Palma, Margarida; Dias, Paulo Jorge; Roque, Filipa de Canaveira; Luzia, Laura; Guerreiro, Joana Fernandes; Sá-Correia, Isabel
2017-01-13
The food spoilage yeast species Zygosaccharomyces bailii exhibits an extraordinary capacity to tolerate weak acids, in particular acetic acid. In Saccharomyces cerevisiae, the transcription factor Haa1 (ScHaa1) is considered the main player in genomic expression reprogramming in response to acetic acid stress, but the role of its homologue in Z. bailii (ZbHaa1) is unknown. In this study it is demonstrated that ZbHaa1 is a ScHaa1 functional homologue by rescuing the acetic acid susceptibility phenotype of S. cerevisiae haa1Δ. The disruption of ZbHAA1 in Z. bailii IST302 and the expression of an extra ZbHAA1 copy confirmed ZbHAA1 as a determinant of acetic acid tolerance. ZbHaa1 was found to be required for acetic acid stress-induced transcriptional activation of Z. bailii genes homologous to ScHaa1-target genes. An evolutionary analysis of the Haa1 homologues identified in 28 Saccharomycetaceae species genome sequences, including Z bailii, was carried out using phylogenetic and gene neighbourhood approaches. Consistent with previous studies, this analysis revealed a group containing pre-whole genome duplication species Haa1/Cup2 single orthologues, including ZbHaa1, and two groups containing either Haa1 or Cup2 orthologues from post-whole genome duplication species. S. cerevisiae Cup2 (alias Ace1) is a transcription factor involved in response and tolerance to copper stress. Taken together, these observations led us to hypothesize and demonstrate that ZbHaa1 is also involved in copper-induced transcriptional regulation and copper tolerance. The transcription factor ZbHaa1 is required for adaptive response and tolerance to both acetic acid and copper stresses. The subfunctionalization of the single ancestral Haa1/Cup2 orthologue that originated Haa1 and Cup2 paralogues after whole genome duplication is proposed.
Baleiras Couto, M.M.; Huis in 't Veld, J.H.J.
1995-01-01
Changes in the fatty acid profile of Zygosaccharomyces bailii strains, isolated from different sources, after growth at increasing concentrations of ethanol and/or decreasing temperatures were determined. Differences in fatty acid composition between Zygosaccharomyces bailii strains at standard
A differential medium for the enumeration of the spoilage yeast Zygosaccharomyces bailii in wine.
Schuller, D; Côrte-Real, M; Leão, C
2000-11-01
A collection of yeasts, isolated mostly from spoiled wines, was used in order to develop a differential medium for Zygosaccharomyces bailii. The 118 selected strains of 21 species differed in their origin and resistance to preservatives and belonged to the genera Pichia, Torulaspora, Dekkera, Debaryomyces, Saccharomycodes, Issatchenkia, Kluyveromyces, Kloeckera, Lodderomyces, Schizosaccharomyces, Rhodotorula, Saccharomyces, and Zygosaccharomyces. The design of the culture medium was based on the different ability of the various yeast species to grow in a mineral medium with glucose and formic acid (mixed-substrate medium) as the only carbon and energy sources and supplemented with an acid-base indicator. By manipulating the concentration of the acid and the sugar it was possible to select conditions where only Z. bailii strains gave rise to alkalinization, associated with a color change of the medium (positive response). The final composition of the mixed medium was adjusted as a compromise between the percentage of recovery and selectivity for Z. bailii. This was accomplished by the use of pure or mixed cultures of the yeast strains and applying the membrane filtration methodology. The microbiological analysis of two samples of contaminated Vinho Verde showed that the new medium can be considered as a differential medium to distinguish Z. bailii from other contaminating yeasts, having potential application in the microbiological control of wines and probably other beverages and foods.
Directory of Open Access Journals (Sweden)
Joana F Guerreiro
2016-01-01
Full Text Available Very high concentrations of acetic acid at low pH induce programmed cell death (PCD in both the experimental model Saccharomyces cerevisiae and in Zygosaccharomyces bailii, the latter being considered the most problematic acidic food spoilage yeast due to its remarkable intrinsic resistance to this food preservative. However, while the mechanisms underlying S. cerevisiae PCD induced by acetic acid have been previously examined, the corresponding molecular players remain largely unknown in Z. bailii. Also, the reason why acetic acid concentrations known to be necrotic for S. cerevisiae induce PCD with an apoptotic phenotype in Z. bailii remains to be elucidated. In this study, a 2-DE-based expression mitochondrial proteomic analysis was explored to obtain new insights into the mechanisms involved in PCD in the Z. bailii derived hybrid strain ISA1307. This allowed the quantitative assessment of expression of protein species derived from each of the parental strains, with special emphasis on the processes taking place in the mitochondria known to play a key role in acetic acid – induced PCD. A marked decrease in the content of proteins involved in mitochondrial metabolism, in particular, in respiratory metabolism (Cor1, Rip1, Lpd1, Lat1 and Pdb1, with a concomitant increase in the abundance of proteins involved in fermentation (Pdc1, Ald4, Dld3 was registered. Other differentially expressed identified proteins also suggest the involvement of the oxidative stress response, protein translation, amino acid and nucleotide metabolism, among other processes, in the PCD response. Overall, the results strengthen the emerging concept of the importance of metabolic regulation of yeast PCD.
Directory of Open Access Journals (Sweden)
Bateman Alex
2009-09-01
Full Text Available Abstract Background Peptidase family A1, to which pepsin belongs, had been assumed to be restricted to eukaryotes. The tertiary structure of pepsin shows two lobes with similar folds and it has been suggested that the gene has arisen from an ancient duplication and fusion event. The only sequence similarity between the lobes is restricted to the motif around the active site aspartate and a hydrophobic-hydrophobic-Gly motif. Together, these contribute to an essential structural feature known as a psi-loop. There is one such psi-loop in each lobe, and so each lobe presents an active Asp. The human immunodeficiency virus peptidase, retropepsin, from peptidase family A2 also has a similar fold but consists of one lobe only and has to dimerize to be active. All known members of family A1 show the bilobed structure, but it is unclear if the ancestor of family A1 was similar to an A2 peptidase, or if the ancestral retropepsin was derived from a half-pepsin gene. The presence of a pepsin homologue in a prokaryote might give insights into the evolution of the pepsin family. Results Homologues of the aspartic peptidase pepsin have been found in the completed genomic sequences from seven species of bacteria. The bacterial homologues, unlike those from eukaryotes, do not possess signal peptides, and would therefore be intracellular acting at neutral pH. The bacterial homologues have Thr218 replaced by Asp, a change which in renin has been shown to confer activity at neutral pH. No pepsin homologues could be detected in any archaean genome. Conclusion The peptidase family A1 is found in some species of bacteria as well as eukaryotes. The bacterial homologues fall into two groups, one from oceanic bacteria and one from plant symbionts. The bacterial homologues are all predicted to be intracellular proteins, unlike the eukaryotic enzymes. The bacterial homologues are bilobed like pepsin, implying that if no horizontal gene transfer has occurred the duplication
Simpson, M.; Mojibian, M.; Barriga, K.; Scott, F.W.; Fasano, A.; Rewers, M.; Norris, J.M.
2010-01-01
Aims To determine whether Glb1 homologue antibodies are associated with islet autoimmunity (IA) in children at increased risk for type 1 diabetes (T1D), and to investigate their relation with putative environmental correlates of T1D. Methods We selected a sample from the Diabetes Autoimmunity Study in the Young (DAISY), a prospective study of children at increased risk for T1D. Cases were those who were positive for insulin, glutamic acid decarboxylase (GAD), or insulinoma-associated antigen-2 (IA-2) autoantibodies on two consecutive visits and either diagnosed with diabetes mellitus or still autoantibody positive when selected. Controls were from the same increased risk group, of similar age as the cases but negative for autoantibodies. Sera from 91 IA cases and 82 controls were analyzed in a blinded manner for immunoglobulin G (IgG) antibodies to Glb1 homologue by ELISA. Results Adjusting for family history of T1D and HLA-DR4 positivity, Glb1 homologue antibodies were not associated with IA case status (OR: 1.01, 95% CI: 0.99 – 1.03). Adjusting for age, family history of T1D, and HLA-DR4 positivity, Glb1 homologue antibody levels were inversely associated with breast-feeding duration (beta = −0.08, p = 0.001) and directly associated with current intake of foods containing gluten (beta = 0.24, p = 0.007) in IA cases but not in controls. Zonulin, a biomarker of gut permeability, was directly associated with Glb1 homologue antibody levels in cases (beta = 0.73, p = 0.003) but not in controls. Conclusion Differences in correlates of Glb1 antibodies in IA cases and controls suggest an underlying difference in mucosal immune response. PMID:19622083
Palma, Margarida; Guerreiro, Joana F; Sá-Correia, Isabel
2018-01-01
Acetic acid is an important microbial growth inhibitor in the food industry; it is used as a preservative in foods and beverages and is produced during normal yeast metabolism in biotechnological processes. Acetic acid is also a major inhibitory compound present in lignocellulosic hydrolysates affecting the use of this promising carbon source for sustainable bioprocesses. Although the molecular mechanisms underlying Saccharomyces cerevisiae response and adaptation to acetic acid have been studied for years, only recently they have been examined in more detail in Zygosaccharomyces bailii . However, due to its remarkable tolerance to acetic acid and other weak acids this yeast species is a major threat in the spoilage of acidic foods and beverages and considered as an interesting alternative cell factory in Biotechnology. This review paper emphasizes genome-wide strategies that are providing global insights into the molecular targets, signaling pathways and mechanisms behind S. cerevisiae and Z. bailii tolerance to acetic acid, and extends this information to other weak acids whenever relevant. Such comprehensive perspective and the knowledge gathered in these two yeast species allowed the identification of candidate molecular targets, either for the design of effective strategies to overcome yeast spoilage in acidic foods and beverages, or for the rational genome engineering to construct more robust industrial strains. Examples of successful applications are provided.
Three TFL1 homologues regulate floral initiation in the biofuel plant Jatropha curcas
Li, Chaoqiong; Fu, Qiantang; Niu, Longjian; Luo, Li; Chen, Jianghua; Xu, Zeng-Fu
2017-01-01
Recent research revealed that TERMINAL FLOWER 1 (TFL1) homologues are involved in the critical developmental process of floral initiation in several plant species. In this study, the functions of three putative TFL1 homologues (JcTFL1a, JcTFL1b and JcTFL1c) in the biofuel plant Jatropha curcas were analysed using the transgenic approach. JcTFL1b and JcTFL1c, but not JcTFL1a, could complement the TFL1 function and rescue early flowering and determinate inflorescence phenotype in tfl1-14 Arabidopsis mutant, thus suggesting that JcTFL1b and JcTFL1c may be homologues of TFL1. Transgenic Jatropha overexpressing JcTFL1a, JcTFL1b or JcTFL1c showed late flowering, whereas only JcTFL1b and JcTFL1c overexpression delayed flowering in transgenic Arabidopsis. JcTFL1b-RNAi transgenic Jatropha consistently exhibited moderately early flowering phenotype. JcFT and JcAP1 were significantly downregulated in transgenic Jatropha overexpressing JcTFL1a, JcTFL1b or JcTFL1c, which suggested that the late flowering phenotype of these transgenic Jatropha may result from the repressed expression of JcFT and JcAP1. Our results indicate that these three JcTFL1 genes play redundant roles in repressing flowering in Jatropha. PMID:28225036
The fate of acetic acid during glucose co-metabolism by the spoilage yeast Zygosaccharomyces bailii.
Directory of Open Access Journals (Sweden)
Fernando Rodrigues
Full Text Available Zygosaccharomyces bailii is one of the most widely represented spoilage yeast species, being able to metabolise acetic acid in the presence of glucose. To clarify whether simultaneous utilisation of the two substrates affects growth efficiency, we examined growth in single- and mixed-substrate cultures with glucose and acetic acid. Our findings indicate that the biomass yield in the first phase of growth is the result of the weighted sum of the respective biomass yields on single-substrate medium, supporting the conclusion that biomass yield on each substrate is not affected by the presence of the other at pH 3.0 and 5.0, at least for the substrate concentrations examined. In vivo(13C-NMR spectroscopy studies showed that the gluconeogenic pathway is not operational and that [2-(13C]acetate is metabolised via the Krebs cycle leading to the production of glutamate labelled on C(2, C(3 and C(4. The incorporation of [U-(14C]acetate in the cellular constituents resulted mainly in the labelling of the protein and lipid pools 51.5% and 31.5%, respectively. Overall, our data establish that glucose is metabolised primarily through the glycolytic pathway, and acetic acid is used as an additional source of acetyl-CoA both for lipid synthesis and the Krebs cycle. This study provides useful clues for the design of new strategies aimed at overcoming yeast spoilage in acidic, sugar-containing food environments. Moreover, the elucidation of the molecular basis underlying the resistance phenotype of Z. bailii to acetic acid will have a potential impact on the improvement of the performance of S. cerevisiae industrial strains often exposed to acetic acid stress conditions, such as in wine and bioethanol production.
Cloning and characterization of maize ZmSPK1, a homologue to ...
African Journals Online (AJOL)
hope&shola
2006-03-15
Mar 15, 2006 ... homologue to nonfermenting1-related protein kinase2 ... RT-PCR analysis showed that the ZmSPK1 expression was induced by mannitol, salt and ... MAPKKK in which each component is activated by .... It has been one of the main ... Protein kinase ATP-binding region signature is shown in gray box.
Crystal structure of a bacterial homologue of glucose transporters GLUT1-4.
Sun, Linfeng; Zeng, Xin; Yan, Chuangye; Sun, Xiuyun; Gong, Xinqi; Rao, Yu; Yan, Nieng
2012-10-18
Glucose transporters are essential for metabolism of glucose in cells of diverse organisms from microbes to humans, exemplified by the disease-related human proteins GLUT1, 2, 3 and 4. Despite rigorous efforts, the structural information for GLUT1-4 or their homologues remains largely unknown. Here we report three related crystal structures of XylE, an Escherichia coli homologue of GLUT1-4, in complex with d-xylose, d-glucose and 6-bromo-6-deoxy-D-glucose, at resolutions of 2.8, 2.9 and 2.6 Å, respectively. The structure consists of a typical major facilitator superfamily fold of 12 transmembrane segments and a unique intracellular four-helix domain. XylE was captured in an outward-facing, partly occluded conformation. Most of the important amino acids responsible for recognition of D-xylose or d-glucose are invariant in GLUT1-4, suggesting functional and mechanistic conservations. Structure-based modelling of GLUT1-4 allows mapping and interpretation of disease-related mutations. The structural and biochemical information reported here constitutes an important framework for mechanistic understanding of glucose transporters and sugar porters in general.
Helliwell, S. B.; Wagner, P.; Kunz, J.; Deuter-Reinhard, M.; Henriquez, R.; Hall, M. N.
1994-01-01
The Saccharomyces cerevisiae genes TOR1 and TOR2 were originally identified by mutations that confer resistance to the immunosuppressant rapamycin. TOR2 was previously shown to encode an essential 282-kDa phosphatidylinositol kinase (PI kinase) homologue. The TOR1 gene product is also a large (281 kDa) PI kinase homologue, with 67% identity to TOR2. TOR1 is not essential, but a TOR1 TOR2 double disruption uniquely confers a cell cycle (G1) arrest as does exposure to rapamycin; disruption of T...
A lesion mimic phenotype in tomato obtained by isolating and silencing an Lls1 homologue
Spassieva, S; Hille, J
Lesion mimic phenotypes serve as a tool to study the regulation of cell death in plants. In order to obtain a tomato lesion mimic phenotype, we used the conservation of the lethal leaf spot 1 (Lls1) genes between plant species. The tomato Lls1 homologue was cloned, sequenced and analyzed. It showed
Directory of Open Access Journals (Sweden)
Moore Landon L
2008-02-01
Full Text Available Abstract Background The spindle checkpoint delays the onset of anaphase until all sister chromatids are aligned properly at the metaphase plate. To investigate the role san-1, the MAD3 homologue, has in Caenorhabditis elegans embryos we used RNA interference (RNAi to identify genes synthetic lethal with the viable san-1(ok1580 deletion mutant. Results The san-1(ok1580 animal has low penetrating phenotypes including an increased incidence of males, larvae arrest, slow growth, protruding vulva, and defects in vulva morphogenesis. We found that the viability of san-1(ok1580 embryos is significantly reduced when HCP-1 (CENP-F homologue, MDF-1 (MAD-1 homologue, MDF-2 (MAD-2 homologue or BUB-3 (predicted BUB-3 homologue are reduced by RNAi. Interestingly, the viability of san-1(ok1580 embryos is not significantly reduced when the paralog of HCP-1, HCP-2, is reduced. The phenotype of san-1(ok1580;hcp-1(RNAi embryos includes embryonic and larval lethality, abnormal organ development, and an increase in abnormal chromosome segregation (aberrant mitotic nuclei, anaphase bridging. Several of the san-1(ok1580;hcp-1(RNAi animals displayed abnormal kinetochore (detected by MPM-2 and microtubule structure. The survival of mdf-2(RNAi;hcp-1(RNAi embryos but not bub-3(RNAi;hcp-1(RNAi embryos was also compromised. Finally, we found that san-1(ok1580 and bub-3(RNAi, but not hcp-1(RNAi embryos, were sensitive to anoxia, suggesting that like SAN-1, BUB-3 has a functional role as a spindle checkpoint protein. Conclusion Together, these data suggest that in the C. elegans embryo, HCP-1 interacts with a subset of the spindle checkpoint pathway. Furthermore, the fact that san-1(ok1580;hcp-1(RNAi animals had a severe viability defect whereas in the san-1(ok1580;hcp-2(RNAi and san-1(ok1580;hcp-2(ok1757 animals the viability defect was not as severe suggesting that hcp-1 and hcp-2 are not completely redundant.
DEFF Research Database (Denmark)
Chrzanowski, L; Stasiewicz, M; Owsianiak, Mikolaj
2009-01-01
hypothesize that in the presence of diesel fuel low-water-soluble ionic liquids may become more toxic to hydrocarbon-degrading microorganisms. In this study the influence of 1-alkoxymethyl-2-methyl-5-hydroxypyridinium chloride homologues (side-chain length from C-3 to C-18) on biodegradation of diesel fuel...... by a bacterial consortium was investigated. Whereas test performed for the consortium cultivated on disodium succinate showed that toxicity of the investigated ionic liquids decreased with increase in side-chain length, only higher homologues (C-8-C-18) caused a decrease in diesel fuel biodegradation......, respectively. We conclude that in the presence of hydrocarbons acting as a solvent, the increased bioavailability of hydrophobic homologues is responsible for the decrease in biodegradation efficiency of diesel fuel....
Characterization of four RecQ homologues from rice (Oryza sativa L. cv. Nipponbare)
International Nuclear Information System (INIS)
Saotome, Ai; Kimura, Seisuke; Mori, Yoko; Uchiyama, Yukinobu; Morohashi, Kengo; Sakaguchi, Kengo
2006-01-01
The RecQ family of DNA helicases is conserved throughout the biological kingdoms. In this report, we have characterized four RecQ homologues clearly expressed in rice. OsRecQ1, OsRecQ886, and OsRecQsim expressions were strongly detected in meristematic tissues. Transcription of the OsRecQ homologues was differentially induced by several types of DNA-damaging agents. The expression of four OsRecQ homologues was induced by MMS and bleomycin. OsRecQ1 and OsRecQ886 were induced by H 2 O 2 , and MitomycinC strongly induced the expression of OsRecQ1. Transient expression of OsRecQ/GFP fusion proteins demonstrated that OsRecQ2 and OsRecQ886 are found in nuclei, whereas OsRecQ1 and OsRecQsim are found in plastids. Neither OsRecQ1 nor OsRecQsim are induced by light. These results indicate that four of the RecQ homologues have different and specific functions in DNA repair pathways, and that OsRecQ1 and OsRecQsim may not involve in plastid differentiation but different aspects of a plastid-specific DNA repair system
Energy Technology Data Exchange (ETDEWEB)
Lin, Jiusheng; Prahlad, Janani; Wilson, Mark A. (UNL)
2012-08-21
DJ-1 is a conserved, disease-associated protein that protects against oxidative stress and mitochondrial damage in multiple organisms. Human DJ-1 contains a functionally essential cysteine residue (Cys106) whose oxidation is important for regulating protein function by an unknown mechanism. This residue is well-conserved in other DJ-1 homologues, including two (DJ-1{alpha} and DJ-1{beta}) in Drosophila melanogaster. Because D. melanogaster is a powerful model system for studying DJ-1 function, we have determined the crystal structure and impact of cysteine oxidation on Drosophila DJ-1{beta}. The structure of D. melanogaster DJ-1{beta} is similar to that of human DJ-1, although two important residues in the human protein, Met26 and His126, are not conserved in DJ-1{beta}. His126 in human DJ-1 is substituted with a tyrosine in DJ-1{beta}, and this residue is not able to compose a putative catalytic dyad with Cys106 that was proposed to be important in the human protein. The reactive cysteine in DJ-1 is oxidized readily to the cysteine-sulfinic acid in both flies and humans, and this may regulate the cytoprotective function of the protein. We show that the oxidation of this conserved cysteine residue to its sulfinate form (Cys-SO{sub 2{sup -}}) results in considerable thermal stabilization of both Drosophila DJ-1{beta} and human DJ-1. Therefore, protein stabilization is one potential mechanism by which cysteine oxidation may regulate DJ-1 function in vivo. More generally, most close DJ-1 homologues are likely stabilized by cysteine-sulfinic acid formation but destabilized by further oxidation, suggesting that they are biphasically regulated by oxidative modification.
Homologue Pairing in Flies and Mammals: Gene Regulation When Two Are Involved
Directory of Open Access Journals (Sweden)
Manasi S. Apte
2012-01-01
Full Text Available Chromosome pairing is usually discussed in the context of meiosis. Association of homologues in germ cells enables chromosome segregation and is necessary for fertility. A few organisms, such as flies, also pair their entire genomes in somatic cells. Most others, including mammals, display little homologue pairing outside of the germline. Experimental evidence from both flies and mammals suggests that communication between homologues contributes to normal genome regulation. This paper will contrast the role of pairing in transmitting information between homologues in flies and mammals. In mammals, somatic homologue pairing is tightly regulated, occurring at specific loci and in a developmentally regulated fashion. Inappropriate pairing, or loss of normal pairing, is associated with gene misregulation in some disease states. While homologue pairing in flies is capable of influencing gene expression, the significance of this for normal expression remains unknown. The sex chromosomes pose a particularly interesting situation, as females are able to pair X chromosomes, but males cannot. The contribution of homologue pairing to the biology of the X chromosome will also be discussed.
Toxicities of emamectin benzoate homologues and photodegradates to Lepidoptera.
Argentine, Joseph A; Jansson, Richard K; Starner, Van R; Halliday, W Ross
2002-12-01
The toxicity of a number of emamectin benzoate homologues and photodegradates to five species of Lepidoptera was investigated using diet and foliar bioassays. The emamectin benzoate homologues B1a and B1b were equally toxic in the diet and foliar assays to Spodoptera exigua (Hübner), Heliothis virescens (F.), Tricoplusia ni (Hübner), and Spodoptera frugiperda (J. E. Smith), within each of these species. Plutella xylostella (L.) was the most sensitive species to emamectin benzoate. The AB1a photodegradate of emamectin benzoate was as toxic as the parent compound in the diet assay. However, in the foliage assay AB1a was 4.4-fold less toxic to S. exigua than the parent compound. The MFB1a photodegradate of emamectin benzoate was as toxic as the parent compound to P. xylostella, and 3.1 to 6.2 times as toxic as the parent compound to the other species in the diet assay. The order of toxicity of the photodegradates were AB1a > MFB1a > FAB1a > 8,9-Z-MAB1a > PAB1a.
Over-expression, purification and characterization of an Asc-1 homologue from Gloeobacter violaceus
DEFF Research Database (Denmark)
Wang, Xiaole; Hald, Helle; Ernst, Heidi Asschenfeldt
2010-01-01
The human alanine-serine-cysteine transporter 1 (Asc-1) belongs to the slc7a family of solute carrier transporters. Asc-1 mediates the uptake of D-serine in an exchanger-type fashion, coupling the process to the release of alanine and cysteine. Among the bacterial Asc-1 homologues, one transporter...... of auto-induction was crucial for obtaining high yields and purity of the transporter. The transporter was purified with yields in the range of 0.2-0.4 mg per L culture and eluted in a single peak from a size-exclusion column. The circular dichroism spectrum revealed a folded and apparently all...
Identification of aldehyde oxidase 1 and aldehyde oxidase homologue 1 as dioxin-inducible genes
International Nuclear Information System (INIS)
Rivera, Steven P.; Choi, Hyun Ho; Chapman, Brett; Whitekus, Michael J.; Terao, Mineko; Garattini, Enrico; Hankinson, Oliver
2005-01-01
Aldehyde oxidases are a family of highly related molybdo-flavoenzymes acting upon a variety of compounds of industrial and medical importance. We have identified aldehyde oxidase 1 (AOX1) as a 2,3,7,8-tetrachlorodibenzo-p-dioxin (dioxin) inducible gene in the mouse hepatoma cell line Hepa-1. AOX1 mRNA levels were not increased by dioxin in mutant derivatives of the Hepa-1 cell line lacking either functional aryl hydrocarbon receptor (AHR) or aryl hydrocarbon receptor nuclear translocator (ARNT) proteins, thus demonstrating that transcriptional induction of AOX1 in response to dioxin occurs through the AHR pathway. Dioxin induction of AOX1 mRNA was also observed in mouse liver. In addition, levels of AOX1 protein as well as those of aldehyde oxidase homologue 1 (AOH1), a recently identified homolog of AOX1, were elevated in mouse liver in response to dioxin. Employing an aldehyde oxidase specific substrate, AOX1/AOH1 activity was shown to be induced by dioxin in mouse liver. This activity was inhibited by a known inhibitor of aldehyde oxidases, and eliminated by including tungstate in the mouse diet, which is known to lead to inactivation of molybdoflavoenzymes, thus confirming that the enzymatic activity was attributable to AOX1/AOH1. Our observations thus identify two additional xenobiotic metabolizing enzymes induced by dioxin
Knappy, Chris; Barillà, Daniela; Chong, James; Hodgson, Dominic; Morgan, Hugh; Suleman, Muhammad; Tan, Christine; Yao, Peng; Keely, Brendan
2015-12-01
Higher homologues of widely reported C(86) isoprenoid diglycerol tetraether lipid cores, containing 0-6 cyclopentyl rings, have been identified in (hyper)thermophilic archaea, representing up to 21% of total tetraether lipids in the cells. Liquid chromatography-tandem mass spectrometry confirms that the additional carbon atoms in the C(87-88) homologues are located in the etherified chains. Structures identified include dialkyl and monoalkyl ('H-shaped') tetraethers containing C(40-42) or C(81-82) hydrocarbons, respectively, many representing novel compounds. Gas chromatography-mass spectrometric analysis of hydrocarbons released from the lipid cores by ether cleavage suggests that the C(40) chains are biphytanes and the C(41) chains 13-methylbiphytanes. Multiple isomers, having different chain combinations, were recognised among the dialkyl lipids. Methylated tetraethers are produced by Methanothermobacter thermautotrophicus in varying proportions depending on growth conditions, suggesting that methylation may be an adaptive mechanism to regulate cellular function. The detection of methylated lipids in Pyrobaculum sp. AQ1.S2 and Sulfolobus acidocaldarius represents the first reported occurrences in Crenarchaeota. Soils and aquatic sediments from geographically distinct mesotemperate environments that were screened for homologues contained monomethylated tetraethers, with di- and trimethylated structures being detected occasionally. The structural diversity and range of occurrences of the C(87-89) tetraethers highlight their potential as complementary biomarkers for archaea in natural environments. Copyright © 2015 John Wiley & Sons, Ltd.
Homologue Structure of the SLAC1 Anion Channel for Closing Stomata in Leaves
Energy Technology Data Exchange (ETDEWEB)
Y Chen; L Hu; M Punta; R Bruni; B Hillerich; B Kloss; B Rost; J Love; S Siegelbaum; W Hendrickson
2011-12-31
The plant SLAC1 anion channel controls turgor pressure in the aperture-defining guard cells of plant stomata, thereby regulating the exchange of water vapour and photosynthetic gases in response to environmental signals such as drought or high levels of carbon dioxide. Here we determine the crystal structure of a bacterial homologue (Haemophilus influenzae) of SLAC1 at 1.20 {angstrom} resolution, and use structure-inspired mutagenesis to analyse the conductance properties of SLAC1 channels. SLAC1 is a symmetrical trimer composed from quasi-symmetrical subunits, each having ten transmembrane helices arranged from helical hairpin pairs to form a central five-helix transmembrane pore that is gated by an extremely conserved phenylalanine residue. Conformational features indicate a mechanism for control of gating by kinase activation, and electrostatic features of the pore coupled with electrophysiological characteristics indicate that selectivity among different anions is largely a function of the energetic cost of ion dehydration.
International Nuclear Information System (INIS)
Bertin, Benjamin; Caby, Stephanie; Oger, Frederik; Sasorith, Souphatta; Wurtz, Jean-Marie; Pierce, Raymond J.
2005-01-01
In an attempt to understand development and differentiation processes of the parasitic blood fluke Schistosoma mansoni, several members of the nuclear receptor superfamily were cloned, including SmFtz-F1 (S. mansoni Fushi Tarazu-factor 1). The Ftz-F1 nuclear receptor subfamily only contains orphan receptors that bind to their response element as monomers. Whereas SmFtz-F1 displays these basic functional properties, we have identified an original and specific interaction between SmFtz-F1 and the schistosome RXR homologue, SmRXR1. The mammalian two-hybrid assay showed that the D, E, and F domains of SmFtz-F1 were capable of interacting specifically with the E domain of SmRXR1 but not with that of mouse RXRα. Using three-dimensional LBD homology modelling and structure-guided mutagenesis, we were able to demonstrate the essential role of exposed residues located in the dimerization interfaces of both receptors in the maintenance of the interaction. Cotransfection experiments with constructions encoding full-length nuclear receptors show that SmRXR1 potentiates the transcriptional activity of SmFtz-F1 from various promoters. Nevertheless, the lack of identification of a dimeric response element for this SmFtz-F1/SmRXR1 heterodimer seems to indicate a 'tethering' mechanism. Thus, our results suggest for the first time that a member of the Ftz-F1 family could heterodimerize functionally with a homologue of the universal heterodimerization partner of nuclear receptors. This unique property confirms that SmFtz-F1 may be involved in the development and differentiation of schistosome-specific structures
International Nuclear Information System (INIS)
Brown, J.S.; Boehm, P.D.; Sauer, T.C.; Wong, W.M.C.
1993-01-01
Techniques utilizing double ratio plots of selected polynuclear aromatic hydrocarbon (PAH) alkyl homologues were used to identify and distinguish crude oils and refined petroleum products from each other and to distinguish petroleum sources in complex pollutant regimes. Petroleum samples were fractionated by high performance liquid chromatography (HPLC) into saturated and aromatic (PAH) hydrocarbon fractions. The saturated hydrocarbon fractions were then analyzed by gas chromatography/flame ionization detection (GC/FID) to obtain a resolved/unresolved alkane fingerprint of each oil. The aromatic fractions of the oils were analyzed by gas chromatography/mass spectrometry (GC/MS) for PAH and selected alkyl homologues. Comparisons of the saturated hydrocarbon fingerprints indicated that some oils were indistinguishable based on the alkane fingerprint alone. Another double ratio plot of the alkyl chrysenes and alkyl dibenzothiophenes was effective in establishing the weathering of oil in environmental samples which were processed using the same analytical techniques, since the dibenzothiophenes are degraded more rapidly than the chrysenes. The application of selected ratios in oil spill source identification in complex environmental samples from Suisin Bay California and Boston Harbor are discussed. The use of ratios to measure the extent of weathering in oil spill samples from Prince William Sound and the Gulf of Alaska is examined
International Nuclear Information System (INIS)
Hayashi, Naoyuki; Murakami, Seishi; Tsurusaki, Susumu; Nagaura, Zen-ichiro; Oki, Masaya; Nishitani, Hideo; Kobayashi, Masahiko; Shimizu, Hiroko; Yamamoto, Ken-ichi; Nishimoto, Takeharu
2007-01-01
RanGTPase is involved in many cellular processes. It functions in nuclear-cytosolic transport and centrosome formation. Ran also localizes to chromatin as RCC1 does, its guanine nucleotide exchange factor, but Ran's function on chromatin is not known. We found that gsp1, a temperature-sensitive mutant of GSP1, a Saccharomyces cerevisiae Ran homologue, suppressed the hydroxyurea (HU) and ultra violet (UV) sensitivities of the mec1 mutant. In UV-irradiated mec1 gsp1 cells, Rad53 was phosphorylated despite the lack of Mec1. This suppression depended on the TEL1 gene, given that the triple mutant, mec1 gsp1 tel1, was unable to grow. The gsp1 mutations also suppressed the HU sensitivity of the rad9 mutant in a Tel1-dependent manner, but not the HU sensitivity of the rad53 mutant. These results indicated that Rad53 was activated by the Tel1 pathway in mec1 gsp1 cells, suggesting that Gsp1 helps regulate the role switching the ATM family kinases Mec1 and Tel1
Nilsson, G.; Svensson, G.
2001-01-01
Single crystals of four homologues in the series nBa(Nb,Zr)O3+3mNbO, with n:m=2:1, 3:1, 4:1, and 5:1, were found in the reduced Ba-Nb-Zr-O system. Single-crystal X-ray diffraction data were collected for all the crystals. For all homologues the space group was found to be P4/mmm. The structures can be described as intergrowths of Ba(Nb,Zr)O3 perovskite and NbO slabs. The refined cell parameters and compositions of the 2:1, 3:1, and 4:1 homologues are a=4.1768(5) Å and c=12.269(2) Å for Ba2Nb4.5(1)Zr0.5(1)O9, a=4.1769(5) Å and c=16.493(3) Å for Ba3+δNb4.8(2)-δ Zr1.2(2)O12-δ (δ=0.098(4)), and a=4.1747(6) Å and c= 20.619(4) Å for Ba4+δNb5.1(4)-δZr1.9(4)O15-δ (δ=0.270(9)). The refined cell parameters of the 5:1 homologue are a=4.1727(3) Å and c=24.804(3) Å. Zr replaces Nb only in the NbO6 octahedra found in the perovskite slabs.
Homologue Pairing in Flies and Mammals: Gene Regulation When Two Are Involved
Apte, Manasi S.; Meller, Victoria H.
2011-01-01
Chromosome pairing is usually discussed in the context of meiosis. Association of homologues in germ cells enables chromosome segregation and is necessary for fertility. A few organisms, such as flies, also pair their entire genomes in somatic cells. Most others, including mammals, display little homologue pairing outside of the germline. Experimental evidence from both flies and mammals suggests that communication between homologues contributes to normal genome regulation. This paper will co...
DEFF Research Database (Denmark)
Andersen, Ditte C; Jensen, Charlotte H; Schneider, Mikael
2010-01-01
Delta like 1 homologue (Dlk1) exists in both transmembrane and soluble molecular forms, and is implicated in cellular growth and plays multiple roles in development, tissue regeneration, and cancer. Thus, DLK1 levels are critical for cell function, and abnormal DLK1 expression can be lethal...... increases with cell density, and peaks at the same stage where membrane DLK1(M) and soluble DLK1(S) are found at maximum levels. Remarkably, miR-15a represses the amount of all Dlk1 variants at the mRNA level but also the level of DLK1(M) protein while it increases the amount of DLK1(S) supporting a direct...... while increasing cell numbers, scenarios that were completely rescued by addition of purified DLK1(S). Our data thus imply that miR-15a regulates cell size and proliferation by fine-tuning Dlk1 among others, and further emphasize miR-15a and DLK1 levels to play important roles in growth signaling...
Contribution of polycomb homologues Bmi-1 and Mel-18 to medulloblastoma pathogenesis.
Wiederschain, Dmitri; Chen, Lin; Johnson, Brett; Bettano, Kimberly; Jackson, Dowdy; Taraszka, John; Wang, Y Karen; Jones, Michael D; Morrissey, Michael; Deeds, James; Mosher, Rebecca; Fordjour, Paul; Lengauer, Christoph; Benson, John D
2007-07-01
Bmi-1 and Mel-18 are structural homologues that belong to the Polycomb group of transcriptional regulators and are believed to stably maintain repression of gene expression by altering the state of chromatin at specific promoters. While a number of clinical and experimental observations have implicated Bmi-1 in human tumorigenesis, the role of Mel-18 in cancer cell growth has not been investigated. We report here that short hairpin RNA-mediated knockdown of either Bmi-1 or Mel-18 in human medulloblastoma DAOY cells results in the inhibition of proliferation, loss of clonogenic survival, anchorage-independent growth, and suppression of tumor formation in nude mice. Furthermore, overexpression of both Bmi-1 and Mel-18 significantly increases the clonogenic survival of Rat1 fibroblasts. In contrast, stable downregulation of Bmi-1 or Mel-18 alone does not affect the growth of normal human WI38 fibroblasts. Proteomics-based characterization of Bmi-1 and Mel-18 protein complexes isolated from cancer cells revealed substantial similarities in their respective compositions. Finally, gene expression analysis identified a number of cancer-relevant pathways that may be controlled by Bmi-1 and Mel-18 and also showed that these Polycomb proteins regulate a set of common gene targets. Taken together, these results suggest that Bmi-1 and Mel-18 may have overlapping functions in cancer cell growth.
Impact of buffer gas quenching on the 1S0 → 1P1 ground-state atomic transition in nobelium
International Nuclear Information System (INIS)
Chhetri, P.; Lautenschlaeger, F.; Ackermann, D.; Backe, H.; Lauth, W.; Block, M.; Duellmann, C.E.; Goetz, S.; Cheal, B.; Wraith, C.; Even, J.; Ferrer, R.; Giacoppo, F.; Hessberger, F.P.; Khuyagbaatar, J.; Kishor Mistry, A.; Raeder, S.; Yakushev, A.; Kaleja, O.; Kunz, P.; Laatiaoui, M.; Minaya Ramirez, E.; Walther, T.
2017-01-01
Using the sensitive Radiation Detected Resonance Ionization Spectroscopy (RADRIS) technique an optical transition in neutral nobelium (No, Z = 102) was identified. A remnant signal when delaying the ionizing laser indicated the influence of a strong buffer gas induced de-excitation of the optically populated level. A subsequent investigation of the chemical homologue, ytterbium (Yb, Z = 70), enabled a detailed study of the atomic levels involved in this process, leading to the development of a rate equation model. This paves the way for characterizing resonance ionization spectroscopy (RIS) schemes used in the study of nobelium and beyond, where atomic properties are currently unknown. (authors)
Monolayer structures of alkyl aldehydes: Odd-membered homologues
International Nuclear Information System (INIS)
Phillips, T.K.; Clarke, S.M.; Bhinde, T.; Castro, M.A.; Millan, C.; Medina, S.
2011-01-01
Crystalline monolayers of three aldehydes with an odd number of carbon atoms in the alkyl chain (C 7 , C 9 and C 11 ) at low coverages are observed by a combination of X-ray and neutron diffraction. Analysis of the diffraction data is discussed and possible monolayer crystal structures are proposed; although unique structures could not be ascertained for all molecules. We conclude that the structures are flat on the surface, with the molecules lying in the plane of the layer. The C 11 homologue is determined to have a plane group of either p2, pgb or pgg, and for the C 7 homologue the p2 plane group is preferred.
Metheetrairut, Chanatip; Ahuja, Yuri; Slack, Frank J
2017-10-02
The heterochronic pathway in C. elegans controls the relative timing of cell fate decisions during post-embryonic development. It includes a network of microRNAs (miRNAs), such as let-7, and protein-coding genes, such as the stemness factors, LIN-28 and LIN-41. Here we identified the acn-1 gene, a homologue of mammalian angiotensin-converting enzyme (ACE), as a new suppressor of the stem cell developmental defects of let-7 mutants. Since acn-1 null mutants die during early larval development, we used RNAi to characterize the role of acn-1 in C. elegans seam cell development, and determined its interaction with heterochronic factors, including let-7 and its downstream interactors - lin-41, hbl-1, and apl-1. We demonstrate that although RNAi knockdown of acn-1 is insufficient to cause heterochronic defects on its own, loss of acn-1 suppresses the retarded phenotypes of let-7 mutants and enhances the precocious phenotypes of hbl-1, though not lin-41, mutants. Conversely, the pattern of acn-1 expression, which oscillates during larval development, is disrupted by lin-41 mutants but not by hbl-1 mutants. Finally, we show that acn-1(RNAi) enhances the let-7-suppressing phenotypes caused by loss of apl-1, a homologue of the Alzheimer's disease-causing amyloid precursor protein (APP), while significantly disrupting the expression of apl-1 during the L4 larval stage. In conclusion, acn-1 interacts with heterochronic genes and appears to function downstream of let-7 and its target genes, including lin-41 and apl-1.
Stasyk, Oleh V.; Stasyk, Olena G.; Komduur, Janet; Veenhuis, Marten; Cregg, James M.; Sibirny, Andrei A.
2004-01-01
Peroxisome biogenesis and synthesis of peroxisomal enzymes in the methylotrophic yeast Hansenula polymorpha are under the strict control of glucose repression. We identified an H. polymorpha glucose catabolite repression gene (HpGCR1) that encodes a hexose transporter homologue. Deficiency in GCR1
Directory of Open Access Journals (Sweden)
Wang Haiyang
2002-12-01
Full Text Available Abstract Background Constitutive photomorphogenic 1 (COP1 has been defined as a central regulator of photomorphogenic development in plants, which targets key transcription factors for proteasome-dependent degradation. Although COP1 mammalian homologue has been previously reported, its function and distribution in animal kingdom are not known. Results Here we report the characterization of full-length human and mouse COP1 cDNAs and the genomic structures of the COP1 genes from several different species. Mammalian COP1 protein binds to ubiquitinated proteins in vivo and is itself ubiquitinated. Furthermore, mammalian COP1 is predominately nuclear localized and exists primarily as a complex of over 700 kDa. Through mutagenesis studies, we have defined a leucine-rich nuclear export signal (NES within the coiled-coil domain of mammalian COP1 and a nuclear localization signal (NLS, which is composed of two clusters of positive-charged amino acids, bridged by the RING finger. Disruption of the RING finger structure abolishes the nuclear import, while deletion of the entire RING finger restores the nuclear import. Conclusions Our data suggest that mammalian COP1, similar to its plant homologue, may play a role in ubiquitination. Mammalian COP1 contains a classic leucine-rich NES and a novel bipartite NLS bridged by a RING finger domain. We propose a working model in which the COP1 RING finger functions as a structural scaffold to bring two clusters of positive-charged residues within spatial proximity to mimic a bipartite NLS. Therefore, in addition to its well-characterized role in ubiquitination, the RING finger domain may also play a structural role in nuclear import.
Qi, Shengcai; Yan, Yanhong; Wen, Yue; Li, Jialiang; Wang, Jing; Chen, Fubo; Tang, Xiaoshan; Shang, Guangwei; Xu, Yuanzhi; Wang, Raorao
2017-06-01
This study aimed to investigate the functions of delta-like homologue 1 (DLK1) in the proliferation and differentiation of human dental pulp stem cells (hDPSCs). Immunohistochemical analysis was used to determine the expression of alkaline phosphatase (ALP), dentin sialophosphoprotein (DSPP), DLK1, NOTCH1 and p-ERK1/2 in the mouse first maxillary molar. Recombinant lentivirus was constructed to overexpress DLK1 stably in hDPSCs. The cell viability and proliferation of hDPSCs were examined by CCK8 and EdU incorporation assay respectively. The odontoblastic differentiation of hDPSCs was determined by detection of ALPase activity assay, ALP and alizarin red staining and the expression of mineralization-related genes including ALP, DSPP and dental matrix protein. The mRNA and protein levels of DLK1 and p-ERK1/2 protein expression were detected. ERK inhibitor was used to test the differentiation effect of DLK1 on hDPSCs. Delta-like homologue 1 was highly expressed on the odontoblasts and dental pulp cells on the first maxillary molar; the expression of p-ERK1/2 is similar with the DLK1 in the same process. The expression level of DLK1 increased significantly after the odontoblastic induction of hDPSCs. DLK1 overexpression increased the proliferation ability of hDPSCs and inhibited odontoblastic differentiation of hDPSCs. The protein level of p-ERK1/2 significantly increased in hDPSCs/dlk1-oe group. ERK signalling pathway inhibitor reversed the odontoblastic differentiation effects of DLK1 on hDPSCs. The proliferation of hDPSCs was promoted after DLK1 overexpression. DLK1 inhibited the odontoblastic differentiation of hDPSCs, which maybe through ERK signalling pathway. © 2017 John Wiley & Sons Ltd.
The expression of the rice (Oryza sativa L.) homologue of Snm1 is induced by DNA damages
International Nuclear Information System (INIS)
Kimura, Seisuke; Saotome, Ai; Uchiyama, Yukinobu; Mori, Yoko; Tahira, Yasue; Sakaguchi, Kengo
2005-01-01
We isolated and characterized the rice homologue of the DNA repair gene Snm1 (OsSnm1). The length of the cDNA was 1862 bp; the open reading frame encoded a predicted product of 485 amino acid residues with a molecular mass of 53.2 kDa. The OsSnm1 protein contained the conserved β-lactamase domain in its internal region. OsSnm1 was expressed in all rice organs. The expression was induced by MMS, H 2 O 2 , and mitomycin C, but not by UV. Transient expression of an OsSnm1/GFP fusion protein in onion epidermal cells revealed the localization of OsSnm1 to the nucleus. These results suggest that OsSnm1 is involved not only in the repair of DNA interstrand crosslinks, but also in various other DNA repair pathways
Bakker, E; Butterbach, P; Rouppe van der Voort, J; van der Vossen, E; van Vliet, J; Bakker, J; Goverse, A
2003-05-01
Nine resistance gene homologues (RGHs) were identified in two diploid potato clones (SH and RH), with a specific primer pair based on conserved motifs in the LRR domain of the potato cyst nematode resistance gene Gpa2 and the potato virus X resistance gene Rx1. A modified AFLP method was used to facilitate the genetic mapping of the RGHs in the four haplotypes under investigation. All nine RGHs appeared to be located in the Gpa2/ Rx1 cluster on chromosome XII. Construction of a physical map using bacterial artificial chromosome (BAC) clones for both the Solanum tuberosum ssp. tuberosum and the S. tuberosum ssp. andigena haplotype of SH showed that the RGHs are located within a stretch of less than 200 kb. Sequence analysis of the RGHs revealed that they are highly similar (93 to 95%) to Gpa2 and Rx1. The sequence identities among all RGHs range from 85 to 100%. Two pairs of RGHs are identical, or nearly so (100 and 99.9%), with each member located in a different genotype. Southern-blot analysis on genomic DNA revealed no evidence for additional homologues outside the Gpa2/ Rx1 cluster on chromosome XII.
Identification of possible targets of the Aspergillus fumigatus CRZ1 homologue, CrzA
Directory of Open Access Journals (Sweden)
Goldman Gustavo H
2010-01-01
Full Text Available Abstract Background Calcineurin, a serine/threonine-specific protein phosphatase, plays an important role in the control of cell morphology and virulence in fungi. Calcineurin regulates localization and activity of a transcription factor called CRZ1. Recently, we characterize Aspergillus fumigatus CRZ1 homologue, AfCrzA. Here, we investigate which pathways are influenced by A. fumigatus AfCrzA during a short pulse of calcium by comparatively determining the transcriptional profile of A. fumigatus wild type and ΔAfcrzA mutant strains. Results We were able to observe 3,622 genes modulated in at least one timepoint in the mutant when compared to the wild type strain (3,211 and 411 at 10 and 30 minutes, respectively. Decreased mRNA abundance in the ΔcrzA was seen for genes encoding calcium transporters, transcription factors and genes that could be directly or indirectly involved in calcium metabolism. Increased mRNA accumulation was observed for some genes encoding proteins involved in stress response. AfCrzA overexpression in A. fumigatus increases the expression of several of these genes. The deleted strain of one of these genes, AfRcnA, belonging to a class of endogenous calcineurin regulators, calcipressins, had more calcineurin activity after exposure to calcium and was less sensitive to menadione 30 μM, hydrogen peroxide 2.5 mM, EGTA 25 mM, and MnCl2 25 mM. We constructed deletion, overexpression, and GFP fusion protein for the closely related A. nidulans AnRcnA. GFP::RcnA was mostly detected along the germling, did not accumulate in the nuclei and its location is not affected by the cellular response to calcium chloride. Conclusion We have performed a transcriptional profiling analysis of the A. fumigatus ΔAfcrzA mutant strain exposed to calcium stress. This provided an excellent opportunity to identify genes and pathways that are under the influence of AfCrzA. AfRcnA, one of these selected genes, encodes a modulator of calcineurin
The role of the leukemia-associated ETO homologue repressors in hematopoiesis
Olsson, André
2006-01-01
The fusion protein AML1-ETO is observed in acute myeloid patients with the chromosomal translocation t(8;21). Cells with this chimeric protein have impaired granulocytic and erythroid differentiation with accumulation of myeloblasts. The transcriptional co-repressor ETO (Eight Twenty One) was identified from the cloning of AML1-ETO. Subsequently, MTGR1 (Myeloid Translocation Gene-Related protein 1) and MTG16 (Myeloid Translocation Gene on chromosome 16) were found to be homologues to ETO, all...
The Mycobacterium tuberculosis homologue of the Mycobacterium ...
African Journals Online (AJOL)
With the completion of genome sequencing of Mycobacterium tuberculosis and upsurge in the incidence of M. tuberculosis infection worldwide partly as a result of HIV pandemic, there is need for rationale approach to vaccine and chemotherapy discoveries for M. tuberculosis. The homologue of mig gene of. Mycobacterium ...
Detection of a Yersinia pestis gene homologue in rodent samples
Directory of Open Access Journals (Sweden)
Timothy A. Giles
2016-08-01
Full Text Available A homologue to a widely used genetic marker, pla, for Yersinia pestis has been identified in tissue samples of two species of rat (Rattus rattus and Rattus norvegicus and of mice (Mus musculus and Apodemus sylvaticus using a microarray based platform to screen for zoonotic pathogens of interest. Samples were from urban locations in the UK (Liverpool and Canada (Vancouver. The results indicate the presence of an unknown bacterium that shares a homologue for the pla gene of Yersinia pestis, so caution should be taken when using this gene as a diagnostic marker.
International Nuclear Information System (INIS)
Ohno, Shuji; Miyahara, Shinya; Kurata, Yuji; Katsura, Ryoei; Yoshida, Shigeru
2006-01-01
Experimental study using the transpiration method investigates equilibrium evaporation behavior of radionuclide polonium ( 210 Po) generated and accumulated in liquid lead-bismuth eutectic (LBE) cooled nuclear systems. The experiment consists of two series of tests: preliminary evaporation tests for homologue element tellurium (Te) in LBE, and evaporation tests for 210 Po-accumulated LBE in which test specimens are prepared by neutron irradiation. The evaporation tests of Te in LBE provide the suggestion that Te exists in a chemical form of PbTe as well as the information for confirming the validity of technique and conditions of Po test. From the evaporation tests of 210 Po in LBE, we obtain fundamental data and empirical equations such as 210 Po vapor concentration in the gas phase, 210 Po partial vapor pressure, thermodynamic activity coefficients, and gas-liquid equilibrium partition coefficient of 210 Po in LBE in the temperature range from 450 to 750degC. Additionally, radioactivity concentration of 210 Po and 210m Bi vapor in a cover gas region of a typical LBE-cooled nuclear system is specifically estimated based on the obtained experimental results, and the importance of 210 Po evaporation behavior is quantitatively demonstrated. (author)
International Nuclear Information System (INIS)
Elegheert, Jonathan; Hemel, Debbie van den; Dix, Ina; Stout, Jan; Van Beeumen, Jozef; Brigé, Ann; Savvides, Savvas N.
2009-01-01
Of the four old yellow enzyme homologues found in S. oneidensis, SYE4 is the homologue most implicated in resistance to oxidative stress. SYE4 was recombinantly expressed in Escherichia coli, purified and crystallized using the hanging-drop vapour-diffusion method. Shewanella oneidensis is an environmentally versatile Gram-negative γ-proteobacterium that is endowed with an unusually large proteome of redox proteins. Of the four old yellow enzyme (OYE) homologues found in S. oneidensis, SYE4 is the homologue most implicated in resistance to oxidative stress. SYE4 was recombinantly expressed in Escherichia coli, purified and crystallized using the hanging-drop vapour-diffusion method. The crystals belonged to the orthorhombic space group P2 1 2 1 2 1 and were moderately pseudo-merohedrally twinned, emulating a P422 metric symmetry. The native crystals of SYE4 were of exceptional diffraction quality and provided complete data to 1.10 Å resolution using synchrotron radiation, while crystals of the reduced enzyme and of the enzyme in complex with a wide range of ligands typically led to high-quality complete data sets to 1.30–1.60 Å resolution, thus providing a rare opportunity to dissect the structure–function relationships of a good-sized enzyme (40 kDa) at true atomic resolution. Here, the attainment of a number of experimental milestones in the crystallographic studies of SYE4 and its complexes are reported, including isolation of the elusive hydride–Meisenheimer complex
Identification of a candidate CD5 homologue in the amphibian Xenopus laevis.
Jürgens, J B; Gartland, L A; Du Pasquier, L; Horton, J D; Göbel, T W; Cooper, M D
1995-11-01
We identified a novel T cell Ag in the South African clawed toad (Xenopus laevis) by a mAb designated 2B1. This Ag is present in relatively high levels on most thymocytes, approximately 65% of splenocytes, 55% of PBL, and 65% of intestinal lymphocytes, but is rarely seen on IgM+ B cells in any of these tissues. Lymphocytes bearing the 2B1 Ag proliferate in response to stimulation with Con A or PHA, whereas the 2B1- lymphocytes are reactive to LPS. Biochemical analysis indicates that this Ag is a differentially phosphorylated glycoprotein of 71 to 82 kDa. The protein core of 64 kDa bears both N- and O-linked carbohydrate side chains. The amino-terminal protein sequence of the 2B1 Ag shares significant homology with both the macrophage scavenger receptor type 1 motif and the mammalian CD5/CD6 family. The biochemical characteristics and cellular distribution of the 2B1 Ag suggest that it represents the CD5 homologue in X. laevis. While T cells constitutively express this highly conserved molecule, Xenopus B cells acquire the CD5 homologue only when they are stimulated in the presence of T cells.
Phosphatase and tensin homologue deleted on chromosome 10 ...
African Journals Online (AJOL)
Phosphatase and tensin homologue deleted on chromosome 10 (PTEN) is a tumor suppressor gene deleted or mutated in many human cancers such as glioblastoma, spinal tumors, prostate, bladder, adrenals, thyroid, breast, endometrium, and colon cancers. They result from loss of heterozygosity (LOH) for the PTEN ...
Govindaraju, Gayathri; Jabeena, C A; Sethumadhavan, Devadathan Valiyamangalath; Rajaram, Nivethika; Rajavelu, Arumugam
2017-10-01
In eukaryotes, cytosine methylation regulates diverse biological processes such as gene expression, development and maintenance of genomic integrity. However, cytosine methylation and its functions in pathogenic apicomplexan protozoans remain enigmatic. To address this, here we investigated the presence of cytosine methylation in the nucleic acids of the protozoan Plasmodium falciparum. Interestingly, P. falciparum has TRDMT1, a conserved homologue of DNA methyltransferase DNMT2. However, we found that TRDMT1 did not methylate DNA, in vitro. We demonstrate that TRDMT1 methylates cytosine in the endogenous aspartic acid tRNA of P. falciparum. Through RNA bisulfite sequencing, we mapped the position of 5-methyl cytosine in aspartic acid tRNA and found methylation only at C38 position. P. falciparum proteome has significantly higher aspartic acid content and a higher proportion of proteins with poly aspartic acid repeats than other apicomplexan pathogenic protozoans. Proteins with such repeats are functionally important, with significant roles in host-pathogen interactions. Therefore, TRDMT1 mediated C38 methylation of aspartic acid tRNA might play a critical role by translational regulation of important proteins and modulate the pathogenicity of the malarial parasite. Copyright © 2017 Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Azevedo, W.F.; Ward, R.J.; Lombardi, F.R.; Arni, R.K.; Soares, A.M.; Giglio, J.R.; Fontes, M.R.M.
1997-01-01
Full text. Phospho lipases A2 (PLA 2 ; E C 3.1.1.4, phosphatides s n-2 acyl hydrolases) hydrolysis the s n-2 ester bond of phospholipids showing enhanced activity at lamellar or membrane surfaces. Intracellular PLA 2 s are involved at phospholipid metabolism and signal transduction, whereas extracellular PLA 2 s are found in mammalian pancreatic juices, the venoms of snakes, lizards and insects. Based on their high primary sequence similarity, extracellular PLA 2 s are separated into Classes I, II and III. Class II PLA 2 s are found in snake venoms of Crotalidae an Viperidae species, and include the sub-family of Lys PLA 2 s homologue. he coordination of the Ca 2+ ion in the PLA 2 calcium-binding loop includes and aspartate at position 49. In the catalytically active PLA 2 s, this calcium ion plays a critical role in the stabilization of the tetrahedral transition state intermediate in the catalytic mechanism. The conservative substitution Asp49-Lys results in a decreased calcium affinity with a concomitant loss of catalytic activity, and naturally occurring PLA 2 s-homologues showing the same substitution are catalytically inactive. However, the Lys PLA 2 s possess cytolytic and myotoxic activities and furthermore retain the ability to disrupt the integrity of both plasma membranes and model lipid layers by a ca 2+ -independent mechanism for which there is no evidence of lipid hydrolysis. Lys 49 PLA 2 homologues have been isolated from several Bothrops spp. venoms including B. moojeni. Therefore, in order to improve our understanding of the molecular basis of the myotoxic and Ca 2+ independent membrane damaging activities we have determined the crystal structure of MjTX-II, a Lys 49 homologue from the venom of B. moojeni. The model presented has been determined at 2.0 A resolution and refined to a crystallographic residual of 19.7% (R f ree=28.1%). (author)
Koronowski, Kevin B; Khoury, Nathalie; Saul, Isabel; Loris, Zachary B; Cohan, Charles H; Stradecki-Cohan, Holly M; Dave, Kunjan R; Young, Juan I; Perez-Pinzon, Miguel A
2017-11-01
Resveratrol, at least in part via SIRT1 (silent information regulator 2 homologue 1) activation, protects against cerebral ischemia when administered 2 days before injury. However, it remains unclear if SIRT1 activation must occur, and in which brain cell types, for the induction of neuroprotection. We hypothesized that neuronal SIRT1 is essential for resveratrol-induced ischemic tolerance and sought to characterize the metabolic pathways regulated by neuronal Sirt1 at the cellular level in the brain. We assessed infarct size and functional outcome after transient 60 minute middle cerebral artery occlusion in control and inducible, neuronal-specific SIRT1 knockout mice. Nontargeted primary metabolomics analysis identified putative SIRT1-regulated pathways in brain. Glycolytic function was evaluated in acute brain slices from adult mice and primary neuronal-enriched cultures under ischemic penumbra-like conditions. Resveratrol-induced neuroprotection from stroke was lost in neuronal Sirt1 knockout mice. Metabolomics analysis revealed alterations in glucose metabolism on deletion of neuronal Sirt1 , accompanied by transcriptional changes in glucose metabolism machinery. Furthermore, glycolytic ATP production was impaired in acute brain slices from neuronal Sirt1 knockout mice. Conversely, resveratrol increased glycolytic rate in a SIRT1-dependent manner and under ischemic penumbra-like conditions in vitro. Our data demonstrate that resveratrol requires neuronal SIRT1 to elicit ischemic tolerance and identify a novel role for SIRT1 in the regulation of glycolytic function in brain. Identification of robust neuroprotective mechanisms that underlie ischemia tolerance and the metabolic adaptations mediated by SIRT1 in brain are crucial for the translation of therapies in cerebral ischemia and other neurological disorders. © 2017 American Heart Association, Inc.
Directory of Open Access Journals (Sweden)
Nikola Kellner
2014-01-01
Full Text Available The conserved NineTeen protein complex (NTC is an integral subunit of the spliceosome and required for intron removal during pre-mRNA splicing. The complex associates with the spliceosome and participates in the regulation of conformational changes of core spliceosomal components, stabilizing RNA-RNA- as well as RNA-protein interactions. In addition, the NTC is involved in cell cycle checkpoint control, response to DNA damage, as well as formation and export of mRNP-particles. We have identified the Num1 protein as the homologue of SPF27, one of NTC core components, in the basidiomycetous fungus Ustilago maydis. Num1 is required for polarized growth of the fungal hyphae, and, in line with the described NTC functions, the num1 mutation affects the cell cycle and cell division. The num1 deletion influences splicing in U. maydis on a global scale, as RNA-Seq analysis revealed increased intron retention rates. Surprisingly, we identified in a screen for Num1 interacting proteins not only NTC core components as Prp19 and Cef1, but several proteins with putative functions during vesicle-mediated transport processes. Among others, Num1 interacts with the motor protein Kin1 in the cytoplasm. Similar phenotypes with respect to filamentous and polar growth, vacuolar morphology, as well as the motility of early endosomes corroborate the genetic interaction between Num1 and Kin1. Our data implicate a previously unidentified connection between a component of the splicing machinery and cytoplasmic transport processes. As the num1 deletion also affects cytoplasmic mRNA transport, the protein may constitute a novel functional interconnection between the two disparate processes of splicing and trafficking.
Vetere, A; Li, W-C; Paroni, F; Juhl, K; Guo, L; Nishimura, W; Dai, X; Bonner-Weir, S; Sharma, A
2010-01-01
The basic helix-loop-helix transcription factor neurogenin-3 (NGN3) commits the fates of pancreatic progenitors to endocrine cell types, but knowledge of the mechanisms regulating the choice between proliferation and differentiation of these progenitors is limited. Using a chromatin immunoprecipitation cloning approach, we searched for direct targets of NGN3 and identified a zinc-finger transcription factor, OVO homologue-like 1 (OVOL1). Transactivation experiments were carried out to elucidate the functional role of NGN3 in Ovol1 gene expression. Embryonic and adult rodents pancreases were immunostained for OVOL1, Ki67 and NGN3. We showed that NGN3 negatively regulates transcription of Ovol1 in an E-box-dependent fashion. The presence of either NGN3 or NEUROD1, but not MYOD, reduced endogenous Ovol1 mRNA. OVOL1 was detected in pancreatic tissue around embryonic day 15.5, after which OVOL1 levels dramatically increased. In embryonic pancreas, OVOL1 protein levels were low in NGN3(+) or Ki67(+) cells, but high in quiescent differentiated cells. OVOL1 presence was maintained in adult pancreas, where it was detected in islets, pancreatic ducts and some acinar cells. Additionally OVOL1 presence was lacking in proliferating ductules in regenerating pancreas and induced in cells as they began to acquire their differentiated phenotype. The timing of OVOL1 appearance in pancreas and its increased levels in differentiated cells suggest that OVOL1 promotes the transition of cells from a proliferating, less-differentiated state to a quiescent more-differentiated state. We conclude that OVOL1, a downstream target of NGN3, may play an important role in regulating the balance between proliferation and differentiation of pancreatic cells.
Identification of NoxD/Pro41 as the homologue of the p22phox NADPH oxidase subunit in fungi.
Lacaze, Isabelle; Lalucque, Hervé; Siegmund, Ulrike; Silar, Philippe; Brun, Sylvain
2015-03-01
NADPH oxidases (Nox) are membrane complexes that produce O2(-). Researches in mammals, plants and fungi highlight the involvement of Nox-generated ROS in cell proliferation, differentiation and defense. In mammals, the core enzyme gp91(phox)/Nox2 is associated with p22(phox) forming the flavocytochrome b558 ready for activation by a cytosolic complex. Intriguingly, no homologue of the p22(phox) gene has been found in fungal genomes, questioning how the flavoenzyme forms. Using whole genome sequencing combined with phylogenetic analysis and structural studies, we identify the fungal p22(phox) homologue as being mutated in the Podospora anserina mutant IDC(509). Functional studies show that the fungal p22(phox), PaNoxD, acts along PaNox1, but not PaNox2, a second fungal gp91(phox) homologue. Finally, cytological analysis of functional tagged versions of PaNox1, PaNoxD and PaNoxR shows clear co-localization of PaNoxD and PaNox1 and unravel a dynamic assembly of the complex in the endoplasmic reticulum and in the vacuolar system. © 2014 John Wiley & Sons Ltd.
Lin, Yuan-Na; Bhuwania, Ridhirama; Gromova, Kira; Failla, Antonio Virgilio; Lange, Tobias; Riecken, Kristoffer; Linder, Stefan; Kneussel, Matthias; Izbicki, Jakob R; Windhorst, Sabine
2015-07-30
Drosophila homologue of Diaphanous 1 (DIAPH1) regulates actin polymerization and microtubule (MT) stabilization upon stimulation with lysophosphatidic acid (LPA). Recently, we showed strongly reduced lung metastasis of DIAPH1-depleted colon cancer cells but we found accumulations of DIAPH1-depleted cells in bone marrow. Here, we analyzed possible organ- or tissue-specific metastasis of DIAPH1-depleted HCT-116 cells. Our data confirmed that depletion of DIAPH1 strongly inhibited lung metastasis and revealed that, in contrast to control cells, DIAPH1-depleted cells did not form metastases in further organs. Detailed mechanistic analysis on cells that were not stimulated with LPA to activate the cytoskeleton-modulating activity of DIAPH1, revealed that even under basal conditions DIAPH1 was essential for cellular adhesion to collagen. In non-stimulated cells DIAPH1 did not control actin dynamics but, interestingly, was essential for stabilization of microtubules (MTs). Additionally, DIAPH1 controlled directed vesicle trafficking and with this, local clustering of the adhesion protein integrin-β1 at the plasma membrane. Therefore, we conclude that under non-stimulating conditions DIAPH1 controls cellular adhesion by stabilizing MTs required for local clustering of integrin-β1 at the plasma membrane. Thus, blockade of DIAPH1-tubulin interaction may be a promising approach to inhibit one of the earliest steps in the metastatic cascade of colon cancer.
Alexiadis, Anastasios; Delidakis, Christos; Kalantidis, Kriton
2017-07-01
The conserved 3'-5' RNA exonuclease ERI1 is implicated in RNA interference inhibition, 5.8S rRNA maturation and histone mRNA maturation and turnover. The single ERI1 homologue in Drosophila melanogaster Snipper (Snp) is a 3'-5' exonuclease, but its in vivo function remains elusive. Here, we report Snp requirement for normal Drosophila development, since its perturbation leads to larval arrest and tissue-specific downregulation results in abnormal tissue development. Additionally, Snp directly interacts with histone mRNA, and its depletion results in drastic reduction in histone transcript levels. We propose that Snp protects the 3'-ends of histone mRNAs and upon its absence, histone transcripts are readily degraded. This in turn may lead to cell cycle delay or arrest, causing growth arrest and developmental perturbations. © 2017 Federation of European Biochemical Societies.
Directory of Open Access Journals (Sweden)
Jianrao HU, Mingfu CAO, Jiong Chen
2009-10-01
Full Text Available Bactericidal/permeability-increasing protein (BPI and LPS-binding protein (LBP play an important role in host defence. Current evidence shows that BPI/LBP may be widely existed in different cells and tissue types of animals. A full-length cDNA clone encoding a BPI/LBP homologue (dBPI, 1757bp in size, was characterized in venom gland of the hundred-pace snake Deinagkistrodon acutus. Its deduced amino acid sequence of 417 residues had 13.8%–21.5% identity to BPI like 1(BPIL1 and BPI like 3(BPIL3 of other animals. Conserved cysteine residues which are involved in disulfide bond formation between the final strand of the N-terminal beta sheet and the long alpha helix of BPI are identified as Cys146-Cys183 of dBPI. Phylogenetic tree analysis showed that the BPI/LBP homologues formed five large clusters and dBPI was in a large cluster including BPIL1 and BPIL3. dBPI mRNA shows a tissue specific expression in venom gland. This is the first study to identify the cDNA encoding BPI/LBP homologues from reptiles [Current Zoology 55 (5: –2009].
Kumar, L; Sridhara, S; Singh, B P; Gangal, S V
1998-11-01
Previous studies have established the role of Imperata cylindrica (Ic) pollen in type I allergic disorders. However, no systematic information is available on the allergen composition of Ic pollen extract. To characterize the IgE-binding proteins of Ic pollen extract and to detect the presence of grass group 1, 4 and 5 allergen homologues, if any. Pollen extract of Ic was analyzed by in vivo and in vitro procedures such as intradermal tests (ID), enzyme-linked immunosorbent assay (ELISA), ELISA-inhibition, thin-layer isoelectric focusing (TLIEF), sodium dodecylsulfate polyacrylamide gel electrophoresis (SDS-PAGE) and immunoblotting. Dot blot assay was carried out to check the presence of well-known group 1, 4, and 5 allergen homologues in Ic pollen extract. Out of 303 respiratory allergies patients skin-tested, 27 showed sensitivity to Ic pollen extract. Specific IgE levels were elevated in all 15 serum samples tested. The extract prepared for this study was found to be highly potent since it required only 400 ng of homologous proteins for 50% inhibition of binding in ELISA inhibition assays. TLIEF of Ic pollen extract showed 44 silver-stained bands (pI 3.5-7.0) while SDS-PAGE resolved it into 24 Coomassie-Brilliant-Blue-stained bands (MW 100-10 kD). Immunoblotting with individual patient sera recognized 7 major IgE-binding bands (MW 85, 62, 57, 43, 40, 28 and 16 kD) in Ic pollen extract. A panel of monoclonal antibodies, specific to group 1, 4 and 5 allergens from Phleum pratense pollen extract identified group 5 and group 4 homologues in Ic pollen extract. Ic pollen extract was characterized for the protein profile by TLIEF and SDS-PAGE. IgE reactivity was determined by ELISA and immunoblot. Monoclonal antibodies to group 5 and group 4 allergens reacted weakly showing that this pollen contains group 5 and group 4 homologous allergens.
Isolation and characterization of an AGAMOUS homologue from cocoa
Chaidamsari, T.; Sugiarit, H.; Santoso, D.; Angenent, G.C.; Maagd, de R.A.
2006-01-01
We report the cloning of a cDNA from TcAG, an AG (Arabidopsis thaliana MADS-box C-type transcription factor gene AGAMOUS) homologue from cocoa (Theobroma cacao L.). TcAG was in the cocoa flower expressed primarily in stamens and ovaries, comparable to AG in Arabidopsis. Additionally, we found that
The actin homologue MreB organizes the bacterial cell membrane
Strahl, H.; Burmann, F.; Hamoen, L.W.
2014-01-01
The eukaryotic cortical actin cytoskeleton creates specific lipid domains, including lipid rafts, which determine the distribution of many membrane proteins. Here we show that the bacterial actin homologue MreB displays a comparable activity. MreB forms membrane-associated filaments that coordinate
Ben-Simhon, Zohar; Judeinstein, Sylvie; Nadler-Hassar, Talia; Trainin, Taly; Bar-Ya'akov, Irit; Borochov-Neori, Hamutal; Holland, Doron
2011-11-01
Anthocyanins are the major pigments responsible for the pomegranate (Punica granatum L.) fruit skin color. The high variability in fruit external color in pomegranate cultivars reflects variations in anthocyanin composition. To identify genes involved in the regulation of anthocyanin biosynthesis pathway in the pomegranate fruit skin we have isolated, expressed and characterized the pomegranate homologue of the Arabidopsis thaliana TRANSPARENT TESTA GLABRA1 (TTG1), encoding a WD40-repeat protein. The TTG1 protein is a regulator of anthocyanins and proanthocyanidins (PAs) biosynthesis in Arabidopsis, and acts by the formation of a transcriptional regulatory complex with two other regulatory proteins: bHLH and MYB. Our results reveal that the pomegranate gene, designated PgWD40, recovered the anthocyanin, PAs, trichome and seed coat mucilage phenotype in Arabidopsis ttg1 mutant. PgWD40 expression and anthocyanin composition in the skin were analyzed during pomegranate fruit development, in two accessions that differ in skin color intensity and timing of appearance. The results indicate high positive correlation between the total cyanidin derivatives quantity (red pigments) and the expression level of PgWD40. Furthermore, strong correlation was found between the steady state levels of PgWD40 transcripts and the transcripts of pomegranate homologues of the structural genes PgDFR and PgLDOX. PgWD40, PgDFR and PgLDOX expression also correlated with the expression of pomegranate homologues of the regulatory genes PgAn1 (bHLH) and PgAn2 (MYB). On the basis of our results we propose that PgWD40 is involved in the regulation of anthocyanin biosynthesis during pomegranate fruit development and that expression of PgWD40, PgAn1 and PgAn2 in the pomegranate fruit skin is required to regulate the expression of downstream structural genes involved in the anthocyanin biosynthesis.
Inhibition of hydroxyapatite growth by casein, a potential salivary phosphoprotein homologue.
Romero, Maria J R H; Nakashima, Syozi; Nikaido, Toru; Ichinose, Shizuko; Sadr, Alireza; Tagami, Junji
2015-08-01
Salivary phosphoproteins are essential in tooth mineral regulation but are often overlooked in vitro. This study aimed to evaluate the effect of casein, as a salivary phosphoprotein homologue, on the deposition and growth of hydroxyapatite (HA) on tooth surfaces. Hydroxyapatite growth was quantified using seeded crystal systems. Artificial saliva (AS) containing HA powder and 0, 10, 20, 50, or 100 μg ml(-1) of casein, or 100 μg ml(-1) of dephosphorylated casein (Dcasein), was incubated for 0-8 h at 37°C, pH 7.2. Calcium concentrations were measured using atomic absorption spectroscopy (AAS). Surface precipitation of HA on bovine enamel and dentine blocks, incubated in similar conditions for 7 d, was examined using field emission scanning electron microscopy (FE-SEM) and transmission electron microscopy (TEM) with selected area electron diffraction (SAED). Casein adsorption was assessed using modified Lowry assays and zeta-potential measurements. The AAS results revealed a concentration-dependent inhibition of calcium consumption. Hydroxyapatite precipitation occurred when no casein was present, whereas precipitation of HA was apparently completely inhibited in casein-containing groups. Adsorption data demonstrated increasingly negative zeta-potential with increased casein concentration and an affinity constant similar to proline-rich proteins with Langmuir modelling. Casein inhibited the deposition and growth of HA primarily through the binding of esterized phosphate to HA active sites, indicating its potential as a mineral-regulating salivary phosphoprotein homologue in vitro. © 2015 Eur J Oral Sci.
Characterization and cloning of TMV resistance gene N homologues ...
African Journals Online (AJOL)
Tobacco cultivars Nicotiana tabacum cv. Samsun NN plants carrying the N gene contain a multitude of N-related genes. We cloned a few N homologues and isolated two full-length cDNAs of NL-C26 and NL-B69 genes from N. tabacum cv. Samsun NN. Nucleotide sequence analysis showed that the coding regions of ...
International Nuclear Information System (INIS)
Fahleson, Tobias; Norman, Patrick; Coriani, Sonia; Rizzo, Antonio; Rikken, Geert L. J. A.
2013-01-01
We report on the results of a systematic ab initio study of the Jones birefringence of noble gases, of furan homologues, and of monosubstituted benzenes, in the gas phase, with the aim of analyzing the behavior and the trends within a list of systems of varying size and complexity, and of identifying candidates for a combined experimental/theoretical study of the effect. We resort here to analytic linear and nonlinear response functions in the framework of time-dependent density functional theory. A correlation is made between the observable (the Jones constant) and the atomic radius for noble gases, or the permanent electric dipole and a structure/chemical reactivity descriptor as the para Hammett constant for substituted benzenes
Mouse homologue of yeast Prp19 interacts with mouse SUG1, the regulatory subunit of 26S proteasome
International Nuclear Information System (INIS)
Sihn, Choong-Ryoul; Cho, Si Young; Lee, Jeong Ho; Lee, Tae Ryong; Kim, Sang Hoon
2007-01-01
Yeast Prp19 has been shown to involve in pre-mRNA splicing and DNA repair as well as being an ubiquitin ligase. Mammalian homologue of yeast Prp19 also plays on similar functional activities in cells. In the present study, we isolated mouse SUG1 (mSUG1) as binding partner of mouse Prp19 (mPrp19) by the yeast two-hybrid system. We confirmed the interaction of mPrp9 with mSUG1 by GST pull-down assay and co-immunoprecipitation assay. The N-terminus of mPrp19 including U-box domain was associated with the C-terminus of mSUG1. Although, mSUG1 is a regulatory subunit of 26S proteasome, mPrp19 was not degraded in the proteasome-dependent pathway. Interestingly, GFP-mPrp19 fusion protein was co-localized with mSUG1 protein in cytoplasm as the formation of the speckle-like structures in the presence of a proteasome inhibitor MG132. In addition, the activity of proteasome was increased in cells transfected with mPrp19. Taken together, these results suggest that mPrp19 involves the regulation of protein turnover and may transport its substrates to 26S proteasome through mSUG1 protein
Lozupone, Francesco; Perdicchio, Maurizio; Brambilla, Daria; Borghi, Martina; Meschini, Stefania; Barca, Stefano; Marino, Maria Lucia; Logozzi, Mariantonia; Federici, Cristina; Iessi, Elisabetta; de Milito, Angelo; Fais, Stefano
2009-12-01
Tumour cannibalism is a characteristic of malignancy and metastatic behaviour. This atypical phagocytic activity is a crucial survival option for tumours in conditions of low nutrient supply, and has some similarities to the phagocytic activity of unicellular microorganisms. In fact, Dictyostelium discoideum has been used widely as a model to study phagocytosis. Recently, phg1A has been described as a protein that is primarily involved in the phagocytic process of this microorganism. The closest human homologue to phg1A is transmembrane 9 superfamily protein member 4 (TM9SF4). Here, we report that TM9SF4 is highly expressed in human malignant melanoma cells deriving from metastatic lesions, whereas it is undetectable in healthy human tissues and cells. TM9SF4 is predominantly expressed in acidic vesicles of melanoma cells, in which it co-localizes with the early endosome antigens Rab5 and early endosome antigen 1. TM9SF4 silencing induced marked inhibition of cannibal activity, which is consistent with a derangement of intracellular pH gradients, with alkalinization of acidic vesicles and acidification of the cell cytosol. We propose TM9SF4 as a new marker of malignancy, representing a potential new target for anti-tumour strategies with a specific role in tumour cannibalism and in the establishment of a metastatic phenotype.
DEFF Research Database (Denmark)
Farrell, Helen E; Abraham, Alexander M; Cardin, Rhonda D
2011-01-01
The human cytomegalovirus (CMV) proteins US28 and UL33 are homologous to chemokine receptors (CKRs). Knockout of the mouse CMV M33 protein (UL33 homologue) results in substantial attenuation of salivary gland infection/replication and reduced efficiency of reactivation from tissue explants. M33-m...
International Nuclear Information System (INIS)
Nomoto, Ryohei; Tezuka, Takeaki; Miyazono, Ken-ichi; Tanokura, Masaru; Horinouchi, Sueharu; Ohnishi, Yasuo
2012-01-01
A Streptomyces homologue of the mycobacterial integration host factor mIHF was heterologously produced, purified and crystallized in the presence of a 16-mer duplex DNA by the sitting-drop vapour-diffusion method. The best crystal diffracted X-rays to 2.22 Å resolution and belonged to space group C2. The mycobacterial integration host factor (mIHF) is a small nonspecific DNA-binding protein that is essential for the growth of Mycobacterium smegmatis. mIHF homologues are widely distributed among Actinobacteria, and a Streptomyces homologue of mIHF is involved in control of sporulation and antibiotic production in S. coelicolor A3(2). Despite their important biological functions, a structure of mIHF or its homologues has not been elucidated to date. Here, the S. griseus mIHF homologue (SGR6054) was expressed and purified from Escherichia coli and crystallized in the presence of a 16-mer duplex DNA by the sitting-drop vapour-diffusion method. The plate-shaped crystal belonged to space group C2, with unit-cell parameters a = 88.53, b = 69.35, c = 77.71 Å, β = 96.63°, and diffracted X-rays to 2.22 Å resolution
Energy Technology Data Exchange (ETDEWEB)
Nomoto, Ryohei; Tezuka, Takeaki; Miyazono, Ken-ichi; Tanokura, Masaru; Horinouchi, Sueharu; Ohnishi, Yasuo [Graduate School of Agricultural and Life Sciences, The University of Tokyo, 1-1-1 Yayoi, Bunkyo-ku, Tokyo 113-8657 (Japan)
2012-08-31
A Streptomyces homologue of the mycobacterial integration host factor mIHF was heterologously produced, purified and crystallized in the presence of a 16-mer duplex DNA by the sitting-drop vapour-diffusion method. The best crystal diffracted X-rays to 2.22 Å resolution and belonged to space group C2. The mycobacterial integration host factor (mIHF) is a small nonspecific DNA-binding protein that is essential for the growth of Mycobacterium smegmatis. mIHF homologues are widely distributed among Actinobacteria, and a Streptomyces homologue of mIHF is involved in control of sporulation and antibiotic production in S. coelicolor A3(2). Despite their important biological functions, a structure of mIHF or its homologues has not been elucidated to date. Here, the S. griseus mIHF homologue (SGR6054) was expressed and purified from Escherichia coli and crystallized in the presence of a 16-mer duplex DNA by the sitting-drop vapour-diffusion method. The plate-shaped crystal belonged to space group C2, with unit-cell parameters a = 88.53, b = 69.35, c = 77.71 Å, β = 96.63°, and diffracted X-rays to 2.22 Å resolution.
Brown, N K; Harvey, D J
1988-04-01
Methyl-delta-8-tetrahydrocannabinol (methyl-delta-8-THC), methyl-delta-9-THC and abn-methyl-delta-8-THC were synthesized by condensation of orcinol and (1S)-cis-verbenol and were administered to male Charles River CD-1 mice. Extracted hepatic metabolites were isolated by chromatography on Sephadex LH-20 and examined by gas chromatography/mass spectrometry as trimethylsilyl (TMS), (2H9)TMS and methyl ester/TMS derivatives. In addition, metabolic fractions were reduced with lithium aluminium deuteride to convert carboxylic acids to alcohols for structural correlation. Metabolites from methyl-delta-8-THC were similar with respect to the positions substituted to those produced by higher homologues; the major metabolite was methyl-delta-8-THC-11-oic acid. abn-Methyl-delta-8-THC was metabolized in a different manner. The location of the aromatic methyl group at the position adjacent to ring fusion appeared to inhibit metabolism at C(11) to a considerable extent and also to reduce the amount of the resulting alcohol from being oxidized to a carboxylic acid. This caused other metabolic pathways to become dominant, with the result that a compound containing a hydroxy group at the gem-methyl position was the major metabolite. Hydroxylation at this position has not been confirmed with any other cannabinoid, although it is thought to result in trace concentrations of hydroxy metabolites from some compounds. Metabolism of methyl-delta-9-THC was also similar to that of the higher homologues, with the exception that less metabolism occurred at C(8) and a higher percentage of the total metabolic fraction was accounted for by the 11-oic acid metabolite. Minor metabolites were mainly dihydroxy compounds and hydroxylated derivatives of delta-9-THC-11-oic acid.
Qiu, Jiaen; Henderson, Sam W; Tester, Mark A.; Roy, Stuart J; Gilliham, Mathew
2016-01-01
Salinity tolerance is correlated with shoot chloride (Cl–) exclusion in multiple crops, but the molecular mechanisms of long-distance Cl– transport are poorly defined. Here, we characterize the in planta role of AtSLAH1 (a homologue of the slow type anion channel-associated 1 (SLAC1)). This protein, localized to the plasma membrane of root stelar cells, has its expression reduced by salt or ABA, which are key predictions for a protein involved with loading Cl– into the root xylem. Artificial microRNA knockdown mutants of AtSLAH1 had significantly reduced shoot Cl− accumulation when grown under low Cl–, whereas shoot Cl– increased and the shoot nitrate/chloride ratio decreased following AtSLAH1 constitutive or stelar-specific overexpression when grown in high Cl–. In both sets of overexpression lines a significant reduction in shoot biomass over the null segregants was observed under high Cl– supply, but not low Cl– supply. Further in planta data showed AtSLAH3 overexpression increased the shoot nitrate/chloride ratio, consistent with AtSLAH3 favouring nitrate transport. Heterologous expression of AtSLAH1 in Xenopus laevis oocytes led to no detectible transport, suggesting the need for post-translational modifications for AtSLAH1 to be active. Our in planta data are consistent with AtSLAH1 having a role in controlling root-to-shoot Cl– transport.
Qiu, Jiaen
2016-06-23
Salinity tolerance is correlated with shoot chloride (Cl–) exclusion in multiple crops, but the molecular mechanisms of long-distance Cl– transport are poorly defined. Here, we characterize the in planta role of AtSLAH1 (a homologue of the slow type anion channel-associated 1 (SLAC1)). This protein, localized to the plasma membrane of root stelar cells, has its expression reduced by salt or ABA, which are key predictions for a protein involved with loading Cl– into the root xylem. Artificial microRNA knockdown mutants of AtSLAH1 had significantly reduced shoot Cl− accumulation when grown under low Cl–, whereas shoot Cl– increased and the shoot nitrate/chloride ratio decreased following AtSLAH1 constitutive or stelar-specific overexpression when grown in high Cl–. In both sets of overexpression lines a significant reduction in shoot biomass over the null segregants was observed under high Cl– supply, but not low Cl– supply. Further in planta data showed AtSLAH3 overexpression increased the shoot nitrate/chloride ratio, consistent with AtSLAH3 favouring nitrate transport. Heterologous expression of AtSLAH1 in Xenopus laevis oocytes led to no detectible transport, suggesting the need for post-translational modifications for AtSLAH1 to be active. Our in planta data are consistent with AtSLAH1 having a role in controlling root-to-shoot Cl– transport.
Seguin, Alexandra; Santos, Renata; Pain, Debkumar; Dancis, Andrew; Camadro, Jean-Michel; Lesuisse, Emmanuel
2011-02-25
Saccharomyces cerevisiae cells lacking the yeast frataxin homologue (Δyfh1) accumulate iron in the mitochondria in the form of nanoparticles of ferric phosphate. The phosphate content of Δyfh1 mitochondria was higher than that of wild-type mitochondria, but the proportion of mitochondrial phosphate that was soluble was much lower in Δyfh1 cells. The rates of phosphate and iron uptake in vitro by isolated mitochondria were higher for Δyfh1 than wild-type mitochondria, and a significant proportion of the phosphate and iron rapidly became insoluble in the mitochondrial matrix, suggesting co-precipitation of these species after oxidation of iron by oxygen. Increasing the amount of phosphate in the medium decreased the amount of iron accumulated by Δyfh1 cells and improved their growth in an iron-dependent manner, and this effect was mostly transcriptional. Overexpressing the major mitochondrial phosphate carrier, MIR1, slightly increased the concentration of soluble mitochondrial phosphate and significantly improved various mitochondrial functions (cytochromes, [Fe-S] clusters, and respiration) in Δyfh1 cells. We conclude that in Δyfh1 cells, soluble phosphate is limiting, due to its co-precipitation with iron.
Natural gas geochemistry and its origins in Kuqa depression
Institute of Scientific and Technical Information of China (English)
2008-01-01
According to gas compositional and carbon isotopic measurement of 114 gas samples from the Kuqa depression,accumulation of the natural gases in the depression is dominated by hydrocarbon gases, with high gas dryness(C1/C1-4)at the middle and northern parts of the depression and low one towards east and west sides and southern part.The carbon isotopes of methane and its homologues are relatively enriched in 13 C,and the distributive range ofδ13C 1 ,δ13C 2 andδ13C 3 is-32‰―-36‰,-22‰―-24‰and-20‰―-22‰,respectively.In general,the carbon isotopes of gaseous alkanes become less negative with the increase of carbon numbers.Theδ13C CO2 value is less than-10‰in the Kuqa depression,indicating its organogenic origin.The distributive range of 3 He/ 4 He ratio is within n×10-8 and a decrease in 3 He/ 4 He ratio from north to south in the depression is observed.Based on the geochemical parameters of natural gas above,natural gas in the Kuqa depression is of characteristics of coal-type gas origin.The possible reasons for the partial reversal of stable carbon isotopes of gaseous alkanes involve the mixing of gases from one common source rock with different thermal maturity or from two separated source rock intervals of similar kerogen type,multistages accumulation of natural gas under high-temperature and over-pressure conditions,and sufficiency and diffusion of natural gas.
From Cell Death to Metabolism: Holin-Antiholin Homologues with New Functions
DEFF Research Database (Denmark)
van den Esker, Marielle H.; Kovács, Ákos T.; Kuipers, Oscar P.
2017-01-01
, but their functions can be different, depending on the species. Using a series of biochemical and genetic approaches, in a recent article in mBio, Charbonnier et al. (mBio 8:e00976-17, 2017, https://doi.org/10.1128/mBio.00976-17) demonstrate that the antiholin homologue in Bacillus subtilis transports pyruvate...
Directory of Open Access Journals (Sweden)
Thomas Anne VT
2005-10-01
Full Text Available Abstract Background Lymphocyte function-associated antigen-1 (LFA-1, CD11a/CD18, alphaLbeta2, the most abundant and widely expressed beta2-integrin, is required for many cellular adhesive interactions during the immune response. Many studies have shown that LFA-1 is centrally involved in the pathogenesis of several diseases caused by Repeats-in-toxin (RTX -producing bacteria. Results The porcine-LFA-1 CD11a (alpha subunit coding sequence was cloned, sequenced and compared with the available mammalian homologues in this study. Despite some focal differences, it shares all the main characteristics of these latter. Interestingly, as in sheep and humans, an allelic variant with a triplet insertion resulting in an additional Gln-744 was consistently identified, which suggests an allelic polymorphism that might be biologically relevant. Conclusion Together with the pig CD18-encoding cDNA, which has been available for a long time, the sequence data provided here will allow the successful expression of porcine CD11a, thus giving the first opportunity to express the Sus scrofa beta2-integrin LFA-1 in vitro as a tool to examine the specificities of inflammation in the porcine species.
Behaviour of the homologues of Rf and Db in complexing media
International Nuclear Information System (INIS)
Trubert, D.; Monroy Guzman, F.; Hussonnois, M.; Brillard, L.; Le Naour, C.; Servajean, V.; Constantinescu, O.; Constantinescu, M.; Ardisson, G.; Barci, V.; Weiss, B.
1999-01-01
In order to study the chemical behaviour of the trans-actinide elements, the chemical properties of their most probable homologues have been investigated by ion exchange methods in various complexing media. A new chromatographic method allowing the determination of distribution coefficients in the case o short-lived isotopes has been developed and successfully tested with the RACHEL device. (authors)
The actin homologue MreB organizes the bacterial cell membrane
Strahl, Henrik; Bürmann, Frank; Hamoen, Leendert W.
2014-01-01
The eukaryotic cortical actin cytoskeleton creates specific lipid domains, including lipid rafts, which determine the distribution of many membrane proteins. Here we show that the bacterial actin homologue MreB displays a comparable activity. MreB forms membrane-associated filaments that coordinate bacterial cell wall synthesis. We noticed that the MreB cytoskeleton influences fluorescent staining of the cytoplasmic membrane. Detailed analyses combining an array of mutants, using specific lip...
Rella, Monika; Elliot, Joann L; Revett, Timothy J; Lanfear, Jerry; Phelan, Anne; Jackson, Richard M; Turner, Anthony J; Hooper, Nigel M
2007-01-01
Abstract Background Mammalian angiotensin converting enzyme (ACE) plays a key role in blood pressure regulation. Although multiple ACE-like proteins exist in non-mammalian organisms, to date only one other ACE homologue, ACE2, has been identified in mammals. Results Here we report the identification and characterisation of the gene encoding a third homologue of ACE, termed ACE3, in several mammalian genomes. The ACE3 gene is located on the same chromosome downstream of the ACE gene. Multiple ...
Directory of Open Access Journals (Sweden)
Bart eGeurten
2012-03-01
Full Text Available Hoverflies and blowflies have distinctly different flight styles. Yet, both species have been shown to structure their flight behaviour in a way that facilitates extraction of 3D information from the image flow on the retina (optic flow. Neuronal candidates to analyse the optic flow are the tangential cells in the third optical ganglion – the lobula complex. These neurons are directionally selective and integrate the optic flow over large parts of the visual field. Homologue tangential cells in hoverflies and blowflies have a similar morphology. Because blowflies and hoverflies have similar neuronal layout but distinctly different flight behaviours, they are an ideal substrate to pinpoint potential neuronal adaptations to the different flight styles.In this article we describe the relationship between locomotion behaviour and motion vision on three different levels:1.We compare the different flight styles based on the categorisation of flight behaviour into prototypical movements.2.We measure the species specific dynamics of the optic flow under naturalistic flight conditions. We found the translational optic flow of both species to be very different.3.We describe possible adaptations of a homologue motion sensitive neuron. We stimulate this cell in blowflies (Calliphora and hoverflies (Eristalis with naturalistic optic flow generated by both species during free flight. The characterized hoverfly tangential cell responds faster to transient changes in the optic flow than its blowfly homologue. It is discussed whether and how the different dynamical response properties aid optic flow analysis.
International Nuclear Information System (INIS)
Jenei, Veronika; Andersson, Tommy; Jakus, Judit; Dib, Karim
2005-01-01
E3B1, a human homologue of the mouse gene product Abi-1, has been implicated in growth-factor-mediated regulation of the small GTPases p21 Ras and Rac. E3b1 is a regulator of Rac because it can form a complex with Sos-1 and eps8, and such a Sos-1-e3B1-eps8 complex serves as a guanine nucleotide exchange factor for Rac. In the present study, we found that overexpression of e3B1 in NIH3T3/EGFR cells sensitized EGF-induced activation of Rac1, whereas it had no impact on EGF-induced activation of p21 Ras . Remarkably, we found that EGF-induced activation of the p21 Ras -related GTPase Rap1 was also sensitized in NIH3T3/EGFR-e3B1 cells. Thus, in NIH3T3/EGFR-e3B1 cells, maximal EGF-induced activation of Rap1 occurs with a dose of EGF much lower than in NIH3T3/EGFR cells. We also report that overexpression of e3B1 in NIH3T3/EGFR cells renders EGF-induced activation of Rap1 completely dependent on Src tyrosine kinases but not on c-Abl. However, EGF-induced tyrosine phosphorylation of the Rap GEF C3G occurred regardless of whether e3B1 was overexpressed or not, and this did not involve Src tyrosine kinases. Accordingly, we propose that overexpression of e3B1 in NIH3T3/EGFR cells leads to mobilization of Src tyrosine kinases that participate in EGF-induced activation of Rap1 and inhibition of cell proliferation
Structural studies on a non-toxic homologue of type II RIPs from ...
Indian Academy of Sciences (India)
Structural studies on a non-toxic homologue of type II RIPs from bitter gourd: Molecular basis of non-toxicity, conformational selection and glycan structure. MS accepted http://www.ias.ac.in/jbiosci. THYAGESHWAR CHANDRAN, ALOK SHARMA and M VIJAYAN. J. Biosci. 40(5), October 2015, 929–941, © Indian Academy of ...
International Nuclear Information System (INIS)
Dhanani, Kalpeshkumar R.; Khan, Ziauddin; Raval, Dilip; Semwal, Pratibha; George, Siju; Paravastu, Yuvakiran; Thankey, Prashant; Khan, Mohammad Shoaib; Pradhan, Subrata
2015-01-01
SST-1 Tokamak, the first Indian Steady-state Superconducting experimental device is at present under operation in Institute for Plasma Research. For plasma break down and initiation, the piezoelectric valve based gas feed system is implemented as primary requirement due to its precise control, easy handling, low costs for both construction and maintenance and its flexibility in working gas selection. The main functions of SST-1 gas feed system are to feed the required amount of ultrahigh purity hydrogen gas for specified period into the vessel during plasma operation and ultrahigh helium gas for glow discharge cleaning. In addition to these facilities, the gas feed system is used to feed a mixture gas of hydrogen and helium as well as other gases like nitrogen and Argon during divertor cooling etc. The piezoelectric valves used in SST-1 are remotely driven by a PXI based platform and are calibrated before the plasma operation during each SST-1 plasma operation with precise control. This paper will present the technical development and the results of gas fueling in SST-1. (author)
Structure of HLA-A*1101 in complex with a hepatitis B peptide homologue
DEFF Research Database (Denmark)
Blicher, Thomas; Kastrup, Jette Sandholm; Pedersen, Lars Østergaard
2006-01-01
A high-resolution structure of the human MHC-I molecule HLA-A*1101 is presented in which it forms a complex with a sequence homologue of a peptide that occurs naturally in hepatitis B virus DNA polymerase. The sequence of the bound peptide is AIMPARFYPK, while that of the corresponding natural...
Directory of Open Access Journals (Sweden)
Livia C. T. Scorza
2017-02-01
Full Text Available Abstract Background Passiflora (passionflowers makes an excellent model for studying plant evolutionary development. They are mostly perennial climbers that display axillary tendrils, which are believed to be modifications of the inflorescence. Passionflowers are also recognized by their unique flower features, such as the extra whorls of floral organs composed of corona filaments and membranes enclosing the nectary. Although some work on Passiflora organ ontogeny has been done, the developmental identity of both Passiflora tendrils and the corona is still controversial. Here, we combined ultrastructural analysis and expression patterns of the flower meristem and floral organ identity genes of the MADS-box AP1/FUL clade to reveal a possible role for these genes in the generation of evolutionary novelties in Passiflora. Results We followed the development of structures arising from the axillary meristem from juvenile to adult phase in P. edulis. We further assessed the expression pattern of P. edulis AP1/FUL homologues (PeAP1 and PeFUL, by RT-qPCR and in situ hybridization in several tissues, correlating it with the developmental stages of P. edulis. PeAP1 is expressed only in the reproductive stage, and it is highly expressed in tendrils and in flower meristems from the onset of their development. PeAP1 is also expressed in sepals, petals and in corona filaments, suggesting a novel role for PeAP1 in floral organ diversification. PeFUL presented a broad expression pattern in both vegetative and reproductive tissues, and it is also expressed in fruits. Conclusions Our results provide new molecular insights into the morphological diversity in the genus Passiflora. Here, we bring new evidence that tendrils are part of the Passiflora inflorescence. This points to the convergence of similar developmental processes involving the recruitment of genes related to flower identity in the origin of tendrils in different plant families. The data obtained also
Directory of Open Access Journals (Sweden)
Aleksander F Sikorski
2007-01-01
Full Text Available The review is focused on the domain structure and function of protein 4.1, one of the proteins belonging to the membrane skeleton. The protein 4.1 of the red blood cells (4.1R is a multifunctional protein that localizes to the membrane skeleton and stabilizes erythrocyte shape and membrane mechanical properties, such as deformability and stability, via lateral interactions with spectrin, actin, glycophorin C and protein p55. Protein 4.1 binding is modulated through the action of kinases and/or calmodulin-Ca2+. Non-erythroid cells express the 4.1R homologues: 4.1G (general type, 4.1B (brain type, and 4.1N (neuron type, and the whole group belongs to the protein 4.1 superfamily, which is characterized by the presence of a highly conserved FERM domain at the N-terminus of the molecule. Proteins 4.1R, 4.1G, 4.1N and 4.1B are encoded by different genes. Most of the 4.1 superfamily proteins also contain an actin-binding domain. To date, more than 40 members have been identified. They can be divided into five groups: protein 4.1 molecules, ERM proteins, talin-related molecules, protein tyrosine phosphatase (PTPH proteins and NBL4 proteins. We have focused our attention on the main, well known representatives of 4.1 superfamily and tried to choose the proteins which are close to 4.1R or which have distinct functions. 4.1 family proteins are not just linkers between the plasma membrane and membrane skeleton; they also play an important role in various processes. Some, such as focal adhesion kinase (FAK, non-receptor tyrosine kinase that localizes to focal adhesions in adherent cells, play the role in cell adhesion. The other members control or take part in tumor suppression, regulation of cell cycle progression, inhibition of cell proliferation, downstream signaling of the glutamate receptors, and establishment of cell polarity; some are also involved in cell proliferation, cell motility, and/or cell-to-cell communication.
Reth, Margot; Ciric, Anita; Christensen, Guttorm N; Heimstad, Eldbjørg S; Oehme, Michael
2006-08-15
Congener and homologue group patterns of chlorinated paraffins (CPs) in biota can be influenced by different processes, but these are not well studied yet. Short- (SCCPs) and medium-chain chlorinated paraffins (MCCPs) were quantified in liver from Arctic char and seabirds (little auk and kittiwake) collected at Bear Island (European Arctic) as well as in cod from Iceland and Norway. CP concentrations were between 5 and 88 ng/g wet weight (ww) for SCCPs and between 5 and 55 ng/g ww for MCCPs with one exception of 370 ng/g measured in a liver sample from little auk. The SCCP homologue group patterns were compared with those of technical mixtures and of SCCPs present in cod liver from the Baltic Sea. The latter showed a more common SCCP homologue distribution (sum of C(11) and C(12)>60%) in contrast to cod liver from the Northwest of Europe, which had a high abundance of C(10) and C(12) congeners. Seabirds from Bear Island contained an equally distributed SCCP homologue group pattern. In Arctic char, the SCCP distribution was closer to technical products, but with a high proportion (average of 18.9%) of C(10) congeners. A comparison of C(10)/C(12) ratios confirmed the higher abundance of C(10) congeners in samples from higher latitudes. For the first time, MCCPs could be detected in Arctic samples. The average proportion of C(14) congeners was 65.8%. The C(14)/C(15) abundance ratio was similar to technical mixtures. High-chlorinated CPs (Cl(>7)) were also detectable. The average chlorine content of the SCCPs was 61.9% (59.0-63.3%), and that of the MCCPs 55.8% (54.5-57.4%).
Directory of Open Access Journals (Sweden)
Zengliang Ruan
Full Text Available Thioredoxins (Trx proteins are a family of small, highly-conserved and ubiquitous proteins that play significant roles in the resistance of oxidative damage. In this study, a homologue of Trx was identified from the cDNA library of tentacle of the jellyfish Cyanea capillata and named CcTrx1. The full-length cDNA of CcTrx1 was 479 bp with a 312 bp open reading frame encoding 104 amino acids. Bioinformatics analysis revealed that the putative CcTrx1 protein harbored the evolutionarily-conserved Trx active site 31CGPC34 and shared a high similarity with Trx1 proteins from other organisms analyzed, indicating that CcTrx1 is a new member of Trx1 sub-family. CcTrx1 mRNA was found to be constitutively expressed in tentacle, umbrella, oral arm and gonad, indicating a general role of CcTrx1 protein in various physiological processes. The recombinant CcTrx1 (rCcTrx1 protein was expressed in Escherichia coli BL21 (DE3, and then purified by affinity chromatography. The rCcTrx1 protein was demonstrated to possess the expected redox activity in enzymatic analysis and protection against oxidative damage of supercoiled DNA. These results indicate that CcTrx1 may function as an important antioxidant in C. capillata. To our knowledge, this is the first Trx protein characterized from jellyfish species.
A Potato cDNA Encoding a Homologue of Mammalian Multidrug Resistant P-Glycoprotein
Wang, W.; Takezawa, D.; Poovaiah, B. W.
1996-01-01
A homologue of the multidrug resistance (MDR) gene was obtained while screening a potato stolon tip cDNA expression library with S-15-labeled calmodulin. The mammalian MDR gene codes for a membrane-bound P-glycoprotein (170-180 kDa) which imparts multidrug resistance to cancerous cells. The potato cDNA (PMDR1) codes for a polypeptide of 1313 amino acid residues (ca. 144 kDa) and its structural features are very similar to the MDR P-glycoprotein. The N-terminal half of the PMDR1-encoded protein shares striking homology with its C-terminal half, and each half contains a conserved ATP-binding site and six putative transmembrane domains. Southern blot analysis indicated that potato has one or two MDR-like genes. PMDR1 mRNA is constitutively expressed in all organs studied with higher expression in the stem and stolon tip. The PMDR1 expression was highest during tuber initiation and decreased during tuber development.
Energy Technology Data Exchange (ETDEWEB)
Li, Fang [Key Laboratory of Separation Science for Analytical Chemistry, Dalian Institute of Chemical Physics, Chinese Academy of Sciences, No. 457 Zhongshan Road, Dalian 116023 (China); University of Chinese Academy of Sciences, Beijing 100049 (China); Jin, Jing [Key Laboratory of Separation Science for Analytical Chemistry, Dalian Institute of Chemical Physics, Chinese Academy of Sciences, No. 457 Zhongshan Road, Dalian 116023 (China); Sun, Xiaoli [Key Laboratory of Separation Science for Analytical Chemistry, Dalian Institute of Chemical Physics, Chinese Academy of Sciences, No. 457 Zhongshan Road, Dalian 116023 (China); University of Chinese Academy of Sciences, Beijing 100049 (China); Wang, Xueli; Li, Yun; Shah, Syed Mazhar [Key Laboratory of Separation Science for Analytical Chemistry, Dalian Institute of Chemical Physics, Chinese Academy of Sciences, No. 457 Zhongshan Road, Dalian 116023 (China); Chen, Jiping, E-mail: chenjp@dicp.ac.cn [Key Laboratory of Separation Science for Analytical Chemistry, Dalian Institute of Chemical Physics, Chinese Academy of Sciences, No. 457 Zhongshan Road, Dalian 116023 (China)
2014-09-15
Highlights: • Atmospheric PCNs were detected by isotope-dilution GC–MS/MS. • The pollution levels of PCNs covering from mono- to octa-CNs were investigated comprehensively in air samples. • The dioxin-like toxicity and human exposure levels of PCNs in air samples were estimated. - Abstract: Atmospheric polychlorinated naphthalenes (PCNs) ranging from mono-CNs to octa-CNs were detected using isotope-dilution gas chromatography coupled with triple quadrupole mass spectrometry (GC–MS/MS). The developed instrumental method was successfully applied to the determination of PCNs in technical products. It was observed that there were significant differences in concentrations, homologue profiles, chlorinated contents and total toxic equivalents (∑TEQs) of PCNs for four Halowax products. Subsequently, the validation of the analytical method was evaluated for the determination of PCNs in air samples in terms of method detection limit (MDL), recovery and matrix effect. The results demonstrated that this method could provide satisfactory sensitivity and adequate selectivity with lower cost. It was conducted to comprehensively evaluate the levels, composition patterns, ∑TEQs, and daily intake exposure of PCNs in indoor and outdoor air samples. Concentrations and ∑TEQs of PCNs in air samples ranged 47.7–832.7 pg m{sup −3} and 1.31–5.99 fg m{sup −3}, respectively, and the predominant homologues were di- and tri-CNs in the gas phase. The results indicated that this analytical method was useful for the accurate and specific evaluation of dioxin-like toxicity and human exposure levels of PCNs in the atmosphere.
Jin, Taewon; Kim, Oh Yoen; Shin, Min-Jeong; Choi, Eun Young; Lee, Sung Sook; Han, Ye Sun; Chung, Ji Hyung
2014-10-29
Adiponectin, an adipokine, has been described as showing physiological benefits against obesity-related malfunctions and vascular dysfunction. Several natural compounds that promote the expression and secretion of adipokines in adipocytes could be useful for treating metabolic disorders. This study investigated the effect of fisetin, a dietary flavonoid, on the regulation of adiponectin in adipocytes using 3T3-L1 preadipocytes. The expression and secretion of adiponectin increased in 3T3-L1 cells upon treatment with fisetin in a dose-dependent manner. Fisetin-induced adiponectin secretion was inhibited by peroxisome proliferator-activated receptor (PPAR) antagonists. It was also revealed that fisetin increased the activities of PPARs and silent mating type information regulation 2 homologue 1 (SIRT1) in a dose-dependent manner. Furthermore, the up-regulation of adiponectin and the activation of PPARs induced by fisetin were prevented by a SIRT1 inhibitor. Fisetin also promoted deacetylation of PPAR γ coactivator 1 (PGC-1) and its interaction with PPARs. SIRT knockdown by siRNA significantly decreased both adiponectin production and PPARs-PGC-1 interaction. These results provide evidence that fisetin promotes the gene expression of adiponectin through the activation of SIRT1 and PPARs in adipocytes.
Dinesh, Bhimareddy; Squillaci, Marco A; Ménard-Moyon, Cécilia; Samorì, Paolo; Bianco, Alberto
2015-10-14
The integration of carbon nanotubes (CNTs) into organized nanostructures is of great interest for applications in materials science and biomedicine. In this work we studied the self-assembly of β and γ homologues of diphenylalanine peptides under different solvent and pH conditions. We aimed to investigate the role of peptide backbone in tuning the formation of different types of nanostructures alone or in combination with carbon nanotubes. In spite of having the same side chain, β and γ peptides formed distinctively different nanofibers, a clear indication of the role played by the backbone homologation on the self-assembly. The variation of the pH allowed to transform the nanofibers into spherical structures. Moreover, the co-assembly of β and γ peptides with carbon nanotubes covalently functionalized with the same peptide generated unique dendritic assemblies. This comparative study on self-assembly using diphenylalanine backbone homologues and of the co-assembly with CNT covalent conjugates is the first example exploring the capacity of β and γ peptides to adopt precise nanostructures, particularly in combination with carbon nanotubes. The dendritic organization obtained by mixing carbon nanotubes and peptides might find interesting applications in tissue engineering and neuronal interfacing.
Is the Prosthetic Homologue Necessary for Embodiment?
Dornfeld, Chelsea; Swanston, Michelle; Cassella, Joseph; Beasley, Casey; Green, Jacob; Moshayev, Yonatan; Wininger, Michael
2016-01-01
Embodiment is the process by which patients with limb loss come to accept their peripheral device as a natural extension of self. However, there is little guidance as to how exacting the prosthesis must be in order for embodiment to take place: is it necessary for the prosthetic hand to look just like the absent hand? Here, we describe a protocol for testing whether an individual would select a hand that looks like their own from among a selection of five hands, and whether the hand selection (regardless of homology) is consistent across multiple exposures to the same (but reordered) set of candidate hands. Pilot results using healthy volunteers reveals that hand selection is only modestly consistent, and that selection of the prosthetic homologue is atypical (61 of 192 total exposures). Our protocol can be executed in minutes, and makes use of readily available equipment and softwares. We present both a face-to-face and a virtual protocol, for maximum flexibility of implementation.
1st European Conference on Gas Micro Flows (GasMems 2012)
Frijns, A.J.H.; Valougeorgis, D.; Colin, S.; Baldas, L.
2012-01-01
PREFACE The aim of the 1st European Conference on Gas Micro Flows is to advance research in Europe and worldwide in the field of gas micro flows as well as to improve global fundamental knowledge and to enable technological applications. Gas flows in microsystems are of great importance and touch
Hermes, Fatemah A; Cronan, John E
2013-10-01
The covalent attachment of lipoate to the lipoyl domains (LDs) of the central metabolism enzymes pyruvate dehydrogenase (PDH) and oxoglutarate dehydrogenase (OGDH) is essential for their activation and thus for respiratory growth in Saccharomyces cerevisiae. A third lipoate-dependent enzyme system, the glycine cleavage system (GCV), is required for utilization of glycine as a nitrogen source. Lipoate is synthesized by extraction of its precursor, octanoyl-acyl carrier protein (ACP), from the pool of fatty acid biosynthetic intermediates. Alternatively, lipoate is salvaged from previously modified proteins or from growth medium by lipoate protein ligases (Lpls). The first Lpl to be characterized, LplA of Escherichia coli, catalyses two partial reactions: activation of the acyl chain by formation of acyl-AMP, followed by transfer of the acyl chain to lipoyl domains (LDs). There is a surprising diversity within the Lpl family of enzymes, several of which catalyse reactions other than ligation reactions. For example, the Bacillus subtilis Lpl homologue LipM is an octanoyltransferase that transfers the octanoyl moiety from octanoyl-ACP to GCV. Another B. subtilis Lpl homologue, LipL, transfers octanoate from octanoyl-GCV to other LDs in an amido-transfer reaction. Study of eukaryotic Lpls has lagged behind studies of the bacterial enzymes. We report that the Lip3 Lpl homologue of the yeast S. cerevisiae has octanoyl-CoA-protein transferase activity, and discuss implications of this activity on the physiological role of Lip3 in lipoate synthesis. Published 2013. This article is a U.S. Government work and is in the public domain in the USA.
Crystallization and preliminary diffraction analysis of a DsbA homologue from Wolbachia pipientis
Energy Technology Data Exchange (ETDEWEB)
Kurz, M. [Institute for Molecular Bioscience and ARC Special Research Centre for Functional and Applied Genomics, University of Queensland, St Lucia, QLD 4072 (Australia); Iturbe-Ormaetxe, I. [School of Integrative Biology, The University of Queensland, St Lucia, QLD 4072 (Australia); Jarrott, R. [Institute for Molecular Bioscience and ARC Special Research Centre for Functional and Applied Genomics, University of Queensland, St Lucia, QLD 4072 (Australia); O’Neill, S. L. [School of Integrative Biology, The University of Queensland, St Lucia, QLD 4072 (Australia); Byriel, K. A.; Martin, J. L., E-mail: j.martin@imb.uq.edu.au; Heras, B., E-mail: j.martin@imb.uq.edu.au [Institute for Molecular Bioscience and ARC Special Research Centre for Functional and Applied Genomics, University of Queensland, St Lucia, QLD 4072 (Australia)
2008-02-01
The first crystallization of a W. pipientis protein, α-DsbA1, was achieved using hanging-drop and sitting-drop vapour diffusion. α-DsbA1 is one of two DsbA homologues encoded by the Gram-negative α-proteobacterium Wolbachia pipientis, an endosymbiont that can behave as a reproductive parasite in insects and as a mutualist in medically important filarial nematodes. The α-DsbA1 protein is thought to be important for the folding and secretion of Wolbachia proteins involved in the induction of reproductive distortions. Crystals of native and SeMet α-DsbA1 were grown by vapour diffusion and belong to the monoclinic space group C2, with unit-cell parameters a = 71.4, b = 49.5, c = 69.3 Å, β = 107.0° and one molecule in the asymmetric unit (44% solvent content). X-ray data were recorded from native crystals to a resolution of 2.01 Å using a copper anode and data from SeMet α-DsbA1 crystals were recorded to 2.45 Å resolution using a chromium anode.
Electricity and gas market observatory. 1. quarter 2007
International Nuclear Information System (INIS)
2007-01-01
Since July 1, 2004, all electricity and gas consumers can be eligible according to their consumption site, as long as all or part of the electricity or gas consumed is designed for non-residential use. The purpose of the observatory is to provide the general public with indicators for monitoring market deregulation. It both covers the wholesale and retail electricity and gas markets in Metropolitan France. This observatory is updated every three months and data are available on CRE web-site (www.cre.fr). It presents: The electricity market; The retail electricity market: Eligible customer segments and their respective weights, Status at April 1, 2007, Dynamic analysis: 1. Quarter 2007; The wholesale electricity market: Traded volumes on the French wholesale electricity market and comparison with European markets, Prices on the French wholesale electricity market and European comparison, Import and export volumes, Concentration of the French electricity market, Striking facts of the 1. 2007 quarter; The gas market; The retail gas market: The eligible customer segments and their respective weights, Status at April 1. 2007; The wholesale gas market: Gas pricing and gas markets in Europe,The wholesale market in France. Some glossaries are attached to the document: Electricity and gas market observatories combined glossary; Specific electricity market observatory glossary; Specific gas market observatory glossary
Electricity and gas market observatory. 1. quarter 2007
Energy Technology Data Exchange (ETDEWEB)
NONE
2007-07-01
Since July 1, 2004, all electricity and gas consumers can be eligible according to their consumption site, as long as all or part of the electricity or gas consumed is designed for non-residential use. The purpose of the observatory is to provide the general public with indicators for monitoring market deregulation. It both covers the wholesale and retail electricity and gas markets in Metropolitan France. This observatory is updated every three months and data are available on CRE web-site (www.cre.fr). It presents: The electricity market; The retail electricity market: Eligible customer segments and their respective weights, Status at April 1, 2007, Dynamic analysis: 1. Quarter 2007; The wholesale electricity market: Traded volumes on the French wholesale electricity market and comparison with European markets, Prices on the French wholesale electricity market and European comparison, Import and export volumes, Concentration of the French electricity market, Striking facts of the 1. 2007 quarter; The gas market; The retail gas market: The eligible customer segments and their respective weights, Status at April 1. 2007; The wholesale gas market: Gas pricing and gas markets in Europe,The wholesale market in France. Some glossaries are attached to the document: Electricity and gas market observatories combined glossary; Specific electricity market observatory glossary; Specific gas market observatory glossary.
Gas Fuelling System for SST-1Tokamak
Dhanani, Kalpesh; Raval, D. C.; Khan, Ziauddin; Semwal, Pratibha; George, Siju; Paravastu, Yuvakiran; Thankey, Prashant; Khan, M. S.; Pradhan, Subrata
2017-04-01
SST-1 Tokamak, the first Indian Steady-state Superconducting experimental device is at present under operation in the Institute for Plasma Research. For plasma break down & initiation, piezoelectric valve based gas feed system is implemented as a primary requirement due to its precise control, easy handling, low construction and maintenance cost and its flexibility in the selection of the working gas. Hydrogen gas feeding with piezoelectric valve is used in the SST-1 plasma experiments. The piezoelectric valves used in SST-1 are remotely driven by a PXI based platform and are calibrated before each SST-1 plasma operation with precise control. This paper will present the technical development and the results of the gas fuelling system of SST-1.
Kasthuri, Saranya Revathy; Premachandra, H K A; Umasuthan, Navaneethaiyer; Whang, Ilson; Lee, Jehee
2013-09-15
Repertoires of proteins and small peptides play numerous physiological roles as hormones, antimicrobial peptides, and cellular signaling factors. The beta-thymosins are a group of small acidic peptides involved in processes such as actin sequestration, neuronal development, wound healing, tissue repair, and angiogenesis. Recent characterization of the beta thymosins as immunological regulators in invertebrates led to our identification and characterization of a beta-thymosin homologue (Tβ) from Haliotis discus discus. The cDNA possessed an ORF of 132 bp encoding a protein of 44 amino acids with a molecular mass of 4977 Da. The amino acid sequence shows high identity with another molluskan beta-thymosin and has a characteristic actin binding motif (LKKTET) and glutamyl donors. Phylogenetic analysis showed a close relationship with molluskan homologues, as well as its distinct identity and common ancestral origin. Genomic analysis revealed a 3 exon-2 intron structure similar to the other homologues. In silico promoter analysis also revealed significant transcription factor binding sites, providing evidence for the expression of this gene under different cellular conditions, including stress or pathogenic attack. Tissue distribution profiling revealed a ubiquitous presence in all the examined tissues, but with the highest expression in mantle and hemocyte. Immune challenge with lipopolysaccharide, poly I:C and Vibrio parahemolyticus induced beta-thymosin expression in gill and hemocytes, affirming an immune-related role in invertebrates. Copyright © 2013 Elsevier B.V. All rights reserved.
Electricity and gas market observatory. 1. Quarter 2007
International Nuclear Information System (INIS)
2007-01-01
Since July 1, 2004, all electricity and gas consumers can be eligible according to their consumption site, as long as all or part of the electricity or gas consumed is designed for non-residential use. The purpose of the observatory is to provide the general public with indicators for monitoring market deregulation. It both covers the wholesale and retail electricity and gas markets in Metropolitan France. This observatory is updated every three months and data are available on CRE web site (www.cre.fr). It completes the information already published by CRE: - practical information for eligible customers: consumer guide, list of suppliers, - communications regarding markets running; CRE's annual activity report. Content: A - The electricity market: The retail electricity market (Introduction, Eligible customer segments and their respective weights, Status at April 1, 2007, Dynamic analysis: 1. Quarter 2007); The wholesale electricity market (Introduction, Traded volumes on the French wholesale electricity market and comparison with European markets, Prices on the French wholesale electricity market and European comparison, Import and export volumes, Concentration of the French electricity market, Striking facts of the 1. 2007 quarter); B - The gas market: The retail gas market (Introduction, The eligible customer segments and their respective weights, Status at April 1, 2007); The wholesale gas market (Gas pricing and gas markets in Europe, The wholesale market in France); C - Appendices: Electricity and gas market observatories combined glossary, Specific electricity market observatory glossary, Specific gas market observatory glossary
Electricity and gas market observatory 1. Quarter 2009
International Nuclear Information System (INIS)
2009-01-01
The purpose of the observatory is to provide the general public with indicators for monitoring market deregulation. It both covers the wholesale and retail electricity and gas markets in Metropolitan France. This observatory is updated every three months and data are available on CRE web site (www.cre.fr). Since the 1. of July 2007, all customers can choose their gas and electricity suppliers. Content: A - The electricity market: The retail electricity market (Introduction, Customer segments and their respective weight, Status on March 31, 2009, Dynamic analysis: 1. Quarter 2009), The wholesale electricity market (Introduction, Wholesale market activity in France, Prices on the French wholesale market and European comparison, Import and export volumes, Concentration of the French electricity market). B - The gas market: The retail gas market (Introduction, Customer segments and their respective weight, Status on March 31. 2009, Dynamic analysis: 1. Quarter 2009), The wholesale gas market (Main steps in the French Wholesale gas market, Gas pricing and gas markets in Europe, The wholesale market in France, Prices on the French wholesale market and European comparison, Concentration of the French gas market) C - Appendices: Electricity and gas market observatories combined glossary, Specific electricity market observatory glossary, Specific gas market observatory glossary
Periodontal status of teeth restored with crowns and its contralateral homologue, Valdivia- Chile.
Israel Antonio Juárez; Sofía Larroulet; Makarena Ojeda; Cristian Rosas
2015-01-01
ABSTRACT Aim: To determine periodontal status of fixes single prostheses (FSP) made during the year 2013 in Austral University of Chile, and its contralateral homologue (CH).Methods: All patients with FSP made during 2013, that met the selection criteria and agreed to participate were evaluated. During the year 2014 was measured: probing depth, attachment level; bleeding on probing and dental plaque index for each FSP and CH; and consigned biological width invasion. Were measured one FSP...
Energy Technology Data Exchange (ETDEWEB)
Lautenschlaeger, Felix; Walther, Thomas [Institut fuer Angewandte Physik, TU Darmstadt, 64289 Darmstadt (Germany); Laatiaoui, Mustapha; Block, Michael [GSI Helmholtzzentrum fuer Schwerionenforschung GmbH, 64291 Darmstadt (Germany); Helmholtz-Institut Mainz, 55128 Mainz (Germany); Lauth, Werner; Backe, Hartmut [Institut fuer Kernphysik, JGU Mainz, 55128 Mainz (Germany); Hessberger, Fritz-Peter [GSI Helmholtzzentrum fuer Schwerionenforschung GmbH, 64291 Darmstadt (Germany)
2013-07-01
The study of the atomic structure of transfermium elements like nobelium (No) and lawrencium (Lr) via Radiation Detected Resonance Ionization Spectroscopy (RADRIS) is one of the most fascinating disciplines of modern atomic physics. It allows the determination of relativistic effects at the heaviest elements and provides a critical test of theoretical predictions. For these transfermium elements no experimental data on atomic level schemes are available at present. First experiments on {sup 254}No were performed in 2007, in which a buffer gas cell with an overall efficiency of 1%. In this experiment the evaporation temperature of nobelium was determined for the first time. To increase the efficiency of the buffer gas cell, off-line measurements have been performed with nat. ytterbium, the chemical homologue of nobelium. Also on-line experiments during a parasitic beam-time in 2012 provided an insight into the critical parameters of our setup. The results of the off-line and on-line measurements are briefly summarized in this talk.
Yuan, Bo; Fu, Jianjie; Wang, Yawei; Jiang, Guibin
2017-01-01
Short-chain chlorinated paraffins (SCCPs) in multi-environmental matrices are studied in Taizhou, Zhejiang Province, China, which is a notorious e-waste dismantling area. The investigated matrices consist of paddy field soil, paddy seeds (Oryza sativa, separated into hulls and rice unpolished) and apple snails (Ampullariidae, inhabiting the paddy fields). The sampling area covered a 65-km radius around the contamination center. C 10 and C 11 are the two predominant homologue groups in the area, accounting for about 35.7% and 33.0% of total SCCPs, respectively. SCCPs in snails and hulls are generally higher than in soil samples (30.4-530 ng/g dw), and SCCPs in hulls are approximate five times higher than in corresponding rice samples (4.90-55.1 ng/g dw). Homologue pattern analysis indicates that paddy seeds (both hull and rice) tend to accumulate relatively high volatile SCCP homologues, especially the ones with shorter carbon chain length, while snails tend to accumulate relatively high lipophilic homologues, especially the ones with more substituted chlorines. SCCPs in both paddy seeds and snails are linearly related to those in the soil. The e-waste dismantling area, which covers a radius of approximate 20 km, shows higher pollution levels for SCCPs according to their spatial distribution in four matrices. The preliminary assessment indicates that SCCP levels in local soils pose no significant ecological risk for soil dwelling organisms, but higher risks from dietary exposure of SCCPs are suspected for people living in e-waste dismantling area. Copyright © 2016 Elsevier Ltd. All rights reserved.
International Nuclear Information System (INIS)
Canduri, R.J.; Ward, R.J.; Azevedo Junior, G.W.F. de; Arni, R.K.; Soares, A.M.; Giglio, J.R.
1997-01-01
Full text. Phospho lipases A2 (PLA 2 ) are small enzymes that specifically hydrolysed the sn-2 ester bond of phospholipids, preferentially in lamellar or micellar aggregates at membrane surfaces. These enzymes are widely distributed in nature and have been extensively studied. Toxic proteins from venoms from Bothrops species include catalytically active PLA 2 s and calcium independent PLA 2L ys 49 homologues. The substitution of Asp49 by Lys greatly diminishes the ability of these PLA 2 to bind calcium, an ion that plays a critical role in the stabilization of the tetrahedral transition state intermediate in the catalytic mechanism. The Lys 49 PLA 2 homologues and therefore catalytically inactive yet maintain cytolytic and myotoxic activities and furthermore retain the ability to disrupt the integrity of both plasma membranes and model lipid bilayers by a poorly understood Ca 2+ independente mechanism. Lys49 PLA 2 homologues demonstrate a specific toxic activity against skeletal muscle, affecting only muscle fibers and leaving other tissue structure such as connective tissue, nerves and vessels essentially unharmed. In order to improve our understanding of the molecular basis of the myotoxic and Ca 2+ -independent membrane damaging activities, we have determined the crystal structure of Pr TX-I, a Lys49 variant from the venom of B. pirajai. The model presented has been determined at 2.8 angstrom resolution and refined to a crystallographic residual of 19.7% (R free =29.7%). (author)
Electricity and gas market observatory. 1. Quarter 2008
International Nuclear Information System (INIS)
2008-01-01
The purpose of the observatory is to provide the general public with indicators for monitoring market deregulation. It both covers the wholesale and retail electricity and gas markets in Metropolitan France. This observatory is updated every three months and data are available on CRE web site (www.cre.fr). Since the 1. of July 2007, all customers can choose their gas and electricity suppliers. Content: A - The electricity market: The retail electricity market (Introduction, Customer segments and their respective weight, Status at March 31, 2007, Dynamic analysis: 1. Quarter 2008); The wholesale electricity market (Introduction, Wholesale market activity in France, Prices on the French wholesale market and European comparison, Import and export volumes, Concentration of the French electricity market); B - The gas market: The retail gas market (Introduction, Customer segments and their respective weight, Status on March 31, 2008, Dynamic analysis: 1. Quarter 2008); The wholesale gas market (Gas pricing and gas markets in Europe, The wholesale market in France, Striking fact of the first quarter 2008); C - Appendices: Electricity and gas market observatories combined glossary, Specific electricity market observatory glossary, Specific gas market observatory glossary
Phospholipase C δ-type consists of three isozymes: bovine PLCδ2 is a homologue of human/mouse PLCδ4
International Nuclear Information System (INIS)
Irino, Yasuhiro; Cho, Hiroyuki; Nakamura, Yoshikazu; Nakahara, Masamichi; Furutani, Masahiro; Suh, Pann-Ghill; Takenawa, Tadaomi; Fukami, Kiyoko
2004-01-01
To date, 12 phospholipase C (PLC) isozymes have been identified in mammals, and they are divided into five classes, β-, γ-, δ-, ε-, and ζ-type. PLCδ-type is reported to be composed of four isozymes, PLCδ1-δ4. Here we report that a screening for mouse PLCδ2 from a BAC library with primers that amplify a specific region of bovine PLCδ2 resulted in isolation of one clone containing the mouse PLCδ4 gene. Furthermore, a database search revealed that there is only one gene corresponding to PLCδ2 and PLCδ4 in the mouse and human genomes, indicating that bovine PLCδ2 is a homologue of human and mouse PLCδ4. However, PLCδ2 Western blot analysis with a widely used commercial anti-PLCδ2 antibody showed an expression pattern distinct from that of PLCδ4 in wild-type mice. In addition, an 80-kDa band, which was recognized by antibody against PLCδ2, was smaller than an 85-kDa band detected by anti-PLCδ4 antibody, and the 80-kDa band was detectable in lysates of brain, testis, and spleen from PLCδ4-deficient mice. We also found that immunoprecipitates from brain lysates with this PLCδ2 antibody contained no PLC activity. From these data, we conclude that bovine PLCδ2 is a homologue of human and mouse PLCδ4, and that three isozymes (δ1, δ3, and δ4) exist in the PLCδ family
Wang, Xue-Tong; Xu, Si-Yue; Wang, Xi-Kui; Hu, Bao-Ping; Jia, Hao-Hao
2017-08-01
In order to systematically investigate the spatial distribution, homologue profiles, and sources of short- and medium-chain chlorinated paraffins (SCCPs and MCCPs) in suburban soils in Shanghai, SCCPs and MCCPs in soils were analyzed using gas chromatography coupled with low resolution mass spectrometry in electron capture negative ion (ECNI) mode (GC-ECNI-MS). The CP concentrations in soils were between not detected (ND) - 697 ng g -1 with a median value of 3.52 ng g -1 for SCCPs, and ND - 666 ng g -1 with a median value of 15.3 ng g -1 for MCCPs, respectively. The concentrations of MCCPs in most soils were higher than that of SCCPs. The total CP concentrations (sum of SCCPs and MCCPs) in soils varied from ND to 964 ng g -1 with a median value of 20.5 ng g -1 . The concentration of MCCPs was higher than that of SCCPs in most soils. The levels of SCCPs and MCCPs in suburban soils in Shanghai were at the medium level when compared to other areas around the world. No significant correlation was observed between soil CP concentrations and total organic carbon contents (p > 0.05). For different use type of soils, the median concentrations of CPs in soils were found higher in greenland than that in other areas probably due to busy traffic, sewage sludge application and/or wastewater irrigation. All soils were divided into two groups by hierarchical cluster analysis (HCA) both for SCCPs and MCCPs. Three discharge sources of CPs in suburban soil of Shanghai were identified by PMF model. Copyright © 2017 Elsevier Ltd. All rights reserved.
Xu, F; Liang, X; Lin, B; Su, F
1999-03-01
Based on the linear retention equation of the logarithm of the capacity factor (logk') vs. the methanol volume fraction (psi) of aqueous binary mobile phase in soil leaching column chromatography, the intersection point rule for the logk' of homologues and weak polar chlorobenzenes, with psi, as well as with boiling point, has been derived due to existence of the similar interactions among solutes of the same series, stationary phase (soil) and eluent (methanol-water). These rules were testified by experimental data of homologues (n-alkylbenzenes, methylbenzenes) and weak polar chlorobenzenes.
The toxic equivalency (TEQ) values of polychlorinated dibenzo-p-dioxins and polychlorinated dibenzofurans (PCDD/Fs) are predicted with a model based on the homologue concentrations measured from a laboratory-scale reactor (124 data points), a package boiler (61 data points), and ...
Posey, Karen L; Koufopanou, Vassiliki; Burt, Austin; Gimble, Frederick S
2004-01-01
Homing endonuclease genes (HEGs) are mobile DNA elements that are thought to confer no benefit to their host. They encode site-specific DNA endonucleases that perpetuate the element within a species population by homing and disseminate it between species by horizontal transfer. Several yeast species contain the VMA1 HEG that encodes the intein-associated VMA1-derived endonuclease (VDE). The evolutionary state of VDEs from 12 species was assessed by assaying their endonuclease activities. Only two enzymes are active, PI-ZbaI from Zygosaccharomyces bailii and PI-ScaI from Saccharomyces cariocanus. PI-ZbaI cleaves the Z.bailii recognition sequence significantly faster than the Saccharomyces cerevisiae site, which differs at six nucleotide positions. A mutational analysis indicates that PI-ZbaI cleaves the S.cerevisiae substrate poorly due to the absence of a contact that is analogous to one made in PI-SceI between Gln-55 and nucleotides +9/+10. PI-ZbaI cleaves the Z.bailii substrate primarily due to a single base-pair substitution (A/T+5 --> T/A+5). Structural modeling of the PI-ZbaI/DNA complex suggests that Arg-331, which is absent in PI-SceI, contacts T/A+5, and the reduced activity observed in a PI-ZbaI R331A mutant provides evidence for this interaction. These data illustrate that homing endonucleases evolve altered specificity as they adapt to recognize alternative target sites.
Posey, Karen L.; Koufopanou, Vassiliki; Burt, Austin; Gimble, Frederick S.
2004-01-01
Homing endonuclease genes (HEGs) are mobile DNA elements that are thought to confer no benefit to their host. They encode site-specific DNA endonucleases that perpetuate the element within a species population by homing and disseminate it between species by horizontal transfer. Several yeast species contain the VMA1 HEG that encodes the intein-associated VMA1-derived endonuclease (VDE). The evolutionary state of VDEs from 12 species was assessed by assaying their endonuclease activities. Only two enzymes are active, PI-ZbaI from Zygosaccharomyces bailii and PI-ScaI from Saccharomyces cariocanus. PI-ZbaI cleaves the Z.bailii recognition sequence significantly faster than the Saccharomyces cerevisiae site, which differs at six nucleotide positions. A mutational analysis indicates that PI-ZbaI cleaves the S.cerevisiae substrate poorly due to the absence of a contact that is analogous to one made in PI-SceI between Gln-55 and nucleotides +9/+10. PI-ZbaI cleaves the Z.bailii substrate primarily due to a single base-pair substitution (A/T+5 → T/A+5). Structural modeling of the PI-ZbaI/DNA complex suggests that Arg-331, which is absent in PI-SceI, contacts T/A+5, and the reduced activity observed in a PI-ZbaI R331A mutant provides evidence for this interaction. These data illustrate that homing endonucleases evolve altered specificity as they adapt to recognize alternative target sites. PMID:15280510
Trans-Caspian gas pipeline feasibility study. Volume 1
International Nuclear Information System (INIS)
1999-01-01
This study, conducted by Enron Engineering and Construction Company, was funded by the US Trade and Development Agency. The study provides detailed information concerning natural gas demand in Turkey and Southern Europe. The purpose of the study is to estimate the rate at which new gas can be absorbed in the Turkish market and be re-exported to the markets in Europe, as well as to forecast Turkish natural gas demand for the period up to 2020. The study also evaluates gas demand and pricing for the market in the 2002--2005 time frame. This is Volume 1 of a 3-volume report, and is divided into the following sections: (1) Task A: Gas Sales; (2) Task B: Initial Economic Screening; (3) Task D: Project Cost Analysis
Wang, Thanh; Han, Shanlong; Yuan, Bo; Zeng, Lixi; Li, Yingming; Wang, Yawei; Jiang, Guibin
2012-12-01
Short chain chlorinated paraffins (SCCPs) are semi-volatile chemicals that are considered persistent in the environment, potential toxic and subject to long-range transport. This study investigates the concentrations and gas-particle partitioning of SCCPs at an urban site in Beijing during summer and wintertime. The total atmospheric SCCP levels ranged 1.9-33.0 ng/m(3) during wintertime. Significantly higher levels were found during the summer (range 112-332 ng/m(3)). The average fraction of total SCCPs in the particle phase (ϕ) was 0.67 during wintertime but decreased significantly during the summer (ϕ = 0.06). The ten and eleven carbon chain homologues with five to eight chlorine atoms were the predominant SCCP formula groups in air. Significant linear correlations were found between the gas-particle partition coefficients and the predicted subcooled vapor pressures and octanol-air partition coefficients. The gas-particle partitioning of SCCPs was further investigated and compared with both the Junge-Pankow adsorption and K(oa)-based absorption models. Copyright © 2012 Elsevier Ltd. All rights reserved.
Targeting the Enhancer of Zeste Homologue 2 in Medulloblastoma
Alimova, Irina; Venkataraman, Sujatha; Harris, Peter; Marquez, Victor E.; Northcott, Paul A; Dubuc, Adrian; Taylor, Michael D; Foreman, Nicholas K; Vibhakar, Rajeev
2012-01-01
Enhancer of zeste homologue 2 (EZH2) is the catalytic subunit of Polycomb repressive complex 2 that catalyzes the trimethylation of histone H3 on Lys 27, and represses gene transcription. EZH2 enhances cancer-cell proliferation and regulates stem cell maintenance and differentiation. Here, we demonstrate that EZH2 is highly expressed in medulloblastoma, a highly malignant brain tumor of childhood, and this altered expression is correlated with genomic gain of chromosome 7 in a subset of medulloblastoma. Inhibition of EZH2 by RNAi suppresses medulloblastoma tumor cell growth. We show that 3-deazaneplanocin A, a chemical inhibitor of EZH2, can suppress medulloblastoma cell growth partially by inducing apoptosis. Suppression of EZH2 expression diminishes the ability of tumor cells to form spheres in culture and strongly represses the ability of known oncogenes to transform neural stem cells. These findings establish a role of EZH2 in medulloblastoma and identify EZH2 as a potential therapeutic target especially in high-risk tumors. PMID:22287205
Kotani, Eiji; Muto, Sayaka; Ijiri, Hiroshi; Mori, Hajime
2015-07-01
Previous reports have indicated that the Bombyx mori nucleopolyhedrovirus (BmNPV) nucleic acid binding proteins BRO-B and BRO-E are expressed during the early stage of infection and that the BRO family likely supports the regulation of mRNA; however, no study has directly examined the function of BRO family proteins in virus-permissive cells. Here, we show that BRO-B and BRO-E associate with cellular T-cell intracellular antigen 1 homologue (BmTRN-1), a translational regulator, and other cellular translation-related proteins in silkworm cells during viral infection. We created BM-N cells that expressed BRO-B/E to study molecular interactions between BmTRN-1 and BRO-B/E and how they influenced protein synthesis. Fluorescent microscopy revealed that BmTRN-1 was localized in cytoplasmic foci during BmNPV infection. Immunofluorescence studies confirmed that BmTRN-1 and BRO-B/E were colocalized in the amorphous conspicuous cytoplasmic foci. Reporter gene studies revealed that co-expression of BRO-B/E synergistically led to a significant decrease in protein synthesis from a designed transcript carrying the 5'untranslated region of a cellular mRNA with no significant change of transcript abundance. Additionally, RNA interference-mediated knockdown of BmTRN-1 resulted in a marked inhibition of the ability of BRO-B/E to regulate the transcript. These results suggested that the association of BmTRN-1 with BRO-B/E is responsible for the inhibitory regulation of certain mRNAs at the post-transcriptional level and add an additional mechanism for how baculoviruses control protein synthesis during infection.
Geluk, Annemieke; van Meijgaarden, Krista E.; Franken, Kees L. M. C.; Subronto, Yanri W.; Wieles, Brigitte; Arend, Sandra M.; Sampaio, Elizabeth P.; de Boer, Tjitske; Faber, William R.; Naafs, Ben; Ottenhoff, Tom H. M.
2002-01-01
In this paper we describe identification and characterization of Mycobacterium leprae ESAT-6 (L-ESAT-6), the homologue of M. tuberculosis ESAT-6 (T-ESAT-6). T-ESAT-6 is expressed by all pathogenic strains belonging to the M. tuberculosis complex but is absent from virtually all other mycobacterial
Johnson, William H; Wang, Susan C; Stanley, Thanuja M; Czerwinski, Robert M; Almrud, Jeffrey J; Poelarends, Gerrit J; Murzin, Alexey G; Whitman, Christian P
2004-01-01
A series of 2-fluoro-4-alkene and 2-fluoro-4-alkyne substrate analogues were synthesized and examined as potential inhibitors of three enzymes: 4-oxalocrotonate tautomerase (4-OT) and vinylpyruvate hydratase (VPH) from the catechol meta-fission pathway and a closely related 4-OT homologue found in
Kroczynska, Barbara; Evangelista, Christina M; Samant, Shalaka S; Elguindi, Ebrahim C; Blond, Sylvie Y
2004-03-19
The murine tumor cell DnaJ-like protein 1 or MTJ1/ERdj1 is a membrane J-domain protein enriched in microsomal and nuclear fractions. We previously showed that its lumenal J-domain stimulates the ATPase activity of the molecular chaperone BiP/GRP78 (Chevalier, M., Rhee, H., Elguindi, E. C., and Blond, S. Y. (2000) J. Biol. Chem. 275, 19620-19627). MTJ1/ERdj1 also contains a large carboxyl-terminal cytosolic extension composed of two tryptophan-mediated repeats or SANT domains for which the function(s) is unknown. Here we describe the cloning of the human homologue HTJ1 and its interaction with alpha(1)-antichymotrypsin (ACT), a member of the serine proteinase inhibitor (serpin) family. The interaction was initially identified in a two-hybrid screening and further confirmed in vitro by dot blots, native electrophoresis, and fluorescence studies. The second SANT domain of HTJ1 (SANT2) was found to be sufficient for binding to ACT, both in yeast and in vitro. Single tryptophan-alanine substitutions at two strictly conserved residues significantly (Trp-497) or totally (Trp-520) abolished the interaction with ACT. SANT2 binds to human ACT with an intrinsic affinity equal to 0.5 nm. Preincubation of ACT with nearly stoichiometric concentrations of SANT2 wild-type but not SANT2: W520A results in an apparent loss of ACT inhibitory activity toward chymotrypsin. Kinetic analysis indicates that the formation of the covalent inhibitory complex ACT-chymotrypsin is significantly delayed in the presence of SANT2 with no change on the catalytic efficiency of the enzyme. This work demonstrates for the first time that the SANT2 domain of MTJ1/HTJ1/ERdj1 mediates stable and high affinity protein-protein interactions.
The actin homologue MreB organizes the bacterial cell membrane.
Strahl, Henrik; Bürmann, Frank; Hamoen, Leendert W
2014-03-07
The eukaryotic cortical actin cytoskeleton creates specific lipid domains, including lipid rafts, which determine the distribution of many membrane proteins. Here we show that the bacterial actin homologue MreB displays a comparable activity. MreB forms membrane-associated filaments that coordinate bacterial cell wall synthesis. We noticed that the MreB cytoskeleton influences fluorescent staining of the cytoplasmic membrane. Detailed analyses combining an array of mutants, using specific lipid staining techniques and spectroscopic methods, revealed that MreB filaments create specific membrane regions with increased fluidity (RIFs). Interference with these fluid lipid domains (RIFs) perturbs overall lipid homeostasis and affects membrane protein localization. The influence of MreB on membrane organization and fluidity may explain why the active movement of MreB stimulates membrane protein diffusion. These novel MreB activities add additional complexity to bacterial cell membrane organization and have implications for many membrane-associated processes.
Jaiswal, Richa; Stepanik, Vince; Rankova, Aneliya; Molinar, Olivia; Goode, Bruce L; McCartney, Brooke M
2013-05-10
Vertebrate APC collaborates with Dia through its Basic domain to assemble actin filaments. Despite limited sequence homology between the vertebrate and Drosophila APC Basic domains, Drosophila APC1 collaborates with Dia to stimulate actin assembly in vitro. The mechanism of actin assembly is highly conserved over evolution. APC-Dia collaborations may be crucial in a wide range of animal cells. Adenomatous polyposis coli (APC) is a large multidomain protein that regulates the cytoskeleton. Recently, it was shown that vertebrate APC through its Basic domain directly collaborates with the formin mDia1 to stimulate actin filament assembly in the presence of nucleation barriers. However, it has been unclear whether these activities extend to homologues of APC and Dia in other organisms. Drosophila APC and Dia are each required to promote actin furrow formation in the syncytial embryo, suggesting a potential collaboration in actin assembly, but low sequence homology between the Basic domains of Drosophila and vertebrate APC has left their functional and mechanistic parallels uncertain. To address this question, we purified Drosophila APC1 and Dia and determined their individual and combined effects on actin assembly using both bulk fluorescence assays and total internal reflection fluorescence microscopy. Our data show that APC1, similar to its vertebrate homologue, bound to actin monomers and nucleated and bundled filaments. Further, Drosophila Dia nucleated actin assembly and protected growing filament barbed ends from capping protein. Drosophila APC1 and Dia directly interacted and collaborated to promote actin assembly in the combined presence of profilin and capping protein. Thus, despite limited sequence homology, Drosophila and vertebrate APCs exhibit highly related activities and mechanisms and directly collaborate with formins. These results suggest that APC-Dia interactions in actin assembly are conserved and may underlie important in vivo functions in a broad
The gas phase oxide and oxyhydroxide chemistry of trace amounts of rhenium
International Nuclear Information System (INIS)
Eichler, R.; Eichler, B.; Jost, D.T.; Dressler, R.; Tuerler, A.; Gaeggeler, H.W.
1999-01-01
In preparation of experiments to investigate the chemical properties of bohrium (Bh, element 107) the behaviour of Re, its lighter homologue in group 7, was studied in different oxidizing chemical systems. The adsorption data of Re oxide and oxyhydroxide compounds on quartz surfaces were evaluated from results of thermochromatography experiments and confirmed in isothermal gas chromatography experiments applying 1 cm as standard state for the simple gas adsorption process: X(g) ↔ X(ads) (X = ReO 3 , HReO 4 ) ΔH ads (ReO 3 ) = -190 ± 10 kJ/mol; ΔS ads (ReO 3 ) = -179±30 J/mol K; ΔH ads (HReO 4 ) = -77 ± 5 kJ/mol; ΔS ads (HReO 4 ) = -187±50 J/mol K. An on-line separation method for oxides and oxyhydroxides of short lived Re isotopes using isothermal high temperature gas-solid adsorption chromatography was developed. Separation yields and times of group 7 elements from lanthanides (model for actinides), polonium and bismuth were determined using the model isotopes 169,170,174,176 Re, 152-155 Er, 151-154 Ho, 218 Po, and 214 Bi. An updated correlation function between the microscopic adsorption enthalpy and the macroscopic sublimation enthalpy was calculated from the experimental adsorption data of this work and literature data. (orig.)
Directory of Open Access Journals (Sweden)
Aino L K Liukko
Full Text Available Lipocalin allergens form a notable group of proteins, as they contain most of the significant respiratory allergens from mammals. The basis for the allergenic capacity of allergens in the lipocalin family, that is, the development of T-helper type 2 immunity against them, is still unresolved. As immunogenicity has been proposed to be a decisive feature of allergens, the purpose of this work was to examine human CD4+ T cell responses to the major dog allergen Can f 1 and to compare them with those to its human homologue, tear lipocalin (TL. For this, specific T cell lines were induced in vitro from the peripheral blood mononuclear cells of Can f 1-allergic and healthy dog dust-exposed subjects with peptides containing the immunodominant T cell epitopes of Can f 1 and the corresponding TL peptides. We found that the frequency of Can f 1 and TL-specific T cells in both subject groups was low and close to each other, the difference being about two-fold. Importantly, we found that the proliferative responses of both Can f 1 and TL-specific T cell lines from allergic subjects were stronger than those from healthy subjects, but that the strength of the responses within the subject groups did not differ between these two antigens. Moreover, the phenotype of the Can f 1 and TL-specific T cell lines, determined by cytokine production and expression of cell surface markers, resembled each other. The HLA system appeared to have a minimal role in explaining the allergenicity of Can f 1, as the allergic and healthy subjects' HLA background did not differ, and HLA binding was very similar between Can f 1 and TL peptides. Along with existing data on lipocalin allergens, we conclude that strong antigenicity is not decisive for the allergenicity of Can f 1.
Collier, G.; Gibson, G.
1968-01-01
FORTRAN 4 program /P1-GAS/ calculates the P-O and P-1 transfer matrices for neutron moderation in a monatomic gas. The equations used are based on the conditions that there is isotropic scattering in the center-of-mass coordinate system, the scattering cross section is constant, and the target nuclear velocities satisfy a Maxwellian distribution.
Background gas density and beam losses in NIO1 beam source
Energy Technology Data Exchange (ETDEWEB)
Sartori, E., E-mail: emanuele.sartori@igi.cnr.it; Veltri, P.; Serianni, G. [Consorzio RFX (CNR, ENEA, INFN, Università di Padova, Acciaierie Venete SpA), C.so Stati Uniti 4, 35127 Padova (Italy); Cavenago, M. [INFN-LNL, v.le dell’Università 2, I-35020 Legnaro (PD) (Italy)
2016-02-15
NIO1 (Negative Ion Optimization 1) is a versatile ion source designed to study the physics of production and acceleration of H- beams up to 60 keV. In ion sources, the gas is steadily injected in the plasma source to sustain the discharge, while high vacuum is maintained by a dedicated pumping system located in the vessel. In this paper, the three dimensional gas flow in NIO1 is studied in the molecular flow regime by the Avocado code. The analysis of the gas density profile along the accelerator considers the influence of effective gas temperature in the source, of the gas temperature accommodation by collisions at walls, and of the gas particle mass. The calculated source and vessel pressures are compared with experimental measurements in NIO1 during steady gas injection.
Wang, Huili; Hao, Wei; Ning, Tingting; Zheng, Mingli; Xu, Chuncheng
2018-02-01
This study investigated the association of yeast species with improved aerobic stability of total mixed ration (TMR) silages with prolonged ensiling, and clarified the characteristics of yeast species and their role during aerobic deterioration. Whole crop corn (WCC) silages and TMR silages formulated with WCC were ensiled for 7, 14, 28, and 56 d and used for an aerobic stability test. Predominant yeast species were isolated from different periods and identified by sequencing analyses of the 26S rRNA gene D1/D2 domain. Characteristics (assimilation and tolerance) of the yeast species and their role during aerobic deterioration were investigated. In addition to species of Candida glabrata and Pichia kudriavzevii ( P. kudriavzevii ) previously isolated in WCC and TMR, Pichia manshurica ( P. manshurica ), Candida ethanolica ( C. ethanolica ), and Zygosaccharomyces bailii ( Z. bailii ) isolated at great frequency during deterioration, were capable of assimilating lactic or acetic acid and tolerant to acetic acid and might function more in deteriorating TMR silages at early fermentation (7 d and 14 d). With ensiling prolonged to 28 d, silages became more (p<0.01) stable when exposed to air, coinciding with the inhibition of yeast to below the detection limit. Species of P. manshurica that were predominant in deteriorating WCC silages were not detectable in TMR silages. In addition, the predominant yeast species of Z. bailii in deteriorating TMR silages at later fermentation (28 d and 56 d) were not observed in both WCC and WCC silages. The inhibition of yeasts, particularly P. kudriavzevii , probably account for the improved aerobic stability of TMR silages at later fermentation. Fewer species seemed to be involved in aerobic deterioration of silages at later fermentation and Z. bailii was most likely to initiate the aerobic deterioration of TMR silages at later fermentation. The use of WCC in TMR might not influence the predominant yeast species during aerobic
Directory of Open Access Journals (Sweden)
Huili Wang
2018-02-01
Full Text Available Objective This study investigated the association of yeast species with improved aerobic stability of total mixed ration (TMR silages with prolonged ensiling, and clarified the characteristics of yeast species and their role during aerobic deterioration. Methods Whole crop corn (WCC silages and TMR silages formulated with WCC were ensiled for 7, 14, 28, and 56 d and used for an aerobic stability test. Predominant yeast species were isolated from different periods and identified by sequencing analyses of the 26S rRNA gene D1/D2 domain. Characteristics (assimilation and tolerance of the yeast species and their role during aerobic deterioration were investigated. Results In addition to species of Candida glabrata and Pichia kudriavzevii (P. kudriavzevii previously isolated in WCC and TMR, Pichia manshurica (P. manshurica, Candida ethanolica (C. ethanolica, and Zygosaccharomyces bailii (Z. bailii isolated at great frequency during deterioration, were capable of assimilating lactic or acetic acid and tolerant to acetic acid and might function more in deteriorating TMR silages at early fermentation (7 d and 14 d. With ensiling prolonged to 28 d, silages became more (p<0.01 stable when exposed to air, coinciding with the inhibition of yeast to below the detection limit. Species of P. manshurica that were predominant in deteriorating WCC silages were not detectable in TMR silages. In addition, the predominant yeast species of Z. bailii in deteriorating TMR silages at later fermentation (28 d and 56 d were not observed in both WCC and WCC silages. Conclusion The inhibition of yeasts, particularly P. kudriavzevii, probably account for the improved aerobic stability of TMR silages at later fermentation. Fewer species seemed to be involved in aerobic deterioration of silages at later fermentation and Z. bailii was most likely to initiate the aerobic deterioration of TMR silages at later fermentation. The use of WCC in TMR might not influence the predominant
Zhai, Yifan; Yang, James C.; Spiess, Paul; Nishimura, Michael I.; Overwijk, Willem W.; Roberts, Bruce; Restifo, Nicholas P.; Rosenberg, Steven A.
2008-01-01
The recent identification of genes encoding melanoma-associated antigens has opened new possibilities for the development of cancer vaccines designed to cause the rejection of established tumors. To develop a syngeneic animal model for evaluating antigen-specific vaccines in cancer therapy, the murine homologues of the human melanoma antigens MART1 and gp 100, which were specifically recognized by tumor-infiltrating lymphocytes from patients with melanoma, were cloned and sequenced from a murine B16 melanoma cDNA library. The open reading frames of murine MART1 and gp 100 encode proteins of 113- and 626-amino acids with 68.8 and 77% identity to the respective human proteins. Comparison of the DNA sequences of the murine MART1 genes, derived from normal melanocytes, the immortalized nontumorgenic melanocyte line Melan-a and the B16 melanoma, showed all to be identical. Northern and Western blot analyses confirmed that both genes encoded products that were melanocyte lineage proteins. Mice immunized with murine MART1 or gp 100 using recombinant vaccinia virus failed to produce any detectable T-cell responses or protective immunity against B16 melanoma. In contrast, immunization of mice with human gp 100 using recombinant adenoviruses elicited T cells specific for hgp100, but these T cells also cross reacted with B16 tumor in vitro and induced significant but weak protection against B16 challenge. Immunization with human and mouse gp100 together [adenovirus type 2 (Ad2)-hep100 plus recombinant vaccinia virus (rVV)-mgp100], or immunization with human gp100 (Ad2-hgp100) and boosting with heterologous vector (rVV-hgp100 or rVV-mgp100) or homologous vector (Ad2-hgp100), did not significantly enhance the protective response against B16 melanoma. These results may suggest that immunization with heterologous tumor antigen, rather than self, may be more effective as an immunotherapeutic reagent in designing antigen-specific cancer vaccines. PMID:9101410
Gašparič, Meti Buh; Lenassi, Metka; Gostinčar, Cene; Rotter, Ana; Plemenitaš, Ana; Gunde-Cimerman, Nina; Gruden, Kristina; Zel, Jana
2013-01-01
Soil salinity and drought are among the most serious agricultural and environmental problems of today. Therefore, investigations of plant resistance to abiotic stress have received a lot of attention in recent years. In this study, we identified the complete coding sequence of a 3'-phosphoadenosine-5'-phosphatase protein, ApHal2, from the halotolerant yeast Aureobasidium pullulans. Expression of the ApHAL2 gene in a Saccharomyces cerevisiae hal2 mutant complemented the mutant auxotrophy for methionine, and rescued the growth of the hal2 mutant in media with high NaCl concentrations. A 21-amino-acids-long region of the ApHal2 enzyme was inserted into the Arabidopsis thaliana homologue of Hal2, the SAL1 phosphatase. The inserted sequence included the META motif, which has previously been implicated in increased sodium tolerance of the Hal2 homologue from a related fungal species. Transgenic Arabidopsis plants overexpressing this modified SAL1 (mSAL1) showed improved halotolerance and drought tolerance. In a medium with an elevated salt concentration, mSAL1-expressing plants were twice as likely to have roots in a higher length category in comparison with the wild-type Arabidopsis and with plants overexpressing the native SAL1, and had 5% to 10% larger leaf surface area under moderate and severe salt stress, respectively. Similarly, after moderate drought exposure, the mSAL1-expressing plants showed 14% increased dry weight after revitalisation, with no increase in dry weight of the wild-type plants. With severe drought, plants overexpressing native SAL1 had the worst rehydration success, consistent with the recently proposed role of SAL1 in severe drought. This was not observed for plants expressing mSAL1. Therefore, the presence of this fungal META motif sequence is beneficial under conditions of increased salinity and moderate drought, and shows no drawbacks for plant survival under severe drought. This demonstrates that adaptations of extremotolerant fungi should
OAS proteins and cGAS: unifying concepts in sensing and responding to cytosolic nucleic acids.
Hornung, Veit; Hartmann, Rune; Ablasser, Andrea; Hopfner, Karl-Peter
2014-08-01
Recent discoveries in the field of innate immunity have highlighted the existence of a family of nucleic acid-sensing proteins that have similar structural and functional properties. These include the well-known oligoadenylate synthase (OAS) family proteins and the recently identified OAS homologue cyclic GMP-AMP (cGAMP) synthase (cGAS). The OAS proteins and cGAS are template-independent nucleotidyltransferases that, once activated by double-stranded nucleic acids in the cytosol, produce unique classes of 2'-5'-linked second messenger molecules, which - through distinct mechanisms - have crucial antiviral functions. 2'-5'-linked oligoadenylates limit viral propagation through the activation of the enzyme RNase L, which degrades host and viral RNA, and 2'-5'-linked cGAMP activates downstream signalling pathways to induce de novo antiviral gene expression. In this Progress article, we describe the striking functional and structural similarities between OAS proteins and cGAS, and highlight their roles in antiviral immunity.
Holden gas-fired furnace baseline data. Revision 1
International Nuclear Information System (INIS)
Weatherspoon, K.A.
1996-11-01
The Holden gas-fired furnace is used in the enriched uranium recovery process to dry and combust small batches of combustibles. The ash is further processed. The furnace operates by allowing a short natural gas flame to burn over the face of a wall of porous fire brick on two sides of the furnace. Each firing wall uses two main burners and a pilot burner to heat the porous fire brick to a luminous glow. Regulators and orifice valves are used to provide a minimum gas pressure of 4 in. water column at a rate of approximately 1,450 scf/h to the burners. The gas flow rate was calculated by determining the gas flow appropriate for the instrumentation in the gas line. Observed flame length and vendor literature were used to calculate pilot burner gas consumption. Air for combustion, purging, and cooling is supplied by a single blower. Rough calculations of the air-flow distribution in piping entering the furnace show that air flow to the burners approximately agrees with the calculated natural gas flow. A simple on/off control loop is used to maintain a temperature of 1,000 F in the furnace chamber. Hoods and glove boxes provide contamination control during furnace loading and unloading and ash handling. Fan EF-120 exhausts the hoods, glove boxes, and furnace through filters to Stack 33. A review of the furnace safety shows that safety is ensured by design, interlocks, procedure, and a safety system. Recommendations for safety improvements include installation of both a timed ignition system and a combustible-gas monitor near the furnace. Contamination control in the area could be improved by redesigning the loading hood face and replacing worn gaskets throughout the system. 33 refs., 16 figs
Directory of Open Access Journals (Sweden)
Grauman Peter L
2007-07-01
Full Text Available Abstract Background Frataxin is discussed as involved in the biogenesis of iron-sulfur clusters. Recently it was discovered that a frataxin homologue is a structural component of the respiratory NADH:ubiquinone oxidoreductase (complex I in Thermus thermophilus. It was not clear whether frataxin is in general a component of complex I from bacteria. The Escherichia coli homologue of frataxin is coined CyaY. Results We report that complex I is completely assembled to a stable and active enzyme complex equipped with all known iron-sulfur clusters in a cyaY mutant of E. coli. However, the amount of complex I is reduced by one third compared to the parental strain. Western blot analysis and live cell imaging of CyaY engineered with a GFP demonstrated that CyaY is located in the cytoplasm and not attached to the membrane as to be expected if it were a component of complex I. Conclusion CyaY plays a non-essential role in the assembly of complex I in E. coli. It is not a structural component but may transiently interact with the complex.
PREFACE: 1st European Conference on Gas Micro Flows (GasMems 2012)
Frijns, Arjan; Valougeorgis, Dimitris; Colin, Stéphane; Baldas, Lucien
2012-05-01
The aim of the 1st European Conference on Gas Micro Flows is to advance research in Europe and worldwide in the field of gas micro flows as well as to improve global fundamental knowledge and to enable technological applications. Gas flows in microsystems are of great importance and touch almost every industrial field (e.g. fluidic microactuators for active control of aerodynamic flows, vacuum generators for extracting biological samples, mass flow and temperature micro-sensors, pressure gauges, micro heat-exchangers for the cooling of electronic components or for chemical applications, and micro gas analyzers or separators). The main characteristic of gas microflows is their rarefaction, which for device design often requires modelling and simulation both by continuous and molecular approaches. In such flows various non-equilibrium transport phenomena appear, while the role played by the interaction between the gas and the solid device surfaces becomes essential. The proposed models of boundary conditions often need an empirical adjustment strongly dependent on the micro manufacturing technique. The 1st European Conference on Gas Micro Flows is organized under the umbrella of the recently established GASMEMS network (www.gasmems.eu/) consisting of 13 participants and six associate members. The main objectives of the network are to structure research and train researchers in the fields of micro gas dynamics, measurement techniques for gaseous flows in micro experimental setups, microstructure design and micro manufacturing with applications in lab and industry. The conference takes place on June 6-8 2012, at the Skiathos Palace Hotel, on the beautiful island of Skiathos, Greece. The conference has received funding from the European Community's Seventh Framework Programme FP7/2007-2013 under grant agreement ITN GASMEMS no. 215504. It owes its success to many people. We would like to acknowledge the support of all members of the Scientific Committee and of all
International Nuclear Information System (INIS)
Gough, N.M.; Gearing, D.P.; King, J.A.; Willson, T.A.; Hilton, D.J.; Nicola, N.A.; Metcalf, D.
1988-01-01
A human homologue of the recently cloned murine leukemia-inhibitory factor (LIF) gene was isolated from a genomic library by using the marine cDNA as a hybridization probe. The nucleotide sequence of the human gene indicated that human LIF has 78% amino acid sequence identity with murine LIF, with no insertions or deletions, and that the region of the human gene encoding the mature protein has one intervening sequence. After oligonucleotide-mediated mutagenesis, the mature protein-coding region of the LIF gene was introduced into the yeast expression vector YEpsec1. Yeast cells transformed with the resulting recombinant could be induced with galactose to produce high levels of a factor that induced the differentiation of murine M1 leukemic cells in a manner analogous to murine LIF. This factor competed with 125 I-labeled native murine LIF for binding to specific cellular receptors on murine cells, compatible with a high degree of structural similarity between the murine and human factors
Isolation of a cotton NADP(H oxidase homologue induced by drought stress
Directory of Open Access Journals (Sweden)
NEPOMUCENO ALEXANDRE LIMA
2000-01-01
Full Text Available The aim of this study was to identify and isolate genes that are differentially expressed in four selected cotton (Gossypium hirsutum L. genotypes contrasting according to their tolerance to water deficit. The genotypes studied were Siokra L-23, Stoneville 506, CS 50 and T-1521. Physiological, morphological and developmental changes that confer drought tolerance in plants must have a molecular genetic basis. To identify and isolate the genes, the mRNA Differential Display (DD technique was used. Messenger RNAs differentially expressed during water deficit were identified, isolated, cloned and sequenced. The cloned transcript A12B15-5, a NADP(H oxidase homologue, was up regulated only during the water deficit stress and only in Siokra L-23, a drought tolerant genotype. Ribonuclease protection assay confirmed that transcription.
Gas metal arc weldability of 1.5 GPa grade martensitic steels
Hwang, Insung; Yun, Hyeonsang; Kim, Dongcheol; Kang, Munjin; Kim, Young-Min
2018-01-01
The gas metal arc weldability of 1.5 GPa grade martensitic (MART) steel was evaluated using both inverter direct current (DC) and DC pulse power type welders, under conditions of different welding currents, welding speeds, and shielding gasses. By investigating the bead appearance, tensile strength, and arc stability, it was determined that DC pulse power is better than inverter DC power for arc welding of 1.3 mm thick 1.5 GPa grade MART steel. Further, from the results of the weldability for various shielding gases, it was determined that mixed shielding gas is more effective for welding 1.5 GPa grade MART steel than is pure inert gas (Ar) or active (CO2) gas. In the case of pure shielding gas, no sound bead was formed under any conditions. However, when the mixed shielding gas was used, sound and fine beads were obtained.
18 CFR 1c.1 - Prohibition of natural gas market manipulation.
2010-04-01
... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Prohibition of natural gas market manipulation. 1c.1 Section 1c.1 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION, DEPARTMENT OF ENERGY GENERAL RULES PROHIBITION OF ENERGY MARKET MANIPULATION § 1c.1...
The occurrence of spoilage yeasts in cream-filled bakery products.
Osimani, Andrea; Milanović, Vesna; Taccari, Manuela; Cardinali, Federica; Pasquini, Marina; Aquilanti, Lucia; Clementi, Francesca
2017-04-01
Filling creams can provide an adequate substrate for spoilage yeasts because some yeasts can tolerate the high osmotic stress in these products. To discover the source of spoilage of a cream-filled baked product, end products, raw materials, indoor air and work surfaces were subjected to microbiological and molecular analyses. The efficacy of disinfectants against spoilage yeasts was also assessed. The analyses on end products revealed the presence of the closest relatives to Zygosaccharomyces bailii with counts ranging from 1.40 to 4.72 log cfu g -1 . No spoilage yeasts were found in the indoor air and work surfaces. Polymerase chain reaction-denaturing gradient gel electrophoresis analysis, carried out directly on filling creams collected from unopened cans, showed the presence of bands ascribed to the closest relatives to Z. bailii sensu lato, although with counts products, reliable and sensitive methods must be used. Moreover, hygiene and the application of good manufacturing practices represent the most efficient way for the prevention and minimization of cross-contamination. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.
García-Álvarez, Laura; Holden, Matthew T G; Lindsay, Heather; Webb, Cerian R; Brown, Derek F J; Curran, Martin D; Walpole, Enid; Brooks, Karen; Pickard, Derek J; Teale, Christopher; Parkhill, Julian; Bentley, Stephen D; Edwards, Giles F; Girvan, E Kirsty; Kearns, Angela M; Pichon, Bruno; Hill, Robert L R; Larsen, Anders Rhod; Skov, Robert L; Peacock, Sharon J; Maskell, Duncan J; Holmes, Mark A
2011-08-01
Animals can act as a reservoir and source for the emergence of novel meticillin-resistant Staphylococcus aureus (MRSA) clones in human beings. Here, we report the discovery of a strain of S aureus (LGA251) isolated from bulk milk that was phenotypically resistant to meticillin but tested negative for the mecA gene and a preliminary investigation of the extent to which such strains are present in bovine and human populations. Isolates of bovine MRSA were obtained from the Veterinary Laboratories Agency in the UK, and isolates of human MRSA were obtained from diagnostic or reference laboratories (two in the UK and one in Denmark). From these collections, we searched for mecA PCR-negative bovine and human S aureus isolates showing phenotypic meticillin resistance. We used whole-genome sequencing to establish the genetic basis for the observed antibiotic resistance. A divergent mecA homologue (mecA(LGA251)) was discovered in the LGA251 genome located in a novel staphylococcal cassette chromosome mec element, designated type-XI SCCmec. The mecA(LGA251) was 70% identical to S aureus mecA homologues and was initially detected in 15 S aureus isolates from dairy cattle in England. These isolates were from three different multilocus sequence type lineages (CC130, CC705, and ST425); spa type t843 (associated with CC130) was identified in 60% of bovine isolates. When human mecA-negative MRSA isolates were tested, the mecA(LGA251) homologue was identified in 12 of 16 isolates from Scotland, 15 of 26 from England, and 24 of 32 from Denmark. As in cows, t843 was the most common spa type detected in human beings. Although routine culture and antimicrobial susceptibility testing will identify S aureus isolates with this novel mecA homologue as meticillin resistant, present confirmatory methods will not identify them as MRSA. New diagnostic guidelines for the detection of MRSA should consider the inclusion of tests for mecA(LGA251). Department for Environment, Food and Rural Affairs
Directory of Open Access Journals (Sweden)
Ning-bo Zhao
2014-01-01
Full Text Available Performance degradation forecast technology for quantitatively assessing degradation states of aeroengine using exhaust gas temperature is an important technology in the aeroengine health management. In this paper, a GM (1, 1 Markov chain-based approach is introduced to forecast exhaust gas temperature by taking the advantages of GM (1, 1 model in time series and the advantages of Markov chain model in dealing with highly nonlinear and stochastic data caused by uncertain factors. In this approach, firstly, the GM (1, 1 model is used to forecast the trend by using limited data samples. Then, Markov chain model is integrated into GM (1, 1 model in order to enhance the forecast performance, which can solve the influence of random fluctuation data on forecasting accuracy and achieving an accurate estimate of the nonlinear forecast. As an example, the historical monitoring data of exhaust gas temperature from CFM56 aeroengine of China Southern is used to verify the forecast performance of the GM (1, 1 Markov chain model. The results show that the GM (1, 1 Markov chain model is able to forecast exhaust gas temperature accurately, which can effectively reflect the random fluctuation characteristics of exhaust gas temperature changes over time.
Czudnochowski, Nadine; Wang, Amy Liya; Finer-Moore, Janet; Stroud, Robert M
2013-10-23
Human pseudouridine (Ψ) synthase Pus1 (hPus1) modifies specific uridine residues in several non-coding RNAs: tRNA, U2 spliceosomal RNA, and steroid receptor activator RNA. We report three structures of the catalytic core domain of hPus1 from two crystal forms, at 1.8Å resolution. The structures are the first of a mammalian Ψ synthase from the set of five Ψ synthase families common to all kingdoms of life. hPus1 adopts a fold similar to bacterial Ψ synthases, with a central antiparallel β-sheet flanked by helices and loops. A flexible hinge at the base of the sheet allows the enzyme to open and close around an electropositive active-site cleft. In one crystal form, a molecule of Mes [2-(N-morpholino)ethane sulfonic acid] mimics the target uridine of an RNA substrate. A positively charged electrostatic surface extends from the active site towards the N-terminus of the catalytic domain, suggesting an extensive binding site specific for target RNAs. Two α-helices C-terminal to the core domain, but unique to hPus1, extend along the back and top of the central β-sheet and form the walls of the RNA binding surface. Docking of tRNA to hPus1 in a productive orientation requires only minor conformational changes to enzyme and tRNA. The docked tRNA is bound by the electropositive surface of the protein employing a completely different binding mode than that seen for the tRNA complex of the Escherichia coli homologue TruA. Copyright © 2013 Elsevier Ltd. All rights reserved.
Ha, Cheol Woong; Kim, Kwantae; Chang, Yeon Ji; Kim, Bongkeun; Huh, Won-Ki
2014-07-01
In Saccharomyces cerevisiae, the stability of highly repetitive rDNA array is maintained through transcriptional silencing. Recently, a β-1,3-glucanosyltransferase Gas1 has been shown to play a significant role in the regulation of transcriptional silencing in S. cerevisiae. Here, we show that the gas1Δ mutation increases rDNA silencing in a Sir2-dependent manner. Remarkably, the gas1Δ mutation induces nuclear localization of Msn2/4 and stimulates the expression of PNC1, a gene encoding a nicotinamidase that functions as a Sir2 activator. The lack of enzymatic activity of Gas1 or treatment with a cell wall-damaging agent, Congo red, exhibits effects similar to those of the gas1Δ mutation. Furthermore, the loss of Gas1 or Congo red treatment lowers the cAMP-dependent protein kinase (PKA) activity in a cell wall integrity MAP kinase Slt2-dependent manner. Collectively, our results suggest that the dysfunction of Gas1 plays a positive role in the maintenance of rDNA integrity by decreasing PKA activity and inducing the accumulation of Msn2/4 in the nucleus. It seems that nuclear-localized Msn2/4 stimulate the expression of Pnc1, thereby enhancing the association of Sir2 with rDNA and promoting rDNA stability. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
International Nuclear Information System (INIS)
Wang Thanh; Han Shanlong; Yuan Bo; Zeng Lixi; Li Yingming; Wang Yawei; Jiang Guibin
2012-01-01
Short chain chlorinated paraffins (SCCPs) are semi-volatile chemicals that are considered persistent in the environment, potential toxic and subject to long-range transport. This study investigates the concentrations and gas-particle partitioning of SCCPs at an urban site in Beijing during summer and wintertime. The total atmospheric SCCP levels ranged 1.9–33.0 ng/m 3 during wintertime. Significantly higher levels were found during the summer (range 112–332 ng/m 3 ). The average fraction of total SCCPs in the particle phase (φ) was 0.67 during wintertime but decreased significantly during the summer (φ = 0.06). The ten and eleven carbon chain homologues with five to eight chlorine atoms were the predominant SCCP formula groups in air. Significant linear correlations were found between the gas-particle partition coefficients and the predicted subcooled vapor pressures and octanol–air partition coefficients. The gas-particle partitioning of SCCPs was further investigated and compared with both the Junge–Pankow adsorption and K oa -based absorption models. - Highlights: ► Short chain chlorinated paraffins were investigated in air samples from Beijing. ► Higher levels of SCCPs were found in air during summertime than wintertime. ► Relevant physical–chemical properties were estimated by SPARC and EPI Suite. ► Obtained data were used to model the gas-particle partitioning of SCCPs. - Atmospheric levels and gas-particle partitioning of SCCPs in Beijing, China.
Neuhausen, J; Eichler, B
2004-01-01
The evaporation behaviour of polonium and its lighter homologues selenium and tellurium dissolved in liquid Pb-Bi-eutecticum (LBE) has been studied at various temperatures in the range from 482 K up to 1330 K under Ar/H2 and Ar/H2O-atmospheres using γ-ray spectroscopy. Polonium release in the temperature range of interest for technical applications is slow. Within short term (1h) experiments measurable amounts of polonium are evaporated only at temperatures above 973 K. Long term experiments reveal that a slow evaporation of polonium occurs at temperatures around 873 K resulting in a fractional polonium loss of the melt around 1% per day. Evaporation rates of selenium and tellurium are smaller than those of polonium. The presence of H2O does not enhance the evaporation within the error limits of our experiments. The thermodynamics and possible reaction pathways involved in polonium release from LBE are discussed.
TMBP200, a XMAP215 homologue of tobacco BY-2 cells, has an essential role in plant mitosis.
Yasuhara, Hiroki; Oe, Yuki
2011-07-01
TMBP200 from tobacco BY-2 cells is a member of the highly conserved family of microtubule-associated proteins that includes Xenopus XMAP215, human TOGp, and Arabidopsis MOR1/GEM1. XMAP215 homologues have an essential role in spindle assembly and function in animals and yeast, but their role in plant mitosis is not fully clarified. Here, we show by immunoblot analysis that TMBP200 levels in synchronously cultured BY-2 cells increased when the cells entered mitosis, thus indicating that TMBP200 plays an important role in mitosis in tobacco. To investigate the role of TMBP200 in mitosis, we employed inducible RNA interference to silence TMBP200 expression in BY-2 cells. The resulting depletion of TMBP200 caused severe defects in bipolar spindle formation and resulted in the appearance of multinucleated cells with variable-sized nuclei. This finding indicates that TMBP200 has an essential role in bipolar spindle formation and function.
Gas condensate reservoir performance : part 1 : fluid characterization
Energy Technology Data Exchange (ETDEWEB)
Thomas, F.B.; Bennion, D.B. [Hycal Energy Research Laboratories Ltd., Calgary, AB (Canada); Andersen, G. [ChevronTexaco, Calgary, AB (Canada)
2006-07-01
Phase behaviour in gas condensate reservoirs is sensitive to changes in pressure and temperature, which can lead to significant errors in fluid characterization. The challenging task of characterizing in situ fluids in gas condensate reservoirs was discussed with reference to the errors that occur as a result of the complex coupling between phase behavior and geology. This paper presented techniques for reservoir sampling and characterization and proposed methods for minimizing errors. Errors are often made in the classification of dew point systems because engineering criteria does not accurately represent the phase behavior of the reservoir. For example, the fluid of a certain condensate yield may be categorized as a wet gas rather than a retrograde condensate fluid. It was noted that the liquid yield does not dictate whether the fluid is condensate or wet gas, but rather where the reservoir temperature is situated in the pressure temperature phase loop. In order to proceed with a viable field development plan and optimization, the reservoir fluid must be understood. Given that gas productivity decreases with liquid drop out in the near wellbore region, capillary pressure plays a significant role in retrograde reservoirs. It was noted that well understood parameters will lead to a better assessment of the amount of hydrocarbon in place, the rate at which the resource can be produced and optimization strategies as the reservoir matures. It was concluded that multi-rate sampling is the best method to use in sampling fluids since the liquid yield changes as a function of rate. Although bottom-hole sampling in gas condensate reservoirs may be problematic, it should always be performed to address any concerns for liquid-solid separation. Produced fluids typically reveal a specific signature that informs the operator of in situ properties. This paper presented examples that pertain to wet versus retrograde condensate behavior and the presence of an oil zone. The
Worcester 1 Inch Solenoid-Actuated Gas Operated SCHe System Valves
International Nuclear Information System (INIS)
VAN KATWIJK, C.
2000-01-01
1 inch Gas-operated full-port ball valves incorporate a solenoid and limit switches as integral parts of the actuator. These valves are normally open and fail safe to the open position (GOV-1*02 and 1*06 fail closed) to provide a flow path of helium gas to the MCO under helium purge and off-normal conditions when the MCO is isolated
Real-gas effects 1: Simulation of ideal gas flow by cryogenic nitrogen and other selected gases
Hall, R. M.
1980-01-01
The thermodynamic properties of nitrogen gas do not thermodynamically approximate an ideal, diatomic gas at cryogenic temperatures. Choice of a suitable equation of state to model its behavior is discussed and the equation of Beattie and Bridgeman is selected as best meeting the needs for cryogenic wind tunnel use. The real gas behavior of nitrogen gas is compared to an ideal, diatomic gas for the following flow processes: isentropic expansion; normal shocks; boundary layers; and shock wave boundary layer interactions. The only differences in predicted pressure ratio between nitrogen and an ideal gas that may limit the minimum operating temperatures of transonic cryogenic wind tunnels seem to occur at total pressures approaching 9atmospheres and total temperatures 10 K below the corresponding saturation temperature, where the differences approach 1 percent for both isentropic expansions and normal shocks. Several alternative cryogenic test gases - air, helium, and hydrogen - are also analyzed. Differences in air from an ideal, diatomic gas are similar in magnitude to those of nitrogen. Differences for helium and hydrogen are over an order of magnitude greater than those for nitrogen or air. Helium and hydrogen do not approximate the compressible flow of an ideal, diatomic gas.
DEFF Research Database (Denmark)
Madsen, Jens; Tornøe, Ida; Nielsen, Ole
2003-01-01
CRP-ductin is a protein expressed mainly by mucosal epithelial cells in the mouse. Sequence homologies indicate that CRP-ductin is the mouse homologue of human gp-340, a glycoprotein that agglutinates microorganisms and binds the lung mucosal collectin surfactant protein-D (SP-D). Here we report...... that purified CRP-ductin binds human SP-D in a calcium-dependent manner and that the binding is not inhibited by maltose. The same properties have previously been observed for gp-340 binding of SP-D. CRP-ductin also showed calcium-dependent binding to both gram-positive and -negative bacteria. A polyclonal...... antibody raised against gp-340 reacted specifically with CRP-ductin in Western blots. Immunoreactivity to CRP-ductin was found in the exocrine pancreas, in epithelial cells throughout the gastrointestinal tract and in the parotid ducts. A panel of RNA preparations from mouse tissues was screened for CRP...
Western Gas Sands Project. Status report, 1 September 1979-30 September 1979
Energy Technology Data Exchange (ETDEWEB)
None
1979-01-01
This report summarizes progress of the government-sponsored projects directed toward increasing gas production from the low-permeability gas sands of the western United States. Bartlesville Energy Technology Center continued work on rock-fluid interaction and advanced logging techniques. Lawrence Livermore Laboratory continued experimental and theoretical work on hydraulic fracturing mechanics and analysis of well test data. Los Alamos Scientific Laboratory continued work on permeability and porosity determination of core samples and geological support studies. Sandia Laboratories continued work on their EGR Instrumentation and Diagnostic Program. Cyclic gas injection continued at Colorado Interstate Gas Company's Miller No. 1 and Sprague No. 1 wells. The DOE Well Test Facility is continuing to provide technical support to the Gas Research Institute/Rio Blanco Natural Gas MHF experiment. The Gas Producing Enterprises, Inc. Natural Buttes Unit wells continued to flow to sales. The Mitchell Energy Corporation Muse-Duke No. 1 was opened after a 28-day shut-in period. The hydraulic fracturing containment experiment continued for the Sandia-mineback program.
Crystal structure of a bacterial homologue of the bile acid sodium symporter ASBT
Hu, Nien-Jen; Iwata, So; Cameron, Alexander D.; Drew, David
2011-01-01
High cholesterol levels greatly increase the risk of cardiovascular disease. By its conversion into bile acids, about 50% of cholesterol is eliminated from the body. However bile acids released from the bile duct are constantly recycled, being reabsorbed in the intestine via the Apical Sodium dependent Bile acid Transporter (ASBT). It has been shown in animal models that plasma cholesterol levels are significantly lowered by specific inhibitors of ASBT1,2, thus ASBT is a target for hypercholesterolemia drugs. Here, we describe the crystal structure of a bacterial homologue of ASBT from Neisseria meningitidis (ASBTNM) at 2.2Å. ASBTNM contains two inverted structural repeats of five transmembrane helices. A Core domain of six helices harbours two sodium ions while the remaining helices form a Panel-like domain. Overall the architecture of the protein is remarkably similar to the sodium-proton antiporter NhaA3 despite no detectable sequence homology. A bile acid molecule is situated between the Core and Panel domains in a large hydrophobic cavity. Residues near to this cavity have been shown to affect the binding of specific inhibitors of human ASBT4. The position of the bile acid together with the molecular architecture suggests the rudiments of a possible transport mechanism. PMID:21976025
Energy Technology Data Exchange (ETDEWEB)
Noble, A. G.; McDonald, M. [Kavli Institute for Astrophysics and Space Research, Massachusetts Institute of Technology, 77 Massachusetts Avenue, Cambridge, MA 02139 (United States); Muzzin, A. [Department of Physics and Astronomy, York University, 4700 Keele Street, Toronto, ON MJ3 1P3 (Canada); Nantais, J. [Departamento de Ciencias Físicas, Universidad Andres Bello, Fernandez Concha 700, Las Condes 7591538, Santiago, Región Metropolitana (Chile); Rudnick, G. [The University of Kansas, Department of Physics and Astronomy, 1251 Wescoe Hall Drive, Lawrence, KS 66045 (United States); Van Kampen, E.; Manilla-Robles, A. [European Southern Observatory, Karl-Schwarzschild-Strasse 2, D-85748 Garching bei München (Germany); Webb, T. M. A.; Delahaye, A. [Department of Physics, McGill University, 3600 rue University, Montréal, QC H3A 2T8 (Canada); Wilson, G.; DeGroot, A.; Foltz, R. [Department of Physics and Astronomy, University of California, Riverside, CA 92521 (United States); Yee, H. K. C. [Department of Astronomy and Astrophysics, University of Toronto, 50 St. George Street, Toronto, ON M5S 3H4 (Canada); Boone, K.; Hayden, B.; Perlmutter, S. [Department of Physics, University of California Berkeley, 366 LeConte Hall, MC 7300, Berkeley, CA 94720-7300 (United States); Cooper, M. C. [Department of Physics and Astronomy, University of California, Irvine, 4129 Frederick Reines Hall, Irvine, CA 92697 (United States); Demarco, R. [Departamento de Astronomía, Universidad de Concepción, Casilla 160-C, Concepción, Región del Biobío (Chile); Lidman, C., E-mail: noble@mit.edu [Australian Astronomical Observatory, 105 Delhi Road, North Ryde, NSW 2113 (Australia)
2017-06-20
We present ALMA CO (2–1) detections in 11 gas-rich cluster galaxies at z ∼ 1.6, constituting the largest sample of molecular gas measurements in z > 1.5 clusters to date. The observations span three galaxy clusters, derived from the Spitzer Adaptation of the Red-sequence Cluster Survey. We augment the >5 σ detections of the CO (2–1) fluxes with multi-band photometry, yielding stellar masses and infrared-derived star formation rates, to place some of the first constraints on molecular gas properties in z ∼ 1.6 cluster environments. We measure sizable gas reservoirs of 0.5–2 × 10{sup 11} M {sub ☉} in these objects, with high gas fractions ( f {sub gas}) and long depletion timescales ( τ ), averaging 62% and 1.4 Gyr, respectively. We compare our cluster galaxies to the scaling relations of the coeval field, in the context of how gas fractions and depletion timescales vary with respect to the star-forming main sequence. We find that our cluster galaxies lie systematically off the field scaling relations at z = 1.6 toward enhanced gas fractions, at a level of ∼4 σ , but have consistent depletion timescales. Exploiting CO detections in lower-redshift clusters from the literature, we investigate the evolution of the gas fraction in cluster galaxies, finding it to mimic the strong rise with redshift in the field. We emphasize the utility of detecting abundant gas-rich galaxies in high-redshift clusters, deeming them as crucial laboratories for future statistical studies.
Gangloff, Y G; Pointud, J C; Thuault, S; Carré, L; Romier, C; Muratoglu, S; Brand, M; Tora, L; Couderc, J L; Davidson, I
2001-08-01
The RNA polymerase II transcription factor TFIID comprises the TATA binding protein (TBP) and a set of TBP-associated factors (TAF(II)s). TFIID has been extensively characterized for yeast, Drosophila, and humans, demonstrating a high degree of conservation of both the amino acid sequences of the constituent TAF(II)s and overall molecular organization. In recent years, it has been assumed that all the metazoan TAF(II)s have been identified, yet no metazoan homologues of yeast TAF(II)47 (yTAF(II)47) and yTAF(II)65 are known. Both of these yTAF(II)s contain a histone fold domain (HFD) which selectively heterodimerizes with that of yTAF(II)25. We have cloned a novel mouse protein, TAF(II)140, containing an HFD and a plant homeodomain (PHD) finger, which we demonstrated by immunoprecipitation to be a mammalian TFIID component. TAF(II)140 shows extensive sequence similarity to Drosophila BIP2 (dBIP2) (dTAF(II)155), which we also show to be a component of Drosophila TFIID. These proteins are metazoan homologues of yTAF(II)47 as their HFDs selectively heterodimerize with dTAF(II)24 and human TAF(II)30, metazoan homologues of yTAF(II)25. We further show that yTAF(II)65 shares two domains with the Drosophila Prodos protein, a recently described potential dTAF(II). These conserved domains are critical for yTAF(II)65 function in vivo. Our results therefore identify metazoan homologues of yTAF(II)47 and yTAF(II)65.
Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya
2002-01-01
The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, a...
Western Gas Sands Project. Status report, 1 August-31 August, 1979
Energy Technology Data Exchange (ETDEWEB)
None
1979-01-01
This status report summarizes progress of government-sponsored projects directed toward increasing gas production from the low-permeability gas sands of the western United States. Work on fracture conductivity, rock-fluid interaction, and log evaluation and interpretation techniques continued at Bartlesville. Work commenced on completing, testing and possible hydraulic fracturing of the Rio Blanco Natural Gas Company well No. 397-19-1 and on the evaluation of seismic data for stratigraphic studies of lenticular sands. LLL continued experimental and theoretical work on hydraulic fracturing mechanics and analysis of well test data. LASL worked on developing NMR methods to define fluid saturation, porosity, and permeability of western gas sands at in situ conditions. M.D. Wood, Inc. was involved in design and site preparation for two hydraulic fracture mapping jobs in the Cotton Valley Trend in Texas. Testing and analyses of the borehole seismic system and borehole hydrophone system continued at Sandia. Field tests and related activities for the WGSP progressed as scheduled in August. Cyclic injection of dehydrated natural gas and production in Colorado Interstate Gas Company's Miller No. 1 and Sprague No. 1 wells continued. The Gas Producing Enterprises, Inc. wells, Natural Buttes Units 9, 14, 18 and 20 flowed to sales. The Mitchell Energy Corporation Muse-Duke No. 1 was shut-in for a 15-day pressure buildup test. Hydraulic fracture containment experiments and activities in the multi-frac test series continued at the Nevada Test Site for Sandia Laboratories' mineback program.
Energy Technology Data Exchange (ETDEWEB)
Liao, H.; Li, B.; Zhang, B. [Chinese Academy of Sciences, Taiyuan (China). State Key Lab. of Coal Conversion
1998-06-01
To improve the economics of the hydropyrolysis process, it has been suggested that cheaper hydrogen-rich gases (such as coke oven gas, synthesis gas) could be used instead of pure hydrogen. Pyrolysis of Chinese Xianfeng lignite was carried out with coke oven gas (COG) and synthesis gas (SG) as reactive gases at 0.1-5 MPa and at a final temperature up to 650{degree}C with a heating rate of 5-25{degree}C min{sup -1} in a 10 g fixed-bed reactor. The results indicate that it is possible to use COG and SG instead of pure hydrogen in hydropyrolysis, but that the experimental conditions must be adjusted to optimize the yields of the valuable chemicals. 14 refs., 3 figs., 6 tabs.
Broad anti-HIV activity of the Oscillatoria agardhii agglutinin homologue lectin family.
Férir, Geoffrey; Huskens, Dana; Noppen, Sam; Koharudin, Leonardus M I; Gronenborn, Angela M; Schols, Dominique
2014-10-01
Oscillatoria agardhii agglutinin homologue (OAAH) proteins belong to a recently discovered lectin family. The founding member OAA and a designed hybrid OAAH (OPA) recognize similar but unique carbohydrate structures of Man-9, compared with other antiviral carbohydrate-binding agents (CBAs). These two newly described CBAs were evaluated for their inactivating properties on HIV replication and transmission and for their potential as microbicides. Various cellular assays were used to determine antiviral activity against wild-type and certain CBA-resistant HIV-1 strains: (i) free HIV virion infection in human T lymphoma cell lines and PBMCs; (ii) syncytium formation assay using persistently HIV-infected T cells and non-infected CD4+ T cells; (iii) DC-SIGN-mediated viral capture; and (iv) transmission to uninfected CD4+ T cells. OAA and OPA were also evaluated for their mitogenic properties and potential synergistic effects using other CBAs. OAA and OPA inhibit HIV replication, syncytium formation between HIV-1-infected and uninfected T cells, DC-SIGN-mediated HIV-1 capture and transmission to CD4+ target T cells, thereby rendering a variety of HIV-1 and HIV-2 clinical isolates non-infectious, independent of their coreceptor use. Both CBAs competitively inhibit the binding of the Manα(1-2)Man-specific 2G12 monoclonal antibody (mAb) as shown by flow cytometry and surface plasmon resonance analysis. The HIV-1 NL4.3(2G12res), NL4.3(MVNres) and IIIB(GRFTres) strains were equally inhibited as the wild-type HIV-1 strains by these CBAs. Combination studies indicate that OAA and OPA act synergistically with Hippeastrum hybrid agglutinin, 2G12 mAb and griffithsin (GRFT), with the exception of OPA/GRFT. OAA and OPA are unique CBAs with broad-spectrum anti-HIV activity; however, further optimization will be necessary for microbicidal application. © The Author 2014. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights
Sakaue, H; Takahashi, T; Teramoto, Y
2002-01-01
Non-freon gas mixtures (Ar/iso-C sub 4 H sub 1 sub 0) were tested as the chamber gas for 1 and 2 mm gas gap Resistive Plate Chambers (RPCs) with float glass as the resistive electrodes, operated in the streamer mode. With the narrower (1 mm) gas gap, streamer charge is reduced (approx 1/3), which reduces the dead time (and dead area), associated with each streamer, improving the detection efficiency. The best performance was obtained for two cases: Ar/iso-C sub 4 H sub 1 sub 0 =50/50 and 60/40. For the 50/50 mixture, a detection efficiency of better than 98% was obtained for the 1 mm gap RPC, while the efficiency was 95% for the 2 mm gap RPC, each operated as a double-gap RPC. The measured time resolution (rms) was 1.45+-0.05 (2.52+-0.09) ns for the 1 (2) mm gap RPC for the 50/50 mixture.
Ma, Xindong; Zhang, Haijun; Zhou, Hongqiang; Na, Guangshui; Wang, Zhen; Chen, Chen; Chen, Jingwen; Chen, Jiping
2014-06-01
Chlorinated paraffins (CPs) were measured in air samples at a remote air monitoring site established in Georgia King Island, Fildes Peninsula of Antarctica (Great Wall Station, China) to study the long-range atmospheric transport of these anthropogenic pollutants to the Antarctic. Gas- and particle-phase CPs were collected using polyurethane foam plugs (PUF) and glass fiber filters (GFF) respectively during summertime of 2012. The total atmospheric levels of SCCPs and MCCPs ranged from 9.6 to 20.8 pg m-3 (average: 14.9 pg m-3) and 3.7-5.2 pg m-3 (average: 4.5 pg m-3), respectively. C10 and C11 carbon chain homologues with Cl5 and Cl6 chlorine atoms predominated in SCCP formula groups both in gas- and particle-phase. Significant linear correlation was found between gas/particle partition coefficients (KP) and sub-cooled liquid vapor pressures (pL°) (R2 = 0.437, p chlorinated CPs and overestimate the sorption of highly chlorinated CPs.
Pure- and mixed-gas CO2/CH4 separation properties of PIM-1 and an amidoxime-functionalized PIM-1
Swaidan, Raja
2014-05-01
The prototypical solution-processable polymer of intrinsic microporosity, PIM-1, and derivatives thereof offer combinations of permeability and selectivity that make them potential candidate materials for membrane-based gas separations. Paramount to the design and evaluation of PIMs for economical natural gas sweetening is a high and stable CO2/CH4 selectivity under realistic, mixed-gas conditions. Here, amidoxime-functionalized PIM-1 (AO-PIM-1) was prepared and examined for fundamental structure/property relationships. Qualitative NLDFT pore-size distribution analyses of physisorption isotherms (N2 at -196 oC; CO2 at 0 oC) reveal a tightened microstructure indicating size-sieving ultra-microporosity (<7Å). AO-PIM-1 demonstrated a three-fold increase in αD(CO2/CH4) over PIM-1, surpassing the 2008 upper bound with P(CO2)=1153Barrer and ideal α(CO2/CH4)=34. Under a 50:50 CO2:CH4 mixed-gas feed, AO-PIM-1 showed less selectivity loss than PIM-1, maintaining a mixed-gas α(CO2/CH4) ~21 across a 20bar pressure range. Conversely, PIM-1 endured up to 60% increases in mixed-gas CH4 permeability over pure-gas values concurrent with a selectivity of only ~8 at 20bar. A pervasive intermolecular hydrogen bonding network in AO-PIM-1 predominantly yields a rigidified microstructure that mitigates CO2-induced matrix dilations, reducing detrimental mixed-gas CH4 copermeation. © 2014 Elsevier B.V.
Gas1 expression in parietal cells of Bowman's capsule in experimental diabetic nephropathy.
Luna-Antonio, Brenda I; Rodriguez-Muñoz, Rafael; Namorado-Tonix, Carmen; Vergara, Paula; Segovia, Jose; Reyes, Jose L
2017-07-01
Gas1 (Growth Arrest-Specific 1) is a pleiotropic protein with novel functions including anti-proliferative and proapoptotic activities. In the kidney, the expression of Gas1 has been described in mesangial cells. In this study, we described that renal parietal cells of Bowman's capsule (BC) and the distal nephron cells also express Gas1. The role of Gas1 in the kidney is not yet known. There is a subpopulation of progenitor cells in Bowman's capsule with self-renewal properties which can eventually differentiate into podocytes as a possible mechanism of regeneration in the early stages of diabetic nephropathy. We analyzed the expression of Gas1 in the parietal cells of Bowman's capsule in murine experimental diabetes. We found that diabetes reduced the expression of Gas1 and increased the expression of progenitor markers like NCAM, CD24, and SIX1/2, and mesenchymal markers like PAX2 in the Bowman's capsule. We also analyzed the expression of WT1 (a podocyte-specific marker) on BC and observed an increase in the number of WT1 positive cells in diabetes. In contrast, nephrin, another podocyte-specific protein, decreases its expression in the first week of diabetes in the glomerular tuft, which is gradually restored during the second and third weeks of diabetes. These results suggest that in diabetes the decrease of Gas1 promotes the activation of parietal progenitor cells of Bowman's capsule that might differentiate into podocytes and compensate their loss observed in this pathology.
International Nuclear Information System (INIS)
Ahmed, Sameh; Kishikawa, Naoya; Nakashima, Kenichiro; Kuroda, Naotaka
2007-01-01
A sensitive and highly selective high-performance liquid chromatography (HPLC) method was developed for the determination of vitamin K homologues including phylloquinone (PK), menaquinone-4 (MK-4) and menaquinone-7 (MK-7) in human plasma using post-column peroxyoxalate chemiluminescence (PO-CL) detection following on-line ultraviolet (UV) irradiation. The method was based on ultraviolet irradiation (254 nm, 15 W) of vitamin K to produce hydrogen peroxide and a fluorescent product at the same time, which can be determined with PO-CL detection. The separation of vitamin K by HPLC was accomplished isocratically on an ODS column within 35 min. The method involves the use of 2-methyl-3-pentadecyl-1,4-naphthoquinone as an internal standard. The detection limits (signal-to-noise ratio = 3) were 32, 38 and 85 fmol for PK, MK-4 and MK-7, respectively. The recoveries of PK, MK-4 and MK-7 were greater than 82% and the inter- and intra-assay R.S.D. values were 1.9-5.4%. The sensitivity and selectivity of this method were sufficient for clinical and nutritional applications
Development of lab scale fast gas injection system for SST-1 Tokamak
International Nuclear Information System (INIS)
Pathan, F.S.; Banaudha, Moni; Khristi, Yohan; Khan, M.S.; Khan, Ziauddin; Raval, D.C.; Khirwadkar, Samir
2017-01-01
The plasma density control plays an important role in Tokamak operation. The factors that influence plasma density in a Tokamak device are working gas injection, pumping, ionization rate and the recycle coefficient representing the wall conditions. Among these factors, gas injection is relatively convenient to be controlled. Hence, the most frequently adopted method to control the plasma density is to control the fast gas injection. This paper describes the design and experimental work carried out towards the development of Fast Gas Injection System for SST-1 Tokamak. Laboratory based test setup was successfully established for Fast Gas Injection System that can feed predefined quantity of gas in a controlled manner into vacuum chamber. Further, this FGIS system will be implemented in SST-1 Tokamak environment with online density feedback signal
Krätschmer, Kerstin; Cojocariu, Cristian; Schächtele, Alexander; Malisch, Rainer; Vetter, Walter
2018-03-02
For decades, high quantities of short-chain chlorinated paraffins (SCCP) and medium-chain chlorinated paraffins (MCCP) have been widely used, for instance as plasticizers or flame retardants, leading to global pollution due to unintentional emissions from products or waste. Due to the high complexity of chlorinated paraffins with several thousand congeners there is no consensus on an analytical procedure for SCCPs and MCCPs in food samples. Amongst the multitude of methods currently in use, high-resolution mass spectrometry is particularly valuable for in-depth studies of homologue patterns. Here we analyse SCCPs and MCCPs with gas chromatography coupled to high-resolution Orbitrap mass spectrometry (GC-Orbitrap-HRMS) operated in full-scan acquisition in electron capture negative ion (ECNI) mode at 60,000 and 120,000 resolution (FWHM, m/z 200, equals roughly 30,000 and 60,000 at 5% peak height). Linear dynamic range, selectivity and sensitivity tests confirmed an excellent linearity in a concentration range of 25-15,000 pg/μL with very low limits of detection (LODs) in the low pg/μL range. Spiking experiments with high levels of native mono- and di-ortho-polychlorinated biphenyls (PCBs) and mixtures of MCCP and SCCP standards did not have a negative impact on isotope ratios of the examined homologues. Besides the [M-Cl] - fragment ions used for quantification, the mass spectra of homologues also featured [M-HCl] - ions whose abundance increased with decreasing chlorination degree. In addition, [M-HCl-Cl] - ions were detected with a relative abundance of 5-10%. Three salmon (Salmo salar) samples farmed in Norway showed a consistent CP homologue pattern which differed both from the CP pattern in a sample from Scottish aquaculture and a wild salmon sample. These measurements produce evidence that discretely different CP patterns may exist in different areas of origin. Our results demonstrate that GC/ECNI-Orbitrap-HRMS is well-suited for the analysis of CPs by
Van Nguyen, Dung; Van Nguyen, Cuong; Bonsall, David; Ngo, Tue Tri; Carrique-Mas, Juan; Pham, Anh Hong; Bryant, Juliet E; Thwaites, Guy; Baker, Stephen; Woolhouse, Mark; Simmonds, Peter
2018-02-28
Rodents and bats are now widely recognised as important sources of zoonotic virus infections in other mammals, including humans. Numerous surveys have expanded our knowledge of diverse viruses in a range of rodent and bat species, including their origins, evolution, and range of hosts. In this study of pegivirus and human hepatitis-related viruses, liver and serum samples from Vietnamese rodents and bats were examined by PCR and sequencing. Nucleic acids homologous to human hepatitis B, C, E viruses were detected in liver samples of 2 (1.3%) of 157 bats, 38 (8.1%), and 14 (3%) of 470 rodents, respectively. Hepacivirus-like viruses were frequently detected (42.7%) in the bamboo rat, Rhizomys pruinosus , while pegivirus RNA was only evident in 2 (0.3%) of 638 rodent serum samples. Complete or near-complete genome sequences of HBV, HEV and pegivirus homologues closely resembled those previously reported from rodents and bats. However, complete coding region sequences of the rodent hepacivirus-like viruses substantially diverged from all of the currently classified variants and potentially represent a new species in the Hepacivirus genus. Of the viruses identified, their routes of transmission and potential to establish zoonoses remain to be determined.
Nitrogen Gas Heating and Supply System for SST-1 Tokamak
International Nuclear Information System (INIS)
Khan, Ziauddin; Pathan, Firozkhan; Paravastu, Yuvakiran; George, Siju; Ramesh, Gattu; Bindu, Hima; Raval, Dilip C.; Thankey, Prashant; Dhanani, Kalpesh; Pradhan, Subrata
2013-01-01
Steady State Tokamak (SST-1) vacuum vessel baking as well as baking of the first wall components of SST-1 are essential to plasma physics experiments. Under a refurbishment spectrum of SST-1, the nitrogen gas heating and supply system has been fully refurbished. The SST-1 vacuum vessel consists of ultra-high vacuum (UHV) compatible eight modules and eight sectors. Rectangular baking channels are embedded on each of them. Similarly, the SST-1 plasma facing components (PFC) are comprised of modular graphite diverters and movable graphite based limiters. The nitrogen gas heating and supply system would bake the plasma facing components at 350°C and the SST-1 vacuum vessel at 150°C over an extended duration so as to remove water vapour and other absorbed gases. An efficient PLC based baking facility has been developed and implemented for monitoring and control purposes. This paper presents functional and operational aspects of a SST-1 nitrogen gas heating and supply system. Some of the experimental results obtained during the baking of SST-1 vacuum modules and sectors are also presented here. (fusion engineering)
The oil palm Shell gene controls oil yield and encodes a homologue of SEEDSTICK
Singh, Rajinder; Leslie Low, Eng-Ti; Ooi, Leslie Cheng-Li; Ong-Abdullah, Meilina; Chin, Ting Ngoot; Nagappan, Jayanthi; Nookiah, Rajanaidu; Amiruddin, Mohd Din; Rosli, Rozana; Abdul Manaf, Mohamad Arif; Chan, Kuang-Lim; Halim, Mohd Amin; Azizi, Norazah; Lakey, Nathan; Smith, Steven W; Budiman, Muhammad A; Hogan, Michael; Bacher, Blaire; Van Brunt, Andrew; Wang, Chunyan; Ordway, Jared M; Sambanthamurthi, Ravigadevi; Martienssen, Robert A
2014-01-01
A key event in the domestication and breeding of the oil palm, Elaeis guineensis, was loss of the thick coconut-like shell surrounding the kernel. Modern E. guineensis has three fruit forms, dura (thick-shelled), pisifera (shell-less) and tenera (thin-shelled), a hybrid between dura and pisifera1–4. The pisifera palm is usually female-sterile but the tenera yields far more oil than dura, and is the basis for commercial palm oil production in all of Southeast Asia5. Here, we describe the mapping and identification of the Shell gene responsible for the different fruit forms. Using homozygosity mapping by sequencing we found two independent mutations in the DNA binding domain of a homologue of the MADS-box gene SEEDSTICK (STK) which controls ovule identity and seed development in Arabidopsis. The Shell gene is responsible for the tenera phenotype in both cultivated and wild palms from sub-Saharan Africa, and our findings provide a genetic explanation for the single gene heterosis attributed to Shell, via heterodimerization. This gene mutation explains the single most important economic trait in oil palm, and has implications for the competing interests of global edible oil production, biofuels and rainforest conservation6. PMID:23883930
Western Gas Sands Project. Status report, 1 July-31 July, 1979
Energy Technology Data Exchange (ETDEWEB)
Atkinson, C H
1979-01-01
National Laboratories and Energy Technology Centers continued projects during July. Bartlesville Energy Technology Center continued work on core/fluid testing, fabrication of and improvements to confining pressure apparatus, advanced logging techniques and interpretation and reservoir simulation studies. At Lawrence Livermore Laboratory theoretical analysis and experimental programs continued for hydraulic fracturing. Testing of the borehole seismic and hydrophone systems for fracture mapping continued at Sandia Laboratories. The CER Corporation RB-MHF 3 well has been transferred to Rio Blanco Natural Gas Company for further testing. Cyclic gas injection and production continued at CIG's Miller No. 1 and Sprague No. 1 wells. The DOE well test facility was transported to the Rio Blanco Natural Gas Company well No. 397-19-1 Government. The cumulative production of Mitchell Energy Muse-Duke No. 1 as of July 31, 1979, was just over one billion cubic ft of gas. A flow log was run on the Mobil PCU F31-13G well. Exploratory coring for the Sandia Hole No. 6 fracture experiment continued in July with the completion of two additional holes.
43 CFR 16.1 - Agreements to dispose of helium in natural gas.
2010-10-01
... 43 Public Lands: Interior 1 2010-10-01 2010-10-01 false Agreements to dispose of helium in natural gas. 16.1 Section 16.1 Public Lands: Interior Office of the Secretary of the Interior CONSERVATION OF HELIUM § 16.1 Agreements to dispose of helium in natural gas. (a) Pursuant to his authority and...
Zhao, Ning-bo; Yang, Jia-long; Li, Shu-ying; Sun, Yue-wu
2014-01-01
Performance degradation forecast technology for quantitatively assessing degradation states of aeroengine using exhaust gas temperature is an important technology in the aeroengine health management. In this paper, a GM (1, 1) Markov chain-based approach is introduced to forecast exhaust gas temperature by taking the advantages of GM (1, 1) model in time series and the advantages of Markov chain model in dealing with highly nonlinear and stochastic data caused by uncertain factors. In this ap...
Details of the allocation rules for natural gas. Version 1.2
International Nuclear Information System (INIS)
2004-01-01
Details are given of the allocation process and method that will be used in the natural gas sector in the Netherlands as soon as small-scale energy consumers are free to choose an energy supplier (July 1, 2004). The method is based on a market model in which natural gas trade takes place at the TTF (Title Transfer Facility) and natural gas trade at the GOS (Gas Receiving Station) is excluded. Also attention is paid to the allocation process for shippers and suppliers [nl
Regulatory Multidimensionality of Gas Vesicle Biogenesis in Halobacterium salinarum NRC-1
Directory of Open Access Journals (Sweden)
Andrew I. Yao
2011-01-01
Full Text Available It is becoming clear that the regulation of gas vesicle biogenesis in Halobacterium salinarum NRC-1 is multifaceted and appears to integrate environmental and metabolic cues at both the transcriptional and posttranscriptional levels. The mechanistic details underlying this process, however, remain unclear. In this manuscript, we quantify the contribution of light scattering made by both intracellular and released gas vesicles isolated from Halobacterium salinarum NRC-1, demonstrating that each form can lead to distinct features in growth curves determined by optical density measured at 600 nm (OD600. In the course of the study, we also demonstrate the sensitivity of gas vesicle accumulation in Halobacterium salinarum NRC-1 on small differences in growth conditions and reevaluate published works in the context of our results to present a hypothesis regarding the roles of the general transcription factor tbpD and the TCA cycle enzyme aconitase on the regulation of gas vesicle biogenesis.
The urokinase receptor and its structural homologue C4.4A in human cancer
DEFF Research Database (Denmark)
Jacobsen, B; Ploug, M
2008-01-01
The urokinase-type plasminogen activator receptor (uPAR) and its structural homologue C4.4A are multidomain members of the Ly6/uPAR/alpha-neurotoxin protein domain family. Both are glycosylphosphatidylinositol-anchored membrane glycoproteins encoded by neighbouring genes located on chromosome 19q13...... that high protein expression in tumour cells of non-small cell pulmonary adenocarcinomas is associated with a particularly severe disease progression. This review will evaluate structural-functional and disease-related aspects of uPAR and C4.4A with a view to possible pharmacological targeting strategies...... in the human genome. The structural relationship between the two proteins is, however, not reflected at the functional level. Whereas uPAR has a well-established role in regulating and focalizing uPA-mediated plasminogen activation to the surface of those cells expressing the receptor, the biological function...
Qi, Honglan; Teesdale, Justin J; Pupillo, Rachel C; Rosenthal, Joel; Bard, Allen J
2013-09-11
Two new 2,2'-bipyridine (bpy) derivatives containing ancillary BODIPY chromophores attached at the 5- and 5'-positions (BB3) or 6- and 6'-positions (BB4) were prepared and characterized. In this work, the basic photophysics, electrochemistry, and electrogenerated chemiluminescence (ECL) of BB3 and BB4 are compared with those previously reported for a related bpy-BODIPY derivative (BB2) (J. Phys. Chem. C 2011, 115, 17993-18001). Cyclic voltammetry revealed that BB3 and BB4 display reversible 2e(-) oxidation and reduction waves, which consist of two closely spaced (50-70 mV) 1e(-) events. This redox behavior is consistent with the frontier molecular orbitals calculated for BB3 and BB4 and indicates that the 2,2'-bipyridine spacer of each bpy-BODIPY homologue does not facilitate efficient electronic communication between the tethered indacene units. In the presence of a coreactant such as tri-n-propylamine (TPA) or benzoyl peroxide (BPO), BB3 and BB4 exhibit strong ECL and produce spectra that are very similar to their corresponding photoluminescence profiles. The ECL signal obtained under annihilation conditions, however, is significantly different and is characterized by two distinct bands. One of these bands is centered at ∼570 nm and is attributed to emission via an S- or T-route. The second band occurs at longer wavelengths and is centered around ∼740 nm. The shape and concentration dependence of this long-wavelength ECL signal is not indicative of emission from an excimer or aggregate, but rather it suggests that a new emissive species is formed from the bpy-BODIPY luminophores during the annihilation process.
Qi, Honglan; Teesdale, Justin J.; Pupillo, Rachel C.
2014-01-01
Two new 2,2’-bipyridine (bpy) derivatives containing ancillary BODIPY chromophores attached at the 5- and 5’-positions (BB3) or 6- and 6’-positions (BB4) were prepared and characterized. In this work, the basic photophysics, electrochemistry and electrogenerated chemiluminescence (ECL) of BB3 and BB4 are compared with those previously reported for a related bpy-BODIPY derivative (BB2) (J. Phys. Chem. C 2011, 115, 17993–18001). Cyclic voltammetry revealed that BB3 and BB4 display reversible 2e− oxidation and reduction waves, which consist of two closely spaced (50 – 70 mV) 1e− events. This redox behavior is consistent with the frontier molecular orbitals calculated for BB3 and BB4 and indicates that the 2,2’-bipyridine spacer of each bpy- BODIPY homologue does not facilitate efficient electronic communication between the tethered indacene units. In the presence of a coreactant such as tri-n-propylamine (TPA) or benzoyl peroxide (BPO), BB3 and BB4 exhibit strong ECL and produce spectra that are very similar to their corresponding photoluminescence profiles. The ECL signal obtained under annihilation conditions, however, is significantly different and is characterized by two distinct bands. One of these bands is centered at ~570 nm and is attributed to emission via an S- or T-route. The second band, occurs at longer wavelengths and is centered around ~740 nm. The shape and concentration dependence of this long-wavelength ECL signal is not indicative of emission from an excimer or aggregate, but rather is suggests that a new emissive species is formed from the bpy-BODIPY luminophores during the annihilation process. PMID:23980850
Directory of Open Access Journals (Sweden)
Phelan Anne
2007-06-01
Full Text Available Abstract Background Mammalian angiotensin converting enzyme (ACE plays a key role in blood pressure regulation. Although multiple ACE-like proteins exist in non-mammalian organisms, to date only one other ACE homologue, ACE2, has been identified in mammals. Results Here we report the identification and characterisation of the gene encoding a third homologue of ACE, termed ACE3, in several mammalian genomes. The ACE3 gene is located on the same chromosome downstream of the ACE gene. Multiple sequence alignment and molecular modelling have been employed to characterise the predicted ACE3 protein. In mouse, rat, cow and dog, the predicted protein has mutations in some of the critical residues involved in catalysis, including the catalytic Glu in the HEXXH zinc binding motif which is Gln, and ESTs or reverse-transcription PCR indicate that the gene is expressed. In humans, the predicted ACE3 protein has an intact HEXXH motif, but there are other deletions and insertions in the gene and no ESTs have been identified. Conclusion In the genomes of several mammalian species there is a gene that encodes a novel, single domain ACE-like protein, ACE3. In mouse, rat, cow and dog ACE3, the catalytic Glu is replaced by Gln in the putative zinc binding motif, indicating that in these species ACE3 would lack catalytic activity as a zinc metalloprotease. In humans, no evidence was found that the ACE3 gene is expressed and the presence of deletions and insertions in the sequence indicate that ACE3 is a pseudogene.
Drakouli, Sotiria; Lyberopoulou, Aggeliki; Papathanassiou, Maria; Mylonis, Ilias; Georgatsou, Eleni
2017-08-01
Scaffold attachment factor B1 (SAFB1) is an integral component of the nuclear matrix of vertebrate cells. It binds to DNA on scaffold/matrix attachment region elements, as well as to RNA and a multitude of different proteins, affecting basic cellular activities such as transcription, splicing and DNA damage repair. In the present study, we show that enhancer of rudimentary homologue (ERH) is a new molecular partner of SAFB1 and its 70% homologous paralogue, scaffold attachment factor B2 (SAFB2). ERH interacts directly in the nucleus with the C-terminal Arg-Gly-rich region of SAFB1/2 and co-localizes with it in the insoluble nuclear fraction. ERH, a small ubiquitous protein with striking homology among species and a unique structure, has also been implicated in fundamental cellular mechanisms. Our functional analyses suggest that the SAFB/ERH interaction does not affect SAFB1/2 function in transcription (e.g. as oestrogen receptor α co-repressors), although it reverses the inhibition exerted by SAFB1/2 on the splicing kinase SR protein kinase 1 (SRPK1), which also binds on the C-terminus of SAFB1/2. Accordingly, ERH silencing decreases lamin B receptor and SR protein phosphorylation, which are major SRPK1 substrates, further substantiating the role of SAFB1 and SAFB2 in the co-ordination of nuclear function. © 2017 Federation of European Biochemical Societies.
Górnaś, Paweł
2015-04-01
The tocochromanol profile was studied in seed oils recovered from by-products of fruit industry, five dessert and seven crab apple varieties grown in Eastern Europe (Latvia). The seed oils obtained from dessert apples were characterized by higher contents of tocopherols (191.05-379.08 mg/100g oil) when compared to seed oils recovered from crab apples (130.55-202.54 mg/100g oil). The predominant homologues of tocopherol in all the studied samples were α and β over γ and δ. However, seed oils recovered from the apple cultivars 'Antej' and 'Beforest' had a unique profile of four tocopherol homologues (α:β:γ:δ) 91.41:80.55:72.46:79.03 and 114.55:112.84:78.69:73.00 mg/100g oil, respectively. A single dilution of seed oils in 2-propanol facilitated the direct use samples in the DPPH assay as well as injection into the RP-HPLC system containing a PFP (pentafluorophenyl) column, which resulted in a rapid separation of all four tocopherol homologues with excellent repeatability and reproducibility. Copyright © 2014 Elsevier Ltd. All rights reserved.
Progress Toward Buffer Gas Cooling of a 1 μB Species
Johnson, Cort; Newman, Bonna; Brahms, Nathan; Decarvalho, Robert; Li, Chih-Hao; Greytak, Tom; Kleppner, Dan; Doyle, John
2006-05-01
Thermalization with a non-magnetic ^3He buffer gas has been demonstrated to be an effective means of removing heat from a sample of hot magnetic atoms held in a magnetic trap[1]. To thermally isolate the atoms, it is necessary to remove the buffer gas without sweeping away the magnetically trapped atoms. The magnetic trap strength is proportional to the magnitude of the atom's moment. This is the primary reason that trapping a 1 μB species has never been realized in a buffer gas cooling experiment. Eventually, we plan to use this technique to trap and cool atomic hydrogen and deuterium. We have built a cryogenic valved cell suspended from a dilution refrigerator along the axis of a 4T quadrupole magnetic field. The cell is maintained at a base temperature of 100mK. The buffer gas is removed by opening the valve. Any remaining buffer gas may be energetic enough to scatter the atoms out of the trapping potential, thus limiting the lifetime. Therefore, we lower the temperature of the cell to decrease the vapor pressure of any ^3He remaining on the walls. We can mimic the conditions of a 1 μB species using atomic Mn (5 μB) simply by lowering the trapping field strength by a factor of five. Further, we will report on efforts to trap and thermally isolate ^7Li, a true 1 μB species. [1]J. D. Weinstein et al., Phys. Rev. A 57, R3173 (1998).
International Nuclear Information System (INIS)
Carson, M.; Stram, B.
1993-01-01
This paper reports that in the countries that make up the Commonwealth of Independent States (C.I.S.), with their vast resources and a considerable existing production base, prospects are good for further growth of the region's exportable gas surplus. Investment fundamentals are stronger for gas than for any other energy resources in the area. But the pipeline infrastructure to move large amounts of gas will need extensive refurbishment to ensure export reliability and growth. Given the potential in terms of production and markets, significant amounts of outside investment in oil, natural gas, and NGL infrastructure will likely increase dramatically in these countries in the near future. These are some of the major conclusions of Enron Corp.'s recent investigations in the C.I.S. and other former Soviet republics
Origin of natural gas; Tennen gas no kigen
Energy Technology Data Exchange (ETDEWEB)
Katayama, Y. [The Institute of Applied Energy, Tokyo (Japan)
1996-03-20
Natural gas, which is a general term of flammable hydrocarbon gases such as methane, is classified by origin into the following categories : (1) oil field gas (oil gas), (2) aquifers (bacteria-fermented methane), (3) coal gas (coal field gas), and (4) abiogenetic gas. The natural gas which has (1-4) origins and is now used as resource in a large quantity is (1) oil field gas. This gas is a hydrocarbon gas recovered in the production process of petroleum and contains components such as ethane, propane and butane. To the contrary, (2) aquifers and (3) coal gas have methane as main component. As (4) abiogenetic methane, there are gas formed in inorganic reaction in activities of submarine volcanos and deep gas (earth origin gas). Oil field gas has kerogen origin. Aquifers were formed by fermentation of organic matters. Coal gas was formed by coalification of vitrinite. As abiogenetic methane, there are inorganic reaction formation gas and deep gas, the latter of which exists little as resource. 7 refs., 11 figs., 1 tab.
PolyPole-1: An accurate numerical algorithm for intra-granular fission gas release
International Nuclear Information System (INIS)
Pizzocri, D.; Rabiti, C.; Luzzi, L.; Barani, T.; Van Uffelen, P.; Pastore, G.
2016-01-01
The transport of fission gas from within the fuel grains to the grain boundaries (intra-granular fission gas release) is a fundamental controlling mechanism of fission gas release and gaseous swelling in nuclear fuel. Hence, accurate numerical solution of the corresponding mathematical problem needs to be included in fission gas behaviour models used in fuel performance codes. Under the assumption of equilibrium between trapping and resolution, the process can be described mathematically by a single diffusion equation for the gas atom concentration in a grain. In this paper, we propose a new numerical algorithm (PolyPole-1) to efficiently solve the fission gas diffusion equation in time-varying conditions. The PolyPole-1 algorithm is based on the analytic modal solution of the diffusion equation for constant conditions, combined with polynomial corrective terms that embody the information on the deviation from constant conditions. The new algorithm is verified by comparing the results to a finite difference solution over a large number of randomly generated operation histories. Furthermore, comparison to state-of-the-art algorithms used in fuel performance codes demonstrates that the accuracy of PolyPole-1 is superior to other algorithms, with similar computational effort. Finally, the concept of PolyPole-1 may be extended to the solution of the general problem of intra-granular fission gas diffusion during non-equilibrium trapping and resolution, which will be the subject of future work. - Highlights: • A new numerical algorithm (PolyPole-1) for intra-granular fission gas release in time-varying conditions is developed. • The concept combines the modal analytic solution for constant conditions and a polynomial correction. • PolyPole-1 is extensively verified and compared to other state-of-the-art algorithms. • PolyPole-1 exhibits a superior accuracy and a similar computational time relative to other algorithms. • The PolyPole-1 algorithm can be
PolyPole-1: An accurate numerical algorithm for intra-granular fission gas release
Energy Technology Data Exchange (ETDEWEB)
Pizzocri, D. [Politecnico di Milano, Department of Energy, Nuclear Engineering Division, Via La Masa 34, 20156 Milano (Italy); Rabiti, C. [Idaho National Laboratory, P.O. Box 1625, Idaho Falls, ID 83415-3840 (United States); Luzzi, L.; Barani, T. [Politecnico di Milano, Department of Energy, Nuclear Engineering Division, Via La Masa 34, 20156 Milano (Italy); Van Uffelen, P. [European Commission, Joint Research Centre, Institute for Transuranium Elements, P.O. Box 2340, 76125 Karlsruhe (Germany); Pastore, G., E-mail: giovanni.pastore@inl.gov [Idaho National Laboratory, P.O. Box 1625, Idaho Falls, ID 83415-3840 (United States)
2016-09-15
The transport of fission gas from within the fuel grains to the grain boundaries (intra-granular fission gas release) is a fundamental controlling mechanism of fission gas release and gaseous swelling in nuclear fuel. Hence, accurate numerical solution of the corresponding mathematical problem needs to be included in fission gas behaviour models used in fuel performance codes. Under the assumption of equilibrium between trapping and resolution, the process can be described mathematically by a single diffusion equation for the gas atom concentration in a grain. In this paper, we propose a new numerical algorithm (PolyPole-1) to efficiently solve the fission gas diffusion equation in time-varying conditions. The PolyPole-1 algorithm is based on the analytic modal solution of the diffusion equation for constant conditions, combined with polynomial corrective terms that embody the information on the deviation from constant conditions. The new algorithm is verified by comparing the results to a finite difference solution over a large number of randomly generated operation histories. Furthermore, comparison to state-of-the-art algorithms used in fuel performance codes demonstrates that the accuracy of PolyPole-1 is superior to other algorithms, with similar computational effort. Finally, the concept of PolyPole-1 may be extended to the solution of the general problem of intra-granular fission gas diffusion during non-equilibrium trapping and resolution, which will be the subject of future work. - Highlights: • A new numerical algorithm (PolyPole-1) for intra-granular fission gas release in time-varying conditions is developed. • The concept combines the modal analytic solution for constant conditions and a polynomial correction. • PolyPole-1 is extensively verified and compared to other state-of-the-art algorithms. • PolyPole-1 exhibits a superior accuracy and a similar computational time relative to other algorithms. • The PolyPole-1 algorithm can be
Natural gas annual 1992: Volume 1
Energy Technology Data Exchange (ETDEWEB)
1993-11-22
This document provides information on the supply and disposition of natural gas to a wide audience including industry, consumers, Federal and State agencies, and education institutions. The 1992 data are presented in a sequence that follows natural gas (including supplemental supplies) from its production top its end use. Tables summarizing natural gas supply and disposition from 1988 to 1992 are given for each Census Division and each State. Annual historical data are shown at the national level. Volume 2 of this report presents State-level historical data.
Permafrost-associated gas hydrate: is it really approximately 1% of the global system?
Ruppel, Carolyn
2015-01-01
Permafrost-associated gas hydrates are often assumed to contain ∼1 % of the global gas-in-place in gas hydrates based on a study26 published over three decades ago. As knowledge of permafrost-associated gas hydrates has grown, it has become clear that many permafrost-associated gas hydrates are inextricably linked to an associated conventional petroleum system, and that their formation history (trapping of migrated gas in situ during Pleistocene cooling) is consistent with having been sourced at least partially in nearby thermogenic gas deposits. Using modern data sets that constrain the distribution of continuous permafrost onshore5 and subsea permafrost on circum-Arctic Ocean continental shelves offshore and that estimate undiscovered conventional gas within arctic assessment units,16 the done here reveals where permafrost-associated gas hydrates are most likely to occur, concluding that Arctic Alaska and the West Siberian Basin are the best prospects. A conservative estimate is that 20 Gt C (2.7·1013 kg CH4) may be sequestered in permafrost-associated gas hydrates if methane were the only hydrate-former. This value is slightly more than 1 % of modern estimates (corresponding to 1600 Gt C to 1800 Gt C2,22) for global gas-in-place in methane hydrates and about double the absolute estimate (11.2 Gt C) made in 1981.26
Adenovirus Detection by the cGAS/STING/TBK1 DNA Sensing Cascade
Lam, Eric; Stein, Saskia
2014-01-01
Adenovirus (Ad) infection triggers a cell-specific antiviral response following exposure of viral DNA to the intracellular compartment. A variety of DNA sensors (DAI, AIM2, DDx41, RNA polymerase [Pol] III, and IFI16 [p204]) have been identified in recent years; however, the DNA sensor involved in detection of adenovirus has not been established. Cyclic GMP-AMP synthase (cGAS), a DNA sensor that produces a cyclic guanine-adenine dinucleotide (cGAMP) inducer of STING, has been examined to determine its role in generating an antiadenoviral response. Short hairpin RNA (shRNA) lentiviral vectors targeting TBK1, STING, and cGAS were established in murine MS1 endothelial and RAW 264.7 macrophage cell lines. Knockdown of TBK1, STING, and cGAS results in a dramatic reduction in the activation of the primary antiviral response marker phosphorylated interferon (IFN) response factor 3 (IRF3) following exposure to adenovirus. Furthermore, activation of secondary type I IFN signaling targets (ptyrSTAT1 and ptyrSTAT2 [ptyrSTAT1/2]) was also compromised. Consistent with compromised activation of primary and secondary response markers, transcriptional activation of IRF3-responsive genes (beta IFN [IFN-β], ISG15, ISG54) and secondary response transcripts were diminished in cells knocked down in cGAS, STING, or TBK1. These data establish cGAS as the dominant cytosolic DNA sensor responsible for detection of internalized adenovirus leading to induction of the type I interferon antiviral cascade. PMID:24198409
Directory of Open Access Journals (Sweden)
Yi-Ting Lee
2016-09-01
Full Text Available We have overcome the synthetic difficulty of 9,9′,9′′,9′′′,9′′′′,9′′′′′-((phenylsilanetriyltris(benzene-5,3,1-triylhexakis(9H-carbazole (SimCP3 an advanced homologue of previously known SimCP2 as a solution-processed, high triplet gap energy host material for a blue phosphorescence dopant. A series of organic light-emitting diodes based on blue phosphorescence dopant iridium (III bis(4,6-difluorophenylpyridinatopicolate, FIrpic, were fabricated and tested to demonstrate the validity of solution-processed SimCP3 in the device fabrication.
Yu, Xiao-Zhang; Lin, Yu-Juan; Lu, Chun-Jiao; Zhang, Xue-Hong
2017-09-01
Involvement of genes (CYS-A1, CYS-C1 and NIT4) encoded with cysteine synthase, β-cyanoalanine synthase, nitrilase and cyanide metabolisms are evident in Arabidopsis. In the present study, identifications of CYS-A1, CYS-C1 and NIT4, predictions of conserved motifs, and constructions of phylogenetic relationships, based on their amino acid sequences in rice, were conducted. In order to elucidate the transcriptional responses of these cyanide-degrading genes, two candidate homologues were selected for each gene to test their expression changes upon exposure to exogenous KCN in rice seedlings using RT-PCR. Results showed that all selected candidate homologous genes were differentially expressed at different exposure points in roots and shoots of rice seedlings, suggesting their distinct roles during cyanide assimilation. Both candidate homologues for CYS-A1 constantly exhibited more abundant transcripts in comparison to control. However, only one candidate homologue for CYS-C1 and NIT4 showed a remarkable up-regulation during KCN exposure. Analysis of both tissue and solution cyanide indicated that rice seedlings were quickly able to metabolize exogenous KCN with minor accumulation in plant tissues. In conclusion, significant up-regulation of CYS-A1 suggested that the endogenous pool of cysteine catalyzed by cysteine synthase does not restrict the conversion of exogenous KCN into cyanoalanine through the β-cyanoalanine pathway. However, insufficient responses of the transcription level of NIT4 suggested that NIT enzyme may be a limiting factor for cyanoalanine assimilation by rice seedlings.
Western Gas Sands Project. Status report, 1 March 1979--31 March 1979
Energy Technology Data Exchange (ETDEWEB)
None
1979-01-01
Progress of the government-sponsored projects directed toward increasing gas production from low-permeability gas sands of the western United States is summarized. During March, National Laboratories and Energy Technology Centers generally progressed on schedule. Bartlesville Energy Technology Center continued work on fracture conductivity, rock-fluid interaction, and log evaluation techniques. Theoretical and experimental work on hydraulic fracturing mechanics and analysis of well test data continued at Lawrence Livermore Laboratory. Sandia Laboratories completed preparations for the NTS evaluation test of the borehole seismic system. M.D. Wood, Inc. monitored the formation of a hydraulic fracture in the Wattenburg gas field, Weld County, Colorado. Measurement of bottom-hole pressure in the Miller No. 1 and Sprague No. 1 wells for the CIG cyclic gas injection project continued. The Mitchell Energy Corporation Muse--Duke No. 1 was flowing 4,000 MCFD in March. Efforts to clean out Mobil's PCU F31-13G well continued.
18 CFR 260.1 - FERC Form No. 2, Annual report for Major natural gas companies.
2010-04-01
... report for Major natural gas companies. 260.1 Section 260.1 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION, DEPARTMENT OF ENERGY APPROVED FORMS, NATURAL GAS ACT STATEMENTS AND REPORTS (SCHEDULES) § 260.1 FERC Form No. 2, Annual report for Major natural gas companies. (a...
Online precision gas evaluation of the ATLAS Muon Spectrometer during LHC RUN1
The ATLAS collaboration
2014-01-01
The ATLAS Muon Spectrometer, a six story structure embedded in a toroidal magnetic field, is constructed of nearly 1200 Monitored Drift Tube chambers (MDTs) containing 354,000 aluminum drift tubes. The operating gas is 93% Ar + 7% CO2 with a small amount of water vapor at a pressure of 3 bar. The momentum resolution required for the LHC physics (dp/p = 2% at 100 GeV) demands that MDT gas gas quality and the associated gas dependent calibrations be determined with a rapid feedback cycle. During the LHC Run 1 more than 2 billion liters of gas flowed through the detector at a rate 100,000 l/hr. Online evauation of MDT gas in real time and the associated contribution to the determination of the time-to-space functions was conducted by the dedicated Gas Monitor Chamber. We report on the operation and results of the GMC over the first three years of LHC running. During this period, the GMC has operated with a nearly 100% duty cycle, providing hourly measurements of the MDT drift times with 1 ns precision, correspon...
Ultra Clean 1.1MW High Efficiency Natural Gas Engine Powered System
Energy Technology Data Exchange (ETDEWEB)
Zurlo, James; Lueck, Steve
2011-08-31
Dresser, Inc. (GE Energy, Waukesha gas engines) will develop, test, demonstrate, and commercialize a 1.1 Megawatt (MW) natural gas fueled combined heat and power reciprocating engine powered package. This package will feature a total efficiency > 75% and ultra low CARB permitting emissions. Our modular design will cover the 1 – 6 MW size range, and this scalable technology can be used in both smaller and larger engine powered CHP packages. To further advance one of the key advantages of reciprocating engines, the engine, generator and CHP package will be optimized for low initial and operating costs. Dresser, Inc. will leverage the knowledge gained in the DOE - ARES program. Dresser, Inc. will work with commercial, regulatory, and government entities to help break down barriers to wider deployment of CHP. The outcome of this project will be a commercially successful 1.1 MW CHP package with high electrical and total efficiency that will significantly reduce emissions compared to the current central power plant paradigm. Principal objectives by phases for Budget Period 1 include: • Phase 1 – market study to determine optimum system performance, target first cost, lifecycle cost, and creation of a detailed product specification. • Phase 2 – Refinement of the Waukesha CHP system design concepts, identification of critical characteristics, initial evaluation of technical solutions, and risk mitigation plans. Background
Molecular Gas Reservoirs in Cluster Galaxies at z = 1.46
Hayashi, Masao; Tadaki, Ken-ichi; Kodama, Tadayuki; Kohno, Kotaro; Yamaguchi, Yuki; Hatsukade, Bunyo; Koyama, Yusei; Shimakawa, Rhythm; Tamura, Yoichi; Suzuki, Tomoko L.
2018-04-01
We present molecular gas reservoirs of 18 galaxies associated with the XMMXCS J2215.9–1738 cluster at z = 1.46. From Band 7 and Band 3 data of the Atacama Large Millimeter/submillimeter Array, we detect dust continuum emission at 870 μm and the CO J = 2–1 emission line from 8 and 17 member galaxies, respectively, within a clustercentric radius of R 200. The molecular gas masses derived from the CO and/or dust continuum luminosities show that the fraction of molecular gas mass and the depletion timescale for the cluster galaxies are larger than expected from the scaling relations of molecular gas on stellar mass and offset from the main sequence of star-forming galaxies in general fields. The galaxies closer to the cluster center in terms of both projected position and accretion phase seem to show a larger deviation from the scaling relations. We speculate that the environment of the galaxy cluster helps feed the gas through inflow to the member galaxies and reduce the efficiency of star formation. The stacked Band 3 spectrum of 12 quiescent galaxies with M stellar ∼ 1011 M ⊙ within 0.5R 200 shows no detection of a CO emission line, giving the upper limit of molecular gas mass and molecular gas fraction to be ≲1010 M ⊙ and ≲10%, respectively. Therefore, the massive galaxies in the cluster core quench the star formation activity while consuming most of the gas reservoirs.
Collisions of halogen (2P) and rare gas (1S) atoms
International Nuclear Information System (INIS)
Becker, C.H.
1978-12-01
Differential cross sections I (THETA) at several collision energies measured in crossed molecular beam experiments are reported for several combinations of halogen atoms ( 2 P) scattered off rare gas-rare gas atoms ( 1 S 0 ), namely, F + Ne, F + Ar, F + Kr, F + Xe, C1 + Xe. The scattering is described by an elastic model appropriate to Hund's case c coupling. With the use of this model, the X 1/2, I 3/2, and II 1/2 interaction potential energy curves are derived by fitting calculated differential cross sections, based on analytic representations of the potentials, to the data. The F - Xe X 1/2 potential shows a significant bonding qualitatively different than for the other F-rare gases. The I 3/2 and II 1/2 potentials closely resemble the van der Waals interactions of the one electron richer ground state rare gas-rare gas systems. Coupled-channel scattering calculations are carried out for F + Ar, F + Xe, and C1 + Xe using the realistic potential curves derived earlier. The results justify the use of the elastic model, and give additional information on intramultiplet and intermultiplet transitions. The transitions are found to be governed by the crossing of the two Ω = 1/2 potentials in the complex plane. The measured I (theta) and I (THETA) derived from the coupled-channel computations show small oscillations or perturbations (Stueckelberg oscillations) though quantitative agreement is not obtained.The nature of the anomalous F - Xe X 1/2 potential is discussed as is the approximation of a constant spin orbit coupling over the experimentally accessible range of internuclear distances for these open shell molecules. 55 references
Energy Technology Data Exchange (ETDEWEB)
NONE
2008-07-01
The purpose of the observatory is to provide the general public with indicators for monitoring market deregulation. It both covers the wholesale and retail electricity and gas markets in Metropolitan France. This observatory is updated every three months and data are available on CRE web site (www.cre.fr). Since the 1. of July 2007, all customers can choose their gas and electricity suppliers. Content: A - The electricity market: The retail electricity market (Introduction, Customer segments and their respective weight, Status at March 31, 2007, Dynamic analysis: 1. Quarter 2008); The wholesale electricity market (Introduction, Wholesale market activity in France, Prices on the French wholesale market and European comparison, Import and export volumes, Concentration of the French electricity market); B - The gas market: The retail gas market (Introduction, Customer segments and their respective weight, Status on March 31, 2008, Dynamic analysis: 1. Quarter 2008); The wholesale gas market (Gas pricing and gas markets in Europe, The wholesale market in France, Striking fact of the first quarter 2008); C - Appendices: Electricity and gas market observatories combined glossary, Specific electricity market observatory glossary, Specific gas market observatory glossary.
Boc modifies the spectrum of holoprosencephaly in the absence of Gas1 function
Directory of Open Access Journals (Sweden)
Maisa Seppala
2014-07-01
Full Text Available Holoprosencephaly is a heterogeneous developmental malformation of the central nervous system characterized by impaired forebrain cleavage, midline facial anomalies and wide phenotypic variation. Indeed, microforms represent the mildest manifestation, associated with facial anomalies but an intact central nervous system. In many cases, perturbations in sonic hedgehog signaling are responsible for holoprosencephaly. Here, we have elucidated the contribution of Gas1 and an additional hedgehog co-receptor, Boc during early development of the craniofacial midline, by generating single and compound mutant mice. Significantly, we find Boc has an essential role in the etiology of a unique form of lobar holoprosencephaly that only occurs in conjunction with combined loss of Gas1. Whilst Gas1−/− mice have microform holoprosencephaly characterized by a single median maxillary central incisor, cleft palate and pituitary anomalies, Boc−/− mice have a normal facial midline. However, Gas1−/−; Boc−/− mutants have lobar holoprosencephaly associated with clefting of the lip, palate and tongue, secondary to reduced sonic hedgehog transduction in the central nervous system and face. Moreover, maxillary incisor development is severely disrupted in these mice, arresting prior to cellular differentiation as a result of apoptosis in the odontogenic epithelium. Thus, Boc and Gas1 retain an essential function in these tooth germs, independent of their role in midline development of the central nervous system and face. Collectively, this phenotype demonstrates both redundancy and individual requirements for Gas1 and Boc during sonic hedgehog transduction in the craniofacial midline and suggests BOC as a potential digenic locus for lobar holoprosencephaly in human populations.
Pure- and mixed-gas CO2/CH4 separation properties of PIM-1 and an amidoxime-functionalized PIM-1
Swaidan, Raja; Ghanem, Bader; Litwiller, Eric; Pinnau, Ingo
2014-01-01
to the design and evaluation of PIMs for economical natural gas sweetening is a high and stable CO2/CH4 selectivity under realistic, mixed-gas conditions. Here, amidoxime-functionalized PIM-1 (AO-PIM-1) was prepared and examined for fundamental structure
Bartholomeusz, Trixie Ann; Molinié, Roland; Roscher, Albrecht; Felpin, François-Xavier; Gillet, Françoise; Lebreton, Jacques; Mesnard, François; Robins, Richard J
2005-08-01
The metabolism of (R,S)-N-methylanabasine and (R,S)-N-methylanatabine has been studied in a cell suspension culture of Nicotiana plumbaginifolia. Both substrates are effectively demethylated, anabasine or anatabine, respectively, accumulating in the medium. Similarly, there is strong stereoselectivity for the (R)-isomers of both substrates. The kinetics of metabolism of (R,S)-N-methylanabasine differ significantly from those of nicotine in that no further degradation of the initial demethylation product occurs. (R,S)-N-Methylanatabine, however, shows kinetics closer to those of nicotine, with loss of alkaloid from the system. Further more, (R,S)-N-methylanabasine does not diminish (S)-nicotine demethylation, indicating a lack of competition. However, the metabolism of (S)-nicotine is affected by the presence of (R,S)-N-methylanabasine. Hence, the demethylation of the piperidine homologues of nicotine is seen to be similar but not identical to that of the pyridine analogues. The implications of these different metabolic profiles in relation to the demethylation activity are discussed.
Rigden, Daniel J; Thomas, Jens M H; Simkovic, Felix; Simpkin, Adam; Winn, Martyn D; Mayans, Olga; Keegan, Ronan M
2018-03-01
Molecular replacement (MR) is the predominant route to solution of the phase problem in macromolecular crystallography. Although routine in many cases, it becomes more effortful and often impossible when the available experimental structures typically used as search models are only distantly homologous to the target. Nevertheless, with current powerful MR software, relatively small core structures shared between the target and known structure, of 20-40% of the overall structure for example, can succeed as search models where they can be isolated. Manual sculpting of such small structural cores is rarely attempted and is dependent on the crystallographer's expertise and understanding of the protein family in question. Automated search-model editing has previously been performed on the basis of sequence alignment, in order to eliminate, for example, side chains or loops that are not present in the target, or on the basis of structural features (e.g. solvent accessibility) or crystallographic parameters (e.g. B factors). Here, based on recent work demonstrating a correlation between evolutionary conservation and protein rigidity/packing, novel automated ways to derive edited search models from a given distant homologue over a range of sizes are presented. A variety of structure-based metrics, many readily obtained from online webservers, can be fed to the MR pipeline AMPLE to produce search models that succeed with a set of test cases where expertly manually edited comparators, further processed in diverse ways with MrBUMP, fail. Further significant performance gains result when the structure-based distance geometry method CONCOORD is used to generate ensembles from the distant homologue. To our knowledge, this is the first such approach whereby a single structure is meaningfully transformed into an ensemble for the purposes of MR. Additional cases further demonstrate the advantages of the approach. CONCOORD is freely available and computationally inexpensive, so
Characterization of Two 20kDa-Cement Protein (cp20k) Homologues in Amphibalanus amphitrite
He, Li-Sheng
2013-05-22
The barnacle, Amphibalanus amphitrite, is a common marine fouling organism. Understanding the mechanism of barnacle adhesion will be helpful in resolving the fouling problem. Barnacle cement is thought to play a key role in barnacle attachment. Although several adult barnacle cement proteins have been identified in Megabalanus rosa, little is known about their function in barnacle settlement. In this study, two homologous 20k-cement proteins (cp20k) in Amphibalanus amphitrite, named Bamcp20k-1 and Bamcp20k-2, were characterized. The two homologues share primary sequence structure with proteins from other species including Megabalanus rosa and Fistulobalanus albicostatus. The conserved structure included repeated Cys domains and abundant charged amino acids, such as histidine. In this study we demonstrated that Bamcp20k-1 localized at the α secretory cells in the cyprid cement gland, while Bamcp20k-2 localized to the β secretory cells. The differential localizations suggest differential regulation for secretion from the secretory cells. Both Bamcp20k-1 and Bamcp20k-2 from cyprids dissolved in PBS. However, adult Bamcp20k-2, which was dominant in the basal shell of adult barnacles, was largely insoluble in PBS. Solubility increased in the presence of the reducing reagent Dithiothreitol (DTT), suggesting that the formation of disulfide bonds plays a role in Bamcp20k-2 function. In comparison, Bamcp20k-1, which was enriched in soft tissue, could not be easily detected in the shell and base by Western blot and easily dissolved in PBS. These differential solubilities and localizations indicate that Bamcp20k-1 and Bamcp20k-2 have distinct functions in barnacle cementing. © 2013 He et al.
Characterization of Two 20kDa-Cement Protein (cp20k) Homologues in Amphibalanus amphitrite
He, Li-Sheng; Zhang, Gen; Qian, Pei-Yuan
2013-01-01
The barnacle, Amphibalanus amphitrite, is a common marine fouling organism. Understanding the mechanism of barnacle adhesion will be helpful in resolving the fouling problem. Barnacle cement is thought to play a key role in barnacle attachment. Although several adult barnacle cement proteins have been identified in Megabalanus rosa, little is known about their function in barnacle settlement. In this study, two homologous 20k-cement proteins (cp20k) in Amphibalanus amphitrite, named Bamcp20k-1 and Bamcp20k-2, were characterized. The two homologues share primary sequence structure with proteins from other species including Megabalanus rosa and Fistulobalanus albicostatus. The conserved structure included repeated Cys domains and abundant charged amino acids, such as histidine. In this study we demonstrated that Bamcp20k-1 localized at the α secretory cells in the cyprid cement gland, while Bamcp20k-2 localized to the β secretory cells. The differential localizations suggest differential regulation for secretion from the secretory cells. Both Bamcp20k-1 and Bamcp20k-2 from cyprids dissolved in PBS. However, adult Bamcp20k-2, which was dominant in the basal shell of adult barnacles, was largely insoluble in PBS. Solubility increased in the presence of the reducing reagent Dithiothreitol (DTT), suggesting that the formation of disulfide bonds plays a role in Bamcp20k-2 function. In comparison, Bamcp20k-1, which was enriched in soft tissue, could not be easily detected in the shell and base by Western blot and easily dissolved in PBS. These differential solubilities and localizations indicate that Bamcp20k-1 and Bamcp20k-2 have distinct functions in barnacle cementing. © 2013 He et al.
Directory of Open Access Journals (Sweden)
Gang Gao
2015-01-01
Full Text Available To figure out the process and controlling factors of gas reservoir formation in deep-waters, based on an analysis of geological features, source of natural gas and process of reservoir formation in the Liwan 3-1 gas field, physical simulation experiment of the gas reservoir formation process has been performed, consequently, pattern and features of gas reservoir formation in the Baiyun sag has been found out. The results of the experiment show that: ① the formation of the Liwan 3-1 faulted anticline gas field is closely related to the longstanding active large faults, where natural gas is composed of a high proportion of hydrocarbons, a small amount of non-hydrocarbons, and the wet gas generated during highly mature stage shows obvious vertical migration signs; ② liquid hydrocarbons associated with natural gas there are derived from source rock of the Enping & Zhuhai Formation, whereas natural gas comes mainly from source rock of the Enping Formation, and source rock of the Wenchang Formation made a little contribution during the early Eocene period as well; ③ although there was gas migration and accumulation, yet most of the natural gas mainly scattered and dispersed due to the stronger activity of faults in the early period; later as fault activity gradually weakened, gas started to accumulate into reservoirs in the Baiyun sag; ④ there is stronger vertical migration of oil and gas than lateral migration, and the places where fault links effective source rocks with reservoirs are most likely for gas accumulation; ⑤ effective temporal-spatial coupling of source-fault-reservoir in late stage is the key to gas reservoir formation in the Baiyun sag; ⑥ the nearer the distance from a trap to a large-scale fault and hydrocarbon source kitchen, the more likely gas may accumulate in the trap in late stage, therefore gas accumulation efficiency is much lower for the traps which are far away from large-scale faults and hydrocarbon source
Cu(1+) in HKUST-1: selective gas adsorption in the presence of water.
Nijem, Nour; Bluhm, Hendrik; Ng, May L; Kunz, Martin; Leone, Stephen R; Gilles, Mary K
2014-09-11
Spectroscopic evidence for an enhanced binding of Nitric Oxide (NO) to metal centers with lower oxidation states (open Cu(1+) sites) in Cu3(btc)2 (HKUST-1) is presented. The Cu(1+) sites created by thermal treatment or X-ray exposure exhibit a preferential adsorption of NO compared to H2O. This phenomenon demonstrates the potential use of MOFs with lower oxidation state metal centers for selective gas separation.
Online precision gas evaluation of the ATLAS Muon Spectrometer during LHC Run1
AUTHOR|(CDS)2092735; The ATLAS collaboration
2016-01-01
The ATLAS Muon Spectrometer, a six story structure embedded in a toroidal magnetic field, is constructed of nearly 1200 Monitored Drift Tube chambers (MDTs) containing 354,000 aluminum drift tubes. The operating gas is 93% Ar + 7% CO${_2}$ with a small amount of water vapor at a pressure of 3 bar. The momentum resolution required for ATLAS physics demands that MDT gas quality and the associated gas dependent calibrations be determined with a rapid feedback cycle. During the LHC Run1, more than 2 billion liters of gas flowed through the detector at a rate 100,000 l/hr. Online evaluation of MDT gas in real time and the associated contribution to the determination of the time-to-space functions was conducted by the dedicated Gas Monitor Chamber (GMC). We report on the operation and results of the GMC over the first three years of LHC running. During this period, the GMC has operated with a nearly 100% duty cycle, providing hourly measurements of the MDT drift times with 1 ns precision, corresponding to minute ch...
Mid-infrared 1 W hollow-core fiber gas laser source.
Xu, Mengrong; Yu, Fei; Knight, Jonathan
2017-10-15
We report the characteristics of a 1 W hollow-core fiber gas laser emitting CW in the mid-IR. Our system is based on an acetylene-filled hollow-core optical fiber guiding with low losses at both the pump and laser wavelengths and operating in the single-pass amplified spontaneous emission regime. Through systematic characterization of the pump absorption and output power dependence on gas pressure, fiber length, and pump intensity, we determine that the reduction of pump absorption at high pump flux and the degradation of gain performance at high gas pressure necessitate the use of increased gain fiber length for efficient lasing at higher powers. Low fiber attenuation is therefore key to efficient high-power laser operation. We demonstrate 1.1 W output power at a 3.1 μm wavelength by using a high-power erbium-doped fiber amplifier pump in a single-pass configuration, approximately 400 times higher CW output power than in the ring cavity previously reported.
Wu, Liejun; Chen, Yongli; Caccamise, Sarah A.L.; Li, Qing X.
2012-01-01
A difference equation (DE) model is developed using the methylene retention increment (Δtz) of n-alkanes to avoid the influence of gas holdup time (tM). The effects of the equation orders (1st–5th) on the accuracy of a curve fitting show that a linear equation (LE) is less satisfactory and it is not necessary to use a complicated cubic or higher order equation. The relationship between the logarithm of Δtz and the carbon number (z) of the n-alkanes under isothermal conditions closely follows the quadratic equation for C3–C30 n-alkanes at column temperatures of 24–260 °C. The first and second order forward differences of the expression (Δlog Δtz and Δ2log Δtz, respectively) are linear and constant, respectively, which validates the DE model. This DE model lays a necessary foundation for further developing a retention model to accurately describe the relationship between the adjusted retention time and z of n-alkanes. PMID:22939376
Matsushika, Akinori; Suzuki, Toshihiro; Goshima, Tetsuya; Hoshino, Tamotsu
2017-08-01
We previously showed that overexpression of IoGAS1, which was isolated from the multiple stress-tolerant yeast Issatchenkia orientalis, endows Saccharomyces cerevisiae cells with the ability to grow and ferment under acidic and high-salt conditions. The deduced amino acid sequence of the IoGAS1 gene product exhibits 60% identity with the S. cerevisiae Gas1 protein, a glycosylphosphatidylinositol-anchored protein essential for maintaining cell wall integrity. However, the functional roles of ScGAS1 in stress tolerance and pH regulation remain unclear. In the present study, we characterized ScGAS1 regarding its roles in tolerance to low pH and high salt concentrations. Transcriptional analysis indicated that, as for the IoGAS1 gene, ScGAS1 expression was pH dependent, with maximum expression at pH 3.0; the presence of salt increased endogenous expression of both GAS1 genes at almost all pH levels. These results suggested that ScGAS1, like IoGAS1, is involved in a novel acid- and salt-stress adaptation mechanism in S. cerevisiae. Overexpression of ScGAS1 in S. cerevisiae improved growth and ethanol production from glucose under acid stress without added salt, although the stress tolerance of the ScGAS1-overexpressing strain was inferior to that of the IoGAS1-overexpressing strain. However, overexpression of ScGAS1 did not result in increased tolerance of S. cerevisiae to combined acid and salt stress, even though ScGAS1 appears to be a salt-responsive gene. Thus, ScGAS1 is directly implicated in tolerance to low pH but does not confer salinity tolerance, supporting the view that ScGAS1 and IoGAS1 have overlapping yet distinct roles in stress tolerance in yeast. Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.
Chen, H.; Rossier, C.; Lalioti, M. D.; Lynn, A.; Chakravarti, A.; Perrin, G.; Antonarakis, S. E.
1996-01-01
In an effort to contribute to the transcript map of human chromosome 21 and the understanding of the pathophysiology of trisomy 21, we have used exon trapping to identify fragments of chromosome 21 genes. Two trapped exons, from pools of chromosome 21-specific cosmids, showed homology to the Drosophila white (w) gene. We subsequently cloned the corresponding cDNA for a human homologue of the Drosophila w gene (hW) from human retina and fetal brain cDNA libraries. The gene belongs to the ATP-b...
Directory of Open Access Journals (Sweden)
Teruo Umemoto
2012-03-01
Full Text Available Various arylsulfur pentafluorides, ArSF5, have long been desired in both academic and industrial areas, and ArSF5 compounds have attracted considerable interest in many areas such as medicines, agrochemicals, and other new materials, since the highly stable SF5 group is considered a “super-trifluoromethyl group” due to its significantly higher electronegativity and lipophilicity. This article describes the first practical method for the production of various arylsulfur pentafluorides and their higher homologues, bis- and tris(sulfur pentafluorides, from the corresponding diaryl disulfides or aryl thiols. The method consists of two steps: (Step 1 treatment of a diaryl disulfide or an aryl thiol with chlorine in the presence of an alkali metal fluoride, and (step 2 treatment of the resulting arylsulfur chlorotetrafluoride with a fluoride source, such as ZnF2, HF, and Sb(III/V fluorides. The intermediate arylsulfur chlorotetrafluorides were isolated by distillation or recrystallization and characterized. The aspects of these new reactions are revealed and reaction mechanisms are discussed. As the method offers considerable improvement over previous methods in cost, yield, practicality, applicability, and large-scale production, the new processes described here can be employed as the first practical methods for the economical production of various arylsulfur pentafluorides and their higher homologues, which could then open up a new era of “super-trifluoromethyl” arene chemistry and its applications in many areas.
Directory of Open Access Journals (Sweden)
Andreas Pfannmüller
Full Text Available The rice pathogenic fungus Fusarium fujikuroi is well known for the production of a broad spectrum of secondary metabolites (SMs such as gibberellic acids (GAs, mycotoxins and pigments. The biosynthesis of most of these SMs strictly depends on nitrogen availability and of the activity of permeases of nitrogen sources, e.g. the ammonium and amino acid permeases. One of the three ammonium permeases, MepB, was recently shown to act not only as a transporter but also as a nitrogen sensor affecting the production of nitrogen-repressed SMs. Here we describe the identification of a general amino acid permease, FfGap1, among the 99 putative amino acid permeases (AAPs in the genome of F. fujikuroi. FfGap1 is able to fully restore growth of the yeast gap1∆ mutant on several amino acids including citrulline and tryptophane. In S. cerevisiae, Gap1 activity is regulated by shuttling between the plasma membrane (nitrogen limiting conditions and the vacuole (nitrogen sufficiency, which we also show for FfGap1. In yeast, the Npr1 serine/threonine kinase stabilizes the Gap1 position at the plasma membrane. Here, we identified and characterized three NPR1-homologous genes, encoding the putative protein kinases FfNpr1-1, FfNpr1-2 and FfNpr1-3 with significant similarity to yeast Npr1. Complementation of the yeast npr1Δ mutant with each of the three F. fujikuroi NPR1 homologues, resulted in partial restoration of ammonium, arginine and proline uptake by FfNPR1-1 while none of the three kinases affect growth on different nitrogen sources and nitrogen-dependent sorting of FfGap1 in F. fujikuroi. However, exchange of the putative ubiquitin-target lysine 9 (K9A and 15 (K15A residues of FfGap1 resulted in extended localization to the plasma membrane and increased protein stability independently of nitrogen availability. These data suggest a similar regulation of FfGap1 by nitrogen-dependent ubiquitination, but differences regarding the role of Fusarium Npr1
Western Gas Sands Project. Status report, April 1--April 30, 1979
Energy Technology Data Exchange (ETDEWEB)
Atkinson, C H
1979-01-01
Progress of government-sponsored projects directed toward increasing gas production from the low-permeability gas sands of the western United States is summarized. Work by the USGS toward resource assessment in the four primary study areas continued. Bartlesville Energy Technology Center continued work on fracture conductivity, rock-fluid interaction, and log evaluation and interpretation techniques. Experimental and theoretical work on hydraulic fracturing mechanics and analysis of well test data continued at Lawrence Livermore Laboratory. Gathering of bottom-hole pressure data from the Miller No. 1 well and Sprague No. 1 well in the Wattenberg Field, Colorado continued. Fracturing fluid/rock interaction tests have been completed by Terra Tek for Gas Producing Enterprises, Inc., on sandstone horizons in the lower Mesaverde. The Mitchell Energy Corporation Muse-Duke No. 1 was flowed 4,000 MCFGD in April. Fishing operations on the Mobil PCU F31-13G well were unsuccessful. Six zones of the first horizontal experimental hole in the Sandia Laboratories interface test series were mined back to examine the behavior of the hydraulic fracture at the interface. Data collection by CER Corporation and TRW for GRI's Analysis of Tight Formations project continued.
Anugraha, Gandhirajan; Jeyaprita, Parasurama Jawaharlal; Madhumathi, Jayaprakasam; Sheeba, Tamilvanan; Kaliraj, Perumal
2013-12-01
Although multiple vaccine strategy for lymphatic filariasis has provided tremendous hope, the choice of antigens used in combination has determined its success in the previous studies. Multiple antigens comprising key vaccine candidates from different life cycle stages would provide a promising strategy if the antigenic combination is chosen by careful screening. In order to analyze one such combination, we have used a chimeric construct carrying the well studied B. malayi antigens thioredoxin (BmTRX) and venom allergen homologue (BmVAH) as a fusion protein (TV) and evaluated its immune responses in mice model. The efficacy of fusion protein vaccine was explored in comparison with the single antigen vaccines and their cocktail. In mice, TV induced significantly high antibody titer of 1,28,000 compared to cocktail vaccine TRX+VAH (50,000) and single antigen vaccine TRX (16,000) or VAH (50,000). Furthermore, TV elicited higher level of cellular proliferative response together with elevated levels of IFN-γ, IL-4 and IL-5 indicating a Th1/Th2 balanced response. The isotype antibody profile showed significantly high level of IgG1 and IgG2b confirming the balanced response elicited by TV. Immunization with TV antigen induced high levels of both humoral and cellular immune responses compared to either cocktail or antigen given alone. The result suggests that TV is highly immunogenic in mice and hence the combination needs to be evaluated for its prophylactic potential.
International Nuclear Information System (INIS)
Delfosse, Vanessa; Hugonnet, Jean-Emmanuel; Sougakoff, Wladimir; Mayer, Claudine
2005-01-01
The crystallization of a hypothetical penicillin-binding protein from the archaeon P. abyssi in space group C2 by hanging-drop vapour diffusion is reported. The genome of the hyperthermophilic archaeon Pyrococcus abyssi contains a gene (pab0087) encoding a penicillin-binding protein (PBP) homologue. This sequence consists of 447 residues and shows significant sequence similarity to low-molecular-weight PBPs and class C β-lactamases. The Pab0087 protein was overexpressed, purified and crystallized. Diffraction data from two different crystal forms were collected to 2.7 and 2.0 Å resolution. Both crystals belong to space group C2, with unit-cell parameters a = 160.59, b = 135.74, c = 113.02 Å, β = 117.36° and a = 166.97, b = 131.25, c = 189.39 Å, β = 113.81°, respectively. The asymmetric unit contains four and eight molecules, respectively, with fourfold non-crystallographic symmetry
Czech Academy of Sciences Publication Activity Database
Tomaštíková, Eva; Cenklová, Věra; Kohoutová, Lucie; Petrovská, Beáta; Váchová, Lenka; Halada, Petr; Kočárová, Gabriela; Binarová, Pavla
2012-01-01
Roč. 12, č. 83 (2012) ISSN 1471-2229 R&D Projects: GA ČR(CZ) GA204/07/1169; GA ČR GP204/09/P155; GA ČR GAP501/12/2333; GA MŠk(CZ) LC06034; GA MŠk LC545; GA AV ČR IAA500200719 Grant - others:GA MŠk(CZ) ED0007/01/01 Program:ED Institutional research plan: CEZ:AV0Z50380511; CEZ:AV0Z50200510 Keywords : Arabidopsis homologue of RanBPM * CTLH-complex * LisH-CTLH domain proteins Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 4.354, year: 2012
Probing the Outflowing Multiphase Gas ∼1 kpc below the Galactic Center
Energy Technology Data Exchange (ETDEWEB)
Savage, Blair D.; Kim, Tae-Sun; Wakker, Bart P. [Department of astronomy, University of Wisconsin, Madison, 475 North Charter Street, Madison, WI 53706 (United States); Fox, Andrew J. [Space Telescope Science Institute, 3700 San Martin Drive, Baltimore, MD, 21218 (United States); Massa, Derck [Space Science Institute, 4750 Walnut Street, Suite 205, Boulder, CO 80301 (United States); Bordoloi, Rongmon [MIT-Kavli Center for Astrophysics and Space Research, 77 Massachusetts Avenue, Cambridge, MA 02139 (United States); Jenkins, Edward B. [Princeton University Observatory, Princeton, NJ 08544 (United States); Lehner, Nicolas [Department of Physics, University of Notre Dame, Notre Dame, IN 46556 (United States); Bland-Hawthorn, Joss [Institute of Astronomy, School of Physics, University of Sydney, NSW 2006 (Australia); Lockman, Felix J. [Green Bank Observatory, P.O. Box 2, Green Bank, WV 24944 (United States); Hernandez, Svea [Department of Astrophysics, Radboud University, Nijmegen, PO Box 9010, 6500 GL Nijmegen (Netherlands)
2017-10-01
Comparison of interstellar medium (ISM) absorption in the UV spectrum of LS 4825, a B1 Ib−II star d = 21 ± 5 kpc from the Sun toward l = 1.°67 and b = −6.°63, with ISM absorption toward an aligned foreground star at d < 7.0 ± 1.7 kpc, allows us to isolate and study gas associated with the Milky Way nuclear wind. Spectra from the Space Telescope Imaging Spectrograph show low-ionization absorption out to d < 7 kpc (e.g., O i, C ii, Mg ii, Si ii, Fe ii, S ii) only between 0 and 40 km s{sup −1}, while absorption at d > 7 kpc, ∼1 kpc below the Galactic plane, is complex and spans −290 to +94 km s{sup −1}. The intermediate and high ions Si iii, C iv, Si iv, and N v show extremely strong absorption with multiple components from −283 to 107 km s{sup −1}, implying that the ISM ∼1 kpc below the Galactic center has a substantial reservoir of plasma and more gas containing C iv and N v than in the Carina OB1 association at z = 0 kpc. Abundances and physical conditions are presented for many absorption components. The high ion absorption traces cooling transition temperature plasma probably driven by the outflowing hot gas, while the extraordinarily large thermal pressure, p / k ∼ 10{sup 5} cm{sup −3} K{sup −1}, in an absorption component at −114 km s{sup −1} probably arises from the ram pressure of the outflowing hot gas. The observations are consistent with a flow whose ionization structure in the high ions can be understood through a combination of nonequilibrium radiative cooling and turbulent mixing.
Temperature Evolution of a 1 MA Triple-Nozzle Gas-Puff Z-Pinch
de Grouchy, Philip; Banasek, Jacob; Engelbrecht, Joey; Qi, Niansheng; Atoyan, Levon; Byvank, Tom; Cahill, Adam; Moore, Hannah; Potter, William; Ransohoff, Lauren; Hammer, David; Kusse, Bruce; Laboratory of Plasma Studies Team
2015-11-01
Mitigation of the Rayleigh-Taylor instability (RTI) plays a critical role in optimizing x-ray output at high-energy ~ 13 keV using the triple-nozzle Krypton gas-puff at Sandia National Laboratory. RTI mitigation by gas-puff density profiling using a triple-nozzle gas-puff valve has recently been recently demonstrated on the COBRA 1MA z-pinch at Cornell University. In support of this work we investigate the role of shell cooling in the growth of RTI during gas-puff implosions. Temperature measurements within the imploding plasma shell are recorded using a 527 nm, 10 GW Thomson scattering diagnostic for Neon, Argon and Krypton puffs. The mass-density profile is held constant at 22 microgram per centimeter for all three puffs and the temperature evolution of the imploding material is recorded. In the case of Argon puffs we find that the shell ion and electron effective temperatures remain in equilibrium at around 1keV for the majority of the implosion phase. In contrast scattered spectra from Krypton are dominated by of order 10 keV effective ion temperatures. Supported by the NNSA Stewardship Sciences Academic Programs.
Antidepressant Binding Site in a Bacterial Homologue of Neurotransmitter Transporters
International Nuclear Information System (INIS)
Singh, S.; Yamashita, A.; Gouaux, E.
2007-01-01
Sodium-coupled transporters are ubiquitous pumps that harness pre-existing sodium gradients to catalyse the thermodynamically unfavourable uptake of essential nutrients, neurotransmitters and inorganic ions across the lipid bilayer. Dysfunction of these integral membrane proteins has been implicated in glucose/galactose malabsorption, congenital hypothyroidism, Bartter's syndrome, epilepsy, depression, autism and obsessive-compulsive disorder. Sodium-coupled transporters are blocked by a number of therapeutically important compounds, including diuretics, anticonvulsants and antidepressants, many of which have also become indispensable tools in biochemical experiments designed to probe antagonist binding sites and to elucidate transport mechanisms. Steady-state kinetic data have revealed that both competitive and noncompetitive modes of inhibition exist. Antagonist dissociation experiments on the serotonin transporter (SERT) have also unveiled the existence of a low-affinity allosteric site that slows the dissociation of inhibitors from a separate high-affinity site. Despite these strides, atomic-level insights into inhibitor action have remained elusive. Here we screen a panel of molecules for their ability to inhibit LeuT, a prokaryotic homologue of mammalian neurotransmitter sodium symporters, and show that the tricyclic antidepressant (TCA) clomipramine noncompetitively inhibits substrate uptake. Cocrystal structures show that clomipramine, along with two other TCAs, binds in an extracellular-facing vestibule about 11 (angstrom) above the substrate and two sodium ions, apparently stabilizing the extracellular gate in a closed conformation. Off-rate assays establish that clomipramine reduces the rate at which leucine dissociates from LeuT and reinforce our contention that this TCA inhibits LeuT by slowing substrate release. Our results represent a molecular view into noncompetitive inhibition of a sodium-coupled transporter and define principles for the rational
Antidepressant Binding Site in a Bacterial Homologue of Neurotransmitter Transporters
Energy Technology Data Exchange (ETDEWEB)
Singh,S.; Yamashita, A.; Gouaux, E.
2007-01-01
Sodium-coupled transporters are ubiquitous pumps that harness pre-existing sodium gradients to catalyse the thermodynamically unfavourable uptake of essential nutrients, neurotransmitters and inorganic ions across the lipid bilayer. Dysfunction of these integral membrane proteins has been implicated in glucose/galactose malabsorption, congenital hypothyroidism, Bartter's syndrome, epilepsy, depression, autism and obsessive-compulsive disorder. Sodium-coupled transporters are blocked by a number of therapeutically important compounds, including diuretics, anticonvulsants and antidepressants, many of which have also become indispensable tools in biochemical experiments designed to probe antagonist binding sites and to elucidate transport mechanisms. Steady-state kinetic data have revealed that both competitive and noncompetitive modes of inhibition exist. Antagonist dissociation experiments on the serotonin transporter (SERT) have also unveiled the existence of a low-affinity allosteric site that slows the dissociation of inhibitors from a separate high-affinity site. Despite these strides, atomic-level insights into inhibitor action have remained elusive. Here we screen a panel of molecules for their ability to inhibit LeuT, a prokaryotic homologue of mammalian neurotransmitter sodium symporters, and show that the tricyclic antidepressant (TCA) clomipramine noncompetitively inhibits substrate uptake. Cocrystal structures show that clomipramine, along with two other TCAs, binds in an extracellular-facing vestibule about 11 {angstrom} above the substrate and two sodium ions, apparently stabilizing the extracellular gate in a closed conformation. Off-rate assays establish that clomipramine reduces the rate at which leucine dissociates from LeuT and reinforce our contention that this TCA inhibits LeuT by slowing substrate release. Our results represent a molecular view into noncompetitive inhibition of a sodium-coupled transporter and define principles for the
Contreras, A; Hidalgo, C; Schmidt, S; Henschke, P A; Curtin, C; Varela, C
2015-07-16
High alcohol concentrations reduce the complexity of wine sensory properties. In addition, health and economic drivers have the wine industry actively seeking technologies that facilitate the production of wines with lower alcohol content. One of the simplest approaches to achieve this aim would be the use of wine yeast strains which are less efficient at transforming grape sugars into ethanol, however commercially available wine yeasts produce very similar ethanol yields. Non-conventional yeast, in particular non-Saccharomyces species, have shown potential for producing wines with lower alcohol content. These yeasts are naturally present in the early stages of fermentation but in general are not capable of completing alcoholic fermentation. We have evaluated 48 non-Saccharomyces isolates to identify strains that, with limited aeration and in sequential inoculation regimes with S. cerevisiae, could be used for the production of wine with lower ethanol concentration. Two of these, Torulaspora delbrueckii AWRI1152 and Zygosaccharomyces bailii AWRI1578, enabled the production of wine with reduced ethanol concentration under limited aerobic conditions. Depending on the aeration regime T. delbrueckii AWRI1152 and Z. bailii AWRI1578 showed a reduction in ethanol concentration of 1.5% (v/v) and 2.0% (v/v) respectively, compared to the S. cerevisiae anaerobic control. Copyright © 2015 Elsevier B.V. All rights reserved.
The ontogeny of nanos homologue expression in the oligochaete annelid Tubifex tubifex.
Mohri, Ki-Ichi; Nakamoto, Ayaki; Shimizu, Takashi
2016-01-01
We have cloned and characterized the expression of a nanos homologue (designated Ttu-nos) from the oligochaete annelid Tubifex tubifex. Ttu-nos mRNA is distributed broadly throughout the early cleavage stages. Ttu-nos is expressed in most if not all of the early blastomeres, in which Ttu-nos RNA associates with pole plasms. Ttu-nos transcripts are concentrated to 2d and 4d cells. Shortly after 2d(111) (derived from 2d cell) divides into a bilateral pair of NOPQ proteloblasts, Ttu-nos RNA vanishes from the embryo, which is soon followed by the resumption of Ttu-nos expression in nascent primary blast cells produced by teloblasts. The resumption of Ttu-nos expression occurs only in a subset of teloblast lineages (viz., M, N and Q). After Ttu-nos expression is retained in the germ band for a while, it disappears in anterior-to-posterior progression. At the end of embryogenesis, there is no trace of Ttu-nos expression. Thereafter, growing juveniles do not show any sign of Ttu-nos expression, either. The first sign of Ttu-nos expression is detected in oocytes in the ovary of young adults (ca 40 days after hatching), and its expression continues in growing oocytes that undergo yolk deposition and maturation in the ovisac. Copyright © 2015 Elsevier B.V. All rights reserved.
Assessment of greenhouse gas emissions from natural gas
International Nuclear Information System (INIS)
Anon
2000-01-01
The study, 'Assesment of greenhouse gas emission from natural gas' by independent consultants Energetics Pty Ltd, shows that natural gas has significantly fewer greenhouses gas emissions than either black or brown cola for the defined life cycle stages. The life cycle emissions from natural gas use by an Australian Major User are approximately 50% less than the emissions from Victorian brown coal and approximately 38% less than the emissions from Australian average black coal. Australian Best Practice gas fired electricity generation is estimated to emit between 514 and 658 kg CO 2 e/MWh. By comparison, Australian Best Practice coal-fired electricity generation is estimated to emit between 907 and 1,246 kg CO 2 e/MWh for black and brown coal respectively. Greenhouse gas emissions from Australian Best Practice gas-fired electricity generation using combined cycle gas turbines (including full fuel cycle emissions) vary from 41% to 46% of the emissions from brown coal-fired electricity generation and 57% to 64% of emissions from black coal-fired electricity generation. Greenhouse gas emissions from direct gas supply water heating range from 1,470 to 2,042 kilograms per annum. This compares with emissions of 1,922 to 2,499 kg for electric heating from gas-fired electricity generation and 3,975 to 5,393 kg for coal-fired electricity generation. The implications for greenhouse policy nationally are also discussed, emphasising the need to review national energy policy, currently tied to 'fuel neutrality' doctrine
DEFF Research Database (Denmark)
Skjødt, Mikkel-Ole; Palarasah, Yaseelan; Rasmussen, Karina Juhl
2010-01-01
The lectin complement pathway has important functions in vertebrate host defence and accumulating evidence of primordial complement components trace its emergence to invertebrate phyla. We introduce two putative mannose-binding lectin homologues (CioMBLs) from the urochordate species Ciona intest...... protease in the epithelia cells lining the stomach and intestine. In conclusion we present two urochordate MBLs and identify an associated serine protease, which support the concept of an evolutionary ancient origin of the lectin complement pathway....
Energy Technology Data Exchange (ETDEWEB)
Choi, Suzy; Kim, Hyun Jin, E-mail: kimhyunjin@skku.edu
2014-01-03
Highlights: •Split-ubiquitin MY2H screen identified GATE16 as an interacting protein of TRPML3. •TRPML3 specifically binds to a mammalian ATG8 homologue GATE16, not to LC3B. •The interaction of TRPML3 with GATE16 facilitates autophagosome formation. •GATE16 is expressed in both autophagosome and extra-autophagosomal compartments. -- Abstract: TRPML3 is a Ca{sup 2+} permeable cation channel expressed in multiple intracellular compartments. Although TRPML3 is implicated in autophagy, how TRPML3 can regulate autophagy is not understood. To search interacting proteins with TRPML3 in autophagy, we performed split-ubiquitin membrane yeast two-hybrid (MY2H) screening with TRPML3-loop as a bait and identified GATE16, a mammalian ATG8 homologue. GST pull-down assay revealed that TRPML3 and TRPML3-loop specifically bind to GATE16, not to LC3B. Co-immunoprecipitation (co-IP) experiments showed that TRPML3 and TRPML3-loop pull down only the lipidated form of GATE16, indicating that the interaction occurs exclusively at the organellar membrane. The interaction of TRPML3 with GATE16 and GATE16-positive vesicle formation were increased in starvation induced autophagy, suggesting that the interaction facilitates the function of GATE16 in autophagosome formation. However, GATE16 was not required for TRPML3 trafficking to autophagosomes. Experiments using dominant-negative (DN) TRPML3(D458K) showed that GATE16 is localized not only in autophagosomes but also in extra-autophagosomal compartments, by contrast with LC3B. Since GATE16 acts at a later stage of the autophagosome biogenesis, our results suggest that TRPML3 plays a role in autophagosome maturation through the interaction with GATE16, by providing Ca{sup 2+} in the fusion process.
Synthesis and Transport Properties of Novel MOF/PIM-1/MOF Sandwich Membranes for Gas Separation.
Fuoco, Alessio; Khdhayyer, Muhanned R; Attfield, Martin P; Esposito, Elisa; Jansen, Johannes C; Budd, Peter M
2017-02-11
Metal-organic frameworks (MOFs) were supported on polymer membrane substrates for the fabrication of composite polymer membranes based on unmodified and modified polymer of intrinsic microporosity (PIM-1). Layers of two different MOFs, zeolitic imidazolate framework-8 (ZIF-8) and Copper benzene tricarboxylate ((HKUST-1), were grown onto neat PIM-1, amide surface-modified PIM-1 and hexamethylenediamine (HMDA) -modified PIM-1. The surface-grown crystalline MOFs were characterized by a combination of several techniques, including powder X-ray diffraction, infrared spectroscopy and scanning electron microscopy to investigate the film morphology on the neat and modified PIM-1 membranes. The pure gas permeabilities of He, H₂, O₂, N₂, CH₄, CO₂ were studied to understand the effect of the surface modification on the basic transport properties and evaluate the potential use of these membranes for industrially relevant gas separations. The pure gas transport was discussed in terms of permeability and selectivity, highlighting the effect of the MOF growth on the diffusion coefficients of the gas in the new composite polymer membranes. The results confirm that the growth of MOFs on polymer membranes can enhance the selectivity of the appropriately functionalized PIM-1, without a dramatic decrease of the permeability.
Al-Asmari, Fahad; Mereddy, Ram; Sultanbawa, Yasmina
2017-08-01
The global concerns regarding the emergence of fungicide-resistant strains and the impact of the excessive use of fungicidal practises on our health, food, and environment have increased, leading to a demand for alternative clean green technologies as treatments. Photosensitization is a treatment that utilises a photosensitiser, light and oxygen to cause cell damage to microorganisms. The effect of photosensitization mediated by curcumin on Aspergillus niger, Aspergillus flavus, Penicillium griseofulvum, Penicillium chrysogenum, Fusarium oxysporum, Candida albicans and Zygosaccharomyces bailii was investigated using three methods. The viability of spores/cells suspended in aqueous buffer using different concentrations of curcumin solution (100-1000μM) and light dose (0, 24, 48, 72 and 96J/cm 2 ) were determined. Spraying curcumin solution on inoculated surfaces of agar plates followed by irradiation and soaking spores/cells in curcumin solution prior to irradiation was also investigated. In aqueous mixtures, photosensitised spores/cells of F. oxysporum and C. albicans were inhibited at all light doses and curcumin concentrations, while inactivation of A. niger, A. flavus P. griseofulvum, P. chrysogenum and Z. bailii were highly significant (Pcurcumin at 800μM showed complete inhibition for A. niger, F. oxysporum, C. albicans and Z. bailii, while A. flavus P. griseofulvum, and P. chrysogenum reduced by 75%, 80.4% and 88.5% respectively. Soaking spores/cells with curcumin solution prior to irradiation did not have a significant effect on the percentage reduction. These observations suggest that a novel photosensitization mediated curcumin treatment is effective against fungal spores/cells and the variation of percentage reduction was dependent on curcumin concentration, light dosage and fungal species. Copyright © 2017 Elsevier B.V. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Pearce, R.J.H.; Andrew, P.; Bryan, S.; Hemmrich, J.L. [JET Joint Undertaking, Abingdon, Oxon (United Kingdom)
1998-07-01
The JET gas baking plant allows the vacuum vessel to be heated for conditioning and plasma operations. The vessel was maintained at 320 deg. C for the JET DT experiments (DTE 1). The design of the plant is outlined with particular reference to the features to provide compatibility with tritium operations. The experience of baking gas activation and tritium permeation into the plant are given, Developmentsto reduce the tritium permeation out of the vessel are considered. (authors)
Energy Technology Data Exchange (ETDEWEB)
NONE
2000-03-01
It is recommended that the Lithuanian Gas Industry considers: (1) To adopt a base temperature (T{sub b}) of 15 deg. C in order to uniform with the European preferable base temperature [cf. clause. 3.1]. (2) To use TC domestic gas meters at outdoor located gas meters and even when the gas meter is located just inside the exterior wall, in order to avoid too large error on the annual volume measured. Such TC meters should comply with EN 1359 clause B.23 (or alternatively the more strictly Danish type approval requirements) [cf. clause 3.2]. (3) To carry out supplementary high pressure calibration on turbine gas meters intended to be used at operating pressures of 3 or 6 bar in order to check if used makes and types are sensible to Reynolds number. If so, it would result in a measuring error at operating pressures higher than as determined by calibration with air at atmospheric pressure [cf. clause 3.3]. Similar tests should be considered for the existing Vortex gas meters. (4) To adopt the Danish legislation on legal metrology on gas meters in absence of a similar Lithuanian one due to its up to date requirements towards the distribution companies [cf. clause 3.4]. The first step towards such adoption would require a draft translation of the Danish legislation, at least into English. (5) To adopt the Danish in sevice inspection programme on domestic gas meters and on larger gas meters and gas measuring systems as well as on in-situ check of gas-volume electronic conversion devices [cf. clause 3.5.2 - 2.5.4]. The first step towards such adoption would require a draft translation of the 3 existing Danish manuals on calibration and in-situ check programmes, at least into English. Another approach would be a visit at HNG by 2-3 people from the Lithuanian Gas Industry in order to get acquainted with the Danish practice on laboratory calibration and in-situ check of gas-volume electronic conversion devices. However, it should be noticed that in-situ check measuring
The regulation of APAF1 expression during development and tumourigenesis
DEFF Research Database (Denmark)
Hickman, E S; Helin, K
2002-01-01
Apoptosis Protease-Activating Factor 1, APAF1, was originally isolated four years ago and shown to be the mammalian homologue of the C. elegans pro-apoptotic ced4 gene. Since then, the expression of APAF1 has been demonstrated to be involved in several cell death pathways, including the induction...
Khan, Muntazim Munir; Shishatskiy, Sergey; Filiz, Volkan
2018-01-02
This work reports on the preparation and gas transport performance of mixed matrix membranes (MMMs) based on the polymer of intrinsic microporosity (PIM-1) and potassium dodecahydrododecaborate (K₂B 12 H 12 ) as inorganic particles (IPs). The effect of IP loading on the gas separation performance of these MMMs was investigated by varying the IP content (2.5, 5, 10 and 20 wt %) in a PIM-1 polymer matrix. The derived MMMs were characterized by scanning electron microscopy (SEM), thermogravimetric analysis (TGA), single gas permeation tests and sorption measurement. The PIM1/K₂B 12 H 12 MMMs show good dispersion of the IPs (from 2.5 to 10 wt %) in the polymer matrix. The gas permeability of PIM1/K₂B 12 H 12 MMMs increases as the loading of IPs increases (up to 10 wt %) without sacrificing permselectivity. The sorption isotherm in PIM-1 and PIM1/K₂B 12 H 12 MMMs demonstrate typical dual-mode sorption behaviors for the gases CO₂ and CH₄.
Synthesis of 1-octacosanol and GC-C-IRMS discrimination of samples from different origin.
Cravotto, Giancarlo; Calcio Gaudino, Emanuela; Barge, Alessandro; Binello, Arianna; Albertino, Andrea; Aghemo, Costanza
2010-03-01
Lately, long-chain primary alcohols have been investigated in depth on account of their biological activities. In particular, 1-octacosanol (C(28)H(57)OH), the main component of policosanol, the hypolipidaemic fatty alcohol mixture obtained from sugar cane wax, has been the subject of a multitude of pharmacological studies. The aim of this work was to search a convenient synthetic protocol for the preparation of 1-octacosanol in a gram scale. The key step was a Wittig reaction between the octadecyltriphenylphosphonium ylide and the methyl 10-oxodecanoate. Some steps were further improved by power ultrasound and microwave irradiation, either alone or in combination. Our methodology is suitable for a rapid generation of homologues by varying the chain length in the alkyl halide. Due to the high commercial value, a series of 1-octacosanol samples, either isolated from natural sources or from synthesis (different origin and suppliers), were analysed by gas chromatography-combustion-isotopic ratio mass spectrometry (GC-C-IRMS) and according to the carbon isotopic content, classified on the basis of their origin.
La Russa, M; Bogen, C; Uhmeyer, A; Doebbe, A; Filippone, E; Kruse, O; Mussgnug, J H
2012-11-30
Photosynthetic organisms like plants and algae can use sunlight to produce lipids as important metabolic compounds. Plant-derived triacylglycerols (TAGs) are valuable for human and animal nutrition because of their high energy content and are becoming increasingly important for the production of renewable biofuels. Acyl-CoA:diacylglycerol acyltransferases (DGATs) have been demonstrated to play an important role in the accumulation of TAG compounds in higher plants. DGAT homologue genes have been identified in the genome of the green alga Chlamydomonas reinhardtii, however their function in vivo is still unknown. In this work, the three most promising type-2 DGAT candidate genes potentially involved in TAG lipid accumulation (CrDGAT2a, b and c) were investigated by constructing overexpression strains. For each of the genes, three strains were identified which showed enhanced mRNA levels of between 1.7 and 29.1 times that of the wild type (wt). Total lipid contents, neutral lipids and fatty acid profiles were determined and showed that an enhanced mRNA expression level of the investigated DGAT genes did not boost the intracellular TAG accumulation or resulted in alterations of the fatty acid profiles compared to wild type during standard growth condition or during nitrogen or sulfur stress conditions. We conclude that biotechnological efforts to enhance cellular TAG amount in microalgae need further insights into the complex network of lipid biosynthesis to identify potential bottlenecks of neutral lipid production. Copyright © 2012 Elsevier B.V. All rights reserved.
Synthesis and Transport Properties of Novel MOF/PIM-1/MOF Sandwich Membranes for Gas Separation
Directory of Open Access Journals (Sweden)
Alessio Fuoco
2017-02-01
Full Text Available Metal-organic frameworks (MOFs were supported on polymer membrane substrates for the fabrication of composite polymer membranes based on unmodified and modified polymer of intrinsic microporosity (PIM-1. Layers of two different MOFs, zeolitic imidazolate framework-8 (ZIF-8 and Copper benzene tricarboxylate ((HKUST-1, were grown onto neat PIM-1, amide surface-modified PIM-1 and hexamethylenediamine (HMDA -modified PIM-1. The surface-grown crystalline MOFs were characterized by a combination of several techniques, including powder X-ray diffraction, infrared spectroscopy and scanning electron microscopy to investigate the film morphology on the neat and modified PIM-1 membranes. The pure gas permeabilities of He, H2, O2, N2, CH4, CO2 were studied to understand the effect of the surface modification on the basic transport properties and evaluate the potential use of these membranes for industrially relevant gas separations. The pure gas transport was discussed in terms of permeability and selectivity, highlighting the effect of the MOF growth on the diffusion coefficients of the gas in the new composite polymer membranes. The results confirm that the growth of MOFs on polymer membranes can enhance the selectivity of the appropriately functionalized PIM-1, without a dramatic decrease of the permeability.
Synthesis and Transport Properties of Novel MOF/PIM-1/MOF Sandwich Membranes for Gas Separation
Fuoco, Alessio; Khdhayyer, Muhanned R.; Attfield, Martin P.; Esposito, Elisa; Jansen, Johannes C.; Budd, Peter M.
2017-01-01
Metal-organic frameworks (MOFs) were supported on polymer membrane substrates for the fabrication of composite polymer membranes based on unmodified and modified polymer of intrinsic microporosity (PIM-1). Layers of two different MOFs, zeolitic imidazolate framework-8 (ZIF-8) and Copper benzene tricarboxylate ((HKUST-1), were grown onto neat PIM-1, amide surface-modified PIM-1 and hexamethylenediamine (HMDA) -modified PIM-1. The surface-grown crystalline MOFs were characterized by a combination of several techniques, including powder X-ray diffraction, infrared spectroscopy and scanning electron microscopy to investigate the film morphology on the neat and modified PIM-1 membranes. The pure gas permeabilities of He, H2, O2, N2, CH4, CO2 were studied to understand the effect of the surface modification on the basic transport properties and evaluate the potential use of these membranes for industrially relevant gas separations. The pure gas transport was discussed in terms of permeability and selectivity, highlighting the effect of the MOF growth on the diffusion coefficients of the gas in the new composite polymer membranes. The results confirm that the growth of MOFs on polymer membranes can enhance the selectivity of the appropriately functionalized PIM-1, without a dramatic decrease of the permeability. PMID:28208658
Menand, Benoit
2002-01-01
TOR (target of rapamycin) protein kinases were identified in yeast, mammals and Drosophila as central controllers of cell growth. Thu, G1 to S phases progression through the cell cycle is blocked by rapamycin, a drug which specifically inhibits TOR activity by forming a ternary complex with the peptidyl-prolyl isomerase FKBP12 (FK506 and rapamycin binding protein), and the FKBP-rapamycin binding domain (FRB) of TOR proteins. This work presents the study, the Arabidopsis homologue of yeast and...
Directory of Open Access Journals (Sweden)
Watanabe Haruo
2005-10-01
Full Text Available Abstract Background It has been speculated that the γ-glutamyl transpeptidase (ggt gene is present only in Neisseria meningitidis and not among related species such as Neisseria gonorrhoeae and Neisseria lactamica, because N. meningitidis is the only bacterium with GGT activity. However, nucleotide sequences highly homologous to the meningococcal ggt gene were found in the genomes of N. gonorrhoeae isolates. Results The gonococcal homologue (ggt gonococcal homologue; ggh was analyzed. The nucleotide sequence of the ggh gene was approximately 95 % identical to that of the meningococcal ggt gene. An open reading frame in the ggh gene was disrupted by an ochre mutation and frameshift mutations induced by a 7-base deletion, but the amino acid sequences deduced from the artificially corrected ggh nucleotide sequences were approximately 97 % identical to that of the meningococcal ggt gene. The analyses of the sequences flanking the ggt and ggh genes revealed that both genes were localized in a common DNA region containing the fbp-ggt (or ggh-glyA-opcA-dedA-abcZ gene cluster. The expression of the ggh RNA could be detected by dot blot, RT-PCR and primer extension analyses. Moreover, the truncated form of ggh-translational product was also found in some of the gonococcal isolates. Conclusion This study has shown that the gonococcal ggh gene is a pseudogene of the meningococcal ggt gene, which can also be designated as Ψggt. The gonococcal ggh (Ψggt gene is the first identified bacterial pseudogene that is transcriptionally active but phenotypically silent.
Surveying the Dense Gas in Barnard 1 and NGC 1333 from Cloud to Core Scales
Storm, Shaye; Mundy, Lee; Teuben, Peter; Lee, Katherine; Fernandez-Lopez, Manuel; Looney, Leslie; Rosolowsky, Erik; Classy Collaboration
2013-07-01
The CARMA Large Area Star formation Survey (CLASSy) is mapping molecular emission across large areas of the nearby Perseus and Serpens Molecular Clouds. With an angular resolution of 7 arcsec, CLASSy probes dense gas on scales from a few thousand AU to parsecs with CARMA-23 and single-dish observations. The resulting maps of N2H+, HCN, and HCO+ J=1-0 trace the kinematics and structure of the high-density gas in regions covering a wide range of intrinsic star formation activity. This poster presents an overview of three completed CLASSy fields, NGC 1333, Barnard 1, and Serpens Main, and then focuses on the dendrogram analysis that CLASSy is using to characterize the emission structure. We have chosen a dendrogram analysis over traditional clump finding because dendrograms better encode the hierarchical nature of cloud structure and better facilitate analysis of cloud properties across the range of size scales probed by CLASSy. We present a new dendrogram methodology that allows for non-binary mergers of kernels, which results in a gas hierarchy that is more true to limitations of the S/N in the data. The resulting trees from Barnard 1 and NGC 1333 are used to derive physical parameters of the identified gas structures, and to probe the kinematic relationship between gas structures at different spatial scales and evolutionary stages. We derive a flat relation between mean internal turbulence and structure size for the dense gas in both regions, but find a difference between the magnitude of the internal turbulence in regions with and without protostars; the dense gas in the B1 main core and NGC 1333 are characterized by mostly transonic to supersonic turbulence, while the B1 filaments and clumps southwest of the main core have mostly subsonic turbulence. These initial results, along with upcoming work analyzing the completed CLASSy observations, will be used to test current theories for star formation in turbulent molecular clouds.
Over-expression of ZmPti1, a homologue to Pti1, increases salt ...
African Journals Online (AJOL)
PRECIOUS
2010-02-01
Feb 1, 2010 ... have not been studied for its roles under salt stress condition. Previous study has ..... expression of a single Ca2+-dependent protein kinase confers both cold and ... Mechanisms of high salinity tolerance in plants. Methods ...
Validating tyrosinase homologue melA as a photoacoustic reporter gene for imaging Escherichia coli
Paproski, Robert J.; Li, Yan; Barber, Quinn; Lewis, John D.; Campbell, Robert E.; Zemp, Roger
2015-10-01
To understand the pathogenic processes for infectious bacteria, appropriate research tools are required for replicating and characterizing infections. Fluorescence and bioluminescence imaging have primarily been used to image infections in animal models, but optical scattering in tissue significantly limits imaging depth and resolution. Photoacoustic imaging, which has improved depth-to-resolution ratio compared to conventional optical imaging, could be useful for visualizing melA-expressing bacteria since melA is a bacterial tyrosinase homologue which produces melanin. Escherichia coli-expressing melA was visibly dark in liquid culture. When melA-expressing bacteria in tubes were imaged with a VisualSonics Vevo LAZR system, the signal-to-noise ratio of a 9× dilution sample was 55, suggesting that ˜20 bacteria cells could be detected with our system. Multispectral (680, 700, 750, 800, 850, and 900 nm) analysis of the photoacoustic signal allowed unmixing of melA-expressing bacteria from blood. To compare photoacoustic reporter gene melA (using Vevo system) with luminescent and fluorescent reporter gene Nano-lantern (using Bruker Xtreme In-Vivo system), tubes of bacteria expressing melA or Nano-lantern were submerged 10 mm in 1% Intralipid, spaced between melA-expressing bacteria even when the tubes were less than 1 mm from each other, while bioluminescence and fluorescence imaging could not resolve the two tubes of Nano-lantern-expressing bacteria even when the tubes were spaced 10 mm from each other. After injecting 100-μL of melA-expressing bacteria in the back flank of a chicken embryo, photoacoustic imaging allowed visualization of melA-expressing bacteria up to 10-mm deep into the embryo. Photoacoustic signal from melA could also be separated from deoxy- and oxy-hemoglobin signal observed within the embryo and chorioallantoic membrane. Our results suggest that melA is a useful photoacoustic reporter gene for visualizing bacteria, and further work
Western Gas Sands Project. Status report, 1 June--30 June 1979
Energy Technology Data Exchange (ETDEWEB)
1979-01-01
This edition of the WGSP status report summarizes June 1979 progress of government-sponsored projects directed toward increasing gas production from the low-permeability gas sands of the western United States. Background information is provided in the September 1977, status report, NVO/0655-100. Work by the USGS toward resource assessment in the four primary study areas continued. CK GeoEnergy started a core hole in Grand County, Utah. During June, projects of the National Laboratories and Energy Technology Centers continued. Bartlesville Energy Technology Center continued work on fracture conductivity, rock-fluid interaction, and log evaluation and interpretation techniques. Experimental and theoretical work on hydraulic fracturing mechanics and analysis of well test data continued at Lawrence Livermore Laboratory. The CER Corporation RB-MHF 3 final report has been distributed. Cyclic gas injection began again on CIG's Sprague No. 1 well. The DOE well test facility was transported to Vernal, Utah for minor repairs and storage. The GPE wells, Natural Buttes Units 9, 14 and 18 flowed to sales. The Mitchell Energy Muse-Duke No. 1 well flowed 3,000 MCFD in June. Attempts to kill the Mobil PCU F31-13G well failed. Exploratory coring of the Sandia Hole No. 6 Formation Interface Fracture Experiment resumed in June.
Evidence of an association between genetic variation of the coactivator PGC-1beta and obesity
DEFF Research Database (Denmark)
Andersen, G; Wegner, L; Yanagisawa, K
2005-01-01
Peroxisome proliferator activated receptor-gamma coactivator-1beta (PGC-1beta) is a recently identified homologue of the tissue specific coactivator PGC-1alpha, a coactivator of transcription factors such as the peroxisome proliferators activated receptors and nuclear respiratory factors. PGC-1...
DEFF Research Database (Denmark)
Koch, Birgit; Nybroe, Ole
2006-01-01
A expression. The mutant grew slower than the wild-type strain in minimal medium with L-serine as the sole nitrogen source, while growth rates were similar on a mixture of L-serine and L-cysteine. Reverse transcriptase polymerase chain reaction analysis indicated that the bolA homologue is the second gene...
Electricity and gas market observatory. 1. quarter 2006
International Nuclear Information System (INIS)
2006-01-01
Since July 2004, all electricity and gas consumers can be eligible according to their consumption site, as long as all or part of the electricity or gas consumed is designed for non-residential use. The purpose of the observatory is to provide the general public with indicators for monitoring market deregulation. It both covers the wholesale and retail electricity and gas markets in Metropolitan France. This observatory is updated every three months and data are available on CRE web site (www.cre.fr). It completes the information already published by CRE: practical information for eligible customers: consumer guide, list of suppliers, communications regarding markets running, CRE annual activity report. (author)
Electricity and gas market observatory. 1. 2005 quarter
International Nuclear Information System (INIS)
2005-01-01
Since July 2004, all electricity and gas consumers can be eligible according to their consumption site, as long as all or part of the electricity or gas consumed is designed for non-residential use. The purpose of the observatory is to provide the general public with indicators for monitoring market deregulation. It both covers the wholesale and retail electricity and gas markets in Metropolitan France. This observatory is updated every three months and data are available on CRE web site (www.cre.fr). It completes the information already published by CRE: practical information for eligible customers: consumer guide, list of suppliers, communications regarding markets running, CRE annual activity report. (author)
Energy Technology Data Exchange (ETDEWEB)
Dolinski, U [Deutsches Inst. fuer Wirtschaftsforschung, Berlin (Germany, F.R.). Abt. Bergbau und Energie
1978-01-01
Since the oil crisis the buyers's market started to change to a seller's market as a result of the worldwide rising demand for natural gas. This development will be amplified with the increasing significance and volume of LNG trade. This depends upon the availability of handling and tanker capacities. It is considered that technical solutions are available. The internationalisation of the world natural gas market imposes changes in terms of trade for the Federal Republic of Germany. In the sixties, terms of trade made under sales considerations presented no problems. But gas buyers today are forced to accept sellers' terms looking for the buyer offering the highest prices and other sales advantages. The world gas market has assumed the features of a polypolistic market. The security of supply is not a matter of adequate reserves, but almost entirely that of terms of contract on which the natural gas supply can be ensured. It is thereby decisive, whether it will be possible in future to procure the required amount of gas at such terms that it can be sold on the German energy market at competetive rates.
Characterization of a novel organic solute transporter homologue from Clonorchis sinensis.
Directory of Open Access Journals (Sweden)
Yanyan Lu
2018-04-01
Full Text Available Clonorchis sinensis is a liver fluke that can dwell in the bile ducts of mammals. Bile acid transporters function to maintain the homeostasis of bile acids in C. sinensis, as they induce physiological changes or have harmful effects on C. sinensis survival. The organic solute transporter (OST transports mainly bile acid and belongs to the SLC51 subfamily of solute carrier transporters. OST plays a critical role in the recirculation of bile acids in higher animals. In this study, we cloned full-length cDNA of the 480-amino acid OST from C. sinensis (CsOST. Genomic analysis revealed 11 exons and nine introns. The CsOST protein had a 'Solute_trans_a' domain with 67% homology to Schistosoma japonicum OST. For further analysis, the CsOST protein sequence was split into the ordered domain (CsOST-N at the N-terminus and disordered domain (CsOST-C at the C-terminus. The tertiary structure of each domain was built using a threading-based method and determined by manual comparison. In a phylogenetic tree, the CsOST-N domain belonged to the OSTα and CsOST-C to the OSTβ clade. These two domains were more highly conserved with the OST α- and β-subunits at the structure level than at sequence level. These findings suggested that CsOST comprised the OST α- and β-subunits. CsOST was localized in the oral and ventral suckers and in the mesenchymal tissues abundant around the intestine, vitelline glands, uterus, and testes. This study provides fundamental data for the further understanding of homologues in other flukes.
Characterization of a novel organic solute transporter homologue from Clonorchis sinensis
Dai, Fuhong; Lee, Ji-Yun; Pak, Jhang Ho; Sohn, Woon-Mok
2018-01-01
Clonorchis sinensis is a liver fluke that can dwell in the bile ducts of mammals. Bile acid transporters function to maintain the homeostasis of bile acids in C. sinensis, as they induce physiological changes or have harmful effects on C. sinensis survival. The organic solute transporter (OST) transports mainly bile acid and belongs to the SLC51 subfamily of solute carrier transporters. OST plays a critical role in the recirculation of bile acids in higher animals. In this study, we cloned full-length cDNA of the 480-amino acid OST from C. sinensis (CsOST). Genomic analysis revealed 11 exons and nine introns. The CsOST protein had a ‘Solute_trans_a’ domain with 67% homology to Schistosoma japonicum OST. For further analysis, the CsOST protein sequence was split into the ordered domain (CsOST-N) at the N-terminus and disordered domain (CsOST-C) at the C-terminus. The tertiary structure of each domain was built using a threading-based method and determined by manual comparison. In a phylogenetic tree, the CsOST-N domain belonged to the OSTα and CsOST-C to the OSTβ clade. These two domains were more highly conserved with the OST α- and β-subunits at the structure level than at sequence level. These findings suggested that CsOST comprised the OST α- and β-subunits. CsOST was localized in the oral and ventral suckers and in the mesenchymal tissues abundant around the intestine, vitelline glands, uterus, and testes. This study provides fundamental data for the further understanding of homologues in other flukes. PMID:29702646
Some studies on tar pillets at Veraval coast (Gujarat)
Digital Repository Service at National Institute of Oceanography (India)
Kadam, A.N.
Infrared spectroscopic (IR) analysis indicated that the tar pillets contain saturated hydrocarbons particularly higher homologues of n-paraffins, unsaturated and carbonyl type of polar compounds. Gas chromatographic (GLC) fingerprint pattern...
Worcester 1 Inch Solenoid-Actuated Gas-Operated VPS System Ball Valve
International Nuclear Information System (INIS)
VAN KATWIJK, C.
2000-01-01
1 inch Gas-operated full-port ball valve incorporates a solenoid and limit switches as integral parts of the actuator. The valve is normally open and fails safe to the closed position. The associated valve position switch is class GS
State and trends of ionization gas analysis. 1
International Nuclear Information System (INIS)
Leonhardt, J.W.; Grosse, H.J.; Popp, P.
1980-01-01
The ionization gas analysis makes use of the fact that the ionization-induced conductivity of gases and gas mixtures changes with the composition of such mixtures. A general description is given of ionization detectors based on this principle and theory, properties, and main fields of application of electron capture detectors are discussed
Edge profiles in K shell photoabsorption spectra of gaseous hydrides of 3p elements and homologues
Hauko, R.; Gomilšek, J. Padežnik; Kodre, A.; Arčon, I.; Aquilanti, G.
2017-10-01
Photoabsorption spectra of gaseous hydrides of 3p elements (PH3, H2S, HCl) are measured in the energy region of photoexcitations pertaining to K edge. The analysis of the edge profile is extended to hydrides of 4p series (GeH4, AsH3, H2Se, HBr) from an earlier experiment, and to published spectra of 2p hydrides (CH4, NH3, H2O, HF) and noble gases Ar, Kr and Ne and SiH4. The edge profiles are modelled with a linear combination of lorentzian components, describing excitations to individual bound states and to continuum. Transition energies and probabilities are also calculated in the non-relativistic molecular model of the ORCA code, in good agreement with the experiment. Edge profiles in the heavier homologues are closely similar, the symmetry of the molecule governs the transitions to the lowest unoccupied orbitals. In 2p series the effect of the strong nuclear potential prevails. Transitions to higher, atomic-like levels remain very much the same as in free atoms.
Structure of a thermostable serralysin from Serratia sp. FS14 at 1.1 Å resolution.
Wu, Dongxia; Ran, Tinting; Wang, Weiwu; Xu, Dongqing
2016-01-01
Serralysin is a well studied metalloprotease, and typical serralysins are not thermostable. The serralysin isolated from Serratia sp. FS14 was found to be thermostable, and in order to reveal the mechanism responsible for its thermostability, the crystal structure of serralysin from Serratia sp. FS14 was solved to a crystallographic R factor of 0.1619 at 1.10 Å resolution. Similar to its homologues, it mainly consists of two domains: an N-terminal catalytic domain and a `parallel β-roll' C-terminal domain. Comparative studies show that the shape of the catalytic active-site cavity is more open owing to the 189-198 loop, with a short 310-helix protruding further from the molecular surface, and that the β-sheets comprising the `parallel β-roll' are longer than those in its homologues. The formation of hydrogen bonds from one of the nonconserved residues (Asn200) to Lys27 may contribute to the thermostability.
Effectiveness of chitosan against wine-related microorganisms.
Bağder Elmaci, Simel; Gülgör, Gökşen; Tokatli, Mehmet; Erten, Hüseyin; İşci, Asli; Özçelik, Filiz
2015-03-01
The antimicrobial action of chitosan against wine related microorganisms, including Lactobacillus plantarum, Saccharomyces cerevisiae, Oeonococcus oeni, Lactobacillus hilgardii, Brettanomyces bruxellensis, Hanseniaspora uvarum and Zygosaccharomyces bailii was examined in laboratory media. In order to assess the potential applicability of chitosan as a microbial control agent for wine, the effect of chitosan, applied individually and/or in combination with sulphur dioxide (SO2), on the growth of microorganisms involved in various stages of winemaking and on the fermentative performance of S. cerevisiae was investigated. Of the seven wine-related microorganisms studied, S. cerevisiae exhibited the strongest resistance to antimicrobial action of chitosan in laboratory media with a minimum inhibitory concentration (MIC) greater than 2 g/L. L. hilgardii, O. oeni and B. bruxellensis were the most susceptible to chitosan since they were completely inactivated by chitosan at 0.2 g/L. The MIC of chitosan for L. plantarum, H. uvarum and Z. bailii was 2, 0.4 and 0.4 g/L, respectively. In wine experiments, it was found that chitosan had a retarding effect on alcoholic fermentation without significantly altering the viability and the fermentative performance of S. cerevisiae. With regard to non-Saccharomyces yeasts (H. uvarum and Z. bailii) involved in winemaking, the early deaths of these yeasts in mixed cultures with S. cerevisiae were not probably due to the antimicrobial action of chitosan but rather due to ethanol produced by the yeasts. The complex interactions between chitosan and wine ingredients as well as microbial interactions during wine fermentation considerably affect the efficacy of chitosan. It was concluded that chitosan was worthy of further investigation as an alternative or complementary preservative to SO2 in wine industry.
Green gas. Gas of natural gas quality from biomass. Update of the 2004 study
International Nuclear Information System (INIS)
Welink, Jan-Henk; Dumont, M.; Kwant, K.
2007-01-01
In 2004 a study was published on green gas. Green gas is defined as a gaseous energy carrier from renewable biomass with a similar quality as natural gas. As a result of new developments in the field of co-digestion/fermentation the Dutch Ministry of Economic Affairs asked it's agency SenterNovem to update the 2004 study. The aim of the update is (1) to gain insight into operational aspects of green gas projects, e.g. reliability, efficiency and maintenance aspects; (2) stimulate the production of green gas, taking into account the economics of green gas projects, calculation of the financial gap of green gas production, efficient use of biogas (conversion to electricity or directly input into the natural gas distribution systems, and aspects with regard to commercialization and the market; and (3) the potential of green gas [nl
International Nuclear Information System (INIS)
Haas, C.
1990-05-01
The characteristics of electric heat pumps are described. Options are defined and assessed for utilizing gas heating in conjunction with existing residential electric heat pumps. These options include gas heat introduced into the refrigeration circuit, a flue gas-heated tube bank in the air supply duct, and a hot-water-to-air coil in the supply duct. Economics are presented for conversion of a residence's total space and water heating from electric to gas in New York City and Atlanta. Potential marketing strategies are discussed, and potential gas sales volumes from conversions are estimated. The study concludes that the use of gas water heating coupled with a hydronic coil in the supply ductwork from the air handler is the most advantageous option for the gas industry
Directory of Open Access Journals (Sweden)
E Wyroba
2009-08-01
Full Text Available Phagosome maturation is a complex process enabling degradation of internalised particles. Our data obtained at the gene, protein and cellular level indicate that the set of components involved in this process and known up to now in mammalian cells is functioning in unicellular eukaryote. Rab7-interacting partners: homologues of its effector RILP (Rab-interacting lysosomal protein and LAMP-2 (lysosomal membrane protein 2 as well as a7 subunit of the 26S proteasome were revealed in Paramecium phagolysosomal compartment. We identified the gene/transcript fragments encoding RILP-related proteins (RILP1 and RILP2 in Paramecium by PCR/RT-PCR and sequencing. The deduced amino acid sequences of RILP1 and RILP2 show 60.5% and 58.3% similarity, respectively, to the region involved in regulating of lysosomal morphology and dynein-dynactin recruitment of human RILP. RILP colocalised with Rab7 in Paramecium lysosomes and at phagolysosomal membrane during phagocytosis of both the latex beads and bacteria. In the same compartment LAMP-2 was present and its expression during latex internalisation was 2.5-fold higher than in the control when P2 protein fractions (100 000 x g of equal load were quantified by immunoblotting. LAMP-2 crossreacting polypeptide of ~106 kDa was glycosylated as shown by fluorescent and Western analysis of the same blot preceded by PNGase F treatment. The a7 subunit of 26S proteasome was detected close to the phagosomal membrane in the small vesicles, in some of which it colocalised with Rab7. Immunoblotting confirmed presence of RILPrelated polypeptide and a7 subunit of 26S proteasome in Paramecium protein fractions. These results suggest that Rab7, RILP and LAMP-2 may be involved in phagosome maturation in Paramecium.
Institute of Scientific and Technical Information of China (English)
傅玉才; 章家新; 郑晓虹; 刘红
2004-01-01
Objective To clone and characterize a Racl homologue from Trichomonas vaginalis for studying cell cycle of the organism. Methods A cDNA library derived from T. vaginalis mRNA was constructed into λ TriplEx2 phage vector. An expression sequence tag program was launched. Sequences of cDNA clones were analyzed using NCBI BLAST algorithms, and ClustalW and Treeview programs. Results A cDNA clone with a length of 714 base pairs was isolated. The sequence analysis showed that the cDNA clone has an open reading frame with 600 bp. The deduced amino acid sequence from the open reading frame contains 200 residuals and is most homologous to Rac1 subfamily of Rho GTPases with > 60% identity. The conserved sequence elements of Rho GTPases, such as GTP-binding sites, GTPase-activating protein (GAP) interaction motifs, GTP-dissociation inhibitors (GDI) interaction motifs, guanine nucleotide exchange factor (GEF) interaction elements, etc, were detected in the amino acid sequence. The phylogenetic analysis showed that the cDNA clone is grouped in the Rac subfamily and is more closely related to Rac1 proteins of protozoa. Conclusion The cDNA clone isolated belongs to Rac subfamily of Rho GTPases and is probably a Rac1 protein of T. vaginalis.%目的获得阴道毛滴虫Rac1蛋白的cDNA克隆,研究其在细胞周期中的调解作用.方法提取阴道毛滴虫总RNA,构建cDNA表达文库,随机分离cDNA克隆并测序.用在线生物分析软件NCBI BLAST、ClustalW以及Treeview等程序进行序列分析.结果获得一株有714 bp的cDNA克隆.序列分析表明,该克隆开放阅读框具600 bp,推测肽链具200个氨基酸.该肽链与Rho家族中Rac1鸟苷三磷酸(GTP)酶同源性最高(>60%),并具多种Rho GTP酶的保守基序,如GTP结合部位、GTP酶激活蛋白作用基序、GTP分离抑制因子作用基序、鸟嘌呤核苷酸交换因子作用基序等.进化树分析显示该克隆属于Rac亚家族GTP酶,与原虫Rac1蛋白最接近.结论该克隆
Energy Technology Data Exchange (ETDEWEB)
Shimamura, Mai; Kyotani, Akane [Department of Applied Biology, Kyoto Institute of Technology, Matsugasaki, Sakyo-ku, Kyoto 606-8585 (Japan); Insect Biomedical Research Center, Kyoto Institute of Technology, Matsugasaki, Sakyo-ku, Kyoto 606-8585 (Japan); Azuma, Yumiko [Department of Neurology, Kyoto Prefectural University of Medicine, 465 Kajii-cho,Kamigyo-ku, Kyoto 602-8566 (Japan); Yoshida, Hideki; Binh Nguyen, Thanh [Department of Applied Biology, Kyoto Institute of Technology, Matsugasaki, Sakyo-ku, Kyoto 606-8585 (Japan); Insect Biomedical Research Center, Kyoto Institute of Technology, Matsugasaki, Sakyo-ku, Kyoto 606-8585 (Japan); Mizuta, Ikuko; Yoshida, Tomokatsu; Mizuno, Toshiki [Department of Neurology, Kyoto Prefectural University of Medicine, 465 Kajii-cho,Kamigyo-ku, Kyoto 602-8566 (Japan); Nakagawa, Masanori [North Medical Center, Kyoto Prefectural University of Medicine, 465 Kajii-cho, Kamigyo-ku, Kyoto 602-8566 (Japan); Tokuda, Takahiko, E-mail: ttokuda@koto.kpu-m.ac.jp [Department of Neurology, Kyoto Prefectural University of Medicine, 465 Kajii-cho,Kamigyo-ku, Kyoto 602-8566 (Japan); Department of Molecular Pathobiology of Brain Diseases, Graduate School of Medical Science, Kyoto Prefectural University of Medicine, 465 Kajii-cho, Kamigyo-ku, Kyoto 602-8566 (Japan); Yamaguchi, Masamitsu, E-mail: myamaguc@kit.ac.jp [Department of Applied Biology, Kyoto Institute of Technology, Matsugasaki, Sakyo-ku, Kyoto 606-8585 (Japan); Insect Biomedical Research Center, Kyoto Institute of Technology, Matsugasaki, Sakyo-ku, Kyoto 606-8585 (Japan)
2014-08-01
Amyotrophic Lateral Sclerosis (ALS) is a fatal neurodegenerative disease that causes progressive muscular weakness. Fused in Sarcoma (FUS) that has been identified in familial ALS is an RNA binding protein that is normally localized in the nucleus. However, its function in vivo is not fully understood. Drosophila has Cabeza (Caz) as a FUS homologue and specific knockdown of Caz in the eye imaginal disc and pupal retina using a GMR-GAL4 driver was here found to induce an abnormal morphology of the adult compound eyes, a rough eye phenotype. This was partially suppressed by expression of the apoptosis inhibitor P35. Knockdown of Caz exerted no apparent effect on differentiation of photoreceptor cells. However, immunostaining with an antibody to Cut that marks cone cells revealed fusion of these and ommatidia of pupal retinae. These results indicate that Caz knockdown induces apoptosis and also inhibits differentiation of cone cells, resulting in abnormal eye morphology in adults. Mutation in EGFR pathway-related genes, such as rhomboid-1, rhomboid-3 and mirror suppressed the rough eye phenotype induced by Caz knockdown. Moreover, the rhomboid-1 mutation rescued the fusion of cone cells and ommatidia observed in Caz knockdown flies. The results suggest that Caz negatively regulates the EGFR signaling pathway required for determination of cone cell fate in Drosophila. - Highlights: • Knockdown of Cabeza induced rough eye phenotype. • Knockdown of Cabeza induced fusion of cone cells in pupal retinae. • Knockdown of Cabeza induced apoptosis in pupal retinae. • Mutation in EGFR pathway-related genes suppressed the rough eye phenotype. • Cabeza may negatively regulate the EGFR pathway.
6.1 Greenhouse gas emissions and climate change
International Nuclear Information System (INIS)
2004-01-01
In Austria, greenhouse gas emissions (GHG) have increased by about 10 % between 1990 and 2001. This means that already in 2001 the emissions reached the level projected with current measures for 2010. Thus Austria is far from complying with the 13 % reduction required under the Kyoto Protocol, meaning that GHG emissions will have to be reduce annually by 1.4 million tons of CO 2 -equivalents to fulfill its protocol obligation. It is shown that 2001 GHG emissions had increased by 9.6 % since the base year 1990, the main reason for this increase is the growing use of fossil fuels and the resulting increase in CO 2 emissions. The highest growth rates can be observed in the transport sector by almost half (+ 49 %). Basically, greenhouse gas emission trends depend on a number of factors, about two thirds of them are caused by energy production, so the most important parameters affecting GHG are the trends of energy consumption, the energy mix and the following factors: population growth, economic growth, outdoor temperature and the resulting heating requirements, improvement of energy efficiency, the proportion of renewable energy sources such as electricity generation in hydroelectric power stations (which influences the need for supplementary power production in thermal power plants), the mix of fossil fuels, for example in caloric power plants (natural gas combustion produces about 40 % less CO 2 per energy unit than coal combustion), the structure and price effects of energy market liberalization, which influence the use of various fuels in electricity production and the import of electricity, world market prices for energy, structural changes in the economy and in the behavior of consumers. Changes in important driving forces and in GHG emissions, sector emissions trends and Austrian, European and global emissions projections are provided. (nevyjel)
DEFF Research Database (Denmark)
Kurokawa, Yusuke; Nagai, Keisuke; Hung, Phung Danh
2018-01-01
Floods impede gas (O2and CO2) exchange between plants and the environment. A mechanism to enhance plant gas exchange under water comprises gas films on hydrophobic leaves, but the genetic regulation of this mechanism is unknown. We used a rice mutant (dripping wet leaf 7, drp7) which does...... not retain gas films on leaves, and its wild-type (Kinmaze), in gene discovery for this trait. Gene complementation was tested in transgenic lines. Functional properties of leaves as related to gas film retention and underwater photosynthesis were evaluated. Leaf Gas Film 1 (LGF1) was identified as the gene...... determining leaf gas films. LGF1 regulates C30 primary alcohol synthesis, which is necessary for abundant epicuticular wax platelets, leaf hydrophobicity and gas films on submerged leaves. This trait enhanced underwater photosynthesis 8.2-fold and contributes to submergence tolerance. Gene function...
Lorenson, Thomas; Collett, Timothy S.
2018-01-01
The National Gas Hydrate Program Expedition 01 (NGHP-01) targeted gas hydrate accumulations offshore of the Indian Peninsula and along the Andaman convergent margin. The primary objectives of coring were to understand the geologic and geochemical controls on the accumulation of methane hydrate and their linkages to underlying petroleum systems. Four areas were investigated: 1) the Kerala-Konkan Basin in the eastern Arabian Sea, 2) the Mahanadi and 3) Krishna-Godavari Basins in the western Bay of Bengal, and 4) the Andaman forearc Basin in the Andaman Sea.Upward flux of methane at three of the four of the sites cored during NGHP-01 is apparent from the presence of seafloor mounds, seismic evidence for upward gas migration, shallow sub-seafloor geochemical evidence of methane oxidation, and near-seafloor gas composition that resembles gas from depth.The Kerala-Konkan Basin well contained only CO2 with no detectable hydrocarbons suggesting there is no gas hydrate system here. Gas and gas hydrate from the Krishna-Godavari Basin is mainly microbial methane with δ13C values ranging from −58.9 to −78.9‰, with small contributions from microbial ethane (−52.1‰) and CO2. Gas from the Mahanadi Basin was mainly methane with lower concentrations of C2-C5 hydrocarbons (C1/C2 ratios typically >1000) and CO2. Carbon isotopic compositions that ranged from −70.7 to −86.6‰ for methane and −62.9 to −63.7‰ for ethane are consistent with a microbial gas source; however deeper cores contained higher molecular weight hydrocarbon gases suggesting a small contribution from a thermogenic gas source. Gas composition in the Andaman Basin was mainly methane with lower concentrations of ethane to isopentane and CO2, C1/C2 ratios were mainly >1000 although deeper samples were compositions range from −65.2 to −80.7‰ for methane, −53.1 to −55.2‰ for ethane is consistent with mainly microbial gas sources, although one value recorded of −35.4‰ for propane
Sequence of a cDNA encoding turtle high mobility group 1 protein.
Zheng, Jifang; Hu, Bi; Wu, Duansheng
2005-07-01
In order to understand sequence information about turtle HMG1 gene, a cDNA encoding HMG1 protein of the Chinese soft-shell turtle (Pelodiscus sinensis) was amplified by RT-PCR from kidney total RNA, and was cloned, sequenced and analyzed. The results revealed that the open reading frame (ORF) of turtle HMG1 cDNA is 606 bp long. The ORF codifies 202 amino acid residues, from which two DNA-binding domains and one polyacidic region are derived. The DNA-binding domains share higher amino acid identity with homologues sequences of chicken (96.5%) and mammalian (74%) than homologues sequence of rainbow trout (67%). The polyacidic region shows 84.6% amino acid homology with the equivalent region of chicken HMG1 cDNA. Turtle HMG1 protein contains 3 Cys residues located at completely conserved positions. Conservation in sequence and structure suggests that the functions of turtle HMG1 cDNA may be highly conserved during evolution. To our knowledge, this is the first report of HMG1 cDNA sequence in any reptilian.
Splicing factor 1 modulates dietary restriction and TORC1 pathway longevity in C. elegans
DEFF Research Database (Denmark)
Heintz, Caroline; Doktor, Thomas K; Lanjuin, Anne
2017-01-01
via splicing factor 1 (SFA-1; the C. elegans homologue of SF1, also known as branchpoint binding protein, BBP). We show that SFA-1 is specifically required for lifespan extension by dietary restriction and by modulation of the TORC1 pathway components AMPK, RAGA-1 and RSKS-1/S6 kinase. We also...... homeostasis is a biomarker and predictor of life expectancy in Caenorhabditis elegans. Using transcriptomics and in-depth splicing analysis in young and old animals fed ad libitum or subjected to dietary restriction, we find defects in global pre-mRNA splicing with age that are reduced by dietary restriction...
International Nuclear Information System (INIS)
Tanai, Kenji; Fujita, Tomoo; Noda, Masaru; Yamamoto, Shuichi; Shimura, Tomoyuki; Sato, Shin
2013-01-01
Japan Atomic Energy Agency has been planning in-situ gas migration test in Horonobe URL, Hokkaido. This paper discusses the optimum gas injection procedure for the test to understand gas migration behaviour in surrounded rock. The stepwise constant gas injection was selected, taking into account domestic and overseas gas related research results. Hydro-mechanical-gas coupling analysis which is able to consider the dissolved methane in Horonobe groundwater was applied to evaluate the gas behaviour. The results have indicated no significant mechanical damages to the rock and have supported the appropriateness of selected gas injection procedure for the test. (author)
Lorenson, Thomas; Collett, Timothy S.
2018-01-01
The National Gas Hydrate Program Expedition 01 (NGHP-01) targeted gas hydrate accumulations offshore of the Indian Peninsula and along the Andaman convergent margin. The primary objectives of coring were to understand the geologic and geochemical controls on the accumulation of methane hydrate and their linkages to underlying petroleum systems. Four areas were investigated: 1) the Kerala-Konkan Basin in the eastern Arabian Sea, 2) the Mahanadi and 3) Krishna-Godavari Basins in the western Bay of Bengal, and 4) the Andaman forearc Basin in the Andaman Sea.Upward flux of methane at three of the four of the sites cored during NGHP-01 is apparent from the presence of seafloor mounds, seismic evidence for upward gas migration, shallow sub-seafloor geochemical evidence of methane oxidation, and near-seafloor gas composition that resembles gas from depth.The Kerala-Konkan Basin well contained only CO2 with no detectable hydrocarbons suggesting there is no gas hydrate system here. Gas and gas hydrate from the Krishna-Godavari Basin is mainly microbial methane with δ13C values ranging from −58.9 to −78.9‰, with small contributions from microbial ethane (−52.1‰) and CO2. Gas from the Mahanadi Basin was mainly methane with lower concentrations of C2-C5 hydrocarbons (C1/C2 ratios typically >1000) and CO2. Carbon isotopic compositions that ranged from −70.7 to −86.6‰ for methane and −62.9 to −63.7‰ for ethane are consistent with a microbial gas source; however deeper cores contained higher molecular weight hydrocarbon gases suggesting a small contribution from a thermogenic gas source. Gas composition in the Andaman Basin was mainly methane with lower concentrations of ethane to isopentane and CO2, C1/C2 ratios were mainly >1000 although deeper samples were exploration and occurs in a forearc basin. Each of these hydrate-bearing systems overlies and is likely supported by the presence and possible migration of gas from deeper gas-prone petroleum
International Nuclear Information System (INIS)
Tacconi, L. J.; Genzel, R.; Wuyts, S.; Förster Schreiber, N. M.; Gracia-Carpio, J.; Lutz, D.; Saintonge, A.; Neri, R.; Cox, P.; Combes, F.; Bolatto, A.; Cooper, M. C.; Bournaud, F.; Burkert, A.; Comerford, J.; Davis, M.; Newman, S.; García-Burillo, S.; Naab, T.; Omont, A.
2013-01-01
We present PHIBSS, the IRAM Plateau de Bure high-z blue sequence CO 3-2 survey of the molecular gas properties in massive, main-sequence star-forming galaxies (SFGs) near the cosmic star formation peak. PHIBSS provides 52 CO detections in two redshift slices at z ∼ 1.2 and 2.2, with log(M * (M ☉ )) ≥ 10.4 and log(SFR(M ☉ /yr)) ≥ 1.5. Including a correction for the incomplete coverage of the M * -SFR plane, and adopting a ''Galactic'' value for the CO-H 2 conversion factor, we infer average gas fractions of ∼0.33 at z ∼ 1.2 and ∼0.47 at z ∼ 2.2. Gas fractions drop with stellar mass, in agreement with cosmological simulations including strong star formation feedback. Most of the z ∼ 1-3 SFGs are rotationally supported turbulent disks. The sizes of CO and UV/optical emission are comparable. The molecular-gas-star-formation relation for the z = 1-3 SFGs is near-linear, with a ∼0.7 Gyr gas depletion timescale; changes in depletion time are only a secondary effect. Since this timescale is much less than the Hubble time in all SFGs between z ∼ 0 and 2, fresh gas must be supplied with a fairly high duty cycle over several billion years. At given z and M * , gas fractions correlate strongly with the specific star formation rate (sSFR). The variation of sSFR between z ∼ 0 and 3 is mainly controlled by the fraction of baryonic mass that resides in cold gas.
Gas pricing in Europe. Pt. 1. Wholesale markets
International Nuclear Information System (INIS)
Donath, R.
1996-01-01
The article investigates gas pricing in the European procurement market and the wholesale markets of the most important EU consumer markets. It demonstrates that value-oriented pricing principles override cost-oriented pricing principles. For one thing, and independently of pricing principles, two- or three-part demand price systems or basic price systems are common. For another, the frequently encountered opportunities for the differentiation of prices show that as long as there is merely substitution competition instead of direct competition, gas suppliers have a certain degree of freedom in fixing their prices. By contrast, the introduction of direct competition in Great Britain has reduced suppliers' individual price fixing margins, because short-term supply and demand variations in the now created spot market are decisive for gas pricing. (orig.) [de
Sheng, Jian-Xiong; Jacob, Daniel J.; Maasakkers, Joannes D.; Sulprizio, Melissa P.; Zavala-Araiza, Daniel; Hamburg, Steven P.
2017-06-01
Canada and Mexico have large but uncertain methane emissions from the oil/gas industry. Inverse analyses of atmospheric methane observations can improve emission estimates but require accurate source patterns as prior information. In order to serve this need, we develop a 0.1° × 0.1° gridded inventory of oil/gas emissions in Canada for 2013 and Mexico for 2010 by disaggregating national emission inventories using best available data for production, processing, transmission, and distribution. Results show large differences with the EDGAR v4.2 gridded global inventory used in past inverse analyses. Canadian emissions are concentrated in Alberta (gas production and processing) and Mexican emissions are concentrated along the east coast (oil production).
Gupta, Atul K.; Seneviratne, J. M.; Joshi, G. K.; Kumar, Anil
2012-01-01
Signaling pathways that activate different mitogen-activated protein kinases (MAPKs) in response to certain environmental conditions, play important role in mating type switching (Fus3) and pathogenicity (Pmk1) in many fungi. In order to determine the roles of such regulatory genes in Tilletia indica, the causal pathogen of Karnal bunt (KB) of wheat, semi-quantitative and quantitative RT-PCR was carried out to isolate and determine the expression of MAP kinase homologues during fungal growth and development under in vitro culture. Maximum expression of TiFus3 and TiPmk1 genes were observed at 14th and 21st days of culture and decreased thereafter. To investigate whether the fungus alters the expression levels of same kinases upon interaction with plants, cultures were treated with 1% of host factors (extracted from S-2 stage of wheat spikes). Such treatment induced the expression of MAPks in time dependent manner compared to the absence of host factors. These results suggest that host factor(s) provide certain signal(s) which activate TiFus3 and TiPmk1 during morphogenetic development of T. indica. The results also provides a clue about the role of host factors in enhancing the disease potential due to induction of MAP kinases involved in fungal development and pathogenecity. PMID:22547988
Sarcocystis neurona is the most frequent cause of Equine Protozoal Myeloencephalitis (EPM), a debilitating neurologic disease of horses that can be difficult to treat. We identified SnCDPK1, the S. neurona homologue of calcium dependent protein kinase 1 (CDPK1), a validated drug target in Toxoplasma...
Overexpression of the essential Sis1 chaperone reduces TDP-43 effects on toxicity and proteolysis
Park, Sei-Kyoung; Hong, Joo Y.; Arslan, Fatih; Tietsort, Alex; Tank, Elizabeth M. H.; Li, Xingli
2017-01-01
Amyotrophic lateral sclerosis (ALS) is a devastating neurodegenerative disease characterized by selective loss of motor neurons with inclusions frequently containing the RNA/DNA binding protein TDP-43. Using a yeast model of ALS exhibiting TDP-43 dependent toxicity, we now show that TDP-43 overexpression dramatically alters cell shape and reduces ubiquitin dependent proteolysis of a reporter construct. Furthermore, we show that an excess of the Hsp40 chaperone, Sis1, reduced TDP-43’s effect on toxicity, cell shape and proteolysis. The strength of these effects was influenced by the presence of the endogenous yeast prion, [PIN+]. Although overexpression of Sis1 altered the TDP-43 aggregation pattern, we did not detect physical association of Sis1 with TDP-43, suggesting the possibility of indirect effects on TDP-43 aggregation. Furthermore, overexpression of the mammalian Sis1 homologue, DNAJB1, relieves TDP-43 mediated toxicity in primary rodent cortical neurons, suggesting that Sis1 and its homologues may have neuroprotective effects in ALS. PMID:28531192
Energy Technology Data Exchange (ETDEWEB)
Colt, John; Bouck, Gerald R.; Fidler, Larry
1986-12-01
This report presents recently published information and on-going research on the various areas of gas supersaturation. Growing interest in the effects of chronic gas supersaturation on aquatic animals has been due primarily to heavy mortality of salmonid species under hatchery conditions. Extensive examination of affected animals has failed to consistently identify pathogenic organisms. Water quality sampling has shown that chronic levels of gas supersaturation are commonly present during a significant period of the year. Small marine fish larvae are significantly more sensitive to gas supersaturation than salmonids. Present water quality criteria for gas supersaturation are not adequate for the protection of either salmonids under chronic exposure or marine fish larvae, especially in aquaria or hatcheries. To increase communication between interested parties in the field of gas supersaturation research and control, addresses and telephone numbers of all people responding to the questionnaire are included. 102 refs.
Report from SG 1.1: improving the performance of existing gas storages
Energy Technology Data Exchange (ETDEWEB)
NONE
2000-07-01
This report aims to identify underlying trends for improvements in the underground gas storage (UGS) industry. It highlights best practices and state-of-the-art technology used in operating gas storages. The core conclusions of this report are based on a survey, which was sent out to the member countries. A reply was received from 15 countries, represented by 22 companies/institutions, including more than 100 gas storage sites. This response represents some 30% of the total estimated world storage working volume. In the survey operators were asked to report on the following issues: - measures implemented to improve the performance, - current priorities for improvements, - most important drivers for improvement, - techniques used to analyze performance, - techniques used to optimize storage performance, - software packages used, - technology used for reservoir management, wells and surface facilities, - safety and environment. (author)
International Nuclear Information System (INIS)
Roberts, Richard.
1994-01-01
The NSW Southern Coalfield at Bulli is Australia's most gas plagued producing region. Whilst gas drainage using long boreholes has been successfully adapted in high methane areas, these techniques are not efficient when high levels of carbon dioxide are present, as is the case at Bulli NSW. This article discusses the limitations of the current gas drainage technologies and the improvements needed in underground drilling technologies and hydrofacing for efficient gas drainage. 1 table, 1 photo
Meng, Xiangzhi; Schoggins, John; Rose, Lloyd; Cao, Jingxin; Ploss, Alexander; Rice, Charles M; Xiang, Yan
2012-04-01
Vaccinia virus (VACV) K1L and C7L function equivalently in many mammalian cells to support VACV replication and antagonize antiviral activities induced by type I interferons (IFNs). While K1L is limited to orthopoxviruses, genes that are homologous to C7L are found in diverse mammalian poxviruses. In this study, we showed that the C7L homologues from sheeppox virus and swinepox virus could rescue the replication defect of a VACV mutant deleted of both K1L and C7L (vK1L(-)C7L(-)). Interestingly, the sheeppox virus C7L homologue could rescue the replication of vK1L(-)C7L(-) in human HeLa cells but not in murine 3T3 and LA-4 cells, in contrast to all other C7L homologues. Replacing amino acids 134 and 135 of the sheeppox virus C7L homologue, however, made it functional in the two murine cell lines, suggesting that these two residues are critical for antagonizing a putative host restriction factor which has some subtle sequence variation in human and murine cells. Furthermore, the C7L family of host range genes from diverse mammalian poxviruses were all capable of antagonizing type I IFN-induced antiviral activities against VACV. Screening of a library of more than 350 IFN-stimulated genes (ISGs) identified interferon-regulated factor 1 (IRF1) as an inhibitor of vK1L(-)C7L(-) but not wild-type VACV. Expression of either K1L or C7L, however, rendered vK1L(-)C7L(-) resistant to IRF1-induced antiviral activities. Altogether, our data show that K1L and C7L antagonize IRF1-induced antiviral activities and that the host modulation function of C7L is evolutionally conserved in all poxviruses that can readily replicate in tissue-cultured mammalian cells.
Design and Characterization of the VMM1 ASIC for Micropattern Gas Detectors
Metcalfe, J; The ATLAS collaboration; Fried, J; Li, S; Nambiar, N; Polychronakos, V; Vernon, E
2013-01-01
We present here the measurements of the first prototype VMM1 ASIC designed at Brookhaven National Laboratory in 130 nm CMOS and fabricated in spring 2012. The 64-channel ASIC features a novel design for use with several types of micropattern gas detectors. The data driven system measures peak amplitude and timing information in tracking mode and first channel hit address in trigger mode. Several programmable gain and integration times allows the flexibility to work with Micromegas, Thin Gap Chambers (TGCs), and Gas Electron Multiplier (GEM) detectors. The IC design architecture and features will be presented along with measurements characterizing the performance of the VMM1 such as noise, linearity of the response, time walk, and calibration range. The concept for use with Micromegas in ATLAS Upgrade will also be covered including characterization under test beam conditions.
A simple operational gas release and swelling model. Pt. 1
International Nuclear Information System (INIS)
Wood, M.H.; Matthews, J.R.
1980-01-01
A new and simple model of fission gas release and swelling has been developed for oxide nuclear fuel under operational conditions. The model, which is to be incorporated into a fuel element behaviour code, is physically based and applicable to fuel at both thermal and fast reactor ratings. In this paper we present that part of the model describing the behaviour of intragranular gas: a future paper will detail the treatment of the grain boundary gas. The results of model calculations are compared with recent experimental observations of intragranular bubble concentrations and sizes, and gas release from fuel irradiated under isothermal conditions. Good agreement is found between experiment and theory. (orig.)
TRBP and eIF6 homologue in Marsupenaeus japonicus play crucial roles in antiviral response.
Directory of Open Access Journals (Sweden)
Shuai Wang
Full Text Available Plants and invertebrates can suppress viral infection through RNA silencing, mediated by RNA-induced silencing complex (RISC. Trans-activation response RNA-binding protein (TRBP, consisting of three double-stranded RNA-binding domains, is a component of the RISC. In our previous paper, a TRBP homologue in Fenneropenaeus chinensis (Fc-TRBP was reported to directly bind to eukaryotic initiation factor 6 (Fc-eIF6. In this study, we further characterized the function of TRBP and the involvement of TRBP and eIF6 in antiviral RNA interference (RNAi pathway of shrimp. The double-stranded RNA binding domains (dsRBDs B and C of the TRBP from Marsupenaeus japonicus (Mj-TRBP were found to mediate the interaction of TRBP and eIF6. Gel-shift assays revealed that the N-terminal of Mj-TRBP dsRBD strongly binds to double-stranded RNA (dsRNA and that the homodimer of the TRBP mediated by the C-terminal dsRBD increases the affinity to dsRNA. RNAi against either Mj-TRBP or Mj-eIF6 impairs the dsRNA-induced sequence-specific RNAi pathway and facilitates the proliferation of white spot syndrome virus (WSSV. These results further proved the important roles of TRBP and eIF6 in the antiviral response of shrimp.
The unexpectedly large dust and gas content of quiescent galaxies at z > 1.4
Gobat, R.; Daddi, E.; Magdis, G.; Bournaud, F.; Sargent, M.; Martig, M.; Jin, S.; Finoguenov, A.; Béthermin, M.; Hwang, H. S.; Renzini, A.; Wilson, G. W.; Aretxaga, I.; Yun, M.; Strazzullo, V.; Valentino, F.
2018-03-01
Early-type galaxies (ETGs) contain most of the stars present in the local Universe and, above a stellar mass content of 5 × 1010 solar masses, vastly outnumber spiral galaxies such as the Milky Way. These massive spheroidal galaxies have, in the present day, very little gas or dust in proportion to their mass1, and their stellar populations have been evolving passively for over 10 billion years. The physical mechanisms that led to the termination of star formation in these galaxies and depletion of their interstellar medium remain largely conjectural. In particular, there are currently no direct measurements of the amount of residual gas that might still be present in newly quiescent spheroidals at high redshift2. Here we show that quiescent ETGs at redshift z 1.8, close to their epoch of quenching, contained at least two orders of magnitude more dust at a fixed stellar mass compared with local ETGs. This implies the presence of substantial amounts of gas (5-10%), which has been consumed less efficiently than in more active galaxies, probably due to their spheroidal morphology, consistent with our simulations. This lower star formation efficiency, combined with an extended hot gas halo possibly maintained by persistent feedback from an active galactic nucleus, keep ETGs mostly passive throughout cosmic time.
Fission gas release and swelling in the fuel pins M1-3 and F9-3: Risoe Fission Gas Project
Energy Technology Data Exchange (ETDEWEB)
Walker, C T; Ray, I L.F.; Coquerelle, M; Blank, H
1982-01-01
This report presents results for the microscopic swelling local swelling and local gas release in the pin sections M1-3-11 and F9-3-44. The local gas release was derived from the concentration of retained xenon which was measured with the electron microprobe. In addition to xenon, the radial distributions of caesium and neodymium were also determined by EMPA. Caesium is assumed to contribute to microscopic swelling because it results mainly from the decay of /sup 133/Xe, /sup 135/Xe and /sup 137/Xe and, therefore, is trapped together with xenon in bubbles and pores. Neodymium, on the other hand, is soluble in UO/sub 2/ and does not migrate under the influence of the temperature gradients that exist during irradiation. Therefore, the radial distribution of this fission product is an indelible imprint of the burn-up from which the average flux depression can be deduced. 1 ref., 15 figs., 3 tabs.
International Nuclear Information System (INIS)
Corbin, Patrick; Ferrier, Jerome; Holleaux, Didier; Vivier, Laurent; Gattaz, Pierre; Delga, Carole; Carenco, Jean-Francois; Sadamori, Keisuke
2017-01-01
This special issue of 'Gaz d'Aujourd'hui' journal is entirely devoted to the 2017 Gas Congress proceedings. The congress was organized in 5 round tables and 12 workshops: Round table 1 - COP 21 2 years after, workshops 1-6: 1 - digital transformation: what are the challenges for the gas sector? 2 - Which actors and what policies to fight against energy insecurity? 3 - Natural gas development: what fiscal signs? 4 - Terrestrial transportation: current situation and prospects; 5 - Consumers' perception of gas; 6 - industrial uses; Round table 2 - Maritime and fluvial LNG perspectives; Round table 3 - Territories, the new decision-makers, workshops 7-12: 7 - What energy regulation for tomorrow? 8 - How to succeed in injecting more and more green gas? 9 - Digital, data and emerging technologies (drones, blockchain..): challenges and applications for gas networks? 10 - Underground storage: a promising infrastructure? 11 - Security of supply: what new cooperation? 12 - Power-to-gas: a new way of energy valorization; Round table 4 - Gas and electricity, winning synergies; Round table 5 - The Europe of gas
Energy Technology Data Exchange (ETDEWEB)
Tsukamoto, Yuta; Katayama, Chisako [Graduate School of Science, Kobe University, 1-1 Rokkodai-cho Nada, Kobe 657-8501 (Japan); Shinohara, Miki; Shinohara, Akira [Institute for Protein Research, Osaka University, 3-2 Yamadaoka, Suita, Osaka 565-0871 (Japan); Maekawa, Shohei [Graduate School of Science, Kobe University, 1-1 Rokkodai-cho Nada, Kobe 657-8501 (Japan); Miyamoto, Masaaki, E-mail: miya@kobe-u.ac.jp [Graduate School of Science, Kobe University, 1-1 Rokkodai-cho Nada, Kobe 657-8501 (Japan); Center for Supports to Research and Education Activities, Kobe University, 1-1 Rokkodai-cho Nada, Kobe 657-8501 (Japan)
2013-11-29
Highlights: •Multiple functions of Rab5 GTPase in fission yeast were found. •Roles of Rab5 in fission yeast were discussed. •Relation between Rab5 and actin cytoskeleton were discussed. -- Abstract: Inner-membrane transport is critical to cell function. Rab family GTPases play an important role in vesicle transport. In mammalian cells, Rab5 is reported to be involved in the regulation of endosome formation, phagocytosis and chromosome alignment. Here, we examined the role of the fission yeast Rab5 homologue Ypt5 using a point mutant allele. Mutant cells displayed abnormal cell morphology, mating, sporulation, endocytosis, vacuole fusion and responses to ion stress. Our data strongly suggest that fission yeast Rab5 is involved in the regulation of various types of cellular functions.
International Nuclear Information System (INIS)
Tsukamoto, Yuta; Katayama, Chisako; Shinohara, Miki; Shinohara, Akira; Maekawa, Shohei; Miyamoto, Masaaki
2013-01-01
Highlights: •Multiple functions of Rab5 GTPase in fission yeast were found. •Roles of Rab5 in fission yeast were discussed. •Relation between Rab5 and actin cytoskeleton were discussed. -- Abstract: Inner-membrane transport is critical to cell function. Rab family GTPases play an important role in vesicle transport. In mammalian cells, Rab5 is reported to be involved in the regulation of endosome formation, phagocytosis and chromosome alignment. Here, we examined the role of the fission yeast Rab5 homologue Ypt5 using a point mutant allele. Mutant cells displayed abnormal cell morphology, mating, sporulation, endocytosis, vacuole fusion and responses to ion stress. Our data strongly suggest that fission yeast Rab5 is involved in the regulation of various types of cellular functions
Isolation and characterisation of a banana CYCD2;1 gene and its ...
African Journals Online (AJOL)
Stimulation of the cell cycle by over-expression of Arabidopsis CyclinD2;1 enhanced growth in tobacco and rice, but not Arabidopsis. To broaden the range of species and to improve an important crop species for developing countries, a CyclinD2;1 homologue was isolated from an East African highland banana cultivar ...
Arterial blood gas reference values for sea level and an altitude of 1,400 meters.
Crapo, R O; Jensen, R L; Hegewald, M; Tashkin, D P
1999-11-01
Blood gas measurements were collected on healthy lifetime nonsmokers at sea level (n = 96) and at an altitude of 1,400 meters (n = 243) to establish reference equations. At each study site, arterial blood samples were analyzed in duplicate on two separate blood gas analyzers and CO-oximeters. Arterial blood gas variables included Pa(O(2)), Pa(CO(2)), pH, and calculated alveolar-arterial PO(2) difference (AaPO(2)). CO-oximeter variables were Hb, COHb, MetHb, and Sa(O(2)). Subjects were 18 to 81 yr of age with 166 male and 173 female. Outlier data were excluded from multiple regression analysis, and reference equations were fitted to the data in two ways: (1) best fit using linear, squared, and cross-product terms; (2) simple equations, including only the variables that explained at least 3% of the variance. Two sets of equations were created: (1) using only the sea level data and (2) using the combined data with barometric pressure as an independent variable. Comparisons with earlier studies revealed small but significant differences; the decline in Pa(O(2)) with age at each altitude was consistent with most previous studies. At sea level, the equation that included barometric pressure predicted Pa(O(2)) slightly better than the sea level specific equation. The inclusion of barometric pressure in the equations allows better prediction of blood gas reference values at sea level and at altitudes as high as 1,400 meters.
Gas6 Promotes Inflammatory (CCR2hiCX3CR1lo) Monocyte Recruitment in Venous Thrombosis.
Laurance, Sandrine; Bertin, François-René; Ebrahimian, Talin; Kassim, Yusra; Rys, Ryan N; Lehoux, Stéphanie; Lemarié, Catherine A; Blostein, Mark D
2017-07-01
Coagulation and inflammation are inter-related. Gas6 (growth arrest-specific 6) promotes venous thrombosis and participates to inflammation through endothelial-innate immune cell interactions. Innate immune cells can provide the initiating stimulus for venous thrombus development. We hypothesize that Gas6 promotes monocyte recruitment during venous thrombosis. Deep venous thrombosis was induced in wild-type and Gas6-deficient (-/-) mice using 5% FeCl 3 and flow reduction in the inferior vena cava. Total monocyte depletion was achieved by injection of clodronate before deep venous thrombosis. Inflammatory monocytes were depleted using an anti-C-C chemokine receptor type 2 (CCR2) antibody. Similarly, injection of an anti-chemokine ligand 2 (CCL2) antibody induced CCL2 depletion. Flow cytometry and immunofluorescence were used to characterize the monocytes recruited to the thrombus. In vivo, absence of Gas6 was associated with a reduction of monocyte recruitment in both deep venous thrombosis models. Global monocyte depletion by clodronate leads to smaller thrombi in wild-type mice. Compared with wild type, the thrombi from Gas6 -/- mice contain less inflammatory (CCR2 hi CX 3 CR1 lo ) monocytes, consistent with a Gas6-dependent recruitment of this monocyte subset. Correspondingly, selective depletion of CCR2 hi CX 3 CR1 lo monocytes reduced the formation of venous thrombi in wild-type mice demonstrating a predominant role of the inflammatory monocytes in thrombosis. In vitro, the expression of both CCR2 and CCL2 were Gas6 dependent in monocytes and endothelial cells, respectively, impacting monocyte migration. Moreover, Gas6-dependent CCL2 expression and monocyte migration were mediated via JNK (c-Jun N-terminal kinase). This study demonstrates that Gas6 specifically promotes the recruitment of inflammatory CCR2 hi CX 3 CR1 lo monocytes through the regulation of both CCR2 and CCL2 during deep venous thrombosis. © 2017 American Heart Association, Inc.
Centre of the European gas market. The European Autumn Gas Conference
International Nuclear Information System (INIS)
Van Hasselt, F.; Van der Wal, W.; Ruinen, H.
1998-01-01
From the results of the 1997 European Autumn Gas Conference in Barcelona, Spain, it appears that the European gas industry is mainly focused on the liberalization of the European energy market. The main topic of the Conference was 'dealing with surplus'. A brief overview is given of the natural gas trade developments in the European countries. 1 ill., 1 tab. 2 ills
Phases of a polar spin-1 Bose gas in a magnetic field
International Nuclear Information System (INIS)
Kis-Szabo, Krisztian; Szepfalusy, Peter; Szirmai, Gergely
2007-01-01
The two Bose-Einstein condensed phases of a polar spin-1 gas at nonzero magnetizations and temperatures are investigated. The Hugenholtz-Pines theorem is generalized to this system. Crossover to a quantum phase transition is also studied. Results are discussed in a mean field approximation
DEFF Research Database (Denmark)
Berg, Rolf W.; Harris, Pernille; Riisager, Anders
2013-01-01
A unique new ionic liquid−gas adduct solid state compound formed between 1,1,3,3-tetramethylguanidinium chloride ([tmgH]Cl) and sulfur dioxide has been characterized by X-ray diffraction and Raman spectroscopy. The structure contains SO2 molecules of near normal structure kept at their positions ...... with bromide and iodide are discussed. Some of these salts may prove useful as reversible absorbents of SO2 in industrial flue gases....
International Nuclear Information System (INIS)
Hunter, S.R.; Christophorou, L.G.; McCorkle, D.L.; Sauers, I.; Ellis, H.W.; James, D.R.
1982-01-01
Electron attachment to perfluoropropylene (1-C 3 F 6 ) in 1-C 3 F 6 /buffer gas mixtures has been found to be anomalously dependent on both the 1-C 3 F 6 and buffer gas pressures, as well as on the gas temperature. We have found also that the uniform field breakdown strength of pure 1-C 3 F 6 is dependent on gas pressure but not on the gas temperature. A mass spectrometer study of the negative ions formed in a moderately high pressure corona discharge has been made, and the principal negative ions formed by electron attachment to 1-C 3 F 6 have been identified. Based on these studies, a reaction scheme for electron attachment to 1-C 3 F 6 is proposed which results in stable negative ion clusters but does not involve pre-existing dimers. Further, we propose that the observed pressure dependence in the breakdown strength of this gas is due to the large pressure dependence of the electron attachment process we observed
Amaral, André F S; Ramasamy, Adaikalavan; Castro-Giner, Francesc; Minelli, Cosetta; Accordini, Simone; Sørheim, Inga-Cecilie; Pin, Isabelle; Kogevinas, Manolis; Jõgi, Rain; Balding, David J; Norbäck, Dan; Verlato, Giuseppe; Olivieri, Mario; Probst-Hensch, Nicole; Janson, Christer; Zock, Jan-Paul; Heinrich, Joachim; Jarvis, Deborah L
2014-01-01
Background Increased bronchial responsiveness is characteristic of asthma. Gas cooking, which is a major indoor source of the highly oxidant nitrogen dioxide, has been associated with respiratory symptoms and reduced lung function. However, little is known about the effect of gas cooking on bronchial responsiveness and on how this relationship may be modified by variants in the genes GSTM1, GSTT1 and GSTP1, which influence antioxidant defences. Methods The study was performed in subjects with forced expiratory volume in one second at least 70% of predicted who took part in the multicentre European Community Respiratory Health Survey, had bronchial responsiveness assessed by methacholine challenge and had been genotyped for GSTM1, GSTT1 and GSTP1-rs1695. Information on the use of gas for cooking was obtained from interviewer-led questionnaires. Effect modification by genotype on the association between the use of gas for cooking and bronchial responsiveness was assessed within each participating country, and estimates combined using meta-analysis. Results Overall, gas cooking, as compared with cooking with electricity, was not associated with bronchial responsiveness (β=−0.08, 95% CI −0.40 to 0.25, p=0.648). However, GSTM1 significantly modified this effect (β for interaction=−0.75, 95% CI −1.16 to −0.33, p=4×10−4), with GSTM1 null subjects showing more responsiveness if they cooked with gas. No effect modification by GSTT1 or GSTP1-rs1695 genotypes was observed. Conclusions Increased bronchial responsiveness was associated with gas cooking among subjects with the GSTM1 null genotype. This may reflect the oxidant effects on the bronchi of exposure to nitrogen dioxide. PMID:24613990
Chayakulkeeree, Methee; Johnston, Simon Andrew; Oei, Johanes Bijosono; Lev, Sophie; Williamson, Peter Richard; Wilson, Christabel Frewen; Zuo, Xiaoming; Leal, Ana Lusia; Vainstein, Marilene Henning; Meyer, Wieland; Sorrell, Tania Christine; May, Robin Charles; Djordjevic, Julianne Teresa
2011-01-01
Summary Secreted phospholipase B1 (CnPlb1) is essential for dissemination of Cryptococcus neoformans to the central nervous system (CNS) yet essential components of its secretion machinery remain to be elucidated. Using gene deletion analysis we demonstrate that CnPlb1 secretion is dependent on the CnSEC14 product, CnSec14-1p. CnSec14-1p is a homologue of the phosphatidylinositol transfer protein (PITP) ScSec14p, which is essential for secretion and viability in Saccharomyces cerevisiae. In contrast to CnPlb1, neither laccase 1 (Lac1)-induced melanization within the cell wall nor capsule induction were negatively impacted in CnSEC14-1 deletion mutants (CnΔsec14-1 and CnΔsec14-1CnΔsfh5). Similar to the CnPLB1 deletion mutant (CnΔplb1), CnΔsec14-1 was hypo-virulent in mice and did not disseminate to the CNS by day 14 post infection. Furthermore, macrophage expulsion of live CnΔsec14-1 and CnΔplb1 (vomocytosis) was reduced. Individual deletion of CnSEC14-2, a closely-related CnSEC14-1 homologue, and CnSFH5, a distantly-related SEC fourteen-like homologue, did not abrogate CnPlb1 secretion or virulence. However, reconstitution of CnΔsec14-1 with CnSEC14-1 or CnSEC14-2 restored both phenotypes, consistent with functional genetic redundancy. We conclude that CnPlb1 secretion is SEC14-dependent and that C. neoformans preferentially exports virulence determinants to the cell periphery via distinct pathways. We also demonstrate that CnPlb1 secretion is essential for vomocytosis. PMID:21453402
The plant PTS1 receptor : similarities and differences to its human and yeast counterparts
Wimmer, C; Schmid, Markus; Veenhuis, M; Gietl, C
1998-01-01
Two targeting signals, PTS1 and PTS2, mediate import of proteins into the peroxisomal matrix. We have cloned and sequenced the watermelon (Citrullus vulgaris) cDNA homologue to the PTS1 receptor gene (PEX5). Its gene product, CvPex5p, belongs to the family of tetratricopeptide repeat (TPR)
Remaining authorized gas exports under long-term licences as of 1 November 1995
International Nuclear Information System (INIS)
1995-01-01
A statistical base of information on natural gas exports authorized under long-term licences to markets in the U.S. as of November 1, 1995, was provided. The first part of the report focused on the total licensed exports to the U.S. while the second part provided a breakdown of the licensed export volumes by U.S. market regions. The National Energy Board Act empowers the National Energy Board to issue licences and orders for the export of natural gas from Canada. Licences are issued for long-term periods (over 2 years) and orders for short-term periods (2 years or less). Each individual export licence contains terms and conditions including the duration of the licence, the point of export where the gas may leave Canada, and the maximum allowable volumes that may be exported daily, annually, and throughout the term of the licence. 17 figs
Large scale gas injection test (Lasgit): Results from two gas injection tests
International Nuclear Information System (INIS)
Cuss, R. J.; Harrington, J. F.; Noy, D. J.; Wikman, A.; Sellin, P.
2011-01-01
This paper describes the initial results from a large scale gas injection test (Lasgit) performed at the Aespoe Hard Rock Laboratory (Sweden)). Lasgit is a full-scale field-scale experiment based on the Swedish KBS-3V repository concept, examining the processes controlling gas and water flow in compact buffer bentonite. The first 2 years of the test focused on the artificial hydration of the bentonite buffer. This was followed by a programme of hydraulic and gas injection tests which ran from day 843 to 1110. A further period of artificial hydration occurred from day 1110 to 1385, followed by a more complex programme of gas injection testing which remains on going (day 1385+). After 2 years of hydration, hydraulic conductivity and specific storage values in the lower filter array were found to range from 9 x 10 -14 to 1.6 x 10 -13 m/s and 5.5 x 10 -5 to 4.4 x 10 -4 m -1 respectively, with the injection filter FL903 yielding values of 7.5 x 10 -14 m/s and 2.5 x 10 -5 m -1 . A second set of hydraulic measurements were performed over 1 year and a half later yielding similar values, in the range 7.8 x 10 -14 m/s and 1.3 x 10 -13 m/s. The hydraulic conductivity of FL903 had reduced slightly to 5.3 x 10 -14 m/s while specific storage had increased to 4.0 x 10 -5 m -1 . Both datasets agree with laboratory values performed on small-scale saturated samples. Two sets of gas injection tests were performed over a 3 year period. During the course of testing, gas entry pressure was found to increase from around 650 kPa to approximately 1.3 MPa, indicative of the maturation of the clay. The sequential reduction in volumetric flow rate and lack of correlation between the rate of gas inflow and the gas pressure gradient observed during constant pressure steps prior to major gas entry, is suggestive of a reduction in gas permeability of the buffer and indicates only limited quantities of gas can be injected into the clay without interacting with the continuum stress field. Major gas
International Nuclear Information System (INIS)
Van Gelder, J.W.
2000-01-01
This first part of a series on developments in the European gas market features the growth in gas supply. 35% of the gas demand must be covered from sources outside Europe. For the future additional imports are required from countries such as the Russian Federation, Algeria and Nigeria. Over the next few years the artificial link between ga and oil prices will disappear, bringing the gas price to a structurally lower level. It will be of crucial importance that gas suppliers will not be able to form cartels to keep prices high. All competing projects will curb price increases on the European market, but will definitely result in more freedom of choice for European natural gas consumers
Energy Technology Data Exchange (ETDEWEB)
Genzel, R.; Tacconi, L. J.; Kurk, J.; Wuyts, S.; Foerster Schreiber, N. M.; Gracia-Carpio, J. [Max-Planck-Institut fuer extraterrestrische Physik (MPE), Giessenbachstr., D-85748 Garching (Germany); Combes, F.; Freundlich, J. [Observatoire de Paris, LERMA, CNRS, 61 Av. de l' Observatoire, F-75014 Paris (France); Bolatto, A. [Department of Astronomy, University of Maryland, College Park, MD 20742-2421 (United States); Cooper, M. C. [Department of Physics and Astronomy, Frederick Reines Hall, University of California, Irvine, CA 92697 (United States); Neri, R. [IRAM, 300 Rue de la Piscine, F-38406 St. Martin d' Heres, Grenoble (France); Nordon, R. [Sackler School of Physics and Astronomy, Tel Aviv University, Tel Aviv 69978 (Israel); Bournaud, F. [Service d' Astrophysique, DAPNIA, CEA/Saclay, F-91191 Gif-sur-Yvette Cedex (France); Burkert, A. [Universitaetssternwarte der Ludwig-Maximiliansuniversitaet, Scheinerstr. 1, D-81679 Muenchen (Germany); Comerford, J. [Department of Astronomy and McDonald Observatory, 1 University Station, C1402 Austin, TX 78712-0259 (United States); Cox, P. [Department of Physics, Le Conte Hall, University of California, 94720 Berkeley, CA (United States); Davis, M. [Department of Astronomy, Campbell Hall, University of California, Berkeley, CA 94720 (United States); Garcia-Burillo, S. [Observatorio Astronomico Nacional-OAN, Observatorio de Madrid, Alfonso XII, 3, E-28014 Madrid (Spain); Naab, T. [Max-Planck Institut fuer Astrophysik, Karl Schwarzschildstrasse 1, D-85748 Garching (Germany); Lutz, D., E-mail: genzel@mpe.mpg.de, E-mail: linda@mpe.mpg.de; and others
2013-08-10
We report matched resolution imaging spectroscopy of the CO 3-2 line (with the IRAM Plateau de Bure millimeter interferometer) and of the H{alpha} line (with LUCI at the Large Binocular Telescope) in the massive z = 1.53 main-sequence galaxy EGS 13011166, as part of the ''Plateau de Bure high-z, blue-sequence survey'' (PHIBSS: Tacconi et al.). We combine these data with Hubble Space Telescope V-I-J-H-band maps to derive spatially resolved distributions of stellar surface density, star formation rate, molecular gas surface density, optical extinction, and gas kinematics. The spatial distribution and kinematics of the ionized and molecular gas are remarkably similar and are well modeled by a turbulent, globally Toomre unstable, rotating disk. The stellar surface density distribution is smoother than the clumpy rest-frame UV/optical light distribution and peaks in an obscured, star-forming massive bulge near the dynamical center. The molecular gas surface density and the effective optical screen extinction track each other and are well modeled by a ''mixed'' extinction model. The inferred slope of the spatially resolved molecular gas to star formation rate relation, N = dlog{Sigma}{sub starform}/dlog{Sigma}{sub molgas}, depends strongly on the adopted extinction model, and can vary from 0.8 to 1.7. For the preferred mixed dust-gas model, we find N = 1.14 {+-} 0.1.
A Gas Chromatographic System for the Detection of Ethylene Gas Using Ambient Air as a Carrier Gas.
Zaidi, Nayyer Abbas; Tahir, Muhammad Waseem; Vellekoop, Michael J; Lang, Walter
2017-10-07
Ethylene gas is a naturally occurring gas that has an influence on the shelf life of fruit during their transportation in cargo ships. An unintentional exposure of ethylene gas during transportation results in a loss of fruit. A gas chromatographic system is presented here for the detection of ethylene gas. The gas chromatographic system was assembled using a preconcentrator, a printed 3D printed gas chromatographic column, a humidity sensor, solenoid valves, and an electrochemical ethylene gas sensor. Ambient air was used as a carrier gas in the gas chromatographic system. The flow rate was fixed to 10 sccm. It was generated through a mini-pump connected in series with a mass flow controller. The metal oxide gas sensor is discussed with its limitation in ambient air. The results show the chromatogram obtained from metal oxide gas sensor has low stability, drifts, and has uncertain peaks, while the chromatogram from the electrochemical sensor is stable and precise. Furthermore, ethylene gas measurements at higher ppb concentration and at lower ppb concentration were demonstrated with the electrochemical ethylene gas sensor. The system separates ethylene gas and humidity. The chromatograms obtained from the system are stable, and the results are 1.2% repeatable in five similar measurements. The statistical calculation of the gas chromatographic system shows that a concentration of 2.3 ppb of ethylene gas can be detected through this system.
International Nuclear Information System (INIS)
Anon.
2013-01-01
This special issue of Gaz d'Aujourd'hui journal contains the proceedings of the 2013 edition of the annual French gas conference. These proceedings comprise 7 talks, 5 round-tables and 9 workshops: 1 - Opening talk (H. Malherbe); 2 - Defending the natural gas position in the energy mix (G. Mestralet); 3 - The new youth of natural gas (P. Sauquet); 4 - Round-table No.1: the natural gas market perspectives; 5 - Round-table No.2: natural gas in France's energy transition; 6 - Answering the energy transition challenges (B. Lescoeur); 7 - Round-table No.3: towards an integrated European market in 2014?; 8 - Building up the European gas market (P. de Ladoucette); 9 - Workshop No.1: the big client's strategies in the gas market; 10 - Workshop No.2: the fuel gas perspectives in terrestrial mobility; 11 - Workshop No.3: gas innovations; 12 - The 2030 and 2050 strategy of the European Union policy (B. Devlin); 13 - Round-table No.4: Decentralized production and local development; 14 - Workshop No.4: Gas and maritime transport; 15 - Workshop No.5: bio-methane, vector of the energy transition; 16 - Workshop No.6: Evolution of the storage activity; 17 - Workshop No.7: Dwellings renovation and natural gas development; 18 - Workshop No.8: Is the target model of gas a reality?; 19 - Workshop No.9: Non-conventional gases in the world; 20 - Round-table No.5: Actors' strategy; 21 - Closing talk (J. Ferrier)
Gas Hydrate Storage of Natural Gas
Energy Technology Data Exchange (ETDEWEB)
Rudy Rogers; John Etheridge
2006-03-31
Environmental and economic benefits could accrue from a safe, above-ground, natural-gas storage process allowing electric power plants to utilize natural gas for peak load demands; numerous other applications of a gas storage process exist. A laboratory study conducted in 1999 to determine the feasibility of a gas-hydrates storage process looked promising. The subsequent scale-up of the process was designed to preserve important features of the laboratory apparatus: (1) symmetry of hydrate accumulation, (2) favorable surface area to volume ratio, (3) heat exchanger surfaces serving as hydrate adsorption surfaces, (4) refrigeration system to remove heat liberated from bulk hydrate formation, (5) rapid hydrate formation in a non-stirred system, (6) hydrate self-packing, and (7) heat-exchanger/adsorption plates serving dual purposes to add or extract energy for hydrate formation or decomposition. The hydrate formation/storage/decomposition Proof-of-Concept (POC) pressure vessel and supporting equipment were designed, constructed, and tested. This final report details the design of the scaled POC gas-hydrate storage process, some comments on its fabrication and installation, checkout of the equipment, procedures for conducting the experimental tests, and the test results. The design, construction, and installation of the equipment were on budget target, as was the tests that were subsequently conducted. The budget proposed was met. The primary goal of storing 5000-scf of natural gas in the gas hydrates was exceeded in the final test, as 5289-scf of gas storage was achieved in 54.33 hours. After this 54.33-hour period, as pressure in the formation vessel declined, additional gas went into the hydrates until equilibrium pressure/temperature was reached, so that ultimately more than the 5289-scf storage was achieved. The time required to store the 5000-scf (48.1 hours of operating time) was longer than designed. The lower gas hydrate formation rate is attributed to a
1, 3-Dimethylbutylamine (DMBA), is a CNS stimulant which has recently been identified in multiple dietary supplements and sometimes labeled as a natural constituent of Pouchung tea. DMBA is an homologue of 1,3-dimethylamylamine (DMAA) which the US Food and Drug Administration has attempted to remov...
Draft genome sequence of Penicillium marneffei strain PM1.
Woo, Patrick C Y; Lau, Susanna K P; Liu, Bin; Cai, James J; Chong, Ken T K; Tse, Herman; Kao, Richard Y T; Chan, Che-Man; Chow, Wang-Ngai; Yuen, Kwok-Yung
2011-12-01
Penicillium marneffei is the most important thermal dimorphic, pathogenic fungus endemic in China and Southeast Asia and is particularly important in HIV-positive patients. We report the 28,887,485-bp draft genome sequence of P. marneffei, which contains its complete mitochondrial genome, sexual cycle genes, a high diversity of Mp1p homologues, and polyketide synthase genes.
Dpb11/TopBP1 contributes to genomicstability via homologous recombinationand checkpoint signaling
DEFF Research Database (Denmark)
Germann, Susanne Manuela
for recruitment. Also, the chicken homologue TopBP1 colocalizes with RPA1 as well as Rad51 when DNA damage is induced. Previously, dpb11 mutants have been shown to be sensitive to DNA-damaging agents that cause DSBs, DNA alkylation and stalled replication forks. Interestingly, we found the point mutants dpb11-PF...
Combustion heating value gas in a gas turbine
Energy Technology Data Exchange (ETDEWEB)
Kelsall, G [CTDD, British Coal Corporation, Cheltenham (United Kingdom); Cannon, M [European Gas Turbines Ltd., Lincoln (United Kingdom)
1997-12-31
Advanced coal and/or biomass based power generation systems offer the potential for high efficiency electricity generation with minimum environmental impact. An important component for many of these advanced power generation cycles is the gas turbine, for which development of a combustion system to burn low calorific value coal derived fuel gas, at turbine inlet temperatures of typically 1 100 - 1 260 deg C and with minimum pollutant emissions, is a key issue. A phased combustor development programme is under-way burning low calorific value fuel gas (3.6 - 4.1 MJ/m{sup 3}) with low emissions, particularly NO{sub x} derived from fuel-bound nitrogen. The first and second phases of the combustor development programme have been completed. The first phase used a generic tubo-annular, prototype combustor based on conventional design principles. Combustor performance for this first prototype combustor was encouraging. The second phase assessed five design variants of the prototype combustor, each variant achieving a progressive improvement in combustor performance. The operating conditions for this assessment were selected to represent a particular medium sized industrial gas turbine operating as part of an Air Blown Gasification Cycle (ABGC). The test conditions assessed therefore included the capability to operate the combustor using natural gas as a supplementary fuel, to suit one possible start-up procedure for the cycle. The paper presents a brief overview of the ABGC development initiative and discusses the general requirements for a gas turbine operating within such a cycle. In addition, it presents full combustor performance results for the second phase of turbine combustor development and discusses the rationale for the progressive design modifications made within that programme. The strategy for the further development of the combustor to burn low calorific value fuel gas with very low conversion of fuel-bound nitrogen to NO{sub x} is presented. (orig.) 6 refs.
Combustion heating value gas in a gas turbine
Energy Technology Data Exchange (ETDEWEB)
Kelsall, G. [CTDD, British Coal Corporation, Cheltenham (United Kingdom); Cannon, M. [European Gas Turbines Ltd., Lincoln (United Kingdom)
1996-12-31
Advanced coal and/or biomass based power generation systems offer the potential for high efficiency electricity generation with minimum environmental impact. An important component for many of these advanced power generation cycles is the gas turbine, for which development of a combustion system to burn low calorific value coal derived fuel gas, at turbine inlet temperatures of typically 1 100 - 1 260 deg C and with minimum pollutant emissions, is a key issue. A phased combustor development programme is under-way burning low calorific value fuel gas (3.6 - 4.1 MJ/m{sup 3}) with low emissions, particularly NO{sub x} derived from fuel-bound nitrogen. The first and second phases of the combustor development programme have been completed. The first phase used a generic tubo-annular, prototype combustor based on conventional design principles. Combustor performance for this first prototype combustor was encouraging. The second phase assessed five design variants of the prototype combustor, each variant achieving a progressive improvement in combustor performance. The operating conditions for this assessment were selected to represent a particular medium sized industrial gas turbine operating as part of an Air Blown Gasification Cycle (ABGC). The test conditions assessed therefore included the capability to operate the combustor using natural gas as a supplementary fuel, to suit one possible start-up procedure for the cycle. The paper presents a brief overview of the ABGC development initiative and discusses the general requirements for a gas turbine operating within such a cycle. In addition, it presents full combustor performance results for the second phase of turbine combustor development and discusses the rationale for the progressive design modifications made within that programme. The strategy for the further development of the combustor to burn low calorific value fuel gas with very low conversion of fuel-bound nitrogen to NO{sub x} is presented. (orig.) 6 refs.
The Orphan Nuclear Receptor TLX/NR2E1 in Neural Stem Cells and Diseases.
Wang, Tao; Xiong, Jian-Qiong
2016-02-01
The human TLX gene encodes an orphan nuclear receptor predominantly expressed in the central nervous system. Tailess and Tlx, the TLX homologues in Drosophila and mouse, play essential roles in body-pattern formation and neurogenesis during early embryogenesis and perform crucial functions in maintaining stemness and controlling the differentiation of adult neural stem cells in the central nervous system, especially the visual system. Multiple target genes and signaling pathways are regulated by TLX and its homologues in specific tissues during various developmental stages. This review aims to summarize previous studies including many recent updates from different aspects concerning TLX and its homologues in Drosophila and mouse.
Validating tyrosinase homologue MelA as a photoacoustic reporter gene for imaging Escherichia coli
Paproski, Robert J.; Li, Yan; Barber, Quinn; Lewis, John D.; Campbell, Robert; Zemp, Roger
2015-03-01
Antibiotic drug resistance is a major worldwide issue. Development of new therapies against pathogenic bacteria requires appropriate research tools for replicating and characterizing infections. Previously fluorescence and bioluminescence modalities have been used to image infectious burden in animal models but scattering significantly limits imaging depth and resolution. We hypothesize that photoacoustic imaging, which has improved depth-toresolution ratio, could be useful for visualizing MelA-expressing bacteria since MelA is a bacterial tyrosinase homologue involved in melanin production. Using an inducible expression system, E. coli expressing MelA were visibly black in liquid culture. Phosphate buffered saline (PBS), MelA-expressing bacteria (at different dilutions in PBS), and chicken embryo blood were injected in plastic tubes which were imaged using a VisualSonics Vevo LAZR system. Photoacoustic imaging at 6 different wavelengths (680, 700, 750, 800, 850 and 900nm) enabled spectral de-mixing to distinguish melanin signals from blood. The signal to noise ratio of 9x diluted MelA bacteria was 55, suggesting that ~20 bacteria cells could be detected with our system. When MelA bacteria were injected as a 100 μL bolus into a chicken embryo, photoacoustic signals from deoxy- and oxy- hemoglobin as well as MelA-expressing bacteria could be separated and overlaid on an ultrasound image, allowing visualization of the bacterial location. Photoacoustic imaging may be a useful tool for visualizing bacterial infections and further work incorporating photoacoustic reporters into infectious bacterial strains is warranted.
Buffer-gas cooling of antiprotonic helium to 1.5 to 1.7 K, and antiproton-to–electron mass ratio
Hori, Masaki; Sótér, Anna; Barna, Daniel; Dax, Andreas; Hayano, Ryugo; Kobayashi, Takumi; Murakami, Yohei; Todoroki, Koichi; Yamada, Hiroyuki; Horváth, Dezső; Venturelli, Luca
2016-01-01
Charge, parity, and time reversal (CPT) symmetry implies that a particle and its antiparticle have the same mass. The antiproton-to-electron mass ratio Embedded Image can be precisely determined from the single-photon transition frequencies of antiprotonic helium. We measured 13 such frequencies with laser spectroscopy to a fractional precision of 2.5 × 10−9 to 16 × 10−9. About 2 × 109 antiprotonic helium atoms were cooled to temperatures between 1.5 and 1.7 kelvin by using buffer-gas cooling in cryogenic low-pressure helium gas; the narrow thermal distribution led to the observation of sharp spectral lines of small thermal Doppler width. The deviation between the experimental frequencies and the results of three-body quantum electrodynamics calculations was reduced by a factor of 1.4 to 10 compared with previous single-photon experiments. From this, Embedded Image was determined as 1836.1526734(15), which agrees with a recent proton-to-electron experimental value within 8 × 10−10.
Flammable gas issues in double-contained receiver tanks. Revision 1
International Nuclear Information System (INIS)
Peurrung, L.M.; Mahoney, L.A.; Stewart, C.W.; Gauglitz, P.A.; Pederson, L.R.; Bryan, S.A.; Shepard, C.L.
1998-06-01
Four double-contained receiver tanks (DCRTs) at Hanford will be used to store salt-well pumped liquids from tanks on the Flammable Gas Watch List. This document was created to serve as a technical basis or reference document for flammable gas issues in DCRTs. The document identifies, describes, evaluates, and attempts to quantify potential gas carryover and release mechanisms. It estimates several key parameters needed for these calculations, such as initial aqueous concentrations and ventilation rate, and evaluates the uncertainty in those estimates. It justifies the use of the Schumpe model for estimating vapor-liquid equilibrium constants. It identifies several potential waste compatibility issues (such as mixing and pH or temperature changes) that could lead to gas release and provides a basis for calculating their effects. It evaluates the potential for gas retention in precipitated solids within a DCRT and whether retention could lead to a buoyant displacement instability (rollover) event. It discusses rates of radiolytic, thermal, and corrosive hydrogen generation within the DCRT. It also describes in detail the accepted method of calculating the lower flammability limit (LFL) for mixtures of flammable gases
Flammable gas issues in double-contained receiver tanks. Revision 1
Energy Technology Data Exchange (ETDEWEB)
Peurrung, L.M.; Mahoney, L.A.; Stewart, C.W.; Gauglitz, P.A.; Pederson, L.R.; Bryan, S.A.; Shepard, C.L.
1998-06-01
Four double-contained receiver tanks (DCRTs) at Hanford will be used to store salt-well pumped liquids from tanks on the Flammable Gas Watch List. This document was created to serve as a technical basis or reference document for flammable gas issues in DCRTs. The document identifies, describes, evaluates, and attempts to quantify potential gas carryover and release mechanisms. It estimates several key parameters needed for these calculations, such as initial aqueous concentrations and ventilation rate, and evaluates the uncertainty in those estimates. It justifies the use of the Schumpe model for estimating vapor-liquid equilibrium constants. It identifies several potential waste compatibility issues (such as mixing and pH or temperature changes) that could lead to gas release and provides a basis for calculating their effects. It evaluates the potential for gas retention in precipitated solids within a DCRT and whether retention could lead to a buoyant displacement instability (rollover) event. It discusses rates of radiolytic, thermal, and corrosive hydrogen generation within the DCRT. It also describes in detail the accepted method of calculating the lower flammability limit (LFL) for mixtures of flammable gases.
Giger, Roman J; Wolfer, D P; De Wit, G M; Verhaagen, J
1996-01-01
Semaphorin III/collapsin-1 (semaIII/coll-1) is a chemorepellent that exhibits a repulsive effect on growth cones of dorsal root ganglion neurons. To identify structures that express semaIII/coll-1 in developing mammals, we cloned the rat homologue and performed in situ hybridization on embryonic,
Resistance of WE43 and ZRE1 Magnesium Alloys to Gas Corrosion
Directory of Open Access Journals (Sweden)
Przeliorz R.
2017-06-01
Full Text Available In spite of the fact that in most applications, magnesium alloys are intended for operation in environments with room temperature, these alloys are subject to elevated temperature and oxidizing atmosphere in various stages of preparation (casting, welding, thermal treatment. At present, the studies focus on development of alloys with magnesium matrix, intended for plastic forming. The paper presents results of studies on oxidation rate of WE43 and ZRE1 magnesium foundry alloys in dry and humidified atmosphere of N2+1%O2. Measurements of the oxidation rate were carried out using a Setaram thermobalance in the temperature range of 350-480°C. Corrosion products were analyzed by SEM-SEI, BSE and EDS. It was found that the oxide layer on the WE43 alloy has a very good resistance to oxidation. The high protective properties of the layer should be attributed to the presence of yttrium in this alloy. On the other hand, a porous, two-layer scale with a low adhesion to the substrate forms on the ZRE1 alloy. The increase in the sample mass in dry gas is lower than that in humidified gas.
Arai, Teppei; Kojima, Ryo; Motegi, Yoshiki; Kato, Jun; Kasumi, Takafumi; Ogihara, Jun
2015-12-01
The production of pigments as secondary metabolites by microbes is known to vary by species and by physiological conditions within a single strain. The fungus strain Penicillium purpurogenum IAM15392 has been found to produce violet pigment (PP-V) and orange pigment (PP-O),Monascus azaphilone pigment homologues, when grown under specific culture conditions. In this study, we analysed PP-V and PP-O production capability in seven strains of P. purpurogenum in addition to strain IAM15392 under specific culture conditions. The pigment production pattern of five strains cultivated in PP-V production medium was similar to that of strain IAM15392, and all violet pigments produced by these five strains were confirmed to be PP-V. Strains that did not produce pigment were also identified. In addition, two strains cultivated in PP-O production medium produced a violet pigment identified as PP-V. The ribosomal DNA (rDNA) internal transcribed spacer (ITS) region sequences from the eight P. purpurogenum strains were sequenced and used to construct a neighbor-joining phylogenetic tree. PP-O and PP-V production of P. purpurogenum was shown to be related to phylogenetic placement based on rDNA ITS sequence. Based on these results, two hypotheses for the alteration of pigment production of P. purpurogenum in evolution were proposed. Copyright © 2015 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.
Feasibility of flare gas reformation to practical energy in Farashband gas refinery: no gas flaring.
Rahimpour, Mohammad Reaza; Jokar, Seyyed Mohammad
2012-03-30
A suggested method for controlling the level of hazardous materials in the atmosphere is prevention of combustion in flare. In this work, three methods are proposed to recover flare gas instead of conventional gas-burning in flare at the Farashband gas refinery. These methods aim to minimize environmental and economical disadvantages of burning flare gas. The proposed methods are: (1) gas to liquid (GTL) production, (2) electricity generation with a gas turbine and, (3) compression and injection into the refinery pipelines. To find the most suitable method, the refinery units that send gas to the flare as well as the required equipment for the three aforementioned methods are simulated. These simulations determine the amount of flare gas, the number of GTL barrels, the power generated by the gas turbine and the required compression horsepower. The results of simulation show that 563 barrels/day of valuable GTL products is produced by the first method. The second method provides 25 MW electricity and the third method provides a compressed natural gas with 129 bar pressure for injection to the refinery pipelines. In addition, the economics of flare gas recovery methods are studied and compared. The results show that for the 4.176MMSCFD of gas flared from the Farashband gas refinery, the electricity production gives the highest rate of return (ROR), the lowest payback period, the highest annual profit and mild capital investment. Therefore, the electricity production is the superior method economically. Copyright © 2012 Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Michael, H.
1993-01-01
An overview is presented of the Venezuelan natural gas industry. The structure of PDVSA, the Petroleos de Venezuela Organization, its foreign and domestic affiliates, and its subsidiaries are discussed. Natural gas resources in Venezuela total 290 trillion cubic feet, and Venezuela's share of world, OPEC and latin American production and reserves are 1%, 11% and 26%, respectively for production and 3%, 6% and 49% for reserves. Venezuela's gas pipeline network, plants, production, and marketing are described. Natural gas production and demand forecasts to 2002 are presented. Gas resources are largely located in eastern Venezuela, and large volumes of natural gas non-associated with crude oil will start to become important in the Venezuelan natural gas industry. 19 figs
Lindholm, Lena; Engström, Karl Gunnar
2012-09-01
Gas embolism is an identified problem during cardiopulmonary bypass (CPB). Our aim was to analyze the potential influence from gas solubility based on simple physical laws, here called endogenous gas embolism. Gas solubility decreases at higher temperature and gas bubbles are presumably formed at CPB warming. An experimental model to measure gas release was designed. Medium (water or blood retrieved from mediastinal drains, 14.6 mL) was incubated and equilibrated with gas (air, 100% oxygen, or 5% carbon dioxide in air) at low temperature (10 degrees C or 23 degrees C). At warming to 37 degrees C, gas release was digitally measured. Also, the effect of fluid motion was evaluated. At warming, the medium became oversaturated with dissolved gas. When fluid motion was applied, gas was released to form bubbles. This was exemplified by a gas release of .45% (.31/.54, medians and quartile range, volume percent, p = .007) and 1.26% (1.14/ 1.33, p = .003) when blood was warmed from 23 degrees C or 10 degrees C to 37 degrees C, respectively (carbon dioxide 5% in air). Consistent findings were seen for water and with the other types of gas exposure. The theory of endogenous gas embolization was confirmed with gas being released at warming. The endogenous gas formation demonstrated a dynamic pattern with oversaturation and with rapid gas released at fluid motion. The gas release at warming was substantial, in particular when the results were extrapolated to full-scale CPB conditions. The interference from endogenous gas formation should be considered in parallel to external sources of gas microemboli. cardiopulmonary bypass, gas embolization, microemboli, gas solubility, temperature.
Greenhouse gas and energy analysis of substitute natural gas from biomass for space heat
International Nuclear Information System (INIS)
Pucker, Johanna; Zwart, Robin; Jungmeier, Gerfried
2012-01-01
In this paper, the greenhouse gas and energy balances of the production and use for space heating of substitute natural gas from biomass (bio-SNG) for space heat are analysed. These balances are compared to the use of natural gas and solid biomass as wood chips to provide the same service. The reduction of the greenhouse gas emissions (CO 2 -eq.) – carbon dioxide, methane and nitrous oxide – and of the fossil primary energy use is investigated in a life cycle assessment (LCA). This assessment was performed for nine systems for bio-SNG; three types of gasification technologies (O 2 -blown entrained flow, O 2 -blown circulating fluidised bed and air–steam indirect gasification) with three different types of feedstock (forest residues, miscanthus and short rotation forestry). The greenhouse gas analysis shows that forest residues using the air–steam indirect gasification technology result in the lowest greenhouse gas emissions (in CO 2 -eq. 32 kg MWh −1 of heat output). This combination results in 80% reduction of greenhouse gas emissions when compared to natural gas and a 29% reduction of greenhouse gases if the forest residues were converted to wood chips and combusted. The gasification technologies O 2 -blown entrained flow and O 2 -blown circulating fluidised bed gasification have higher greenhouse gas emissions that range between in CO 2 -eq. 41 to 75 kg MWh −1 of heat output depending on the feedstock. When comparing feedstocks in the bio-SNG systems, miscanthus had the highest greenhouse gas emissions bio-SNG systems producing in CO 2 -eq. 57–75 kg MWh −1 of heat output. Energy analysis shows that the total primary energy use is higher for bio-SNG systems (1.59–2.13 MWh MWh −1 of heat output) than for the reference systems (in 1.37–1.51 MWh MWh −1 of heat output). However, with bio-SNG the fossil primary energy consumption is reduced compared to natural gas. For example, fossil primary energy use is reduced by 92% when air
Power generation from landfill gas workshop discussion of Session 1
International Nuclear Information System (INIS)
Loning, A.; Bevan, G.; Moss, H.
1992-01-01
The discussion following presentations on the UK Dept. of Energy's involvement with power generation form landfill gas and the UK Government's attitude to pollution prevention from landfill gas power production is presented. The discussion focusses particularly on the Non-Fossil Fuel Obligation. (UK)
Greenhouse gas and energy analysis of substitute natural gas from biomass for space heat
Energy Technology Data Exchange (ETDEWEB)
Pucker, J.; Jungmeier, G. [JOANNEUM RESEARCH Forschungsgesellschaft mbH, RESOURCES - Institute for Water, Energy and Sustainability, Steyrergasse 17, 8010 Graz (Austria); Zwart, R. [Energy Research Centre of The Netherlands (ECN), Westerduinweg 3, 1755 LE Petten (Netherlands)
2012-03-15
In this paper, the greenhouse gas and energy balances of the production and use for space heating of substitute natural gas from biomass (bio-SNG) for space heat are analysed. These balances are compared to the use of natural gas and solid biomass as wood chips to provide the same service. The reduction of the greenhouse gas emissions (CO{sub 2}-eq.) - carbon dioxide, methane and nitrous oxide - and of the fossil primary energy use is investigated in a life cycle assessment (LCA). This assessment was performed for nine systems for bio-SNG; three types of gasification technologies (O{sub 2}-blown entrained flow, O{sub 2}-blown circulating fluidised bed and air-steam indirect gasification) with three different types of feedstock (forest residues, miscanthus and short rotation forestry). The greenhouse gas analysis shows that forest residues using the air-steam indirect gasification technology result in the lowest greenhouse gas emissions (in CO{sub 2}-eq. 32 kg MWh{sup -1} of heat output). This combination results in 80% reduction of greenhouse gas emissions when compared to natural gas and a 29% reduction of greenhouse gases if the forest residues were converted to wood chips and combusted. The gasification technologies O{sub 2}-blown entrained flow and O{sub 2}-blown circulating fluidised bed gasification have higher greenhouse gas emissions that range between in CO{sub 2}-eq. 41 to 75 kg MWh{sup -1} of heat output depending on the feedstock. When comparing feedstocks in the bio-SNG systems, miscanthus had the highest greenhouse gas emissions bio-SNG systems producing in CO2-eq. 57-75 kg MWh{sup -1} of heat output. Energy analysis shows that the total primary energy use is higher for bio-SNG systems (1.59-2.13 MWh MWh{sup -1} of heat output) than for the reference systems (in 1.37-1.51 MWh MWh{sup -1} of heat output). However, with bio-SNG the fossil primary energy consumption is reduced compared to natural gas. For example, fossil primary energy use is reduced by
The group 1 pathogenesis-related (PR-1) proteins originally identified from plants and their homologues are also found in other eukaryotic kingdoms. Studies on non-plant PR-1-like (PR-1L) proteins have been pursued widely in humans/animals but rarely in filamentous ascomycetes. Here we report the ch...
International Nuclear Information System (INIS)
Vijaysri, Sangeetha; Talasela, Latha; Mercer, Andrew A.; Mcinnes, Colin J.; Jacobs, Bertram L.; Langland, Jeffrey O.
2003-01-01
Orf virus (OV), the prototypic parapoxvirus, is resistant to the effects of interferon (IFN) and this function of OV has been mapped to the OV20.0L gene. The protein product of this gene shares 31% amino acid identity to the E3L-encoded protein of vaccinia virus (VV) that is required for the broad host range and IFN-resistant phenotype of VV in cells in culture and for virulence of the virus in vivo. In this study we investigated whether the distantly related OV E3L homologue could complement the deletion of E3L in VV. The recombinant VV (VV/ORF-E3L) expressing the OV E3L homologue in place of VV E3L was indistinguishable from wt VV in its cell-culture phenotype. But VV/ORF-E3L was over a 1000-fold less pathogenic than wt VV (LD 50 > 5 x 10 6 PFU, compared to LD 50 of wtVV = 4 x 10 3 PFU) following intranasal infection of mice. While wt VV spread to the lungs and brain and replicated to high titers in the brain of infected mice, VV/ORF-E3L could not be detected in the lungs or brain following intranasal infection. VV/ORF-E3L was at least 100,000-fold less pathogenic than wt VV on intracranial injection. Domain swap experiments demonstrate that the difference in pathogenesis maps to the C-terminal domain of these proteins. This domain has been shown to be required for the dsRNA binding function of the VV E3L
ORIGINS OF SCATTER IN THE RELATIONSHIP BETWEEN HCN 1-0 AND DENSE GAS MASS IN THE GALACTIC CENTER
Energy Technology Data Exchange (ETDEWEB)
Mills, Elisabeth A. C. [San Jose State University, 1 Washington Square, San Jose, CA 95192 (United States); Battersby, Cara, E-mail: elisabeth.mills@sjsu.edu [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States)
2017-01-20
We investigate the correlation of HCN 1-0 with gas mass in the central 300 pc of the Galaxy. We find that on the ∼10 pc size scale of individual cloud cores, HCN 1-0 is well correlated with dense gas mass when plotted as a log–log relationship. There is ∼0.75 dex of scatter in this relationship from clouds like Sgr B2, which has an integrated HCN 1-0 intensity of a cloud less than half its mass, and others that have HCN 1-0 enhanced by a factor of 2–3 relative to clouds of comparable mass. We identify the two primary sources of scatter to be self-absorption and variations in HCN abundance. We also find that the extended HCN 1-0 emission is more intense per unit mass than in individual cloud cores. In fact the majority (80%) of HCN 1-0 emission comes from extended gas with column densities below 7 × 10{sup 22} cm{sup −2}, accounting for 68% of the total mass. We find variations in the brightness of HCN 1-0 would only yield a ∼10% error in the dense gas mass inferred from this line in the Galactic center. However, the observed order of magnitude HCN abundance variations, and the systematic nature of these variations, warn of potential biases in the use of HCN as dense gas mass tracer in more extreme environments such as an active galactic nucleus and shock-dominated regions. We also investigate other 3 mm tracers, finding that HNCO is better correlated with mass than HCN, and might be a better tracer of cloud mass in this environment.
DEFF Research Database (Denmark)
Bachmann, E; Krogh, T N; Højrup, P
1996-01-01
The mouse homologue to human fetal antigen 1 (hFA1) was purified from mouse amniotic fluid by cation exchange chromatography and immunospecific affinity chromatography. Mouse FA1 (mFA1) is a single chain glycoprotein with an M(r) of 42-50 kDa (SDS-PAGE). The N-terminal amino acid sequence (39...... residues) revealed 74% identity to hFA1 and 100% identity to the translated cDNAs referred to as mouse dlk, pref-1 and SCP-1. mFA1 is the secreted processed molecule encoded by the mRNA defined by these identical mouse cDNAs. Monospecific rabbit anti-mFA1 antibodies, purified by ammonium sulfate...... precipitation and immunospecific affinity chromatography, were used for immunohistochemical and quantitative ELISA techniques. The indirect immunoperoxidase technique demonstrated mFA1 within the endocrine structures of adult mouse pancreas, whereas the exocrine tissue remained unstained. FA1-positive staining...
Ishikawa, Masamichi; Kitano, Ryota
2010-02-16
Polystyrene latex particles showed gas-liquid condensation under the conditions of large particle radius (a > kappa(-1)) and intermediate kappa a, where kappa is the Debye-Hückel parameter and a is the particle radius. The particles were dissolved in deionized water containing ethanol from 0 to 77 vol %, settled to the bottom of the glass plate within 1 h, and then laterally moved toward the center of a cell over a 20 h period in reaching a state of equilibrium condensation. All of the suspensions that were 1 and 3 microm in diameter and 0.01-0.20 vol % in concentration realized similar gas-liquid condensation with clear gas-liquid boundaries. In 50 vol % ethanol solvent, additional ethanol was added to enhance the sedimentation force so as to restrict the particles in a monoparticle layer thickness. The coexistence of gas-liquid-solid (crystalline solid) was microscopically recognized from the periphery to the center of the condensates. A phase diagram of the gas-liquid condensation was created as a function of KCl concentration at a particle diameter of 3 microm, 0.10 vol % concentration, and 50:50 water/ethanol solvent at room temperature. The miscibility gap was observed in the concentration range from 1 to 250 microM. There was an upper limit of salt concentration where the phase separation disappeared, showing nearly critical behavior of macroscopic density fluctuation from 250 microM to 1 mM. These results add new experimental evidence to the existence of colloidal gas-liquid condensation and specify conditions of like-charge attraction between particles.
Suarez, Sebastián A; Muller, Federico; Gutiérrez Suburu, Matías E; Fonrouge, Ana; Baggio, Ricardo F; Cukiernik, Fabio D
2016-10-01
The crystalline structures of four homologues of the 1,2-dibromo-4,5-dialkoxybenzene series [Br 2 C 6 H 2 (OC n H 2n + 1 ) 2 for n = 2, 12, 14 and 18] have been solved by means of single-crystal crystallography. Comparison along the series, including the previously reported n = 10 and n = 16 derivatives, shows a clear metric trend (b and c essentially fixed along the series and a growing linearly with n), in spite of some subtle differences in space groups and/or packing modes. A uniform packing pattern for the aliphatic chains has been found for the n = 12 to 18 homologues, which slightly differs from that of the n = 10 derivative. The crystalline structures of all the higher homologues (n = 10-18) seem to arise from van der Waals interchain interactions and, to a lesser extent, type II Br...Br interactions. The dominant role of interchain interactions provides direct structural support for the usual interpretation of melting point trends like that found along this series. Atoms in Molecules (AIM) analysis allows a comparison of the relative magnitude of the interchain and Br...Br interactions, an analysis validated by the measured melting enthalpies.
Vogel, S. de; Bongaerts, B.W.C.; Wouters, K.A.D.; Kester, A.D.M.; Schouten, L.J.; Goeij, A.F.P.M. de; Bruïne, A.P. de; Goldbohm, R.A.; Brandt, P.A. van den; Engeland, M. van; Weijenberg, M.P.
2008-01-01
Intake of dietary factors that serve as methyl group donors may influence promoter hypermethylation in colorectal carcinogenesis. We investigated whether dietary folate, vitamin B2 and vitamin B6, methionine and alcohol were associated with mutL homologue 1 (MLH1) hypermethylation and the related
The first genome sequence of a metatherian herpesvirus: Macropodid herpesvirus 1.
Vaz, Paola K; Mahony, Timothy J; Hartley, Carol A; Fowler, Elizabeth V; Ficorilli, Nino; Lee, Sang W; Gilkerson, James R; Browning, Glenn F; Devlin, Joanne M
2016-01-22
While many placental herpesvirus genomes have been fully sequenced, the complete genome of a marsupial herpesvirus has not been described. Here we present the first genome sequence of a metatherian herpesvirus, Macropodid herpesvirus 1 (MaHV-1). The MaHV-1 viral genome was sequenced using an Illumina MiSeq sequencer, de novo assembly was performed and the genome was annotated. The MaHV-1 genome was 140 kbp in length and clustered phylogenetically with the primate simplexviruses, sharing 67% nucleotide sequence identity with Human herpesviruses 1 and 2. The MaHV-1 genome contained 66 predicted open reading frames (ORFs) homologous to those in other herpesvirus genomes, but lacked homologues of UL3, UL4, UL56 and glycoprotein J. This is the first alphaherpesvirus genome that has been found to lack the UL3 and UL4 homologues. We identified six novel ORFs and confirmed their transcription by RT-PCR. This is the first genome sequence of a herpesvirus that infects metatherians, a taxonomically unique mammalian clade. Members of the Simplexvirus genus are remarkably conserved, so the absence of ORFs otherwise retained in eutherian and avian alphaherpesviruses contributes to our understanding of the Alphaherpesvirinae. Further study of metatherian herpesvirus genetics and pathogenesis provides a unique approach to understanding herpesvirus-mammalian interactions.
Rio Vista gas leak study: Belleaire Gas Field, California
International Nuclear Information System (INIS)
Wilkey, P.L.
1992-08-01
The Rio Vista gas leak study evaluated methods for remotely sensing gas leaks from buried pipelines and developed methods to elucidate methane transport and microbial oxidation in soils. Remote-sensing methods were evaluated by singing gas leaks along an abandoned Pacific Gas and Electric (PG ampersand E) gas field collection line in northern California and applying surface-based and airborne remote-sensing techniques in the field, including thermal imaging, laser imaging, and multispectral imagery. The remote-sensing techniques exhibited limitations in range and in their ability to correlate with ground truth data. To elucidate methane transport and microbial oxidation in soils, a study of a controlled leak permitted field testing of methods so that such processes could be monitored and evaluated. Monitoring and evaluation techniques included (1) field measurement of soil-gas concentrations, temperatures, and pressures; (2) laboratory measurement of soil physical/chemical properties and activity of methane-oxidizing microorganisms by means of field samples; and (3) development of a preliminary numerical analysis technique for combined soil-gas transport/methane oxidation. Soil-gas concentrations at various depths responded rapidly to the high rate of gas leakage. The number of methane-oxidizing microorganisms in site soils rapidly increased when the gas leak was initiated and decreased after the leak was terminated. The preliminary field, laboratory, and numerical analysis techniques tested for this study of a controlled gas leak could be successfully applied to future studies of gas leaks. Because soil-gas movement is rapid and temporally variable, the use of several complementary techniques that permit generalization of site-specific results is favored
Gas/particle partitioning of carbonyls in the photooxidation of isoprene and 1,3,5-trimethylbenzene
Directory of Open Access Journals (Sweden)
R. M. Healy
2008-06-01
Full Text Available A new denuder-filter sampling technique has been used to investigate the gas/particle partitioning behaviour of the carbonyl products from the photooxidation of isoprene and 1,3,5-trimethylbenzene. A series of experiments was performed in two atmospheric simulation chambers at atmospheric pressure and ambient temperature in the presence of NOx and at a relative humidity of approximately 50%. The denuder and filter were both coated with the derivatizing agent O-(2,3,4,5,6-pentafluorobenzyl-hydroxylamine (PFBHA to enable the efficient collection of gas- and particle-phase carbonyls respectively. The tubes and filters were extracted and carbonyls identified as their oxime derivatives by GC-MS. The carbonyl products identified in the experiments accounted for around 5% and 10% of the mass of secondary organic aerosol formed from the photooxidation of isoprene and 1,3,5-trimethylbenzene respectively.
Experimental gas/particle partitioning coefficients were determined for a wide range of carbonyl products formed from the photooxidation of isoprene and 1,3,5-trimethylbenzene and compared with the theoretical values based on standard absorptive partitioning theory. Photooxidation products with a single carbonyl moiety were not observed in the particle phase, but dicarbonyls, and in particular, glyoxal and methylglyoxal, exhibited gas/particle partitioning coefficients several orders of magnitude higher than expected theoretically. These findings support the importance of heterogeneous and particle-phase chemical reactions for SOA formation and growth during the atmospheric degradation of anthropogenic and biogenic hydrocarbons.
Analytical treatment of gas flows through multilayer insulation, project 1
Lin, J. T.
1972-01-01
A theoretical investigation of gas flow inside a multilayer insulation system was made for the case of the broadside pumping process. A set of simultaneous first-order differential equations for the temperature and pressure of the gas molecules through the perforations on the insulation layers. A modified Runge-Kutta method was used for numerical experiment. The numerical stability problem was also investigated. It was shown that when the relaxation time is less than the time period over which the gas properties change appreciably, the set of differential equations can be replaced by a set of algebraic equations for solution. Numerical examples were given and comparisons with experimental data were made.
HTGR gas turbine program. Semiannual progress report, April 1-September 30, 1978
International Nuclear Information System (INIS)
1979-12-01
This report describes work performed under the gas turbine HTGR (HTGR-GT) program, Department of Energy Contract DE-AT03-76-SF70046, during the period April 1, 1978 through September 30, 1978. The work reported covers the demonstration and commercial plant concept studies including plant layout, heat exchanger studies, turbomachine studies, systems analysis, and reactor core engineering
International Nuclear Information System (INIS)
Masuda, T.
1990-01-01
This paper reports on natural gas which now appears ready to take a leading role on the world energy stage. Demand for natural gas, and specifically LNG, will be strong throughout the world, particularly in Asia. Indonesia and Malaysia will become much more dependent on natural gas in the Asian market. In Thailand, where remarkable economic growth has been fueled by imported oil and domestically produced natural gas, LNG may soon have to be imported from neighboring countries. The author sees Thailand's imports of natural gas increasing from 1.5 to 4.5 million tons annually. Similarly, Korea's imports of LNG will rise from 2 to 8 million tons between 1987 and 2000. In Japan, energy demand is expected to increase at an even faster rate in the 1990s. Given the opposition to nuclear power generation and growing concern about the greenhouse effect, it is likely that LNG will satisfy a major portion of Japan's increasing demand for energy. Japanese gas companies are studying the possibility of establishing a national pipeline network to move gas beyond metropolitan areas
Characterization of Mixed xWO3(1-xY2O3 Nanoparticle Thick Film for Gas Sensing Application
Directory of Open Access Journals (Sweden)
M. H. Shahrokh Abadi
2010-05-01
Full Text Available Microstructural, topology, inner morphology, and gas-sensitivity of mixed xWO3(1-xY2O3 nanoparticles (x = 1, 0.95, 0.9, 0.85, 0.8 thick-film semiconductor gas sensors were studied. The surface topography and inner morphological properties of the mixed powder and sensing film were characterized with X-ray diffraction (XRD, atomic force microscopy (AFM, transmission electron microscopy (TEM, and scanning electron microscopy (SEM. Also, gas sensitivity properties of the printed films were evaluated in the presence of methane (CH4 and butane (C4H10 at up to 500 °C operating temperature of the sensor. The results show that the doping agent can modify some structural properties and gas sensitivity of the mixed powder.
Gas Flow Measurements On IFA-504 And IFA-6 10.1
International Nuclear Information System (INIS)
Braaten, Knut; Sandberg, Rune V.
1997-12-01
This report covers the recent axial gas flow measurements performed in the Halden reactor on IFA-504 and IFA-610.1. The measurements are performed during hot standby and at power. Gas flow measurements have been performed at regular intervals on the three rods with solid pellets in IFA-504, which has reached a burnup of about 68 MWd/kgUO 2 . The measurements show, as earlier, a decrease in the hydraulic diameters, where rod number 2 has a smaller hydraulic diameter than rod number 1 and 3. Rod 1, 2 and 3 have, at the end of -97, hydraulic diameters of 9, 2.5 and 9.5 jim respectively at full power (15 kW/m). IFA-610.1 was loaded into the core in July-97 with a pre-irradiated segment, and has as of December -97 a burnup of 54 MWd/kgUO 2 . The primary objective of this rig was to perform a 'lift off' experiment where internal pressurisation of the test rod should provoke cladding creep out which would also cause an increase in the flow area. The fuel rod was pressurised to 300 bar overpressure, by steps of 50 bar. The results show an increase in the pellet-clad hydraulic diameter of 4-5 mm that occurred upon pressurisation from 0 to 200 bar overpressure. There was no sign of any further increase in the hydraulic diameter after pressurisation to 300 bar for one week. The operation with 300 bar overpressure will be continued. (author)
Examination and vibration characteristics of gas circulator (B1) of HENDEL
International Nuclear Information System (INIS)
Shimomura, Hiroaki; Izawa, Naoki; Ihzuka, Takayuki; Kawaji, Satoshi; Kunitama, Takehiko; Hayashi, Haruyoshi; Kobayashi, Toshiaki; Katoh, Michio
1985-06-01
An examination and vibration measurements were conducted on the gas bearing type high speed helium gas circulator after the failure on April 1984 and the repairing on August 1984. The examination made clear that the cause of the failure and scratching of gas bearing pads and journal shaft was found. The vibrational spectra showed a clear difference between failed and repaired conditions, and a frequency analysis technique by means of fast Fourier transform and a small-scale computer is expected as a useful method of diagnosis for circulators. A conceptual scheme of gas circulator diagnostic system based on above principle is shown, and a basic process of diagnostic software is described. (author)
Energy Technology Data Exchange (ETDEWEB)
Welink, Jan-Henk; Dumont, M.; Kwant, K. Datum januari 2007
2007-01-15
In 2004 a study was published on green gas. Green gas is defined as a gaseous energy carrier from renewable biomass with a similar quality as natural gas. As a result of new developments in the field of co-digestion/fermentation the Dutch Ministry of Economic Affairs asked it's agency SenterNovem to update the 2004 study. The aim of the update is (1) to gain insight into operational aspects of green gas projects, e.g. reliability, efficiency and maintenance aspects; (2) stimulate the production of green gas, taking into account the economics of green gas projects, calculation of the financial gap of green gas production, efficient use of biogas (conversion to electricity or directly input into the natural gas distribution systems, and aspects with regard to commercialization and the market; and (3) the potential of green gas. [Dutch] De laatste jaren wordt er gewerkt aan initiatieven om groen gas te produceren. Een recent initiatief is het opwaarderen van biogas tot aardgaskwaliteit door Biogast, wat er toe zal leiden dat al deze zomer Eneco op kleinschalig niveau duurzaam gas levert aan eindverbruikers. Het potentieel aan groen gas dat mogelijk gemaakt zou kunnen worden, is de laatste jaren ook veranderd. Met name de voorspoedige ontwikkelingen op het gebied van co-vergisting met mest zorgen voor een toename van het potentieel. In 2004 is een studie gemaakt over groen gas. Vanwege de voorspoedige ontwikkelingen op het gebied van co-vergisting is de situatie die gold voor het rapport uit 2004 veranderd. Het ministerie van Economische Zaken heeft SenterNovem gevraagd om een update te maken van de studie over groen gas uit 2004. De doelstelling van de update van deze studie Groen Gas is (1) het verkrijgen van inzicht op basis van de huidige ontwikkelingen, in: de bedrijfstechnische aspecten van dergelijke projecten, zoals betrouwbaarheid, rendement en onderhoudsaspecten; (2) aspecten voor het mogelijk stimuleren van de productie van groen gas. Hierbij hoort: (a
Zhu, Ling; Song, Linsheng; Zhang, Huan; Zhao, Jianmin; Li, Chenghua; Xu, Wei
2008-06-01
Apoptosis is an active process of cell death, which is an integral part of growth and development in multicellular organisms. The defender against cell death 1 (DAD1), the regulatory protein to inhibit the apoptosis process, was first cloned from the bay scallop Argopecten irradians by randomly sequencing a whole tissue cDNA library and rapid amplification of cDNA end (RACE). The full-length cDNA of the A. irradians DAD1 was 607 bp, consist of a 5'-terminal untranslated region (UTR) of 63 bp, a 3'-terminal UTR of 205 bp with a canonical polyadenylation signal sequence AATAAA and a poly (A) tail, and an open reading frame of 339 bp. The deduced amino acid sequence of the A. irradians DAD1 showed 75.5% identity to Araneus ventricosus, 74.5% to Drosophila melanogaster, and 73.6% to Homo sapiens, Sus scrofa, Mesocricetus auratus, Rattus norvegicus and Mus musculus. Excluding the Saccharomyces cerevisiae DAD1 homologue, all animal DAD1 including A. irradians DAD1 homologue formed a subgroup and all plant DAD1 proteins formed another subgroup in the phylogenetic analysis. The A. irradians DAD1 was expressed in all examined tissues including adductor muscle, mantle, gills, digestive gland, gonad and hemolymph, suggesting that A. irradians DAD1 is expressed in most body tissues. Furthermore, the mRNA expression levels of A. irradians DAD1 gene of hemolymph were particularly high after injury, suggesting that the gene is responsive to injury stimuli.
International Nuclear Information System (INIS)
1998-01-01
The New Brunswick government intends to award a franchise to establish natural gas distribution in the province. To this end, the province wishes to invite bids from qualified entities to establish gas distribution facilities. The province will select the preferred bidder(s) through a two-stage competitive bidding process. This document details the province's policy objectives, questions and issues to be addressed in stage 1 of the process, and the schedule for the process. Appendices include copies of relevant provincial statutes and regulations
Boltorn-Modified Poly(2,6-dimethyl-1,4,phenylene oxide) Gas Separation Membranes
Sterescu, D.M.; Stamatialis, Dimitrios; Mendes, Eduardo; Kruse, Jan; Rätzke, Klaus; Faupel, Franz; Wessling, Matthias
2007-01-01
This paper describes the preparation, characterization and the permeation properties of poly(2,6-dimethyl-1,4-phenylene oxide) (PPO) dense polymer films containing aliphatic hyperbranched polyesters, Boltorn (H20, H30, and H40). The Boltorn are dispersed in PPO at various concentrations. The gas
USING IN VIVO GAS UPTAKE STUDIES TO ESTIMATE METABOLIC RATE CONSTANTS FOR CCL CHEMICALS: 1,1-DICHLOROPROPENE AND 2,2-DICHLOROPROPANE. Mitchell, C T, Evans, M V, Kenyon, E M. NHEERL, U.S. EPA, ORD, ETD, RTP, NC The Safe Drinking Water Act Amendments of 1996 required ...
Natural gas pipeline technology overview.
Energy Technology Data Exchange (ETDEWEB)
Folga, S. M.; Decision and Information Sciences
2007-11-01
The United States relies on natural gas for one-quarter of its energy needs. In 2001 alone, the nation consumed 21.5 trillion cubic feet of natural gas. A large portion of natural gas pipeline capacity within the United States is directed from major production areas in Texas and Louisiana, Wyoming, and other states to markets in the western, eastern, and midwestern regions of the country. In the past 10 years, increasing levels of gas from Canada have also been brought into these markets (EIA 2007). The United States has several major natural gas production basins and an extensive natural gas pipeline network, with almost 95% of U.S. natural gas imports coming from Canada. At present, the gas pipeline infrastructure is more developed between Canada and the United States than between Mexico and the United States. Gas flows from Canada to the United States through several major pipelines feeding U.S. markets in the Midwest, Northeast, Pacific Northwest, and California. Some key examples are the Alliance Pipeline, the Northern Border Pipeline, the Maritimes & Northeast Pipeline, the TransCanada Pipeline System, and Westcoast Energy pipelines. Major connections join Texas and northeastern Mexico, with additional connections to Arizona and between California and Baja California, Mexico (INGAA 2007). Of the natural gas consumed in the United States, 85% is produced domestically. Figure 1.1-1 shows the complex North American natural gas network. The pipeline transmission system--the 'interstate highway' for natural gas--consists of 180,000 miles of high-strength steel pipe varying in diameter, normally between 30 and 36 inches in diameter. The primary function of the transmission pipeline company is to move huge amounts of natural gas thousands of miles from producing regions to local natural gas utility delivery points. These delivery points, called 'city gate stations', are usually owned by distribution companies, although some are owned by
Nicosia, Aldo; Bennici, Carmelo; Biondo, Girolama; Costa, Salvatore; Di Natale, Marilena; Masullo, Tiziana; Monastero, Calogera; Ragusa, Maria Antonietta; Tagliavia, Marcello; Cuttitta, Angela
2018-01-11
Gene family encoding translationally controlled tumour protein (TCTP) is defined as highly conserved among organisms; however, there is limited knowledge of non-bilateria. In this study, the first TCTP homologue from anthozoan was characterised in the Mediterranean Sea anemone, Anemonia viridis . The release of the genome sequence of Acropora digitifera , Exaiptasia pallida , Nematostella vectensis and Hydra vulgaris enabled a comprehensive study of the molecular evolution of TCTP family among cnidarians. A comparison among TCTP members from Cnidaria and Bilateria showed conserved intron exon organization, evolutionary conserved TCTP signatures and 3D protein structure. The pattern of mRNA expression profile was also defined in A. viridis . These analyses revealed a constitutive mRNA expression especially in tissues with active proliferation. Additionally, the transcriptional profile of A. viridis TCTP ( AvTCTP ) after challenges with different abiotic/biotic stresses showed induction by extreme temperatures, heavy metals exposure and immune stimulation. These results suggest the involvement of AvTCTP in the sea anemone defensome taking part in environmental stress and immune responses.
Directory of Open Access Journals (Sweden)
Aldo Nicosia
2018-01-01
Full Text Available Gene family encoding translationally controlled tumour protein (TCTP is defined as highly conserved among organisms; however, there is limited knowledge of non-bilateria. In this study, the first TCTP homologue from anthozoan was characterised in the Mediterranean Sea anemone, Anemonia viridis. The release of the genome sequence of Acropora digitifera, Exaiptasia pallida, Nematostella vectensis and Hydra vulgaris enabled a comprehensive study of the molecular evolution of TCTP family among cnidarians. A comparison among TCTP members from Cnidaria and Bilateria showed conserved intron exon organization, evolutionary conserved TCTP signatures and 3D protein structure. The pattern of mRNA expression profile was also defined in A. viridis. These analyses revealed a constitutive mRNA expression especially in tissues with active proliferation. Additionally, the transcriptional profile of A. viridis TCTP (AvTCTP after challenges with different abiotic/biotic stresses showed induction by extreme temperatures, heavy metals exposure and immune stimulation. These results suggest the involvement of AvTCTP in the sea anemone defensome taking part in environmental stress and immune responses.
Exact Extremal Statistics in the Classical 1D Coulomb Gas
Dhar, Abhishek; Kundu, Anupam; Majumdar, Satya N.; Sabhapandit, Sanjib; Schehr, Grégory
2017-08-01
We consider a one-dimensional classical Coulomb gas of N -like charges in a harmonic potential—also known as the one-dimensional one-component plasma. We compute, analytically, the probability distribution of the position xmax of the rightmost charge in the limit of large N . We show that the typical fluctuations of xmax around its mean are described by a nontrivial scaling function, with asymmetric tails. This distribution is different from the Tracy-Widom distribution of xmax for Dyson's log gas. We also compute the large deviation functions of xmax explicitly and show that the system exhibits a third-order phase transition, as in the log gas. Our theoretical predictions are verified numerically.
International Nuclear Information System (INIS)
Groenewegen, G.G.
1992-01-01
On a conference (Gas for Europe in the 1990's) during the Gasexpo '91 the author held a speech of which the Dutch text is presented here. Attention is paid to the current European pricing methods (prices based on the costs of buying, transporting and distributing the natural gas and prices based on the market value, which is deducted from the prices of alternative fuels), and the transparency of the prices (lack of information on the way the prices are determined). Also attention is paid to the market signal transparency and gas-gas competition, which means a more or less free market of gas distribution. The risks of gas-to-gas competition for a long term price stability, investment policies and security of supply are discussed. Opposition against the Third Party Access (TPA), which is the program to implement gas-to-gas competition, is caused by the fear of natural gas companies for lower gas prices and lower profits. Finally attention is paid to government regulation and the activities of the European Commission (EC) in this matter. 1 fig., 6 ills., 1 tab
Duval, J.M.; Duval, J.-M.; Folkers, Albertje; Mulder, M.H.V.; Desgrandchamps, G.; Smolders, C.A.; Smolders, C.A.
1993-01-01
The effect of the introduction of specific adsorbents on the gas separation properties of polymeric membranes has been studied. For this purpose both carbon molecular sieves and zeolites are considered. The results show that zeolites such as silicate-1, 13X and KY improve to a large extent the
Bosteels, Michel; Haider, S
2001-01-01
Both LHCb RICH will be operated with fluorocarbon as gas radiator. RICH 1 will be filled with 4m^3 of C4F10 and RICH 2 with 100m^3 of CF4. The gas systems will run as a closed loop circulation and a gas recovery system within the closed loop is planned for RICH 1, where the recovery of the CF4 will only be realised during filling and emptying of the detector. Inline gas purification is foreseen for the gas systems in order to limit water and oxygen impurities.
Dindar, Gülcin; Anger, Andreas M; Mehlhorn, Christine; Hake, Sandra B; Janzen, Christian J
2014-11-12
DOT1 enzymes are conserved methyltransferases that catalyse the methylation of lysine 79 on histone H3 (H3K79). Most eukaryotes contain one DOT1 enzyme, whereas African trypanosomes have two homologues, DOT1A and DOT1B, with different enzymatic activities. DOT1A mediates mono- and dimethylation of H3K76, the homologue of H3K79 in other organisms, whereas DOT1B additionally catalyses H3K76 trimethylation. However, it is unclear how these different enzymatic activities are achieved. Here we employ a trypanosomal nucleosome reconstitution system and structure-guided homology modelling to identify critical residues within and outside the catalytic centre that modulate product specificity. Exchange of these residues transfers the product specificity from one enzyme to the other, and reveals the existence of distinct regulatory domains adjacent to the catalytic centre. Our study provides the first evidence that a few crucial residues in DOT1 enzymes are sufficient to catalyse methyl-state-specific reactions. These results might also have far-reaching consequences for the functional understanding of homologous enzymes in higher eukaryotes.
Organtini, Kari L; Myers, Anne L; Jobst, Karl J; Reiner, Eric J; Ross, Brian; Ladak, Adam; Mullin, Lauren; Stevens, Douglas; Dorman, Frank L
2015-10-20
Residential and commercial fires generate a complex mixture of volatile, semivolatile, and nonvolatile compounds. This study focused on the semi/nonvolatile components of fire debris to better understand firefighter exposure risks. Using the enhanced sensitivity of gas chromatography coupled to atmospheric pressure ionization-tandem mass spectrometry (APGC-MS/MS), complex fire debris samples collected from simulation fires were analyzed for the presence of potentially toxic polyhalogenated dibenzo-p-dioxins and dibenzofurans (PXDD/Fs and PBDD/Fs). Extensive method development was performed to create multiple reaction monitoring (MRM) methods for a wide range of PXDD/Fs from dihalogenated through hexa-halogenated homologue groups. Higher halogenated compounds were not observed due to difficulty eluting them off the long column used for analysis. This methodology was able to identify both polyhalogenated (mixed bromo-/chloro- and polybromo-) dibenzo-p-dioxins and dibenzofurans in the simulated burn study samples collected, with the dibenzofuran species being the dominant compounds in the samples. Levels of these compounds were quantified as total homologue groups due to the limitations of commercial congener availability. Concentration ranges in household simulation debris were observed at 0.01-5.32 ppb (PXDFs) and 0.18-82.11 ppb (PBDFs). Concentration ranges in electronics simulation debris were observed at 0.10-175.26 ppb (PXDFs) and 0.33-9254.41 ppb (PBDFs). Samples taken from the particulate matter coating the firefighters' helmets contained some of the highest levels of dibenzofurans, ranging from 4.10 ppb to 2.35 ppm. The data suggest that firefighters and first responders at fire scenes are exposed to a complex mixture of potentially hundreds to thousands of different polyhalogenated dibenzo-p-dioxins and dibenzofurans that could negatively impact their health.
Rare gas constraints on the history of Boulder 1, Station 2, Apollo 17
International Nuclear Information System (INIS)
Leich, D.A.; Kahl, S.B.; Kirschbaum, A.R.; Niemeyer, S.; Phinney, D.
1975-01-01
Rare gas isotopic analyses have been performed on both pile-irradiated and unirradiated samples from Boulder 1, Station 2. Two samples from rock 72255, the Civet Cat clast and a sample of adjacent breccia, have concordant 40 Ar- 39 Ar ages of 3.99 +- 0.03 b.y. and 4.01 +- 0.03 b.y., respectively. Several samples from rock 72275 have complex thermal release patterns with no datable features, but an intermediate temperature plateau from the dark rim material of the Marble Cake clast yields an age of 3.99 +- 0.03 b.y., indistinguishable from the age of rock 72255. We regard these ages as upper limits on the time of the Serenitatis basin-forming event. The absence of fossil solar-wind trapped gases in the breccia samples implies that a prior existence for the boulder as near-surface regolith material can be regarded as extremely unlikely. Instead, the small trapped rare-gas components have isotopic and elemental compositions diagnostic of the terrestrial-type trapped component which has previously been identified in several Apollo 16 breccias and in rock 14321. Excess fission Xe is found in all Boulder 1 samples in approximately 1:1 proportions with Xe from spontaneous fission of 238 U. This excess fission Xe is attributed to spontaneous fission of 244 Pu in situ. Cosmic-ray exposure ages for samples from rocks 72215 and 72255 are concordant with mean 81 Kr-Kr exposure ages of 41.4 +- 1.4 m.y. and 44.1 +- 3.3 m.y., respectively. However, a distinctly different 81 Kr-Kr exposure age of 52.5 +- 1.4 m.y. is obtained for samples from rock 72275. A two-stage exposure model is developed to account for this discordance and for the remaining cosmogenic rare-gas data. The first stage was initiated at least 55 m.y. ago, probably as a result of the excavation of the boulder source-crop. A discrete change in shielding depths approx. 35 m.y. ago probably corresponds to the dislodgement of Boulder 1 from the South Massif and emplacement in its present position
Coupling of a two phase gas liquid 3D Darcy flow in fractured porous media with a 1D free gas flow
Brenner , Konstantin; Masson , Roland; Trenty , Laurent; Zhang , Yumeng
2015-01-01
A model coupling a three dimensional gas liquid compositional Darcy flow in a frac-tured porous medium, and a one dimensional compositional free gas flow is presented. The coupling conditions at the interface between the gallery and the porous medium account for the molar normal fluxes continuity for each component, the gas liquid thermody-namical equilibrium, the gas pressure continuity and the gas and liquid molar fractions continuity. The fractures are represented as interfaces of codimens...
Bate-Eya, Laurel T; Gierman, Hinco J; Ebus, Marli E; Koster, Jan; Caron, Huib N; Versteeg, Rogier; Dolman, M Emmy M; Molenaar, Jan J
2017-04-01
Neuroblastoma is predominantly characterised by chromosomal rearrangements. Next to V-Myc Avian Myelocytomatosis Viral Oncogene Neuroblastoma Derived Homolog (MYCN) amplification, chromosome 7 and 17q gains are frequently observed. We identified a neuroblastoma patient with a regional 7q36 gain, encompassing the enhancer of zeste homologue 2 (EZH2) gene. EZH2 is the histone methyltransferase of lysine 27 of histone H3 (H3K27me3) that forms the catalytic subunit of the polycomb repressive complex 2. H3K27me3 is commonly associated with the silencing of genes involved in cellular processes such as cell cycle regulation, cellular differentiation and cancer. High EZH2 expression correlated with poor prognosis and overall survival independent of MYCN amplification status. Unexpectedly, treatment of 3 EZH2-high expressing neuroblastoma cell lines (IMR32, CHP134 and NMB), with EZH2-specific inhibitors (GSK126 and EPZ6438) resulted in only a slight G1 arrest, despite maximum histone methyltransferase activity inhibition. Furthermore, colony formation in cell lines treated with the inhibitors was reduced only at concentrations much higher than necessary for complete inhibition of EZH2 histone methyltransferase activity. Knockdown of the complete protein with three independent shRNAs resulted in a strong apoptotic response and decreased cyclin D1 levels. This apoptotic response could be rescued by overexpressing EZH2ΔSET, a truncated form of wild-type EZH2 lacking the SET transactivation domain necessary for histone methyltransferase activity. Our findings suggest that high EZH2 expression, at least in neuroblastoma, has a survival function independent of its methyltransferase activity. This important finding highlights the need for studies on EZH2 beyond its methyltransferase function and the requirement for compounds that will target EZH2 as a complete protein. Copyright © 2017 Elsevier Ltd. All rights reserved.
Ruppel, Carolyn D.
2018-01-17
Gas hydrate is a naturally occurring, ice-like substance that forms when water and gas combine under high pressure and at moderate temperatures. Methane is the most common gas present in gas hydrate, although other gases may also be included in hydrate structures, particularly in areas close to conventional oil and gas reservoirs. Gas hydrate is widespread in ocean-bottom sediments at water depths greater than 300–500 meters (m; 984–1,640 feet [ft]) and is also present in areas with permanently frozen ground (permafrost). Several countries are evaluating gas hydrate as a possible energy resource in deepwater or permafrost settings. Gas hydrate is also under investigation to determine how environmental change may affect these deposits.
Natural gas and Brazilian energetic matrix; Gas natural no Brasil
Energy Technology Data Exchange (ETDEWEB)
Moraes, Ricardo Luchese de [White Martins S.A., Rio de Janeiro, RJ (Brazil)
1997-07-01
Recent projection of the market in global scale shows a tendency in natural gas using replacing mostly the fuel oil. Its market share well increase from 21.1% in 1994 to 24.0% in 2010. The annual energetic use will reach 29.23 x 10{sup 9} Gcal in 2010 (8990 million Nm{sup 3} natural gas/day) versus 18.90 x 10{sup 9} Gcal in 1994 (5810 million Nm{sup 3} natural gas/day). For Brazil, its consumption will increase from 8.7 million Nm{sup 3} natural gas/day in 1994 to 35.9 million Nm{sup 3} natural gas/day in 2010. Projects like Brazil-Bolivia natural gas pipeline, will supply 18 million Nm{sup 3} natural gas/day, which expected to start-up before the year 2000. This projects will supply the Brazilian southern regions, that do not consume natural gas at the current moment. Although there are many different kind of natural gas consumption in the industry this paper presents the technical and economical estimate of the injection in the blast furnace operating with coke or charcoal. The process simulation is done assisted by math modeling developed by White Martins/Praxair Inc. (author)
The impact of northern gas on North American gas infrastructure
International Nuclear Information System (INIS)
Letwin, S.
2004-01-01
The three business units that Enbridge operates are crude oil pipelines; natural gas liquids (NGL) transportation; and gas transmission and distribution. The need for more infrastructure will increase as the demand for natural gas increases. This presentation outlined the issues that surround and sometimes impede infrastructure development. It also emphasized the need for northern gas supply at a time when conventional natural gas supplies are decreasing and demand is growing. Additional LNG supply is required along with new supply from Alaska, Mackenzie Delta and the east coast. The issue of a secure source of supply was discussed along with northern gas expectations. It is expected that Mackenzie Delta gas (1.2 bcf/day) will be available by 2008 to 2010 and Alaska North Slope gas (4 bcf/day) will be available from 2012 to 2014. Gas demand by industrial, residential, commercial and power generation sectors across North America was illustrated. The challenge lies in creating infrastructure to move the supply to where it is most in demand. General infrastructure issues were reviewed, such as prices, regulatory streamlining, lead times, stakeholder issues and supporting infrastructure. 19 figs
Static and transient characteristics of the shaft seal system for helium gas circulator (Part 1)
International Nuclear Information System (INIS)
Morohoshi, S.; Saki, K.; Nemoto, M.; Taniguchi, S.; Sugimoto, A.; Kojima, M.
1982-01-01
A development program of the shaft seal system for the helium circulator supported by water lubricated bearings is presented. A seal system simulating tester and a computer program which can simulate the transient characteristics of a buffer gas seal system were newly introduced, and an investigation was performed experimentally and analytically of the characteristics of water and gas seals and of the buffer gas seal system including the control system. Main results are as follows: (1) Water seals were especially investigated in detail, and it was found that turbulence in water flow through seal clearance and deformation of seal components affected the leakage characteristics of water seals. They should be considered not only to make safety design but also to get optimum design of the seal system. (2) The calculation method for transient response of the buffer gas seal system including the control system was developed. This digital simulating method can well simulate transients encountered in the tester, and it would make a powerful tool for developing a safe seal system under steady state operation conditions and at depressurization accidents in a reactor
Searching for Faint Traces of CO(2-1) and HCN(4-3) Gas In Debris Disks
Stafford Lambros, Zachary; Hughes, A. Meredith
2018-01-01
The surprising presence of molecular gas in the debris disks around main sequence stars provides an opportunity to study the dissipation of primordial gas and, potentially, the composition of gas in other solar systems. Molecular gas is not expected to survive beyond the pre-main sequence phase, and it is not yet clear whether the gas is a remnant of the primordial protoplanetary material or whether the gas, like the dust, is second-generation material produced by collisional or photodesorption from planetesimals, exocomets, or the icy mantles of dust grains. Here we present two related efforts to characterize the prevalence and properties of gas in debris disks. First, we place the lowest limits to date on the CO emission from an M star debris disk, using 0.3" resolution observations of CO(2-1) emission from the AU Mic system with the Atacama Large Millimeter/submillimeter Array (ALMA). We place a 3-sigma upper limit on the integrated flux of 0.39 Jy km/s, corresponding to a maximum CO mass of 5e10-6 (Earth Masses) if the gas is in LTE. We also present the results of an ALMA search for HCN(4-3) emission from the prototypical gas-rich debris disk around 49 Ceti at a spatial resolution of 0.3". Despite hosting one of the brightest CO-rich debris disks yet discovered, our observations of 49 Ceti also yield a low upper limit of 0.057 Jy km/s in the HCN line, leaving CO as the only molecule clearly detected in emission from a debris disk. We employ several methods of detecting faint line emission from debris disks, including a model based on Keplerian kinematics as well as a spectral shifting method previously used to detect faint CO emission from the Fomalhaut debris disk, and compare our results.
MAKE SUPER-EARTHS, NOT JUPITERS: ACCRETING NEBULAR GAS ONTO SOLID CORES AT 0.1 AU AND BEYOND
Energy Technology Data Exchange (ETDEWEB)
Lee, Eve J.; Chiang, Eugene; Ormel, Chris W., E-mail: evelee@berkeley.edu, E-mail: echiang@astro.berkeley.edu, E-mail: ormel@berkeley.edu [Department of Astronomy, University of California Berkeley, Berkeley, CA 94720-3411 (United States)
2014-12-20
Close-in super-Earths having radii 1-4 R {sub ⊕} may possess hydrogen atmospheres comprising a few percent by mass of their rocky cores. We determine the conditions under which such atmospheres can be accreted by cores from their parent circumstellar disks. Accretion from the nebula is problematic because it is too efficient: we find that 10 M {sub ⊕} cores embedded in solar metallicity disks tend to undergo runaway gas accretion and explode into Jupiters, irrespective of orbital location. The threat of runaway is especially dire at ∼0.1 AU, where solids may coagulate on timescales orders of magnitude shorter than gas clearing times; thus nascent atmospheres on close-in orbits are unlikely to be supported against collapse by planetesimal accretion. The time to runaway accretion is well approximated by the cooling time of the atmosphere's innermost convective zone, whose extent is controlled by where H{sub 2} dissociates. Insofar as the temperatures characterizing H{sub 2} dissociation are universal, timescales for core instability tend not to vary with orbital distance—and to be alarmingly short for 10 M {sub ⊕} cores. Nevertheless, in the thicket of parameter space, we identify two scenarios, not mutually exclusive, that can reproduce the preponderance of percent-by-mass atmospheres for super-Earths at ∼0.1 AU, while still ensuring the formation of Jupiters at ≳ 1 AU. Scenario (a): planets form in disks with dust-to-gas ratios that range from ∼20× solar at 0.1 AU to ∼2× solar at 5 AU. Scenario (b): the final assembly of super-Earth cores from mergers of proto-cores—a process that completes quickly at ∼0.1 AU once begun—is delayed by gas dynamical friction until just before disk gas dissipates completely. Both scenarios predict that the occurrence rate for super-Earths versus orbital distance, and the corresponding rate for Jupiters, should trend in opposite directions, as the former population is transformed into the latter: as
Coal liquefaction and gas conversion: Proceedings. Volume 1
Energy Technology Data Exchange (ETDEWEB)
1993-12-31
Volume I contains papers presented at the following sessions: AR-Coal Liquefaction; Gas to Liquids; and Direct Liquefaction. Selected papers have been processed separately for inclusion in the Energy Science and Technology Database.
Cyclotron resonant gas breakdown with a 1.22-nm 13CH3F laser
International Nuclear Information System (INIS)
Hacker, M.P.; Lax, B.; Metz, R.N.; Temkin, R.J.
1979-01-01
Cyclotron-resonant laser-induced gas breakdown has been studied for the first time in the transverse geometry, using 1.222-nm 13 CH 3 F laser radiation propagating perpendicular to the magnetic field axis. The line shape of absorbed laser radiation versus magnetic field near electron cyclotron resonance (87.75 kG) indicates a strong dependence of the line shape on the focused laser intensity. This dependence is not predicted by the standard equilibrium theory of high-frequency gas breakdown in a magnetic field. We have developed an analytic theory to explain the observed line shapes. The theory takes into account the laser propagation characteristics, in particular that there is nonuniform ionization due to strong resonant absorption of the laser radiation in a length comparable to or shorter than that of the laser focal volume. The transverse geometry simplifies the theoretical analysis because the observed line shapes are not significantly affected by Doppler broadening. Extensive data have been obtained on the fraction of laser pulse energy absorbed in the gas breakdown volume as a function of magnetic field, helium gas pressure, and incident laser pulse energy. Good quantitative agreement is obtained between the observed laser pulse absorption line shapes and the nonuniform ionization theory
Optical Response of Poly (1,4-Phenylene-1,2-Di (P-Phenoxyphenyl Vinylene Towards Oxygen Gas
Directory of Open Access Journals (Sweden)
F.S Mehamod
2017-10-01
with terephthaloydichloride and biphenylether as starting materials and anhydrous AlCl3 as the catalyst, while the dpop-PDV was synthesized via the McMurry coupling reaction. The polymerization was carried out in THF with TiCl4 and Zn as the catalyst and reducing agent respectively. Characterization on monomer and polymer had been carried out by using FTIR, GCMS, DSC, TGA, GPC and melting point measurement. Response of the polymer towards oxygen gas was described in terms of fluorescence spectra, repeatability, reproducibility and the response curve. Results obtained showed that the fluorescence intensity decreased upon exposure to O2 gas, indicating that the polymer was responsive to the presence of the O2 gas and the sample was found regenerable by flushing the polymer solution with N2 gas.
Energy Technology Data Exchange (ETDEWEB)
De Nardo, L., E-mail: laura.denardo@unipd.it [University of Padova, Physics and Astronomy Department and PD-INFN, via Marzolo 8, I-35131 Padova (Italy); Farahmand, M., E-mail: majid.farahmand@rivm.nl [Centre for Environmental Safety and Security, National Institute for Public Health and the Environment (RIVM), PO Box 1, NL-3720 BA Bilthoven (Netherlands)
2016-05-21
A Tissue-Equivalent Proportional Counter (TEPC), based on a single GEM foil of standard geometry, has been tested with pure propane gas at low pressure, in order to simulate a tissue site of about 1 µm equivalent size. In this work, the performance of GEM with propane gas at a pressure of 21 and 28 kPa will be presented. The effective gas gain was measured in various conditions using a {sup 244}Cm alpha source. The dependence of effective gain on the electric field strength along the GEM channel and in the drift and induction region was investigated. A maximum effective gain of about 5×10{sup 3} has been reached. Results obtained in pure propane gas are compared with gas gain measurements in gas mixtures commonly employed in microdosimetry, that is propane and methane based Tissue-Equivalent gas mixtures.
Ökmen, B.; Collemare, J.; Griffiths, S.A.; Burgt, van der A.; Cox, R.; Wit, de P.J.G.M.
2014-01-01
Fungal Wor1-like proteins are conserved transcriptional regulators that are reported to regulate the virulence of several plant pathogenic fungi by affecting the expression of virulence genes. Here, we report the functional analysis of CfWor1, the homologue of Wor1 in Cladosporium fulvum. ¿cfwor1
The origin of gas seeps and shallow gas in northern part of South China Sea
Li, M.; Jin, X.
2003-04-01
The northern part of South China Sea is of passive continental margin, which geologic units include shelf, slope and deep sea basin. There are rifting basins forming during Paleogene (or Cretaceous ?) to Quaternary developed on shelf and slope, which sediments are dominated by fluvial and lake clastic rock of Paleogene, and marine clastic rock and carbonate of Neogene - Quaternary. The main basins include the Pearl River Mouth Basin, Beibu Gulf basin, Qiongdongnan Basin and Yinggehai basin. They contain rich oil and gas resources, and have become important industrial oil and gas producing region in South China Sea. With the increasing of petroleum exploration actives and marine petroleum engineering, it has been paid more attention to the investigation and research of gas seeps and shallow gas, for they become a potential threaten to the marine engineering while they are regarded as the indicators of industrial oil and gas. By study the distribution and geochemical characteristics of gas seeps in northeast part of Yinggehai basin and shallow gas in sediments on slope, combined with their regional geologic background, this paper deals with the origin, migration pathway and emission mechanism of gas seeps and shallow gas in northern part of South China Sea, for providing a base knowledge for the evaluation of marine engineering geology. In northeast part of Yinggehai basin gas seeps have been found and recorded for near 100 years. During 1990s, as a part of petroleum exploration, the gas seeps in the basin have been investigated and research by oil companies (Baojia Huang et al., 1992; Jiaqiong He et al., 2000). Gas seeps were found in shallow water area along southwest coast of Hainan Island, water depth usually less than 50 m. The occurrence of gas seeps can be divided into two types: (1) gas continuously emission, continuous gas bubbles groups can be detected by sonar underwater and observed on water surface. (2) gas intermittently emission, the time intervals
Directory of Open Access Journals (Sweden)
Knüchel Ruth
2008-05-01
Full Text Available Abstract Background The human gene ERH (Enhancer of the Rudimentary gene Homologue has previously been identified by in silico analysis of four million ESTs as a gene differentially expressed in breast cancer. The biological function of ERH protein has not been fully elucidated, however functions in cell cycle progression, pyrimidine metabolism a possible interaction with p21(Cip1/Waf1 via the Ciz1 zinc finger protein have been suggested. The aim of the present study was a systematic characterization of ERH expression in human breast cancer in order to evaluate possible clinical applications of this molecule. Methods The expression pattern of ERH was analyzed using multiple tissue northern blots (MTN on a panel of 16 normal human tissues and two sets of malignant/normal breast and ovarian tissue samples. ERH expression was further analyzed in breast cancer and normal breast tissues and in tumorigenic as well as non-tumorigenic breast cancer cell lines, using quantitative RT-PCR and non-radioisotopic in situ hybridization (ISH. Results Among normal human tissues, ERH expression was most abundant in testis, heart, ovary, prostate, and liver. In the two MTN sets of malignant/normal breast and ovarian tissue,ERH was clearly more abundantly expressed in all tumours than in normal tissue samples. Quantitative RT-PCR analyses showed that ERH expression was significantly more abundant in tumorigenic than in non-tumorigenic breast cancer cell lines (4.5-fold; p = 0.05, two-tailed Mann-Whitney U-test; the same trend was noted in a set of 25 primary invasive breast cancers and 16 normal breast tissue samples (2.5-fold; p = 0.1. These findings were further confirmed by non-radioisotopic ISH in human breast cancer and normal breast tissue. Conclusion ERH expression is clearly up-regulated in malignant as compared with benign breast cells both in primary human breast cancer and in cell models of breast cancer. Since similar results were obtained for ovarian
International Nuclear Information System (INIS)
Hartnell, Gaynor
2000-01-01
Following the UK Government's initiative for stimulating renewable energy through the Non-Fossil Fuel Obligation (NFFO), the UK landfill gas industry has more than trebled in size in just 4 years. As a result, UK companies are now in a strong position to offer their skills and services overseas. Ireland, Greece and Spain also resort heavily to disposal to landfill. Particularly rapid growth of the landfill gas market is expected in the OECD-Pacific and NAFTA areas. The article explains that landfill gas is a methane-rich mixture produced by anaerobic decomposition of organic wastes in landfills: under optimum conditions, up to 500 cubic meters of gas can be obtained from 1 tonne of biodegradable waste. Data on the number and capacity of sites in the UK are given. The Landfill Gas Association runs courses to counteract the skills shortage in the UK, and tailored courses for overseas visitors are planned
Gas replacement system for fuel cell. Nenryo denchi no gas chikan hoshiki
Energy Technology Data Exchange (ETDEWEB)
Sugiyama, T
1990-02-14
When stopping the operation of a fuel cell, the gas in the reaction gas system is purged using such an inert gas as nitrogen for inactivation. A gas source such as inert gas bomb must be prepared beforehand for the purpose. This invention relates to a method of production of inert gas from the air collected from atmosphere to use it as the purge gas. The air collected from the atmosphere is passed through an oxygen remover filled with oxidation catalyst to remove oxygen, and dehumidified by a dehumidifier filled with drying agent, the obtained inert drying gas with nitrogen as the main constituent being used as the purge gas. Copper system catalyst supported by silica is used as the oxidation catalyst, and silica gel as the drying agent. After the operation of the fuel cell is re-started, a part of the high temperature fuel gas extracted from the reaction gas system is introduced to the oxygen remover for the reduction of oxidation catalyst and for heat regeneration of dehumidifying agent by the contained hydrogen. 1 fig.
PHIBSS: Unified Scaling Relations of Gas Depletion Time and Molecular Gas Fractions
Tacconi, L. J.; Genzel, R.; Saintonge, A.; Combes, F.; García-Burillo, S.; Neri, R.; Bolatto, A.; Contini, T.; Förster Schreiber, N. M.; Lilly, S.; Lutz, D.; Wuyts, S.; Accurso, G.; Boissier, J.; Boone, F.; Bouché, N.; Bournaud, F.; Burkert, A.; Carollo, M.; Cooper, M.; Cox, P.; Feruglio, C.; Freundlich, J.; Herrera-Camus, R.; Juneau, S.; Lippa, M.; Naab, T.; Renzini, A.; Salome, P.; Sternberg, A.; Tadaki, K.; Übler, H.; Walter, F.; Weiner, B.; Weiss, A.
2018-02-01
This paper provides an update of our previous scaling relations between galaxy-integrated molecular gas masses, stellar masses, and star formation rates (SFRs), in the framework of the star formation main sequence (MS), with the main goal of testing for possible systematic effects. For this purpose our new study combines three independent methods of determining molecular gas masses from CO line fluxes, far-infrared dust spectral energy distributions, and ∼1 mm dust photometry, in a large sample of 1444 star-forming galaxies between z = 0 and 4. The sample covers the stellar mass range log(M */M ⊙) = 9.0–11.8, and SFRs relative to that on the MS, δMS = SFR/SFR(MS), from 10‑1.3 to 102.2. Our most important finding is that all data sets, despite the different techniques and analysis methods used, follow the same scaling trends, once method-to-method zero-point offsets are minimized and uncertainties are properly taken into account. The molecular gas depletion time t depl, defined as the ratio of molecular gas mass to SFR, scales as (1 + z)‑0.6 × (δMS)‑0.44 and is only weakly dependent on stellar mass. The ratio of molecular to stellar mass μ gas depends on (1+z{)}2.5× {(δ {MS})}0.52× {({M}* )}-0.36, which tracks the evolution of the specific SFR. The redshift dependence of μ gas requires a curvature term, as may the mass dependences of t depl and μ gas. We find no or only weak correlations of t depl and μ gas with optical size R or surface density once one removes the above scalings, but we caution that optical sizes may not be appropriate for the high gas and dust columns at high z. Based on observations of an IRAM Legacy Program carried out with the NOEMA, operated by the Institute for Radio Astronomy in the Millimetre Range (IRAM), which is funded by a partnership of INSU/CNRS (France), MPG (Germany), and IGN (Spain).
Gas Phase Pressure Effects on the Apparent Thermal Conductivity of JSC-1A Lunar Regolith Simulant
Yuan, Zeng-Guang; Kleinhenz, Julie E.
2011-01-01
Gas phase pressure effects on the apparent thermal conductivity of a JSC-1A/air mixture have been experimentally investigated under steady state thermal conditions from 10 kPa to 100 kPa. The result showed that apparent thermal conductivity of the JSC-1A/air mixture decreased when pressure was lowered to 80 kPa. At 10 kPa, the conductivity decreased to 0.145 W/m/degree C, which is significantly lower than 0.196 W/m/degree C at 100 kPa. This finding is consistent with the results of previous researchers. The reduction of the apparent thermal conductivity at low pressures is ascribed to the Knudsen effect. Since the characteristic length of the void space in bulk JSC-1A varies over a wide range, both the Knudsen regime and continuum regime can coexist in the pore space. The volume ratio of the two regimes varies with pressure. Thus, as gas pressure decreases, the gas volume controlled by Knudsen regime increases. Under Knudsen regime the resistance to the heat flow is higher than that in the continuum regime, resulting in the observed pressure dependency of the apparent thermal conductivity.
GARUSO - Version 1.0. Uncertainty model for multipath ultrasonic transit time gas flow meters
Energy Technology Data Exchange (ETDEWEB)
Lunde, Per; Froeysa, Kjell-Eivind; Vestrheim, Magne
1997-09-01
This report describes an uncertainty model for ultrasonic transit time gas flow meters configured with parallel chords, and a PC program, GARUSO Version 1.0, implemented for calculation of the meter`s relative expanded uncertainty. The program, which is based on the theoretical uncertainty model, is used to carry out a simplified and limited uncertainty analysis for a 12`` 4-path meter, where examples of input and output uncertainties are given. The model predicts a relative expanded uncertainty for the meter at a level which further justifies today`s increasing tendency to use this type of instruments for fiscal metering of natural gas. 52 refs., 15 figs., 11 tabs.
Refining Bio-Gas Produced from Biomass: An Alternative to Cooking Gas
Directory of Open Access Journals (Sweden)
A. S. ABDULKAREEM
2005-06-01
Full Text Available Our life is completely dependent on a reliable and adequate supply of energy. In other to reduce dependence on fossil fuels, the use of animal dung in producing a renewable alternative source of energy has been proved using cow dung. This work is aimed at produced and refined bio - gas from animal dung by reduces the H2S and CO2 content of bio - gas in other to improved the quality of the bio - gas to be used as an alternative to the petroleum based produces in use now. The sample of gas produced was passed through the gas chromatography to determine the percentage composition (mol % dry basis of the bio - gas contents. The results of the bio - gas before refinement were 54.09% mole dry CH4, 40.02mole % dry CO2 and 0.80mole % dry H2S which conformed with the literature values of 50 - 65 % mole dry CH4, 35 - 50 % mole dry CO2 and 0.1 - 1.0 % mole dry H2S. After refining, the composition of bio - gas on dry basis were 54.09% mole dry CH4, 4.01% mole dry CO2, 0.02% mole dry O2, 0.05% mole dry NH3, 0.01% mole dry H2S, 0.5% mole dry H2 and 2.54% mole dry N2. Analysis of the remnant indicated that it could be used for plant nutrient.
International Nuclear Information System (INIS)
1989-12-01
The Eighth Meeting of the IAEA International Working Group on Gas-Cooled Reactors was held in Vienna, Austria, from 30 January - 1 February, 1989. The Summary Report (Part I) contains the Minutes of the Meeting
Energy Technology Data Exchange (ETDEWEB)
Villar, M. V.; Gutierre-Rodrigo, V.; Martin, P. I.; Romero, F. J.; Barcala, J. M.
2013-07-01
The gas permeability of the Spanish FEBEX bentonite compacted at dry densities of between 1.4 and 1.8 g/cm{sup 3} with high water contents was measured for different confining, injection and back pressures. The results were compared with results obtained in previous investigations for lower degrees of saturation. It was checked that gas permeability was greatly affected by dry density, decreasing about three orders of magnitude when it increased from 1.5 to 1.8 g/cm{sup 3} for similar water content. The increase of water content caused also a decrease in gas permeability. It was found that both gas permeability and the relative gas permeability were mainly related to the accessible porosity. These relationships could be fitted to potential expressions with exponents between 3 and 4, as well as the relationship between intrinsic permeability and void ratio. For gas pressures below 1.2 MPa no effect of the injection or confining pressures on the value of permeability was detected. For a given confining pressure the permeability value decreased as the effective pressure increased, especially if the increase in effective pressure was due to a decrease in gas back pressure. It was checked that the Klinkenberg effect was not significant for this material in the range of pressures applied in the tests. The gas breakthrough pressure values in FEBEX saturated bentonite were determined for different dry densities. They increased clearly with dry density and were always higher than the swelling pressure of the bentonite. In high density samples gas flow tended to stop abruptly after breakthrough, whereas in lower density samples gas flow decreased gradually until a given pressure gradient was reached. The permeabilities computed after breakthrough (which usually did not stabilise) were inversely related to dry density. This would indicate that, even if the flow took place predominantly through preferential pathways that sometimes closed quickly after breakthrough and others
International Nuclear Information System (INIS)
Villar, M. V.; Gutierrez-Rodrigo, V.; Martin, P. L.; Romero, F. J.; Barcala, J. M.
2013-01-01
The gas permeability of the Spanish FEBEX bentonite compacted at dry densities of between 1.4 and 1.8 g/cm 3 with high water contents was measured for different confining, injection and back pressures. The results were compared with results obtained in previous investigations for lower degrees of saturation. It was checked that gas permeability was greatly affected by dry density, decreasing about three orders of magnitude when it increased from 1.5 to 1.8 g/cm 3 for similar water content. The increase of water content caused also a decrease in gas permeability. It was found that both gas permeability and the relative gas permeability were mainly related to the accessible porosity. These relationships could be fitted to potential expressions with exponents between 3 and 4, as well as the relationship between intrinsic permeability and void ratio. For gas pressures below 1.2 MPa no effect of the injection or confining pressures on the value of permeability was detected. For a given confining pressure the permeability value decreased as the effective pressure increased, especially if the increase in effective pressure was due to a decrease in gas back pressure. It was checked that the Klinkenberg effect was not significant for this material in the range of pressures applied in the tests. The gas breakthrough pressure values in FEBEX saturated bentonite were determined for different dry densities. They increased clearly with dry density and were always higher than the swelling pressure of the bentonite. In high density samples gas flow tended to stop abruptly after breakthrough, whereas in lower density samples gas flow decreased gradually until a given pressure gradient was reached. The permeabilities computed after breakthrough (which usually did not stabilise) were inversely related to dry density. This would indicate that, even if the flow took place predominantly through preferential pathways that sometimes closed quickly after breakthrough and others remained
International Nuclear Information System (INIS)
Shirley, Yancy L.; Svoboda, Brian; Ellsworth-Bowers, Timothy P.; Schlingman, Wayne M.; Ginsburg, Adam; Battersby, Cara; Stringfellow, Guy; Glenn, Jason; Bally, John; Rosolowsky, Erik; Gerner, Thomas; Mairs, Steven; Dunham, Miranda K.
2013-01-01
The Bolocam Galactic Plane Survey (BGPS) is a 1.1 mm continuum survey of dense clumps of dust throughout the Galaxy covering 170 deg 2 . We present spectroscopic observations using the Heinrich Hertz Submillimeter Telescope of the dense gas tracers, HCO + and N 2 H + 3-2, for all 6194 sources in the BGPS v1.0.1 catalog between 7.°5 ≤ l ≤ 194°. This is the largest targeted spectroscopic survey of dense molecular gas in the Milky Way to date. We find unique velocities for 3126 (50.5%) of the BGPS v1.0.1 sources observed. Strong N 2 H + 3-2 emission (T mb > 0.5 K) without HCO + 3-2 emission does not occur in this catalog. We characterize the properties of the dense molecular gas emission toward the entire sample. HCO + is very sub-thermally populated and the 3-2 transitions are optically thick toward most BGPS clumps. The median observed line width is 3.3 km s –1 consistent with supersonic turbulence within BGPS clumps. We find strong correlations between dense molecular gas integrated intensities and 1.1 mm peak flux and the gas kinetic temperature derived from previously published NH 3 observations. These intensity correlations are driven by the sensitivity of the 3-2 transitions to excitation conditions rather than by variations in molecular column density or abundance. We identify a subset of 113 sources with stronger N 2 H + than HCO + integrated intensity, but we find no correlations between the N 2 H + /HCO + ratio and 1.1 mm continuum flux density, gas kinetic temperature, or line width. Self-absorbed profiles are rare (1.3%)
Ohata, Masaki; Sakurai, Hiromu; Nishiguchi, Kohei; Utani, Keisuke; Günther, Detlef
2015-09-03
An inductively coupled plasma mass spectrometry (ICPMS) coupled with gas to particle conversion-gas exchange technique was applied to the direct analysis of ultra-trace semiconductor gas in ambient air. The ultra-trace semiconductor gases such as arsine (AsH3) and phosphine (PH3) were converted to particles by reaction with ozone (O3) and ammonia (NH3) gases within a gas to particle conversion device (GPD). The converted particles were directly introduced and measured by ICPMS through a gas exchange device (GED), which could penetrate the particles as well as exchange to Ar from either non-reacted gases such as an air or remaining gases of O3 and NH3. The particle size distribution of converted particles was measured by scanning mobility particle sizer (SMPS) and the results supported the elucidation of particle agglomeration between the particle converted from semiconductor gas and the particle of ammonium nitrate (NH4NO3) which was produced as major particle in GPD. Stable time-resolved signals from AsH3 and PH3 in air were obtained by GPD-GED-ICPMS with continuous gas introduction; however, the slightly larger fluctuation, which could be due to the ionization fluctuation of particles in ICP, was observed compared to that of metal carbonyl gas in Ar introduced directly into ICPMS. The linear regression lines were obtained and the limits of detection (LODs) of 1.5 pL L(-1) and 2.4 nL L(-1) for AsH3 and PH3, respectively, were estimated. Since these LODs revealed sufficiently lower values than the measurement concentrations required from semiconductor industry such as 0.5 nL L(-1) and 30 nL L(-1) for AsH3 and PH3, respectively, the GPD-GED-ICPMS could be useful for direct and high sensitive analysis of ultra-trace semiconductor gas in air. Copyright © 2015 Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Levinsky, H.B.; Van Rij, M.L.D.
2011-01-01
By request of various market parties (suppliers and users of natural gas), the Dutch Ministry of Economic Affairs, Agriculture and Innovation (ELI) took a leading role in anticipating the future changes in gas quality. ELI requested an inventory of the consequences of variations in natural gas quality for end users. [nl
Energy Technology Data Exchange (ETDEWEB)
Tada, A. [Agency of Natural Resources and Energy, Tokyo (Japan)
1995-07-20
This paper introduces the summary of the partial amendment in the gas business law (which was enforced in March 1995 upon propositions from the General Energy Investigation Council). The amendment consists mainly of deregulation on business rules for gas supply to large users. The amendment may be summarized as follows: the present billing regulations are deregulated for cases that gas purchasers are large users, permitting in principle the pricing to be agreed upon negotiations between the concerned parties; general gas business operators are allowed to supply gas under certain conditions even outside their supply areas, provided the supply is limited to large users; even any other persons than the general gas business operators can supply gas under certain conditions; persons to start newly a large -scale gas supply business shall be applied with the mandatory portions of the safety regulations that have already been imposed on the general gas business operators; clerical works for the national examination on chief gas engineers will be commissioned to civil organizations; and duplicated application of regulations in the gas utility industry law is eliminated for those operators who are subjected to regulations in the electric utility industry law. 1 fig.
International Nuclear Information System (INIS)
Thomas, Julie A.; Rolando, Mandy R.; Carroll, Christopher A.; Shen, Peter S.; Belnap, David M.; Weintraub, Susan T.; Serwer, Philip; Hardies, Stephen C.
2008-01-01
Pseudomonas chlororaphis phage 201φ2-1 is a relative of Pseudomonas aeruginosa myovirus φKZ. Phage 201φ2-1 was examined by complete genomic sequencing (316,674 bp), by a comprehensive mass spectrometry survey of its virion proteins and by electron microscopy. Seventy-six proteins, of which at least 69 have homologues in φKZ, were identified by mass spectrometry. Eight proteins, in addition to the major head, tail sheath and tail tube proteins, are abundant in the virion. Electron microscopy of 201φ2-1 revealed a multitude of long, fine fibers apparently decorating the tail sheath protein. Among the less abundant virion proteins are three homologues to RNA polymerase β or β' subunits. Comparison between the genomes of 201φ2-1 and φKZ revealed substantial conservation of the genome plan, and a large region with an especially high rate of gene replacement. The φKZ-like phages exhibited a two-fold higher rate of divergence than for T4-like phages or host genomes
Illinois statewide gas utility plan, 1993-2002. Volume 1. Executive summary
International Nuclear Information System (INIS)
1992-12-01
The second Illinois Statewide Natural Gas Utility Plan is a continuation of the Least-Cost Planning effort introduced by the Public Utilities Act of 1986. The purpose of the Plan, like its predecessor, is to provide a framework and a set of policies which will allow and encourage local distribution companies to develop least-cost plans consistent with the goals of the Act: to provide efficient, environmentally sound, reliable, and equitable public utility service at the least possible cost. The Plan assesses natural gas demand and supply under five scenarios for the period 1993-2002. Key issues related to the development of least-cost natural gas plans are identified, and policies for addressing the issues are developed. The rationale and potential for natural gas demand side management (DSM) programs and policies are explored, and recommendations made with respect to utility DSM capability-building and DSM cost-recovery
International Nuclear Information System (INIS)
Anon.
2008-01-01
In 1962, a major natural gas export system from Alberta to San Francisco was brought online. The $300 million, 2,200 km Alberta and Southern system was expected to transport 584 million cubic feet daily in its first year of operation, more than one-third the total volume of gas sold by Canadian producers the previous year. The new gas export market also served to create more gas for the Canadian market because the incentive to serve a large export market also encouraged producers to explore for and develop more gas. The pipeline system started in the foothills belt 200 km northwest of Edmonton, and spanned through Idaho, Washington, Oregon and California. One month before its official opening, a gas line explosion occurred during pressure testing of a lateral line. The Alberta portion of the Alberta and Southern system was also used 2 decades later as a tie-in to the Alaska Highway Gas Pipeline project. Other key events in 1962 included approval of the Great Canadian Oil Sands Limited; the manufacture of the first rock drill bits in western Canada; production of 90 million cubic feet of natural gas from 12 wells in Quebec; and, an increase in oil production from the Soviet Union. 1 tab., 1 fig
Directory of Open Access Journals (Sweden)
Akinori Matsushika
Full Text Available The use of yeasts tolerant to acid (low pH and salt stress is of industrial importance for several bioproduction processes. To identify new candidate genes having potential roles in low-pH tolerance, we screened an expression genomic DNA library of a multiple-stress-tolerant yeast, Issatchenkia orientalis (Pichia kudriavzevii, for clones that allowed Saccharomyces cerevisiae cells to grow under highly acidic conditions (pH 2.0. A genomic DNA clone containing two putative open reading frames was obtained, of which the putative protein-coding gene comprising 1629 bp was retransformed into the host. This transformant grew significantly at pH 2.0, and at pH 2.5 in the presence of 7.5% Na2SO4. The predicted amino acid sequence of this new gene, named I. orientalis GAS1 (IoGAS1, was 60% identical to the S. cerevisiae Gas1 protein, a glycosylphosphatidylinositol-anchored protein essential for maintaining cell wall integrity, and 58-59% identical to Candida albicans Phr1 and Phr2, pH-responsive proteins implicated in cell wall assembly and virulence. Northern hybridization analyses indicated that, as for the C. albicans homologs, IoGAS1 expression was pH-dependent, with expression increasing with decreasing pH (from 4.0 to 2.0 of the medium. These results suggest that IoGAS1 represents a novel pH-regulated system required for the adaptation of I. orientalis to environments of diverse pH. Heterologous expression of IoGAS1 complemented the growth and morphological defects of a S. cerevisiae gas1Δ mutant, demonstrating that IoGAS1 and the corresponding S. cerevisiae gene play similar roles in cell wall biosynthesis. Site-directed mutagenesis experiments revealed that two conserved glutamate residues (E161 and E262 in the IoGas1 protein play a crucial role in yeast morphogenesis and tolerance to low pH and salt stress. Furthermore, overexpression of IoGAS1 in S. cerevisiae remarkably improved the ethanol fermentation ability at pH 2.5, and at pH 2.0 in the
Metabolomic profiling reveals a role for CPT1c in neuronal oxidative metabolism
Lee, Jieun; Wolfgang, Michael J
2012-01-01
Abstract Background Carnitine Palmitoyltransferase-1c (CPT1c) is a neuron specific homologue of the carnitine acyltransferase family of enzymes. CPT1 isoenzymes transfer long chain acyl groups to carnitine. This constitutes a rate setting step for mitochondrial fatty acid beta-oxidation by facilitating the initial step in acyl transfer to the mitochondrial matrix. In general, neurons do not heavily utilize fatty acids for bioenergetic needs and definitive enzymatic activity has been unable to...
Lee, Arum; Park, Eun-Byeol; Lee, Janghyun; Choi, Byong-Seok; Kang, Suk-Jo
2017-03-01
Cyclic GMP-AMP synthase (cGAS) is a DNA-sensing enzyme in the innate immune system. Recent studies using core-cGAS lacking the N terminus investigated the mechanism for binding of double-stranded (ds) DNA and synthesis of 2',3'-cyclic GMP-AMP (cGAMP), a secondary messenger that ultimately induces type I interferons. However, the function of the N terminus of cGAS remains largely unknown. Here, we found that the N terminus enhanced the activity of core-cGAS in vivo. Importantly, the catalytic activity of core-cGAS decreased as the length of double-stranded DNA (dsDNA) increased, but the diminished activity was restored by addition of the N terminus. Furthermore, the N terminus de-oligomerized the 2 : 2 complex of core-cGAS and dsDNA into a 1 : 1 complex, suggesting that the N terminus enhanced the activity of core-cGAS by facilitating formation of a monomeric complex of cGAS and DNA. © 2017 Federation of European Biochemical Societies.
Energy Technology Data Exchange (ETDEWEB)
Shirley, Yancy L.; Svoboda, Brian [Steward Observatory, 933 North Cherry Avenue, Tucson, AZ 85721 (United States); Ellsworth-Bowers, Timothy P.; Schlingman, Wayne M.; Ginsburg, Adam; Battersby, Cara; Stringfellow, Guy; Glenn, Jason; Bally, John [CASA, University of Colorado, CB 389, Boulder, CO 80309 (United States); Rosolowsky, Erik [Department of Physics, University of Alberta, 4-181 CCIS Edmonton AB T6G 2E1 (Canada); Gerner, Thomas [Max-Planck-Institut für Astronomie (MPIA), Knigstuhl 17, D-69117 Heidelberg (Germany); Mairs, Steven [Department of Physics and Astronomy, University of Victoria, P.O. Box 3055, STN CSC, Victoria, BC V8W 3P6 (Canada); Dunham, Miranda K. [Department of Astronomy, Yale University, P.O. Box 208101, New Haven, CT 06520 (United States)
2013-11-01
The Bolocam Galactic Plane Survey (BGPS) is a 1.1 mm continuum survey of dense clumps of dust throughout the Galaxy covering 170 deg{sup 2}. We present spectroscopic observations using the Heinrich Hertz Submillimeter Telescope of the dense gas tracers, HCO{sup +} and N{sub 2}H{sup +} 3-2, for all 6194 sources in the BGPS v1.0.1 catalog between 7.°5 ≤ l ≤ 194°. This is the largest targeted spectroscopic survey of dense molecular gas in the Milky Way to date. We find unique velocities for 3126 (50.5%) of the BGPS v1.0.1 sources observed. Strong N{sub 2}H{sup +} 3-2 emission (T {sub mb} > 0.5 K) without HCO{sup +} 3-2 emission does not occur in this catalog. We characterize the properties of the dense molecular gas emission toward the entire sample. HCO{sup +} is very sub-thermally populated and the 3-2 transitions are optically thick toward most BGPS clumps. The median observed line width is 3.3 km s{sup –1} consistent with supersonic turbulence within BGPS clumps. We find strong correlations between dense molecular gas integrated intensities and 1.1 mm peak flux and the gas kinetic temperature derived from previously published NH{sub 3} observations. These intensity correlations are driven by the sensitivity of the 3-2 transitions to excitation conditions rather than by variations in molecular column density or abundance. We identify a subset of 113 sources with stronger N{sub 2}H{sup +} than HCO{sup +} integrated intensity, but we find no correlations between the N{sub 2}H{sup +}/HCO{sup +} ratio and 1.1 mm continuum flux density, gas kinetic temperature, or line width. Self-absorbed profiles are rare (1.3%)
Yan, Rihui; Thomas, Sharon E; Tsai, Jui-He; Yamada, Yukihiro; McKee, Bruce D
2010-02-08
Sister chromatid cohesion is essential to maintain stable connections between homologues and sister chromatids during meiosis and to establish correct centromere orientation patterns on the meiosis I and II spindles. However, the meiotic cohesion apparatus in Drosophila melanogaster remains largely uncharacterized. We describe a novel protein, sisters on the loose (SOLO), which is essential for meiotic cohesion in Drosophila. In solo mutants, sister centromeres separate before prometaphase I, disrupting meiosis I centromere orientation and causing nondisjunction of both homologous and sister chromatids. Centromeric foci of the cohesin protein SMC1 are absent in solo mutants at all meiotic stages. SOLO and SMC1 colocalize to meiotic centromeres from early prophase I until anaphase II in wild-type males, but both proteins disappear prematurely at anaphase I in mutants for mei-S332, which encodes the Drosophila homologue of the cohesin protector protein shugoshin. The solo mutant phenotypes and the localization patterns of SOLO and SMC1 indicate that they function together to maintain sister chromatid cohesion in Drosophila meiosis.
Mazáň, Marián; Ragni, Enrico; Popolo, Laura; Farkaš, Vladimír
2011-09-01
BGTs [β-(1,3)-glucanosyltransglycosylases; EC 2.4.1.-] of the GH72 (family 72 of glycosylhydrolases) are GPI (glycosylphosphatidylinositol)-anchored proteins that play an important role in the biogenesis of fungal cell walls. They randomly cleave glycosidic linkages in β-(1,3)-glucan chains and ligate the polysaccharide portions containing newly formed reducing ends to C(3)(OH) at non-reducing ends of other β-(1,3)-glucan molecules. We have developed a sensitive fluorescence-based method for the assay of transglycosylating activity of GH72 enzymes. In the new assay, laminarin [β-(1,3)-glucan] is used as the glucanosyl donor and LamOS (laminarioligosaccharides) fluorescently labelled with SR (sulforhodamine) serve as the acceptors. The new fluorescent assay was employed for partial biochemical characterization of the heterologously expressed Gas family proteins from the yeast Saccharomyces cerevisiae. All the Gas enzymes specifically used laminarin as the glucanosyl donor and a SR-LamOS of DP (degree of polymerization) ≥5 as the acceptors. Gas proteins expressed in distinct stages of the yeast life cycle showed differences in their pH optima. Gas1p and Gas5p, which are expressed during vegetative growth, had the highest activity at pH 4.5 and 3.5 respectively, whereas the sporulation-specific Gas2p and Gas4p were most active between pH 5 and 6. The novel fluorescent assay provides a suitable tool for the screening of potential glucanosyltransferases or their inhibitors.
International Nuclear Information System (INIS)
Parent, L.
1991-01-01
This paper reports that U.S. gas producers won't see much price relief in 1991, barring a Persian Gulf war that interrupts crude supply which might be replaced by gas on short notice. Besides the current supply surplus, natural gas futures have added yet another dimension to the process of setting gas prices. Spectators (read speculators) having no intention of ever buying one cu ft of gas now have a hand in setting the forward price of gas. That doesn't necessarily mean something bad; it simply means that there is a new game with new rules and new players. All things considered, look for an average spot price of $1.70 this year. Exploration should pick up modestly, but production from conventional sources is expected to decline slightly in the '90s. Technological developments that enhance deliverability and reduce finding costs will moderate the decline, but not halt it
Natural gas - an alternative. Swedish electric power from Norwegian natural gas
International Nuclear Information System (INIS)
1986-10-01
The report describes the possible substitution of electric power by natural gas on the heat source market and how gas can be used for power production. The cost of distribution and means of supply are presented. 1/3 of the electric power produced by nuclear power plants can be replaced by the middle of the nineties. Transport techniques for gas and its total volume as well as transport cost from Norwegian North Sea are discussed
Shao, Chung-Ping; Hor, Lien-I
2001-01-01
Expression of the Vibrio vulnificus metalloprotease gene, vvp, was turned up rapidly when bacterial growth reached the late log phase. A similar pattern of expression has been found in the metalloprotease gene of Vibrio cholerae, and this has been shown to be regulated by a Vibrio harveyi LuxR-like transcriptional activator. To find out whether a LuxR homologue exists in V. vulnificus, a gene library of this organism was screened by colony hybridization using a probe derived from a sequence that is conserved in various luxR-like genes of vibrios. A gene containing a 618-bp open reading frame was identified and found to be identical to the smcR gene of V. vulnificus reported previously. An isogenic SmcR-deficient (RD) mutant was further constructed by an in vivo allelic exchange technique. This mutant exhibited an extremely low level of vvp transcription compared with that of the parent strain. On the other hand, the cytolysin gene, vvhA, was expressed at a higher level in the RD mutant than in the parent strain during the log phase of growth. These data suggested that SmcR might not only be a positive regulator of the protease gene but might also be involved in negative regulation of the cytolysin gene. Virulence of the RD mutant in either normal or iron-overloaded mice challenged by intraperitoneal injection was comparable to that of the parent strain, indicating that SmcR is not required for V. vulnificus virulence in mice. PMID:11157950
Development and mapping of SSR markers linked to resistance-gene homologue clusters in common bean
Institute of Scientific and Technical Information of China (English)
Luz; Nayibe; Garzon; Matthew; Wohlgemuth; Blair
2014-01-01
Common bean is an important but often a disease-susceptible legume crop of temperate,subtropical and tropical regions worldwide. The crop is affected by bacterial, fungal and viral pathogens. The strategy of resistance-gene homologue(RGH) cloning has proven to be an efficient tool for identifying markers and R(resistance) genes associated with resistances to diseases. Microsatellite or SSR markers can be identified by physical association with RGH clones on large-insert DNA clones such as bacterial artificial chromosomes(BACs). Our objectives in this work were to identify RGH-SSR in a BAC library from the Andean genotype G19833 and to test and map any polymorphic markers to identify associations with known positions of disease resistance genes. We developed a set of specific probes designed for clades of common bean RGH genes and then identified positive BAC clones and developed microsatellites from BACs having SSR loci in their end sequences. A total of 629 new RGH-SSRs were identified and named BMr(bean microsatellite RGH-associated markers). A subset of these markers was screened for detecting polymorphism in the genetic mapping population DOR364 × G19833. A genetic map was constructed with a total of 264 markers,among which were 80 RGH loci anchored to single-copy RFLP and SSR markers. Clusters of RGH-SSRs were observed on most of the linkage groups of common bean and in positions associated with R-genes and QTL. The use of these new markers to select for disease resistance is discussed.
Energy Technology Data Exchange (ETDEWEB)
Ghate, M.R.; Markel, K.E. Jr.; Jarr, L.A.; Bossart, S.J. (eds.)
1987-08-01
On June 16 through 19, 1987, METC sponsored the Seventh Annual Gasification and Gas Stream Cleanup Systems Contractors Review Meeting which was held at the Sheraton Lakeview Conference Center in Morgantown, West Virginia. The primary purpose of the meeting was threefold: to review the technical progress and current status of the gasification and gas stream cleanup projects sponsored by the Department of Energy; to foster technology exchange among participating researchers and other technical communities; to facilitate interactive dialogues which would identify research needs that would make coal-based gasification systems more attractive economically and environmentally. More than 310 representatives of Government, academia, industry, and foreign energy research organizations attended the 4-day meeting. Fifty-three papers and thirty poster displays were presented summarizing recent developments in the gasification and gas stream cleanup programs. Volume I covers information presented at sessions 1 through 4 on systems for the production of Co-products and industrial fuel gas, environmental projects, and components and materials. Individual papers have been processed for the Energy Data Base.
Anion exchange behaviour of Zr, Hf, Nb, Ta and Pa as homologues of RF and Db in fluoride medium
International Nuclear Information System (INIS)
Monroy G, F.; Trubert, D.; Brillard, L.; Hussonnois, M.; Constantinescu, O.; Le Naour, C.
2010-01-01
Studies of the chemical property of trans actinide elements are very difficult due to their short half-lives and extremely small production yields. However it is still possible to obtain considerable information about their chemical properties, such as the most stable oxidation states in aqueous solution, complexing ability, etc., comparing their behaviour with their lighter homologous in the periodic table. In order to obtain a better knowledge of the behaviour of rutherfordium, RF (element 104), dub nium, Db (element 105) in HF medium, the sorption properties of Zr, Hf, Nb, Ta an Pa, homologues of RF and Db, were studied in NH 4 F/HClO 4 medium in this work. Stability constants of the fluoride complexes of these elements were experimentally obtained from K d obtained at different F - and H + concentrations. The anionic complexes: [Zr(Hf)F 5 ] - , [Zr(Hf)F 6 ] 2- , [Zr(Hf)F 7 ] 3- , [Ta(Pa)F 6 ] - , [Ta(Pa)F 7 ] 2- , [Ta(Pa)F 8 ] 3- , [NbOF 4 ] - and [NbOF 5 ] 2- are present as predominant species in the HF range over investigation. (Author)
Effects of UV-B radiation on wax biosynthesis
International Nuclear Information System (INIS)
Barnes, J.; Paul, N.; Percy, K.; Broadbent, P.; McLaughlin, C.; Mullineaux, P.; Creissen, G.; Wellburn, A.
1994-01-01
Two genotypes of tobacco (Nicotiana tabacum L.) were exposed in controlled environment chambers to three levels of biologically effective ultraviolet-B radiation (UV-B BE ; 280-320nm): 0, 4.54 (ambient) and 5.66 (∼ 25% enhancement) kJ m -2 d -1 . After 28 days, the quantity of wax deposited on leaf surfaces was determined gravimetrically; epicuticular wax chemical composition was determined by capillary gas chromatography with homologue assignments confirmed by gas chromatography-mass spectrometry. Leaf wettability was assessed by measuring the contact angle of water droplets placed on leaf surfaces. Tobacco wax consisted of three major hydrocarbon classes: Straight-chain alkanes (C 27 -C 33 ) which comprised ∼ 59% of the hydrocarbon fraction, containing a predominance of odd-chain alkanes with C 31 as the most abundant homologue; branched-chain alkanes (C 25 -C 32 ) which comprised ∼38% of the hydrocarbon fraction with anteiso 3-methyltriacontane (C 30 ) as the predominant homologue; and fatty acids (C 14 -C 18 ) which comprised ∼ 3% of the wax. Exposure to enhanced UV-B radiation reduced the quantity of wax on the adaxial surface of the transgenic mutant, and resulted in marked changes in the chemical composition of the wax on the exposed leaf surface. Enhanced UV-B decreased the quantity of straight-chain alkanes, increased the quantity of branched-chain alkanes and fatty acids, and resulted in shifts toward shorter straight-chain lengths. Furthermore, UV-B-induced changes in wax composition were associated with increased wettability of tobacco leaf surfaces. Overall, the data are consistent with the view that UV-B radiation has a direct and fundamental effect on wax biosynthesis. Relationships between the physico-chemical nature of the leaf surface and sensitivity to UV-B radiation are discussed. (orig.)
Energy Technology Data Exchange (ETDEWEB)
Gudz, A.
1975-05-01
Natural gas from the Shatlyk gas field in the Kara Kum Desert, Turkmenia, U.S.S.R., will soon be available to the European section of the U.S.S.R. with the recent completion of the 291-mi Shatlyk-Khiva gas pipeline and the completion of all associated production units by the end of the year. The gas field, with explored reserves of (1.5 trillion m/sup 3/), is expected to be producing (100 million m/sup 3//day) at the end of 1975. Diagonal profiling was used in the exploration stage to reduce the number of boreholes required from 16 to 11, saving about $6.7 million (5 million rubles) and cutting the exploration time by almost 2 y. Most of the boreholes, drilled within the contour of the gas-bearing structure, can be used for gas production. The gas, produced at 2352 psi and 205/sup 0/F, is cooled to 113/sup 0/F, stripped of condensate and moisture, metered, and treated before transmission.
UNEP greenhouse gas abatement costing studies. Zimbabwe country study. Phase 1
Energy Technology Data Exchange (ETDEWEB)
Shakespeare Maya, R. [Southern Centre for Energy and Environment (Zimbabwe); Muguti, E. [Ministry of Transport and Energy. Department of Energy (Zimbabwe); Fenhann, J.; Morthorst, P.E. [Risoe National Laboratory. Systems Analysis Department (Denmark)
1992-08-01
The UNEP (United Nations Environment Programme) programme of Greenhouse Gas Abatement Costing Studies is intended to clarify the economic issues involved in assessing the costs of limiting emissions of greenhouse gases and to propose approaches to comparable costing studies. Phase 1 of the Zimbabwe country study describes the current energy situation in Zimbabwe related to the national economy, energy supply and demand and amounts of greenhouse gas emissions. Factors regarding the geography, (including a map illustrating the degree and character of land degradation by erosion) population, politics, international relations, land-use and management of the energy sector are dealt with in detail and the text is illustrated with data compiled from the study. It is estimated that Zimbabwe consumed 270.4 Tj of energy during 1988 and emitted 21.7 tonnes of carbon dioxide. An emission intensity of 80.2 tonnes/Tj for the whole economy and 63.6 tonnes/Tj for electric power generation alone was calculated. Forecasting for the year 2020 estimated carbon dioxide emission intensities of 73.5 tonnes/Tj for the whole economy and 43.7 tonnes for power generation. Net carbon dioxide emissions are predicted to be 30-42 tonnes during 2020. (AB).
Energy Technology Data Exchange (ETDEWEB)
Marques Gomes, Andre; Schmidt, Sebastian; Neumann, Jens [BMW Group, Muenchen (Germany)
2011-07-01
The simulation fo the thermodynamical properties of turbochargers in IC engines is mostly done with 1D gas exchange simulation tools, in which the turbocharger is represented by maps, or with 3D-CFD tools, in which a more precise geometrical detail of the charger can be considered. The present work aims for a modeling depth which lies between these 2 variants. This approach (''1D gas exchange simulation with 1D modeling of the turbocharger'') is not only motivated by enabling a better interaction, when compared to the map-based approach, between an IC engine and the turbocharger, but by distinctly reducing the modeling efforts and computing time when compared to the 3D-CFD approach. Within the study, a coarsely discretized model of a centrifugal compressor is built using only the model library of the commercial software GT-Power. For the validation regarding total pressure ratio and isentropic efficiency, the results of the stationary simulations of two different compressors are compared to CFD and measurement results. Differences can be seen only close to the choking limit of the compressor. The model was further used to demonstrate its applicability in extrapolated regions of the compressor map and in the instable operating range near the surge limit. (orig.)
Future forecast for life-cycle greenhouse gas emissions of LNG and city gas 13A
International Nuclear Information System (INIS)
Okamura, Tomohito; Furukawa, Michinobu; Ishitani, Hisashi
2007-01-01
The objective of this paper is to analyze the most up-to-date data available on total greenhouse-gas emissions of a LNG fuel supply chain and life-cycle of city gas 13A based on surveys of the LNG projects delivering to Japan, which should provide useful basic-data for conducting life-cycle analyses of other product systems as well as future alternative energy systems, because of highly reliable data qualified in terms of its source and representativeness. In addition, the life-cycle greenhouse-gas emissions of LNG and city-gas 13A in 2010 were also predicted, taking into account not only the improvement of technologies, but also the change of composition of LNG projects. As a result of this analysis, the total amount of greenhouse-gas emissions of the whole city-gas 13A chain at present was calculated to be 61.91 g-CO 2 /MJ, and the life-cycle greenhouse-gas emissions of LNG and city-gas 13A in 2010 could be expected to decrease by about 1.1% of the current emissions
Diatomic infrared gas-dynamic laser
International Nuclear Information System (INIS)
Mckenzie, R.L.
1971-01-01
A laser is provided which utilizes the infrared vibration rotation transitions of a diatomic gas such as carbon monoxide. The laser action is produced by an active diatomic gas such as carbon monoxide mixed with a vibrationally resonant pumping gas such as nitrogen. In addition, a noble gas such as argon may be employed as a third gas in the mixture. The gas mixture contains from 1 to 80 vol percent of the active gas based on the pumping gas, and the third gas, if used, can constitute up to 90 percent of the total gas volume. A number of significantly different wavelengths can be produced by the laser. A single laser may contain several optical resonators at different locations, so that the desired wave length can be selected at will
DEFF Research Database (Denmark)
Haumann, Marco; Dentler, Katharina; Joni, Joni
2007-01-01
The concept of supported ionic liquid phase (SILP) catalysis has been extended to 1-butene hydroformylation. A rhodium-sulfoxantphos complex was dissolved in [BMIM][n-C8H17OSO3] and this solution was highly dispersed on silica. Continuous gas-phase experiments in a fixed-bed reactor revealed...
Chiral gas chromatography for the determination of 1,2-O-isopropylidene-sn-glycerol stereoisomers
Dröge, M.J; Bos, R.; Woerdenbag, H.J.; Quax, Wim; Droge, MJ
2003-01-01
A stereospecific gas chromatography (GC) method using a (6-O-tButyldimethylsilyl-2,3-di-O-methyl)-beta-cyclodextrin as the chiral stationary phase has been developed and validated for the determination of the enantiomers of 1,2-O-isopropylidene-sn-glycerol (IPG), an important chiral synthon, in
Directory of Open Access Journals (Sweden)
Chenchen Fang
2016-12-01
Full Text Available The coal measure gas sources of coal-derived gas fields in the Late Paleozoic China are the Lower Carboniferous Dishuiquan Formation, the Upper Carboniferous Batamayineishan Formation and Benxi Formation, the Lower Permian Taiyuan Formation and Shanxi Formation, and the Upper Permian Longtan Formation. The coal-derived gas accumulates in Ordovician, Carboniferous, Permian, and Paleocene reservoirs and are distributed in Ordos Basin, Bohai Bay Basin, Junggar Basin, and Sichuan Basin. There are 16 gas fields and 12 of them are large gas fields such as the Sulige large gas field which is China's largest reserve with the highest annual output. According to component and alkane carbon isotope data of 99 gas samples, they are distinguished to be coal-derived gas from coal-derived gas with δ13C2 > −28.5‰ and δ13C1 -δ13C2 -δ13C3 identification chart. The Late Paleozoic relative gas fields of coal measure are significant for the Chinese natural gas industry: proven natural gas geological reserves and annual output of them account for 1/3 in China, and the gas source of three significant large gas fields is coal-derived, which of five significant large gas fields supporting China to be a great gas producing country. The average reserves of the gas fields and the large gas fields formed from the late Paleozoic coal measure are 5.3 and 1.7 times that of the gas fields and the large gas fields in China.
Particle fuelling for long pulse with standard gas puff and supersonic pulsed gas injection
International Nuclear Information System (INIS)
Bucalossi, J.; Tsitrone, E.; Martin, G.
2003-01-01
In addition to the standard gas puff and to the technically complex pellet injection, a novel intermediate method, based on the injection of a supersonic high density cloud of neutrals, has been recently implemented on the Tore Supra tokamak. Fuelling efficiency, in the 30-50% range are found while it lies in the 10-20% range for the gas puff. It is not sensitive to the plasma density and to the additional heating. According to modelling, the increased efficiency is attributed to the very short injection duration compared to the particle confinement time and to the strong cooling of the plasma edge resulting from the massive injection of matter. A feedback loop on the frequency of the injector has been successfully implemented to control the plasma density. In long pulse experiments (>200s), wall saturation has not been reached. Gas puffing rate was typically around 1 Pa.m 3 s -1 while dynamic wall retention around 0.6 Pa.m 3 s -1 . Co-deposited carbon layer could trap such large amounts of gas. A discharge fuelled by supersonic pulsed gas injections exhibits lower wall retention than a gas puff fuelled discharge. (author)
The Hsk1(Cdc7) Replication Kinase Regulates Origin Efficiency
Patel, Prasanta K.; Kommajosyula, Naveen; Rosebrock, Adam; Bensimon, Aaron; Leatherwood, Janet; Bechhoefer, John; Rhind, Nicholas
2008-01-01
Origins of DNA replication are generally inefficient, with most firing in fewer than half of cell cycles. However, neither the mechanism nor the importance of the regulation of origin efficiency is clear. In fission yeast, origin firing is stochastic, leading us to hypothesize that origin inefficiency and stochasticity are the result of a diffusible, rate-limiting activator. We show that the Hsk1-Dfp1 replication kinase (the fission yeast Cdc7-Dbf4 homologue) plays such a role. Increasing or ...
Alghunaimi, Fahd
2013-05-01
Gas transport properties of PIM-1 (the first ladder polymer with intrinsic microporosity) and TC-PIM-1 (thermally cross-linked PIM-1) at 35°C and different pressures were thoroughly studied. The purpose of this study was to evaluate and compare the performance of the TC-PIM-1 membranes with PIM-1 for natural gas separation. The TC-PIM-1 polymer was prepared by post-modification of PIM-1 at 300°C for a period of two days. Sorption isotherms of seven gases, including N2, O2, CH4, CO2, C2H6, C3H8 and n-C4H10, were determined for PIM-1 and TC-PIM-1 using the dual-volume barometric sorption technique at 35°C at different pressures. The sorption isotherms followed the dual-mode sorption model, which is typical for glassy polymers. Moreover, permeability (P) of eight gases, including He, H2, N2, O2, CH4, CO2, C3H8 and n-C4H10, were determined for PIM-1 and TC-PIM-1 at 35°C and 2.0 atm. Furthermore, average diffusion coefficients (D ̅) were calculated from the permeability and solubility data for all tested gases for both polymers. The sorption (S), permeability (P) and average diffusion coefficients (D ̅) for the TC-PIM-1 membrane exhibited lower values than the PIM-1 membrane. However, the TC-PIM-1 membrane showed exceptional gas separation performance. The TC-PIM-1 membrane had a helium (He) permeability of 1218 barrer with He/CH4 and He/N2 ideal selectivities of 27.1 and 23.9 respectively, and carbon dioxide (CO2) permeability of 1088 barrer with CO2/CH4 and CO2/N2 ideal selectivities of 24.2 and 21.3 respectively. Additionally, the TC-PIM-1 membrane showed a hydrogen (H2) permeability of 2452 barrer with an ideal H2/CH4 selectivity of 54.5.
Alberta Advanced Education and Technology, 2011
2011-01-01
The graduate of the Natural Gas Compression Technician apprenticeship program is a certified journeyperson who will be able to install, commission, maintain and repair equipment used to gather store and transmit natural gas. Advanced Education and Technology has prepared this course outline in partnership with the Natural Gas Compression…
Mao, Yiyin; shi, Li; Huang, Hubiao; Cao, Wei; Li, Junwei; Sun, Luwei; Jin, Xianda; Peng, Xinsheng
2013-06-25
Large scale, robust, well intergrown free-standing HKUST-1 membranes were converted from copper hydroxide nanostrand free-standing films in 1,3,5-benzenetricarboxylic acid water-ethanol solution at room temperature, and explored for gas separation. The truncated crystals are controllable and favorable for the dense intergrowth.
Ionized and Molecular Gas Kinematics in a z = 1.4 Star-forming Galaxy
Übler, H.; Genzel, R.; Tacconi, L. J.; Förster Schreiber, N. M.; Neri, R.; Contursi, A.; Belli, S.; Nelson, E. J.; Lang, P.; Shimizu, T. T.; Davies, R.; Herrera-Camus, R.; Lutz, D.; Plewa, P. M.; Price, S. H.; Schuster, K.; Sternberg, A.; Tadaki, K.; Wisnioski, E.; Wuyts, S.
2018-02-01
We present deep observations of a z = 1.4 massive, star-forming galaxy (SFG) in molecular and ionized gas at comparable spatial resolution (CO 3–2, NOrthern Extended Millimeter Array (NOEMA); Hα, Large Binocular Telescope (LBT)). The kinematic tracers agree well, indicating that both gas phases are subject to the same gravitational potential and physical processes affecting the gas dynamics. We combine the one-dimensional velocity and velocity dispersion profiles in CO and Hα to forward-model the galaxy in a Bayesian framework, combining a thick exponential disk, a bulge, and a dark matter halo. We determine the dynamical support due to baryons and dark matter, and find a dark matter fraction within one effective radius of {f}DM}(≤slant {R}e)={0.18}-0.04+0.06. Our result strengthens the evidence for strong baryon-dominance on galactic scales of massive z ∼ 1–3 SFGs recently found based on ionized gas kinematics alone. Based on observations carried out with the IRAM Interferometer NOEMA. IRAM is supported by INSU/CNRS (France), MPG (Germany), and IGN (Spain). Based on observations carried out with the LBT. The LBT is an international collaboration among institutions in the United States, Italy, and Germany. LBT Corporation partners are: LBT Beteiligungsgesellschaft, Germany, representing the Max-Planck Society, The Leibniz Institute for Astrophysics Potsdam, and Heidelberg University; The University of Arizona on behalf of the Arizona Board of Regents; Istituto Nazionale di Astrofisica, Italy; The Ohio State University, and The Research Corporation, on behalf of The University of Notre Dame, University of Minnesota and University of Virginia.
Gas tagging system development in Japan
International Nuclear Information System (INIS)
Sekiguchi, N.; Rindo, H.; Akiyama, T.; Miyazawa, T.; Heki, H.
1981-05-01
The Gas tagging method has been considered to be most desirable for a failed fuel location system for the fast breeder reactor, regarding the component reduction in the reactor vessel and rapid location during reactor operation. The gas tagging system has been designed by referring to R and D results obtained in Japan and other countries. The designed system is comprised of tag gas filling pins, cover gas sampling system, tag gas recovery and enrichment system, tag gas analyzer and system control and data handling computers. The main specifications for this system have been decided as follows; 1) Main function is location of failed fuels in core and a part of blanket region, 2) Identification capability is each subassembly, 3) Time for identification is within a few days, 4) Continuous operation with automatic start at fuel failure, 5) Detection sensitivity must cover both gas leak and pin burst. In designing the gas tagging system, the following R and D items were selected; 1) System design study, 2) Tag gas capsule development, 3) Modeling the tag gas behavior in reactor primary cooling system, 4) Tag gas recovery and enrichment system, 5) Computer code development for tag gas isotope ratio change estimation. Details of the Japanese gas tagging system development appear in this paper. (author)
... to produce gas. Often, relatively simple changes in eating habits can lessen bothersome gas. Certain digestive system disorders, ... such as soda and beer, increase stomach gas. Eating habits, such as eating too quickly, drinking through a ...
International Nuclear Information System (INIS)
Oku, Tatsuo; Kikuyama, Toshihiko; Fukaya, Kiyoshi; Kodaira, Tsuneo
1978-11-01
This is a collection of mechanical properties data of 2-1/4Cr-1Mo steel necessary for structural design and safety analysis of the pressure vessel of the Experimental Very High Temperature Gas-Cooled Reactor (VHTR). These include physical properties, mechanical properties, temper embrittlement, creep with fatigue, fracture toughness and irradiation effects. A review of the data shows the research areas to be carried out particularly in the future for more data. (author)
Hahs, Charles A.; Burbage, Charles H.
1984-01-01
The invention is a pneumatically operated valve assembly for simultaneously (1) closing gas-transfer lines connected to a gas centrifuge or the like and (2) establishing a recycle path between two of the lines so closed. The valve assembly is especially designed to be compact, fast-acting, reliable, and comparatively inexpensive. It provides large reductions in capital costs for gas-centrifuge cascades.
Gas sector developments in Trinidad and Tobago
International Nuclear Information System (INIS)
McGuire, G.
1997-01-01
The outlook for the natural gas industry in Trinidad and Tobago was discussed. The country's proven reserves, as of January 1997, were estimated at 16.1 trillion cubic feet. The National Gas Company (NGC) is key to expansion of the country's gas business. In 1996 NGC sold 683 million cubic feet of natural gas. The petrochemical sector accounted for 57.6 per cent of sales, power generation 22.4 per cent and metal and other heavy industry 19 per cent. Amoco, Enron and British Gas are the principal suppliers. Natural gas demand in Trinidad and Tobago is predicted to surpass the 1.5 billion cubic feet per day threshold by the year 2001, rising to 2.1 billion cubic feet per day by 2006. During the 1997-2001 period, gas sales to the petrochemical sector will increase by a compounded average of 24 per cent per year due to new plant expansions in the methanol and ammonia sectors. Trinidad expects to be firmly established as the world's leading exporter of methanol and ammonia by the year 2001. Increased gas sales will also be stimulated by the proposed establishment of an aluminium smelter in Trinidad. 1 tab., 1 fig
Worldwide natural gas pipeline situation. Sekai no tennen gas pipeline jokyo
Energy Technology Data Exchange (ETDEWEB)
Arimoto, T [Osaka Gas Co. Ltd., Osaka (Japan)
1993-03-01
Constructing natural gas pipelines in wide areas requires investments of a huge amount. Many countries are building natural gas supply infrastructures under public support as nations' basic policy of promoting use of natural gas. This paper describes the present conditions of building pipelines in Western Europe, the U.S.A., Korea and Taiwan. In Western Europe, transporting companies established in line with the national policy own trunk pipelines and storage facilities, and import and distribute natural gas. The U.S.A. has 2300 small and large pipeline companies bearing transportation business. Pipelines extend about 1.9 million kilometers in total, with trunk pipelines accounting for about 440,000 kilometers. The companies are given eminent domain for the right of way. Korea has a plan to build a pipeline network with a distance of 1600 kilometers in around 2000. Taiwan has completed trunk pipelines extending 330 kilometers in two years. In Japan, the industry is preparing draft plans for wide area pipeline construction. 5 figs., 1 tab.
Gas, gas, gas... discoveries and developments booming worldwide
International Nuclear Information System (INIS)
Maxwell, F.
2000-01-01
Deep water exploration is yielding more than billion barrel oil fields. Unocal's 3 May discovery of 2-3 Tcf of gas in its Kutei block of Indonesia marks the first major discovery of natural gas in the deep water frontier: Wildcats Gula and Gada were drilled in over 1800 m of water as part of an aggressive search for gas instigated by Unocal last year. The author makes a survey of gas exploration and development throughout the world. (author)
Requirements for gas quality and gas appliances
Levinsky, Howard; Gersen, Sander; Kiewiet, Bert
2015-01-01
Introduction The gas transmission network in the Netherlands transports two different qualities of gas, low-calorific gas known as G-gas or L-gas and, high calorific gas (H-gas). These two gas qualities are transported in separate networks, and are connected by means of five blending and conversion
Gas transport in graphitic materials
International Nuclear Information System (INIS)
Hoinkis, E.
1995-02-01
The characterization of the gas transport properties of porous solids is of interest in several fields of science and technology. Many catalysts, adsorbents, soils, graphites and carbons are porous. The gas transport through most porous solids can be well described by the dusty gas model invented by Evans, Watson and Mason. This model includes all modes of gas tranport under steady-state conditions, which are Knudsen diffusion, combined Knudsen/continuum diffusion and continuum diffusion, both for gas pairs with equal and different molecular weights. In the absence of a pressure difference gas transport in a pore system can be described by the combined Knudsen/continuum diffusion coefficient D 1 for component 1 in the pores, the Knudsen diffusion coefficient D 1K in the pores, and the continuum diffusion coefficient D 12 for a binary mixture in the pores. The resistance to stationary continuum diffusion of the pores is characterized by a geometrical factor (ε/τ) 12 = (ε/τ)D 12 , were D 12 is the continuum diffusion coefficient for a binary mixture in free space. The Wicke-Kallenbach method was often used to measure D 1 as function of pressure. D 12 and D 1K can be derived from a plot 1/D 1 νs P, and ε/τcan be calculated since D 12 is known. D 1K and the volume of dead end pores can be derived from transient measurements of the diffusional flux at low pressures. From D 1K the expression (ε/τ c ) anti l por may be calculated, which characterizes the pore system for molecular diffusion, where collisions with the pore walls are predominant. (orig.)
Energy Technology Data Exchange (ETDEWEB)
NONE
1997-12-31
The overall aim of the project was to gain more knowledge about the kinetics of gas hydrate formation especially the early growth phase. Knowledge of kinetics of gas hydrate formation is important and measurements of gas hydrate particle size and concentration can contribute to improve this knowledge. An experimental setup for carrying out experimental studies of the nucleation and growth of gas hydrates has been constructed and tested. Multi wavelength extinction (MWE) was the experimental technique selected for obtaining particle diameter and concentration. The principle behind MWE is described as well as turbidity spectrum analysis that in an initial stage of the project was considered as an alternative experimental technique. Details of the experimental setup and its operation are outlined. The measuring cell consists of a 1 litre horizontal tube sustaining pressures up to 200 bar. Laser light for particle size determination can be applied through sapphire windows. A description of the various auxiliary equipment and of another gas hydrate cell used in the study are given. A computer program for simulation and analysis of gas hydrate experiments is based on the gas hydrate kinetics model proposed by Skovborg and Rasmussen (1993). Initial measurements showed that knowledge of the refractive index of gas hydrates was important in order to use MWE. An experimental determination of the refractive index of methane and natural gas hydrate is described. The test experiments performed with MWE on collectives of gas hydrate particles and experiments with ethane, methane and natural gas hydrate are discussed. Gas hydrate particles initially seem to grow mainly in size and at latter stages in number. (EG) EFP-94; 41 refs.
Energy Technology Data Exchange (ETDEWEB)
NONE
1998-12-31
The overall aim of the project was to gain more knowledge about the kinetics of gas hydrate formation especially the early growth phase. Knowledge of kinetics of gas hydrate formation is important and measurements of gas hydrate particle size and concentration can contribute to improve this knowledge. An experimental setup for carrying out experimental studies of the nucleation and growth of gas hydrates has been constructed and tested. Multi wavelength extinction (MWE) was the experimental technique selected for obtaining particle diameter and concentration. The principle behind MWE is described as well as turbidity spectrum analysis that in an initial stage of the project was considered as an alternative experimental technique. Details of the experimental setup and its operation are outlined. The measuring cell consists of a 1 litre horizontal tube sustaining pressures up to 200 bar. Laser light for particle size determination can be applied through sapphire windows. A description of the various auxiliary equipment and of another gas hydrate cell used in the study are given. A computer program for simulation and analysis of gas hydrate experiments is based on the gas hydrate kinetics model proposed by Skovborg and Rasmussen (1993). Initial measurements showed that knowledge of the refractive index of gas hydrates was important in order to use MWE. An experimental determination of the refractive index of methane and natural gas hydrate is described. The test experiments performed with MWE on collectives of gas hydrate particles and experiments with ethane, methane and natural gas hydrate are discussed. Gas hydrate particles initially seem to grow mainly in size and at latter stages in number. (EG) EFP-94; 41 refs.
Energy Technology Data Exchange (ETDEWEB)
McDonald, J. P. [NIH, Bethesda, MD. (United States); Levine, A. S.; Woodgate, R.
1997-12-15
Damage-inducible mutagenesis in prokaryotes is largely dependent upon the activity of the UmuD'C-like proteins. Since many DNA repair processes are structurally and/or functionally conserved between prokaryotes and eukaryotes, we investigated the role of RAD30, a previously uncharacterized Saccharomyces cerevisiae DNA repair gene related to the Escherichia coli dinB, umuC and S. cerevisiae REV1 genes, in UV resistance and UV-induced mutagenesis. Similar to its prokaryotic homologues, RAD30 was found to be damage inducible. Like many S. cerevisiae genes involved in error-prone DNA repair, epistasis analysis clearly places RAD30 in the RAD6 group and rad30 mutants display moderate UV sensitivity reminiscent of rev mutants. However, unlike rev mutants, no defect in UV-induced reversion was seen in rad30 strains. While rad6 and rad18 are both epistatic to rad30, no epistasis was observed with rev1, rev3, rev7 or rad5, all of which are members of the RAD6 epistasis group. These findings suggest that RD30 participates in a novel error-free repair pathway dependent on RAD6 and RAD18, but independent of REV1, REV3, REV7 and RAD5. (author)
Chen, Laiguo; Huang, Yumei; Han, Shuang; Feng, Yongbin; Jiang, Guo; Tang, Caiming; Ye, Zhixiang; Zhan, Wei; Liu, Ming; Zhang, Sukun
2013-01-25
Accurately quantifying short chain chlorinated paraffins (SCCPs) in soil samples with gas chromatograph coupled with electron capture negative ionization mass spectrometry (GC-ECNI-MS) is difficult because many other polychlorinated pollutants are present in the sample matrices. These pollutants (e.g., polychlorinated biphenyls (PCBs), organochlorine pesticides (OCPs) and toxaphene) can cause serious interferences during SCCPs analysis with GC-MS. Four main columns packed with different adsorbents, including silica gel, Florisil and alumina, were investigated in this study to determine their performance for separating interfering pollutants from SCCPs. These experimental results suggest that the optimum cleanup procedure uses a silica gel column and a multilayer silica gel-Florisil composite column. This procedure completely separated 22 PCB congeners, 23 OCPs and three toxaphene congeners from SCCPs. However, p,p'-DDD, cis-nonachlor and o,p'-DDD were not completely removed and only 53% of the total toxaphene was removed. This optimized method was successfully and effectively applied for removing interfering pollutants from real soil samples. SCCPs in 17 soil samples from different land use areas within a suburban region were analyzed with the established method. The concentrations of SCCPs in these samples were between 7 and 541 ng g(-1) (mean: 84 ng g(-1)). Similar homologue SCCPs patterns were observed between the soil samples collected from different land use areas. In addition, lower chlorinated (Cl(6/7)) C(10)- and C(11)- SCCPs were the dominant congeners. Copyright © 2012 Elsevier B.V. All rights reserved.
Use of dilute ammonia gas for treatment of 1,2,3-trichloropropane and explosives-contaminated soils.
Coyle, Charles G; Waisner, Scott A; Medina, Victor F; Griggs, Chris S
2017-12-15
Laboratory studies were performed to test a novel reactive gas process for in-situ treatment of soils containing halogenated propanes or explosives. A soil column study, using a 5% ammonia-in-air mixture, established that the treatment process can increase soil pH from 7.5 to 10.2. Batch reactor experiments were performed to demonstrate contaminant destruction in sealed jars exposed to ammonia. Comparison of results from batch reactors that were, and were not, exposed to ammonia demonstrated reductions in concentrations of 1,2,3-trichloropropane (TCP), 1,3-dichloropropane (1,3-DCP), 1,2-dicholoropropane (1,2-DCP) and dibromochloropropane (DBCP) that ranged from 34 to 94%. Decreases in TCP concentrations at 23° C ranged from 37 to 65%, versus 89-94% at 62° C. A spiked soil column study was also performed using the same set of contaminants. The study showed a pH penetration distance of 30 cm in a 2.5 cm diameter soil column (with a pH increase from 8 to > 10), due to treatment via 5% ammonia gas at 1 standard cubic centimeter per minute (sccm) for 7 days. Batch reactor tests using explosives contaminated soils exhibited a 97% decrease in 2,4,6-trinitrotoluene (TNT), an 83% decrease in nitrobenzene, and a 6% decrease in hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX). A biotransformation study was also performed to investigate whether growth of ammonia-oxidizing microorganisms could be stimulated via prolonged exposure of soil to ammonia. Over the course of the 283 day study, only a very small amount of nitrite generation was observed; indicating very limited ammonia monooxygenase activity. Overall, the data indicate that ammonia gas addition can be a viable approach for treating halogenated propanes and some types of explosives in soils. Published by Elsevier Ltd.
Janssens, Geert; Mangelinckx, Sven; Courtheyn, Dirk; Prévost, Stéphanie; De Poorter, Geert; De Kimpe, Norbert; Le Bizec, Bruno
2013-07-31
Although the ability to differentiate between endogenous steroids and synthetic homologues on the basis of their (13)C/(12)C isotopic ratio has been known for over a decade, this technique has been scarcely implemented for food safety purposes. In this study, a method was developed using gas chromatography-mass spectrometry/combustion/isotope ratio mass spectrometry (GC-MS/C/IRMS) to demonstrate the abuse of 17β-estradiol in cattle, by comparison of the (13)C/(12)C ratios of the main metabolite 17α-estradiol and an endogenous reference compound (ERC), 5-androstene-3β,17α-diol, in bovine urine. The intermediate precisions were determined as 0.46 and 0.26‰ for 5-androstene-3β,17α-diol and 17α-estradiol, respectively. This is, to the authors' knowledge, the first reported use of GC-MS/C/IRMS for the analysis of steroid compounds for food safety issues.
Western Gas Sands Project. Status report, 1 January 1979--31 January 1979
Energy Technology Data Exchange (ETDEWEB)
Atkinson, C H
1979-01-01
Aim is to increase gas production from the low-permeability gas sands of the western U.S. Progress is reported on: project management, resource assessment, R and D at various facilities, and field tests and demonstrations. (DLC)
Burow, Meike; Losansky, Anja; Müller, René; Plock, Antje; Kliebenstein, Daniel J.; Wittstock, Ute
2009-01-01
Glucosinolates are a group of thioglucosides that are components of an activated chemical defense found in the Brassicales. Plant tissue damage results in hydrolysis of glucosinolates by endogenous thioglucosidases known as myrosinases. Spontaneous rearrangement of the aglucone yields reactive isothiocyanates that are toxic to many organisms. In the presence of specifier proteins, alternative products, namely epithionitriles, simple nitriles, and thiocyanates with different biological activities, are formed at the expense of isothiocyanates. Recently, simple nitriles were recognized to serve distinct functions in plant-insect interactions. Here, we show that simple nitrile formation in Arabidopsis (Arabidopsis thaliana) ecotype Columbia-0 rosette leaves increases in response to herbivory and that this increase is independent of the known epithiospecifier protein (ESP). We combined phylogenetic analysis, a screen of Arabidopsis mutants, recombinant protein characterization, and expression quantitative trait locus mapping to identify a gene encoding a nitrile-specifier protein (NSP) responsible for constitutive and herbivore-induced simple nitrile formation in Columbia-0 rosette leaves. AtNSP1 is one of five Arabidopsis ESP homologues that promote simple nitrile, but not epithionitrile or thiocyanate, formation. Four of these homologues possess one or two lectin-like jacalin domains, which share a common ancestry with the jacalin domains of the putative Arabidopsis myrosinase-binding proteins MBP1 and MBP2. A sixth ESP homologue lacked specifier activity and likely represents the ancestor of the gene family with a different biochemical function. By illuminating the genetic and biochemical bases of simple nitrile formation, our study provides new insights into the evolution of metabolic diversity in a complex plant defense system. PMID:18987211
Energy Technology Data Exchange (ETDEWEB)
Hasterok, Constanze
2017-10-25
The XENON1T experiment aims at the direct detection of the well motivated dark matter candidate of weakly interacting massive particles (WIMPs) scattering off xenon nuclei. The first science run of 34.2 live days has already achieved the most stringent upper limit on spin-independent WIMP-nucleon cross-sections above masses of 10 GeV with a minimum of 7.7.10{sup -47} cm{sup 2} at a mass of 35 GeV. Crucial for this unprecedented sensitivity are a high xenon gas purity and a good understanding of the background. In this work, a procedure is described that was developed to measure the purity of the experiment's xenon inventory of more than three tons during its initial transfer to the detector gas system. The technique of gas chromatography has been employed to analyze the noble gas for impurities with the focus on oxygen and krypton contaminations. Furthermore, studies on the calibration of the experiment's dominating background induced by natural gamma and beta radiation were performed. Hereby, the novel sources of radioactive isotopes that can be dissolved in the xenon were employed, namely {sup 220}Rn and tritium. The sources were analyzed in terms of a potential impact on the outcome of a dark matter search. As a result of the promising findings for {sup 220}Rn, the source was successfully deployed in the first science run of XENON1T. The first WIMP search of XENON1T is outlined in this thesis, in which a background component from interactions taking place in close proximity to the detector wall is identified, investigated and modeled. A background prediction was derived that was incorporated into the background model of the WIMP search which was found to be in good agreement with the observation.
The Eps15 C. elegans homologue EHS-1 is implicated in synaptic vesicle recycling
DEFF Research Database (Denmark)
Salcini, A E; Hilliard, M A; Croce, A
2001-01-01
implicated Eps15 in endocytosis, its function in the endocytic machinery remains unclear. Here we show that the Caenorhabditis elegans gene, zk1248.3 (ehs-1), is the orthologue of Eps15 in nematodes, and that its product, EHS-1, localizes to synaptic-rich regions. ehs-1-impaired worms showed temperature...
Alghunaimi, Fahd
2013-01-01
the performance of the TC-PIM-1 membranes with PIM-1 for natural gas separation. The TC-PIM-1 polymer was prepared by post-modification of PIM-1 at 300°C for a period of two days. Sorption isotherms of seven gases, including N2, O2, CH4, CO2, C2H6, C3H8 and n-C4H
Collins, James HP; Sederman, Andrew John; Gladden, Lynn Faith; Afeworki, Mobae; Kushnerick, J Douglas; Thomann, Hans
2016-01-01
Magnetic resonance (MR) imaging techniques have been used to study gas phase dynamics during co-current up-flow in a column of inner diameter 43 mm, packed with spherical non-porous elements of diameters of 1.8, 3 and 5 mm. MR measurements of gas hold-up, bubble-size distribution, and bubble-rise velocities were made as a function of flow rate and packing size. Gas and liquid flow rates were studied in the range of 20–250 cm3 s−1 and 0–200 cm3 min−1, respectively. The gas hold-up within the b...
Kim, Sung-Jin; Kim, Kye-Won; Cho, Man-Ho; Franceschi, Vincent R; Davin, Laurence B; Lewis, Norman G
2007-07-01
A major goal currently in Arabidopsis research is determination of the (biochemical) function of each of its approximately 27,000 genes. To date, however, 12% of its genes actually have known biochemical roles. In this study, we considered it instructive to identify the gene expression patterns of nine (so-called AtCAD1-9) of 17 genes originally annotated by The Arabidopsis Information Resource (TAIR) as cinnamyl alcohol dehydrogenase (CAD, EC 1.1.1.195) homologues [see Costa, M.A., Collins, R.E., Anterola, A.M., Cochrane, F.C., Davin, L.B., Lewis N.G., 2003. An in silico assessment of gene function and organization of the phenylpropanoid pathway metabolic networks in Arabidopsis thaliana and limitations thereof. Phytochemistry 64, 1097-1112.]. In agreement with our biochemical studies in vitro [Kim, S.-J., Kim, M.-R., Bedgar, D.L., Moinuddin, S.G.A., Cardenas, C.L., Davin, L.B., Kang, C.-H., Lewis, N.G., 2004. Functional reclassification of the putative cinnamyl alcohol dehydrogenase multigene family in Arabidopsis. Proc. Natl. Acad. Sci. USA 101, 1455-1460.], and analysis of a double mutant [Sibout, R., Eudes, A., Mouille, G., Pollet, B., Lapierre, C., Jouanin, L., Séguin A., 2005. Cinnamyl Alcohol Dehydrogenase-C and -D are the primary genes involved in lignin biosynthesis in the floral stem of Arabidopsis. Plant Cell 17, 2059-2076.], both AtCAD5 (At4g34230) and AtCAD4 (At3g19450) were found to have expression patterns consistent with development/formation of different forms of the lignified vascular apparatus, e.g. lignifying stem tissues, bases of trichomes, hydathodes, abscission zones of siliques, etc. Expression was also observed in various non-lignifying zones (e.g. root caps) indicative of, perhaps, a role in plant defense. In addition, expression patterns of the four CAD-like homologues were investigated, i.e. AtCAD2 (At2g21730), AtCAD3 (At2g21890), AtCAD7 (At4g37980) and AtCAD8 (At4g37990), each of which previously had been demonstrated to have low CAD
Directory of Open Access Journals (Sweden)
K. P. Wyche
2009-01-01
Full Text Available A series of photooxidation experiments were conducted in an atmospheric simulation chamber in order to investigate the oxidation mechanism and secondary organic aerosol (SOA formation potential of the model anthropogenic gas phase precursor, 1,3,5-trimethylbenzene. Alongside specific aerosol measurements, comprehensive gas phase measurements, primarily by Chemical Ionisation Reaction Time-of-Flight Mass Spectrometry (CIR-TOF-MS, were carried out to provide detailed insight into the composition and behaviour of the organic components of the gas phase matrix during SOA formation. An array of gas phase organic compounds was measured during the oxidation process, including several previously unmeasured primary bicyclic compounds possessing various functional groups. Analysis of results obtained during this study implies that these peroxide bicyclic species along with a series of ring opening products and organic acids contribute to SOA growth. The effect of varying the VOC/NOx ratio on SOA formation was explored, as was the effect of acid seeding. It was found that low NOx conditions favour more rapid aerosol formation and a higher aerosol yield, a result that implies a role for organic peroxides in the nucleation process and SOA growth.
Field tests and commercialization of natural gas leak detectors
Energy Technology Data Exchange (ETDEWEB)
Choi, D S; Jeon, J S; Kim, K D; Cho, Y A [R and D Center, Korea Gas Corporation, Ansan (Korea)
1999-09-01
Objectives - (1) fields test of industrial gas leak detection monitoring system. (2) commericialization of residential gas leak detector. Contents - (1) five sets of gas leak detection monitoring system were installed at natural gas transmition facilities and tested long term stability and their performance. (2) improved residential gas leak detector was commercialised. Expected benefits and application fields - (1) contribution to the improvement of domestic gas sensor technology. (2) localization of fabrication technology for gas leak detectors. 23 refs., 126 figs., 37 tabs.
Observations of high-velocity molecular gas near Herbig-Haro objects: HH 24--27 and HH 1--2
International Nuclear Information System (INIS)
Snell, R.L.; Edwards, S.
1982-01-01
High-velocity CO has been detected in the vicinity of the Herbig-Haro objects HH 24--27. These observations indicate that there are two sources of high-velocity outflow; one centered on an infrared source near HH 26, and the second centered roughly 2' south of HH 24. The redshifted and blueshifted wings in both sources are spatially separated suggesting that the high-velocity gas is due to energetic bipolar outflow from young stars embedded in the molecular cloud. The association of Herbig-Haro objects with regions of high-velocity gas suggests a common origin for both in the interaction of a stellar wind with the ambient molecular cloud. The mass loss rates implied by our observations, assuming that the rate of mass loss has been constant throughout the dynamical lifetime of the bipolar lobes, are roughly 10 -6 M/sub sun/ yr -1 for both sources. We have also searched for high-velocity gas near HH 1--2 but found no evidence for mass outflow in this region
A comparative study of gas-gas miscibility processes in underground gas storage reservoirs
Energy Technology Data Exchange (ETDEWEB)
Rafiee, M.M.; Schmitz, S. [DBI - Gastechnologisches Institut gGmbH, Freiberg (Germany)
2013-08-01
Intermixture of gases in underground gas reservoirs have had great weight for natural gas storage in UGS projects with substitution of cushion gas by inert gases or changing the stored gas quality or origin, as for the replacement of town gas by natural gas. It was also investigated during the last years for Enhanced Gas Recovery (EGR) and Carbon Capture and Storage (CCS) projects. The actual importance of its mechanisms is discussed for the H{sub 2} storage in Power to Gas to Power projects (PGP). In these approaches miscibility of the injected gas with the gas in place in the reservoir plays an important role in the displacement process. The conditions and parameters for the gas-gas displacement and mixing have been investigated in previous projects, as e.g. the miscibility of CO{sub 2} with natural gas (CLEAN). Furthermore the miscibility process of town gas with natural gas and sauer gas with sweet gas were also previously measured and compared in laboratory. The objective of this work is to investigate the miscibility of H{sub 2} injection into natural gas reservoirs using a compositional and a black oil reservoir simulator. Three processes of convection, dispersion and diffusion are considered precisely. The effect of gas miscibility is studied for both simulators and the results are compared to find optimum miscibility parameters. The findings of this work could be helpful for further pilot and field case studies to predict and monitor the changes in gas composition and quality. In future this monitoring might become more important when PGP together with H{sub 2}-UGS, as storage technology, will help to successfully implement the change to an energy supply from more renewable sources. Similarly the method confirms the use of the black oil simulator as an alternative for gas-gas displacement and sequestration reservoir simulation in comparison to the compositional simulator. (orig.)
British Gas plans global gas unit expansion
International Nuclear Information System (INIS)
Vielvoye, R.
1991-01-01
This paper reports on developing a global gas business, a British Gas plc's strategy for evolving a state owned U.K. gas company to a privatized worldwide oil and gas giant. By 2000, BG's global gas business is expected to provide 20% of its revenues, compared with 40% each from its exploration and production operations and its U.K. gas business. The global gas unit (GGU) plans to meet its targets mainly through acquiring holdings in gas transmission and distribution companies around the world. In the 12 months since GGU was established, it has made two such major acquisitions in this area. BG acquired Consumers Gas Co., Ltd., Ontario, Canada's biggest natural gas distribution company, for $943.5 million. It also took a 10% stake in Catalana de Gas SA, Barcelona, the largest privately owned gas utility in Spain and in terms of number of customers, the fourth largest in western Europe. BG also is targeting additional revenues from developing gas fired cogeneration systems in developing countries with gas reserves but no established transmission and distribution systems
Directory of Open Access Journals (Sweden)
McNeel Gordon Jantzen
2014-03-01
Full Text Available Musicians have a more accurate temporal and tonal representation of auditory stimuli than their non-musician counterparts (Kraus & Chandrasekaran, 2010; Parbery-Clark, Skoe, & Kraus, 2009; Zendel & Alain, 2008; Musacchia, Sams, Skoe, & Kraus, 2007. Musicians who are adept at the production and perception of music are also more sensitive to key acoustic features of speech such as voice onset timing and pitch. Together, these data suggest that musical training may enhance the processing of acoustic information for speech sounds. In the current study, we sought to provide neural evidence that musicians process speech and music in a similar way. We hypothesized that for musicians, right hemisphere areas traditionally associated with music are also engaged for the processing of speech sounds. In contrast we predicted that in non-musicians processing of speech sounds would be localized to traditional left hemisphere language areas. Speech stimuli differing in voice onset time was presented using a dichotic listening paradigm. Subjects either indicated aural location for a specified speech sound or identified a specific speech sound from a directed aural location. Musical training effects and organization of acoustic features were reflected by activity in source generators of the P50. This included greater activation of right middle temporal gyrus (MTG and superior temporal gyrus (STG in musicians. The findings demonstrate recruitment of right hemisphere in musicians for discriminating speech sounds and a putative broadening of their language network. Musicians appear to have an increased sensitivity to acoustic features and enhanced selective attention to temporal features of speech that is facilitated by musical training and supported, in part, by right hemisphere homologues of established speech processing regions of the brain.
Drosophila arginine methyltransferase 1 (DART1) is an ecdysone receptor co-repressor
International Nuclear Information System (INIS)
Kimura, Shuhei; Sawatsubashi, Shun; Ito, Saya; Kouzmenko, Alexander; Suzuki, Eriko; Zhao, Yue; Yamagata, Kaoru; Tanabe, Masahiko; Ueda, Takashi; Fujiyama, Sari; Murata, Takuya; Matsukawa, Hiroyuki; Takeyama, Ken-ichi; Yaegashi, Nobuo
2008-01-01
Histone arginine methylation is an epigenetic marker that regulates gene expression by defining the chromatin state. Arginine methyltransferases, therefore, serve as transcriptional co-regulators. However, unlike other transcriptional co-regulators, the physiological roles of arginine methyltransferases are poorly understood. Drosophila arginine methyltransferase 1 (DART1), the mammalian PRMT1 homologue, methylates the arginine residue of histone H4 (H4R3me2). Disruption of DART1 in Drosophila by imprecise P-element excision resulted in low viability during metamorphosis in the pupal stages. In the pupal stage, an ecdysone hormone signal is critical for developmental progression. DART1 interacted with the nuclear ecdysone receptor (EcR) in a ligand-dependent manner, and co-repressed EcR in intact flies. These findings suggest that DART1, a histone arginine methyltransferase, is a co-repressor of EcR that is indispensable for normal pupal development in the intact fly
Survey of stranded gas and delivered costs to Europe of selected gas resources
Attanasi, E.D.; Freeman, P.A.
2011-01-01
Two important trends affecting the expected growth of global gas markets are (1) the shift by many industrialized countries from coal-fired electricity generation to the use of natural gas to generate electricity and (2) the industrialization of the heavily populated Asian countries of India and China. This paper surveys discovered gas in stranded conventional gas accumulations and presents estimates of the cost of developing and producing stranded gas in selected countries. Stranded gas is natural gas in discovered or identified fields that is not currently commercially producible for either physical or economic reasons. Published reserves of gas at the global level do not distinguish between volumes of gas in producing fields and volumes in nonproducing fields. Data on stranded gas reported here-that is the volumes, geographical distribution, and size distributions of stranded gas fields at the country and regional level-are based on the examination of individual-field data and represent a significant improvement in information available to industry and government decision makers. Globally, stranded gas is pervasive, but large volumes in large accumulations are concentrated in only a few areas. The cost component of the paper focuses on stranded conventional gas accumulations in Africa and South America that have the potential to augment supplies to Europe. The methods described for the computation of extraction and transport costs are innovative in that they use information on the sizes and geographical distribution of the identified stranded gas fields. The costs are based on industry data specific to the country and geologic basin where the stranded gas is located. Gas supplies to Europe can be increased significantly at competitive costs by the development of stranded gas. Net extraction costs of producing the identified gas depend critically on the natural-gas-liquids (NGLs) content, the prevailing prices of liquids, the size of the gas accumulation, and the
Directory of Open Access Journals (Sweden)
A. Zodge
2017-10-01
Full Text Available One of the major drawbacks of diastereomeric salt precipitation based enantioseparation is the time and solvent requirement of crystallization. In the gas antisolvent (GAS approach, supercritical carbon dioxide is applied as an antisolvent, and the precipitation takes place in a couple of minutes. By setting the process parameters diastereomeric excess, yields, and selectivity can be controlled. Applicability of the process is demonstrated on the resolution of racemic 2-methoxyphenylacetic acid with enantiopure (R-(−-1-cyclohexylethylamine. Diastereomeric excess values over 55 % along with 80 % yields were achieved at optimal conditions in a single step.
Zikhali, Meluleki; Wingen, Luzie U.; Griffiths, Simon
2016-01-01
Earliness per se (Eps) genes account for the variation in flowering time when vernalization and photoperiod requirements are satisfied. Genomics and bioinformatics approaches were used to describe allelic variation for 40 Triticum aestivum genes predicted, by synteny with Brachypodium distachyon, to be in the 1DL Eps region. Re-sequencing 1DL genes revealed that varieties carrying early heading alleles at this locus, Spark and Cadenza, carry a subtelomeric deletion including several genes. The equivalent region in Rialto and Avalon is intact. A bimodal distribution in the segregating Spark X Rialto single seed descent (SSD) populations enabled the 1DL QTL to be defined as a discrete Mendelian factor, which we named Eps-D1. Near isogenic lines (NILs) and NIL derived key recombinants between markers flanking Eps-D1 suggest that the 1DL deletion contains the gene(s) underlying Eps-D1. The deletion spans the equivalent of the Triticum monoccocum Eps-A m 1 locus, and hence includes MODIFIER OF TRANSCRIPTION 1 (MOT1) and FTSH PROTEASE 4 (FTSH4), the candidates for Eps-A m 1. The deletion also contains T. aestivum EARLY FLOWERING 3-D1 (TaELF3-D1) a homologue of the Arabidopsis thaliana circadian clock gene EARLY FLOWERING 3. Eps-D1 is possibly a homologue of Eps-B1 on chromosome 1BL. NILs carrying the Eps-D1 deletion have significantly reduced total TaELF3 expression and altered TaGIGANTEA (TaGI) expression compared with wild type. Altered TaGI expression is consistent with an ELF3 mutant, hence we propose TaELF3-D1 as the more likely candidate for Eps-D1. This is the first direct fine mapping of Eps effect in bread wheat. PMID:26476691
Zikhali, Meluleki; Wingen, Luzie U; Griffiths, Simon
2016-01-01
Earliness per se (Eps) genes account for the variation in flowering time when vernalization and photoperiod requirements are satisfied. Genomics and bioinformatics approaches were used to describe allelic variation for 40 Triticum aestivum genes predicted, by synteny with Brachypodium distachyon, to be in the 1DL Eps region. Re-sequencing 1DL genes revealed that varieties carrying early heading alleles at this locus, Spark and Cadenza, carry a subtelomeric deletion including several genes. The equivalent region in Rialto and Avalon is intact. A bimodal distribution in the segregating Spark X Rialto single seed descent (SSD) populations enabled the 1DL QTL to be defined as a discrete Mendelian factor, which we named Eps-D1. Near isogenic lines (NILs) and NIL derived key recombinants between markers flanking Eps-D1 suggest that the 1DL deletion contains the gene(s) underlying Eps-D1. The deletion spans the equivalent of the Triticum monoccocum Eps-A (m) 1 locus, and hence includes MODIFIER OF TRANSCRIPTION 1 (MOT1) and FTSH PROTEASE 4 (FTSH4), the candidates for Eps-A (m) 1. The deletion also contains T. aestivum EARLY FLOWERING 3-D1 (TaELF3-D1) a homologue of the Arabidopsis thaliana circadian clock gene EARLY FLOWERING 3. Eps-D1 is possibly a homologue of Eps-B1 on chromosome 1BL. NILs carrying the Eps-D1 deletion have significantly reduced total TaELF3 expression and altered TaGIGANTEA (TaGI) expression compared with wild type. Altered TaGI expression is consistent with an ELF3 mutant, hence we propose TaELF3-D1 as the more likely candidate for Eps-D1. This is the first direct fine mapping of Eps effect in bread wheat. © The Author 2015. Published by Oxford University Press on behalf of the Society for Experimental Biology.
International Nuclear Information System (INIS)
Shiga, Kiyoto; Yamamoto, Hiroshi; Okamoto, Hiroshi
1990-01-01
Rig (rat insulinoma gene) was first isolated from a cDNA library of rat insulinomas and has been found to be activated in various human tumors such as insulinomas, esophageal cancers, and colon cancers. Here the authors isolated the human homologue of rig from a genomic DNA library constructed from a human esophageal carcinoma and determined its complete nucleotide sequence. The gene is composed of about 3,000 nucleotides and divided into four exons separated by three introns: exon 3 encodes the nuclear location signal and the DNA-binding domain of the RIG protein. The transcription initiation site was located at -46 base pairs upstream from the first ATG codon. The 5'-flanking region of the gene has no apparent TATA-box or CAAT-box sequence. However, two GC boxes are found at -189 and -30 base pairs upstream from the transcription initiation site and five GC boxes are also found in introns 1 and 2. The gene is bounded in the 5' region by CpG islands, regions of DNA with a high GC content and a high frequency of CpG dinucleotides relative to the bulk genome. Furthermore, the human genome contains at least six copies of RIG pseudogenes, and four of them have the characteristics of processed pseudogenes. From these results together with the finding that RIG is expressed in a wide variety of tissues and cells, they speculate that RIG belongs to the class of housekeeping genes, whose products are necessary for the growth of all cell types
2010-10-01
... gas (LPG) and compressed natural gas (CNG) must meet the following requirements: (a) The design, installation and testing of each LPG system must meet ABYC A-1, “Marine Liquefied Petroleum Gas (LPG) Systems... 46 Shipping 4 2010-10-01 2010-10-01 false Gas systems. 121.240 Section 121.240 Shipping COAST...
GAS2L1 Is a Centriole-Associated Protein Required for Centrosome Dynamics and Disjunction.
Au, F.K.; Jia, Y.; Jiang, K.; Grigoriev, I.S.; Hau, B.K.; Shen, Y.; Du, S.; Akhmanova, A.S.; Qi, R.Z.
2017-01-01
Mitotic spindle formation and chromosome segregation require timely separation of the two duplicated centrosomes, and this process is initiated in late G2 by centrosome disjunction. Here we report that GAS2L1, a microtubule- and actin-binding protein, associates with the proximal end of mature
Energy Technology Data Exchange (ETDEWEB)
NONE
1997-12-31
Economically viable natural gas production from the low permeability Mesaverde Formation in the Piceance Basin, Colorado requires the presence of an intense set of open natural fractures. Establishing the regional presence and specific location of such natural fractures is the highest priority exploration goal in the Piceance and other western US tight, gas-centered basins. Recently, Advanced Resources International, Inc. (ARI) completed a field program at Rulison Field, Piceance Basin, to test and demonstrate the use of advanced seismic methods to locate and characterize natural fractures. This project began with a comprehensive review of the tectonic history, state of stress and fracture genesis of the basin. A high resolution aeromagnetic survey, interpreted satellite and SLAR imagery, and 400 line miles of 2-D seismic provided the foundation for the structural interpretation. The central feature of the program was the 4.5 square mile multi-azimuth 3-D seismic P-wave survey to locate natural fracture anomalies. The interpreted seismic attributes are being tested against a control data set of 27 wells. Additional wells are currently being drilled at Rulison, on close 40 acre spacings, to establish the productivity from the seismically observed fracture anomalies. A similar regional prospecting and seismic program is being considered for another part of the basin. The preliminary results indicate that detailed mapping of fault geometries and use of azimuthally defined seismic attributes exhibit close correlation with high productivity gas wells. The performance of the ten new wells, being drilled in the seismic grid in late 1996 and early 1997, will help demonstrate the reliability of this natural fracture detection and mapping technology.
Overview of the performance of the JET active gas handling system during and after DTE1
International Nuclear Information System (INIS)
Laesser, R.; Atkins, G.; Bell, A.
1999-02-01
The JET Active Gas Handling System (AGHS) was designed, built and commissioned to handle safely radioactive tritium gas mixtures, to supply tritium (T 2 ) and deuterium (D 2 ) to the JET torus, to process the exhaust gases with the main purpose to enrich and re-use T 2 and D 2 , to detritiate tritiated impurities and to keep discharges far below the approved daily release limits. In addition, the AGHS had to supply the necessary ventilation air streams during maintenance or repair inside or outside of the AGHS building. During the first Deuterium-Tritium Experiment (DTE1) at JET in 1997 the AGHS fulfilled all these tasks in an excellent manner. No unauthorised or unplanned tritium releases occurred and no operational delays were caused by the AGHS. In fact, this was the first true demonstration that quantities of tritium in the tens of grams range can be processed and recycled safely and efficiently in a large fusion device. At the start of DTE1 20 g of tritium were available on the JET site. About 100 g of tritium were supplied from the AGHS to the users which necessitated the recycling of tritium at least five times. Approximately 220 tritium plasma shots were performed during DTE1. Large amounts of tritium were temporarily trapped in the torus. This overview presents the performance of the whole AGHS during DTE1 as well as general aspects such as the preparation for DTE1; the quantities of gases supplied from the AGHS to the users and pumped back to the AGHS; tritium accountancy; interlock systems; failure of equipment; and gives detailed information of the gas processing in each subsystem of the AGHS. As a consequence of the performance of the AGHS during DTE1 we can state confidently that the AGHS is ready for further Deuterium-Tritium Experiments. (author)
Life-cycle greenhouse gas emissions of shale gas, natural gas, coal, and petroleum.
Burnham, Andrew; Han, Jeongwoo; Clark, Corrie E; Wang, Michael; Dunn, Jennifer B; Palou-Rivera, Ignasi
2012-01-17
The technologies and practices that have enabled the recent boom in shale gas production have also brought attention to the environmental impacts of its use. It has been debated whether the fugitive methane emissions during natural gas production and transmission outweigh the lower carbon dioxide emissions during combustion when compared to coal and petroleum. Using the current state of knowledge of methane emissions from shale gas, conventional natural gas, coal, and petroleum, we estimated up-to-date life-cycle greenhouse gas emissions. In addition, we developed distribution functions for key parameters in each pathway to examine uncertainty and identify data gaps such as methane emissions from shale gas well completions and conventional natural gas liquid unloadings that need to be further addressed. Our base case results show that shale gas life-cycle emissions are 6% lower than conventional natural gas, 23% lower than gasoline, and 33% lower than coal. However, the range in values for shale and conventional gas overlap, so there is a statistical uncertainty whether shale gas emissions are indeed lower than conventional gas. Moreover, this life-cycle analysis, among other work in this area, provides insight on critical stages that the natural gas industry and government agencies can work together on to reduce the greenhouse gas footprint of natural gas.
Automatic isotope gas analysis of tritium labelled organic materials Pt. 1
International Nuclear Information System (INIS)
Gacs, I.; Mlinko, S.
1978-01-01
A new automatic procedure developed to convert tritium in HTO hydrogen for subsequent on-line gas counting is described. The water containing tritium is introduced into a column prepared from molecular sieve-5A and heated to 550 deg C. The tritium is transferred by isotopic exchange into hydrogen flowing through the column. The radioactive gas is led into an internal detector for radioactivity measurement. The procedure is free of memory effects, provides quantitative recovery with analytical reproducibility better than 0.5% rel. at a preset number of counts. The experimental and analytical results indicate that isotopic exchange between HTO and hydrogen over a column prepared from alumina or molecular sieve-5A can be successfully applied for the quantitative transfer of tritium from HTO into hydrogen for on-line gas countinq. This provides an analytical procedure for the automatic determination of tritium in water with an analytical reproducibility better than 0.5% rel. The exchange process will also be suitable for rapid tritium transfer from water formed during the decomposition of tritium-labelled organic compounds or biological materials. The application of the procedure in automatic isotope gas analysis of organic materials labelled with tritium will be described in subsequent papers (Parts II and III). (T.G.)
International Nuclear Information System (INIS)
Rogers, C; Schief, W K
2011-01-01
A 2+1-dimensional version of a non-isothermal gas dynamic system with origins in the work of Ovsiannikov and Dyson on spinning gas clouds is shown to admit a Hamiltonian reduction which is completely integrable when the adiabatic index γ = 2. This nonlinear dynamical subsystem is obtained via an elliptic vortex ansatz which is intimately related to the construction of a Lax pair in the integrable case. The general solution of the gas dynamic system is derived in terms of Weierstrass (elliptic) functions. The latter derivation makes use of a connection with a stationary nonlinear Schrödinger equation and a Steen–Ermakov–Pinney equation, the superposition principle of which is based on the classical Lamé equation
Physics of gas breakdown for ion beam transport in gas
International Nuclear Information System (INIS)
Olson, C.L.; Poukey, J.W.; Hinshelwood, D.D.; Rose, D.V.; Hubbard, R.F.; Lampe, M.; Neri, J.M.; Ottinger, P.F.; Slinker, S.P.; Stephanakis, S.J.; Young, F.C.; Welch, D.R.
1993-01-01
Detailed analysis, experiments, and computer simulations are producing a new understanding of gas breakdown during intense ion beam transport in neutral gas. Charge neutralization of beam micro clumps is shown to limit the net clump potentials to a non-zero value π min , which can lead to divergence growth and axial energy spreading. At pressures approx-gt 1 Torr, plasma shielding should substantially reduce this effect Current neutralization has been studied in experiments on the GAMBLE II accelerator. The importance of fast electrons (knockons and runaways) has been established in IPROP simulations, which are in agreement with the experiments. For light ion fusion parameters with pressures approx-gt 1 Torr, very small net current fractions (much-lt 1%) appear feasible, permitting ballistic transport in gas. Self-pinched requires higher net current fractions (≥ 2%) and preliminary IPROP code results indicate that this appears achievable for small-radius intense beams in lower pressure gases (approx-gt Torr). Several self-pinched transport concepts look promising. The importance of these results for both light ion fusion and heavy ion fusion is discussed
Brown, D. H.; Corman, J. C.
1976-01-01
Ten energy conversion systems are defined and analyzed in terms of efficiency. These include: open-cycle gas turbine recuperative; open-cycle gas turbine; closed-cycle gas turbine; supercritical CO2 cycle; advanced steam cycle; liquid metal topping cycle; open-cycle MHD; closed-cycle inert gas MHD; closed-cycle liquid metal MHD; and fuel cells. Results are presented.
International Nuclear Information System (INIS)
Deneanu, Cornel; Popa Nemoiu, Dragos; Nica, Dana; Bucur, Cosmin
2007-01-01
The continuous monitoring of gas mixture concentrations (deuterium/ hydrogen/oxygen/nitrogen) accumulated in 'Moderator Cover Gas', 'Liquid Control Zone' and 'Heat Transport D 2 O Storage Tank Cover Gas', as well as the continuous monitoring of Heavy Water into Light Water concentration in 'Boilers Steam', 'Boilers Blown Down', 'Moderator heat exchangers', and 'Recirculated Water System', sensing any leaks of Cernavoda NPP U1 led to requirement of developing a new process network for gas chromatograph and analyzers connected to the SCADA system and Digital Control Computers of Cernavoda NPP Unit 1. In 2005 it was designed and implemented the process network for gas chromatograph which connected the gas chromatograph equipment to the SCADA system and Digital Control Computers of the Cernavoda NPP Unit 1. Later this process network for gas chromatograph has been extended to connect the AE13 and AE14 Fourier Transform Infrared (FTIR) analyzers with either. The Gas Chromatograph equipment measures with best accuracy the mixture gases (deuterium/ hydrogen/oxygen/nitrogen) concentration. The Fourier Transform Infrared (FTIR) AE13 and AE14 Analyzers measure the Heavy Water into Light Water concentration in Boilers Steam, Boilers BlownDown, Moderator heat exchangers, and Recirculated Water System, monitoring and signaling any leaks. The Gas Chromatograph equipment and Fourier Transform Infrared (FTIR) AE13 and AE14 Analyzers use the new OPC (Object Link Embedded for Process Control) technologies available in ABB's VistaNet network for interoperability with automation equipment. This new process network has interconnected the ABB chromatograph and Fourier Transform Infrared analyzers with plant Digital Control Computers using new technology. The result was an increased reliability and capability for inspection and improved system safety
GAS STORAGE TECHNOLOGY CONSORTIUM
Energy Technology Data Exchange (ETDEWEB)
Robert W. Watson
2004-10-18
Gas storage is a critical element in the natural gas industry. Producers, transmission and distribution companies, marketers, and end users all benefit directly from the load balancing function of storage. The unbundling process has fundamentally changed the way storage is used and valued. As an unbundled service, the value of storage is being recovered at rates that reflect its value. Moreover, the marketplace has differentiated between various types of storage services, and has increasingly rewarded flexibility, safety, and reliability. The size of the natural gas market has increased and is projected to continue to increase towards 30 trillion cubic feet (TCF) over the next 10 to 15 years. Much of this increase is projected to come from electric generation, particularly peaking units. Gas storage, particularly the flexible services that are most suited to electric loads, is critical in meeting the needs of these new markets. In order to address the gas storage needs of the natural gas industry, an industry-driven consortium was created--the Gas Storage Technology Consortium (GSTC). The objective of the GSTC is to provide a means to accomplish industry-driven research and development designed to enhance operational flexibility and deliverability of the Nation's gas storage system, and provide a cost effective, safe, and reliable supply of natural gas to meet domestic demand. To accomplish this objective, the project is divided into three phases that are managed and directed by the GSTC Coordinator. The first phase, Phase 1A, was initiated on September 30, 2003, and was completed on March 31, 2004. Phase 1A of the project included the creation of the GSTC structure, development and refinement of a technical approach (work plan) for deliverability enhancement and reservoir management. This report deals with Phase 1B and encompasses the period July 1, 2004, through September 30, 2004. During this time period there were three main activities. First was the
Goncharov, I; Palfi, Z; Bindereif, A; Michaeli, S
1999-04-30
Trans-splicing in trypanosomes involves the addition of a common spliced leader (SL) sequence, which is derived from a small RNA, the SL RNA, to all mRNA precursors. The SL RNA is present in the cell in the form of a ribonucleoprotein, the SL RNP. Using conventional chromatography and affinity selection with 2'-O-methylated RNA oligonucleotides at high ionic strength, five proteins of 70, 16, 13, 12, and 8 kDa were co-selected with the SL RNA from Leptomonas collosoma, representing the SL RNP core particle. Under conditions of lower ionic strength, additional proteins of 28 and 20 kDa were revealed. On the basis of peptide sequences, the gene coding for a protein with a predicted molecular weight of 11.9 kDa was cloned and identified as homologue of the cis-spliceosomal SmE. The protein carries the Sm motifs 1 and 2 characteristic of Sm antigens that bind to all known cis-spliceosomal uridylic acid-rich small nuclear RNAs (U snRNAs), suggesting the existence of Sm proteins in trypanosomes. This finding is of special interest because trypanosome snRNPs are the only snRNPs examined to date that are not recognized by anti-Sm antibodies. Because of the early divergence of trypanosomes from the eukaryotic lineage, the trypanosome SmE protein represents one of the primordial Sm proteins in nature.
Study of the MWPC gas gain behaviour as a function of the gas pressure and temperature
Pinci, D
2005-01-01
The Muon System of the LHCb experiment is composed of five detection stations (M1-M5) equipped with 1368 Multi-Wire Proportional Chambers (MWPC) and 24 Triple-GEM detectors. The Multi Wire Proportional Chamber (MWPC) performances (detection efficiency, time resolution, pad-cluster size and ageing properties) are heavily dependent on the gas gain. The chamber gain depends on the gas density and therefore on the gas temperature and pressure. The impact of the environmental parameters on the MWPC gain has been studied in detail. The results, togheter with a simple method proposed to account for the gain variations, are reported in this note. The absolute gas gain at the testing voltage of 2750 V was also measured to be (1.2 +- 0.1)*10^5.
International Nuclear Information System (INIS)
Bateman, J.E.
1994-01-01
The operation of gas counters used for detecting radiation is explained in terms of the four fundamental physical processes which govern their operation. These are 1) conversion of neutral radiation into charged particles, 2) ionization of the host gas by a fast charge particle 3) transport of the gas ions to the electrodes and 4) amplification of the electrons in a region of enhanced electric field. Practical implications of these are illustrated. (UK)
API Specification Q1: The quality system specification for the oil and gas industry
International Nuclear Information System (INIS)
Peurifoy, C.K.
1994-01-01
The Oil and Gas Production Industry began using the American Petroleum Institute's Specification Q1, ''Specification for Quality Programs'' (1st Edition, January 1, 1985) in late 1984. The generic ISO 9000 Series Standards, ''Quality management and quality assurance standards,'' were developed at about the same time and were published for public use in 1987. By late 1989 and into the early nineties, the formation of the European Economic Community and the issuance of the EC Procurement Directives sparked a rush by companies worldwide to comply with all the requirements necessary to do business in Europe. The ensuing ''ISO Mania'' has created a windfall for any company providing ISO 9000 quality system certification, consulting, training and almost anything to do with ISO 9000. It is difficult to miss one of the hundreds of newspaper and trade magazine articles promoting the ISO 9000 Quality Standards for use in almost every industry. This paper discusses the latest developments of both the lesser known API Spec Q1 and the much publicized ISO 9001 as well as discusses some of the similarities and differences between them and possible future trends. It also reviews some of the strengths and weaknesses of both documents to support the sentiment that API Spec Q1, in conjunction with the API Monogram Program, is the best quality standard for use in ordering equipment, materials and services for the Oil and Gas Industry
Seafloor geomorphic manifestations of gas venting and shallow subbottom gas hydrate occurrences
Paull, C K; Caress, D W; Thomas, Hans; Lundsten, Eve M.; Anderson, Kayce; Gwiazda, Roberto; Riedel, M; McGann, Mary; Herguera, J C
2015-01-01
High-resolution multibeam bathymetry data collected with an autonomous underwater vehicle (AUV) complemented by compressed high-intensity radar pulse (Chirp) profiles and remotely operated vehicle (ROV) observations and sediment sampling reveal a distinctive rough topography associated with seafloor gas venting and/or near-subsurface gas hydrate accumulations. The surveys provide 1 m bathymetric grids of deep-water gas venting sites along the best-known gas venting areas along the Pacific margin of North America, which is an unprecedented level of resolution. Patches of conspicuously rough seafloor that are tens of meters to hundreds of meters across and occur on larger seafloor topographic highs characterize seepage areas. Some patches are composed of multiple depressions that range from 1 to 100 m in diameter and are commonly up to 10 m deeper than the adjacent seafloor. Elevated mounds with relief of >10 m and fractured surfaces suggest that seafloor expansion also occurs. Ground truth observations show that these areas contain broken pavements of methane-derived authigenic carbonates with intervening topographic lows. Patterns seen in Chirp profiles, ROV observations, and core data suggest that the rough topography is produced by a combination of diagenetic alteration, focused erosion, and inflation of the seafloor. This characteristic texture allows previously unknown gas venting areas to be identified within these surveys. A conceptual model for the evolution of these features suggests that these morphologies develop slowly over protracted periods of slow seepage and shows the impact of gas venting and gas hydrate development on the seafloor morphology.
Method of separation of gas mixtures
Energy Technology Data Exchange (ETDEWEB)
Berlin, M.A.; Potapov, V.F.; Potapova, M.S.
1980-04-05
Gas mixtures are separated in a rectification tower by repeated counterflow contact of the heated gas flow and cool condensate as the pressure drops in each stage of separation (StR) and when condensate is added from StR with lower pressure to the StR with higher pressure. In order to reduce energy consumption noncondensing gas in amounts of 5-15 percent by weight of the amount of incoming gases are added. Hydrocarbon or carbon dioxide gas can be used as the latter. Example. To separate natural gas of the Shatlyk deposit of composition, percent by mo1: C1 -- 94.960; C2 -- 4.260; C3 -- 0.200; C4 -- 0.08; C4+B -- 0.51. It is enriched with carbon dioxide gas in an amount of 10 percent by weight. Upon rectification of the enriched hydrocarbon mixture separation is achieved at lower pressures of the gas mixture and less cold. This leads to reduction of energy consumption by 10-12 percent.
Anion exchange behaviour of Zr, Hf, Nb, Ta and Pa as homologues of RF and Db in fluoride medium
Energy Technology Data Exchange (ETDEWEB)
Monroy G, F. [ININ, Carretera Mexico-Toluca s/n, 52750 Ocoyoacac, Estado de Mexico (Mexico); Trubert, D.; Brillard, L.; Hussonnois, M.; Constantinescu, O.; Le Naour, C., E-mail: fabiola.monroy@inin.gob.m [Institut de Physique Nucleaire, F-91406 Orsay, France (France)
2010-07-01
Studies of the chemical property of trans actinide elements are very difficult due to their short half-lives and extremely small production yields. However it is still possible to obtain considerable information about their chemical properties, such as the most stable oxidation states in aqueous solution, complexing ability, etc., comparing their behaviour with their lighter homologous in the periodic table. In order to obtain a better knowledge of the behaviour of rutherfordium, RF (element 104), dub nium, Db (element 105) in HF medium, the sorption properties of Zr, Hf, Nb, Ta an Pa, homologues of RF and Db, were studied in NH{sub 4}F/HClO{sub 4} medium in this work. Stability constants of the fluoride complexes of these elements were experimentally obtained from K{sub d} obtained at different F{sup -} and H{sup +} concentrations. The anionic complexes: [Zr(Hf)F{sub 5}]{sup -}, [Zr(Hf)F{sub 6}]{sup 2-}, [Zr(Hf)F{sub 7}]{sup 3-}, [Ta(Pa)F{sub 6}]{sup -}, [Ta(Pa)F{sub 7}]{sup 2-}, [Ta(Pa)F{sub 8}]{sup 3-}, [NbOF{sub 4}]{sup -} and [NbOF{sub 5}]{sup 2-} are present as predominant species in the HF range over investigation. (Author)
Pazman, C; Mayes, C A; Fanto, M; Haynes, S R; Mlodzik, M
2000-04-01
The small GTPase Ras plays an important role in many cellular signaling processes. Ras activity is negatively regulated by GTPase activating proteins (GAPs). It has been proposed that RasGAP may also function as an effector of Ras activity. We have identified and characterized the Drosophila homologue of the RasGAP-binding protein G3BP encoded by rasputin (rin). rin mutants are viable and display defects in photoreceptor recruitment and ommatidial polarity in the eye. Mutations in rin/G3BP genetically interact with components of the Ras signaling pathway that function at the level of Ras and above, but not with Raf/MAPK pathway components. These interactions suggest that Rin is required as an effector in Ras signaling during eye development, supporting an effector role for RasGAP. The ommatidial polarity phenotypes of rin are similar to those of RhoA and the polarity genes, e.g. fz and dsh. Although rin/G3BP interacts genetically with RhoA, affecting both photoreceptor differentiation and polarity, it does not interact with the gain-of-function genotypes of fz and dsh. These data suggest that Rin is not a general component of polarity generation, but serves a function specific to Ras and RhoA signaling pathways.
Sensing of HSV-1 by the cGAS-STING pathway in microglia orchestrates antiviral defence in the CNS
DEFF Research Database (Denmark)
Reinert, Line S; Lopušná, Katarína; Winther, Henriette
2016-01-01
Herpes simplex encephalitis (HSE) is the most common form of acute viral encephalitis in industrialized countries. Type I interferon (IFN) is important for control of herpes simplex virus (HSV-1) in the central nervous system (CNS). Here we show that microglia are the main source of HSV-induced t......Herpes simplex encephalitis (HSE) is the most common form of acute viral encephalitis in industrialized countries. Type I interferon (IFN) is important for control of herpes simplex virus (HSV-1) in the central nervous system (CNS). Here we show that microglia are the main source of HSV......-induced type I IFN expression in CNS cells and these cytokines are induced in a cGAS-STING-dependent manner. Consistently, mice defective in cGAS or STING are highly susceptible to acute HSE. Although STING is redundant for cell-autonomous antiviral resistance in astrocytes and neurons, viral replication...... is strongly increased in neurons in STING-deficient mice. Interestingly, HSV-infected microglia confer STING-dependent antiviral activities in neurons and prime type I IFN production in astrocytes through the TLR3 pathway. Thus, sensing of HSV-1 infection in the CNS by microglia through the cGAS-STING pathway...
Fabrication of a P3HT-ZnO Nanowires Gas Sensor Detecting Ammonia Gas
Directory of Open Access Journals (Sweden)
Chin-Guo Kuo
2017-12-01
Full Text Available In this study, an organic-inorganic semiconductor gas sensor was fabricated to detect ammonia gas. An inorganic semiconductor was a zinc oxide (ZnO nanowire array produced by atomic layer deposition (ALD while an organic material was a p-type semiconductor, poly(3-hexylthiophene (P3HT. P3HT was suitable for the gas sensing application due to its high hole mobility, good stability, and good electrical conductivity. In this work, P3HT was coated on the zinc oxide nanowires by the spin coating to form an organic-inorganic heterogeneous interface of the gas sensor for detecting ammonia gas. The thicknesses of the P3HT were around 462 nm, 397 nm, and 277 nm when the speeds of the spin coating were 4000 rpm, 5000 rpm, and 6000 rpm, respectively. The electrical properties and sensing characteristics of the gas sensing device at room temperature were evaluated by Hall effect measurement and the sensitivity of detecting ammonia gas. The results of Hall effect measurement for the P3HT-ZnO nanowires semiconductor with 462 nm P3HT film showed that the carrier concentration and the mobility were 2.7 × 1019 cm−3 and 24.7 cm2∙V−1∙s−1 respectively. The gas sensing device prepared by the P3HT-ZnO nanowires semiconductor had better sensitivity than the device composed of the ZnO film and P3HT film. Additionally, this gas sensing device could reach a maximum sensitivity around 11.58 per ppm.
SIRT1 may play a crucial role in overload-induced hypertrophy of skeletal muscle.
Koltai, Erika; Bori, Zoltán; Chabert, Clovis; Dubouchaud, Hervé; Naito, Hisashi; Machida, Shuichi; Davies, Kelvin Ja; Murlasits, Zsolt; Fry, Andrew C; Boldogh, Istvan; Radak, Zsolt
2017-06-01
Silent mating type information regulation 2 homologue 1 (SIRT1) activity and content increased significantly in overload-induced hypertrophy. SIRT1-mediated signalling through Akt, the endothelial nitric oxide synthase mediated pathway, regulates anabolic process in the hypertrophy of skeletal muscle. The regulation of catabolic signalling via forkhead box O 1 and protein ubiquitination is SIRT1 dependent. Overload-induced changes in microRNA levels regulate SIRT1 and insulin-like growth factor 1 signalling. Significant skeletal muscle mass guarantees functional wellbeing and is important for high level performance in many sports. Although the molecular mechanism for skeletal muscle hypertrophy has been well studied, it still is not completely understood. In the present study, we used a functional overload model to induce plantaris muscle hypertrophy by surgically removing the soleus and gastrocnemius muscles in rats. Two weeks of muscle ablation resulted in a 40% increase in muscle mass, which was associated with a significant increase in silent mating type information regulation 2 homologue 1 (SIRT1) content and activity (P overload-induced hypertrophy. These findings, along with the well-known regulatory roles that SIRT1 plays in modulating both anabolic and catabolic pathways, allow us to propose the hypothesis that SIRT1 may actually play a crucial causal role in overload-induced hypertrophy of skeletal muscle. This hypothesis will now require rigorous direct and functional testing. © 2017 The Authors. The Journal of Physiology © 2017 The Physiological Society.
International Nuclear Information System (INIS)
Molyneaux, M.P.
1998-01-01
An overview of natural gas markets in Canada and in the United States was provided. The major factors that determine the direction of natural gas prices were depicted graphically. Price volatility has decreased in recent months. As expected, April through November total energy consumption reached historically high levels. Demand for natural gas during the summer of 1997 was not as strong as anticipated. Nuclear energy appears to be on the slippery slope, with natural gas-driven electricity projects to fill the void. Hydroelectricity had a strong showing in 1997. Prospects are less bright for 1998 due to above average temperatures. Canadian natural gas export capacity has increased 5.5 times between 1986 and estimated 1999 levels. Despite this, in 1997, deliveries to the United States were marginally behind expectations. Natural gas consumption, comparative fuel prices, natural gas drilling activity, natural gas storage capacity, actual storage by region, and average weekly spot natural gas prices, for both the U. S. and Canada, were also provided. With regard to Canada, it was suggested that Canadian producers are well positioned for a significant increase in their price realization mostly because of the increase in Canada's export capacity in 1997 (+175 Mmcf/d), 1998 (1,060 Mmcf/d) and potentially in 1999 or 2000, via the Alliance Pipeline project. Nevertheless, with current production projections it appears next to impossible to fill the 10.9 Bcf/d of export capacity that will be potentially in place by the end of 1999. tabs., figs
Energy Technology Data Exchange (ETDEWEB)
NONE
1998-12-31
ARCTECH has developed a novel process (MicGAS) for direct, anaerobic biomethanation of coals. Biomethanation potential of coals of different ranks (Anthracite, bitumious, sub-bitumious, and lignites of different types), by various microbial consortia, was investigated. Studies on biogasification of Texas Lignite (TxL) were conducted with a proprietary microbial consortium, Mic-1, isolated from hind guts of soil eating termites (Zootermopsis and Nasutitermes sp.) and further improved at ARCTECH. Various microbial populations of the Mic-1 consortium carry out the multi-step MicGAS Process. First, the primary coal degraders, or hydrolytic microbes, degrade the coal to high molecular weight (MW) compounds. Then acedogens ferment the high MW compounds to low MW volatile fatty acids. The volatile fatty acids are converted to acetate by acetogens, and the methanogens complete the biomethanation by converting acetate and CO{sub 2} to methane.
International Nuclear Information System (INIS)
2003-01-01
This symposium provided an opportunity for participants to learn from gas industry leaders in both Canada and the United States, different strategies to cost-effectively develop unconventional gas resources. In particular, the representative from EnCana Corporation discussed the results of tight gas drilling in Northeastern British Columbia. The speaker for MGV Energy reported on the outcome of test drilling for coalbed methane (CBM) in Southern Alberta. The economic development of tight gas reservoirs in the United States Permian Basin was discussed by the speaker representing BP America Production Company. The role of unconventional gas in the North American natural gas supply and demand picture was dealt with by TransCanada PipeLines Limited and Canadian Gas Potential Committee. The trend for natural gas prices in North America was examined by Conoco Inc. The Geological Survey of Canada addressed the issue of gas hydrate potential in the Mackenzie Delta Mallik Field. In addition, one presentation by El Paso Production Company discussed the successful drilling for deep, tight gas and CBM in the United States. There were nine presentations at this symposium, of which three were indexed separately for inclusion in this database. refs., tabs., figs
Uptake of Organic Gas Phase Species by 1-Methylnaphthalene
Zhang, H.; Xia, J.; Davidovits, P.; Jayne, J. T.; Kolb, C. E.; Worsnop, D. R.
2002-12-01
Using a droplet train apparatus, the mass accommodation coefficients (α) on 1-methylnapthalene of gas phase m-xylene, ethylbenzene, butylbenzene, α-pinene, γ-terpinene, and 2-methyl-2-hexanol were measured as a function of temperature (265 K to 296 K). 1-methylnapthalene was selected as a surrogate for hydrophobic and aromatic hydrocarbons found in tropospheric aerosols. The mass accommodation coefficients (α) of all the molecules obtained from these measurements exhibit negative temperature dependence. The upper and lower values of α at 265 K and 296 K respectively are: for m-xylene 0.44 and 0.26; for ethylbenzene 0.37 and 0.22; for butylbenzene 0.47 and 0.31; for α-pinene 0.47 and 0.096; for γ-terpinene 0.39 and 0.12; for 2-methyl-2-hexanol 0.44 and 0.26. The uptake measurements also yielded values for the product HDl1/2 for most of the molecules studied (H = Henry's law constant, Dl = liquid phase diffusion coefficient). Using calculated values of Dl the Henry's law constant is obtained, and expressed in the form ln H (M/atm) = -A + B/T. The A and B values for the molecules studied are listed in Table 1. Table 1: A and B values for the Henry's law constant H expressed as ln H (M/atm) = -A + B/T \\ m-xylene: A=7.20, B=4060\\ethylbenzene: A=5.81, B=3660\\butylbenzene: A=16.95, B=7330α-pinene: A=15.69, B=6360\\2-methyl-2-hexanol: A=9.95, B=4760
Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya
2002-12-01
The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.
Gas market prospects in Europe
International Nuclear Information System (INIS)
Rissanen, E.
1992-01-01
Gas demand in Europe may rise 50 to 70% during the next 20 years. The most weighty reasons for the increase would be a robust increase of gas-fuelled power generation, the gas use for abating environmental pollution and a remarkable replacement of coal and oil by gas. A dilemma will be whether a sufficient volume of gas is available particularly for Eastern Europe. The total indigenous production and the imports from existing sources cannot increase sufficiently. Other reasons for new imports are diversification and security of supplies and a short lifetime of domestic reserves. Potential sources to import incremental gas and their shares could be as follows: Algeria and Libya 15 - 20%, Russia 20 - 35%, overseas imports as LNG (liquefied natural gas) 20 - 35% and Iran by pipeline 20 - 25%. 1 tab
Suitability of selected free-gas and dissolved-gas sampling containers for carbon isotopic analysis.
Eby, P; Gibson, J J; Yi, Y
2015-07-15
Storage trials were conducted for 2 to 3 months using a hydrocarbon and carbon dioxide gas mixture with known carbon isotopic composition to simulate typical hold times for gas samples prior to isotopic analysis. A range of containers (both pierced and unpierced) was periodically sampled to test for δ(13)C isotopic fractionation. Seventeen containers were tested for free-gas storage (20°C, 1 atm pressure) and 7 containers were tested for dissolved-gas storage, the latter prepared by bubbling free gas through tap water until saturated (20°C, 1 atm) and then preserved to avoid biological activity by acidifying to pH 2 with phosphoric acid and stored in the dark at 5°C. Samples were extracted using valves or by piercing septa, and then introduced into an isotope ratio mass spectrometer for compound-specific δ(13)C measurements. For free gas, stainless steel canisters and crimp-top glass serum bottles with butyl septa were most effective at preventing isotopic fractionation (pierced and unpierced), whereas silicone and PTFE-butyl septa allowed significant isotopic fractionation. FlexFoil and Tedlar bags were found to be effective only for storage of up to 1 month. For dissolved gas, crimp-top glass serum bottles with butyl septa were again effective, whereas silicone and PTFE-butyl were not. FlexFoil bags were reliable for up to 2 months. Our results suggest a range of preferred containers as well as several that did not perform very well for isotopic analysis. Overall, the results help establish better QA/QC procedures to avoid isotopic fractionation when storing environmental gas samples. Recommended containers for air transportation include steel canisters and glass serum bottles with butyl septa (pierced and unpierced). Copyright © 2015 John Wiley & Sons, Ltd.
Energy Technology Data Exchange (ETDEWEB)
Leroux, H
1943-01-01
Various efforts to produce fuel gas from waste materials by fermentation are reviewed. Although the thermal yield appears to be attractive (60%) in the formation of CH/sub 4/ + CO/sub 2/ from cellulose the process requires very large equipment owing to the slowness of the reaction. From 1 ton of waste, a daily production of 1 m/sup 2/ of gas (7700 cal) is obtained for 50 days.
Improved gas installations and services. Phase 1: Analysis project. Part report
International Nuclear Information System (INIS)
Nielsen, K.J.
1996-05-01
As Danish gas companies receive a large number of complaints related to the installation and operation of gas installations it was suggested that a course for personnel should be established in order to raise the standard of services and installation requirements. The first phase of the described project was to evaluate the quality of the gas installers' services so as to determine which aspects of installation and services should be emphasized during such a course. Interviews were carried out and questionnaires (illustrated within the document) sent out to installaters etc. Recommendations include that the level of information given to customers should be raised, also in relation to maintenance, and that installation should be improved. Analyses of the degree of customers' satisfaction, of the nature of the quality of services etc. expected, subjects for further training in this area and details of the training system are dealt with
Productivity improvements in gas distribution
International Nuclear Information System (INIS)
Young, M.R.
1997-01-01
In 1993, the Hilmer Report resulted in the introduction of the National Competition Policy which, in the case of the gas industry, aims to promote gas-on-gas competition where to date it has been excluded. In response, and to prepare for wide gas industry reform, Gas and Fuel formed three fundamentally different core businesses on 1 July 1996 - Energy Retail, Network, and Contestable Services. In one productivity improvement initiative which is believed to be unique, Gas and Fuel appointed three companies as strategic alliance partners for distribution system maintenance. Gas and Fuel can now concentrate on its core role as asset manager which owns and operates the distribution system while procuring all services from what will become non-regulated businesses. This Paper details this initiative and the benefits which have resulted from overall changes and improvements, and outlines the challenges facing Gas and Fuel in the future. (au)
Directory of Open Access Journals (Sweden)
Ling Nie
2016-01-01
Full Text Available Cardiac fibroblasts (CFs play a key role in cardiac fibrosis by regulating the balance between extracellular matrix synthesis and breakdown. Although phosphatase and tensin homologue on chromosome 10 (PTEN has been found to play an important role in cardiovascular disease, it is not clear whether PTEN is involved in functional regulation of CFs. In the present study, PTEN was overexpressed in neonatal rat CFs via recombinant adenovirus-mediated gene transfer. The effects of PTEN overexpression on cell-cycle progression and angiotensin II- (Ang II- mediated regulation of collagen metabolism, synthesis of matrix metalloproteinases, and Akt/P27 signaling were investigated. Compared with uninfected cells and cells infected with green fluorescent protein-expressing adenovirus (Ad-GFP, cells infected with PTEN-expressing adenovirus (Ad-PTEN significantly increased PTEN protein and mRNA levels in CFs (P<0.05. The proportion of CFs in the G1/S cell-cycle phase was significantly higher for PTEN-overexpressing cells. In addition, Ad-PTEN decreased mRNA expression and the protein synthesis rate of collagen types I and III and antagonized Ang II-induced collagen synthesis. Overexpression of PTEN also decreased Ang II-induced matrix metalloproteinase-2 (MMP-2 and tissue inhibitor of metalloproteinase-1 (TIMP-1 production as well as gelatinase activity. Moreover, Ad-PTEN decreased Akt expression and increased P27 expression independent of Ang II stimulation. These results suggest that PTEN could regulate its functional effects in neonatal rat CFs partially via the Akt/P27 signaling pathway.
International Nuclear Information System (INIS)
Riddell, C.H.
1993-01-01
The natural gas industry and market prospects in Canada are reviewed from a producer's point of view. In the first eight months of 1993, $2.3 billion in new equity was raised for natural gas exploration and production, compared to $900 million in 1991 and $1.2 billion in 1992. The number of wells drilled in the western Canada basin is expected to reach 8,000-9,000 in 1993, up from 5,600 in 1992, and Canadian producers' share of the North American natural gas market will probably reach 20% in 1993, up from 13% in 1986. Potential and proved gas supply in North America is ca 750 trillion ft 3 , of which ca 30% is in Canada. Factors affecting gas producers in Canada are the deregulated nature of the market, low costs for finding gas (finding costs in the western Canada basin are the lowest of any basin in North America), and the coming into balance of gas supply and demand. The former gas surplus has been reduced by expanding markets and by low prices which reduced the incentive to find new reserves. This surplus is largely gone, and prices have started rising although they are still lower than the pre-deregulation prices. Progress is continuing toward an integrated North American gas market in which a number of market hubs allow easy gas trading between producers and consumers. Commodity exchanges for hedging gas prices are beginning operation and electronic trading of gas contracts and pipeline capacity will also become a reality. 4 figs
Design of a hybrid gas proportional counter with CdTe guard counters for sup 1 sup 4 C dating system
Zhang, L; Hinamoto, N; Nakazawa, M; Yoshida, K
2002-01-01
Nowadays uniform, low-cost and large-size compound semiconductor detectors are available up to several square centimeters. We are trying to combine this technology with conventional gas detectors to upgrade an anticoincidence type proportional counter, Oeschger-type thin wall counter of 2.2 l, used for a sup 1 sup 4 C dating facility at the University of Tokyo. In order to increase the ratio of the signal to the background for smaller quantity of samples less than 1 g, an effective approach is to minimize the detector volume at higher gas pressure. However, the anticoincidence function suffers from such a small volume. Therefore we designed a new active wall gas counter of 0.13 l counting volume using CdTe compound semiconductor detectors as the wall of the gas proportional counter to perform anticoincidence. Simulation study showed that at noise thresholds less than 70 keV, the wall counters can reject above 99.8% of events arising from outer gamma rays. Measured noise levels of CdTe detectors were smaller t...
Janssens, Geert; Mangelinckx, Sven; Courtheyn, Dirk; De Kimpe, Norbert; Matthijs, Bert; Le Bizec, Bruno
2015-09-02
The administration of synthetic homologues of naturally occurring steroids can be demonstrated by measuring (13)C/(12)C isotopic ratios of their urinary metabolites. Gas chromatography-mass spectrometry/combustion/isotope ratio mass spectrometry (GC-MS/C/IRMS) was used in this study to appraise in a global approach isotopic deviations of two 17β-testosterone metabolites (17α-testosterone and etiocholanolone) and one 17β-estradiol metabolite (17α-estradiol) together with those of 5-androstene-3β,17α-diol as endogenous reference compound (ERC). Intermediate precisions of 0.35‰, 1.05‰, 0.35‰, and 0.21‰, respectively, were observed (n = 8). To assess the performance of the analytical method, a bull and a heifer were treated with 17β-testosterone propionate and 17β-estradiol-3-benzoate. The sensitivity of the method permitted the demonstration of 17β-estradiol treatment up to 24 days. For 17β-testosterone treatment, the detection windows were 3 days and 24 days for the bull and the heifer, respectively. The capability of GC-MS/C/IRMS to demonstrate natural steroid abuse for urinary steroids was eventually compared to those of mass spectrometry (LC-MS/MS) when measuring intact steroid esters in blood and hair.
International Nuclear Information System (INIS)
Ramirez, M.
1999-01-01
A series of overhead viewgraphs accompanied this presentation which focused on various aspects of the natural gas industry in Mexico. Some of the viewgraphs depicted statistics from 1998 regarding natural gas throughput from various companies in North America, natural gas reserves around the world, and natural gas reserves in Mexico. Other viewgraphs depicted associated and non-associated natural gas production from 1988 to 1998 in million cubic feet per day. The Burgos Basin and the Cantarell Basin gas production from 1997 to 2004 was also depicted. Other viewgraphs were entitled: (1) gas processing infrastructure for 1999, (2) cryogenic plant at Cd. PEMEX, (3) average annual growth of dry natural gas production for 1997-2004 is estimated at 5.2 per cent, (4) gas flows for December 1998, (5) PGPB- interconnect points, (6) U.S. Mexico gas trade for 1994-1998, (7) PGPB's interconnect projects with U.S., and (8) natural gas storage areas. Technological innovations in the industry include more efficient gas turbines which allow for cogeneration, heat recovery steam generators which reduce pollutant emissions by 21 per cent, cold boxes which increase heat transfer efficiency, and lateral reboilers which reduce energy consumption and total costs. A pie chart depicting natural gas demand by sector shows that natural gas for power generation will increase from 16 per cent in 1997 to 31 per cent in 2004. The opportunities for cogeneration projects were also reviewed. The Comision Federal de Electricidad and independent power producers represent the largest opportunity. The 1997-2001 investment program proposes an 85 per cent sulphur dioxide emission reduction compared to 1997 levels. This presentation also noted that during the 1998-2001 period, total ethane production will grow by 58 tbd. 31 figs
Energy Technology Data Exchange (ETDEWEB)
Hernandez R, Alejandro; Lopez H, Juan Arturo R; Mazur Czerwiec, Zdizslaw; Cordero G, Jesus [Instituto de Investigaciones Electricas, Cuernavaca, Morelos (Mexico)
2006-07-01
This technical article presents an analysis including the three-dimensional modeling of the flow channel in the nozzle and the movable blade in order to discover the velocity distribution, temperatures and pressures of the main hot gas flow produced in the inter-stage 1. The aim is to establish key evaluation criteria leading to an opportune repair and therefore smaller operation expenses. Thus, the application of a commercial software of CFD is described to model the channel of the first stage in the gas turbine Frame 7, the geometric architecture is shown in the web of the gas turbine, as well as the border conditions used in the results assessment. [Spanish] Este articulo tecnico presenta un analisis que incluye la modelacion tridimensional del canal de flujo en la tobera y el alabe movil para conocer las distribuciones de las velocidades, temperaturas y presiones del flujo principal de gases calientes que se desarrollan en la inter-etapa 1. El fin es establecer criterios clave de evaluacion que conduzcan a una oportuna reparacion y por ende menores gastos de operacion. Asi, se describe la aplicacion de un software comercial de CFD para modelar el canal de flujo de la primera etapa de una turbina de gas Frame 7, se muestra la arquitectura geometrica y el mallado de la turbina de gas, asi como las condiciones de frontera usadas y la validacion de resultados.
Gas-on-gas competition in Shanghai
International Nuclear Information System (INIS)
Manuhutu, Chassty; Owen, Anthony D.
2010-01-01
In common with other major economic centres in China, Shanghai's energy consumption has been increasing rapidly to support the high growth rate of its economy. To achieve rational, efficient and clean use of energy, together with improved environmental quality within the city, the Shanghai municipal government has decided to expand the supply and utilization of natural gas. Shanghai plans to increase the share of natural gas in its primary energy mix to 7 per cent by 2010, up from 3 per cent in 2005. This increase in natural gas demand has to be matched with a corresponding increase in supply. To date, the Shanghai region has relied on offshore extracted natural gas but this supply is limited due to the size of the reserves. Since 2005, the West-East pipeline has provided an alternative for Shanghai but demands from other regions could reduce the potential for expanding supplies from that source. Since domestic production will not be sufficient to meet demand in the near future, Shanghai is building a liquefied natural gas (LNG) regasification terminal at the Yangshan deep-water port that would allow an additional supply of more than 3 billion cubic meters per year of natural gas. Malaysia has already committed to supply LNG to the Shanghai terminal at a price that is significantly higher than the wholesale 'city-gate' price for natural gas transported via pipeline, but still lower than the gas price to end-use consumers. The presence of both an LNG terminal and a transmission pipeline that connects Shanghai to domestic gas-producing regions will create gas-on-gas competition. This study assesses the benefits of introducing such competition to one of China's most advanced cities under various scenarios for demand growth. In this paper, the impact of imported LNG on market concentration in Shanghai's gas market will be analysed using the Herfindahl-Hirschmann index (HHI) and the residual supply index (RSI). Our results show that Shanghai remains a supply
High-BTU gas production from tar-bearing hot coke oven gas over iron catalyst
Energy Technology Data Exchange (ETDEWEB)
L.Y. Li; K. Morishita; T. Takarada [Gunma University, Gunma (Japan). Department of Biological and Chemical Engineering
2005-07-01
To utilize the tar-bearing hot coke oven gas (the by-product of coke making process) more effectively, a process was developed by converting the hot coke oven gas into a methane rich high-BTU gas over iron-bearing catalysts. The catalytic behaviour of Indonesian limonite ore was mainly discussed. For a reference, a conventional nickel catalyst (Ni/Al{sub 2}O{sub 3}) was employed. Laboratory scale tests were carried out in a two-stage fixed-bed reactor at ambient pressure. A bituminous coal sample was heated at first stage, the volatiles was carried by feed gas and decomposed at second stage. The limonite promoted hydropyrolysis of coal volatiles similar to Ni/Al{sub 2}O{sub 3} catalyst. High yields of total product gas and methane were obtained at 50 vol.% hydrogen atmosphere with a feed gas of 60 ml min{sup -1} hydrogen and 60 ml min{sup -1} nitrogen. After experiments, hydrocarbons heavier than ethane were not observed. Also that, carbon balance was more than 99.8% in coal char, product gases and carbon deposits. It was considered that coal volatiles converted into light gases and carbon almost completely in catalyst bed. Yields of product gas and methane depended upon catalytic temperature. At 923 K, the maximum yield of product gas was achieved at 74.3% for limonite catalyst on carbon balance with methane 83.2 vol.% of the carbonaceous gas products. Comparing with limonite, Fe/Al{sub 2}O{sub 3} and BOF dust samples showed low activities on coal volatiles catalytic decomposition. 21 refs., 5 figs., 3 tabs.
Ceramic stationary gas turbine development. Final report, Phase 1
Energy Technology Data Exchange (ETDEWEB)
NONE
1994-09-01
This report summarizes work performed by Solar Turbines Inc. and its subcontractors during the period September 25, 1992 through April 30, 1993. The objective of the work is to improve the performance of stationary gas turbines in cogeneration through implementation of selected ceramic components.
Chen, Yu Wai; Tajima, Toshitaka; Rees, Martin; Garcia-Maya, Mitla
2009-09-01
Human homologue A of Rad23 (hHR23A) plays dual roles in DNA repair as well as serving as a shuttle vehicle targeting polyubiquitinated proteins for degradation. Its N-terminal ubiquitin-like (UbL) domain interacts with the 19S proteasomal cap and provides the docking mechanism for protein delivery. Pyramidal crystals of the UbL domain of hHR23A were obtained by the hanging-drop vapour-diffusion method with ammonium sulfate as the crystallizing agent. The crystals diffracted to beyond 2 A resolution and belonged to the hexagonal space group P6(5)22, with unit-cell parameters a = b = 78.48, c = 63.57 A. The structure was solved by molecular replacement using the UbL domain of yeast Dsk2 as the search model.
Union Gas Limited 2000 annual report
International Nuclear Information System (INIS)
2000-01-01
Financial information from Union Gas was presented along with a review of their operations throughout 2000. Union Gas is a major Canadian natural gas utility providing energy services to more than 1.1 million residential, commercial and industrial customers in more than 400 communities in Ontario. The company also provides natural gas storage and transportation services for other utilities and energy market participants in Ontario, Quebec and the United States. Revenue for 2000 was reported to be $1.6 billion, net income was $113 million and assets totaled $3.9 billion. Total throughput for 2000 was 35.8 billion cubic meters. Union Gas is a wholly-owned subsidiary of Westcoast Energy Inc. of Vancouver, British Columbia. In 2000, progress was made toward the introduction of performance-based regulation to replace the cost of service regulation currently in use. This initiative will enable the company to provide competitively priced services to customers, allowing them, along with shareholders to benefit from efficiency enhancements and new service offerings. tabs., figs
Energy Technology Data Exchange (ETDEWEB)
Dall Bentzen, J.; Hummelshoej, R.M. (COWI A/S (DK)); Henriksen, Ulrik (Danmarks Tekniske Univ., DTU-MEK (DK)); Geest, C. (Babcock and Wilcox Voelund (DK))
2007-05-15
On basis of successful process verification at the laboratory plant during the project's Phase 1a, a gas cleaning system has been designed, established and commissioned during this Phase 1c project, with the objective of demonstrating that the gas from the LT-BIG gasifier can be cleaned by means of bag filter, in order for the gas to become suitable for motor operation and possibly other purposes. It has further been a purpose of the project to document continuous operation of the laboratory plant. Thus, 3 tests have been made during the project with a duration of 12 hours, 66 hours and 211 hours, respectively, in total ca. 100 hours' operation. In total, the pilot plant has now been operating for 150-200 hours. During the tests, tar measurements have been made before bag filter, after bag filter and after the activated carbon filter. The gas cleaning system is designed so that a partial current of the gas can be led to a cooler and a bag filter, where the temperature and speed over the filter can be adjusted. Particles are caught in the bag filter, and the vaporous tar materials near the bag filter are caught in a following activated carbon filter. (au)
Ayoub, Emily; Hall, Anita; Scott, Adam M.; Chagnon, Mélanie J.; Miquel, Géraldine; Hallé, Maxime; Noda, Masaharu; Bikfalvi, Andreas; Tremblay, Michel L.
2013-01-01
PTP-PEST is a cytosolic ubiquitous protein tyrosine phosphatase (PTP) that contains, in addition to its catalytic domain, several protein-protein interaction domains that allow it to interface with several signaling pathways. Among others, PTP-PEST is a key regulator of cellular motility and cytoskeleton dynamics. The complexity of the PTP-PEST interactome underscores the necessity to identify its interacting partners and physiological substrates in order to further understand its role in focal adhesion complex turnover and actin organization. Using a modified yeast substrate trapping two-hybrid system, we identified a cytosolic adaptor protein named Src kinase-associated phosphoprotein 55 homologue (SKAP-Hom) as a novel substrate of PTP-PEST. To confirm PTP-PEST interaction with SKAP-Hom, in vitro pull down assays were performed demonstrating that the PTP catalytic domain and Proline-rich 1 (P1) domain are respectively binding to the SKAP-Hom Y260 and Y297 residues and its SH3 domain. Subsequently, we generated and rescued SKAP-Hom-deficient mouse embryonic fibroblasts (MEFs) with WT SKAP-Hom, SKAP-Hom tyrosine mutants (Y260F, Y260F/Y297F), or SKAP-Hom SH3 domain mutant (W335K). Given the role of PTP-PEST, wound-healing and trans-well migration assays were performed using the generated lines. Indeed, SKAP-Hom-deficient MEFs showed a defect in migration compared with WT-rescued MEFs. Interestingly, the SH3 domain mutant-rescued MEFs showed an enhanced cell migration corresponding potentially with higher tyrosine phosphorylation levels of SKAP-Hom. These findings suggest a novel role of SKAP-Hom and its phosphorylation in the regulation of cellular motility. Moreover, these results open new avenues by which PTP-PEST regulates cellular migration, a hallmark of metastasis. PMID:23897807
Reducing the greenhouse gas footprint of shale gas
International Nuclear Information System (INIS)
Wang Jinsheng; Ryan, David; Anthony, Edward J.
2011-01-01
Shale gas is viewed by many as a global energy game-changer. However, serious concerns exist that shale gas generates more greenhouse gas emissions than does coal. In this work the related published data are reviewed and a reassessment is made. It is shown that the greenhouse gas effect of shale gas is less than that of coal over long term if the higher power generation efficiency of shale gas is taken into account. In short term, the greenhouse gas effect of shale gas can be lowered to the level of that of coal if methane emissions are kept low using existing technologies. Further reducing the greenhouse gas effect of shale gas by storing CO 2 in depleted shale gas reservoirs is also discussed, with the conclusion that more CO 2 than the equivalent CO 2 emitted by the extracted shale gas could be stored in the reservoirs at significantly reduced cost. - Highlights: ► The long-term greenhouse gas footprint of shale gas is smaller than that of coal. ► Carbon capture and storage should be considered for fossil fuels including shale gas. ► Depleted shale gas fields could store more CO 2 than the equivalent emissions. ► Linking shale gas development with CO 2 storage could largely reduce the total cost.
Peterson, Richard D.; Eshel, Ben; Rice, Christopher A.; Perram, Glen P.
2018-02-01
The diode-pumped rare gas laser (DPRGL) has been suggested as a potential high-gain, high-energy laser which requires densities on the order of 1013 cm-3 at pressures around 1 atmosphere for efficient operation. Argon 1s5 number densities have been measured in micro-hollow cathode discharges with electrode gaps of 127 and 254 μm and hole diameters from 100-400 μm. The dependency of the metastable argon (1s5) density on total gas pressure, electrode gap distance and hole diameter were explored. The measured densities were all in the range of 0.5 - 2 × 1013 cm-3 with the 400 μm hole diameters being the lowest.
Oil and gas: crises and controversies. V. 1: global issues
Energy Technology Data Exchange (ETDEWEB)
Odell, P.
2001-11-01
Oil and gas are the drivers of modern economics and issues relating to them impinge importantly on national and international politics. This first of two volumes of Odell's collected papers and essays charts the sequence of significant developments, over the past 40 years, of this most international of industries. At one level, the book is a work of recent economic history, but an appreciation of the past is essential for proper interpretation of the present, and all the more so, if forecasting is one's trade. For these reasons, this book needs to be on the shelves of all who are professionally concerned with contemporary and/or prospective global oil and gas issues. (author)
International Nuclear Information System (INIS)
Mayer, G.; Wittmann, F.H.; Moetsch, H.A.
1998-05-01
In the planned Swiss repository for low- and intermediate-level radioactive waste, the voids between the waste containers will be backfilled with a highly permeable mortar (NAGRA designation: mortar M1 ). As well as providing mechanical stability through filling of voids and sorbing radionuclides, the mortar must divert gases formed in the repository as a result of corrosion into the neighbouring host rock. This will prevent damage which could be caused by excess pressure on the repository structures. Water transport, which is coupled to gas transport, is also of interest. The former is responsible for the migration of radionuclides. Up till now, numerical simulations for a repository situation were carried out using transport parameters determined for small samples in the laboratory. However, the numerical simulations still had to be validated by a large-scale experiment. The investigations presented here should close this gap. Investigations into gas and water transport were carried out using a column (up to 5.4 m high) filled with backfill mortar. The column has a modular construction and can be sealed at the top end with a material of defined permeability (plug or top plug). The possibility to vary the material of the plug allows the influence of the more impermeable cavern lining or possible gas escape vents in the cavern roof to be investigated. A gas supply is connected to the bottom end and is used to simulate different gas generation rates from the waste. A total of 5 experiments were carried out in which the gas generation rate, the column height and the permeability of the plug were varied. Before the start of the experiments, the mortar in the column and the plug were saturated with water to approx. 95 %. In all the experiments, an increase in pressure with time could be observed. The higher the gas generation rate and the lower the permeability of the plug, the more quickly this occurred. At the beginning, only water flow out of the top of the column
Calibration and uncertainties in gas microflow measurement in the range of 2–200 µg s−1 of nitrogen
International Nuclear Information System (INIS)
Barbe, J; Dijoux, F; Yardin, C; Macé, T; Vaslin-Reimann, S
2010-01-01
Today the field of chemistry needs calibration in gas microflow measurement for applications such as thin film deposition, catalysis or the automotive industry. Few European metrology laboratories conduct this type of calibration. In France no laboratory can calibrate below 20 µg s −1 . To meet this growing need, LNE has developed a calibration bench using the method of 'traced gas' in the range of 2–200 µg s −1 . The method and the uncertainty estimation of the calibration bench and calibration results of three laminar flowmeters of Molbloc type and industrial flowmeters are presented in this paper
Portal-venous gas unrelated to mesenteric ischemia
International Nuclear Information System (INIS)
Wiesner, Walter; Mortele, Koenraad J.; Ji, Hoon; Ros, Pablo R.; Glickman, Jonathan N.
2002-01-01
The aim of this study was to report on 8 patients with all different non-ischemic etiologies for portal-venous gas and to discuss this rare entity and its potentially misleading CT findings in context with a review of the literature. The CT examinations of eight patients who presented with intrahepatic portal-venous gas, unrelated to bowel ischemia or infarction, were reviewed and compared with their medical records with special emphasis on the pathogenesis and clinical impact of portal-venous gas caused by non-ischemic conditions. The etiologies for portal-venous gas included: abdominal trauma (n=1); large gastric cancer (n=1); prior gastroscopic biopsy (n=1); prior hemicolectomy (n=1); graft-vs-host reaction (n=1); large paracolic abscess (n=1); mesenteric recurrence of ovarian cancer superinfected with clostridium septicum (n=1); and sepsis with Pseudomonas aeruginosa (n=1). The clinical outcome of all patients was determined by their underlying disease and not negatively influenced by the presence of portal-venous gas. Although the presence of portal-venous gas usually raises the suspicion of bowel ischemia and/or intestinal necrosis, this CT finding may be related to a variety of non-ischemic etiologies and pathogeneses as well. The knowledge about these conditions may help to avoid misinterpretation of CT findings, inappropriate clinical uncertainty and unnecessary surgery in certain cases. (orig.)
International Nuclear Information System (INIS)
Romney, G.
1998-01-01
This presentation focused on the strategies used by Texaco Global Gas and Power in their international marketing and business development. The company is a fully integrated mid-stream company with natural gas sales of 3.6 billion cubic feet per day and operating revenues of $3.6 billion. The company operates 1,116 miles of interstate gas pipelines and owns a dominant NGL export facility in Washington. They also generate 2223 MW of electric power. An additional 2428 MW are currently under development. In Colombia, Texaco supplies 90 per cent of the marketed gas. In Trinidad and Tobago, Texaco is in a 50/50 joint venture in the Dolphin field. Texaco also has a significant downstream presence in Brazil and is pursuing opportunities of the Gas Apertura in Venezuela. Key to the company's success are a defined strategy, dedication to the market place, alliances based on common interests and complimentary strengths, acceptance of greater risk and regionally based solutions. The bulk of the paper is devoted to describing the company's priorities and strategies in each of the Latin American countries. 5 figs
Semiconductor Ceramic Mn0.5Fe1.5O3-Fe2O3 from Natural Minerals as Ethanol Gas Sensors
Aliah, H.; Syarif, D. G.; Iman, R. N.; Sawitri, A.; Sanjaya WS, M.; Nurul Subkhi, M.; Pitriana, P.
2018-05-01
In this research, Mn and Fe-based ceramic gas sensing were fabricated and characterized. This research used natural mineral which is widely available in Indonesia and intended to observe the characteristics of Mn and Fe-based semiconducting material. Fabricating process of the thick films started by synthesizing the ceramic powder of Fe(OH)3 and Mn oxide material using the precipitation method. The deposition from precipitation method previously was calcined at a temperature of 800 °C to produce nanoparticle powder. Nanoparticle powder that contains Mn and Fe oxide was mixed with an organic vehicle (OV) to produce a paste. Then, the paste was layered on the alumina substrate by using the screen printing method. XRD method was utilized to characterize the thick film crystal structure that has been produced. XRD spectra showed that the ceramic layer was formed from the solid Mn0.5Fe1.5O3 (bixbyite) and Fe2O3. In addition, the electrical properties (resistance) examination was held in the room that contains air and ethanol to determine the sensor sensitivity of ethanol gas. The sensor resistance decreases as the ethanol gas was added, showing that the sensor was sensitive to ethanol gas and an n-type semiconductor. Gas sensor exhibit sensitive characterization of ethanol gas on the concentration of (100 to 300) ppm at a temperature of (150 to 200) °C. This showed that the Mn0.5Fe1.5O3-Fe2O3 ceramic semiconductor could be utilized as the ethanol gas detector.
Union Gas and Ontario gas production
International Nuclear Information System (INIS)
Cameron, C.
2001-01-01
A step-by-step review of the tie-in process of new production wells into the Union Gas System is described. Requirements of the producer and those of Union Gas are explained. Also described are the choices available to the producer to sell his gas. He can sell either to Union Gas directly at an agreed upon price, or the producer has the option to have what is called an M13 contract which allows him to sell his gas at Dawn, where it can be stored within parameters of the contract, and sold to any buyer at Dawn at a negotiated rate. This arrangement, while entailing a much greater administrative load than direct sale to Union Gas, nevertheless, allows the producer to take advantage of market fluctuations. A third option provided by Union Gas is to make available to the producer storage space greater than the provisions of the M13 contract at current market rate, thereby opening up the opportunity to the producer to capture additional value in later winter months (when gas is in greater demand)
Temperature of gas delivered from ventilators.
Chikata, Yusuke; Onodera, Mutsuo; Imanaka, Hideaki; Nishimura, Masaji
2013-01-01
Although heated humidifiers (HHs) are the most efficient humidifying device for mechanical ventilation, some HHs do not provide sufficient humidification when the inlet temperature to the water chamber is high. Because portable and home-care ventilators use turbines, blowers, pistons, or compressors to inhale in ambient air, they may have higher gas temperature than ventilators with piping systems. We carried out a bench study to investigate the temperature of gas delivered from portable and home-care ventilators, including the effects of distance from ventilator outlet, fraction of inspiratory oxygen (FIO2), and minute volume (MV). We evaluated five ventilators equipped with turbine, blower, piston, or compressor system. Ambient air temperature was adjusted to 24°C ± 0.5°C, and ventilation was set at FIO2 0.21, 0.6, and 1.0, at MV 5 and 10 L/min. We analyzed gas temperature at 0, 40, 80, and 120 cm from ventilator outlet and altered ventilator settings. While temperature varied according to ventilators, the outlet gas temperature of ventilators became stable after, at the most, 5 h. Gas temperature was 34.3°C ± 3.9°C at the ventilator outlet, 29.5°C ± 2.2°C after 40 cm, 25.4°C ± 1.2°C after 80 cm and 25.1°C ± 1.2°C after 120 cm (P < 0.01). FIO2 and MV did not affect gas temperature. Gas delivered from portable and home-care ventilator was not too hot to induce heated humidifier malfunctioning. Gas soon declined when passing through the limb.
Oil and Gas Field Locations, Geographic NAD83, LDNR (2007) [oil_gas_fields_LDNR_2007
Louisiana Geographic Information Center — This GIS layer consists of oil and gas field approximate center point locations (approximately 1,800). Oil and gas fields not assigned a center point by the DNR...
Gas development plan - Estonia
International Nuclear Information System (INIS)
1994-06-01
The total supply of natural gas to Estonia is provided by the Russian company ''Lentransgas'', a 10 year contract is under negotiation. The gas transmission system is physically a part of the transmission network in the Baltic region which previously operated as an integral part of the USSR gas transmission system. The potential market is too small to justify investment in an alternative pipeline from the North Sea. The general reduction in purchasing power in the former COMECON countries has resulted in a decreased industrial production in Estonia and lead to a steep decline in natural gas consumption in all sectors except households. The Danish firm ''Dansk Olie og Naturgas A/S'' has been requested to assist the Estonian company ''AS Eesti Gaas J.S.C.'' in preparing a gas development plan for Estonia. Phase 1 of this plan aims to provide a detailed description of the status of the existing situation under the headings of gas supply and demand, transmission and distribution, economy and organization. The most important problems related to the current transition of the Estonian gas sector towards operation under market conditions are addressed, focussing on gas supply and market conditions, flow control and metering. The general organization of the gas sector in Estonia is described and possible models for future organization are discussed. Some recommendations are given and areas in need of further investigation are identified. (AB)
Natural gas industry in Bulgaria
International Nuclear Information System (INIS)
Mashkin, L.
1994-01-01
An overview of the Bulgarian natural gas industry is presented. The starting point was the discovery of the indigenous Chiren gas-field in 1967. The first agreement with the ex-USSR for supply of natural gas and construction of main pipelines was signed in 1968. The state gas company BULGARGAZ is responsible for transportation, storage, distribution, processing and marketing of the gas to over 150 industrial companies in the country, as well as for the transportation services to gas importers in neighboring Turkey. The GAZSTROJMONTAZH company accomplish the construction of the local and transit pipelines to Turkey and Greece, as well as of some objects in Iran, Syria, Ukraine and Germany. In the past 20 years, 87890 million m 3 natural gas from Russia are supplied and 846 million m 3 - from domestic sources. The share of natural gas in the overall energy balance is 13.6% for 1992. The restructuring and further development of gas industry require to take into account some factors as: security in supply; investments for technical assurance; pricing policy for natural gas; development of private business. Some administrative problems are also mentioned. 2 tabs., 1 fig
Finland's leading natural gas company
International Nuclear Information System (INIS)
Anon.
2000-01-01
The ownership structure of Finland's leading natural gas company, Gasum, changed fundamentally in 1999, and the company is now no longer a subsidiary of Fortum Corporation. 'Our new strong and broad ownership base will enable us to develop the natural gas business and pipeline network in Finland in response to the requirements of our Finnish customers', says Antero Jaennes, Gasum's Chairman and CEO, who stresses that Gasum is committed to remaining the leading developer of the Finnish natural gas market and the number-one gas supplier. Natural gas usage in Finland in 1999 totalled 3.9 billion m 3 (38.7 TWh), unchanged from 1998. Natural gas accounted for 11% of Finland's total primary energy need, as it did in 1998. The proportion of natural gas used in district heating rose by 2% to 36%, and moved down 2% in power generation to 10%. Industry's use of natural gas fell 1% to 17%. 75% of natural gas was used in combined heat and power (CHP) generation in industry and district heating. In 2000, Gasum expects to sell 4 billion m 3 of natural gas (40 TWh)
Harvey, D J; Martin, B R; Paton, W D
1977-02-01
Glucuronide conjugates of cannabidiol (CBD), 7-hydroxy-CBD, propyl-CBD, cannabinol (CBN), 7-hydroxy-CBN, CBN-7-oic acid, propyl CBN and cannabichromene have been identified as major metabolites of CBD, CBN and their propyl homologues and of cannabichromene in mouse liver. Trace amounts of the glucuronide conjugates of delta1- and delta1(6)-tetrahydrocannabinol (THC) were also detected. Identification was made by combined gas-liquid chromatographic and mass spectrometric studies of the trimethylsilyl (TMS), d9-TMS and methyl ester-TMS derivatives of the glucuronides and the TMS derivatives of the product of the reduction of the metabolites with lithium aluminium deuteride.