignment is taken into account.

Lamb wave band gaps in a double-sided phononic plate

Science.gov (United States)

Wang, Peng; Chen, Tian-Ning; Yu, Kun-Peng; Wang, Xiao-Peng

2013-02-01

In this paper, we report on the theoretical investigation of the propagation characteristics of Lamb wave in a phononic crystal structure constituted by a square array of cylindrical stubs deposited on both sides of a thin homogeneous plate. The dispersion relations, the power transmission spectra, and the displacement fields of the eigenmodes are studied by using the finite-element method. We investigate the evolution of band gaps in the double-sided phononic plate with stub height on both sides arranged from an asymmetrical distribution to a symmetrical distribution gradually. Numerical results show that as the double stubs in a unit cell arranged more symmetrically on both sides, band width shifts, new band gaps appear, and the bands become flat due to localized resonant modes which couple with plate modes. Specially, more band gaps and flat bands can be found in the symmetrical system as a result of local resonances of the stubs which interact in a stronger way with the plate modes. Moreover, the symmetrical double-sided plate exhibits lower and smaller band gap than that of the asymmetrical plate. These propagation properties of elastic or acoustic waves in the double-sided plate can potentially be utilized to generate filters, slow the group velocity, low-frequency sound insulation, and design acoustic sensors.

47 CFR 61.47 - Adjustments to the SBI; pricing bands.

Science.gov (United States)

2010-10-01

... 47 Telecommunication 3 2010-10-01 2010-10-01 false Adjustments to the SBI; pricing bands. 61.47... (CONTINUED) TARIFFS General Rules for Dominant Carriers § 61.47 Adjustments to the SBI; pricing bands. (a) In...) Pricing bands shall be established each tariff year for each service category and subcategory within a...

Dual-band absorber for multispectral plasmon-enhanced infrared photodetection

International Nuclear Information System (INIS)

Yu, Peng; Ashalley, Eric; Wang, Zhiming; Wu, Jiang; Govorov, Alexander

2016-01-01

For most of the reported metamaterial absorbers, the peak absorption only occurs at one single wavelength. Here, we investigated a dual-band absorber which is based on simple gold nano-rings. Two absorption peaks can be readily achieved in 3–5 µ m and 8–14 µ m via tuning the width and radius of gold nano-rings and dielectric constant. The average maximum absorption of two bands can be as high as 95.1% (−0.22 dB). Based on the simulation results, the perfect absorber with nano-rings demonstrates great flexibility to create dual-band or triple-band absorption, and thus holds potential for further applications in thermophotovoltaics, multicolor infrared focal plane arrays, optical filters, and biological sensing applications. (paper)

Evaluation of a color fused dual-band NVG

NARCIS (Netherlands)

Hogervorst, M.A.; Toet, A.

2009-01-01

We designed and evaluated a dual-band Night Vision Goggles sensor system. The sensor system consists of two optically aligned NVGs fitted with filters splitting the sensitive range into a visual and a near-infrared band. The Color-the-night technique (Hogervorst & Toet, FUSION2008) was used to fuse

Band structure of superlattice with δ-like potential

International Nuclear Information System (INIS)

Gashimzade, N.F.; Gashimzade, F.M.; Hajiev, A.T.

1993-08-01

Band structure of superlattice with δ-like potential has been calculated taking into account interaction of carriers of different kinds. Superlattices of semiconductors with degenerated valence band and zero-gap semiconductors have been considered. For the latter semimetal-semiconductor transition has been obtained. (author). 8 refs, 1 fig

Bands dispersion and charge transfer in β-BeH2

Science.gov (United States)

Trivedi, D. K.; Galav, K. L.; Joshi, K. B.

2018-04-01

Predictive capabilities of ab-initio method are utilised to explore bands dispersion and charge transfer in β-BeH2. Investigations are carried out using the linear combination of atomic orbitals method at the level of density functional theory. The crystal structure and related parameters are settled by coupling total energy calculations with the Murnaghan equation of state. Electronic bands dispersion from PBE-GGA is reported. The PBE-GGA, and PBE0 hybrid functional, show that β-BeH2 is a direct gap semiconductor with 1.18 and 2.40 eV band gap. The band gap slowly decreases with pressure and beyond l00 GPa overlap of conduction and valence bands at the r point is observed. Charge transfer is studied by means of Mullikan population analysis.

Nanoscale measurements of unoccupied band dispersion in few-layer graphene.

Science.gov (United States)

Jobst, Johannes; Kautz, Jaap; Geelen, Daniël; Tromp, Rudolf M; van der Molen, Sense Jan

2015-11-26

The properties of any material are fundamentally determined by its electronic band structure. Each band represents a series of allowed states inside a material, relating electron energy and momentum. The occupied bands, that is, the filled electron states below the Fermi level, can be routinely measured. However, it is remarkably difficult to characterize the empty part of the band structure experimentally. Here, we present direct measurements of unoccupied bands of monolayer, bilayer and trilayer graphene. To obtain these, we introduce a technique based on low-energy electron microscopy. It relies on the dependence of the electron reflectivity on incidence angle and energy and has a spatial resolution ∼10 nm. The method can be easily applied to other nanomaterials such as van der Waals structures that are available in small crystals only.

Spins of superdeformed band in {sup 192}Hg

Energy Technology Data Exchange (ETDEWEB)

Lauritsen, T.; Khoo, T.L.; Henry, R.G. [and others

1995-08-01

Determination of the spins of SD states is the most important challenge in the study of superdeformation. Knowledge of the spin will provide crucial information on SD bands, in particular on the fascinating phenomenon of bands with identical energies and moments of inertia. Angular distribution coefficients of the {gamma}rays decaying out of the {sup 192}Hg SD band were determined using Eurogam data. These coefficients, as well as the spectral shape and multiplicity of the spectrum, are compared with the results of calculations, thereby providing a check on these calculations. From the measured decay multiplicity and the calculated average spin removed per photon (0.3 h), we deduce the average spin {bar I}{sub decay} removed by the {gamma} rays connecting SD and normal states. The spin I{sub SD} of the SD band from which the decay occurs is given by I{sub SD} = {bar I} decay + {bar I} ND, where {bar I} ND is the average spin removed by the normal yrast states. The state from which the major decay out of the SD band occurs is found to have spin 9.5 {plus_minus} 0.8 h. Since angular momentum is (quantized), this leads to a spin assignment of 9 or 10 h. The latter value is favored since the yrast band in the SD well must have only even spin values. This constitutes the first deduction of spin from data in the mass 150 and 190 regions. The spin of 10 h agrees with the spin which is inferred from a model, using the observed moment of inertia (Im){sup (2)}{omega}.

Wakefield Band Partitioning in LINAC Structures

International Nuclear Information System (INIS)

Jones, Roger M

2003-01-01

In the NLC project multiple bunches of electrons and positrons will be accelerated initially to a centre of mass of 500 GeV and later to 1 TeV or more. In the process of accelerating 192 bunches within a pulse train, wakefields are excited which kick the trailing bunches off axis and can cause luminosity dilution and BBU (Beam Break Up). Several structures to damp the wakefield have been designed and tested at SLAC and KEK and these have been found to successfully damp the wakefield [1]. However, these 2π/3 structures suffered from electrical breakdown and this has prompted us to explore lower group velocity structures operating at higher fundamental mode phase advances. The wakefield partitioning amongst the bands has been found to change markedly with increased phase advance. Here we report on general trends in the kick factor and associated wakefield band partitioning in dipole bands as a function of phase advance of the synchronous mode in linacs. These results are applicable to both TW (travelling wave) and SW (standing wave) structures

Radiometric Evaluation of SNPP VIIRS Band M11 via Sub-Kilometer Intercomparison with Aqua MODIS Band 7 over Snowy Scenes

Directory of Open Access Journals (Sweden)

Mike Chu

2018-03-01

Full Text Available A refined intersensor comparison study is carried out to evaluate the radiometric stability of the 2257 nm channel (M11 of the first Visible Infrared Imaging Radiometer Suite (VIIRS aboard the Suomi National Polar-orbiting Partnership (SNPP satellite. This study is initiated as part of the examination into the performance of key shortwave infrared (SWIR bands for SNPP VIIRS ocean color data processing and applications, with Band M11 playing key role over turbid and inland waters. The evaluation utilizes simultaneous nadir overpasses (SNOs to compare SNPP VIIRS Band M11 against Band 7 of the MODerate-resolution Imaging Spectroradiometer (MODIS in the Aqua satellite over concurrently observed scenes. The standard result of the radiance comparison is a seemingly uncontrolled and inconsistent time series unsuitable for further analyses, in great contrast to other matching band-pairs whose radiometric comparisons are typically stable around 1.0 within 1% variation. The mismatching relative spectral response (RSR between the two respective bands, with SNPP VIIRS M11 at 2225 to 2275 nm and Aqua MODIS B7 at 2125 to 2175 nm, is demonstrated to be the cause of the large variation because of the different dependence of the spectral responses of the two bands over identical scenes. A consistent radiometric comparison time series, however, can be extracted from SNO events that occur over snowy surfaces. A customized selection and analysis procedure successfully identifies the snowy scenes within the SNO events and builds a stable comparison time series. Particularly instrumental for the success of the comparison is the use of the half-kilometer spatial resolution data of Aqua MODIS B7 that significantly enhances the statistics. The final refined time series of Aqua MODIS B7 radiance over the SNPP VIIRS M11 radiance is stable at around 0.39 within 2.5% showing no evidence of drift. The radiometric ratio near 0.39 suggests the strong presence of medium

Band structure and orbital character of monolayer MoS2 with eleven-band tight-binding model

Science.gov (United States)

Shahriari, Majid; Ghalambor Dezfuli, Abdolmohammad; Sabaeian, Mohammad

2018-02-01

In this paper, based on a tight-binding (TB) model, first we present the calculations of eigenvalues as band structure and then present the eigenvectors as probability amplitude for finding electron in atomic orbitals for monolayer MoS2 in the first Brillouin zone. In these calculations we are considering hopping processes between the nearest-neighbor Mo-S, the next nearest-neighbor in-plan Mo-Mo, and the next nearest-neighbor in-plan and out-of-plan S-S atoms in a three-atom based unit cell of two-dimensional rhombic MoS2. The hopping integrals have been solved in terms of Slater-Koster and crystal field parameters. These parameters are calculated by comparing TB model with the density function theory (DFT) in the high-symmetry k-points (i.e. the K- and Γ-points). In our TB model all the 4d Mo orbitals and the 3p S orbitals are considered and detailed analysis of the orbital character of each energy level at the main high-symmetry points of the Brillouin zone is described. In comparison with DFT calculations, our results of TB model show a very good agreement for bands near the Fermi level. However for other bands which are far from the Fermi level, some discrepancies between our TB model and DFT calculations are observed. Upon the accuracy of Slater-Koster and crystal field parameters, on the contrary of DFT, our model provide enough accuracy to calculate all allowed transitions between energy bands that are very crucial for investigating the linear and nonlinear optical properties of monolayer MoS2.

A short note on dynamic programming in a band.

Science.gov (United States)

Gibrat, Jean-François

2018-06-15

Third generation sequencing technologies generate long reads that exhibit high error rates, in particular for insertions and deletions which are usually the most difficult errors to cope with. The only exact algorithm capable of aligning sequences with insertions and deletions is a dynamic programming algorithm. In this note, for the sake of efficiency, we consider dynamic programming in a band. We show how to choose the band width in function of the long reads' error rates, thus obtaining an [Formula: see text] algorithm in space and time. We also propose a procedure to decide whether this algorithm, when applied to semi-global alignments, provides the optimal score. We suggest that dynamic programming in a band is well suited to the problem of aligning long reads between themselves and can be used as a core component of methods for obtaining a consensus sequence from the long reads alone. The function implementing the dynamic programming algorithm in a band is available, as a standalone program, at: https://forgemia.inra.fr/jean-francois.gibrat/BAND_DYN_PROG.git.

Band gap tuning of amorphous Al oxides by Zr alloying

Energy Technology Data Exchange (ETDEWEB)

Canulescu, S., E-mail: stec@fotonik.dtu.dk; Schou, J. [Department of Photonics Engineering, Technical University of Denmark, 4000 Roskilde (Denmark); Jones, N. C.; Hoffmann, S. V. [ISA, Department of Physics and Astronomy, Aarhus University, 8000 Aarhus (Denmark); Borca, C. N.; Piamonteze, C. [Swiss Light Source, Paul Scherrer Institut, 5232 Villigen PSI (Switzerland); Rechendorff, K.; Nielsen, L. P.; Almtoft, K. P. [Danish Technological Institute, Kongsvang Alle 29, 8000 Aarhus (Denmark); Gudla, V. C.; Bordo, K.; Ambat, R. [Department of Mechanical Engineering, Technical University of Denmark, 2800 Kgs-Lyngby (Denmark)

2016-08-29

The optical band gap and electronic structure of amorphous Al-Zr mixed oxides with Zr content ranging from 4.8 to 21.9% were determined using vacuum ultraviolet and X-ray absorption spectroscopy. The light scattering by the nano-porous structure of alumina at low wavelengths was estimated based on the Mie scattering theory. The dependence of the optical band gap of the Al-Zr mixed oxides on the Zr content deviates from linearity and decreases from 7.3 eV for pure anodized Al{sub 2}O{sub 3} to 6.45 eV for Al-Zr mixed oxides with a Zr content of 21.9%. With increasing Zr content, the conduction band minimum changes non-linearly as well. Fitting of the energy band gap values resulted in a bowing parameter of ∼2 eV. The band gap bowing of the mixed oxides is assigned to the presence of the Zr d-electron states localized below the conduction band minimum of anodized Al{sub 2}O{sub 3}.

Band Alignment at GaN/Single-Layer WSe2 Interface

KAUST Repository

Tangi, Malleswararao

2017-02-21

We study the band discontinuity at the GaN/single-layer (SL) WSe2 heterointerface. The GaN thin layer is epitaxially grown by molecular beam epitaxy on chemically vapor deposited SL-WSe2/c-sapphire. We confirm that the WSe2 was formed as an SL from structural and optical analyses using atomic force microscopy, scanning transmission electron microscopy, micro-Raman, absorbance, and microphotoluminescence spectra. The determination of band offset parameters at the GaN/SL-WSe2 heterojunction is obtained by high-resolution X-ray photoelectron spectroscopy, electron affinities, and the electronic bandgap values of SL-WSe2 and GaN. The valence band and conduction band offset values are determined to be 2.25 ± 0.15 and 0.80 ± 0.15 eV, respectively, with type II band alignment. The band alignment parameters determined here provide a route toward the integration of group III nitride semiconducting materials with transition metal dichalcogenides (TMDs) for designing and modeling of their heterojunction-based electronic and optoelectronic devices.

Band Alignment at GaN/Single-Layer WSe2 Interface

KAUST Repository

Tangi, Malleswararao; Mishra, Pawan; Tseng, Chien-Chih; Ng, Tien Khee; Hedhili, Mohamed N.; Anjum, Dalaver H.; Alias, Mohd Sharizal; Wei, Nini; Li, Lain-Jong; Ooi, Boon S.

2017-01-01

We study the band discontinuity at the GaN/single-layer (SL) WSe2 heterointerface. The GaN thin layer is epitaxially grown by molecular beam epitaxy on chemically vapor deposited SL-WSe2/c-sapphire. We confirm that the WSe2 was formed as an SL from structural and optical analyses using atomic force microscopy, scanning transmission electron microscopy, micro-Raman, absorbance, and microphotoluminescence spectra. The determination of band offset parameters at the GaN/SL-WSe2 heterojunction is obtained by high-resolution X-ray photoelectron spectroscopy, electron affinities, and the electronic bandgap values of SL-WSe2 and GaN. The valence band and conduction band offset values are determined to be 2.25 ± 0.15 and 0.80 ± 0.15 eV, respectively, with type II band alignment. The band alignment parameters determined here provide a route toward the integration of group III nitride semiconducting materials with transition metal dichalcogenides (TMDs) for designing and modeling of their heterojunction-based electronic and optoelectronic devices.

Geographic and temporal differences in band reporting rates for American black ducks

Science.gov (United States)

Conroy, M.J.; Blandin, W.W.

1984-01-01

Recoveries of reward- and standard-banded American black ducks (Anas rubripes) were used to estimate band reporting rates and to investigate geographic and temporal variability in reporting rate for 1978-80. Reporting rates were higher close ( 20 km) to the parent banding site in 3 of 42 samples and were higher close to the nearest black duck banding site in 3 of 35 samples., Reporting rates were higher P 0.05) in Canada than in the Atlantic Flyway for the pre-huntIng season 1980-banded sample, but were otherwise similar among regions. Temporal differences over the duration of the study occured, but there were no consistent trends over time. The small number of rejections suggests that there is little evidence of differences in band reporting rate by proximity to banding sites, geographic location, or over time. Thus, the best estimate of band reporting rate for black ducks is a constant 0.43. This estimate should be used with caution, because we believe that it overestimates reporting rate due to the unknown proportion of reward bands found that were not reported.

X-band uplink feedcone capabilities, components, and layout

Science.gov (United States)

Marlin, H.; Freiley, A.; Hartop, R.

1986-01-01

Two new X-(7.2 GHz up, 8.4 GHz down) and S-band (2.1 to 2.3 Ghz) common aperture (XSC) feedcones are being added to the DSS 45 and DSS 65 34-Meter Efficiency Antennas. These new feedcones are modifications of the existing SXC feedcone design incorporating a new high power (20-kW) X-band transmitter. The modified Antenna Microwave Subsystem design also incorporates two additional X-band low noise amplifiers and greater phase stability performance to meet both the increased stability requirements for Galileo gravity wave experiments and requirements for spacecraft navigation near the Sun. A third XSC will be constructed for DSS 15 later.

Sub-band-gap laser micromachining of lithium niobate

DEFF Research Database (Denmark)

Christensen, F. K.; Müllenborn, Matthias

1995-01-01

method is reported which enables us to do laser processing of lithium niobate using sub-band-gap photons. Using high scan speeds, moderate power densities, and sub-band-gap photon energies results in volume removal rates in excess of 106µm3/s. This enables fast micromachining of small piezoelectric...

Optimum design of band-gap beam structures

DEFF Research Database (Denmark)

Olhoff, Niels; Niu, Bin; Cheng, Gengdong

2012-01-01

The design of band-gap structures receives increasing attention for many applications in mitigation of undesirable vibration and noise emission levels. A band-gap structure usually consists of a periodic distribution of elastic materials or segments, where the propagation of waves is impeded...... or significantly suppressed for a range of external excitation frequencies. Maximization of the band-gap is therefore an obvious objective for optimum design. This problem is sometimes formulated by optimizing a parameterized design model which assumes multiple periodicity in the design. However, it is shown...... in the present paper that such an a priori assumption is not necessary since, in general, just the maximization of the gap between two consecutive natural frequencies leads to significant design periodicity. The aim of this paper is to maximize frequency gaps by shape optimization of transversely vibrating...

Theoretical Prediction of the Forming Limit Band

International Nuclear Information System (INIS)

Banabic, D.; Paraianu, L.; Vos, M.; Jurco, P.

2007-01-01

Forming Limit Band (FLB) is a very useful tool to improve the sheet metal forming simulation robustness. Until now, the study of the FLB was only experimental. This paper presents the first attempt to model the FLB. The authors have established an original method for predicting the two margins of the limit band. The method was illustrated on the AA6111-T43 aluminum alloy. A good agreement with the experiments has been obtained

Theoretical Prediction of the Forming Limit Band

Science.gov (United States)

Banabic, D.; Vos, M.; Paraianu, L.; Jurco, P.

2007-04-01

Forming Limit Band (FLB) is a very useful tool to improve the sheet metal forming simulation robustness. Until now, the study of the FLB was only experimental. This paper presents the first attempt to model the FLB. The authors have established an original method for predicting the two margins of the limit band. The method was illustrated on the AA6111-T43 aluminum alloy. A good agreement with the experiments has been obtained.

Modification in band gap of zirconium complexes

Energy Technology Data Exchange (ETDEWEB)

Sharma, Mayank, E-mail: mayank30134@gmail.com; Singh, J.; Chouhan, S. [Department of Physics, ISLE, IPS Academy, Indore (M.P.) (India); Mishra, A. [School of Physics, Devi Ahilya Vishwavidyalaya, Indore (M.P.) (India); Shrivastava, B. D. [Govt. P. G. College, Biora (M.P.) (India)

2016-05-06

The optical properties of zirconium complexes with amino acid based Schiff bases are reported here. The zirconium complexes show interesting stereo chemical features, which are applicable in organometallic and organic synthesis as well as in catalysis. The band gaps of both Schiff bases and zirconium complexes were obtained by UV-Visible spectroscopy. It was found that the band gap of zirconium complexes has been modified after adding zirconium compound to the Schiff bases.

A superdeformed band in {sup 142}Sm

Energy Technology Data Exchange (ETDEWEB)

Hackman, G; Mullins, J M; Kuehner, J A; Prevost, D; Waddington, J C [McMaster Univ., Hamilton, ON (Canada). Dept. of Physics; Galindo-Uribarri, A; Janzen, V P; Radford, D C; Schmeing, N; Ward, D [Atomic Energy of Canada Ltd., Chalk River, ON (Canada). Chalk River Nuclear Labs.

1992-08-01

Observation of {gamma}-{gamma} coincidences from the reaction {sup 124}Sn({sup 24}Mg,6n){sup 142}Sm at 145 MeV indicates the existence of a rotational band with dynamic moment of inertia J{sup (2)} similar to that of the superdeformed band in the isotone {sup 143}Eu. This result is consistent with calculations predicting superdeformed structures in N = 80, Z {approx} 64 nuclei. (author). 8 refs., 4 figs.

Health Risks Faced by Public School Band Directors

Science.gov (United States)

Woolery, Danielle N.; Woolery, Jesse A.