Directory of Open Access Journals (Sweden)
Andrés Javier Quiroga
2005-09-01
Full Text Available Introducción. La infección con Helicobacter pylori está asociada con el desarrollo de diferentes enfermedades gastroduodenales. Varios genes de virulencia de H. pylori se han relacionado con mayor riesgo de enfermedad gástrica. Objetivos. El propósito de este trabajo fue determinar las posibles asociaciones entre la presencia de los genes vacA, cagA, cagE, babA2 y oipA en aislamientos de H. pylori de pacientes colombianos y las diferentes consecuencias clínicas de la infección. Materiales y métodos. Mediante PCR se evaluaron los genotipos cagA, vacA, cagE, oipA y babA2 en 166 aislamientos de H. pylori provenientes de 50 pacientes con úlcera péptica, 39 con gastritis crónica no atrófica, 26 con gastritis crónica atrófica, 26 con metaplasia intestinal y 25 con adenocarcinoma gástrico. Resultados. La frecuencia de los genotipos cagA, cagE, babA2 y oipA fue de 73%, 75%, 48% y 74%, respectivamente. El 64% (100/157 de los aislamientos presentó el genotipo citotóxico vacAs1m1/cagA positivo/cagE positivo. Se observó una mayor frecuencia de cepas citotóxicas en pacientes con cáncer (84%, metaplasia (91% y úlcera (81% en comparación con pacientes con gastritis no atrófica (50% (p=0,002, 0,008 y 0,007, respectivamente. La frecuencia de oipA y babA2 fue mayor en cepas citotóxicas que en cepas no citotóxicas (oipA: 81% vs. 52%, p=0,003; babA2: 58% vs. 12%, p=0,000. No se observaron diferencias significativas en la frecuencia de los genes oipA o babA2 solos o en asociación con vacA y cagA/cagE y las diferentes enfermedades gastroduodenales. Conclusiones. No se encontraron evidencias que sugieran que los genes babA2 u oipA puedan servir como marcadores de ulcerogénesis o carcinogénesis en esta población, solos o en asociación con cagA, cagE o vacA.
Primer aislamiento de Escherichia coli O157:H7 Enterohemorrágica en el Perú
Directory of Open Access Journals (Sweden)
Blanca Huapaya C
2001-01-01
Full Text Available En Febrero del año 2001 como parte del "Estudio transversal de los agentes etiológicos de diarrea aguda" en la Macrorregión Sur del país, el Laboratorio Referencial de Tacna aisló una cepa procedente de una muestra de heces de un lactante de 11 meses de edad con un cuadro de diarrea disentérica, identificándola como Escherichia coli O157. Esta cepa fue confirmada y caracterizada en el Instituto Nacional de Salud como E. coli O157:H7 toxina shiga tipo II, siendo el primer aislamiento reportado de Escherichia coli enterohemorrágica en el Perú.
Data of evolutionary structure change: 1BABA-2ZLWD [Confc[Archive
Lifescience Database Archive (English)
Full Text Available 1BABA-2ZLWD 1BAB 2ZLW A D MELSPADKTNVKAAWGKVGAHAGEYGAEALERMFLSFPT...R VQLSGEEKAAVLALWDKVN--EEEVGGEALGRLLVVYPWTQRFFDSFGDLSNPGAVMGNPKVKAHGKKVLHSFGEGVHHLDNLKGTFAALSEL...dex> 2ZLW D 2ZLWD WD
Directory of Open Access Journals (Sweden)
Siavosh Rayatpanah
2012-03-01
Full Text Available Charcoal rot, caused by Macrophomina phaseolina (Tassi Goid., is an economically important disease of oilseed plants in Northern Iran. Seventy isolates of M. phaseolina were obtained from different hosts, including soybean (Glycine max L., and sunflower (Helianthus annuus L. in the northern oilseed planting regions of Iran. RAPD-PCR amplification profiles, by using of six random OPA primers (kit A showed polymorphisms among the isolates. The primer OPA-13 (5'_ CAGCACCCAC_3' amplified the genomic DNA of all isolates of M.phaseolina producing 4-12 bands of sizes between 0.25 and 2.3 kb. Unweighted pair-group method with arithmetic mean (UPGMA analysis classified the isolates into the nine major groups with 64% similarity. Pathogenicity of isolates was evaluated at seedling stage of soybean, sunflower, and maize (Zea mays L. plants under in vitro conditions. None of the isolates were pathogenic on corn, while all of the isolates infected soybean and sunflower seedlings. Isolates were more virulent on soybean than sunflower. The disease index on sunflower and soybean varied between 19-24 and 27-30 respectively. These results indicated a significant pathogenic and genetic variability within the Iranian isolates of M. phaseolina. Cultivation with crop rotation was probably tended to induce less diversity of the pathogen isolates.Pudrición carbonosa, causada por Macrophomina phaseolina (Tassi Goid., es una enfermedad de importancia económica de las plantas de semillas oleaginosas en el norte de Irán. Setenta aislamientos de M. phaseolina se obtuvieron de diferentes hospederos, incluyendo soya (Glycine max L. y girasol (Helianthus annuus L. en las regiones de plantación de semillas oleaginosas del norte de Irán. Perfiles RAPD-PCR de amplificación, utilizando primers aleatorios de seis OPA (kit A mostraron polimorfismos entre los aislamientos. El primer OPA-13 (5'-CAGCACCCAC-3' amplificó el ADN genómico de todos los aislamientos de M. phaseolina
Linguistic Alternants and Code Selection in Baba Malay.
Pakir, Anne
1989-01-01
Provides a brief account and explanation of the phenomenon of language use among the Baba community, which uses Hokkien, Malay, and English in the process of code selection and code mixing/switching. Data are drawn from recordings of conversation of the Babas and Nyonyas. (Author/OD)
Osman, Hussein Ali; Hasan, Habsah; Suppian, Rapeah; Hassan, Syed; Andee, Dzulkarnaen Zakaria; Abdul Majid, Noorizan; Zilfalil, Bin-alwi
2015-01-01
The severity of disease outcome in dyspepsia has been attributed to Helicobacter pylori virulence genes. The aim of this study was to determine the distribution of H. pylori virulence genes (cagA, babA2, and dupA) and to determine whether or not there arises a significant correlation with clinical dyspepsia outcomes. H. pylori genotypes cagA, babA2, and dupA were identified by polymerase chain reactions from gastric biopsy samples in 105 H. pylori-positive patients. The positive rates for cagA, babA2, and dupA genes in H. pylori dyspeptic patients were 69.5%, 41.0%, and 22.9%, respectivel cagA was more prevalent in Indians (39.7%), babA2 was more prevalent in Malays (39.5%), and dupA detection occurred more frequently in both Indians and Malays and at the same rate (37.5%). The Chinese inhabitants had the lowest prevalence of the three genes. Nonulcer disease patients had a significantly higher distribution of cagA (76.7%), babA2 (74.4%), and dupA (75.0%). There was no apparent association between these virulence genes and the clinical outcomes. The lower prevalence of these genes and variations among different ethnicities implies that the strains are geographically and ethnically dependent. None of the virulence genes were knowingly beneficial in predicting the clinical outcome of H. pylori infection in our subjects.
Assimilation of Baba and Nyonya in Malaysia
Razaleigh Muhamat Kawangit
2015-01-01
This research set outs to explore the exact level of the social aspect of assimilation between Baba and Nyonya and their Malay counterparts in Malaysia. It was sure that assimilation in social aspect is a dilemma which Baba and Nyonya face when they interact with Malays as a dominant ethnic group. It suggests that when the process of interaction, their behavior changes in line with the identity of the Malays. This is because the majority influenced the minority in the Malaysian context. Whils...
OSMAN, HUSSEIN ALI; HASAN, HABSAH; SUPPIAN, RAPEAH; HASSAN, SYED; ANDEE, DZULKARNAEN ZAKARIA; MAJID, NOORIZAN ABDUL; ZILFALIL, BIN ALWI
2015-01-01
Background/aim: The severity of disease outcome in dyspepsia has been attributed to Helicobacter pylori virulence genes. The aim of this study was to determine the distribution of H. pylori virulence genes (cagA, babA2, and dupA) and to determine whether or not there arises a significant correlation with clinical dyspepsia outcomes. Materials and methods: H. pylori genotypes cagA, babA2, and dupA were identified by polymerase chain reactions from gastric biopsy samples in 105 H. pylori-posit...
Umaporn Muneenam; Pongbaworn Suwannattachote; Rita Sri Mustikasari
2017-01-01
The article presents: (1) a comparative study of interpretation types of Baba and Nyonya tourism and evaluates the interpretation results in four countries, (2) the development of the self-guiding interpretations of Baba and Nyonya tourism that present the shared culture in the four countries and, (3) the results of tests on the effectiveness and satisfaction of volunteers from the development of the self-guiding interpretation of Baba and Nyonya tourism. The research methodologies were: (1) ...
Directory of Open Access Journals (Sweden)
Ahmad R. Albattat
2017-06-01
Full Text Available Baba Nyonya food is a wonderful combination of Malay and Chinese cuisine with influences from Indonesia, Thailand, India, Holland, Portugal and England. Nyonya food presents the unique identity which combined culture and heritage, adapting ingredients and recipes. The purpose of this study is to find out awareness among Culinary Art students in the Management and Science University (MSU, Shah Alam about Baba Nyonya food, and to identify the uniqueness of Baba Nyonya’s food. In this study, resource based theory has been exploited for developing conceptual research framework. Data collected using self–administered questionnaire among 110 respondents involving students of Culinary Arts through convenience sampling method. The data analysis has been conducted using frequency, descriptive statistic as well as Statistical Package for Social Science (SPSS16. Results clarified that the culinary art students are aware about the uniqueness of Baba Nyonya food and the average ratio of students who know is overwhelming. The study concluded that the establishment of awareness among students about Baba Nyonya food is crucial related to the fact that Baba Nyonya food has been gradually forgotten.
Chinese literary works translated into Baba Malay: a bibliographical study
Yoong, S. K.; Zainab, A.N.
2002-01-01
Analyses 68 unique titles of Baba translated works published between 1889 and 1950. The titles are held in the libraries of the University of Malaya (UM), Science University Malaysia (USM), National University of Malaysia (UKM), the Dewan Bahasa dan Pustaka (DBP), National University of Singapore (NUS), National Library of Singapore (NLS) and the British Library (BL). The results reveal three periods of active publication of Baba translated works. A total of 18 works were translated before Wo...
Plake, Conrad; Schiemann, Torsten; Pankalla, Marcus; Hakenberg, Jörg; Leser, Ulf
2006-10-01
The biomedical literature contains a wealth of information on associations between many different types of objects, such as protein-protein interactions, gene-disease associations and subcellular locations of proteins. When searching such information using conventional search engines, e.g. PubMed, users see the data only one-abstract at a time and 'hidden' in natural language text. AliBaba is an interactive tool for graphical summarization of search results. It parses the set of abstracts that fit a PubMed query and presents extracted information on biomedical objects and their relationships as a graphical network. AliBaba extracts associations between cells, diseases, drugs, proteins, species and tissues. Several filter options allow for a more focused search. Thus, researchers can grasp complex networks described in various articles at a glance. http://alibaba.informatik.hu-berlin.de/
Directory of Open Access Journals (Sweden)
Javier Antonio Escobar-Pérez
2014-04-01
Full Text Available Introducción. USA300 es un linaje genético que se encuentra en aislamientos de Staphylococcus aureus sensibles (SASM y resistentes a meticilina (SARM. Actualmente, en Colombia las infecciones por SARM en hospitales y en la comunidad son causadas principalmente por un clon con genotipo comunitario (SARM-GC relacionado genéticamente con el clon USA300. El origen de esta variante es aún desconocido. Objetivo. Identificar y caracterizar aislamientos de S. aureus resistentes y sensibles a meticilina con el fin de aportar información para establecer un posible origen de los aislamientos SARM-GC en Colombia. Materiales y métodos. Se realizó una caracterización de aislamientos SASM relacionados con el clon USA300 detectados a partir de un análisis de 184 aislamientos de S. aureus (90 SARM y 94 SASM causantes de infecciones. La relación genética de los aislamientos se determinó por electroforesis en gel de campo pulsado (PFGE, tipificación de secuencias multilocus (MLST y tipificación del gen de la proteína A (spa. Resultados. De los 184 aislamientos, 27 (14,7 % presentaron características moleculares y relación genética con el clon USA300, y de ellos, 18 fueron SARM y nueve fueron SASM. Todos los aislamientos SARM relacionados con este clon albergaban un casete estafilocócico cromosómico mec (SCCmec IVc (3.1.2. En ningún aislamiento SASM se detectaron secuencias remanentes de SCCmec o una duplicación del sitio attB que evidenciaran la pérdida del casete. Conclusión. El origen de los aislamientos SARM-GC en Colombia probablemente se encuentre en la diseminación de clones SASM relacionados con el clon USA300 que adquirieron el SCCmec IVc posteriormente.
Ng, Poh-Kheng; Lim, Phaik-Eem; Phang, Siew-Moi
2014-01-01
Congracilaria babae was first reported as a red alga parasitic on the thallus of Gracilaria salicornia based on Japanese materials. It was circumscribed to have deep spermatangial cavities, coloration similar to its host and the absence of rhizoids. We observed a parasitic red alga with morphological and anatomical features suggestive of C. babae on a Hydropuntia species collected from Sabah, East Malaysia. We addressed the taxonomic affinities of the parasite growing on Hydropuntia sp. based on the DNA sequence of molecular markers from the nuclear, mitochondrial and plastid genomes (nuclear ITS region, mitochondrial cox1 gene and plastid rbcL gene). Phylogenetic analyses based on all genetic markers also implied the monophyly of the parasite from Hydropuntia sp. and C. babae, suggesting their conspecificity. The parasite from Hydropuntia sp. has a DNA signature characteristic to C. babae in having plastid rbcL gene sequence identical to G. salicornia. C. babae is likely to have evolved directly from G. salicornia and subsequently radiated onto a secondary host Hydropuntia sp. We also recommend the transfer of C. babae to the genus Gracilaria and propose a new combination, G. babae, based on the anatomical observations and molecular data.
Directory of Open Access Journals (Sweden)
Poh-Kheng Ng
Full Text Available Congracilaria babae was first reported as a red alga parasitic on the thallus of Gracilaria salicornia based on Japanese materials. It was circumscribed to have deep spermatangial cavities, coloration similar to its host and the absence of rhizoids. We observed a parasitic red alga with morphological and anatomical features suggestive of C. babae on a Hydropuntia species collected from Sabah, East Malaysia. We addressed the taxonomic affinities of the parasite growing on Hydropuntia sp. based on the DNA sequence of molecular markers from the nuclear, mitochondrial and plastid genomes (nuclear ITS region, mitochondrial cox1 gene and plastid rbcL gene. Phylogenetic analyses based on all genetic markers also implied the monophyly of the parasite from Hydropuntia sp. and C. babae, suggesting their conspecificity. The parasite from Hydropuntia sp. has a DNA signature characteristic to C. babae in having plastid rbcL gene sequence identical to G. salicornia. C. babae is likely to have evolved directly from G. salicornia and subsequently radiated onto a secondary host Hydropuntia sp. We also recommend the transfer of C. babae to the genus Gracilaria and propose a new combination, G. babae, based on the anatomical observations and molecular data.
Ahmad R. Albattat; Liyana Asmara; Nur Aainaa Bakri; Nur Syazwani Norzaman
2017-01-01
Baba Nyonya food is a wonderful combination of Malay and Chinese cuisine with influences from Indonesia, Thailand, India, Holland, Portugal and England. Nyonya food presents the unique identity which combined culture and heritage, adapting ingredients and recipes. The purpose of this study is to find out awareness among Culinary Art students in the Management and Science University (MSU), Shah Alam about Baba Nyonya food, and to identify the uniqueness of Baba Nyonya’s food. In this study, re...
Aislamiento de Sporothrix pallida complex en muestras clínicas y ambientales de Chile
Directory of Open Access Journals (Sweden)
Rodrigo M Cruz Choappa
2014-12-01
Full Text Available Se informa para Chile el aislamiento de S. pallida complex desde muestras médicas y del suelo del hogar de una paciente. Los hongos del complejo Sporothrix schenckii pueden causar distintas infecciones. En Chile, los aislamientos médicos y ambientales de este complejo son poco frecuentes. El objetivo de este trabajo fue identificar un agente atípico en un caso de onicomicosis y detectar su presencia en el suelo del jardín del hogar de la paciente. Para esto, las muestras clínicas se obtuvieron por raspado subungueal del primer dedo del pie derecho, y las muestras de suelo, de diferentes sectores del jardín. La identificación de las especies se realizó por morfofisiología y para la confirmación molecular se envió una de las cepas aisladas de la uña de la paciente al CBS (14.062. Se identificó S. pallida complex tanto de las muestras de uña como de aquellas provenientes del suelo del jardín.
Susceptibilidad a antimicrobianos en aislamientos de Streptococcus pneumoniae invasor en Colombia
Directory of Open Access Journals (Sweden)
Aura Lucía Leal
1999-03-01
Full Text Available Se realizó un estudio para determinar los patrones de susceptibilidad a los antimicrobianos de los aislamientos de Streptococcus pneumoniae causante de enfermedad invasora diagnosticada en Colombia en niños menores de 5 años entre 1994 y 1996 y para establecer la distribución de los tipos capsulares de los aislamientos resistentes. Se analizaron 324 aislamientos recuperados durante la ejecución del Protocolo Nacional de Serotipificación de S. pneumoniae realizado en Santa Fe de Bogotá, Medellín y Cali, Colombia, entre julio de 1994 y marzo de 1996. Se observó que 119 de todos los aislamientos (36,7% presentaban susceptibilidad disminuida por lo menos a un antimicrobiano, que 39 (12% presentaban susceptibilidad disminuida a la penicilina y que de estos últimos aislamientos, 29 presentaban resistencia intermedia y 10 resistencia alta. Nueve aislamientos (2,8% presentaban resistencia a la ceftriaxona, 80 (24,7% a la combinación de trimetoprima y sulfametoxazol (TMS, 49 (15,1% al cloranfenicol y 31 (9,6% a la eritromicina. Se observó resistencia a dos antimicrobianos en 31 aislamientos (9,6% y multirresistencia en 22 (6,7%. Estos 22 aislamientos mostraron resistencia al TMS. Las asociaciones más frecuentes fueron penicilina, TMS y eritromicina en 5 casos; penicilina, cloranfenicol, TMS y eritromicina en 4; penicilina, ceftriaxona, cloranfenicol y TMS en 3; y penicilina, ceftriaxona, cloranfenicol, TMS y eritromicina en 3 casos. Los serotipos más frecuentes en los aislamientos resistentes a la penicilina fueron: 23F (53,8%, 14 (25,6%, 6B (7,7%, 9V (5,1%, 19F (5,1% y 34 (2,6%. Los serotipos más frecuentes en los aislamientos resistentes a antimicrobianos distintos de la penicilina fueron: 5 (37,5%, 23F (7,5%, 14 (18,8% y 6B (13,8%. Esta diferencia en la distribución de los serotipos fue estadísticamente significativa (P < 0,0001. Los resultados de este estudio indican la necesidad de mantener una vigilancia activa de los patrones de
Directory of Open Access Journals (Sweden)
Tobío, J. M.
1970-07-01
Full Text Available This is a very specific subject in the field of architectural acoustics, namely, insulation'. Emphasis is placed on the theoretical foundations of this phenomenon, and the most simple formula are developed to calculate easily the transmission losses of a material or the constructional insulating arrangements. The practical aspect of insulation can be considered by means of several graphs and charts, without the use of mathematics, and utilising common materials, that will not substantially increase the cost of the project. Finally this papers offers a critical discussion of building codes, and their reference to the acoustical insulation of dwellings, and data is included on the new regulations of the Madrid Municipality.Se trata un tema muy concreto de la Acústica Arquitectónica, el aislamiento, haciendo hincapié en los fundamentos teóricos del fenómeno y estableciendo las fórmulas más sencillas que permiten calcular fácilmente las pérdidas de transmisión de un material o disposición constructiva aislante. Varias gráficas y abacos permiten abordar, sin ningún tratamiento matemático, el problema práctico del aislamiento, aprovechando los materiales comunes y sin ocasionar gastos que graven sustancialmente el importe del proyecto. Por último, se hace un estudio crítico de las normas y su incidencia en los problemas del aislamiento de viviendas, incluyendo datos referentes a la nueva Ordenanza del Ayuntamiento de Madrid.
Mario Sánchez Gumiel
2013-01-01
En febrero de 2012 se cumplieron cuarenta años de la visita de Richard Nixon a China y, por tanto, de la reanudación de las relaciones sino-americanas que habían sido interrumpidas en 1949. Desde entonces, Estados Unidos y China han mantenido una recíproca política de contención y aislamiento, conscientes de sus diferencias, pero sabedores también de la necesidad de un entendimiento mutuo. Como consecuencia dicha política de contención y aislamiento, el océano Pacífico está transformándose, c...
HAK ÂŞIĞI AMASYALI FEDÂÎ BABA VE TASAVVUF KÜLTÜRÜ [GOD-LOVER FEDÂÎ BABA FROM AMASYA AND SUFI CULTURE
Directory of Open Access Journals (Sweden)
Cafer Özdemir
2017-09-01
Full Text Available Fedâî Baba 1855 yılında Amasya’nın merkez mahallelerinden Yassıçal’da doğmuş ve 1940 yılında ölmüştür. Farklı bir kişiliğe sahip olan bu âşığın çocukluğunda geceleri türbelerde yattığı rivayet edilmektedir. Bir süre Amasya’da medrese eğitimi almıştır. Bir rivayete göre eğitimini tamamlamadan medreseyi bırakmıştır. Tokat ili Erbaa ilçesinde medfun Şeyh Mahmut Veli’nin soyundan gelen Derunî Baba’dan tasavvuf ilmini almıştır. Birçok kerameti anlatılan âşığın bilinen iki yüz elli iki şiiri mevcuttur. Âşık tarzı şiir geleneğine uygun olarak rüyasında bade içip âşıklığa adım attığı bilinen Fedâî Baba saz çalamamakta, fakat irticalen şiir söyleme yeteneği bulunmaktadır. Bir Hak âşığı olarak Amasya ve civarını sıkça gezdiği için kendisi bir nevi gezici âşık konumundadır. Hem divan şiiri hem de halk şiiri geleneklerine uygun şiirler söylemiştir. Divan şiiri tarzındaki şiirleri, halk şiiri tarzında söylediği şiirlere göre dil açısından daha ağırdır. Başarılı bir âşık olduğu anlaşılan Fedâî Baba lirik bir üslûba sahiptir. “İlmi ledün, mürşit, zikir, dört kapı, ilahi aşk, tevhit” gibi tasavvuf geleneğinin temlerini dile getiren Fedâî Baba, Alevi-Bektaşi geleneğine mensup olduğu için şiirlerinde bu geleneğin izleri görülür. Tasavvuf ve Bektaşi kültürünün temel özelliklerini şiirlerinde ustaca harmanlamıştır. Amasya’nın Alevi-Bektaşi kültüründe önemli bir yeri vardır. Fedâî Baba, bu yörede güçlü bir etkisi olmasına rağmen hakkında fazla araştırma yapılmamış bir şahsiyettir. Çalışmada âşığın biyografisi üzerinde durulup şiirlerinden hareketle onun Alevi-Bektaşi kültüründeki önemi ve tasavvuf düşüncesi ortaya konmaya çalışılmıştır. Amasya’nın zengin bir değeri olarak görülmesi gereken bu âşık, yaşadığı dönemde halkı eğitmeye ve
VARIABILIDAD GENÉTICA DE AISLAMIENTOS COLOMBIANOS DEL POTATO MOP-TOP VIRUS (PMTV)
In\\u00E9s Osorio-Giraldo; Pablo Guti\\u00E9rrez-S\\u00E1nchez; Mauricio Mar\\u00EDn-Montoya
2013-01-01
El objetivo de este trabajo fue evaluar los niveles de variación de aislamientos de PMTV en cultivos de papa de Colombia durante los años 2010 y 2011. Se obtuvieron secuencias de los genes de la cápside viral (CP, ARN 2) y del Triple Bloque de Genes (TGB2, ARN 3) de cepas de PMTV de los departamentos de Antioquia, Boyacá, Cundinamarca y Nariño. Adicionalmente, dos de los aislamientos fueron secuenciados en >83% de sus ARN 2 y 3. Los análisis filogenéticos basados en CP indicaron la presencia ...
Susceptibilidad a antimicrobianos en aislamientos de Streptococcus pneumoniae invasor en Colombia
Aura Lucía Leal; Castañeda Elizabeth
1999-01-01
Se realizó un estudio para determinar los patrones de susceptibilidad a los antimicrobianos de los aislamientos de Streptococcus pneumoniae causante de enfermedad invasora diagnosticada en Colombia en niños menores de 5 años entre 1994 y 1996 y para establecer la distribución de los tipos capsulares de los aislamientos resistentes. Se analizaron 324 aislamientos recuperados durante la ejecución del Protocolo Nacional de Serotipificación de S. pneumoniae realizado en Santa Fe de Bogotá, Medell...
Directory of Open Access Journals (Sweden)
Ademi Moraes Lima
2006-08-01
Full Text Available O objetivo deste trabalho foi avaliar a utilização de fibras (epicarpo de babaçu (Orbignya spp em combinação com partículas de Pinus elliottii em diferentes proporções na confecção de chapas de madeira aglomerada, bem como avaliar o efeito de dois teores de adesivo à base de uréia-formaldeído. As chapas foram prensadas a 160 ºC, utilizando-se dois níveis de resinas (6 e 8%, base peso seco de partículas e tempo de prensagem de 10 min, obtendo-se oito tratamentos. Para cada tratamento foram feitas três repetições, totalizando 24 chapas, com densidade nominal de 0,70 g/cm³. As propriedades avaliadas foram: flexão estática - módulo de ruptura (MOR e módulo de elasticidade (MOE; tração perpendicular-ligação interna (LI; estabilidade dimensional - inchamento em espessura (IE 2 e 24 horas e absorção de água (AA 2 e 24 horas, de acordo com a norma ASTM D 1037-91. O aumento do teor de fibras de babaçu associado ao aumento no teor de adesivo contribuiu para a redução nos valores de inchamento em espessura e absorção de água. O aumento do teor de adesivo de 6 para 8% foi fundamental para a melhoria das propriedades inchamento em espessura, absorção em água, módulo de ruptura e módulo de elasticidade. Utilizando até 30% de fibras de babaçu na composição das chapas, os valores de MOR foram superiores aos estabelecidos pela CS 236-66.The objective of this work was to evaluate the use of babaçu (Orbignya spp fiber (epicarp in combination with particles of Pinus elliottii at different ratios in particleboard manufacturing, as well as evaluating the effect of different adhesive contents. The boards were pressed at 160 ºC, using two resin levels - 6% and 8% (particle dry weight basis and 10 min pressing time, totaling eight treatments, tree repetitions per treatment, totaling twenty four boards, with 0.70 g/cm³ nominal density. The evaluated properties were as follows: Static bending - modulus of rupture (MOR and
Directory of Open Access Journals (Sweden)
Daniel Albiero
2011-03-01
Full Text Available O babaçu (Orbignya phalerata é uma típica palmeira das matas de transição dos ecossistemas Amazônia/Cerrado e Amazônia/Caatinga, sendo de grande importância econômica, social e ambiental nestas regiões. Os produtos advindos dos babaçuais possibilitam renda para uma das camadas mais pobres da região amazônica e um dos entraves para a obtenção eficiente destes produtos é a colheita dos cocos de babaçu, que atualmente se faz no sistema extrativista. O objetivo deste trabalho foi realizar o desenvolvimento e projeto de uma colhedora de babaçu adaptável ao ambiente de trabalho da agricultura familiar e as características das matas de transição amazônicas. Para tal foram realizados estudos de literatura que nortearam as decisões e simplificações de projeto, assim como foram realizados os cálculos e desenhos da nova colhedora. O projeto foi realizado através de ferramentas de engenharia que apresentaram como resultados o memorial de cálculo que descreve o caminho técnico para o dimensionamento dos elementos constituintes da colhedora e a partir destes os desenhos detalhados dos elementos da nova máquina. Pelos desenhos detalhados suas considerações e decisões concluí-se que a colhedora de babaçu apresenta-se passível de ser construída com materiais nacionais de baixo custo, além de fácil operação, manutenção e com mínimo efeito sobre os babaçuais naturais.The babaçu (Orbignya phalerata is a typical palm of transition forests of Amazon/Savana and Amazon/Caatinga econsystems; it is very important economically, socially and environmentally in this region. Products derived from babaçu provide income for the poor of these regions. One of the problems for obtaining this product efficiently is the extractivist system of harvesting. The objective of this work is to set up a self-propelling project of babaçu harvesting, for family farmers of the Amazonian transition forest region, which would not interfere in
Directory of Open Access Journals (Sweden)
Mario Sánchez Gumiel
2013-02-01
Full Text Available En febrero de 2012 se cumplieron cuarenta años de la visita de Richard Nixon a China y, por tanto, de la reanudación de las relaciones sino-americanas que habían sido interrumpidas en 1949. Desde entonces, Estados Unidos y China han mantenido una recíproca política de contención y aislamiento, conscientes de sus diferencias, pero sabedores también de la necesidad de un entendimiento mutuo. Como consecuencia dicha política de contención y aislamiento, el océano Pacífico está transformándose, como el Atlántico después de la Segunda Guerra Mundial, en el nuevo escenario geopolítico del siglo XXI.Palabras Clave: Estados Unidos, China, Nixon, Mao, Deng Xiaoping, Taiwán, Chiang Kai-Shek, Contención, Aislamiento, Corea, Vietnam, Tian’anmen, URSS, Comunismo, Capitalismo.___________________Abstract:On February 2012 took place the fourtieth anniversary of President Nixon’s visiting to China and, as a consequence, of the resumption of the Sino-American relations which had been interrupted in 1949. Since then, the United States and China have experienced a reciprocal policy of containment without isolation, both being aware of their mutual differences but knowing of the necessity of mutual understanding as well. As a result, the Pacific ocean is making changes, just as the Atlantic after the Second World War, in order to become the new geopolitical place of the Twenty First century.Keywords: United States, China, Nixon, Mao, Deng Xiaoping, Taiwán, Chiang Kai-Shek, Containment, Isolation, Korea, Vietnam, Tian’anmen, USSR, Communism, Capitalism.
Hakobyan, Liana
2018-01-01
This article examines Julio Cortázar's short story "Las babas del diablo" from a visual perspective and at the intersection of Roland Barthes's ideas on photography and Severo Sarduy's theory on the Neobaroque. I propose that in "Las babas del diablo" photography and the Neobaroque--two seemingly unrelated concepts--interact…
Directory of Open Access Journals (Sweden)
Daiana Hollender
Full Text Available Brucella abortus es el agente causal de la brucelosis bovina, enfermedad zoonótica que se encuentra ampliamente distribuida en el mundo. Actualmente existen ocho biovariedades de B. abortus. En Argentina se encuentra con mayor frecuencia la biovariedad 1, pero también se suele aislar la biovariedad 2, que es más patogénica que la anterior. Resulta necesario contar con métodos de tipificación que tengan la resolución suficiente para permitir el seguimiento epidemiológico de los brotes de brucelosis y de los programas de control de la enfermedad. Debido a la gran homogeneidad genética que existe entre las distintas especies del género Brucella, ha sido dificultoso el desarrollo de herramientas moleculares para realizar el análisis epidemiológico de los aislamientos. La publicación del genoma de varias especies de Brucella facilitó el diseño de estas herramientas. El objetivo del presente trabajo fue emplear un esquema de análisis multilocus de VNTR en aislamientos de Argentina obtenidos en nuestro laboratorio. De los 56 aislamientos analizados se obtuvieron 47 perfiles genotípicos diferentes. El empleo de este esquema permitió asignarles a dichos aislamientos la biovariedad correspondiente. A través del análisis goeBURST se pudo relacionar a todos los genotipos entre sí, y además, proponer al genotipo de la biovariedad 2 como fundador.
Positional short-range order in the nematic phase of n BABAs
Usha Deniz, K.; Pepy, G.; Parette, G.; Keller, P.
1991-10-01
The positional short-range order, SRO ⊥, perpendicular to the nematic director n̂ has been studied in the fibre-type nematics, nBABAs, by neutron diffraction. SRO ⊥ is found to be dependent on other types of nematic short-range order but not on the orientational long-range order.
Directory of Open Access Journals (Sweden)
Rodolfo Puglisi
2012-01-01
Full Text Available Luego de presentar los caracteres fundamentales del armazón institucional de la Or - ganización Sri Sathya Sai Baba ( osss B , surgida en la India, y de bosquejar la historia del movimiento Sai Baba en Argentina, en este artículo presento las que denomino tres estrategias socioadaptativas puestas en juego por el movimiento para favorecer la acomodación de sus creencias al campo sociorreligioso argentino, es decir, examino cómo se tejen puentes simbólicos con el trasfondo cultural local a fin de lograr una identificación con los valores de la sociedad receptora.
Stephane Mananga, Eugene
2013-01-01
Floquet-Magnus expansion is used to study the effect of chemical shift anisotropy in solid-state NMR of rotating solids. The chemical shift interaction is irradiated with two types of radiofrequency pulse sequences: BABA and C7. The criteria for the chemical shift anisotropy to be averaged out in each rotor period are obtained. Copyright © 2013 Elsevier Inc. All rights reserved.
Mananga, Eugene S; Reid, Alicia E
This paper presents the study of finite pulse widths for the BABA pulse sequence using the Floquet-Magnus expansion (FME) approach. In the FME scheme, the first order F 1 is identical to its counterparts in average Hamiltonian theory (AHT) and Floquet theory (FT). However, the timing part in the FME approach is introduced via the Λ 1 ( t ) function not present in other schemes. This function provides an easy way for evaluating the spin evolution during "the time in between" through the Magnus expansion of the operator connected to the timing part of the evolution. The evaluation of Λ 1 ( t ) is useful especially for the analysis of the non-stroboscopic evolution. Here, the importance of the boundary conditions, which provides a natural choice of Λ 1 (0) is ignored. This work uses the Λ 1 ( t ) function to compare the efficiency of the BABA pulse sequence with δ - pulses and the BABA pulse sequence with finite pulses. Calculations of Λ 1 ( t ) and F 1 are presented.
Directory of Open Access Journals (Sweden)
Maria E Cattana
Full Text Available La criptococosis es una infección fúngica causada por levaduras del género Cryptococcus, particularmente las del complejo Cryptococcus neoformans/Cryptococcus gattii. El conocimiento sobre la casuística de la criptococosis en el nordeste argentino es exiguo y no se tiene información sobre los tipos moleculares circulantes. El objetivo de este estudio fue realizar la caracterización genética de los aislamientos pertenecientes al complejo C. neoformans/C. gattii obtenidos en el Hospital «Dr. Julio C. Perrando» de la ciudad de Resistencia (Chaco, Argentina, con el fin de determinar especie, variedad y genotipo. Durante dos años y un mes se estudiaron 26 aislamientos clínicos. Mediante métodos convencionales y moleculares, un aislamiento fue identificado como C. gattii genotipo VGI y los 25 restantes como C. neoformans var.grubii, 23 de los cuales correspondieron al genotipo VNI y dos al genotipo VNII. Estos datos son una contribución al conocimiento de la epidemiología de la criptococosis en la Argentina y el primer informe sobre genotipos del complejo C. neoformans/C. gattii de origen clínico en el nordeste argentino.
Mananga, Eugene S.; Reid, Alicia E.
2013-01-01
This paper presents a study of finite pulse widths for the BABA pulse sequence using the Floquet-Magnus expansion (FME) approach. In the FME scheme, the first order ? is identical to its counterparts in average Hamiltonian theory (AHT) and Floquet theory (FT). However, the timing part in the FME approach is introduced via the ? function not present in other schemes. This function provides an easy way for evaluating the spin evolution during the time in between' through the Magnus expansion of the operator connected to the timing part of the evolution. The evaluation of ? is particularly useful for the analysis of the non-stroboscopic evolution. Here, the importance of the boundary conditions, which provide a natural choice of ? , is ignored. This work uses the ? function to compare the efficiency of the BABA pulse sequence with ? and the BABA pulse sequence with finite pulses. Calculations of ? and ? are presented.
Directory of Open Access Journals (Sweden)
Guillermo M. Carrillo-Castañeda
2011-11-01
Full Text Available La contaminación del suelo reduce la producción y calidad de los alimentos. Para la recuperación de suelos contaminados la fitorremediación compite favorablemente con costosos métodos fÃsicos y quÃmicos. En este trabajo fueron colectadas muestras de suelo y de raÃz de plantas silvestres en nueve sitios en el predio del Colegio de Posgraduados, Campus Montecillo. Después de determinar el pH de las muestras de suelo, del sobrenadante se estriaron muestras en medio sólido B de King. Del ápice de raÃces se obtuvieron muestras para estriarlas en el mismo medio y las cajas fueron incubadas a 26-28 °C. De 223 aislamientos bacterianos obtenidos, 23 fueron seleccionados por producir pigmentos fluorescentes y ser inocuos. Dos aislamientos de suelo (2S-10, 2S-9 y uno de raÃz (2R-2 fueron los de mayor producción de pigmentos fluorescentes. La semilla de alfalfa inoculada con células de los aislamientos 2S-10, 2R-2, y 2S-9 germinó en 78, 56, y 88 %, respectivamente mientras que la semilla sin inocular germinó en 88 %. En una prueba preliminar, resaltó el mayor desarrollo de las plántulas inoculadas con el aislamiento 2S10. Mediante la interacción planta-microorganismo se logra acrecentar la potencialidad de las plantas para acumular metales y hacer más eficiente el proceso de fitorremediación.
DSC and X-ray diffraction investigations of phase transitions in HxBABA and NBABA
International Nuclear Information System (INIS)
Usha Deniz, K.; Paranjpe, A.S.; Mirza, E.B.; Parvathanathan, P.S.; Patel, K.S.
1979-01-01
The phase transitions and the heats of transformation, of the hexyl (HxBABA) and nonyl (NBABA) members of the series of compounds, p-n-Alkoxybenzylidene-p-Aminobenzoic Acids, have been studied by DSC in the temperature range, - 100 0 C to 300 0 C. A scheme of transitions has been proposed for each of the compounds. X-ray diffraction measurements have been done in the smectic C(Ssub(c)) and nematic (N) phases of these materials. The results reveal that (1) the Ssub(c) phase in both compounds is of the C 1 -type, (2) Ssub(c)-type order is seen throughout the nematic phase in HxBABA, whereas in NBABA, it is seen only in the neighbourhood of the Ssub(c)-N transition, (3) the temperature dependence of the smectic layer thickness, d, and of the directly measured tilt angle, theta sub(t,d), reflect faithfully the strength of the first order transition, Ssub(c)-N, and (4) there is a marked difference between the values and the temperature variations of theta sub(t,d) and theta sub(t,c) (tilt angle calculated from d) which is not completely understood, at present
NNLO massive corrections to Bhabha scattering and theoretical precision of BabaYaga rate at NLO
International Nuclear Information System (INIS)
Carloni Calame, C.M.; Nicrosini, O.; Piccinini, F.; Riemann, T.; Worek, M.
2011-12-01
We provide an exact calculation of next-to-next-to-leading order (NNLO) massive corrections to Bhabha scattering in QED, relevant for precision luminosity monitoring at meson factories. Using realistic reference event selections, exact numerical results for leptonic and hadronic corrections are given and compared with the corresponding approximate predictions of the event generator BabaYaga rate at NLO. It is shown that the NNLO massive corrections are necessary for luminosity measurements with per mille precision. At the same time they are found to be well accounted for in the generator at an accuracy level below the one per mille. An update of the total theoretical precision of BabaYaga rate at NLO is presented and possible directions for a further error reduction are sketched. (orig.)
Inhibición in vitro de aislamientos nativos de Trichoderma en presencia de la cepa comercial T22
Directory of Open Access Journals (Sweden)
Gabriela Hernández – Ramírez
2013-01-01
Full Text Available Título en ingles: In vitro inhibition from native isolates of Trichoderma against commercial strain T22. Título corto: Inhibición in vitro de aislamientos nativos Resumen El objetivo de este trabajo fue evaluar 14 aislamientos nativos del género Trichoderma (Tn obtenidos de la rizósfera del cultivo de caña de azúcar de acuerdo con su efecto de inhibición In vitro en cultivos duales contra la cepa comercial de Trichoderma harzianum (T22. Los aislamientos nativos con mayor índice de inhibición fueron los denominados Palma (T12 y Hubero (T11, con un valor de 2, mientras que T01, T04, T05 y T08 presentaron un valor de 1. Además, el mayor porcentaje de inhibición fue causado por el aislamiento T03, con una media de 92.32 ± 2.64%, sin diferencias estadísticas con los nativos T07, con un valor inhibición de 88.99 ± 1.46%, T01 87.93 ± 2.28%, y T12; 87.71 ± 3.16. En este caso, los aislamientos T07 y T12 mostraron capacidad inhibitoria con mayores atributos para su selección como agentes de control biológico. Al evaluar la tolerancia In vitro de los aislamientos nativos de Trichoderma a la actividad del agua (aw, se observó efecto significativo sobre el desarrollo micelial de los aislamientos de Trichoderma nativo evaluados. Los aislamientos T03 (7919.3 ± 932.53 y T12 (6388.2 ± 623.40 presentaron el mejor desarrollo radial. Estos resultados sugieren que los aislamientos T03 y T12 podrían desarrollarse mejor bajo condiciones de estrés hídrico. Por lo anterior, concluimos que los aislamientos T07 y T12, son los mejores candidatos como agentes inhibidores y se sugiere evaluarlos In vitro o invernadero contra el agente causal de la enfermedad del muermo rojo en caña de azúcar (Colletotrichum falcatum. Palabras clave: Control Biológico; tolerancia; ompetencia; estrés hídrico; actividad de agua. Abstract The objective of this work was to evaluate 14 native e Trichoderma genus isolates (Tn obtained from the rhyzosphere of
La doctrina malikí sobre esclavitud y el Miray de Ahmad Baba
Directory of Open Access Journals (Sweden)
Marta García Novo
2010-01-01
Full Text Available La obra Miray al-s. uud, del alfaquí de Tombuctú Ah. mad Baba (1556-1627, perteneciente a la escuela jurídica malikí, es una fatwà u opinión legal en el marco de la jurisprudencia islámica, que aborda la cuestión de los esclavos negros (sudan que reclamaban la libertad en los mercados del norte de África, por haber sido capturados siendo musulmanes, algo que no está permitido en el islam. De acuerdo con el Derecho islámico clásico, sólo los no musulmanes que no cuenten con la protección de un pacto o del estatuto de lad imma, pueden ser esclavizados. Ah. mad Baba reitera esta doctrina en el Miray, haciendo hincapié en que, de acuerdo con la religión islámica, no existe ninguna relación entre el color de la piel y la esclavitud, y que los negros que habitan el bilad al-sudan (el África occidental premoderna no son esclavos por naturaleza. Además, como medio para evitar la esclavización de musulmanes libres procedentes del África occidental premoderna, el autor lleva a cabo una clasificación de los pueblos que, en su época, han adoptado o no el islam en este ámbito geográfico, un sistema que plantea serias debilidades estructurales a la hora de llevar a cabo su fin, quizá también intencionadas.The work Miray al-s. uud, written in 17th century Timbuktu by Ah. mad Baba (1556- 1627, an Islamic scholar that adhered to the Malikí law school, is a fatwa or legal opinion that addresses the issue of the black (sudan slaves that claimed their freedom in the markets of North Africa, for having been captured while being Muslims, something not allowed in pre- Modern Islamic law. According to it, only infidels without the protection of a pact or of the dhimma status can be legally enslaved. Ah. mad Baba repeats this doctrine, while emphasising that the black skin colour has nothing to do with slavery in islam, and that the peoples of pre-Modern West Africa (bilad al-sudan are not slaves by nature. Besides this, and as a means of
Directory of Open Access Journals (Sweden)
Jill Terry Rudy
2016-06-01
Full Text Available This paper considers transforming forms and their purposes in the popular culture trope of the televised Monster of the Week (MOTW. In the rare televised appearances outside of Slavic nations, Baba Yaga tends to show up in MOTW episodes. While some MOTW are contemporary inventions, many, like Baba Yaga, are mythological and fantastic creatures from folk narratives. Employing the concept of the folkloresque, we explore how contemporary audiovisual tropes gain integrity and traction by indexing traditional knowledge and belief systems. In the process, we examine key affordances of these forms involving the possibilities of wonder and the portability of tradition. Using digital humanities methods, we built a “monster typology” by scraping lists of folk creatures, mythological beasts, and other supernatural beings from online information sources, and we used topic modeling to investigate central concerns of MOTW series. Our findings indicate connections in these shows between crime, violence, family, and loss. The trope formulates wonder and families through folk narrative and monster forms and functions. We recognize Baba Yaga’s role as villain in these episodes and acknowledge that these series also shift between episodic and serial narrative arcs involving close relationships between characters and among viewers and fans.
Necesidad del aislamiento térmico en la edificación actual
Directory of Open Access Journals (Sweden)
Alamán, A.
1972-09-01
Full Text Available The author attempts to clear up a few ideas on this subject, as not everyone knows enough about its correct use: what is meant by thermal insulation and thermal conductivity, essential requirements with respect to material, lightweight and heavy insulation, justification of insulation for reasons of building evolution, comfort, economy and to avoid condensation, as well as the influence of openings in outside walls.El autor trata de aclarar algunos conceptos sobre esta materia, ya que, en realidad, no todos conocen adecuadamente su correcto empleo: qué se entiende por aislamiento térmico y por conductividad térmica, condiciones que deben exigirse a los materiales, aislamientos ligeros y pesados, justificación del aislamiento por razones de evolución de la construcción, de confort, de economía y para evitar condensaciones, así como la influencia de los huecos en las fachadas.
Vigo, Germán B.; Giacoboni, Gabriela I.; Gagetti, Paula S.; Pasterán, Fernando G.; Corso, Alejandra C.
2015-01-01
Se estudiaron 28 aislamientos obtenidos de muestras clínicas de perros e identificados por espectrometría de masas (MALDI-TOF) como Staphylococcus pseudintermedius; el objetivo fue evaluar la sensibilidad a los antimicrobianos por el método de difusión y establecer la relación clonal entre aislamientos por electroforesis en campo pulsado (PFGE). La resistencia a meticilina se evaluó mediante PCR por amplificación del gen mecA y se observó en 3/28 aislamientos (10,7 %). Quince aislamientos (53...
Directory of Open Access Journals (Sweden)
N. Ordóñez
1994-09-01
Full Text Available Se determinó l variedad y el serotipo de 192 aislamientos de Cryptococcus neoformans recuperados de 1972 a 1992; 163 de origen clínico y 29 del medio ambiente. En los aislamientos clínicos se determinaron las dos variedades de C. neoformans: la variedad neoformans en el 92,6% de los pacientes y la variedad gattii en el 7,4%. En el medio ambiente se encontró la variedad neoformans en el 100% de los aislamientos. El serotipo encontrado con más frecuencia fue el serotipo A, el cual se observó en el 92% de los aislamientos clínicos y en el 100% del medio ambiente, seguido por el serotipo B (6,8%; también, se determinaron aislamientos de los serotipos C (0,6% y D (0,6%. C. neoformans var. neoformans se recuperó en todos los años de los que se tuvieron aislamientos y C. neoformans var. gattii solamente se observó en aislamientos clínicos a partir de 1986. C. neoformans var. neoformans fue aislado durante los 12 meses del año y C. neoformans var. gattii se encontró distribuido en los meses defebrero, abril, junio, agosto, septiembre y diciembre. C. neoformans var. neoformans se observó en 109 (66,9% cepas de pacientes del sexo masculino y en 36 (22,1% del sexo femenino; C. neoformans var. gattii se observó en 5 (3% cepas de hombres y en 6 (3,7% mujeres.
Caracterización molecular de un aislamiento cubano de parvovirus canino
Directory of Open Access Journals (Sweden)
Anniet Fresneda-Disotuar
2015-12-01
Full Text Available El parvovirus canino tipo 2 (VPC-2 es el agente causal de una enfermedad infecto-contagiosa que produce gastroenteritis aguda hemorrágica que afecta a caninos jóvenes. El VPC-2 es un virus con genoma ADN, pequeño, desnudo y muy resistente a las condiciones ambientales que emergió y se expandió rápidamente a fines de la década de los años 70. En los años 80 surgieron consecutivamente dos variantes antigénicas, denominadas VPC-2a y VPC-2b. En el 2000 se detectó una nueva variante antigénica llamada VPC-2c, reportándose con frecuencia en comunidades caninas de varios países del mundo. El objetivo de este trabajo consistió en caracterizar un aislamiento cubano de parvovirus canino, atenuado y adaptado a cultivo celular. El material genético fue amplificado por reacción en cadena de la polimerasa y secuenciado posteriormente. Las secuencias obtenidas fueron analizadas y comparadas con secuencias de aislados y cepas conocidas depositadas en las bases de datos, donde se evidenció que el aislamiento cubano era del tipo VPC-2.
Heterocigosis y aislamiento: el caso de las poblaciones andinas
Directory of Open Access Journals (Sweden)
Acreche, Noemí
2003-01-01
Full Text Available Poblaciones de la Puna y del Valle Calchaquí de la Provincia de Salta, de las que se conoce su condición de aislamiento reproductivo, fueron estudiadas con el objeto de analizar si existe asociación entre los niveles de heterocigosis por individuo para grupos sanguíneos eritrocitarios y STRs y el lugar de origen de sus padres. A tales efectos se considera para acda individuo la proporción de loci heterocigotos y la pertenencia de sus padres a una de las siguientes categorías: ambos no migrantes, no migrante-migrante de corta distancia/migrante de larga distancia, ambos migrantes de larga distancia, migrante de corta distancia-migrante de larga distancia. Los grupos sanguíneos presentan mayor variabilidad en el Valle que en la Puna, de acuerdo a lo esperado por el grado de aislamiento y diferencias significativas en los promedios de heterocigosisi por individuo en ambas zonas. Por el contrario, los STRs mantienen valores constantes por lo que los análisis a partir de grupos sanguíneos reflejarían mejor las condiciones de aislamiento de las diferentes poblaciones. No se observó asociación entre las categorías definidas según la procedencia de los padres y la proporción de loci heterocigotos en los individuos.
Directory of Open Access Journals (Sweden)
Carolina Firacative
2006-06-01
Full Text Available Introducción. Streptococcus pneumoniae serotipo 5 es causa importante de enfermedad invasora en Colombia, donde se ha demostrado la circulación del clon 19-Colombia(5 susceptible a penicilina pero resistente a tetraciclina y a cloranfenicol. Objetivo. Establecer las relaciones genéticas de aislamientos invasores colombianos de S. pneumoniae serotipo 5 recuperados entre 1994 y 2004 con el clon 19-Colombia(5. Materiales y métodos. Se estudiaron 83 aislamientos que tenían datos de susceptibilidad a penicilina, vancomicina, ceftriaxona, eritromicina, trimetoprim sulfametoxazol, cloranfenicol y tetraciclina, de los cuales 29 fueron obtenidos de niños menores de cinco años. El patrón de restricción del ADN se determinó por electroforesis en gel de campo pulsado, usando la enzima Sma I. La similitud genética entre los aislamientos y el clon se estableció según los criterios de Tenover y utilizando el programa Fingerprinting II. Resultados. Todos los aislamientos se relacionaron con el clon 19-Colombia5 y se agruparon en el patrón electroforético A con 17 subtipos. El patrón A se estableció en 32 aislamientos (38,6%, el A8 en 18 (21,7% y el A5 en 10 (12%, los 15 patrones restantes agruparon los otros 23 aislamientos. Los 34 aislamientos resistentes a tetraciclina y cloranfenicol mostraron relación con los patrones electroforéticos A (n = 32, A16 (n = 1 y A28 (n = 1, caracterizados, al igual que el clon, por presentar una banda de 340 Kb. Conclusión. Estos resultados muestran la circulación continua en el país de aislamientos de S. pneumoniae serotipo 5 genéticamente relacionados con el clon 19-Colombia(5.
Caracterización de aislamientos clínicos de Leptospira para su uso en vacunas veterinarias
Directory of Open Access Journals (Sweden)
Yaritza Cuba-Romero
2016-04-01
Full Text Available Uno de los criterios más importantes para el desarrollo de inmunógenos de Leptospira es contar con cepas bien caracterizadas por su virulencia y representativa de los serogrupos circulantes desde el punto de vista clínico y veterinario. Todo lo cual permite garantizar inmunógenos capaces de proteger contra los serovares presente en la formulación y que afectan a los animales en riesgo. Este trabajo se realizó a partir de aislamientos del agente causal de cinco casos clínicos autóctonos de Leptospira en la provincia de Holguín, Cuba, mediante métodos convencionales: crecimiento a 13ºC, medio suplementado con 8-azaguanina y en presencia de cloruro de sodio. Además, los aislamientos se clasificaron hasta nivel de serogrupo mediante la técnica de microaglutinación. A partir de estos aislamientos fue seleccionada y caracterizada una cepa del serogrupo Ballum como candidato vacunal. Los aislamientos no mostraron crecimiento a 13ºC, ni cuando se le añadió al medio 8-azaguanina (2,25 mg/mL, mientras que todas las cepas mostraron conversión a forma esférica en presencia de cloruro de sodio (1M. La clasificación de los aislamientos permitió disponer de dos cepas pertenecientes al serogrupo Ballum y dos a Pomona. La cepa seleccionada mostró alta virulencia y patogenicidad en el biomodelo Hámster Sirio, además de buena estabilidad en los medios de cultivos. Su clasificación hasta el nivel de serovar mediante el uso de anticuerpos monoclonales determinó su pertenencia al serovar Ballum. El presente trabajo, por primera vez, sienta las bases para formulaciones vacunales novedosas en animales, conteniendo el serogrupo Ballum.
Gehring,Christoph; Zelarayán,Marcelo Luís C.; Almeida,Rosângela B.; Moraes,Flávio Henrique R.
2011-01-01
A palmeira babaçu (Attalea speciosa C.Martius, Arecaceae) tem grande importância socioeconômica e ecológica em grande parte da área tropical brasileira, especialmente em áreas degradadas por queimadas freqüentes na Amazônia. No entanto, ainda pouco se sabe sobre as características ecológicas desta espécie-chave. Este estudo investiga a alometria do babaçu com o objetivo de estabelecer uma metodologia eficiente na estimativa da biomassa aérea de palmeiras juvenis e adultas e para um melhor ent...
UniPrime2: a web service providing easier Universal Primer design.
Boutros, Robin; Stokes, Nicola; Bekaert, Michaël; Teeling, Emma C
2009-07-01
The UniPrime2 web server is a publicly available online resource which automatically designs large sets of universal primers when given a gene reference ID or Fasta sequence input by a user. UniPrime2 works by automatically retrieving and aligning homologous sequences from GenBank, identifying regions of conservation within the alignment, and generating suitable primers that can be used to amplify variable genomic regions. In essence, UniPrime2 is a suite of publicly available software packages (Blastn, T-Coffee, GramAlign, Primer3), which reduces the laborious process of primer design, by integrating these programs into a single software pipeline. Hence, UniPrime2 differs from previous primer design web services in that all steps are automated, linked, saved and phylogenetically delimited, only requiring a single user-defined gene reference ID or input sequence. We provide an overview of the web service and wet-laboratory validation of the primers generated. The system is freely accessible at: http://uniprime.batlab.eu. UniPrime2 is licenced under a Creative Commons Attribution Noncommercial-Share Alike 3.0 Licence.
Czech Academy of Sciences Publication Activity Database
Satková, P.; Starý, T.; Plešková, E.; Zapletalová, M.; Kašparovský, T.; Činčalová-Kubienová, L.; Luhová, L.; Mieslerová, B.; Mikulík, Jaromír; Lochman, J.; Petřivalský, M.
2017-01-01
Roč. 119, č. 5 (2017), s. 829-840 ISSN 0305-7364 Institutional support: RVO:61389030 Keywords : baba * Defence genes * Ethylene * Oidium neolycopersici * Oligandrin * Powdery mildew * Resistance * Solanum habrochaites * Solanum lycopersicum * Tomato Subject RIV: GF - Plant Pathology, Vermin, Weed, Plant Protection OBOR OECD: Plant sciences, botany Impact factor: 4.041, year: 2016
Consideraciones sobre aislamientos térmicos
Directory of Open Access Journals (Sweden)
García Arroyo, A.
1966-06-01
Full Text Available The yearly change in ambient temperature, and also the daily variations, become notably evident inside buildings. In extreme cases they cause considerable discomfort. This can be avoided by two means: insulation and heating or air conditioning. As each of these factors covers a wide range of possibilities, a detailed study of the physical factors, such as location, cost, climate, etc., makes it possible to find the most suitable materials, with the best overall thermal transmission factor (Ue, and the cheapest thickness (te of the insulating material.La variación anual de la temperatura externa, así como la diaria, se manifiesta de una manera notable en el interior de los edificios creando, en condiciones extremas, un inconfort evitable mediante la combinación apropiada de dos elementos: aislamientos y sistemas de calefacción o aire acondicionado. Dada la extensa gama de variación de cada uno de estos factores, haciendo un estudio detallado de sus propiedades físicas, situación, costes y clima de la región, encontramos el material más idóneo a emplear, coeficiente global de transmisión térmica (Ue del aislamiento y espesor (te más económico del material aislante.
Directory of Open Access Journals (Sweden)
L. Fernández Canigia
2007-09-01
Standards Institute (CLSI, anteriormente NCCLS. En los tres períodos considerados, los antibióticos más activos frente a aislamientos de la especie B. fragilis como así también frente a aislamientos pertenecientes a otras especies del grupo B. fragilis fueron imipenem, con 99,1 y 100% de actividad, respectivamente, y metronidazol, con 100% de actividad. Con ampicilina-sulbactama se observó a lo largo del tiempo una disminución de la sensibilidad, desde el 100% en el primer período hasta un 90,3 y 82,4% en el último, para B. fragilis y para especies del grupo distintas de B. fragilis, respectivamente. Cuando se consideraron los tres períodos juntos, se observaron diferencias significativas entre la especie B. fragilis y los restantes aislamientos del grupo para cefoxitina, piperacilina y clindamicina (84,2% vs. 56,5%; 85,9% vs. 66,7% and 88,8% vs. 64,7%, respectivamente, p< 0.05. Cefoxitina fue el antibiótico que mostró mayores variaciones a través del tiempo y entre especies. Las tasas de sensibilidad a clindamicina fueron bajas (alrededor del 60% entre los aislamientos no pertenecientes a la especie B. fragilis durante los últimos dos períodos. Las variaciones observadas en los perfiles de sensibilidad del grupo B. fragilis muestran la necesidad de vigilar periódicamente la emergencia de resistencia a los antimicrobianos, a fin de orientar el tratamiento de las infecciones por bacterias anaerobias.
"Encierro sobre el encierro" aislamiento por tuberculosis. Centro penitenciario Medellín Colombia
Directory of Open Access Journals (Sweden)
Laura María Almeida Rueda
2016-04-01
Full Text Available Introducción: Las personas privadas de la libertad diagnosticadas con tuberculosis son aisladas para evitar el contagio a otros internos y a los guardianes, a esta situación los participantes le dan significados que pueden ayudar en el diseño de programas para el control de la tuberculosis en centros penitenciarios. Objetivo: Comprender el significado que las personas privadas de la libertad, le dan al aislamiento a que se deben someter durante el tratamiento de la tuberculosis. Metodología: Se utilizó la investigación cualitativa con enfoque etnográfico, se realizaron 14 entrevistas y 400 horas de observación. Se llevó diario de campo. Hallazgos: Las personas privadas de la libertad diagnosticadas con tuberculosis son llevadas a un lugar de aislamiento que favorece la curación y al mismo tiempo genera discriminación. El aislamiento es considerado un "encierro sobre el encierro". Este trae consecuencias físicas, socio-culturales y psicológicas. Para disminuir el impacto buscan distracción y cuando ven síntomas de recuperación lo toman con paciencia. Conclusión: El aislamiento se ve desde dos perspectivas: la comodidad y tener que soportar el encierro y la discriminación. Genera conflictos y alteraciones en la salud física y mental
Aislamiento de tres cepas de leishmania
Directory of Open Access Journals (Sweden)
Florentino Rey
1942-08-01
Full Text Available Con el ánimo de estudiar el problema parasitológico de la Leishmaniasis cutánea en Colombia, emprendimos algunas experiencias al respecto. Este es un estudio de aislamiento de tres cepas de Leishmania obtenidas de tres enfermos de distintas regiones del país, Investigadores colombianos que se han ocupado con anterioridad de este problema, obtuvieron siempre resultados negativos. Comunicaciones posteriores informarán sobre estudios experimentales de las cepas mencionadas.
Directory of Open Access Journals (Sweden)
Silvia Blair
2008-06-01
Conclusiones. La baja sensibilidad a la cloroquina concuerda con otros estudios in vitro y con la baja eficacia terapéutica in vivo. Aunque 96% de los aislamientos fueron sensibles a artesunato, éste y otros estudios han observado aislamientos con disminución de la sensibilidad a las artemisininas (CI50>10,5 nM, lo que sugiere que el uso indiscriminado de estos medicamentos pone en riesgo su efectividad y podría dejarnos sin opciones para el tratamiento del paludismo por P. falciparum.
Cañizalez Briceño, Luis Miguel; Guedez de Olivar, Clemencia; Castillo, Carmen Elena; Olivar, Rafael
2015-01-01
La broca (Hypothenemus hampei) es insecto plaga que causa pérdidas considerables en café. El principal control ha sido el químico, sin embargo, actualmente se buscan alternativas más ecológicas. El objetivo fue caracterizar 12 aislamientos nativos de Beauveria bassiana y evaluar el control en la broca. La caracterización involucró la morfología, fisiología y patogenicidad de los aislamientos en adultos de H. hampei. El tamaño de los conidios osciló entre 2,55 y 2,42 micras. La ger...
Rodriguez-Flores, Paula C; Machordom, Annie; Macpherson, Enrique
2017-06-09
The genus Fennerogalathea Baba, 1988 was known to contain two species: F. chacei Baba, 1988, the type species, from the Philippines, Taiwan and Indonesia and F. chirostyloides Tirmizi & Javed, 1993 from the Bay of Bengal. In the present study, three new species of the genus are described and illustrated: F. chani n. sp. from Papua New Guinea, F. cultrata n. sp. from New Caledonia and Vanuatu and F. ensifera n. sp. from Fiji. The new species are morphologically distinguishable on the basis of the shape and spination of the rostrum and the presence/absence of a small spine on the frontal margin of the carapace. The species also show clear genetic differences (COI and 16S rDNA) among them.
Analysis of Sustainability of New Rural Housing (Case of ole Baba Hoseyn Bridge Village
Directory of Open Access Journals (Sweden)
Jeyran Chamcham
2016-10-01
Full Text Available Modernization of rural housing based on the principles of sustainability is one of the most important prerequisites for achieving sustainable development in rural areas. This can only be achieved by knowing the exact status of rural housing and its range of stability. And rural planning is not possible without it. On the other hand, survey of the stability of the different aspects of rural housing will have a decisive role in decisions related to how to promote this project aimed at sustainable rural development. Therefore, this study we have investigated and compared the economic, Social, environmental, technical and physical aspects of new rural housing with sustainability approach, quantitative paradigm and the case study method. The statistical population in the study were all the people of Baba Hoseyn Bridge Village from which a number were selected who had reconstructed their homes. The results are shown in 4 dimensions of new housing's economic, social, environmental, technical and physical aspects in the Baba Hoseyn Bridge Village although they have very little inclination towards sustainability. Despite this, the hybrid economic index for reconstruction of rural housing turned out to be more stable than other metrics.
Directory of Open Access Journals (Sweden)
Izcara-Palacios, Simón Pedro
2010-08-01
Full Text Available “Social isolation” is a concept poorly developed in the analysis of poverty. “Social exclusion” and “marginality” are concepts more frequently used. “Social isolation” refers to an erosion of the relational sphere of the individual (i.e.: it is a lack of familial support and/or social networks, and an absence of social activity and recreational interaction. Moreover, “social isolation” is associated with anxiety and depression symptoms. This paper analyses the situation of “social isolation” of Tamaulipas’ undocumented farm workers employed in the United Stated.
El concepto de “aislamiento social” ha sido insuficientemente utilizado en el análisis de la pobreza. “Exclusión social” y “marginalidad” son dos conceptos más desarrollados. El “aislamiento social” hace referencia a una erosión de las esferas relacionales del individuo (esto es, a una falta de soporte familiar y/o redes sociales, y a una ausencia de actividad social e interacción recreacional. Más aún, el “aislamiento social” está asociado a síntomas de ansiedad y depresión. Este artículo analiza la situación de aislamiento social de los jornaleros indocumentados tamaulipecos empleados en los Estados Unidos.
The ability of T2/B4 primers to detect Leishmania infantum among ...
African Journals Online (AJOL)
SERVER
2008-04-03
Apr 3, 2008 ... Reverse Primer (5`-CCT CTC TTT TTT CNC TGT GC-3`). (Schönian et al., 1996),. B. Forward Primer (RV1) (5`-GTG GGG GAG GGG CGT TCT-3`) and Reverse Primer (RV2) (5`-ATT TTA CAC CAA CCC CCA GTT-. 3`) (Lachaud et al., 2002; Reale et al., 1999),. C. Forward Primer (T2) (5`-CGG CTT CGC ...
Directory of Open Access Journals (Sweden)
Ibonne Aydee García Romero
2005-07-01
Full Text Available Antecedentes. Las enterobacterias, antaño flora normal del tracto gastrointestinal, han cambiado su biología y emergido como agentes patógenos nosocomiales que se tornan resistentes los antibióticos conocidos. Objetivo. Realizar la caracterización epidemiológico-molecular de 20 aislamientos de Enterobacter cloacae resistentes a cefalosporinas de tercera generación; provenientes de un hospital de tercer nivel de Bogotá-Colombia. Material y métodos. Los aislamientos fueron identificados mediante sistemas automatizados Microscan y VITEK, se utilizó el Enterobacter asbureae como control externo inter-especie. La confirmación de resistencia se hizo por técnica de difusión en agar, y una vez establecida se realizó BLEE para comprobación. La determinación de puntos isoeléctricos se hizo, mediante lisis por ultrasonido y la genotipificación mediante la metodología para bacterias Gramnegativas propuesta por Versalovic. Resultados: Los aislamientos colectados durante un año fueron causantes de 15 casos de infección Intrahospitalaria y dos colonizaciones. Todos los aislamientos presentaron resistencia a cefotaxima, ceftazidima, ceftriaxona, aztreonam y ciprofloxacina, 95% a amikacina, gentamicina y cloranfenicol, 75% a trimetoprim/sulfametoxazol, 20% a cefepime y todos fueron sensibles a imipenem. Dos aislamientos fueron confirmados como productores de â-lactamasas de espectro extendido (BLEE por la técnica microbiológica de disco combinado. Por isoelectroenfoque presentaron dos â-lactamasas con puntos isoeléctricos (pI de 5,4 y 8,2. En los 18 aislamientos no inhibidos por ácido clavulánico, se detectaron entre 2 y 4 â-lactamasas con pI de 5,4; 6,0; 7,0; 8,2 y mayor que 8,2; la resistencia a cefalosporinas de tercera generación podría ser atribuida a la hiperproducción de AmpC; los valores de pI sugieren la producción simultánea de â-lactamasas tipo SHV y TEM. La genotipificación mediante tres metodologías de rep
Directory of Open Access Journals (Sweden)
Javier Antonio Escobar
2012-06-01
Full Text Available Introducción. Los aislamientos de Staphylococcus aureus resistente a la meticilina asociado a la comunidad (SARM-AC, están aumentando la frecuencia de infecciones en personas sanas de la comunidad y en pacientes hospitalizados. En Colombia y en la región andina estos aislamientos tienen un componente genético relacionado con el clon pandémico USA300. Objetivo. Diseñar y estandarizar dos metodologías para la diferenciación rápida de aislamientos colombianos de S. aureus resistente a la meticilina asociado a la comunidad de los asociados al hospital (SARM-AH. Materiales y métodos. Se estandarizaron dos metodologías moleculares para la identificación de aislamientos de S. aureus resistente a la meticilina asociado a la comunidad. La primera se basa en la digestión diferencial con tres enzimas de restricción de los genes cinasa de carbamato (arcC y cinasa de guanilato (gmk para los tipos de secuencia 5 (ST5 y 8 (ST8, correspondientes a aislamientos de S. aureus resistente a la meticilina asociado al hospital y asociado a la comunidad, respectivamente. La segunda se basa en la amplificación por reacción en cadena de la polimerasa de cinco factores de virulencia que se encuentran de manera diferencial en estos aislamientos. Las dos metodologías fueron validadas en 237 aislamientos clínicos de S. aureus resistente a la meticilina. Resultados. Con la primera metodología se identificaron el 100 % y 93,2 % de los aislamientos de S. aureus resistente a la meticilina asociado a la comunidad y asociado al hospital, respectivamente. Con la segunda metodología se identificaron correctamente los dos tipos de aislamientos. Conclusiones. Estas dos metodologías son una buena alternativa en términos de ahorro en tiempo y dinero comparadas con otras técnicas, como la electroforesis en campo pulsado y la tipificación de secuencias multilocus para la rápida identificación de aislamientos de S. aureus resistente a la meticilina asociado a la
Directory of Open Access Journals (Sweden)
César A. Arias
2008-06-01
Conclusión. Los aislamientos colombianos de S. pneumoniae mantienen susceptibilidad a las fluoroquinolonas de última generación. La resistencia a fluoroquinolonas es alta en S. aureus, especialmente en aislamientos resistentes a la meticilina (cercana al 100%.
Kim, Dong-Ho; Choi, June Young; Kim, Byoung-Gook; Hwang, Jin-Young; Park, Seong-Joo; Oh, Ah-Young; Jeon, Young-Tae; Ryu, Jung-Hee
2016-01-01
Abstract Background: Robotic or endoscopic thyroidectomy using bilateral axillo-breast approach (BABA) is frequently performed for excellent cosmesis. However, postoperative pain is remained as concerns due to the extent tissue dissection and tension during the operation. Ketamine is a noncompetitive N-methyl-d-aspartate (NMDA) receptor antagonist that reduces acute postoperative pain. We evaluated the effects of intraoperative ketamine infusion on postoperative pain control and recovery profiles following BABA robotic or endoscopic thyroidectomy. Methods: Fifty-eight adult patients scheduled for BABA robotic or endoscopic thyroidectomy were randomized into a control group (n = 29) and ketamine group (n = 29). Following induction of anesthesia, patients in each group were infused with the same volume of saline or ketamine solution (1 mg/kg bolus, 60 μg/kg/h continuous infusion). Total intravenous anesthesia with propofol and remifentanil was used to induce and maintain anesthesia. Pain scores (101-point numerical rating scale, 0 = no pain, 100 = the worst imaginable pain), the consumption of rescue analgesics, and other postoperative adverse effects were assessed at 1, 6, 24, and 48 hours postoperatively. Results: Patients in the ketamine group reported lower pain scores than those in the control group at 6 hours (30 [30] vs 50 [30]; P = 0.017), 24 hours (20 [10] vs 30 [20]; P ketamine infusion during anesthesia resulted in lower postoperative pain scores following BABA robotic or endoscopic thyroidectomy, with no increase in adverse events. PMID:27930531
Komai, Tomoyuki; Grave, Sammy De; Saito, Tomomi
2016-05-17
Two new species of the deep-water spongicolid genus Spongiocaris Bruce & Baba, 1973, are described and illustrated from two localities in the Indo-West Pacific. Spongiocaris panglao n. sp. is described on the basis of material from the Bohol Sea, the Philippines, at depths of 220-731 m. Spongiocaris tuerkayi n. sp. is described on the basis of material from Atlantis Bank in the southwestern Indian Ocean at depths of 743-1053 m. Among eight known congeners, both new species appear close to S. semiteres Bruce & Baba, 1973, differing in the rostral length and armature, shape of the carapace, telsonal armature, development of the grooming apparatus of the first pereopod and shape of the third pereopod chela. An identification key to the species currently assigned to Spongiocaris is presented.
Directory of Open Access Journals (Sweden)
Aura Lucía Leal
1999-03-01
Full Text Available Se realizó un estudio para determinar los patrones de susceptibilidad a los antimicrobianos de los aislamientos de Streptococcus pneumoniae causante de enfermedad invasora diagnosticada en Colombia en niños menores de 5 años entre 1994 y 1996 y para establecer la distribución de los tipos capsulares de los aislamientos resistentes. Se analizaron 324 aislamientos recuperados durante la ejecución del Protocolo Nacional de Serotipificación de S. pneumoniae realizado en Santa Fe de Bogotá, Medellín y Cali, Colombia, entre julio de 1994 y marzo de 1996. Se observó que 119 de todos los aislamientos (36,7% presentaban susceptibilidad disminuida por lo menos a un antimicrobiano, que 39 (12% presentaban susceptibilidad disminuida a la penicilina y que de estos últimos aislamientos, 29 presentaban resistencia intermedia y 10 resistencia alta. Nueve aislamientos (2,8% presentaban resistencia a la ceftriaxona, 80 (24,7% a la combinación de trimetoprima y sulfametoxazol (TMS, 49 (15,1% al cloranfenicol y 31 (9,6% a la eritromicina. Se observó resistencia a dos antimicrobianos en 31 aislamientos (9,6% y multirresistencia en 22 (6,7%. Estos 22 aislamientos mostraron resistencia al TMS. Las asociaciones más frecuentes fueron penicilina, TMS y eritromicina en 5 casos; penicilina, cloranfenicol, TMS y eritromicina en 4; penicilina, ceftriaxona, cloranfenicol y TMS en 3; y penicilina, ceftriaxona, cloranfenicol, TMS y eritromicina en 3 casos. Los serotipos más frecuentes en los aislamientos resistentes a la penicilina fueron: 23F (53,8%, 14 (25,6%, 6B (7,7%, 9V (5,1%, 19F (5,1% y 34 (2,6%. Los serotipos más frecuentes en los aislamientos resistentes a antimicrobianos distintos de la penicilina fueron: 5 (37,5%, 23F (7,5%, 14 (18,8% y 6B (13,8%. Esta diferencia en la distribución de los serotipos fue estadísticamente significativa (P A study was done to determine the patterns of susceptibility to antimicrobial agents in isolates of Streptococcus
Directory of Open Access Journals (Sweden)
Zamanian Hassan
2016-03-01
Full Text Available The Baba Ali skarn deposit, situated 39 km to the northwest of Hamadan (Iran, is the result of a syenitic pluton that intruded and metamorphosed the diorite host rock. Rare earth element (REE values in the quartz syenite and diorite range between 35.4 and 560 ppm. Although the distribution pattern of REEs is more and less flat and smooth, light REEs (LREEs in general show higher concentrations than heavy REEs (HREEs in different lithounits. The skarn zone reveals the highest REE-enriched pattern, while the ore zone shows the maximum depletion pattern. A comparison of the concentration variations of LREEs (La–Nd, middle REEs (MREEs; Sm–Ho and HREEs (Er–Lu of the ore zone samples to the other zones elucidates two important points for the distribution of REEs: 1 the distribution patterns of LREEs and MREEs show a distinct depletion in the ore zone while representing a great enrichment in the skarn facies neighbouring the ore body border and decreasing towards the altered diorite host rock; 2 HREEs show the same pattern, but in the exoskarn do not reveal any distinct increase as observed for LREEs and MREEs. The ratio of La/Y in the Baba Ali skarn ranges from 0.37 to 2.89. The ore zone has the highest La/Y ratio. In this regard the skarn zones exhibit two distinctive portions: 1 one that has La/Y >1 beingadjacent to the ore body and; 2 another one with La/Y < 1 neighbouring altered diorite. Accordingly, the Baba Ali profile, from the quartz syenite to the middle part of the exoskarn, demonstrates chiefly alkaline conditions of formation, with a gradual change to acidic towards the altered diorite host rocks. Utilising three parameters, Ce/Ce*, Eu/Eu* and (Pr/Ybn, in different minerals implies that the hydrothermal fluids responsible for epidote and garnet were mostly of magmatic origin and for magnetite, actinolite and phlogopite these were of magmatic origin with low REE concentration or meteoric water involved.
Listeria monocytogenes en alimentos: ¿son todos los aislamientos igual de virulentos?
Directory of Open Access Journals (Sweden)
V. López
Full Text Available Listeria monocytogenes es un patógeno humano que se transmite a través de los alimentos y que causa infecciones graves, con una alta tasa de mortalidad. A pesar de la ubicuidad del microorganismo, la tasa real de la enfermedad es bastante baja y se asocia casi siempre a condiciones predisponentes. Tradicionalmente se consideraba que los aislamientos presentes en los alimentos y en el ambiente tenían la misma capacidad patogénica que los aislamientos de origen clínico. Pero el análisis de mutaciones en los genes de determinados factores de virulencia (internalina, hemolisina, fosfolipasas, proteína de superficie ActA y proteína reguladora PrfA, los estudios cuantitativos realizados con cultivos celulares y la genética de poblaciones, están replanteando la discusión sobre la variabilidad de la virulencia de L. monocytogenes. A pesar de todos estos avances, no existe un único marcador que permita comprobar la virulencia de los aislamientos naturales de esta especie. Probablemente en el futuro, la combinación de diferentes marcadores moleculares permitirá detectar los alimentos contaminados sólo por los clones virulentos de L. monocytogenes, con lo que se mejorará la prevención de la listeriosis humana transmitida por alimentos.
Directory of Open Access Journals (Sweden)
Carlos Padilla R
2003-07-01
Full Text Available Objetivos: Genotipificar los aislamientos de Bartonella bacilliformis a través de la amplificación de elementos repetitivos mediante el uso de ERIC-PCR y REP-PCR, y determinar si existe variabilidad genética entre aislamientos de varias zonas endémicas. Materiales y Métodos: Se evaluaron mediante el uso del ERIC-PCR y REP-PCR 17 aislamientos de B. bacilliformis de Lima, Cusco y Ancash. Los aislamientos fueron realizados durante los años 1998 y 1999. Para el análisis de los patrones de bandas se usó el software GelCompar 4,0. Resultados: Fueron identificados en los 17 aislamientos 10 genotipos. Los genotipos D, E y H fueron detectados en Cusco; mientras que los genotipos B, C, G, J e I en Lima; y el genotipo F en Ancash. Conclusiones: Nuestros resultados sugieren que REP-PCR y ERIC-PCR son métodos útiles para genotipificar aislamientos de B. bacilliformis. La variabilidad genética debe ser tomada en cuenta en estudios epidemiológicos y clínicos de Bartonelosis; así como el desarrollo de nuevas técnicas diagnósticas y de vacunas.
Directory of Open Access Journals (Sweden)
Mabel Karina Rodríguez
Full Text Available Objetivo: Analizar del 2002 al 2013 los datos de la vigilancia de los serotipos y sensibilidad antimicrobiana de los aislamientos invasivos de Haemophilus influenzae ( H. influenzae en niños menores de 60 meses. Materiales y métodos: Se analizaron los datos demográficos, fuente y enfermedad asociada de los aislamientos invasivos de H. influenzae recibidos entre 2002 y 2013. Todos los aislamientos habían sido confirmados bacteriológicamente, tenían el dato del serotipo, el cual fue determinado por el método de aglutinación en lámina y PCR y los patrones de sensibilidad antimicrobiana por concentración inhibitoria mínima a ampicilina, SXT, cloranfenicol, cefuroxima y ceftriaxona. El análisis se realizó por periodos de 3 años. Resultados: Por enfermedad invasiva el 50,5% eran de pacientes con meningitis, 23,5% de neumonías, 19,5% de sepsis y bacteriemia, 2,0% de otros y 4,5% sin dato. Por procedencia se recibieron de Bogotá y Antioquia 55 aislamientos de cada uno, de Risaralda 24, de Valle 15, de Santander 11 y 40 de 14 departamentos. El serotipo predominante fue el Hib (40,5%, seguido de HiNT (38,0%, Hia (17,5%, Hid (2,0%, Hif (1,5% y Hie (0,5%. Del total de los aislamientos, 12,0% eran resistentes a ampicilina; 16,5% a SXT; 1,0% a cloranfenicol y 0,5% a ceftriaxona. Todos los aislamientos fueron sensibles a cefuroxima y a rifampicina. Conclusiones: La vigilancia por el laboratorio es una vigilancia pasiva voluntaria pero, no obstante el número reducido de aislamientos, permite determinar que Hib continúa circulando en esta población y que hay otros serotipos de H. influenzae que causan enfermedad invasiva. Por tanto es necesario mantener y fortalecer la vigilancia de este patógeno.
Hidrólise parcial enzimática da gordura de babaçu
Directory of Open Access Journals (Sweden)
OLIVEIRA Andréa Lícia de Almeida
1999-01-01
Full Text Available Lipases são enzimas de origem animal, vegetal ou microbiana que catalisam a hidrólise total ou parcial de óleos e gorduras, fornecendo ácidos graxos livres, acilgliceróis parciais e glicerol. O trabalho teve como objetivo verificar a ação da lipase comercial FAP (Amano Pharmaceutical Co. no processo de hidrólise parcial da gordura de babaçu. Foi utilizada a Metodologia de Superfície de Resposta para representar o sistema na região estudada. O tratamento estatístico possibilitou analisar a influência das variáveis indepentes concentração de enzima (3 a 327U/mL e tempo de reação (1 a 31h na variável dependente: % de hidrólise. Os resultados experimentais observados nas reações, variaram de 6,52 a 41,44% de hidrólise da gordura de babaçu. Pela aplicação do modelo estatístico, os resultados estimados variaram de 13,57 a 43,80% de hidrólise. O nível de significância foi de 99% para o modelo % de hidrólise. Foi observado que 87,8% da variação da resposta pode ser explicada pela regressão múltipla, demostrando ser bom o ajustamento do modelo aos dados experimentais.
Directory of Open Access Journals (Sweden)
Clara Inés Agudelo
2006-06-01
Full Text Available Introducción. Streptococcus pneumoniae es una las principales causas de morbilidad y mortalidad en niños y adultos en el mundo. Objetivo. Realizar un análisis de los datos de la vigilancia por el laboratorio de los aislamientos invasores de S. pneumoniae recuperados entre 1994 y 2004. Materiales y métodos. Se empleó la información de los aislamientos invasores de S. pneumoniae recibidos en el Grupo de Microbiología del Instituto Nacional de Salud durante la vigilancia de meningitis bacteriana aguda e infección respiratoria aguda entre 1994 y 2004. Los aislamientos contaban con datos epidemiológicos, serotipo, patrones de susceptibilidad antimicrobiana y algunos con tipificación molecular. Resultados. Se analizaron los datos de 2.022 aislamientos procedentes de 120 hospitales de diferentes regiones del país, recuperados principalmente de hemocultivos (50,7% y líquido cefalorraquídeo (42%. Los serotipos más importantes fueron el 14, 6B, 23F, 1, 5, 6A, 19F, 18C y 9V, los cuales corresponden al 83,6% en niños menores de 6 años, al 74,0% en el grupo de 6 a 14 años y al 61,4% en mayores de 14 años. El 29,8% de los aislamientos presentó susceptibilidad disminuida a la penicilina (SDP, 44,3% a trimetoprim-sulfametoxazol, 32,4% a tetraciclina, 8,2% a cloranfenicol, 3,8% a eritromicina; todos fueron sensibles a vancomicina y el 13% fue multirresistente. Se tipificaron 602 aislamientos con SDP, de los cuales 27 (4,5% se relacionaron con el clon 1-España23F, 38 (6,3% con el clon 2-España6B, 301 (50% con el 3- España9V y 75 (12,5% con el clon 26-Colombia23F, además, los 138 aislamientos con tipo capsular 5 se relacionaron con el clon 19-Colombia5. Conclusiones. Los resultados proporcionan información básica necesaria para el diseño e implementación de estrategias para la prevención de la enfermedad neumocócica en nuestro país.
MethPrimer: designing primers for methylation PCRs.
Li, Long-Cheng; Dahiya, Rajvir
2002-11-01
DNA methylation is an epigenetic mechanism of gene regulation. Bisulfite- conversion-based PCR methods, such as bisulfite sequencing PCR (BSP) and methylation specific PCR (MSP), remain the most commonly used techniques for methylation mapping. Existing primer design programs developed for standard PCR cannot handle primer design for bisulfite-conversion-based PCRs due to changes in DNA sequence context caused by bisulfite treatment and many special constraints both on the primers and the region to be amplified for such experiments. Therefore, the present study was designed to develop a program for such applications. MethPrimer, based on Primer 3, is a program for designing PCR primers for methylation mapping. It first takes a DNA sequence as its input and searches the sequence for potential CpG islands. Primers are then picked around the predicted CpG islands or around regions specified by users. MethPrimer can design primers for BSP and MSP. Results of primer selection are delivered through a web browser in text and in graphic view.
Directory of Open Access Journals (Sweden)
D. Piedrahita
2005-01-01
Full Text Available La Rinotraqueitis Infecciosa Bovina (RIB es una enfermedad, altamente contagiosa, de distribución mundial, de origen viral, causada por el Herpesvirus Bovino-1 (BoHV-1. Produce alteraciones en el sistema respiratorio y reproductivo, lo que la convierte en una enfermedad con un gran impacto económico para los sistemas de producción ganadera. Este trabajo tuvo como objetivo caracterizar, mediante técnicas de biología molecular, tres aislamientos colombianos del BoHV-1 (dos de la sabana de Bogotá y uno de los Llanos Orientales. Los aislamientos fueron analizados con las enzimas de restricción Bam HI, Bst EII, Eco RI Pst I y Hind III. En este estudio también se implementó una rápida, sensitiva y específica prueba de PCR para la detección de tres glicoproteínas de superficie del Herpesvirus Bovino-1 (BoHV-1, cuyos fragmentos fueron secuenciados, lo que permitió encontrar homologías del 100% comparadas con los reportes del Gene Bank. Por medio del análisis con la enzima de restricción Hind III se clasificaron los aislamientos de la sabana de Bogotá como subtipo BoHV-1.2a y el de los Llanos Orientales como subtipo BoHV-1.1.
Directory of Open Access Journals (Sweden)
Vera V.
2005-11-01
Full Text Available La Rinotraqueitis Infecciosa Bovina (RIB es una enfermedad, altamente contagiosa, de distribución mundial, de origen viral, causada por el Herpesvirus Bovino-1 (BoHV-1. Produce alteraciones en el sistema respiratorio y reproductivo, lo que la convierte en una enfermedad con un gran impacto económico para los sistemas de producción ganadera. Este trabajo tuvo como objetivo caracterizar, mediante técnicas de biología molecular, tres aislamientos colombianos del BoHV-1 (dos de la sabana de Bogotá y uno de los Llanos Orientales. Los aislamientos fueron analizados con las enzimas de restricción Bam HI, Bst EII, Eco RI Pst I y Hind III. En este estudio también se implementó una rápida, sensitiva y específica prueba de PCR para la detección de tres glicoproteínas de superficie del Herpesvirus Bovino-1 (BoHV-1, cuyos fragmentos fueron secuenciados, lo que permitió encontrar homologías del 100% comparadas con los reportes del Gene Bank. Por medio del análisis con la enzima de restricción Hind III se clasificaron los aislamientos de la sabana de Bogotá como subtipo BoHV-1.2a y el de los Llanos Orientales como subtipo BoHV-1.1.
Directory of Open Access Journals (Sweden)
M. S. Ramírez
2010-06-01
Full Text Available Acinetobacter baumannii is considered an important pathogen in our hospital environment having a well-known capacity to acquire different mechanisms of antibiotic resistance. Previous studies in our laboratory had exposed the high dispersion of class 2 integrons in this species. In the present study, we analyzed 7 multiresistant intI2 positive A. baumannii isolates, 6 of which were found to harbour the Tn7::In2-8 element. Our results demonstrate the unusually high distribution of Tn7::In2-8 among different A. baumannii clones from Chile, suggesting a particular behavior of these elements at geographical level.Acinetobacter baumannii, patógeno de importancia clínica en el ámbito hospitalario, es reconocido como un microorganismo que posee la capacidad de evolucionar rápidamente hacia la multirresistencia. Estudios previos efectuados en nuestro laboratorio han demostrado la alta dispersión de los integrones de clase 2 en aislamientos de esta especie. En el presente trabajo se analizaron 7 aislamientos de Acinetobacter baumannii multirresistentes portadores de la integrasa de clase 2, 6 de los cuales portaban el inusual arreglo Tn7::In2-8. Nuestros resultados muestran una elevada frecuencia de dispersión del elemento Tn7::In2-8 en diferentes clones circulantes en Chile, lo que sugiere un comportamiento geográfico particular.
Directory of Open Access Journals (Sweden)
Ana Luz Galván
2008-09-01
Full Text Available Introducción. Los microsporidios son agentes de infecciones oportunistas en pacientes con sida y con trasplantes, principalmente. Enterocytozoon bieneusi y Encephalitozoon intestinalis son los más frecuentes, asociados con infecciones entéricas. Los cultivos celulares han contribuido al conocimiento de los microsporidios. En Colombia no se han obtenido aislamientos provenientes de pacientes con microsporidiosis y, por consiguiente, no existen cepas autóctonas de los mismos. Objetivo. Establecer el cultivo celular de microsporidios intestinales a partir de materia fecal de pacientes parasitados. Materiales y métodos. Se realizó concentración agua-éter de la materia fecal positiva para microsporidios y el sedimento resultante se trató con una mezcla de antibióticos y antimicóticos durante 18 horas a 37 oC. Se inocularon células Vero previamente cultivadas en placas de 24 pozos y en medio RPMI con suplemento de suero bovino fetal al 10% y antibióticos, con las esporas concentradas. Los cultivos se mantuvieron a 37 oC al 5% de CO2. Se cambió de medio cada dos días y se evaluó la presencia de esporas en los sobrenadantes mediante Gram-cromótropo rápido en caliente. Resultados. En la segunda semana después de la infección, se encontraron esporas de microsporidios con morfología y coloración características. Mediante PCR se determinó que el microsporidio encontrado correspondía a la especie E. intestinalis. Conclusión. Se estableció el cultivo in vitro de microsporidios de materia fecal. Este protocolo es importante para la obtención y el mantenimiento de cepas autóctonas en Colombia, y contribuirá a las investigaciones de aspectos bioquímicos, inmunológicos y epidemiológicos de dichas cepas.
Medium Caliber Lead-Free Electric Primer. Version 2
2012-09-01
2008). Safe Drinking Water Act of 1986 lists lead compounds as carcinogens (27 CCR 27001 – Dec. 2008). EPA began a Phase I assessment to determine...primer cups was our standard method, wet loading using solvents (hexane and iso -propanol) was investigated to reduce risk of accidental ignition...LOADING OPERATION (Single Die) Wet primer mix charge with solvent (Hexane/ Iso -Propanol) and stir to mix to a uniform slurry Insert primer cup in
Una revisión del fenómeno de aislamiento magnético
Directory of Open Access Journals (Sweden)
Zósimo Arévalo Velosa
2007-09-01
Full Text Available Los dispositivos de alta energía son diseñados para que funcionen con campos eléctricos y magnéticos extrema-damente altos. Debido a esto, dichos dispositivos presentan fenómenos y comportamientos no lineales, como el aislamiento magnético que altera el transporte de los electrones. La no linealidad ha obligado a analizar y revisar desde el punto de vista matemático las condiciones de frontera y las soluciones del problema. El objetivo de este trabajo es exponer el tema a un nivel que facilite su difusión entre la comunidad académica no familiarizada con el mismo. Para ello, el trabajo presenta una descripción de los fenómenos que se generan cuando hay campos eléctricos y magnéticos muy altos, tomando el caso de un diodo plano al vacío, así como las ecuaciones que modelan el fenómeno de aislamiento magnético; también demuestra la existencia de las soluciones y encuentra las positivas en base a los métodos de solución superior e inferior para problemas de valor de frontera, y pro-porciona algunos ejemplos de aplicación del fenómeno de aislamiento magnético.
Directory of Open Access Journals (Sweden)
Neutra, Richard J.
1961-11-01
Full Text Available Con los nuevos tipos estructurales y con los adelantos de las ciencias biológicas en lo que se refiere a los procesos orgánicos, mis ideas sobre aislamiento, y las de casi todos los demás arquitectos y constructores, han sufrido una evolución interesantísima en los últimos veinticinco años. Y me complace subrayar que los que, como yo, estudiamos el decorado humano, podemos hacer mucho en beneficio de nuestros clientes. No hace aún mucho tiempo toda la protección de una casa contra el peligro de transferencia térmica se confiaba exclusivamente a muros y cubiertas no aislantes. Los propietarios se limitaban a culpar al tiempo de su falta de confort. Pero esta falta de comodidad en cuanto a calefacción no era la única consecuencia; tras ella aparecían daños de efectos duraderos y patológicos.
Directory of Open Access Journals (Sweden)
Nadia Guadalupe Sánchez-Coello
2012-01-01
Full Text Available La mayoría de las cícadas contienen altas concentraciones de aceites esenciales, flavonoides, polifenoles y polisacáridos que interfieren en la extracción de ADN, causando productos de amplificación errados o inhibiendo la PCR. La optimización del aislamiento del ADN y el empleo de iniciadores de secuencias intergénicas repetidas simples (ISSRs se investigaron en Ceratozamia mexicana Brongn., una cícada mexicana en peligro de extinción. El ADN obtenido de tejido foliar fresco, con un amortiguador modificado de cetil trimetil amonio, nos permitió obtener un ADN de buena calidad, sin pigmentos coloridos o contaminantes. La modificación al protocolo de extracción de ADN, basado en CTAB, fue un prelavado por 1 h, del tejido foliar, con una solución de 0.7 M de NaCl, para facilitar la lisis celular. El ADN extraído exitosamente se amplificó por PCR, usando seis iniciadores arbitrarios ISSR. Se observaron productos de amplificación reproducibles en todas las reacciones de PCR. Nuestros resultados muestran que la implementación mejora significativamente la calidad del ADN obtenido, usando una concentración baja de iniciadores (25 pM. Se detectaron 23 bandas fuertes, nueve de las cuales fueron polimórficas. Los resultados indican que el protocolo de optimización del aislamiento del ADN y en el sistema de PCR es viable para futuros trabajos en esta especie. Este trabajo es el primer protocolo de extracción de ADN y de ISSR reportado para esta especie ornamental en peligro de extinción.
Polyacid macromolecule primers
Sugama, Toshifumi.
1989-12-26
Hydrophilic polyacids are described, such as macromolecules of polyitaconic acid and polyacrylic acid, where such macromolecules have molecular weights >50,000 as primers between a polymeric top coating, such as polyurethane, and an oxidized aluminum or aluminum alloy. A near monolayer of primer is used in polymeric adhesive/oxidized aluminum adhered joint systems in 0.05% primer concentration to give superior results in standard peel tests. 2 figs.
Kim, Dong-Ho; Choi, June Young; Kim, Byoung-Gook; Hwang, Jin-Young; Park, Seong-Joo; Oh, Ah-Young; Jeon, Young-Tae; Ryu, Jung-Hee
2016-12-01
Robotic or endoscopic thyroidectomy using bilateral axillo-breast approach (BABA) is frequently performed for excellent cosmesis. However, postoperative pain is remained as concerns due to the extent tissue dissection and tension during the operation. Ketamine is a noncompetitive N-methyl-D-aspartate (NMDA) receptor antagonist that reduces acute postoperative pain. We evaluated the effects of intraoperative ketamine infusion on postoperative pain control and recovery profiles following BABA robotic or endoscopic thyroidectomy. Fifty-eight adult patients scheduled for BABA robotic or endoscopic thyroidectomy were randomized into a control group (n = 29) and ketamine group (n = 29). Following induction of anesthesia, patients in each group were infused with the same volume of saline or ketamine solution (1 mg/kg bolus, 60 μg/kg/h continuous infusion). Total intravenous anesthesia with propofol and remifentanil was used to induce and maintain anesthesia. Pain scores (101-point numerical rating scale, 0 = no pain, 100 = the worst imaginable pain), the consumption of rescue analgesics, and other postoperative adverse effects were assessed at 1, 6, 24, and 48 hours postoperatively. Patients in the ketamine group reported lower pain scores than those in the control group at 6 hours (30 [30] vs 50 [30]; P = 0.017), 24 hours (20 [10] vs 30 [20]; P ketamine infusion during anesthesia resulted in lower postoperative pain scores following BABA robotic or endoscopic thyroidectomy, with no increase in adverse events.
Directory of Open Access Journals (Sweden)
Ortiz Rojas Luz Yineth
2012-03-01
Full Text Available
El análisis molecular del cistron, (ue codica para la proteina de la cubierta del virus del mosaico de la caña de azúcar (SCMV reportado en la base de datos del banco de genes (GenBank, reveló la pre- sencia de 65 nucleotidos adicionales (ue codican para (uince aminoãcidos, en la region amino de la secuencia de la proteina de la cubierta del aislamiento mexicano identicado con el nümero de acceso GU474635. El análisis BLAST indicó que esta característica particular también está presente en el aislamiento DDDF6F, reportado en 1FF1 en Estados Unidos. El anãlisis logenHtico de 1I5 secuen- cias de la proteína de la cubierta de SCMV reportadas de Asia, África, Brasil y Argentina, entro otros, sugiere diJerentes origenes logeogrãcos de los aislamientos mexicanos. El aislamiento mexicano GU6N6OP5 es filogeneticamente mãs cercano a aislamientos de QCWV de Brasil X de EE.UU., mien- tras que secuencias de la proteína de la cubierta del virus SCMV reportadas en China y Alemania son
logenHticamente mãs cercanas al aislamiento mexicano EUDF1DN5. Las caracteristicas particulares que comparten aislamientos virales de tres países del continente americano, a saber, EE.UU., México X Brasil, sugieren un baYo control tosanitario en el intercambio de material vegetal.Directory of Open Access Journals (Sweden)
Giovanni Chaves-Bedoya
2012-01-01
Full Text Available El análisis molecular del cistrón, que codifica para la proteína de la cubierta del virus del mosaico de la caña de azúcar (SCMV reportado en la base de datos del banco de genes (GenBank, reveló la presencia de 45 nucleótidos adicionales que codifican para quince aminoácidos, en la región amino de la secuencia de la proteína de la cubierta del aislamiento mexicano identificado con el número de acceso GU474635. El análisis BLAST indicó que esta característica particular también está presente en el aislamiento D00949, reportado en 1991 en Estados Unidos. El análisis filogenético de 185 secuencias de la proteína de la cubierta de SCMV reportadas de Asia, áfrica, Brasil y Argentina, entro otros, sugiere diferentes orígenes filogeográficos de los aislamientos mexicanos. El aislamiento mexicano GU474635 es filogenéticamente más cercano a aislamientos de SCMV de Brasil y de EE.UU., mientras que secuencias de la proteína de la cubierta del virus SCMV reportadas en China y Alemania son filogenéticamente más cercanas al aislamiento mexicano EU091075. Las características particulares que comparten aislamientos virales de tres países del continente americano, a saber, EE.UU., México y Brasil, sugieren un bajo control fitosanitario en el intercambio de material vegetal.
Directory of Open Access Journals (Sweden)
Gilda Toraño
2012-12-01
Full Text Available Con el objetivo de caracterizar los aislamientos de Haemophilus influenzae, responsables de enfermedades invasivas en Cuba, en la etapa posterior a la vacunación se estudió el total de los recuperados durante el período 2008-2011, remitidos al Instituto "Pedro Kourí" desde diferentes provincias del país. La confirmación de especie y determinación de serotipos se realizó atendiendo al requerimiento de los factores V y X y empleando el método de aglutinación en lámina, respectivamente. Se definieron los biotipos a través de las pruebas de indol, urea y ornitina; se determinó la concentración mínima inhibitoria (CMI mediante la prueba del elipsómetro para la ampicilina, la ceftriaxona, el cloranfenicol y la rifampicina. Para 23 aislamientos se corroboró la identificación como H. influenzae : 21 fueron serotipables y 2 no tipables (HNT. El 90,4% de los serotipables fueron serotipo b y se detectaron dos serotipos a. Nueve aislamientos de H. influenzae b pertenecieron al biotipo I y los aislamientos, serotipo a y HNT, al biotipo II. En una cepa se demostró producción de la enzima ß-lactamasa y resistencia para la ampicilina y el cloranfenicol, con valores de CMI= 8 y 12 µg/mL, respectivamente. Se puso en evidencia que a pesar de la disminución de la incidencia de la enfermedad invasiva por Hib, este serotipo aún constituye el más frecuente y se alerta sobre la necesidad de una vigilancia sostenida que permita detectar fallos vacunales. La susceptibilidad antimicrobiana demostrada para este período pudiera considerarse como un beneficio adicional de la introducción de la vacunación en Cuba.
Claudia Rocío Sierra Parada; Édgar Alberto Sánchez Morales; Sandra Consuelo Henao Riveros; Alfredo Saavedra Rodríguez
2008-01-01
Antecedentes. La aparición de aislamientos de Mycobacterium tuberculosis resistentes a los medicamentos ha hecho que se busquen métodos más rápidos y confiables para la determinación de la susceptibilidad a las drogas antituberculosas. Objetivo. Determinación de la susceptibilidad a drogas antituberculosas de primera línea en aislamientos de M. tuberculosis utilizando el método del tubo indicador de crecimiento micobacteriano (MGIT). Material y métodos. Se estudiaron 49 aislamientos de...
DEFF Research Database (Denmark)
Devert, Anthony; Fabre, Nicolas; Floris, Maina Huguette Joséphine
2015-01-01
) targeted by RNA silencing. The dsRNA is subsequently cleaved by the ribonuclease DICER-like into secondary small interfering RNAs (siRNAs) that reinforce and/or maintain the silenced state of the target RNA. Models of RNA silencing propose that RDRs could use primer-independent and primer......Cellular RNA-dependent RNA polymerases (RDRs) are fundamental components of RNA silencing in plants and many other eukaryotes. In Arabidopsis thaliana genetic studies have demonstrated that RDR2 and RDR6 are involved in the synthesis of double stranded RNA (dsRNA) from single stranded RNA (ssRNA......-dependent initiation to generate dsRNA from a transcript targeted by primary siRNA or microRNA (miRNA). However, the biochemical activities of RDR proteins are still partly understood. Here, we obtained active recombinant RDR2 and RDR6 in a purified form. We demonstrate that RDR2 and RDR6 have primer...
Directory of Open Access Journals (Sweden)
D. Libkind
2007-09-01
Full Text Available La identificación rápida de levaduras de origen ambiental o clínico es de importancia para el estudio de la biodiversidad de estos microorganismos y para la detección de posibles patógenos. Rhodotorula mucilaginosa es una levadura ubicua y pigmentada, capaz de producir infecciones en pacientes inmunocomprometidos. En este trabajo se evaluó la utilidad de la técnica de fingerprinting conocida como MSP-PCR (Micro/Minisatellite-Primed PCR en la caracterización e identificación de aislamientos ambientales de R. mucilaginosa provenientes de la Patagonia noroccidental. Sobre la base de sus caracteres fenotípicos, de un total de 200 levaduras pigmentadas se seleccionaron 110 aislamientos que presuntamente corresponderían a la especie R. mucilaginosa. Se evaluaron los iniciadores (GTG5, (GAC5 y M13 en aislamientos representativos, y se seleccionó el iniciador (GTG5 por ser el que permitió una mejor agrupación de los aislamientos pertenecientes a R. mucilaginosa y una mejor diferenciación de éstos con los de especies filogenéticamente próximas. Utilizando dicho iniciador, el 87% de los aislamientos de R. mucilaginosa presentó un perfil de MSP-PCR similar (> 60% al de la cepa de referencia CBS 316T de R. mucilaginosa. La técnica de MSP-PCR resultó efectiva, tanto para caracterizar e identificar un número elevado de aislamientos ambientales de R. mucilaginosa como para detectar polimorfismos en la especie.The rapid identification of environmental or clinical yeast isolates is important for biodiversity studies and the detection of probable pathogens. Rhodotorula mucilaginosa is a ubiquitous and pigmented yeast capable of infecting immunocompromised patients. In this study, we evaluated the Micro/mini satellite-primed PCR (MSP-PCR fingerprinting method for the characterization and identification of R. mucilaginosa isolates from natural environments in northwestern Patagonia. There were selected 110 putative R. mucilaginosa isolates
Directory of Open Access Journals (Sweden)
María A Jure
2015-06-01
Full Text Available Escherichia coli O157 es un patógeno emergente asociado a diarrea, colitis hemorrágica y síndrome urémico hemolítico. Los productos cárnicos constituyen una importante fuente de contaminación con este microorganismo. Los objetivos de este estudio fueron establecer la frecuencia de detección de E. coli O157 en productos cárnicos y media res en la provincia de Tucumán, caracterizar los factores de virulencia de los aislamientos obtenidos, establecer la relación clonal entre cepas regionales mediante electroforesis de campo pulsado y comparar con lo consignado en la base de datos nacional. Desde 2004 hasta 2013 se analizaron 169 muestras de carne picada, 35 embutidos y 216 esponjados de media res. Se identificaron 13 aislamientos de E. coli O157; 6 de ellos fueron O157:H7 productores de toxina Shiga y se caracterizaron como stx2c(vh-a/eae/ehxA (n = 5 y stx2/eae/ehxA (n = 1; los 7 aislamientos de E. coli O157 no toxigénicos fueron O157:NT(n = 4,O157:NM (n = 1,O157:ND (n = 1 y O157:H16 (n = 1. Los patrones de PFGE fueron diferentes entre sí y de los registrados en la base de datos nacional. Se concluye que existe gran diversidad genética en los aislamientos de E. coli O157 circulantes en nuestra región.
Directory of Open Access Journals (Sweden)
Marcia Barquero Quirós
2013-01-01
Full Text Available La antracnosis es una enfermedad causada por varias especies del género Colletotrichum en diferentes hospederos. C. acutatum y C. gloeosporioides son especies morfológicamente similares, que pueden causar síntomas similares en el mismo hospedero. Se colectaron 220 aislamientos de Colletotrichum de muestras con síntomas típicos de antracnosis en helecho hoja de cuero (Rumohra adiantiformis, limón criollo (Citrus aurantifolia, carambola (Averrhoa carambola, papaya (Carica papaya y mango (Mangifera indica en Costa Rica y Florida, Estados Unidos. Los aislamientos se caracterizaron por morfología de colonia, sensibilidad al benomil, y PCR con los iniciadores específicos para C. acutatum y C. gloeosporioides CaInt2 y Cg/fInt1, respectivamente; también se analizó la morfología de las colonias de ambas especies. De los 85 aislamientos obtenidos de mango, todos los aislamientos de Florida fueron identificados como C. acutatum, mientras que todos los aislamientos de Costa Rica fueron C. gloeosporioides. De los 60 aislamientos de carambola, 3 provenientes de Costa Rica fueron C. acutatum (primer informe y el resto fueron C. gloeosporioides. Todos los aislamientos de helecho hoja de cuero (25 aislamientos y de limón criollo (25 aislamientos se identificaron como C. acutatum. Los demás aislamientos de carambola y mango así como todos los aislamientos de papaya, se identificaron como C. gloeosporioides. No se encontró diferenciación de síntomas entre ambas especies sobre los hospederos donde se encontraron.
Directory of Open Access Journals (Sweden)
Valencia Jenny
1999-12-01
Full Text Available
EI hongo Sclerotinia sclerotiorum ocasiona perdidas apreciables en diversos cultivos de flores y hortalizas. La investigación consistió en evaluar la capacidad antagónica de algunos aislamientos de Trichoderma sp. Y Gliocladium sp. Sobre Sclerotinia sclerotiorum, tanto in vitro, como en plantas de crisantemo. Los mejores antagonistas del patógeno in vitro fueron los aislamientos G-8B y G-98 de Gliocladium sp. y los aislamientos T-2IB y T-34B de Trichoderma sp. Los dos aislamientos de Gliocladium sp. Formaron un halo de inhibición alrededor de la colonia del patógeno, mientras que los aislamientos de Trichoderma sp. Produjeron esporulación abundante sobre las colonias del patógeno. Los mejores tratamientos en el control de la enfermedad en plantas de crisantemo fueron los aislamientos T-2IB y T-34B de Trichoderma sp. y el aislamiento G-8B de Gliocladium sp., con un menor índice y una menor severidad de la enfermedad. La metodología de evaluación in vitro utilizada en la investigación fue confiable, ya que los resultados encontrados en el laboratorio fueron bastante similares a los obtenidos en el ensayo de invernadero. Además, los aislamientos de Trichoderma y de Gliocladium utilizados ocasionaron un estimulo apreciable en el crecimiento de las plantas y un adelanto en la floración.
Directory of Open Access Journals (Sweden)
Diego Fernando Marmolejo
2008-10-01
Full Text Available Se colectaron picudos de Cosmopolites y Metamasius en municipios del Valle del Cauca, Caldas y Quindío. Se obtuvieron cultivos monospóricos con diluciones de 10-10 y 10-11. Los aislamientos fueron almacenados a -80°C con glicerol al 10% y el ADN a -20°C. Los marcadores moleculares RAM generaron 82 fragmentos de los cuales 67% fueron polimórficos con una heterocigocidad de 0.24, que indica diversidad media a alta. A un índice de similitud 0.84 se formaron 5 grupos: uno con 11 aislamientos y 4 con un solo aislamiento. En el gran grupo se detectó un duplicado y se encontró diversidad del hongo en los sitios muestreados. No se encontró relación entre aislamientos sobre Cosmopolites y Metamasius o zona geográfica en la formación de grupos genéticos.
Aislamiento rápido del virus dengue 3 por el método de shell vial en el brote de dengue en Lima
Directory of Open Access Journals (Sweden)
Victoria Gutiérrez P
2005-07-01
Full Text Available El aislamiento de virus dengue con los métodos tradicionales demora hasta un mes, en situaciones de emergencia como el brote de dengue clásico en el distrito de Comas-Lima entre abril y mayo de 2005, es necesario un diagnóstico precoz. Se procesaron 117 muestras de sueros de pacientes con diagnóstico clínico de dengue clásico en fase virémica procedentes la zona del brote, mediante el método de shell vial para el aislamiento del virus dengue en la línea celular C6-36, se identificó el serotipo del virus mediante inmunofluorescencia indirecta (IFI empleando anticuerpos monoclonales. Se logró el aislamiento del virus DEN-3 al quinto día de cosecha en el 48,7% (57/117 de los sueros. Los resultados sugieren que el método de shell vial, por el menor tiempo de aislamiento que el método tradicional, puede ser implementado como método de diagnóstico y usado en la vigilancia epidemiológica del virus dengue.
Gutiérrez, Carolina; de Bedout, Catalina; Tobón, Angela María; Cano, Luz Elena; Arango, Myrtha; Tabares, Angela María; Restrepo, Angela
2007-01-01
Se determinó la sensibilidad al fluconazol y al voriconazol de aislamientos de Candida spp. obtenidos de la mucosa oral de 54 pacientes con sida hospitalizados en la ESE Hospital La María (Medellín, Colombia). Además, se comprobó la especie de tales aislamientos. Los pacientes eran todos adultos (promedio de 40,5 años, rango de 23 a 56) y la mayoría (77,8%) hombres. En 40 (71,1%) de ellos se obtuvo crecimiento de Candida spp. y en 6 (11,1%) se aisló más de una especie de Candida. La clasifica...
Sierra Parada, Claudia Rocío; Sánchez Morales, Édgar Alberto; Henao Riveros, Sandra Consuelo; Saavedra Rodríguez, Alfredo
2010-01-01
Antecedentes. La aparición de aislamientos de Mycobacterium tuberculosis resistentes a los medicamentos ha hecho que se busquen métodos más rápidos y confiables para la determinación de la susceptibilidad a las drogas antituberculosas. Objetivo. Determinación de la susceptibilidad a drogas antituberculosas de primera línea en aislamientos de M. tuberculosis utilizando el método del tubo indicador de crecimiento micobacteriano (MGIT). Material y métodos. Se estudiaron 49 aislamientos...
Directory of Open Access Journals (Sweden)
Diana Pachón C.
2011-05-01
Full Text Available Objetivo. Determinar la presencia de microorganismos del género Salmonella sp. en el ambiente acuático de los ejemplares Crocodylus intermedius y testudines en la Estación de Biología Tropical Roberto Franco (EBTRF. Materiales y métodos. En este estudio se utilizó la metodología estándar para aislar e identificar microorganismos del género Salmonella sp., a partir de muestras de agua y sedimento de 52 estanques (nEstanques Crocodylus=25; nEstanques testudines=27; se procedió a serotipificar los aislamientos por el método convencional de Kaufmann-White y se realizaron pruebas de sensibilidad a antimicrobianos por la técnica de Kirby Bauer. Resultados. Se determinó la presencia de Salmonella sp., en un 33% del total de estanques muestreados. El 29% de los aislamientos de Salmonella sp. serotipificados, correspondió al serogrupo B; los serogrupos C, C1, C2 y D1 presentaron menores porcentajes. Con las pruebas de sensibilidad a antimicrobianos se determinó que el 100% de los aislamientos fueron sensibles a norfloxacina. Conclusiones. La ocurrencia de Salmonella sp., en los estanques de la EBTRF fue del 33%, con la mayor presencia del serogrupo B, donde se encuentran especies con características ampliamente zoonóticas. Con los resultados obtenidos es necesario el seguimiento de las normas de bioseguridad establecidas en la estación para el manejo de las poblaciones allí mantenidas y evitar de esa manera la ocurrencia de cuadros zoonóticos.
AUTHOR|(SzGeCERN)780240
2015-01-01
In the context of exploring further collaboration between Senegal and CERN, His Excellency Mr. Mame Baba Cisse, Ambassador Extraordinary and Plenipotentiary of Senegal to the United Nations Office at Geneva, visited CERN. Mrs. Fama Diagne Sene, visiting scientist from Université Alioune Diop De Bambey, is currently at CERN where she works within the Scientific Information Service on a photo-digitization project.
Directory of Open Access Journals (Sweden)
Márcio Ulisses de Lima Rufino
2008-12-01
Full Text Available O Nordeste do Brasil abriga 80 espécies de palmeiras nativas, com baixo endemismo (27,5%, algumas delas ameaçadas pelas alterações destrutivas do habitat natural, associadas à exploração desordenada. Investigou-se do ponto de vista etnobotânico a importância do ouricuri (Syagrus coronata e do babaçu (Orbignya phalerata em uma comunidade estabelecida junto ao Parque Nacional Vale do Catimbau, município de Buíque, Pernambuco. A importância atribuída pelo povo local para essas espécies foi analisada sob os seguintes aspectos: número de usos, número de informantes que faziam uso de seus produtos diretos ou indiretos; grau de consenso entre os informantes referentes aos usos relatados. Os dados foram obtidos através de entrevistas semi-estruturadas (60 informantes e de índices baseados em técnicas de consenso do informante. Foram citadas sete categorias de uso: alimento do homem; alimento de animais domésticos; alimento de animais silvestres; construção; artesanato; combustível; medicinal. Apesar da diversidade de usos (Sc = 33; Oph = 25, a importância das duas espécies está relacionada predominantemente ao aproveitamento da amêndoa, como mostram os índices de valor para frutos (Sc = 0,48; Oph = 0,56. Analisando a contribuição de cada espécie para o uso total, o ouricuri apresentou maior valor (8,58 em relação ao babaçu (6,31. Sinais de um processo de erosão do conhecimento foram observados, com vários usos apontados como não mais praticados na comunidade, particularmente os associados ao artesanato.The palm tree flora of Brazilian Northeast includes 80 native species, with a low level of endemism (27.5%, some of them threatened by the destructive alterations of the natural habitat, associated to disordered exploration. This study investigated the importance of the ouricuri (Syagrus coronata and the babaçu (Orbignya phalerata in a community established near the Catimbau Valley National Park, Buíque municipality
Primer3_masker: integrating masking of template sequence with primer design software.
Kõressaar, Triinu; Lepamets, Maarja; Kaplinski, Lauris; Raime, Kairi; Andreson, Reidar; Remm, Maido
2018-06-01
Designing PCR primers for amplifying regions of eukaryotic genomes is a complicated task because the genomes contain a large number of repeat sequences and other regions unsuitable for amplification by PCR. We have developed a novel k-mer based masking method that uses a statistical model to detect and mask failure-prone regions on the DNA template prior to primer design. We implemented the software as a standalone software primer3_masker and integrated it into the primer design program Primer3. The standalone version of primer3_masker is implemented in C. The source code is freely available at https://github.com/bioinfo-ut/primer3_masker/ (standalone version for Linux and macOS) and at https://github.com/primer3-org/primer3/ (integrated version). Primer3 web application that allows masking sequences of 196 animal and plant genomes is available at http://primer3.ut.ee/. maido.remm@ut.ee. Supplementary data are available at Bioinformatics online.
Directory of Open Access Journals (Sweden)
P. M. Bermúdez
2016-01-01
Full Text Available La diseminación de Salmonella spp. resistente a antimicrobianos en las cadenas productivas de alimentos de origen animal es una preocupación de salud pública de carácter mundial. Este estudio describe los patrones de resistencia antimicrobiana de 283 aislamientos de Salmonella enterica procedentes de plantas de beneficio porcino en Colombia. Se evaluó la susceptibilidad antimicrobiana frente a diez antimicrobianos mediante el método de difusión en disco: amoxacilina-ácido clavulánico (30 ug, ampicilina (10 ug, ceftiofur (30 ug, ciprofloxacina (5 ug, cloranfenicol (30 ug, florfenicol (30 ug, gentamicina (10 ug, sulfadiazina/trimetroprim (25 ug, tetraciclina (30 ug y tilmicosina (15 ug. Los resultados evidenciaron la presencia de 279 aislamientos multirresistentes de Salmonella enterica de origen porcino provenientes del ambiente y del producto terminado en las plantas de beneficio evaluadas (46,64% n: 132. Se detectaron 52 patrones de multiresistencia: el más común fue ceftiofur-tetraciclina-tilmicosina en el 9,89% (n: 28 de los aislamientos. Con referencia a estos antimicrobianos, 96,82% (n: 274 de los aislamientos fueron resistentes a tetraciclina, 73,14% (n: 207 a tilmicosina y 28,27% (n: 80 a ceftiofur. De especial interés fue la alta proporción de aislamientos resistentes a ceftiofur, debido a una posible resistencia cruzada con ceftriaxona. Los resultados obtenidos demuestran la necesidad de promover el diseño e implementación de un Programa oficial Integrado de Vigilancia de la Resistencia Antimicrobiana, además de sistemas de monitoreo voluntario en cada eslabón de la cadena productiva porcina, para contribuir a la prevención y control de la transmisión de microorganismos resistentes de origen alimentario en el marco del sistema de gestión de inocuidad alimentaria en Colombia.
Medidas de aislamiento en enfermedades transmisibles dentro del ámbito hospitalario
Villanueva Rábano, Raúl
2016-01-01
En el ámbito hospitalario, son un problema frecuente las infecciones nosocomiales, causadas por las enfermedades transmisibles que pasan de unos pacientes a otros. Estas infecciones son potencialmente prevenibles, a través de medidas de aislamiento llevadas a cabo por el personal sanitario y no sanitario encargado de atender al paciente. En este aspecto, el papel del personal de enfermería es de fundamental importancia dado que mantienen un estrecho contacto con el paciente como cuidadores pr...
Directory of Open Access Journals (Sweden)
Pacios Álvarez, Antonia
2007-06-01
Full Text Available The house prototype of the Provisional Emergency House System uses wood and its derivatives for the facades, floor structure, roofing and partitions. The extensive use of wooden panels for the construction and the lack of data, in Spain, about their acoustic behavior bring up the necessity to make in situ measurements of the acoustic isolation to airborne sound. Panels used for facades and partitions are built with a wooden framework and membrane of oriented strand board in both sides, for the facades, and of laminated plaster boards for the inner partitions. With the objective of verifying the sound insulation of the facades according to Spanish Standard UNE EN ISO 140-5, in situ measurements of airborne sound insulation of facade elements and facades have been made; according to Spanish Standard UNE EN ISO 140-4, in situ measurements of airborne sound insulation between rooms for internal walls have also been made. The procedure of the global insulation has been followed to measure the acoustic insulation of complete facades without making distinction between the elements that form it.El prototipo de vivienda del Sistema de Vivienda Provisional de Emergencia utiliza principalmente la madera y sus derivados tanto en los cerramientos y particiones como en el forjado y la cubierta. El empleo de soluciones constructivas ligeras y la falta de datos en España acerca del comportamiento acústico de los mismos plantea la necesidad de realizar mediciones in situ del aislamiento acústico a ruido aéreo. El panel base de cerramiento y particiones se construye partiendo de un entramado de montantes de madera con membrana en ambas caras de tableros de virutas de madera orientadas, para el caso de los cerramientos exteriores, y de tableros laminados de yeso para las particiones interiores. Con el objeto de comprobar el aislamiento acústico de dichos cerramiento se han realizado ensayos siguiendo la Norma UNE EN ISO 140-5 para la medición in situ del
Quiñones Pérez, Dianelys; Carmona Cartaya, Yenisel; Zayas Illas, Arnaldo; Abreu Capote, Miriam; Salazar Rodriguez, Daniel; García Giro, Sandra; Torres Tamayo, Dalia; Kobayashi, Nobumichi; Valverde de Francisco, Aránzazu; del Campo Moreno, Rosa
2014-01-01
Introducción: el género Klebsiella causa brotes hospitalarios, por cepas multidrogorresistentes en diferentes continentes y conlleva a un aumento en la morbimortalidad. Objetivos: identificar las especies de Klebsiella causantes de infecciones en hospitales cubanos, determinar la procedencia de los aislamientos según el servicio, y la susceptibilidad antimicrobiana, conocer la prevalencia de aislamientos productores de ß-lactamasas de espectro extendido (BLEE), y tipos, así como la susceptibi...
Directory of Open Access Journals (Sweden)
Cluadia Milena Medina
2009-09-01
Full Text Available La filósfera es un ecosistema complejo que a pesar de contar con un gran número de microorganismos asociados, presenta pocos estudios diseñados para entender las características eco-fisiológicas de los microorganismos que lo habitan. Las levaduras, como elemento importante de este hábitat, están expuestas a un ambiente variable afectado por la planta hospedera, edad y posición de la hoja, disponibilidad y calidad de nutrientes, temperatura, pH, radiación y actividad del agua. Estos factores producen una presión de selección para el establecimiento de poblaciones naturales o introducidas de levaduras que puedan desplazar otras poblaciones de hongos fitopatógenos. En este estudio se obtuvieron 80 aislamientos de levaduras filosféricas de dos cultivos de mora (Rubus glaucus, a las que se les determinó su nicho potencial en términos de su capacidad para crecer a diferentes condiciones de temperatura, pH, estrés osmótico y tolerancia a radiación UV. El estrés osmótico fue la condición evaluada más restrictiva para las levaduras obtenidas, ya que únicamente seis aislamientos presentaron un crecimiento superior a 0.3 unidades de DO a 405nm, cuando fueron crecidas a 50% y 60% de glucosa. Este estudio permitió seleccionar diez aislamientos filosféricos de levaduras, destacados por su capacidad para crecer en un amplio rango de condiciones. De estos, cuatro aislamientos LvF 34, LvF 43, LvF 44 y LvF 50 se destacaron por su capacidad de antagonismo contra el hongo fitopatogeno Botritys cinérea. Su determinación taxonómica permitió reportar por primera vez las especies Candida kunwinensis y Rhodotorula colostri con potencial biocontrolador.
Mananga, Eugene S; Reid, Alicia E; Charpentier, Thibault
2012-02-01
This article describes the use of an alternative expansion scheme called Floquet-Magnus expansion (FME) to study the dynamics of spin system in solid-state NMR. The main tool used to describe the effect of time-dependent interactions in NMR is the average Hamiltonian theory (AHT). However, some NMR experiments, such as sample rotation and pulse crafting, seem to be more conveniently described using the Floquet theory (FT). Here, we present the first report highlighting the basics of the Floquet-Magnus expansion (FME) scheme and hint at its application on recoupling sequences that excite more efficiently double-quantum coherences, namely BABA and C7 radiofrequency pulse sequences. The use of Λ(n)(t) functions available only in the FME scheme, allows the comparison of the efficiency of BABA and C7 sequences. Copyright © 2011 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Antônio Robson Bezerra Xenofonte
2008-11-01
Full Text Available Com o objetivo de avaliar o desempenho, o consumo voluntário e a digestibilidade dos nutrientes, foram utilizados 24 ovinos sem raça definida (SRD, machos não-castrados, com peso inicial de 20 ± 3,25 kg e 4,6 ± 0,8 meses de idade. Os animais foram mantidos em confinamento e alimentados com dietas com farelo de babaçu (0, 10, 20 e 30% em substituição ao feno de capim-colonião. As dietas, isoprotéicas e isoenergéticas, foram fornecidas em forma de ração completa. Utilizou-se um delineamento em blocos casualizados, com quatro tratamentos e seis repetições. O consumo de matéria seca foi influenciado pela inclusão do farelo de babaçu na dieta e apresentou redução de 302 g/dia a cada 10% de participação de farelo de babaçu. A ingestão dos nutrientes e o desempenho foram restringidos pela diminuição do consumo de matéria seca. A inclusão do farelo de babaçu reduziu linearmente o ganho de peso dos animais. A digestibilidade dos nutrientes foi influenciada pelos níveis de farelo de babaçu, mas esse aumento está associado às reduções na ingestão de matéria seca. O farelo de babaçu, ao ser utilizado como alternativa de alimento para cordeiros em crescimento, compromete o consumo de alimentos e o ganho de peso dos animais.With the objective to evaluate the performance, voluntary intake and nutrient digestibilities, 24 NDB (no defined breed, non castrated male lambs with 20 ± 3.25 BW initial and 4.6 ± 0.8 months old were used. Animals were kept in feedlot and fed diets with babassu meal (0, 10, 20 and 30% in substitution to Panicum maximum Jack hay. The diets, isoprotein and isonitrogenous, were fed in a complete mix ration. A completely blocks randomized design, with four treatments and six replicates was used. The dry matter intake was influenced by the inclusion of babassu meal in the diet and presented a reduction of 302 g/day for each 10% of babassu meal inclusion. Nutrient intake and performance were limited by
Caracterización fenotípica de aislamientos ambientales de Cryptococcus neoformans.
Directory of Open Access Journals (Sweden)
Sandra Huérfano
2003-09-01
Full Text Available La criptococosis es causada por las tres variedades de Cryptococcus neoformans, las cuales presentan diferencias fisiológicas y de virulencia, algunas de las cuales se han estudiado para reconocer aspectos de su biología. Este trabajo evaluó las características fenotípicas de aislamientos ambientales de las variedades grubii y gattii, con el fin de establecer diferencias asociadas con el ciclo de vida y la virulencia. Se estudiaron 28 aislamientos serotipo A y 31 serotipo C. Se evaluaron la morfología macroscópica y microscópica de blastoconidias cultivadas en agar Sabouraud y suelos, el crecimiento a 37 °C, la producción de 22 enzimas extracelulares, la frecuencia del fenómeno de fructificación haploide, la pareja sexual, el patrón de sensibilidad a toxinas asesinas (killer y la virulencia en ratones Balb/c. No se observaron diferencias entre las dos variedades en la morfología macroscópica, la microscópica, ni en el crecimiento a 37 °C (p>0,05; sin embargo, se observó disminución del tamaño celular y capsular de blastoconidias cultivadas en suelo comparado con el tamaño en Sabouraud (p
Directory of Open Access Journals (Sweden)
Manuel Medell
2014-04-01
Full Text Available Introducción. Actualmente se considera a Enterococcus spp. como uno de los agentes de infección hospitalaria más importantes, siendo su resistencia a los antibióticos un problema importante en los centros de salud. Objetivos. Caracterizar la resistencia antimicrobiana en 50 cepas de Enterococcus spp. aisladas de muestras clínicas de pacientes hospitalizados. Materiales y métodos. Se llevó a cabo un estudio de tipo descriptivo observacional de corte transversal en 50 aislamientos clínicos de estas especies microbianas. Se trabajó un aislamiento por paciente. La identificación y la sensibilidad a los antibióticos se realizaron por métodos automatizados y convencionales. El análisis fenotípico de los mecanismos de resistencia a glucopéptidos se hizo según las recomendaciones de la Sociedad Española de Enfermedades Infecciosas y Microbiología Clínica. Resultados. De 50 aislamientos, 30 (60,0 % y 20 (40,0 % pertenecían a las especies de Enterococcus faecalis y Enterococcus faecium, respectivamente. La resistencia global expresada por este género fue de 38/50 (76,0 % para ampicilina; 33/50 (66,0 % para gentamicina de alto nivel; 34/50 (68,0 % para estreptomicina de alto nivel; 26/50 (52,0 % para ciprofloxacina; 4/50 (8,0 % para linezolid; 17/50 (34,0 % para teicoplanina; 25/50 (50,0 % para vancomicina; 31/50 (62,0 % para minociclina; 34/50 (68,0 % para tetraciclina y 9/50 (18,0 % para nitrofurantoina. Frente a los glucopéptidos, 25/50 (50,0 % y 10/50 (20,0 % de los aislamientos presentaron los mecanismos Van A y Van B, respectivamente. Conclusiones. Podemos concluir que la mayoría de las veces, las cepas aisladas en el Hospital Hermanos Ameijeiras mostraron porcentajes de resistencia por encima de lo reportado en la literatura científica consultada. El alto porcentaje de cepas con resistencia a la vancomicina podría influir en la aparición de otros gérmenes Gram positivos con resistencia a este fármaco. Se reporta por
ESCUELAS-ISLA: UN AISLAMIENTO INSTITUCIONAL
Directory of Open Access Journals (Sweden)
Claudio Vergara Reyes
2012-01-01
Full Text Available Este trabajo trata acerca de un tipo de escuela en la realidad educativa chilena, denominada "escuela-isla", caracterizada por su aislamiento institucional del entorno social, económico, político, religioso y cultural. El concepto nace de una serie de reflexiones bajo el marco formativo de las prácticas pedagógicas tempranas, a partir de un conjunto de experiencias que configuran al centro de enseñanza y que resultan clave para la comprensión de la naturaleza del término. El documento hace una caracterización de este tipo de escuela, reconociendo cualidades que no son propias de una institución social. Asimismo, se propone y justifica la necesidad de un tipo de "alianza simbiótica" entre la organización educativa y el resto de organizaciones de la comunidad (red de enlace para complementar y potenciar su función educativa (formativa. Por último, se destaca la importancia de la interacción de la escuela con otras instituciones de la sociedad, y que tales vínculos constituyen una estrategia educativa para el desarrollo social y comunitario.
Directory of Open Access Journals (Sweden)
Natali Moreno
2010-12-01
Full Text Available Debido a las dificultadas asociadas con la identificación serológica de aislamientos de Leptospira ssp, se genera gran interés en la pruebas moleculares por su poder discriminatorio, reproducibilidad y fácil interpretación. Objetivo. Aplicar y validar la prueba de PCR convencional, usando dos pares de iniciadores descritos previamente y dirigidos a los genes lipL32 (PCR simple y secY/flaB (PCR múltiple, con el fin de evaluar su aplicación para identificar especies patógenas y saprófitas de Leptospira spp. Materiales y métodos. Para la estandarización de las pruebas de PCR se usó 22 cepas de referencia internacional y 12 aislamientos colombianos. Se determinó el nivel de detección de cada pareja de iniciadores, su especificidad frente a otros microorganismos causantes de enfermedades endémicas en Colombia y su capacidad de identificar especies dentro del grupo de Leptospira. Resultados. El límite de detección de la PCR simple lipL32 fue una dilución 1:10000 y para la PCR múltiple secY/flaB fue una dilución 1:100 para el gen secY y 1:1000 para flaB. La especificidad de todos los iniciadores fue de 100%. La PCR simple lipL32, mostró amplificado específico para 21/22 cepas de referencia mientras que la PCR multiple secY/flaB lo fue para 18/22 cepas. De los 12 aislamientos colombianos, siete fueron positivos por PCR lipL32 y seis lo fueron por PCR secY/flaB. Conclusiones. Los resultados más consistentes fueron obtenidos con la PCR simple lipL32 tanto en límite de detección, especificidad y utilidad para la identificación de Leptospira spp, por lo que esta prueba es aplicable a la identificación molecular de aislamientos patógenos de Leptospira spp de diversas fuentes.Serological identification of Leptospira ssp isolates is difficult to achieve. Thus, molecular testing may be of great interest thanks to its high discrimination power, reproducibility and easy interpretation. Objective. To implement and validate conventional
Directory of Open Access Journals (Sweden)
Marcos Odilon Dias Rodrigues
2016-08-01
Full Text Available Objetivou-se com esse trabalho avaliar as características agronômicas, estruturais e massa de raiz do Panicum maximum cv. Mombaça em diferentes condições de pastejo dentro do mesmo pasto em sistema de monocultivo e integrado pastagem-floresta (consorciado com palmeiras de babaçu. Foram realizadas avaliações nos meses de dezembro de 2012 a fevereiro de 2013. Os sistemas foram mantidos sob pastejo contínuo com ovinos (média de 20 kg de peso vivo durante todo período de avaliação. O delineamento foi inteiramente ao acaso em parcelas subdivididas, sendo: parcelas os sistemas e subparcelas as alturas de pastejo, com 3 ciclos de coleta. A presença da palmeira do babaçu influenciou a produtividade de massa seca da parte aérea em sistema consorciado devido a diminuição no perfilhamento da gramínea ocasionado pelo estresse do sombreamento. A produção de massa seca de raiz decresceu sendo influenciada pelo sombreamento e pela intensidade de pastejo nas alturas avaliadas, ocorrendo diminuição à medida que decresceu a altura da gramínea. O sistema de monocultivo teve melhores resultados para as mesmas alturas em todos os parâmetros avaliados em comparação com o sistema consorciado, onde número de perfilhos, produção de matéria seca (MS da parte aérea, índice de área folear (IAF, % de MS foram maiores em sistema de monocultivo independente das alturas avaliadas. O sombreamento natural das palmeiras de babaçu influenciou negativamente as características produtivas e estruturais do Panicum maximum cv. Mombaça, alterando dessa forma a arquitetura da gramínea e diminuindo sua capacidade produtiva.
Directory of Open Access Journals (Sweden)
E. A. Manfredi
2010-09-01
Full Text Available La presencia de Staphylococcus aureus en los alimentos representa un riesgo potencial para la salud pública; sus enterotoxinas son el principal factor de virulencia. La detección de las enterotoxinas de S. aureus puede realizarse por ELISA, aunque sólo es posible detectar el pool de enterotoxinas SEA, SEB, SEC, SED y SEE. Los objetivos del presente trabajo fueron optimizar dos técnicas de PCR múltiple para la detección de los genes sea, seb, sec, sed y see de S. aureus y caracterizar un conjunto de 115 aislamientos de Staphylococcus spp. asociados a intoxicaciones alimentarias provenientes de diferentes provincias de Argentina. La caracterización se realizó por pruebas bioquímicas, ELISA y PCR. Sesenta y ocho aislamientos (59,1% fueron positivos por ELISA, mientras que 61 (53% fueron positivos por PCR. De los aislamientos positivos por PCR, 34 (55,7% portaron el gen sea, 9 (14,8% el gen seb, 5 (8,1% el gen see, 4 (6,5% el gen sec, 6 (9,9% los genes sea y seb, 2 (3,3% los genes sea y sec, y 1 (1,7% los genes sea y sed. Este es el primer estudio de caracterización genotípica de aislamientos de S. aureus asociados con brotes de intoxicación alimentaria registrados en distintas provincias argentinas.The presence of Staphylococcus aureus in food represents a potential risk to public health, being its enterotoxins the major virulence factor. Enterotoxin detection can be determined by ELISA, but only for the pool of enterotoxins SEA, SEB, SEC, SED and SEE. The main aims of this study were to optimize two PCR techniques for detection of S. aureus sea, seb, sec, sed and see, and to characterize Staphylococcus spp. isolates associated with food intoxication. Two PCR techniques were optimized and 115 Staphylococcus spp. isolates from Ciudad Autónoma de Buenos Aires, and Buenos Aires, Córdoba, and Neuquén provinces were characterized. The characterization was performed by biochemical tests, ELISA and PCR. Sixty-eight isolates (59.1% were
UniPrimer: A Web-Based Primer Design Tool for Comparative Analyses of Primate Genomes
Directory of Open Access Journals (Sweden)
Nomin Batnyam
2012-01-01
Full Text Available Whole genome sequences of various primates have been released due to advanced DNA-sequencing technology. A combination of computational data mining and the polymerase chain reaction (PCR assay to validate the data is an excellent method for conducting comparative genomics. Thus, designing primers for PCR is an essential procedure for a comparative analysis of primate genomes. Here, we developed and introduced UniPrimer for use in those studies. UniPrimer is a web-based tool that designs PCR- and DNA-sequencing primers. It compares the sequences from six different primates (human, chimpanzee, gorilla, orangutan, gibbon, and rhesus macaque and designs primers on the conserved region across species. UniPrimer is linked to RepeatMasker, Primer3Plus, and OligoCalc softwares to produce primers with high accuracy and UCSC In-Silico PCR to confirm whether the designed primers work. To test the performance of UniPrimer, we designed primers on sample sequences using UniPrimer and manually designed primers for the same sequences. The comparison of the two processes showed that UniPrimer was more effective than manual work in terms of saving time and reducing errors.
Javier Antonio Escobar; Ingrid Tatiana Gómez; Martha Johanna Murillo; Betsy Esperanza Castro; Bibiana Chavarro; Ricaurte Alejandro Márquez; Natasha Vanegas
2012-01-01
Introducción. Los aislamientos de Staphylococcus aureus resistente a la meticilina asociado a la comunidad (SARM-AC), están aumentando la frecuencia de infecciones en personas sanas de la comunidad y en pacientes hospitalizados. En Colombia y en la región andina estos aislamientos tienen un componente genético relacionado con el clon pandémico USA300. Objetivo. Diseñar y estandarizar dos metodologías para la diferenciación rápida de aislamientos colombianos de S. aureus resistente a la me...
Aislamiento en pacientes psiquiátricos Seclusion of psychiatric patients
Directory of Open Access Journals (Sweden)
Franklin Escobar Córdoba
2009-01-01
Full Text Available El objetivo del presente artículo es aportar pautas para la evaluación y tratamiento de pacientes agresivos mediante el uso del aislamiento. A esos efectos, se realizó una revisión narrativa de la literatura, basada en la búsqueda mediante la combinación de las palabras "seclusion" y/o "patient seclusion" y/o "Restraint, Physical" y/o "Mentally Ill Persons", en las bases de datos MEDLINE, Ovid, SciELO, HINARI, LILACS, IMBIOMED y Latindex. Se seleccionaron 12 de 8.418 artículos de mayor relevancia para su aplicación en nuestro medio, teniendo como límites de la búsqueda revisiones, metanálisis, estudios controlados aleatorizados y estudios clínicos, adultos, ambos géneros, humanos, idioma inglés y español, de los años 2002 a 2007. Se halló un conocimiento amplio en el tratamiento del paciente agresivo. Las indicaciones del aislamiento no difieren con respecto a las de restricción, siendo importantes los riesgos de hetero o autoagresividad y de daño al entorno físico. Las contraindicaciones y consideraciones éticas, médicas y legales son claras y se deben implementar para una adecuada práctica clínica. El uso adecuado del aislamiento por parte del personal de salud debe formar parte de un plan terapéutico adecuado y tener en cuenta las recomendaciones para su uso en el contexto local.The objective of the present study is to contribute rules for the evaluation and treatment of an aggressive patient by means of seclusion. We searched the literature in the MEDLINE, Ovid, SciELO, HINARI, LILACS, IMBIOMED and Latindex databases, using the combination of the following words: "seclusion" and/or "patient seclusion" and/or "restraint, physical" and/or "mentally ill persons". Twelve out of 8,418 articles were selected for their application in Colombia according to the following limits of the search: clinical trial, meta-analysis, randomized controlled trial, review of the literature, adults, both genders, published between 2002 and
High-speed measurement of firearm primer blast waves
Courtney, Michael; Daviscourt, Joshua; Eng, Jonathan; Courtney, Amy
2012-01-01
This article describes a method and results for direct high-speed measurements of firearm primer blast waves employing a high-speed pressure transducer located at the muzzle to record the blast pressure wave produced by primer ignition. Key findings are: 1) Most of the lead styphnate based primer models tested show 5.2-11.3% standard deviation in the magnitudes of their peak pressure. 2) In contrast, lead-free diazodinitrophenol (DDNP) based primers had standard deviations of the peak blast p...
Primers-4-Yeast: a comprehensive web tool for planning primers for Saccharomyces cerevisiae.
Yofe, Ido; Schuldiner, Maya
2014-02-01
The budding yeast Saccharomyces cerevisiae is a key model organism of functional genomics, due to its ease and speed of genetic manipulations. In fact, in this yeast, the requirement for homologous sequences for recombination purposes is so small that 40 base pairs (bp) are sufficient. Hence, an enormous variety of genetic manipulations can be performed by simply planning primers with the correct homology, using a defined set of transformation plasmids. Although designing primers for yeast transformations and for the verification of their correct insertion is a common task in all yeast laboratories, primer planning is usually done manually and a tool that would enable easy, automated primer planning for the yeast research community is still lacking. Here we introduce Primers-4-Yeast, a web tool that allows primers to be designed in batches for S. cerevisiae gene-targeting transformations, and for the validation of correct insertions. This novel tool enables fast, automated, accurate primer planning for large sets of genes, introduces consistency in primer planning and is therefore suggested to serve as a standard in yeast research. Primers-4-Yeast is available at: http://www.weizmann.ac.il/Primers-4-Yeast Copyright © 2013 John Wiley & Sons, Ltd.
Directory of Open Access Journals (Sweden)
Simón Pedro Izcara Palacios
2009-01-01
Full Text Available Los jornaleros inmigrantes constituyen uno de los grupos sociales más pobres de las comarcas agrarias de Estados Unidos y España. Los trabajadores agrarios migratorios viven en áreas remotas y sufren de malnutrición, salarios bajos, alta movilidad laboral, condiciones laborales precarias y ambientes laborales inadecuados. Por una parte, el sector agrario, que constituye un refugio laboral para los trabajadores ilegales, opera fuera del mercado laboral formal; por otra parte, los jornaleros padecen un grave problema de "aislamiento social", esto ha sido señalado como una de las principales causas de falta de bienestar de éstos. El artículo analiza, de modo comparativo, la situación de irregularidad laboral y aislamiento social de los jornaleros tamaulipecos empleados en la agricultura estadounidense y los trabajadores marroquíes empleados en el sector agrario andaluz.
Directory of Open Access Journals (Sweden)
Muñoz Flórez Jaime Eduardo
2008-09-01
Full Text Available Se colectaron picudos de Cosmopolites y Metamasius en municipios del Valle del Cauca, Caldas y Quindío. Se obtuvieron cultivos monospóricos con diluciones de 10-10 y 10-11. Los aislamientos fueron almacenados a -80°C con glicerol al 10% y el ADN a –20°C. Los marcadores moleculares RAM generaron 82 fragmentos de los cuales 67% fueron polimórficos con una heterocigocidad de 0.24, que indica diversidad media a alta. A un índice de similitud 0.84 se formaron 5 grupos: uno con 11 aislamientos y 4 con un solo aislamiento. En el gran grupo se detectó un duplicado y se encontró diversidad del hongo en los sitios muestreados. No se encontró relación entre aislamientos sobre Cosmopolites y Metamasius o zona geográfica en la formación de grupos genéticos.
Reservoir operation using El Niño forecasts-case study of Daule Peripa and Baba, Ecuador
DEFF Research Database (Denmark)
Gelati, Emiliano; Madsen, Henrik; Rosbjerg, Dan
2014-01-01
Reservoir operation is studied for the Daule Peripa and Baba system in Ecuador, where El Niño events cause anomalously heavy precipitation. Reservoir inflow is modelled by a Markov-switching model using El Niño-Southern Oscillation (ENSO) indices as input. Inflow is forecast using 9-month lead time...... Reservoir. Optimized operation is compared to historical management of Daule Peripa. Hypothetical management scenarios are used as the benchmark for the planned system, for which no operation policy is known. Upper bounds for operational performance are found via dynamic programming by assuming perfect...... knowledge of future inflow. The results highlight the advantages of combining inflow forecasts and storage targets in reservoir operation. © 2014 © 2014 IAHS Press....
Hume, Benjamin C.C.; Ziegler, Maren; Poulain, Julie; Pochon, Xavier; Romac, Sarah; Boissin, Emilie; de Vargas, Colomban; Planes, Serge; Wincker, Patrick; Voolstra, Christian R.
2018-01-01
The Internal Transcribed Spacer 2 (ITS2) rRNA gene is a commonly targeted genetic marker to assess diversity of Symbiodinium, a dinoflagellate genus of algal endosymbionts that is pervasively associated with marine invertebrates, and notably reef-building corals. Here we tested three commonly used ITS2 primer pairs (SYM_VAR_5.8S2/SYM_VAR_REV, ITSintfor2/ITSReverse, and ITS-DINO/ITS2Rev2) with regard to amplification specificity and sensitivity towards Symbiodinium, as well as sub-genera taxonomic bias. We tested these primers over a range of sample types including three coral species, coral surrounding water, reef surface water, and open ocean water to assess their suitability for use in large-scale next generation sequencing projects and to develop a standardised PCR protocol. We found the SYM_VAR_5.8S2/SYM_VAR_REV primers to perform superior to the other tested ITS2 primers. We therefore used this primer pair to develop a standardised PCR protocol. To do this, we tested the effect of PCR-to-PCR variation, annealing temperature, cycle number, and different polymerase systems on the PCR efficacy. The Symbiodinium ITS2 PCR protocol developed here delivers improved specificity and sensitivity towards Symbiodinium with apparent minimal sub-genera taxonomic bias across all sample types. In particular, the protocol’s ability to amplify Symbiodinium from a range of environmental sources will facilitate the study of Symbiodinium populations across biomes.
Hume, Benjamin C.C.
2018-05-23
The Internal Transcribed Spacer 2 (ITS2) rRNA gene is a commonly targeted genetic marker to assess diversity of Symbiodinium, a dinoflagellate genus of algal endosymbionts that is pervasively associated with marine invertebrates, and notably reef-building corals. Here we tested three commonly used ITS2 primer pairs (SYM_VAR_5.8S2/SYM_VAR_REV, ITSintfor2/ITSReverse, and ITS-DINO/ITS2Rev2) with regard to amplification specificity and sensitivity towards Symbiodinium, as well as sub-genera taxonomic bias. We tested these primers over a range of sample types including three coral species, coral surrounding water, reef surface water, and open ocean water to assess their suitability for use in large-scale next generation sequencing projects and to develop a standardised PCR protocol. We found the SYM_VAR_5.8S2/SYM_VAR_REV primers to perform superior to the other tested ITS2 primers. We therefore used this primer pair to develop a standardised PCR protocol. To do this, we tested the effect of PCR-to-PCR variation, annealing temperature, cycle number, and different polymerase systems on the PCR efficacy. The Symbiodinium ITS2 PCR protocol developed here delivers improved specificity and sensitivity towards Symbiodinium with apparent minimal sub-genera taxonomic bias across all sample types. In particular, the protocol’s ability to amplify Symbiodinium from a range of environmental sources will facilitate the study of Symbiodinium populations across biomes.
Directory of Open Access Journals (Sweden)
E. Beatrice Hervé, Dra.
2014-05-01
Resultados: En los años estudiados la tasa de positividad para MOMR osciló entre 16,4% y 9,8%. La distribución por MOMR, para el conjunto de los años en estudio, fue la siguiente: SAMR un 20–25%; ERV, entre 35 y 49% y; B Gram negativos un 38–60%. Por otro lado, la sensibilidad del sistema de vigilancia evaluada durante el primer semestre de 2010 fue de un 91% para aislamiento y de un 93% para los cultivos. En base a los resultados obtenidos durante primer semestre de 2011 de características de pacientes colonizados, se estableció el 2012 un algoritmo que considera: centro de origen, edad, tiempo de permanencia en centro de origen y unidad de destino, para definir la necesidad de dejar o no a un paciente trasladado con medidas de aislamiento. Esto permite realizar una acción más racional y costo-efectiva para el control de MOMR en nuestro establecimiento, reduciendo la carga de aislamientos y cultivos en un 20%.
Directory of Open Access Journals (Sweden)
Narda María Olarte
2010-09-01
Conclusiones. El 7,2% de los pacientes que ingresaron a la unidad de cuidados intensivos estaban colonizados con SARM. Éste es el primer reporte de colonización por aislamientos de SARM-ST8-SCCmec IVc adquirido en la comunidad y relacionado genéticamente con el clon pandémico USA300-0114 en Colombia.
Hexavalent Chromium IV-Free Primer Development
Alldredge, Michael J.; Buck, Amy L.
2015-01-01
Primer materials provide corrosion protection for metal parts as well as an increased adhesion between metallic substrates and thermal protection systems (TPSs). Current primers for use in cryogenic applications contain hexavalent chromium. This hexavalent chromium provides excellent corrosion protection even in a cryogenic environment, but it is a carcinogen that requires special equipment and waste control procedures to use. The hazardous nature of hexavalent chromium makes it an obsolescence risk in the future. This study included two phases of evaluation. Thirteen primers were initially identified as candidates and twelve of those primers were tested in phase 1. Four of the best performing candidates from phase 1 continued into phase 2 testing. Phase 1 testing consisted mostly of liquid constituent and physical property testing. Cryoflex and salt fog testing were included in phase 1 because of their importance to the overall success of a candidate material. Phase 2 consisted of physical, thermal, and mechanical properties for nominally processed and fabricated specimens.
Directory of Open Access Journals (Sweden)
Fabiana A Moredo
2012-06-01
Full Text Available El objetivo del trabajo fue caracterizar mediante PCR 47 aislamientos de Escheríchia coli recuperados de 32 cerdos con diagnóstico clínico de diarrea posdestete (DPD y de 3 cerdos con enfermedad de los edemas (ED. Sobre 44 aislamientos provenientes de cerdos con DPD, 42 (95,5 % fueron caracterizados como E. coli enterotoxigénicos (ETEC y 2 (4,5 % como E. coli productores de toxina Shiga (STEC. Catorce aislamientos de ETEC (33,3 % fueron positivos para los genes estl/estlI/fedA. El genotipo más complejo fue eltA/estll/east1/faeG/aidA. Los aislamientos provenientes de cerdos con ED se clasificaron como STEC porcinos y fueron portadores de stxJaidA. Once aislamientos (25 % fueron portadores del gen que codifica la expresión de la adhesina AIDA-I. Sin embargo, en ningún aislamiento se detectaron los genes que codifican la expresión de las adhesinas F5, F6, F41, de intimina y de "Paa". La prevención de la DPD y de la ED podría realizarse mediante el desarrollo de vacunas que generen anticuerpos contra las adhesinas de las cepas de E. coli prevalentes en la Argentina.The purpose of this work was to characterize 47 Escherichia coli strains isolated from 32 pigs diagnosed with postweaning diarrhea and tree pigs with edema disease by PCR. Forty two (95.5 % of the strains isolated from diarrheic pigs were characterized as enterotoxigenic E. coli (ETEC and 2 (4.5 % as Shiga toxin-producing E. coli (STEC. Fourteen (33.3 % ETEC strains were positive for est/estll/fedA genes. The most complex genotype was eltA/estl/faeG/aidA. Strains isolated from pigs with ED were classified as porcine STEC and were stxjaidA carriers. Eleven (25 % strains carried the gene encoding adhesln protein AIDA-I. However, genes coding for F5, F6, F41, intimin and Paa were not detected. The development of vaccines generating antibodies against prevalent E. coli adhesins in Argentina could be useful for the prevention of PWD and ED.
Directory of Open Access Journals (Sweden)
Jorge Enrique Villamil
2014-06-01
Full Text Available Se evaluó la eficacia de hongos entomopatógenos nativos en el biocontrol de Tecia solanivora (Lepidoptera: Gelechiidae in vitro. Los aislamientos fueron obtenidos de larvas y adultos de gusano blanco Premmotrypes vorax, barrenador del curubo Aepytus sp, picudo de la palma Rinchophorus palmarum, broca del café Hypothenemus hampei, polilla guatemalteca Tecia solanivora y palomilla de la papa Phthorimaea operculella infectados, de los municipios de Ventaquemada, Umbita, Coper (Boyacá y San gil (Santander. El trabajo se realizó en el laboratorio de control biológico del Grupo Manejo Biológico de Cultivos en Tunja, Colombia. Se seleccionaron in vitro, de forma preliminar cinco de los siete aislamientos de hongos obtenidos: Bv01, Bv03, Bv04, Bv05 y Bv07, los cuales ocasionaron mortalidades superiores al 10%. De acuerdo con la caracterización morfológica realizada, los hongos encontrados pertenecen al género Beauveria. La evaluación de su eficacia se realizó con 10 larvas de T. solanivora desinfectadas y sumergidas en suspensión de 1x107esporas.mL-1, las cuales se observaron durante 32 días, registrando cada 8 días la mortalidad. Se empleó un diseño completamente al azar, con 6 tratamientos, 4 repeticiones y una prueba de separación de medias de Tukey. Los resultados mostraron que 32 días después de la inoculación los aislamientos Bv03 y Bv05 fueron los que produjeron la mayor mortalidad acumulada (7,4 y 8,5%, respectivamente. Se confirma el bajo potencial de los hongos entomopatógenos nativos para el control de larvas de T. solanivora.
Directory of Open Access Journals (Sweden)
RANJIT SINGH GHUMAN
2013-12-01
Full Text Available The paper highlights a case study of a rural girls college located in a remote village of Gurdaspur district in Indian Punjab. The idea of this unique college was conceptualised by one Baba Aya Singh, a social and religious activist, from a village near the college way back in 1925. It was really a revolutionary idea because female education in India, particularly higher education, was a distant dream at that time. The college was, however, started with only 14 rural girls after about half-a-century when the great visionary Baba Aya Singh had a dream to educate the rural girls. Access to and affordability of higher education is the uniqueness of this college. The student has to pay only Rs. 5800 (about US $ 65 per annum, which includes both the tuition fee and boarding and lodging. It is equally significant to note that the entire expenses of the college are met by this and the produce of agricultural land of the college. The college does not take any outside help. The meritorious senior class students teach the junior class students. The college in its own humble, but significant, way made a revolutionary contribution to the education of poor rural girls who, otherwise, would not have dreamt of college education. Apart from, class-room teaching and bookish knowledge, the students are taught social, ethical and management skills in a most natural manner. The product of the college has proved to be the agents of change and rural transformation.
Directory of Open Access Journals (Sweden)
Maritza Alvarez
1991-06-01
Full Text Available En el presente estudio se comparó la técnica de inmunoperoxidasa para la detección de citomegalovirus (IPCMV utilizando anticuerpos monoclonales que reconocen proteínas precoces virales con el método convencional de aislamiento viral en fibroblastos humanos. Un total de 150 muestras de orina fueron examinadas encontrando una sensibilidad de un 89.8% y una especificidad de 91.3% de la técnica de IPCMV comparada con el aislamiento viral. Una de las ventajas que presentó la IPCMV fue la rapidez con que fueron obtenidos los resultados (48 horas mientras que el aislamiento viral fue como promedio 14 días.An Immunoperoxidase assay was applied to detect early antigens of Cytomegalovirus (CMV in 150 urine samples from immunocompromised patients, using the commercial available monoclonal antibody against CMV El3. The detection of early antigen by IP (IPCMV is compared to the conventional cell culture isolation regarding specificity and sensitivity in order to evaluate is usefulness in the diagnostic of CMV infections. The IPCMV showed a sensitivity of 89.8% and a specificity of 91.3% when compared to the isolation method. The great advantage of the IPCMV is based on the shorter time results are achieved, since 48-72 Hs can be enough to provide evidence of CMV infection, while in the isolation technique cytopatho-genic effect was present around 14 days after sample inoculation.
Directory of Open Access Journals (Sweden)
Dunn Sade N
2008-06-01
Full Text Available Abstract Background Quantitative Real Time RT-PCR (q2(RTPCR is a maturing technique which gives researchers the ability to quantify and compare very small amounts of nucleic acids. Primer design and optimization is an essential yet time consuming aspect of using q2(RTPCR. In this paper we describe the design and empirical optimization of primers to amplify and quantify plastid RNAs from Zea mays that are robust enough to use with other closely related species. Results Primers were designed and successfully optimized for 57 of the 104 reported genes in the maize plastome plus two nuclear genes. All 59 primer pairs produced single amplicons after end-point reverse transcriptase polymerase chain reactions (RT-PCR as visualized on agarose gels and subsequently verified by q2(RTPCR. Primer pairs were divided into several categories based on the optimization requirements or the uniqueness of the target gene. An in silico test suggested the majority of the primer sets should work with other members of the Poaceae family. An in vitro test of the primer set on two unsequenced species (Panicum virgatum and Miscanthus sinensis supported this assumption by successfully producing single amplicons for each primer pair. Conclusion Due to the highly conserved chloroplast genome in plant families it is possible to utilize primer pairs designed against one genomic sequence to detect the presence and abundance of plastid genes or transcripts from genomes that have yet to be sequenced. Analysis of steady state transcription of vital system genes is a necessary requirement to comprehensively elucidate gene expression in any organism. The primer pairs reported in this paper were designed for q2(RTPCR of maize chloroplast genes but should be useful for other members of the Poaceae family. Both in silico and in vitro data are presented to support this assumption.
PHUSER (Primer Help for USER): a novel tool for USER fusion primer design
DEFF Research Database (Denmark)
Olsen, Lars Rønn; Hansen, Niels Bjørn; Bonde, Mads
2011-01-01
containing a customizable USER cassette. Designing primers using PHUSER ensures that the primers have similar annealing temperature (Tm), which is essential for efficient PCR. PHUSER also avoids identical overhangs, thereby ensuring correct order of assembly of DNA fragments. All possible primers...
Directory of Open Access Journals (Sweden)
Sheu Shew-Meei
2012-05-01
Full Text Available Abstract Background Intragenomic recombination between babA and babB mediates antigenic variations and may help H. pylori colonization. This study determined whether variable genotypes of babA and babB correlate to different clinical disease outcomes, and can distribute over the different gastric niches. Results This study enrolled 92 clinical strains (45 from peptic ulcer, 27 from gastritis, and 20 from gastric cancer to detect whether the babA and babB are at locus A or B by PCR reactions using the primers designed from the upstream and variable region of the babA and babB genes. Four genotypes of babA and babB (A B, AB B, A AB, AB AB were found. The distribution of the 4 genotypes in 92 clinical strains was significantly different among patients with different gastric diseases (p vs. 9.7%, p p p > 0.05. Besides, the study enrolled 19 patients to verify whether variable genotypes of babAB existed in the different gastric niches. Among the patients infected with more than one babAB genotypes over antrum and corpus, there were higher rate of genotypes as A B or AB AB in isolates from antrum than in those from corpus (75.0 % vs. 16.7%, p Conclusions The H. pylori isolate with the AB AB genotype correlates with an increased gastric cancer risk, and colonize in an antrum predominant manner.
VizPrimer: a web server for visualized PCR primer design based on known gene structure.
Zhou, Yang; Qu, Wubin; Lu, Yiming; Zhang, Yanchun; Wang, Xiaolei; Zhao, Dongsheng; Yang, Yi; Zhang, Chenggang
2011-12-15
The visualization of gene structure plays an important role in polymerase chain reaction (PCR) primer design, especially for eukaryotic genes with a number of splice variants that users need to distinguish between via PCR. Here, we describe a visualized web server for primer design named VizPrimer. It utilizes the new information technology (IT) tools, HTML5 to display gene structure and JavaScript to interact with the users. In VizPrimer, the users can focus their attention on the gene structure and primer design strategy, without wasting time calculating the exon positions of splice variants or manually configuring complicated parameters. In addition, VizPrimer is also suitable for the design of PCR primers for amplifying open reading frames and detecting single nucleotide polymorphisms (SNPs). VizPrimer is freely available at http://biocompute.bmi.ac.cn/CZlab/VizPrimer/. The web server supported browsers: Chrome (≥5.0), Firefox (≥3.0), Safari (≥4.0) and Opera (≥10.0). zhangcg@bmi.ac.cn; yangyi528@vip.sina.com.
International Nuclear Information System (INIS)
Ravi, M.S.; Panchasara, Chirag; Vijay, R.; Suchetha Kumari, N.; Sanjeev, Ganesh
2013-01-01
To evaluate the in vitro genotoxicity and cytotoxicity of two visible light-cured adhesives. The materials tested were 1. orthodontic adhesive with primer (Transbond XT3M) and 2. Orthodontic adhesive without primer (Heliosit, Ivoclar Vivadent AG), Cured sterile individual masses were exposed to 2 kGy electron beam radiation, both irradiated and non irradiated materials were immersed in Phosphate buffer saline and left at 370℃ for 24 hr. Then a volume of 200 μL of the extract medium was mixed with human peripheral blood lymphocyte tested for comet assay by single cell DNA Damage assay and Apoptosis by DNA diffusion agar assay. Evaluation of cytotoxicity was carried out by Hemolysis assay method. Haemolytic activity of orthodontic adhesive without primer (53.34±3.12) was slightly more than that of orthodontic adhesive with primer (52.9±.88). In case of Apoptosis, adhesive with primer (188.92±55.05) and adhesives without primer (186.75±101.83) showed increased diffusion of DNA compared to normal lymphocyte (111.22±8.78). However the level of DNA diffusion was not significantly different between the two adhesives. Both adhesives were cytotoxic and induced apoptosis. Adhesives without primer were found to be slightly toxic than that of adhesive with primer. Both the adhesives had no significant effect on the percentage of DNA tail and olive tail moment of DNA exposed to electron beam radiation. (author)
Actividad antifúngica de extractos de biomasa celular de neem sobre aislamientos de dermatofitos
Ospina Salazar, Daniel Iván; Hoyos Sánchez, Rodrigo Alberto; Arango Arteaga, Myrtha; Orozco Sánchez, Fernando; Ríos Salazar, Jhon Diego
2014-01-01
Título en español: Actividad antifúngica de extractos de biomasa celular de neem sobre aislamientos de dermatofitos Título en ingles: Antifungal activity of neem cellular biomass extracts on dermatophytes isolates Título corto: Actividad antifúngica de extractos de biomasa celular de neem Resumen: Las líneas celulares de neem (Azadirachta indica A. Juss.) cultivadas en suspensión líquida han demostrado producir metabolitos secundarios bioactivos, particularmente triterpenoides. E...
Directory of Open Access Journals (Sweden)
Umaporn Muneenam
2017-09-01
The results showed that there were personal and non-personal interpretations providing differences in the Baba and Nyonya tourism areas. The results from the t-test between the treatment and controlled groups found that before the treatment group had read the 10 postcards, their knowledge was minimal; however, after they had read the 10 postcards for self-guiding interpretation, their knowledge after was significantly different at .05. Moreover, the treatment group recorded “satisfied” gradings for the 10 postcards overall with a score of 4.49 out of 5 using a Likert scale; while the highest satisfaction was with the quality of printing (4.80, but the lowest satisfaction was increased Southeast Asia culture concern and awareness (4.07.
MPprimer: a program for reliable multiplex PCR primer design
Directory of Open Access Journals (Sweden)
Wang Xiaolei
2010-03-01
Full Text Available Abstract Background Multiplex PCR, defined as the simultaneous amplification of multiple regions of a DNA template or multiple DNA templates using more than one primer set (comprising a forward primer and a reverse primer in one tube, has been widely used in diagnostic applications of clinical and environmental microbiology studies. However, primer design for multiplex PCR is still a challenging problem and several factors need to be considered. These problems include mis-priming due to nonspecific binding to non-target DNA templates, primer dimerization, and the inability to separate and purify DNA amplicons with similar electrophoretic mobility. Results A program named MPprimer was developed to help users for reliable multiplex PCR primer design. It employs the widely used primer design program Primer3 and the primer specificity evaluation program MFEprimer to design and evaluate the candidate primers based on genomic or transcript DNA database, followed by careful examination to avoid primer dimerization. The graph-expanding algorithm derived from the greedy algorithm was used to determine the optimal primer set combinations (PSCs for multiplex PCR assay. In addition, MPprimer provides a virtual electrophotogram to help users choose the best PSC. The experimental validation from 2× to 5× plex PCR demonstrates the reliability of MPprimer. As another example, MPprimer is able to design the multiplex PCR primers for DMD (dystrophin gene which caused Duchenne Muscular Dystrophy, which has 79 exons, for 20×, 20×, 20×, 14×, and 5× plex PCR reactions in five tubes to detect underlying exon deletions. Conclusions MPprimer is a valuable tool for designing specific, non-dimerizing primer set combinations with constrained amplicons size for multiplex PCR assays.
Técnica para aislamiento de bacteriófagos específicos para E.coli DH5α a partir de aguas residuales
Directory of Open Access Journals (Sweden)
Gabriel Gaviria A.
2012-04-01
Full Text Available Objetivo. Establecer una técnica para el aislamiento de bacteriófagos a partir de aguas residuales específicos para E. coli DH5α. Materiales y métodos. Se tomó como base el método 1601 de la Agencia de Protección Ambiental de los Estados Unidos de América y un método de obtención de enterovirus a partir de aguas residuales. En el desarrollo del protocolo se realizaron múltiples pruebas utilizando como control positivo el bacteriófago T4 y los aislamientos de bacteriófagos obtenidos a partir de aguas residuales. Resultados. Se observó la formación de unidades formadoras de placa (UFP, se obtuvó la titulación de los bacteriófagos presentes en cada uno de los cultivos de E.coli DH5α, se determinaron las relaciones que existen entre la cuantificación de la formación de unidades formadoras de placa (UFP del tratamiento control y el tratamiento experimental y las respectivas características de las (UFP en cada uno de los experimentos realizados. Conclusiones. Se logró establecer un protocolo microbiológico para el aislamiento de bacteriófagos específicos para E. coli DH5α.
Directory of Open Access Journals (Sweden)
Miryam Palomino
2010-03-01
Full Text Available Se estandarizó el método de centrifugación en placa, para el aislamiento del virus dengue a partir de muestras de suero humano. Se utilizó la línea celular C6/36-HT determinándose los valores óptimos de velocidad de centrifugación, volumen de inóculo, dilución de suero y tiempo de incubación. Posteriormente, 22 muestras de suero con aislamiento viral positivo y cepas referenciales de los cuatro serotipos del virus dengue, fueron procesadas simultáneamente por el método de centrifugación en placa y el método convencional de cultivo en tubo, los aislamientos fueron tipificados mediante inmunofluorescencia indirecta empleando anticuerpos monoclonales. Se optimizó el método de centrifugación en placa inoculando 200 μL de diluciσn de suero 1/20, centrifugaciσn a 1600 rpm/30 min, presentando sensibilidad de 95,5% a cinco dνas postinoculación. Se concluye que el método de centrifugación en placa mejora el porcentaje de aislamiento, con significativa reducción en tiempo de aislamiento del virus dengue.The plate centrifugation assay was standardized for dengue virus isolation from serum samples. C6/36-HT cells were used determining the optimal values for centrifugation spin speed, inoculum, sera dilution, and incubation time. Then, 22 positive serum samples with viral isolation and viral strains of the four reference dengue virus serotypes were tested simultaneously by the standardized plate centrifugation method and the conventional tube culture. The isolations were typified by indirect immunofluorescent test using monoclonal antibodies. The plate centrifugation method was optimized to 200 μL of inoculum, dilution of sera 1/20, centrifugation speed at 1600 rpm/30 min, and sensitivity of 95,5% after 5 days post-inoculation. We concluded that the plate centrifugation method increased dengue virus isolation, with a significant reduction of the time of isolation for dengue virus.
Low-copy nuclear primers and ycf1 primers in Cactaceae.
Franck, Alan R; Cochrane, Bruce J; Garey, James R
2012-10-01
To increase the number of variable regions available for phylogenetic study in the Cactaceae, primers were developed for a portion of the plastid ycf1 gene and intron-spanning regions of two low-copy nuclear genes (isi1, nhx1). • Primers were tested on several families within Caryophyllales, focusing on the Cactaceae. Gel electrophoresis indicated positive amplification in most samples. Sequences of these three regions (isi1, nhx1, ycf1) from Harrisia exhibited variation similar to or greater than two plastid regions (atpB-rbcL intergenic spacer and rpl16 intron). • The isi, nhx, and ycf1 primers amplify phylogenetically useful information applicable to the Cactaceae and other families in the Caryophyllales.
Die vroeë kommunikasieontwikkeling van ’n groep babas met pediatriese MIV/VIGS in sorgsentrums
Directory of Open Access Journals (Sweden)
Isabel Bam
2003-11-01
Full Text Available The high prevalence and serious sequelae of the pediatric human immunodeficiency virus (HIV/AIDS in South Africa pose great challenges for clinicians involved in early intervention to develop appropriate interdisciplinary programmes for primary prevention of transmission of the virus as well as secondary interventions directed at the early management of the unique combination of serious health problems, neuro-developmental needs and caregiving circumstances of the infants. Opsomming Die hoë prevalensie en ernstige gevolge van die pediatriese menslike immuniteitsgebrek-virus (MIV/VIGS in Suid-Afrika stel groot uitdagings aan klinici betrokke by vroeë intervensie om toepaslike interdissiplinêre programme te ontwikkel vir primêre voorkoming van oordrag van die virus asook sekondêre intervensies gerig op die vroeë hantering van die babas se unieke kombinasie van ernstige Gesondheids-probleme, neuro-ontwikkelingsbehoeftes en versorgingsomstandighede. *Please note: This is a reduced version of the abstract. Please refer to PDF for full text.
Optimization of ISSR-PCR reaction system and selection of primers in Bryum argenteum
Directory of Open Access Journals (Sweden)
Ma Xiaoying
2017-02-01
Full Text Available In order to determine optimum ISSR-PCR reaction system for moss Bryum argenteum,the concentrations of template DNA primers,dNTPs,Mg2+ and Taq DNA polymerase were optimized in four levels by PCR orthogonal experimental method. The appropriate primers were screened from 100 primers by temperature gradient PCR,and the optimal anneal temperature of the screened primers were determined. The results showed that the optimized 20 μL ISSR-PCR reaction system was as follows:template DNA 20 ng/20 μL,primers 0.45 μmol/L,Mg2+2.65 mmol/L,Taq DNA polymerase 0.4 U/20 μL,dNTPs 0.45 mmol/L. Using this system,50 primers with clear bands,repeatability well and polymorphism highly were selected from 100 primers. The establishment of this system,the screened primers and the annealing temperature could provide a theoretical basis for further research on the genetic diversity of bryophytes using ISSR molecular markers.
Directory of Open Access Journals (Sweden)
Alfredo Prado
2014-04-01
Full Text Available Introducción. La caracterización fenotípica de las bacterias del género Acinetobacter mediante pruebas bioquímicas y microscópicas es posible. Varios estudios han demostrado que los aislamientos provenientes de infecciones asociadas a la atención en salud presentan una elevada resistencia a los antibióticos de primera elección. Objetivo. Describir los patrones de resistencia de los aislamientos de Acinetobacter baumannii obtenidos en una institución de salud, así como sus características fenotípicas y los posibles mecanismos de resistencia. Materiales y métodos. Se realizó un estudio descriptivo de corte transversal con 28 informes de muestras tomadas a pacientes hospitalizados con infección por A. baumannii. Las pruebas de sensibilidad para ceftazidime, cefepime, meropenem, amikacina y ciprofloxacina se realizaron con el sistema automatizado Vitek® y la clasificación de sensible, intermedia y resistente se hizo con base en el protocolo establecido por el Clinical and Laboratory Standards Institute para el año 2007. Resultados. El mayor porcentaje de aislamientos correspondió al sexo masculino (53,6 %, a la sala de infectología (28,5 % y al mes de septiembre (21,4 %; el tipo de muestra más frecuente fue el de secreción endotraqueal (53,6 %. A partir de los patrones de los perfiles de sensibilidad a los antibióticos empleados se obtuvieron 13 filotipos. Conclusión. Acinetobacter baumannii es un agente patógeno resistente a múltiples antimicrobianos, involucrado en brotes de infecciones asociadas a la atención en salud. Los patrones de los perfiles de resistencia permiten inferir que los posibles mecanismos de resistencia presentes en la mayoría de los aislamientos son la producción de betalactamasas de espectro extendido, las enzimas modificadoras del antibiótico y la modificación del sitio diana.
Guaca-González, Yina Marcela; Flórez-Restrepo, Gladys Fernanda; Moncayo-Ortíz, José Ignacio; Santacruz-Ibarra, Jorge; Álvarez-Aldana, Adalucy
2018-03-15
Introducción. Staphylococcus aureus coloniza mucosas y piel, y causa graves infecciones en el hombre y los animales. Es importante establecer el estatus de portadoras de cepas enterotoxigénicas de este microorganismo en manipuladoras de alimentos, con el fin de prevenir intoxicaciones alimentarias.Objetivo. Establecer las correlaciones entre los genes de enterotoxinas clásicas, el gen tsst-1, la producción de toxinas en cultivo y la resistencia antimicrobiana en aislamientos de S. aureus provenientes de manipuladoras de alimentos que cuidan niños en sus comunidades.Materiales y métodos. Se cultivaron muestras de las fosas nasales y las yemas de los dedos de las manos, y se identificó S. aureus empleando las pruebas de rutina y métodos automatizados. La extracción de ADN se hizo mediante el método de bromuro de cetil-trimetil-amonio (Cetyl-Trimethyl-Ammonium Bromide, CTAB) modificado. Para la detección de superantígenos se emplearon pruebas de reacción en cadena de la polimerasa (PCR) simple y múltiple, y para la de toxinas, estuches comerciales.Resultados. Se encontró que el 22,0 % de los aislamientos correspondía a portadoras de S. aureus: 17,0 % en los aislamientos de fosas nasales; 5,0 % en los de las manos y 6,7 % simultáneamente en los dos sitios. La prevalencia de superantígenos fue de 73,7 %. El genotipo más frecuente fue el seatsst-1, con 10,0 %. La resistencia a un solo antibiótico fue de 74,7 % y, a cuatro antibióticos, de 3,2 %; de los aislamientos, el 93,7 % correspondía a cepas productoras de betalactamasas. La detección de genes clásicos y de tsst-1 mediante PCR fue de 48,4 % y la de toxinas en el sobrenadante, de 42,1 %,con una correlación de 95,7 %. Las mayores correlaciones se establecieron entre las toxinas TSST-1 (22/22) y SEA (17/18). La correlación del gen tsst-1 con la proteína y la resistencia fue de 100 %. Todos los aislamientos con el genotipo sea-tsst-1 t fueron resistentes y productores de las toxinas
Directory of Open Access Journals (Sweden)
Shamshul Ansari
Full Text Available Helicobacter pylori BabA is an important outer membrane protein that involves in the attachment to the gastric mucosa and enhances the virulence property of the bacterium. This study was aimed to characterize the bab genotypes, to evaluate its association with cagA, vacA and clinical diseases as well as degree of gastric inflammation.H. pylori isolates from four countries were subjected for the characterization of bab. The locus specific forward and bab specific reverse primers were used to get the specific products by PCR, which could distinguish the three locus (A, B and C. The histological activities were evaluated according to the Updated Sydney system.In patients from high risk countries (Bhutan and Myanmar relatively higher frequencies of strains with babA-positivity (91.8% and 90.7%, respectively, babA at locus A (98% and 91.2%, respectively and with single babA (96.8% and 91.2%, respectively were found. Strains with two loci occupied were the most prevalent in Bhutan (84.6%, Myanmar (74.7%, Nepal (58.3% and Bangladesh (56.9%. The genotype babA at locus A/babB at locus B/bab-negative at locus C (babA/babB/- was the most common genotype isolated from Bhutan (82.7%, Myanmar (58.7%, Nepal (32% and Bangladesh (31.4% among all genotypes assessed. This genotype was also associated with the peptic ulcer disease (P = 0.013 when compared to gastritis. babA-positive characteristics and the genotype babA/babB/- exhibited the enhanced histological activities.The higher prevalence of virulence associated babA-positive characteristics and enhanced histological activities in Bhutan than in Myanmar, Nepal and Bangladesh might partly explain why the peoples in Bhutan are at higher risk for developing severe gastric complications.
Ansari, Shamshul; Kabamba, Evariste Tshibangu; Shrestha, Pradeep Krishna; Aftab, Hafeza; Myint, Thein; Tshering, Lotay; Sharma, Rabi Prakash; Ni, Nwe; Aye, Than Than; Subsomwong, Phawinee; Uchida, Tomohisa; Ratanachu-Ek, Thawee; Vilaichone, Ratha-Korn; Mahachai, Varocha; Matsumoto, Takashi; Akada, Junko; Yamaoka, Yoshio
2017-01-01
Helicobacter pylori BabA is an important outer membrane protein that involves in the attachment to the gastric mucosa and enhances the virulence property of the bacterium. This study was aimed to characterize the bab genotypes, to evaluate its association with cagA, vacA and clinical diseases as well as degree of gastric inflammation. H. pylori isolates from four countries were subjected for the characterization of bab. The locus specific forward and bab specific reverse primers were used to get the specific products by PCR, which could distinguish the three locus (A, B and C). The histological activities were evaluated according to the Updated Sydney system. In patients from high risk countries (Bhutan and Myanmar) relatively higher frequencies of strains with babA-positivity (91.8% and 90.7%, respectively), babA at locus A (98% and 91.2%, respectively) and with single babA (96.8% and 91.2%, respectively) were found. Strains with two loci occupied were the most prevalent in Bhutan (84.6%), Myanmar (74.7%), Nepal (58.3%) and Bangladesh (56.9%). The genotype babA at locus A/babB at locus B/bab-negative at locus C (babA/babB/-) was the most common genotype isolated from Bhutan (82.7%), Myanmar (58.7%), Nepal (32%) and Bangladesh (31.4%) among all genotypes assessed. This genotype was also associated with the peptic ulcer disease (P = 0.013) when compared to gastritis. babA-positive characteristics and the genotype babA/babB/- exhibited the enhanced histological activities. The higher prevalence of virulence associated babA-positive characteristics and enhanced histological activities in Bhutan than in Myanmar, Nepal and Bangladesh might partly explain why the peoples in Bhutan are at higher risk for developing severe gastric complications.
Directory of Open Access Journals (Sweden)
Gloria Patricia Barrera Cubillos
2014-07-01
Full Text Available Título en español: Caracterización morfológica, biológica y genética de un aislamiento Colombiano de granulovirus de Erinnyis ello (L. (Lepidoptera: Sphingidae Título en ingles: Characterization of a Colombian isolate of Erinnyis ello granulovirus (L. (Lepidoptera: Sphingidae Titulo corto: Granulovirus de E. ello Resumen: El gusano cachón Erinnyis ello (L. es una plaga polífaga que puede causar graves pérdidas en cultivos de caucho. El uso de granulovirus representa una alternativa interesante para el control biológico de este insecto. Tres aislamientos colombianos del granulovirus de E. ello (EeGV recuperados en larvas de campo, fueron caracterizados morfológica y molecularmente. Los cuerpos de inclusión de los tres aislamientos presentaron forma ovoide con una única nucleocápside, con tamaño promedio de 302,9 ± 22 x 181,5 ± 16 nm. El análisis de los perfiles de restricción con diferentes endonucleasas no mostró diferencias entre los tres aislamientos, lo cual sugiere que son muestras de la misma cepa viral, denominada VG010, cuyo tamaño del genoma se estimó en 88,7 Kb. El análisis de las relaciones filogenéticas basado en las secuencias de lef-8, lef-9 y gran mostró con alta consistencia la estrecha relación entre VG010 y un aislamiento de EeGV (M34-4 previamente descrito, lo cual sugiere que son variantes genotípicas de la misma especie viral. La eficacia del aislamiento VG010 en condiciones de laboratorio sobre larvas de segundo y cuarto estadio fue de 100 % y 64 % respectivamente, mientras que la concentración letal media (CL50 fue 4,3 x 103 CI/mL. La productividad viral, osciló entre 2,1 x 109 y 3,8 x 109 CI/gramo de larva. Estos resultados representan la base para el desarrollo de un nuevo bioinsecticida para el control de la plaga en campo. Palabras clave: Gusano cachón. Baculovirus. Control biológico. Filogenia. Abstract: Erinnyis ello (L. is a polyphagous lepidopteran pest that may cause serious
Directory of Open Access Journals (Sweden)
Leila Yousefi
2015-06-01
Full Text Available Introduction: The purpose of this research was to analyze blood-group antigen-binding adhesion (babA2 and sialic acid binding adhesion (sabA genotypes status in Helicobacter pylori (H. pylori isolates and their relationship with clinical outcomes. Methods: Gastric biopsy specimens were homogenized and placed in Brucella agar medium supplemented with 5% sheep blood and 3 antibiotics and were cultured at 37 °C under microaerophilic conditions and incubated for 4-7 days. H. pylori was identified by typical morphology, gram-staining and urease tests, and babA2 and sabA genes were detected by polymerase chain reaction (PCR. Results: From a total of 100 H. pylori isolates; babA2 and sabA genes were detected in 23.0 and 26.4%, respectively. There was a significant relationship between these genes and clinical outcomes (P < 0.050. Conclusion: We found that the babA2 status was not related to clinical outcomes in Tabriz, Iran. However, sabA was a promoting determinant for disease, and multivariate analysis disclosed sabA to be an independent marker of non-ulcer diseases in our subjects.
Directory of Open Access Journals (Sweden)
I. Roncancio-Sánchez
2006-06-01
Full Text Available La producción de combustibles, solventes y algunos productos químicos a partir de sustratos celulósicos usando microorganismos ofrece una ventaja frente a los de origen fósil. Un acercamiento prometedor ha sido la implementación de ingeniería genética utilizando genes de enzimas involucradas en la degradación de desechos celulósicos. En la última década se han generado bibliotecas genéticas para proveer enzimas celulolíticas, que hagan el proceso más rentable, lo cual permitiría aprovechar mejor residuos celulósicos disponibles. Este trabajo describe el aislamiento de dos fragmentos de ADN que expresan actividad endo-β-1,4-glucanasa, a partir de un segmento ADN de 13Kb (clon 02080-25 aislado de una biblioteca genómica de la cepa nativa Clostridium sp IBUN22A. El aislamiento de la región codificadora se realizó a través de pruebas de inducción de la actividad, análisis por restricción del segmento y de una sub-biblioteca con la enzima Sau3A I. 325 clones fueron obtenidos, de los cuales 271 tenían inserto. El tamizaje molecular de estos últimos mostró que siete clones presentaron tamaños entre 3500pb y 7000pb y el tamizaje enzimático con carboximetilcelulosa como sustrato permitió el aislamiento de los clones pBSh-37 y pBSh-26 con la actividad endo-β-1,4-glucanasa original, de tamaños de inserto de 627pb y 879pb respectivamente. Este trabajo es el punto de partida para el aislamiento de enzimas de alto potencial biotecnológico.
Directory of Open Access Journals (Sweden)
Carmen R. Méndez
2013-12-01
Full Text Available El objetivo del estudio fue aislar y caracterizar E. coliO157:H7 a partir de carne molida fresca de bovino obtenida en diferentes mercados de abastos. Se analizaron 195 muestras; para el aislamiento y enumeración de E. coli se utilizó la técnica del Numero Más probable mediante tubos múltiples; para el aislamiento y caracterización de E. coliO157:H7 el enriquecimiento selectivo y el análisis bioquímico, las colonias características se confirmaron mediante pruebas serológicas. Para determinar la presencia de shigatoxina (stx1, stx2 e intimina (eae A se empleó la técnica de PCR multiplex en tiempo real y para enterohemolisina la prueba de hemólisis. El 87.18% de la muestras fue positivo para E. coliy el 77.95% presentó un recuento igual o superior a 50 NMP/g. Se obtuvieron 3 (1.54% cepas de E. coliO157:H7, una stx1 +/ stx2 +/ eaeA – y enterohemolisina -, una stx1 +/ stx2 -/ eaeA + y enterohemolisina – y la otra stx1 -/ stx2 -/ eaeA – y enterohemolisina +. También se obtuvieron 4 cepas (2.05% de E. coli O157 no H7, ninguna presentó factores de virulencia. El estudio reveló el riesgo potencial de que E. coliO157:H7 afecte a la población de Lima.
Directory of Open Access Journals (Sweden)
Gisela Santella
2011-12-01
Full Text Available OBJETIVO: Identificar la proteína de membrana externa ausente en los aislamientos resistentes y determinar tanto las causas de su ausencia en la membrana, como la presencia de otros mecanismos de resistencia a carbapenemes en aislamientos clínicos de Pseudomonas aeruginosa. MÉTODOS: Se estudió un brote de 20 aislamientos de P. aeruginosa previamente caracterizados como productores de la metalobetalactamasa IMP-13. Estos aislamientos presentaron igual expresión de la enzima IMP-13, pero solo cinco de ellos fueron resistentes a carbapenemes. En esos cinco aislamientos resistentes se confirmó la ausencia de una proteína de membrana externa. Se secuenciaron oprD y ampC; se identificaron las proteínas de membrana externa por desorción/ionización láser asistida por matriz/espectometría de masa tiempo de vuelo (MALDI-TOF; se determinó el nivel de expresión de oprD, de AmpC y de los sistemas de eflujo tipo Mex, por reacción en cadena de polimerasa en tiempo real, y por último, se determinó la contribución del déficit de oprD a la resistencia a carbapenemes. RESULTADOS: La proteína de la membrana externa ausente en el grupo R (resistentes a ambos carbapenemes fue identificada como OprD-TS, pero no se observaron variaciones en su expresión. El gen oprD presentó mutaciones en los cinco aislamientos resistentes. Se observó la misma producción de la enzima tipo AmpC PDC-5 y del sistema de eflujo Mex AB-OprM entre los aislamientos sensibles y resistentes a carbapenemes. Se analizó cómo la presencia conjunta de IMP-13 y el déficit de oprD contribuyen al aumento de la resistencia. CONCLUSIONES: Distintos mecanismos contribuyen a la resistencia de aislamientos productores de IMP-13 a carbapenemes. La posibilidad de no detectar estos aislamientos productores de IMP-13 representa un riesgo latente de selección de mutantes con mecanismos de resistencia que se suman para aumentar la resistencia a carbapenemes.OBJECTIVE: To identify the
CRISPR Primer Designer: Design primers for knockout and chromosome imaging CRISPR-Cas system.
Yan, Meng; Zhou, Shi-Rong; Xue, Hong-Wei
2015-07-01
The clustered regularly interspaced short palindromic repeats (CRISPR)-associated system enables biologists to edit genomes precisely and provides a powerful tool for perturbing endogenous gene regulation, modulation of epigenetic markers, and genome architecture. However, there are concerns about the specificity of the system, especially the usages of knocking out a gene. Previous designing tools either were mostly built-in websites or ran as command-line programs, and none of them ran locally and acquired a user-friendly interface. In addition, with the development of CRISPR-derived systems, such as chromosome imaging, there were still no tools helping users to generate specific end-user spacers. We herein present CRISPR Primer Designer for researchers to design primers for CRISPR applications. The program has a user-friendly interface, can analyze the BLAST results by using multiple parameters, score for each candidate spacer, and generate the primers when using a certain plasmid. In addition, CRISPR Primer Designer runs locally and can be used to search spacer clusters, and exports primers for the CRISPR-Cas system-based chromosome imaging system. © 2014 Institute of Botany, Chinese Academy of Sciences.
Preparation and Characterization of Acrylic Primer for Concrete Substrate Application
Directory of Open Access Journals (Sweden)
El-Sayed Negim
2016-01-01
Full Text Available This study dealt with the properties of acrylic primer for concrete substrate using acrylic syrup, made from a methyl methacrylate monomer solution of terpolymers. Terpolymer systems consisting of methyl methacrylate (MMA, 2-ethylhexyl acrylate (2-EHA, and methacrylic acid (MAA with different chemical composition ratios of MMA and 2-EHA were synthesized through bulk polymerization using azobisisobutyronitrile (AIBN as initiator. The terpolymer composition is characterized by FTIR, 1H NMR, DSC, TGA, and SEM. The glass transition temperature and the thermal stability increased with increasing amounts of MMA in the terpolymer backbone. The effect of chemical composition of terpolymers on physicomechanical properties of primer films was investigated. However, increasing the amount of MMA in terpolymer backbone increased tensile and contact angle of primer films while elongation at break, water absorption, and bond strength are decreased. In particular, the primer syrup containing 65% 2-EHA has good bonding strength with concrete substrate around 1.1 MPa.
Directory of Open Access Journals (Sweden)
C. Toledo
2004-03-01
Full Text Available Entre abril de 1999 y julio de 2000 se obtuvieron 144 aislamientos sucesivos de enterococos (uno por paciente a partir de cultivos de una variedad de sitios anatómicos. La distribución de las diferentes especies fue: 119 (82,6% Enterococcus faecalis, 11 (7,6% E. faecium y 14 (9,7% otras especies (5 E. raffinosus, 4 E. avium, 3 E. casseliflavus, 1 E. pseudoavium y 1 E. dispar, las cuales estuvieron asociadas con infecciones clínicas. Los sitios más comunes de aislamiento fueron: tracto urinario 54,9%, cavidad abdominal 12,5%, heridas quirúrgicas 12,5%, abscesos 6,9% y pie diabético 6,2%. Se detectó alto nivel de resistencia a gentamicina, estreptomicina o ambos en 48,6% de los aislamientos. Los aislamientos de E. faecium y E. raffinosus fueron significativamente más resistentes a ampicilina e imipenem que E. faecalis. Ninguna de las cepas exhibió actividad de b-lactamasa. Una cepa de E. faecium (0,7% fue resistente a vancomicina y teicoplanina (fenotipo Van A y dos cepas de E. casseliflavus (1,4% mostraron bajo nivel de resistencia a vancomicina (fenotipo Van C. Debido a estos diversos mecanismos de resistencia antimicrobiana, el tratamiento exitoso y el control de las infecciones enterocócicas con agentes antimicrobianos corrientes se hace cada vez más dificultoso.Beetween April 1, 1999 and June 30, 2000, 144 isolates of enterococci (one per patient from cultures of several anatomic sites were collected . One hundred and nineteen (82.6% E. faecalis, 11 (7.6% E. faecium and 14 (9.7% of other species (5 E. raffinosus, 4 E. avium, 3 E. casseliflavus, 1 E. pseudoavium, and 1 E. dispar were associated with clinical infections. The most common sites of isolation were: the urinary tract 54.9%, abdominal cavity 12.5%, surgical wounds 12.5%, abscesses 6.9% and diabetic foot 6.2%. High-level resistance to gentamicin or streptomycin or both was detected in 48.6% of the isolates. E. faecium and E. raffinosus were significantly more resistant than
FOTOGRAFÍA, CINE Y TRADUCCIÓN EN "LAS BABAS DEL DIABLO"
Directory of Open Access Journals (Sweden)
Valeria de los Ríos
2008-04-01
Full Text Available En este artículo se analiza el cuento "Las babas del diablo" de Julio Cortázar desde una perspectiva visual. La hipótesis central de este texto es que Cortázar relaciona escritura, fotografía y cine para poner enjuego la relación entre arte, sujeto y realidad. Esta conexión está mediada por la técnica, específicamente por aparatos como la cámara fotográfica y la máquina de escribir. Cortázar vincula fotografía y escritura a partir del concepto de traducción, construyendo un protagonista que es al mismo tiempo un observador y un letrado. Este protagonista pasa de ser un sujeto eminentemente fotográfico, a convertirse en el involuntario espectador de un filme.In this article, I analyze the short story "Blow-up " by Julio Cortázar from a visual point of view. This text's central hypothesis is that Cortázar relates writing, photography and cinema in order to put into play the connection between art, subject and reality. This link is mediated by technique, specifically by apparatuses such as the photographic camera and the typewriter. Cortázar associates photography and writing through the concept of translation, constructing a protagonist that is at the same time an observer and a letrado. This protagonist, first a photographic subject, becomes an involuntary film spectator.
Caracterización de vidrios para la evaluación del aislamiento acústico a ruido aéreo
Directory of Open Access Journals (Sweden)
Alba Fernández, J.
2012-08-01
Full Text Available The main contribution of this paper is the formulation of an alternative to experimental determination of loss factor and, consequently, to improve the predictions of airborne sound insulation for any type of monolithic or laminated glass. In addition, a review of the standards related to measurement of mechanical parameters of glass is carried out, with particular interest in laminated glass.
Indeed, one of the problems that arise in the current context of building acoustics is to meet the requirements of facades airborne sound insulation of existing Building Technical Code (BTC. It is known that the blind and the hollow part of the facade should be distinguished. The weakest part regarding to airborne sound insulation is the empty one (consisting of glass, woodwork and other elements. Choosing an adequate woodwork makes the glass surface become the limiting factor.
The Constructive Elements Catalog (CEC of the BTC, the UNE-EN 12758:2011 standard, as well as some, increasingly, data vendors provide information about airborne sound insulation for monolithic glass, laminated glass and double glazing. In the case of laminated glass, these data are limited only to those with a single intermediate layer, and also nonacoustic. Can therefore be said that there is a gap of knowledge in this regard. To obtain reliable predictions of airborne sound insulation of multilayer partitions, such as laminated glass, mechanical characteristics must be known, being loss factor one of the most important.
La principal aportación del trabajo es la formulación de una alternativa que facilita la determinación experimental del factor de pérdidas y, en consecuencia, mejorar las predicciones de aislamiento a ruido aéreo para vidrios con una o más capas intermedias sea cual fuere su naturaleza. Además, se realiza una revisión de las normativas relacionadas con los ensayos de los parámetros mecánicos necesarios para la caracterizar los vidrios, centr
Directory of Open Access Journals (Sweden)
Adriana Arévalo
2005-09-01
Full Text Available Introducción. Se han informado infecciones naturales y experimentales con Giardia sp. en bovinos, equinos, caprinos, caninos, felinos y roedores como ratones, ratas y gerbos; estos últimos son el modelo más adecuado para estudios de la infección por Giardia duodenalis y Giardia muris. Objetivo. Establecer el comportamiento de la infección con aislamientos colombianos de Giardia duodenalis en el modelo animal del gerbo. Materiales y métodos. Se purificaron mediante gradientes de sacarosa y percoll quistes del parásito obtenidos a partir de heces de pacientes sintomáticos infectados. La inoculación a los animales se realizó mediante sonda gástrica con 5x103 quistes. El curso de la infección se estableció mediante recuento diario de quistes y semanal de trofozoítos durante treinta días. Resultados. La eliminación de quistes presentó un patrón intermitente de excreción, con ausencia en la primera y cuarta semanas de infección, y presencia constante durante la segunda y tercera semanas, en número variable con promedio mínimo de 79 y máximo de 17.943 quistes liberados en heces recolectadas en un período de dos horas. Se observó colonización de los trofozoítos en el intestino delgado, en número que osciló entre 15.000 y 6'577.778 trofozoítos por ml. Conclusiones. En gerbos infectados con aislamientos de Giardia duodenalis circulantes en otras regiones geográficas, la resolución natural de la infección oscila entre 86 y 114 días mientras que los gerbos infectados con aislamientos colombianos del parásito la resuelven al día 30. El gerbo constituye un modelo animal adecuado para la infección con aislamientos colombianos de G. duodenalis. La infección experimental por Giardia en gerbo permite obtener quistes y trofozoítos del parásito en cantidades suficientes con la finalidad de ser utilizados como antígenos para la inmunización de animales y para la obtención de anticuerpos que puedan utilizarse para la detecci
González-Torrealba, Jenny; García C, Gisela C; Alvarado-Rico, Sonia; Marcano de Díaz, Elizabeth; Rodríguez, Albert
2017-01-01
Se realizó la descripción histológica de los órganos endocrinos de nueve babas, cinco hembras y cuatro machos (Caiman crocodilus crocodilus), provenientes del Hato Santa Ana, estado Guárico y de la laguna de oxidación de la Facultad de Agronomía de la Universidad Central de Venezuela (UCV), estado Aragua. Las muestras se fijaron en formol neutro al 10% v/v y se incluyeron en parafina en el Laboratorio de Histoquímica de la Facultad de Ciencias Veterinarias de la UCV. Todos los órganos fueron ...
Düşünme Stilleri Ve Anne-Baba Tutumları Arasındaki İlişki
Palut, Birsen
2008-01-01
Düşünme stili bireyin zihninde olup bitenlerin ve düşünme süreçlerinin farklı şekillerde dışa yansıması olarak tanımlanmaktadır. Düşünme stillerinin oluşum ve gelişim sürecinde bireyin sosyalleşme süreci önemli bir yer tutmaktadır. Bu süreçte anne ve baba tutumları bireylerde hangi tür düşünme süreçlerinin baskın hale geleceğinin belirlenmesinde en önemli faktörlerden birini oluşturmaktadır. Ailelerin içinde yaşadığı kültürel değerler ve inançlar ebeveynlerin çocuk yetiştirme değerlerini, gel...
Bioinformatic tools for PCR Primer design
African Journals Online (AJOL)
ES
reaction (PCR), oligo hybridization and DNA sequencing. Proper primer design is actually one of the most important factors/steps in successful DNA sequencing. Various bioinformatics programs are available for selection of primer pairs from a template sequence. The plethora programs for PCR primer design reflects the.
Directory of Open Access Journals (Sweden)
Ni Luh Putu Indi Dharmayanti
2016-07-01
Full Text Available Until recently, two clades of of avian influenza viruses (AIVs designated as 2.3.2 and 2.2.3 havebeen circulating in Indonesia. Mutations of AIV genes have cretaed many more variants of the virus. It istherefore important to evaluate the appropriate methods used for the detection and diagnosis of AI virusin the field. Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR have been used as a standardmethod for detection of AIV in many laboratories in Indonesia. The success of RT-PCR for detection ofAIV virus is dependent on the nucleotide sequences of primer that match with the circulating of AIVs. Theaims of this study was to develop RT-PCR by designing primers for H5 subtype specific to the circulatingAIVs in the field. The primers were designed using Primer Design software, and optimization andvalidation of the primer were conducted using AIVs that have been characterized in the previous study.The primers were then used RT-PCR using AIV isolates from field samples and their sensitivity andspecificity were then determined. The results showed that the H5 primers designed in this study, H5-IDand H5-NLP, was able to detect the AIVs in field samples better than the H5-specific primers have beenused previously. In conclusion, H5 primers designed based on recent viruses in the field showed betterresults in the detection of AI virus as compared to the previous primers. As AIV-H5N1 subtype in the fieldwill continue to change and evolve, the use of primers designed in this study is recommended for diagnosisof H5 AIV.
Directory of Open Access Journals (Sweden)
Garzón Gerardo
1986-12-01
Full Text Available A partir de plantas de crisantemo de las variedades Surf, Yellow Garland y Clrcus afectadas por la agalla de corona en la Sabana de Bogotá, se obtuvieron 3 aislamientos bacterlales de A. radlobacter varo tumefaclens Smith &.. Townsend, los cuales se caracterizaron e identificaron mediante observaciones macroscópicas y microscópicas y la realización de pruebas fisiológicas y bioqurmicas en el laboratorio; para probar la patogenecidad de dichos aislamientos se inocularon en plantas de tomate, en discos de zanahoria y de remolacha.
Se realizaron 2 ensayos para determinar el efecto de la cepa K-84 de A. radlobacter varo radlobacter sobre la enfermedad ocasionada por 2 aislamientos patógenos de A. radlobacter
var. tumefaclens en plantas de crisantemo o de las variedades Clrcus, Yellow Garland y Surf. El primer ensayo se desarrollo en bancos de enraizamiento con esquejes sin enraizar y el segundo ensayo se hizo con esquejes enraizados y colocados en materas. Los 3 aislamientos patógenos presentaron un alto porcentaje de Infección en las variedades Circus y Yellow Garland, mientras que la variedad Surf fue la menos afectada. La cepa K-84 fue más efectiva en el ensayo de materas que en el ensayo en bancos de
enraizamiento por la fácil lixiviación de la bacteria con el agua de riego. Se encontró un mejor control de la cepa K-84 para los aislamientos patógenos pertenecientes al blotlpo 2. La inmersión en preslembra de los esquejes en una solución de cloro y el uso continuo de este elemento en el agua de riego fueron el mejor tratamiento para .el control de la agalla de corona en bancos de enraizamiento yen materas.
Directory of Open Access Journals (Sweden)
Juan McEwen
2003-01-01
Full Text Available Aunque es poco lo que se conoce acerca de la biología evolutiva
del hongo P. brasiliensis, varios estudios moleculares han demostrado que existen variaciones en secuencias de ADN entre sus aislamientos, las que se correlacionan con el origen geográfico de las mismas y con diferencias en su virulencia para modelos murinos (1,2. Se desconoce si estas variaciones son el resultado final de un proceso de especiación alopátrica que daría origen a especies aisladas genéticamente provistas de características fenotípicas (patogenicidad, inmunogenicidad y genotípicas diferentes, las que podrían ser usadas como una alternativa para mejorar e innovar los métodos actuales de diagnóstico. Por lo tanto, proponemos como objetivo general estudiar un aspecto fundamental de la biología evolutiva del hongo patógeno humano P. brasiliensis como es la especiación.
30 CFR 56.6304 - Primer protection.
2010-07-01
... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 56.6304 Section 56.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of explosives...
KENO-VI Primer: A Primer for Criticality Calculations with SCALE/KENO-VI Using GeeWiz
International Nuclear Information System (INIS)
Bowman, Stephen M.
2008-01-01
The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory is widely used and accepted around the world for criticality safety analyses. The well-known KENO-VI three-dimensional Monte Carlo criticality computer code is one of the primary criticality safety analysis tools in SCALE. The KENO-VI primer is designed to help a new user understand and use the SCALE/KENO-VI Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO-VI in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO-VI that are useful in criticality analyses. The primer is based on SCALE 6, which includes the Graphically Enhanced Editing Wizard (GeeWiz) Windows user interface. Each example uses GeeWiz to provide the framework for preparing input data and viewing output results. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO-VI input and allows the user to quickly run a simple criticality problem with SCALE/KENO-VI. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO-VI features that are covered in detail in the sample problems in that section. Upon completion of the primer, a new user should be comfortable using GeeWiz to set up criticality problems in SCALE/KENO-VI. The primer provides a starting point for the criticality safety analyst who uses SCALE/KENO-VI. Complete descriptions are provided in the SCALE/KENO-VI manual. Although the primer is self-contained, it is intended as a companion volume to the SCALE/KENO-VI documentation. (The SCALE manual is provided on the SCALE installation DVD.) The primer provides specific examples of
Po-Wen, Chen; Singh, Prashant; Zimmerli, Laurent
2013-01-01
Boosted responsiveness of plant cells to stress at the onset of pathogen- or chemically induced resistance is called priming. The chemical β-aminobutyric acid (BABA) enhances Arabidopsis thaliana resistance to hemibiotrophic bacteria through the priming of the salicylic acid (SA) defence response. Whether BABA increases Arabidopsis resistance to the necrotrophic bacterium Pectobacterium carotovorum ssp. carotovorum (Pcc) is not clear. In this work, we show that treatment with BABA protects Arabidopsis against the soft-rot pathogen Pcc. BABA did not prime the expression of the jasmonate/ethylene-responsive gene PLANT DEFENSIN 1.2 (PDF1.2), the up-regulation of which is usually associated with resistance to necrotrophic pathogens. Expression of the SA marker gene PATHOGENESIS RELATED 1 (PR1) on Pcc infection was primed by BABA treatment, but SA-defective mutants demonstrated a wild-type level of BABA-induced resistance against Pcc. BABA primed the expression of the pattern-triggered immunity (PTI)-responsive genes FLG22-INDUCED RECEPTOR-LIKE KINASE 1 (FRK1), ARABIDOPSIS NON-RACE SPECIFIC DISEASE RESISTANCE GENE (NDR1)/HAIRPIN-INDUCED GENE (HIN1)-LIKE 10 (NHL10) and CYTOCHROME P450, FAMILY 81 (CYP81F2) after inoculation with Pcc or after treatment with purified bacterial microbe-associated molecular patterns, such as flg22 or elf26. PTI-mediated callose deposition was also potentiated in BABA-treated Arabidopsis, and BABA boosted Arabidopsis stomatal immunity to Pcc. BABA treatment primed the PTI response in the SA-defective mutants SA induction deficient 2-1 (sid2-1) and phytoalexin deficient 4-1 (pad4-1). In addition, BABA priming was associated with open chromatin configurations in the promoter region of PTI marker genes. Our data indicate that BABA primes the PTI response upon necrotrophic bacterial infection and suggest a role for the PTI response in BABA-induced resistance. © 2012 THE AUTHORS. MOLECULAR PLANT PATHOLOGY © 2012 BSPP AND BLACKWELL PUBLISHING LTD.
Directory of Open Access Journals (Sweden)
Daniel DomÃnguez Romero
2013-04-01
Full Text Available Helvella lacunosa (H. lacunosa adicionalmente a su importancia micorrÃzica tiene un alto valor comercial. La producción comercial de H. lacunosa tiene dos ventajas: Beneficio económico para las comunidades que sean capaces de producirlo y; conservación de la biodiversidad en el bosque al prevenir la sobre explotación de la especie y mantener la relación micorrÃzica hongo:planta. Es necesario, en principio, obtener el micelio puro (aislamiento, y a partir de éste buscar la técnica de micorrización más adecuada para su producción. El aislamiento de cepas, requiere de pruebas selectivas de diversos medios de cultivo lo que permite identificar los requerimientos potenciales para inducir el desarrollo del micelio. Se realizaron pruebas de crecimiento en cinco medios de cultivo con el objetivo de obtener cepas puras del hongo ectomicorrÃzico H. lacunosa. Mediante un Análisis de Covarianza se demostró que existe una relación lineal entre el tiempo de incubación y el diámetro, lo que indica que la velocidad de crecimiento acumulado del micelio, fue diferente entre los medios de cultivo (F4, 240 = 17.008; p
Directory of Open Access Journals (Sweden)
Sandra Carolina Firacative Ropero
2006-01-01
resistentes a tetraciclina y cloranfenicol, estuvieron relacionados con el patrón electroforético A (n=32 y los subtipos A16 (n=1 y A28 (n=1, caracterizados por presentar una banda de 340 Kb, al igual que el clon. Estos resultados muestran la prevalencia y circulación continua de aislamientos de S. pneumoniae serotipo 5, los cuales están genéticamente relacionados con el clon 19-Colombia.
Albuquerque,N.I.; Contreras,C.C.; Alencar,S.; Meirelles,C.F.; Aguiar,A.P.; Moreira,J.A.; Packer,I.U.
2009-01-01
Analisaram-se as propriedades da carne e o perfil de ácidos graxos do pernil de catetos alimentados com dietas contendo diferentes porcentagens de torta de babaçu, usada como fonte energética alternativa substituindo parte do milho na alimentação, em sistemas de produção em cativeiro. Avaliou-se o pernil de 12 animais quanto às suas propriedades - perda de peso ao cozimento, força de cisalhamento, pH e capacidade de retenção de água-, depois extraiu-se o óleo da carne e determinou-se o perfil...
Shimomura, Yumi; Morimoto, Sho; Hoshino, Yuko Takada; Uchida, Yoshitaka; Akiyama, Hiroko; Hayatsu, Masahito
2012-01-01
Ammonia monooxygenase subunit A gene (amoA) is frequently used as a functional gene marker for diversity analysis of ammonia-oxidizing bacteria (AOB). To select a suitable amoA primer for real-time PCR and PCR-denaturing gradient gel electrophoresis (DGGE), three reverse primers (degenerate primer amoA-2R; non-degenerate primers amoA-2R-GG and amoA-2IR) were examined. No significant differences were observed among the three primers in terms of quantitative values of amoA from environmental samples using real-time PCR. We found that PCR-DGGE analysis with the amoA-2IR primer gave the best results in this studied soil. These results indicate that amoA-2IR is a suitable primer for community analysis of AOB in the environment. PMID:22075625
DNA Extraction and Primer Selection
DEFF Research Database (Denmark)
Karst, Søren Michael; Nielsen, Per Halkjær; Albertsen, Mads
Talk regarding pitfalls in DNA extraction and 16S amplicon primer choice when performing community analysis of complex microbial communities. The talk was a part of Workshop 2 "Principles, Potential, and Limitations of Novel Molecular Methods in Water Engineering; from Amplicon Sequencing to -omics...
Directory of Open Access Journals (Sweden)
Arenas Fernández, Tatiana
2012-01-01
Full Text Available Introducción: debido a la problemática actual de fármaco-resistencia hacia los antibióticos b-lactámicos, se ha hecho necesario, en busca de una solución, trabajar con nuevas moléculas con potencial farmacológico, así como utilizar novedosos sistemas poliméricos como matrices o excipientes farmacéuticos.Objetivo: evaluar la actividad antibiótica de la ampicilina, combinada con un compuesto sintético de tipo chalcona, denominado (2E-3-(2,3-dimetoxifenil-1-(4-metilfenilprop-2-en- 1-ona, sobre un aislamiento clínico de Staphylococcus aureus resistente a penicilinas, en presencia de una matriz polimérica hidrosoluble denominada poli(ácido maleico-co-2-vinilpirrolidona.Materiales y métodos: el compuesto sintético y la matriz polimérica se obtuvieron por métodos descritos en la literatura. Se usó un aislamiento clínico de Staphylococcus aureus resistente a penicilinas y se hicieron ensayos de actividad antibiótica por la técnica de macrodilución en caldo, de la cual se obtuvieron las concentraciones inhibidoras mínimas de los compuestos evaluados.Resultados: la mezcla ampicilina-chalcona muestra un efecto antibiótico menor que el de su referente ampicilina-sulbactam. No obstante, cuando se utiliza la matriz polimérica en combinación con la ampicilina-chalcona se aprecia un incremento significativo de la actividad antibiótica, evidenciado en que la concentración inhibidora mínima es la mitad de la del referente comercial.
Serber, Robert
2018-01-01
Unabridged declassified value reproduction of The Los Alamos Primer by Robert Serber, in full color with all censor markings. This is the booklet given to new workers at Los Alamos during World War II, to catch them up on how to build a practical fission bomb. The Primer was driven by Robert Oppenheimer asking his protégé Robert Serber to summarize all knowledge and possible solutions known as of April 1943 in a series of lectures. Serber did such an excellent job that the notes from the series was turned into The Los Alamos Primer. Serber was known as an expert that bridged theory and reality, and so was also chosen to be one of the first Americans to enter Hiroshima and Nagasaki to assess the atomic damage in 1945.
Do we need primer for orthodontic bonding? A randomized controlled trial.
Nandhra, Sarabjit Singh; Littlewood, Simon J; Houghton, Nadine; Luther, Friedy; Prabhu, Jagadish; Munyombwe, Theresa; Wood, Simon R
2015-04-01
To evaluate the clinical performance of APC™II Victory Series™ (3M Unitek) brackets in direct orthodontic bonding with and without the use of primer. A single-operator, two-centre prospective, non-inferiority randomized controlled clinical trial. The Orthodontic departments at the Leeds Dental Institute and St Luke's Hospital, Bradford, UK. Ethical approval was granted by Leeds (East) Research Ethics Committee on 18th of December 2009 (Reference 09/H1306/102). The protocol was not published prior to trial commencement. Ninety-two patients requiring orthodontic treatment with fixed appliances were randomly allocated to the control (bonded with primer) or test groups (bonded without primer). Patients were randomly allocated to either the control or experimental group. This was performed by preparing opaque numbered sealed envelopes in advance using a random numbers table generated by a computer by an independent third party . Once the envelopes were opened, blinding of the operator and the patient was no longer possible due to the nature of the intervention. Patients were approached for inclusion in the trial if they qualified for NHS orthodontic treatment requiring fixed appliances and had no previous orthodontic treatment. Number of bracket failures, time to bond-up appliances, and the adhesive remnant index (ARI) when bracket failure occurred, over a 12-month period Failure rate with primer was 11.1 per cent and without primer was 15.8 per cent. Bonding without primer was shown statistically to be non-inferior to bonding with primer odds ratio 0.95-2.25 (P = 0.08). Mean difference in bond-up time per bracket was 0.068 minutes (4 seconds), which was not statistically significant (P = 0.402). There was a statistically significant difference in the Adhesive Remnant Index - ARI 0 with primer 49.4 per cent, no primer 76.5 per cent, (P failure rate of 2% to be clinically significant. When bonding with APC™II Victory Series™ brackets without primer was shown
In vivo effect of a self-etching primer on dentin.
Milia, E; Lallai, M R; García-Godoy, F
1999-08-01
To determine the ultrastructural aspects of the dentin collagen area in the cavity preparation floor produced in vivo after phosphoric acid acid-etching or after using Clearfil Liner Bond 2 self-etching primer (LB2 Primer). Twenty-four non-carious third molars scheduled for extraction from young adult patients (16-30 years old) were used. Conventional Class I cavities (+/- 2 mm deep) were prepared on the occlusal surfaces of all teeth using a cylindrical diamond bur on a high-speed handpiece with copious water spray. To avoid dehydration of the dentin, the smear layer-covered dentin was briefly air-dried for 2 seconds. Cavities were assigned at random to the following groups: Group A: Dentin etched for 15 seconds with 34% phosphoric acid, rinsed for 20 seconds and then briefly air-dried for 2 seconds with oil-free compressed air leaving the surfaces slightly moist. Group B: LB2 Primer was applied to the cavity surfaces for 30 seconds and then briefly air-dried to remove the solvent. Group C: The untreated dentin smear layer was used as a control. In all three groups, the cavities were filled incrementally with a resin-based composite (APX), light curing every increment for 40 seconds. After 30 minutes, the teeth were extracted atraumatically and the samples immediately prepared for evaluation with the transmission electron microscope. The use of a self-etching primer did not produce significant morphological changes in the moist dentin substrate. Adverse morphological conditions where observed when there was an excess water on the dentin surface. Phosphoric acid altered the collagen more severely than the self-etching primer.
DEFF Research Database (Denmark)
Lund, Anders Henrik; Duch, M; Lovmand, J
1997-01-01
, but not with a noncomplementary tRNA-like molecule. The engineered primer was shown to be involved in both the initiation of first-strand synthesis and second-strand transfer. These results provide an in vivo demonstration that the retroviral replication machinery may recognize sequence complementarity rather than actual primer...... binding site and 3' primer sequences. Use of mutated primer binding site vectors replicating via engineered primers may add additional control features to retroviral gene transfer technology....
Nanotechnology: A Policy Primer
2013-06-24
savings in the United States of 24 million barrels of oil.4 • Universal access to clean water. Nanotechnology water desalination and filtration...CRS Report for Congress Prepared for Members and Committees of Congress Nanotechnology : A Policy Primer John F. Sargent Jr. Specialist...COVERED 00-00-2013 to 00-00-2013 4. TITLE AND SUBTITLE Nanotechnology : A Policy Primer 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT
Bond strength of compomers to dentin using acidic primers.
Tate, W H; You, C; Powers, J M
1999-10-01
To determine the in vitro bond strengths of seven compomer/bonding agent restorative systems to human dentin. Seven compomer/bonding agents were bonded to human dentin, stored in water at 37 degrees C for 24 hours, and debonded in tension. Bonding conditions were with and without phosphoric acid etching, with and without the use of combined primer/bonding agents, and under moist and wet bond interfaces. Without phosphoric acid etching, F2000/F2000 Compomer Primer/Adhesive and F2000/Single Bond Dental Adhesive System were less sensitive to dentin wetness. With moist dentin, bond strengths of Dyract/Prime & Bond 2.1, Dyract AP/Prime & Bond 2.1, Hytac/OSB light-curing, one-component bonding agent, F2000/Single Bond, and Freedom/STAE single component light-cured dentin/enamel adhesive system, were improved with phosphoric acid etching. Also, with moist dentin, the bond strength of F2000/F2000 Compomer Primer/Adhesive in the 3M Clicker dispensing system was higher without phosphoric acid etching, whereas bonds of Compoglass/Syntac Single-component were not affected by phosphoric acid etching. Bonding did not occur without primer/bonding agent, regardless of surface condition or use of phosphoric acid etching.
Tiwari, Siddharth; Meyer, Wendy L; Stelinski, Lukasz L
2013-10-01
β-Aminobutyric acid (BABA) is known to induce resistance to microbial pathogens, nematodes and insects in several host plant/pest systems. The present study was undertaken to determine whether a similar effect of BABA occurred against the Asian citrus psyllid, Diaphorina citri Kuwayama, in citrus. A 25 mM drench application of BABA significantly reduced the number of eggs/plant as compared with a water control, whereas 200 and 100 mM applications of BABA reduced the numbers of nymphs/plant and adults/plants, respectively. A 5 mM foliar application of BABA significantly reduced the number of adults but not eggs or nymphs when compared with a water control treatment. In addition, leaf-dip bioassays using various concentrations (25–500 mM) of BABA indicated no direct toxic effect on 2nd and 5th instar nymphs or adult D. citri. BABA-treated plants were characterized by significantly lower levels of iron, magnesium, phosphorus, sodium, sulfur and zinc as compared with control plants. The expression level of the PR-2 gene (β-1,3-glucanase) in BABA-treated plants that were also damaged by D. citri adult feeding was significantly higher than in plants exposed to BABA, D. citri feeding alone or control plants. Our results indicate the potential for using BABA as a systemic acquired resistance management tool for D. citri.
International Nuclear Information System (INIS)
Truc, Trinh Anh; Hang, Thi Xuan; Oanh, Vu Ke; Dung, Nguyen Tuan
2004-01-01
Corrosion resistance of coating system consisting of zinc-rich primer (ZRP) and topcoat based on polyurethane resin with the presence of 3-aminopropyl-triethoxysilan (APS) and 2-(benzothialylthio) succinic acid (BSA) was studied by electrochemical impedance and wet adhesion. The interface metal/primer/topcoat was analyzed by scanning electronic microscopy. It was found that the presence of APS and BSA improved adhesion and barrier property of the topcoats
Directory of Open Access Journals (Sweden)
S. González Fraga
2009-03-01
Full Text Available La infección por Vibrio cholerae, el agente causal del cólera, se trasmite al hombre por ingestión de agua y alimentos contaminados. Aunque son los serogrupos O1 y O139 los que habitualmente se asocian al cólera epidémico, los aislamientos de otros serogrupos también son causales de gastroenteritis e infecciones extra-intestinales. Durante el período 2003-2005, se investigó la presencia de V. cholerae en la materia fecal de niños con diarrea atendidos en el Hospital del Niño Jesús, Tucumán. Se recuperaron 34 aislamientos de V. cholerae no-O1, no-O139. Se determinaron sus perfiles de virulencia por PCR, la sensibilidad a los antimicrobianos y la diversidad genética por electroforesis en campo pulsado. Se obtuvieron ocho perfiles de virulencia, aunque ningún aislamiento fue positivo para la toxina colérica ni para la toxina termoestable. Cuatro aislamientos fueron positivos para el sistema de secreción de tipo tres. El 17,6% de los aislamientos fueron resistentes o de sensibilidad intermedia a ampicilina y el 5,9% fueron resistentes a trimetoprima-sulfametoxazol. Los aislamientos resultaron muy diversos: se hallaron 27 patrones distintos en 29 aislamientos tipificables por electroforesis en campo pulsado. A pesar de su baja incidencia, V. cholerae continúa siendo un agente causal de diarrea en niños, los que se ven afectados por una amplia variedad de cepas circulantes.Vibrio cholerae, etiologic agent of cholera, is transmitted to humans by ingestion of contaminated food or water. Even though serogroups O1 and O139 are the ones usually associated to epidemic cholera, isolates from other serogroups also cause gastroenteritis and extraintestinal infections. During the period 2003-2005, presence of V. cholerae in stools was investigated in children with diarrhea that seaked assistance at the Niño Jesús Hospital in Tucumán. Thirty four isolates of V. cholerae non-O1, non-O139 were recovered. We characterized the isolates studying
Hatry , Laura
2012-01-01
No cabe duda que la mayor afinidad entre el cine y los géneros literarios reside en la novela y el teatro. El caso del cuento es especial, ya que se trata, en cierto modo y sólo en los cuentos de raigambre poética, a la vez de prosa y de poesía y tal vez es por esto que en la historia de la literatura no ha alcanzado la atención que merece. En el caso que nos ocupa se trata de una influencia especial que ha tenido el cuento "Las babas del diablo" de Cortázar: la inspiración para el largometra...
International Nuclear Information System (INIS)
Flude, J.W.; Nicholas, J.R.
1991-04-01
This Predictive Maintenance Primer provides utility plant personnel with a single-source reference to predictive maintenance analysis methods and technologies used successfully by utilities and other industries. It is intended to be a ready reference to personnel considering starting, expanding or improving a predictive maintenance program. This Primer includes a discussion of various analysis methods and how they overlap and interrelate. Additionally, eighteen predictive maintenance technologies are discussed in sufficient detail for the user to evaluate the potential of each technology for specific applications. This document is designed to allow inclusion of additional technologies in the future. To gather the information necessary to create this initial Primer the Nuclear Maintenance Applications Center (NMAC) collected experience data from eighteen utilities plus other industry and government sources. NMAC also contacted equipment manufacturers for information pertaining to equipment utilization, maintenance, and technical specifications. The Primer includes a discussion of six methods used by analysts to study predictive maintenance data. These are: trend analysis; pattern recognition; correlation; test against limits or ranges; relative comparison data; and statistical process analysis. Following the analysis methods discussions are detailed descriptions for eighteen technologies analysts have found useful for predictive maintenance programs at power plants and other industrial facilities. Each technology subchapter has a description of the operating principles involved in the technology, a listing of plant equipment where the technology can be applied, and a general description of the monitoring equipment. Additionally, these descriptions include a discussion of results obtained from actual equipment users and preferred analysis techniques to be used on data obtained from the technology. 5 refs., 30 figs
Actividad antifúngica de extractos de biomasa celular de neem sobre aislamientos de dermatofitos
Directory of Open Access Journals (Sweden)
Daniel Iván Ospina Salazar
2014-07-01
Full Text Available Título en español: Actividad antifúngica de extractos de biomasa celular de neem sobre aislamientos de dermatofitos Título en ingles: Antifungal activity of neem cellular biomass extracts on dermatophytes isolates Título corto: Actividad antifúngica de extractos de biomasa celular de neem Resumen: Las líneas celulares de neem (Azadirachta indica A. Juss. cultivadas en suspensión líquida han demostrado producir metabolitos secundarios bioactivos, particularmente triterpenoides. En consecuencia, se han realizado estudios para el control de microorganismos de importancia médica, como los hongos dermatofitos. El objetivo principal de este trabajo fue evaluar a través de un método de referencia in vitro la actividad antifúngica de diferentes extractos de cultivos celulares de neem sobre varios aislamientos de Trichophyton mentagrophytes, Trichophyton rubrum y Epidermophyton floccosum. Se realizó un escalado de cultivos de suspensiones celulares de neem, a partir de los cuales se obtuvo un extracto crudo metanólico. Éste extracto fue fraccionado posteriormente por cromatografía en columna de silica gel. Con los extractos obtenidos se determinó la Concentración Mínima Inhibitoria (CMI, siguiendo el método de microdilución en caldo M38-A2, con cinco aislamientos de T. mentagrophytes, cinco de T. rubrum y tres de E. floccosum. Se usó como control positivo el antimicótico Terbinafina. Los resultados mostraron que el extracto crudo de biomasa celular de neem inhibe el crecimiento hasta en 100 % de T. mentagrophytes, T. rubrum y E. floccosum. Al evaluar las fracciones por separado, se observó que las de menor polaridad exhibieron en general mayor actividad antifúngica (CMI=109 µg/mL que el extracto crudo per se (CMI=2500 µg/mL y las fracciones más polares (CMI=7000 µg/mL. Lo anterior indica que las células de neem cultivadas en suspensión producen compuestos con actividad antifúngica, siendo más bioactivos los presentes
Directory of Open Access Journals (Sweden)
Giovanni Chaves-Bedoya
2012-01-01
Full Text Available El análisis molecular del cistrón, que codifica para la proteína de la cubierta del virus del mosaico de la caña de azúcar (SCMV reportado en la base de datos del banco de genes (GenBank, reveló la presencia de 45 nucleótidos adicionales que codifican para quince aminoácidos, en la región amino de la secuencia de la proteína de la cubierta del aislamiento mexicano identificado con el número de acceso GU474635. El análisis BLAST indicó que esta característica particular también está presente en el aislamiento D00949, reportado en 1991 en Estados Unidos. El análisis filogenético de 185 secuencias de la proteína de la cubierta de SCMV reportadas de Asia, áfrica, Brasil y Argentina, entro otros, sugiere diferentes orígenes filogeográficos de los aislamientos mexicanos. El aislamiento mexicano GU474635 es filogenéticamente más cercano a aislamientos de SCMV de Brasil y de EE.UU., mientras que secuencias de la proteína de la cubierta del virus SCMV reportadas en China y Alemania son filogenéticamente más cercanas al aislamiento mexicano EU091075. Las características particulares que comparten aislamientos virales de tres países del continente americano, a saber, EE.UU., México y Brasil, sugieren un bajo control fitosanitario en el intercambio de material vegetal.The molecular analysis of the Sugarcane mosaic virus (SCMV for coat protein cistron reported in the public GenBank database, revealed the presence of 45 additional nucleotides coding for 15 amino acids in the N-terminal region of the coat protein sequence of the mexican isolate GU474635. BLAST analysis indicates this particular feature is also present in the coat protein sequence identified with the accession number D00949 reported in the USA in 1991. Phylogenetic analysis of 185 SCMV coat protein sequences reported from Asia, Africa, Brazil and Argentina among others, suggest a putative different phylogeographical origin of the mexican SCMV isolates. Coat protein
Energy Technology Data Exchange (ETDEWEB)
Ni, Chun Chun
2009-11-16
Based on extensive analysis of the 'China Energy Databook Version 7' (October 2008) this Primer for China's Energy Industry draws a broad picture of China's energy industry with the two goals of helping users read and interpret the data presented in the 'China Energy Databook' and understand the historical evolution of China's energy inustry. Primer provides comprehensive historical reviews of China's energy industry including its supply and demand, exports and imports, investments, environment, and most importantly, its complicated pricing system, a key element in the analysis of China's energy sector.
Directory of Open Access Journals (Sweden)
Fernando Montoya
1989-01-01
Full Text Available
Se evaluaron 3 medios de cultivo de composición diferente (Mycobiotic agar, agar de Kaminski y agar de Kaminski adicionado con nistatina para el aislamiento de dermatofitos y el reaislamiento de S. schenckii y hongos negros, agentes de cromomicosis. Con el objeto de puntualizar diferencias entre dichos medios se determinaron, para cada uno, la frecuencia de aislamiento de los hongos, sus características morfológicas y su tiempo de crecimiento, así como la rapidez e Intensidad de la contaminación bacteriana y/o micótica. Se estudiaron 150 muestras de pacientes con sospecha clínica de dermatofitosis y se hicieron 30 reaislamientos de S. schenckiiy 10 de agentes de cromomicosis. Se demostró la utilidad del agar de Kaminski modificado, tanto para el aislamiento como para el reaislamiento de los agentes señalados, a pesar de su mayor índice de contaminación microbiana. Fue, además, útil para el aislamiento de levaduras del género Candida.
Three culture media with different composition (Mycobiotic agar, Kaminski agarand Kaminski agar modified with nystatin were evaluated for isolation of dermatophytes and reisolation of S. schenckiiand dematiaceous fungi. One hundred and fifty specimens of cases suspicious of dermatophytosis, as well as 30 strains of S. schenckiiand 10 of chromoblatomycosis agents were studied. The modified Kaminski agar was efficient for the isolation and reisolation of the tested agents, in spite of Its greater contamination rate; It was equally adequate for isolation of Candida species.
African Journals Online (AJOL)
Timade VENTURE
temperatures (ranging from 300 - 600 C) and particle sizes (ranging from 0.09 - 0.6 mm) were studied on the waste egg-shells. The as-heated powders and processed powders were characterized by photomicrographic analysis, X-ray powder diffraction (XRD), scanning electron microscopy (SEM), and energy dispersive.
Patrón de los motivos EPIYA de cepas cubanas de Helicobacter pylori positivas para CagA
Directory of Open Access Journals (Sweden)
Lino E. Torres
2012-03-01
Conclusión. La mayoría de los aislamientos cubanos presentaron las combinaciones de motivos EPIYA menos virulentas (ABC. Los resultados del empleo de los nuevos cebadores y el análisis de la secuenciación, confirmaron que todas las cepas estudiadas portaban el gen cagA de tipo occidental. Ninguno de los patrones específicos de EPIYA se asoció con úlcera péptica. Este es el primer reporte que muestra la distribución de los motivos EPIYA en los aislamientos de H. pylori de la región del Caribe. DOI: http://dx.doi.org/10.7705/biomedica.v32i1.453
CRUZ COTA, LIZETH RAMONA
2012-01-01
Los hongos entomopatógenos son una alternativa promisoria para el control de plagas agrícolas. En este estudio, se obtuvieron diversos aislamientos nativos de estos microorganismos provenientes de larvas de gallina ciega del género Phyllophaga sp., una de la plagas más importantes del cultivo de maíz en el estado de Guanajuato. En total se obtuvieron 16 aislamientos de hongos entomopatógenos, de los cuales ocho pertenecen a Beauveria bassiana (Bals.) Vuill. y el resto a Meta...
Aislamiento microbiológico de Salmonella spp. y herramientas moleculares para su detección
Directory of Open Access Journals (Sweden)
Jose Gonzalez Pedraza
2014-01-01
Full Text Available Salmonella spp, es uno de los principales agentes causales de intoxicaciones alimentarías a nivel mundial, coloniza a la mayoría de los animales y el ser humano. No es detectable en muestras que tienen un bajo número de células y los métodos tradicionales para su aislamiento tienen baja especificidad, baja sensibilidad y consumen mucho tiempo. Esta revisión presenta un análisis sobre los métodos para la detección de Salmonella spp. y se profundiza en los estudios moleculares encaminados al diagnóstico de este microorganismo de importancia en salud pública. En los últimos años se han desarrollado diferentes protocolos utilizando métodos moleculares para la detección de Salmonella spp. a partir de muestras clínicas y alimentos. Los costos para la detección molecular de Salmonella spp. son elevados en com- paración con los métodos tradicionales, pero la alta sensibilidad y especificidad que ofrece la PCR, los beneficios al sector salud al lograr un diagnóstico rápido y preciso, la relación costo beneficio que otorga al sector productivo permitiendo liberar productos alimenticios al mercado con mayor rapidez, justifican la implementación de estas técnicas. La revisión de las ventajas y desventajas de los métodos microbiológicos tradicionales y moleculares para detectar Salmonella spp. en diferentes matrices, permite establecer la mejor estrategia a seguir en la detección y diagnóstico de microorganismos de difícil aislamiento. Dada la complejidad de las diferentes metodologías que existen para la detección de Salmonella spp, dichas técnicas serán presentadas en forma independiente.
Optimal pcr primers for rapid and accurate detection of Aspergillus flavus isolates.
Al-Shuhaib, Mohammed Baqur S; Albakri, Ali H; Alwan, Sabah H; Almandil, Noor B; AbdulAzeez, Sayed; Borgio, J Francis
2018-03-01
Aspergillus flavus is among the most devastating opportunistic pathogens of several food crops including rice, due to its high production of carcinogenic aflatoxins. The presence of these organisms in economically important rice strip farming is a serious food safety concern. Several polymerase chain reaction (PCR) primers have been designed to detect this species; however, a comparative assessment of their accuracy has not been conducted. This study aims to identify the optimal diagnostic PCR primers for the identification of A. flavus, among widely available primers. We isolated 122 A. flavus native isolates from randomly collected rice strips (N = 300). We identified 109 isolates to the genus level using universal fungal PCR primer pairs. Nine pairs of primers were examined for their PCR diagnostic specificity on the 109 isolates. FLA PCR was found to be the optimal PCR primer pair for specific identification of the native isolates, over aflP(1), aflM, aflA, aflD, aflP(3), aflP(2), and aflR. The PEP primer pair was found to be the most unsuitable for A. flavus identification. In conclusion, the present study indicates the powerful specificity of the FLA PCR primer over other commonly available diagnostic primers for accurate, rapid, and large-scale identification of A. flavus native isolates. This study provides the first simple, practical comparative guide to PCR-based screening of A. flavus infection in rice strips. Copyright © 2018 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Nao Nishida
Full Text Available The DigiTag2 assay enables analysis of a set of 96 SNPs using Kapa 2GFast HotStart DNA polymerase with a new protocol that has a total running time of about 7 hours, which is 6 hours shorter than the previous protocol. Quality parameters (conversion rate, call rate, reproducibility and concordance were at the same levels as when genotype calls were acquired using the previous protocol. Multiplex PCR with 192 pairs of locus-specific primers was available for target preparation in the DigiTag2 assay without the optimization of reaction conditions, and quality parameters had the same levels as those acquired with 96-plex PCR. The locus-specific primers were able to achieve sufficient (concentration of target amplicon ≥5 nM and specific (concentration of unexpected amplicons <2 nM amplification within 2 hours, were also able to achieve detectable amplifications even when working in a 96-plex or 192-plex form. The improved DigiTag2 assay will be an efficient platform for screening an intermediate number of SNPs (tens to hundreds of sites in the replication analysis after genome-wide association study. Moreover, highly parallel and short-acting amplification with locus-specific primers may thus facilitate widespread application to other PCR-based assays.
MCMC-ODPR: Primer design optimization using Markov Chain Monte Carlo sampling
Directory of Open Access Journals (Sweden)
Kitchen James L
2012-11-01
Full Text Available Abstract Background Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR algorithm. Results After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. Conclusions MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.
MCMC-ODPR: primer design optimization using Markov Chain Monte Carlo sampling.
Kitchen, James L; Moore, Jonathan D; Palmer, Sarah A; Allaby, Robin G
2012-11-05
Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR) algorithm. After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.
Directory of Open Access Journals (Sweden)
Laura Errecalde
Full Text Available Describimos el primer caso en Argentina de Staphylococcus aureus resistente a la meticilina adquirido en la comunidad con sensibilidad intermedia a la vancomicina y no sensibilidad a la daptomicina. Caso clínico: Paciente masculino, con antecedente de insuficiencia renal crónica en hemodiálisis y osteosíntesis de cadera debido a una fractura. Se internó por síndrome febril persistente luego del desplazamiento de la prótesis por un traumatismo. Se aisló de hemocultivos S. aureus resistente a la meticilina adquirido en la comunidad. Durante el tratamiento con vancomicina y daptomicina, se observó un aumento gradual de la CIM de vancomicina de 1 µg/ml (VSSA a 2 µg/ml (h-VISA y a 4 µg/ml (VISA, y la emergencia de no sensibilidad a daptomicina (CIM = 4 µg/ml. Al suspender la vancomicina y la daptomicina, la cepa revirtió al fenotipo de sensibilidad a ambas drogas. Es mandatorio evaluar por CIM la sensibilidad a vancomicina y a daptomicina intratratamiento cuando estas drogas se usan como terapia.
Menopause 101: A Primer for the Perimenopausal
... Abstracts Media Award Recipients Media Policy Media Requests Menopause 101: A primer for the perimenopausal The information ... about 2 years earlier. Common Body Changes at Menopause Each woman’s experience of menopause is different. Many ...
The Corrosion Protection of 2219-T87 Aluminum by Organic and Inorganic Zinc-Rich Primers
Danford, M. D.; Mendrek, M. J.; Walsh, D. W.
1995-01-01
The behavior of zinc-rich primer-coated 2219-T87 aluminum in a 3.5-percent Na-Cl was investigated using electrochemical techniques. The alternating current (ac) method of electrochemical impedance spectroscopy (EIS), in the frequency range of 0.001 to 40,000 Hz, and the direct current (dc) method of polarization resistance (PR) were used to evaluate the characteristics of an organic, epoxy zinc-rich primer and an inorganic, ethyl silicate zinc-rich primer. A dc electrochemical galvanic corrosion test was also used to determine the corrosion current of each zinc-rich primer anode coupled to a 2219-T87 aluminum cathode. Duration of the EIS/PR and galvanic testing was 21 days and 24 h, respectively. The galvanic test results demonstrated a very high galvanic current between the aluminum cathode and both zinc-rich primer anodes (37.9 pA/CM2 and 23.7 pA/CM2 for the organic and inorganic primers, respectively). The PR results demonstrated a much higher corrosion rate of the zinc in the inorganic primer than in the organic primer, due primarily to the higher porosity in the former. Based on this investigation, the inorganic zinc-rich primer appears to provide superior galvanic protection and is recommended for additional study for application in the solid rocket booster aft skirt.
Directory of Open Access Journals (Sweden)
Lenne Jilliam M.
1986-06-01
Full Text Available Se encontró considerable variación en el crecimiento, color, zonificación, esclerocios, textura del micelio y en la virulencia de siete aislamientos de R. solani. Como seis aislamientos fueron multinucleados y uno binucleado, se demostró que es indispensable determinar ésta característica en ensayos con R. solani. Los aislamientos se ubicaron en los grupos de anastomosis AG -1, AG-2, AG-4; pero en los ensayos con electroforesis de isoenzirnas los modelos de bandas para los a islamientos probadores de los AG y los probados en éste estudio fueron diferentes, lo que llevó a cuestionar la importancia de los AG. Los ecotípos de Centrosema spp y P. phaseoloides fueron más afectados que los de S. guianensis, D. ovalifolium y S. capitata. La reacción al daño de R. solani fue diferencial en los ecotipos CIAT 1283 (tardío y 184 (común y tuvo mucha relación con la edad; en general, la enfermedad se incrementó con la edad en el eco tipo tardío y disminuyó con ésta o fue independiente en el ecotipo común; el ecotipo más fectado fue el tardío; las pérdidas de forraje no fueron considerables, pero el efecto en la digestibilidad fue notorio; la capacidad de rebrote fue buena en 184. Se observó un estímulo en el crecimiento de las plantas de S.guianensis y D. ovalifolium.Considerable variation was found in the growth, color, zonation, sclerotia, mycelial texture and virulence of seven isolates of R. solani. Six multinuclease and one binuclease isolates were determined, demonstrating that it is indispensable to determine this characteristic in trials with this pathogen. The isolates were placed in three anastomosis group AG -1, AG -2 and AG -4; but with electrophoresis of isoenzymes it was found that the band models were different for the known rest AG iso lates and those isolates proven in this study which questions the importance of anastomosis qroups. Ecotypes of Centrosema spp. and P. phaseoloides were more affected than those of S
Aspectos económicos del aislamiento acústico
Directory of Open Access Journals (Sweden)
Amarilla, Beatriz C.
1990-12-01
Full Text Available The general objective of this study was to analyze the soundproofing/cost ratio with different building alternatives for interior walls and floors.
This technical-economic study was divided into three parts:
— Dividing walls (environmental noises
— Floors (impact noises
— Special Solutions (double walls, floating floors, etcetera
The results show that in developing countries the most costly solutions are not always the best for housing, as far as soundproofing is concerned. A good knowledge of the economic aspects related to this matter allows obtaining a good quality at a moderate cost, which is a priority in this type of country.
El objetivo general de este trabajo fue el de analizar el comportamiento de la relación costo-aislamiento acústico en soluciones constructivas alternativas para muros interiores y entrepisos.
Este estudio técnico-económico comprende tres partes:
* Muros divisorios (ruidos aéreos.
* Entrepisos (ruidos de impacto.
* Soluciones especiales (muros de doble hoja, pisos flotantes,
etc.
Se llega a la conclusión que, en los países en desarrollo, no siempre las mejores soluciones para la vivienda, desde el punto de vista acústico, son las de mayor costo. Conocer en profundidad los aspectos económicos de esta cuestión significa poder lograr una buena calidad con costos moderados, lo cual constituye una prioridad en este tipo de países.
Directory of Open Access Journals (Sweden)
Martin Beránek
2012-01-01
Full Text Available Dideoxynucleotide DNA sequencing is one of the principal procedures in molecular biology. Loss of an initial part of nucleotides behind the 3' end of the sequencing primer limits the readability of sequenced amplicons. We present a method which extends the readability by using sequencing primers modified by polyadenylated tails attached to their 5' ends. Performing a polymerase chain reaction, we amplified eight amplicons of six human genes (AMELX, APOE, HFE, MBL2, SERPINA1 and TGFB1 ranging from 106 bp to 680 bp. Polyadenylation of the sequencing primers minimized the loss of bases in all amplicons. Complete sequences of shorter products (AMELX 106 bp, SERPINA1 121 bp, HFE 208 bp, APOE 244 bp, MBL2 317 bp were obtained. In addition, in the case of TGFB1 products (366 bp, 432 bp, and 680 bp, respectively, the lengths of sequencing readings were significantly longer if adenylated primers were used. Thus, single strand dideoxynucleotide sequencing with adenylated primers enables complete or near complete readability of short PCR amplicons.
Multiplexing Short Primers for Viral Family PCR
Energy Technology Data Exchange (ETDEWEB)
Gardner, S N; Hiddessen, A L; Hara, C A; Williams, P L; Wagner, M; Colston, B W
2008-06-26
We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets for large, diverse, and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers ({approx}3700 18-mers or {approx}2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and for several diverse species such as foot-and-mouth disease virus, hemagglutinin and neuraminidase segments of influenza A virus, Norwalk virus, and HIV-1.
KENO V.a Primer: A Primer for Criticality Calculations with SCALE/KENO V.a Using CSPAN for Input
International Nuclear Information System (INIS)
Busch, R.D.
2003-01-01
The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory (ORNL) is widely used and accepted around the world for criticality safety analyses. The well-known KENO V.a three-dimensional Monte Carlo criticality computer code is the primary criticality safety analysis tool in SCALE. The KENO V.a primer is designed to help a new user understand and use the SCALE/KENO V.a Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO V.a in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO V.a that are useful in criticality analyses. The primer is based on SCALE 4.4a, which includes the Criticality Safety Processor for Analysis (CSPAN) input processor for Windows personal computers (PCs). A second edition of the primer, which uses the new KENO Visual Editor, is currently under development at ORNL and is planned for publication in late 2003. Each example in this first edition of the primer uses CSPAN to provide the framework for data input. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO V.a input and allows the user to quickly run a simple criticality problem with SCALE/KENO V.a. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO V.a features which are covered in detail in the example problems in that section. Upon completion of the primer, a new user should be comfortable using CSPAN to set up criticality problems in SCALE/KENO V.a
Primer on spontaneous heating and pyrophoricity
Energy Technology Data Exchange (ETDEWEB)
1994-12-01
This primer was prepared as an information resource for personnel responsible for operation of DOE nuclear facilities. It has sections on combustion principles, spontaneous heating/ignition of hydrocarbons and organics, pyrophoric gases and liquids, pyrophoric nonmetallic solids, pyrophoric metals (including Pu and U), and accident case studies. Although the information in this primer is not all-encompassing, it should provide the reader with a fundamental knowledge level sufficient to recognize most spontaneous combustion hazards and how to prevent ignition and widespread fires. This primer is provided as an information resource only, and is not intended to replace any fire protection or hazardous material training.
Identification of E. coli O157:H7 by Using Specific Primers for rfbE and stx2b Genes
Directory of Open Access Journals (Sweden)
Mostafa Bakhshi
2017-07-01
Sorbitol-MacConkey agar was used to verification of growth ability of selected colonies during PCR. Results: By appearance of the bonds belong to rfbE and stx2B genes on agarose gel, the ability of designed primers in gene detection in samples of E .coli O157:H7 was verified. Colonies which selected during PCR have growth potency on sorbitol-MacConkey agar medium. Conclusion: It was revealed that we can prepare a fast, precise and relative comfortable method for detection of E. coli O157:H7 strain by using PCR technique and specific primers than other available methods.
30 CFR 57.6304 - Primer protection.
2010-07-01
... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 57.6304 Section 57.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Transportation-Surface and Underground § 57.6304 Primer protection. (a) Tamping shall not be done directly on a...
Directory of Open Access Journals (Sweden)
Uğur ÇAPULCUOĞLU
2013-04-01
Full Text Available ÖZETBu araştırma, Maslach Tükenmişlik modeli çerçevesinde, stresle başaçıkma, sınav kaygısı, akademik yetkinlik ve anne-baba tutumları değişkenlerinin lise öğrencilerinin tükenmişlik düzeylerini yordamadaki katkılarını incelemek amacıyla gerçekleştirilmiştir. 1385 lise öğrencisinin katıldığı araştırmada, Maslach Tükenmişlik Envanteri-Öğrenci Formu (MTE-ÖF, “Stresle Başa Çıkma Tarzları Ölçeği”, “Sınav Kaygısı Envanteri”, “Ergenlerde Yetkinlik Beklentisi Ölçeği” ve “Ana Baba Tutum Envanteri” kullanılmıştır. Öğrencilerin tükenmişlik düzeylerinin stresle başaçıkma, sınav kaygısı, akademik yetkinlik ve anne-baba tutumlarının yordayıp yordamadığını belirlemek amacıyla, çoklu regresyon analizi yapılmıştır. Bulgular; akademik yetkinliğin tükenmenin % 14’ünü, duyarsızlaşmanın % 10’unu ve yetkinliğin ise % 20’sini açıkladığını göstermiştir. Bu değişkenin yanı sıra, tükenme alt boyutunda olumlu stresle başaçıkma ve sınav kaygısının; duyarsızlaşma alt boyutunda olumsuz stresle başaçıkma ve sınav kaygısının; yetkinlik alt boyutunda ise sosyal destek arama yaklaşımı ve demokratik ana-baba tutumlarının önemli yordayıcılar olduğu belirlenmiştir.
Lizzie Karen Becerra Gutiérrez; María Valeria Horna Acevedo
2016-01-01
Los biosurfactantes son moléculas anfipáticas que reducen la tensión en la interfase, incrementando así la solubilidad en agua y disponibilidad de compuestos orgánicos, son producidos por bacterias, hongos, y levaduras. Para el aislamiento de bacterias productoras de biosurfactante y lipasas, se sembró en medios inductores 10% de efluentes residuales procedentes de camales y suelos de grifos contaminados con hidrocarburos de la Provincia de Trujillo - Perú. Los cultivos aislados se sembraron ...
Directory of Open Access Journals (Sweden)
María A. Jure
2011-03-01
Full Text Available En los últimos años, algunas enterobacterias como Klebsiella pneumoniae, Proteus mirabilis y Escherichia coli adquirieron resistencia a las cefalosporinas de tercera generación (C3G por la adquisición de ß-lactamasas de tipo AmpC plasmídicas, mecanismo que se está comunicando cada vez con mayor frecuencia en el mundo. El objetivo de esta investigación fue detectar la emergencia de ß-lactamasas AmpC plasmídicas en Tucumán e identificar sus tipos predominantes. Se estudió la sensibilidad a diferentes antimicrobianos de 733 aislamientos clínicos consecutivos de enterobacterias obtenidos en el período marzo-julio de 2009 en tres centros asistenciales de nuestra provincia. Se realizaron pruebas de sensibilidad por difusión y se seleccionaron tres aislamientos de E. coli y uno de P. mirabilis resistentes a C3G y a cefoxitina. En estos aislamientos se determinó la CIM por E-test y se evaluó el mecanismo enzimático de resistencia mediante sinergia con discos de ácido aminofenilborónico y ensayo microbiológico de Masuda. Se realizó PCR usando cebadores dirigidos al grupo CIT de las AmpC plasmídicas. Se obtuvo un amplicón de 462 pb que fue secuenciado; presentó un 100% de identidad con blaCMY-2 en los cuatro aislamientos. En conclusión, las ß-lactamasas AmpC tipo CMY-2 emergieron en nuestro medio, de modo que es importante implementar una vigilancia sistemática de estas resistencias para evitar potenciales consecuencias clínicas y epidemiológicas.In the last years, Enterobacteriaceae such as Klebsiella pneumoniae, Proteus mirabilis and Escherichia coli, have acquired resistance to third-generation cephalosporins (C3G because of the presence of plasmid-mediated AmpC ß-lactamases. The aim of this work was to detect plasmid AmpC enzymes and to investigate the predominant types in our region. Between March and July 2009, 733 consecutive isolates of Enterobacteriaceae derived from hospitals and outpatient centers were studied
Scrimer: designing primers from transcriptome data
Czech Academy of Sciences Publication Activity Database
Mořkovský, Libor; Pačes, Jan; Rídl, Jakub; Reifová, R.
2015-01-01
Roč. 15, č. 6 (2015), s. 1415-1420 ISSN 1755-098X R&D Projects: GA MŠk EE2.3.20.0303 Institutional support: RVO:68081766 ; RVO:68378050 Keywords : next-generation sequencing * primer design * SNaPshot * SNP genotyping * transcriptome Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 5.298, year: 2015
Directory of Open Access Journals (Sweden)
V. López
2006-12-01
Full Text Available Listeria monocytogenes es un patógeno humano que se transmite a través de los alimentos y que causa infecciones graves, con una alta tasa de mortalidad. A pesar de la ubicuidad del microorganismo, la tasa real de la enfermedad es bastante baja y se asocia casi siempre a condiciones predisponentes. Tradicionalmente se consideraba que los aislamientos presentes en los alimentos y en el ambiente tenían la misma capacidad patogénica que los aislamientos de origen clínico. Pero el análisis de mutaciones en los genes de determinados factores de virulencia (internalina, hemolisina, fosfolipasas, proteína de superficie ActA y proteína reguladora PrfA, los estudios cuantitativos realizados con cultivos celulares y la genética de poblaciones, están replanteando la discusión sobre la variabilidad de la virulencia de L. monocytogenes. A pesar de todos estos avances, no existe un único marcador que permita comprobar la virulencia de los aislamientos naturales de esta especie. Probablemente en el futuro, la combinación de diferentes marcadores moleculares permitirá detectar los alimentos contaminados sólo por los clones virulentos de L. monocytogenes, con lo que se mejorará la prevención de la listeriosis humana transmitida por alimentos.Listeria monocytogenes is a foodborne human pathogen responsible for invasive infections presenting overall a high mortality. Despite the ubiquity of the microorganism, the actual disease rate is quite low and the disease is most often associated with an underlying predisposition. Foodborne and environmental isolates were traditionally considered of similar pathogenicity compared to clinical isolates. But the analysis of mutations in the genes encoding specific virulence factors (internalin, hemolysin, phospholipases, surface protein ActA and regulator protein PrfA, quantitative studies with cell cultures and population genetics have raised considerable concerns about virulence differences among L
Comparison of shear bond strength of orthodontic brackets using various zirconia primers.
Lee, Ji-Yeon; Kim, Jin-Seok; Hwang, Chung-Ju
2015-07-01
The aim of this study was to compare the shear bond strength (SBS) of orthodontic brackets bonded to zirconia surfaces using three different zirconia primers and one silane primer, and subjected to thermocycling. We designed 10 experimental groups following the surface treatment and thermocycling. The surface was treated with one of the following method: no-primer (NP), Porcelain Conditioner (PC), Z-PRIME Plus (ZP), Monobond Plus (MP) and Zirconia Liner Premium (ZL) (n=20). Then each group was subdivided to non-thermocycled and thermocycled groups (NPT, PC, ZPT, MPT, ZLT) (n=10). Orthodontic brackets were bonded to the specimens using Transbond™ XT Paste and light cured for 15 s at 1,100 mW/cm(2). The SBS was measured at a 1 mm/min crosshead speed. The failure mode was assessed by examination with a stereomicroscope and the amount of bonding resin remaining on the zirconia surface was scored using the modified adhesive remnant index (ARI). The SBS of all experimental groups decreased after thermocycling. Before thermocycling, the SBS was ZL, ZP ≥ MP ≥ PC > NP but after thermocycling, the SBS was ZLT ≥ MPT ≥ ZPT > PCT = NPT (p > 0.05). For the ARI score, both of the groups lacking primer (NP and NPT) displayed adhesive failure modes, but the groups with zirconia primers (ZP, ZPT, MP, MPT, ZL, and ZLT) were associated with mixed failure modes. Surface treatment with a zirconia primer increases the SBS relative to no-primer or silane primer application between orthodontic brackets and zirconia prostheses.
β-aminobutyric acid mediated drought stress alleviation in maize (Zea mays L.).
Shaw, Arun K; Bhardwaj, Pardeep K; Ghosh, Supriya; Roy, Sankhajit; Saha, Suman; Sherpa, Ang R; Saha, Samir K; Hossain, Zahed
2016-02-01
The present study highlights the role of β-aminobutyric acid (BABA) in alleviating drought stress effects in maize (Zea mays L.). Chemical priming was imposed by pretreating 1-week-old plants with 600 μM BABA prior to applying drought stress. Specific activities of key antioxidant enzymes and metabolites (ascorbate and glutathione) levels of ascorbate-glutathione cycle were studied to unravel the priming-induced modulation of plant defense system. Furthermore, changes in endogenous ABA and JA concentrations as well as mRNA expressions of key genes involved in their respective biosynthesis pathways were monitored in BABA-primed (BABA+) and non-primed (BABA-) leaves of drought-challenged plants to better understand the mechanistic insights into the BABA-induced hormonal regulation of plant response to water-deficit stress. Accelerated stomatal closure, high relative water content, and less membrane damage were observed in BABA-primed leaves under water-deficit condition. Elevated APX and SOD activity in non-primed leaves found to be insufficient to scavenge all H2O2 and O2 (·-) resulting in oxidative burst as evident after histochemical staining with NBT and DAB. A higher proline accumulation in non-primed leaves also does not give much protection against drought stress. Increased GR activity supported with the enhanced mRNA and protein expressions might help the BABA-primed plants to maintain a high GSH pool essential for sustaining balanced redox status to counter drought-induced oxidative stress damages. Hormonal analysis suggests that in maize, BABA-potentiated drought tolerance is primarily mediated through JA-dependent pathway by the activation of antioxidant defense systems while ABA biosynthesis pathway also plays an important role in fine-tuning of drought stress response.
Rust transformation/rust compatible primers
Emeric, Dario A.; Miller, Christopher E.
1993-01-01
Proper surface preparation has been the key to obtain good performance by a surface coating. The major obstacle in preparing a corroded or rusted surface is the complete removal of the contaminants and the corrosion products. Sandblasting has been traditionally used to remove the corrosion products before painting. However, sandblasting can be expensive, may be prohibited by local health regulations and is not applicable in every situation. To get around these obstacles, Industry developed rust converters/rust transformers and rust compatible primers (high solids epoxies). The potential use of these products for military equipment led personnel of the Belvoir Research, Development and Engineering Center (BRDEC) to evaluate the commercially available rust transformers and rust compatible primers. Prior laboratory experience with commercially available rust converters, as well as field studies in Hawaii and Puerto Rico, revealed poor performance, several inherent limitations, and lack of reliability. It was obvious from our studies that the performance of rust converting products was more dependent on the amount and type of rust present, as well as the degree of permeability of the coating, than on the product's ability to form an organometallic complex with the rust. Based on these results, it was decided that the Military should develop their own rust converter formulation and specification. The compound described in the specification is for use on a rusted surface before the application of an organic coating (bituminous compounds, primer or topcoat). These coatings should end the need for sandblasting or the removing of the adherent corrosion products. They also will prepare the surface for the application of the organic coating. Several commercially available rust compatible primers (RCP) were also tested using corroded surfaces. All of the evaluated RCP failed our laboratory tests for primers.
An iterative method for selecting degenerate multiplex PCR primers.
Souvenir, Richard; Buhler, Jeremy; Stormo, Gary; Zhang, Weixiong
2007-01-01
Single-nucleotide polymorphism (SNP) genotyping is an important molecular genetics process, which can produce results that will be useful in the medical field. Because of inherent complexities in DNA manipulation and analysis, many different methods have been proposed for a standard assay. One of the proposed techniques for performing SNP genotyping requires amplifying regions of DNA surrounding a large number of SNP loci. To automate a portion of this particular method, it is necessary to select a set of primers for the experiment. Selecting these primers can be formulated as the Multiple Degenerate Primer Design (MDPD) problem. The Multiple, Iterative Primer Selector (MIPS) is an iterative beam-search algorithm for MDPD. Theoretical and experimental analyses show that this algorithm performs well compared with the limits of degenerate primer design. Furthermore, MIPS outperforms an existing algorithm that was designed for a related degenerate primer selection problem.
Bioinformatic tools and guideline for PCR primer design | Abd ...
African Journals Online (AJOL)
Bioinformatics has become an essential tool not only for basic research but also for applied research in biotechnology and biomedical sciences. Optimal primer sequence and appropriate primer concentration are essential for maximal specificity and efficiency of PCR. A poorly designed primer can result in little or no ...
Aislamiento de algas del embalse del Neusa por medio de cultivos In Vitro
Directory of Open Access Journals (Sweden)
A. Maldonado
2000-07-01
Full Text Available EI cultivo de algas a nivel mundial es un oficio de vieja data, pero en Colombia se encuentra en sus primeras etapas de desarrollo. El presente trabajo desarrollado en el Laboratorio de Bioensayos, Departamento de Biología, Universidad Nacional de Colombia está encaminado a aportar técnicas en el desarrollo del cultivo de algas. En la parte practica del trabajo se utilizaron muestras de agua del embalse del Neusa las cuales se cultivaron en medios líquido y solido. Se observo un mejor crecimiento de cianofíceas filamentosas en medio solido y algas verdes en medio líquido. Las clamidomonas se ven favorecidas en ambos medios, hecho que permitió aislar una sepa pura de este tipo de algas. Las diatorneas por el hecho de crecer en relación con algas verdes generan un problema metodológico para su aislamiento, que aun se encuentra sin resolver.
Directory of Open Access Journals (Sweden)
Adriana Idalina Torcato de Oliveira
2016-01-01
Full Text Available Babaçu (A. speciosa, Buriti (M. flexuosa, and Macaúba (A. aculeata are palm trees typical of the ecotone area between Cerrado and the Amazon rainforest. The purpose of this study was to evaluate the antimicrobial potential of the extracts prepared from the leaves of those palms as well as determine their chemical compositions. The ethanol extracts were prepared in a Soxhlet apparatus and tested by disk diffusion and agar dilution technique against Staphylococcus aureus, Enterococcus faecalis, Escherichia coli, Pseudomonas aeruginosa, Candida albicans, and Candida parapsilosis. However, there was no significant activity at concentrations of 25, 50, and 100 mg·Ml−1. Moreover, the phytochemical analysis revealed the presence of tannins, flavonoids, catechins, steroids, triterpenes, and saponins. Gas chromatography (GC/MS analysis also identified organic acids, such as capric (decanoic acid, lauric (dodecanoic acid, myristic (tetradecanoic acid, phthalic (1,2-benzenedicarboxylic acid, palmitic (hexadecanoic acid, stearic (octadecanoic acid, linoleic (9,12-octadecadienoic acid (omega-6, linolenic (octadecatrienoic acid (omega-3, and the terpenes citronellol and phytol. Based on the chemical composition in the palm leaf extracts, the palms have the potential to be useful in the food, cosmetic, and pharmaceutical industries.
Stielow, J B; Lévesque, C A; Seifert, K A; Meyer, W; Iriny, L; Smits, D; Renfurm, R; Verkley, G J M; Groenewald, M; Chaduli, D; Lomascolo, A; Welti, S; Lesage-Meessen, L; Favel, A; Al-Hatmi, A M S; Damm, U; Yilmaz, N; Houbraken, J; Lombard, L; Quaedvlieg, W; Binder, M; Vaas, L A I; Vu, D; Yurkov, A; Begerow, D; Roehl, O; Guerreiro, M; Fonseca, A; Samerpitak, K; van Diepeningen, A D; Dolatabadi, S; Moreno, L F; Casaregola, S; Mallet, S; Jacques, N; Roscini, L; Egidi, E; Bizet, C; Garcia-Hermoso, D; Martín, M P; Deng, S; Groenewald, J Z; Boekhout, T; de Beer, Z W; Barnes, I; Duong, T A; Wingfield, M J; de Hoog, G S; Crous, P W; Lewis, C T; Hambleton, S; Moussa, T A A; Al-Zahrani, H S; Almaghrabi, O A; Louis-Seize, G; Assabgui, R; McCormick, W; Omer, G; Dukik, K; Cardinali, G; Eberhardt, U; de Vries, M; Robert, V
2015-12-01
The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic markers were tested across > 1 500 species (1 931 strains or specimens) and the outcomes of almost twenty thousand (19 577) polymerase chain reactions were evaluated. We tested several well-known primer pairs that amplify: i) sections of the nuclear ribosomal RNA gene large subunit (D1-D2 domains of 26/28S); ii) the complete internal transcribed spacer region (ITS1/2); iii) partial β -tubulin II (TUB2); iv) γ-actin (ACT); v) translation elongation factor 1-α (TEF1α); and vi) the second largest subunit of RNA-polymerase II (partial RPB2, section 5-6). Their PCR efficiencies were compared with novel candidate primers corresponding to: i) the fungal-specific translation elongation factor 3 (TEF3); ii) a small ribosomal protein necessary for t-RNA docking; iii) the 60S L10 (L1) RP; iv) DNA topoisomerase I (TOPI); v) phosphoglycerate kinase (PGK); vi) hypothetical protein LNS2; and vii) alternative sections of TEF1α. Results showed that several gene sections are accessible to universal primers (or primers universal for phyla) yielding a single PCR-product. Barcode gap and multi-dimensional scaling analyses revealed that some of the tested candidate markers have universal properties providing adequate infra- and inter-specific variation that make them attractive barcodes for species identification. Among these gene sections, a novel high fidelity primer pair for TEF1α, already widely used as a phylogenetic marker in mycology, has potential as a supplementary DNA barcode with superior resolution to ITS. Both TOPI and PGK show promise for the Ascomycota, while TOPI and LNS2 are attractive for the Pucciniomycotina, for which universal primers for ribosomal subunits often fail.
Screening for Residual Disease in Pediatric Burkitt Lymphoma Using Consensus Primer Pools
Directory of Open Access Journals (Sweden)
Melissa Agsalda
2009-01-01
Full Text Available Assessing molecular persistent or minimal residual disease (PD/MRD in childhood Burkitt lymphoma (BL is challenging because access to original tumor is usually needed to design patient-specific primers (PSPs. Because BL is characterized by rearranged immunoglobulin heavy chain (IgVH genes, IgVH primer pools from IgVH1–IgVH7 regions were tested to detect PD/MRD, thus eliminating the need for original tumor. The focus of the current study was to assess the feasibility of using IgVH primer pools to detect disease in clinical specimens. Fourteen children diagnosed with B-NHL had follow-up repository specimens available to assess PD/MRD. Of the 14 patients, 12 were PD/MRD negative after 2 months of therapy and remained in remission at the end of therapy; 2/14 patients were PD/MRD positive at 2-3 months and later relapsed. PSP-based assays from these 14 patients showed 100% concordance with the current assay. This feasibility study warrants further investigation to assess PD/MRD using IgVH primer pools, which could have clinical significance as a real-time assessment tool to monitor pediatric BL and possibly other B-cell non-Hodgkin lymphoma therapy.
Screening for residual disease in pediatric burkitt lymphoma using consensus primer pools.
Agsalda, Melissa; Kusao, Ian; Troelstrup, David; Shiramizu, Bruce
2009-01-01
Assessing molecular persistent or minimal residual disease (PD/MRD) in childhood Burkitt lymphoma (BL) is challenging because access to original tumor is usually needed to design patient-specific primers (PSPs). Because BL is characterized by rearranged immunoglobulin heavy chain (IgV(H)) genes, IgV(H) primer pools from IgV(H1)-IgV(H7) regions were tested to detect PD/MRD, thus eliminating the need for original tumor. The focus of the current study was to assess the feasibility of using IgV(H) primer pools to detect disease in clinical specimens. Fourteen children diagnosed with B-NHL had follow-up repository specimens available to assess PD/MRD. Of the 14 patients, 12 were PD/MRD negative after 2 months of therapy and remained in remission at the end of therapy; 2/14 patients were PD/MRD positive at 2-3 months and later relapsed. PSP-based assays from these 14 patients showed 100% concordance with the current assay. This feasibility study warrants further investigation to assess PD/MRD using IgV(H) primer pools, which could have clinical significance as a real-time assessment tool to monitor pediatric BL and possibly other B-cell non-Hodgkin lymphoma therapy.
Simple sequence repeat marker loci discovery using SSR primer.
Robinson, Andrew J; Love, Christopher G; Batley, Jacqueline; Barker, Gary; Edwards, David
2004-06-12
Simple sequence repeats (SSRs) have become important molecular markers for a broad range of applications, such as genome mapping and characterization, phenotype mapping, marker assisted selection of crop plants and a range of molecular ecology and diversity studies. With the increase in the availability of DNA sequence information, an automated process to identify and design PCR primers for amplification of SSR loci would be a useful tool in plant breeding programs. We report an application that integrates SPUTNIK, an SSR repeat finder, with Primer3, a PCR primer design program, into one pipeline tool, SSR Primer. On submission of multiple FASTA formatted sequences, the script screens each sequence for SSRs using SPUTNIK. The results are parsed to Primer3 for locus-specific primer design. The script makes use of a Web-based interface, enabling remote use. This program has been written in PERL and is freely available for non-commercial users by request from the authors. The Web-based version may be accessed at http://hornbill.cspp.latrobe.edu.au/
Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen
2015-09-01
Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.
Value for money assessment for public-private partnerships : a primer.
2015-01-01
This primer addresses Value for Money Assessment for public-private partnerships (P3s). Companion : primers on Financial Assessment and Risk Assessment for P3s are also available as part of this series of : primers.
Single primer amplification reaction methods reveal exotic and ...
Indian Academy of Sciences (India)
Unknown
mulberry varieties using three different PCR based single primer amplification ..... the results of a multi- variate analysis using Mahalanobis D2 statistic in case of .... Rajan M V, Chaturvedi H K and Sarkar A 1997 Multivariate analysis as an aid ...
Directory of Open Access Journals (Sweden)
C. A. Lopes
2009-09-01
Full Text Available Yeasts belonging to the genus Dekkera/Brettanomyces, especially the species Dekkera bruxellensis, have long been associated with the production of volatile phenols responsible for off-flavour in wines. According to recent reports, the species Pichia guilliermondii could also produce these compounds at the initial stages of fermentation. Based on the abundance of P. guilliermondii in Patagonian winemaking, we decided to study the relevance of indigenous isolates belonging to this species as wine spoilage yeast. Twenty-three indigenous isolates obtained from grape surfaces and red wine musts were analyzed in their capacity to produce volatile phenols on grape must. The relationship between molecular Random Amplified Polymorphic DNA (RAPD and physiological (killer biotype patterns detected in indigenous populations of P. guilliermondii and volatile phenol production was also evaluated. Different production levels of 4-ethylphenol, 4-vinylguaiacol and 4-ethylguaiacol were detected among the isolates; however, the values were always lower than those produced by the D. bruxellensis reference strain in the same conditions. High levels of 4-vinylphenol were detected among P. guilliermondii indigenous isolates. The combined use of RAPD and killer biotype allowed us to identify the isolates producing the highest volatile phenol levels.Las levaduras del género Dekkera/Brettanomyces, sobre todo la especie Dekkera bruxellensis, siempre han sido asociadas con la producción de fenoles volátiles responsables de aromas desagradables en los vinos. Recientemente, se ha demostrado que la especie Pichia guilliermondii también es capaz de producir estos compuestos, particularmente durante las etapas iniciales de la fermentación. Dada la abundancia de P. guilliermondii en las bodegas de la Patagonia, se decidió evaluar la importancia de algunos aislamientos indígenas de esta especie como levaduras alterantes de vinos regionales. Se evaluó la capacidad de
Economics : pricing, demand, and economic efficiency : a primer.
2008-11-01
The Congestion Pricing Primer Series is part of : FHWAs outreach efforts to introduce the various : aspects of congestion pricing to decision-makers and : transportation professionals in the United States. The : primers are intended to lay out the...
Antoniou, Grigoris; Harmelen, Frank van
2004-01-01
The development of the Semantic Web, with machine-readable content, has the potential to revolutionize the World Wide Web and its use. A Semantic Web Primer provides an introduction and guide to this still emerging field, describing its key ideas, languages, and technologies. Suitable for use as a
Atrisco-Morales, Josefina; Martínez-Santos, Verónica I; Román-Román, Adolfo; Alarcón-Millán, Judit; De Sampedro-Reyes, José; Cruz-Del Carmen, Iván; Martínez-Carrillo, Dinorah N; Fernández-Tilapa, Gloria
2018-03-01
Virulent genotypes of Helicobacter pylori vacA s1m1/cagA + /babA2 + have been associated with severe gastric diseases. VacA, CagA and BabA are polymorphic proteins, and their association with the disease is allele-dependent. The aims of this work were: (i) to determine the prevalence of H. pylori by type of chronic gastritis; (ii) to describe the frequency of cagA, babA2 and vacA genotypes in strains from patients with different types of chronic gastritis; (iii) to characterize the variable region of cagA alleles. A total of 164 patients with chronic gastritis were studied. Altogether, 50 H. pylori strains were isolated, and the status of cagA, babA2 and vacA genotypes was examined by PCR. cagA EPIYA segment identification was performed using PCR and sequencing of cagA fragments of six randomly selected strains.Results/Key findings. The overall prevalence of H. pylori was 30.5 %. Eighty percent of the isolated strains were vacA s1m1, and the cagA and babA2 genes were detected in 74 and 32 % of the strains, respectively. The most frequent genotypes were vacA s1m1/cagA + /babA2 - and vacA s1m1/cagA + /babA2 + , with 40 % (20/50) and 28 % (14/50), respectively. In cagA + , the most frequent EPIYA motif was -ABC (78.4 %), and EPIYA-ABCC and -ABCCC motifs were found in 10.8 % of the strains. A modified EPIYT-B motif was found in 66.6 % of the sequenced strains. H. pylori strains carrying vacA s1m1, cagA + and babA2 - genotypes were the most prevalent in patients with chronic gastritis from the south of Mexico. In the cagA + strains, the EPIYA-ABC motif was the most common.
DEFF Research Database (Denmark)
Hansen, A C; Grunwald, T; Lund, Anders Henrik
2001-01-01
could be obtained by cotransfection of a gene for an engineered tRNA(Pro)-tRNA hybrid with a match to PBS-Pro. The importance of tRNA backbone identity was further analyzed by complementing the PBS-X2 vector with a gene for a matching x2 primer with a tRNA backbone, which led to three- to fourfold...
Energy Technology Data Exchange (ETDEWEB)
Dan Arthur; Bruce Langhus; Jon Seekins
2005-05-25
During the second half of the 1990's Coal Bed Methane (CBM) production increased dramatically nationwide to represent a significant new source of income and natural gas for many independent and established producers. Matching these soaring production rates during this period was a heightened public awareness of environmental concerns. These concerns left unexplained and under-addressed have created a significant growth in public involvement generating literally thousands of unfocused project comments for various regional NEPA efforts resulting in the delayed development of public and fee lands. The accelerating interest in CBM development coupled to the growth in public involvement has prompted the conceptualization of this project for the development of a CBM Primer. The Primer is designed to serve as a summary document, which introduces and encapsulates information pertinent to the development of Coal Bed Methane (CBM), including focused discussions of coal deposits, methane as a natural formed gas, split mineral estates, development techniques, operational issues, producing methods, applicable regulatory frameworks, land and resource management, mitigation measures, preparation of project plans, data availability, Indian Trust issues and relevant environmental technologies. An important aspect of gaining access to federal, state, tribal, or fee lands involves education of a broad array of stakeholders, including land and mineral owners, regulators, conservationists, tribal governments, special interest groups, and numerous others that could be impacted by the development of coal bed methane. Perhaps the most crucial aspect of successfully developing CBM resources is stakeholder education. Currently, an inconsistent picture of CBM exists. There is a significant lack of understanding on the parts of nearly all stakeholders, including industry, government, special interest groups, and land owners. It is envisioned the Primer would being used by a variety of
International Nuclear Information System (INIS)
Zhan Fangfang; Zhou Xiaoming; Xing Da
2013-01-01
Graphical abstract: In this work, we have developed and demonstrated a magnetic primer based RT-PCR assay for ECL detection of rotavirus. In the presence of two functional primers (magnetic primer and TBR-primer) and PCR reagents, cDNA from RT was amplified directly onto MPs during PCR cycles of denaturation, annealing and extension. The resulting MPs–TBR complexes were easily loaded on the electrode surface and produced a concentrated ECL signal. The figure shows the schematic illustration of magnetic primer RT-PCR based ECL assay for rotavirus detection. Highlights: ► A novel method for detection of rotavirus has been developed. ► In the presence of magnetic primer, TBR-primer and PCR reagents, cDNA form RT was amplified directly onto MPs. ► To obtain the best sensing and efficient performance, important parameters associated with the efficiency were investigated carefully. ► The proposed method will find numerous applications in food safety field and clinical diagnosis. - Abstract: A novel method for detection of rotavirus has been developed by integrating magnetic primer based reverse transcription-polymerase chain reaction (RT-PCR) with electrochemiluminescence (ECL) detection. This is realized by accomplishing RT of rotavirus RNA in traditional way and performing PCR of the resulting cDNA fragment on the surface of magnetic particles (MPs). In order to implement PCR on MPs and achieve rapid ECL detection, forward and reverse primers are bounded to MPs and tris-(2,2′-bipyridyl) ruthenium (TBR), respectively. After RT-PCR amplification, the TBR labels are directly enriched onto the surface of MPs. Then the MPs–TBR complexes can be loaded on the electrode surface and analyzed by magnetic ECL platform without any post-modification or post-incubation process. So some laborious manual operations can be avoided to achieve rapid yet sensitive detection. In this study, rotavirus in fecal specimens was successfully detected within 1.5 h. Experimental
Directory of Open Access Journals (Sweden)
Yunpeng Zhong
Full Text Available Priming can improve plant innate capability to deal with the stresses caused by both biotic and abiotic factors. In this study, the effect of DL-β-amino-n-butyric acid (BABA against Aphis glycines Matsumura, the soybean aphid (SA was evaluated. We found that 25 mM BABA as a root drench had minimal adverse impact on plant growth and also efficiently protected soybean from SA infestation. In both choice and non-choice tests, SA number was significantly decreased to a low level in soybean seedlings drenched with 25 mM BABA compared to the control counterparts. BABA treatment resulted in a significant increase in the activities of several defense enzymes, such as phenylalanine ammonia-lyase (PAL, peroxidase (POX, polyphenol oxidase (PPO, chitinase (CHI, and β-1, 3-glucanase (GLU in soybean seedlings attacked by aphid. Meanwhile, the induction of 15 defense-related genes by aphid, such as AOS, CHS, MMP2, NPR1-1, NPR1-2, and PR genes, were significantly augmented in BABA-treated soybean seedlings. Our study suggest that BABA application is a promising way to enhance soybean resistance against SA.
Quick spacecraft charging primer
International Nuclear Information System (INIS)
Larsen, Brian Arthur
2014-01-01
This is a presentation in PDF format which is a quick spacecraft charging primer, meant to be used for program training. It goes into detail about charging physics, RBSP examples, and how to identify charging.
The Universal Primer - An open source solution for archiving, organizing and streaming live lectures
DEFF Research Database (Denmark)
Christoffersen, Marc Juul; Panton, Hans Christian Hansen; Krajowski-Kukiel, Maciej
2011-01-01
. The goal of the Universal Primer is to address these problems, and allow anyone, anywhere, to teach or learn anything that can be reasonably taught or learned through a computer. The Universal Primer is 1: A fully open source solution for streaming live lectures. And 2: A Wikipedia-like website...
Primer design for a prokaryotic differential display RT-PCR.
Fislage, R; Berceanu, M; Humboldt, Y; Wendt, M; Oberender, H
1997-05-01
We have developed a primer set for a prokaryotic differential display of mRNA in the Enterobacteriaceae group. Each combination of ten 10mer and ten 11mer primers generates up to 85 bands from total Escherichia coli RNA, thus covering expressed sequences of a complete bacterial genome. Due to the lack of polyadenylation in prokaryotic RNA the type T11VN anchored oligonucleotides for the reverse transcriptase reaction had to be replaced with respect to the original method described by Liang and Pardee [ Science , 257, 967-971 (1992)]. Therefore, the sequences of both the 10mer and the new 11mer oligonucleotides were determined by a statistical evaluation of species-specific coding regions extracted from the EMBL database. The 11mer primers used for reverse transcription were selected for localization in the 3'-region of the bacterial RNA. The 10mer primers preferentially bind to the 5'-end of the RNA. None of the primers show homology to rRNA or other abundant small RNA species. Randomly sampled cDNA bands were checked for their bacterial origin either by re-amplification, cloning and sequencing or by re-amplification and direct sequencing with 10mer and 11mer primers after asymmetric PCR.
Climate Change, Health, and Communication: A Primer.
Chadwick, Amy E
2016-01-01
Climate change is one of the most serious and pervasive challenges facing us today. Our changing climate has implications not only for the ecosystems upon which we depend, but also for human health. Health communication scholars are well-positioned to aid in the mitigation of and response to climate change and its health effects. To help theorists, researchers, and practitioners engage in these efforts, this primer explains relevant issues and vocabulary associated with climate change and its impacts on health. First, this primer provides an overview of climate change, its causes and consequences, and its impacts on health. Then, the primer describes ways to decrease impacts and identifies roles for health communication scholars in efforts to address climate change and its health effects.
Directory of Open Access Journals (Sweden)
Zhiyuan Wu
2014-01-01
Full Text Available A multiplex snapback primer system was developed for the simultaneous detection of JAK2 V617F and MPL W515L/K mutations in Philadelphia chromosome- (Ph- negative myeloproliferative neoplasms (MPNs. The multiplex system comprises two snapback versus limiting primer sets for JAK2 and MPL mutation enrichment and detection, respectively. Linear-After exponential (LATE PCR strategy was employed for the primer design to maximize the amplification efficiency of the system. Low ionic strength buffer and rapid PCR protocol allowed for selective amplification of the mutant alleles. Amplification products were analyzed by melting curve analysis for mutation identification. The multiplex system archived 0.1% mutation load sensitivity and <5% coefficient of variation inter-/intra-assay reproducibility. 120 clinical samples were tested by the multiplex snapback primer assay, and verified with amplification refractory system (ARMS, quantitative PCR (qPCR and Sanger sequencing method. The multiplex system, with a favored versatility, provided the molecular diagnosis of Ph-negative MPNs with a suitable implement and simplified the genetic test process.
Zhang, Yunqing; Zhang, Xinju; Xu, Xiao; Kang, Zhihua; Li, Shibao; Zhang, Chen; Su, Bing
2014-01-01
A multiplex snapback primer system was developed for the simultaneous detection of JAK2 V617F and MPL W515L/K mutations in Philadelphia chromosome- (Ph-) negative myeloproliferative neoplasms (MPNs). The multiplex system comprises two snapback versus limiting primer sets for JAK2 and MPL mutation enrichment and detection, respectively. Linear-After exponential (LATE) PCR strategy was employed for the primer design to maximize the amplification efficiency of the system. Low ionic strength buffer and rapid PCR protocol allowed for selective amplification of the mutant alleles. Amplification products were analyzed by melting curve analysis for mutation identification. The multiplex system archived 0.1% mutation load sensitivity and <5% coefficient of variation inter-/intra-assay reproducibility. 120 clinical samples were tested by the multiplex snapback primer assay, and verified with amplification refractory system (ARMS), quantitative PCR (qPCR) and Sanger sequencing method. The multiplex system, with a favored versatility, provided the molecular diagnosis of Ph-negative MPNs with a suitable implement and simplified the genetic test process. PMID:24729973
Marketing Information Products and Services : A Primer for ...
International Development Research Centre (IDRC) Digital Library (Canada)
Marketing Information Products and Services : A Primer for Librarians and Information Professionals. Couverture du livre Marketing Information Products and Services : A Primer for Librarians and Information Professionals. Directeur(s) : Abhinandan K. Jain, Ashok Jambhekar, T.P.Rama Rao et S. Sreenivas Rao. Maison(s) ...
Directory of Open Access Journals (Sweden)
Fortes F. Celia L. de Luces
1990-12-01
Full Text Available Con el fin de evaluar el MRS-S (Sorbato al 0.10% en el aislamiento de bacterias lácticas se cultivaron muestras de leche de cabra cruda en MRS-S y PCA en profundidad y se incubaron en aerobiósis a 320C durante 48 horas. Los cocos gram positivos, catalasa negativos que crecieron en MRS-S se aislaron y sometieron a caracterización preliminar a través del crecimiento en agar MRS-S, MRS-T (tetraciclina 0.20 µg/ml, N-L (bacterias aromáticas, reducción de la leche tornasolada a 40 y 21oC y crecimiento a 45 y 10oC.Las cepas seleccionadas se sometieron a caracterización fisiológica y Bioquímica. El medio MRS-S mostró ser efectivo con un porcentaje de inhibición de la flora indeseable del 86.56%, y adecuado por el aislamiento de Lactococcus. De acuerdo con los perfiles taxonómicos se consiguió aislar de un total de 156 colonias dos Lactococcus lactis subsp. lactis y un Lactococcus lactis biovar diacetilactis.With the objective of evaluating the MRS-S (0.10% of sorbate in the isolation of lactic bacteria samples of raw goat milk were cultivated in MRS-S and PCA in deep and incubated in aerobic conditions for 48 hours al 32oC. Gram positive coccus, negative catalase which grew in MRS-S were isolated and preliminarly characterized through the growing process in agar MRS-S, MRS-T (O.20ltg/ml tetracycline, N-L (aromatic bacteria, litmus milk reduction at 40 and 210C and growing at 45 and 10oC. Selected strains were subject to the physiological and biochemical characterization. MRS-S media showed to be effective with an 86.56% of inhibition for indesirable bacteria and adequated for Lactococcus isolation. Related to taxonomic profiles from 156 colonies were isolated two lactococcus lactis subsp. lactis and one Lactococcus luctis biovar diacetilactis.
An environmentally acceptable primer for galvanized steel: Formulation and evaluation by SVET
Energy Technology Data Exchange (ETDEWEB)
Simoes, A.M.P., E-mail: alda.simoes@ist.utl.p [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal); Carbonari, R.O.; Di Sarli, A.R.; Amo, B. del [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal); Romagnoli, R., E-mail: estelectro@cidepint.gov.a [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal)
2011-01-15
Research highlights: {yields} Chromates can be replaced successfully by aluminium phosphosilicate in paint systems. {yields} The solvents of the primer are eco-friendly ones. {yields} The primer adheres on galvanized steel and allows top-coating. {yields} The binder of the primer is compatible with other binders for top-coating. - Abstract: The object of this paper was to formulate a two-pack wash primer employing aluminium phosphosilicate as active anticorrosive pigment instead of basic zinc chromate. The anticorrosive action of the primer was evaluated by the polarization technique and the scanning vibrating electrode technique (SVET). The exposed surface was then examined by scanning electron microscopy (SEM) and the surface composition determined by energy dispersive X-ray (EDX) analysis. The primer was finally integrated in a complete paint scheme whose anticorrosive performance was evaluated by the salt spray chamber and electrochemical impedance spectroscopy. The adhesion of the primer plus a painting system was also evaluated by standard ASTM D 3359-90 test method. The wash primer pigmented with zinc chromate was used as reference. Results indicated that basic zinc chromate could be replaced by the more eco-friendly wash-primer containing aluminium phosphosilicate.
Microsatellite primers for fungus-growing ants
DEFF Research Database (Denmark)
Villesen, Palle; Gertsch, P J; Boomsma, JJ
2002-01-01
We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...... developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants....
Microsatellite Primers for Fungus-Growing Ants
DEFF Research Database (Denmark)
Villesen Fredsted, Palle; Gertsch, Pia J.; Boomsma, Jacobus Jan (Koos)
2002-01-01
We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...... developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants....
Chai, Young Jun; Song, Junho; Kang, Jiyoung; Woo, Jung-Woo; Song, Ra-Yeong; Kwon, Hyungju; Kim, Su-Jin; Choi, June Young; Lee, Kyu Eun
2016-05-01
Postoperative pain for robotic thyroid surgeries including bilateral axillo-breast approach (BABA) has not been well studied. In this study, we have developed a self-reporting application (SRA) for iPad and prospectively collected pain scores from open thyroidectomy (OT) and BABA robotic thyroidectomy (RT) patients. Female patients who underwent total thyroidectomy for papillary thyroid carcinoma were included. Patients recorded pain scores for throat, anterior neck, posterior neck, chest, and back on postoperative days 1, 2, and 3. Once discharged, on postoperative day 14, a survey was also conducted on satisfaction of SRA and cosmesis. A total of 54 patients were enrolled (27 BABA RT and 27 OT). There were no significant differences between the 2 groups in clinicopathological characteristics and postoperative complication rates. Postoperative pain scores at days 1, 2, 3, and 14 were not significantly different between the groups for throat, anterior neck, posterior neck, or back. Postoperative analgesic requirements were similar between the 2 groups. Wound satisfaction scores were significantly higher in the BABA RT group (BABA RT 7.4 vs. OT 5.7; P = 0.016). Satisfaction scores for the usefulness of SRA were above 7.2 for all four questionnaire items on the 10-point scale. Postoperative pain for BABA RT is equivalent to OT but offers greater cosmetic satisfaction for patients. A mobile device application such as SRA may facilitate proper assessment and management of pain in postoperative patients.
Specific primer design of mitochondrial 12S rRNA for species identification in raw meats
Cahyadi, M.; Puruhita; Barido, F. H.; Hertanto, B. S.
2018-01-01
Polymerase chain reaction (PCR) is a molecular technique that widely used in agriculture area including species identification in animal-based products for halalness and food safety reasons. Amplification of DNA using PCR needs a primer pair (forward and reverse primers) to isolate specific DNA fragment in the genome. This objective of this study was to design specific primer from mitochondrial 12S rRNA region for species identification in raw beef, pork and chicken meat. Three published sequences, HQ184045, JN601075, and KT626857, were downloaded from National Center for Biotechnology Information (NCBI) website. Furthermore, those reference sequences were used to design specific primer for bovine, pig, and chicken species using primer3 v.0.4.0. A total of 15 primer pairs were picked up from primer3 software. Of these, an universal forward primer and three reverse primers which are specific for bovine, pig, and chicken species were selected to be optimized using multiplex-PCR technique. The selected primers were namely UNIF (5’-ACC GCG GTC ATA CGA TTA AC-3’), SPR (5’-AGT GCG TCG GCT ATT GTA GG-3’), BBR (5’-GAA TTG GCA AGG GTT GGT AA-3’), and AR (5’-CGG TAT GTA CGT GCC TCA GA-3’). In addition, the PCR products were visualized using 2% agarose gels under the UV light and sequenced to be aligned with reference sequences using Clustal Omega. The result showed that those primers were specifically amplified mitochondrial 12S rRNA regions from bovine, pig, and chicken using PCR. It was indicated by the existence of 155, 357, and 611 bp of DNA bands for bovine, pig, and chicken species, respectively. Moreover, sequence analysis revealed that our sequences were identically similar with reference sequences. It can be concluded that mitochondrial 12S rRNA may be used as a genetic marker for species identification in meat products.
Energy Technology Data Exchange (ETDEWEB)
Zhan Fangfang; Zhou Xiaoming [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, College of Biophotonics, South China Normal University, Guangzhou 510631 (China); Xing Da, E-mail: xingda@scnu.edu.cn [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, College of Biophotonics, South China Normal University, Guangzhou 510631 (China)
2013-01-25
Graphical abstract: In this work, we have developed and demonstrated a magnetic primer based RT-PCR assay for ECL detection of rotavirus. In the presence of two functional primers (magnetic primer and TBR-primer) and PCR reagents, cDNA from RT was amplified directly onto MPs during PCR cycles of denaturation, annealing and extension. The resulting MPs-TBR complexes were easily loaded on the electrode surface and produced a concentrated ECL signal. The figure shows the schematic illustration of magnetic primer RT-PCR based ECL assay for rotavirus detection. Highlights: Black-Right-Pointing-Pointer A novel method for detection of rotavirus has been developed. Black-Right-Pointing-Pointer In the presence of magnetic primer, TBR-primer and PCR reagents, cDNA form RT was amplified directly onto MPs. Black-Right-Pointing-Pointer To obtain the best sensing and efficient performance, important parameters associated with the efficiency were investigated carefully. Black-Right-Pointing-Pointer The proposed method will find numerous applications in food safety field and clinical diagnosis. - Abstract: A novel method for detection of rotavirus has been developed by integrating magnetic primer based reverse transcription-polymerase chain reaction (RT-PCR) with electrochemiluminescence (ECL) detection. This is realized by accomplishing RT of rotavirus RNA in traditional way and performing PCR of the resulting cDNA fragment on the surface of magnetic particles (MPs). In order to implement PCR on MPs and achieve rapid ECL detection, forward and reverse primers are bounded to MPs and tris-(2,2 Prime -bipyridyl) ruthenium (TBR), respectively. After RT-PCR amplification, the TBR labels are directly enriched onto the surface of MPs. Then the MPs-TBR complexes can be loaded on the electrode surface and analyzed by magnetic ECL platform without any post-modification or post-incubation process. So some laborious manual operations can be avoided to achieve rapid yet sensitive detection
A physicists guide to The Los Alamos Primer
International Nuclear Information System (INIS)
Reed, B Cameron
2016-01-01
In April 1943, a group of scientists at the newly established Los Alamos Laboratory were given a series of lectures by Robert Serber on what was then known of the physics and engineering issues involved in developing fission bombs. Serber’s lectures were recorded in a 24 page report titled The Los Alamos Primer , which was subsequently declassified and published in book form. This paper describes the background to the Primer and analyzes the physics contained in its 22 sections. The motivation for this paper is to provide a firm foundation of the background and contents of the Primer for physicists interested in the Manhattan Project and nuclear weapons. (invited comment)
Aislamiento y caracterización de micromicetos biodegradadores de polietileno
Directory of Open Access Journals (Sweden)
Carmen R. Méndez
2013-05-01
Full Text Available La biodegradación del polietileno por microorganismos es una solución para la reducción de la contaminación por plásticos. En el presente trabajo se muestran los resultados del aislamiento y caracterización de cepas de hongos capaces de degradar el polietileno, así como la determinación de las condiciones de pH y temperatura en las que se logran la mayor actividad. Los hongos fueron aislados de productos elaborados con polietileno obtenidos de relleno sanitario, la identificación taxonómica en base a características macroscópicas del crecimiento en placa petri y el estudio microscópico empleando la técnica de microcultivo en lámina. La actividad biodegradadora se determinó con la técnica de Kavelman y Kendrick, a temperaturas entre 20 y 30 °C y a pH 4,5 – 8,0. Veinte cepas de micromicetos fueron aisladas e identificadas, en 5 (25% se evidencio la capacidad de biodegradar el polietileno a 20 °C, siendo el pH 6,5 el óptimo, la cepa de mayor rendimiento pertenece a la especie de Aspergillus flavus. A temperatura de 30 °C, 6 (30% cepas evidenciaron actividad degradadora, siendo pH 6,5 el óptimo, la cepa de mayor rendimiento fue la misma del caso anterior.
Cepas de Campylobacter jejuni resistentes a quinolonas aisladas de humanos, gallinas y pollos
Directory of Open Access Journals (Sweden)
Rodolfo Notario
2011-08-01
Full Text Available Se compararon 8 aislamientos de Campylobacter jejuni provenientes de humanos con enfermedad diarreica aguda, con 23 aislamientos de cloaca de gallinas y pollos obtenidos de zonas próximas a la ciudad de Rosario, todos resistentes a la ciprofloxacina. Las muestras se sembraron en agar selectivo y se incubaron en microaerofilia a 42 °C. Las colonias se identificaron con el método tradicional. Los aislamientos se conservaron a -70 °C en caldo cerebro corazón con 17% v/v de glicerina. La clonalidad se determinó por RAPD-PCR, utilizando el primer 1254 (Stern NJ. Se interpretaron los aislamientos como clones distintos cuando diferían en una banda de amplificación. Se obtuvieron 5 clones diferentes. Los patrones I, II y V fueron aislados en criaderos industriales de pollos y en humanos (el II también en un establecimiento de gallinas ponedoras de huevos. En un gallinero familiar se obtuvo el patrón I. El patrón III sólo se obtuvo de humanos. El patrón IV se halló en uno de los criaderos pero no en humanos. Se pudo determinar que 93.5% de las cepas se aislaron tanto de animales como de humanos, por lo que se considera posible que la colonización de criaderos con cepas resistentes a los antimicrobianos pudiera ser el origen de la infección de humanos.
Directory of Open Access Journals (Sweden)
Katherine Sedano-Rojas
2011-10-01
Full Text Available Objetivo: Determinar la frecuencia de aislamiento de Cándida en cultivos de CIV en un hospital de alta complejidad entre los años 2008 y 2009 y describir las características clínicas de los pacientes. Material y métodos: Estudio descriptivo retrospectivo. Se revisaron 783 registros de cultivos de catéter intravascular (CIV de la sección microbiología del Laboratorio Central del Hospital Nacional Cayetano Heredia, desde enero de 2008 a diciembre de 2009, así como la historia clínica de los pacientes con cultivo positivo a Cándida sp. Para la estadística se utilizó la hoja de cálculo de Microsoft Excel 2007, así como el programa estadístico Epi Info versión 3.4.3. Resultados: Se encontraron 467 (59,6% cultivos positivos; 425 (91% fueron bacterias. S. epidermidis se aisló en 215/467 (46%, siendo predominante en la Unidad de Cuidados Intensivos de Recién Nacidos (UCI-RN. Cándida se aisló en 42 (9%; 43,8% Cándida sp, 25% C. albicans y 31,3% C. krusei. Conclusiones: La frecuencia de aislamiento de cándida en cultivos de CIV fue 9%, siendo la especie más frecuente C. krusei. El 18,7% fallecieron. (Rev Med Hered 2011;22:176-181..
Streptococcus gallolyticus subsp. pasteurianus en líquido cefalorraquídeo de un paciente pediátrico
Directory of Open Access Journals (Sweden)
Liz M Vélez Balestro
Full Text Available Hasta la fecha se han descrito casos de meningitis por Streptococcus gallolyticus subsp. pasteurianus en adultos, y de los pocos casos pediátricos, el mayor número se presentó en neonatos. En este trabajo presentamos un caso de meningitis y bacteriemia por este estreptococo en un paciente de 9 meses, con reiteradas hospitalizaciones por enfermedades respiratorias; este constituye el primer aislamiento documentado del citado microorganismo en Santa Fe.
Chinchilla-Brenes, Sonia; Sánchez-Oller, Sylvia
2001-01-01
Proyecto de Investigación El problema de la deserción estudiantil es un fenómeno mundial que involucra principalmente a alumnos de primer ingreso a los centros educativos y de manera particular a las instituciones de educación superior las cuales reportan índices de deserción de alrededor del 30% en el primer año. Ante esta situación se hace necesaria la atención de la población de primer ingreso con programas específicos que acompañen a los y las estudiantes en este proceso de ajuste al m...
RUCS: Rapid identification of PCR primers for unique core sequences
DEFF Research Database (Denmark)
Thomsen, Martin Christen Frølund; Hasman, Henrik; Westh, Henrik
2017-01-01
Designing PCR primers to target a specific selection of whole genome sequenced strains can be a long, arduous, and sometimes impractical task. Such tasks would benefit greatly from an automated tool to both identify unique targets, and to validate the vast number of potential primer pairs...... for the targets in silico . Here we present RUCS, a program that will find PCR primer pairs and probes for the unique core sequences of a positive genome dataset complement to a negative genome dataset. The resulting primer pairs and probes are in addition to simple selection also validated through a complex...... in silico PCR simulation. We compared our method, which identifies the unique core sequences, against an existing tool called ssGeneFinder, and found that our method was 6.5-20 times more sensitive. We used RUCS to design primer pairs that would target a set of genomes known to contain the mcr-1 colistin...
Directory of Open Access Journals (Sweden)
Adriana M. Celis
2005-12-01
Full Text Available Introducción. Las especies del género Malassezia se consideran levaduras oportunistas emergentes de gran importancia. Han sido asociadas a diferentes patologías dermatológicas y sistémicas de las cuales se aislan una o más especies de este género. El papel de estas levaduras en las enfermedades dermatológicas no se ha aclarado completamente, ya que la Malassezia spp. pertenece a la flora normal de la piel. Objetivo. Buscar marcadores genéticos en los aislamientos de Malassezia spp. que permitan correlacionar las lesiones dermatológicas con las especies aisladas. Materiales y métodos. Se obtuvieron 103 aislamientos de Malassezia spp. a partir de muestras de pacientes con pitiriasis versicolor, dermatitis seborreica, dermatitis seborreica en pacientes positivos para VIH, dermatitis atópica, y de individuos sanos. Para los controles se usaron ocho cepas del Centraalbureau voor Schimmelcultures (CBS, Holanda. El perfil genético se realizó utilizando la técnica de ADN polimórfico amplificado aleatorio (RAPD con tres iniciadores (OPA2, OPA4, OPA13. Los datos obtenidos se analizaron con los programas Diversity Database y SYN-TAX-PC. Resultados. Se observó heterogeneidad genética intraespecífica en Malassezia furfur, Malassezia globosa, Malassezia restricta, Malassezia slooffiae y Malassezia obtusa, mientras que Malassezia sympodialis mostró mayor homogeneidad. Conclusión. No se determinó ningún patrón genético específico mediante la técnica de RAPD para las especies de Malassezia que se pudiera relacionar con la entidad dermatológica implicada.
Primer on consumer marketing research : procedures, methods, and tools
1994-03-01
The Volpe Center developed a marketing research primer which provides a guide to the approach, procedures, and research tools used by private industry in predicting consumer response. The final two chapters of the primer focus on the challenges of do...
Disclosing bias in bisulfite assay: MethPrimers underestimate high DNA methylation.
Directory of Open Access Journals (Sweden)
Andrea Fuso
Full Text Available Discordant results obtained in bisulfite assays using MethPrimers (PCR primers designed using MethPrimer software or assuming that non-CpGs cytosines are non methylated versus primers insensitive to cytosine methylation lead us to hypothesize a technical bias. We therefore used the two kinds of primers to study different experimental models and methylation statuses. We demonstrated that MethPrimers negatively select hypermethylated DNA sequences in the PCR step of the bisulfite assay, resulting in CpG methylation underestimation and non-CpG methylation masking, failing to evidence differential methylation statuses. We also describe the characteristics of "Methylation-Insensitive Primers" (MIPs, having degenerated bases (G/A to cope with the uncertain C/U conversion. As CpG and non-CpG DNA methylation patterns are largely variable depending on the species, developmental stage, tissue and cell type, a variable extent of the bias is expected. The more the methylome is methylated, the greater is the extent of the bias, with a prevalent effect of non-CpG methylation. These findings suggest a revision of several DNA methylation patterns so far documented and also point out the necessity of applying unbiased analyses to the increasing number of epigenomic studies.
Criticality calculations with MCNP trademark: A primer
International Nuclear Information System (INIS)
Harmon, C.D. II; Busch, R.D.; Briesmeister, J.F.; Forster, R.A.
1994-01-01
With the closure of many experimental facilities, the nuclear criticality safety analyst increasingly is required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his/her facility. This primer will help you, the analyst, understand and use the MCNP Monte Carlo code for nuclear criticality safety analyses. It assumes that you have a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with MCNP in particular. Appendix A gives an introduction to Monte Carlo techniques. The primer is designed to teach by example, with each example illustrating two or three features of MCNP that are useful in criticality analyses. Beginning with a Quickstart chapter, the primer gives an overview of the basic requirements for MCNP input and allows you to run a simple criticality problem with MCNP. This chapter is not designed to explain either the input or the MCNP options in detail; but rather it introduces basic concepts that are further explained in following chapters. Each chapter begins with a list of basic objectives that identify the goal of the chapter, and a list of the individual MCNP features that are covered in detail in the unique chapter example problems. It is expected that on completion of the primer you will be comfortable using MCNP in criticality calculations and will be capable of handling 80 to 90 percent of the situations that normally arise in a facility. The primer provides a set of basic input files that you can selectively modify to fit the particular problem at hand
Desmarais, Samantha M.; Leitner, Thomas; Barron, Annelise E.
2012-01-01
DNA barcodes are short, unique ssDNA primers that “mark” individual biomolecules. To gain better understanding of biophysical parameters constraining primer-dimer formation between primers that incorporate barcode sequences, we have developed a capillary electrophoresis method that utilizes drag-tag-DNA conjugates to quantify dimerization risk between primer-barcode pairs. Results obtained with this unique free-solution conjugate electrophoresis (FSCE) approach are useful as quantitatively precise input data to parameterize computation models of dimerization risk. A set of fluorescently labeled, model primer-barcode conjugates were designed with complementary regions of differing lengths to quantify heterodimerization as a function of temperature. Primer-dimer cases comprised two 30-mer primers, one of which was covalently conjugated to a lab-made, chemically synthesized poly-N-methoxyethylglycine drag-tag, which reduced electrophoretic mobility of ssDNA to distinguish it from ds primer-dimers. The drag-tags also provided a shift in mobility for the dsDNA species, which allowed us to quantitate primer-dimer formation. In the experimental studies, pairs of oligonucleotide primer-barcodes with fully or partially complementary sequences were annealed, and then separated by free-solution conjugate CE at different temperatures, to assess effects on primer-dimer formation. When less than 30 out of 30 basepairs were bonded, dimerization was inversely correlated to temperature. Dimerization occurred when more than 15 consecutive basepairs formed, yet non-consecutive basepairs did not create stable dimers even when 20 out of 30 possible basepairs bonded. The use of free-solution electrophoresis in combination with a peptoid drag-tag and different fluorophores enabled precise separation of short DNA fragments to establish a new mobility shift assay for detection of primer-dimer formation. PMID:22331820
Ongkowidjaja, F.; Soegiharto, B. M.; Purbiati, M.
2017-08-01
The shear bond strength (SBS) can be increased by removing protein pellicles from the enamel surface by deproteinization using 5.25% sodium hypochlorite (NaOCl). The SBS of a self-etch primer is lower than that of a total etch primer; nonetheless, it prevents white spot lesions. This study aimed to assess the SBS of the Anyetch (AE) total etch primer and FL-Bond II Shofu (FL) self-etch primer after enamel deproteinization using 5.25% NaOCl. Forty eight human maxillary first premolars were extracted, cleaned, and divided into four groups. In group A, brackets were bonded to the enamel without deproteinization before etching (A1: 10 teeth using total etch primer (AE); A2: 10 teeth using self-etch primer (FL)). In group B, brackets were bonded to the enamel after deproteinization with 5.25% NaOCl before etching (B1: 10 teeth using total etch primer (AE); B2: 10 teeth using self-etch primer (FL)). Brackets were bonded using Transbond XT, stored in artificial saliva for 24 h at 37°C, mounted on acrylic cylinders, and debonded using a Shimadzu AG-5000 universal testing machine. There were no significant differences in SBS between the total etch (AE) groups (p > 0.05) and between the self-etch (FL) groups (p > 0.05). There were significant differences in SBS between groups A and B. The mean SBS for groups A1, A2, B1, and B2 was 12.91±3.99, 4.46±2.47, 13.06±3.66, and 3.62±2.36 MPa, respectively. Deproteinization using NaOCl did not affect the SBS of the total etch primer (AE) group; it reduced the SBS of the self-etch primer (FL) group, but not with a statistically significant difference.
Directory of Open Access Journals (Sweden)
A. Corso
2009-03-01
Full Text Available During the period 1993-2001, a total of 1,499 pneumococci isolates were recovered through the Argentinean surveillance of Streptococcus pneumoniae causing invasive disease in children under 6 years of age, 3.5% of which were erythromycin resistant. Among the 50 erythromycin-resistant strains available, 58% (n=29 harbored mefA/E genes (15 mefA, 30%; and 14 mefE, 28%, 34% (n=17 ermB, and 6% (n=3 both mefA/E plus ermB genes, while one isolate was negative for all the acquired genes studied. The England14-9 (42%, Poland6B-20 (20% and Spain9v-3 (16% clones were responsible for the emergence of pneumococcal macrolide resistance in pediatric population from Argentina.En el marco del programa de vigilancia regional SIREVA, se analizaron 1499 aislamientos de Streptococcus pneumoniae causantes de enfermedad invasiva en menores de 6 años, recuperados entre 1993 y 2001. Se detectó un 3,5% de resistencia a eritromicina. De los 50 aislamientos resistentes a eritromicina que pudieron ser estudiados, el 58% (n=29 tenían los genes mefA/E (15 mefA, 30% y 14 mefE, 28%, el 34% (n=17 el gen ermB y el 6% (n=3 la combinación de genes mefA/E y ermB. Sólo un aislamiento fue negativo para todos los genes analizados. Los clones internacionales England14-9, Poland6B-20 y Spain9v-3 representaron el 78% del total de aislamientos resistentes (42, 20 y 16%, respectivamente y se consideraron los responsables de la emergencia de la resistencia a macrólidos entre los neumococos que afectan a la población pediátrica de Argentina.
Directory of Open Access Journals (Sweden)
Turgut KOÇOĞLU
2012-09-01
ncelediğimiz biyografik kaynaklarda Zarîfî Ömer Baba ile ilgili fazla bilgi bulunmamaktadır. Kaynakların belirttiğine göre bugünkü Bulgaristan sınırlarına dahil Rusçuk kasabasından olan Zarîfî Ömer Baba, Sa'diyye tarikatına intisap etmiş ve bu tarikatta şeyhlik makamına kadar yükselmiştir. Zarîfî’nin tezkirelerde adı geçen 2 eseri vardır. Bunlar, Pend-nâme ve Divân'dır. Ancak yaptığımız katalog taramalarında ona âit olduğu belirtilen 7 eser daha tespit edilmiştir. Bu eserler: Tasavvuf-nâme, İsm-i A’zam, Kitâb-ı İ'tikâd, Hikâye-yi Kan Kalesi, Beyân-ı Ser-encâm, Kısasu’l-Enbiyâ ve Istılahât-ı Meşâyıh'dır. İnceleyebildiğimiz kadarıyla Zarîfî'nin eserleri, din-tasavvuf ve ahlak içeriklidir. Onun, kaynaklarda bahsedilmeyen eserlerinden Istılahât-ı Meşâyıh, bir çeşit tasavvuf terimleri sözlüğüdür. Dînî ve tasavvufî bazı konuların anlatıldığı 23 beyitlik manzum bir bölümle başlayan bu eserde, toplam 70 tasavvufî terim açıklanmıştır. Istılahât-ı Meşayıh'da izah edilen bu terimleri, isimler ve makamlar olarak ikiye ayırmak mümkündür. Eserde isimler ve alametleri mensur, makamlar ise manzum şekilde kaleme alınmıştır. Yazar, önce kendi tasavvuf ekseninde bir insanın sahip olduğu vasıfları ve özellikleri belirten bir ismi mensur olarak izah etmiş sonra bu ismin özelliklerini taşıyan kişinin bulunacağı manevî makamı manzum olarak dile getirmiştir. Bu yazıda ana hatlarıyla Zarîfî’nin hayatı, edebî kişiliği ve eserleri incelenmiş; Istılahât-ı Meşayıh'ın dili, üslubu ve muhtevası üzerine bir inceleme yapılmıştır. Ayrıca bu eserdeki birkaç kavram, aynı tasavvuf terimlerine yüklenen anlamların tarikatlara, meşreblere belki zamana ve mekana göre farklılık arz ettiğini göstermek amacıyla başka tasavvuf terimleri sözlükleriyle mukayese edilmiştir. Son olarak Istılahât-ı Meşâyıh’ın metni mevcut 2 nüshasından hareketle g
Directory of Open Access Journals (Sweden)
Rodolfo Notario
2011-08-01
Full Text Available Se compararon 8 aislamientos de Campylobacter jejuni provenientes de humanos con enfermedad diarreica aguda, con 23 aislamientos de cloaca de gallinas y pollos obtenidos de zonas próximas a la ciudad de Rosario, todos resistentes a la ciprofloxacina. Las muestras se sembraron en agar selectivo y se incubaron en microaerofilia a 42 °C. Las colonias se identificaron con el método tradicional. Los aislamientos se conservaron a -70 °C en caldo cerebro corazón con 17% v/v de glicerina. La clonalidad se determinó por RAPD-PCR, utilizando el primer 1254 (Stern NJ. Se interpretaron los aislamientos como clones distintos cuando diferían en una banda de amplificación. Se obtuvieron 5 clones diferentes. Los patrones I, II y V fueron aislados en criaderos industriales de pollos y en humanos (el II también en un establecimiento de gallinas ponedoras de huevos. En un gallinero familiar se obtuvo el patrón I. El patrón III sólo se obtuvo de humanos. El patrón IV se halló en uno de los criaderos pero no en humanos. Se pudo determinar que 93.5% de las cepas se aislaron tanto de animales como de humanos, por lo que se considera posible que la colonización de criaderos con cepas resistentes a los antimicrobianos pudiera ser el origen de la infección de humanos.Eight quinolone resistant Campylobacter jejuni strains isolated from humans with diarrheal disease were compared with 23 isolates from chicken and from laying hens. Samples were cultured on selective agar in microaerophilia, identified by conventional tests, and conserved in 17% glycerol at -70 °C. Clones were determined by RAPD-PCR employing the 1254 primer (Stern NJ. Five patterns were obtained. Patterns I, II, and V were found in both poultry and human isolates. Pattern I was obtained from poultry in a domestic henhouse. Pattern III was only obtained from humans whereas pattern IV was only obtained from poultry. A 95.3% of clones were found in both, humans and poultry. According to these
Directory of Open Access Journals (Sweden)
Ana L Tamborini
2012-12-01
Full Text Available Se investigó la prevalencia de Campylobacter spp. en 327 pacientes con diarrea y en 36 animales (perros, gatos y pollos que convivían con pacientes en los que se detectó este patógeno; el estudio se llevó a cabo en Santa Rosa, La Pampa, Argentina. Se aisló Campylobacter spp. en 50/327 pacientes y en 12/36 animales, Campylobacter jejuni fue la especie más frecuente. Se detectó resistencia a ciprofoxacina (65 % y a tetraciclina (32 % en una selección de 35 aislamientos de origen humano. En el análisis por electroforesis de campo pulsado de 13 aislamientos de C. jejuni se identificaron siete subtipos genéticos. Dos subtipos agruparon aislamientos de pacientes y de sus respectivos perros, y un tercer subtipo agrupó 1 aislamiento humano y 2 de pollos de ese paciente. Si bien las aves son reconocidas como el principal reservorio, es importante fortalecer la vigilancia de Campylobacter spp. en mascotas, las cuales pueden ser portadores asintomáticos del patógeno.The prevalence of Campylobacter spp. was investigated in 327 patients suffering from diarrhea and in 36 animals (dogs, cats and chickens owned by the patients that presented infection by Campylobacter in Santa Rosa, La Pampa, Argentina. Campylobacter spp. was isolated in 50/327 patients and in 12/36 animals, being Campylobacter jejuni the most common species. Resistance to ciprofoxacin (65 % and tetracycline (32 % was found among 35 isolates of human origin studied. Seven genetic subtypes were observed among 13 C. jejuni isolates by pulsed feld gel electrophoresis. Two subtypes grouped isolates belonging to patients and their respective dogs whereas another subtype grouped one isolate of human origin and two isolates from the patient´s chickens. The results of this investigation highlight the need to strengthen surveillance of Campylobacter spp. not only in poultry, which is recognized as the main reservoir, but also in pets, which were shown to be asymptomatic carriers of the
Jung, Jae-Ho; Choi, Jung Min; Kim, Young-Ok
2018-03-01
We designed a genus-specific primer pair targeting the intracellular parasite Euduboscquella. To increase target specificity and inhibit untargeted PCR, two nucleotides were added at the 3' end of the reverse primer, one being a complementary nucleotide to the Euduboscquella-specific SNP (single-nucleotide polymorphism) and the other a deliberately mismatched nucleotide. Target specificity of the primer set was verified experimentally using PCR of two Euduboscquella species (positive controls) and 15 related species (negative controls composed of ciliates, diatoms and dinoflagellates), and analytical comparison with SILVA SSU rRNA gene database (release 119) in silico. In addition, we applied the Euduboscquella-specific primer set to four environmental samples previously determined by cytological staining to be either positive or negative for Euduboscquella. As expected, only positive controls and environmental samples known to contain Euduboscquella were successfully amplified by the primer set. An inferred SSU rRNA gene phylogeny placed environmental samples containing aloricate ciliates infected by Euduboscquella in a cluster discrete from Euduboscquella groups a-d previously reported from loricate, tintinnid ciliates.
Directory of Open Access Journals (Sweden)
S. Dos-Anjos
2013-12-01
Full Text Available El tejido adiposo obtenido mediante liposucción es una fuente idónea para aislar células con potencial terapéutico, las denominadas células de la fracción estromal vascular (FEV, que incluyen células madre mesenquimales. Estas células se han convertido en una de las principales herramientas de terapia celular autóloga para diversas aplicaciones médicas, y en los últimos años se han ido desarrollando diversas tecnologías para su aislamiento y uso clínico. En este trabajo presentamos un nuevo método rápido, sencillo y eficiente para el aislamiento de células de la FEV mediante un dispositivo médico cerrado que permite recoger y procesar lipoaspirados humanos en el mismo procedimiento quirúrgico de manera coste-efectiva. Además describimos los métodos llevados a cabo para cuantificar la calidad, seguridad y eficacia del inóculo celular obtenido.
Laboratory and gas-fired furnace performance tests of epoxy primers for intumescent coatings
DEFF Research Database (Denmark)
Nørgaard, Kristian Petersen; Dam-Johansen, Kim; Catala, Pere
2014-01-01
, either to ensure adhesion of the intumescent coating to the steel or to provide corrosion resistance. It is essential to document the performance of the intumescent coating together with the primer to ensure the overall quality of coating system. In the present work, two epoxy primers were used...... to a gas-fired furnace following the ISO834 fire curve (a so-called cellulosic fire), one of the primers selected performed well and the other poorly. From tests in the electrically heated oven, it was found that both primers were sensitive to the film thickness employed and the presence of oxygen....... At oxygen-rich conditions, higher primer thicknesses gave weaker performance. In addition, a color change from red to black was observed in nitrogen, while the color remained red in the oxygen-nitrogen mixture. In summary, the results suggest that an adequate choice of primer, primer thickness...
International Nuclear Information System (INIS)
Oldendorf, W.; Oldendorf, W. Jr.
1991-01-01
Designed for studies, radiologists, and clinicians at all levels of training, this book provides a basic introduction to the principles, physics, and instrumentation of magnetic resonance imaging. The fundamental concepts that are essential for the optimal clinical use of MRI are thoroughly explained in easily accessible terms. To facilitate the reader's comprehension, the material is presented nonmathematically, using no equations and a minimum of symbols and abbreviations. MRI Primer presents a clear account of the phenomenon of nuclear magnetic resonance and the use of gradient magnetic fields to create clinically useful images of cross-sectional slices. Close attention is given to the magnetization vector as a means of expressing nuclear behavior, the role of T 1 and T 2 weighing in imaging, the use of contrast agents, and the pulse sequences most often used in clinical practice, as well as to the relative capabilities and limitations of MRI and CT. The basic hardware components of an MRI scanner are described in detail. Sample MRI scans illustrate how MRI characterizes tissue. An appendix provides a brief introduction to quantum processes in MRI
A database of PCR primers for the chloroplast genomes of higher plants
Heinze, Berthold
2007-01-01
Background Chloroplast genomes evolve slowly and many primers for PCR amplification and analysis of chloroplast sequences can be used across a wide array of genera. In some cases 'universal' primers have been designed for the purpose of working across species boundaries. However, the essential information on these primer sequences is scattered throughout the literature. Results A database is presented here which assembles published primer information for chloroplast DNA. Additional primers were designed to fill gaps where little or no primer information could be found. Amplicons are either the genes themselves (typically useful in studies of sequence variation in higher-order phylogeny) or they are spacers, introns, and intergenic regions (for studies of phylogeographic patterns within and among species). The current list of 'generic' primers consists of more than 700 sequences. Wherever possible, we give the locations of the primers in the thirteen fully sequenced chloroplast genomes (Nicotiana tabacum, Atropa belladonna, Spinacia oleracea, Arabidopsis thaliana, Populus trichocarpa, Oryza sativa, Pinus thunbergii, Marchantia polymorpha, Zea mays, Oenothera elata, Acorus calamus, Eucalyptus globulus, Medicago trunculata). Conclusion The database described here is designed to serve as a resource for researchers who are venturing into the study of poorly described chloroplast genomes, whether for large- or small-scale DNA sequencing projects, to study molecular variation or to investigate chloroplast evolution. PMID:17326828
A database of PCR primers for the chloroplast genomes of higher plants
Directory of Open Access Journals (Sweden)
Heinze Berthold
2007-02-01
Full Text Available Abstract Background Chloroplast genomes evolve slowly and many primers for PCR amplification and analysis of chloroplast sequences can be used across a wide array of genera. In some cases 'universal' primers have been designed for the purpose of working across species boundaries. However, the essential information on these primer sequences is scattered throughout the literature. Results A database is presented here which assembles published primer information for chloroplast DNA. Additional primers were designed to fill gaps where little or no primer information could be found. Amplicons are either the genes themselves (typically useful in studies of sequence variation in higher-order phylogeny or they are spacers, introns, and intergenic regions (for studies of phylogeographic patterns within and among species. The current list of 'generic' primers consists of more than 700 sequences. Wherever possible, we give the locations of the primers in the thirteen fully sequenced chloroplast genomes (Nicotiana tabacum, Atropa belladonna, Spinacia oleracea, Arabidopsis thaliana, Populus trichocarpa, Oryza sativa, Pinus thunbergii, Marchantia polymorpha, Zea mays, Oenothera elata, Acorus calamus, Eucalyptus globulus, Medicago trunculata. Conclusion The database described here is designed to serve as a resource for researchers who are venturing into the study of poorly described chloroplast genomes, whether for large- or small-scale DNA sequencing projects, to study molecular variation or to investigate chloroplast evolution.
Detection of enteroviruses and hepatitis a virus in water by consensus primer multiplex RT-PCR
Li, Jun-Wen; Wang, Xin-Wei; Yuan, Chang-Qing; Zheng, Jin-Lai; Jin, Min; Song, Nong; Shi, Xiu-Quan; Chao, Fu-Huan
2002-01-01
AIM: To develop a rapid detection method of enteroviruses and Hepatitis A virus (HAV). METHODS: A one-step, single-tube consensus primers multiplex RT-PCR was developed to simultaneously detect Poliovirus, Coxsackie virus, Echovirus and HAV. A general upstream primer and a HAV primer and four different sets of primers (5 primers) specific for Poliovirus, Coxsacki evirus, Echovirus and HAV cDNA were mixed in the PCR mixture to reverse transcript and amplify the target DNA. Four distinct amplified DNA segments representing Poliovirus, Coxsackie virus, Echovirus and HAV were identified by gel electrophoresis as 589-, 671-, 1084-, and 1128 bp sequences, respectively. Semi-nested PCR was used to confirm the amplified products for each enterovirus and HAV. RESULTS: All four kinds of viral genome RNA were detected, and producing four bands which could be differentiated by the band size on the gel. To confirm the specificity of the multiplex PCR products, semi-nested PCR was performed. For all the four strains tested gave positive results. The detection sensitivity of multiplex PCR was similar to that of monoplex RT-PCR which was 24 PFU for Poliovrus, 21 PFU for Coxsackie virus, 60 PFU for Echovirus and 105 TCID50 for HAV. The minimum amount of enteric viral RNA detected by semi-nested PCR was equivalent to 2.4 PFU for Poliovrus, 2.1 PFU for Coxsackie virus, 6.0 PFU for Echovirus and 10.5 TCID50 for HAV. CONCLUSION: The consensus primers multiplex RT-PCR has more advantages over monoplex RT-PCR for enteric viruses detection, namely, the rapid turnaround time and cost effectiveness. PMID:12174381
Kwon, Hyungju; Yi, Jin Wook; Song, Ra-Yeong; Chai, Young Jun; Kim, Su-jin; Choi, June Young; Lee, Kyu Eun
2016-03-01
There is an ongoing debate about whether robotic thyroidectomy (RT) is appropriate for Graves' disease. The aim of this study was to compare the safety of bilateral axillo-breast approach (BABA) RT with that of open thyroidectomy (OT) in patients with Graves' disease. From January 2008 to June 2014, 189 (44 BABA RT and 145 OT) patients underwent total thyroidectomy for Graves' disease. Recurrence of Graves' disease, intraoperative blood loss, hospital stay, and complication rates including recurrent laryngeal nerve (RLN) palsy and hypoparathyroidism were analyzed between BABA RT and OT groups, after propensity score matching according to age, gender, body mass index, surgical indication, the extent of operation, excised thyroid weight, and follow-up period. No patient experienced recurrence of Graves' disease after median follow-up of 35.0 months. Intraoperative blood loss (151.8 ± 165.4 mL vs. 134.5 ± 75.4 mL; p = 0.534) and hospital stay (3.4 ± 0.7 day vs. 3.3 ± 0.7 day; p = 0.564) were not different between BABA RT and OT groups. Complication rates including transient RLN palsy (11.4 vs. 11.4%; p = 1.000), transient hypoparathyroidism (18.2 vs. 20.5%; p = 0.787), permanent RLN palsy (0 vs. 2.3%; p = 0.315), and permanent hypoparathyroidism (2.3 vs. 2.3%; p = 1.000) were also comparable between groups. BABA RT for Graves' disease showed comparable surgical completeness and complications to conventional OT. BABA RT can be recommended as an alternative surgical option for patients with Graves' disease who are concerned about cosmesis.
Martínez Buitrago, Ernesto; Hernández, Cristhian; Pallares, Cristhian; Pacheco, Robinson; Hurtado, Kelly; Recalde, Mónica
2014-01-01
Introducción: La resistencia bacteriana se consolida como una amenaza para los sistemas de salud en el manejo de las enfermedades infecciosas. La vigilancia epidemiológica de la resistencia bacteriana ha demostrado ser una estrategia efectiva para conocer los patrones de susceptibilidad a los antimicrobianos regionales para el desarrollo de medidas de contención y gestión del uso adecuado de antimicrobianos. Objetivo: Describir los aislamientos microbiológicos y perfiles de resistencia a los ...
Energy Technology Data Exchange (ETDEWEB)
Salcido Lopez, Salvador [Aislantes Minerales, S. A. de C. V. Mexico, D. F. (Mexico)
1994-12-31
Energy Saving through the adequate selection and application of the thermal insulating materials, as well as its coatings for underground piping conducting fluids, both at high and at low temperature. The benefits are outlined at economical level for the investor as well as at ecological level (of vital importance today) and are observed as practical examples in industrial and commercial processes. [Espanol] Ahorro de energeticos mediante la adecuada seleccion y aplicacion de los aislamientos termicos, asi como de sus recubrimientos para tuberias subterraneas que conducen fluidos tanto en alta como en baja temperatura. Los beneficios son destacados tanto a nivel economico para el inversionista, como a nivel ecologico (de vital importancia en la actualidad), y son observados con ejemplos practicos en procesos industriales y comerciales.
Directory of Open Access Journals (Sweden)
Puntipar Sonthiphand
Full Text Available Anaerobic ammonia oxidizing (anammox bacteria play an important role in transforming ammonium to nitrogen gas and contribute to fixed nitrogen losses in freshwater environments. Understanding the diversity and abundance of anammox bacteria requires reliable molecular tools, and these are not yet well established for these important Planctomycetes. To help validate PCR primers for the detection of anammox bacteria within freshwater ecosystems, we analyzed representative positive controls and selected samples from Grand River and groundwater sites, both from Ontario, Canada. The objectives of this study were to identify a suitable anammox denaturing gradient gel electrophoresis (DGGE fingerprint method by using GC-clamp modifications to existing primers, and to verify the specificity of anammox-specific primers used for DGGE, cloning and qPCR methods. Six primer combinations were tested from four published primer sets (i.e. A438f/A684r, Amx368f/Amx820r, An7f/An1388r, and Pla46/1392r for both direct and nested PCR amplifications. All PCR products were run subsequently on DGGE gels to compare the resulting patterns. Two anammox-specific primer combinations were also used to generate clone libraries and quantify anammox bacterial 16S rRNA genes with qPCR. The primer set A438f/A684r was highly specific to anammox bacteria, provided reliable DGGE fingerprints and generated a high proportion of anammox-related clones. A second primer set (Amx368f/Amx820r was anammox specific, based on clone library analysis, but PCR products from different candidate species of anammox bacteria resolved poorly using DGGE analysis. Both DGGE and cloning results revealed that Ca. Brocadia and an uncharacterized anammox bacterial cluster represented the majority of anammox bacteria found in Grand River sediment and groundwater samples, respectively. Together, our results demonstrate that although Amx368f/Amx820r was useful for anammox-specific qPCR and clone library
Directory of Open Access Journals (Sweden)
Ernesto Martínez Buitrago
Full Text Available Introducción: La resistencia bacteriana se consolida como una amenaza para los sistemas de salud en el manejo de las enfermedades infecciosas. La vigilancia epidemiológica de la resistencia bacteriana ha demostrado ser una estrategia efectiva para conocer los patrones de susceptibilidad a los antimicrobianos regionales para el desarrollo de medidas de contención y gestión del uso adecuado de antimicrobianos. Objetivo: Describir los aislamientos microbiológicos y perfiles de resistencia a los antimicrobianos de las principales bacterias gram-negativas y gram-positivas en clínicas y hospitales de alta complejidad de Santiago de Cali, Colombia. Metodología: Estudio descriptivo enmarcado en la estrategia de vigilancia epidemiológica de la resistencia bacteriana desarrollado entre el año 2010 al 2012 en 13 instituciones de alta complejidad. Se recolectaron archivos mensualmente en formato WHONET, se realizaron pruebas de calidad de datos. El análisis fue estratificado por tipos de localización hospitalaria, además de análisis de tendencia a través de los 3 años de seguimiento. Resultados: El 65% de los aislamientos son bacterias de la familia enterobacteriaceae y el 11,4% corresponden a Staphylococcus spp., Escherichia coli presenta hasta un 17% de resistencia a cefalosporinas de 3.ª generación mientras que Klebsiella pneumoniae ha incrementado su perfil de resistencia a carbapenémicos hasta un 2,7% en las UCI; Pseudomonas aeruginosa presenta un perfil MDR de hasta el 21% en UCI y salas de hospitalización general. Conclusiones: Existen altas prevalencias de resistencia a los antimicrobianos en la región; se requiere fortalecer estrategias de vigilancia, prevención y control de la resistencia bacteriana en ambientes hospitalarios y de la comunidad.
Universal primers that amplify RNA from all three flavivirus subgroups
Directory of Open Access Journals (Sweden)
Barnard Ross T
2008-01-01
Full Text Available Abstract Background Species within the Flavivirus genus pose public health problems around the world. Increasing cases of Dengue and Japanese encephalitis virus in Asia, frequent outbreaks of Yellow fever virus in Africa and South America, and the ongoing spread of West Nile virus throughout the Americas, show the geographical burden of flavivirus diseases. Flavivirus infections are often indistinct from and confused with other febrile illnesses. Here we review the specificity of published primers, and describe a new universal primer pair that can detect a wide range of flaviviruses, including viruses from each of the recognised subgroups. Results Bioinformatic analysis of 257 published full-length Flavivirus genomes revealed conserved regions not previously targeted by primers. Two degenerate primers, Flav100F and Flav200R were designed from these regions and used to generate an 800 base pair cDNA product. The region amplified encoded part of the methyltransferase and most of the RNA-dependent-RNA-polymerase (NS5 coding sequence. One-step RT-PCR testing was successful using standard conditions with RNA from over 60 different flavivirus strains representing about 50 species. The cDNA from each virus isolate was sequenced then used in phylogenetic analyses and database searches to confirm the identity of the template RNA. Conclusion Comprehensive testing has revealed the broad specificity of these primers. We briefly discuss the advantages and uses of these universal primers.
The effect of various primers on shear bond strength of zirconia ceramic and resin composite.
Sanohkan, Sasiwimol; Kukiattrakoon, Boonlert; Larpboonphol, Narongrit; Sae-Yib, Taewalit; Jampa, Thibet; Manoppan, Satawat
2013-11-01
To determine the in vitro shear bond strengths (SBS) of zirconia ceramic to resin composite after various primer treatments. Forty zirconia ceramic (Zeno, Wieland Dental) specimens (10 mm in diameter and 2 mm thick) were prepared, sandblasted with 50 μm alumina, and divided into four groups (n = 10). Three experimental groups were surface treated with three primers; CP (RelyX Ceramic Primer, 3M ESPE), AP (Alloy Primer, Kuraray Medical), and MP (Monobond Plus, Ivoclar Vivadent AG). One group was not treated and served as the control. All specimens were bonded to a resin composite (Filtek Supreme XT, 3M ESPE) cylinder with an adhesive system (Adper Scotchbond Multi-Purpose Plus Adhesive, 3M ESPE) and then stored in 100% humidity at 37°C for 24 h before SBS testing in a universal testing machine. Mean SBS (MPa) were analyzed with one-way analysis of variance (ANOVA) and the Tukey's Honestly Significant Difference (HSD) test (α = 0.05). Group AP yielded the highest mean and standard deviation (SD) value of SBS (16.8 ± 2.5 MPa) and Group C presented the lowest mean and SD value (15.4 ± 1.6 MPa). The SBS did not differ significantly among the groups (P = 0.079). Within the limitations of this study, the SBS values between zirconia ceramic to resin composite using various primers and untreated surface were not significantly different.
Primers for phylogeny reconstruction in Bignonieae (Bignoniaceae) using herbarium samples.
Zuntini, Alexandre R; Fonseca, Luiz Henrique M; Lohmann, Lúcia G
2013-09-01
New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. • Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. • The standardized methodology allows the inclusion of herbarium materials as alternative sources of DNA for phylogenetic studies in Bignonieae.
The study of a Mg-rich epoxy primer for protection of AZ91D magnesium alloy
Energy Technology Data Exchange (ETDEWEB)
Lu Xiangyu [School of Materials Science and Engineering, Beijing University of Chemical Technology, Beijing 100029 (China); Zuo Yu, E-mail: zuoy@mail.buct.edu.c [School of Materials Science and Engineering, Beijing University of Chemical Technology, Beijing 100029 (China); Zhao Xuhui; Tang Yuming; Feng Xingguo [School of Materials Science and Engineering, Beijing University of Chemical Technology, Beijing 100029 (China)
2011-01-15
Research highlights: {yields} A Mg-rich epoxy primer was prepared by adding pure magnesium particles in epoxy coating. Cross scratch testing results showed that in 3% NaCl solution the Mg-rich primer showed better protection for AZ91D magnesium alloy than the same epoxy primer without Mg addition. {yields} The open circuit potential of AZ91D alloy in NaCl solution decreased after coated with Mg-rich coating, suggesting that cathodic protection effect of the Mg-rich coating on AZ91D alloy was present. {yields} EIS studies showed that during the immersion tests of AZ91D alloy with Mg-rich coating the magnesium particles in coating dissolved with the charge-transfer resistance R{sub ct} at the magnesium particle/coating interface decreased and the double-layer capacitance Q{sub dl} increased. While the coating resistance remained stable for a long time and corrosion of the AZ91D alloy substrate was obviously delayed. - Abstract: A Mg-rich epoxy primer was prepared by adding pure magnesium particles to an epoxy coating. The coating properties were studied with electrochemical impedance spectroscopy (EIS), scanning electronic microscopy (SEM) and X-ray diffraction (XRD). The Mg-rich primer showed better protection for AZ91D magnesium alloy than the same epoxy primer without Mg addition. The open circuit potential measurements showed cathodic protection effect of the Mg-rich primer on AZ91D alloy. Cross scratch testing showed that the Mg-rich primer provided better protection for the substrate than original epoxy coating. The precipitation of Mg(OH){sub 2} in the coating also provided some degree of barrier protection.
The study of a Mg-rich epoxy primer for protection of AZ91D magnesium alloy
International Nuclear Information System (INIS)
Lu Xiangyu; Zuo Yu; Zhao Xuhui; Tang Yuming; Feng Xingguo
2011-01-01
Research highlights: → A Mg-rich epoxy primer was prepared by adding pure magnesium particles in epoxy coating. Cross scratch testing results showed that in 3% NaCl solution the Mg-rich primer showed better protection for AZ91D magnesium alloy than the same epoxy primer without Mg addition. → The open circuit potential of AZ91D alloy in NaCl solution decreased after coated with Mg-rich coating, suggesting that cathodic protection effect of the Mg-rich coating on AZ91D alloy was present. → EIS studies showed that during the immersion tests of AZ91D alloy with Mg-rich coating the magnesium particles in coating dissolved with the charge-transfer resistance R ct at the magnesium particle/coating interface decreased and the double-layer capacitance Q dl increased. While the coating resistance remained stable for a long time and corrosion of the AZ91D alloy substrate was obviously delayed. - Abstract: A Mg-rich epoxy primer was prepared by adding pure magnesium particles to an epoxy coating. The coating properties were studied with electrochemical impedance spectroscopy (EIS), scanning electronic microscopy (SEM) and X-ray diffraction (XRD). The Mg-rich primer showed better protection for AZ91D magnesium alloy than the same epoxy primer without Mg addition. The open circuit potential measurements showed cathodic protection effect of the Mg-rich primer on AZ91D alloy. Cross scratch testing showed that the Mg-rich primer provided better protection for the substrate than original epoxy coating. The precipitation of Mg(OH) 2 in the coating also provided some degree of barrier protection.
Development of specific primers for genus Fusarium and F. solani ...
African Journals Online (AJOL)
Yomi
2012-01-05
Jan 5, 2012 ... reproductive parts of plants. They are ... plant species in most parts of the world. .... 20 µl 2.5X master mix (Eppendorf) and 1 µl of each forward and ... List of primers developed for rapid detection of Fusarium sp. and F. solani.
Summary of the primer on tumor immunology and the biological therapy of cancer
Directory of Open Access Journals (Sweden)
Margolin Kim
2009-01-01
Full Text Available Abstract The International Society for Biological Therapy of Cancer (iSBTc is one of the "premier destinations for interaction and innovation in the cancer biologics community". It provides a primer course each year during the annual meeting to address the most important areas of tumor immunology and immunotherapy. The course has been given by prominent investigators in the area of interest, covering the core principles of cancer immunology and immunotherapy. The target audience for this program includes investigators from academic, regulatory, and biopharmaceutical venues. The program goal is to enable the attendees to learn the current status and the most recent advances in biologic therapies, and to leverage this knowledge towards the improvement of cancer therapy. The 2008 immunologic primer course was held on October 30 at the 23rd Annual meeting of iSBTc in San Diego, CA. Nine internationally renowned investigators gave excellent presentations on different topics. The topics covered in this primer included: (1 cytokines in cancer immunology; (2 anti-angiogenic therapy; (3 end stage: immune killing of tumors; (4 blocking T cell checkpoints; (5 approach to identification and therapeutic exploitation of tumor antigens; (6 T regulatory cells; (7 adoptive T cell therapy; (8 immune monitoring of cancer immunotherapy; and (9 immune adjuvants. We summarized the topics in this primer for public education. The related topic slides and schedule can be accessed online http://www.isbtc.org/meetings/am08/primer08.
Design of a Percussion and Electric Primer Gun Firing Power Supply
2014-07-01
solenoid failure. As new instrumentation techniques such as high-speed video and laser interferometry have been introduced into our gun testing...to drive a solenoid into a percussion primer or ignite the M52A3B1 electric primer. To reduce power requirements, it uses charged capacitor banks to...drive the solenoid or ignite the primer. This report details the design and construction of the power supplies. 15. SUBJECT TERMS power supply
Du, X Y; Hu, Q N; Zhang, Q L; Wang, Y B; Luo, Z R
2013-06-06
Retrotransposon-based molecular markers are powerful molecular tools. However, these markers are not readily available due to the difficulty in obtaining species-specific retrotransposon primers. Although recent techniques enabling the rapid isolation of retrotransposon sequences have facilitated primer development, this process nonetheless remains time-consuming and costly. Therefore, research into the transferability of retrotransposon primers developed from one plant species onto others would be of great value. The present study investigated the transferability of retrotransposon primers derived from 'Luotian-tianshi' persimmon (Diospyros kaki Thunb.) across other fruit crops, as well as within the genus using inter-retrotransposon amplified polymorphism molecular marker. Fourteen of the 26 retrotransposon primers tested (53.85%) produced robust and reproducible amplification products across all fruit crops tested, indicating their applicability across plant species. Four of the 13 fruit crops showed the best transferability performances: persimmon, grape, citrus, and peach. Furthermore, similarity coefficients and UPGMA clustering indicated that these primers could further offer a potential tool for germplasm differentiation, parentage identification, genetic diversity assessment, classification, and phylogenetic studies across a variety of plant species. Transferability was further confirmed by examining published primers derived from Rosaceae, Gramineae, and Solanaceae. This study is one of the few currently available studies concerning the transferability of retrotransposon primers across plant species in general, and is the first successful study of the transferability of retrotransposon primers derived from persimmon. The primers presented here will help reduce costs for future retrotransposon primer development and therefore contribute to the popularization of retrotransposon molecular markers.
Bioinformatic tools for PCR Primer design
African Journals Online (AJOL)
ES
Bioinformatics is an emerging scientific discipline that uses information ... complex biological questions. ... and computer programs for various purposes of primer ..... polymerase chain reaction: Human Immunodeficiency Virus 1 model studies.
Fine tuning of reactive oxygen species homeostasis regulates primed immune responses in Arabidopsis.
Pastor, Victoria; Luna, Estrella; Ton, Jurriaan; Cerezo, Miguel; García-Agustín, Pilar; Flors, Victor
2013-11-01
Selected stimuli can prime the plant immune system for a faster and stronger defense reaction to pathogen attack. Pretreatment of Arabidopsis with the chemical agent β-aminobutyric acid (BABA) augmented H2O2 and callose production after induction with the pathogen-associated molecular pattern (PAMP) chitosan, or inoculation with the necrotrophic fungus Plectosphaerella cucumerina. However, BABA failed to prime H2O2 and callose production after challenge with the bacterial PAMP Flg22. Analysis of Arabidopsis mutants in reactive oxygen species (ROS) production (rbohD) or ROS scavenging (pad2, vtc1, and cat2) suggested a regulatory role for ROS homeostasis in priming of chitosan- and P. cucumerina-inducible callose and ROS. Moreover, rbohD and pad2 were both impaired in BABA-induced resistance against P. cucumerina. Gene expression analysis revealed direct induction of NADPH/respiratory burst oxidase protein D (RBOHD), γ-glutamylcysteine synthetase 1 (GSH1), and vitamin C defective 1 (VTC1) genes after BABA treatment. Conversely, ascorbate peroxidase 1 (APX1) transcription was repressed by BABA after challenge with chitosan or P. cucumerina, probably to provide a more oxidized environment in the cell and facilitate augmented ROS accumulation. Measuring ratios between reduced and oxidized glutathione confirmed that augmented defense expression in primed plants is associated with a more oxidized cellular status. Together, our data indicate that an altered ROS equilibrium is required for augmented defense expression in primed plants.
DEFF Research Database (Denmark)
Balint, Adam; Tenk, Miklós; Deim, Zoltán
2009-01-01
A real-time PCR assay, based on Primer-Probe Energy Transfer (PriProET), was developed to improve the detection and quantification of porcine circovirus type 2 (PVC2). PCV2 is recognised as the essential infectious agent in post-weaning multisystemic wasting syndrome (PMWS) and has been associated...... in different organs. The data obtained in this study correlate with those described earlier; namely, the viral load in 1 ml plasma and in 500 ng tissue DNA exceeds 10(7) copies in the case of PMWS. The results indicate that the new assay provides a specific, sensitive and robust tool for the improved detection...... and quantification of PCV2....
Directory of Open Access Journals (Sweden)
Clara Inés Agudelo
2009-04-01
Full Text Available OBJETIVO:Determinar la evolución de la resistencia a la eritromicina, el cloranfenicol, el trimetoprim-sulfametozaxol (SXT y la vancomicina de aislamientos invasores de Streptococcus pneumoniae obtenidos de niños de 10 países de América Latina y del Caribe en seis años de vigilancia. MÉTODOS: Se analizaron 8 993 aislamientos de S. pneumoniae recuperados entre 2000 y 2005 de niños menores de 6 años con infecciones invasoras, procedentes de Argentina, Brasil, Chile, Colombia, Cuba, México, Paraguay, República Dominicana, Uruguay y Venezuela. La sensibilidad a los antibióticos se determinó mediante los métodos establecidos y estandarizados en el proyecto SIREVA. La resistencia a múltiples antibióticos se definió como la resistencia a tres o más familias de antibióticos, de los no betalactámicos analizados en este estudio o de los betalactámicos evaluados en un estudio previo en el que 37,8% de estos aislamientos presentaron sensibilidad disminuida a la penicilina. RESULTADOS: Se encontró algún grado de resistencia al SXT y la eritromicina (56,4% y 15,4% de los aislamientos estudiados, respectivamente y 4,6% presentó alta resistencia al cloranfenicol. Todos los aislamientos fueron sensibles a la vancomicina. Se observó la mayor frecuencia de resistencia al SXT en los aislamientos de neumonía y a la eritromicina en los casos de sepsis (61,6% y 25,5%, respectivamente; P OBJECTIVE: To examine the development of resistance to erythromycin, chloramphenicol, trimethoprim-sulfamethoxazole (TMP-SMZ, and vancomycin of the invasive isolates of Streptococcus pneumoniae obtained from children in 10 Latin American/Caribbean countries during six years of surveillance. METHODS: Analysis of 8 993 isolates of S. pneumoniae recovered in 2000-2005 from children with invasive infections, who were less than 6 years of age, and from Argentina, Brazil, Chile, Colombia, Cuba, Dominican Republic, Mexico, Paraguay, Uruguay, or Venezuela. Antibiotic
Directory of Open Access Journals (Sweden)
Lilia Carolina Mora Moreno
2006-07-01
sedimentos, mediante la utilización de medios de cultivo selectivos (agar tributirina, agar aceite de girasol. Primero se evaluó la concentración del sustrato (aceite de girasol en la cual se encontraba el mayor número de morfotipos aislados, luego se comparó la eficiencia de los dos medios de cultivo de acuerdo a la cantidad de morfotipos aislados. Se evaluaron tres concentraciones diferentes de sustrato. Se aisló un total de 18 cepas pertenecientes a los géneros Bacillus, Pseudomonas, Acinetobacter, Streptomyces, Penicillium, Alternaria. Los medios evaluados constituyen alternativas sencillas de aislamiento de microorganismos con actividad lipolítica en sedimentos.
Primers for Phylogeny Reconstruction in Bignonieae (Bignoniaceae Using Herbarium Samples
Directory of Open Access Journals (Sweden)
Alexandre R. Zuntini
2013-08-01
Full Text Available Premise of the study: New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. Methods and Results: Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. Conclusions: The standardized methodology allows the inclusion of herbarium materials as alternative sources of DNA for phylogenetic studies in Bignonieae.
Real-time PCR (qPCR) primer design using free online software.
Thornton, Brenda; Basu, Chhandak
2011-01-01
Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most commonly used fluorescent chemistries are SYBR® Green dyes and TaqMan®, Molecular Beacon or Scorpion probes. SYBR® Green is very simple to use and cost efficient. As SYBR® Green dye binds to any double-stranded DNA product, its success depends greatly on proper primer design. Many types of online primer design software are available, which can be used free of charge to design desirable SYBR® Green-based qPCR primers. This laboratory exercise is intended for those who have a fundamental background in PCR. It addresses the basic fluorescent chemistries of real-time PCR, the basic rules and pitfalls of primer design, and provides a step-by-step protocol for designing SYBR® Green-based primers with free, online software. Copyright © 2010 Wiley Periodicals, Inc.
Yetter, Carol J.
2009-01-01
This hearing aid primer is designed to define the differences among the three levels of hearing instrument technology: conventional analog circuit technology (most basic), digitally programmable/analog circuit technology (moderately advanced), and fully digital technology (most advanced). Both moderate and advanced technologies mean that hearing…
International Nuclear Information System (INIS)
Moriyasu, K.
1981-01-01
A basic primer for QCD is presented using a semiclassical approach to the colour Maxwell equations. The non-Abelian nature of colour symmetry and the violation of superposition by colour fields is compared with QED. A simple discussion of asymptotic freedom is also presented. (author)
GETPrime: a gene- or transcript-specific primer database for quantitative real-time PCR.
Gubelmann, Carine; Gattiker, Alexandre; Massouras, Andreas; Hens, Korneel; David, Fabrice; Decouttere, Frederik; Rougemont, Jacques; Deplancke, Bart
2011-01-01
The vast majority of genes in humans and other organisms undergo alternative splicing, yet the biological function of splice variants is still very poorly understood in large part because of the lack of simple tools that can map the expression profiles and patterns of these variants with high sensitivity. High-throughput quantitative real-time polymerase chain reaction (qPCR) is an ideal technique to accurately quantify nucleic acid sequences including splice variants. However, currently available primer design programs do not distinguish between splice variants and also differ substantially in overall quality, functionality or throughput mode. Here, we present GETPrime, a primer database supported by a novel platform that uniquely combines and automates several features critical for optimal qPCR primer design. These include the consideration of all gene splice variants to enable either gene-specific (covering the majority of splice variants) or transcript-specific (covering one splice variant) expression profiling, primer specificity validation, automated best primer pair selection according to strict criteria and graphical visualization of the latter primer pairs within their genomic context. GETPrime primers have been extensively validated experimentally, demonstrating high transcript specificity in complex samples. Thus, the free-access, user-friendly GETPrime database allows fast primer retrieval and visualization for genes or groups of genes of most common model organisms, and is available at http://updepla1srv1.epfl.ch/getprime/. Database URL: http://deplanckelab.epfl.ch.
Tools for Ultraspecific Probe/Primer Design
National Research Council Canada - National Science Library
Fofanov, Yurly
2006-01-01
.... Our approach will deliver DNA probes and PCR primers that have an unprecedentedly low probability of false positives or confusion by environmental background, and which resist evasion by threat agent engineering...
Diversity of internal structures in inhibited epoxy primers
Directory of Open Access Journals (Sweden)
Anthony E. Hughes
2015-10-01
Full Text Available Computed tomography is making a significant impact in the field of materials science in recent years. In this paper the authors report on advances made in three areas of characterization and also identified where further research needs to be focused. First we report on a new approach to data analysis called “Data Constrained Modelling (DCM” in which compositional tomography can be undertaken rather than adsorption or phase contrast tomography. This is achieved by collecting X-ray CT data at different energies and then combining the datasets to reconstruct 3D compositional tomography. Second, on the application of this approach to inhibited primers typical of those used in the aerospace industry. Aerospace primers are effectively composite materials containing inorganic phases which are bound together with a polymer. Understanding the materials science of these systems requires information over several orders of magnitude in length-scale. In this paper we report on how DCM can be used to extend our understanding at the smaller length scales at the limits of resolution of the technique. The third and final advance is in extending the approach to include 4-dimensional studies. In this case we examine the primer before and after leaching. This process causes changes in the primer which can be both detected and quantified using the above approach.
Scandiani, María Mercedes; Carmona, Marcelo Aníbal; Luque, Alicia Graciela; Matos, Kedma da Silva; Lenzi, Lisandro; Formento, Ángela Norma; Martinez, Cristina Valeria; Ferri, Mónica Raquel; Lo Piccolo, Melina; Tartabini, Mirta; Alvarez, Diego; Sautua, Francisco
2012-01-01
Los objetivos de este trabajo fueron aislar e identificar los agentes causales del síndrome de la muerte súbita (SMS) en muestras provenientes de diferentes localidades de Argentina, y cuantificar la incidencia de la enfermedad y los daños causados a campo en el rendimiento. Se analizaron 215 raíces provenientes de plantas con síntoma foliares típicos de SMS para el aislamiento e identificación de los agentes causales. Para realizar las pruebas de patogenicidad se efectuaron dos bioensayos en...
Directory of Open Access Journals (Sweden)
L. Rodero
2006-09-01
Full Text Available Se estudiaron 1193 aislamientos clínicos para estandarizar y evaluar un método de difusión con discos de fluconazol de lectura visual, que permita detectar levaduras sensibles al antifúngico. Las especies analizadas fueron: Candida albicans (n=584, Candida parapsilosis (n=196, Candida tropicalis (n=200, Candida glabrata (n=113, Candida krusei (n=50, Candida spp. y otras levaduras oportunistas (n=50. Los discos fueron manufacturados en el INEI-ANLIS "Dr. Carlos G. Malbrán". Se midieron los halos de inhibición del crecimiento producidos por fluconazol y la concentración inhibitoria mínima (CIM por el método de referencia M27-A2 modificado por EUCAST. Se establecieron los valores de corte del método de difusión en: ≥16 mm para levaduras sensibles a fluconazol (CIM ≤ 8 µg/ml, entre 9 y 15 mm para sensibles dependientes de la dosis (CIM = 16-32 mg/ml y ≤ 8 mm para resistentes (CIM ≥ 64 µg/ml. El método de difusión tuvo 94,7% de concordancia con el de referencia, con 0,2% de errores very major y 0,3% de errores major. La reproducibilidad inter e intralaboratorio fue muy buena. Para detectar aislamientos sensibles a fluconazol, este método resulta confiable y de bajo costo; sin embargo, es conveniente que los aislamientos con halos ≤ 15 mm sean reevaluados por el método de referencia.In order to standardize and evaluate a disk diffusion method with visual reading to detect in vitro fluconazole susceptibility of yeast, 1193 clinical isolates were tested. These included 584 Candida albicans, 196 Candida parapsilosis, 200 Candida tropicalis, 113 Candida glabrata, 50 Candida krusei and 50 Candida spp. and other opportunistic yeasts. The disks were manufactured in the INEI-ANLIS "Dr. Carlos G. Malbrán". The disk diffusion method results were compared to MIC results obtained by the reference CLSI M27-A2 broth microdilution method modified by EUCAST. The interpretative breakpoints for in vitro susceptibility testing of fluconazole
Courtney, Elya; Courtney, Amy; Summer, Peter David; Courtney, Michael
2014-01-01
Results are presented for lead free primers based on diazodinitrophenol (DDNP)compared with tests on lead styphnate based primers. First, barrel friction measurements in 5.56 mm NATO are presented. Second, shot to shot variations in blast waves are presented as determined by detonating primers in a 7.62x51mm rifle chamber with a firing pin, but without any powder or bullet loaded and measuring the blast wave at the muzzle with a high speed pressure transducer. Third, variations in primer blas...
Energy Technology Data Exchange (ETDEWEB)
Peralta Solorio, Jose Luis [Fideicomiso para el Ahorro de la Energia (Mexico)
2005-07-15
An extension study of the Financing Program for Energy Saving looked for the evaluation of the electric energy saving potential obtained by the replacement of air conditioning equipment and the application of thermal insulation in 30 houses of two Mexican cities with warmth climate. In a joint effort with Comision Federal de Electricidad the consumption files of the users were analyzed and field measurements of electric demand and of refrigeration were made. As a following step the change of the refrigeration necessities derived from the application of thermal insulation were evaluated as well as the energy efficiency improvement obtained by the substitution of the air conditioning equipment and the favorable results obtained by the implementation of both measures - thermal insulation and change of air conditioning equipment in a joint form. This way, as a conclusion, the optimum sequence of application of these measures is revealed. [Spanish] Un estudio extension del Programa de Financiamiento para el Ahorro de Energia Electrica busco evaluar el potencial de ahorro de energia electrica alcanzado por el reemplazo de equipos de aire acondicionado y la aplicacion de aislamiento termico en 30 viviendas de dos ciudades mexicanas con clima calido. En un esfuerzo conjunto con la Comision Federal de Electricidad se analizaron los historiales de consumo de los usuarios y se efectuaron las mediciones de campo de demanda electrica y de refrigeracion. Como paso siguiente se valoro el cambio en las necesidades de refrigeracion derivado de la aplicacion de aislamiento termico al igual que la mejora en eficiencia energetica obtenida por la sustitucion de aire acondicionado y se identificaron los resultados favorecedores arrojados por la implementacion de ambas medidas -aislamiento termico y cambio de equipo de aire acondicionado- en forma conjunta. De esta manera, como conclusion, se devela la mas optima secuencia de aplicacion de estas medidas.
Microsatellite Primers in the Lichen Symbiotic Alga Trebouxia decolorans (Trebouxiophyceae
Directory of Open Access Journals (Sweden)
Francesco Dal Grande
2013-03-01
Full Text Available Premise of the study: Polymorphic microsatellite markers were developed for the symbiotic green alga Trebouxia decolorans to study fine-scale population structure and clonal diversity. Methods and Results: Using Illumina pyrosequencing, 20 microsatellite primer sets were developed for T. decolorans. The primer sets were tested on 43 individuals sampled from four subpopulations in Germany. The primers amplified di-, tri-, and tetranucleotide repeats with three to 15 alleles per locus, and the unbiased haploid diversity per locus ranged from 0.636 to 0.821. Conclusions: The identified microsatellite markers will be useful to study the genetic diversity, dispersal, and reproductive mode of this common lichen photobiont.
Directory of Open Access Journals (Sweden)
Cristiane Becher Rosa
2008-06-01
Full Text Available OBJETIVO: o objetivo deste trabalho foi avaliar a resistência ao cisalhamento da colagem ortodôntica de um adesivo hidrofílico (Transbond Moisture-Insensitive Primer, 3M Unitek, Monrovia, Califórnia, de um adesivo auto-condicionante (Transbond Self-Etching Primer, 3M Unitek, Monrovia, Califórnia, e sem uso de adesivo, em superfícies de esmalte secas ou contaminadas por saliva. METODOLOGIA: incisivos bovinos (60 foram divididos em 6 grupos: (1 controle sem contaminação salivar (sem adesivo, (2 controle com contaminação salivar (sem adesivo, (3 adesivo auto-condicionante sem contaminação salivar, (4 adesivo auto-condicionante com contaminação salivar antes do adesivo, (5 adesivo hidrofílico sem contaminação salivar e (6 adesivo hidrofílico com contaminação salivar antes do adesivo. Braquetes metálicos foram colados com compósito (Transbond XT, 3M Unitek, Monrovia, Califórnia. Após a colagem, os corpos-de prova foram armazenados a 37±1ºC em ambiente úmido até a realização do teste de cisalhamento. Diferença estatística foi determinada com valor de probabilidade de 0,05 ou menos (p AIM: The purpose of this study was to evaluate the shear bond strength of orthodontic bonding with the use of a hydrophilic primer (Transbond Moisture-Insensitive Primer, 3M Unitek, Monrovia, Calif., a self-etching primer (Transbond Plus Self-etching Primer, 3M Unitek, Monrovia, Calif. and without primer application, in dry and saliva contaminated enamel surfaces. METHODS: Bovine incisors (60 were divided into 6 groups: (1 uncontaminated control (no primer, (2 control with saliva contamination (no primer, (3 uncontaminated self-etching primer, (4 saliva contamination before self-etching primer, (5 uncontaminated hydrophilic primer and (6 saliva contamination before hydrophilic primer. Stainless steel brackets were bonded with composite resin (Transbond XT, 3M Unitek, Monrovia, Calif.. After bonding, all samples were stored at 37±1°C in a
40 CFR 63.745 - Standards: Primer and topcoat application operations.
2010-07-01
... CATEGORIES (CONTINUED) National Emission Standards for Aerospace Manufacturing and Rework Facilities § 63.745.../L (4.5 lb/gal) of primer (less water), as applied, for general aviation rework facilities; or 650 g... (4.5 lb/gal) of primer (less water and exempt solvents), as applied, for general aviation rework...
Directory of Open Access Journals (Sweden)
Natalia Raigosa Gómez
2009-06-01
Full Text Available Se estudio el nivel de variabilidad genética de una población de 35 aislamientos de Phytophthora infestans obtenidos en diferentes hospedantes y regiones geográficas de Colombia, mediante las técnicas de haplotipos mitocondriales y RAPD. Los resultados encontrados sugieren la existencia en el país de los haplotipos mitocondriales Ia en los aislamientos que afectan tomate de árbol (Solanum betaceum y IIa en cultivos de papa; dichos haplotipos están asociados a los linajes genéticos EC-3 y EC-1, respectivamente. Sin embargo, tres aislamientos obtenidos en tomate de mesa (S. lycopersicum, pimentón (Capsicum sp. y pepino de agua (S. muricatum requieren de un análisis posterior, debido a la falta de correlación entre los perfiles de restricción generados con los cuatro pares de cebadores utilizados en esta prueba y los haplotipos mitocondriales mencionados en la literatura. De otra parte, mediante cuatro cebadores RAPD, fue posible encontrar variabilidad al interior de los dos linajes genéticos, siendo interesante el hecho que los aislamientos obtenidos en tomate de árbol (EC-3 fueron divididos en dos grupos, relacionados con una distancia genética de 0,17. Estos hallazgos indican que es importante contemplar las fuentes de variación asexual en el análisis de la estructura poblacional de este oomycete y por tanto en el diseño de las estrategias de control de las enfermedades que causa P. infestans en cultivos de solanáceas de importancia económica.The level of genetic variability of 35 isolates of Phytophthora infestans obtained from different hosts and geographical regions of Colombia was studied through mitochondrial haplotypes and RAPD techniques. Results suggested the existence of mitochondrial haplotypes Ia affecting tree tomato (Solanum betaceum and IIa in potato, which are associated with genetic lineages EC-3 and EC-1, respectively. However, three isolates obtained from tomato (S. lycopersicum, capsicum (Capsicum sp. and
Structure of Hepatitis C Virus Polymerase in Complex with Primer-Template RNA
Energy Technology Data Exchange (ETDEWEB)
Mosley, Ralph T.; Edwards, Thomas E.; Murakami, Eisuke; Lam, Angela M.; Grice, Rena L.; Du, Jinfa; Sofia, Michael J.; Furman, Philip A.; Otto, Michael J. (Pharmasset); (Emerald)
2012-08-01
The replication of the hepatitis C viral (HCV) genome is accomplished by the NS5B RNA-dependent RNA polymerase (RdRp), for which mechanistic understanding and structure-guided drug design efforts have been hampered by its propensity to crystallize in a closed, polymerization-incompetent state. The removal of an autoinhibitory {beta}-hairpin loop from genotype 2a HCV NS5B increases de novo RNA synthesis by >100-fold, promotes RNA binding, and facilitated the determination of the first crystallographic structures of HCV polymerase in complex with RNA primer-template pairs. These crystal structures demonstrate the structural realignment required for primer-template recognition and elongation, provide new insights into HCV RNA synthesis at the molecular level, and may prove useful in the structure-based design of novel antiviral compounds. Additionally, our approach for obtaining the RNA primer-template-bound structure of HCV polymerase may be generally applicable to solving RNA-bound complexes for other viral RdRps that contain similar regulatory {beta}-hairpin loops, including bovine viral diarrhea virus, dengue virus, and West Nile virus.
Microsatellite Primer Development for Post Oak, Quercus stellata (Fagaceae
Directory of Open Access Journals (Sweden)
Warren B. Chatwin
2014-10-01
Full Text Available Premise of the study: The American Cross Timbers forest ecosystem runs from southeastern Kansas to Central Texas and is primarily composed of post oak (Quercus stellata. This old-growth forest currently occupies only about 2% of its ancestral range. To facilitate genetic research on this species, we developed microsatellite primers specific to post oak from reduced genomic libraries. Methods and Results: Two Q. stellata individuals, sampled from the northern and southern range of the post oak forest, were subject to genomic reduction and 454 pyrosequencing. Bioinformatic analysis identified putative microsatellites from which 12 polymorphic primer sets were screened on three populations. The number of alleles observed ranged from five to 20 across all populations, while observed and expected heterozygosity values ranged from 0.05 to 0.833 and 0.236 to 0.893, respectively, within individual populations. Conclusions: We report the development of microsatellite markers, specific to post oak, to aid the study of genetic diversity and population structure of extant forest remnants.
Directory of Open Access Journals (Sweden)
Diego Fernando Marmolejo
2008-10-01
Full Text Available Se colectaron picudos de Cosmopolites y Metamasius en municipios del Valle del Cauca, Caldas y Quindío. Se obtuvieron cultivos monospóricos con diluciones de 10-10 y 10-11. Los aislamientos fueron almacenados a -80°C con glicerol al 10% y el ADN a -20°C. Los marcadores moleculares RAM generaron 82 fragmentos de los cuales 67% fueron polimórficos con una heterocigocidad de 0.24, que indica diversidad media a alta. A un índice de similitud 0.84 se formaron 5 grupos: uno con 11 aislamientos y 4 con un solo aislamiento. En el gran grupo se detectó un duplicado y se encontró diversidad del hongo en los sitios muestreados. No se encontró relación entre aislamientos sobre Cosmopolites y Metamasius o zona geográfica en la formación de grupos genéticos.Weevils Cosmopolites and Metamasius in municipalities of the Valle del Cauca, Caldas and Quindío departaments of Colombia were collected. Monosporic cultures were obtained from10-10 and 10-11 dilutions of Beauveria bassiana. Isolates were kept at -80°C with 10% glycerol and DNA stored at -20°C. RAMs molecular markers generated a total of 82 fragments of which 67% were polymorphic. A heterozygosity value of 0.24 indicated a medium - high diversity. Five groups were formed which have a similarity value of 0.84 and one big group with 11 isolates and four groups with only one isolate. In the big group was detected a duplicate and fungi genetic diversity in the sampled places. Neither relationship among isolates of Cosmopolites and Metamasius nor geographical zone related to the formation of genetic groups.
Zhang, Huimin; He, Hongkui; Yu, Xiujuan; Xu, Zhaohui; Zhang, Zhizhou
2016-11-01
It remains an unsolved problem to quantify a natural microbial community by rapidly and conveniently measuring multiple species with functional significance. Most widely used high throughput next-generation sequencing methods can only generate information mainly for genus-level taxonomic identification and quantification, and detection of multiple species in a complex microbial community is still heavily dependent on approaches based on near full-length ribosome RNA gene or genome sequence information. In this study, we used near full-length rRNA gene library sequencing plus Primer-Blast to design species-specific primers based on whole microbial genome sequences. The primers were intended to be specific at the species level within relevant microbial communities, i.e., a defined genomics background. The primers were tested with samples collected from the Daqu (also called fermentation starters) and pit mud of a traditional Chinese liquor production plant. Sixteen pairs of primers were found to be suitable for identification of individual species. Among them, seven pairs were chosen to measure the abundance of microbial species through quantitative PCR. The combination of near full-length ribosome RNA gene library sequencing and Primer-Blast may represent a broadly useful protocol to quantify multiple species in complex microbial population samples with species-specific primers.
Cheng, Yu-Huei
2014-12-01
Specific primers play an important role in polymerase chain reaction (PCR) experiments, and therefore it is essential to find specific primers of outstanding quality. Unfortunately, many PCR constraints must be simultaneously inspected which makes specific primer selection difficult and time-consuming. This paper introduces a novel computational intelligence-based method, Teaching-Learning-Based Optimisation, to select the specific and feasible primers. The specified PCR product lengths of 150-300 bp and 500-800 bp with three melting temperature formulae of Wallace's formula, Bolton and McCarthy's formula and SantaLucia's formula were performed. The authors calculate optimal frequency to estimate the quality of primer selection based on a total of 500 runs for 50 random nucleotide sequences of 'Homo species' retrieved from the National Center for Biotechnology Information. The method was then fairly compared with the genetic algorithm (GA) and memetic algorithm (MA) for primer selection in the literature. The results show that the method easily found suitable primers corresponding with the setting primer constraints and had preferable performance than the GA and the MA. Furthermore, the method was also compared with the common method Primer3 according to their method type, primers presentation, parameters setting, speed and memory usage. In conclusion, it is an interesting primer selection method and a valuable tool for automatic high-throughput analysis. In the future, the usage of the primers in the wet lab needs to be validated carefully to increase the reliability of the method.
The Fluid Reading Primer: Animated Decoding Support for Emergent Readers.
Zellweger, Polle T.; Mackinlay, Jock D.
A prototype application called the Fluid Reading Primer was developed to help emergent readers with the process of decoding written words into their spoken forms. The Fluid Reading Primer is part of a larger research project called Fluid Documents, which is exploring the use of interactive animation of typography to show additional information in…
Takubo, Chikako; Yasuda, Genta; Murayama, Ryosuke; Ogura, Yukari; Tonegawa, Motoka; Kurokawa, Hiroyasu; Miyazaki, Masashi
2010-08-01
We used ultrasonic measurements to monitor the influence of power density and primer application on the polymerization reaction of dual-cured resin cements. The ultrasonic equipment comprised a pulser-receiver, transducers, and an oscilloscope. Resin cements were mixed and inserted into a transparent mould, and specimens were placed on the sample stage, onto which the primer, if used, was also applied. Power densities of 0 (no irradiation), 200, or 600 mW cm(-2) were used for curing. The transit time through the cement disk was divided by the specimen thickness to obtain the longitudinal sound velocity. When resin cements were light-irradiated, each curve displayed an initial plateau of approximately 1,500 m s(-1), which rapidly increased to a second plateau of 2,300-2,900 m s(-1). The rate of sound velocity increase was retarded when the cements were light-irradiated at lower power densities, and increased when the primer was applied. The polymerization behaviour of dual-cured resin cements was therefore shown to be affected by the power density of the curing unit and the application of self-etching primer. (c) 2010 The Authors. Journal compilation (c) 2010 Eur J Oral Sci.
Targeted reduction of highly abundant transcripts using pseudo-random primers.
Arnaud, Ophélie; Kato, Sachi; Poulain, Stéphane; Plessy, Charles
2016-04-01
Transcriptome studies based on quantitative sequencing can estimate levels of gene expression by measuring target RNA abundance in sequencing libraries. Sequencing costs are proportional to the total number of sequenced reads, and in order to cover rare RNAs, considerable quantities of abundant and identical reads are needed. This major limitation can be addressed by depleting a proportion of the most abundant sequences from the library. However, such depletion strategies involve either extra handling of the input RNA sample or use of a large number of reverse transcription primers, termed not-so-random (NSR) primers, which are costly to synthesize. Taking advantage of the high tolerance of reverse transcriptase to mis-prime, we found that it is possible to use as few as 40 pseudo-random (PS) reverse transcription primers to decrease the rate of undesirable abundant sequences within a library without affecting the overall transcriptome diversity. PS primers are simple to design and can be used to deplete several undesirable RNAs simultaneously, thus creating a flexible tool for enriching transcriptome libraries for rare transcript sequences.
Asari, Masaru; Okuda, Katsuhiro; Hoshina, Chisato; Omura, Tomohiro; Tasaki, Yoshikazu; Shiono, Hiroshi; Matsubara, Kazuo; Shimizu, Keiko
2016-02-01
The aim of this study was to develop a cost-effective genotyping method using high-quality DNA for human identification. A total of 21 short tandem repeats (STRs) and amelogenin were selected, and fluorescent fragments at 22 loci were simultaneously amplified in a single-tube reaction using locus-specific primers with 24-base universal tails and four fluorescent universal primers. Several nucleotide substitutions in universal tails and fluorescent universal primers enabled the detection of specific fluorescent fragments from the 22 loci. Multiplex polymerase chain reaction (PCR) produced intense FAM-, VIC-, NED-, and PET-labeled fragments ranging from 90 to 400 bp, and these fragments were discriminated using standard capillary electrophoretic analysis. The selected 22 loci were also analyzed using two commercial kits (the AmpFLSTR Identifiler Kit and the PowerPlex ESX 17 System), and results for two loci (D19S433 and D16S539) were discordant between these kits due to mutations at the primer binding sites. All genotypes from the 100 samples were determined using 2.5 ng of DNA by our method, and the expected alleles were completely recovered. Multiplex 22-locus genotyping using four fluorescent universal primers effectively reduces the costs to less than 20% of genotyping using commercial kits, and our method would be useful to detect silent alleles from commercial kit analysis. Copyright © 2015 Elsevier Inc. All rights reserved.
Martínez Rebollar, A.; Campos Francisco, W.
2015-01-01
El Aislamiento Social es un problema que se acentúa en la etapa de la vejez, poniendo en riesgo la integridad física y mental de los adultos mayores. Para mitigar este problema, se han desarrollado trabajos computacionales que fomentan la socialización a través de actividades de interacción social basadas en la comunicación y movilidad del adulto mayor. Sin embargo, son escasos los trabajos que proveen evidencia estadística acerca del impacto de las actividades de interacción social con el gr...
Defense Primer: DOD Contractors
2017-02-10
functions, from intelligence analysis or software development to landscaping or food service. Why does DOD use individual contractors? Going back to...that provide professional services, from research to management support. The bulk of contractors—more than 70%—provide products, and these include...10 U.S.C. Part IV: Service, Supply, and Procurement. CRS Products CRS In Focus IF10548, Defense Primer: U.S. Defense Industrial Base, by Daniel
Directory of Open Access Journals (Sweden)
Luk Ketut Budi Maitriani
2015-10-01
Full Text Available ABSTRAK : Penelitian ini bertujuan untuk memperoleh sepasang primer terbaik hasil desain secara in silico menggunakan program Clone Manager Suite 6 (University of Groningen. Primer ini didesain untuk digunakan dalam mengamplifikasi fragmen gen inhA isolat klinis Multidrug Resistance Tuberculosis (MDR-TB mencakup kodon 94 (nukleotida 280-282. Kodon 94 gen inhA merupakan posisi yang sering mengalami mutasi dan mengakibatkan koresisten terhadap isoniazid dan ethionamid. Desain primer menggunakan sekuen gen inhA Mycobacterium tuberculosis yang diperoleh dari situs www.ncbi.nlm.nih.gov (GenBank : AF106077. Hasil desain diperoleh sepasang primer terbaik dan diuji secara in vitro menggunakan metode Polymerase Chain Reaction (PCR. Template DNA yang digunakan adalah isolat klinis MDR-TB. Proses amplifikasi diawali dengan denaturasi awal pada 95°C selama 15 menit dan diikuti oleh 45 siklus amplifikasi (denaturasi pada suhu 94°C selama 1 menit, annealing pada 56°C selama 1 menit 20 detik dan elongasi pada 72°C selama 2 menit serta diakhiri dengan elongasi akhir pada 72°C selama 10 menit. Produk PCR dideteksi menggunakan elektroforesis gel agarosa 1,5%. Kesimpulan penelitian adalah diperoleh sepasang primer terbaik berdasarkan kriteria pada program Clone Manager Suite 6 (University of Groningen, meliputi: panjang primer, %GC, Tm (melting temperature, interaksi primer (dimers dan hairpins, stabilitas primer, repeats, runs dan false priming. Primer tersebut meliputi, primer forward (pF-inhA 5’ CTGGTTAGCGGAATCATCAC 3’ dan primer reverse (pR-inhA 5’ CGACCGTCATCCA-GTTGTA 3’ dengan ukuran produk 460 pb. ABSTRACT: The aim of this study was to obtain the best pair of primer as result in silico design using Clone Manager Suite 6 program (University of Groningen. The primer was designed for amplifying inhA gene fragment of Multidrug Resistance Tuberculosis (MDR-TB clinical isolates include codon 94 (nucleotide 280-282. Codon 94 of inhA gene is
Directory of Open Access Journals (Sweden)
Joseph-Alexander Verreet
2011-01-01
Full Text Available Early detection of infection is very important for efficient management of Mycosphaerella graminicola leaf blotch. To monitor and quantify the occurrence of this fungus during the growing season, a diagnostic method based on real-time PCR was developed. Standard and real-time PCR assays were developed using SYBR Green chemistry to quantify M. graminicola in vitro or in wheat samples. Microsatellite dinucleotide specific-primers were designed based on microsatellite repeats of sequences present in the genome of M. graminicola. Specificity was checked by analyzing DNA of 55 M. graminicola isolates obtained from different geographical origins. The method appears to be highly specific for detecting M. graminicola; no fluorescent signals were observed from 14 other closely related taxa. Primer (CT 7 G amplified a specific amplicon of 570 bp from all M. graminicola isolates. The primers did not amplify DNA extracted from 14 other fungal species. The approximate melting temperature (Tm of the (CT 7 G primer was 84.2 °C. The detection limit of the real-time PCR assay with the primer sets (CT 7 G is 10 fg/25 µL, as compared to 10 pg/25 µL using conventional PCR technology. From symptomless leaves, a PCR fragment could be generated two days after inoculation. Both conventional and real-time PCR could successfully detect the fungus from artificially inoculated wheat leaves. However, real-time PCR appeared much more sensitive than conventional PCR. The developed quantitative real-time PCR method proved to be rapid, sensitive, specific, cost-effective and reliable for the identification and quantification of M. graminicola in wheat.
Directory of Open Access Journals (Sweden)
Li Kelvin
2012-11-01
Full Text Available Abstract Background In a high-throughput environment, to PCR amplify and sequence a large set of viral isolates from populations that are potentially heterogeneous and continuously evolving, the use of degenerate PCR primers is an important strategy. Degenerate primers allow for the PCR amplification of a wider range of viral isolates with only one set of pre-mixed primers, thus increasing amplification success rates and minimizing the necessity for genome finishing activities. To successfully select a large set of degenerate PCR primers necessary to tile across an entire viral genome and maximize their success, this process is best performed computationally. Results We have developed a fully automated degenerate PCR primer design system that plays a key role in the J. Craig Venter Institute’s (JCVI high-throughput viral sequencing pipeline. A consensus viral genome, or a set of consensus segment sequences in the case of a segmented virus, is specified using IUPAC ambiguity codes in the consensus template sequence to represent the allelic diversity of the target population. PCR primer pairs are then selected computationally to produce a minimal amplicon set capable of tiling across the full length of the specified target region. As part of the tiling process, primer pairs are computationally screened to meet the criteria for successful PCR with one of two described amplification protocols. The actual sequencing success rates for designed primers for measles virus, mumps virus, human parainfluenza virus 1 and 3, human respiratory syncytial virus A and B and human metapneumovirus are described, where >90% of designed primer pairs were able to consistently successfully amplify >75% of the isolates. Conclusions Augmenting our previously developed and published JCVI Primer Design Pipeline, we achieved similarly high sequencing success rates with only minor software modifications. The recommended methodology for the construction of the consensus
Freshwater Wetlands: A Citizen's Primer.
Catskill Center for Conservation and Development, Inc., Hobart, NY.
The purpose of this "primer" for the general public is to describe the general characteristics of wetlands and how wetland alteration adversely affects the well-being of humans. Particular emphasis is placed on wetlands in New York State and the northeast. Topics discussed include wetland values, destruction of wetlands, the costs of…
Directory of Open Access Journals (Sweden)
María Mercedes Bravo
2010-08-01
Full Text Available Introduction. Studies using Western Helicobacter pylori strains have shown that a risk factor for gastric cancer is the number of EPIYA-C motifs in the cytotoxin-associated A protein. CagA is delivered into epithelial cells, where it becomes tyrosine phosphorylated in their EPIYA repeats and induces cytoskeleton rearrangements.
Objectives. The objective of this study was to evaluate H. pylori cagA positive strains isolated from Colombian patients with gastroduodenal diseases for the number of EPIYA-C repeats in cagA and their ability to induce cytoskeleton rearrangements in epithelial cells.
Materials and methods. We analyzed the 3' EPIYA repeats region of cagA by PCR in 93 H. pylori cagA positive strains from 49 patients with gastritis, 17 with gastric cancer, and 24 with duodenal ulcer. AGS cells exposed to the various H. pylori isolates were evaluated for rearrangements in their cytoskeleton.
Results. Strains with one EPIYA-C were the most frequent in gastritis and duodenal ulcer patients. Strains with three EPIYA-C were mainly found in gastric cancer. We found a significantly higher risk of gastric cancer for individuals infected with strains harboring three EPIYA-C motifs (OR=12.4, CI95%: 2.32-66.3. Strains from gastric cancer showed significantly higher percentages of induction of cytoskeleton rearrangements in comparison with those from gastritis (p Mann-Whitney<0.005.
Conclusions. H. pylori strains with three EPIYA-C repeats can confer an increased risk of cancer to infected individuals.Introducción. En los aislamientos de Helicobacter pylori del hemisferio occidental, se ha observado que el número de repeticiones EPIYA-C en la proteína CagA es un factor de riesgo para cáncer gástrico. La proteína CagA es introducida en la célula epitelial y, posteriormente, es fosforilada en las tirosinas presentes en los motivos EPIYA e induce rearreglos en el citoesqueleto.
Objetivos. Nuestro propósito fue evaluar el n
Directory of Open Access Journals (Sweden)
Aníbal A. Brizzio
2013-03-01
Full Text Available Introducción. La intoxicación alimentaria estafilocócica es la más frecuente de las intoxicaciones alimentarias. La acción de las enterotoxinas de Staphylococcus aureus en la luz intestinal provoca una importante pérdida de agua que origina vómitos y diarrea. Objetivo. Presentar una estrategia rápida, fiable y de bajo costo, basada en una reacción en cadena de la polimerasa (PCR múltiple para, simultáneamente, identificar S. aureus y detectar genes de las cinco enterotoxinas clásicas de S. aureus (sea, seb, sec, sed, see en cepas de Staphylococcus spp. aisladas de alimentos. Materiales y métodos. Se trabajó con aislamientos recuperados de 12 brotes de intoxicación alimentaria estafilocócica ocurridos en la provincia de Santa Fe, Argentina. El aislamiento y la caracterización fenotípica se llevaron a cabo mediante procedimientos estándar. La evaluación genotípica se hizo por una PCR múltiple, utilizando simultáneamente cebadores para los genes nuc, sea-see y 16S rRNA. Resultados. En las cepas analizadas se detectó 58 % de portadoras de genes toxigénicos. Las toxinas sea y seb se encontraron en igual porcentaje (29 %, mientras que las sec, sed y see se encontraron en menor e idéntica proporción (14 %. No encontramos más de un tipo diferente de enterotoxinas de S. aureus en los aislamientos analizados. Conclusiones. La estrategia de PCR múltiple diseñada en este trabajo permitió identificar cepas de S. aureus y confirmar, al mismo tiempo, su enterotoxigenicidad. En estos momentos, nuestros esfuerzos están dirigidos a detectar los genes que codifican enterotoxinas distintas de las clásicas, a fin de conocer su incidencia en las intoxicaciones alimentarias estafilocócicas e investigar su relevancia en la salud pública de nuestro país. doi: http://dx.doi.org/10.7705/biomedica.v33i1.816
Quantitative Microbial Risk Assessment Tutorial - Primer
This document provides a Quantitative Microbial Risk Assessment (QMRA) primer that organizes QMRA tutorials. The tutorials describe functionality of a QMRA infrastructure, guide the user through software use and assessment options, provide step-by-step instructions for implementi...
A tool for design of primers for microRNA-specific quantitative RT-qPCR. BMC Bioinformatics
DEFF Research Database (Denmark)
Busk, Peter Kamp
2014-01-01
of formation of secondary structures and primer dimers. Testing of the primers showed that 76 out of 79 primers (96%) worked for quantification of microRNAs by miR-specific RT-qPCR of mammalian RNA samples. This success rate corresponds to the success rate of manual primer design. Furthermore, primers designed......Background MicroRNAs are small but biologically important RNA molecules. Although different methods can be used for quantification of microRNAs, quantitative PCR is regarded as the reference that is used to validate other methods. Several commercial qPCR assays are available but they often come...... at a high price and the sequences of the primers are not disclosed. An alternative to commercial assays is to manually design primers but this work is tedious and, hence, not practical for the design of primers for a larger number of targets. Results I have developed the software miRprimer for automatic...
Optimisation of the PCR-invA primers for the detection of Salmonella ...
African Journals Online (AJOL)
A polymerase chain reaction (PCR)-based method for the detection of Salmonella species in water samples was optimised and evaluated for speed, specificity and sensitivity. Optimisation of Mg2+ and primer concentrations and cycling parameters increased the sensitivity and limit of detection of PCR to 2.6 x 104 cfu/m.
Improved group-specific primers based on the full SILVA 16S rRNA gene reference database.
Pfeiffer, Stefan; Pastar, Milica; Mitter, Birgit; Lippert, Kathrin; Hackl, Evelyn; Lojan, Paul; Oswald, Andreas; Sessitsch, Angela
2014-08-01
Quantitative PCR (qPCR) and community fingerprinting methods, such as the Terminal Restriction Fragment Length Polymorphism (T-RFLP) analysis,are well-suited techniques for the examination of microbial community structures. The use of phylum and class-specific primers can provide enhanced sensitivity and phylogenetic resolution as compared with domain-specific primers. To date, several phylum- and class-specific primers targeting the 16S ribosomal RNA gene have been published. However, many of these primers exhibit low discriminatory power against non-target bacteria in PCR. In this study, we evaluated the precision of certain published primers in silico and via specific PCR. We designed new qPCR and T-RFLP primer pairs (for the classes Alphaproteobacteria and Betaproteobacteria, and the phyla Bacteroidetes, Firmicutes and Actinobacteria) by combining the sequence information from a public dataset (SILVA SSU Ref 102 NR) with manual primer design. We evaluated the primer pairs via PCR using isolates of the above-mentioned groups and via screening of clone libraries from environmental soil samples and human faecal samples. As observed through theoretical and practical evaluation, the primers developed in this study showed a higher level of precision than previously published primers, thus allowing a deeper insight into microbial community dynamics.
Sensory reception of the primer pheromone ethyl oleate
Muenz, Thomas S.; Maisonnasse, Alban; Plettner, Erika; Le Conte, Yves; Rössler, Wolfgang
2012-05-01
Social work force distribution in honeybee colonies critically depends on subtle adjustments of an age-related polyethism. Pheromones play a crucial role in adjusting physiological and behavioral maturation of nurse bees to foragers. In addition to primer effects of brood pheromone and queen mandibular pheromone—both were shown to influence onset of foraging—direct worker-worker interactions influence adult behavioral maturation. These interactions were narrowed down to the primer pheromone ethyl oleate, which is present at high concentrations in foragers, almost absent in young bees and was shown to delay the onset of foraging. Based on chemical analyses, physiological recordings from the antenna (electroantennograms) and the antennal lobe (calcium imaging), and behavioral assays (associative conditioning of the proboscis extension response), we present evidence that ethyl oleate is most abundant on the cuticle, received by olfactory receptors on the antenna, processed in glomeruli of the antennal lobe, and learned in olfactory centers of the brain. The results are highly suggestive that the primer pheromone ethyl oleate is transmitted and perceived between individuals via olfaction at close range.
Técnicas de aislamiento y concentración de volátiles de aceites vegetales
Directory of Open Access Journals (Sweden)
Morales, M. T.
1992-06-01
Full Text Available One of the methods for food flavor evaluation is the analysis of volatile components. First step in this kind of analysis Is the isolation and concentration of volatiles. A review is carried out about different techniques applied in foods and especially in vegetable oils. Very different methods have been used, an explication of each one with its different cases are presented. Likewise the applications carried out in vegetable oils during last years are discussed.
Uno de los métodos de evaluación del flavor de los alimentos consiste en la determinación de sus componentes volátiles. La primera etapa necesaria para realizar este tipo de análisis es el aislamiento y concentración de los mismos. Se ha realizado una revisión bibliográfica sobre las diferentes técnicas utilizadas para este fin en diferentes alimentos y especialmente en aceites vegetales. Los métodos utilizados son muy diversos, se ofrece una explicación de cada uno de ellos considerando las diferentes variantes existentes. Asimismo se detallan las aplicaciones realizadas en aceites vegetales durante los últimos años.
PRIMEGENSw3: a web-based tool for high-throughput primer and probe design.
Kushwaha, Garima; Srivastava, Gyan Prakash; Xu, Dong
2015-01-01
Highly specific and efficient primer and probe design has been a major hurdle in many high-throughput techniques. Successful implementation of any PCR or probe hybridization technique depends on the quality of primers and probes used in terms of their specificity and cross-hybridization. Here we describe PRIMEGENSw3, a set of web-based utilities for high-throughput primer and probe design. These utilities allow users to select genomic regions and to design primer/probe for selected regions in an interactive, user-friendly, and automatic fashion. The system runs the PRIMEGENS algorithm in the back-end on the high-performance server with the stored genomic database or user-provided custom database for cross-hybridization check. Cross-hybridization is checked not only using BLAST but also by checking mismatch positions and energy calculation of potential hybridization hits. The results can be visualized online and also can be downloaded. The average success rate of primer design using PRIMEGENSw3 is ~90 %. The web server also supports primer design for methylated sequences, which is used in epigenetic studies. Stand-alone version of the software is also available for download at the website.
Directory of Open Access Journals (Sweden)
Carmen Eliana Realpe Ortiz
2006-12-01
Full Text Available El hongo Rosellinia pepo Pat., causante de la llaga estrellada, se considera uno de los principales problemas fitosanitarios de la macadamia por ocasionar la muerte de la planta en su etapa productiva. Debido a que no existe una metodología de aislamiento confiable que asegure la recuperación del hongo con un porcentaje mínimo de contaminación y los estudios relacionados con este patógeno son escasos se planteó una investigación con el fin de perfeccionar una metodología de aislamiento y realizar algunas caracterizaciones morfológicas de este patógeno. La nueva metodología permitió obtener aislamientos con un 91,26% de pureza del hongo. La tasa de crecimiento fue de 4,68 mm día-1. Las colonias son de color blanco y apariencia algodonosa en su inicio, pero a medida que envejece el micelio toma un color café o negro y su apariencia se torna quebradiza. La observación de micelio blanco en forma de estrella en el lado interior del medio sintético permite diferenciarlo de otras especies como R. bunodes. Las mediciones microscópicas de los hinchamientos piriformes presentaron en promedio 106,4mm de largo y 75,3mm de ancho. Este trabajo también permitió determinar el nivel de inóculo infectivo.The fungus Rosellinia pepo Pat, the causal agent of star gall, is considered to be a main phytosanitary problem to the Macademia tree by causing the death of the tree while in its productive stage. Because no reliable isolation method exists that assures recovery of the mushroom with a minimum percentage of contamination and studies of this pathogen are scarce. This study was conducted to perfect an isolation methodology and permit some morphological characterizations of this pathogen. The new methodology allowed isolations with 91,26% purity of mushroom to be obtained. The rate of growth was 4,68 mm day-1. The colonies were of white color and cottony appearance in the beginning, but as the micelio aged it assumed a brown or black color and a
GST-PRIME: an algorithm for genome-wide primer design.
Leister, Dario; Varotto, Claudio
2007-01-01
The profiling of mRNA expression based on DNA arrays has become a powerful tool to study genome-wide transcription of genes in a number of organisms. GST-PRIME is a software package created to facilitate large-scale primer design for the amplification of probes to be immobilized on arrays for transcriptome analyses, even though it can be also applied in low-throughput approaches. GST-PRIME allows highly efficient, direct amplification of gene-sequence tags (GSTs) from genomic DNA (gDNA), starting from annotated genome or transcript sequences. GST-PRIME provides a customer-friendly platform for automatic primer design, and despite the relative simplicity of the algorithm, experimental tests in the model plant species Arabidopsis thaliana confirmed the reliability of the software. This chapter describes the algorithm used for primer design, its input and output files, and the installation of the standalone package and its use.
Polderman, R.N.; Frencken, J.E.F.M.
2007-01-01
OBJECTIVES: The null-hypothesis tested was; there is no difference in effectiveness between a new low-viscosity glass ionomer and a resin-based glutaraldehyde containing primer in treating hypersensitive teeth after 2 years. METHODS: Using a split-mouth design, hypersensitive teeth in 14 adult
Primer Vector Optimization: Survey of Theory, new Analysis and Applications
Guzman
This paper presents a preliminary study in developing a set of optimization tools for orbit rendezvous, transfer and station keeping. This work is part of a large scale effort undergoing at NASA Goddard Space Flight Center and a.i. solutions, Inc. to build generic methods, which will enable missions with tight fuel budgets. Since no single optimization technique can solve efficiently all existing problems, a library of tools where the user could pick the method most suited for the particular mission is envisioned. The first trajectory optimization technique explored is Lawden's primer vector theory [Ref. 1]. Primer vector theory can be considered as a byproduct of applying Calculus of Variations (COV) techniques to the problem of minimizing the fuel usage of impulsive trajectories. For an n-impulse trajectory, it involves the solution of n-1 two-point boundary value problems. In this paper, we look at some of the different formulations of the primer vector (dependent on the frame employed and on the force model). Also, the applicability of primer vector theory is examined in effort to understand when and why the theory can fail. Specifically, since COV is based on "small variations", singularities in the linearized (variational) equations of motion along the arcs must be taken into account. These singularities are a recurring problem in analyzes that employ "small variations" [Refs. 2, 3]. For example, singularities in the (2-body problem) variational equations along elliptic arcs occur when [Ref. 4], 1) the difference between the initial and final times is a multiple of the reference orbit period, 2) the difference between the initial and final true anomalies are given by k, for k= 0, 1, 2, 3,..., note that this cover the 3) the time of flight is a minimum for the given difference in true anomaly. For the N-body problem, the situation is more complex and is still under investigation. Several examples, such as the initialization of an orbit (ascent trajectory) and
Bioinspired Catecholic Primers for Rigid and Ductile Dental Resin Composites.
Shin, Eeseul; Ju, Sung Won; An, Larry; Ahn, Eungjin; Ahn, Jin-Soo; Kim, Byeong-Su; Ahn, B Kollbe
2018-01-17
In the construction of dental restorative polymer composite materials, surface priming on mineral fillers is essential to improve the mechanical performance of the composites. Here we present bioinspired catechol-functionalized primers for a tougher dental resin composite containing glass fillers. The catecholic primers with different polymerizable end groups were designed and then coated on glass surfaces using a simple drop-casting or dip-coating process. The surface binding ability and possible cross-linking (coupling or chemical bridging between the glass substrate and the dental resin) of the catecholic bifunctional primers were evaluated using atomic force microscopy, contact angle measurements, and the knife shear bonding test and compared to a state-of-the-art silane-based coupling agent. Various mechanical tests including shrinkage and compression tests of the dental resin composites were also conducted. Compression tests of the composites containing the catecholic primed fillers exhibited enhanced mechanical properties, owing to the bidentate hydrogen bonding of catechol moieties to the oxide mineral surface. Furthermore, the superior biocompatibility of the primed surface was confirmed via cell attachment assay, thus providing applicability of catecholic primers for practical dental and biomedical applications.
Energy Technology Data Exchange (ETDEWEB)
Ordonez C, Luis Felipe [Aislantes Minerales, S. A. de C. V., Mexico, D. F. (Mexico)
1993-12-31
-economias nacionales como a las microeconomias familiares individuales. En consecuencia directa de la reduccion en el consumo energetico, se reduce en forma proporcional la emision de los contaminantes derivados de la combustion. La reduccion se realiza en su gasto diario y transfiere sus beneficios en forma directa e inmediata. Otros efectos secundarios beneficos son; se mejora sensiblemente la calidad de vida de los habitantes de viviendas mas confortables, se generan nuevos empleos y necesidades de mayor capacitacion al personal de la construccion y se amplia la oferta de alternativas de sistemas constructivos. En primer termino, se hace una presentacion resumida y explicada de la legislacion y reglamentacion adoptada en una amplia lista de distintos paises del mundo; lideres en este aspecto. Posteriormente, se hace una presentacion de las medidas que se pudieran implementar a este respecto en Mexico y se sugieren valores especificos de aislamiento relativos a las distintas regiones climatologicas mexicanas.
Energy Technology Data Exchange (ETDEWEB)
Ordonez C, Luis Felipe [Aislantes Minerales, S. A. de C. V., Mexico, D. F. (Mexico)
1992-12-31
-economias nacionales como a las microeconomias familiares individuales. En consecuencia directa de la reduccion en el consumo energetico, se reduce en forma proporcional la emision de los contaminantes derivados de la combustion. La reduccion se realiza en su gasto diario y transfiere sus beneficios en forma directa e inmediata. Otros efectos secundarios beneficos son; se mejora sensiblemente la calidad de vida de los habitantes de viviendas mas confortables, se generan nuevos empleos y necesidades de mayor capacitacion al personal de la construccion y se amplia la oferta de alternativas de sistemas constructivos. En primer termino, se hace una presentacion resumida y explicada de la legislacion y reglamentacion adoptada en una amplia lista de distintos paises del mundo; lideres en este aspecto. Posteriormente, se hace una presentacion de las medidas que se pudieran implementar a este respecto en Mexico y se sugieren valores especificos de aislamiento relativos a las distintas regiones climatologicas mexicanas.
Nonspecific amplification of human DNA by Streptococcus pneumoniae LytA primer
Directory of Open Access Journals (Sweden)
Helen Hencida Thangamony
2018-01-01
Full Text Available Background: Determination of various analytical parameters is essential for the validation of primers used for in-house nucleic acid amplification tests. While standardising a high-resolution melt analysis (HRMA for detection of Streptococcus pneumoniae in acute pyogenic meningitis, we encountered non-specific amplification of certain base pair sequences of human DNA by Centers for Disease Control & Prevention, USA recommended S. pneumoniae LytA primer. Materials and Methods: HRMA was standardised using DNA extracted from an ATCC strain of S. pneumoniae using SP LytA F373 primer and Type-it HRMTM polymerase chain reaction kit in Rotor-Gene Q Thermal Cycler according to the manufacturer's instructions. Specificity of the primers was determined in dry and wet laboratory experiments against diverse related and unrelated microbial pathogens by HRMA and on DNA extracted from unspiked clinical samples negative for SP DNA. Sensitivity was determined by calculating lower limit of detection threshold in experiments with spiked samples. The amplicon from spiked experiments was sequenced and analysed through Gene Bank. Results: Our dry/wet laboratory experiments showed two separate curves and different Tm values indicating certain non-specific amplification by the primer. Basic Local Alignment Search Tool (BLAST analysis of the amplicon obtained in the spiked experiment showed sequences of human chromosome 20 associated with Homo sapiens protein tyrosine phosphatase, receptor type T gene. The problem was resolved by stopping the reaction at 30th Ct cycle and observing the Tm values. Conclusion: Since HRMA is done without a specific probe, one should be aware of non-specific amplifications while using primers for HRMA of human clinical samples.
Ekstrom, Claus Thorn
2011-01-01
Newcomers to R are often intimidated by the command-line interface, the vast number of functions and packages, or the processes of importing data and performing a simple statistical analysis. The R Primer provides a collection of concise examples and solutions to R problems frequently encountered by new users of this statistical software.Rather than explore the many options available for every command as well as the ever-increasing number of packages, the book focuses on the basics of data preparation and analysis and gives examples that can be used as a starting point. The numerous examples i
Aislamiento de polisacáridos a partir de cordones umbilicales humanos
Directory of Open Access Journals (Sweden)
Guillermo Lago
2002-12-01
Full Text Available Se realizó el aislamiento y caracterización de polisacáridos obtenidos a partir de cordones umbilicales humanos mediante una modificación a la técnica de Danishevsky y Bella. Se trataron los cordones con solución de cloruro de sodio bajo condiciones de temperatura y agitación controlada y se precipitaron los polisacáridos mediante la adición de una disolución de bromuro de cetiltrimetilamonio al 1 %. Se resuspendió el sedimento obtenido en una solución de cloruro de sodio 0,4 mol/L eliminando algunas impurezas que no se solubilizan a esta fuerza iónica mediante centrifugación y se precipitó el producto de interés mediante la adición de etanol al sobrenadante, caracterizándose por métodos químicos. El producto puede ser empleado como materia prima para obtener un gel cicatrizante en la Industria Médico-Farmacéutica.The polysaccharides obtained from human umbilical cords by a modification of Danishevsky and Bella’s technique were isolated and characterized. The cords were treated with a sodium chloride solution under controlled temperature and agitation conditions. The polysaccharides were precipitated by adding a disolution of cetyltrimethylammonium 1 %. The sediment obtained in a sodium chloride solution 0.4 mol/L was resuspended, eliminating some impurities that were not soluble at this ionic force by centrifugation. The product of interest was precipitated by adding ethanol to the supernadant and it was characterized by chemical methods. This product may be used as a raw material to obtain a healing gel in the Medicopharmaceutical Industry.
Primer sets for cloning the human repertoire of T cell Receptor Variable regions.
Boria, Ilenia; Cotella, Diego; Dianzani, Irma; Santoro, Claudio; Sblattero, Daniele
2008-08-29
Amplification and cloning of naïve T cell Receptor (TR) repertoires or antigen-specific TR is crucial to shape immune response and to develop immuno-based therapies. TR variable (V) regions are encoded by several genes that recombine during T cell development. The cloning of expressed genes as large diverse libraries from natural sources relies upon the availability of primers able to amplify as many V genes as possible. Here, we present a list of primers computationally designed on all functional TR V and J genes listed in the IMGT, the ImMunoGeneTics information system. The list consists of unambiguous or degenerate primers suitable to theoretically amplify and clone the entire TR repertoire. We show that it is possible to selectively amplify and clone expressed TR V genes in one single RT-PCR step and from as little as 1000 cells. This new primer set will facilitate the creation of more diverse TR libraries than has been possible using currently available primer sets.
THE QUALITY IMPROVEMENT OF PRIMER PACKAGING PROCESS USING SIX SIGMA METHODOLOGY
Directory of Open Access Journals (Sweden)
Prima Ditahardiyani
2008-01-01
Full Text Available The implementation of Six Sigma has become a common theme in many organizations. This paper presents the Six Sigma methodology and its implementation in a primer packaging process of Cranberry drink. DMAIC (Define, Measure, Analyze, Improve and Control approach is used to analyze and to improve the primer packaging process, which have high variability and defects output. After the improvement, the results showed that there was an increasing sigma level. However, it is not significantly and has not achieved the world standard quality, yet. Therefore, the implementation of Six Sigma in primer packaging process of Cranberry drink still has a room for doing a further research.
Lee, Ji-Yeon; Ahn, Jaechan; An, Sang In; Park, Jeong-Won
2018-02-01
The aim of this study is to compare the shear bond strengths of ceramic brackets bonded to zirconia surfaces using different zirconia primers and universal adhesive. Fifty zirconia blocks (15 × 15 × 10 mm, Zpex, Tosoh Corporation) were polished with 1,000 grit sand paper and air-abraded with 50 µm Al 2 O 3 for 10 seconds (40 psi). They were divided into 5 groups: control (CO), Metal/Zirconia primer (MZ, Ivoclar Vivadent), Z-PRIME Plus (ZP, Bisco), Zirconia Liner (ZL, Sun Medical), and Scotchbond Universal adhesive (SU, 3M ESPE). Transbond XT Primer (used for CO, MZ, ZP, and ZL) and Transbond XT Paste was used for bracket bonding (Gemini clear ceramic brackets, 3M Unitek). After 24 hours at 37°C storage, specimens underwent 2,000 thermocycles, and then, shear bond strengths were measured (1 mm/min). An adhesive remnant index (ARI) score was calculated. The data were analyzed using one-way analysis of variance and the Bonferroni test ( p = 0.05). Surface treatment with primers resulted in increased shear bond strength. The SU group showed the highest shear bond strength followed by the ZP, ZL, MZ, and CO groups, in that order. The median ARI scores were as follows: CO = 0, MZ = 0, ZP = 0, ZL = 0, and SU = 3 ( p < 0.05). Within this experiment, zirconia primer can increase the shear bond strength of bracket bonding. The highest shear bond strength is observed in SU group, even when no primer is used.
Galkiewicz, Julia P; Kellogg, Christina A
2008-12-01
PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem.
Galkiewicz, Julia P.; Kellogg, Christina A.
2008-01-01
PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem.
Directory of Open Access Journals (Sweden)
Julio Alberto Molé Menéndez
2012-02-01
Full Text Available El aislamiento de los generadores eléctricos de gran potencia (Turbogeneradores e Hidrogeneradores es el componente que más influye en su confiabilidad operacional, por lo cual es vital conocer su estado para aplicar las acciones correctivas requeridas. Para alcanzar tal fin, existen múltiples ensayos, controles y criterios relativos a inspecciones sensoriales, muchos de ellos concebidos hace más de medio siglo y que aún subsisten en variantes modernizadas, mientras que otros, más modernos, han sido generalizados y perfeccionados constantemente. Las técnicas y métodos para la aplicación de los ensayos, controles e inspecciones también han evolucionado. En este trabajo se resumen algunas experiencias en la aplicación de los ensayos más actuales relativos a la evaluación de la contaminación, la detección de deficiencias en la protección anticorona, la presencia de descargas parciales internas y la evaluación del envejecimiento del aislamiento, que son aplicados en las áreas de influencia de los autores.The insulation of power generators (Turbogenerator and Hydrogenerators is the component that influences more in its operational reliability, thus is vital to know its state to apply corrective actions. In order to reach such aim, multiple tests, sensorial controls and criteria regarding inspection have been developed, many of conceived them for more than half century and that still subsists in modernized variants, whereas others, more modern, have been generalized and perfected constantly. The techniques and methods for the application of the tests, controls and inspection also have evolved. This work reviews some experiences in the application of recent improvements to insulation tests about the evaluation of contamination, detection problems in the anticorona slot protection, internal partial discharges and the evaluation of the aging, that are applied in the areas of influence of the authors.
Directory of Open Access Journals (Sweden)
Julio J. Masquijo
2014-10-01
Full Text Available Introducción: si bien el crecimiento prenatal y posnatal del pie ha sido documentado hace varios años, el crecimiento longitudinal del primer metatarsiano en particular no ha sido estudiado previamente. El objetivo del estudio es determinar el patrón de crecimiento longitudinal posnatal de este hueso y compararlo con el del pie y los huesos largos del miembro inferior. Materiales y Métodos: mediante una búsqueda informatizada, se identificaron pacientes <18 años de edad con radiografías informadas como “normal” por el radiólogo. Se analizó una muestra de 886 pacientes divididos en 18 grupos según la edad (0-11 meses, 1 año, 2 años, etc. y el sexo. El análisis de las imágenes se realizó con un software de imágenes Kodak Carestream PACS. Resultados: el largo promedio en el primer grupo fue de 19,91 mm (3,20; 15,22-25,62. El largo promedio en el último grupo fue de 66,13 mm (5,33; 52,50-77,18. La tasa de crecimiento anual fue de 2,71 mm. La edad promedio al momento del cierre de la fisis fue de 14.85 años (± 1.64 para los varones y 14.77 años (± 3.63 para las niñas. Conclusión: el crecimiento del primer metatarsiano acompaña el crecimiento longitudinal del pie, pero no el de los huesos largos del miembro inferior. Las curvas de crecimiento del primer metatarsiano descritas en este artículo pueden ser aplicadas en patologías que afectan el desarrollo del pie o que requieren cirugía de corrección sobre el primer metatarsiano, o se las puede emplear como estándar de referencia en futuros estudios.
Molecular passportization of clones of karelian birch using PCRwith semi-specific primers
Directory of Open Access Journals (Sweden)
Tatyana V Matveeva
2008-09-01
Full Text Available Using 4 clones of Karelian birch (Betula pendula Roth var caretica Merckl. from the collection of the karelian birch of the laboratory of genetics of Research Institute of Forest Genetics and Breeding, Voronezh, one normal tree of Betula pendula Roth, and one tree of B. pubescens Ehrh., collected from the nature, we have analyzed the possibility of application of PCR with semi-specific primers for molecular typing. We found primers with high percentage of polymorphic markers. These primers could be recommended for molecular typing of birch.
Directory of Open Access Journals (Sweden)
Tri Joko Raharjo
2017-07-01
Full Text Available Porcine adulteration in meatball samples were analyzed using real-time polymerase chain reaction (RT-PCR, based on the ND5 primer obtained by previous study. This work consisted of three stages which were annealing temperature optimization, method validation, and application. DNA template was extracted using phenol-CIAA (chloroform-iso amyl alcohol method. The optimum annealing temperature for ND5 primers (forward primer 5'-CATTCGCCTCACTCACATTAACC-3' and reverse primer 5'-AAGAGAGAGTTCTACGGTCTGTAG-3' was 58.0 °C, obtained after testing annealing at 50.5 to 59.5 °C gradient temperature with 5 °C interval. Melting curve analysis was done at 65.0 to 95.0 °C, with increasing temperature for 0.5 °C per 2 sec. Method was validated for its specificity, precision and limit of detection. RT-PCR method with ND5 primers produced 227 bp DNA fragment with 78.50 °C Tm value. From eight commercial meatball samples, one was detected containing porcine. The methods showed high specificity and precision, with experimentally determined limits for porcine were no less than 1%.
Galkiewicz, Julia P.; Kellogg, Christina A.
2008-01-01
PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. PMID:18931299
El primer virreinato americano
Directory of Open Access Journals (Sweden)
Cassá, Roberto
2006-12-01
Full Text Available This article explores the government of viceroy Christopher Columbus in the American territories. We return to the first Spanish settlement in Santo Domingo and the contradictions inherent to this expansionist proyect. The contradictions were part of the
logic of the absolutist state and Columbus’ reaction against the controls imposed by the monarchs. Secondly, we look into the dificulties that the Admiral encountered to develop a mercantilist model. In this context, we examine the rationale behind the first government of the Indies and the features that defined the new West Indian society.
El artículo trata sobre el gobierno de Cristóbal Colón en tierras americanas. Retomamos el tema del primer emplazamiento español en Santo Domingo y las contradicciones que tuvo aquel proyecto debido a la lógica del estado absolutista, a la ambición desmedida del descubridor y a su reacción ante los controles que desde un principio impusieron los monarcas. En un segundo momento analizamos las dificultades que encontró el Almirante para desarrollar un modelo mercantilista acorde a sus ideas y a los acuerdos a que llegó con la Corona. En ese contexto analizamos la lógica del primer gobierno colombinista en las Indias y los rasgos que definieron la nueva sociedad antillana.
Sediment transport primer: estimating bed-material transport in gravel-bed rivers
Peter Wilcock; John Pitlick; Yantao Cui
2009-01-01
This primer accompanies the release of BAGS, software developed to calculate sediment transport rate in gravel-bed rivers. BAGS and other programs facilitate calculation and can reduce some errors, but cannot ensure that calculations are accurate or relevant. This primer was written to help the software user define relevant and tractable problems, select appropriate...
Aislamiento acústico a ruido aéreo en acristalamientos de vidrio
Directory of Open Access Journals (Sweden)
Escuder Silla, E.
2007-08-01
Full Text Available In this paper, the Ookura & Saito model is applied to determine the Airborne Sound Insulation of glazing systems. In particular, the calculations that appear are for monolithic glasses of different thicknesses and laminated glasses from different types. There are different prediction models of the airborne acoustic behaviour of multilayer panels (and the laminated glasses can be considered like such. In all of them, the input data are the elastic constants and the loss factor. The monolithic glasses and the intermediate layer have been characterized according to different Standards. The results are compared with experimental measurements and data of the study of Marsh (1, obtaining a range of acceptable adjustment.
En este artículo se aplica el modelo de Ookura & Saito para determinar el aislamiento acústico a ruido aéreo de sistemas constructivos basados en vidrios. En concreto, los cálculos que se presentan son para vidrios monolíticos de distintos espesores y para vidrios laminados de diferentes tipos. Existen diferentes modelos de predicción del comportamiento acústico a ruido aéreo de estructuras multicapa (y los vidrios laminados pueden considerarse como tales. En todos ellos, los datos de entrada son las constantes elásticas y el factor de pérdidas. Tanto los vidrios monolíticos como la capa intermedia se han caracterizado siguiendo diferentes normativas. Los resultados se comparan con medidas experimentales y con datos recogidos del estudio de Marsh (1, obteniéndose un grado de ajuste aceptable.
Caetano-Anollés, G; Gresshoff, P M
1996-06-01
DNA amplification fingerprinting (DAF) with mini-hairpins harboring arbitrary "core" sequences at their 3' termini were used to fingerprint a variety of templates, including PCR products and whole genomes, to establish genetic relationships between plant tax at the interspecific and intraspecific level, and to identify closely related fungal isolates and plant accessions. No correlation was observed between the sequence of the arbitrary core, the stability of the mini-hairpin structure and DAF efficiency. Mini-hairpin primers with short arbitrary cores and primers complementary to simple sequence repeats present in microsatellites were also used to generate arbitrary signatures from amplification profiles (ASAP). The ASAP strategy is a dual-step amplification procedure that uses at least one primer in each fingerprinting stage. ASAP was able to reproducibly amplify DAF products (representing about 10-15 kb of sequence) following careful optimization of amplification parameters such as primer and template concentration. Avoidance of primer sequences partially complementary to DAF product termini was necessary in order to produce distinct fingerprints. This allowed the combinatorial use of oligomers in nucleic acid screening, with numerous ASAP fingerprinting reactions based on a limited number of primer sequences. Mini-hairpin primers and ASAP analysis significantly increased detection of polymorphic DNA, separating closely related bermudagrass (Cynodon) cultivars and detecting putatively linked markers in bulked segregant analysis of the soybean (Glycine max) supernodulation (nitrate-tolerant symbiosis) locus.
Directory of Open Access Journals (Sweden)
Anderson Pinheiro de Freitas
2004-06-01
Full Text Available To evaluate the effect of different surface treatments on shear bond strength between a metallic alloy (Co-Cr-Mo - Remanium CD and a resin cement (Rely X TM and to evaluate the mode of fracture after testing, forty couples of metallic-alloy disks were melted, regularized, polished, submitted to four thermal cycles (Vacuum, 960ºC, 8 minutes and randomly separated into four groups. Each group received a different type of treatment: Group PSP: Polished with sandpaper 600; Group PCP: Polished with sandpaper 600 and application of the metal primer Alloy Primer (Kuraray; Group JSP: Sandblasted with 100µm aluminum oxide; Group JCP: Sandblasted with 100mm aluminum oxide and treated with a metal Primer. The groups were cemented and stored in distilled water at 37ºC for 36 hours and submitted to the shear bond strength test. The mean and standard deviation (in Kgf/cm² obtained for each group was: PSP 4.0/0.4; PCP 88.9/33.6; JSP 163.2/27.6; JCP 144.5/54.0. After the statistical analysis the authors concluded that: the highest values were obtained for the sandblasted groups (JSP, JCP, regardless of the primer application; the Alloy Primer increased the retention between the Rely X cement and the polished surface of the Co-Cr-Mo alloy, yet its bond strength was not greater than that obtained with sandblasting; all specimens showed adhesive failures in the tested interface.Para avaliar o efeito de diferentes tratamentos superficiais sobre a resistência ao cisalhamento da união entre uma liga metálica (Co-Cr-Mo - Remanium CD e um cimento resinoso (Rely X TM e analisar o tipo de fratura durante a separação dos espécimes, quarenta pares de discos metálicos foram fundidos, regularizados e polidos, submetidos a quatro ciclos térmicos (vácuo, 960ºC, 8 minutos e divididos aleatoriamente em quatro grupos. Cada grupo recebeu um tipo de tratamento: Grupo PSP: Polimento com lixa d'água Nº 600; Grupo PCP: Polimento com lixa 600 e aplicação do
Microsatellite Primers in the Foundation Tree Species Pinus edulis and P. monophylla (Pinaceae
Directory of Open Access Journals (Sweden)
Andrew L. Krohn
2013-07-01
Full Text Available Premise of the study: Microsatellite primers were developed in the foundational tree species Pinus edulis to investigate population differentiation of P. edulis and hybridization among closely related species. Methods and Results: Using a hybridization protocol, primer sets for 11 microsatellite loci were developed using megagametophyte tissue from P. edulis and scored for polymorphism in three populations of P. edulis and a single P. monophylla population. The primers amplified simple and compound di-, tri-, and pentanucleotide repeats with two to 18 alleles per locus. Conclusions: These results demonstrate the utility of the described primers for studies of population differentiation within and among P. edulis populations as well as across putative hybrid zones where P. edulis may coexist with sister species.
Characteristics of the population employed in primer sector in Turkey
Directory of Open Access Journals (Sweden)
Bayar Rüya
2006-01-01
Full Text Available Activities related to the production of raw material like agriculture husbandry, forestry, fishery are called as primer activities. Especially people living in rural areas earn their livings on primer activities, mainly agriculture. Rural planning is inevitable for providing rural development which has an important place in all development of a country. And achievement of this planning depends on putting forth the characteristics of the population living in rural areas with its different aspects. Therefore, the requirements will be introduced more clearly and the increase in the welfare levels of the people living in rural areas will have been achieved. To achieve the rural development and progress, in addition to the features like the size of agricultural products, products that are cultivated, activities like husbandry, forestry, hunting, etc. and the qualities of the enterprises in which these activities are carried out, policies applied, capital, market and technology, the characteristics of the population employed in this sector is also of importance. Considering these points, what is aimed in this study is to put forth the characteristics of the population employed in primer sector in Turkey. According to the census results of the year 2000 in Turkey 38% of the population is employed, and 48% of this work is in primer sector.
Primer sets for cloning the human repertoire of T cell Receptor Variable regions
Directory of Open Access Journals (Sweden)
Santoro Claudio
2008-08-01
Full Text Available Abstract Background Amplification and cloning of naïve T cell Receptor (TR repertoires or antigen-specific TR is crucial to shape immune response and to develop immuno-based therapies. TR variable (V regions are encoded by several genes that recombine during T cell development. The cloning of expressed genes as large diverse libraries from natural sources relies upon the availability of primers able to amplify as many V genes as possible. Results Here, we present a list of primers computationally designed on all functional TR V and J genes listed in the IMGT®, the ImMunoGeneTics information system®. The list consists of unambiguous or degenerate primers suitable to theoretically amplify and clone the entire TR repertoire. We show that it is possible to selectively amplify and clone expressed TR V genes in one single RT-PCR step and from as little as 1000 cells. Conclusion This new primer set will facilitate the creation of more diverse TR libraries than has been possible using currently available primer sets.
Directory of Open Access Journals (Sweden)
Christoph Gehring
2011-03-01
Full Text Available A palmeira babaçu (Attalea speciosa C.Martius, Arecaceae tem grande importância socioeconômica e ecológica em grande parte da área tropical brasileira, especialmente em áreas degradadas por queimadas freqüentes na Amazônia. No entanto, ainda pouco se sabe sobre as características ecológicas desta espécie-chave. Este estudo investiga a alometria do babaçu com o objetivo de estabelecer uma metodologia eficiente na estimativa da biomassa aérea de palmeiras juvenis e adultas e para um melhor entendimento da sua arquitetura. A biomassa de palmeiras juvenis pode ser estimada facilmente e com precisão com o diâmetro mínimo das ráquis das folhas a 30 cm de extensão. A biomassa de palmeiras adultas pode ser estimada com base na altura do tronco lenhoso, também relativamente de fácil medição em campo. A biomassa foliar das palmeiras adultas foi em media 31,7% da biomassa aérea, porém houve uma alta variação e, portanto, somente pode ser estimada indiretamente através da relação entre a razão madeira:folha e biomassa aérea total. Os teores de carbono no babaçu apresentaram baixa variação, sem diferenças sistemáticas em relação ao tamanho ou estágio de crescimento, o que aponta à aplicabilidade geral dos valores 42.5% C para troncos, 39.8% C para folhas. Em conseqüência do limitado crescimento secundário do diâmetro inerente de palmeiras, não houve relação do diâmetro de tronco com a altura e a biomassa das palmeiras adultas. Observou-se que o afilamento do caule diminui com o aumento da altura das palmeiras, o que é parcialmente compensado pelo incremento da densidade de madeira em troncos quase-cilíndricos. No entanto, a altura máxima do babaçu, de cerca de 30 metros, aparentemente está definida por limitações na estabilidade mecânica. Todas as relações alométricas aqui descritas são independentes da idade da vegetação, indicando a aplicabilidade geral das relações encontradas
Genus-Specific Primers for Study of Fusarium Communities in Field Samples
Edel-Hermann, Véronique; Gautheron, Nadine; Durling, Mikael Brandström; Kolseth, Anna-Karin; Steinberg, Christian; Persson, Paula; Friberg, Hanna
2015-01-01
Fusarium is a large and diverse genus of fungi of great agricultural and economic importance, containing many plant pathogens and mycotoxin producers. To date, high-throughput sequencing of Fusarium communities has been limited by the lack of genus-specific primers targeting regions with high discriminatory power at the species level. In the present study, we evaluated two Fusarium-specific primer pairs targeting translation elongation factor 1 (TEF1). We also present the new primer pair Fa+7/Ra+6. Mock Fusarium communities reflecting phylogenetic diversity were used to evaluate the accuracy of the primers in reflecting the relative abundance of the species. TEF1 amplicons were subjected to 454 high-throughput sequencing to characterize Fusarium communities. Field samples from soil and wheat kernels were included to test the method on more-complex material. For kernel samples, a single PCR was sufficient, while for soil samples, nested PCR was necessary. The newly developed primer pairs Fa+7/Ra+6 and Fa/Ra accurately reflected Fusarium species composition in mock DNA communities. In field samples, 47 Fusarium operational taxonomic units were identified, with the highest Fusarium diversity in soil. The Fusarium community in soil was dominated by members of the Fusarium incarnatum-Fusarium equiseti species complex, contradicting findings in previous studies. The method was successfully applied to analyze Fusarium communities in soil and plant material and can facilitate further studies of Fusarium ecology. PMID:26519387
Directory of Open Access Journals (Sweden)
Piedad Agudelo-Flórez
2014-09-01
Conclusión. Se identificó la presencia de la especie L. santarosai con capacidad patógena comparable con la cepa Fiocruz L1-130 de L. interrogans, de reconocida virulencia y tropismo pulmonar, en cuanto a los aspectos histopatológicos de tropismo a pulmón y riñón. Nunca antes se había evaluado en un modelo experimental un aislamiento de origen local bajo estos criterios biológicos.
Directory of Open Access Journals (Sweden)
Juan Felipe Ramirez
2008-06-01
Full Text Available Antecedentes. Los métodos convencionales para a identificación de levaduras del género Candida requieren mucho tiempo, necesitan cantidad importante de la muestra y, en muchos casos, es necesario realizar cultivo. Objetivos. Evaluar un par de cebadores para la identificación de levaduras del género Candida y demostrar su potencial aplicación para el diagnóstico de infecciones intraoculares. Materiales y métodos. Se utilizaron 17 cepas de referencia, 29 aislamientos clínicos de flujo vaginal, 7 muestras de humor acuoso y una de humor vítreo. Evaluamos tres métodos para el rompimiento de la pared celular: congelación descongelación, sonicación, y la enzima liticasa. Para la purificación del ácido nucleico, se utilizó en los tres casos el estuche comercial Wizard Genomics; en la reacción de PCR, el estuche comercial Go Taq Green Master Mix y los iniciadores ITS3 e ITS4 a una concentración de 0,5 µM. Resultados. De los tres métodos el que mejor resultados ofreció fue el uso de enzima liticasa más el estuche comercial. Con los iniciadores ITS3 e ITS4 fue posible identificar las levaduras únicamente a nivel de género y no se presentó reacción cruzada con otros microorganismos comúnmente encontrados en diferentes muestras de tejido humano. La sensibilidad fue de 100 fg. Se lograron identificar por PCR todos los aislamientos a partir de flujo vaginal y de una muestra de humor acuso. Para las demás muestras de humor acuoso el diagnóstico fue para otros agentes causales, entre ellos, Toxoplasma sp. Conclusión. Consideramos que ésta es una metodología adecuada, la cual permite identificar levaduras del género Candida con gran sensibilidad y reproducibilidad.Background. Conventional methods for Candida identification are time consuming, require high amounts of the sample and in several cases the culture is mandatory. Aims. To evaluate two primers for the identification of Candida and to demonstrate their application for
Bergkemper, Fabian; Kublik, Susanne; Lang, Friederike; Krüger, Jaane; Vestergaard, Gisle; Schloter, Michael; Schulz, Stefanie
2016-06-01
Phosphorus (P) is of central importance for cellular life but likewise a limiting macronutrient in numerous environments. Certainly microorganisms have proven their ability to increase the phosphorus bioavailability by mineralization of organic-P and solubilization of inorganic-P. On the other hand they efficiently take up P and compete with other biota for phosphorus. However the actual microbial community that is associated to the turnover of this crucial macronutrient in different ecosystems remains largely anonymous especially taking effects of seasonality and spatial heterogeneity into account. In this study seven oligonucleotide primers are presented which target genes coding for microbial acid and alkaline phosphatases (phoN, phoD), phytases (appA), phosphonatases (phnX) as well as the quinoprotein glucose dehydrogenase (gcd) and different P transporters (pitA, pstS). Illumina amplicon sequencing of soil genomic DNA underlined the high rate of primer specificity towards the respective target gene which usually ranged between 98% and 100% (phoN: 87%). As expected the primers amplified genes from a broad diversity of distinct microorganisms. Using DNA from a beech dominated forest soil, the highest microbial diversity was detected for the alkaline phosphatase (phoD) gene which was amplified from 15 distinct phyla respectively 81 families. Noteworthy the primers also allowed amplification of phoD from 6 fungal orders. The genes coding for acid phosphatase (phoN) and the quinoprotein glucose dehydrogenase (gcd) were amplified from 20 respectively 17 different microbial orders. In comparison the phytase and phosphonatase (appA, phnX) primers covered 13 bacterial orders from 2 different phyla respectively. Although the amplified microbial diversity was apparently limited both primers reliably detected all orders that contributed to the P turnover in the investigated soil as revealed by a previous metagenomic approach. Genes that code for microbial P transporter
Galkiewicz, J.P.; Kellogg, C.A.
2008-01-01
PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. Copyright ?? 2008, American Society for Microbiology. All Rights Reserved.
Directory of Open Access Journals (Sweden)
Halima Awale
2008-01-01
Full Text Available El objetivo de esta investigación fue determinar la variabilidad patogénica de C. lindemuthianum en zonas productoras de frijol común en Ecuador y Guatemala para identificar las combinaciones de genes de resistencia más efectivas para las condiciones locales. Aislamientos de antracnosis recolectados fueron caracterizados para la identifi cación de las razas presentes en estos países empleando el juego estándar de 12 cultivares diferenciales. De acuerdo a la evaluación, solamente dos razas (5, 9 mostraron estar presentes en los dos países. En Guatemala se registró una mayor diversidad patogénica (mayor número de razas que en Ecuador. Basados en esta información y en otros datos de estudios realizados anteriormente, sugerimos como la combinación genética más efectiva la piramidación de los genes Co-12 y Co-42. Esta combinación conferiría resistencia completa a casi todas las razas de C. lindemuthianum identifi cadas hasta el momento en los dos países.
Directory of Open Access Journals (Sweden)
Evelio Palomino‐Marín
2011-01-01
Full Text Available Todo sistema de aislamiento de vibraciones está encaminado en primera instancia a aislarvibraciones como su propio nombre lo indica. En ocasiones es menester que a la máquina no laperturben vibraciones procedentes del entorno, como lo puede ser por ejemplo, el caso de unarectificadora en un taller de mecanizado. Así mismo, en otras ocasiones resulta necesario aislar lamáquina para evitar que las vibraciones producidas por ella misma afecten al entorno. Tal es el casode los grupos electrógenos MAN 18 V48/60 B, cuyos motores de combustión interna responden a undiseño de 18 cilindros en “V” distribuidos en 13 metros de longitud. El sistema de aislamiento deestos motores consta de 14 paquetes de ocho resortes cada uno, incluyendo un amortiguadorviscoso por cada calzo. Se efectuaron mediciones espectrales de vibraciones en cada uno de estoscalzos antivibratorios, sobre y debajo de estos respectivamente y se evaluó la eficiencia de estoscalzos en todo el espectro, determinándose aquellas frecuencias que por determinadas razones noalcanzan los niveles de eficiencia en el aislamiento establecidos a tales efectos. De esta manera, sepresenta una metodología para conducir este análisis.Palabras claves: calzos antivibratorios, aislamiento de vibraciones, grupos electrógenos.___________________________________________________________________AbstractA vibroisolation system has a priority goal which is isolate vibrations. Such vibrations can come fromthe environment and could affect the machine behavior and could affect its technological functionstoo. That’s the case of a machine tool, for instance. However, it is also possible that vibrations comefrom the own machine and in this case the main goal of vibroisolation system is to avoid thatvibrations go to machine foundations. This is the case on which this paper is focused. Twelvevibration isolators with eight springs each one including a viscous damper are mounted asvibroisolation system on
Primer registro de Serratospiculum tendo (Nematoda: Diplotriaenidae para el Perú
Directory of Open Access Journals (Sweden)
Luis A. Gomez-Puerta
2014-05-01
Full Text Available Reportamos por primera vez la presencia del nematodo, Serratospiculum tendo Nitzsch, 1819, parasitando los sacos aéreos de un halcón peregrino (Falco peregrinus Tunstall, 1771. Seis nematodos (2 machos y 4 hembras fueron colectados e identificados como S. tendo. El hallazgo de este nematodo constituye el primer registro en el Perú.
Cryer, CW
2014-01-01
Mathematics and engineering are inevitably interrelated, and this interaction will steadily increase as the use of mathematical modelling grows. Although mathematicians and engineers often misunderstand one another, their basic approach is quite similar, as is the historical development of their respective disciplines. The purpose of this Math Primer is to provide a brief introduction to those parts of mathematics which are, or could be, useful in engineering, especially bioengineering. The aim is to summarize the ideas covered in each subject area without going into exhaustive detail. Formula
Majid, Shahn
2002-05-01
Here is a self-contained introduction to quantum groups as algebraic objects. Based on the author's lecture notes for the Part III pure mathematics course at Cambridge University, the book is suitable as a primary text for graduate courses in quantum groups or supplementary reading for modern courses in advanced algebra. The material assumes knowledge of basic and linear algebra. Some familiarity with semisimple Lie algebras would also be helpful. The volume is a primer for mathematicians but it will also be useful for mathematical physicists.
Directory of Open Access Journals (Sweden)
Leidy González
2014-06-01
Full Text Available Introducción. La resistencia bacteriana es un problema de salud pública a nivel mundial que compromete seriamente la capacidad de tratar las infecciones. Objetivo. Describir el perfil de resistencia a los antimicrobianos marcadores en enterobacterias identificadas en hospitales colombianos. Materiales y métodos. Se hizo una revisión bibliográfica sistemática de las publicaciones indexadas en Medline, Embase y Lilacs, además de la búsqueda manual de todos los números de revistas colombianas reconocidas en el campo de la infectología y otros afines para identificar referencias no disponibles electrónicamente. Resultados. Se identificaron 43 estudios y reportes de vigilancia epidemiológica con información sobre la resistencia de las enterobacterias en hospitales, principalmente de Bogotá, Cali y Medellín. La tasa de resistencia en Escherchia coli oscila entre 3 y 11 %, 5 y 20 % y 0,2 a 0,8 % para piperacilina-tazobactam, cefalosporinas de tercera generación y carbapenémicos, respectivamente. En aislamientos de Klebsiella pneumoniae, la resistencia oscila entre 21,8 y 48,1 % frente a piperacilina-tazobactam, 20 y 35 % frente a cefalosporinas de amplio espectro y 3 y 8 % frente a carbapenémicos, con variaciones importantes por ciudades, niveles de atención y circunstancias clínicas. Conclusiones. La diseminación de la resistencia bacteriana en enterobacterias aisladas en hospitales colombianos es un problema creciente que requiere medidas prontas para cortar las cadenas de transmisión.
Directory of Open Access Journals (Sweden)
Wang Xiaowei
2008-12-01
Full Text Available Abstract Background Quantitative polymerase chain reaction (QPCR is a widely applied analytical method for the accurate determination of transcript abundance. Primers for QPCR have been designed on a genomic scale but non-specific amplification of non-target genes has frequently been a problem. Although several online databases have been created for the storage and retrieval of experimentally validated primers, only a few thousand primer pairs are currently present in existing databases and the primers are not designed for use under a common PCR thermal profile. Results We previously reported the implementation of an algorithm to predict PCR primers for most known human and mouse genes. We now report the use of that resource to identify 17483 pairs of primers that have been experimentally verified to amplify unique sequences corresponding to distinct murine transcripts. The primer pairs have been validated by gel electrophoresis, DNA sequence analysis and thermal denaturation profile. In addition to the validation studies, we have determined the uniformity of amplification using the primers and the technical reproducibility of the QPCR reaction using the popular and inexpensive SYBR Green I detection method. Conclusion We have identified an experimentally validated collection of murine primer pairs for PCR and QPCR which can be used under a common PCR thermal profile, allowing the evaluation of transcript abundance of a large number of genes in parallel. This feature is increasingly attractive for confirming and/or making more precise data trends observed from experiments performed with DNA microarrays.
Directory of Open Access Journals (Sweden)
Marco Suárez
2006-05-01
Full Text Available Objetivo. Estudiar los factores ambientales y genéticos que influyen sobre la edad al primer parto dehembras romosinuano. Materiales y métodos. Fueron estudiados 932 datos de la edad al primer partode hembras de la raza Romosinuano, nacidas en el Centro de Investigación Turipaná de CORPOICA,Cereté, Colombia, en el período de 1980 a 2001. Para el estudio de los factores ambientales se utilizóel análisis de varianza mediante modelos lineales utilizando el procedimiento GLM de SAS (1995.Resultados. La edad al primer parto fue de 1162.3±4.2 días, con un coeficiente de variación del 11.19%.El análisis de varianza reveló que el año y mes de nacimiento fueron causas estadísticamente significativasde variación de la edad al primer parto. La heredabilidad, calculada por la correlación intraclase entremedias hermanas paternas fue de 0.16±0.08. Conclusión. El año y mes de nacimiento influyeron en laedad al primer parto de hembras romosinuano, pero la heredabilidad de la edad al primer parto y elsexo de la cría no se constituyen en características importantes a tener en cuenta.
β-Amino-n-butyric Acid Regulates Seedling Growth and Disease Resistance of Kimchi Cabbage
Directory of Open Access Journals (Sweden)
Yeong Chae Kim
2013-09-01
Full Text Available Non-protein amino acid, β-amino-n-butyric acid (BABA, has been involved in diverse physiological processes including seedling growth, stress tolerance and disease resistance of many plant species. In the current study, treatment of kimchi cabbage seedlings with BABA significantly reduced primary root elongation and cotyledon development in a dose-dependent manner, which adverse effects were similar to the plant response to exogenous abscisic acid (ABA application. BABA was synergistically contributing ABA-induced growth arrest during the early seedling development. Kimchi cabbage leaves were highly damaged and seedling growth was delayed by foliar spraying with high concentrations of BABA (10 to 20 mM. BABA played roles differentially in in vitro fungal conidial germination, mycelial growth and conidation of necrotroph Alternaria brassicicola causing black spot disease and hemibiotroph Colletotrichum higginsianum causing anthracnose. Pretreatment with BABA conferred induced resistance of the kimchi cabbage against challenges by the two different classes of fungal pathogens in a dose-dependent manner. These results suggest that BABA is involved in plant development, fungal development as well as induced fungal disease resistance of kimchi cabbage plant.
Directory of Open Access Journals (Sweden)
Martha Ilce Orozco Mera
2012-01-01
Full Text Available Título en ingles: LSSP-PCR to identify polymorphisms in the gene cry1B of Bacillus thuringiensis native strain Resumen: Se estandarizó la técnica LSSP-PCR (reacción en cadena de la polimerasa con un único oligonucleótido en condiciones de baja astringencia, para identificar polimorfismos del gen cry1B en aislamientos nativos de Bacillus thuringiensis (Bt. Se evaluaron 164 aislamientos nativos colombianos identificándose el gen cry1Ba en 11 de estos aislamientos. Los 11 fragmentos amplificados, junto con el de la cepa de referencia Bt subsp. aizawai HD137, se analizaron por LSSP-PCR y los patrones electroforéticos obtenidos se compararon cualitativamente. Con los productos amplificados mediante el oligonucleótido directo se construyó un dendrograma utilizando UPGMA que mostró tres agrupamientos con similitud de 83, 79 y 68%. La agrupación con 68% de similaridad correspondió al aislamiento nativo BtGC120 que presentó el patrón de bandas más variable. Con el oligonucleótido reverso el aislamiento BtGC120 mostró una menor variabilidad (43%. La secuencia nucleotidica obtenida de este fragmento de 806 pares de bases mostró una identidad de 93% con la secuencia de los genes cry1Bc1 de Bt morrisoni y cry1Bb1 de la cepa BT-EG5847. Se predijo del marco de lectura +3 una proteína de 268 residuos aminoácidicos, con 88% de identidad con la proteína Cry1Bc. Esta secuencia reveló dos dominios, una endotoxina N implicada en la formación del poro y otra endotoxina M relacionada en el reconocimiento del receptor. La evaluación biológica del aislamiento BtGC120 sobre larvas de primer instar del insecto plaga Spodoptera frugiperda, mostró una CL50 de 1,896 ng de proteína total por cm2. Este estudio muestra que la LSSP-PCR es una técnica que permite identificar de una manera específica variaciones en las secuencias de los genes cry de Bt, con potencialidad de encontrar nuevos genes con novedosas actividades biológicas. Abstract
2016-03-01
This primer aims to increase the effectiveness of T2 activity in transportation by describing how T2 practices can be successfully integrated into : the research process to capture the potential real-world benefits of our communitys research inves...
A finite element primer for beginners the basics
Zohdi, Tarek I
2014-01-01
The purpose of this primer is to provide the basics of the Finite Element Method, primarily illustrated through a classical model problem, linearized elasticity. The topics covered are:(1) Weighted residual methods and Galerkin approximations,(2) A model problem for one-dimensional?linear elastostatics,(3) Weak formulations in one dimension,(4) Minimum principles in one dimension,(5) Error estimation in one dimension,(5) Construction of Finite Element basis functions in one dimension,(6) Gaussian Quadrature,(7) Iterative solvers and element by element data structures,(8) A model problem for th
Transport phenomena in Newtonian fluids a concise primer
Olsson, Per
2013-01-01
This short primer provides a concise and tutorial-style introduction to transport phenomena in Newtonian fluids , in particular the transport of mass, energy and momentum. The reader will find detailed derivations of the transport equations for these phenomena, as well as selected analytical solutions to the transport equations in some simple geometries. After a brief introduction to the basic mathematics used in the text, Chapter 2, which deals with momentum transport, presents a derivation of the Navier-Stokes-Duhem equation describing the basic flow in a Newtonian fluid. Also provided at
Directory of Open Access Journals (Sweden)
Peter Zarras
2014-09-01
Full Text Available In this study, an electroactive polymer (EAP, poly(2,5-bis(N-methyl-N- hexylaminophenylene vinylene (BAM-PPV, was tested as an alternative to current hexavalent chromium (Cr(VI-based Army wash primers. BAM-PPV was tested in both laboratory and field studies to determine its adhesive and corrosion-inhibiting properties when applied to steel and aluminum alloys. The Army Research Laboratory (ARL tests showed that BAM-PPV combined with an epoxy primer and the Army chemical agent-resistant coating (CARC topcoat met Army performance requirements for military coatings. After successful laboratory testing, the BAM-PPV was then field tested for one year at the Aberdeen Test Center (ATC. This field testing showed that BAM-PPV incorporated into the Army military coating survived with no delamination of the coating and only minor corrosion on the chip sites.
Directory of Open Access Journals (Sweden)
Pérez-Rey David
2010-08-01
Full Text Available Abstract Background Primer and probe sequences are the main components of nucleic acid-based detection systems. Biologists use primers and probes for different tasks, some related to the diagnosis and prescription of infectious diseases. The biological literature is the main information source for empirically validated primer and probe sequences. Therefore, it is becoming increasingly important for researchers to navigate this important information. In this paper, we present a four-phase method for extracting and annotating primer/probe sequences from the literature. These phases are: (1 convert each document into a tree of paper sections, (2 detect the candidate sequences using a set of finite state machine-based recognizers, (3 refine problem sequences using a rule-based expert system, and (4 annotate the extracted sequences with their related organism/gene information. Results We tested our approach using a test set composed of 297 manuscripts. The extracted sequences and their organism/gene annotations were manually evaluated by a panel of molecular biologists. The results of the evaluation show that our approach is suitable for automatically extracting DNA sequences, achieving precision/recall rates of 97.98% and 95.77%, respectively. In addition, 76.66% of the detected sequences were correctly annotated with their organism name. The system also provided correct gene-related information for 46.18% of the sequences assigned a correct organism name. Conclusions We believe that the proposed method can facilitate routine tasks for biomedical researchers using molecular methods to diagnose and prescribe different infectious diseases. In addition, the proposed method can be expanded to detect and extract other biological sequences from the literature. The extracted information can also be used to readily update available primer/probe databases or to create new databases from scratch.
Optimizing chemically induced resistance in tomato against Botrytis cinerea
DEFF Research Database (Denmark)
Luna, Estrella; Beardon, Emily G; Ravnskov, Sabine
2016-01-01
repressed plant growth at higher concentrations of the chemicals, which was particularly pronounced in hydroponically grown plants after BABA treatment. Both seed coating with BABA, and seedling treatments with BABA or JA, did not affect AMF root colonization in soil-grown tomato. Our study has identified...
Sousa, Ana Beatriz Silva; de Mattos Pimenta Vidal, Cristina; Leme-Kraus, Ariene Arcas; de Carvalho Panzeri Pires-de-Souza, Fernanda; Bedran-Russo, Ana K.
2016-01-01
Objective To evaluate the effect of experimental primers (chlorhexidine, enriched mixture of proanthocyanidins and doxycycline) on the adhesive properties and gelatinolytic activity at dentin-resin interfaces of occlusal Class I restorations. Methods The inactivation of enzymes by the experimental primers was assessed by fluorescence assay and gelatin zymography. To assess the adhesive properties, occlusal Class I cavities were prepared in sound human molars, etched with phosphoric acid and restored with one of the primers and an etch-and-rinse adhesive system (Adper Single Bond Plus - 3M ESPE). After the restorative procedures, the specimens were divided into two subgroups (n = 6) consisting of storage in incubation buffer or axial cyclic loading at 50 N and 1,000,000 cycles. Then, the sectioned and sliced specimens were assigned to in situ zymography assay and microtensile bond strength (TBS) test. Results Fluorescence assay and gelatin zymography revealed that the experimental primers inactivated rMMPs. In situ zymography (2-way ANOVA, Tukey, p 0.05). Significance The use of experimental primers impaired the enzymatic activity at the dentin-adhesive interface after cyclic loading and the activity of rMMPs. Cyclic loading did not have a significant effect on the bond strength. PMID:27524231
Evaluación de Hongos Antagonistas De Botrytis cinerea Pers., en Plantaciones de Mora, Costa Rica
Directory of Open Access Journals (Sweden)
María Angélica Marín-Chacón
2017-01-01
Full Text Available Se realizó el aislamiento, identificación y evaluación in vitro y en campo de hongos antagonistas de Botrytis cinerea Pers., en plantaciones de mora. La obtención de organismos antagonistas se hizo en Cartago en las localidades de La Luchita, Bajo Canet, Jardín y División durante el 2012. De los frutos se obtuvo un grupo de 43 aislamientos pertenecientes a 10 géneros distintos de los hongos: Aspergillus sp., Bispora sp., Cladosporium spp., Colletotrichum sp., Curvularia sp., Macrophoma sp., Paecilomyces spp., Pestalotia spp., Rhizoctonia sp., y Trichoderma spp. A todos los aislamientos se les realizaron pruebas de capacidad antagónica, mediante la técnica de cultivos duales, competencia por sustrato y antibiosis. Se seleccionaron solamente los aislamientos que superaron un 70% del PIC, y estos fueron 4 aislamientos (BC1, J14, J2.2 y J2.1 del género Trichoderma spp. Para las pruebas de campo se utilizaron 3 aislamientos (BC1, J2.2 y J2.1 del presente trabajo y 3 (BV1, SM13B y SM18 del mismo género previamente aislados. Las pruebas de campo se realizaron en el 2013. Los aislamientos de Trichoderma spp., que tuvieron estadísticamente (p≤0,0001 mayor efecto sobre B. cinerea fueron BV1 y BC1, los cuales dieron menos frutos enfermos.
Sequence diversity in haloalkane dehalogenases, as revealed by PCR using family-specific primers
Czech Academy of Sciences Publication Activity Database
Kotík, Michael; Faměrová, Veronika
2012-01-01
Roč. 88, č. 2 (2012), s. 212-217 ISSN 0167-7012 R&D Projects: GA ČR GAP504/10/0137; GA ČR GAP207/10/0135 Institutional research plan: CEZ:AV0Z50200510 Keywords : Dehalogenation * Consensus sequence * Degenerate PCR primer Subject RIV: EE - Microbiology, Virology Impact factor: 2.161, year: 2012
Prunier, Rachel; Latimer, Andrew
2010-01-01
Microsatellite primers were developed in the South African sclerophyllous shrub Protea punctata to investigate the degree of population differentiation within and between P. punctata and closely related species. • 10 primer pairs were identified from three individuals of Protea punctata. The primers amplified di- and tri-nucleotide repeats. Across all P. punctata samples, the loci have 8-49 alleles. All primers also amplified in Protea section Exsertae (P. aurea, P. aurea subsp. potbergensis, P. mundii, P. venusta, P. lacticolor, and P. subvestita). The loci had 14-69 alleles across the subgenus. • These results show the broad utility of microsatellite loci for future studies of population genetics in the white proteas and their potential utility across the entire genus.
Profitability primer: a guide to profitability analysis in the electric power industry
International Nuclear Information System (INIS)
Woo, C.K.; Lloyd-Zannetti, D.; Martin, J.; Price, S.
1996-06-01
As the electric power industry is opened to forces of competition, increased attention must be focused to develop products and services that deliver good value to customers and to identify customer segments that are profitable to serve. This primer introduces the concept of profitability analysis and its application to the electric power industry. The primer recognizes that some segments of the business will remain monopolistic and subject to regulations, while other segments will become competitive. The primer also recognizes that customer profitability is critically dependent on a host of related issues such as how internal costs are allocated to various functions and how revenues are collected and allocated
Priyadarshini, P; Tiwari, K; Das, A; Kumar, D; Mishra, M N; Desikan, P; Nath, G
2017-02-01
To evaluate the sensitivity and specificity of a new nested set of primers designed for the detection of Mycobacterium tuberculosis complex targeting a highly conserved heat shock protein gene (hsp65). The nested primers were designed using multiple sequence alignment assuming the nucleotide sequence of the M. tuberculosis H37Rv hsp65 genome as base. Multidrug-resistant Mycobacterium species along with other non-mycobacterial and fungal species were included to evaluate the specificity of M. tuberculosis hsp65 gene-specific primers. The sensitivity of the primers was determined using serial 10-fold dilutions, and was 100% as shown by the bands in the case of M. tuberculosis complex. None of the other non M. tuberculosis complex bacterial and fungal species yielded any band on nested polymerase chain reaction (PCR). The first round of amplification could amplify 0.3 ng of the template DNA, while nested PCR could detect 0.3 pg. The present hsp65-specific primers have been observed to be sensitive, specific and cost-effective, without requiring interpretation of biochemical tests, real-time PCR, sequencing or high-performance liquid chromatography. These primer sets do not have the drawbacks associated with those protocols that target insertion sequence 6110, 16S rDNA, rpoB, recA and MPT 64.
Temas de Física para Ingeniería: Primer principio de la termodinámica
Beléndez Vázquez, Augusto
1992-01-01
Acústica, fluidos y termodinámica: "Primer principio de la termodinámica". Objetivos y caracteres generales de la termodinámica. Conceptos fundamentales de la termodinámica. Capacidad calorífica, calor específico y calor latente. Trabajo. Primer principio de la termodinámica: energía interna. Algunas aplicaciones del primer principio.
Directory of Open Access Journals (Sweden)
B. Passerini De Rossi
2007-12-01
Full Text Available Medical devices are often colonized by bacteria which may cause severe infections. The aim of this work was to evaluate biofilm formation by S. maltophilia isolates from device-associated nosocomial infections. The 13 local isolates exhibited different capacities of biofilm formation on hydrophilic and hydrophobic surfaces. All isolates formed strong biofilms in polystyrene microplates, while strong, moderate or weak biofilms were detected in borosilicate (BS or polypropylene (PP tubes. The proficiency of biofilm formation was better evaluated by the level of crystal violet staining expressed relative to the final culture density. The microscopic analysis of biofilms formed on glass coverslips revealed the presence of a matrix of exopolysaccharides and microcolonies typical of biofilm architecture. Isolates with increased adhesion to BS showed larger microcolonies. According to our results, twitching correlated well with attachment to the three abiotic surfaces tested, while swimming only showed a slight correlation with biofilm formation on PP. Poor correlation was observed between cell surface hydrophobicity and biofilm formation. One of the highest biofilm-producing isolates adhered to urethral catheters of different materials, and exhibited an increased resistance to oxidative stress, one of the common stresses encountered by bacteria during the infection process due to the immune response.El objetivo de este trabajo fue evaluar la formación de biopelículas por parte de aislamientos de Stenotrophomonas maltophilia. Los 13 aislamientos locales evaluados mostraron diferente capacidad de formar biopelículas en superficies hidrofílicas e hidrofóbicas. Todos ellos formaron biopelículas fuertes en microplacas de poliestireno (PS, mientras que se observaron biopelículas fuertes, moderadas o débiles en tubos de borosilicato (BS o polipropileno (PP. La medida del cristal violeta unido a la biopelícula expresada en función de la densidad
The Influence of Saâdiâs Gulistan on the Translation of Adventures of Haji Baba of Ispahan
Directory of Open Access Journals (Sweden)
S Jamali
2014-11-01
Full Text Available In the translation of Adventures of Haji Baba of Ispahan, Mirza Habib Isfahani has transferred the heritage of traditional Persian writing to the modern fiction writing. Mirza Habib method in this translation in which different texts are present is as if previous texts are playing in an orchestra in this last flame of traditional prose. Amongst such texts, Saâdiâs works, especailly Gulistan, have a prominent presence. Thus, the authors of this article aim to explore intertextual relations of this work with Gulistan on the basis of Gerard Genette theory of transtextuality in three levels of explicit intertextualit, covert intertextuality (implicit and connotative intertextuality as well as hypertextuality. The references of this translation to Gulistan and Mirza Habibâs borrowings from this work reveal the role of Saâdiâs language and expressive style in the formation of Mirza Habibâs method of writing and style. Such an attitude is, indeed, a response to the hypothesis that whether contemporary prose can be considered as the sequence of traditional prose and linguistic and expressive links of classic texts with contemporary texts can be identified or not.
A primer on motor vehicle air pollution.
1973-01-01
This primer presents a brief state-of-the art review of motor vehicle air pollution. Its purpose is to aid highway personnel in understanding the nature of this environmental problem on our highways and to present possible solutions for its abatement...
Patil, Basanagouda S; Rao, Bk Raghavendra; Sharathchandra, Sm; Hegde, Reshma; Kumar, G Vinay
2013-09-01
The aim of the present study was to investigate the effectiveness of the one total-etch self-priming adhesive, one two-step self-etching primer adhesive, and one 'all-in-one' self-etching adhesive system on the adhesion of a resin composite to enamel. Thirty-six freshly extracted human mandibular molars were selected for this study. A fat area about 5 mm in diameter was created on the exposed mesial surface of enamel of each tooth by moist grinding with 320, 420 and 600 grit silicon carbide paper. Twelve teeth were randomly assigned into three groups. In group 1, Adper Easy One (3M ESPE), a one step self-etching primer adhesive was applied and light curing unit for 10 seconds. In group 2, Adper SE Plus, a two-step self-etching primer with bottle A containing the aqueous primer and bottle B containing the acidic adhesive was applied and light cured for 10 seconds. Group 3 (control)-etchant 37% phosphoric acid is applied to the surface for 15 seconds and rinsed with water and air dried and adhesive (single bond 2) is applied to the surface and tube is placed and light cured for 20 seconds. Composite material (Z350) was placed in the tube and light cured for 40 seconds in all the groups. Bond strength testing was done using universal testing machine at the enamel-composite interface. The debonded enamel surface was evaluated in stereomicroscope to assess the cohesive, adhesive or mixed fracture. Data was statistically analyzed by one way analysis of variance (ANOVA). Group 1 performed least among all groups with a mean score of 19.46 MPa. Group 2 had a mean score of 25.67 MPa. Group 3 had a mean score of 27.16 MPa. Under the conditions of this in vitro study, the bond strength values of the two-step self-etching primer systems tested were similar to the total-etch. And, one step self-etching primers have lower bond strength compared to the total-etch.
Primer on CDM programme of activities
Energy Technology Data Exchange (ETDEWEB)
Hinostroza, M. (UNEP Risoe Centre, Roskilde (Denmark)); Lescano, A.D. (A2G Carbon Partners (Peru)); Alvarez, J.M. (Ministerio del Ambiente del Peru (Peru)); Avendano, F.M. (EEA Fund Management Ltd. (United Kingdom)
2009-07-01
As an advanced modality introduced in 2005, the Programmatic CDM (POA) is expected to address asymmetries of participation, especially of very small-scale project activities in certain areas, key sectors and many countries with considerable potential for greenhouse gas emission reductions, not reached by the traditional single-project-based CDM. Latest experiences with POAs and the recently finalized official guidance governing the Programmatic CDM are the grassroots of this Primer, which has the purpose of supporting the fully understanding of rules and procedures of POAs by interpreting them and analyzing real POA cases. Professional and experts from the public and private entities have contributed to the development of this Primer, produced by the UNEP Risoe Centre, as part of knowledge support activities for the Capacity Development for the CDM (CD4CDM) project. The overall objective of the CD4CDM is to develop the capacities of host countries to identify, design, approve, finance, implement CDM projects and commercialize CERs in participating countries. The CDM4CDM is funded by the Netherlands Ministry of Foreign Affairs. (author)
An anti-steroidogenic inhibitory primer pheromone in male sea lamprey (Petromyzon marinus)
Chung-Davidson, Yu-Wen; Wang, Huiyong; Bryan, Mara B.; Wu, Hong; Johnson, Nicholas S.; Li, Weiming
2013-01-01
Reproductive functions can be modulated by both stimulatory and inhibitory primer pheromones released by conspecifics. Many stimulatory primer pheromones have been documented, but relatively few inhibitory primer pheromones have been reported in vertebrates. The sea lamprey male sex pheromone system presents an advantageous model to explore the stimulatory and inhibitory primer pheromone functions in vertebrates since several pheromone components have been identified. We hypothesized that a candidate sex pheromone component, 7α, 12α-dihydroxy-5α-cholan-3-one-24-oic acid (3 keto-allocholic acid or 3kACA), exerts priming effects through the hypothalamic-pituitary-gonadal (HPG) axis. To test this hypothesis, we measured the peptide concentrations and gene expressions of lamprey gonadotropin releasing hormones (lGnRH) and the HPG output in immature male sea lamprey exposed to waterborne 3kACA. Exposure to waterborne 3kACA altered neuronal activation markers such as jun and jun N-terminal kinase (JNK), and lGnRH mRNA levels in the brain. Waterborne 3kACA also increased lGnRH-III, but not lGnRH-I or -II, in the forebrain. In the plasma, 3kACA exposure decreased all three lGnRH peptide concentrations after 1 h exposure. After 2 h exposure, 3kACA increased lGnRHI and -III, but decreased lGnRH-II peptide concentrations in the plasma. Plasma lGnRH peptide concentrations showed differential phasic patterns. Group housing condition appeared to increase the averaged plasma lGnRH levels in male sea lamprey compared to isolated males. Interestingly, 15α-hydroxyprogesterone (15α-P) concentrations decreased after prolonged 3kACA exposure (at least 24 h). To our knowledge, this is the only known synthetic vertebrate pheromone component that inhibits steroidogenesis in males.
KULTUR PRIMER FIBROBLAS: PENELITIAN PENDAHULUAN
Directory of Open Access Journals (Sweden)
Yuli Kurniawati
2015-05-01
Full Text Available AbstrakKultur sel fibroblas banyak digunakan untuk penelitian proses penyembuhan luka dan penuaankulit. Metode ini digunakan untuk melihat perkembangan sel, proliferasi kinetik seluler, sertabiosintesis komponen matriks ekstraseluler. Penelitian pendahuluan ini dilakukan untuk optimasiteknik laboratorium serta berbagai kendala yang didapatkan saat kultur fibroblas. Kultur primerfibroblas dibagi menjadi 2 jenis sampel yaitu sampel yang berasal dari embrio mencit usia 7,5–9,5 hari, dan kulit pasien keloid. Sampel dari embrio mencit dilakukan kultur primer denganmetode dissociated fibroblast. Sampel jaringan keloid dan kulit normal dikultur dengan metodeskin explant. Fibroblas yang berasal dari kultur primer embrio mencit tumbuh baik sehinggadapat dilakukan subkultur dan disimpan di dalam nitrogen cair suhu -198°C. Fibroblas yangberasal dari sampel keloid pertama tumbuh sesuai pola pertumbuhan fibroblas, namun padasampel kedua terdapat kontaminasi Paecilomyces sp. yang merupakan salah satu jenis jamurkontaminan. Sel fibroblas mudah untuk dikultur karena memiliki kemampuan tumbuh danmelekat yang tinggi serta regenerasi cepat, namun penelitian lebih lanjut untuk optimasi teknikkultur dan pencegahan kontaminasi masih dibutuhkan sehingga sel dapat tumbuh baik.AbstractFibroblast cell culture method has been used for wound healing and skin aging studies. Thismethod was used for cell development imaging study, celullar kinetic proliferation andextracelullar matrix component biosynthesis. This preeliminary study was done for laboratoricaltechnic optimation as well as problems appeared in fibroblast culture. Fibroblasts primary culturewas divided into 2 type of samples, from 7.5-9.5-day-mice embryo and keloid-patient skin.Primary culture with dissociated fibroblast method was done for mice embryo sample. Keloidtissue sample and normal skin were cultured with skin explant method. Fibroblasts that weretaken from mice embryo primary culture grew well
The effects of pH on N-methacryloyl glycine primer on bond strength to acid-etched dentin.
Nishiyama, N; Suzuki, K; Asakura, T; Nakai, H; Yasuda, S; Nemoto, K
1996-07-01
To develop a more effective adhesive primer, it is imperative to understand the adhesion mechanisms of the resin to the demineralized dentin through a dentin primer. When the bonding agent was directly applied to the dentin etched by 40 wt % phosphoric acid without a primer pretreatment, the bond strength of the resin to the dentin was 5 MPa. Conversely, when the demineralized dentin was pretreated with the N-methacryloyl glycine (NM alpha A) primer solution with a pH value of 1.5, the bond strength increased considerably to 15 MPa. However, the bond strength dropped dramatically from 15 to 3 MPa when the sodium salt of NM alpha A was added, thereby increasing the pH value of the NM alpha A primer solution from 3.2 to 5.0. When the pH value was increased above 3.5 (pKa value), the number of ionized NM alpha A species increased in the solution. As a result, the bond strength of the resin fell to approximately 3 MPa. This result was obtained despite the 5-micron-thick hybrid layer that was created in the subsurface of the intertubular dentin. The number of unionized NM alpha A species increased by lowering the pH value below 3.5. As a result, the NM alpha A primer provided a higher bond strength of the resin to the demineralized dentin. In contrast, when 10 wt % citric acid containing 3 wt % ferric chloride was applied to the dentin, maximum bond strength was obtained when the pH value of the NM alpha A primer solution was 3.5. The pH dependency of the bond strength obtained following 10 wt % citric acid containing 3 wt % ferric chloride etching is different from the results obtained from 40 wt % phosphoric acid etching. This can be attributed to the difference in the characteristics of the demineralized collageous layer.
Forest Interpreter's Primer on Fire Management.
Zelker, Thomas M.
Specifically prepared for the use of Forest Service field-based interpreters of the management, protection, and use of forest and range resources and the associated human, cultural, and natural history found on these lands, this book is the second in a series of six primers on the multiple use of forest and range resources. Following an…
Directory of Open Access Journals (Sweden)
A. C. López
2008-12-01
oxitetraciclina en las poblaciones de Bacillus cereus presentes en la miel. De un total de 77 aislamientos evaluados, 30 (39% resultaron resistentes a tetraciclina y/o minociclina de acuerdo con los resultados de las pruebas de difusión en disco. Dentro del grupo que presentó un fenotipo resistente, se investigó la presencia de los determinantes tetK, tetL, tetM, tetO, tetW, otrA y otrB por PCR y se determinaron los valores de CIM para tetraciclina, oxitetraciclina y minociclina. De acuerdo con los resultados obtenidos por PCR, 23 aislamientos (77% presentaron al menos un determinante de resistencia a tetraciclina o a oxitetraciclina; el genotipo tetK se encontró en 10 de esos aislamientos, mientras que los genotipos tetL, tetM y otrA se hallaron en 3, 2 y 5 aislamientos, respectivamente. Ningún aislamiento presentó los genotipos tetW, tetO ni otrB. Adicionalmente, se encontraron los genotipos tetK plus tetM (2 aislamientos; tetK plus tetL (1 aislamiento y tetK plus otrA (1 aislamiento. Por otra parte, 7 cepas (23% resultaron resistentes a tetraciclina, oxitetraciclina y/o minociclina por CIM, pero no presentaban ninguno de los determinantes tet u otr estudiados. Estos resultados indican la existencia de un alto porcentaje de cepas de B. cereus aisladas de miel con genes de resistencia a tetraciclina y oxitetraciclina, incluyendo los determinantes tetK, tetL, tetM y otrA. Este estudio constituye el primer registro de la presencia del determinante tetK de resistencia a tetraciclina en B. cereus, como así también la presencia del determinante otrA dentro del género Bacillus.
Designing for transportation management and operations : a primer.
2013-02-01
This primer is focused on the collaborative and systematic consideration of management and operations during transportation : project design and development. This is termed designing for operations. Effectively designing for operations involves...
Can previous acid etching increase the bond strength of a self-etching primer adhesive to enamel?
Directory of Open Access Journals (Sweden)
Ana Paula Morales Cobra Carvalho
2009-06-01
Full Text Available Because a greater research effort has been directed to analyzing the adhesive effectiveness of self etch primers to dentin, the aim of this study was to evaluate, by microtensile testing, the bond strength to enamel of a composite resin combined with a conventional adhesive system or with a self-etching primer adhesive, used according to its original prescription or used with previous acid etching. Thirty bovine teeth were divided into 3 groups with 10 teeth each (n= 10. In one of the groups, a self-etching primer (Clearfil SE Bond - Kuraray was applied in accordance with the manufacturer's instructions and, in the other, it was applied after previous acid etching. In the third group, a conventional adhesive system (Scotchbond Multipurpose Plus - 3M-ESPE was applied in accordance with the manufacturer's instructions. The results obtained by analysis of variance revealed significant differences between the adhesive systems (F = 22.31. The self-etching primer (Clearfil SE Bond presented lower enamel bond strength values than the conventional adhesive system (Scotchbond Multipurpose Plus (m = 39.70 ± 7.07 MPa both when used according to the original prescription (m = 27.81 ± 2.64 MPa and with previous acid etching (m = 25.08 ± 4.92 MPa.
Evaluation of genetic diversity in open pollinated guava by iPBS primers
International Nuclear Information System (INIS)
Mehmood, A.; Jaskani, M.J.; Ahmad, S.; Ahmad, R.
2013-01-01
DNA markers are important tools for assessing genetic diversity and relationships among species, cultivars and breeding materials. Many horticultural species are lacking genomic information. DNA markers that do not require prior knowledge of DNA sequences are therefore appealing for horticultural research. A retrotransposon-based DNA marker system, iPBS (inter primer binding sites) developed from conserved primer binding sites within retrotransposons, was used to study the genetic variation and relationships in ornamental guava. PCR from 6 iPBS primers (dominant markers) produced a total of 113 bands (52.38-100% polymorphic) ranging from 150 bp to 3000 bp, and the mean PIC value for each primer ranging from 0.1245 to 0.3698. Molecular information generated from both iPBS was separately scored in a matrix for phylogenetic dendrogram construction. The phylogenetic dendrogram based on iPBS markers reflected morphologic classifications of the accessions that were studied. The iPBS PCR-based genome fingerprinting technology in this study is low-cost and provides another effective alternative in differentiation of accessions in guava (Psidium guajava Linn.) and related species or genera. (author)
The UVM primer a step-by-step introduction to the universal verification methodology
Salemi, Ray
2013-01-01
The UVM Primer uses simple, runnable code examples, accessible analogies, and an easy-to-read style to introduce you to the foundation of the Universal Verification Methodology. You will learn the basics of object-oriented programming with SystemVerilog and build upon that foundation to learn how to design testbenches using the UVM. Use the UVM Primer to brush up on your UVM knowledge before a job interview to be able to confidently answer questions such as "What is a uvm_agent?" , "How do you use uvm_sequences?", and "When do you use the UVM's factory." The UVM Primer's downloadable code examples give you hands-on experience with real UVM code. Ray Salemi uses online videos (on www.uvmprimer.com) to walk through the code from each chapter and build your confidence. Read The UVM Primer today and start down the path to the UVM.
Grushetskaia, Z E; Lemesh, V A; Khotyleva, L V
2010-01-01
Cellulose synthase catalytic subunit genes, CesA, have been discovered in several higher plant species, and it has been shown that the CesA gene family has multiple members. HVR2 fragment of these genes determine the class specificity of the CESA protein and its participation in the primary or secondary cell wall synthesis. The aim of this study was development of specific and degenerated primers to flax CesA gene fragments leading to obtaining the class specific HVR2 region of the gene. Two pairs of specific primers to the certain fragments of CesA-1 and CesA-6 genes and one pair of degenerated primers to HVR2 region of all flax CesA genes were developed basing on comparison of six CesA EST sequences of flax and full cDNA sequences of Arabidopsis, poplar, maize and cotton plants, obtained from GenBank. After amplification of flax cDNA, the bands of expected size were detected (201 and 300 b.p. for the CesA-1 and CesA-6, and 600 b.p. for the HVR2 region of CesA respectively). The developed markers can be used for cloning and sequencing of flax CesA genes, identifying their number in flax genome, tissue and stage specificity.
A Primer on Electric Utilities, Deregulation, and Restructuring of U.S. Electricity Markets
Energy Technology Data Exchange (ETDEWEB)
Warwick, William M.
2002-06-03
This primer is offered as an introduction to utility restructuring to better prepare readers for ongoing changes in public utilities and associated energy markets. It is written for use by individuals with responsibility for the management of facilities that use energy, including energy managers, procurement staff, and managers with responsibility for facility operations and budgets. The primer was prepared by the Pacific Northwest National Laboratory under sponsorship from the U.S. Department of Energy?s Federal Energy Management Program. The impetus for this primer originally came from the Government Services Administration who supported its initial development.
Cytochrome c oxidase I primers for corbiculate bees: DNA barcode and mini-barcode.
Françoso, E; Arias, M C
2013-09-01
Bees (Apidae), of which there are more than 19 900 species, are extremely important for ecosystem services and economic purposes, so taxon identity is a major concern. The goal of this study was to optimize the DNA barcode technique based on the Cytochrome c oxidase (COI) mitochondrial gene region. This approach has previously been shown to be useful in resolving taxonomic inconsistencies and for species identification when morphological data are poor. Specifically, we designed and tested new primers and standardized PCR conditions to amplify the barcode region for bees, focusing on the corbiculate Apids. In addition, primers were designed to amplify small COI amplicons and tested with pinned specimens. Short barcode sequences were easily obtained for some Bombus century-old museum specimens and shown to be useful as mini-barcodes. The new primers and PCR conditions established in this study proved to be successful for the amplification of the barcode region for all species tested, regardless of the conditions of tissue preservation. We saw no evidence of Wolbachia or numts amplification by these primers, and so we suggest that these new primers are of broad value for corbiculate bee identification through DNA barcode. © 2013 John Wiley & Sons Ltd.
Directory of Open Access Journals (Sweden)
Santiago Alfredo Dorrbercker Drake
2014-04-01
Full Text Available El aislamiento de los generadores eléctricos de gran potencia (Turbogeneradores e Hidrogeneradores es el componente que más influye en su confiabilidad operacional, por lo cual es vital conocer su estado para aplicar las acciones correctivas requeridas. Para alcanzar tal fin, existen múltiples ensayos, controles y criterios relativos a inspecciones sensoriales, muchos de ellos concebidos hace más de medio siglo y que aún subsisten en variantes modernizadas, mientras que otros, más modernos, han sido generalizados y perfeccionados constantemente. Las técnicas y métodos para la aplicación de los ensayos, controles e inspecciones también han evolucionado. En este trabajo se resumen algunas experiencias en la aplicación de los ensayos más actuales relativos a la evaluación de la contaminación, la detección de deficiencias en la protección anticorona, la presencia de descargas parciales internas y la evaluación del envejecimiento del aislamiento, que son aplicados en las áreas de influencia de los autores. The insulation of power generators (Turbogenerator and Hydrogenerators is the component that influences more in its operational reliability, thus is vital to know its state to apply corrective actions. In order to reach such aim, multiple tests, sensorial controls and criteria regarding inspection have been developed, many of conceived them for more than half century and that still subsists in modernized variants, whereas others, more modern, have been generalized and perfected constantly. The techniques and methods for the application of the tests, controls and inspection also have evolved. This work reviews some experiences in the application of recent improvements to insulation tests about the evaluation of contamination, detection problems in the anticorona slot protection, internal partial discharges and the evaluation of the aging, that are applied in the areas of influence of the authors.
[Design of primers to DNA of lactic acid bacteria].
Lashchevskiĭ, V V; Kovalenko, N K
2003-01-01
Primers LP1-LP2 to the gene 16S rRNA have been developed, which permit to differentiate lactic acid bacteria: Lactobacillus plantarum, L. delbrueckii subsp. bulgaricus and Streptococcus salivarius subsp. thermophilus. The strain-specific and species-specific differentiations are possible under different annealing temperature. Additional fragments, which are synthesized outside the framework of gene 16S rRNA reading, provide for the strain-specific type of differentiation, and the fragment F864 read in the gene 16S rRNA permits identifying L. plantarum.
Directory of Open Access Journals (Sweden)
F.A. Moredo
2007-12-01
Full Text Available Se estudiaron 69 aislamientos de Escherichia coli provenientes de cerdos clínicamente sanos o con signología clínica no compatible con diarreas causadas por este microorganismo, con el objetivo de determinar el patrón de resistencia a los antimicrobianos frecuentemente utilizados en medicina veterinaria y humana. Se empleó el método de difusión en agar. Se observaron elevados porcentajes de resistencia frente a ampicilina, estreptomicina y tetraciclina, antimicrobianos utilizados en las explotaciones porcinas, y frente a trimetoprima-sulfametoxazol y cloranfenicol, compuestos que han dejado de utilizarse hace varios años. El 62% de los aislamientos mostró multirresistencia. Los resultados obtenidos en el presente trabajo corroboran la hipótesis de que la distribución fenotípica de la resistencia y, posiblemente, la de sus determinantes genéticos están directamente influenciadas por los tratamientos antimicrobianos utilizados.Sixty-nine Escherichia coli isolates from healthy pigs or with clinical signs non-compatible with diarrhea caused by this microorganism, were studied. The purpose was to determine the resistance profile against antimicrobials frequently used in veterinary and human medicine. The agar diffusion method was used. High resistance percentages against antimicrobials used in swine farms such as ampicillin, streptomycin and tetracycline were observed, as well as against trimetoprim-sulfametoxazole and chloramphenicol, compounds that were stopped being used several years ago. Sixty two percent of isolates showed multidrug-resistance. The results obtained in this work corroborate the hypothesis that the phenotypic distribution of resistance and possibly that of its genetic determinants, are directly influenced by the antimicrobial treatments used.
Inteligencia emocional y autoconcepto en los estudiantes de primer ciclo
Castillo Canales, Braulio
2017-01-01
En nuestra investigación se tuvo como problema: ¿Qué relación existe entre inteligencia emocional y autoconcepto en los estudiantes de primer ciclo de Administración en Turismo y Hotelería de la Universidad César Vallejo, Lima 2015-II? Además el objetivo fue: Determinar la relación entre inteligencia emocional y autoconcepto en los estudiantes de primer ciclo de Administración en Turismo y Hotelería de la Universidad César Vallejo, Lima 2015-II. El tipo de estudio fue básica...
Teaching Thermal Hydraulics & Numerical Methods: An Introductory Control Volume Primer
Energy Technology Data Exchange (ETDEWEB)
Lucas, D.S.
2004-10-03
This paper covers the basics of the implementation of the control volume method in the context of the Homogeneous Equilibrium Model (HEM)(T/H) code using the conservation equations of mass, momentum, and energy. This primer uses the advection equation as a template. The discussion will cover the basic equations of the control volume portion of the course in the primer, which includes the advection equation, numerical methods, along with the implementation of the various equations via FORTRAN into computer programs and the final result for a three equation HEM code and its validation.
Móvil remisión de V. cinta del primer móvil.
2011-01-01
[ES] Definición del término Móvil remisión de V. cinta del primer móvil. en el diccionario Dicter. [EN] Definition of the word Móvil remisión de V. cinta del primer móvil. in the dictionary Dicter.
Gabus, Caroline; Ivanyi-Nagy, Roland; Depollier, Julien; Bucheton, Alain; Pelisson, Alain; Darlix, Jean-Luc
2006-01-01
Mobile LTR-retroelements comprising retroviruses and LTR-retrotransposons form a large part of eukaryotic genomes. Their mode of replication and abundance favour the notion that they are major actors in eukaryote evolution. The Gypsy retroelement can spread in the germ line of the fruit fly Drosophila melanogaster via both env-independent and env-dependent processes. Thus, Gypsy is both an active retrotransposon and an infectious retrovirus resembling the gammaretrovirus MuLV. However, unlike gammaretroviruses, the Gypsy Gag structural precursor is not processed into Matrix, Capsid and Nucleocapsid (NC) proteins. In contrast, it has features in common with Gag of the ancient yeast TY1 retroelement. These characteristics of Gypsy make it a very interesting model to study replication of a retroelement at the frontier between ancient retrotransposons and retroviruses. We investigated Gypsy replication using an in vitro model system and transfection of insect cells. Results show that an unstructured domain of Gypsy Gag has all the properties of a retroviral NC. This NC-like peptide forms ribonucleoparticle-like complexes upon binding Gypsy RNA and directs the annealing of primer tRNA(Lys,2) to two distinct primer binding sites (PBS) at the genome 5' and 3' ends. Only the 5' PBS is indispensable for cDNA synthesis in vitro and in Drosophila cells.
Leopold, Luna Bergere; Langbein, Walter Basil
1960-01-01
When you open the faucet you expect water to flow. And you expect it to flow night or day, summer or winter, whether you want to fill a glass or water the lawn. It should be clean and pure, without any odor.You have seen or read about places where the water doesn't have these qualities. You may have lived in a city where you were allowed to water the lawn only during a few hours of certain days. We know a large town where the water turns brown after every big rainstorm.Beginning shortly after World War II, large areas in the Southwestern United States had a 10-year drought, and newspapers published a lot of information about its effects. Some people say that the growing demand for water will cause serious shortages over much of the country in the next 10 to 40 years. But it has always been true that while water wells and springs dry up in some places, floods may be occurring in other places at the same time.Nearly every month news stories are published describing floods somewhere in the country. In fact, every year, on the average, 75,000 persons are forced from their homes by floods. In some years, as in 1951 when the lower Kansas River experienced a great flood, half a million people are affected. To understand the reasons for such recurring distress, it is necessary to know something about rivers and about the flat land or flood plain that borders the river.Interest in water and related problems is growing as our population increases and as the use of water becomes steadily greater. To help meet this heightened interest in general information about water and its use and control is the reason this primer was written. The primer is in two parts. The first part tells about hydrology, or the science that concerns the relation of water to our earth, and the second part describes the development of water supplies and the use of water. The Geological Survey is publishing this primer in nontechnical language in the hope that it will enable the general reader to
Energy Technology Data Exchange (ETDEWEB)
Zhang, Xuan; Zhang, Xiaofeng; Yan, Yue; Zhong, Yanli; Li, Lei; Zhang, Guanli [Beijing Institute of Aeronautical Materials (BIAM), Haidian District, Beijing, 100095 (China)
2015-04-01
A silicone-based primer layer was developed to improve the adhesion and thermal stability of amorphous transparent indium zinc oxide (IZO) films on polycarbonate (PC). The IZO films deposited by direct current magnetron sputtering at room temperature on primer-treated and untreated PCs were evaluated ex situ in terms of surface morphology, adhesion, optical, and electrical properties during annealing at 120 C in air. Nano-scratch tests indicated the adhesion of IZO films on primer-treated substrates was superior to that on untreated PCs. This superior adhesion can be attributed to the strong Si-O-Si inorganic bonds abundant in the primer layer and better matches of the primer layer in the terms of thermal expansion to the IZO. Moreover, the electrical resistivity of IZO films prepared on primer-treated PCs remained stable during the annealing treatment, whereas those of IZO films on untreated PCs presented a continuously increasing trend, which was attributed to the decrease in carrier concentration that resulted from oxygen adsorption. (copyright 2015 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)
Sarafianou, Aspasia; Seimenis, Ioannis; Papadopoulos, Triantafillos
2008-05-01
There is a need for achieving reliable chemical bond strength between veneering composites resins and casting alloys through the use of simplified procedures. The purpose of this study was to examine the shear bond strength of an indirect composite resin to a Ni-Cr alloy, using 4 primers and 2 airborne-particle-abrasion procedures. Fifty-six Ni-Cr (Heraenium NA) discs, 10 mm in diameter and 1.5 mm in height, were fabricated. Twenty-four discs were airborne-particle abraded with 50-microm Al2O3 particles, while another 24 were airborne-particle abraded with 250-microm Al2O3 particles. The following primers were applied on 6 discs of each airborne-particle-abrasion treatment group: Solidex Metal Photo Primer (MPP50, MPP250), Metal Primer II (MPII50, MPII250), SR Link (SRL50, SRL250), and Tender Bond (TB50, TB250). The Rocatec system was used on another 6 discs, airborne-particle abraded according to the manufacturer's recommendations, which served as the control group (R). Two more discs were airborne-particle abraded with 50-microm and 250-microm Al2O3 particles, respectively, to determine the Al content on their surfaces, without any bonding procedure. The indirect composite resin used was Sinfony. Specimens were thermally cycled (5 degrees C and 55 degrees C, 30-second dwell time, 5000 cycles) and tested in shear mode in a universal testing machine. The failure mode was determined with an optical microscope, and selected specimens were subjected to energy dispersive spectroscopy (EDS). Mean bond strength values were analyzed using 2-way ANOVA followed by Tukey's multiple comparison tests (alpha=.05) and compared to the control group using 1-way ANOVA followed by Tukey's multiple comparison tests (alpha=.05). The groups abraded with 50-microm particles exhibited significantly higher bond strength compared to the groups abraded with 250-microm particles. Group MPII50 exhibited the highest mean value (17.4 +/-2 MPa). Groups MPP50, MPP250, and TB50, TB250 showed
Directory of Open Access Journals (Sweden)
Christopher Ryan Penton
2013-09-01
Full Text Available Targeting sequencing to genes involved in key environmental processes, i.e. ecofunctional genes, provides an opportunity to sample nature’s gene guilds to greater depth and help link community structure to process-level outcomes. Vastly different approaches have been implemented for sequence processing and, ultimately, for taxonomic placement of these gene reads. The overall quality of next generation sequence analysis of functional genes is dependent on multiple steps and assumptions of unknown diversity. To illustrate current issues surrounding amplicon read processing we provide examples for three ecofunctional gene groups. A combination of in-silico, environmental and cultured strain sequences was used to test new primers targeting the dioxin and dibenzofuran degrading genes dxnA1, dbfA1, and carAa. The majority of obtained environmental sequences were classified into novel sequence clusters, illustrating the discovery value of the approach. For the nitrite reductase step in denitrification, the well-known nirK primers exhibited deficiencies in reference database coverage, illustrating the need to refine primer-binding sites and/or to design multiple primers, while nirS primers exhibited bias against five phyla. Amino acid-based OTU clustering of these two N-cycle genes from soil samples yielded only 114 unique nirK and 45 unique nirS genus-level groupings, likely a reflection of constricted primer coverage. Finally, supervised and non-supervised OTU analysis methods were compared using the nifH gene of nitrogen fixation, with generally similar outcomes, but the clustering (non-supervised method yielded higher diversity estimates and stronger site-based differences. High throughput amplicon sequencing can provide inexpensive and rapid access to nature’s related sequences by circumventing the culturing barrier, but each unique gene requires individual considerations in terms of primer design and sequence processing and classification.
Family-specific vs. universal PCR primers for the study of mitochondrial DNA in plants
Directory of Open Access Journals (Sweden)
Aleksić Jelena M.
2016-01-01
Full Text Available Mitochondrial genomes (mtDNAs or mitogenomes of seed plants are characterized by a notoriously unstable organization on account of which available so-called universal or consensus primers may fail to fulfil their foreseen function - amplification of various mtDNA regions in a broad range of plant taxa. Thus, the primers developed for groups assumed to have similar organization of their mitogenomes, such as families, may facilitate a broader usage of more variable non-coding portions of these genomes in group members. Using in silico PCR method and six available complete mitogenomes of Fabaceae, it has been demonstrated that only three out of 36 published universal primer and three Medicago sativa-specific primer pairs that amplify various mtDNA regions are suitable for six representatives of the Fabaceae family upon minor modifications, and develop 21 Fabaceae-specific primer pairs for amplification of all 14 cis-splicing introns in genes of NADH subunits (nad genes which represent the most commonly used non-coding mtDNA regions in various studies in plants. Using the same method and six available complete mitogenomes of representatives of related families Cucurbitaceae, Euphorbiaceae and Rosaceae and a model plant, Arabidopsis thaliana, it has further been demonstrated that applicability of newly developed primer pairs for amplification of nad introns in more or less related taxa was dependent not only on species evolutionary distances but also on their genome sizes. A reported set of 24 primer pairs is a valuable resource which may facilitate a broader usage of mtDNA variability in future studies at both intra- and inter-specific levels in Fabaceae, which is the third largest family of flowering plants rarely studied at the mtDNA level, and in other more or less related taxa. [Projekat Ministarstva nauke Republike Srbije, br. 173005
D'Alessandro, Oriana; Selmi, Gonzalo J.; Deyá, Cecilia; Di Sarli, Alejandro; Romagnoli, Roberto
2018-02-01
Tannins are polyphenols synthesized by plants and useful for the coating industry as corrosion inhibitors. In addition, lanthanum salts have a great inhibitory effect on steel corrosion. The aim of this study was to obtain lanthanum "tannate" with adequate solubility to be incorporated as the corrosion inhibitor in a wash-primer. The "tannate" was obtained from commercial "Quebracho" tannin and 0.1 M La(NO3)3. The soluble tannin was determined by the Folin-Denis reagent, while the concentration of Lanthanum was obtained by a gravimetric procedure. The protective action of "tannate" on SAE 1010 steel was evaluated by linear polarization curves and corrosion potential measurements. Lanthanum "tannate" was incorporated in a wash-primer formulation and tested by corrosion potential and ionic resistance measurements. The corrosion rate was also determined by the polarization resistance technique. Besides, the primer was incorporated in an alkyd paint system and its anticorrosion performance assessed in the salt spray cabinet and by electrochemical impedance spectroscopy. Results showed that lanthanum "tannate" primer inhibits the development of deleterious iron oxyhydroxides on the steel substrate and incorporated into a paint system had a similar behavior to the primer formulated with zinc tetroxychromate.
The use of a fluoropolymer containing primer to enhance adhesion of rotolined fluoropolymer coatings
Energy Technology Data Exchange (ETDEWEB)
Lech, L.M. [DuPont, Parkersburg, WV (United States)
1999-11-01
Fluoropolymers such as PFA and ETFE are often used in rotolining applications. A common source of failure for rotolined coatings is delamination from the metal substrate. Extensive thermal cycling of the coated part, permeation of the contained liquid to the substrate, or a combination of both thermal cycling and permeation causes this. Rotolined coatings are typically applied directly to the metal part. It has been found that applying an aqueous fluoropolymer based primer to the metal substrate prior to applying the rotolined resin increases the time before delamination is observed. The primer is applied by conventional spray techniques and can either be force dried at low temperature or air-dried under ambient conditions. The primer consists primarily of a fluoropolymer such as ETFE or PFA and a bonding agent such as polyamide-imide, polyphenylene sulfide, or polyether sulfone. After the primer is applied to the metal part, the fluoropolymer in the primer melt blends with the fluoropolymer rotolining resin during the rotolining process. The bonding agent enhances the adhesion of the entire coating system to the metal part. This extends the lifetime of the rotolined coatings.
Directory of Open Access Journals (Sweden)
Mónica M. Steciow
2001-01-01
Full Text Available Allomyces neomoniliformis y Dictyuchus missouriensis fueron aislados de un suelo agrícola conteniendo materia orgánica (hojas, raíces y tallos en Argentina. Ambas especies son citadas por primera vez para la Argentina y por segunda vez para Sudamérica, siendo el hallazgo más austral para el hemisferio occidental. Constituye el segundo aislamiento en Argentina de especies del género Allomyces y Dictyuchus. Se realizan consideraciones acerca de la distribucion de ambas especies
Directory of Open Access Journals (Sweden)
E. De Los A. Méndez
2008-09-01
Full Text Available Se determinaron los fenotipos de resistencia caracterizados por la concentración inhibitoria mínima, la difusión con discos y la producción de β-lactamasa de 434 aislamientos de Neisseria gonorrhoeae obtenidos de pacientes atendidos en el Servicio de Enfermedades de Transmisión Sexual del Hospital Dr. José María Cullen, Santa Fe, Argentina. Se realizaron pruebas de sensibilidad a los siguientes antimicrobianos: penicilina, tetraciclina, ciprofloxacina, espectinomicina, azitromicina y ceftriaxona. A tres aislamientos resistentes a ciprofloxacina se les realizó electroforesis de campo pulsado. Se destacaron tres situaciones epidemiológicas de interés: en el año 1997, alta incidencia de aislamientos con resistencia plasmídica a tetraciclina (33,3%; en el período 2002-2004, un aumento significativo de la resistencia plasmídica a penicilina (9,7% a 34,8%; y en el año 2000, la emergencia de dos de los tres primeros aislamientos con resistencia a quinolonas del país. El primer aislamiento resistente a azitromicina en nuestro hospital emerge en el 2004. Este trabajo jerarquiza el rol del Laboratorio de Microbiología Clínica en la orientación del tratamiento empírico de la gonorrea.Resistance phenotypes characterized by minimum inhibitory concentration, disk diffusion and β-lactamase production were determined in 434 isolates from patients attending the Sexually Transmitted Disease Service at Dr. José María Cullen Hospital in Santa Fe, Argentina. Susceptibility tests to penicillin, tetracycline, ciprofloxacin, espectinomycin, azithromycin and ceftriaxone were performed. Pulsed-field gel electrophoresis was conducted made to on three ciprofloxacin-resistant isolates. Epidemiologically speaking, three interesting events should be highlighted: during 1997, plasmid-mediated high level tetracycline-resistant strains were observed (33.3%; from 2002 to 2004 a significant increase of plasmid-mediated penicillin-resistant strains was
Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders
Energy Technology Data Exchange (ETDEWEB)
Weber, James R.; Schell, Charlotte J.; Marino, T; Bilyard, Gordon R.
2004-02-10
This version of the communication primer comprises two interlocking parts: Pat 1, a practical section, intended to prepare you for public interactions, and Part 2, a theoretical section that provides social and technical bases for the practices recommended in Part 1. The mutual support of practice and theory is very familiar in science and clearly requires a willingness to observe and revise our prior assumptions--in this document, we invoke both. We hope that is offering will represent a step both towards improving practice and maturing the theory of practical science communication.
Leonhardt, U.
2001-01-01
Laboratory-based optical analogs of astronomical objects such as black holes rely on the creation of light with an extremely low or even vanishing group velocity (slow light). These brief notes represent a pedagogical attempt towards elucidating this extraordinary form of light. This paper is a contribution to the book Artificial Black Holes edited by Mario Novello, Matt Visser and Grigori Volovik. The paper is intended as a primer, an introduction to the subject for non-experts, not as a det...
Cervantes, Fernando A.; Castañeda, Mario
2012-01-01
Este estudio evaluó la magnitud de la divergencia genética entre Lepus insularis y L. californicus xanti de la Península de Baja California causada por el aislamiento geográfico de L. insularis efectuando un análisis de aloenzimas. Los resultados se compararon con un sistema biogeográfico similar que se presenta entre L. c. sheldoni de Isla Carmen y L. c. martirensis con distribución de la región norte de la Península. Se examinaron 26 loci con muestras de tejido de corazón y riñón mediante l...
Comparison of Self-Etch Primers with Conventional Acid Etching System on Orthodontic Brackets
Zope, Amit; Zope-Khalekar, Yogita; Chitko, Shrikant S.; Kerudi, Veerendra V.; Patil, Harshal Ashok; Jaltare, Pratik; Dolas, Siddhesh G
2016-01-01
Introduction The self-etching primer system consists of etchant and primer dispersed in a single unit. The etching and priming are merged as a single step leading to fewer stages in bonding procedure and reduction in the number of steps that also reduces the chance of introduction of error, resulting in saving time for the clinician. It also results in smaller extent of enamel decalcification. Aim To compare the Shear Bond Strength (SBS) of orthodontic bracket bonded with Self-Etch Primers (SEP) and conventional acid etching system and to study the surface appearance of teeth after debonding; etching with conventional acid etch and self-etch priming, using stereomicroscope. Materials and Methods Five Groups (n=20) were created randomly from a total of 100 extracted premolars. In a control Group A, etching of enamel was done with 37% phosphoric acid and bonding of stainless steel brackets with Transbond XT (3M Unitek, Monrovia, California). Enamel conditioning in left over four Groups was done with self-etching primers and adhesives as follows: Group B-Transbond Plus (3M Unitek), Group C Xeno V+ (Dentsply), Group D-G-Bond (GC), Group E-One-Coat (Coltene). The Adhesive Remnant Index (ARI) score was also evaluated. Additionally, the surface roughness using profilometer were observed. Results Mean SBS of Group A was 18.26±7.5MPa, Group B was 10.93±4.02MPa, Group C was 6.88±2.91MPa while of Group D was 7.78±4.13MPa and Group E was 10.39±5.22MPa respectively. In conventional group ARI scores shows that over half of the adhesive was remaining on the surface of tooth (score 1 to 3). In self-etching primer groups ARI scores show that there was no or minor amount of adhesive remaining on the surface of tooth (score 4 and 5). SEP produces a lesser surface roughness on the enamel than conventional etching. However, statistical analysis shows significant correlation (pbracket bonding after enamel conditioning with any of the SEPs tested. The SEPs used in Groups C (Xeno V
Bond strength of primer/cement systems to zirconia subjected to artificial aging.
Zhao, Li; Jian, Yu-Tao; Wang, Xiao-Dong; Zhao, Ke
2016-11-01
Creating reliable and durable adhesion to the nonactive zirconia surface is difficult and has limited zirconia use. The introduction of functional monomers such as 10-methacryloyloxydecyl dihydrogen phosphate (MDP) appears to have enhanced bond strength to zirconia. The purpose of this in vitro study was to evaluate the long-term bond strength of several MDP-containing primer/cement systems to zirconia. Zirconia blocks were divided into 6 groups (n=24) according to the 3 primers/cements to be bonded, as follows: Scotchbond Universal/RelyX Ultimate (SU/RU; consisting of MDP-containing primer/MDP-free cement); Clearfil ceramic primer/Panavia F (CCP/PAN; consisting ofMDP-containing/MDP-containing); and Z-Prime Plus/Duo-Link (ZP/DUO; consisting ofMDP-containing/MDP-free), which were compared with 3 nonprimed groups, RU, PAN, and DUO. After bonding, each group was further divided into 3 subgroups (n=8) according to the level of aging: 24-hour storage in water at 37°C (24H); 30-day storage at 37°C (30D); and 30-day storage at 37°C followed by 3000 thermal cycles (30D/TC). After aging, a shear bond strength test and failure mode analysis were performed. The data were analyzed using 2-way ANOVA (α=.05). After aging, nearly all primer/cement groups presented significantly higher bond strength than the related nonprimed groups for each level of aging (P<.05), except for CCP/PAN versus PAN with 24H (P=.741). SU/RU had the highest bond strength among the groups for all treatments (P<.05), except for CCP/PAN versus SU/RU with 30D/TC (P=.171). Among the nonprimed groups, only RU went through 30D/TC without premature debonding. With 24H and 30D, the failure modes in SU/RU and CCP/PAN were purely mixed, whereas those in the other groups were mainly adhesive, except for RU. The superiority of the initial bond strength in SU/RU may result from some functional components other than MDP. The presence of MDP in the cement did not appear to have a positive effect on long-term bond
Directory of Open Access Journals (Sweden)
G. Weltman
2005-12-01
Full Text Available Haemophilus influenzae es reconocido como un agente patógeno responsable de infecciones localizadas y sistémicas. Se han descrito 6 tipos de polisacáridos capsulares antigénicamente distintos (a, b, c, d, e, y f que se pueden identificar por aglutinación en lámina con antisueros específicos. También existen cepas no capsuladas (NC fenotípicamente no tipificables (NT. La introducción de la vacuna conjugada produjo una marcada disminución de las enfermedades invasivas causadas por H. influenzae tipo b. En este contexto, la tipificación capsular mediante PCR es el método más apropiado para distinguir las cepas no capsuladas de las mutantes b deficientes en cápsula (b- y detectar la presencia de cepas pertenecientes a otros serotipos que no puedan ser tipificables por aglutinación. Se determinó el genotipo capsular a 38 aislamientos de Haemophilus influenzae no tipificables por aglutinación, derivados al servicio de Bacteriología Clínica del INEI-ANLIS "Dr. Carlos G. Malbrán" en el período 2002-2004. El 78,9% de los aislamientos provenían de hemocultivos y la mayor parte de ellos estaban asociados a foco respiratorio. El 100% de los aislamientos fueron identificados como H. influenzae no capsulados mediante la técnica de PCR.Haemophilus influenzae is recognized as a pathogenic agent responsible of localized and systemic infections. Six antigenically different capsular polysaccharide types have been described (a, b, c, d, e, and f which can be identified by slide agglutination with specific antisera. Besides there are non capsulated strains that cannot be typed by slide agglutination. The introduction of the conjugated vaccine produced an important reduction of invasive diseases caused by H. influenzae type b. Capsular typing by PCR is the most appropriated method for distinguishing non capsulated strains from capsule deficient type b mutants (b- and for detecting strains of other serotypes that cannot be detected by slide
Ayala Pastaz, Klever Bayardo
2017-01-01
Desarrollar un proceso a escala de laboratorio para la conservación y producción de cepas nativas de Monascus purpureus, mediante bioprocesos que permita el máximo aprovechamiento del recurso natural fúngico y el manejo sostenible de la biodiversidad. Se evidencia un limitado conocimiento en el manejo y aprovechamiento sustentable de la especie Monascus spp. nativo ecuatoriano, tanto en su proceso de aislamiento, conservación y producción; así como del ciclo de vida en el medio natural y m...
Specific and sensitive quantitative RT-PCR of miRNAs with DNA primers
DEFF Research Database (Denmark)
Balcells, Ingrid; Cirera Salicio, Susanna; Busk, Peter K.
2011-01-01
BACKGROUND: MicroRNAs are important regulators of gene expression at the post-transcriptional level and play an important role in many biological processes. Due to the important biological role it is of great interest to quantitatively determine their expression level in different biological...... be designed with a success rate of 94%. The method was able to quantify synthetic templates over eight orders of magnitude and readily discriminated between microRNAs with single nucleotide differences. Importantly, PCR with DNA primers yielded significantly higher amplification efficiencies of biological...... samples than a similar method based on locked nucleic acids-spiked primers, which is in agreement with the observation that locked nucleic acid interferes with efficient amplification of short templates. The higher amplification efficiency of DNA primers translates into higher sensitivity and precision...
Liu, Xiaojing; Locasale, Jason W
2017-04-01
Metabolomics generates a profile of small molecules that are derived from cellular metabolism and can directly reflect the outcome of complex networks of biochemical reactions, thus providing insights into multiple aspects of cellular physiology. Technological advances have enabled rapid and increasingly expansive data acquisition with samples as small as single cells; however, substantial challenges in the field remain. In this primer we provide an overview of metabolomics, especially mass spectrometry (MS)-based metabolomics, which uses liquid chromatography (LC) for separation, and discuss its utilities and limitations. We identify and discuss several areas at the frontier of metabolomics. Our goal is to give the reader a sense of what might be accomplished when conducting a metabolomics experiment, now and in the near future. Copyright © 2017 Elsevier Ltd. All rights reserved.
Fenstermacher, Katherine J; Achuthan, Vasudevan; Schneider, Thomas D; DeStefano, Jeffrey J
2018-01-16
DNA polymerases (DNAPs) recognize 3' recessed termini on duplex DNA and carry out nucleotide catalysis. Unlike promoter-specific RNA polymerases (RNAPs), no sequence specificity is required for binding or initiation of catalysis. Despite this, previous results indicate that viral reverse transcriptases bind much more tightly to DNA primers that mimic the polypurine tract. In the current report, primer sequences that bind with high affinity to Taq and Klenow polymerases were identified using a modified Selective Evolution of Ligands by Exponential Enrichment (SELEX) approach. Two Taq -specific primers that bound ∼10 (Taq1) and over 100 (Taq2) times more stably than controls to Taq were identified. Taq1 contained 8 nucleotides (5' -CACTAAAG-3') that matched the phage T3 RNAP "core" promoter. Both primers dramatically outcompeted primers with similar binding thermodynamics in PCR reactions. Similarly, exonuclease minus Klenow polymerase also selected a high affinity primer that contained a related core promoter sequence from phage T7 RNAP (5' -ACTATAG-3'). For both Taq and Klenow, even small modifications to the sequence resulted in large losses in binding affinity suggesting that binding was highly sequence-specific. The results are discussed in the context of possible effects on multi-primer (multiplex) PCR assays, molecular information theory, and the evolution of RNAPs and DNAPs. Importance This work further demonstrates that primer-dependent DNA polymerases can have strong sequence biases leading to dramatically tighter binding to specific sequences. These may be related to biological function, or be a consequences of the structural architecture of the enzyme. New sequence specificity for Taq and Klenow polymerases were uncovered and among them were sequences that contained the core promoter elements from T3 and T7 phage RNA polymerase promoters. This suggests the intriguing possibility that phage RNA polymerases exploited intrinsic binding affinities of
Directory of Open Access Journals (Sweden)
David L Nordstrom
2012-06-01
Full Text Available The aim of this paper is to introduce novice researchers to surveys as a method of data collection. It starts with the definition of a survey, its major purposes and types as well as changes in the goals surveys have helped to achieve over time. Advantages and disadvantages of surveys over population censuses and medical examinations are discussed. Approaches to questionnaire construction are introduced along with properties that questionnaires are evaluated for. Modes of administration, sample size issues, and data analysis approaches are also introduced. The primer is illustrated with examples of surveys conducted in different countries with various public health purposes.
Directory of Open Access Journals (Sweden)
Diana Sari
2015-05-01
Full Text Available AbstrakDismenore primer merupakan nyeri menstruasi yang dijumpai tanpa kelainan yang nyata pada alat-alat genital. Lebih dari 50% wanita mengalami dismenore primer dan 15% diantaranya mengalami nyeri yang hebat.Tujuan penelitian ini adalah untuk menentukan hubungan tingkat stres dengan derajat dismenore primer. Penelitian dilakukan pada mahasiswi pendidikan dokter Fakultas Kedokteran Universitas Andalas angkatan 2009 dan 2010. Desain penelitian ini menggunakan cross sectional study dengan jumlah subjek 165 orang. Pengumpulan data dari responden dilakukan dengan wawancara terpimpin (pengisian kuesioner. Analisa statistik yang digunakan adalah uji chi-square dan uji koefisien korelasi sederhana. Uji chi-square menunjukan ada hubungan yang bermakna antara stres dengan kejadian dismenore primer dan uji statistik koefisien korelasi sederhana menunjukkan ada hubungan yang bermakna dengan korelasi agak lemah antara tingkat stres dengan derajat dismenore primer.Kata kunci: stres, dismenore primer, mahasiswi fakultas kedokteran AbstractPrimary dysmenorrhoea is menstrual pain founded without real abnormalities in genital organs. More than 50% woman experiance it and 15% had severe pain. The objective of this study was to determine relationship between stress and primary dysmenorrhoea. Research was executed to education medical female students medical faculty of Andalas University class of 2009 and 2010. This research use cross sectional study design with 165 subjects. Data was collected by guided interview. Statistic analysis use chi-square test and simple correlation test. Chi-square test show there is significant relationship between stress and primary dysmenorrhoea and simple coefficient test show there is weak correlation between stress levels and degree of primary dysmenorrhoea.Keywords: stress, primary dysmenorrhoea, female student of medical faculty
Qualification and Flight Test of Non-Chrome Primers for C-130 Aircraft
2011-08-17
system Significant hexavalent chrome reduction in finish system Potential exposure level of spray applied chromated conversion coating not as...Lockheed Martin Aeronautics Company Qualification and Flight Test of Non- Chrome Primers for C-130 Aircraft Scott Jones Lockheed Martin...00-2011 to 00-00-2011 4. TITLE AND SUBTITLE Qualification and Flight Test of Non- Chrome Primers for C-130 Aircraft 5a. CONTRACT NUMBER 5b. GRANT
Rivas, R; Velázquez, E; Valverde, A; Mateos, P F; Martínez-Molina, E
2001-04-01
Polymerase chain reation (PCR) fingerprints are used to characterize and recognize bacteria and are generally obtained using universal primers that generate an array of DNA amplicons, which can be separated by electrophoresis. Universal primers 8F and 1491 R have been used to amplify specifically 16S rDNA. We have used these primers at an annealing temperature of 50 degrees C. Agarose gel electrophoresis of PCR products revealed several bands. The band pattern of each bacterial species was different and the strains belonging to the same species shared an identical pattern. The patterns obtained did not show variations with plasmid DNA content or the growth stage of the bacteria. The peculiarity of the randomly amplified polymorphic DNA (RAPD) described in this work lies in the use of two large primers (proximately 20 nt) to obtain the pattern, since normally a only smaller primer is used, and in the new application for the primers used to amplify 16S rDNA. This new procedure, called two primers (TP)-RAPD fingerprinting, is thus rapid, sensitive, reliable, highly reproducible and suitable for experiments with a large number of microorganisms, and can be applied to bacterial taxonomy, ecological studies and for the detection of new bacterial species.
Energy Technology Data Exchange (ETDEWEB)
Jothikumar, N., E-mail: jin2@cdc.gov; Hill, Vincent R.
2013-06-28
Highlights: •Uses a single-labeled fluorescent primer for real-time PCR. •The detection sensitivity of PET PCR was comparable to TaqMan PCR. •Melt curve analysis can be performed to confirm target amplicon production. •Conventional PCR primers can be converted to PET PCR primers. -- Abstract: We report the development of a fluorescently labeled oligonucleotide primer that can be used to monitor real-time PCR. The primer has two parts, the 3′-end of the primer is complimentary to the target and a universal 17-mer stem loop at the 5′-end forms a hairpin structure. A fluorescent dye is attached to 5′-end of either the forward or reverse primer. The presence of guanosine residues at the first and second position of the 3′ dangling end effectively quenches the fluorescence due to the photo electron transfer (PET) mechanism. During the synthesis of nucleic acid, the hairpin structure is linearized and the fluorescence of the incorporated primer increases several-fold due to release of the fluorescently labeled tail and the absence of guanosine quenching. As amplicons are synthesized during nucleic acid amplification, the fluorescence increase in the reaction mixture can be measured with commercially available real-time PCR instruments. In addition, a melting procedure can be performed to denature the double-stranded amplicons, thereby generating fluorescence peaks that can differentiate primer dimers and other non-specific amplicons if formed during the reaction. We demonstrated the application of PET-PCR for the rapid detection and quantification of Cryptosporidium parvum DNA. Comparison with a previously published TaqMan® assay demonstrated that the two real-time PCR assays exhibited similar sensitivity for a dynamic range of detection of 6000–0.6 oocysts per reaction. PET PCR primers are simple to design and less-expensive than dual-labeled probe PCR methods, and should be of interest for use by laboratories operating in resource
International Nuclear Information System (INIS)
Jothikumar, N.; Hill, Vincent R.
2013-01-01
Highlights: •Uses a single-labeled fluorescent primer for real-time PCR. •The detection sensitivity of PET PCR was comparable to TaqMan PCR. •Melt curve analysis can be performed to confirm target amplicon production. •Conventional PCR primers can be converted to PET PCR primers. -- Abstract: We report the development of a fluorescently labeled oligonucleotide primer that can be used to monitor real-time PCR. The primer has two parts, the 3′-end of the primer is complimentary to the target and a universal 17-mer stem loop at the 5′-end forms a hairpin structure. A fluorescent dye is attached to 5′-end of either the forward or reverse primer. The presence of guanosine residues at the first and second position of the 3′ dangling end effectively quenches the fluorescence due to the photo electron transfer (PET) mechanism. During the synthesis of nucleic acid, the hairpin structure is linearized and the fluorescence of the incorporated primer increases several-fold due to release of the fluorescently labeled tail and the absence of guanosine quenching. As amplicons are synthesized during nucleic acid amplification, the fluorescence increase in the reaction mixture can be measured with commercially available real-time PCR instruments. In addition, a melting procedure can be performed to denature the double-stranded amplicons, thereby generating fluorescence peaks that can differentiate primer dimers and other non-specific amplicons if formed during the reaction. We demonstrated the application of PET-PCR for the rapid detection and quantification of Cryptosporidium parvum DNA. Comparison with a previously published TaqMan® assay demonstrated that the two real-time PCR assays exhibited similar sensitivity for a dynamic range of detection of 6000–0.6 oocysts per reaction. PET PCR primers are simple to design and less-expensive than dual-labeled probe PCR methods, and should be of interest for use by laboratories operating in resource
Pandey, Ram Vinay; Pulverer, Walter; Kallmeyer, Rainer; Beikircher, Gabriel; Pabinger, Stephan; Kriegner, Albert; Weinhäusel, Andreas
2016-01-01
Bisulfite (BS) conversion-based and methylation-sensitive restriction enzyme (MSRE)-based PCR methods have been the most commonly used techniques for locus-specific DNA methylation analysis. However, both methods have advantages and limitations. Thus, an integrated approach would be extremely useful to quantify the DNA methylation status successfully with great sensitivity and specificity. Designing specific and optimized primers for target regions is the most critical and challenging step in obtaining the adequate DNA methylation results using PCR-based methods. Currently, no integrated, optimized, and high-throughput methylation-specific primer design software methods are available for both BS- and MSRE-based methods. Therefore an integrated, powerful, and easy-to-use methylation-specific primer design pipeline with great accuracy and success rate will be very useful. We have developed a new web-based pipeline, called MSP-HTPrimer, to design primers pairs for MSP, BSP, pyrosequencing, COBRA, and MSRE assays on both genomic strands. First, our pipeline converts all target sequences into bisulfite-treated templates for both forward and reverse strand and designs all possible primer pairs, followed by filtering for single nucleotide polymorphisms (SNPs) and known repeat regions. Next, each primer pairs are annotated with the upstream and downstream RefSeq genes, CpG island, and cut sites (for COBRA and MSRE). Finally, MSP-HTPrimer selects specific primers from both strands based on custom and user-defined hierarchical selection criteria. MSP-HTPrimer produces a primer pair summary output table in TXT and HTML format for display and UCSC custom tracks for resulting primer pairs in GTF format. MSP-HTPrimer is an integrated, web-based, and high-throughput pipeline and has no limitation on the number and size of target sequences and designs MSP, BSP, pyrosequencing, COBRA, and MSRE assays. It is the only pipeline, which automatically designs primers on both genomic
Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders
Energy Technology Data Exchange (ETDEWEB)
Bilyard, G.R.; Word, C.J.; Weber, J.R.; Harding, A.K.
2000-09-27
This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of groups interacting about topics in bioremediation or the NABIR program. The primer also provides brief, useful models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums.
Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders
Energy Technology Data Exchange (ETDEWEB)
A Harding; B Metting; C Word; G Bilyard; G Hund; J Amaya; J Weber; S Gajewski; S Underriner; T Peterson
1998-12-10
This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of @oups interacting about topics in bioremediation or the NABIR program. The primer also provides briez usefid models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums.
Directory of Open Access Journals (Sweden)
Diana Bocarejo
2011-01-01
Full Text Available La práctica del multiculturalismo en Colombia se ejerce en el contexto de complejas disputas y reclamos provenientes de diferentes actores sociales, beneficiarios o no de derechos diferenciales. En este artículo se estudian dos paradojas de los arreglos políticos del multiculturalismo en Colombia, relacionadas con la forma como se espacializa la diferencia indígena, y con ellas, se examinan sus implicaciones políticas. La primera paradoja es la forma como se juzga quién es o no un sujeto indígena legal, utilizando como una de las características predominantes el que un indígena viva en "su" resguardo rural. La segunda paradoja es el aislamiento político que se ha configurado entre indígenas y campesinos. De esta forma, se pretende demostrar la relevancia de estudiar no solo las políticas culturales, sino también la cultura política que posibilita y construye el multiculturalismo.
2017-09-28
Technical Report 3. DATES COVERED (From - To) October 2012–September 2017 4. TITLE AND SUBTITLE Verification and Demonstration for Transition of...surfaces to protect against corrosion and improve the adhesion of the subsequent primer to the base metal. The wash primer contains hexavalent chromium (Cr...Adhesion 6 2.3 Dry Tape Adhesion 7 2.4 Pencil Hardness 8 2.5 Chip Resistance Test 8 2.6 Accelerated Corrosion Testing 10 2.7 Outdoor Exposure Testing at
Information Manager (The) - Vol 15, No 1-2 (2015)
African Journals Online (AJOL)
The Adoption of Cloud Computing Technology for Library Services in the National Open University of Nigeria Library · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. Okwoli Mercy Enefu, Dr Ezra S Gbaje, Dr Baba S Aduku, 22-32 ...
A primer of multivariate statistics
Harris, Richard J
2014-01-01
Drawing upon more than 30 years of experience in working with statistics, Dr. Richard J. Harris has updated A Primer of Multivariate Statistics to provide a model of balance between how-to and why. This classic text covers multivariate techniques with a taste of latent variable approaches. Throughout the book there is a focus on the importance of describing and testing one's interpretations of the emergent variables that are produced by multivariate analysis. This edition retains its conversational writing style while focusing on classical techniques. The book gives the reader a feel for why
IDENTIFICACIÓN DEL AGENTE CAUSAL DE LA ANTRACNOSIS DE Sansevieria spp. EN COSTA RICA
Directory of Open Access Journals (Sweden)
Gerardo Pérez-León
2013-01-01
Full Text Available Sansevieria spp. (Agavaceae es una ornamental de follaje originaria de África y Asia. S. trifasciata (St es la especie con mayor número de cultivares en el mercado de exportación de Costa Rica a Estados Unidos y Holanda. Muestras foliares de S. trifasciata var. “Hahnii” con lesiones circulares y acuosas (algunas alargadas y secas, fueron analizadas. El patógeno recuperado fue identificado como Colletotrichum sansevieriae Nakamura (CsN mediante pruebas de patogenicidad, morfología y técnicas moleculares. Los aislamientos mono-hifales presentaron coloración crema, crecimiento postrado y escasa producción de conidios. La patogenicidad de CsN se evaluó en 7 variedades de St; Sansevieriasp., var., jiboia; S. cylindrica y las ornamentalesCodiaeum variegatum, Cordelyne terminalis y Dracaena deremensis, mediante 2 sistemas deinoculación: plantas en maceta (invernaderoy hojas separadas (laboratorio; con ambos sereprodujeron los síntomas de la enfermedad. Cinco de las variedades de S. trifasciata desarrollaron síntomas, “Hahnii” la más susceptible. Ninguna de las otras ornamentales presentósíntomas. CsN fue re-aislado de hojas inoculadas (postulados de Koch. La amplificación mediante PCR de la región ITS con los iniciadores ITS5 e ITS4 produjo un fragmento de aproximadamente 600pb, cuya secuencia de nucleótidos fue idéntica para los aislamientos mono-hifales. En el Banco de Genes, la secuencia alineó con accesiones de CsN de Australia y USA, con un índice de simi laridad del 99 al 100%. El análisis filogenético, con base en la región ITS2, agrupó (99% valor debootstrap los aislamientos costarricenses con elaislamiento tipo CsN de Japón y los de Australia y USA. Hasta donde se conoce, éste es el primer informe de la antracnosis de Sansevieria en C. R.
A Primer on Basic Effect Size Concepts.
Elmore, Patricia B.; Rotou, Ourania
The increased interest in reporting effect sizes means that it is necessary to consider what should be included in a primer on effect sizes. A review of papers on effect sizes and commonly repeated statistical analyses suggests that it is important to discuss effect sizes relative to bivariate correlation, t-tests, analysis of variance/covariance,…
Directory of Open Access Journals (Sweden)
N.I. Albuquerque
2009-12-01
Full Text Available Analisaram-se as propriedades da carne e o perfil de ácidos graxos do pernil de catetos alimentados com dietas contendo diferentes porcentagens de torta de babaçu, usada como fonte energética alternativa substituindo parte do milho na alimentação, em sistemas de produção em cativeiro. Avaliou-se o pernil de 12 animais quanto às suas propriedades - perda de peso ao cozimento, força de cisalhamento, pH e capacidade de retenção de água-, depois extraiu-se o óleo da carne e determinou-se o perfil dos ácidos graxos. Não foram observados efeitos (P>0,05 das porcentagens de torta de babaçu sobre as propriedades da carne; os ácidos graxos (AG insaturados, mono e poli-insaturados, foram encontrados em maior quantidade (51,6-57,8% que os ácidos graxos saturados (42,2-48,4% na carne do pernil. Baseando-se na teoria de que os AG poli-insaturados ingeridos na dieta humana são responsáveis pela redução nos níveis séricos de colesterol, sugere-se que a carne de catetos seja uma boa fonte alternativa de proteína.The meat properties and the fatty acids profile of the ham of peccaries ham fed diets with different levels of babassu meal, used as an alternative energy source substituting part of corn on feeding peccaries in captivity, were studied. The ham meats of 12 animals were evaluated on their properties: cooking losses, shear force, pH, and water holding capacity. After that, the meat oil was extracted to determine the fatty acids contents. No effects (P>0.05 of the babassu meal levels on the meat properties were observed. The unsaturated fatty acids, mono and polyunsaturated, were found in higher quantity than the saturated fatty acids in the ham meat of peccaries. Based on the theory that the polyunsaturated fatty acids ingested in the human diet are responsible for reduction of the seric levels of cholesterol, it can be suggested that the peccary meat is a good alternative source of protein.
Directory of Open Access Journals (Sweden)
Roberts WE
2015-09-01
Full Text Available Wendy E Roberts,1 Lily I Jiang,2 James H Herndon Jr3 1Generational and Cosmetic Dermatology, Rancho Mirage, CA, 2Thomas J Stephens and Associates, Richardson, 3Dermatology Center of Dallas, Dallas, TX, USA Background: Photoaged skin results from various environmental factors, most importantly chronic sun exposure. Dyschromia and fine lines/wrinkles are common clinical manifestations of photodamaged skin. Purpose: This single-center clinical trial was conducted to assess the efficacy and tolerability of a new multifunctional facial primer (camouflage, broad-spectrum SPF 50, and a treatment for hyperpigmentation when used by females with mild-to-moderate facial hyperpigmentation and fine lines due to photoaging over a course of 12 weeks. Patients and methods: Subjects were provided test material (Even Up-Clinical Pigment Perfector and supporting products to use on their face and neck. Products were used according to specific application instructions. Clinical grading for efficacy and tolerability assessments were performed by an expert grader at baseline, baseline (post-application primer, week 4, week 8, week 12, and week 12 (post-application primer. Standardized digital photographs were taken, and self-assessment questionnaires were conducted. Results: Twenty-eight female subjects completed the 12-week trial. The facial primer improved scores for the appearance of hyperpigmentation and other photoaging parameters immediately after the first application. The treatment also showed a progressive improvement in the clinical assessment of hyperpigmentation and other photoaging parameters over the 12-week trial. These long-term benefits can be attributed to an improvement in the underlying skin condition. The facial primer was well tolerated. Subject questionnaires showed that the product was highly rated at all visits. Conclusion: The facial primer was shown to be effective and well tolerated for immediate and long-term improvement in the appearance
Beauchaine, Theodore P.
2009-01-01
Taxometric procedures provide an empirical means of determining which psychiatric disorders are typologically distinct from normal behavioral functioning. Although most disorders reflect extremes along continuously distributed behavioral traits, identifying those that are discrete has important implications for accurate diagnosis, effective treatment, early identification of risk, and improved understanding of etiology. This article provides (a) brief descriptions of the conceptual bases of several taxometric procedures, (b) example analyses using simulated data, and (c) strategies for avoiding common pitfalls that are often observed in taxometrics research. To date, most taxometrics studies have appeared in the adult psychopathology literature. It is hoped that this primer will encourage interested readers to extend taxometrics research to child and adolescent populations. PMID:18088222
Directory of Open Access Journals (Sweden)
Ernesto Calderón-Jaimes
2003-04-01
Full Text Available OBJECTIVE: To describe the antimicrobial activity of several antimicrobial agents against 97 clinical significant isolates of Enterococcus spp. MATHERIAL AND METHODS: During a 2-year prospective study at Instituto Nacional de Pediatria (National Institute of Pediatrics in Mexico City. Ninety seven strains of Enterococcus spp. (60 E. faecalis and 37 E. faecium were tested against 11 antibiotics. Susceptibility tests were performed with agar, according to the standards of the sNational Committee for Clinical Laboratory Standards (NCCLS. Isolates were screened for high-level resistance (HLR to beta-lactams, aminoglycosides, glycopeptides and other antibiotics, as well as for vancomycin-phenotypes. Differences between proportions were evaluated with chi2 of Fisher exact fest. RESULTS: Overall resistance rates to the antibiotics tested were: 17/97 (17.5% to penicillin, ampicillin, amoxicillin-clavulanate and imipenem. There was neither HLR nor beta-lactamase production; 74/97 (48.4% were resistant to erythromycin; 60% to ciprofloxacin; 31/97 (32% to gentamicin, and 55/97 (56.7% to streptomycin. Seven strains were vancomycin-resistant enterococci (VRE, all of them identified as E. faecium; 5/7 with Van A and 2/7 with Van B phenotypes. All the isolates were susceptible to linezolid. The difference in susceptibility among species was significant. CONCLUSIONS: Mutidrug-resistant enterococci is a real problem and continuous surveillance is necessary. The microbiology laboratory is the first line of defense against the spread of multiantibiotic-resistan enterococci in the hospital environment . All the strains recovered should be tested for susceptibility to ampicillin, streptomycin, gentamicin and glycopeptides.OBJECTIVO: Describir la actividad antimicrobiana de varios antibióticos, contra 97 cepas de Enterococcus spp., consideradas como aislamientos clínicamente significativos. MATERIAL Y MÉTODOS: En un estudio prospectivo de dos años, (enero de 1998
Magnesium-Based Sacrificial Anode Cathodic Protection Coatings (Mg-Rich Primers for Aluminum Alloys
Directory of Open Access Journals (Sweden)
Michael D. Blanton
2012-09-01
Full Text Available Magnesium is electrochemically the most active metal employed in common structural alloys of iron and aluminum. Mg is widely used as a sacrificial anode to provide cathodic protection of underground and undersea metallic structures, ships, submarines, bridges, decks, aircraft and ground transportation systems. Following the same principle of utilizing Mg characteristics in engineering advantages in a decade-long successful R&D effort, Mg powder is now employed in organic coatings (termed as Mg-rich primers as a sacrificial anode pigment to protect aerospace grade aluminum alloys against corrosion. Mg-rich primers have performed very well on aluminum alloys when compared against the current chromate standard, but the carcinogenic chromate-based coatings/pretreatments are being widely used by the Department of Defense (DoD to protect its infrastructure and fleets against corrosion damage. Factors such as reactivity of Mg particles in the coating matrix during exposure to aggressive corrosion environments, interaction of atmospheric gases with Mg particles and the impact of Mg dissolution, increases in pH and hydrogen gas liberation at coating-metal interface, and primer adhesion need to be considered for further development of Mg-rich primer technology.
Liu, Weipeng; Zhu, Minjun; Liu, Hongxing; Wei, Jitao; Zhou, Xiaoming; Xing, Da
2016-07-15
Searching for a strategy to enhance the efficiency of nucleic acid amplification and achieve exquisite discrimination of nucleic acids at the single-base level for biological detection has become an exciting research direction in recent years. Here, we have developed a simple and universal primer design strategy which produces a fascinating effect on isothermal strand displacement amplification (iSDA). We refer to the resultant primer as "invading stacking primer (IS-Primer)" which is based on contiguous stacking hybridization and toehold-mediated exchange reaction and function by merely changing the hybridization location of the primer. Using the IS-Primer, the sensitivity in detecting the target miR-21 is improved approximately five fold compared with the traditional iSDA reaction. It was further demonstrated that the IS-Primer acts as an invading strand to initiate branch migration which can increase the efficiency of the untwisting of the hairpin probe. This effect is equivalent to reducing the free energy of the stem, and the technique shows superior selectivity for single-base mismatches. By demonstrating the enhanced effect of the IS-Primer in the iSDA reaction, this work may provide a potentially new avenue for developing more sensitive and selective nucleic acids assays. Copyright © 2016 Elsevier B.V. All rights reserved.
Gamper, H.A.; Leuchtmann, A.
2007-01-01
Taxon-specific polymerase chain reaction (PCR) primers enable detection of arbuscular mycorrhizal fungi (AMF, Glomeromycota) in plant roots where the fungi lack discriminative morphological and biochemical characters. We designed and validated pairs of new PCR primers targeted to the flanking
Directory of Open Access Journals (Sweden)
A. Torres Valle
2005-01-01
Full Text Available La seguridad durante las intervenciones de mantenimiento se trata de manera limitada y en general independiente de lossistemas de gestión del mantenimiento. Esta variable está afectada por múltiples factores de tipo técnico o humano, muchasveces subjetivos y difíciles de cuantificar, lo que limita el diseño de planes preventivos. Sin embargo, algunos factoresconstituyen puntos comunes: las configuraciones de aislamiento durante las vías libres y los errores humanos asociados a suviolación. Esta característica permitió desarrollar el análisis de tales situaciones a través de la metodología de árboles defallos que vincula coherentemente fallos de equipos y errores humanos. La metodología ha sido automatizada dentro delcódigo MOSEG Win Ver 1.0 y la misma puede abarcar desde el análisis de una situación particular de vía libre hasta el deuna estrategia completa de mantenimiento desde el punto de vista de la seguridad del personal mantenedor.Palabras Claves: Vía libre, configuración de aislamiento, árbol de fallos, errores humanos, estrategias demantenimiento._____________________________________________________________________________Abstract.Safety during maintenance operations have been studied in a limited way and generally isolated from the maintenancemanagement system. Safety is affected by multiple both technical and human factors, of a subjective nature and difficult toquantify, this limits its value for designing preventive plans. However, some factors constitute common points namely:isolating configurations during the work protection code and human errors associated with its violation. Such situationswere able to be analyzed by following this feature through the fault tree methodology that matches equipment failures andhuman errors coherently. The methodology is automated as part of MOSEG Win Ver 1.0 code. It ranges from the analysisof particular situations up to complete maintenance strategy from the point of view of
Directory of Open Access Journals (Sweden)
Editorial, Equipo
1968-11-01
Full Text Available Not availableEl Foamglas es un material constituido por vidrio químicamente puro, de tipo boro-silicato, inorgánico, sin adición de aglomerante. Se presenta y utiliza en placas de diferentes dimensiones estandarizadas. Estas placas se colocan en cubiertas planas o con pendiente. Se unen con betún y se recubren con una impermeabilización. Otros empleos no considerados en el presente documento son: en el doblado de muros, en las cámaras frigoríficas, en las fachadas ligeras, falsos techos, en el aislamiento de depósitos de agua y tuberías.
Directory of Open Access Journals (Sweden)
Firuzbakht MM
2011-04-01
Full Text Available "nBackground and Aims: The aim of this study was to evaluate the effect of application of two types of primers over bracket bases on the shear bond strength (SBS and mode of bond failure."nMaterials and Methods: In this study, 75 human premolar teeth were divided into three equal groups. In group 1 (control, after surface preparation of enamel by conventional method (acid etching+primer brackets were bonded with Transbond XT composite. In group 2 (TX, brackets were bonded to enamel same as the first group but Transbond XT primer were used on bracket bases before placement of composite. In group 3 (PL, Transbond plus primer was applied on bracket bases before placement of composite. After 24 h, the SBS test was performed by universal testing machine at crosshead speed of 0.5 mm/min. Then, adhesive remnant index (ARI scores and percentage of cohesive fracture were determined using stereomicroscopy. SBS data were analyzed by one-way ANOVA and Duncan tests. Kruskal-Wallis and Mann-Whitney tests were used to analyze ARI and cohesive fracture results."nResults: There was significant difference in SBS values among the groups (P<0.001. The highest SBS was shown in TX group and the lowest was seen in PL group. There was no significant difference between control and TX groups in ARI scores (P=0.199. No significant difference was found in cohesive fracture values between the groups (P=0.093. Both the control and TX groups showed significant difference in ARI scores and cohesive fracture compared with the PL group in all of the comparisons (P<0.001."nConclusion: Application of Transbond XT primer over bracket base affects the bond strength and failure mode. Transbond XT primer increased the bond strength but Transbond plus primer decreased it.
Development and evaluation of new primers for PCR-based identification of Prevotella intermedia.
Zhou, Yanbin; Liu, Dali; Wang, Yiwei; Zhu, Cailian; Liang, Jingping; Shu, Rong
2014-08-01
The aim of this study was to develop new Prevotella intermedia-specific PCR primers based on the 16S rRNA. The new primer set, Pi-192 and Pi-468, increased the accuracy of PCR-based P. intermedia identification and could be useful in the detection of P. intermedia as well as epidemiological studies on periodontal disease. Copyright © 2014 Elsevier Ltd. All rights reserved.
Su, Lei; Zhang, Qianqian; Gong, Jun
2017-07-01
Peritrich ciliates are highly diverse and can be important bacterial grazers in aquatic ecosystems. Morphological identifications of peritrich species and assemblages in the environment are time-consuming and expertise-demanding. In this study, two peritrich-specific PCR primers were newly designed to amplify a fragment including the internal transcribed spacer (ITS) region of ribosomal rDNA from environmental samples. The primers showed high specificity in silico, and in tests with peritrich isolates and environmental DNA. Application of these primers in clone library construction and sequencing yielded exclusively sequences of peritrichs for water and sediment samples. We also found the ITS1, ITS2, ITS, D1 region of 28S rDNA, and ITS+D1 region co-varied with, and generally more variable than, the V9 region of 18S rDNA in peritrichs. The newly designed specific primers thus provide additional tools to study the molecular diversity, community composition, and phylogeography of these ecologically important protists in different systems.
Molecular Basis for DNA Double-Strand Break Annealing and Primer Extension by an NHEJ DNA Polymerase
Directory of Open Access Journals (Sweden)
Nigel C. Brissett
2013-11-01
Full Text Available Nonhomologous end-joining (NHEJ is one of the major DNA double-strand break (DSB repair pathways. The mechanisms by which breaks are competently brought together and extended during NHEJ is poorly understood. As polymerases extend DNA in a 5′-3′ direction by nucleotide addition to a primer, it is unclear how NHEJ polymerases fill in break termini containing 3′ overhangs that lack a primer strand. Here, we describe, at the molecular level, how prokaryotic NHEJ polymerases configure a primer-template substrate by annealing the 3′ overhanging strands from opposing breaks, forming a gapped intermediate that can be extended in trans. We identify structural elements that facilitate docking of the 3′ ends in the active sites of adjacent polymerases and reveal how the termini act as primers for extension of the annealed break, thus explaining how such DSBs are extended in trans. This study clarifies how polymerases couple break-synapsis to catalysis, providing a molecular mechanism to explain how primer extension is achieved on DNA breaks.
DEFF Research Database (Denmark)
Mengel-From, Jonas; Sanchez Sanchez, Juan Jose; Børsting, Claus
2005-01-01
A novel single-base extension (SBE) assay using cleavable and noncleavable SBE primers in the same reaction mix is described. The cleavable SBE primers consisted of deoxyribonucleotides and one ribonucleotide (hereafter denoted chimeric primers), whereas the noncleavable SBE primers consisted....... A ribonuclease mix was developed to specifically cleave the chimeric primers, irrespective of the base of the ribonucleotide, whereas standard primers without a ribonucleotide were unaffected by the ribonuclease treatment. The SBE products were analyzed in linear mode using a matrix-assisted laser desorption...... containing 9 chimeric primers and 8 standard primers....
S. Dos-Anjos; J. Mercader; A.J. Katz.; R. Llull
2013-01-01
El tejido adiposo obtenido mediante liposucción es una fuente idónea para aislar células con potencial terapéutico, las denominadas células de la fracción estromal vascular (FEV), que incluyen células madre mesenquimales. Estas células se han convertido en una de las principales herramientas de terapia celular autóloga para diversas aplicaciones médicas, y en los últimos años se han ido desarrollando diversas tecnologías para su aislamiento y uso clínico. En este trabajo presentamos un nuevo ...
The astrobiology primer: an outline of general knowledge--version 1, 2006.
Billings, L; Cameron, V; Claire, M; Dick, G J; Domagal-Goldman, S D; Javaux, E J; Johnson, O J; Laws, C; Race, M S; Rask, J; Rummel, J D; Schelble, R T; Vance, S
2006-10-01
The Astrobiology Primer has been created as a reference tool for those who are interested in the interdisciplinary field of astrobiology. The field incorporates many diverse research endeavors, but it is our hope that this slim volume will present the reader with all he or she needs to know to become involved and to understand, at least at a fundamental level, the state of the art. Each section includes a brief overview of a topic and a short list of readable and important literature for those interested in deeper knowledge. Because of the great diversity of material, each section was written by a different author with a different expertise. Contributors, authors, and editors are listed at the beginning, along with a list of those chapters and sections for which they were responsible. We are deeply indebted to the NASA Astrobiology Institute (NAI), in particular to Estelle Dodson, David Morrison, Ed Goolish, Krisstina Wilmoth, and Rose Grymes for their continued enthusiasm and support. The Primer came about in large part because of NAI support for graduate student research, collaboration, and inclusion as well as direct funding. We have entitled the Primer version 1 in hope that it will be only the first in a series, whose future volumes will be produced every 3-5 years. This way we can insure that the Primer keeps up with the current state of research. We hope that it will be a great resource for anyone trying to stay abreast of an ever-changing field.
Promotion primer. Foerderfibel
Energy Technology Data Exchange (ETDEWEB)
1981-01-01
This revised edition of the promotion primer is to serve as a topical orientation aid for industrial firms, unions, boards and other bodies interested where the actions of governmental R and D and innovation policy are compiled and clearly arranged. It is important for the success of governmental aids that the institutions concerned are informed about all possibilities of the promotion, financing and advisory programme. Beyond the presentation of the research promotion sectors, the fiscal measures and the contractual as well as the joint research this revised edition focussess on the fields of consultative services for innovation and information. For many firms the access to qualified information and guidance is of particular importance. That is why this brochure points out the ways towards governmental research promotion. The BMFT has provided a remarkable contribution to research promotion by establishing information and consultative services for trade and industry.
Síntesis y Caracterización de Ag2Cu2O3, el primer óxido de cobre y plata
Directory of Open Access Journals (Sweden)
Gómez-Romero, P.
2000-06-01
Full Text Available Despite the crystal-chemical similarities between copper and silver ions, there is no known silver copper oxide, neither natural nor synthetic. In this work, we present the synthesis at room-temperature of the first silver copper oxide of formula Ag2Cu2O3 (tetragonal, a=5.8857(3Å, c=10.6868(7Å, space group I41/amd, Z=4. It should be noted that the thermal stability of this new oxide is enhanced with respect to Ag2O or even CuO. The structure consists of alternating chains of edge-sharing square planar Cu(II and zigzag chains of linearly coordinated Ag(I ions.A pesar de las similitudes cristaloquímicas entre los iones de cobre y los de plata, no existe ningún óxido mixto de cobre y plata ni natural ni sintético. En este trabajo se presenta la síntesis a bajas temperaturas del primer óxido mixto de cobre y plata, de fórmula Ag2Cu2O3 (tetragonal, a=5.8857(3Å, c=10.6868(7Å, grupo espacial I41/amd, Z=4. Este óxido posee una estabilidad térmica superior a los correspondientes óxidos de cobre y de plata. Contiene cadenas de iones Cu(II cuadrado-planos que alternan con cadenas en zig-zag de Ag(I con coordinación lineal.
Gold nanoparticle-assisted primer walking for closing the human chromosomal gap
DEFF Research Database (Denmark)
Li, H; Shi, B; Li, X
2013-01-01
The finished sequence of the human genome still contains 260 euchromatic gaps. All the PCR-based genome walking techniques used to close gaps have common limitations, such as low efficiency and low specificity. We herein describe a strategy to solve this problem by employing gold nanoparticles (Au......NPs) to improve the efficiency in primer walking amplification. We used this strategy to close a gap in human chromosome 5 containing a DNA stretch composed of the 12SAT repeat. The obtained gap sequence is highly conserved among several mammalian genomes. The demonstrated AuNP-assisted primer walking strategy...
Wang, Yong
2009-10-09
Bacterial 16S ribosomal DNA (rDNA) amplicons have been widely used in the classification of uncultured bacteria inhabiting environmental niches. Primers targeting conservative regions of the rDNAs are used to generate amplicons of variant regions that are informative in taxonomic assignment. One problem is that the percentage coverage and application scope of the primers used in previous studies are largely unknown. In this study, conservative fragments of available rDNA sequences were first mined and then used to search for candidate primers within the fragments by measuring the coverage rate defined as the percentage of bacterial sequences containing the target. Thirty predicted primers with a high coverage rate (>90%) were identified, which were basically located in the same conservative regions as known primers in previous reports, whereas 30% of the known primers were associated with a coverage rate of <90%. The application scope of the primers was also examined by calculating the percentages of failed detections in bacterial phyla. Primers A519-539, E969- 983, E1063-1081, U515 and E517, are highly recommended because of their high coverage in almost all phyla. As expected, the three predominant phyla, Firmicutes, Gemmatimonadetes and Proteobacteria, are best covered by the predicted primers. The primers recommended in this report shall facilitate a comprehensive and reliable survey of bacterial diversity in metagenomic studies. © 2009 Wang, Qian.
Effect of oligonucleotide primers in determining viral variability within hosts
Directory of Open Access Journals (Sweden)
Moya Andrés
2004-12-01
Full Text Available Abstract Background Genetic variability in viral populations is usually estimated by means of polymerase chain reaction (PCR based methods in which the relative abundance of each amplicon is assumed to be proportional to the frequency of the corresponding template in the initial sample. Although bias in template-to-product ratios has been described before, its relevance in describing viral genetic variability at the intrapatient level has not been fully assessed yet. Results To investigate the role of oligonucleotide design in estimating viral variability within hosts, genetic diversity in hepatitis C virus (HCV populations from eight infected patients was characterised by two parallel PCR amplifications performed with two slightly different sets of primers, followed by cloning and sequencing (mean = 89 cloned sequences per patient. Population genetics analyses of viral populations recovered by pairs of amplifications revealed that in seven patients statistically significant differences were detected between populations sampled with different set of primers. Conclusions Genetic variability analyses demonstrates that PCR selection due to the choice of primers, differing in their degeneracy degree at some nucleotide positions, can eclipse totally or partially viral variants, hence yielding significant different estimates of viral variability within a single patient and therefore eventually producing quite different qualitative and quantitative descriptions of viral populations within each host.
Effect of oligonucleotide primers in determining viral variability within hosts.
Bracho, Maria Alma; García-Robles, Inmaculada; Jiménez, Nuria; Torres-Puente, Manuela; Moya, Andrés; González-Candelas, Fernando
2004-12-09
Genetic variability in viral populations is usually estimated by means of polymerase chain reaction (PCR) based methods in which the relative abundance of each amplicon is assumed to be proportional to the frequency of the corresponding template in the initial sample. Although bias in template-to-product ratios has been described before, its relevance in describing viral genetic variability at the intrapatient level has not been fully assessed yet. To investigate the role of oligonucleotide design in estimating viral variability within hosts, genetic diversity in hepatitis C virus (HCV) populations from eight infected patients was characterised by two parallel PCR amplifications performed with two slightly different sets of primers, followed by cloning and sequencing (mean = 89 cloned sequences per patient). Population genetics analyses of viral populations recovered by pairs of amplifications revealed that in seven patients statistically significant differences were detected between populations sampled with different set of primers. Genetic variability analyses demonstrates that PCR selection due to the choice of primers, differing in their degeneracy degree at some nucleotide positions, can eclipse totally or partially viral variants, hence yielding significant different estimates of viral variability within a single patient and therefore eventually producing quite different qualitative and quantitative descriptions of viral populations within each host.
Brownfields Technology Primer: Selecting and Using Phytoremediation for Site Cleanup
This primer explains the phytoremediation process, discusses the potential advantages and considerations in selecting phytoremediation to clean up brownfields sites, and provides information on additional resources about phytoremediation.
FullSSR: Microsatellite Finder and Primer Designer
Directory of Open Access Journals (Sweden)
Sebastián Metz
2016-01-01
Full Text Available Microsatellites are genomic sequences comprised of tandem repeats of short nucleotide motifs widely used as molecular markers in population genetics. FullSSR is a new bioinformatic tool for microsatellite (SSR loci detection and primer design using genomic data from NGS assay. The software was tested with 2000 sequences of Oryza sativa shotgun sequencing project from the National Center of Biotechnology Information Trace Archive and with partial genome sequencing with ROCHE 454® from Caiman latirostris, Salvator merianae, Aegla platensis, and Zilchiopsis collastinensis. FullSSR performance was compared against other similar SSR search programs. The results of the use of this kind of approach depend on the parameters set by the user. In addition, results can be affected by the analyzed sequences because of differences among the genomes. FullSSR simplifies the detection of SSRs and primer design on a big data set. The command line interface of FullSSR was intended to be used as part of genomic analysis tools pipeline; however, it can be used as a stand-alone program because the results are easily interpreted for a nonexpert user.
Directory of Open Access Journals (Sweden)
Cheng-Hong Yang
Full Text Available BACKGROUND: Complete mitochondrial (mt genome sequencing is becoming increasingly common for phylogenetic reconstruction and as a model for genome evolution. For long template sequencing, i.e., like the entire mtDNA, it is essential to design primers for Polymerase Chain Reaction (PCR amplicons which are partly overlapping each other. The presented chromosome walking strategy provides the overlapping design to solve the problem for unreliable sequencing data at the 5' end and provides the effective sequencing. However, current algorithms and tools are mostly focused on the primer design for a local region in the genomic sequence. Accordingly, it is still challenging to provide the primer sets for the entire mtDNA. METHODOLOGY/PRINCIPAL FINDINGS: The purpose of this study is to develop an integrated primer design algorithm for entire mt genome in general, and for the common primer sets for closely-related species in particular. We introduce ClustalW to generate the multiple sequence alignment needed to find the conserved sequences in closely-related species. These conserved sequences are suitable for designing the common primers for the entire mtDNA. Using a heuristic algorithm particle swarm optimization (PSO, all the designed primers were computationally validated to fit the common primer design constraints, such as the melting temperature, primer length and GC content, PCR product length, secondary structure, specificity, and terminal limitation. The overlap requirement for PCR amplicons in the entire mtDNA is satisfied by defining the overlapping region with the sliding window technology. Finally, primer sets were designed within the overlapping region. The primer sets for the entire mtDNA sequences were successfully demonstrated in the example of two closely-related fish species. The pseudo code for the primer design algorithm is provided. CONCLUSIONS/SIGNIFICANCE: In conclusion, it can be said that our proposed sliding window-based PSO
Dorn-In, Samart; Bassitta, Rupert; Schwaiger, Karin; Bauer, Johann; Hölzel, Christina S
2015-06-01
Universal primers targeting the bacterial 16S-rRNA-gene allow quantification of the total bacterial load in variable sample types by qPCR. However, many universal primer pairs also amplify DNA of plants or even of archaea and other eukaryotic cells. By using these primers, the total bacterial load might be misevaluated, whenever samples contain high amounts of non-target DNA. Thus, this study aimed to provide primer pairs which are suitable for quantification and identification of bacterial DNA in samples such as feed, spices and sample material from digesters. For 42 primers, mismatches to the sequence of chloroplasts and mitochondria of plants were evaluated. Six primer pairs were further analyzed with regard to the question whether they anneal to DNA of archaea, animal tissue and fungi. Subsequently they were tested with sample matrix such as plants, feed, feces, soil and environmental samples. To this purpose, the target DNA in the samples was quantified by qPCR. The PCR products of plant and feed samples were further processed for the Single Strand Conformation Polymorphism method followed by sequence analysis. The sequencing results revealed that primer pair 335F/769R amplified only bacterial DNA in samples such as plants and animal feed, in which the DNA of plants prevailed. Copyright © 2015 Elsevier B.V. All rights reserved.
PIPEMicroDB: microsatellite database and primer generation tool for pigeonpea genome.
Sarika; Arora, Vasu; Iquebal, M A; Rai, Anil; Kumar, Dinesh
2013-01-01
Molecular markers play a significant role for crop improvement in desirable characteristics, such as high yield, resistance to disease and others that will benefit the crop in long term. Pigeonpea (Cajanus cajan L.) is the recently sequenced legume by global consortium led by ICRISAT (Hyderabad, India) and been analysed for gene prediction, synteny maps, markers, etc. We present PIgeonPEa Microsatellite DataBase (PIPEMicroDB) with an automated primer designing tool for pigeonpea genome, based on chromosome wise as well as location wise search of primers. Total of 123 387 Short Tandem Repeats (STRs) were extracted from pigeonpea genome, available in public domain using MIcroSAtellite tool (MISA). The database is an online relational database based on 'three-tier architecture' that catalogues information of microsatellites in MySQL and user-friendly interface is developed using PHP. Search for STRs may be customized by limiting their location on chromosome as well as number of markers in that range. This is a novel approach and is not been implemented in any of the existing marker database. This database has been further appended with Primer3 for primer designing of selected markers with left and right flankings of size up to 500 bp. This will enable researchers to select markers of choice at desired interval over the chromosome. Furthermore, one can use individual STRs of a targeted region over chromosome to narrow down location of gene of interest or linked Quantitative Trait Loci (QTLs). Although it is an in silico approach, markers' search based on characteristics and location of STRs is expected to be beneficial for researchers. Database URL: http://cabindb.iasri.res.in/pigeonpea/
Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders; FINAL
International Nuclear Information System (INIS)
Bilyard, G.R.; Word, C.J.; Weber, J.R.; Harding, A.K.
2000-01-01
This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of groups interacting about topics in bioremediation or the NABIR program. The primer also provides brief, useful models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums
Energy Technology Data Exchange (ETDEWEB)
Ordonez C, Luis Felipe [Aislantes Minerales, S.A. de C.V. (Mexico)
1996-12-31
One of the technologies for energy saving easier to understand and one of the fastest and economical to install in the dwelling, commercial and industrial, construction is represented by the use of thermal insulation for the thermal energy losses control. As a result of the application of this technology in direct form for the smaller consumption of energy fuels, will have the effect of a lesser emission of pollution gases that produce the green house effect of the earth atmosphere. The thermal insulating materials, made from a variety of raw materials, many of which utilize large amounts of recycled products in the benefit of the smaller use of natural resources, offer annually and permanently reductions in the energy consumption much higher than the energy resources utilized just once in its manufacture. Therefore, they are also an economical way in contributing in the reduction of atmospheric pollutants of the so-called greenhouse gases. [Espanol] Una de las tecnologias para el ahorro de energia mas faciles de comprender y de las mas rapidas y economicas de instalar en la edificacion de vivienda, comercial e industrial, es la que representa el uso de aislamientos termicos para el control de las perdidas de energia termica. Como resultado de la aplicacion de esta tecnologia, en forma directa por el menor consumo de energeticos combustibles, tendra como efecto la menor emision de gases contaminantes que producen el efecto de invernadero en la atmosfera terrestre. Los aislamientos termicos, fabricados de una gran variedad de materiales, muchos de los cuales utilizan grandes cantidades de productos reciclados en beneficio del menor uso de los recursos naturales, ofrecen anualmente y permanentemente reducciones de consumo de energia muy superiores a los recursos energeticos utilizados una sola vez en su manufactura. Por ende, tambien son una forma economica a coadyuvar en la reduccion de contaminantes atmosfericos de los llamados gases de invernadero.
Energy Technology Data Exchange (ETDEWEB)
Ordonez C, Luis Felipe [Aislantes Minerales, S.A. de C.V. (Mexico)
1997-12-31
One of the technologies for energy saving easier to understand and one of the fastest and economical to install in the dwelling, commercial and industrial, construction is represented by the use of thermal insulation for the thermal energy losses control. As a result of the application of this technology in direct form for the smaller consumption of energy fuels, will have the effect of a lesser emission of pollution gases that produce the green house effect of the earth atmosphere. The thermal insulating materials, made from a variety of raw materials, many of which utilize large amounts of recycled products in the benefit of the smaller use of natural resources, offer annually and permanently reductions in the energy consumption much higher than the energy resources utilized just once in its manufacture. Therefore, they are also an economical way in contributing in the reduction of atmospheric pollutants of the so-called greenhouse gases. [Espanol] Una de las tecnologias para el ahorro de energia mas faciles de comprender y de las mas rapidas y economicas de instalar en la edificacion de vivienda, comercial e industrial, es la que representa el uso de aislamientos termicos para el control de las perdidas de energia termica. Como resultado de la aplicacion de esta tecnologia, en forma directa por el menor consumo de energeticos combustibles, tendra como efecto la menor emision de gases contaminantes que producen el efecto de invernadero en la atmosfera terrestre. Los aislamientos termicos, fabricados de una gran variedad de materiales, muchos de los cuales utilizan grandes cantidades de productos reciclados en beneficio del menor uso de los recursos naturales, ofrecen anualmente y permanentemente reducciones de consumo de energia muy superiores a los recursos energeticos utilizados una sola vez en su manufactura. Por ende, tambien son una forma economica a coadyuvar en la reduccion de contaminantes atmosfericos de los llamados gases de invernadero.
Hafeez, Mian A; Shivaramaiah, Srichaitanya; Dorsey, Kristi Moore; Ogedengbe, Mosun E; El-Sherry, Shiem; Whale, Julia; Cobean, Julie; Barta, John R
2015-05-01
Species-specific PCR primers targeting the mitochondrial cytochrome c oxidase subunit I (mtCOI) locus were generated that allow for the specific identification of the most common Eimeria species infecting turkeys (i.e., Eimeria adenoeides, Eimeria meleagrimitis, Eimeria gallopavonis, Eimeria meleagridis, Eimeria dispersa, and Eimeria innocua). PCR reaction chemistries were optimized with respect to divalent cation (MgCl2) and dNTP concentrations, as well as PCR cycling conditions (particularly anneal temperature for primers). Genomic DNA samples from single oocyst-derived lines of six Eimeria species were tested to establish specificity and sensitivity of these newly designed primer pairs. A mixed 60-ng total DNA sample containing 10 ng of each of the six Eimeria species was used as DNA template to demonstrate specific amplification of the correct product using each of the species-specific primer pairs. Ten nanograms of each of the five non-target Eimeria species was pooled to provide a non-target, control DNA sample suitable to test the specificity of each primer pair. The amplifications of the COI region with species-specific primer pairs from pooled samples yielded products of expected sizes (209 to 1,012 bp) and no amplification of non-target Eimeria sp. DNA was detected using the non-target, control DNA samples. These primer pairs specific for Eimeria spp. of turkeys did not amplify any of the seven Eimeria species infecting chickens. The newly developed PCR primers can be used as a diagnostic tool capable of specifically identifying six turkey Eimeria species; additionally, sequencing of the PCR amplification products yields sequence-based genotyping data suitable for identification and molecular phylogenetics.
La arquitectura tardía de Frank Lloyd Wright, el primer maestro moderno
González Capitel, Antón
1996-01-01
1. La arquitectura tardía de Frank Lloyd Wright, el primer maestro moderno l. l. Un Wright renovado. Talleres y residencias l. l. l. Nuevas casas de Wright en su segunda «edad de oro»: un neoplasticismo orgánico en la casa de la Cascada l. l. 2. Geometrías y disposiciones alternativas l. 2. Arquitectura y ciudad orgánicas 1. 2. 1. El desarrollo de la arquitectura orgánica 1. 3. Arquitecturas relacionadas con la de Frank Lloyd Wright entre los emigrados europeos: Schindler y...
Inokuchi, Shota; Yamashita, Yasuhiro; Nishimura, Kazuma; Nakanishi, Hiroaki; Saito, Kazuyuki
2017-11-01
Phenomena known as null alleles and peak imbalance can occur because of mutations in the primer binding sites used for DNA typing. In these cases, an accurate statistical evaluation of DNA typing is difficult. The estimated likelihood ratio is incorrectly calculated because of the null allele and allele dropout caused by mutation-induced peak imbalance. Although a number of studies have attempted to uncover examples of these phenomena, few reports are available on the human identification kit manufactured by Qiagen. In this study, 196 Japanese individuals who were heterozygous at D2S1360 were genotyped using an Investigator HDplex Kit with optimal amounts of DNA. A peak imbalance was frequently observed at the D2S1360 locus. We performed a sequencing analysis of the area surrounding the D2S1360 repeat motif to identify the cause for peak imbalance. A point mutation (G>A transition) 136 nucleotides upstream from the D2S1360 repeat motif was discovered in a number of samples. The allele frequency of the mutation was 0.0566 in the Japanese population. Therefore, human identification or kinship testing using the Investigator HDplex Kit requires caution because of the higher frequency of single nucleotide polymorphisms at the primer binding site of D2S1360 locus in the Japanese population.
Challenges to Malaysia’s National Security
1990-04-09
royal regatta escorted by loyal Chinese warriors and accompanied by charming maids.4 This event was the beginning of the present " Baba and Nyonya ...Century there were two distinct groups of Chinese in Malaya. One consisted of the Baba - Nyonya or Straits Chinese, born and lived for the most part in...the Straits Settlements of Melaka and Penang Island, where their ancestors had come to enjoy the British law and order. The Babas (males) and the
Lv, Xu-Cong; Jiang, Ya-Jun; Liu, Jie; Guo, Wei-Ling; Liu, Zhi-Bin; Zhang, Wen; Rao, Ping-Fan; Ni, Li
2017-08-16
Denaturing gradient gel electrophoresis (DGGE) has become a widely used tool to examine microbial community structure. However, when DGGE is applied to evaluate the fungal community of traditional fermentation starters, the choice of hypervariable ribosomal RNA gene regions is still controversial. In the current study, several previously published fungal PCR primer sets were compared and evaluated using PCR-DGGE, with the purpose of screening a suitable primer set to study the fungal community of traditional fermentation starters for Hong Qu glutinous rice wine. Firstly, different primer sets were used to amplify different hypervariable regions from pure fungal cultures. Except NS1/FR1+ and ITS1fGC/ITS4, other primer sets (NL1+/LS2R, NL3A/NL4GC, FF390/FR1+, NS1/GCFung, NS3+/YM951r and ITS1fGC/ITS2r) amplified the target DNA sequences successfully. Secondly, the selected primer sets were further evaluated based on their resolution to distinguish different fungal cultures through DGGE fingerprints. Three primer sets (NL1+/LS2R, NS1/GCFung and ITS1fGC/ITS2r) were finally selected for investigating the fungal community structure of different traditional fermentation starters for Hong Qu glutinous rice wine. The internal transcribed spacer (ITS) region amplified by ITS1fGC/ITS2r, which is more hypervariable than the 18S rRNA gene and 26S rRNA gene, provides an excellent tool to separate amplification products of different fungal species. Results indicated that PCR-DGGE profile using ITS1fGC/ITS2r showed more abundant fungal species than that using NL1+/LS2R and NS1/GCFung. Therefore, ITS1fGC/ITS2r is the most suitable primer set for PCR-DGGE analysis of fungal community structure in traditional fermentation starters for Hong Qu glutinous rice wine. DGGE profiles based on ITS1fGC/ITS2r revealed the presence of twenty-four fungal species in traditional fermentation starter. A significant difference of fungal community can be observed directly from DGGE fingerprints and
Primers for polymerase chain reaction to detect genomic DNA of Toxocara canis and T. cati.
Wu, Z; Nagano, I; Xu, D; Takahashi, Y
1997-03-01
Primers for polymerase chain reaction to amplify genomic DNA of both Toxocara canis and T. cati were constructed by adapting cloning and sequencing random amplified polymorphic DNA. The primers are expected to detect eggs and/or larvae of T. canis and T. cati, both of which are known to cause toxocariasis in humans.
Xiao, Jing; Zhao, Jin; Liu, Mengjun; Liu, Ping; Dai, Li; Zhao, Zhihui
2015-01-01
Chinese jujube (Ziziphus jujuba), an economically important species in the Rhamnaceae family, is a popular fruit tree in Asia. Here, we surveyed and characterized simple sequence repeats (SSRs) in the jujube genome. A total of 436,676 SSR loci were identified, with an average distance of 0.93 Kb between the loci. A large proportion of the SSRs included mononucleotide, dinucleotide and trinucleotide repeat motifs, which accounted for 64.87%, 24.40%, and 8.74% of all repeats, respectively. Among the mononucleotide repeats, A/T was the most common, whereas AT/TA was the most common dinucleotide repeat. A total of 30,565 primer pairs were successfully designed and screened using a series of criteria. Moreover, 725 of 1,000 randomly selected primer pairs were effective among 6 cultivars, and 511 of these primer pairs were polymorphic. Sequencing the amplicons of two SSRs across three jujube cultivars revealed variations in the repeats. The transferability of jujube SSR primers proved that 35/64 SSRs could be transferred across family boundary. Using jujube SSR primers, clustering analysis results from 15 species were highly consistent with the Angiosperm Phylogeny Group (APGIII) System. The genome-wide characterization of SSRs in Chinese jujube is very valuable for whole-genome characterization and marker-assisted selection in jujube breeding. In addition, the transferability of jujube SSR primers could provide a solid foundation for their further utilization. PMID:26000739
Directory of Open Access Journals (Sweden)
Yusmadi Yusmadi
2008-04-01
Full Text Available The quality and palatibility of silage and hay complete ration based on organic primer garbage in peranakan etawah (PE poad ABSTRACT. This research was conducted to study the quality and palatability of silage and hay complete ration based on organic primer garbage in nine heads of Peranakan Etawah (PE Goat. The quality of silage and hay was evaluated By measuring pH, total number of lactic acid Bacteria (LAB, palatability, dry matter (DM and organic matter (OM aroma and color of silage. Nine heads of peranakan etawah were grouped based on their lactation periode and randomly assigned to one of tree dietary treatments. The treatments were (1 Control rations; (2 silage complete ration (SRK; and (3 Hay complete ration (HRK. The results indicated that the silage had PH 4.15 and total number of LAB was 2.4 x 10 cfu/g of silage. Dry matter and organic matter digestibility of SRK were better than those of HRK. The palatability of SRK was higher than HRK but less than control. Storage of SRK for did not change dry matter and organic matter content. Organoleptic analysis indicated that texture and color of HRK were changed at after storage, while SRK was still constant. It is concluded that silage composed of organic primer garbage has high quality in terms of physical, chemical and microbial characteristics, prolong storage.
Energy Technology Data Exchange (ETDEWEB)
Robles Pimentel, Edgar Guillermo; Rosales Sedano, Inocente [Instituto de Investigaciones Electricas, Cuernavaca (Mexico)
1990-12-31
The high tension electrical generators are very high cost equipment, therefore they need to be very reliable. The generators preventive maintenance based in diagnosis techniques of the insulation condition might mean substantial savings for the user. In this article the most common techniques employed all over the world are presented, the greatest part of them already implemented in Mexico by the authors. The techniques and the equipment employed are analyzed and are exemplified with the results obtained in some field experiences. [Espanol] Los generadores electricos de alta tension son equipos de muy alto costo, por lo que necesitan ser muy confiables. El mantenimiento preventivo de los generadores basado en tecnicas de diagnostico del estado del aislamiento puede significar ahorros sustanciales al usuario. En este articulo se presentan las tecnicas mas comunes empleadas en el mundo, la mayor parte de ellas ya implantadas en Mexico por los autores. Se analizan las tecnicas y el equipo empleado, y se ejemplifica con resultados obtenidos de algunas de las experiencias en el campo.
Energy Technology Data Exchange (ETDEWEB)
Robles Pimentel, Edgar Guillermo; Rosales Sedano, Inocente [Instituto de Investigaciones Electricas, Cuernavaca (Mexico)
1989-12-31
The high tension electrical generators are very high cost equipment, therefore they need to be very reliable. The generators preventive maintenance based in diagnosis techniques of the insulation condition might mean substantial savings for the user. In this article the most common techniques employed all over the world are presented, the greatest part of them already implemented in Mexico by the authors. The techniques and the equipment employed are analyzed and are exemplified with the results obtained in some field experiences. [Espanol] Los generadores electricos de alta tension son equipos de muy alto costo, por lo que necesitan ser muy confiables. El mantenimiento preventivo de los generadores basado en tecnicas de diagnostico del estado del aislamiento puede significar ahorros sustanciales al usuario. En este articulo se presentan las tecnicas mas comunes empleadas en el mundo, la mayor parte de ellas ya implantadas en Mexico por los autores. Se analizan las tecnicas y el equipo empleado, y se ejemplifica con resultados obtenidos de algunas de las experiencias en el campo.
Signals and systems primer with Matlab
Poularikas, Alexander D
2006-01-01
Signals and Systems Primer with MATLAB® equally emphasizes the fundamentals of both analog and digital signals and systems. To ensure insight into the basic concepts and methods, the text presents a variety of examples that illustrate a wide range of applications, from microelectromechanical to worldwide communication systems. It also provides MATLAB functions and procedures for practice and verification of these concepts.Taking a pedagogical approach, the author builds a solid foundation in signal processing as well as analog and digital systems. The book first introduces orthogonal signals,
Aislamiento de cryptococcus neoformans var. Grubii en un felino doméstico. Reporte de caso
Directory of Open Access Journals (Sweden)
Marlyn Zapata Montoya
2009-12-01
Full Text Available Se halló evidencia clínica, citológica y serológica de una infección natural con Criptococcus en un felino criollo proveniente de La Mesa, Cundinamarca (Colombia. C. neoformans var. grubii fue aislado del cultivo de secreciones nasales del paciente. Para el tratamiento específico se utilizó fluconazol, que mostró buenos resultados a partir del primer mes de haber iniciado su administración.
In Vitro Evaluation of Shear Bond Strength of Self Etching Primers to Dentin
Directory of Open Access Journals (Sweden)
Reena Vora
2012-01-01
Full Text Available Objectives: To evaluate and compare the shear bond strength of four self etching primer adhesives to dentin. Materials & Methods: A total of 75 extracted human maxillary and mandibular molars were selected for the study. The teeth were divided into 5 groups of 15 teeth each, Group A- AdheSE (Ivoclar Vivadent, Group B-Adper prompt (3M ESPE, Group C- i bond (Heraeus-Kulzer, Group D-XenoIII (Dentsply, De Trey Group E-Single bond (3M ESPE was used and served as control. All the adhesives were applied according to the manufacturer′s instructions. Composite post was built on these bonded surfaces using Z-100 hybrid composite. The teeth were subjected to thermocycling for 500 cycles between 5°C to 55°C. The teeth were then mounted on universal testing machine and fractured under a shearing load, applied at a speed of 0.2mm/min. The readings were noted, tabulated and shear bond strength calculated in Mega Pascal (Mpa units. Results: There was significant difference in the mean shear bond strength of the four self etching primers, adhesives tested. Shear strength values were in the range of 16.57 to 21.73 Mpa. Xeno III gave the highest mean of shear bond strength whereas Adhe SE showed the lowest value of shear strength. Conclusion: Based on the results of the study, it can be concluded that contemporary self etching primer adhesives bond successfully to dentin. Moreover the bonding ability of Self Etching Systems seems to be comparable to the conventional Total Etch Systems.
indCAPS: A tool for designing screening primers for CRISPR/Cas9 mutagenesis events.
Hodgens, Charles; Nimchuk, Zachary L; Kieber, Joseph J
2017-01-01
Genetic manipulation of organisms using CRISPR/Cas9 technology generally produces small insertions/deletions (indels) that can be difficult to detect. Here, we describe a technique to easily and rapidly identify such indels. Sequence-identified mutations that alter a restriction enzyme recognition site can be readily distinguished from wild-type alleles using a cleaved amplified polymorphic sequence (CAPS) technique. If a restriction site is created or altered by the mutation such that only one allele contains the restriction site, a polymerase chain reaction (PCR) followed by a restriction digest can be used to distinguish the two alleles. However, in the case of most CRISPR-induced alleles, no such restriction sites are present in the target sequences. In this case, a derived CAPS (dCAPS) approach can be used in which mismatches are purposefully introduced in the oligonucleotide primers to create a restriction site in one, but not both, of the amplified templates. Web-based tools exist to aid dCAPS primer design, but when supplied sequences that include indels, the current tools often fail to suggest appropriate primers. Here, we report the development of a Python-based, species-agnostic web tool, called indCAPS, suitable for the design of PCR primers used in dCAPS assays that is compatible with indels. This tool should have wide utility for screening editing events following CRISPR/Cas9 mutagenesis as well as for identifying specific editing events in a pool of CRISPR-mediated mutagenesis events. This tool was field-tested in a CRISPR mutagenesis experiment targeting a cytokinin receptor (AHK3) in Arabidopsis thaliana. The tool suggested primers that successfully distinguished between wild-type and edited alleles of a target locus and facilitated the isolation of two novel ahk3 null alleles. Users can access indCAPS and design PCR primers to employ dCAPS to identify CRISPR/Cas9 alleles at http://indcaps.kieber.cloudapps.unc.edu/.
Glennon, Kelsey L; Cron, Glynis V
2016-05-01
Microsatellites were developed for the widespread Helichrysum odoratissimum (Asteraceae) to estimate gene flow across diploid populations and to test if gene flow occurs among other closely related lineages within this genus. Ten primer pairs were developed and tested using populations across South Africa; however, only seven primer pairs were polymorphic for the target species. The seven polymorphic primers amplified di- and trinucleotide repeats with up to 16 alleles per locus among 125 diploid individuals used for analyses. These markers can be used to estimate gene flow among populations of known ploidy level of H. odoratissimum to test evolutionary hypotheses. Furthermore, these markers amplify successfully in other Helichrysum species, including the other three taxonomic Group 4 species, and therefore can be used to inform taxonomic work on these species.
Stielow, J B; Lévesque, C A; Seifert, K A; Meyer, W; Irinyi, L; Smits, D; Renfurm, R; Verkley, G J M; Groenewald, M; Chaduli, D; Lomascolo, A; Welti, S; Lesage-Meessen, L; Favel, A; Al-Hatmi, A M S; Damm, U; Yilmaz, N.; Houbraken, J.; Lombard, L.; Quaedvlieg, W.; Binder, M.; Vaas, L.A.I.; Vu, D.; Yurkov, A.; Begerow, D.; Roehl, O.; Guerreiro, M.; Fonseca, A.; Samerpitak, K.; Diepeningen, A.D. van; Dolatabadi, S.; Moreno, L.F.; Casaregola, S.; Mallet, S.; Jacques, N.; Roscini, L.; Egidi, E.; Bizet, C.; Garcia-Hermoso, D.; Martín, M.P.; Deng, S.; Groenewald, J.Z.; Boekhout, T.; Beer, Z.W. de; Barnes, I.; Duong, T.A.; Wingfield, M.J.; Hoog, G.S. de; Crous, P.W.; Lewis, C.T.; Hambleton, S.; Moussa, T.A.A.; Al-Zahrani, H.S.; Almaghrabi, O.A.; Louis-Seize, G.; Assabgui, R.; McCormick, W.; Omer, G.; Dukik, K.; Cardinali, G.; Eberhardt, U.; Vries, M. de; Robert, V.
2015-01-01
The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic
Directory of Open Access Journals (Sweden)
Santiago A Dorrbercker Drake
2011-02-01
Full Text Available Se presenta un modelo de estado que caracteriza la tensión de ignición de las descargas parciales (DP enel aislamiento principal de las máquinas eléctricas rotatorias de gran potencia (MERGP. Los objetivos delmodelamiento se dirigieron en dos vertientes: la primera a conocer el comportamiento del menor nivel detensión que produce DP y la segunda destinada al comportamiento del tamaño de las cavidades, en lasque puede aparecer DP, atendiendo al nivel instantáneo de la tensión de corriente alterna (CA aplicada alas mismas. El presente trabajo se propone, proveer de una herramienta capaz de modelar el comportamientode algunos parámetros característicos de las DP en el aislamiento principal de las MERGP, cuando elaislamiento principal es sometido a diferentes condiciones de trabajo. This paper describes a state model for PD inception voltage in main insulation of big rotating machines(BRM. Intends of the present paper were: to show the behaviour of PD inception voltage under differentfactors; and to know the relationships between the size of cavities and the instantaneous value of ACapplied voltage to the insulation. The objective of this paper is offer a computational tool able to model theperformance of some PD characteristic parameters when main insulation is under operation conditions.
Detection of Ophiocordyceps sinensis and Its Common Adulterates Using Species-Specific Primers
Liu, Yang; Wang, Xiao-yue; Gao, Zi-tong; Han, Jian-ping; Xiang, Li
2017-01-01
Ophiocordyceps sinensis is a fungus that infects Hepialidae caterpillars, mummifying the larvae and producing characteristic fruiting bodies (stromata) that are processed into one of the most valued traditional Chinese medicines (TCM). The product commands a very high price due to a high demand but a very limited supply. Adulteration with other fungi is a common problem and there is a need to test preparation for the presence of the correct fungus. In the current study, a PCR-based approach for the identification of O. sinensis based on a segment of the internal transcribed spacer (ITS) region was developed. The segments is 146-bp in size and is likely to be amplified even in materials where processing led to DNA fragmentation. Primer development was based on the alignment of sequence data generated from a total of 89 samples of O. sinensis and potential adulterants as well as sequences date from 41 Ophiocordyceps species and 26 Cordyceps species available in GenBank. Tests with primer pair, DCF4/DCR4, demonstrated generation of an amplicon from DNA extracted from O. sinensis stromata, but not from extracts derived from adulterants. Species-specific primer pairs were also developed and tested for detection of the common adulterants, Cordyceps gunnii, Cordyceps cicadae, Cordyceps militaris, Cordyceps liangshanensis and Ophiocordyceps nutans. The collection of primers developed in the present study will be useful for the authentication of preparation claiming to only contain O. sinensis and for the detection of fungi used as adulterants in these preparations. PMID:28680424
International Nuclear Information System (INIS)
Ryu, Jin Sook; Moon, Dae Hyuk; Cheon, Jun Hong; Chung, Yoon Young; Park, Hung Dong; Chung, Young Hwa; Lee, Young Sang
1994-01-01
This study was performed to evaluate the clinical applicability of the reverse transcription polymerase chain reaction (RT-PCR) kit of HCV-RNA using biotinylated and radioiodinated primers. Study subjects were 118 patients with positive anti-HCV. HCV-RNA in patients serum was extracted by guanidium thiocyanate method. After first amplification, the product was reamplified by primers labelled with biotin and I-125. The final amplification product was detected by counting the radioactivity after incubation in avidin coated tubes. In 51 samples, the test was repeated for evaluation of reproducibility. This new method was also compared with conventional RT-PCR methods in 34 samples from patients with chronic liver disease. The results were as follows, 1) HCV-RNA was positive in 85(97%)of 88 patients with chronic liver disease, and in 23 (73%) of 30 patients with normal liver function. 2) In comparison with conventional method, HCV-RNA was detected in 32(94%) of 34 patients with new method, whereas in 27(79% ) of the same group with conventional method 3) Repeated test with new method in 52 samples demonstrated 82% of concordant result. In conclusion, new method with biotinylated and radioiodinated primers was more sensitive than conventional method. However, great care must be taken for quality control because there were considerable interassay variation and possibility of false positivity and false negativity.
Energy Technology Data Exchange (ETDEWEB)
Ryu, Jin Sook; Moon, Dae Hyuk; Cheon, Jun Hong; Chung, Yoon Young; Park, Hung Dong; Chung, Young Hwa; Lee, Young Sang [Asan Medical Center, University of Ulsan, Seoul (Korea, Republic of)
1994-07-15
This study was performed to evaluate the clinical applicability of the reverse transcription polymerase chain reaction (RT-PCR) kit of HCV-RNA using biotinylated and radioiodinated primers. Study subjects were 118 patients with positive anti-HCV. HCV-RNA in patients serum was extracted by guanidium thiocyanate method. After first amplification, the product was reamplified by primers labelled with biotin and I-125. The final amplification product was detected by counting the radioactivity after incubation in avidin coated tubes. In 51 samples, the test was repeated for evaluation of reproducibility. This new method was also compared with conventional RT-PCR methods in 34 samples from patients with chronic liver disease. The results were as follows, 1) HCV-RNA was positive in 85(97%)of 88 patients with chronic liver disease, and in 23 (73%) of 30 patients with normal liver function. 2) In comparison with conventional method, HCV-RNA was detected in 32(94%) of 34 patients with new method, whereas in 27(79% ) of the same group with conventional method 3) Repeated test with new method in 52 samples demonstrated 82% of concordant result. In conclusion, new method with biotinylated and radioiodinated primers was more sensitive than conventional method. However, great care must be taken for quality control because there were considerable interassay variation and possibility of false positivity and false negativity.
Stielow, J.B.; Lévesque, C.A.; Seifert, K.A.; Meyer, W.; Irinyi, L.; Smits, D.; Renfurm, R.; Verkley, G.J.M.; Groenewald, M.; Chaduli, D.; Lomascolo, A.; Welti, S.; Lesage-Meessen, L.; Favel, A.; Al-Hatmi, A.M.S.; Damm, U.; Yilmaz, N.; Houbraken, J.; Lombard, L.; Quaedvlieg, W.; Binder, M.; Vaas, L.A.I.; Vu, D.; Yurkov, A.; Begerow, D.; Roehl, O.; Guerreiro, M.; Fonseca, A.; Samerpitak, K.; Diepeningen, van A.D.; Dolatabadi, S.; Moreno, L.F.; Casaregola, S.; Mallet, S.; Jacques, N.; Roscini, L.; Egidi, E.; Bizet, C.; Garcia-Hermoso, D.; Martin, M.P.; Deng, S.; Groenewald, J.Z.; Boekhout, T.; Beer, de Z.W.; Barnes, I.; Duong, T.A.; Wingfield, M.J.; Hoog, de G.S.; Crous, P.W.; Lewis, C.T.; Hambleton, S.; Moussa, T.A.A.; Al-Zahrani, H.S.; Almaghrabi, O.A.; Louis-Seize, G.; Assabgui, R.; McCormick, W.; Omer, G.; Dukik, K.; Cardinali, G.; Eberhardt, U.; Vries, de M.; Robert, V.
2015-01-01
The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic markers
Primer retention owing to the absence of RNase H1 is catastrophic for mitochondrial DNA replication.
Holmes, J Bradley; Akman, Gokhan; Wood, Stuart R; Sakhuja, Kiran; Cerritelli, Susana M; Moss, Chloe; Bowmaker, Mark R; Jacobs, Howard T; Crouch, Robert J; Holt, Ian J
2015-07-28
Encoding ribonuclease H1 (RNase H1) degrades RNA hybridized to DNA, and its function is essential for mitochondrial DNA maintenance in the developing mouse. Here we define the role of RNase H1 in mitochondrial DNA replication. Analysis of replicating mitochondrial DNA in embryonic fibroblasts lacking RNase H1 reveals retention of three primers in the major noncoding region (NCR) and one at the prominent lagging-strand initiation site termed Ori-L. Primer retention does not lead immediately to depletion, as the persistent RNA is fully incorporated in mitochondrial DNA. However, the retained primers present an obstacle to the mitochondrial DNA polymerase γ in subsequent rounds of replication and lead to the catastrophic generation of a double-strand break at the origin when the resulting gapped molecules are copied. Hence, the essential role of RNase H1 in mitochondrial DNA replication is the removal of primers at the origin of replication.
Directory of Open Access Journals (Sweden)
Ashish Garg
2013-01-01
Results and conclusion: The results of the study indicated that acidic primer containing both the enamel etchant and primer have adequate bond strength with decreased residual adhesive left on the enamel surface after debonding, thereby maintaining a sound unblemished enamel surface after debonding orthodontic brackets and less chances of iatrogenic enamel fracture and crazing along with decreased chairside time.
Blood Donation and Transfusion: A Primer for Health Educators.
Felts, W. Michael; Glascoff, Mary A.
1991-01-01
Presents a primer for health educators about blood donation and transfusion, examining the nature of human blood, the background of blood transfusion, blood donation criteria, risks related to homologous blood transfusion, directed blood donation, potential alternatives to homologous transfusion, and resources for education on the subject. (SM)
Small Commercial Building Re-tuning: A Primer
Energy Technology Data Exchange (ETDEWEB)
Cort, Katherine A.; Hostick, Donna J.; Underhill, Ronald M.; Fernandez, Nicholas; Katipamula, Srinivas
2013-09-30
To help building owners and managers address issues related to energy-efficient operation of small buildings, DOE has developed a Small Building Re-tuning training curriculum. This "primer" provides additional background information to understand some of the concepts presented in the Small Building Re-tuning training. The intent is that those who are less familiar with the buidling energy concepts will review this material before taking the building re-tuning training class.