Nominal Device Support for ATCA Shelf Manager
Energy Technology Data Exchange (ETDEWEB)
Santos, Bruno; Carvalho, Paulo F.; Rodrigues, A.P.; Carvalho, Bernardo B.; Sousa, Jorge; Batista, Antonio J.N.; Combo, Alvaro M.; Cruz, Nuno; Correia, Carlos M.B.A.; Goncalves, Bruno [Instituto de Plasmas e Fusao Nuclear, Instituto Superior Tecnico, Universidade de Lisboa, 1049-001 Lisboa (Portugal); Correia, Miguel [Centro de Instrumentacao, Departamento de Fisica, Universidade de Coimbra, 3004-516 Coimbra (Portugal)
2015-07-01
The ATCA standard specifies a mandatory Shelf Manager (ShM) unit which is a key element for the system operation. It includes the Intelligent Platform Management Controller (IPMC) which monitors the system health, retrieves inventory information and controls the Field Replaceable Units (FRUs). These elements enable the intelligent health monitoring, providing high-availability and safety operation, ensuring the correct system operation. For critical systems like ones of tokamak ITER these features are mandatory to support the long pulse operation. The Nominal Device Support (NDS) was designed and developed for the ITER CODAC Core System (CCS), which will be the responsible for plant Instrumentation and Control (I and C), supervising and monitoring on ITER. It generalizes the Enhanced Physics and Industrial Control System (EPICS) device support interface for Data Acquisition (DAQ) and timing devices. However the support for health management features and ATCA ShM are not yet provided. This paper presents the implementation and test of a NDS for the ATCA ShM, using the ITER Fast Plant System Controller (FPSC) prototype environment. This prototype is fully compatible with the ITER CCS and uses the EPICS Channel Access (CA) protocol as the interface with the Plant Operation Network (PON). The implemented solution running in an EPICS Input / Output Controller (IOC) provides Process Variables (PV) to the PON network with the system information. These PVs can be used for control and monitoring by all CA clients, such as EPICS user interface clients and alarm systems. The results are presented, demonstrating the fully integration and the usability of this solution. (authors)
EPICS device support module as ATCA system manager for the ITER fast plant system controller
Energy Technology Data Exchange (ETDEWEB)
Carvalho, Paulo F., E-mail: pricardofc@ipfn.ist.utl.pt [Associação EURATOM/IST, Instituto de Plasmas e Fusão Nuclear, Instituto Superior Técnico – Universidade Técnica de Lisboa, Lisboa (Portugal); Santos, Bruno; Gonçalves, Bruno; Carvalho, Bernardo B.; Sousa, Jorge; Rodrigues, A.P.; Batista, António J.N.; Correia, Miguel; Combo, Álvaro [Associação EURATOM/IST, Instituto de Plasmas e Fusão Nuclear, Instituto Superior Técnico – Universidade Técnica de Lisboa, Lisboa (Portugal); Correia, Carlos M.B.A. [Centro de Instrumentação, Departamento de Física, Universidade de Coimbra, Coimbra (Portugal); Varandas, Carlos A.F. [Associação EURATOM/IST, Instituto de Plasmas e Fusão Nuclear, Instituto Superior Técnico – Universidade Técnica de Lisboa, Lisboa (Portugal)
2013-10-15
Highlights: ► In Nuclear Fusion, demanding security and high-availability requirements call for redundancy to be available. ► ATCA based Nuclear Fusion Systems are composed by several electronic and mechanical component. ► Control and monitoring of ATCA electronic systems are recommended. ► ITER Fast Plant System Controller Project CODAC system prototype. ► EPICS device support module as External ATCA system manager solution. -- Abstract: This paper presents an Enhanced Physics and Industrial Control System (EPICS) device support module for the International Thermonuclear Experimental Reactor (ITER) Fast Plant System Controller (FPSC) project based in Advanced Telecommunications Computing Architecture (ATCA) specification. The developed EPICS device support module provides an External System Manager (ESM) solution for monitoring and control the ITER FPSC ATCA shelf system and data acquisition boards in order to take proper action and report problems to a control room operator or high level management unit in case of any system failure occurrence. EPICS device support module acts as a Channel Access (CA) server to report problems and publish ATCA system data information to the control room operator, high level management unit or other CA network clients such as Control System Studio Operator Interfaces (CSS OPIs), Best Ever Alarm System Toolkit (BEAST), Best Ever Archive Utility (BEAUTY) or other CA client applications. EPICS device support module communicates with the ATCA Shelf manager (ShM) using HTTP protocol to send and receive commands through POST method in order to get and set system and shelf components properties such as fan speeds measurements, temperatures readings, module status and ATCA boards acquisition and configuration parameters. All system properties, states, commands and parameters are available through the EPICS device support module CA server in EPICS Process Variables (PV) and signals format. ATCA ShM receives the HTTP protocol
ATCA Shelf Manager EPICS device support for ITER CODAC Core System
Energy Technology Data Exchange (ETDEWEB)
Santos, Bruno, E-mail: bsantos@ipfn.ist.utl.pt [Instituto de Plasmas e Fusão Nuclear, Instituto Superior Técnico, Universidade de Lisboa, 1049-001 Lisboa (Portugal); Carvalho, Paulo F.; Rodrigues, A.P.; Carvalho, Bernardo B.; Sousa, Jorge; Batista, António J.N.; Correia, Miguel; Combo, Álvaro M.; Cruz, Nuno [Instituto de Plasmas e Fusão Nuclear, Instituto Superior Técnico, Universidade de Lisboa, 1049-001 Lisboa (Portugal); Correia, Carlos M.B.A. [Centro de Instrumentação, Departamento de Física, Universidade de Coimbra, 3004-516 Coimbra (Portugal); Gonçalves, Bruno [Instituto de Plasmas e Fusão Nuclear, Instituto Superior Técnico, Universidade de Lisboa, 1049-001 Lisboa (Portugal)
2015-10-15
Highlights: • This architecture targets the health management integration into the NDS. • The developed solution supports the ShM redundancy features, specified by ATCA. • The average RTT was around 59 ms and in 99.9% of the cases was less than 130 ms. • Without losing any update cycle, can monitor a system shelf with approximately 400 sensors. • This solution enables the user to configure the entire system in DB files and st.cmd. - Abstract: The ITER CODAC Core System (CCS) is responsible for plant Instrumentation and Control (I&C) supervising and monitoring. This system uses the Enhanced Physics and Industrial Control System (EPICS) Channel Access (CA) protocol as the interface with the Plant Operation Network (PON). This paper presents a generic EPICS device support developed for the integration of the ATCA Shelf Manager (ShM) into the ITER CCS, providing scalability and easy configuration. The device support uses the available HTTP interface on Shelf Manager in the communication layer. Both HTTP server and sensors/actuators definitions can be configured using the EPICS database file and the Input/Output Controller (IOC) initialization file. A proposal based on this device is also presented, targeting the Nominal Device Support (NDS) for health management. The EPICS device support running in an IOC provides Process Variables (PV) to the PON network with the system information and these PVs can be used by all CA clients, such as EPICS user interface clients, alarm systems and archive systems. Operation with redundant ATCA ShMs and device support scalability tests were performed and the results are presented.
GUI Application for ATCA-based LLRF Carrier Board Management
Wychowaniak, Jan; Predki, Pawel; Napieralski, Andrzej
2011-01-01
The Advanced Telecommunications Computing Architecture (ATCA) standard describes an efficient and powerful platform, implementation of which was adopted to be used as a base for control systems in high energy physics. The ATCA platform is considered to be applied for the X-ray Free Electron Laser (X-FEL), being built at Deutsches Electronen- Synchrotron (DESY) in Hamburg, Germany. The Low Level Radio Frequency (LLRF) control system is composed of a few ATCA Carrier Boards. Carrier Board hosts Intelligent Platform Management Controller (IPMC), which is developed in compliance with the PICMG specifications. IPMC is responsible for management and monitoring of sub-modules installed on Carrier Boards and pluggable Advanced Mezzanine Card (AMC) modules. The ATCA Shelf Manager is the main control unit of a single ATCA crate, responsible for all power and fan modules and Carrier Boards installed in ATCA shelf. The device provides a system administrator with a set of control and diagnostic capabilities regarding the ...
Development of high-availability ATCA/PCIe data acquisition instrumentation
Energy Technology Data Exchange (ETDEWEB)
Correia, Miguel; Sousa, Jorge; Batista, Antonio J.N.; Combo, Alvaro; Santos, Bruno; Rodrigues, Antonio P.; Carvalho, Paulo F.; Goncalves, Bruno [Instituto de Plasmas e Fusao Nuclear, Instituto Superior Tecnico, Universidade de Lisboa, 1049- 001 Lisboa (Portugal); Correia, Carlos M.B.A. [Centro de Instrumentacao, Dept. de Fisica, Universidade de Coimbra, 3004-516 Coimbra (Portugal)
2015-07-01
Latest Fusion energy experiments envision a quasi-continuous operation regime. In consequence, the largest experimental devices, currently in development, specify high-availability (HA) requirements for the whole plant infrastructure. HA features enable the whole facility to perform seamlessly in the case of failure of any of its components, coping with the increasing duration of plasma discharges (steady-state) and assuring safety of equipment, people, environment and investment. IPFN developed a control and data acquisition system, aiming for fast control of advanced Fusion devices, which is thus required to provide such HA features. The system is based on in-house developed Advanced Telecommunication Computing Architecture (ATCA) instrumentation modules - IO blades and data switch blades, establishing a PCIe network on the ATCA shelf's back-plane. The data switch communicates to an external host computer through a PCIe data network. At the hardware management level, the system architecture takes advantage of ATCA native redundancy and hot swap specifications to implement fail-over substitution of IO or data switch blades. A redundant host scheme is also supported by the ATCA/PCIe platform. At the software level, PCIe provides implementation of hot plug services, which translate the hardware changes to the corresponding software/operating system devices. The paper presents how the ATCA and PCIe based system can be setup to perform with the desired degree of HA, thus being suitable for advanced Fusion control and data acquisition systems. (authors)
Development of high-availability ATCA/PCIe data acquisition instrumentation
International Nuclear Information System (INIS)
Correia, Miguel; Sousa, Jorge; Batista, Antonio J.N.; Combo, Alvaro; Santos, Bruno; Rodrigues, Antonio P.; Carvalho, Paulo F.; Goncalves, Bruno; Correia, Carlos M.B.A.
2015-01-01
Latest Fusion energy experiments envision a quasi-continuous operation regime. In consequence, the largest experimental devices, currently in development, specify high-availability (HA) requirements for the whole plant infrastructure. HA features enable the whole facility to perform seamlessly in the case of failure of any of its components, coping with the increasing duration of plasma discharges (steady-state) and assuring safety of equipment, people, environment and investment. IPFN developed a control and data acquisition system, aiming for fast control of advanced Fusion devices, which is thus required to provide such HA features. The system is based on in-house developed Advanced Telecommunication Computing Architecture (ATCA) instrumentation modules - IO blades and data switch blades, establishing a PCIe network on the ATCA shelf's back-plane. The data switch communicates to an external host computer through a PCIe data network. At the hardware management level, the system architecture takes advantage of ATCA native redundancy and hot swap specifications to implement fail-over substitution of IO or data switch blades. A redundant host scheme is also supported by the ATCA/PCIe platform. At the software level, PCIe provides implementation of hot plug services, which translate the hardware changes to the corresponding software/operating system devices. The paper presents how the ATCA and PCIe based system can be setup to perform with the desired degree of HA, thus being suitable for advanced Fusion control and data acquisition systems. (authors)
PCI express hotplug implementation for ATCA based instrumentation
Energy Technology Data Exchange (ETDEWEB)
Carvalho, Paulo F.; Santos, Bruno; Correia, Miguel; Combo, Álvaro M.; Rodrigues, António P. [Instituto Plasmas e Fusão Nuclear, Instituto Superior Técnico, Universidade Técnica de Lisboa, 1049-001 Lisboa (Portugal); Pereira, Rita C., E-mail: pricardofc@ipfn.ist.utl.pt [Instituto Plasmas e Fusão Nuclear, Instituto Superior Técnico, Universidade Técnica de Lisboa, 1049-001 Lisboa (Portugal); Fernandes, Ana; Cruz, Nuno; Sousa, Jorge; Carvalho, Bernardo B.; Batista, António J.N. [Instituto Plasmas e Fusão Nuclear, Instituto Superior Técnico, Universidade Técnica de Lisboa, 1049-001 Lisboa (Portugal); Correia, Carlos M.B.A. [Centro de Instrumentação, Departamento de Física, Universidade de Coimbra, 3004-516 Coimbra (Portugal); Gonçalves, Bruno [Instituto Plasmas e Fusão Nuclear, Instituto Superior Técnico, Universidade Técnica de Lisboa, 1049-001 Lisboa (Portugal)
2015-10-15
Highlights: • Hotplug capabilities are designed as an expected or graceful methodology in which the user is not permitted to install or remove a PCIe endpoint device without first notifying the system software. • Hotswap capabilities allow endpoints or PCIe switches with endpoints to be inserted or removed from a PCIe system gracefully or unexpectedly without special consideration. • ATCA, advanced telecommunication computer architecture is a new specification with high availability and high reliability key features which improves data acquisition systems. • Data acquisition systems are used almost everywhere and a demand in the nuclear fusion research field. • Nuclear fusion is a future alternative for power and energy resources generation for world humanity consumption. - Abstract: This paper describes a Peripheral Component Interconnect Express (PCIe) hotplug and hotswap capability implementation for advanced telecommunication computer architecture (ATCA) based instrumentation. PCIe hotplug provides card insertion and removal capability from a running PCIe-based platform without causing system damages and not requiring an entire system shutdown. PCIe hotswap allows endpoints or PCIe switches with endpoint cards to be inserted or removed from a PCIe system gracefully or unexpectedly without special considerations. Control and data acquisition (C&DAQ) cards need to be replaced from a system for fault-condition repair, hardware malfunction, firmware updates or upgrades and hardware reconfiguration. ATCA specification key features such as high reliability and high availability for C&DAQ systems strongly benefits from these capabilities taking advantage from Redhat Enterprise Linux, installed operating system, and corresponding kernel with built-in mechanisms and embedded software modules for hotplug and hotswap support. PCIe hotplug and hotswap implemented solutions in the ATCA-based prototype provides described capabilities to the C&DAQ and PCIe switch
International Nuclear Information System (INIS)
Jeznski, Tomasz
2012-01-01
ATCA/μTCA platforms are attractive because of the modern serial link architecture, high availability features and many packaging options. Less-demanding availability applications can be met economically by scaling back speed and redundancy. The ATCA specification was originally targeted for the Telecom industry but has gained recently a much wider user audience. The purpose of this paper is to report on present hardware and software R and D efforts where ATCA and μTCA are planned, already being used or in development using selected examples for accelerator and detectors in the Physics community. It will present also the status of a proposal for physics extensions to ATCA/μTCA specifications to promote inter-operability of laboratory and industry designs for physics.
Letendre, N; The ATLAS collaboration
2012-01-01
In the context of the LHC upgrade, we develop a new Read Out Driver (ROD) for the ATLAS Liquid Argon (LAr) community. ATCA and μTCA (Advanced/Micro Telecom Computing Architecture) is becoming a standard in high energy physics and a strong candidate to be used for boards and crates. We work to master ATCA and to integrate a large number of high speed links (96 links at 8.5 Gbps) on a ROD evaluation ATCA board. A versatile ATCA IPMI controller for ATCA boards which is FPGA Mezzanine Card (FMC) compliant has been developed to control the ROD evaluation board.
Data of evolutionary structure change: 1AKMC-9ATCA [Confc[Archive
Lifescience Database Archive (English)
Full Text Available 1AKMC-9ATCA 1AKM 9ATC C A -SGFYHKHFLKLLDFTPAELNSLLQLAAKLKADKKSGKEEAKLTGKNIALIFEKDSTRTRCSFEVAAYDQGARVTYLG--PSGSQIGHKESIK... 9ATC A 9ATCA... 9ATC A 9ATCA LAKFDG...del> 2 9ATC A 9ATCA...>A 9ATCA QETQG--RLDNL
Dumont Dayot, N
2012-01-01
In the context of the LHC upgrades, a new Read-Out Driver (ROD) board for the ATLAS LAr calorimeter is being developed. xTCA (Advanced/Micro Telecom Computing Architecture) is becoming a standard in high energy physics and is a serious candidate for future readout systems. We will present our current developments to master ATCA and to integrate a large number of very high speed links (96 links/8.5 Gbps) on a ROD Evaluator ATCA board. To manage our ROD Evaluator, we have developed a versatile ATCA IPMI controller for ATCA boards which is FPGA Mezzanine Card (FMC) compliant.
"LETENDRE, N; The ATLAS collaboration
2011-01-01
In the context of the LHC upgrades, a new Read-Out Driver (ROD) board for the ATLAS LAr calorimeter is being developed. xTCA (Advanced/Micro Telecom Computing Architecture) is becoming a standard in high energy physics and is a serious candidate for future readout systems. We will present our current developments to master ATCA and to integrate a large number of very high speed links (96 links/8.5 Gbps) on a ROD Evaluator ATCA board. To manage our ROD Evaluator, we have developed a versatile ATCA IPMI controller for ATCA boards which is FPGA Mezzanine Card (FMC) compliant.
Data of evolutionary structure change: 1AKMA-2ATCA [Confc[Archive
Lifescience Database Archive (English)
Full Text Available 1AKMA-2ATCA 1AKM 2ATC A A -SGFYHKHFLKLLDFTPAELNSLLQLAAKLKADKKSGKEEAKLTGKNIALIFEKDSTRTRCSFEVAAYDQGARVTYLGPSG--SQIGHKESIK.../line> HIS CA 158 2ATC A 2ATCA...>2ATC A 2ATCA A 2ATCA GDLKYGRTVHS ARG CA 481 2ATC A
"DUMONT DAYOT, N; The ATLAS collaboration; "CAP, S; "DUMONT DAYOT, N; "FOURNIER, L; "LETENDRE, N; "PERROT, G; "Wingerter, I
2011-01-01
In the context of the LHC upgrades, a new Read-Out Driver (ROD) board for the ATLAS LAr calorimeter is being developed. xTCA (Advanced/Micro Telecom Computing Architecture) is becoming a standard in high energy physics and is a serious candidate for future readout systems. We will present our current developments to master ATCA and to integrate a large number of very high speed links (96 links/8.5 Gbps) on a ROD Evaluator ATCA board. To manage our ROD Evaluator, we have developed a versatile ATCA IPMI controller for ATCA boards which is FPGA Mezzanine Card (FMC) compliant.
Data of evolutionary structure change: 1A1SA-2ATCA [Confc[Archive
Lifescience Database Archive (English)
Full Text Available 1A1SA-2ATCA 1A1S 2ATC A A VVSLAGRDLLCLQDYTAEEIWTILETAKMFKIWQKIGKP...entryChain> 2ATC A 2ATCA TEFSGNVP...entryChain> 2ATC A 2ATCA MVGDLKYG...ntryChain> 2ATC A 2ATCA ALAKFDGNR...VID> 3 2ATC A 2ATCA
ATCA/AXIe compatible board for fast control and data acquisition in nuclear fusion experiments
International Nuclear Information System (INIS)
Batista, A.J.N.; Leong, C.; Bexiga, V.; Rodrigues, A.P.; Combo, A.; Carvalho, B.B.; Fortunato, J.; Correia, M.; Teixeira, J.P.; Teixeira, I.C.; Sousa, J.; Gonçalves, B.; Varandas, C.A.F.
2012-01-01
Highlights: ► High performance board for fast control and data acquisition. ► Large IO channel number per board with galvanic isolation. ► Optimized for high reliability and availability. ► Targeted for nuclear fusion experiments with long duration discharges. ► To be used on the ITER Fast Plant System Controller prototype. - Abstract: An in-house development of an Advanced Telecommunications Computing Architecture (ATCA) board for fast control and data acquisition, with Input/Output (IO) processing capability, is presented. The architecture, compatible with the ATCA (PICMG 3.4) and ATCA eXtensions for Instrumentation (AXIe) specifications, comprises a passive Rear Transition Module (RTM) for IO connectivity to ease hot-swap maintenance and simultaneously to increase cabling life cycle. The board complies with ITER Fast Plant System Controller (FPSC) guidelines for rear IO connectivity and redundancy, in order to provide high levels of reliability and availability to the control and data acquisition systems of nuclear fusion devices with long duration plasma discharges. Simultaneously digitized data from all Analog to Digital Converters (ADC) of the board can be filtered/decimated in a Field Programmable Gate Array (FPGA), decreasing data throughput, increasing resolution, and sent through Peripheral Component Interconnect (PCI) Express to multi-core processors in the ATCA shelf hub slots. Concurrently the multi-core processors can update the board Digital to Analog Converters (DAC) in real-time. Full-duplex point-to-point communication links between all FPGAs, of peer boards inside the shelf, allow the implementation of distributed algorithms and Multi-Input Multi-Output (MIMO) systems. Support for several timing and synchronization solutions is also provided. Some key features are onboard ADC or DAC modules with galvanic isolation, Xilinx Virtex 6 FPGA, standard Dual Data Rate (DDR) 3 SODIMM memory, standard CompactFLASH memory card, Intelligent
Historical review of bryological research in Fruška Gora Mt. (Serbia
Directory of Open Access Journals (Sweden)
Ilić Miloš M.
2016-01-01
Full Text Available Fruška Gora is a mountain located in the southern part of Pannonian plane and it is poorly bryologicaly investigated as well as most parts of Serbia. First data on bryophytes, for this region, were published in 1949 by Teodor Soška in his paper Pregled mahovina i lišajeva u okolini Beograda (Review of mosses and lichens in the vicinity of Belgrade. Soška listed 34 species of mosses and 8 liverworts species for this region. Later, in 1955, Zlatko Pavletić in his capital work Prodromus flore briofita Jugoslavije (Prodromus of Yugoslavian bryophyte flora, stated 26 moss species and 3 liverwort species, without indicating specific localities, but all of them were Soška’s original results. In 1966, the second botanist with original findings of bryophytes on Fruška Gora was Popović, who recorded 2 liverwort and 19 moss species, for this mountain, also without specific localities. By far, the most comprehensive data were given by Cvetić and Sabovljević in 2004. Their study A contribution to the bryophyte flora of Fruška Gora (Vojvodina, Serbia counted total number of 118 mosses and 14 liverworts, on 16 localities within National park Fruška Gora. The latest study on bryophytes of Fruška Gora was in 2013, and it is the first and so far, the last study of bryophyte assemblages on grasslands. Authors of this paper recorded 18 species of mosses from 29 releveé. Complete bryophyte flora of Fruška Gora is still unknown. Considering the fact that this is the region with high biodiversity, dense hydrological network and a rather complex geology, Fruška Gora certainly deserves further bryological researches.
ATCA - thermal management study for the ATLAS phase II upgrades
Bortolin, Claudio; Dyngosz, Damian; Kalinowski, Michal; Koziol, Piotr; Mendez, Julian; Walerianczyk, Jan; Zwalinski, Lukasz
2017-01-01
The AdvancedTCA (ATCA) telecom industry standard has been selected as the hardware platform for the “Phase-II Upgrade” of ATLAS at the Large Hadron Collider (LHC) at CERN. In November 2014 a project dedicated to the study of the impact of the ATCA integration in the actual counting rooms was launched analysing the impact on the cooling infrastructures. A spare rack equipped with two ATCA shelves, high power dissipating load blades, temperature and air velocity sensors were installed in a lab....
Precision Time Protocol support hardware for ATCA control and data acquisition system
Energy Technology Data Exchange (ETDEWEB)
Correia, Miguel, E-mail: miguelfc@ipfn.ist.utl.pt [Instituto de Plasmas e Fusão Nuclear, Instituto Superior Técnico, Universidade de Lisboa, 1049-001 Lisboa (Portugal); Sousa, Jorge; Carvalho, Bernardo B.; Santos, Bruno; Carvalho, Paulo F.; Rodrigues, António P.; Combo, Álvaro M.; Pereira, Rita C. [Instituto de Plasmas e Fusão Nuclear, Instituto Superior Técnico, Universidade de Lisboa, 1049-001 Lisboa (Portugal); Correia, Carlos M.B.A. [Centro de Instrumentação, Departamento de Física, Universidade de Coimbra, 3004-516 Coimbra (Portugal); Gonçalves, Bruno [Instituto de Plasmas e Fusão Nuclear, Instituto Superior Técnico, Universidade de Lisboa, 1049-001 Lisboa (Portugal)
2015-10-15
Highlights: • ATCA based control and data acquisition subsystem has been developed at IPFN. • PTP and time stamping were implemented with VHDL and PTP daemon (PTPd) codes. • The RTM (…) provides PTP synchronization with an external GMC. • The main advantage is that timestamps are generated closer to the Physical Layer at the GMII. • IPFN's upgrade consistently exhibited jitter values below 25 ns RMS. - Abstract: An in-house, Advanced Telecom Computing Architecture (ATCA) based control and data acquisition (C&DAQ) subsystem has been developed at Instituto de Plasmas e Fusão Nuclear (IPFN), aiming for compliance with the ITER Fast Plant System Controller (FPSC). Timing and synchronization for the ATCA modules connects to ITER Control, Data Access and Communication (CODAC) through the Timing Communication Network (TCN), which uses IEEE 1588-2008 Precision Time Protocol (PTP) to synchronize devices to a Grand Master Clock (GMC). The TCN infrastructure was tested for an RMS jitter under the limit of 50 ns. Therefore, IPFN's hardware, namely the ATCA-PTSW-AMC4 hub-module, which is in charge of timing and synchronization distribution for all subsystem endpoints, shall also perform within this jitter limit. This paper describes a relevant upgrade, applied to the ATCA-PTSW-AMC4 hardware, to comply with these requirements – in particular, the integration of an add-on module “RMC-TMG-1588” on its Rear Transition Module (RTM). This add-on is based on a commercial FPGA-based module from Trenz Electronic, using the ZHAW “PTP VHDL code for timestamping unit and clock”, which features clock offset and drift correction and hardware-assisted time stamping. The main advantage is that timestamps are generated closer to the Physical Layer, at the Gigabit Ethernet Media Independent Interface (GMII), avoiding the timing uncertainties accumulated through the upper layers. PTP code and user software run in a MicroBlaze™ soft-core CPU with Linux in the
Precision Time Protocol support hardware for ATCA control and data acquisition system
International Nuclear Information System (INIS)
Correia, Miguel; Sousa, Jorge; Carvalho, Bernardo B.; Santos, Bruno; Carvalho, Paulo F.; Rodrigues, António P.; Combo, Álvaro M.; Pereira, Rita C.; Correia, Carlos M.B.A.; Gonçalves, Bruno
2015-01-01
Highlights: • ATCA based control and data acquisition subsystem has been developed at IPFN. • PTP and time stamping were implemented with VHDL and PTP daemon (PTPd) codes. • The RTM (…) provides PTP synchronization with an external GMC. • The main advantage is that timestamps are generated closer to the Physical Layer at the GMII. • IPFN's upgrade consistently exhibited jitter values below 25 ns RMS. - Abstract: An in-house, Advanced Telecom Computing Architecture (ATCA) based control and data acquisition (C&DAQ) subsystem has been developed at Instituto de Plasmas e Fusão Nuclear (IPFN), aiming for compliance with the ITER Fast Plant System Controller (FPSC). Timing and synchronization for the ATCA modules connects to ITER Control, Data Access and Communication (CODAC) through the Timing Communication Network (TCN), which uses IEEE 1588-2008 Precision Time Protocol (PTP) to synchronize devices to a Grand Master Clock (GMC). The TCN infrastructure was tested for an RMS jitter under the limit of 50 ns. Therefore, IPFN's hardware, namely the ATCA-PTSW-AMC4 hub-module, which is in charge of timing and synchronization distribution for all subsystem endpoints, shall also perform within this jitter limit. This paper describes a relevant upgrade, applied to the ATCA-PTSW-AMC4 hardware, to comply with these requirements – in particular, the integration of an add-on module “RMC-TMG-1588” on its Rear Transition Module (RTM). This add-on is based on a commercial FPGA-based module from Trenz Electronic, using the ZHAW “PTP VHDL code for timestamping unit and clock”, which features clock offset and drift correction and hardware-assisted time stamping. The main advantage is that timestamps are generated closer to the Physical Layer, at the Gigabit Ethernet Media Independent Interface (GMII), avoiding the timing uncertainties accumulated through the upper layers. PTP code and user software run in a MicroBlaze™ soft-core CPU with Linux in the same FPGA
Zeng, Lin; Chakraborty, Brinta; Farivar, Tanaz; Burne, Robert A
2017-11-01
The glucose/mannose-phosphotransferase system (PTS) permease EII Man encoded by manLMN in the dental caries pathogen Streptococcus mutans has a dominant influence on sugar-specific, CcpA-independent catabolite repression (CR). Mutations in manL affect energy metabolism and virulence-associated traits, including biofilm formation, acid tolerance, and competence. Using promoter::reporter fusions, expression of the manLMN and the fruRKI operons, encoding a transcriptional regulator, a fructose-1-phosphate kinase and a fructose-PTS permease EII Fru , respectively, was monitored in response to carbohydrate source and in mutants lacking CcpA, FruR, and components of EII Man Expression of genes for EII Man and EII Fru was directly regulated by CcpA and CR, as evinced by in vivo and in vitro methods. Unexpectedly, not only was the fruRKI operon negatively regulated by FruR, but also so was manLMN Carbohydrate transport by EII Man had a negative influence on expression of manLMN but not fruRKI In agreement with the proposed role of FruR in regulating these PTS operons, loss of fruR or fruK substantially altered growth on a number of carbohydrates, including fructose. RNA deep sequencing revealed profound changes in gene regulation caused by deletion of fruK or fruR Collectively, these findings demonstrate intimate interconnection of the regulation of two major PTS permeases in S. mutans and reveal novel and important contributions of fructose metabolism to global regulation of gene expression. IMPORTANCE The ability of Streptococcus mutans and other streptococcal pathogens to survive and cause human diseases is directly dependent upon their capacity to metabolize a variety of carbohydrates, including glucose and fructose. Our research reveals that metabolism of fructose has broad influences on the regulation of utilization of glucose and other sugars, and mutants with changes in certain genes involved in fructose metabolism display profoundly different abilities to grow and
ATCA - thermal management study for the ATLAS phase II upgrades
Bortolin, Claudio; Kalinowski, Michal; Koziol, Piotr; Mendez, Julian; Walerianczyk, Jan; Zwalinski, Lukasz
2017-01-01
The AdvancedTCA (ATCA) telecom industry standard has been selected as the hardware platform for the “Phase-II Upgrade” of ATLAS at the Large Hadron Collider (LHC) at CERN. In November 2014 a project dedicated to the study of the impact of the ATCA integration in the actual counting rooms was launched analysing the impact on the cooling infrastructures. A spare rack equipped with two ATCA shelves, high power dissipating load blades, temperature and air velocity sensors were installed in a lab. Vertical and horizontal cooling performance were checked and some crtitical aspects identified.
ATCA for Machines-- Advanced Telecommunications Computing Architecture
Energy Technology Data Exchange (ETDEWEB)
Larsen, R.S.; /SLAC
2008-04-22
The Advanced Telecommunications Computing Architecture is a new industry open standard for electronics instrument modules and shelves being evaluated for the International Linear Collider (ILC). It is the first industrial standard designed for High Availability (HA). ILC availability simulations have shown clearly that the capabilities of ATCA are needed in order to achieve acceptable integrated luminosity. The ATCA architecture looks attractive for beam instruments and detector applications as well. This paper provides an overview of ongoing R&D including application of HA principles to power electronics systems.
ATCA for Machines-- Advanced Telecommunications Computing Architecture
International Nuclear Information System (INIS)
Larsen, R
2008-01-01
The Advanced Telecommunications Computing Architecture is a new industry open standard for electronics instrument modules and shelves being evaluated for the International Linear Collider (ILC). It is the first industrial standard designed for High Availability (HA). ILC availability simulations have shown clearly that the capabilities of ATCA are needed in order to achieve acceptable integrated luminosity. The ATCA architecture looks attractive for beam instruments and detector applications as well. This paper provides an overview of ongoing R and D including application of HA principles to power electronics systems
Ueki, Toshiyuki; Inouye, Sumiko
2005-12-01
FruA is an essential transcription factor for Myxococcus xanthus development. The expression of tps and dofA genes is fruA dependent. In this study, we show by gel shift and footprint assays with the C-terminal DNA-binding domain of FruA and by a lacZ fusion assay that FruA may directly activate dofA expression during development.
Ueki, Toshiyuki; Inouye, Sumiko
2005-01-01
FruA is an essential transcription factor for Myxococcus xanthus development. The expression of tps and dofA genes is fruA dependent. In this study, we show by gel shift and footprint assays with the C-terminal DNA-binding domain of FruA and by a lacZ fusion assay that FruA may directly activate dofA expression during development.
ATCA-based ATLAS FTK input interface system
Energy Technology Data Exchange (ETDEWEB)
Okumura, Yasuyuki [Chicago U., EFI; Liu, Tiehui Ted [Fermilab; Olsen, Jamieson [Fermilab; Iizawa, Tomoya [Waseda U.; Mitani, Takashi [Waseda U.; Korikawa, Tomohiro [Waseda U.; Yorita, Kohei [Waseda U.; Annovi, Alberto [Frascati; Beretta, Matteo [Frascati; Gatta, Maurizio [Frascati; Sotiropoulou, C-L. [Aristotle U., Thessaloniki; Gkaitatzis, Stamatios [Aristotle U., Thessaloniki; Kordas, Konstantinos [Aristotle U., Thessaloniki; Kimura, Naoki [Aristotle U., Thessaloniki; Cremonesi, Matteo [Chicago U., EFI; Yin, Hang [Fermilab; Xu, Zijun [Peking U.
2015-04-27
The first stage of the ATLAS Fast TracKer (FTK) is an ATCA-based input interface system, where hits from the entire silicon tracker are clustered and organized into overlapping eta-phi trigger towers before being sent to the tracking engines. First, FTK Input Mezzanine cards receive hit data and perform clustering to reduce data volume. Then, the ATCA-based Data Formatter system will organize the trigger tower data, sharing data among boards over full mesh backplanes and optic fibers. The board and system level design concepts and implementation details, as well as the operation experiences from the FTK full-chain testing, will be presented.
ATCA-based ATLAS FTK input interface system
Okumura, Y; The ATLAS collaboration; Olsen, J; Iizawa, T; Mitani, T; Korikawa, T; Yorita, K; Annovi, A; Beretta, M; Gatta, M; Sotiropoulou, C; Gkaitatzis, S; Kordas, K; Kimura, N; Cremonesi, M; Yin, H; Xu, Z
2014-01-01
The first stage of the ATLAS Fast TracKer (FTK) is an ATCA-based input interface system, where hits from the entire silicon tracker must be clustered and organized into overlapping eta-phi trigger towers before being sent to the tracking processors. First, FTK Input Mezzanine cards receive hit data and perform clustering to reduce data volume. Then, the ATCA-based Data Formatter system will organize the trigger tower data, sharing data among boards over a full-mesh backplane. The board and system level performance studies and implementation details, as well as the operation experiences from the FTK full-chain testing, will be presented.
The ITER Fast Plant System Controller ATCA prototype Real-Time Software Architecture
International Nuclear Information System (INIS)
Carvalho, B.B.; Santos, B.; Carvalho, P.F.; Neto, A.; Boncagni, L.; Batista, A.J.N.; Correia, M.; Sousa, J.; Gonçalves, B.
2013-01-01
Highlights: ► High performance ATCA systems for fast control and data acquisition. ► IEEE1588 timing system and synchronization. ► Plasma control algorithms. ► Real-time control software frameworks. ► Targeted for nuclear fusion experiments with long duration discharges. -- Abstract: IPFN is developing a prototype Fast Plant System Controller (FPSC) based in ATCA embedded technologies dedicated to ITER CODAC data acquisition and control tasks in the sub-millisecond range. The main goal is to demonstrate the usability of the ATCA standard and its enhanced specifications for the high speed, very high density parallel data acquisition needs of the most demanding ITER tokamak plasma Instrumentation and Control (I and C) systems. This effort included the in-house development of a new family of high performance ATCA I/O and timing boards. The standard ITER software system CODAC Core System (CCS) v3.1, with the control based in the EPICS system does not cover yet the real-time requirements fulfilled by this hardware, so a new set of software components was developed for this specific platform, attempting to integrate and leverage the new features in CSS, for example the Multithreaded Application Real Time executor (MARTe) software framework, the new Data Archiving Network (DAN) solution, an ATCA IEEE-1588-2008 timing interface, and the Intelligent Platform Management Interface (IPMI) for system monitoring and remote management. This paper presents the overall software architecture for the ATCA FPSC, as well a discussion on the ITER constrains and design choices and finally a detailed description of the software components already developed
The ITER Fast Plant System Controller ATCA prototype Real-Time Software Architecture
Energy Technology Data Exchange (ETDEWEB)
Carvalho, B.B., E-mail: bernardo@ipfn.ist.utl.pt [Associacao EURATOM/IST Instituto de Plasmas e Fusao Nuclear, Instituto Superior Tecnico, Universidade Tecnica de Lisboa, P-1049-001 Lisboa (Portugal); Santos, B.; Carvalho, P.F.; Neto, A. [Associacao EURATOM/IST Instituto de Plasmas e Fusao Nuclear, Instituto Superior Tecnico, Universidade Tecnica de Lisboa, P-1049-001 Lisboa (Portugal); Boncagni, L. [Associazione Euratom-ENEA sulla Fusione, Frascati Research Centre, Division of Fusion Physics, Frascati, Rome (Italy); Batista, A.J.N.; Correia, M.; Sousa, J.; Gonçalves, B. [Associacao EURATOM/IST Instituto de Plasmas e Fusao Nuclear, Instituto Superior Tecnico, Universidade Tecnica de Lisboa, P-1049-001 Lisboa (Portugal)
2013-10-15
Highlights: ► High performance ATCA systems for fast control and data acquisition. ► IEEE1588 timing system and synchronization. ► Plasma control algorithms. ► Real-time control software frameworks. ► Targeted for nuclear fusion experiments with long duration discharges. -- Abstract: IPFN is developing a prototype Fast Plant System Controller (FPSC) based in ATCA embedded technologies dedicated to ITER CODAC data acquisition and control tasks in the sub-millisecond range. The main goal is to demonstrate the usability of the ATCA standard and its enhanced specifications for the high speed, very high density parallel data acquisition needs of the most demanding ITER tokamak plasma Instrumentation and Control (I and C) systems. This effort included the in-house development of a new family of high performance ATCA I/O and timing boards. The standard ITER software system CODAC Core System (CCS) v3.1, with the control based in the EPICS system does not cover yet the real-time requirements fulfilled by this hardware, so a new set of software components was developed for this specific platform, attempting to integrate and leverage the new features in CSS, for example the Multithreaded Application Real Time executor (MARTe) software framework, the new Data Archiving Network (DAN) solution, an ATCA IEEE-1588-2008 timing interface, and the Intelligent Platform Management Interface (IPMI) for system monitoring and remote management. This paper presents the overall software architecture for the ATCA FPSC, as well a discussion on the ITER constrains and design choices and finally a detailed description of the software components already developed.
Valdes, Kayla M.; Sundar, Ganesh S.; Vega, Luis A.; Belew, Ashton T.; Islam, Emrul; Binet, Rachel; El-Sayed, Najib M.
2016-01-01
Bacterial pathogens rely on the availability of nutrients for survival in the host environment. The phosphoenolpyruvate-phosphotransferase system (PTS) is a global regulatory network connecting sugar uptake with signal transduction. Since the fructose PTS has been shown to impact virulence in several streptococci, including the human pathogen Streptococcus pyogenes (the group A Streptococcus [GAS]), we characterized its role in carbon metabolism and pathogenesis in the M1T1 strain 5448. Growth in fructose as a sole carbon source resulted in 103 genes affected transcriptionally, where the fru locus (fruRBA) was the most induced. Reverse transcriptase PCR showed that fruRBA formed an operon which was repressed by FruR in the absence of fructose, in addition to being under carbon catabolic repression. Growth assays and carbon utilization profiles revealed that although the entire fru operon was required for growth in fructose, FruA was the main transporter for fructose and also was involved in the utilization of three additional PTS sugars: cellobiose, mannitol, and N-acetyl-d-galactosamine. The inactivation of sloR, a fruA homolog that also was upregulated in the presence of fructose, failed to reveal a role as a secondary fructose transporter. Whereas the ability of both ΔfruR and ΔfruB mutants to survive in the presence of whole human blood or neutrophils was impaired, the phenotype was not reproduced in murine whole blood, and those mutants were not attenuated in a mouse intraperitoneal infection. Since the ΔfruA mutant exhibited no phenotype in the human or mouse assays, we propose that FruR and FruB are important for GAS survival in a human-specific environment. PMID:26787724
N + 1 redundancy on ATCA instrumentation for Nuclear Fusion
Energy Technology Data Exchange (ETDEWEB)
Correia, Miguel, E-mail: miguelfc@ipfn.ist.utl.pt [Associação EURATOM/IST, Instituto de Plasmas e Fusão Nuclear, Instituto Superior Técnico – Universidade Técnica de Lisboa, Lisboa (Portugal); Sousa, Jorge; Rodrigues, António P.; Batista, António J.N.; Combo, Álvaro; Carvalho, Bernardo B.; Santos, Bruno; Carvalho, Paulo F.; Gonçalves, Bruno [Associação EURATOM/IST, Instituto de Plasmas e Fusão Nuclear, Instituto Superior Técnico – Universidade Técnica de Lisboa, Lisboa (Portugal); Correia, Carlos M.B.A. [Centro de Instrumentação, Departamento de Física, Universidade de Coimbra, Coimbra (Portugal); Varandas, Carlos A.F. [Associação EURATOM/IST, Instituto de Plasmas e Fusão Nuclear, Instituto Superior Técnico – Universidade Técnica de Lisboa, Lisboa (Portugal)
2013-10-15
Highlights: ► In Nuclear Fusion, demanding security and high-availability requirements call for redundancy to be available. ► ATCA standard features desirable redundancy features for Fusion instrumentation. ► The developed control and data acquisition hardware modules support additional redundancy schemes. ► Implementation of N + 1 redundancy of host processor and I/O data modules. -- Abstract: The role of redundancy on control and data acquisition systems has gained a significant importance in the case of Nuclear Fusion, as demanding security and high-availability requirements call for redundancy to be available. IPFN's control and data acquisition system hardware is based on an Advanced Telecommunications Computing Architecture (ATCA) set of I/O (DAC/ADC endpoints) and data/timing switch modules, which handle data and timing from all I/O endpoints. Modules communicate through Peripheral Component Interconnect Express (PCIe), established over the ATCA backplane and controlled by one or more external hosts. The developed hardware modules were designed to take advantage of ATCA specification's redundancy features, namely at the hardware management level, including support of: (i) multiple host operation with N + 1 redundancy – in which a designated failover host takes over data previously assigned to a suddenly malfunctioning host and (ii) N + 1 redundancy of I/O and data/timing switch modules. This paper briefly describes IPFN's control and data acquisition system, which is being developed for ITER fast plant system controller (FPSC), and analyses the hardware implementation of its supported redundancy features.
Horiuchi, Takayuki; Taoka, Masato; Isobe, Toshiaki; Komano, Teruya; Inouye, Sumiko
2002-07-26
Two genes, fruA and csgA, encoding a putative transcription factor and C-factor, respectively, are essential for fruiting body formation of Myxococcus xanthus. To investigate the role of fruA and csgA genes in developmental gene expression, developing cells as well as vegetative cells of M. xanthus wild-type, fruA::Tc, and csgA731 strains were pulse-labeled with [(35)S]methionine, and the whole cell proteins were analyzed using two-dimensional immobilized pH gradient/SDS-PAGE. Differences in protein synthesis patterns among more than 700 protein spots were detected during development of the three strains. Fourteen proteins showing distinctly different expression patterns in mutant cells were analyzed in more detail. Five of the 14 proteins were identified as elongation factor Tu (EF-Tu), Dru, DofA, FruA, and protein S by immunoblot analysis and mass spectroscopy. A gene encoding DofA was cloned and sequenced. Although both fruA and csgA genes regulate early development of M. xanthus, they were found to differently regulate expression of several developmental genes. The production of six proteins, including DofA and protein S, was dependent on fruA, whereas the production of two proteins was dependent on csgA, and one protein was dependent on both fruA and csgA. To explain the present findings, a new model was presented in which different levels of FruA phosphorylation may distinctively regulate the expression of two groups of developmental genes.
Implementation of IEEE-1588 timing and synchronization for ATCA control and data acquisition systems
International Nuclear Information System (INIS)
Correia, Miguel; Sousa, Jorge; Combo, Álvaro; Rodrigues, António P.; Carvalho, Bernardo B.; Batista, António J.N.; Gonçalves, Bruno; Correia, Carlos M.B.A.; Varandas, Carlos A.F.
2012-01-01
Highlights: ► IEEE-1588 over Ethernet protocol is implemented for the synchronization of all clock signals of an ATCA AMC carrier module. ► The ATCA hardware consists of an AMC quad-carrier main-board with PCI Express switching. ► IEEE-1588 is to be implemented on a Virtex-6 FPGA. ► Timing signals on the ATX-AMC4-PTP are managed and routed by a crosspoint-switch implemented on a Virtex-6 FPGA. ► Each clock signal source may be independently located (on each of the AMC cards, RTM or ATCA backplane). - Abstract: Control and data acquisition (C and DA) systems for Fusion experiments are required to provide accurate timing and synchronization (T and S) signals to all of its components. IPFN adopted PICMG's Advanced Telecommunications Computing Architecture (ATCA) industry standard to develop C and DA instrumentation. ATCA was chosen not only for its high throughput characteristics but also for its high availability (HA) features which become of greater importance in steady-state operation scenarios. However, the specified ATCA clock and synchronization interface may be too limited for the timing and synchronization needs in advanced Physics experiments. Upcoming specification extensions, developed by the “xTCA for Physics” workgroups, will contemplate, among others, a complementary timing specification, developed by the PICMG xTCA for Physics IO, Timing and Synchronization Technical Committee. The IEEE-1588 Precision Time Protocol (PTP) over Ethernet is one of the protocols, proposed by the Committee, aiming for precise synchronization of clocks in measurement and control systems, based on low jitter and slave-to-slave skew criteria. The paper presents an implementation of IEEE-1588 over Ethernet, in an ATCA hardware platform. The ATCA hardware consists of an Advanced Mezzanine Card (AMC) quad-carrier front board with PCI Express switching. IEEE-1588 is to be implemented on a Virtex-6 FPGA. Ethernet connectivity with the remote master clock is located on
Development of Fruška Gora and some open questions of sustainability
Directory of Open Access Journals (Sweden)
Bajić-Brković Milica
2010-01-01
Full Text Available Future development of Fruška Gora triggers numerous questions from the domain of sustainability. The solutions defined in the spatial plan-PPPPN Fruška Gora 2022, can be carried out only on condition that the current course of spatial planning and space related decision making change, so that the respective procedures become more sensitive to the specific requirements of sustainability. Sustainability by itself affects the way planning is being performed, while the specifics of a concrete case, like the case explored in this paper, set up a particular input relevant for both the conceptual and methodological aspects of planning. The proposals of implementing the specific sustainability-based techniques along with the practical implications of their use throughout the planning process are examined in this paper. Normally, most of them are not part of a standard planning procedure, however, they become highly relevant in cases like Fruška Gora, or similar. A sequence of innovations and possible modifications of/within the existing paradigm proposed here include: the prevention techniques, carrying capacity assessment as it relates to the eco-balance, risk assessment, impact analysis, eco-sensitive zoning, GIS based monitoring, etc. Special attention is given to the issues of physical and environmental quality, as they relate to sustainability.
Directory of Open Access Journals (Sweden)
Hui Zhou
Full Text Available Aged garlic extract (AGE is widely used as a dietary supplement, and is claimed to promote human health through anti-oxidant/anti-inflammatory activities with hypolipidemic, antiplatelet and neuroprotective effects. Prior studies of AGE have mainly focused on its organosulfur compounds, with little attention paid to its carbohydrate derivatives, such as N-α-(1-deoxy-D-fructos-1-yl-L-arginine (FruArg. The goal of this study is to investigate actions of AGE and FruArg on antioxidative and neuroinflammatory responses in lipopolysaccharide (LPS-activated murine BV-2 microglial cells using a proteomic approach. Our data show that both AGE and FruArg can significantly inhibit LPS-induced nitric oxide (NO production in BV-2 cells. Quantitative proteomic analysis by combining two dimensional differential in-gel electrophoresis (2D-DIGE with mass spectrometry revealed that expressions of 26 proteins were significantly altered upon LPS exposure, while levels of 20 and 21 proteins exhibited significant changes in response to AGE and FruArg treatments, respectively, in LPS-stimulated BV-2 cells. Notably, approximate 78% of the proteins responding to AGE and FruArg treatments are in common, suggesting that FruArg is a major active component of AGE. MULTICOM-PDCN and Ingenuity Pathway Analyses indicate that the proteins differentially affected by treatment with AGE and FruArg are involved in inflammatory responses and the Nrf2-mediated oxidative stress response. Collectively, these results suggest that AGE and FruArg attenuate neuroinflammatory responses and promote resilience in LPS-activated BV-2 cells by suppressing NO production and by regulating expression of multiple protein targets associated with oxidative stress.
Next generation ATCA control infrastructure for the CMS Phase-2 upgrades
Smith, Wesley; Svetek, Aleš; Tikalsky, Jes; Fobes, Robert; Dasu, Sridhara; Smith, Wesley; Vicente, Marcelo
2017-01-01
A next generation control infrastructure to be used in Advanced TCA (ATCA) blades at CMS experiment is being designed and tested. Several ATCA systems are being prepared for the High-Luminosity LHC (HL-LHC) and will be installed at CMS during technical stops. The next generation control infrastructure will provide all the necessary hardware, firmware and software required in these systems, decreasing development time and increasing flexibility. The complete infrastructure includes an Intelligent Platform Management Controller (IPMC), a Module Management Controller (MMC) and an Embedded Linux Mezzanine (ELM) processing card.
International Nuclear Information System (INIS)
Batista, A.J.N.; Leong, C.; Bexiga, V.; Rodrigues, A.P.; Combo, A.; Carvalho, B.B.; Carvalho, P.F.; Fortunato, J.; Santos, B.; Carvalho, P.; Correia, M.; Teixeira, J.P.; Teixeira, I.C.; Sousa, J.; Gonçalves, B.; Varandas, C.A.F.
2013-01-01
This paper describes the implementation and test of a control and data acquisition board designed to be integrated on systems demanding high availability and reliability, foreseen for future experiments like ITER or other long operation fusion devices. The Advanced Telecommunications Computing Architecture (ATCA) standard (PICMG 3.0 and 3.4) was selected for board implementation, which has support for the desired system robustness and performance. Some board features such as rear Input/Output (IO) signals connectivity (passive, copper tracks only), cable-less hot-swap maintenance, Intelligent Platform Management Controller (IPMC) and redundancy on timing signals, communications links and power supplies are significant board improvements, relatively to previous control and data acquisition boards, allowing the development of more reliable system architectures. Moreover, the developed board is also compatible with the emerging ATCA eXtensions for Instrumentation (AXIe) specifications, which provides additional timing and synchronization signals on the backplane. ATCA full-mesh, multi-gigabit, full-duplex, point-to-point communication links between Field Programmable Gate Arrays (FPGA), of peer boards inside the shelf, allow the implementation of distributed algorithms and development of Multi-Input Multi-Output (MIMO) systems. Up to 48 analog input channels, simultaneously digitized (2 MSPS @ 18-bits), are filtered/decimated by the board FPGA and sent to the ATCA/AXIe host through Peripheral Component Interconnect express (PCIe) using Direct Memory Access (DMA). In real-time, the host can update up to 48 analog output channels (1 MSPS @ 18-bits), per board, through PCIe. Further board characteristics comprise analog IO channels with galvanic isolation and an optional signal chopper mode, for offset compensation over time on digital integration of magnetic signals. Board time synchronization is attained by means of the Inter-Range Instrumentation Group (IRIG) time-code
ATCA digital controller hardware for vertical stabilization of plasmas in tokamaks
International Nuclear Information System (INIS)
Batista, A. J. N.; Sousa, J.; Varandas, C. A. F.
2006-01-01
The efficient vertical stabilization (VS) of plasmas in tokamaks requires a fast reaction of the VS controller, for example, after detection of edge localized modes (ELM). For controlling the effects of very large ELMs a new digital control hardware, based on the Advanced Telecommunications Computing Architecture trade mark sign (ATCA), is being developed aiming to reduce the VS digital control loop cycle (down to an optimal value of 10 μs) and improve the algorithm performance. The system has 1 ATCA trade mark sign processor module and up to 12 ATCA trade mark sign control modules, each one with 32 analog input channels (12 bit resolution), 4 analog output channels (12 bit resolution), and 8 digital input/output channels. The Aurora trade mark sign and PCI Express trade mark sign communication protocols will be used for data transport, between modules, with expected latencies below 2 μs. Control algorithms are implemented on a ix86 based processor with 6 Gflops and on field programmable gate arrays with 80 GMACS, interconnected by serial gigabit links in a full mesh topology
Reconfigurable ATCA hardware for plasma control and data acquisition
Energy Technology Data Exchange (ETDEWEB)
Carvalho, B.B., E-mail: bernardo@ipfn.ist.utl.p [Associacao EURATOM/IST Instituto de Plasmas e Fusao Nuclear, Instituto Superior Tecnico, Av. Rovisco Pais, 1049-001 Lisboa (Portugal); Batista, A.J.N.; Correia, M.; Neto, A.; Fernandes, H.; Goncalves, B.; Sousa, J. [Associacao EURATOM/IST Instituto de Plasmas e Fusao Nuclear, Instituto Superior Tecnico, Av. Rovisco Pais, 1049-001 Lisboa (Portugal)
2010-07-15
The IST/EURATOM Association is developing a new generation of control and data acquisition hardware for fusion experiments based on the ATCA architecture. This emerging open standard offers a significantly higher data throughput over a reliable High Availability (HA) mechanical and electrical platform. One of this ATCA boards has 32 galvanically isolated ADC channels (18 bit) each mounted on a swappable plug-in card, 8 DAC channels (16 bit), 8 digital I/O channels and embeds a high performance XILINX Virtex 4 family field programmable gate array (FPGA). The specific modular and configurable hardware design enables adaptable utilization of the board in dissimilar applications. The first configuration, specially developed for tokamak plasma Vertical Stabilization, consists of a Multiple-Input-Multiple-Output (MIMO) controller that is capable of feedback loops faster than 1 ms using a multitude of input signals fed from different boards communicating through the Aurora{sup TM} point-to-point protocol. Massive parallel algorithms can be implemented on the FPGA either with programmed digital logic, using a HDL hardware description language, or within its internal silicon PowerPC{sup TM} running a full fledged real-time operating system. The second board configuration is dedicated for transient recording of the entire 32 channels at 2 MSamples/s to the on-board 512 MB DDR2 memory. Signal data retrieval is accelerated by a DMA-driven PCI Express{sup TM} x1 Interface to the ATCA system controller, providing an overall throughput in excess of 100 MB/s. This paper illustrates these developments and discusses possible configurations for foreseen applications.
Interfaces and Communication Protocols in ATCA-Based LLRF Control Systems
Makowski, Dariusz; Koprek, Waldemar; Jezynski, Tomasz; Piotrowski, Adam; Jablonski, Grzegorz; Jalmuzna, Wojciech; Simrock, Stefan
2009-10-01
Linear accelerators driving Free Electron Lasers (FELs), such as the Free Electron Laser in Hamburg (FLASH) or the X-ray Free Electron Laser (XFEL), require sophisticated Low Level Radio Frequency (LLRF) control systems. The controller of the LLRF system should stabilize the phase and amplitude of the field in accelerating modules below 0.02% of the amplitude and 0.01 degree for phase tolerances to produce an ultra stable electron beam that meets the required conditions for Self-Amplified Spontaneous Emission (SASE). Since the LLRF system for the XFEL must be in operation for the next 20 years, it should be reliable, reproducible and upgradeable. Having in mind all requirements of the LLRF control system, the Advanced Telecommunications Computing Architecture (ATCA) has been chosen to build a prototype of the LLRF system for the FLASH accelerator that is able to supervise 32 cavities of one RF station. The LLRF controller takes advantage of features offered by the ATCA standard. The LLRF system consists of a few ATCA carrier blades, Rear Transition Modules (RTM) and several Advanced Mezzanine Cards (AMCs) that provide all necessary digital and analog hardware components. The distributed hardware of the LLRF system requires a number of communication links that should provide different latencies, bandwidths and protocols. The paper presents the general view of the ATC A-based LLRF system, discusses requirements and proposes an application for various interfaces and protocols in the distributed LLRF control system.
DEMONSTRATION OF AN ATCA BASED RF CONTROL SYSTEM AT FLASH
Simrock, S N; Jezynski, T; Koprek, W; Butkowski, L; Jablonski, G W; Jalmuzna, W; Makowski, D R; Piotrowski, A; Czuba, K
2009-01-01
Future rf control systems will require simultaneous data acquisition of up to 100 fast ADC channels at sampling rates of around 100 MHz and real time signal processing within a few hundred nanoseconds. At the same time the standardization of Low-Level RF systems are common objectives for all laboratories for cost reduction, performance optimization and machine reliability. Also desirable are modularity and scalability of the design as well as compatibility with accelerator instrumentation needs including the control system. All these requirements can be fulfilled with the new telecommunication standard ATCA when adopted to the domain of instrumentation. We describe the architecture and design of an ATCA based LLRF system for the European XFEL. The operation of a prototype capable of controlling the vectorsum of 24-cavities and providing measurements of forward and reflected power are presented.
Er fru Ruben jødisk eller ikke? En drøfting av hennes karakter i Hamsuns Siste Kapitel
Directory of Open Access Journals (Sweden)
Heini Mähönen
2005-07-01
utseende og andre klisjeer om jøder og han knytter disse opp til karakteren fru Ruben. Han konkluder med at hun må være jødisk, til tross for en slående mangel på konkret tekstlig belegg omkring karakterens religiøse og kulturelle tilknytning. På bakgrunn av Simpsons sterke påstand kombinert med mangelfull tekstlig illustrasjon, ønsker vi å drøfte fru Rubens jødiske opphav.
Re-configurable ATCA Hardware for Plasma Control and Data Acquisition
Energy Technology Data Exchange (ETDEWEB)
Carvalho, B.; Batista, A.; Correia, M.; Fernandes, H.; Sousa, J. [Instituto de Plasmas e Fusao Nuclear - Instituto Superior Tecnico, Lisbon (Portugal)
2009-07-01
The IST/EURATOM Association is developing a new generation of control and data acquisition hardware for fusion experiments based on the ATCA architecture. This emerging open standard offers a significantly higher data throughput over a reliable High Availability (HA) mechanical and electrical platform. One of this ATCA boards, has 32 galvanic isolated ADC channels (18 bit) each mounted on a exchangeable plug-in card, 8 DAC channels (16 bit), 8 digital I/O channels and embeds a high performance XILINX Virtex 4 family field programmable gate array (FPGA). The specific modular hardware design enables adaptable utilization of the board in dissimilar applications. The first configuration, specially developed for tokamak plasma Vertical Stabilization, consists of a Multiple-Input-Multiple-Output (MIMO) controller that is capable of feedback loops faster than 1 ms, using a multitude of input signals fed from different boards communicating through the Aurora point-to-point protocol. Massive parallel algorithms can be implemented inside the FPGA either with programmed digital logic, using a HDL hardware description language, or inside the two included silicon PowerPCs running a full fledged real-time operating system. The second board configuration is dedicated for transient recording of the entire 32 channels at 2 MSamples/s to the built-in 512 MBDDR2 memory. Signal data retrieval is accelerated by a DMA-driven PCI Express-x1 Interface to the ATCA system controller providing an overall throughput in excess of 250 MB/s. This paper illustrates these developments and discusses possible configurations for foreseen applications. (authors)
Directory of Open Access Journals (Sweden)
Aleksandra Vujko
2011-01-01
Full Text Available Fruška gora lakes Sot, Bruje and Moharač are the lakes that can be used in many ways for sports and recreation tourism. Nevertheless, the current tourism offer in these lakes is based only on offer for sports fishing. Bearing in mind that Fruška gora National Park, where there are three zones of protection, is of great importance the fact that the second and third zones are, with regard to territorial perspective, areas where it is desirable to develop sports and recreational tourism. Cycling is becoming an increasingly popular form of sports and recreational tourism, so tourism networking of Fruška gora lakes with system of cycle paths would represent only the first step to turn the whole mountain into the European cycle mainstream. In this sense, the aim of this paper is set to map the FJSA cycling paths connected to the system. The field research resulted in the mapping of the terrain. The interviews with experts from the Provincial Secretariat of Environmental Protection, the National Park and the Cycling Association of Vojvodina helped in the SWOT analysis of cycle tourism on Fruška gora lakes.
Directory of Open Access Journals (Sweden)
Škrbić Iva
2012-01-01
Full Text Available If the revival of Fruška gora villages is to be achieved and their extinction prevented, economic activity must be revived, thus enabling the existential conditions for country life. One of the alternatives is to revive the tourist village through the creation of high-quality tourism products and/or services that could be realized on the market. Merging of Fruška gora villages and monasteries may be provided with the necessary resources. However, before planning the tourist products and services, it is necessary to examine the target market demand and determine if there is potential for travel demand. If so, it would generate realistic demand after a market activation of tourism products and services. Therefore, the subject of this paper is rating of attitudes and opinions of the residents of the city of Novi Sad of the particular forms of tourism products / services that might be a part of the offer of the Fruška gora monasteries and villages in order to prove or disprove the validity of the programming of tourist products and services in Fruška gora villages and monasteries, as well as their placement on the tourist market. The study included 75 adult respondents who live in the city of Novi Sad. Survey was used, and data were analyzed by statistical analysis. The results showed that the residents of Novi Sad recognize monasteries and villages of Fruška gora as a valuable resource. There is a high level of interest in this type of tourist products and services that can result in a satisfactory real travel demand.
A New ATLAS Muon CSC Readout System with System on Chip Technology on ATCA Platform
AUTHOR|(SzGeCERN)664042
2016-01-01
The ATLAS muon Cathode Strip Chamber (CSC) back-end readout system has been upgraded during the LHC 2013-2015 shutdown to be able to handle the higher Level-1 trigger rate of 100 kHz and the higher occupancy at Run 2 luminosity. The readout design is based on the Reconfiguration Cluster Element (RCE) concept for high bandwidth generic DAQ implemented on the ATCA platform. The RCE design is based on the new System on Chip Xilinx Zynq series with a processor-centric architecture with ARM processor embedded in FPGA fabric and high speed I/O resources together with auxiliary memories to form a versatile DAQ building block that can host applications tapping into both software and firmware resources. The Cluster on Board (COB) ATCA carrier hosts RCE mezzanines and an embedded Fulcrum network switch to form an online DAQ processing cluster. More compact firmware solutions on the Zynq for G-link, S-link and TTC allowed the full system of 320 G-links from the 32 chambers to be processed by 6 COBs in one ATCA shelf thr...
A New ATLAS Muon CSC Readout System with System on Chip Technology on ATCA Platform
Claus, Richard; The ATLAS collaboration
2015-01-01
The ATLAS muon Cathode Strip Chamber (CSC) backend readout system has been upgraded during the LHC 2013-2015 shutdown to be able to handle the higher Level-1 trigger rate of 100 kHz and the higher occupancy at Run 2 luminosity. The readout design is based on the Reconfiguration Cluster Element (RCE) concept for high bandwidth generic DAQ implemented on the ATCA platform. The RCE design is based on the new System on Chip XILINX ZYNQ series with a processor-centric architecture with ARM processor embedded in FPGA fabric and high speed I/O resources together with auxiliary memories to form a versatile DAQ building block that can host applications tapping into both software and firmware resources. The Cluster on Board (COB) ATCA carrier hosts RCE mezzanines and an embedded Fulcrum network switch to form an online DAQ processing cluster. More compact firmware solutions on the ZYNQ for G-link, S-link and TTC allowed the full system of 320 G-links from the 32 chambers to be processed by 6 COBs in one ATCA shelf thro...
An Integration Framework Tool for ATCA Chassis in the ATLAS Detector Control System
International Nuclear Information System (INIS)
Reed, Robert Graham
2015-01-01
The Large Hadron Collider at CERN is scheduled to undergo a major upgrade in 2022. The ATLAS collaboration will do major modifications to the detector to account for the increased luminosity. More specifically, a large proportion of the current front-end electronics, on the Tile Calorimeter sub-detector, will be upgraded and relocated to the backend. A Demonstrator program has been established as a proof of principle. A new system will be required to house, manage and connect this new hardware. The proposed solution will be an Advanced Telecommunication Computing Architecture (ATCA) which will not only house but also allow advanced management features and control at a hardware level by integrating the ATCA chassis into the Detector Control System. (paper)
Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya
2002-12-01
The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.
A new ATLAS muon CSC readout system with system on chip technology on ATCA platform
Claus, R.; ATLAS Collaboration
2016-07-01
The ATLAS muon Cathode Strip Chamber (CSC) back-end readout system has been upgraded during the LHC 2013-2015 shutdown to be able to handle the higher Level-1 trigger rate of 100 kHz and the higher occupancy at Run 2 luminosity. The readout design is based on the Reconfiguration Cluster Element (RCE) concept for high bandwidth generic DAQ implemented on the ATCA platform. The RCE design is based on the new System on Chip Xilinx Zynq series with a processor-centric architecture with ARM processor embedded in FPGA fabric and high speed I/O resources together with auxiliary memories to form a versatile DAQ building block that can host applications tapping into both software and firmware resources. The Cluster on Board (COB) ATCA carrier hosts RCE mezzanines and an embedded Fulcrum network switch to form an online DAQ processing cluster. More compact firmware solutions on the Zynq for G-link, S-link and TTC allowed the full system of 320 G-links from the 32 chambers to be processed by 6 COBs in one ATCA shelf through software waveform feature extraction to output 32 S-links. The full system was installed in Sept. 2014. We will present the RCE/COB design concept, the firmware and software processing architecture, and the experience from the intense commissioning towards LHC Run 2.
A new ATLAS muon CSC readout system with system on chip technology on ATCA platform
International Nuclear Information System (INIS)
Claus, R.
2016-01-01
The ATLAS muon Cathode Strip Chamber (CSC) back-end readout system has been upgraded during the LHC 2013–2015 shutdown to be able to handle the higher Level-1 trigger rate of 100 kHz and the higher occupancy at Run 2 luminosity. The readout design is based on the Reconfiguration Cluster Element (RCE) concept for high bandwidth generic DAQ implemented on the ATCA platform. The RCE design is based on the new System on Chip Xilinx Zynq series with a processor-centric architecture with ARM processor embedded in FPGA fabric and high speed I/O resources together with auxiliary memories to form a versatile DAQ building block that can host applications tapping into both software and firmware resources. The Cluster on Board (COB) ATCA carrier hosts RCE mezzanines and an embedded Fulcrum network switch to form an online DAQ processing cluster. More compact firmware solutions on the Zynq for G-link, S-link and TTC allowed the full system of 320 G-links from the 32 chambers to be processed by 6 COBs in one ATCA shelf through software waveform feature extraction to output 32 S-links. The full system was installed in Sept. 2014. We will present the RCE/COB design concept, the firmware and software processing architecture, and the experience from the intense commissioning towards LHC Run 2.
A new ATLAS muon CSC readout system with system on chip technology on ATCA platform
Bartoldus, R.; Claus, R.; Garelli, N.; Herbst, R. T.; Huffer, M.; Iakovidis, G.; Iordanidou, K.; Kwan, K.; Kocian, M.; Lankford, A. J.; Moschovakos, P.; Nelson, A.; Ntekas, K.; Ruckman, L.; Russell, J.; Schernau, M.; Schlenker, S.; Su, D.; Valderanis, C.; Wittgen, M.; Yildiz, S. C.
2016-01-01
The ATLAS muon Cathode Strip Chamber (CSC) backend readout system has been upgraded during the LHC 2013-2015 shutdown to be able to handle the higher Level-1 trigger rate of 100 kHz and the higher occupancy at Run-2 luminosity. The readout design is based on the Reconfigurable Cluster Element (RCE) concept for high bandwidth generic DAQ implemented on the Advanced Telecommunication Computing Architecture (ATCA) platform. The RCE design is based on the new System on Chip XILINX ZYNQ series with a processor-centric architecture with ARM processor embedded in FPGA fabric and high speed I/O resources. Together with auxiliary memories, all these components form a versatile DAQ building block that can host applications tapping into both software and firmware resources. The Cluster on Board (COB) ATCA carrier hosts RCE mezzanines and an embedded Fulcrum network switch to form an online DAQ processing cluster. More compact firmware solutions on the ZYNQ for high speed input and output fiberoptic links and TTC allowed the full system of 320 input links from the 32 chambers to be processed by 6 COBs in one ATCA shelf. The full system was installed in September 2014. We will present the RCE/COB design concept, the firmware and software processing architecture, and the experience from the intense commissioning for LHC Run 2.
A new ATLAS muon CSC readout system with system on chip technology on ATCA platform
International Nuclear Information System (INIS)
Bartoldus, R.; Claus, R.; Garelli, N.; Herbst, R.T.; Huffer, M.; Kocian, M.; Ruckman, L.; Russell, J.; Su, D.; Wittgen, M.; Iakovidis, G.; Iordanidou, K.; Moschovakos, P.; Ntekas, K.; Kwan, K.; Lankford, A.J.; Nelson, A.; Schernau, M.; Schlenker, S.; Valderanis, C.
2016-01-01
The ATLAS muon Cathode Strip Chamber (CSC) backend readout system has been upgraded during the LHC 2013-2015 shutdown to be able to handle the higher Level-1 trigger rate of 100 kHz and the higher occupancy at Run-2 luminosity. The readout design is based on the Reconfigurable Cluster Element (RCE) concept for high bandwidth generic DAQ implemented on the Advanced Telecommunication Computing Architecture (ATCA) platform. The RCE design is based on the new System on Chip XILINX ZYNQ series with a processor-centric architecture with ARM processor embedded in FPGA fabric and high speed I/O resources. Together with auxiliary memories, all these components form a versatile DAQ building block that can host applications tapping into both software and firmware resources. The Cluster on Board (COB) ATCA carrier hosts RCE mezzanines and an embedded Fulcrum network switch to form an online DAQ processing cluster. More compact firmware solutions on the ZYNQ for high speed input and output fiberoptic links and TTC allowed the full system of 320 input links from the 32 chambers to be processed by 6 COBs in one ATCA shelf. The full system was installed in September 2014. We will present the RCE/COB design concept, the firmware and software processing architecture, and the experience from the intense commissioning for LHC Run 2
A new ATLAS muon CSC readout system with system on chip technology on ATCA platform
Energy Technology Data Exchange (ETDEWEB)
Claus, R., E-mail: claus@slac.stanford.edu
2016-07-11
The ATLAS muon Cathode Strip Chamber (CSC) back-end readout system has been upgraded during the LHC 2013–2015 shutdown to be able to handle the higher Level-1 trigger rate of 100 kHz and the higher occupancy at Run 2 luminosity. The readout design is based on the Reconfiguration Cluster Element (RCE) concept for high bandwidth generic DAQ implemented on the ATCA platform. The RCE design is based on the new System on Chip Xilinx Zynq series with a processor-centric architecture with ARM processor embedded in FPGA fabric and high speed I/O resources together with auxiliary memories to form a versatile DAQ building block that can host applications tapping into both software and firmware resources. The Cluster on Board (COB) ATCA carrier hosts RCE mezzanines and an embedded Fulcrum network switch to form an online DAQ processing cluster. More compact firmware solutions on the Zynq for G-link, S-link and TTC allowed the full system of 320 G-links from the 32 chambers to be processed by 6 COBs in one ATCA shelf through software waveform feature extraction to output 32 S-links. The full system was installed in Sept. 2014. We will present the RCE/COB design concept, the firmware and software processing architecture, and the experience from the intense commissioning towards LHC Run 2.
Preliminary checklist of Myxomycota and Ascomycota from Fruška Gora mountain
Directory of Open Access Journals (Sweden)
Karaman Maja A.
2012-01-01
Full Text Available Fruška Gora mountain represents very important source of natural and semi-natural forest ecosystems in the northern part of the Republic of Serbia and therefore it is important source of habitats for different groups of fungi. As opposed to coordinated inventory and monitoring projects of fungi established around Europe long ago, mycological researches in Serbia are still sporadic and insufficiently coordinated by authorities and experts. In accordance with that, available data concerning the state of fungi in Serbia are scarce. The aim of this work was to collect all relevant unpublished data considering fungi in Fruška Gora and to present checklist of two fungal phyla: Myxomycota and Ascomycota. In the presented checklist, 23 recorded species of Myxomycota (known as fungal analogues were distributed in 2 classes, 5 orders, and 7 families. The first class (Protosteliomycetes contained only one species - Ceratiomyxa fruticulosa (fam. Ceratiomyxaceae. The largest order was Trichiales (9 species, while the dominant families were Stemonitidaceae and Trichiaceae, each with 6 species recorded. The most abundant species was Lycogala epidendrum (fam. Reticulariaceae, with 13 records. Phylum Ascomycota was represented with 95 species belonging to 6 classes, 12 orders and 29 families. The most highly represented classes were Leotiomycetes (32 species and Pezizomycetes (31 species. The most abundant species were: Xylaria polymorpha (17 records, Xylaria hypoxylon (14 records, and Sarcoscypha coccinea (14 records. [Projekat Ministarstva nauke Republike Srbije, br. III-43002
Lakićević Milena D.; Srđević Bojan M.; Srđević Zorica B.
2015-01-01
This paper deals with the problem of multi-criteria evaluation of four management strategies for Fruška Gora National Park. The criteria set was defined in accordance with the IUCN guidelines for management of national parks. Four strategies were evaluated by testing preference intensities for each alternative with the respect to each criterion. Alternatives with preference above the approval threshold were approved, and a multi-criteria approval matrix w...
A New ATLAS Muon CSC Readout System with System on Chip Technology on ATCA Platform
AUTHOR|(SzGeCERN)696050; Garelli, N.; Herbst, R.T.; Huffer, M.; Iakovidis, G.; Iordanidou, K.; Kwan, K.; Kocian, M.; Lankford, A.J.; Moschovakos, P.; Nelson, A.; Ntekas, K.; Ruckman, L.; Russell, J.; Schernau, M.; Schlenker, S.; Su, D.; Valderanis, C.; Wittgen, M.; Bartoldus, R.
2016-01-01
The ATLAS muon Cathode Strip Chamber (CSC) backend readout system has been upgraded during the LHC 2013-2015 shutdown to be able to handle the higher Level-1 trigger rate of 100 kHz and the higher occupancy at Run 2 luminosity. The readout design is based on the Reconfigurable Cluster Element (RCE) concept for high bandwidth generic DAQ implemented on the Advanced Telecommunication Computing Architecture (ATCA) platform. The RCE design is based on the new System on Chip XILINX ZYNQ series with a processor-centric architecture with ARM processor embedded in FPGA fabric and high speed I/O resources together with auxiliary memories to form a versatile DAQ building block that can host applications tapping into both software and firmware resources. The Cluster on Board (COB) ATCA carrier hosts RCE mezzanines and an embedded Fulcrum network switch to form an online DAQ processing cluster. More compact firmware solutions on the ZYNQ for G-link, S-link and TTC allowed the full system of 320 G-links from the 32 chambe...
A New ATLAS Muon CSC Readout System with System on Chip Technology on ATCA Platform
ATLAS CSC Collaboration; The ATLAS collaboration
2016-01-01
The ATLAS muon Cathode Strip Chamber (CSC) backend readout system has been upgrade during the LHC 2013-2015 shutdown to be able to handle the higher Level-1 trigger rate of 100 kHz and the higher occupancy at Run 2 luminosity. The readout design is based on the Reconfigurable Cluster Element (RCE) concept for high bandwidth generic DAQ implemented on the Advanced Telecommunication Computing Architecture (ATCA) platform. The RCE design is based on the new System on Chip XILINX ZYNQ series with a processor-centric architecture with ARM processor embedded in FPGA fabric and high speed I/O resources together with auxiliary memories to form a versatile DAQ building block that can host applications tapping into both software and firmware resources. The Cluster on Board (COB) ATCA carrier hosts RCE mezzanines and an embedded Fulcrum network switch to form an online DAQ processing cluster. More compact firmware solutions on the ZYNQ for G-link, S-link and TTC allowed the full system of 320 G-links from the 32 chamber...
SURVEY OF COMMUNICATION LINKS FOR ATCA IN PHYSICS
Makowski, D; Piotrowski, A; Cichalewski, W; Jalmuzna, W; Koprek, W; Simrock, S
2009-01-01
Modern machines used in high energy physics require sophisticated and complex control systems. The complex systems are usually built as distributed systems. Therefore, the connectivity and communication links between distributed subsystems play a crucial role in the control system. The Advanced TelecommunicationComputingArchitecture (ATCA) and Advanced Mezzanine Card (AMC) standards have attracted the attention of physics community because they offer various types of data communication channels with high bandwidth, redundancy, high reliability and availability. The standards allow using different types of communication interfaces like PCIe, Gigabit Ethernet, RapidIO. In real-time systems the data transmission latency is also important. The acquisition of real-time data from hundreds of analogue channels is required for the Low Level Radio Frequency (LLRF) controller of XFEL (X-ray Free Electron Laser) accelerator. The paper presents survey of the communication interfaces of the LLRF controller for XFEL. The d...
Prototype Real-time ATCA-based LLRF Control System
Makowski, Dariusz; Jezynski, Tomasz; Piotrowski, Adam; Jablonski, Grzegorz; Jalmuzna, Wojciech; Czuba, Krzysztof; Predki, Paweł; Simrock, Stefan
2011-01-01
The linear accelerators employed to drive Free Electron Lasers (FELs), such as the X-ray Free Electron Laser (XFEL) currently being built in Hamburg, require sophisticated control systems. The Low Level Radio Frequency (LLRF) control system should stabilize the phase and amplitude of the electromagnetic field in accelerating modules with tolerances below 0.02 % for amplitude and 0.01 degree for phase to produce ultra-stable electron beam that meets the conditions required for Self-Amplified Spontaneous Emission (SASE). The LLRF control system of 32-cavity accelerating module of the XFEL accelerator requires acquisition of more than 100 analogue signals sampled with frequency around 100 MHz. Data processing in real-time loop should complete within a few hundreds of nanoseconds. Moreover, the LLRF control system should be reliable, upgradable and serviceable. The Advanced Telecommunications Computing Architecture (ATCA) standard, developed for telecommunication applications, can fulfil all of the above mentione...
A Full Mesh ATCA-based General Purpose Data Processing Board (Pulsar II)
Ajuha, S; Costa de Paiva, Thiago; Das, Souvik; Eusebi, Ricardo; Finotti Ferreira, Vitor; Hahn, Kristian; Hu, Zhen; Jindariani, Sergo; Konigsberg, Jacobo; Liu, Tiehui Ted; Low, Jia Fu; Okumura, Yasuyuki; Olsen, Jamieson; Arruda Ramalho, Lucas; Rossin, Roberto; Ristori, Luciano; Akira Shinoda, Ailton; Tran, Nhan; Trovato, Marco; Ulmer, Keith; Vaz, Mario; Wen, Xianshan; Wu, Jin-Yuan; Xu, Zijun; Yin, Han; Zorzetti, Silvia
2017-01-01
The Pulsar II is a custom ATCA full mesh enabled FPGA-based processor board which has been designed with the goal of creating a scalable architecture abundant in flexible, non-blocking, high bandwidth interconnections. The design has been motivated by silicon-based tracking trigger needs for LHC experiments. In this technical memo we describe the Pulsar II hardware and its performance, such as the performance test results with full mesh backplanes from di↵erent vendors, how the backplane is used for the development of low-latency time-multiplexed data transfer schemes and how the inter-shelf and intra-shelf synchronization works.
A Full Mesh ATCA-based General Purpose Data Processing Board (Pulsar II)
Energy Technology Data Exchange (ETDEWEB)
Ajuha, S. [Univ. of Sao Paulo (Brazil); et al.
2017-06-29
The Pulsar II is a custom ATCA full mesh enabled FPGA-based processor board which has been designed with the goal of creating a scalable architecture abundant in flexible, non-blocking, high bandwidth interconnections. The design has been motivated by silicon-based tracking trigger needs for LHC experiments. In this technical memo we describe the Pulsar II hardware and its performance, such as the performance test results with full mesh backplanes from different vendors, how the backplane is used for the development of low-latency time-multiplexed data transfer schemes and how the inter-shelf and intra-shelf synchronization works.
Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya
2002-01-01
The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, a...
Design of the SLAC RCE Platform: A General Purpose ATCA Based Data Acquisition System
International Nuclear Information System (INIS)
Herbst, R.; Claus, R.; Freytag, M.; Haller, G.; Huffer, M.; Maldonado, S.; Nishimura, K.; O'Grady, C.; Panetta, J.; Perazzo, A.; Reese, B.; Ruckman, L.; Thayer, J.G.; Weaver, M.
2015-01-01
The SLAC RCE platform is a general purpose clustered data acquisition system implemented on a custom ATCA compliant blade, called the Cluster On Board (COB). The core of the system is the Reconfigurable Cluster Element (RCE), which is a system-on-chip design based upon the Xilinx Zynq family of FPGAs, mounted on custom COB daughter-boards. The Zynq architecture couples a dual core ARM Cortex A9 based processor with a high performance 28nm FPGA. The RCE has 12 external general purpose bi-directional high speed links, each supporting serial rates of up to 12Gbps. 8 RCE nodes are included on a COB, each with a 10Gbps connection to an on-board 24-port Ethernet switch integrated circuit. The COB is designed to be used with a standard full-mesh ATCA backplane allowing multiple RCE nodes to be tightly interconnected with minimal interconnect latency. Multiple shelves can be clustered using the front panel 10-gbps connections. The COB also supports local and inter-blade timing and trigger distribution. An experiment specific Rear Transition Module adapts the 96 high speed serial links to specific experiments and allows an experiment-specific timing and busy feedback connection. This coupling of processors with a high performance FPGA fabric in a low latency, multiple node cluster allows high speed data processing that can be easily adapted to any physics experiment. RTEMS and Linux are both ported to the module. The RCE has been used or is the baseline for several current and proposed experiments (LCLS, HPS, LSST, ATLAS-CSC, LBNE, DarkSide, ILC-SiD, etc).
A Full Mesh ATCA-based General Purpose Data Processing Board: Pulsar II
Olsen, J; Okumura, Y
2014-01-01
High luminosity conditions at the LHC pose many unique challenges for potential silicon based track trigger systems. Among those challenges is data formatting, where hits from thousands of silicon modules must first be shared and organized into overlapping trigger towers. Other challenges exist for Level-1 track triggers, where many parallel data paths may be used for 5 high speed time multiplexed data transfers. Communication between processing nodes requires high bandwidth, low latency, and flexible real time data sharing, for which a full mesh backplane is a natural fit. A custom full mesh enabled ATCA board called the Pulsar II has been designed with the goal of creating a scalable architecture abundant in flexible, non-blocking, high bandwidth board- to-board communication channels while keeping the design as simple as possible.
Spectral and morphological analysis of the remnant of supernova 1987A with ALMA and ATCA
Energy Technology Data Exchange (ETDEWEB)
Zanardo, Giovanna; Staveley-Smith, Lister [International Centre for Radio Astronomy Research (ICRAR), M468, University of Western Australia, Crawley, WA 6009 (Australia); Indebetouw, Remy; Chevalier, Roger A. [Department of Astronomy, University of Virginia, P.O. Box 400325, Charlottesville, VA 22904 (United States); Matsuura, Mikako; Barlow, Michael J. [Department of Physics and Astronomy, University College London, Gower Street, London WC1E 6BT (United Kingdom); Gaensler, Bryan M. [Australian Research Council, Centre of Excellence for All-sky Astrophysics (CAASTRO) (Australia); Fransson, Claes; Lundqvist, Peter [Department of Astronomy, Oskar Klein Center, Stockholm University, AlbaNova, SE-106 91 Stockholm (Sweden); Manchester, Richard N. [CSIRO Astronomy and Space Science, Australia Telescope National Facility, P.O. Box 76, Epping, NSW 1710 (Australia); Baes, Maarten [Sterrenkundig Observatorium, Universiteit Gent, Krijgslaan 281 S9, B-9000 Gent (Belgium); Kamenetzky, Julia R. [Steward Observatory, University of Arizona, 933 North Cherry Avenue, Tucson, AZ 85721-0065 (United States); Lakićević, Maša [Institute for the Environment, Physical Sciences and Applied Mathematics, Lennard-Jones Laboratories, Keele University, Staffordshire ST5 5BG (United Kingdom); Marcaide, Jon M. [Departamento de Astronomía, Universidad de Valencia, C/Dr. Moliner 50, E-46100 Burjassot (Spain); Martí-Vidal, Ivan [Department of Earth and Space Sciences, Chalmers University of Technology, Onsala Space Observatory, SE-439 92 Onsala (Sweden); Meixner, Margaret [Space Telescope Science Institute, 3700 San Martin Drive, Baltimore, MD 21218 (United States); Ng, C.-Y. [Department of Physics, University of Hong Kong, Pokfulam Road, Hong Kong (China); Park, Sangwook, E-mail: giovanna.zanardo@gmail.com [Department of Physics, University of Texas at Arlington, 108 Science Hall, Box 19059, Arlington, TX 76019 (United States); and others
2014-12-01
We present a comprehensive spectral and morphological analysis of the remnant of supernova (SN) 1987A with the Australia Telescope Compact Array (ATCA) and the Atacama Large Millimeter/submillimeter Array (ALMA). The non-thermal and thermal components of the radio emission are investigated in images from 94 to 672 GHz (λ 3.2 mm to 450 μm), with the assistance of a high-resolution 44 GHz synchrotron template from the ATCA, and a dust template from ALMA observations at 672 GHz. An analysis of the emission distribution over the equatorial ring in images from 44 to 345 GHz highlights a gradual decrease of the east-to-west asymmetry ratio with frequency. We attribute this to the shorter synchrotron lifetime at high frequencies. Across the transition from radio to far infrared, both the synchrotron/dust-subtracted images and the spectral energy distribution (SED) suggest additional emission beside the main synchrotron component (S {sub ν}∝ν{sup –0.73}) and the thermal component originating from dust grains at T ∼ 22 K. This excess could be due to free-free flux or emission from grains of colder dust. However, a second flat-spectrum synchrotron component appears to better fit the SED, implying that the emission could be attributed to a pulsar wind nebula (PWN). The residual emission is mainly localized west of the SN site, as the spectral analysis yields –0.4 ≲ α ≲ –0.1 across the western regions, with α ∼ 0 around the central region. If there is a PWN in the remnant interior, these data suggest that the pulsar may be offset westward from the SN position.
Directory of Open Access Journals (Sweden)
Marković Jelica
2015-01-01
Full Text Available Customer satisfaction is a guarantee of success in all fields, including those related to the organization of sport events. As a consequence of the event quality appears visitor satisfaction which significantly impacts on the their loyalty and 'word of mouth' promotion, so examination of these categories is especially important to the event organizers in order to control and improve the event. Sports events can be viewed in a broader context, where it is not of primary importance reaching the sports results, but is more emphasized its non-competitive nature. In this case, the sport events include recreation, relaxation, entertainment and leisure, with a significantly different approach and intentions of the organization. Such events lead to intercultural exchange, increase the level of socialization and promote physical activity as a function of improving health. Having in mind that it assumed the characteristics of mass and has become an influential factor in the Vojvodina tourism, this study aims to analyze the quality of the Mountaineering marathon on Fruška gora from the perspective of the participants' satisfaction. For collecting the data, it was used the questionnaire. The sample included 134 participants of the 35th Mountaineering marathon on Fruška gora. For measuring this event quality, it was used modified model SEQSS with 4 dimensions: quality of marathon program, quality of interaction, quality of outcomes and quality of the physical environment. The results have shown that the quality of all measured dimensions is at a high level and that measuring dimension the quality outcome, which includes the socialization and valence, has the greatest impact on the satisfaction of the participants.
Chavarría, Max; Durante-Rodríguez, Gonzalo; Krell, Tino; Santiago, César; Brezovsky, Jan; Damborsky, Jiri; de Lorenzo, Víctor
2014-01-01
Fructose-1-phosphate (F1P) is the preferred effector of the catabolite repressor/activator (Cra) protein of the soil bacterium Pseudomonas putida but its ability to bind other metabolic intermediates in vivo is unclear. The Cra protein of this microorganism (Cra(PP)) was submitted to mobility shift assays with target DNA sequences (the PfruB promoter) and candidate effectors fructose-1,6-bisphosphate (FBP), glucose 6-phosphate (G6P), and fructose-6-phosphate (F6P). 1 mM F1P was sufficient to release most of the Cra protein from its operators but more than 10 mM of FBP or G6P was required to free the same complex. However, isothermal titration microcalorimetry failed to expose any specific interaction between Cra(PP) and FBP or G6P. To solve this paradox, transcriptional activity of a PfruB-lacZ fusion was measured in wild-type and ΔfruB cells growing on substrates that change the intracellular concentrations of F1P and FBP. The data indicated that PfruB activity was stimulated by fructose but not by glucose or succinate. This suggested that Cra(PP) represses expression in vivo of the cognate fruBKA operon in a fashion dependent just on F1P, ruling out any other physiological effector. Molecular docking and dynamic simulations of the Cra-agonist interaction indicated that both metabolites can bind the repressor, but the breach in the relative affinity of Cra(PP) for F1P vs FBP is three orders of magnitude larger than the equivalent distance in the Escherichia coli protein. This assigns the Cra protein of P. putida the sole role of transducing the presence of fructose in the medium into a variety of direct and indirect physiological responses.
Modelling of carrying capacity in National Park - Fruška Gora (Serbia case study
Directory of Open Access Journals (Sweden)
Vujko Aleksandra
2017-03-01
Full Text Available Negative effects of tourism development in a destination are usually the consequence of the high concentration of tourists, accommodation facilities and the activities that are practiced in a relatively restricted area. One of the most important measures to protect the areas is to calculate the maximum number of tourists that can simultaneously reside in a region, i.e. the determination of the carrying capacity. This paper outlines a method for determining carrying capacity based on zoning of environmental resources and zoning within a region. The paper argues for a return to the idea of identifying maximum appropriate number of users. The main hypothesis of the paper is based on the statement that the development of tourism in Fruška Gora (Mountain National Park in Northern Serbia must be in accordance with the basic principles of sustainability, including the determination of carrying capacity. The main research goal was to show the opinion of local residents about the uncontrolled development of tourism, and to determine the carrying capacity in four sports and recreational zones of the mountain. The carrying capacity of the area is calculated by Lavery and Stanev formulas.
FPGA remote update for nuclear environments
Energy Technology Data Exchange (ETDEWEB)
Fernandes, Ana; Pereira, Rita C.; Sousa, Jorge; Carvalho, Paulo F.; Correia, Miguel; Rodrigues, Antonio P.; Carvalho, Bernardo B.; Goncalves, Bruno [Instituto de Plasmasbe Fusao Nuclear, Instituto Superior Tecnico, Universidade de Lisboa, 1049-001 Lisboa, (Portugal); Correia, Carlos M.B.A. [Centro de Instrumentacao, Dept. de Fisica, Universidade de Coimbra, 3004-516 Coimbra, (Portugal)
2015-07-01
The Instituto de Plasmas e Fusao Nuclear (IPFN) has developed dedicated re-configurable modules based on field programmable gate array (FPGA) devices for several nuclear fusion machines worldwide. Moreover, new Advanced Telecommunication Computing Architecture (ATCA) based modules developed by IPFN are already included in the ITER catalogue. One of the requirements for re-configurable modules operating in future nuclear environments including ITER is the remote update capability. Accordingly, this work presents an alternative method for FPGA remote programing to be implemented in new ATCA based re-configurable modules. FPGAs are volatile devices and their programming code is usually stored in dedicated flash memories for properly configuration during module power-on. The presented method is capable to store new FPGA codes in Serial Peripheral Interface (SPI) flash memories using the PCIexpress (PCIe) network established on the ATCA back-plane, linking data acquisition endpoints and the data switch blades. The method is based on the Xilinx Quick Boot application note, adapted to PCIe protocol and ATCA based modules. (authors)
Directory of Open Access Journals (Sweden)
Bobinac Martin T.
2003-01-01
Full Text Available We analyzed the process of stand degradation of individual forest ecosystems in the region of the zonal community Tilio-Carpino-Qurcetum robori-cerris Jov. 79 located in the western part of Fruška Gora National Park. Degradation occurred is consequence to regeneration felling and it progressed towards the extinction of oaks, first of all the valuable pedunculate oak and Vergilius's oak, and then also Turkey oak. The analyzed mature stands were degraded coppice and mainly predominated by the Turkey oak in the tree stratum. In juvenile stands, often initially well regenerated with Turkey oak, the dominant species in the tree stratum are lime, hornbeam, flowering ash, field maple and other secondary species, predominantly of coppice origin. Restitution of the degraded stands is possible by applying an adequate regeneration system. Taking into account the primarily protective function of the analyzed forest ecosystems and the fact that these are degraded and coppice stands, the system of regeneration should be based on combined restoration.
Directory of Open Access Journals (Sweden)
Stajić Branko
2014-01-01
Full Text Available This paper presents the first regional research of the chronologies of sessile oak trees and definition of the local (master chronology of sessile oak in the area of Fruška Gora. In addition, the aim of this study is to determine the strength of the common signal in the growth of sessile oak and its dendroclimatological potential under the given conditions. The quality of the local series of radial increment (chronology and the strength of the common and climatic signals were evaluated using the following parameters: average mean sensitivity, expressed population signal, signal-to-noise ratio and the variance explained by eigenvectors in the procedure of analysis of the principal components. The results have shown that the obtained master chronologies are of satisfactory quality and reliability, and that they contain a sufficient general common ”signal”, which is a characteristic of all analyzed trees that can be processed in all dendroclimatological analyses. It was concluded that, under the investigated site conditions, sessile oak showed low to medium sensitivity of reaction to the modifications of environmental conditions in the past 90 years. [Projekat Ministarstva nauke Republike Srbije: Šumski zasadi u funkciji povećanja pošumljenosti Srbije
Directory of Open Access Journals (Sweden)
Marjanović Miloš
2013-01-01
Full Text Available The paper considers the outcome of multi-criteria analysis of landslide susceptibility on the NW outskirts of Fruška Gora Mountain, Serbia. The area of the interest is known for landslide occurrences, and to focus on the most affected areas, it was necessary to consider some principal factors (lithology, slope inclination, rainfall, erosion, vegetation, altitude and slope aspect and sort them by their importance to the phenomena. Prior to any criteria assessment, available data records had been assembled and refashioned as raster datasets. Thereafter, the criteria arising from an analytical hierarchy process (AHP provided their weights of preference in the final model. In addition, the model was analyzed for the information gain and classified in accordance to the optimal informativeness. Being tailored in the context of raster modelling, aided by the GIS spatial tools, our result gained substantial correlation to the control reference map (a digital photo-geological interpretation map of active and potential landslides.
Directory of Open Access Journals (Sweden)
Lakićević Milena D.
2015-01-01
Full Text Available This paper deals with the problem of multi-criteria evaluation of four management strategies for Fruška Gora National Park. The criteria set was defined in accordance with the IUCN guidelines for management of national parks. Four strategies were evaluated by testing preference intensities for each alternative with the respect to each criterion. Alternatives with preference above the approval threshold were approved, and a multi-criteria approval matrix was generated. According to the matrix, the most suitable management strategy was identified. It implies an intense protection of natural resources and landscape diversity in the national park by applying bio-engineering measures. This illustrative example proved that multi-criteria approval can be considered as a good decision support tool when there is no need for a deeper insight into cardinal values of criteria weights and alternatives, or if the decision maker has to select few from many of alternatives to reduce the decision problem. For a more precise analysis, it is recommended to combine multi-criteria approval with other decision support tools, and future studies might deal with this problem in order to define an alternative framework for decision making in landscape management. [Projekat Ministarstva nauke Republike Srbije, br. 174003: Theory and application of analytic hierarchy process (AHP in multi-criteria decision making under conditions of risk and uncertainty (individual and group context
Local Group dSph radio survey with ATCA (I): observations and background sources
Regis, Marco; Richter, Laura; Colafrancesco, Sergio; Massardi, Marcella; de Blok, W. J. G.; Profumo, Stefano; Orford, Nicola
2015-04-01
Dwarf spheroidal (dSph) galaxies are key objects in near-field cosmology, especially in connection to the study of galaxy formation and evolution at small scales. In addition, dSphs are optimal targets to investigate the nature of dark matter. However, while we begin to have deep optical photometric observations of the stellar population in these objects, little is known so far about their diffuse emission at any observing frequency, and hence on thermal and non-thermal plasma possibly residing within dSphs. In this paper, we present deep radio observations of six local dSphs performed with the Australia Telescope Compact Array (ATCA) at 16 cm wavelength. We mosaicked a region of radius of about 1 deg around three `classical' dSphs, Carina, Fornax, and Sculptor, and of about half of degree around three `ultrafaint' dSphs, BootesII, Segue2, and Hercules. The rms noise level is below 0.05 mJy for all the maps. The restoring beams full width at half-maximum ranged from 4.2 arcsec × 2.5 arcsec to 30.0 arcsec × 2.1 arcsec in the most elongated case. A catalogue including the 1392 sources detected in the six dSph fields is reported. The main properties of the background sources are discussed, with positions and fluxes of brightest objects compared with the FIRST, NVSS, and SUMSS observations of the same fields. The observed population of radio emitters in these fields is dominated by synchrotron sources. We compute the associated source number counts at 2 GHz down to fluxes of 0.25 mJy, which prove to be in agreement with AGN count models.
Fuse, Haruka; Fukamachi, Haruka; Inoue, Mitsuko; Igarashi, Takeshi
2013-02-25
Fructanase enzymes hydrolyze the β-2,6 and β-2,1 linkages of levan and inulin fructans, respectively. We analyzed the influence of fructan on the growth of Prevotella intermedia. The growth of P. intermedia was enhanced by addition of inulin, implying that P. intermedia could also use inulin. Based on this finding, we identified and analyzed the genes encoding a putative fructanase (FruA), sugar transporter (FruB), and fructokinase (FruK) in the genome of strain ATCC25611. Transcript analysis by RT-PCR showed that the fruABK genes were co-transcribed as a single mRNA and semi-quantitative analysis confirmed that the fruA gene was induced in response to fructose and inulin. Recombinant FruA and FruK were purified and characterized biochemically. FruA strongly hydrolyzed inulin, with slight degradation of levan via an exo-type mechanism, revealing that FruA is an exo-β-d-fructanase. FruK converted fructose to fructose-6-phosphate in the presence of ATP, confirming that FruK is an ATP-dependent fructokinase. These results suggest that P. intermedia can utilize fructan as a carbon source for growth, and that the fructanase, sugar transporter, and fructokinase proteins we identified are involved in this fructan utilization. Copyright © 2012 Elsevier B.V. All rights reserved.
Local Group dSph radio survey with ATCA (III): constraints on particle dark matter
International Nuclear Information System (INIS)
Regis, Marco; Colafrancesco, Sergio; Profumo, Stefano; De Blok, W.J.G.; Massardi, Marcella; Richter, Laura
2014-01-01
We performed a deep search for radio synchrotron emissions induced by weakly interacting massive particles (WIMPs) annihilation or decay in six dwarf spheroidal (dSph) galaxies of the Local Group. Observations were conducted with the Australia Telescope Compact Array (ATCA) at 16 cm wavelength, with an rms sensitivity better than 0.05 mJy/beam in each field. In this work, we first discuss the uncertainties associated with the modeling of the expected signal, such as the shape of the dark matter (DM) profile and the dSph magnetic properties. We then investigate the possibility that point-sources detected in the proximity of the dSph optical center might be due to the emission from a DM cuspy profile. No evidence for an extended emission over a size of few arcmin (which is the DM halo size) has been detected. We present the associated bounds on the WIMP parameter space for different annihilation/decay final states and for different astrophysical assumptions. If the confinement of electrons and positrons in the dSph is such that the majority of their power is radiated within the dSph region, we obtain constraints on the WIMP annihilation rate which are well below the thermal value for masses up to few TeV. On the other hand, for conservative assumptions on the dSph magnetic properties, the bounds can be dramatically relaxed. We show however that, within the next 10 years and regardless of the astrophysical assumptions, it will be possible to progressively close in on the full parameter space of WIMPs by searching for radio signals in dSphs with SKA and its precursors
Local Group dSph radio survey with ATCA (III): constraints on particle dark matter
Energy Technology Data Exchange (ETDEWEB)
Regis, Marco [Dipartimento di Fisica, Università di Torino, via P. Giuria 1, I-10125 Torino (Italy); Colafrancesco, Sergio [School of Physics, University of the Witwatersrand, Johannesburg (South Africa); Profumo, Stefano [Department of Physics, University of California, 1156 High St., Santa Cruz, CA 95064 (United States); De Blok, W.J.G. [Netherlands Institute for Radio Astronomy (ASTRON), Postbus 2, 7990 AA Dwingeloo (Netherlands); Massardi, Marcella [INAF—Istituto di Radioastronomia, Via Gobetti 101, I-40129, Bologna (Italy); Richter, Laura, E-mail: regis@to.infn.it, E-mail: sergio.colafrancesco@wits.ac.za, E-mail: profumo@ucsc.edu, E-mail: blok@astron.nl, E-mail: massardi@ira.inaf.it, E-mail: laura@ska.ac.za [SKA South Africa, 3rd Floor, The Park, Park Road, Pinelands, 7405 (South Africa)
2014-10-01
We performed a deep search for radio synchrotron emissions induced by weakly interacting massive particles (WIMPs) annihilation or decay in six dwarf spheroidal (dSph) galaxies of the Local Group. Observations were conducted with the Australia Telescope Compact Array (ATCA) at 16 cm wavelength, with an rms sensitivity better than 0.05 mJy/beam in each field. In this work, we first discuss the uncertainties associated with the modeling of the expected signal, such as the shape of the dark matter (DM) profile and the dSph magnetic properties. We then investigate the possibility that point-sources detected in the proximity of the dSph optical center might be due to the emission from a DM cuspy profile. No evidence for an extended emission over a size of few arcmin (which is the DM halo size) has been detected. We present the associated bounds on the WIMP parameter space for different annihilation/decay final states and for different astrophysical assumptions. If the confinement of electrons and positrons in the dSph is such that the majority of their power is radiated within the dSph region, we obtain constraints on the WIMP annihilation rate which are well below the thermal value for masses up to few TeV. On the other hand, for conservative assumptions on the dSph magnetic properties, the bounds can be dramatically relaxed. We show however that, within the next 10 years and regardless of the astrophysical assumptions, it will be possible to progressively close in on the full parameter space of WIMPs by searching for radio signals in dSphs with SKA and its precursors.
Chavarría, Max; Fuhrer, Tobias; Sauer, Uwe; Pflüger-Grau, Katharina; de Lorenzo, Víctor
2013-01-01
The gene that encodes the catabolite repressor/activator, Cra (FruR), of Pseudomonas putida is divergent from the fruBKA operon for the uptake of fructose via the phosphoenolpyruvate : carbohydrate phosphotransferase system (PTS(Fru)). The expression of the fru cluster has been studied in cells growing on substrates that change the intracellular concentrations of fructose-1-P (F1P), the principal metabolic intermediate that counteracts the DNA-binding ability of Cra on an upstream operator. While the levels of the regulator were not affected by any of the growth conditions tested, the transcription of fruB was stimulated by fructose but not by the gluconeogenic substrate, succinate. The analysis of the P(fruB) promoter activity in a strain lacking the Cra protein and the determination of key metabolites revealed that this regulator represses the expression of PTS(Fru) in a fashion that is dependent on the endogenous concentrations of F1P. Because FruB (i.e. the EI-HPr-EIIA(Fru) polyprotein) can deliver a high-energy phosphate to the EIIA(Ntr) (PtsN) enzyme of the PTS(Ntr) branch, the cross-talk between the two phosphotransferase systems was examined under metabolic regimes that allowed for the high or low transcription of the fruBKA operon. While fructose caused cross-talk, succinate prevented it almost completely. Furthermore, PtsN phosphorylation by FruB occurred in a Δcra mutant regardless of growth conditions. These results traced the occurrence of the cross-talk to intracellular pools of Cra effectors, in particular F1P. The Cra/F1P duo seems to not only control the expression of the PTS(Fru) but also checks the activity of the PTS(Ntr) in vivo. © 2012 Society for Applied Microbiology and Blackwell Publishing Ltd.
Garner, Sarah Rose C; Castellanos, Monica C; Baillie, Katherine E; Lian, Tianshun; Allan, Douglas W
2018-01-08
Female-specific Ilp7 neuropeptide-expressing motoneurons (FS-Ilp7 motoneurons) are required in Drosophila for oviduct function in egg laying. Here, we uncover cellular and genetic mechanisms underlying their female-specific generation. We demonstrate that programmed cell death (PCD) eliminates FS-Ilp7 motoneurons in males, and that this requires male-specific splicing of the sex-determination gene fruitless ( fru ) into the Fru MC isoform. However, in females, fru alleles that only generate Fru M isoforms failed to kill FS-Ilp7 motoneurons. This blockade of Fru M -dependent PCD was not attributable to doublesex gene function but to a non-canonical role for transformer ( tra ), a gene encoding the RNA splicing activator that regulates female-specific splicing of fru and dsx transcripts. In both sexes, we show that Tra prevents PCD even when the Fru M isoform is expressed. In addition, we found that Fru MC eliminated FS-Ilp7 motoneurons in both sexes, but only when Tra was absent. Thus, Fru MC -dependent PCD eliminates female-specific neurons in males, and Tra plays a double-assurance function in females to establish and reinforce the decision to generate female-specific neurons. © 2018. Published by The Company of Biologists Ltd.
What does the fruitless gene tell us about nature vs. nurture in the sex life of Drosophila?
Yamamoto, Daisuke; Kohatsu, Soh
2017-04-03
The fruitless (fru) gene in Drosophila has been proposed to play a master regulator role in the formation of neural circuitries for male courtship behavior, which is typically considered to be an innate behavior composed of a fixed action pattern as generated by the central pattern generator. However, recent studies have shed light on experience-dependent changes and sensory-input-guided plasticity in courtship behavior. For example, enhanced male-male courtship, a fru mutant "hallmark," disappears when fru-mutant males are raised in isolation. The fact that neural fru expression is induced by neural activities in the adult invites the supposition that Fru as a chromatin regulator mediates experience-dependent epigenetic modification, which underlies the neural and behavioral plasticity.
Real-Time IPMI Protocol Analyzer
Kozak, T; Makowski, D
2011-01-01
The Advanced Telecommunications Computing Ar- chitecture (ATCA) is a modern platform, which gains popularity, not only in telecommunication, but also in others fields like High Energy Physics (HEP) experiments. Computing systems based on ATCA provide high performance and efficiency and are char- acterized by significant reliability, availability and serviceability. ATCA offers these features because of an integrated manage- ment system realized by the Intelligent Platform Management Interface (IPMI) implemented on dedicated Intelligent Platform Management Controller (IPMC). IPMC is required on each ATCA board to fulfill the ATCA standard and is responsible for many vital procedures performed to support proper operation of ATCA system. It covers, among others, activation and deactivations of modules, monitoring of actual parameters or controlling fans. The commercially available IPMI implementations are expensive and often not suited to demands of specific ATCA applications and available hardware. Thus, many r...
International Nuclear Information System (INIS)
Canestrari, Francesco; Stimilli, Arianna; Bahia, Hussain U.; Virgili, Amedeo
2015-01-01
Highlights: • Proposal of a new method to analyze low-temperature cracking of bituminous mixtures. • Reliability of the relaxation modulus master curve modeling through Prony series. • Suitability of the pseudo-variables approach for a close form solution. - Abstract: Thermal cracking is a critical failure mode for asphalt pavements. Relaxation modulus is the major viscoelastic property that controls the development of thermally induced tensile stresses. Therefore, accurate determination of the relaxation modulus is fundamental for designing long lasting pavements. This paper proposes a reliable analytical solution for constructing the relaxation modulus master curve by measuring stress and strain thermally induced in asphalt mixtures. The solution, based on Boltzmann’s Superposition Principle and pseudo-variables concepts, accounts for time and temperature dependency of bituminous materials modulus, avoiding complex integral transformations. The applicability of the solution is demonstrated by testing a reference mixture using the Asphalt Thermal Cracking Analyzer (ATCA) device. By applying thermal loadings on restrained and unrestrained asphalt beams, ATCA allows the determination of several parameters, but is still unable to provide reliable estimations of relaxation properties. Without them the measurements from ATCA cannot be used in modeling of pavement behavior. Thus, the proposed solution successfully integrates ATCA experimental data. The same methodology can be applied to all test methods that concurrently measure stress and strain. The statistical parameters used to evaluate the goodness of fit show optimum correlation between theoretical and experimental results, demonstrating the accuracy of this mathematical approach
Billeter, Jean-Christophe; Goodwin, Stephen F
2004-01-01
The fruitless (fru) gene acts in the central nervous system (CNS) of Drosophila melanogaster to establish male sexual behavior. Genetic dissection of the locus has shown that one of the fru gene's promoter, P1, controls the spatial and temporal expression of male-specific FruM proteins critical to
Sex-switching of the Drosophila brain by two antagonistic chromatin factors
Ito, Hiroki; Sato, Kosei; Yamamoto, Daisuke
2013-01-01
In Drosophila melanogaster, the fruitless (fru) gene encoding BTB-Zn-finger transcription factors organizes male sexual behavior by controlling the development of sexually dimorphic neuronal circuitry. However, the molecular mechanism by which fru controls the sexual fate of neurons has been unknown. Our recent study represents a first step toward clarification of this mechanism. We have shown that: (1) Fru forms a complex with the transcriptional cofactor Bonus (Bon), which recruits either of two chromatin regulators, Histone deacetylase 1 (HDAC1) or Heterochromatin protein 1a (HP1a), to Fru-target sites; (2) the Fru-Bon complex has a masculinizing effect on single sexually-dimorphic neurons when it recruits HDAC1, whereas it has a demasculinizing effect when it recruits HP1a; (3) HDAC1 or HP1a thus recruited to Fru-target sites determines the sexual fate of single neurons in an all-or-none manner, as manipulations of HDAC1 or HP1a expression levels affect the proportion of male-typical neurons and female-typical neurons without producing neurons of intersexual characteristics. Here, we hypothesize that chromatin landscape changes induced by ecdysone surges direct the HDAC1- or HP1a-containing Fru complex to distinct targets, thereby allowing them to switch the neuronal sexual fate in the brain. PMID:23519136
Switching the selectivity of a polyglycerol dendrimer monomolecularly imprinted with D-(−)-fructose
Hashidzume, Akihito; Zimmerman, Steven C.
2009-01-01
A polyglycerol dendrimer unimolecularly imprinted with D-(−)-fructose (Fru) was synthesized. The dendrimer formed adducts with several monosaccharides, Fru, D-(+)-galactose, D-(+)-glucose, D-(+)-mannose, and methyl-α-D-mannopyranoside (MMan), by removal of four water molecules. The dendrimer preferred Fru in the absence of N,N,N′,N′-tetramethylmethylenediamine (TMDAM), whereas it preferred MMan in the presence of TMDAM.
Katayama, Hiroshi; Tatemichi, Yuki; Nakajima, Ayako
2017-08-01
A liquid chromatography-tandem mass spectrometry method using a pentafluorophenylpropyl-bonded silica column was developed to simultaneously quantify twenty Amadori products (APs), including N-(1-Deoxy-d-fructosyl-1-yl)-l-isoleucine (Fru-Ile) and N-(1-Deoxy-d-fructosyl-1-yl)-l-leucine (Fru-Leu), in soy sauce, without the need for an ion-pairing reagent or sample derivatization. The method was applied to six types of soy sauce, to determine the total AP levels and the levels of individual APs. The level of total APs widely varied between the eight samples, from 358mg/L to 24347mg/L. The concentrations of N-ε-(1-deoxy-d-fructosyl-1-yl)-l-lysine (Fru-Lys) and N-(1-deoxy-d-fructosyl-1-yl)-l-pyroglutamic acid (Fru-pGlu) were the highest among the APs and the level of Fru-pGlu was similar to that of Fru-Lys. Furthermore, fermentation periods of up to six months greatly influenced AP levels in soy sauce but the levels remained constant thereafter. Thermal treatment of soy sauce had little effect on AP levels. Copyright © 2017. Published by Elsevier Ltd.
Ecdysone signaling regulates specification of neurons with a male-specific neurite in Drosophila
Directory of Open Access Journals (Sweden)
Binglong Zhang
2018-02-01
Full Text Available Some mAL neurons in the male brain form the ipsilateral neurite (ILN[+] in a manner dependent on FruBM, a male-specific transcription factor. FruBM represses robo1 transcription, allowing the ILN to form. We found that the proportion of ILN[+]-mALs in all observed single cell clones dropped from ∼90% to ∼30% by changing the heat-shock timing for clone induction from 4-5 days after egg laying (AEL to 6-7 days AEL, suggesting that the ILN[+]-mALs are produced predominantly by young neuroblasts. Upon EcR-A knockdown, ILN[+]-mALs were produced at a high rate (∼60%, even when heat shocked at 6-7 days AEL, yet EcR-B1 knockdown reduced the proportion of ILN[+]-mALs to ∼30%. Immunoprecipitation assays in S2 cells demonstrated that EcR-A and EcR-B1 form a complex with FruBM. robo1 reporter transcription was repressed by FruBM and ecdysone counteracted FruBM. We suggest that ecdysone signaling modulates the FruBM action to produce an appropriate number of male-type neurons.
Tripodi, KEJ.; Podesta, F. E.
1997-03-01
Pyrphosphate-dependent phosphofructokinase (PFP) was purified to electrophoretic homogeneity from illuminated pineapple (Ananas comosus) leaves. The purified enzyme consists of a single subunit of 61.5 kD that is immunologically related to the potato tuber PFP [beta] subunit. The native form of PFP likely consists of a homodimer of 97.2 kD, as determined by gel filtration. PFP's glycolytic activity was strongly dependent on pH, displaying a maximum at pH 7.7 to 7.9. Gluconeogenic activity was relatively constant between pH 6.7 and 8.7. Activation by Fru-2,6-bisphosphate (Fru-2,6-P2) was dependent on assay pH. In the glycolytic direction, it activated about 10-fold at pH 6.7, but only 2-fold at pH 7.7. The gluconeogenic reaction was only weakly affected by Fru-2,6-P2. The true substrates for the PFP forward and reverse reactions were Fru-6-phosphate and Mg-pyrophosphate, and Fru-1,6-P2, orthophosphate, and Mg2+, respectively. The results suggest that pineapple PFP displays regulatory properties consistent with a pH-based regulation of its glycolytic activity, in which a decrease in cytosolic pH caused by nocturnal acidification during Crassulacean acid metabolism, which could curtail its activity, is compensated by a parallel increase in its sensitivity to Fru-2,6-P2. It is also evident that the [beta] subunit alone is sufficient to confer PFP with a high catalytic rate and the regulatory properties associated with activation by Fru-2,6-P2.
Risk Decision Making Model for Reservoir Floodwater resources Utilization
Huang, X.
2017-12-01
Floodwater resources utilization(FRU) can alleviate the shortage of water resources, but there are risks. In order to safely and efficiently utilize the floodwater resources, it is necessary to study the risk of reservoir FRU. In this paper, the risk rate of exceeding the design flood water level and the risk rate of exceeding safety discharge are estimated. Based on the principle of the minimum risk and the maximum benefit of FRU, a multi-objective risk decision making model for FRU is constructed. Probability theory and mathematical statistics method is selected to calculate the risk rate; C-D production function method and emergy analysis method is selected to calculate the risk benefit; the risk loss is related to flood inundation area and unit area loss; the multi-objective decision making problem of the model is solved by the constraint method. Taking the Shilianghe reservoir in Jiangsu Province as an example, the optimal equilibrium solution of FRU of the Shilianghe reservoir is found by using the risk decision making model, and the validity and applicability of the model are verified.
Patron, Kévin; Gilot, Philippe; Camiade, Emilie; Mereghetti, Laurent
2015-06-01
We identified a Streptococcus agalactiae metabolic region (fru2) coding for a Phosphoenolpyruvate:carbohydrate phosphoTransferase System (PTS) homologous to the Frz system of extraintestinal pathogenic Escherichia coli strains. The Frz system is involved in environmental sensing and regulation of the expression of adaptation and virulence genes in E. coli. The S. agalactiae fru2 region codes three subunits of a PTS transporter of the fructose-mannitol family, a transcriptional activator of PTSs of the MtlR family, an allulose-6 phosphate-3-epimerase, a transaldolase and a transketolase. We demonstrated that all these genes form an operon. The fru2 operon is present in a 17494-bp genomic island. We analyzed by multilocus sequence typing a population of 492 strains representative of the S. agalactiae population and we showed that the presence of the fru2 operon is linked to the phylogeny of S. agalactiae. The fru2 operon is always present within strains of clonal complexes CC 1, CC 7, CC 10, CC 283 and singletons ST 130 and ST 288, but never found in other CCs and STs. Our results indicate that the fru2 operon was acquired during the evolution of the S. agalactiae species from a common ancestor before the divergence of CC 1, CC 7, CC 10, CC 283, ST 130 and ST 288. As S. agalactiae strains of CC 1 and CC 10 are frequently isolated from adults with invasive disease, we hypothesize that the S. agalactiae Fru2 system senses the environment to allow the bacterium to adapt to new conditions encountered during the infection of adults. Copyright © 2015 Elsevier B.V. All rights reserved.
A Readout Driver for the ATLAS LAr Calorimeter at a High Luminosity LHC
Kielburg-Jeka, A; The ATLAS collaboration
2010-01-01
A new readout driver (ROD) is being developed as a central part of the signal processing of the ATLAS liquid-argon calorimeters for operation at the sLHC. In the architecture of the upgraded readout system, the ROD modules will have several challenging tasks: receiving of up to 1.4 Tb/s of data per board from the detector front-end on multiple high-speed serial links, low-latency data processing, data buffering, and data transmission to the ATLAS trigger and DAQ systems. In order to evaluate the different components, prototype boards in ATCA format equipped with modern Xilinx and Altera FPGAs have been built. We will report on the measured performance of the SERDES devices, the parallel signal processing using DSP slices, the implementation of trigger interfaces, using e.g. multi-Gb Ethernet, as well as the development of the ATCA infrastructure on the ROD prototype modules.
A Readout Driver for the ATLAS LAr Calorimeter at a High Luminosity LHC
Kielburg-Jeka, A
2011-01-01
A new readout driver (ROD) is being developed as a central part of the signal processing of the ATLAS liquid-argon calorimeters for operation at the High Luminosity LHC (HL-LHC). In the architecture of the upgraded readout system, the ROD modules will have several challenging tasks: receiving of up to 1.4 Tb/s of data per board from the detector front-end on multiple high-speed serial links, low-latency data processing, data buffering, and data transmission to the ATLAS trigger and DAQ systems. In order to evaluate the different components, prototype boards in ATCA format equipped with modern Xilinx and Altera FPGAs have been built. We will report on the measured performance of the SERDES devices, the parallel signal processing using DSP slices, the implementation of trigger interfaces, using e.g. multi-Gb Ethernet, as well as the development of the ATCA infrastructure on the ROD prototype modules.
Song, Ho-Juhn; Billeter, Jean-Christophe; Reynaud, Enrique; Carlo, Troy; Spana, Eric P; Perrimon, Norbert; Goodwin, Stephen F; Baker, Bruce S; Taylor, Barbara J
2002-01-01
The fruitless (fru) gene in Drosophila melanogaster is a multifunctional gene that has sex-specific functions in the regulation of male sexual behavior and sex-nonspecific functions affecting adult viability and external morphology. While much attention has focused on fru's sex-specific roles, less
Suzuki, Yusuke; Nagasawa, Ryo; Senpuku, Hidenobu
2017-09-01
Streptococcus mutans produces glucosyltransferases encoded by the gtfB and gtfC genes, which synthesize insoluble glucan, and both insoluble and soluble glucans by conversion of sucrose, and are known as principal agents to provide strong biofilm formation and demineralization on tooth surfaces. S. mutans possess a Com-dependent quorum sensing (QS) system, which is important for survival in severe conditions. The QS system is stimulated by the interaction between ComD {Receptor to competence-stimulating peptide (CSP)} encoded by the comD and CSP encoded by the comC, and importantly associated with bacteriocin production and genetic competence. Previously, we found enzyme fructanase (FruA) as a new inhibitor for the glucan-dependent biofilm formation. In the present study, inhibiting effects by FruA on glucan-independent biofilm formation of S. mutans UA159, UA159.gtfB - , UA159.gtfC - , and UA159.gtfBC - were observed in sucrose and no sucrose sugars-supplemented conditions using the plate assay. The reduction of UA159.comC - and UA159.comD - biofilm formation were also observed as compared with UA159 in same conditions. These results suggested that inhibitions of glucan-independent and Com-dependent biofilm formation were involved in the inhibiting mechanism by FruA. To more thoroughly investigate effects by FruA on the QS system, we examined on CSP-stimulated and Com-dependent bacteriocin production and genetic transformation. FruA inhibited bacteriocin production in collaboration with CSP and genetic transformation in bacterial cell conditions treated with FruA. Our findings show that FruA has multiple effects that inhibit survival functions of S. mutans, including biofilm formation and CSP-dependent QS responses, indicating its potential use as an agent for prevention of dental caries. Copyright © 2017 Japanese Society of Chemotherapy and The Japanese Association for Infectious Diseases. Published by Elsevier Ltd. All rights reserved.
Functional analysis of fructosyl-amino acid oxidases of Aspergillus oryzae.
Akazawa, Shin-Ichi; Karino, Tetsuya; Yoshida, Nobuyuki; Katsuragi, Tohoru; Tani, Yoshiki
2004-10-01
Three active fractions of fructosyl-amino acid oxidase (FAOD-Ao1, -Ao2a, and -Ao2b) were isolated from Aspergillus oryzae strain RIB40. N-terminal and internal amino acid sequences of FAOD-Ao2a corresponded to those of FAOD-Ao2b, suggesting that these two isozymes were derived from the same protein. FAOD-Ao1 and -Ao2 were different in substrate specificity and subunit assembly; FAOD-Ao2 was active toward N(epsilon)-fructosyl N(alpha)-Z-lysine and fructosyl valine (Fru-Val), whereas FAOD-Ao1 was not active toward Fru-Val. The genes encoding the FAOD isozymes (i.e., FAOAo1 and FAOAo2) were cloned by PCR with an FAOD-specific primer set. The deduced amino acid sequences revealed that FAOD-Ao1 was 50% identical to FAOD-Ao2, and each isozyme had a peroxisome-targeting signal-1, indicating their localization in peroxisomes. The genes was expressed in Escherichia coli and rFaoAo2 showed the same characteristics as FAOD-Ao2, whereas rFaoAo1 was not active. FAOAo2 disruptant was obtained by using ptrA as a selective marker. Wild-type strain grew on the medium containing Fru-Val as the sole carbon and nitrogen sources, but strain Delta faoAo2 did not grow. Addition of glucose or (NH(4))(2)SO(4) to the Fru-Val medium did not affect the assimilation of Fru-Val by wild-type, indicating glucose and ammonium repressions did not occur in the expression of the FAOAo2 gene. Furthermore, conidia of the wild-type strain did not germinate on the medium containing Fru-Val and NaNO(2) as the sole carbon and nitrogen sources, respectively, suggesting that Fru-Val may also repress gene expression of nitrite reductase. These results indicated that FAOD is needed for utilization of fructosyl-amino acids as nitrogen sources in A. oryzae.
fruitless alternative splicing and sex behaviour in insects
Indian Academy of Sciences (India)
In Drosophila melanogaster, male courtship requires proteins encoded by the fruitless (fru) gene that are produced in different sex-specific isoforms via alternative splicing. Drosophila mutant flies with loss-of-function alleles of the fru gene exhibit blocked male courtship behaviour. However, various individual steps in the ...
International Nuclear Information System (INIS)
Youn, J.H.; Ader, M.; Bergman, R.N.
1989-01-01
Incorporation of Glc and Fru into glycogen was measured in perfused livers from 24-h fasted rats using [6-3H]Glc and [U-14C]Fru. For the initial 20 min, livers were perfused with low Glc (2 mM) to deplete hepatic glycogen and were perfused for the following 30 min with various combinations of Glc and Fru. With constant Fru (2 mM), increasing perfusate Glc increased the relative contribution of Glc carbons to glycogen (7.2 +/- 0.4, 34.9 +/- 2.8, and 59.1 +/- 2.7% at 2, 10, and 20 mM Glc, respectively; n = 5 for each). During perfusion with substrate levels seen during refeeding (10 mM Glc, 1.8 mumol/g/min gluconeogenic flux from 2 mM Fru), Fru provided 54.7 +/- 2.7% of the carbons for glycogen, while Glc provided only 34.9 +/- 2.8%, consistent with in vivo estimations. However, the estimated rate of Glc phosphorylation was at least 1.10 +/- 0.11 mumol/g/min, which exceeded by at least 4-fold the glycogen accumulation rate (0.28 +/- 0.04 mumol of glucose/g/min). The total rate of glucose 6-phosphate supply via Glc phosphorylation and gluconeogenesis (2.9 mumol/g/min) exceeded reported in vivo rates of glycogen accumulation during refeeding. Thus, in perfused livers of 24-h fasted rats there is an apparent redundancy in glucose 6-phosphate supply. These results suggest that the rate-limiting step for hepatic glycogen accumulation during refeeding is located between glucose 6-phosphate and glycogen, rather than at the step of Glc phosphorylation or in the gluconeogenic pathway
Novellasdemunt, Laura; Tato, Irantzu; Navarro-Sabate, Aurea; Ruiz-Meana, Marisol; Méndez-Lucas, Andrés; Perales, Jose Carlos; Garcia-Dorado, David; Ventura, Francesc; Bartrons, Ramon; Rosa, Jose Luis
2013-01-01
Reciprocal regulation of metabolism and signaling allows cells to modulate their activity in accordance with their metabolic resources. Thus, amino acids could activate signal transduction pathways that control cell metabolism. To test this hypothesis, we analyzed the effect of amino acids on fructose-2,6-bisphosphate (Fru-2,6-P2) metabolism. We demonstrate that amino acids increase Fru-2,6-P2 concentration in HeLa and in MCF7 human cells. In conjunction with this, 6-phosphofructo-2-kinase activity, glucose uptake, and lactate concentration were increased. These data correlate with the specific phosphorylation of heart 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase (PFKFB2) isoenzyme at Ser-483. This activation was mediated by the PI3K and p38 signaling pathways. Furthermore, Akt inactivation blocked PFKFB2 phosphorylation and Fru-2,6-P2 production, thereby suggesting that the above signaling pathways converge at Akt kinase. In accordance with these results, kinase assays showed that amino acid-activated Akt phosphorylated PFKFB2 at Ser-483 and that knockdown experiments confirmed that the increase in Fru-2,6-P2 concentration induced by amino acids was due to PFKFB2. In addition, similar effects on Fru-2,6-P2 metabolism were observed in freshly isolated rat cardiomyocytes treated with amino acids, which indicates that these effects are not restricted to human cancer cells. In these cardiomyocytes, the glucose consumption and the production of lactate and ATP suggest an increase of glycolytic flux. Taken together, these results demonstrate that amino acids stimulate Fru-2,6-P2 synthesis by Akt-dependent PFKFB2 phosphorylation and activation and show how signaling and metabolism are inextricably linked. PMID:23457334
Directory of Open Access Journals (Sweden)
Nicole R. Newell
2016-08-01
Full Text Available Male and female reproductive behaviors in Drosophila melanogaster are vastly different, but neurons that express sex-specifically spliced fruitless transcripts (fru P1 underlie these behaviors in both sexes. How this set of neurons can generate such different behaviors between the two sexes is an unresolved question. A particular challenge is that fru P1-expressing neurons comprise only 2–5% of the adult nervous system, and so studies of adult head tissue or whole brain may not reveal crucial differences. Translating Ribosome Affinity Purification (TRAP identifies the actively translated pool of mRNAs from fru P1-expressing neurons, allowing a sensitive, cell-type-specific assay. We find four times more male-biased than female-biased genes in TRAP mRNAs from fru P1-expressing neurons. This suggests a potential mechanism to generate dimorphism in behavior. The male-biased genes may direct male behaviors by establishing cell fate in a similar context of gene expression observed in females. These results suggest a possible global mechanism for how distinct behaviors can arise from a shared set of neurons.
The upgrade for the data acquisition system of the KOTO detector
Energy Technology Data Exchange (ETDEWEB)
Tecchio, M., E-mail: tecchio@umich.edu [University of Michigan, Ann Arbor, MI (United States); Beechert, J.; Campbell, M. [University of Michigan, Ann Arbor, MI (United States); Huff, M. [Kenyon College, Gambier, OH (United States); Micallef, J.; Rymph, C.; Schamis, H.; Su, S. [University of Michigan, Ann Arbor, MI (United States); Xu, J. [Apple Inc., Cupertino, CA (United States)
2016-07-11
A major upgrade to the KOTO detector data acquisition system based on the ATCA standard is being considered. The ATCA standard provides a natural solution to the current KOTO constraints, including communication between boards and higher input and output bandwidth.
The upgrade for the data acquisition system of the KOTO detector
International Nuclear Information System (INIS)
Tecchio, M.; Beechert, J.; Campbell, M.; Huff, M.; Micallef, J.; Rymph, C.; Schamis, H.; Su, S.; Xu, J.
2016-01-01
A major upgrade to the KOTO detector data acquisition system based on the ATCA standard is being considered. The ATCA standard provides a natural solution to the current KOTO constraints, including communication between boards and higher input and output bandwidth.
DEFF Research Database (Denmark)
Lundt, Inge; Yu, Shukun
2010-01-01
1,5-Anhydro-D-fructose (1,5AnFru) is a monoketosaccharide that can be prepared enzymatically from starch by a-1,4-glucan lyase or chemically from D-glucose or D-fructose in a few steps with high yields. The formed 1,5AnFru can be derivatized both enzymatically and chemically to interesting new...
Fifty years of crop protection, 1950-2000
Zadoks, J.C.
2002-01-01
We detected the presence of fructosamine in human and bovine semen. In seminal plasma of healthy normozoospermic men (N = 17) fructosamine was found in 53% of the cases (fru+). In fru+ semen samples the concentration of fructosamine was (mean ± S.E.M., N = 9) 0.45 ± 0.09 mmol/L and varied from 0.15
He, Chunjuan; Yang, Yirui; Zhao, Renfei; Qu, Jingyao; Jin, Lan; Lu, Lili; Xu, Li; Xiao, Min
2018-04-01
Levansucrases, which belong to the glycoside hydrolase family 68 (GH68), synthesize β (2-6)-linked fructan levan with sucrose as substrate. We described the use of a levansucrase (Bl_SacB) from Bacillus licheniformis 8-37-0-1 for catalysis of fructosyl transfer to obtain high levan yield previously. In the present study, six variants (Y246A, N251A, K372A, R369A, R369S, and R369K) were constructed through sequence alignment and structural analysis to explore the synthesis mechanism of Bl_SacB. The selected residues were predicted to localize to the substrate-entering channel of the active cavity and close to or remote from the catalytic triad. The products of these variants ranged from homopolymers levan to fructo-oligosaccharides (FOSs). The primary FOSs were identified through MS and NMR analyses as neolevan-type neokestose [β-D-Fru-(2-6)-α-D-Glc-(1-2)-β-D-Fru], levan-type 6-kestose [β-D-Fru-(2-6)-β-D-Fru-(2-1)-α-D-Glc], and inulin-type 1-kestose [β-D-Fru-(2-1)-β-D-Fru-(2-1)-α-D-Glc]. The mutation at Tyr 246 located remote from the catalytic triad led to the production of short-chain oligosaccharides with degree of polymerization (DP) of up to 25. The replaced Arg 369 located close to the catalytic triad resulted in either elimination of polysaccharide synthesis or complete change in the dominant linkage of the products. The Michaelis constants (K m ) of Y246A, N251A, K372A, and R369K were found to be similar to that of the wild type (WT). However, the turnover number (k cat ) and the value of transfructosylation versus hydrolysis activity of the six variants decreased compared with those of the WT. Hence, the residues located on the surface of the substrate-entering channel of Bl_SacB can be critical in product linkage type and/or elongation mechanism.
Software for Data Acquisition AMC Module with PCI Express Interface
Szachowalow, S; Makowski, D; Butkowski, L
2010-01-01
Free Electron Laser in Hamburg (FLASH) and XRay Free Electron Laser (XFEL) are linear accelerators that require a complex and accurate Low Level Radio Frequency (LLRF) control system. Currently working systems are based on aged Versa Module Eurocard (VME) architecture. One of the alternatives for the VME bus is the Advanced Telecommunications and Computing Architecture (ATCA) standard. The ATCA based LLRF controller mainly consists of a few ATCA carrier boards and several Advanced Mezzanine Cards (AMC). AMC modules are available in variety of functions such as: ADC, DAC, data storage, data links and even CPU cards. This paper focuses on the software that allows user to collect and plot the data from commercially available TAMC900 board.
Journal of Astrophysics and Astronomy | Indian Academy of Sciences
Indian Academy of Sciences (India)
Using 1.4 GHz ATCA & VLA images with 5.5 GHz ATCA data, we present a sample of 12 bent-tailed galaxies over the 4 deg2 area of the Chandra Deep Field South (CDFS). We find 10 new sources, one of which is possibly the highest red-shift bent-tailed galaxy detected at ∼ 2.
Kato, Merii; Tanase, Tomoaki; Mikuriya, Masahiro
2006-04-03
Reactions of CuX2.nH2O with the biscarboxylate ligand XDK (H2XDK = m-xylenediamine bis(Kemp's triacid imide)) in the presence of N-donor auxiliary ligands yielded a series of dicopper(II) complexes, [Cu2(mu-OH)(XDK)(L)2]X (L = N,N,N',N'-tetramethylethylenediamine (tetmen), X = NO3 (1a), Cl (1b); L = N,N,N'-trimethylethylenediamine (tmen), X = NO3 (2a), Cl (2b); L =2,2'-bipyridine (bpy), X = NO3 (3); L = 1,10-phenanthroline (phen), X = NO3 (4); L = 4,4'-dimethyl-2,2'-bipyridine (Me2bpy), X = NO3 (5); L = 4-methyl-1,10-phenanthroline (Mephen), X = NO3 (6)). Complexes 1-6 were characterized by X-ray crystallography (Cu...Cu = 3.1624(6)-3.2910(4) A), and the electrochemical and magnetic properties were also examined. Complexes 3 and 4 readily reacted with diphenyl phosphoric acid (HDPP) or bis(4-nitrophenyl) phosphoric acid (HBNPP) to give [Cu2(mu-phosphate)(XDK)(L)2]NO3 (L = bpy, phosphate = DPP (11); L = phen, phosphate = DPP (12), BNPP (13)), where the phsophate diester bridges the two copper ions in a mu-1,3-O,O' bidentate fashion (Cu...Cu = 4.268(3)-4.315(1) A). Complexes 4 and 6 with phen and Mephen have proven to be good precursors to accommodate a series of sugar monophosphate esters (Sugar-P) onto the biscarboxylate-bridged dicopper centers, yielding [Cu2(mu-Sugar-P)(XDK)(L)2] (Sugar-P = alpha-D-Glc-1-P (23a and b), D-Glc-6-P (24a and b), D-Man-6-P (25a), D-Fru-6-P (26a and b); L = phen (a), Mephen (b)) and [Cu2(mu-Gly-n-P)(XDK)(Mephen)2] (Gly-n-P = glycerol n-phosphate; n = 2 (21), 3 (22)), where Glc, Man, and Fru are glucose, mannose, and fructose, respectively. The structure of [Cu2(mu-MNPP)(XDK)(phen)2(CH3OH)] (20) was characterized as a reference compound (H2MNPP = 4-nitrophenyl phosphoric acid). Complexes 4 and 6 also reacted with d-fructose 1,6-bisphosphate (D-Fru-1,6-P2) to afford the tetranuclear copper(II) complexes formulated as [Cu4(mu-D-Fru-1,6-P2)(XDK)2(L)4] (L = phen (27a), Mephen (27b)). The detailed structure of 27a was determined by X
But, Sergey Y; Solntseva, Natalia P; Egorova, Svetlana V; Mustakhimov, Ildar I; Khmelenina, Valentina N; Reshetnikov, Alexander; Trotsenko, Yuri A
2018-05-01
Four enzymes involved in sucrose metabolism: sucrose phosphate synthase (Sps), sucrose phosphate phosphatase (Spp), sucrose synthase (Sus) and fructokinase (FruK), were obtained as his-tagged proteins from the moderately thermophilic methanotroph Methylocaldum szegediense O12. Sps, Spp, FruK and Sus demonstrated biochemical properties similar to those of other bacterial counterparts, but the translated amino acid sequences of Sps and Spp displayed high divergence from the respective microbial enzymes. The Sus of M. szegediense O12 catalyzed the reversible reaction of sucrose cleavage in the presence of ADP or UDP and preferred ADP as a substrate, thus implying a connection between sucrose and glycogen metabolism. Sus-like genes were found only in a few methanotrophs, whereas amylosucrase was generally used in sucrose cleavage in this group of bacteria. Like other microbial fructokinases, FruK of M. szegediense O12 showed a high specificity to fructose.
International Nuclear Information System (INIS)
Kazakov, Artem; Furukawa, Kazuro
2010-01-01
Requirements for modern and future control systems for large projects like International Linear Collider demand high availability for control system components. Recently telecom industry came up with a great open hardware specification - Advanced Telecom Computing Architecture (ATCA). This specification is aimed for better reliability, availability and serviceability. Since its first market appearance in 2004, ATCA platform has shown tremendous growth and proved to be stable and well represented by a number of vendors. ATCA is an industry standard for highly available systems. On the other hand Service Availability Forum, a consortium of leading communications and computing companies, describes interaction between hardware and software. SAF defines a set of specifications such as Hardware Platform Interface, Application Interface Specification. SAF specifications provide extensive description of highly available systems, services and their interfaces. Originally aimed for telecom applications, these specifications can be used for accelerator controls software as well. This study describes benefits of using these specifications and their possible adoption to accelerator control systems. It is demonstrated how EPICS Redundant IOC was extended using Hardware Platform Interface specification, which made it possible to utilize benefits of the ATCA platform.
Tang, Qingling; Fenton, Aron W
2017-09-01
Many studies of allosteric mechanisms use limited numbers of mutations to test whether residues play "key" roles. However, if a large percentage of the protein contributes to allosteric function, mutating any residue would have a high probability of modifying allostery. Thus, a predicted mechanism that is dependent on only a few residues could erroneously appear to be supported. We used whole-protein alanine-scanning mutagenesis to determine which amino acid sidechains of human liver pyruvate kinase (hL-PYK; approved symbol PKLR) contribute to regulation by fructose-1,6-bisphosphate (Fru-1,6-BP; activator) and alanine (inhibitor). Each nonalanine/nonglycine residue of hL-PYK was mutated to alanine to generate 431 mutant proteins. Allosteric functions in active proteins were quantified by following substrate affinity over a concentration range of effectors. Results show that different residues contribute to the two allosteric functions. Only a small fraction of mutated residues perturbed inhibition by alanine. In contrast, a large percentage of mutated residues influenced activation by Fru-1,6-BP; inhibition by alanine is not simply the reverse of activation by Fru-1,6-BP. Moreover, the results show that Fru-1,6-BP activation would be extremely difficult to elucidate using a limited number of mutations. Additionally, this large mutational data set will be useful to train and test computational algorithms aiming to predict allosteric mechanisms. © 2017 Wiley Periodicals, Inc.
International Nuclear Information System (INIS)
Duran, Joan; Navarro-Sabate, Aurea; Pujol, Anna; Perales, Jose C.; Manzano, Anna; Obach, Merce; Gomez, Marta; Bartrons, Ramon
2008-01-01
Fructose 2,6-bisphosphate (Fru-2,6-P 2 ) is an important metabolite that controls glycolytic and gluconeogenic pathways in several cell types. Its synthesis and degradation are catalyzed by the bifunctional enzyme 6-phosphofructo-2-kinase/fructose 2,6-bisphosphatase (PFK-2). Four genes, designated Pfkfb1-4, codify the different PFK-2 isozymes. The Pfkfb3 gene product, ubiquitous PFK-2 (uPFK-2), has the highest kinase/bisphosphatase activity ratio and is associated with proliferation and tumor metabolism. A transgenic mouse model that overexpresses uPFK-2 under the control of the phosphoenolpyruvate carboxykinase promoter was designed to promote sustained and elevated Fru-2,6-P 2 levels in the liver. Our results demonstrate that in diet-induced obesity, high Fru-2,6-P 2 levels in transgenic livers caused changes in hepatic gene expression profiles for key gluconeogenic and lipogenic enzymes, as well as an accumulation of lipids in periportal cells, and weight gain
Design of eight-channel ADC card for GHz signal conversion
Habib, Samer Bou; Jalmuzna, Wojciech; Jezynski, Tomasz
2011-01-01
This paper describes the design of an eight-channel ATCA card suited for direct analog-to-digital conversion of 1.3 GHz signals with a maximum ADC clock frequency of 500 MHz. The undersampling operation is used for signal conversion. This card was designed for the needs of the LLRF system of the FLASH and XFEL accelerators. The designed module consists of a main ATCA board with eight ADCs, FPGA unit, memory, power supply and diagnostic circuits. The main ATCA card allows connecting a daughter board with IPMI, CPU and fast interfaces for communication purposes. This paper describes such issues as system organization allowing acquisition of data at such high data rates, circuit synchronization by high-quality clock signals, CPU and connectivity features, 20-layer PCB design and techniques used for high-frequency signals transmission and matching.
Chou, Chu-Lin; Pang, Cheng-Yoong; Lee, Tony J F; Fang, Te-Chao
2015-01-01
Besides regulating calcium homeostasis, the effects of vitamin D on vascular tone and metabolic disturbances remain scarce in the literature despite an increase intake with high-fructose corn syrup worldwide. We investigated the effects of calcitriol, an active form of vitamin D, on vascular relaxation, glucose tolerance, and visceral fat pads in fructose-fed rats. Male Wistar-Kyoto rats were divided into 4 groups (n = 6 per group). Group Con: standard chow diet for 8 weeks; Group Fru: high-fructose diet (60% fructose) for 8 weeks; Group Fru-HVD: high-fructose diet as Group Fru, high-dose calcitriol treatment (20 ng / 100 g body weight per day) 4 weeks after the beginning of fructose feeding; and Group Fru-LVD: high-fructose diet as Group Fru, low-dose calcitriol treatment (10 ng / 100 g body weight per day) 4 weeks after the beginning of fructose feeding. Systolic blood pressure was measured twice a week by the tail-cuff method. Blood was examined for serum ionized calcium, phosphate, creatinine, glucose, triglycerides, and total cholesterol. Intra-peritoneal glucose intolerance test, aortic vascular reactivity, the weight of visceral fat pads, adipose size, and adipose angiotensin II levels were analyzed at the end of the study. The results showed that the fructose-fed rats significantly developed hypertension, impaired glucose tolerance, heavier weight and larger adipose size of visceral fat pads, and raised adipose angiotensin II expressions compared with the control rats. High- and low-dose calcitriol reduced modestly systolic blood pressure, increased endothelium-dependent aortic relaxation, ameliorated glucose intolerance, reduced the weight and adipose size of visceral fat pads, and lowered adipose angiotensin II expressions in the fructose-fed rats. However, high-dose calcitriol treatment mildly increased serum ionized calcium levels (1.44 ± 0.05 mmol/L). These results suggest a protective role of calcitriol treatment on endothelial function, glucose
Directory of Open Access Journals (Sweden)
Chu-Lin Chou
Full Text Available Besides regulating calcium homeostasis, the effects of vitamin D on vascular tone and metabolic disturbances remain scarce in the literature despite an increase intake with high-fructose corn syrup worldwide. We investigated the effects of calcitriol, an active form of vitamin D, on vascular relaxation, glucose tolerance, and visceral fat pads in fructose-fed rats. Male Wistar-Kyoto rats were divided into 4 groups (n = 6 per group. Group Con: standard chow diet for 8 weeks; Group Fru: high-fructose diet (60% fructose for 8 weeks; Group Fru-HVD: high-fructose diet as Group Fru, high-dose calcitriol treatment (20 ng / 100 g body weight per day 4 weeks after the beginning of fructose feeding; and Group Fru-LVD: high-fructose diet as Group Fru, low-dose calcitriol treatment (10 ng / 100 g body weight per day 4 weeks after the beginning of fructose feeding. Systolic blood pressure was measured twice a week by the tail-cuff method. Blood was examined for serum ionized calcium, phosphate, creatinine, glucose, triglycerides, and total cholesterol. Intra-peritoneal glucose intolerance test, aortic vascular reactivity, the weight of visceral fat pads, adipose size, and adipose angiotensin II levels were analyzed at the end of the study. The results showed that the fructose-fed rats significantly developed hypertension, impaired glucose tolerance, heavier weight and larger adipose size of visceral fat pads, and raised adipose angiotensin II expressions compared with the control rats. High- and low-dose calcitriol reduced modestly systolic blood pressure, increased endothelium-dependent aortic relaxation, ameliorated glucose intolerance, reduced the weight and adipose size of visceral fat pads, and lowered adipose angiotensin II expressions in the fructose-fed rats. However, high-dose calcitriol treatment mildly increased serum ionized calcium levels (1.44 ± 0.05 mmol/L. These results suggest a protective role of calcitriol treatment on endothelial
In vivo NMR spectroscopy of ripening avocado
International Nuclear Information System (INIS)
Bennett, A.B.; Smith, G.M.; Nichols, B.
1987-01-01
Ripening of avocado fruit is associated with a dramatic increase in respiration. Previous studies have indicated that the increase in respiration is brought about by activation of the glycolytic reaction catalyzing the conversion of fructose-6-phosphate to fructose 1,6-bisphosphate. The authors reinvestigated the proposed role of glycolytic regulation in the respiratory increase using in vivo 31 P nuclear magnetic resonance (NMR) spectroscopy using an external surface coil and analysis of phosphofructokinase (PFK), phosphofructophosphotransferase (PFP), and fructose 2,6-bisphosphate (fru 2,6-P 2 ) levels in ripening avocado fruit. In vivo 31 P NMR spectroscopy revealed large increases in ATP levels accompanying the increase in respiration. Both glycolytic enzymes, PFK and PFP, were present in avocado fruit, with the latter activity being highly stimulated by fru 2,6-P 2 . Fructose 2,6-bisphosphate levels increased approximately 90% at the onset of ripening, indicating that the respiratory increase in ripening avocado may be regulated by the activation of PFP brought about by an increase in fru 2,6-P 2
Bhandari, Raj K; Oda, Robert P; Petrikovics, Ilona; Thompson, David E; Brenner, Matthew; Mahon, Sari B; Bebarta, Vikhyat S; Rockwood, Gary A; Logue, Brian A
2014-05-01
Cyanide causes toxic effects by inhibiting cytochrome c oxidase, resulting in cellular hypoxia and cytotoxic anoxia, and can eventually lead to death. Cyanide exposure can be verified by direct analysis of cyanide concentrations or analyzing its metabolites, including thiocyanate (SCN(-)) and 2-amino-2-thiazoline-4-carboxylic acid (ATCA) in blood. To determine the behavior of these markers following cyanide exposure, a toxicokinetics study was performed in three animal models: (i) rats (250-300 g), (ii) rabbits (3.5-4.2 kg) and (iii) swine (47-54 kg). Cyanide reached a maximum in blood and declined rapidly in each animal model as it was absorbed, distributed, metabolized and eliminated. Thiocyanate concentrations rose more slowly as cyanide was enzymatically converted to SCN(-). Concentrations of ATCA did not rise significantly above the baseline in the rat model, but rose quickly in rabbits (up to a 40-fold increase) and swine (up to a 3-fold increase) and then fell rapidly, generally following the relative behavior of cyanide. Rats were administered cyanide subcutaneously and the apparent half-life (t1/2) was determined to be 1,510 min. Rabbits were administered cyanide intravenously and the t1/2 was determined to be 177 min. Swine were administered cyanide intravenously and the t1/2 was determined to be 26.9 min. The SCN(-) t1/2 in rats was 3,010 min, but was not calculated in rabbits and swine because SCN(-) concentrations did not reach a maximum. The t1/2 of ATCA was 40.7 and 13.9 min in rabbits and swine, respectively, while it could not be determined in rats with confidence. The current study suggests that cyanide exposure may be verified shortly after exposure by determining significantly elevated cyanide and SCN(-) in each animal model and ATCA may be used when the ATCA detoxification pathway is significant.
Vio, R.; Vergès, C.; Andreani, P.
2017-08-01
The matched filter (MF) is one of the most popular and reliable techniques to the detect signals of known structure and amplitude smaller than the level of the contaminating noise. Under the assumption of stationary Gaussian noise, MF maximizes the probability of detection subject to a constant probability of false detection or false alarm (PFA). This property relies upon a priori knowledge of the position of the searched signals, which is usually not available. Recently, it has been shown that when applied in its standard form, MF may severely underestimate the PFA. As a consequence the statistical significance of features that belong to noise is overestimated and the resulting detections are actually spurious. For this reason, an alternative method of computing the PFA has been proposed that is based on the probability density function (PDF) of the peaks of an isotropic Gaussian random field. In this paper we further develop this method. In particular, we discuss the statistical meaning of the PFA and show that, although useful as a preliminary step in a detection procedure, it is not able to quantify the actual reliability of a specific detection. For this reason, a new quantity is introduced called the specific probability of false alarm (SPFA), which is able to carry out this computation. We show how this method works in targeted simulations and apply it to a few interferometric maps taken with the Atacama Large Millimeter/submillimeter Array (ALMA) and the Australia Telescope Compact Array (ATCA). We select a few potential new point sources and assign an accurate detection reliability to these sources.
Directory of Open Access Journals (Sweden)
Juan Bao
2018-01-01
Full Text Available An early warning on the highway will effectively reduce traffic accidents. Considering the influence of an abandoned object on driving behavior, a Visual-based Asymmetric Two-lane Cellular Automata model with Abandoned Object (V-ATCA-AO and an Internet-of-Vehicles-based Asymmetric Two-lane Cellular Automata model with Abandoned Object (IoV-ATCA-AO are proposed. Based on the two models, two types of traffic accidents caused by an abandoned object are analyzed: rear-end collision caused by the abandoned object ahead and collision of the vehicle with the abandoned object. Simulation results show the following: (1 the accidents occur when the road density is smaller, while the accidents will not occur when the density is larger. The results are different from the rear-end collision rate curve without abandoned object in a single lane. (2 Compared with the visual-based avoidance pattern in V-ATCA-AO, the Internet-of-Vehicles-based avoidance pattern in IoV-ATCA-AO can create an early warning for the abandoned object and tell the vehicle to make an earlier lane change and decelerate in advance, thereby significantly reducing the accident rate. (3 Spatiotemporal characteristics in front of the abandoned object directly affect the accident rate: the less the “stability” of a traffic jam in front of the abandoned object, the higher the accident rate.
Revisiting Frequency Reuse towards Supporting Ultra-Reliable Ubiquitous-Rate Communication
DEFF Research Database (Denmark)
Park, Jihong; Kim, Dong Min; Popovski, Petar
2017-01-01
One of the goals of 5G wireless systems stated by the NGMN alliance is to provide moderate rates (50+ Mbps) everywhere and with very high reliability. We term this service Ultra-Reliable Ubiquitous-Rate Communication (UR2C). This paper investigates the role of frequency reuse in supporting UR2C...... in the downlink. To this end, two frequency reuse schemes are considered: user-specific frequency reuse (FRu) and BS-specific frequency reuse (FRb). For a given unit frequency channel, FRu reduces the number of serving user equipments (UEs), whereas FRb directly decreases the number of interfering base stations...
International Linear Collider Accelerator Physics R and D
International Nuclear Information System (INIS)
Gollin, George D.; Davidsaver, Michael; Haney, Michael J.; Kasten, Michael; Chang, Jason; Chodash, Perry; Dluger, Will; Lang, Alex; Liu, Yehan
2008-01-01
to an event at the beginning of the run. We determined that the device installed in our beam, which was instrumented with an 8-bit 500 MHz ADC, could measure the beam timing to an accuracy of 0.4 picoseconds. Simulations of the device showed that an increase in ADC clock rate to 2 GHz would improve measurement precision by the required factor of four. As a result, we felt that a device of this sort, assuming matters concerning dynamic range and long-term stability can be addressed successfully, would work at the ILC. Cost effective operation of the ILC will demand highly reliable, fault tolerant and adaptive solutions for both hardware and software. The large numbers of subsystems and large multipliers associated with the modules in those subsystems will cause even a strong level of unit reliability to become an unacceptable level of system availability. An evaluation effort is underway to evaluate standards associated with high availability, and to guide ILC development with standard practices and well-supported commercial solutions. One area of evaluation involves the Advanced Telecom Computing Architecture (ATCA) hardware and software. We worked with an ATCA crate, processor monitors, and a small amount of ATCA circuit boards in order to develop a backplane 'spy' board that would let us watch the ATCA backplane communications and pursue development of an inexpensive processor monitor that could be used as a physics-driven component of the crate-level controls system. We made good progress, and felt that we had determined a productive direction to extend this work. We felt that we had learned enough to begin designing a workable processor monitor chip if there were to be sufficient interest in ATCA shown by the ILC community. Fault recognition is a challenging issue in the crafting a high reliability controls system. With tens of thousands of independent processors running hundreds of thousands of critical processes, how can the system identify that a problem has
Directory of Open Access Journals (Sweden)
Miguel Ángel SÁNCHEZ-MADRIGAL
Full Text Available Abstract The effects of ultrasound-assisted extraction (UAE at different ultrasound power densities (UPDs; 40, 80, and 120 mW/mL and solid:liquid (S:L ratio (1:2, 1:3, and 1:6 on the extraction of carbohydrates from Agave tequilana plant of different ages were evaluated. Extracts obtained (6- and 7-year-old plant were analyzed in the yield of carbohydrates (YC, fructan (FRU content, simple sugars, fructan profile and the average degree of polymerization (DPn. UPD, S:L ratio, and plant age all affected YC, FRU, and DPn. Maximum YC and FRU were obtained from the older agave with UPD and S:L ratio of 120 mW/mL and 1:6, respectively; while glucose, fructose, and sucrose were highly released from the younger plant. Agave of 7-year-old presented the highest DPn. Fructan degradation occurred at high UPD, increasing the simple sugars and decreasing the DPn. Thermal-traditional extraction without sonication caused more fructan degradation; and overall, ultrasound enhanced fructan extraction and minimized fructan damage, representing a technological alternative for fructan extraction from agave.
Crystal structure and hydrogen bonding in N-(1-deoxy-β-d-fructopyranos-1-yl-2-aminoisobutyric acid
Directory of Open Access Journals (Sweden)
Valeri V. Mossine
2018-01-01
Full Text Available The title compound, alternatively called d-fructose-2-aminoisobutyric acid (FruAib, C10H19NO7, (I, crystallizes exclusively in the β-pyranose form, with two conformationally non-equivalent molecules [(IA and (IB] in the asymmetric unit. In solution, FruAib establishes an equilibrium, with 75.6% of the population consisting of β-pyranose, 10.4% β-furanose, 10.1% α-furanose, 3.0% α-pyranose and <0.7% the acyclic forms. The carbohydrate ring in (I has the normal 2C5 chair conformation and the amino acid portion is in the zwitterion form. Bond lengths and valence angles compare well with the average values from related pyranose structures. All carboxyl, hydroxy and ammonium groups are involved in hydrogen bonding and form a three-dimensional network of infinite chains that are connected through homodromic rings and short chains. Intramolecular hydrogen bonds bridge the amino acid and sugar portions in both molecules. A comparative Hirshfeld surfaces analysis of FruAib and four other sugar–amino acids suggests an increasing role of intramolecular heteroatom interactions in crystal structures with an increasing proportion of C—H bonds.
Evidence for view-invariant face recognition units in unfamiliar face learning.
Etchells, David B; Brooks, Joseph L; Johnston, Robert A
2017-05-01
Many models of face recognition incorporate the idea of a face recognition unit (FRU), an abstracted representation formed from each experience of a face which aids recognition under novel viewing conditions. Some previous studies have failed to find evidence of this FRU representation. Here, we report three experiments which investigated this theoretical construct by modifying the face learning procedure from that in previous work. During learning, one or two views of previously unfamiliar faces were shown to participants in a serial matching task. Later, participants attempted to recognize both seen and novel views of the learned faces (recognition phase). Experiment 1 tested participants' recognition of a novel view, a day after learning. Experiment 2 was identical, but tested participants on the same day as learning. Experiment 3 repeated Experiment 1, but tested participants on a novel view that was outside the rotation of those views learned. Results revealed a significant advantage, across all experiments, for recognizing a novel view when two views had been learned compared to single view learning. The observed view invariance supports the notion that an FRU representation is established during multi-view face learning under particular learning conditions.
Protection device for a thermonuclear device
International Nuclear Information System (INIS)
Kawashima, Shuichi.
1986-01-01
Purpose: To exactly detect the void coefficients of coolants even under high magnetic fields thereby detect the overheat of a thermonuclear device at an early stage. Constitution: The protecting device of this invention comprises a laser beam generation device, a laser beam detection device and an accident detection device. The laser generation device always generates laser beams, which are permeated through coolants and detected by the laser beam detection device, the optical amount of which is transmitted to the accident detection device. The accident detection device judges the excess or insufficiency of the detected optical amount with respect to the optical amount of the laser beams under the stationary state as a reference and issues an accident signal. Since only the optical cables that do not undergo the effect of the magnetic fields are exposed to high magnetic fields in the protection device of this invention, a high reliability can be maintained. (Kamimura, M.)
Hardware trigger processor for the MDT system
AUTHOR|(SzGeCERN)757787; The ATLAS collaboration; Hazen, Eric; Butler, John; Black, Kevin; Gastler, Daniel Edward; Ntekas, Konstantinos; Taffard, Anyes; Martinez Outschoorn, Verena; Ishino, Masaya; Okumura, Yasuyuki
2017-01-01
We are developing a low-latency hardware trigger processor for the Monitored Drift Tube system in the Muon spectrometer. The processor will fit candidate Muon tracks in the drift tubes in real time, improving significantly the momentum resolution provided by the dedicated trigger chambers. We present a novel pure-FPGA implementation of a Legendre transform segment finder, an associative-memory alternative implementation, an ARM (Zynq) processor-based track fitter, and compact ATCA carrier board architecture. The ATCA architecture is designed to allow a modular, staged approach to deployment of the system and exploration of alternative technologies.
Device-Centric Monitoring for Mobile Device Management
Directory of Open Access Journals (Sweden)
Luke Chircop
2016-03-01
Full Text Available The ubiquity of computing devices has led to an increased need to ensure not only that the applications deployed on them are correct with respect to their specifications, but also that the devices are used in an appropriate manner, especially in situations where the device is provided by a party other than the actual user. Much work which has been done on runtime verification for mobile devices and operating systems is mostly application-centric, resulting in global, device-centric properties (e.g. the user may not send more than 100 messages per day across all applications being difficult or impossible to verify. In this paper we present a device-centric approach to runtime verify the device behaviour against a device policy with the different applications acting as independent components contributing to the overall behaviour of the device. We also present an implementation for Android devices, and evaluate it on a number of device-centric policies, reporting the empirical results obtained.
Energy Technology Data Exchange (ETDEWEB)
Carvalho, Ivo S., E-mail: ivoc@ipfn.ist.utl.pt; Duarte, Paulo; Fernandes, Horácio; Valcárcel, Daniel F.; Carvalho, Pedro J.; Silva, Carlos; Duarte, André S.; Neto, André; Sousa, Jorge; Batista, António J.N.; Hekkert, Tiago; Carvalho, Bernardo B.
2014-03-15
Highlights: • All real-time diagnostics and actuators were integrated in the same control platform. • A 100 μs control cycle was achieved under the MARTe framework. • Time-windows based control with several event-driven control strategies implemented. • AC discharges with exception handling on iron core flux saturation. • An HTML discharge configuration was developed for configuring the MARTe system. - Abstract: The ISTTOK tokamak was upgraded with a plasma control system based on the Advanced Telecommunications Computing Architecture (ATCA) standard. This control system was designed to improve the discharge stability and to extend the operational space to the alternate plasma current (AC) discharges as part of the ISTTOK scientific program. In order to accomplish these objectives all ISTTOK diagnostics and actuators relevant for real-time operation were integrated in the control system. The control system was programmed in C++ over the Multi-threaded Application Real-Time executor (MARTe) which provides, among other features, a real-time scheduler, an interrupt handler, an intercommunications interface between code blocks and a clearly bounded interface with the external devices. As a complement to the MARTe framework, the BaseLib2 library provides the foundations for the data, code introspection and also a Hypertext Transfer Protocol (HTTP) server service. Taking advantage of the modular nature of MARTe, the algorithms of each diagnostic data processing, discharge timing, context switch, control and actuators output reference generation, run on well-defined blocks of code named Generic Application Module (GAM). This approach allows reusability of the code, simplified simulation, replacement or editing without changing the remaining GAMs. The ISTTOK control system GAMs run sequentially each 100 μs cycle on an Intel{sup ®} Q8200 4-core processor running at 2.33 GHz located in the ATCA crate. Two boards (inside the ATCA crate) with 32 analog
International Nuclear Information System (INIS)
Carvalho, Ivo S.; Duarte, Paulo; Fernandes, Horácio; Valcárcel, Daniel F.; Carvalho, Pedro J.; Silva, Carlos; Duarte, André S.; Neto, André; Sousa, Jorge; Batista, António J.N.; Hekkert, Tiago; Carvalho, Bernardo B.
2014-01-01
Highlights: • All real-time diagnostics and actuators were integrated in the same control platform. • A 100 μs control cycle was achieved under the MARTe framework. • Time-windows based control with several event-driven control strategies implemented. • AC discharges with exception handling on iron core flux saturation. • An HTML discharge configuration was developed for configuring the MARTe system. - Abstract: The ISTTOK tokamak was upgraded with a plasma control system based on the Advanced Telecommunications Computing Architecture (ATCA) standard. This control system was designed to improve the discharge stability and to extend the operational space to the alternate plasma current (AC) discharges as part of the ISTTOK scientific program. In order to accomplish these objectives all ISTTOK diagnostics and actuators relevant for real-time operation were integrated in the control system. The control system was programmed in C++ over the Multi-threaded Application Real-Time executor (MARTe) which provides, among other features, a real-time scheduler, an interrupt handler, an intercommunications interface between code blocks and a clearly bounded interface with the external devices. As a complement to the MARTe framework, the BaseLib2 library provides the foundations for the data, code introspection and also a Hypertext Transfer Protocol (HTTP) server service. Taking advantage of the modular nature of MARTe, the algorithms of each diagnostic data processing, discharge timing, context switch, control and actuators output reference generation, run on well-defined blocks of code named Generic Application Module (GAM). This approach allows reusability of the code, simplified simulation, replacement or editing without changing the remaining GAMs. The ISTTOK control system GAMs run sequentially each 100 μs cycle on an Intel ® Q8200 4-core processor running at 2.33 GHz located in the ATCA crate. Two boards (inside the ATCA crate) with 32 analog
International Nuclear Information System (INIS)
Zhao Jingzhou; Lin Haichuan; Guo Fang; Liu Zhen'an; Xu Hao; Gong Wenxuan; Liu Zhao
2012-01-01
As the development of the detector, Silicon pixel detectors have been widely used in high energy physics experiments. It needs data processing system with high speed, high bandwidth and high availability to read data from silicon pixel detectors which generate more large data. The same question occurs on Belle II Pixel Detector which is a new style silicon pixel detector used in SuperKEKB accelerator with high luminance. The paper describes the research of High speed data readout and pre-processing system based on xTCA for silicon pixel detector. The system consists of High Performance Computer Node (HPCN) based on xTCA and ATCA frame. The HPCN consists of 4XFPs based on AMC, 1 AMC Carrier ATCA Board (ACAB) and 1 Rear Transmission Module. It characterized by 5 high performance FPGAs, 16 fiber links based on RocketIO, 5 Gbit Ethernet ports and DDR2 with capacity up to 18GB. In a ATCA frame, 14 HPCNs make up a system using the high speed backplane to achieve the function of data pre-processing and trigger. This system will be used on the trigger and data acquisition system of Belle II Pixel detector. (authors)
Power source device for thermonuclear device
International Nuclear Information System (INIS)
Ozaki, Akira.
1992-01-01
The present invention provides a small sized and economical power source device for a thermonuclear device. That is, the device comprises a conversion device having a rated power determined by a power required during a plasma current excitation period and a conversion device having a rated power determined by a power required during a plasma current maintaining period, connected in series to each other. Then, for the former conversion device, power is supplied from an electric power generator and, for the latter, power is supplied from a power system. With such a constitution, during the plasma electric current maintaining period for substantially continuous operation, it is possible to conduct bypassing paired operation for the former conversion device while the electric power generator is put under no load. Further, since a short period rated power may be suffice for the former conversion device and the electric power generator having the great rated power required for the plasma electric current excitation period, they can be reduced in the size and made economical. On the other hand, since the power required for the plasma current maintaining period is relatively small, the capacity of the continuous rated conversion device may be small, and the power can be received from the power system. (I.S.)
Device-Centric Monitoring for Mobile Device Management
Chircop, Luke; Colombo, Christian; Pace, Gordon J.
2016-01-01
The ubiquity of computing devices has led to an increased need to ensure not only that the applications deployed on them are correct with respect to their specifications, but also that the devices are used in an appropriate manner, especially in situations where the device is provided by a party other than the actual user. Much work which has been done on runtime verification for mobile devices and operating systems is mostly application-centric, resulting in global, device-centri...
Marín-Hernández, Álvaro; Rodríguez-Zavala, José S; Del Mazo-Monsalvo, Isis; Rodríguez-Enríquez, Sara; Moreno-Sánchez, Rafael; Saavedra, Emma
2016-01-01
Glycolysis provides precursors for the synthesis of macromolecules and may contribute to the ATP supply required for the constant and accelerated cellular duplication in cancer cells. In consequence, inhibition of glycolysis has been reiteratively considered as an anti-cancer therapeutic option. In previous studies, kinetic modeling of glycolysis in cancer cells allowed the identification of the main steps that control the glycolytic flux: glucose transporter, hexokinase (HK), hexose phosphate isomerase (HPI), and glycogen degradation in human cervix HeLa cancer cells and rat AS-30D ascites hepatocarcinoma. It was also previously experimentally determined that simultaneous inhibition of the non-controlling enzymes lactate dehydrogenase (LDH), pyruvate kinase (PYK), and enolase (ENO) brings about significant decrease in the glycolytic flux of cancer cells and accumulation of intermediate metabolites, mainly fructose-1,6-bisphosphate (Fru1,6BP), and dihydroxyacetone phosphate (DHAP), which are inhibitors of HK and HPI, respectively. Here it was found by kinetic modeling that inhibition of cancer glycolysis can be attained by blocking downstream non flux-controlling steps as long as Fru1,6BP and DHAP, regulatory metabolites of flux-controlling enzymes, are accumulated. Furthermore, experimental results and further modeling showed that oxamate and iodoacetate inhibitions of PYK, ENO, and glyceraldehyde3-phosphate dehydrogenase (GAPDH), but not of LDH and phosphoglycerate kinase, induced accumulation of Fru1,6BP and DHAP in AS-30D hepatoma cells. Indeed, PYK, ENO, and GAPDH exerted the highest control on the Fru1,6BP and DHAP concentrations. The high levels of these metabolites inhibited HK and HPI and led to glycolytic flux inhibition, ATP diminution, and accumulation of toxic methylglyoxal. Hence, the anticancer effects of downstream glycolytic inhibitors are very likely mediated by this mechanism. In parallel, it was also found that uncompetitive inhibition of the
Ontology-Based Device Descriptions and Device Repository for Building Automation Devices
Directory of Open Access Journals (Sweden)
Dibowski Henrik
2011-01-01
Full Text Available Device descriptions play an important role in the design and commissioning of modern building automation systems and help reducing the design time and costs. However, all established device descriptions are specialized for certain purposes and suffer from several weaknesses. This hinders a further design automation, which is strongly needed for the more and more complex building automation systems. To overcome these problems, this paper presents novel Ontology-based Device Descriptions (ODDs along with a layered ontology architecture, a specific ontology view approach with virtual properties, a generic access interface, a triple store-based database backend, and a generic search mask GUI with underlying query generation algorithm. It enables a formal, unified, and extensible specification of building automation devices, ensures their comparability, and facilitates a computer-enabled retrieval, selection, and interoperability evaluation, which is essential for an automated design. The scalability of the approach to several ten thousand devices is demonstrated.
Multi-Device to Multi-Device (MD2MD Content-Centric Networking Based on Multi-RAT Device
Directory of Open Access Journals (Sweden)
Cheolhoon Kim
2017-11-01
Full Text Available This paper proposes a method whereby a device can transmit and receive information using a beacon, and also describes application scenarios for the proposed method. In a multi-device to multi-device (MD2MD content-centric networking (CCN environment, the main issue involves searching for and connecting to nearby devices. However, if a device can’t find another device that satisfies its requirements, the connection is delayed due to the repetition of processes. It is possible to rapidly connect to a device without repetition through the selection of the optimal device using the proposed method. Consequently, the proposed method and scenarios are advantageous in that they enable efficient content identification and delivery in a content-centric Internet of Things (IoT environment, in which multiple mobile devices coexist.
Illjuzii zimnei notshi / Boris Tuch
Tuch, Boris, 1946-
2007-01-01
"Talveöö festival 2006" - "Söör Vantes. Donki Hot", lavastaja Dmitri Krõmov. Ka Ghana tantsuansambli Kusum Gboo tantsuetendus "Somu", jaapanlase Issei Ogata monoetendus "Linnaelu kataloog" ja islandi "Saja-aastane maja" Fru Emilia Teatri esituses
Graphene device and method of using graphene device
Bouchiat, Vincent; Girit, Caglar; Kessler, Brian; Zettl, Alexander K.
2015-08-11
An embodiment of a graphene device includes a layered structure, first and second electrodes, and a dopant island. The layered structure includes a conductive layer, an insulating layer, and a graphene layer. The electrodes are coupled to the graphene layer. The dopant island is coupled to an exposed surface of the graphene layer between the electrodes. An embodiment of a method of using a graphene device includes providing the graphene device. A voltage is applied to the conductive layer of the graphene device. Another embodiment of a method of using a graphene device includes providing the graphene device without the dopant island. A dopant island is placed on an exposed surface of the graphene layer between the electrodes. A voltage is applied to the conductive layer of the graphene device. A response of the dopant island to the voltage is observed.
Humanitarian Use Devices/Humanitarian Device Exemptions in cardiovascular medicine.
Kaplan, Aaron V; Harvey, Elisa D; Kuntz, Richard E; Shiran, Hadas; Robb, John F; Fitzgerald, Peter
2005-11-01
The Second Dartmouth Device Development Symposium held in October 2004 brought together leaders from the medical device community, including clinical investigators, senior representatives from the US Food and Drug Administration, large and small device manufacturers, and representatives from the financial community to examine difficult issues confronting device development. The role of the Humanitarian Use Device/Humanitarian Device Exemption (HUD/HDE) pathway in the development of new cardiovascular devices was discussed in this forum. The HUD/HDE pathway was created by Congress to facilitate the availability of medical devices for "orphan" indications, ie, those affecting HDEs have been granted (23 devices, 6 diagnostic tests). As the costs to gain regulatory approval for commonly used devices increase, companies often seek alternative ways to gain market access, including the HUD/HDE pathway. For a given device, there may be multiple legitimate and distinct indications, including indications that meet the HUD criteria. Companies must choose how and when to pursue each of these indications. The consensus of symposium participants was for the HUD/HDE pathway to be reserved for true orphan indications and not be viewed strategically as part of the clinical development plan to access a large market.
Trehalose prevents adipocyte hypertrophy and mitigates insulin resistance.
Arai, Chikako; Arai, Norie; Mizote, Akiko; Kohno, Keizo; Iwaki, Kanso; Hanaya, Toshiharu; Arai, Shigeyuki; Ushio, Simpei; Fukuda, Shigeharu
2010-12-01
Trehalose has been shown to evoke lower insulin secretion than glucose in oral saccharide tolerance tests in humans. Given this hypoinsulinemic effect of trehalose, we hypothesized that trehalose suppresses adipocyte hypertrophy by reducing storage of triglyceride and mitigates insulin resistance in mice fed a high-fat diet (HFD). Mice were fed an HFD and given drinking water containing 2.5% saccharide (glucose [Glc], trehalose [Tre], maltose [Mal], high-fructose corn syrup, or fructose [Fru]) ad libitum. After 7 weeks of HFD and saccharide intake, fasting serum insulin levels in the Tre/HFD group were significantly lower than in the Mal/HFD and Glc/HFD groups (P fructose corn syrup/HFD, or Fru/HFD group. Analysis of gene expression in mesenteric adipocytes showed that no statistically significant difference in the expression of monocyte chemoattractant protein-1 (MCP-1) messenger RNA (mRNA) was observed between the Tre/HFD group and the distilled water/standard diet group, whereas a significant increase in the MCP-1 mRNA expression was observed in the Glc/HFD, Mal/HFD, Fru/HFD, and distilled water/HFD groups. Thus, our data indicate that trehalose prevents adipocyte hypertrophy and mitigates insulin resistance in HFD-fed mice by reducing insulin secretion and down-regulating mRNA expression of MCP-1. These findings further suggest that trehalose is a functional saccharide that mitigates insulin resistance. Copyright © 2010 Elsevier Inc. All rights reserved.
fruitless alternative splicing and sex behaviour in insects: an ancient ...
Indian Academy of Sciences (India)
2010-09-06
Sep 6, 2010 ... gifts, physical touch, and even the use of aphrodisiac sub- stances. ..... male aggressive interaction' behaviour in D. melanogaster. (Lee and Hall 2000; ..... In conclusion, fru with its complex system of multi-level regulation is ...
DeviceNet-based device-level control in SSRF
Leng Yong Bin; Lu Cheng Meng; Miao Hai Feng; Liu Song Qiang; Shen Guo Bao
2002-01-01
The control system of Shanghai Synchrotron Radiation Facility is an EPICS-based distributed system. One of the key techniques to construct the system is the device-level control. The author describes the design and implementation of the DeviceNet-based device controller. A prototype of the device controller was tested in the experiments of magnet power supply and the result showed a precision of 3 x 10 sup - sup 5
Subjektiivselt Linnateatri kingitusest / Rait Avestik
Avestik, Rait, 1974-
2007-01-01
Teatrifestivalist "Talveöö unenägu 2006", etendustest: "Söör Vantes. Donki Hot" - lavastaja Dmitri Krõmov, Ghana tantsuansambli Kusum Gboo tantsusetendus "Somu", jaapanlase Issei Ogata monoetendus "Linnaelu kataloog" ja islandi "Saja-aastane maja" Fru Emilia Teatri esituses
QoE-Aware Device-to-Device Multimedia Communications
Directory of Open Access Journals (Sweden)
Liang ZHOU
2015-08-01
Full Text Available Multimedia services over mobile device-to-device (D2D networks has recently received considerable attention. In this scenario, each device is equipped with a cellular communication interface, as well as a D2D interface over a shared medium. In this work, we study the performance properties of the mobile D2D communications in the framework of user satisfaction, and develop a fully distributed QoE-aware multimedia communication scheme (QAMCS. Specifically, we translate the opportunistic multimedia communications issue into a stochastic optimization problem, which opens up a new degree of performance to exploit. Moreover, QAMCS is designed for a heterogeneous and dynamic environment, in which user demand, device mobility, and transmission fashion may vary across different devices and applications. Importantly, QAMCS is able to maximize the user satisfaction and only needs each device to implement its own scheme individually in the absence of a central controller.
Directory of Open Access Journals (Sweden)
Yeonjin Jeong
2017-01-01
Full Text Available We consider a multidevice network with asymmetric antenna configurations which supports not only communications between an access point and devices but also device-to-device (D2D communications for the Internet of things. For the network, we propose the transmit and receive beamforming with the channel state information (CSI for virtual multiple-input multiple-output (MIMO enabled by D2D receive cooperation. We analyze the sum rate achieved by a device pair in the proposed method and identify the strategies to improve the sum rate of the device pair. We next present a distributed algorithm and its equivalent algorithm for device pairing to maximize the throughput of the multidevice network. Simulation results confirm the advantages of the transmit CSI and D2D cooperation as well as the validity of the distributive algorithm.
National Research Council Canada - National Science Library
Logue, Brian A; Kirschten, Nicholas P; Petrikovics, Ilona; Moser, Matthew A; Rockwood, Gary A; Baskin, Steven I
2005-01-01
The cyanide metabolite 2-aminothiazoline.4-carboxylic acid (ATCA) is a promising biomarker for cyanide exposure because of its stability and the limitations of direct determination of cyanide and more abundant cyanide metabolites...
Release strategies for making transferable semiconductor structures, devices and device components
Rogers, John A; Nuzzo, Ralph G; Meitl, Matthew; Ko, Heung Cho; Yoon, Jongseung; Menard, Etienne; Baca, Alfred J
2014-11-25
Provided are methods for making a device or device component by providing a multilayer structure having a plurality of functional layers and a plurality of release layers and releasing the functional layers from the multilayer structure by separating one or more of the release layers to generate a plurality of transferable structures. The transferable structures are printed onto a device substrate or device component supported by a device substrate. The methods and systems provide means for making high-quality and low-cost photovoltaic devices, transferable semiconductor structures, (opto-)electronic devices and device components.
Sugar-sweetened beverages (SSBs) are a major dietary contributor to fructose intake. A molecular pathway involving the carbohydrate responsive element-binding protein (ChREBP) and the metabolic hormone fibroblast growth factor 21 (FGF21) may influence sugar metabolism and, thereby, contribute to fru...
Wireless device monitoring methods, wireless device monitoring systems, and articles of manufacture
McCown, Steven H [Rigby, ID; Derr, Kurt W [Idaho Falls, ID; Rohde, Kenneth W [Idaho Falls, ID
2012-05-08
Wireless device monitoring methods, wireless device monitoring systems, and articles of manufacture are described. According to one embodiment, a wireless device monitoring method includes accessing device configuration information of a wireless device present at a secure area, wherein the device configuration information comprises information regarding a configuration of the wireless device, accessing stored information corresponding to the wireless device, wherein the stored information comprises information regarding the configuration of the wireless device, comparing the device configuration information with the stored information, and indicating the wireless device as one of authorized and unauthorized for presence at the secure area using the comparing.
Class 1 devices case studies in medical devices design
Ogrodnik, Peter J
2014-01-01
The Case Studies in Medical Devices Design series consists of practical, applied case studies relating to medical device design in industry. These titles complement Ogrodnik's Medical Device Design and will assist engineers with applying the theory in practice. The case studies presented directly relate to Class I, Class IIa, Class IIb and Class III medical devices. Designers and companies who wish to extend their knowledge in a specific discipline related to their respective class of operation will find any or all of these titles a great addition to their library. Class 1 Devices is a companion text to Medical Devices Design: Innovation from Concept to Market. The intention of this book, and its sister books in the series, is to support the concepts presented in Medical Devices Design through case studies. In the context of this book the case studies consider Class I (EU) and 510(k) exempt (FDA) . This book covers classifications, the conceptual and embodiment phase, plus design from idea to PDS. These title...
Optical Spectra of Radio Planetary Nebulae in the Small Magellanic Cloud
Directory of Open Access Journals (Sweden)
Payne, J. L.
2008-06-01
Full Text Available We present preliminary results from spectral observations of four (4 candidate radio sources co-identified with known planetary nebulae (PNe in the Small Magellanic Cloud (SMC. These were made using the Radcliffe 1.9-meter telescope in Sutherland, South Africa. These radio PNe were originally found in Australia Telescope Compact Array (ATCA surveys of the SMC at 1.42 and 2.37~GHz, and were further confirmed by new high resolution ATCA images at 6 and 3 cm (4arcsec/2arcsec. Optical PNe and radio candidates are within 2arcsec and may represent a sub-population of selected radio bright objects. Nebular ionized masses of these objects may be 2.6~$M_odot$ or greater, supporting the existence of PNe progenitor central stars with masses up to 8 $M_odot$.
Optical spectra of radio planetary nebulae in the small Magellanic cloud
Directory of Open Access Journals (Sweden)
Payne J.L.
2008-01-01
Full Text Available We present preliminary results from spectral observations of four (4 candidate radio sources co-identified with known planetary nebulae (PNe in the Small Magellanic Cloud (SMC. These were made using the Radcliffe 1.9-meter telescope in Sutherland, South Africa. These radio PNe were originally found in Australia Telescope Compact Array (ATCA surveys of the SMC at 1.42 and 2.37 GHz, and were further confirmed by new high resolution ATCA images at 6 and 3 cm (400 /200 . Optical PNe and radio candidates are within 200 and may represent a sub- population of selected radio bright objects. Nebular ionized masses of these objects may be 2.6 Mo or greater, supporting the existence of PNe progenitor central stars with masses up to 8 Mo.
Coordinated mm/sub-mm observations of Sagittarius A* in May 2007
Energy Technology Data Exchange (ETDEWEB)
Kunneriath, D; Eckart, A; Bertram, T; Konig, S [University of Cologne, Zuelpicher Str. 77, D-50937 Cologne (Germany); Vogel, S [Department of Astronomy, University of Maryland, College Park, MD 20742-2421 (United States); Sjouwerman, L [National Radio Astronomy Observatory, PO Box 0, Socorro, NM 87801 (United States); Wiesemeyer, H [IRAM, Avenida Divina Pastora, 7, Nuecleo Central, E-18012 Granada (Spain); Schoedel, R [Instituto de AstrofIsica de AndalucIa, Camino Bajo de Huetor 50, 18008 Granada (Spain); Baganoff, F K [Center for Space Research, Massachusetts Institute of Technology, Cambridge, MA 02139-4307 (United States); Morris, M; Mauerhan, J; Meyer, L [Department of Physics and Astronomy, University of California, Los Angeles, CA 90095-1547 (United States); Dovciak, M; Karas, V [Astronomical Institute, Academy of Sciences, BocnI II, CZ-14131 Prague (Czech Republic); Dowries, D [Institut de Radio Astronomie Millimetrique, Domaine Universitaire, 38406 St. Martin d' Heres (France); Krichbaum, T; Lu, R-S [Max-Planck-Institut fuer Radioastronomie, Auf dem Huegel 69, 53121 Bonn (Germany); Krips, M [Harvard-Smithsonian Center for Astrophysics, SMA project, 60 Garden Street, MS 78 Cambridge, MA 02138 (United States); Markoff, S [Astronomical Institute ' Anton Pannekoek' , University of Amsterdam, Kruislaan 403, 1098SJ Amsterdam (Netherlands); Duschl, W J, E-mail: eckart@phl.uni-koeln.de (and others)
2008-10-15
At the center of the Milky Way, with a distance of {approx}8 kpc, the compact source Sagittarius A* (SgrA*) can be associated with a super massive black hole of {approx}4x 10{sup 6}M{sub o-dot}. SgrA* shows strong variability from the radio to the X-ray wavelength domains. Here we report on simultaneous NIR/sub-millimeter/X-ray observations from May 2007 that involved the NACO adaptive optics (AO) instrument at the European Southern Observatory's Very Large Telescope, the Australian Telescope Compact Array (ATCA), the US mm-array CARMA, the IRAM 30m mm-telescope, and other telescopes. We concentrate on the time series of mm/sub-mm data from CARMA, ATCA, and the MAMBO bolometer at the IRAM 30m telescope.
Comparison of cyanide exposure markers in the biofluids of smokers and non-smokers.
Vinnakota, Chakravarthy V; Peetha, Naga S; Perrizo, Mitch G; Ferris, David G; Oda, Robert P; Rockwood, Gary A; Logue, Brian A
2012-11-01
Cyanide is highly toxic and is present in many foods, combustion products (e.g. cigarette smoke), industrial processes, and has been used as a terrorist weapon. In this study, cyanide and its major metabolites, thiocyanate and 2-amino-2-thiazoline-4-carboxylic acid (ATCA), were analyzed from various human biofluids of smokers (low-level chronic cyanide exposure group) and non-smokers to gain insight into the relationship of these biomarkers to cyanide exposure. The concentrations of each biomarker tested were elevated for smokers in each biofluid. Significant differences (p cyanide exposure, and other statistical methods were performed to better understand the relationship between cyanide and its metabolites. Of the markers studied, the results indicate plasma ATCA, in particular, showed excellent promise as a biomarker for chronic low-level cyanide exposure.
Chandra Takes on Heavy Jets and Massive Winds in 4U 1630-47
Neilsen, Joey
2014-11-01
Recently, Díaz Trigo et al. reported the discovery of relativistic baryons in a jet in XMM/ATCA observations of the 2012 outburst of the black hole 4U 1630-47. We present a search for a similarly massive jet earlier in the same outburst using high-resolution X-ray spectra from the Chandra HETGS. Despite a detection of radio emission with ATCA, we find no evidence of a heavy jet in the X-ray spectrum, with tight upper limits on the relativistic emission lines seen by Díaz Trigo eight months later. Instead, we find deep absorption lines from a massive, highly ionized disk wind, whose properties can be probed with detailed photoionization models. We explore several scenarios to explain the two modes of massive outflow in this remarkable black hole system.
Fructose and Sucrose Intake Increase Exogenous Carbohydrate Oxidation during Exercise.
Trommelen, Jorn; Fuchs, Cas J; Beelen, Milou; Lenaerts, Kaatje; Jeukendrup, Asker E; Cermak, Naomi M; van Loon, Luc J C
2017-02-20
Peak exogenous carbohydrate oxidation rates typically reach ~1 g∙min-1 during exercise when ample glucose or glucose polymers are ingested. Fructose co-ingestion has been shown to further increase exogenous carbohydrate oxidation rates. The purpose of this study was to assess the impact of fructose co-ingestion provided either as a monosaccharide or as part of the disaccharide sucrose on exogenous carbohydrate oxidation rates during prolonged exercise in trained cyclists. Ten trained male cyclists (VO2peak: 65 ± 2 mL∙kg-1∙min-1) cycled on four different occasions for 180 min at 50% Wmax during which they consumed a carbohydrate solution providing 1.8 g∙min-1 of glucose (GLU), 1.2 g∙min-1 glucose + 0.6 g∙min-1 fructose (GLU + FRU), 0.6 g∙min-1 glucose + 1.2 g∙min-1 sucrose (GLU + SUC), or water (WAT). Peak exogenous carbohydrate oxidation rates did not differ between GLU + FRU and GLU + SUC (1.40 ± 0.06 vs. 1.29 ± 0.07 g∙min-1, respectively, p = 0.999), but were 46% ± 8% higher when compared to GLU (0.96 ± 0.06 g∙min-1: p exogenous carbohydrate oxidation rates during the latter 120 min of exercise were 46% ± 8% higher in GLU + FRU or GLU + SUC compared with GLU (1.19 ± 0.12, 1.13 ± 0.21, and 0.82 ± 0.16 g∙min-1, respectively, p exogenous carbohydrate oxidation rates during prolonged exercise in trained cyclists.
"Talveöö unenäo" imedest / Anne-Ly Sova
Sova, Anne-Ly, 1976-
2007-01-01
Teatrifestivalist "Talveöö unenägu 2006". Etendustest: "Söör Vantes. Donki Hot" - lavastaja Dmitri Krõmov, islandi "Saja-aastane maja" Fru Emilia Teatri esituses, jaapanlase Issei Ogata monoetendus "Linnaelu kataloog" - lavastaja Yuzo Morita, Ghana tantsuansambli Kusum Gboo tantsusetendus "Somu" Richard Danguah lavastuses
Gow, J.D.; Wilcox, J.M.
1961-12-26
A device is designed for producing and confining highenergy plasma from which neutrons are generated in copious quantities. A rotating sheath of electrons is established in a radial electric field and axial magnetic field produced within the device. The electron sheath serves as a strong ionizing medium to gas introdueed thereto and also functions as an extremely effective heating mechanism to the resulting plasma. In addition, improved confinement of the plasma is obtained by ring magnetic mirror fields produced at the ends of the device. Such ring mirror fields are defined by the magnetic field lines at the ends of the device diverging radially outward from the axis of the device and thereafter converging at spatial annular surfaces disposed concentrically thereabout. (AFC)
2013-08-22
... Management Act (Magnuson-Stevens Act) and the Atlantic Tunas Convention Act (ATCA). Under the Magnuson... August 28, 2013, 6 San Antonio, TX.... Hilton Palacio Del Rio, 200 S. with the Gulf of Mexico Fishery p.m...
Practical microwave electron devices
Meurant, Gerard
2013-01-01
Practical Microwave Electron Devices provides an understanding of microwave electron devices and their applications. All areas of microwave electron devices are covered. These include microwave solid-state devices, including popular microwave transistors and both passive and active diodes; quantum electron devices; thermionic devices (including relativistic thermionic devices); and ferrimagnetic electron devices. The design of each of these devices is discussed as well as their applications, including oscillation, amplification, switching, modulation, demodulation, and parametric interactions.
2015-11-20
The Food and Drug Administration (FDA or the Agency) is classifying the ultraviolet (UV) radiation chamber disinfection device into class II (special controls). The special controls that will apply to the device are identified in this order and will be part of the codified language for the UV radiation chamber disinfection device classification. The Agency is classifying the device into class II (special controls) in order to provide a reasonable assurance of safety and effectiveness of the device.
Energy Technology Data Exchange (ETDEWEB)
Reese, Jason A; Keenihan, James R; Gaston, Ryan S; Kauffmann, Keith L; Langmaid, Joseph A; Lopez, Leonardo; Maak, Kevin D; Mills, Michael E; Ramesh, Narayan; Teli, Samar R
2017-03-21
The present invention is premised upon an improved photovoltaic device ("PV device"), more particularly to an improved photovoltaic device with a multilayered photovoltaic cell assembly and a body portion joined at an interface region and including an intermediate layer, at least one interconnecting structural member, relieving feature, unique component geometry, or any combination thereof.
Reese, Jason A.; Keenihan, James R.; Gaston, Ryan S.; Kauffmann, Keith L.; Langmaid, Joseph A.; Lopez, Leonardo C.; Maak, Kevin D.; Mills, Michael E.; Ramesh, Narayan; Teli, Samar R.
2015-06-02
The present invention is premised upon an improved photovoltaic device ("PV device"), more particularly to an improved photovoltaic device with a multilayered photovoltaic cell assembly and a body portion joined at an interface region and including an intermediate layer, at least one interconnecting structural member, relieving feature, unique component geometry, or any combination thereof.
High voltage semiconductor devices and methods of making the devices
Energy Technology Data Exchange (ETDEWEB)
Matocha, Kevin; Chatty, Kiran; Banerjee, Sujit
2018-01-23
A multi-cell MOSFET device including a MOSFET cell with an integrated Schottky diode is provided. The MOSFET includes n-type source regions formed in p-type well regions which are formed in an n-type drift layer. A p-type body contact region is formed on the periphery of the MOSFET. The source metallization of the device forms a Schottky contact with an n-type semiconductor region adjacent the p-type body contact region of the device. Vias can be formed through a dielectric material covering the source ohmic contacts and/or Schottky region of the device and the source metallization can be formed in the vias. The n-type semiconductor region forming the Schottky contact and/or the n-type source regions can be a single continuous region or a plurality of discontinuous regions alternating with discontinuous p-type body contact regions. The device can be a SiC device. Methods of making the device are also provided.
U.S. EPA, Pesticide Product Label, SEVIN 5% DUST, 11/19/1981
2011-04-21
... "e;;t~~i~:i'·:,~r:.;~. eT~;:': i:, .O~~~:~J It;;;'"lh~''I~;.rP:~,~: t;~~ ';JI.~~ n>nl~ .nd "',"'nlll frU'1 m"lh KPI>I .. d( 1',",41 r.11 and .""rv II) to 14 ...
Indian Academy of Sciences (India)
The sex-determining system differs considerably among organisms. Even among insect species, the genetic system for sex-determination is highly diversified. In Drosophila melanogaster, somatic sexual differentiation is regulated by a well characterized genetic hierarchy X : A > Sxl > tra/tra2 > dsx and fru. This cascade ...
International Nuclear Information System (INIS)
Hayashi, Toshifumi; Kobayashi, Hiroshi.
1994-01-01
A process control device comprises a memory device for memorizing a plant operation target, a plant state or a state of equipments related with each other as control data, a read-only memory device for storing programs, a plant instrumentation control device or other process control devices, an input/output device for performing input/output with an operator, and a processing device which conducts processing in accordance with the program and sends a control demand or a display demand to the input/output device. The program reads out control data relative to a predetermined operation target, compares and verify them with actual values to read out control data to be a practice premise condition which is further to be a practice premise condition if necessary, thereby automatically controlling the plant or requiring or displaying input. Practice presuming conditions for the operation target can be examined succesively in accordance with the program without constituting complicated logical figures and AND/OR graphs. (N.H.)
Protected geoheritage sites as a touristic value of Srem
Directory of Open Access Journals (Sweden)
Jojić-Glavonjić Tamara
2014-01-01
Full Text Available In the area of the smallest region of Autonomous Province of Vojvodina, which is, excluding Fruška gora, of very uniform geological structure, there is a significant number of geoheritage sites of different protection rank. The most of them are Natural Monuments, some individually protected, some protected as part of a larger entirety (National Park “Fruška gora”. There are two Special Nature Reserves and one Landascape of Exceptional Features. Except their significant importance for science and education, wishing to emphasize touristic value that these attractive objects of nature have, taking into account their number, we have segregated only those who are protected or in the protection procedure. Depending on the protection rank, they are mainly complementary touristic values, rarely interesting to broader spectrum of tourists. With development of appropriate programs (an example of “Leslend” in Inđija and necessary investments, these natural objects could become an equal part of Srem rich touristic offer.
Zhou, Xu; Qin, Xianyan; Gong, Tao; Zhang, Zhi-Rong; Fu, Yao
2017-07-01
d-Fructose modified poly(ε-caprolactone)-polyethylene glycol (PCL-PEG-Fru) diblock amphiphile is synthesized via Cu(I)-catalyzed click chemistry, which self-assembles with D-α-tocopheryl polyethylene glycol 1000 succinate (TPGS) into PCL-PEG-Fru/TPGS mixed micelles (PPF MM). It has been proven that glucose transporter (GLUT)5 is overexpressed in MCF-7 cells other than L929 cells. In this study, PPF MM exhibit a significantly higher uptake efficiency than fructose-free PCL-PEG-N 3 /TPGS mixed micelles in both 2D MCF-7 cells and 3D tumor spheroids. Also, the presence of free d-fructose competitively inhibits the internalization of PPF MM in MCF-7 cells other than L929 cells. PPF MM show selective tumor accumulation in MCF-7 breast tumor bearing mice xenografts. Taken together, PPF MM represent a promising nanoscale carrier system to achieve GLUT5-mediated cell specific delivery in cancer therapy. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
International Nuclear Information System (INIS)
Gálisová, Lucia; Strečka, Jozef
2015-01-01
Magnetocaloric effect in a double-tetrahedral chain, in which nodal lattice sites occupied by the localized Ising spins regularly alternate with three equivalent lattice sites available for mobile electrons, is exactly investigated by considering the one-third electron filling and the ferromagnetic Ising exchange interaction between the mobile electrons and their nearest Ising neighbours. The entropy and the magnetic Grüneisen parameter, which closely relate to the magnetocaloric effect, are exactly calculated in order to investigate the relation between the ground-state degeneracy and the cooling efficiency of the hybrid spin–electron system during the adiabatic demagnetization. - Highlights: • A double-tetrahedral chain of mobile electrons and localized Ising spins is studied. • Magnetic Grüneisen parameter for the system is exactly derived. • Macroscopically degenerate phases FRU and FM constitute the ground state. • MCE is three times higher nearby FRU–FM transition than in FRU phase at small fields
DEFF Research Database (Denmark)
2011-01-01
The present invention relates to a device for limiting movements in one or more anatomical joints, such as a device for limiting movement in the human hip joint after hip replacement surgery. This is provided by a device for limiting movement in the human hip joint, said device comprising: at least...
Cooling device in thermonuclear device
International Nuclear Information System (INIS)
Honda, Tsutomu.
1988-01-01
Purpose: To prevent loss of cooling effect over the entire torus structure directly after accidental toubles in a cooling device of a thermonuclear device. Constitution: Coolant recycling means of a cooling device comprises two systems, which are alternately connected with in-flow pipeways and exit pipeways of adjacent modules. The modules are cooled by way of the in-flow pipeways and the exist pipeways connected to the respective modules by means of the coolant recycling means corresponding to the respective modules. So long as one of the coolant recycling means is kept operative, since every one other modules of the torus structure is still kept cooled, the heat generated from the module put therebetween, for which the coolant recycling is interrupted, is removed by means of heat conduction or radiation from the module for which the cooling is kept continued. No back-up emergency cooling system is required and it can provide high economic reliability. (Kamimura, M.)
Reese, Jason A.; Keenihan, James R.; Gaston, Ryan S.; Kauffmann, Keith L.; Langmaid, Joseph A.; Lopez, Leonardo C.; Maak, Kevin D.; Mills, Michael E.; Ramesh, Narayan; Teli, Samar R.
2015-09-01
The present invention is premised upon an improved photovoltaic device ("PV device"), more particularly to an improved photovoltaic device (10) with a multilayered photovoltaic cell assembly (100) and a body portion (200) joined at an interface region (410) and including an intermediate layer (500), at least one interconnecting structural member (1500), relieving feature (2500), unique component geometry, or any combination thereof.
78 FR 68714 - Medical Devices; Ophthalmic Devices; Classification of the Scleral Plug
2013-11-15
... amendments), as ``preamendments devices.'' FDA classifies these devices after the Agency takes the following.... FDA-2012-N-1238] Medical Devices; Ophthalmic Devices; Classification of the Scleral Plug AGENCY: Food... scleral plugs in order to provide a reasonable assurance of safety and effectiveness of the device. The...
Inflow of atomic gas fuelling star formation
DEFF Research Database (Denmark)
Michałowski, M. J.; Gentile, G.; Hjorth, Jeppe
2016-01-01
Gamma-ray burst host galaxies are deficient in molecular gas, and show anomalous metal-poor regions close to GRB positions. Using recent Australia Telescope Compact Array (ATCA) Hi observations we show that they have substantial atomic gas reservoirs. This suggests that star formation in these ga......Gamma-ray burst host galaxies are deficient in molecular gas, and show anomalous metal-poor regions close to GRB positions. Using recent Australia Telescope Compact Array (ATCA) Hi observations we show that they have substantial atomic gas reservoirs. This suggests that star formation...... in these galaxies may be fuelled by recent inflow of metal-poor atomic gas. While this process is debated, it can happen in low-metallicity gas near the onset of star formation because gas cooling (necessary for star formation) is faster than the Hi-to-H2 conversion....
21 CFR 864.9195 - Blood mixing devices and blood weighing devices.
2010-04-01
... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Blood mixing devices and blood weighing devices. 864.9195 Section 864.9195 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES HEMATOLOGY AND PATHOLOGY DEVICES Products Used In Establishments That...
Garcia-Crespo, Andres Jose
2013-12-10
A sealing device for sealing a gap between a dovetail of a bucket assembly and a rotor wheel is disclosed. The sealing device includes a cover plate configured to cover the gap and a retention member protruding from the cover plate and configured to engage the dovetail. The sealing device provides a seal against the gap when the bucket assemply is subjected to a centrifugal force.
Tai, Yu-Chong (Inventor); Zheng, Siyang (Inventor); Lin, Jeffrey Chun-Hui (Inventor); Kasdan, Harvey L. (Inventor)
2017-01-01
Described herein are particular embodiments relating to a microfluidic device that may be utilized for cell sensing, counting, and/or sorting. Particular aspects relate to a microfabricated device that is capable of differentiating single cell types from dense cell populations. One particular embodiment relates a device and methods of using the same for sensing, counting, and/or sorting leukocytes from whole, undiluted blood samples.
Fructose and Sucrose Intake Increase Exogenous Carbohydrate Oxidation during Exercise
Trommelen, Jorn; Fuchs, Cas J.; Beelen, Milou; Lenaerts, Kaatje; Jeukendrup, Asker E.; Cermak, Naomi M.; van Loon, Luc J. C.
2017-01-01
Peak exogenous carbohydrate oxidation rates typically reach ~1 g·min−1 during exercise when ample glucose or glucose polymers are ingested. Fructose co-ingestion has been shown to further increase exogenous carbohydrate oxidation rates. The purpose of this study was to assess the impact of fructose co-ingestion provided either as a monosaccharide or as part of the disaccharide sucrose on exogenous carbohydrate oxidation rates during prolonged exercise in trained cyclists. Ten trained male cyclists (VO2peak: 65 ± 2 mL·kg−1·min−1) cycled on four different occasions for 180 min at 50% Wmax during which they consumed a carbohydrate solution providing 1.8 g·min−1 of glucose (GLU), 1.2 g·min−1 glucose + 0.6 g·min−1 fructose (GLU + FRU), 0.6 g·min−1 glucose + 1.2 g·min−1 sucrose (GLU + SUC), or water (WAT). Peak exogenous carbohydrate oxidation rates did not differ between GLU + FRU and GLU + SUC (1.40 ± 0.06 vs. 1.29 ± 0.07 g·min−1, respectively, p = 0.999), but were 46% ± 8% higher when compared to GLU (0.96 ± 0.06 g·min−1: p exogenous carbohydrate oxidation rates during the latter 120 min of exercise were 46% ± 8% higher in GLU + FRU or GLU + SUC compared with GLU (1.19 ± 0.12, 1.13 ± 0.21, and 0.82 ± 0.16 g·min−1, respectively, p exogenous carbohydrate oxidation rates during prolonged exercise in trained cyclists. PMID:28230742
Multiple Roles of Soluble Sugars in the Establishment of Gunnera-Nostoc Endosymbiosis1[OA
Khamar, Hima J.; Breathwaite, Erick K.; Prasse, Christine E.; Fraley, Elizabeth R.; Secor, Craig R.; Chibane, Fairouz L.; Elhai, Jeff; Chiu, Wan-Ling
2010-01-01
Gunnera plants have the unique ability to form endosymbioses with N2-fixing cyanobacteria, primarily Nostoc. Cyanobacteria enter Gunnera through transiently active mucilage-secreting glands on stems. We took advantage of the nitrogen (N)-limitation-induced gland development in Gunnera manicata to identify factors that may enable plant tissue to attract and maintain cyanobacteria colonies. Cortical cells in stems of N-stressed Gunnera plants were found to accumulate a copious amount of starch, while starch in the neighboring mature glands was nearly undetectable. Instead, mature glands accumulated millimolar concentrations of glucose (Glc) and fructose (Fru). Successful colonization by Nostoc drastically reduced sugar accumulation in the surrounding tissue. Consistent with the abundance of Glc and Fru in the gland prior to Nostoc colonization, genes encoding key enzymes for sucrose and starch hydrolysis (e.g. cell wall invertase, α-amylase, and starch phosphorylase) were expressed at higher levels in stem segments with glands than those without. In contrast, soluble sugars were barely detectable in mucilage freshly secreted from glands. Different sugars affected Nostoc’s ability to differentiate motile hormogonia in a manner consistent with their locations. Galactose and arabinose, the predominant constituents of polysaccharides in the mucilage, had little or no inhibitory effect on hormogonia differentiation. On the other hand, soluble sugars that accumulated in gland tissue, namely sucrose, Glc, and Fru, inhibited hormogonia differentiation and enhanced vegetative growth. Results from this study suggest that, in an N-limited environment, mature Gunnera stem glands may employ different soluble sugars to attract Nostoc and, once the cyanobacteria are internalized, to maintain them in the N2-fixing vegetative state. PMID:20833727
Pijning, Tjaard; Anwar, Munir A; Böger, Markus; Dobruchowska, Justyna M; Leemhuis, Hans; Kralj, Slavko; Dijkhuizen, Lubbert; Dijkstra, Bauke W
2011-09-09
Fructansucrases (FSs) catalyze a transfructosylation reaction with sucrose as substrate to produce fructo-oligosaccharides and fructan polymers that contain either β-2,1 glycosidic linkages (inulin) or β-2,6 linkages (levan). Levan-synthesizing FSs (levansucrases) have been most extensively investigated, while detailed information on inulosucrases is limited. Importantly, the molecular basis of the different product specificities of levansucrases and inulosucrases is poorly understood. We have elucidated the three-dimensional structure of a truncated active bacterial GH68 inulosucrase, InuJ of Lactobacillus johnsonii NCC533 (residues 145-708), in its apo form, with a bound substrate (sucrose), and with a transfructosylation product. The sucrose binding pocket and the sucrose binding mode are virtually identical with those of GH68 levansucrases, confirming that both enzyme types use the same fully conserved structural framework for the binding and cleavage of the donor substrate sucrose in the active site. The binding mode of the first transfructosylation product 1-kestose (Fru-β(2-1)-Fru-α(2-1)-Glc, where Fru=fructose and Glc=glucose) in subsites -1 to +2 shows for the first time how inulin-type fructo-oligosaccharide bind in GH68 FS and how an inulin-type linkage can be formed. Surprisingly, observed interactions with the sugar in subsites +1 and +2 are provided by residues that are also present in levansucrases. The binding mode of 1-kestose and the presence of a more distant sucrose binding site suggest that residues beyond the +2 subsite, in particular residues from the nonconserved 1B-1C loop, determine product linkage type specificity in GH68 FSs. Copyright © 2011 Elsevier Ltd. All rights reserved.
Radioactive waste processing device
International Nuclear Information System (INIS)
Inaguma, Masahiko; Takahara, Nobuaki; Hara, Satomi.
1996-01-01
In a processing device for filtering laundry liquid wastes and shower drains incorporated with radioactive materials, a fiber filtration device is disposed and an activated carbon filtration device is also disposed subsequent to the fiber filtration device. In addition, a centrifugal dewatering device is disposed for dewatering spent granular activated carbon in the activated carbon filtration device, and a minute filtering device is disposed for filtering the separated dewatering liquid. Filtrates filtered by the minute filtration device are recovered in a collecting tank. Namely, at first, suspended solid materials in laundry liquid wastes and shower drains are captured, and then, ingredients concerning COD are adsorbed in the activated carbon filtration device. The radioactive liquid wastes of spent granular activated carbon in the activated carbon filtration device are reduced by dewatering them by the centrifugal dewatering device, and then the granular activated carbon is subjected to an additional processing. Further, it is separated by filtration using the minute filtration device and removed as cakes. Since the filtrates are recovered to the collecting tank and filtered again, the water quality of the drains is not degraded. (N.H.)
High heat flux device of thermonuclear device
International Nuclear Information System (INIS)
Tachikawa, Nobuo.
1994-01-01
The present invention provides an equipments for high heat flux device (divertor) of a thermonuclear device, which absorbs thermal deformation during operation, has a high installation accuracy, and sufficiently withstands for thermal stresses. Namely, a heat sink member is joined to a structural base. Armour tiles are joined on the heat sink member. Cooling pipes are disposed between the heat sink member and the armour tiles. With such a constitution, the heat sink member using a highly heat conductive material having ductility, such as oxygen free copper, the cooling pipes using a material having excellent high temperature resistance and excellent elongation, such as aluminum-dispersed reinforced copper, and the armour tiles are completely joined on the structural base. Therefore, when thermal deformation tends to cause in the high heat flux device such as a divertor, cooling pipes cause no plastic deformation because of their high temperature resistance, but the heat sink member such as a oxygen free copper causes plastic deformation to absorb thermal deformation. As a result, the high heat flux device such as a divertor causes no deformation. (I.S.)
Repairing method and device for thermonuclear device
International Nuclear Information System (INIS)
Sakurai, Akiko; Masumoto, Hiroshi; Tachikawa, Nobuo.
1995-01-01
The present invention provides a method of and a device for repairing a first wall and a divertor disposed in a vacuum vessel of a thermonuclear device. Namely, an armour tile of the divertor secured, by a brazing material, in a vacuum vessel of the thermonuclear device in which high temperature plasmas of deuterium and tritium are confined to cause fusion reaction is induction-heated or heated by microwaves to melt the brazing material. Only the armour tile is thus exchanged by its attachment/detachment. This device comprises, in the vacuum vessel, an armour tile attaching/detaching manipulator and a repairing manipulator comprising a heating manipulator having induction heating coils at the top end thereof. Induction heating coils are connected to an AC power source. According to the present invention, the armour tile is exchanged without taking the divertor out of the vacuum vessel. Therefore, cutting of a divertor cooling tube for taking the divertor out of the vacuum vessel and re-welding of the divertor for attaching it to the vacuum vessel again are no more necessary. (I.S.)
A medical device is any product used to diagnose, cure, or treat a condition, or to prevent disease. They ... may need one in a hospital. To use medical devices safely Know how your device works. Keep ...
Houddane, Amina; Bultot, Laurent; Novellasdemunt, Laura; Johanns, Manuel; Gueuning, Marie-Agnès; Vertommen, Didier; Coulie, Pierre G; Bartrons, Ramon; Hue, Louis; Rider, Mark H
2017-06-01
Proliferating cells depend on glycolysis mainly to supply precursors for macromolecular synthesis. Fructose 2,6-bisphosphate (Fru-2,6-P 2 ) is the most potent positive allosteric effector of 6-phosphofructo-1-kinase (PFK-1), and hence of glycolysis. Mitogen stimulation of rat thymocytes with concanavalin A (ConA) led to time-dependent increases in lactate accumulation (6-fold), Fru-2,6-P 2 content (4-fold), 6-phosphofructo-2-kinase (PFK-2)/fructose-2,6-bisphosphatase isoenzyme 3 and 4 (PFKFB3 and PFKFB4) protein levels (~2-fold and ~15-fold, respectively) and rates of cell proliferation (~40-fold) and protein synthesis (10-fold) after 68h of incubation compared with resting cells. After 54h of ConA stimulation, PFKFB3 mRNA levels were 45-fold higher than those of PFKFB4 mRNA. Although PFKFB3 could be phosphorylated at Ser461 by protein kinase B (PKB) in vitro leading to PFK-2 activation, PFKFB3 Ser461 phosphorylation was barely detectable in resting cells and only increased slightly in ConA-stimulated cells. On the other hand, PFKFB3 and PFKFB4 mRNA levels were decreased (90% and 70%, respectively) by exposure of ConA-stimulated cells to low doses of PKB inhibitor (MK-2206), suggesting control of expression of the two PFKFB isoenzymes by PKB. Incubation of thymocytes with ConA resulted in increased expression and phosphorylation of the translation factors eukaryotic initiation factor-4E-binding protein-1 (4E-BP1) and ribosomal protein S6 (rpS6). Treatment of ConA-stimulated thymocytes with PFK-2 inhibitor (3PO) or MK-2206 led to significant decreases in Fru-2,6-P 2 content, medium lactate accumulation and rates of cell proliferation and protein synthesis. These data were confirmed by using siRNA knockdown of PFKFB3, PFKFB4 and PKB α/β in the more easily transfectable Jurkat E6-1 cell line. The findings suggest that increased PFKFB3 and PFKFB4 expression, but not increased PFKFB3 Ser461 phosphorylation, plays a role in increasing glycolysis in mitogen
International Nuclear Information System (INIS)
Maeda, Kazuyuki; Takahashi, Shuichi; Maruyama, Mayumi
1998-01-01
The present invention provides a device capable of measuring accurate position and distance easily even at places where operator can not easily access, such as cell facilities for vitrifying radioactive wastes. Referring to a case of the vitrifying cell, an objective equipment settled in the cell is photographed by a photographing device. The image is stored in a position measuring device by way of an image input device. After several years, when the objective equipment is exchanged, a new objective equipment is photographed by a photographing device. The image is also stored in the position measuring device. The position measuring device compares the data of both of the images on the basis of pixel unit. Based on the image of the equipment before the exchange as a reference, extent of the displacement of the installation position of the equipment on the image after the exchange caused by installation error and manufacturing error is determined to decide the position of the equipment after exchange relative to the equipment before exchange. (I.S.)
1985-11-26
bounds require the A.N--, N -,-..-"* • specification of the o(t) function. This function is a quantity which is not easily conceptualized by...different lethal diseases and/or different reasons for reroval fru the study. In a clini- cal trials framwork the primary response of interest, death or
Johannes, Maris, 1959-
2007-01-01
Lühidalt meeldejäävast teatrifestivalil "Talveöö unenägu 2006", etendustest: "Söör Vantes. Donki Hot" - lavastaja Dmitri Krõmov, Ghana tantsuansambli Kusum Gboo tantsusetendus "Somu", jaapanlase Issei Ogata monoetendus "Linnaelu kataloog", islandi "Saja-aastane maja" Fru Emilia Teatri esituses ja Tallinna Linnateatri "Rätsep"
2013-06-10
..., Including Wireless Communication Devices, Portable Music and Data Processing Devices, and Tablet Computers... importing wireless communication devices, portable music and data processing devices, and tablet computers... certain electronic devices, including wireless communication devices, portable music and data processing...
Novel Concepts for Device to Device Communication using Network Coding
DEFF Research Database (Denmark)
Pahlevani, Peyman; Hundebøll, Martin; Pedersen, Morten Videbæk
2014-01-01
Device-to-device communication is currently a hot research topic within 3GPP. Even though D2D communication has been part of previous ad hoc, meshed and sensor networks proposals, the main contribution by 3GPP is that the direct communication among two devices is carried out over a dynamically as...
Device configuration-management system
International Nuclear Information System (INIS)
Nowell, D.M.
1981-01-01
The Fusion Chamber System, a major component of the Magnetic Fusion Test Facility, contains several hundred devices which report status to the Supervisory Control and Diagnostic System for control and monitoring purposes. To manage the large number of diversity of devices represented, a device configuration management system was required and developed. Key components of this software tool include the MFTF Data Base; a configuration editor; and a tree structure defining the relationships between the subsystem devices. This paper will describe how the configuration system easily accomodates recognizing new devices, restructuring existing devices, and modifying device profile information
International Nuclear Information System (INIS)
Qurnell, F.D.; Patterson, C.B.
1979-01-01
A gauge supporting device for measuring say a square tube comprises a pair of rods or guides in tension between a pair of end members, the end members being spaced apart by a compression member or members. The tensioned guides provide planes of reference for measuring devices moved therealong on a carriage. The device is especially useful for making on site dimensional measurements of components, such as irradiated and therefore radioactive components, that cannot readily be transported to an inspection laboratory. (UK)
Implantable electronic medical devices
Fitzpatrick, Dennis
2014-01-01
Implantable Electronic Medical Devices provides a thorough review of the application of implantable devices, illustrating the techniques currently being used together with overviews of the latest commercially available medical devices. This book provides an overview of the design of medical devices and is a reference on existing medical devices. The book groups devices with similar functionality into distinct chapters, looking at the latest design ideas and techniques in each area, including retinal implants, glucose biosensors, cochlear implants, pacemakers, electrical stimulation t
2013-09-18
... Tunas Convention Act (ATCA) and obligations pursuant to binding recommendations of the International...). You may submit attachments to electronic comments in Microsoft Word or Excel, WordPerfect, or Adobe... and appropriate to carry out recommendations of the International Commission for the Conservation of...
Device-independent randomness amplification with a single device
International Nuclear Information System (INIS)
Plesch, Martin; Pivoluska, Matej
2014-01-01
Expansion and amplification of weak randomness with untrusted quantum devices has recently become a very fruitful topic of research. Here we contribute with a procedure for amplifying a single weak random source using tri-partite GHZ-type entangled states. If the quality of the source reaches a fixed threshold R=log 2 (10), perfect random bits can be produced. This technique can be used to extract randomness from sources that can't be extracted neither classically, nor by existing procedures developed for Santha–Vazirani sources. Our protocol works with a single fault-free device decomposable into three non-communicating parts, that is repeatedly reused throughout the amplification process. - Highlights: • We propose a protocol for device independent randomness amplification. • Our protocol repeatedly re-uses a single device decomposable into three parts. • Weak random sources with min-entropy rate greater than 1/4 log 2 (10) can be amplified. • Security against all-quantum adversaries is achieved
Smart portable rehabilitation devices
Directory of Open Access Journals (Sweden)
Leahey Matt
2005-07-01
Full Text Available Abstract Background The majority of current portable orthotic devices and rehabilitative braces provide stability, apply precise pressure, or help maintain alignment of the joints with out the capability for real time monitoring of the patient's motions and forces and without the ability for real time adjustments of the applied forces and motions. Improved technology has allowed for advancements where these devices can be designed to apply a form of tension to resist motion of the joint. These devices induce quicker recovery and are more effective at restoring proper biomechanics and improving muscle function. However, their shortcoming is in their inability to be adjusted in real-time, which is the most ideal form of a device for rehabilitation. This introduces a second class of devices beyond passive orthotics. It is comprised of "active" or powered devices, and although more complicated in design, they are definitely the most versatile. An active or powered orthotic, usually employs some type of actuator(s. Methods In this paper we present several new advancements in the area of smart rehabilitation devices that have been developed by the Northeastern University Robotics and Mechatronics Laboratory. They are all compact, wearable and portable devices and boast re-programmable, real time computer controlled functions as the central theme behind their operation. The sensory information and computer control of the three described devices make for highly efficient and versatile systems that represent a whole new breed in wearable rehabilitation devices. Their applications range from active-assistive rehabilitation to resistance exercise and even have applications in gait training. The three devices described are: a transportable continuous passive motion elbow device, a wearable electro-rheological fluid based knee resistance device, and a wearable electrical stimulation and biofeedback knee device. Results Laboratory tests of the devices
Smart portable rehabilitation devices.
Mavroidis, Constantinos; Nikitczuk, Jason; Weinberg, Brian; Danaher, Gil; Jensen, Katherine; Pelletier, Philip; Prugnarola, Jennifer; Stuart, Ryan; Arango, Roberto; Leahey, Matt; Pavone, Robert; Provo, Andrew; Yasevac, Dan
2005-07-12
The majority of current portable orthotic devices and rehabilitative braces provide stability, apply precise pressure, or help maintain alignment of the joints with out the capability for real time monitoring of the patient's motions and forces and without the ability for real time adjustments of the applied forces and motions. Improved technology has allowed for advancements where these devices can be designed to apply a form of tension to resist motion of the joint. These devices induce quicker recovery and are more effective at restoring proper biomechanics and improving muscle function. However, their shortcoming is in their inability to be adjusted in real-time, which is the most ideal form of a device for rehabilitation. This introduces a second class of devices beyond passive orthotics. It is comprised of "active" or powered devices, and although more complicated in design, they are definitely the most versatile. An active or powered orthotic, usually employs some type of actuator(s). In this paper we present several new advancements in the area of smart rehabilitation devices that have been developed by the Northeastern University Robotics and Mechatronics Laboratory. They are all compact, wearable and portable devices and boast re-programmable, real time computer controlled functions as the central theme behind their operation. The sensory information and computer control of the three described devices make for highly efficient and versatile systems that represent a whole new breed in wearable rehabilitation devices. Their applications range from active-assistive rehabilitation to resistance exercise and even have applications in gait training. The three devices described are: a transportable continuous passive motion elbow device, a wearable electro-rheological fluid based knee resistance device, and a wearable electrical stimulation and biofeedback knee device. Laboratory tests of the devices demonstrated that they were able to meet their design
Development of a wireless blood pressure measuring device with smart mobile device.
İlhan, İlhan; Yıldız, İbrahim; Kayrak, Mehmet
2016-03-01
Today, smart mobile devices (telephones and tablets) are very commonly used due to their powerful hardware and useful features. According to an eMarketer report, in 2014 there were 1.76 billion smartphone users (excluding users of tablets) in the world; it is predicted that this number will rise by 15.9% to 2.04 billion in 2015. It is thought that these devices can be used successfully in biomedical applications. A wireless blood pressure measuring device used together with a smart mobile device was developed in this study. By means of an interface developed for smart mobile devices with Android and iOS operating systems, a smart mobile device was used both as an indicator and as a control device. The cuff communicating with this device through Bluetooth was designed to measure blood pressure via the arm. A digital filter was used on the cuff instead of the traditional analog signal processing and filtering circuit. The newly developed blood pressure measuring device was tested on 18 patients and 20 healthy individuals of different ages under a physician's supervision. When the test results were compared with the measurements made using a sphygmomanometer, it was shown that an average 93.52% accuracy in sick individuals and 94.53% accuracy in healthy individuals could be achieved with the new device. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
International Nuclear Information System (INIS)
Fujita, Kazuhiko.
1996-01-01
A position of a detector is detected by a driving device, and the detected values are sampled by a newly disposed central processing unit for sampling the detected values depending on the sampling position of the detected values. Since the sampling position of the detected values is detected by the driving device, the sampling position for the detection values does not rely on the speed of the driving motor of the driving device. The load on the central processing device for controlling the device is lowered by newly disposing the central processing unit for sampling detected values. When the values for the position of the detector counted after conversion to digital values reach the digital values corresponding to the detection value sampling position outputted from the central processing unit for controlling the device, a counted value comparison circuit causes the central processing unit for controlling the device to sample the detection values outputted from the detector. Then, the processing speed can be increased without interruption processings, which can save the central processing unit for sampling detection values. In addition, software can be simplified and loads can be lowered. (N.H.)
International Nuclear Information System (INIS)
Nagaoka, Etsuo.
1996-01-01
The present invention provides an inspection device in PWR reactor core in which inspection operations are made efficient by stabilizing a posture of the device in front-to-back, vertical and left-to-right directions by a simple structure. When the device conducts inspection while running in liquid, the front and the back directions of the device main body are inspected using a visual device while changing the posture by operating a front-to-back direction propulsion device and a right-to-left direction propulsion device, and a vertical direction propulsion device against to rolling, pitching and yawing of the device main body. In this case, a spherical magnet moves freely in the gravitational direction in a vibration-damping fluid in a non-magnetic spherical shell following the change of the posture of the device main body, in which the vibrations due to the movement of the spherical magnet is settled by the vibration-damping fluid thereby stabilizing the posture of the device main body. At a typical inspection posture, the settling effect is enhanced by the attraction force between the spherical magnets in the spherical shell and each of magnetic force-attracted magnetic members disposed to the outer circumference of the shell, and the posture of the device main body can be confirmed in front-to-back, right-to-left and vertical directions by each of the posture confirming magnetic sensors. (N.H.)
Freudian Notion of Psychoanalysis: Its Implications in Contemporary Teaching Practices
Awan, Muhammad Afzal
2017-01-01
The author has engaged in a critical review of Frued's notion of psychoanalysis and its vitality in teaching. Illustrating from Freud's own assertions and through the interpretations of the later critics, the author has pointed out certain noticeable pitfalls and, or incapacities of contemporary teaching practices. The forces of aggression and sex…
2013-03-19
... INTERNATIONAL TRADE COMMISSION [Investigation No. 337-TA-794] Certain Electronic Devices, Including Wireless Communication Devices, Portable Music and Data Processing Devices, and Tablet Computers... certain electronic devices, including wireless communication devices, portable music and data processing...
Predistortion control device and method, assembly including a predistortion control device
Kokkeler, Andre B.J.
2003-01-01
A predistortion control device (1). The device has a first predistortion control input connectable to a power amplifier output (21); a second predistortion control input (11) connectable to a signal contact of a predistortion device; and a predistortion control output (12) connectable to a control
2013-01-08
... Wireless Communication Devices, Tablet Computers, Media Players, and Televisions, and Components Thereof... devices, including wireless communication devices, tablet computers, media players, and televisions, and... wireless communication devices, tablet computers, media players, and televisions, and components thereof...
Initiation devices, initiation systems including initiation devices and related methods
Energy Technology Data Exchange (ETDEWEB)
Daniels, Michael A.; Condit, Reston A.; Rasmussen, Nikki; Wallace, Ronald S.
2018-04-10
Initiation devices may include at least one substrate, an initiation element positioned on a first side of the at least one substrate, and a spark gap electrically coupled to the initiation element and positioned on a second side of the at least one substrate. Initiation devices may include a plurality of substrates where at least one substrate of the plurality of substrates is electrically connected to at least one adjacent substrate of the plurality of substrates with at least one via extending through the at least one substrate. Initiation systems may include such initiation devices. Methods of igniting energetic materials include passing a current through a spark gap formed on at least one substrate of the initiation device, passing the current through at least one via formed through the at least one substrate, and passing the current through an explosive bridge wire of the initiation device.
High energy devices versus low energy devices in orthopedics treatment modalities
Schultheiss, Reiner
2003-10-01
The orthopedic consensus group defined in 1997 the 42 most likely relevant parameters of orthopedic shock wave devices. The idea of this approach was to correlate the different clinical outcomes with the physical properties of the different devices with respect to their acoustical waves. Several changes in the hypothesis of the dose effect relationship have been noticed since the first orthopedic treatments. The relation started with the maximum pressure p+, followed by the total energy, the energy density; and finally the single treatment approach using high, and then the multiple treatment method using low energy. Motivated by the reimbursement situation in Germany some manufacturers began to redefine high and low energy devices independent of the treatment modality. The OssaTron as a high energy, single treatment electro hydraulic device gained FDA approval as the first orthopedic ESWT device for plantar fasciitis and, more recently, for lateral epicondylitis. Two low energy devices have now also gained FDA approval based upon a single treatment. Comparing the acoustic data, differences between the OssaTron and the other devices are obvious and will be elaborated upon. Cluster analysis of the outcomes and the acoustical data are presented and new concepts will be suggested.
2012-11-26
... INTERNATIONAL TRADE COMMISSION [Investigation No. 337-TA-794] Certain Electronic Devices, Including Wireless Communication Devices, Portable Music and Data Processing Devices, and Tablet Computers... wireless communication devices, portable music and data processing devices, and tablet computers, by reason...
Radiation emitting devices regulations
International Nuclear Information System (INIS)
1970-01-01
The Radiation Emitting Devices Regulations are the regulations referred to in the Radiation Emitting Devices Act and relate to the operation of devices. They include standards of design and construction, standards of functioning, warning symbol specifications in addition to information relating to the seizure and detention of machines failing to comply with the regulations. The radiation emitting devices consist of the following: television receivers, extra-oral dental x-ray equipment, microwave ovens, baggage inspection x-ray devices, demonstration--type gas discharge devices, photofluorographic x-ray equipment, laser scanners, demonstration lasers, low energy electron microscopes, high intensity mercury vapour discharge lamps, sunlamps, diagnostic x-ray equipment, ultrasound therapy devices, x-ray diffraction equipment, cabinet x-ray equipment and therapeutic x-ray equipment
2012-10-04
... INTERNATIONAL TRADE COMMISSION [Investigation No. 337-TA-794] Certain Electronic Devices, Including Wireless Commmunication Devices, Portable Music and Data Processing Devices, and Tablet Computers... communication devices, portable music and data processing devices, and tablet computers, imported by Apple Inc...
2013-05-21
.... FDA-2013-N-0487] Cardiovascular Devices; Reclassification of External Counter- Pulsating Devices for... proposed rule (44 FR 13426, March 9, 1979), the Cardiovascular Device Classification Panel (the 1979 Panel... of Subjects in 21 CFR Part 870 Medical devices, Cardiovascular devices...
International Nuclear Information System (INIS)
Madhavan, N.
2005-01-01
The study of sparsely produced nuclear reaction products in the direction of intense primary beam is a challenging task, the pursuit of which has given rise to the advent or several types of selective devices. These range from a simple parallel plate electrostatic deflector to state-of-the-art electromagnetic separators. There is no single device which can satisfy all the requirements of an ideal recoil transporter, simultaneously. An overview of such devices and their building blocks is presented, which may help in the proper choice of the device as per the experimental requirements. (author)
Multiplexed charge-locking device for large arrays of quantum devices
Energy Technology Data Exchange (ETDEWEB)
Puddy, R. K., E-mail: rkp27@cam.ac.uk; Smith, L. W; Chong, C. H.; Farrer, I.; Griffiths, J. P.; Ritchie, D. A.; Smith, C. G. [Cavendish Laboratory, University of Cambridge, Cambridge CB3 0HE (United Kingdom); Al-Taie, H.; Kelly, M. J. [Cavendish Laboratory, University of Cambridge, Cambridge CB3 0HE (United Kingdom); Centre for Advanced Photonics and Electronics, Electrical Engineering Division, Department of Engineering, 9 J. J. Thomson Avenue, University of Cambridge, Cambridge CB3 0FA (United Kingdom); Pepper, M. [Department of Electronic and Electrical Engineering, University College London, WC1E 7JE (United Kingdom)
2015-10-05
We present a method of forming and controlling large arrays of gate-defined quantum devices. The method uses an on-chip, multiplexed charge-locking system and helps to overcome the restraints imposed by the number of wires available in cryostat measurement systems. The device architecture that we describe here utilises a multiplexer-type scheme to lock charge onto gate electrodes. The design allows access to and control of gates whose total number exceeds that of the available electrical contacts and enables the formation, modulation and measurement of large arrays of quantum devices. We fabricate such devices on n-type GaAs/AlGaAs substrates and investigate the stability of the charge locked on to the gates. Proof-of-concept is shown by measurement of the Coulomb blockade peaks of a single quantum dot formed by a floating gate in the device. The floating gate is seen to drift by approximately one Coulomb oscillation per hour.
MemFlash device: floating gate transistors as memristive devices for neuromorphic computing
Riggert, C.; Ziegler, M.; Schroeder, D.; Krautschneider, W. H.; Kohlstedt, H.
2014-10-01
Memristive devices are promising candidates for future non-volatile memory applications and mixed-signal circuits. In the field of neuromorphic engineering these devices are especially interesting to emulate neuronal functionality. Therefore, new materials and material combinations are currently investigated, which are often not compatible with Si-technology processes. The underlying mechanisms of the device often remain unclear and are paired with low device endurance and yield. These facts define the current most challenging development tasks towards a reliable memristive device technology. In this respect, the MemFlash concept is of particular interest. A MemFlash device results from a diode configuration wiring scheme of a floating gate transistor, which enables the persistent device resistance to be varied according to the history of the charge flow through the device. In this study, we investigate the scaling conditions of the floating gate oxide thickness with respect to possible applications in the field of neuromorphic engineering. We show that MemFlash cells exhibit essential features with respect to neuromorphic applications. In particular, cells with thin floating gate oxides show a limited synaptic weight growth together with low energy dissipation. MemFlash cells present an attractive alternative for state-of-art memresitive devices. The emulation of associative learning is discussed by implementing a single MemFlash cell in an analogue circuit.
MemFlash device: floating gate transistors as memristive devices for neuromorphic computing
International Nuclear Information System (INIS)
Riggert, C; Ziegler, M; Kohlstedt, H; Schroeder, D; Krautschneider, W H
2014-01-01
Memristive devices are promising candidates for future non-volatile memory applications and mixed-signal circuits. In the field of neuromorphic engineering these devices are especially interesting to emulate neuronal functionality. Therefore, new materials and material combinations are currently investigated, which are often not compatible with Si-technology processes. The underlying mechanisms of the device often remain unclear and are paired with low device endurance and yield. These facts define the current most challenging development tasks towards a reliable memristive device technology. In this respect, the MemFlash concept is of particular interest. A MemFlash device results from a diode configuration wiring scheme of a floating gate transistor, which enables the persistent device resistance to be varied according to the history of the charge flow through the device. In this study, we investigate the scaling conditions of the floating gate oxide thickness with respect to possible applications in the field of neuromorphic engineering. We show that MemFlash cells exhibit essential features with respect to neuromorphic applications. In particular, cells with thin floating gate oxides show a limited synaptic weight growth together with low energy dissipation. MemFlash cells present an attractive alternative for state-of-art memresitive devices. The emulation of associative learning is discussed by implementing a single MemFlash cell in an analogue circuit. (paper)
DEFF Research Database (Denmark)
2007-01-01
The present invention relates to a device for use in performing assays on standard laboratory solid supports whereon chemical entities are attached. The invention furthermore relates to the use of such a device and a kit comprising such a device. The device according to the present invention is a...
Eschbach, Eugene A.; LeBlanc, Edward J.; Griffin, Jeffrey W.
1992-01-01
The present invention relates to a security device having a control box (12) containing an electronic system (50) and a communications loop (14) over which the system transmits a signal. The device is constructed so that the communications loop can extend from the control box across the boundary of a portal such as a door into a sealed enclosure into which access is restricted whereby the loop must be damaged or moved in order for an entry to be made into the enclosure. The device is adapted for detecting unauthorized entries into such enclosures such as rooms or containers and for recording the time at which such entries occur for later reference. Additionally, the device detects attempts to tamper or interfere with the operation of the device itself and records the time at which such events take place. In the preferred embodiment, the security device includes a microprocessor-based electronic system (50) and a detection module (72) capable of registering changes in the voltage and phase of the signal transmitted over the loop.
International Nuclear Information System (INIS)
Eschbach, E.A.; LeBlanc, E.J.; Griffin, J.W.
1992-01-01
The present invention relates to a security device having a control box containing an electronic system and a communications loop over which the system transmits a signal. The device is constructed so that the communications loop can extend from the control box across the boundary of a portal such as a door into a sealed enclosure into which access is restricted whereby the loop must be damaged or moved in order for an entry to be made into the enclosure. The device is adapted for detecting unauthorized entries into such enclosures such as rooms or containers and for recording the time at which such entries occur for later reference. Additionally, the device detects attempts to tamper or interfere with the operation of the device itself and records the time at which such events take place. In the preferred embodiment, the security device includes a microprocessor-based electronic system and a detection module capable of registering changes in the voltage and phase of the signal transmitted over the loop. 11 figs
O'Donnell, T.J.
1959-03-10
A brake device is described for utilization in connection with a control rod. The device comprises a pair of parallelogram link mechanisms, a control rod moveable rectilinearly therebetween in opposite directions, and shoes resiliently supported by the mechanism for frictional engagement with the control rod.
Three fundamental devices in one: a reconfigurable multifunctional device in two-dimensional WSe2
Dhakras, Prathamesh; Agnihotri, Pratik; Lee, Ji Ung
2017-06-01
The three pillars of semiconductor device technologies are (1) the p-n diode, (2) the metal-oxide-semiconductor field-effect transistor and (3) the bipolar junction transistor. They have enabled the unprecedented growth in the field of information technology that we see today. Until recently, the technological revolution for better, faster and more efficient devices has been governed by scaling down the device dimensions following Moore’s Law. With the slowing of Moore’s law, there is a need for alternative materials and computing technologies that can continue the advancement in functionality. Here, we describe a single, dynamically reconfigurable device that implements these three fundamental device functions. The device uses buried gates to achieve n- and p-channels and fits into a larger effort to develop devices with enhanced functionalities, including logic functions, over device scaling. As they are all surface conducting devices, we use one material parameter, the interface trap density of states, to describe the key figure-of-merit of each device.
Devices, Distractions and Digital Literacy: "Bring Your Own Device" to Polytech
Drew, Leoni; Forbes, Dianne
2017-01-01
The purpose of this study is to investigate the ways polytechnic students use personal mobile devices to support their learning. This study used purposive sampling and mixed methods to generate data about student ownership and use of mobile digital devices within a single institution. Findings reveal patterns of device ownership, insights into how…
Ibrahim, Yehia M.; Smith, Richard D.
2016-01-26
An ion trap device is disclosed. The device includes a series of electrodes that define an ion flow path. A radio frequency (RF) field is applied to the series of electrodes such that each electrode is phase shifted approximately 180 degrees from an adjacent electrode. A DC voltage is superimposed with the RF field to create a DC gradient to drive ions in the direction of the gradient. A second RF field or DC voltage is applied to selectively trap and release the ions from the device. Further, the device may be gridless and utilized at high pressure.
Directory of Open Access Journals (Sweden)
Li Xu
Full Text Available β-Fructosidases are a widespread group of enzymes that catalyze the hydrolysis of terminal fructosyl units from various substrates. These enzymes also exhibit transglycosylation activity when they function with high concentrations of sucrose, which is used to synthesize fructooligosaccharides (FOS in the food industry. A β-fructosidase (BfrA with high transglycosylation activity was purified from Aspergillus oryzae FS4 as a monomeric glycoprotein. Compared with the most extensively studied Aspergillus spp. fructosidases that synthesize inulin-type β-(2-1-linked FOS, BfrA has unique transfructosylating property of synthesizing levan- and neolevan-type β-(2-6-linked FOS. The coding sequence (bfrAFS4, 1.86 kb of BfrA was amplified and expressed in Escherichia coli and Pichia pastoris. Both native and recombinant proteins showed transfructosylation and hydrolyzation activities with broad substrate specificity. These proteins could hydrolyze the following linkages: Glc α-1, 2-β Fru; Glc α-1, 3-α Fru; and Glc α-1, 5-β Fru. Compared with the unglycosylated E. coli-expressed BfrA (E.BfrA, the N-glycosylated native (N.BfrA and the P. pastoris-expressed BfrA (P.BfrA were highly stable at a wide pH range (pH 4 to 11, and significantly more thermostable at temperatures up to 50°C with a maximum activity at 55°C. Using sucrose as substrate, the Km and kcat values for total activity were 37.19±5.28 mM and 1.0016±0.039×104 s-1 for N.BfrA. Moreover, 10 of 13 putative N-glycosylation sites were glycosylated on N.BfrA, and N-glycosylation was essential for enzyme thermal stability and optima activity. Thus, BfrA has demonstrated as a well-characterized A. oryzae fructosidase with unique transfructosylating capability of synthesizing levan- and neolevan-type FOS.
Fructose and Sucrose Intake Increase Exogenous Carbohydrate Oxidation during Exercise
Directory of Open Access Journals (Sweden)
Jorn Trommelen
2017-02-01
Full Text Available Peak exogenous carbohydrate oxidation rates typically reach ~1 g∙min−1 during exercise when ample glucose or glucose polymers are ingested. Fructose co‐ingestion has been shown to further increase exogenous carbohydrate oxidation rates. The purpose of this study was to assess the impact of fructose co‐ingestion provided either as a monosaccharide or as part of the disaccharide sucrose on exogenous carbohydrate oxidation rates during prolonged exercise in trained cyclists. Ten trained male cyclists (VO2peak: 65 ± 2 mL∙kg−1∙min−1 cycled on four different occasions for 180 min at 50% Wmax during which they consumed a carbohydrate solution providing 1.8 g∙min−1 of glucose (GLU, 1.2 g∙min−1 glucose + 0.6 g∙min−1 fructose (GLU + FRU, 0.6 g∙min−1 glucose + 1.2 g∙min−1 sucrose (GLU + SUC, or water (WAT. Peak exogenous carbohydrate oxidation rates did not differ between GLU + FRU and GLU + SUC (1.40 ± 0.06 vs. 1.29 ± 0.07 g∙min−1, respectively, p = 0.999, but were 46% ± 8% higher when compared to GLU (0.96 ± 0.06 g∙min−1: p < 0.05. In line, exogenous carbohydrate oxidation rates during the latter 120 min of exercise were 46% ± 8% higher in GLU + FRU or GLU + SUC compared with GLU (1.19 ± 0.12, 1.13 ± 0.21, and 0.82 ± 0.16 g∙min−1, respectively, p < 0.05. We conclude that fructose co‐ingestion (0.6 g∙min−1 with glucose (1.2 g∙min−1 provided either as a monosaccharide or as sucrose strongly increases exogenous carbohydrate oxidation rates during prolonged exercise in trained cyclists.
Castellanos, Monica C.; Tang, Jonathan C. Y.; Allan, Douglas W.
2013-01-01
In Drosophila melanogaster, much of our understanding of sexually dimorphic neuronal development and function comes from the study of male behavior, leaving female behavior less well understood. Here, we identify a post-embryonic population of Insulin-like peptide 7 (Ilp7)-expressing neurons in the posterior ventral nerve cord that innervate the reproductive tracts and exhibit a female bias in their function. They form two distinct dorsal and ventral subsets in females, but only a single dorsal subset in males, signifying a rare example of a female-specific neuronal subset. Female post-embryonic Ilp7 neurons are glutamatergic motoneurons innervating the oviduct and are required for female fertility. In males, they are serotonergic/glutamatergic neuromodulatory neurons innervating the seminal vesicle but are not required for male fertility. In both sexes, these neurons express the sex-differentially spliced fruitless-P1 transcript but not doublesex. The male fruitless-P1 isoform (fruM) was necessary and sufficient for serotonin expression in the shared dorsal Ilp7 subset, but although it was necessary for eliminating female-specific Ilp7 neurons in males, it was not sufficient for their elimination in females. By contrast, sex-specific RNA-splicing by female-specific transformer is necessary for female-type Ilp7 neurons in females and is sufficient for their induction in males. Thus, the emergence of female-biased post-embryonic Ilp7 neurons is mediated in a subset-specific manner by a tra- and fru-dependent mechanism in the shared dorsal subset, and a tra-dependent, fru-independent mechanism in the female-specific subset. These studies provide an important counterpoint to studies of the development and function of male-biased neuronal dimorphism in Drosophila. PMID:23981656
Wang, Xiaobin
2014-01-01
Metallic Spintronic Devices provides a balanced view of the present state of the art of metallic spintronic devices, addressing both mainstream and emerging applications from magnetic tunneling junction sensors and spin torque oscillators to spin torque memory and logic. Featuring contributions from well-known and respected industrial and academic experts, this cutting-edge work not only presents the latest research and developments but also: Describes spintronic applications in current and future magnetic recording devicesDiscusses spin-transfer torque magnetoresistive random-access memory (STT-MRAM) device architectures and modelingExplores prospects of STT-MRAM scaling, such as detailed multilevel cell structure analysisInvestigates spintronic device write and read optimization in light of spintronic memristive effectsConsiders spintronic research directions based on yttrium iron garnet thin films, including spin pumping, magnetic proximity, spin hall, and spin Seebeck effectsProposes unique solutions for ...
International Nuclear Information System (INIS)
Coulson, R.A.
1980-01-01
A sealing device for minimising the leakage of toxic or radioactive contaminated environments through a biological shield along an opening through which a flexible component moves that penetrates the shield. The sealing device comprises an outer tubular member which extends over a length not less than the maximum longitudinal movement of the component along the opening. An inner sealing block is located intermediate the length of the component by connectors and is positioned in the bore of the outer tubular member to slide in the bore and effect a seal over the entire longitudinal movement of the component. The cross-section of the device may be circular and the block may be of polytetrafluoroethylene or of nylon impregnated with molybdenum or may be metallic. A number of the sealing devices may be combined into an assembly for a plurality of adjacent longitudinally movable components, each adapted to sustain a tensile load, providing the various drives of a master-slave manipulator. (author)
Delay reduction in multi-hop device-to-device communication using network coding
Douik, Ahmed S.; Sorour, Sameh; Al-Naffouri, Tareq Y.; Yang, Hong-Chuan; Alouini, Mohamed-Slim
2015-01-01
This paper considers the problem of reducing the broadcast delay of wireless networks using instantly decodable network coding (IDNC) based device-to-device (D2D) communications. In D2D-enabled networks, devices help hasten the recovery of the lost
International Nuclear Information System (INIS)
Angus, J.P.; Salt, D.
1988-01-01
A temperature indicating device comprises a plurality of planar elements some undergoing a reversible change in appearance at a given temperature the remainder undergoing an irreversible change in appearance at a given temperature. The device is useful in indicating the temperature which an object has achieved as well as its actual temperature. The reversible change is produced by liquid crystal devices. The irreversible change is produced by an absorbent surface carrying substances e.g. waxes which melt at predetermined temperatures and are absorbed by the surface; alternatively paints may be used. The device is used for monitoring processes of encapsulation of radio active waste. (author)
77 FR 19175 - Atlantic Highly Migratory Species; 2012 Atlantic Bluefin Tuna Quota Specifications
2012-03-30
...). Attachments to electronic comments will be accepted in Microsoft Word or Excel, WordPerfect, or Adobe PDF file... active member of the International Commission for the Conservation of Atlantic Tunas (ICCAT), the United States implements binding ICCAT recommendations to comply with this international treaty. ATCA authorizes...
Thermal energy storage devices, systems, and thermal energy storage device monitoring methods
Tugurlan, Maria; Tuffner, Francis K; Chassin, David P.
2016-09-13
Thermal energy storage devices, systems, and thermal energy storage device monitoring methods are described. According to one aspect, a thermal energy storage device includes a reservoir configured to hold a thermal energy storage medium, a temperature control system configured to adjust a temperature of the thermal energy storage medium, and a state observation system configured to provide information regarding an energy state of the thermal energy storage device at a plurality of different moments in time.
Optical spectra of radio planetary nebulae in the large Magellanic Cloud
Directory of Open Access Journals (Sweden)
Payne J.L.
2008-01-01
Full Text Available We present 11 spectra from 12 candidate radio sources co-identified with known planetary nebulae (PNe in the Large Magellanic Cloud (LMC. Originally found in Australia Telescope Compact Array (ATCA LMC surveys at 1.4, 4.8 and 8.64 GHz and confirmed by new high resolution ATCA images at 6 and 3 cm (4' /2' , these complement data recently presented for candidate radio PNe in the Small Magellanic Cloud (SMC. Their spectra were obtained using the Radcliff 1.9-meter telescope in Sutherland (South Africa. All of the optical PNe and radio candidates are within 2' and may represent a population of selected radio bright sample only. Nebular ionized masses of these objects are estimated to be as high as 1.8 Mfi, supporting the idea that massive PNe progenitor central stars lose much of their mass in the asymptotic giant branch (AGB phase or prior. We also identify a sub-population (33% of radio PNe candidates with prominent ionized iron emission lines.
AUTHOR|(SzGeCERN)759889; The ATLAS collaboration; Begel, Michael; Chen, Hucheng; Chen, Kai; Lanni, Francesco; Takai, Helio; Wu, Weihao
2017-01-01
As part of the ATLAS Phase-I Upgrade, the gFEX is designed to help maintain the ATLAS Level-1 trigger acceptance rate with the increasing LHC luminosity. The gFEX identifies patterns of energy associated with the hadronic decays of high momentum Higgs, W, & Z bosons, top quarks, and exotic particles in real time at the 40MHz LHC bunch crossing rate. The prototype v1 and v2 were designed and fully tested in 2015 and 2016 respectively. A pre-production gFEX board has been manufactured, which is an ATCA module consisting of three UltraScale+ FPGAs and one ZYNQ UltraScale+, and 35 MiniPODs are implemented in an ATCA module. This board receives coarse-granularity (0.2x0.2) information from the entire ATLAS calorimeters on up to 300 optical fibers and 96 links to the L1Topo at the speed up to 12.8 Gb/s.
International Nuclear Information System (INIS)
Winans, J.
1993-01-01
A GPIB device support module is used to provide access to the operating parameters of a GPIB device. GPIB devices may be accessed via National Instruments 1014 cards or via Bitbus Universal Gateways. GPIB devices typically have many parameters, each of which may be thought of in terms of the standard types of database records available in EPICS. It is the job of the device support module designer to decide how the mapping of these parameters will be made to the available record types. Once this mapping is complete, the device support module may be written. The writing of the device support module consists primarily of the construction of a parameter table. This table is used to associate the database record types with the operating parameters of the GPIB instrument. Other aspects of module design include the handling of SRQ events and errors. SRQ events are made available to the device support module if so desired. The processing of an SRQ event is completely up to the designer of the module. They may be ignored, tied to event based record processing, or anything else the designer wishes. Error conditions may be handled in a similar fashion
Device Optimization and Transient Electroluminescence Studies of Organic light Emitting Devices
Energy Technology Data Exchange (ETDEWEB)
Lijuan Zou
2003-08-05
Organic light emitting devices (OLEDs) are among the most promising for flat panel display technologies. They are light, bright, flexible, and cost effective. And while they are emerging in commercial product, their low power efficiency and long-term degradation are still challenging. The aim of this work was to investigate their device physics and improve their performance. Violet and blue OLEDs were studied. The devices were prepared by thermal vapor deposition in high vacuum. The combinatorial method was employed in device preparation. Both continuous wave and transient electroluminescence (EL) were studied. A new efficient and intense UV-violet light emitting device was developed. At a current density of 10 mA/cm{sup 2}, the optimal radiance R could reach 0.38 mW/cm{sup 2}, and the quantum efficiency was 1.25%. using the delayed EL technique, electron mobilities in DPVBi and CBP were determined to be {approx} 10{sup -5} cm{sup 2}/Vs and {approx} 10{sup -4} cm{sup 2}/Vs, respectively. Overshoot effects in the transient El of blue light emitting devices were also observed and studied. This effect was attributed to the charge accumulation at the organic/organic and organic/cathode interfaces.
Device Optimization and Transient Electroluminescence Studies of Organic light Emitting Devices
International Nuclear Information System (INIS)
Lijuan Zou
2003-01-01
Organic light emitting devices (OLEDs) are among the most promising for flat panel display technologies. They are light, bright, flexible, and cost effective. And while they are emerging in commercial product, their low power efficiency and long-term degradation are still challenging. The aim of this work was to investigate their device physics and improve their performance. Violet and blue OLEDs were studied. The devices were prepared by thermal vapor deposition in high vacuum. The combinatorial method was employed in device preparation. Both continuous wave and transient electroluminescence (EL) were studied. A new efficient and intense UV-violet light emitting device was developed. At a current density of 10 mA/cm 2 , the optimal radiance R could reach 0.38 mW/cm 2 , and the quantum efficiency was 1.25%. using the delayed EL technique, electron mobilities in DPVBi and CBP were determined to be ∼ 10 -5 cm 2 /Vs and ∼ 10 -4 cm 2 /Vs, respectively. Overshoot effects in the transient El of blue light emitting devices were also observed and studied. This effect was attributed to the charge accumulation at the organic/organic and organic/cathode interfaces
2012-08-24
... Music and Data Processing Devices, Computers, and Components Thereof; Notice of Receipt of Complaint... complaint entitled Wireless Communication Devices, Portable Music and Data Processing Devices, Computers..., portable music and data processing devices, computers, and components thereof. The complaint names as...
Integrated control rod monitoring device
International Nuclear Information System (INIS)
Saito, Katsuhiro
1997-01-01
The present invention provides a device in which an entire control rod driving time measuring device and a control rod position support device in a reactor building and a central control chamber are integrated systematically to save hardwares such as a signal input/output device and signal cables between boards. Namely, (1) functions of the entire control rod driving time measuring device for monitoring control rods which control the reactor power and a control rod position indication device are integrated into one identical system. Then, the entire devices can be made compact by the integration of the functions. (2) The functions of the entire control rod driving time measuring device and the control rod position indication device are integrated in a central operation board and a board in the site. Then, the place for the installation of them can be used in common in any of the cases. (3) The functions of the entire control rod driving time measuring device and the control rod position indication device are integrated to one identical system to save hardware to be used. Then, signal input/output devices and drift branching panel boards in the site and the central operation board can be saved, and cables for connecting both of the boards is no more necessary. (I.S.)
2011-08-01
..., Including Wireless Communication Devices, Portable Music and Data Processing Devices, and Tablet Computers... electronic devices, including wireless communication devices, portable music and data processing devices, and...''). The complaint further alleges that an industry in the United States exists or is in the process of...
2013-03-04
The Food and Drug Administration (FDA) is publishing an order granting a petition requesting exemption from premarket notification requirements for wheelchair elevator devices commonly known as inclined platform lifts and vertical platform lifts. These devices are used to provide a means for a person with a mobility impairment caused by injury or other disease to move from one level to another, usually in a wheelchair. This order exempts wheelchair elevators, class II devices, from premarket notification and establishes conditions for exemption for this device that will provide a reasonable assurance of the safety and effectiveness of the device without submission of a premarket notification (510(k)). This exemption from 510(k), subject to these conditions, is immediately in effect for wheelchair elevators. All other devices classified under FDA's wheelchair elevator regulations, including attendant-operated stair climbing devices for wheelchairs and portable platform lifts, continue to require submission of 510(k)s. FDA is publishing this order in accordance with the section of the Food, Drug, and Cosmetic Act (the FD&C Act) permitting the exemption of a device from the requirement to submit a 510(k).
International Nuclear Information System (INIS)
Fowler, T.K.
1977-01-01
Three types of thermonuclear fusion devices currently under development are reviewed for an electric utilities management audience. Overall design features of laser fusion, tokamak, and magnetic mirror type reactors are described and illustrated. Thrusts and trends in current research on these devices that promise to improve performance are briefly reviewed. Twenty photographs and drawings are included
High voltage MOSFET devices and methods of making the devices
Banerjee, Sujit; Matocha, Kevin; Chatty, Kiran
2018-06-05
A SiC MOSFET device having low specific on resistance is described. The device has N+, P-well and JFET regions extended in one direction (Y-direction) and P+ and source contacts extended in an orthogonal direction (X-direction). The polysilicon gate of the device covers the JFET region and is terminated over the P-well region to minimize electric field at the polysilicon gate edge. In use, current flows vertically from the drain contact at the bottom of the structure into the JFET region and then laterally in the X direction through the accumulation region and through the MOSFET channels into the adjacent N+ region. The current flowing out of the channel then flows along the N+ region in the Y-direction and is collected by the source contacts and the final metal. Methods of making the device are also described.
High voltage MOSFET devices and methods of making the devices
Banerjee, Sujit; Matocha, Kevin; Chatty, Kiran
2015-12-15
A SiC MOSFET device having low specific on resistance is described. The device has N+, P-well and JFET regions extended in one direction (Y-direction) and P+ and source contacts extended in an orthogonal direction (X-direction). The polysilicon gate of the device covers the JFET region and is terminated over the P-well region to minimize electric field at the polysilicon gate edge. In use, current flows vertically from the drain contact at the bottom of the structure into the JFET region and then laterally in the X direction through the accumulation region and through the MOSFET channels into the adjacent N+ region. The current flowing out of the channel then flows along the N+ region in the Y-direction and is collected by the source contacts and the final metal. Methods of making the device are also described.
Fuel pattern recognition device
International Nuclear Information System (INIS)
Sato, Tomomi.
1995-01-01
The device of the present invention monitors normal fuel exchange upon fuel exchanging operation carried out in a reactor of a nuclear power plant. Namely, a fuel exchanger is movably disposed to the upper portion of the reactor and exchanges fuels. An exclusive computer receives operation signals of the fuel exchanger during operation as inputs, and outputs reactor core fuel pattern information signals to a fuel arrangement diagnosis device. An underwater television camera outputs image signals of a fuel pattern in the reactor core to an image processing device. If there is any change in the image signals for the fuel pattern as a result of the fuel exchange operation of the fuel exchanger, the image processing device outputs the change as image signals to the fuel pattern diagnosis device. The fuel pattern diagnosis device compares the pattern information signals from the exclusive computer with the image signals from the image processing device, to diagnose the result of the fuel exchange operation performed by the fuel exchanger and inform the diagnosis by means of an image display. (I.S.)
2012-09-21
... Devices, Portable Music and Data Processing Devices, Computers, and Components Thereof; Institution of... communication devices, portable music and data processing devices, computers, and components thereof by reason... alleges that an industry in the United States exists as required by subsection (a)(2) of section 337. The...
Firewood preparation devices in 1994
International Nuclear Information System (INIS)
Mutikainen, A.
1994-01-01
A review of the market situation regarding firewood preparation devices is presented. The information was collected from the answers to a mail questionnaire. The review is assumed to include all the leading manufacturers and importers. Firewood production devices were available from 26 manufacturers. The range of models amounted to over 70. These may be divided into three categories: 1. cutting devices: the most common solution being a cross-cutting circular saw. There were only a few of these on sale as it is quite easy to include a splitting device on the same frame. 2. Splitting devices: e.g. screw splitter and hydraulically powered splitter. About 20 models are available on the markets. Cross cutting and splitting devices: these are the most popular devices. A cross-cutting circular saw with screw or hydraulic splitter is the most common type. There are about 50 models available on the markets. Cross-cutting and splitting devices are often equipped with conveyor for transferring the split wood e.g. into a trailer. Chopping devices are delivered as tractor powered devices, as electric motor powered devices or as combustion engine powered devices. Some of them are equipped with a time saving feeding device enabling the next stem to be lifted into position while the previous one is being chopped. The Finnish Work Efficiency Institute's studies show that when cross-cutting and splitting of stems into pieces of 35-50 cm in length, productivity for one operator varies in between 0.8 - 3.2 m 3 /h, depending on the device and work method used. (6 refs., 1 fig., 2 tabs.)
International Nuclear Information System (INIS)
Sasahara, Toshihiko
1998-01-01
The present invention provides a device for detecting welded portions of a reactor pressure vessel. Namely, the device of the present invention comprises (1) a casing to be disposed on the surface to be detected, (2) a probe driving means loaded to the casing, (3) a probe driven along the surface to be detected and (4) a pressure reduction means for keeping the hollow portion in the casing to an evacuated atmosphere. The casing comprises a flexible suction edge to be tightly in contact with the surface to be tested for maintaining the air tight state, (6) a guide wheel for moving the casing along the surface to be tested and (7) a handle for performing transferring operation. The flaw detection device thus constituted has following features. The working efficiency upon conducting detection is improved. The influence of the weight of the device on the detection is small. The device can be applied on the surface of a nonmagnetic material. The efficiency for the flaw detection can be improved. (I.S.)
International Nuclear Information System (INIS)
Tsuji, Tadashi.
1990-01-01
The fuel inspection device of the present invention has a feature of obtaining an optimum illumination upon fuel rod interval inspection operation in a fuel pool. That is, an illumination main body used underwater is connected to a cable which is led out on a floor. A light control device is attached to the other end of the cable and an electric power cable is connected to the light control device. A light source (for example, incandescent lamp) is incorporated in the casing of the illumination main body, and a diffusion plate is disposed at the front to provide a plane light source. The light control device has a light control knob capable of remote-controlling the brightness of the light of the illumination main body. In the fuel inspection device thus constituted, halation is scarcely caused on the image screen upon inspection of fuels by a submerged type television camera to facilitate control upon inspection. Accordingly, efficiency of the fuel inspection can be improved to shorten the operation time. (I.S.)
2017-10-20
The Food and Drug Administration (FDA or we) is classifying the device to detect and identify microbial pathogen nucleic acids in cerebrospinal fluid into class II (special controls). The special controls that will apply to the device type are identified in this order and will be part of the codified language for the device to detect and identify microbial pathogen nucleic acids in cerebrospinal fluid’s classification. We are taking this action because we have determined that classifying the device into class II (special controls) will provide a reasonable assurance of safety and effectiveness of the device. We believe this action will also enhance patients' access to beneficial innovative devices, in part by reducing regulatory burdens.
DEFF Research Database (Denmark)
Stisen, Allan; Blunck, Henrik; Bhattacharya, Sourav
2015-01-01
research results. This is due to variations in training and test device hardware and their operating system characteristics among others. In this paper, we systematically investigate sensor-, device- and workload-specific heterogeneities using 36 smartphones and smartwatches, consisting of 13 different...... device models from four manufacturers. Furthermore, we conduct experiments with nine users and investigate popular feature representation and classification techniques in HAR research. Our results indicate that on-device sensor and sensor handling heterogeneities impair HAR performances significantly...
2015-09-01
1. Overview The purpose of this document is to demonstrate how to gain administrative privileges on an Android device. The term “rooting” is...is applicable for the Samsung Galaxy S3 as well as many other Android devices, but there are several steps involved in rooting an Android device (as...root access has been granted. 4. Conclusion This document serves as a tutorial on how to grant user administrative privilege to an Android device by
HIGH-RESOLUTION RADIO OBSERVATIONS OF THE REMNANT OF SN 1987A AT HIGH FREQUENCIES
International Nuclear Information System (INIS)
Zanardo, Giovanna; Staveley-Smith, L.; Potter, T. M.; Ng, C.-Y.; Gaensler, B. M.; Manchester, R. N.; Tzioumis, A. K.
2013-01-01
We present new imaging observations of the remnant of Supernova (SN) 1987A at 44 GHz, performed in 2011 with the Australia Telescope Compact Array (ATCA). The 0.''35 × 0.''23 resolution of the diffraction-limited image is the highest achieved to date in high-dynamic range. We also present a new ATCA image at 18 GHz derived from 2011 observations, which is super-resolved to 0.''25. The flux density is 40 ± 2 mJy at 44 GHz and 81 ± 6 mJy at 18 GHz. At both frequencies, the remnant exhibits a ring-like emission with two prominent lobes, and an east-west brightness asymmetry that peaks on the eastern lobe. A central feature of fainter emission appears at 44 GHz. A comparison with previous ATCA observations at 18 and 36 GHz highlights higher expansion velocities of the remnant's eastern side. The 18-44 GHz spectral index is α = –0.80 (S ν ∝ν α ). The spectral index map suggests slightly steeper values at the brightest sites on the eastern lobe, whereas flatter values are associated with the inner regions. The remnant morphology at 44 GHz generally matches the structure seen with contemporaneous X-ray and Hα observations. Unlike the Hα emission, both the radio and X-ray emission peaks on the eastern lobe. The regions of flatter spectral index align and partially overlap with the optically visible ejecta. Simple free-free absorption models suggest that emission from a pulsar wind nebula or a compact source inside the remnant may now be detectable at high frequencies or at low frequencies if there are holes in the ionized component of the ejecta.
National Research Council Canada - National Science Library
Schuller, Ivan
2007-01-01
...: ballistic magnetoresistance, magnetic field proximity effect and spin drag. These three phenomena would then be exploited for the design of novel device architectures and to investigate the physical principles behind these devices...
International Nuclear Information System (INIS)
Rollo, F.D.
1977-01-01
The performance of any imaging device depends on two principal factors inherent to the device, namely, plane sensitivity and spatial resolution. These factors may be defined as follows: plane sensitivity is the counts per second recorded by the imaging device for each disintegration per second per square centimeter occurring within a plane sheet of radioactivity. Spatial resolution may be defined as the fidelity with which the imaging device reproduces the activity distribution of an object in the image plane. In all imaging devices, a trade-off exists between these two parameters; that is, as sensitivity improves, spatial resolution is degraded, and vice versa. Therefore, to fully evaluate an imaging system a technique should be selected that measures both parameters and reflects the trade-off between the two. In addition, the method should approximate the clinical problem, namely, the detection of a focal lesion within an activity distribution. Several methods have been described to evaluate nuclear imaging devices. The more common techniques include the use of organ phantoms, bar phantoms, line-spread functions, modulation transfer functions, contrast efficiency functions, and performance index functions. Each of these techniques is briefly described in this chapter, and their advantages and disadvantages are discussed. In addition, a phantom that can be used to simply and completely measure overall imaging system performance is described
Ergonomic material-handling device
Barsnick, Lance E.; Zalk, David M.; Perry, Catherine M.; Biggs, Terry; Tageson, Robert E.
2004-08-24
A hand-held ergonomic material-handling device capable of moving heavy objects, such as large waste containers and other large objects requiring mechanical assistance. The ergonomic material-handling device can be used with neutral postures of the back, shoulders, wrists and knees, thereby reducing potential injury to the user. The device involves two key features: 1) gives the user the ability to adjust the height of the handles of the device to ergonomically fit the needs of the user's back, wrists and shoulders; and 2) has a rounded handlebar shape, as well as the size and configuration of the handles which keep the user's wrists in a neutral posture during manipulation of the device.
Materials for electrochemical device safety
Vissers, Daniel R.; Amine, Khalil; Thackeray, Michael M.; Kahaian, Arthur J.; Johnson, Christopher S.
2015-04-07
An electrochemical device includes a thermally-triggered intumescent material or a gas-triggered intumescent material. Such devices prevent or minimize short circuits in a device that could lead to thermal run-away. Such devices may include batteries or supercapacitors.
Heterostructures and quantum devices
Einspruch, Norman G
1994-01-01
Heterostructure and quantum-mechanical devices promise significant improvement in the performance of electronic and optoelectronic integrated circuits (ICs). Though these devices are the subject of a vigorous research effort, the current literature is often either highly technical or narrowly focused. This book presents heterostructure and quantum devices to the nonspecialist, especially electrical engineers working with high-performance semiconductor devices. It focuses on a broad base of technical applications using semiconductor physics theory to develop the next generation of electrical en
International Nuclear Information System (INIS)
Hosogane, Nobuyuki; Nakayama, Takahide.
1985-01-01
Purpose: To prevent concentration of plasma currents to the plasma center upon plasma shutdown in a torus type thermonuclear device by the injection of fuels to the plasma center thereby prevent plasma disruption at the plasma center. Constitution: The plasma shutdown device comprises a plasma current measuring device that measures the current distribution of plasmas confined within a vacuum vessel and outputs a control signal for cooling the plasma center when the plasma currents concentrate to the plasma center and a fuel supply device that supplies fuels to the plasma center for cooling the center. The fuels are injected in the form of pellets into the plasmas. The direction and the velocity of the injection are set such that the pellets are ionized at the center of the plasmas. (Horiuchi, T.)
Photovoltaic device and method
Cleereman, Robert J; Lesniak, Michael J; Keenihan, James R; Langmaid, Joe A; Gaston, Ryan; Eurich, Gerald K; Boven, Michelle L
2015-01-27
The present invention is premised upon an improved photovoltaic device ("PVD") and method of use, more particularly to an improved photovoltaic device with an integral locator and electrical terminal mechanism for transferring current to or from the improved photovoltaic device and the use as a system.
International Nuclear Information System (INIS)
Lu, J-C; Liao, W-H; Tung, Y-C
2012-01-01
Polydimethylsiloxane (PDMS) microfluidic device is one of the most essential techniques that advance microfluidics research in recent decades. PDMS is broadly exploited to construct microfluidic devices due to its unique and advantageous material properties. To realize more functionalities, PDMS microfluidic devices with multi-layer architectures, especially those with sandwiched membranes, have been developed for various applications. However, existing alignment methods for device fabrication are mainly based on manual observations, which are time consuming, inaccurate and inconsistent. This paper develops a magnet-assisted alignment method to enhance device-level alignment accuracy and precision without complicated fabrication processes. In the developed alignment method, magnets are embedded into PDMS layers at the corners of the device. The paired magnets are arranged in symmetric positions at each PDMS layer, and the magnetic attraction force automatically pulls the PDMS layers into the aligned position during assembly. This paper also applies the method to construct a practical microfluidic device, a tunable chaotic micromixer. The results demonstrate the successful operation of the device without failure, which suggests the accurate alignment and reliable bonding achieved by the method. Consequently, the fabrication method developed in this paper is promising to be exploited to construct various membrane-sandwiched PDMS microfluidic devices with more integrated functionalities to advance microfluidics research. (paper)
Hot gas handling device and motorized vehicle comprising the device
Klein Geltink, J.; Beukers, A.; Van Tooren, M.J.L.; Koussios, S.
2012-01-01
The invention relates to a device for handling hot exhaust gasses discharged from an internal combustion engine. The device comprises a housing (2), enclosing a space (3) for transporting the exhaust gasses. The housing (2) is provided with an entrance - opening (4) for the exhaust gasses discharged
... Artery Disease Venous Thromboembolism Aortic Aneurysm More Implantable Medical Devices Updated:Sep 16,2016 For Rhythm Control ... a Heart Attack Introduction Medications Surgical Procedures Implantable Medical Devices • Life After a Heart Attack • Heart Attack ...
Durbeck, Robert
1988-01-01
Output Hardcopy Devices provides a technical summary of computer output hardcopy devices such as plotters, computer output printers, and CRT generated hardcopy. Important related technical areas such as papers, ribbons and inks, color techniques, controllers, and character fonts are also covered. Emphasis is on techniques primarily associated with printing, as well as the plotting capabilities of printing devices that can be effectively used for computer graphics in addition to their various printing functions. Comprised of 19 chapters, this volume begins with an introduction to vector and ras
Romero, Edwar
2013-01-01
From exoskeletons to neural implants, biomedical devices are no less than life-changing. Compact and constant power sources are necessary to keep these devices running efficiently. Edwar Romero's Powering Biomedical Devices reviews the background, current technologies, and possible future developments of these power sources, examining not only the types of biomedical power sources available (macro, mini, MEMS, and nano), but also what they power (such as prostheses, insulin pumps, and muscular and neural stimulators), and how they work (covering batteries, biofluids, kinetic and ther
2013-04-26
... Devices, Portable Music and Data Processing Devices, Computers and Components Thereof; Commission Decision... importation of certain wireless communication devices, portable music and data processing devices, computers... '826 patent''). The complaint further alleges the existence of a domestic industry. The Commission's...
2012-06-29
... Devices, Portable Music and Data Processing Devices, Computers and Components Thereof, Commission Decision... importation of certain wireless communication devices, portable music and data processing devices, computers... further alleges the existence of a domestic industry. The Commission's notice of investigation named Apple...
2013-02-25
... Devices, Portable Music and Data Processing Devices, Computers and Components Thereof; Commission Decision... importation of certain wireless communication devices, portable music and data processing devices, computers... further alleges the existence of a domestic industry. The Commission's notice of investigation named Apple...
Interaction of the WAT Source in A3395 with the Intracluster Medium
Indian Academy of Sciences (India)
2016-01-27
Jan 27, 2016 ... Using X-ray observations from Chandra and XMM-Newton and radio observations from the Australia Telescope Compact Array (ATCA), we have examined the merging environment of the bimodal cluster Abell 3395. From X-ray data we have produced thermodynamic maps of the cluster. The Wide Angle ...
Rapid interstellar scintillation of quasar PKS 1257-326
Bignall, Hayley E.; Jauncey, David L.; Lovell, James E. J.; Tzioumis, Anastasios K.; Macquart, Jean-Pierre; Kedziora-Chudczer, Lucyna; Engvold, O
2005-01-01
PKS 1257-326 is one of three quasars known to show unusually large and rapid, intra-hour intensity variations, as a result of scintillation in the turbulent Galactic interstellar medium. We have measured time delays in the variability pattern arrival times at the VLA and the ATCA, as well as an
Humanitarian Use Device and Humanitarian Device Exemption regulatory programs: pros and cons.
Bernad, Daniel Maxwell
2009-03-01
The US FDA established the Humanitarian Use Device (HUD) and Humanitarian Device Exemption (HDE) program to encourage medical device firms to address rare diseases. Despite being in existence for over a decade, there has only been one peer-reviewed publication examining this field. The objective of this report is to investigate how the HUD/HDE program differs from the standard regulatory system, discuss its potential advantages and disadvantages, and to speculate which humanitarian devices will be brought to market within the next 5 years. A total of 40 semistructured interviews with stakeholders, representing approximately half (n = 20, 49%) of the firms that have successfully obtained HDE-approved products, were performed in order to acquire the primary data for this paper. There appear to be short-term gains and long-term drains associated with launching humanitarian devices to market. This report aims to provide sponsors with information that may allow them to make better decisions during their product development of humanitarian devices and may, hopefully, also play a role in encouraging other sponsors to take the necessary steps forward in helping to find treatments for patients with rare diseases.
2012-03-09
... DEPARTMENT OF HEALTH AND HUMAN SERVICES Food and Drug Administration 21 CFR Part 866 [Docket No. FDA-2012-N-0165] Medical Devices; Immunology and Microbiology Devices; Classification of Norovirus... AND MICROBIOLOGY DEVICES 0 1. The authority citation for 21 CFR part 866 continues to read as follows...
21 CFR 882.5050 - Biofeedback device.
2010-04-01
... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Biofeedback device. 882.5050 Section 882.5050 Food... DEVICES NEUROLOGICAL DEVICES Neurological Therapeutic Devices § 882.5050 Biofeedback device. (a) Identification. A biofeedback device is an instrument that provides a visual or auditory signal corresponding to...
2012-08-30
... Devices, Portable Music and Data Processing Devices, Computers and Components Thereof; Notice of... communication devices, portable music and data processing devices, computers and components thereof by reason of... complaint further alleges the existence of a domestic industry. The Commission's notice of investigation...
Plasma facing device of thermonuclear device
International Nuclear Information System (INIS)
Sumita, Hideo; Ioki, Kimihiro.
1993-01-01
The present invention improves integrity of thermal structures of a plasma facing device. That is, in the plasma facing device, an armour block portion from a metal cooling pipe to a carbon material comprises a mixed material of the metal as the constituent material of the cooling pipe and ceramics. Then, the mixing ratio of the composition is changed continuously or stepwise to suppress peakings of remaining stresses upon production and thermal stresses upon exertion of thermal loads. Accordingly, thermal integrity of the structural materials can further be improved. In this case, a satisfactory characteristic can be obtained also by using ceramics instead of carbon for the mixed material, and the characteristic such as heat expansion coefficient is similar to that of the armour tile. (I.S.)
Cybersecurity for Connected Diabetes Devices.
Klonoff, David C
2015-04-16
Diabetes devices are increasingly connected wirelessly to each other and to data-displaying reader devices. Threats to the accurate flow of information and commands may compromise the function of these devices and put their users at risk of health complications. Sound cybersecurity of connected diabetes devices is necessary to maintain confidentiality, integrity, and availability of the data and commands. Diabetes devices can be hacked by unauthorized agents and also by patients themselves to extract data that are not automatically provided by product software. Unauthorized access to connected diabetes devices has been simulated and could happen in reality. A cybersecurity standard designed specifically for connected diabetes devices will improve the safety of these products and increase confidence of users that the products will be secure. © 2015 Diabetes Technology Society.
Human Factors and Medical Devices
International Nuclear Information System (INIS)
Dick Sawyer
1998-01-01
Medical device hardware- and software-driven user interfaces should be designed to minimize the likelihood of use-related errors and their consequences. The role of design-induced errors in medical device incidents is attracting widespread attention. The U.S. Food and Drug Administration (FDA) is fully cognizant that human factors engineering is critical to the design of safe medical devices, and user interface design is receiving substantial attention by the agency. Companies are paying more attention to the impact of device design, including user instructions, upon the performance of those health professionals and lay users who operate medical devices. Concurrently, the FDA is monitoring human factors issues in its site inspections, premarket device approvals, and postmarket incident evaluations. Overall, the outlook for improved designs and safer device operation is bright
Radiation emitting devices act
International Nuclear Information System (INIS)
1970-01-01
This Act, entitled the Radiation Emitting Devices Act, is concerned with the sale and importation of radiation emitting devices. Laws relating to the sale, lease or import, labelling, advertising, packaging, safety standards and inspection of these devices are listed as well as penalties for any person who is convicted of breaking these laws
Containment and surveillance devices
International Nuclear Information System (INIS)
Campbell, J.W.; Johnson, C.S.; Stieff, L.R.
The growing acceptance of containment and surveillance as a means to increase safeguards effectiveness has provided impetus to the development of improved surveillance and containment devices. Five recently developed devices are described. The devices include one photographic and two television surveillance systems and two high security seals that can be verified while installed
2011-11-07
... Drug Administration 21 CFR Part 866 Microbiology Devices; Classification of In Vitro Diagnostic Device... CFR Part 866 [Docket No. FDA-2011-N-0729] Microbiology Devices; Classification of In Vitro Diagnostic... of the Microbiology Devices Advisory Panel (the panel). FDA is publishing in this document the...
2011-05-18
.... FDA-2011-N-0103] Microbiology Devices; Classification of In Vitro Diagnostic Device for Bacillus... of the Microbiology Devices Advisory Panel (the Panel). In addition, the proposed rule would... in the Federal Register. 1. Transcript of the FDA Microbiology Devices Panel meeting, March 7, 2002...
Organic bistable light-emitting devices
Ma, Liping; Liu, Jie; Pyo, Seungmoon; Yang, Yang
2002-01-01
An organic bistable device, with a unique trilayer structure consisting of organic/metal/organic sandwiched between two outmost metal electrodes, has been invented. [Y. Yang, L. P. Ma, and J. Liu, U.S. Patent Pending, U.S. 01/17206 (2001)]. When the device is biased with voltages beyond a critical value (for example 3 V), the device suddenly switches from a high-impedance state to a low-impedance state, with a difference in injection current of more than 6 orders of magnitude. When the device is switched to the low-impedance state, it remains in that state even when the power is off. (This is called "nonvolatile" phenomenon in memory devices.) The high-impedance state can be recovered by applying a reverse bias; therefore, this bistable device is ideal for memory applications. In order to increase the data read-out rate of this type of memory device, a regular polymer light-emitting diode has been integrated with the organic bistable device, such that it can be read out optically. These features make the organic bistable light-emitting device a promising candidate for several applications, such as digital memories, opto-electronic books, and recordable papers.
Semiconductor-based, large-area, flexible, electronic devices
Goyal, Amit [Knoxville, TN
2011-03-15
Novel articles and methods to fabricate the same resulting in flexible, large-area, triaxially textured, single-crystal or single-crystal-like, semiconductor-based, electronic devices are disclosed. Potential applications of resulting articles are in areas of photovoltaic devices, flat-panel displays, thermophotovoltaic devices, ferroelectric devices, light emitting diode devices, computer hard disc drive devices, magnetoresistance based devices, photoluminescence based devices, non-volatile memory devices, dielectric devices, thermoelectric devices and quantum dot laser devices.
Secure-Network-Coding-Based File Sharing via Device-to-Device Communication
Wang, Lei; Wang, Qing
2017-01-01
In order to increase the efficiency and security of file sharing in the next-generation networks, this paper proposes a large scale file sharing scheme based on secure network coding via device-to-device (D2D) communication. In our scheme, when a user needs to share data with others in the same area, the source node and all the intermediate nodes need to perform secure network coding operation before forwarding the received data. This process continues until all the mobile devices in the netw...
1980-06-01
distribution for models of far wake, rolling up wake, and near wace . -139- from rRU and fRU at =0 to r = I and f = l at = RIV An analysis of the rollup... economy , the vortex sheets can be replaced by line segments in the middle of the sheets, with a large core radius (which in this case does not have
Positioning devices for patients
International Nuclear Information System (INIS)
Heavens, M.
1981-01-01
It has been suggested that it is very important to position patients reproducibly at different stages of radiotherapy treatment planning and treatment, or similar procedures. Devices have been described for positioning a patient's upper and lower thorax. This invention provides reproducible positioning for a female patient's breasts, for example in planning treatment of and treating breast tumours. The patient is placed prone, using for example an upper thorax device. A support device is placed central to and beneath her breasts to partially displace them outwards. The device may be triangular in section with one apex contacting the chest wall at the sternum. Restraining straps may be provided to hold the breasts against the support device. Means may be provided to take a healthy breast from the path of radiation through the tumour. (author)
2013-05-08
... DEPARTMENT OF HEALTH AND HUMAN SERVICES Food and Drug Administration [Docket No. FDA-2013-N-0001] Microbiology Devices Panel of the Medical Devices Advisory Committee; Notice of Meeting AGENCY: Food and Drug...: Microbiology Devices Panel of the Medical Devices Advisory Committee. General Function of the Committee: To...
76 FR 48871 - Immunology Devices Panel of the Medical Devices Advisory Committee; Notice of Meeting
2011-08-09
... DEPARTMENT OF HEALTH AND HUMAN SERVICES Food and Drug Administration [Docket No. FDA-2011-N-0002] Immunology Devices Panel of the Medical Devices Advisory Committee; Notice of Meeting AGENCY: Food and Drug...: Immunology Devices Panel of the Medical Devices Advisory Committee. General Function of the Committee: To...
Energy Technology Data Exchange (ETDEWEB)
Hawley, W.W.
1983-03-29
A transportable solar panel foundation device which has a bottom member, at least one upstanding side member, and an essentially open top. The side members are angled to permit nesting of a plurality of the foundation devices, and reinforcement pads are carried by the foundation device to support legs for one or more solar panels.
Equipment abnormality monitoring device
International Nuclear Information System (INIS)
Ando, Yasumasa
1991-01-01
When an operator hears sounds in a plantsite, the operator compares normal sounds of equipment which he previously heard and remembered with sounds he actually hears, to judge if they are normal or abnormal. According to the method, there is a worry that abnormal conditions can not be appropriately judged in a case where the number of objective equipments is increased and in a case that the sounds are changed gradually slightly. Then, the device of the present invention comprises a plurality of monitors for monitoring the operation sound of equipments, a recording/reproducing device for recording and reproducing the signals, a selection device for selecting the reproducing signals among the recorded signals, an acoustic device for converting the signals to sounds, a switching device for switching the signals to be transmitted to the acoustic device between to signals of the monitor and the recording/reproducing signals. The abnormality of the equipments can be determined easily by comparing the sounds representing the operation conditions of equipments for controlling the plant operation and the sounds recorded in their normal conditions. (N.H.)
International Nuclear Information System (INIS)
Iwashige, Kengo; Otsuka, Masaya; Yokoyama, Iwao; Yamakawa, Masanori.
1990-01-01
The present invention concerns an after-heat removing device for first reactors. A heat accumulation portion provided in a cooling channel of an after-heat removing device is disposed before a coil-like heat conduction pipe for cooling of the after-heat removing device. During normal reactor operation, the temperature in the heat accumulation portion is near the temperature of the high temperature plenum due to heat conduction and heat transfer from the high temperature plenum. When the reactor is shutdown and the after-heat removing device is started, coolants cooled in the air cooler start circulation. The coolants arriving at the heat accumulation portion deprive heat from the heat accumulation portion and, ion turn, increase their temperature and then reach the cooling coil. Subsequently, the heat calorie possessed in the heat accumulation portion is reduced and the after-heat removing device is started for the operation at a full power. This can reduce the thermal shocks applied to the cooling coil or structures in a reactor vessel upon starting the after-heat removing device. (I.N.)
Utilization technique on variable speed device
International Nuclear Information System (INIS)
1989-12-01
This reports of workshop on power technology describes using technique on variable speed device, which deals with alternating current situation and prospect of current variable speed device, technical trend and prospect of electronics, reduce expenses by variable speed device, control technique, measurement technology, high voltage variable speed device, recent trend of inverter technology, low voltage and high voltage variable speed device control device, operating variable speed device in cooling fan, FDF application and defect case of variable speed device, cooling pump application of water variable transformer, inverter application and energy effect of ventilation equipment, application of variable speed device and analysis of the result of operation and study for application of variable speed technology.
Hardware device binding and mutual authentication
Hamlet, Jason R; Pierson, Lyndon G
2014-03-04
Detection and deterrence of device tampering and subversion by substitution may be achieved by including a cryptographic unit within a computing device for binding multiple hardware devices and mutually authenticating the devices. The cryptographic unit includes a physically unclonable function ("PUF") circuit disposed in or on the hardware device, which generates a binding PUF value. The cryptographic unit uses the binding PUF value during an enrollment phase and subsequent authentication phases. During a subsequent authentication phase, the cryptographic unit uses the binding PUF values of the multiple hardware devices to generate a challenge to send to the other device, and to verify a challenge received from the other device to mutually authenticate the hardware devices.
Ciere, M.; Hernandez Ganan, C.; van Eeten, M.J.G.
2017-01-01
In computing, remote devices may be identified by means of device fingerprinting, which works by collecting a myriad of clientside attributes such as the device’s browser and operating system version, installed plugins, screen resolution, hardware artifacts, Wi-Fi settings, and anything else
International Nuclear Information System (INIS)
Tai, Ichiro; Shirayama, Shin-pei; Nozaki, Shin-ichi.
1978-01-01
Purpose: To provide an incore monitoring device wherein both radiation monitoring and acoustic monitoring are carried out simultaneously by one detector, whereby installation of the device and signal pick-up are facilitated. Incore conditions are accurately grasped. Constitution: When a neutron is irradiated in a state where a DC voltage is applied between the electrode and the vessel in the device, an ionization current is occured by (n.γ) reaction of the transformed substance as in an ionization chamber, Accordingly, a voltage drop occurs at both ends of the resistor of the radiation signal processing system, as a result of which a neutron flux can be detected. Further, when a sound is generated in the reactor, the monitoring device bottom wall which formed by a piezoelectric element detects the sound-waves. This output signal is picked up by the acoustic signal processing system to judge the generation of sound. (Aizawa, K.)
High-Fidelity Piezoelectric Audio Device
Woodward, Stanley E.; Fox, Robert L.; Bryant, Robert G.
2003-01-01
ModalMax is a very innovative means of harnessing the vibration of a piezoelectric actuator to produce an energy efficient low-profile device with high-bandwidth high-fidelity audio response. The piezoelectric audio device outperforms many commercially available speakers made using speaker cones. The piezoelectric device weighs substantially less (4 g) than the speaker cones which use magnets (10 g). ModalMax devices have extreme fabrication simplicity. The entire audio device is fabricated by lamination. The simplicity of the design lends itself to lower cost. The piezoelectric audio device can be used without its acoustic chambers and thereby resulting in a very low thickness of 0.023 in. (0.58 mm). The piezoelectric audio device can be completely encapsulated, which makes it very attractive for use in wet environments. Encapsulation does not significantly alter the audio response. Its small size (see Figure 1) is applicable to many consumer electronic products, such as pagers, portable radios, headphones, laptop computers, computer monitors, toys, and electronic games. The audio device can also be used in automobile or aircraft sound systems.
Nuclear fuel shipping inspection device
International Nuclear Information System (INIS)
Takahashi, Toshio; Hada, Koji.
1988-01-01
Purpose: To provide an nuclear fuel shipping inspection device having a high detection sensitivity and capable of obtaining highly reliable inspection results. Constitution: The present invention concerns a device for distinguishing a fuel assembly having failed fuel rods in LMFBR type reactors. Coolants in a fuel assembly to be inspected are collected by a sampling pipeway and transferred to a filter device. In the filter device, granular radioactive corrosion products (CP) in the coolants are captured, to reduce the background. The coolants, after being passed through the filter device, are transferred to an FP catching device and gamma-rays of iodine and cesium nuclides are measured in FP radiation measuring device. Subsequently, the coolants transferred to a degasing device to separate rare gas FP in the coolants from the liquid phase. In a case if rare gas fission products are detected by the radiation detector, it means that there is a failed fuel rod in the fuel assembly to be inspected. Since the CP and the soluble FP are separated and extracted for the radioactivity measurement, the reliability can be improved. (Kamimura, M.)
Delay reduction in multi-hop device-to-device communication using network coding
Douik, Ahmed S.
2015-08-12
This paper considers the problem of reducing the broadcast delay of wireless networks using instantly decodable network coding (IDNC) based device-to-device (D2D) communications. In D2D-enabled networks, devices help hasten the recovery of the lost packets of devices in their transmission range by sending network coded packets. To solve the problem, the different events occurring at each device are identified so as to derive an expression for the probability distribution of the decoding delay. The joint optimization problem over the set of transmitting devices and the packet combinations of each is formulated. Due to the high complexity of finding the optimal solution, this paper focuses on cooperation without interference between the transmitting users. The optimal solution, in such interference-less scenario, is expressed using a graph theory approach by introducing the cooperation graph. Extensive simulations compare the decoding delay experienced in the Point to Multi-Point (PMP), the fully connected D2D (FC-D2D) and the more practical partially connected D2D (PC-D2D) configurations and suggest that the PC-D2D outperforms the FC-D2D in all situations and provides an enormous gain for poorly connected networks.
Triboluminescent tamper-indicating device
Johnston, Roger G.; Garcia, Anthony R. E.
2002-01-01
A tamper-indicating device is described. The device has a transparent or translucent cylindrical body that includes triboluminescent material, and an outer opaque layer that prevents ambient light from entering. A chamber in the body holds an undeveloped piece of photographic film bearing an image. The device is assembled from two body members. One of the body members includes a recess for storing film and an optical assembly that can be adjusted to prevent light from passing through the assembly and exposing the film. To use the device with a hasp, the body members are positioned on opposite sides of a hasp, inserted through the hasp, and attached. The optical assembly is then manipulated to allow any light generated from the triboluminescent materials during a tampering activity that damages the device to reach the film and destroy the image on the film.
Safety device of thermonuclear device
International Nuclear Information System (INIS)
Aoki, Isao; Ueda, Shuzo; Seki, Yasushi; Sakurai, Akiko; Kasahara, Fumio; Obara, Atsushi; Yamauchi, Michinori.
1997-01-01
The present invention provides a safety device against an event of intrusion of coolants in a vacuum vessel. Namely, a coolant supply system comprises cooling tubes for supplying coolants to main reactor structure components including a vacuum vessel. A detection means detects leakage of coolants in the vacuum vessel. A coolant supply control means controls the supply of coolants to the main reactor structural components based on the leakage detection signals of the detection means. A stagnated material discharging means discharges stagnated materials in the main reactor structural components caused by the leakage of coolants. The leakage of coolants (for example, water) in the vacuum vessel can thus be detected by the water detection device in the vacuum vessel. A control value of a coolant supply means is closed by the leakage detection signals. The supply of coolants to the main reactor structural components is restricted to suppress the leakage. The stagnated materials are discharged to a tank by way of a water draining valve. (I.S.)
Diamond semiconducting devices
International Nuclear Information System (INIS)
Polowczyk, M.; Klugmann, E.
1999-01-01
Many efforts to apply the semiconducting diamond for construction of electronic elements: resistors, thermistors, photoresistors, piezoresistors, hallotrons, pn diodes, Schottky diodes, IMPATT diodes, npn transistor, MESFETs and MISFETs are reviewed. Considering the possibilities of acceptor and donor doping, electrical resistivity and thermal conductivity of diamond as well as high electric-field breakdown points, that diamond devices could be used at about 30-times higher frequency and more then 8200 times power than silicon devices. Except that, due to high heat resistant of diamond, it is concluded that diamond devices can be used in environment at high temperature, range of 600 o C. (author)
International Nuclear Information System (INIS)
Qurnell, F.D.; Patterson, C.B.
1982-01-01
A readily transportable device of relative light weight comprising a pair of tensioned guides for providing accurate and stable reference planes. An embodiment comprises a pair of rods or guides in tension between a pair of end members, the end members being spaced apart by a pair of arcuate compression members. The tensioned guides provide planes of reference for measuring devices moved therealong adjacent to a component to be measured. The device is especially useful for making on-site dimensional measurements of components, such as irradiated and therefore radioactive components, that cannot readily be transported to an inspection laboratory. (author)
DEFF Research Database (Denmark)
2005-01-01
The invention concerns a digital communication device like a hearing aid or a headset. The hearing aid or headset has a power supply, a signal processing device, means for receiving a wireless signal and a receiver or loudspeaker, which produces an audio signal based on a modulated pulsed signal...... point is provided which is in electrical contact with the metal of the metal box and whereby this third connection point is connected to the electric circuitry of the communication device at a point having a stable and well defined electrical potential. In this way the electro-and magnetic radiation...
National Research Council Canada - National Science Library
Westra, Laura
2008-01-01
... Peoples: Some Recent ATCA Jurisprudence First Nations of Canada and the Legal and Illegal Attacks on their Existence 71 103 125 PART III - JUSTIFYING GENOCIDE: PRINCIPLES AND REALITY 7 8 Genocide and Eco-crime: The Interface Aboriginal Rights in Domestic and International Law, and the Special Case of Arctic Peoples 163 187 PART...
Resource management for device-to-device underlay communication
Song, Lingyang; Xu, Chen
2013-01-01
Device-to-Device (D2D) communication will become a key feature supported by next generation cellular networks, a topic of enormous importance to modern communication. Currently, D2D serves as an underlay to the cellular network as a means to increase spectral efficiency. Although D2D communication brings large benefits in terms of system capacity, it also causes interference as well as increased computation complexity to cellular networks as a result of spectrum sharing. Thus, efficient resource management must be performed to guarantee a target performance level of cellular communication.This
Articulating feedstock delivery device
Jordan, Kevin
2013-11-05
A fully articulable feedstock delivery device that is designed to operate at pressure and temperature extremes. The device incorporates an articulating ball assembly which allows for more accurate delivery of the feedstock to a target location. The device is suitable for a variety of applications including, but not limited to, delivery of feedstock to a high-pressure reaction chamber or process zone.
Uchino, Kenji
2009-01-01
Updating its bestselling predecessor, Ferroelectric Devices, Second Edition assesses the last decade of developments-and setbacks-in the commercialization of ferroelectricity. Field pioneer and esteemed author Uchino provides insight into why this relatively nascent and interdisciplinary process has failed so far without a systematic accumulation of fundamental knowledge regarding materials and device development.Filling the informational void, this collection of information reviews state-of-the-art research and development trends reflecting nano and optical technologies, environmental regulat
Organic 'Plastic' Optoelectronic Devices
International Nuclear Information System (INIS)
Sariciftci, N.S.
2006-01-01
Recent developments on conjugated polymer based photovoltaic diodes and photoactive organic field effect transistors (photOFETs) are discussed. The photophysics of such devices is based on the photoinduced charge transfer from donor type semiconducting conjugated polymers onto acceptor type conjugated polymers or acceptor molecules such as Buckminsterfullerene, C 6 0. Potentially interesting applications include sensitization of the photoconductivity and photovoltaic phenomena as well as photoresponsive organic field effect transistors (photOFETs). Furthermore, organic polymeric/inorganic nanoparticle based 'hybrid' solar cells will be discussed. This talk gives an overview of materials' aspect, charge-transport, and device physics of organic diodes and field-effect transistors. Furthermore, due to the compatibility of carbon/hydrogen based organic semiconductors with organic biomolecules and living cells there can be a great opportunity to integrate such organic semiconductor devices (biOFETs) with the living organisms. In general the largely independent bio/lifesciences and information technology of today, can be thus bridged in an advanced cybernetic approach using organic semiconductor devices embedded in bio-lifesciences. This field of bio-organic electronic devices is proposed to be an important mission of organic semiconductor devices
Medical device-related pressure ulcers
Directory of Open Access Journals (Sweden)
Black JM
2016-08-01
Full Text Available Joyce M Black,1 Peggy Kalowes2 1Adult Health and Illness Department, College of Nursing, University of Nebraska Medical Center, Omaha, NE, 2Nursing Research and Innovation, Long Beach Memorial Miller Children’s & Women’s Hospital, Long Beach, CA, USA Abstract: Pressure ulcers from medical devices are common and can cause significant morbidity in patients of all ages. These pressure ulcers appear in the shape of the device and are most often found from the use of oxygen delivery devices. A hospital program designed to reduce the number of pressure ulcers from medical devices was successful. The program involved the development of a team that focused on skin, the results were then published for the staff to track their performance, and it was found that using foam dressings helped reduce the pressure from the device. The incidence of ulcers from medical devices has remained at zero at this hospital since this program was implemented. Keywords: pressure ulcer, medical device related
Control rod drive hydraulic device
International Nuclear Information System (INIS)
Takekawa, Toru.
1994-01-01
The device of the present invention can reliably prevent a possible erroneous withdrawal of control rod driving mechanism when the pressure of a coolant line is increased by isolation operation of hydraulic control units upon periodical inspection for a BWR type reactor. That is, a coolant line is connected to the downstream of a hydraulic supply device. The coolant line is connected to a hydraulic control unit. A coolant hydraulic detection device and a pressure setting device are disposed to the coolant line. A closing signal line and a returning signal line are disposed, which connect the hydraulic supply device and a flow rate control valve for the hydraulic setting device. In the device of the present invention, even if pressure of supplied coolants is elevated due to isolation of hydraulic control units, the elevation of the hydraulic pressure can be prevented. Accordingly, reliability upon periodical reactor inspection can be improved. Further, the facility is simplified and the installation to an existent facility is easy. (I.S.)
Device for cutting protrusions
Bzorgi, Fariborz M [Knoxville, TN
2011-07-05
An apparatus for clipping a protrusion of material is provided. The protrusion may, for example, be a bolt head, a nut, a rivet, a weld bead, or a temporary assembly alignment tab protruding from a substrate surface of assembled components. The apparatus typically includes a cleaver having a cleaving edge and a cutting blade having a cutting edge. Generally, a mounting structure configured to confine the cleaver and the cutting blade and permit a range of relative movement between the cleaving edge and the cutting edge is provided. Also typically included is a power device coupled to the cutting blade. The power device is configured to move the cutting edge toward the cleaving edge. In some embodiments the power device is activated by a momentary switch. A retraction device is also generally provided, where the retraction device is configured to move the cutting edge away from the cleaving edge.
Recent progress in power electronic devices
Energy Technology Data Exchange (ETDEWEB)
Ikeda, Yasuhiko; Yatsuo, Tsutomu
1987-02-01
Recent progress and future trends of power semiconductor devices (especially with respect to motor speed control) were described. Conventional discrete devices such as thyristors, bipolar transistors, unipolar transistors and Bi-MOS devices were referenced to. Reference was also made to High Voltage ICs. There has been steady progress with each of these power devices in current carrying capability, voltage blocking capability and switching speed. The Bipolar-MOS integreated device and the High Voltage IC are particularly interesting because their abilities and performances are much enhanced by skillful combination with conventional discrete devices. However, no one device meets all the needs, and it will always be necessary to select the right device for a specific task. (11 figs, 35 refs)
2009-01-01
The present invention provides a sensor device and a method for detg. the presence and/or amt. of target moieties in a sample fluid, the target moieties being labeled with magnetic or magnetizable objects. The sensor device comprises a magnetic field generating means adapted for applying a retention
Firewood processing devices in Finland 2002
International Nuclear Information System (INIS)
Mutikainen, A.; Kaerhae, K.
2002-01-01
This Forestry Bulletin presents a review of the market situation for firewood processing devices in Finland during March 2002. The review is based on a questionnaire sent to device manufacturers. The firewood processing devices have traditionally been divided into three groups according to their functions: cross-cutting devices, splitting devices and cross-cutting and splitting devices. With a cross-cutting device the tree can be cross-cut only. Because it is easily possible to build the splitting function into a cross-cutting device, merely manufacturing a cross-cutting devices is rare. In all the splitting machines on the market, the splitting is carried out on a horizontally operated hydraulic cylinder pushing against a splitting blade. The types of cross-cutting blade mostly used in cross-cutting and splitting devices are circular i.e. circular saw blade, and chain saw. These devices are called firewood sawing machines. In firewood chopping machines that have a chopping blade, the wood is cross-cut using a spiral or guillotine blade. The splitting is done by a wedge blade or an axe blade. The firewood chopping machines can cross-cut and split stems up to a maximum of 20-22 cm in diameter. Circular blade firewood machines use either a cone screw or hydraulic cylinder and counter blade for splitting. They can handle wood of 20-30 cm thick in diameter. Machines using a chain saw can process stems of a maximum 30-45 cm thick in diameter. All firewood machines that work with a chain saw use a hydraulic cylinder and counter blade for splitting. According to the questionnaire responses, there were 14 (12 Finnish, one Norwegian and one Italian) manufacturers of firewood processing devices in the market. There were over 80 device models. There were only three cross-cutting devices, thirty splitting devices and forty cross-cutting splitting devices. The price range of the devices was 500-66,000 euros (including 22% VAT). According to the MTT Agrifood Research Finland
Directory of Open Access Journals (Sweden)
Minsuh Seo
Full Text Available Cancer cells adopt glycolysis as the major source of metabolic energy production for fast cell growth. The HIF-1-induced PFKFB3 plays a key role in this adaptation by elevating the concentration of Fru-2,6-BP, the most potent glycolysis stimulator. As this metabolic conversion has been suggested to be a hallmark of cancer, PFKFB3 has emerged as a novel target for cancer chemotherapy. Here, we report that a small molecular inhibitor, N4A, was identified as an initial lead compound for PFKFB3 inhibitor with therapeutic potential. In an attempt to improve its potency, we determined the crystal structure of the PFKFB3•N4A complex to 2.4 Å resolution and, exploiting the resulting molecular information, attained the more potent YN1. When tested on cultured cancer cells, both N4A and YN1 inhibited PFKFB3, suppressing the Fru-2,6-BP level, which in turn suppressed glycolysis and, ultimately, led to cell death. This study validates PFKFB3 as a target for new cancer therapies and provides a framework for future development efforts.
Barber, F A; Herbert, M A
2000-09-01
Meniscal repair devices not requiring accessory incisions are attractive. Many factors contribute to their clinical effectiveness including their biomechanical characteristics. This study compared several new meniscal repair devices with standard meniscal suture techniques. Using a porcine model, axis-of-insertion loads were applied to various meniscal sutures and repair devices. A single device or stitch was placed in a created meniscal tear and a load applied. Both loads and modes of failure were recorded. The load-to-failure data show stratification into 4 distinct statistical groups. Group A, 113 N for a double vertical stitch; group B, 80 N for a single vertical stitch; group C, 57 N for the BioStinger, 56 N for a horizontal mattress stitch, and 50 N for the T-Fix stitch; and group D, 33 N for the Meniscus Arrow (inserted by hand or gun), 32 N for the Clearfix screw, 31 N for the SDsorb staple, 30 N for the Mitek meniscal repair system, and 27 N for the Biomet staple. The failure mechanism varied. Sutures broke away from the knot. The Meniscus Arrow and BioStinger pulled through the inner rim with the crossbar intact. The Clearfix screw failed by multiple mechanisms, whereas 1 leg of the SDsorb staple always pulled out of the outer rim. The Mitek device usually failed by pullout from the inner rim. The Biomet staple always broke at the crosshead or just below it. Although the surgeon should be aware of the material properties of the repair technique chosen for a meniscal repair, this information is only an indication of device performance and may not correlate with clinical healing results.
International Nuclear Information System (INIS)
Tronc, D.
1994-01-01
The invention concerns a proton therapy device using a proton linear accelerator which produces a proton beam with high energies and intensities. The invention lies in actual fact that the proton beam which is produced by the linear accelerator is deflected from 270 deg in its plan by a deflecting magnetic device towards a patient support including a bed the longitudinal axis of which is parallel to the proton beam leaving the linear accelerator. The patient support and the deflecting device turn together around the proton beam axis while the bed stays in an horizontal position. The invention applies to radiotherapy. 6 refs., 5 figs
2013-12-30
... DEPARTMENT OF HEALTH AND HUMAN SERVICES Food and Drug Administration 21 CFR Part 870 [Docket No. FDA-2013-N-0487] Cardiovascular Devices; Reclassification of External Counter- Pulsating Devices for...--CARDIOVASCULAR DEVICES 0 1. The authority citation for 21 CFR part 870 continues to read as follows: Authority...
2010-11-05
... DEPARTMENT OF HEALTH AND HUMAN SERVICES Food and Drug Administration 21 CFR Part 892 [Docket No. FDA-2008-N-0273] Medical Devices; Radiology Devices; Reclassification of Full- Field Digital... and Drugs, 21 CFR part 892 is amended as follows: PART 892--RADIOLOGY DEVICES 0 1. The authority...
Plasma devices for hydrocarbon reformation
Cha, Min
2017-01-01
Plasma devices for hydrocarbon reformation are provided. Methods of using the devices for hydrocarbon reformation are also provided. The devices can include a liquid container to receive a hydrocarbon source, and a plasma torch configured
21 CFR 866.2580 - Gas-generating device.
2010-04-01
...) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Microbiology Devices § 866.2580 Gas-generating device. (a) Identification. A gas-generating device is a device intended for medical purposes that produces...
2012-03-28
... DEPARTMENT OF HEALTH AND HUMAN SERVICES Food and Drug Administration [Docket No. FDA-2012-N-0001] Gastroenterology and Urology Devices Panel of the Medical Devices Advisory Committee; Notice of Meeting AGENCY... public. Name of Committee: Gastroenterology and Urology Devices Panel of the Medical Devices Advisory...
2011-11-21
... DEPARTMENT OF HEALTH AND HUMAN SERVICES Food and Drug Administration [Docket No. FDA-2011-N-0002] Gastroenterology and Urology Devices Panel of the Medical Devices Advisory Committee; Notice of Meeting AGENCY... public. Name of Committee: Gastroenterology and Urology Devices Panel of the Medical Devices Advisory...
International Nuclear Information System (INIS)
Murakami, Kiyonobu; Kurosaki, Akira.
1988-01-01
Purpose: To rapidly insert safety rods for a criticality experiment device into a reactor core container to stop the criticality reaction thereby prevent reactivity accidents. Constitution: A cylinder device having a safety rod as a cylinder rod attached with a piston at one end is constituted. The piston is elevated by pressurized air and attracted and fixed by an electromagnet which is a stationary device disposed at the upper portion of the cylinder. If the current supply to the electromagnet is disconnected, the safety rod constituting the cylinder rod is fallen together with the piston to the lower portion of the cylinder. Since the cylinder rod driving device has neither electrical motor nor driving screw as in the conventional device, necessary space can be reduced and the weight is decreased. In addition, since the inside of the nuclear reactor can easily be shielded completely from the external atmosphere, leakage of radioactive materials can be prevented. (Horiuchi, T.)
Compound semiconductor device modelling
Miles, Robert
1993-01-01
Compound semiconductor devices form the foundation of solid-state microwave and optoelectronic technologies used in many modern communication systems. In common with their low frequency counterparts, these devices are often represented using equivalent circuit models, but it is often necessary to resort to physical models in order to gain insight into the detailed operation of compound semiconductor devices. Many of the earliest physical models were indeed developed to understand the 'unusual' phenomena which occur at high frequencies. Such was the case with the Gunn and IMPATI diodes, which led to an increased interest in using numerical simulation methods. Contemporary devices often have feature sizes so small that they no longer operate within the familiar traditional framework, and hot electron or even quantum mechanical models are required. The need for accurate and efficient models suitable for computer aided design has increased with the demand for a wider range of integrated devices for operation at...
International Nuclear Information System (INIS)
Brammer, C.M. Jr.
1977-01-01
Disclosed is a fuel handling guide tube centering device for use in nuclear reactors during fuel assembly handling operations. The device comprises an outer ring secured to the flange of a nuclear reactor pressure vessel, a rotatable table rotatably coupled to the outer ring, and a plurality of openings through the table. Truncated locating cones are positioned in each of the openings in the table, and the locating cones center the guide tube during fuel handling operations. The openings in the table are located such that each fuel assembly in the nuclear core may be aligned with one of the openings by a suitable rotation of the table. The locating cones thereby provide alignment between the fuel handling mechanism located in the guide tube and the individual fuel assemblies of the cone. The need for a device to provide alignment is especially critical for floating nuclear power plants, where wave motion may exist during fuel handling operations. 5 claims, 4 figures
Fluid circulation control device
International Nuclear Information System (INIS)
Benard, Henri; Henocque, Jean.
1982-01-01
Horizontal fluid circulation control device, of the type having a pivoting flap. This device is intended for being fitted in the pipes of hydraulic installation, particularly in a bleed and venting system of a nuclear power station shifting radioactive or contaminated liquids. The characteristic of this device is the cut-out at the top of the flap to allow the air contained in the pipes to flow freely [fr
2010-10-05
...] General and Plastic Surgery Devices Panel of the Medical Devices Advisory Committee; Amendment of Notice... announcing an amendment to the notice of meeting of the General and Plastic Surgery Devices Panel of the..., FDA announced that a meeting of the General and Plastic Surgery Devices Panel of the Medical Devices...
Przygoda, K.; Piotrowski, A.; Jablonski, G.; Makowski, D.; Pozniak, T.; Napieralski, A.
2009-08-01
Pulsed operation of high gradient superconducting radio frequency (SCRF) cavities results in dynamic Lorentz force detuning (LFD) approaching or exceeding the bandwidth of the cavity of order of a few hundreds of Hz. The resulting modulation of the resonance frequency of the cavity is leading to a perturbation of the amplitude and phase of the accelerating field, which can be controlled only at the expense of RF power. Presently, at various labs, a piezoelectric fast tuner based on an active compensation scheme for the resonance frequency control of the cavity is under study. The tests already performed in the Free Electron Laser in Hamburg (FLASH), proved the possibility of Lorentz force detuning compensation by the means of the piezo element excited with the single period of sine wave prior to the RF pulse. The X-Ray Free Electron Laser (X-FEL) accelerator, which is now under development in Deutsche Elektronen-Synchrotron (DESY), will consists of around 800 cavities with a fast tuner fixture including the actuator/sensor configuration. Therefore, it is necessary to design a distributed control system which would be able to supervise around 25 RF stations, each one comprised of 32 cavities. The Advanced Telecomunications Computing Architecture (ATCA) was chosen to design, develop, and build a Low Level Radio Frequency (LLRF) controller for X-FEL. The prototype control system for Lorentz force detuning compensation was designed and developed. The control applications applied in the system were fitted to the main framework of interfaces and communication protocols proposed for the ATCA-based LLRF control system. The paper presents the general view of a designed control system and shows the first experimental results from the tests carried out in FLASH facility. Moreover, the possibilities for integration of the piezo control system to the ATCA standards are discussed.
Sodium aerosol recovering device
International Nuclear Information System (INIS)
Fujimori, Koji; Ueda, Mitsuo; Tanaka, Kazuhisa.
1997-01-01
A main body of a recovering device is disposed in a sodium cooled reactor or a sodium cooled test device. Air containing sodium aerosol is sucked into the main body of the recovering device by a recycling fan and introduced to a multi-staged metal mesh filter portion. The air about against each of the metal mesh filters, and the sodium aerosol in the air is collected. The air having a reduced sodium aerosol concentration circulates passing through a recycling fan and pipelines to form a circulation air streams. Sodium aerosol deposited on each of the metal mesh filters is scraped off periodically by a scraper driving device to prevent clogging of each of the metal filters. (I.N.)
2010-09-23
...] Gastroenterology and Urology Devices Panel of the Medical Devices Advisory Committee; Notice of Meeting AGENCY... public. Name of Committee: Gastroenterology and Urology Devices Panel of the Medical Devices Advisory... committee will discuss, make recommendations, and vote on information related to the PMA for the LAP-BAND...
2013-04-09
... radiofrequency band ranging between 13 megahertz to 27.12 megahertz and is intended for the treatment of medical...] Orthopaedic and Rehabilitation Devices Panel of the Medical Devices Advisory Committee; Notice of Meeting... the public. Name of Committee: Orthopaedic and Rehabilitation Devices Panel of the Medical Devices...
2011-09-07
... DEPARTMENT OF HEALTH AND HUMAN SERVICES Food and Drug Administration [Docket No. FDA-2011-N-0002] Immunology Devices Panel of the Medical Devices Advisory Committee: Notice of Postponement of Meeting AGENCY... postponing the meeting of the Immunology Devices Panel of the Medical Devices Advisory Committee scheduled...
Journal of Astrophysics and Astronomy | Indian Academy of Sciences
Indian Academy of Sciences (India)
2016-01-27
Jan 27, 2016 ... ... present 18 GHz observations of the Bullet cluster using the Austalia Telescope Compact Array (ATCA), which show structure in the Sunyaev–Zeldovich effect; ... The SZE distribution in the western parts of the cluster are co-spatial with the radio halo indicative of a common origin for the hot and relativistic ...
Roque, Nelson A; Boot, Walter R
2018-02-01
Mobile device proficiency is increasingly required to participate in society. Unfortunately, there still exists a digital divide between younger and older adults, especially with respect to mobile devices (i.e., tablet computers and smartphones). Training is an important goal to ensure that older adults can reap the benefits of these devices. However, efficient/effective training depends on the ability to gauge current proficiency levels. We developed a new scale to accurately assess the mobile device proficiency of older adults: the Mobile Device Proficiency Questionnaire (MDPQ). We present and validate the MDPQ and a short 16-question version of the MDPQ (MDPQ-16). The MDPQ, its subscales, and the MDPQ-16 were found to be highly reliable and valid measures of mobile device proficiency in a large sample. We conclude that the MDPQ and MDPQ-16 may serve as useful tools for facilitating mobile device training of older adults and measuring mobile device proficiency for research purposes.
Extraglottic airway devices: technology update
Directory of Open Access Journals (Sweden)
Sharma B
2017-08-01
Full Text Available Bimla Sharma, Chand Sahai, Jayashree Sood Department of Anaesthesiology, Pain and Perioperative Medicine, Sir Ganga Ram Hospital, New Delhi, India Abstract: Extraglottic airway devices (EADs have revolutionized the field of airway management. The invention of the laryngeal mask airway was a game changer, and since then, there have been several innovations to improve the EADs in design, functionality, safety and construction material. These have ranged from changes in the shape of the mask, number of cuffs and material used, like rubber, polyvinylchloride and latex. Phthalates, which were added to the construction material in order to increase device flexibility, were later omitted when this chemical was found to have serious adverse reproductive outcomes. The various designs brought out by numerous companies manufacturing EADs resulted in the addition of several devices to the airway market. These airway devices were put to use, many of them with inadequate or no evidence base regarding their efficacy and safety. To reduce the possibility of compromising the safety of the patient, the Difficult Airway Society (DAS formed the Airway Device Evaluation Project Team (ADEPT to strengthen the evidence base for airway equipment and vet the new extraglottic devices. A preuse careful analysis of the design and structure may help in better understanding of the functionality of a particular device. In the meantime, the search for the ideal EAD continues. Keywords: extraglottic airway devices, laryngeal mask airway, other extraglottic airway devices, safety, technology update
Biomedical devices and systems security.
Arney, David; Venkatasubramanian, Krishna K; Sokolsky, Oleg; Lee, Insup
2011-01-01
Medical devices have been changing in revolutionary ways in recent years. One is in their form-factor. Increasing miniaturization of medical devices has made them wearable, light-weight, and ubiquitous; they are available for continuous care and not restricted to clinical settings. Further, devices are increasingly becoming connected to external entities through both wired and wireless channels. These two developments have tremendous potential to make healthcare accessible to everyone and reduce costs. However, they also provide increased opportunity for technology savvy criminals to exploit them for fun and profit. Consequently, it is essential to consider medical device security issues. In this paper, we focused on the challenges involved in securing networked medical devices. We provide an overview of a generic networked medical device system model, a comprehensive attack and adversary model, and describe some of the challenges present in building security solutions to manage the attacks. Finally, we provide an overview of two areas of research that we believe will be crucial for making medical device system security solutions more viable in the long run: forensic data logging, and building security assurance cases.
Uranium material removing and recovering device
International Nuclear Information System (INIS)
Takita, Shin-ichi.
1997-01-01
A uranium material removing and recovering device for use in removing surplus uranium heavy metal (UO 2 ) generated in a uranium handling facility comprises a uranium material removing device and a uranium material recovering device. The uranium material removing device comprises an adsorbing portion filled with a uranium adsorbent, a control portion for controlling the uranium adsorbent of the uranium adsorbing portion by a controlling agent, a uranium adsorbing device connected thereto and a jetting device for jetting the adsorbing liquid to equipments deposited with uranium. The recovering device comprises a recovering apparatus for recovering uranium materials deposited with the adsorbent liquid removed by the jetting device and a recovering tank for storing the recovered uranium materials. The device of the present invention can remove surplus uranium simply and safely, mitigate body's load upon removing and recovering operations, facilitate the processing for the exchange of the adsorbent and reduces the radioactive wastes. (T.M.)
Deformable paper origami optoelectronic devices
He, Jr-Hau
2017-01-19
Deformable optoelectronic devices are provided, including photodetectors, photodiodes, and photovoltaic cells. The devices can be made on a variety of paper substrates, and can include a plurality of fold segments in the paper substrate creating a deformable pattern. Thin electrode layers and semiconductor nanowire layers can be attached to the substrate, creating the optoelectronic device. The devices can be highly deformable, e.g. capable of undergoing strains of 500% or more, bending angles of 25° or more, and/or twist angles of 270° or more. Methods of making the deformable optoelectronic devices and methods of using, e.g. as a photodetector, are also provided.
Plasma devices for hydrocarbon reformation
Cha, Min Suk
2017-02-16
Plasma devices for hydrocarbon reformation are provided. Methods of using the devices for hydrocarbon reformation are also provided. The devices can include a liquid container to receive a hydrocarbon source, and a plasma torch configured to be submerged in the liquid. The plasma plume from the plasma torch can cause reformation of the hydrocarbon. The device can use a variety of plasma torches that can be arranged in a variety of positions in the liquid container. The devices can be used for the reformation of gaseous hydrocarbons and/or liquid hydrocarbons. The reformation can produce methane, lower hydrocarbons, higher hydrocarbons, hydrogen gas, water, carbon dioxide, carbon monoxide, or a combination thereof.
[Innovation of characteristic medicinal cupping devices].
Li, Jianping; Zhang, Hui; Yang, Jianmei; Xu, Xinchun; Niu, Yanxia; Cai, Jun
2015-08-01
To compare the differences in the characteristic medicinal cupping therapy between the traditional cupping device and the innovated cupping device. Fifty patients of neck and low back pain were selected. The self-comparison was adopted. The cupping therapy was applied to the acupoints located on the left or right side with the traditional cupping device and the innovated cupping device. The cupping sites were centered at bilateral Quyuan (SI 13) and Dachangshu (BL 25). The cups were retained for 10 min. The traditional cupping device was the glass with smooth border, 100mL. The innovated cupping device was the vacuum-sucking cup. The operative time, medicinal leakage, comfort and cupping marks were observed for the two different cupping devices. The operative time with the innovated medicinal cupping device was shorter obviously compared with the traditional one at Quyuan (SI 13) and Dachangshu (BL 25, both Pcupping device was remarkably improved as compared with the traditional one at the two acupoints (both Pcupping operation (both P>0. 05). The cupping marks with the innovated medicinal cupping device were much deeper than those with the traditional one after cupping therapy. The innovated cupping device is more convenent and comfortable in operation during the characteristic medicinal cupping therapy.
Methods of forming semiconductor devices and devices formed using such methods
Fox, Robert V; Rodriguez, Rene G; Pak, Joshua
2013-05-21
Single source precursors are subjected to carbon dioxide to form particles of material. The carbon dioxide may be in a supercritical state. Single source precursors also may be subjected to supercritical fluids other than supercritical carbon dioxide to form particles of material. The methods may be used to form nanoparticles. In some embodiments, the methods are used to form chalcopyrite materials. Devices such as, for example, semiconductor devices may be fabricated that include such particles. Methods of forming semiconductor devices include subjecting single source precursors to carbon dioxide to form particles of semiconductor material, and establishing electrical contact between the particles and an electrode.
21 CFR 872.1740 - Caries detection device.
2010-04-01
... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Caries detection device. 872.1740 Section 872.1740...) MEDICAL DEVICES DENTAL DEVICES Diagnostic Devices § 872.1740 Caries detection device. (a) Identification. The caries detection device is a device intended to show the existence of decay in a patient's tooth...
Optical Spectra of Radio Planetary Nebulae in the Large Magellanic Cloud
Directory of Open Access Journals (Sweden)
Payne, J. L.
2008-12-01
Full Text Available We present 11 spectra from 12 candidate radio sources co-identified with known planetary nebulae (PNe in the Large Magellanic Cloud (LMC. Originally found in Australia Telescope Compact Array (ATCA LMC surveys at 1.4, 4.8 and 8.64~GHz and confirmed by new high resolution ATCA images at 6 and 3~cm (4arcsec/2arcsec, these complement data recently presented for candidate radio PNe in the Small Magellanic Cloud (SMC. Their spectra were obtained using the Radcliffe 1.9-meter telescope in Sutherland (South Africa. All of the optical PNe and radio candidates are within 2arcsec and may represent a population of selected radio bright sample only. Nebular ionized masses of these objects are estimated to be as high as 1.8~$M_odot$, supporting the idea that massive PNe progenitor central stars lose much of their mass in the asymptotic giant branch (AGB phase or prior. We also identify a sub-population (33\\% of radio PNe candidates with prominent ionized iron emission lines.
The FTK to Level-2 Interface Card (FLIC)
Wang, R.; The ATLAS collaboration; Auerbach, Benjamin; Blair, Robert; Drake, Gary; Love, Jeremy; Proudfoot, James; Anderson, J.; Zhang, Jinlong
2016-01-01
The FTK to Level-2 Interface Card (FLIC) of the ATLAS Fast TracKer (FTK) trigger upgrade is the final component in the FTK chain of custom electronics. The FTK performs full event tracking using the ATLAS Silicon detectors for every Level-1(L1) accepted event at 100 kHz. The FLIC is a custom Advanced Telecommunications Architecture (ATCA) card that interfaces the upstream FTK system with the ATLAS trigger and data acquisition (TDAQ) system, and allows for event processing on commercial PC blades making use of the 10 GB Ethernet full mesh ATCA back-plane. The FLIC receives data on 8 optical links at a bandwidth of about 1 Gbps per channel, reformats the data to the ATLAS standard record format, and performs the conversion from local to global module identifier using look up tables in SRAM. After processing, the event records are sent out to the TDAQ system using the S-LINK protocol at 2 Gbps, with a latency of O(10 microseconds). The data processing is handled in two Xilinx Virtex-6 FPGAs, with two additional ...
The FTK to Level-2 Interface Card (FLIC)
Anderson, John Thomas; The ATLAS collaboration; Drake, Gary; Love, Jeremy; Proudfoot, James; Wang, Rui; Zhang, Jinlong; Auerbach, Benjamin
2015-01-01
The FTK to Level-2 Interface Card (FLIC) of the ATLAS Fast TracKer (FTK) trigger upgrade is the final component in the FTK chain of custom electronics. The FTK performs full event tracking using the ATLAS Silicon detectors for every Level-1 accepted event at 100 kHz. The FLIC is a custom Advanced Telecommunications Architecture (ATCA) card that interfaces the upstream FTK system with the ATLAS trigger and data acquisition (TDAQ) system, and allows for event processing on commercial PC blades making use of the 10 GB Ethernet full mesh ATCA back-plane. The FLIC receives data on 8 optical links at a bandwidth of ~1 Gbps per channel, reformats the data to the ATLAS standard record format, and performs the conversion from local to global module identifier using look up tables in SRAM. After processing, the event records are sent out to the TDAQ system using the S-LINK protocol at 2 Gbps, with a latency of O(10 microseconds). The data processing is handled in two Xilinx Virtex-6 FPGAs, with two additional Virtex-6 ...
The Southern HII Region Discovery Survey
Wenger, Trey; Miller Dickey, John; Jordan, Christopher; Bania, Thomas M.; Balser, Dana S.; Dawson, Joanne; Anderson, Loren D.; Armentrout, William P.; McClure-Griffiths, Naomi
2016-01-01
HII regions are zones of ionized gas surrounding recently formed high-mass (OB-type) stars. They are among the brightest objects in the sky at radio wavelengths. HII regions provide a useful tool in constraining the Galactic morphological structure, chemical structure, and star formation rate. We describe the Southern HII Region Discovery Survey (SHRDS), an Australia Telescope Compact Array (ATCA) survey that discovered ~80 new HII regions (so far) in the Galactic longitude range 230 degrees to 360 degrees. This project is an extension of the Green Bank Telescope HII Region Discovery Survey (GBT HRDS), Arecibo HRDS, and GBT Widefield Infrared Survey Explorer (WISE) HRDS, which together discovered ~800 new HII regions in the Galactic longitude range -20 degrees to 270 degrees. Similar to those surveys, candidate HII regions were chosen from 20 micron emission (from WISE) coincident with 10 micron (WISE) and 20 cm (SGPS) emission. By using the ATCA to detect radio continuum and radio recombination line emission from a subset of these candidates, we have added to the population of known Galactic HII regions.
The peculiar cluster MACS J0417.5-1154 in the C and X-bands
Sandhu, Pritpal; Malu, Siddharth; Raja, Ramij; Datta, Abhirup
2018-06-01
We present 5.5 and 9.0 GHz Australia Telescope Compact Array (ATCA) observations of the cluster MACSJ0417.5-1154, one of the most massive galaxy clusters and one of the brightest in X-ray in the Massive Cluster Survey (MACS). We estimate diffuse emission at 5.5 and 9.0 GHz from our ATCA observations, and compare the results with the 235 MHz and 610 MHz GMRT observations and 1575 MHz VLA observations. We also estimate the diffuse emission at low frequencies from existing GLEAM survey data (using the MWA telescope (http://www.mwatelescope.org)), and find that the steepening reported in earlier studies may have been an artefact of underestimates of diffuse emission at low frequencies. High-frequency radio observations of galaxy cluster mergers therefore provide an important complement to low-frequency observations, not only for a probing the `on' and `off' state of radio halos in these mergers, but also to constrain energetics of cluster mergers. We comment on the future directions that further studies of this cluster can take.
The Belle II PXD data acquisition and reduction system
Energy Technology Data Exchange (ETDEWEB)
Lange, Soeren; Gessler, Thomas; Kuehn, Wolfgang; Muenchow, David; Spruck, Bjoern [Giessen Univ. (Germany). 2. Physikalisches Inst.; Lin, Haichuan; Liu, Zhen-An; Xu, Hao; Zhao, Jingzhou [IHEP Beijing (China); Collaboration: Belle II Collaboration
2013-07-01
The Belle II DEPFET pixel detector (PXD) will deliver high data rates of up to 21.6 Gbytes/s for 3% detector occupancy. Data of this high rate must be buffered for 5 seconds, corresponding to the HLT (High Level Trigger) latency, and then a region-of-interest (ROI) filter is applied to reduce the data rate by a factor of ≥10 by charged track extrapolation from other detectors (SVD, CDC). The PXD readout system is based upon ATCA (Advanced Telecommunications Architecture). The 3rd PCB iteration uses a concept with a xTCA carrier board (with a Virtex-4 FX60 FPGA for ATCA backplane routing) and 4 AMC modules (each with a Xilinx Virtex-5 FX70T FPGA). The FPGA firmware implementation comprises a receiver core for the high speed optical links (≤6.25 Gbps), a buffer management with lookup of ≤270.000 pointers/s, DDR2 memory write (native port interface, ≥1.5 Gbytes/s), Gigabit ethernet (UDP stack in VHDL) and a parallelized ROI selection algorithm. Test results of all the components are presented.
76 FR 64223 - Cardiovascular Devices; Reclassification of External Pacemaker Pulse Generator Devices
2011-10-17
... Drug Administration 21 CFR Part 870 Cardiovascular Devices; Reclassification of External Pacemaker... Special Controls Guidance Document: External Pacemaker Pulse Generator; Availability; Proposed Rule and... [Docket No. FDA-2011-N-0650] Cardiovascular Devices; Reclassification of External Pacemaker Pulse...
Mobile Device Encryption Systems
Teufl , Peter; Zefferer , Thomas; Stromberger , Christof
2013-01-01
Part 4: Software Security; International audience; The initially consumer oriented iOS and Android platforms, and the newly available Windows Phone 8 platform start to play an important role within business related areas. Within the business context, the devices are typically deployed via mobile device management (MDM) solutions, or within the bring-your-own-device (BYOD) context. In both scenarios, the security depends on many platform security functions, such as permission systems, manageme...
International Nuclear Information System (INIS)
Fairholme, R.J.
1978-01-01
Magnetic bubbles were first described only ten years ago when research workers were discussing orthoferrites containing μm diameter bubbles. However, problems of material fabrication limit crystals to a few mm across which severely curtailed device development. Since then materials have changed and rare-earth-iron garnet films can be grown up 3 inches in diameter with bubble diameters down to sizes below 1 μm. The first commercial products have device capacities in the range 64 000 to 100 000 bits with bubble diameters between 4 and 6 μm. Chip capacities of 1 Mbit are presently under development in the laboratory, as are new techniques to use submicrometre bubbles. The operation and fabrication of a bubble device is described using the serial loop devices currently being manufactured at Plessey as models. Chip organization is one important variable which directly affects the access time. A range of access times and capacities is available which offers a wide range of market opportunities, ranging from consumer products to fixed head disc replacements. some of the application areas are described. (author)
International Nuclear Information System (INIS)
Kogure, Sumio; Matsuo, Takashiro; Yoshida, Yoji
1996-01-01
An underwater running device for an underwater inspection device for detecting inner surfaces of a reactor or a water vessel has an outer frame and an inner frame, and both of them are connected slidably by an air cylinder and connected rotatably by a shaft. The outer frame has four outer frame legs, and each of the outer frame legs is equipped with a sucker at the top end. The inner frame has four inner frame legs each equipped with a sucker at the top end. The outer frame legs and the inner frame legs are each connected with the outer frame and the inner frame by the air cylinder. The outer and the inner frame legs can be elevated or lowered (or extended or contracted) by the air cylinder. The sucker is connected with a jet pump-type negative pressure generator. The device can run and move by repeating attraction and releasing of the outer frame legs and the inner frame legs alternately while maintaining the posture of the inspection device stably. (I.N.)
International Nuclear Information System (INIS)
Hatayama, Akiyoshi; Seki, Eiji; Kita, Yoshio; Nishitani, Takeo.
1993-01-01
The device of the present invention concerns measurement for neutrons in a tokamak type thermonuclear device and it can measure total amount of generated neutrons accurately throughout the operation period even if an error is caused in counted values by plasma disruption. That is, the device comprises (1) a means for detecting presence or absence of occurrence of plasma disruption and the time for the initiation of the occurrence, (2) a first data processing means for processing detection signals, (3) a means for detecting neutrons generated in plasmas and (4) a second data processing means for calculating integrated values for the number of neutrons generated from the start to the completion of electric discharge when no disruption occurs and calculating integrated values for the number of generated neutrons from the start of electric discharge to the time at the initiation of occurrence of the disruption when disruption is present. In the thus constituted device, even if an error is caused by frequent occurrence of plasma disruption, total time integrated amount of neutrons generated in the plasmas can be measured accurately. (I.S.)
International Nuclear Information System (INIS)
Moriyama, Kunio.
1991-01-01
The monitoring device of the present invention is most suitable to early detection for equipment abnormality, or monitoring of state upon transient conditions such as startup and shutdown of an electric power plant, a large-scaled thermonuclear device and an accelerator plant. That is, in existent moitoring devices, acquired data are stored and the present operation states are monitored in comparison. A plant operation aquisition data reproduction section is disposed to the device. From the past operation conditions stored in the plant operation data aquisition reproducing section, the number of operation cycles that agrees with the present plant operation conditions is sought, to determine the agreed aquired data. Since these aquired data are time sequential data measured based on the standard time determined by the operation sequence, aquired data can be reproduced successively on every sample pitches. With such a constitution, aquired data under the same operation conditions as the present conditions are displayed together with the measured data. Accordingly, accurate monitoring can be conducted from the start-up to the shutdown of the plant. (I.S.)
International Nuclear Information System (INIS)
Kasai, Kenji.
1994-01-01
The device of the present invention is utilized, for example, to a reprocessing facility for storing and processing nuclear fuels and measures and controls the nuclear fuel assembly system so as not to exceed criticality. That is, a conventional criticality alarm device applies a predetermined processing to neutron fluxes generated from a nuclear fuel assembly system containing nuclear fuels and outputs an alarm. The device of the present invention comprises (1) a neutron flux supply source for increasing and decreasing neutron fluxes periodically and supplying them to nuclear fuel assemblies, (2) a detector for detecting neutron fluxes in the nuclear fuel assemblies, (3) a critical state judging section for judging the critical state of the nuclear fuel assemblies based on the periodically changing signals obtained from the detector (2) and (4) an alarm section for outputting criticality alarms depending on the result of the judgement. The device of the present invention can accurately recognize the critical state of the nuclear fuel assembly system and can forecast reaching of the nuclear fuel assembly to criticality or prompt neutron critical state. (I.S.)
Chuang, Kai-Chi; Chung, Hao-Tung; Chu, Chi-Yan; Luo, Jun-Dao; Li, Wei-Shuo; Li, Yi-Shao; Cheng, Huang-Chung
2018-06-01
An AlO x layer was deposited on HfO x , and bilayered dielectric films were found to confine the formation locations of conductive filaments (CFs) during the forming process and then improve device-to-device uniformity. In addition, the Ti interposing layer was also adopted to facilitate the formation of oxygen vacancies. As a result, the resistive random access memory (RRAM) device with TiN/Ti/AlO x (1 nm)/HfO x (6 nm)/TiN stack layers demonstrated excellent device-to-device uniformity although it achieved slightly larger resistive switching characteristics, which were forming voltage (V Forming) of 2.08 V, set voltage (V Set) of 1.96 V, and reset voltage (V Reset) of ‑1.02 V, than the device with TiN/Ti/HfO x (6 nm)/TiN stack layers. However, the device with a thicker 2-nm-thick AlO x layer showed worse uniformity than the 1-nm-thick one. It was attributed to the increased oxygen atomic percentage in the bilayered dielectric films of the 2-nm-thick one. The difference in oxygen content showed that there would be less oxygen vacancies to form CFs. Therefore, the random growth of CFs would become severe and the device-to-device uniformity would degrade.
Network-Assisted Device-to-Device (D2D) Direct Proximity Discovery with Underlay Communication
DEFF Research Database (Denmark)
Pratas, Nuno; Popovski, Petar
2015-01-01
) direct communication between proximate devices. While (ii) is treated extensively in the recent literature, (i) has received relatively little attention. In this paper we analyze a network-assisted underlay proximity discovery protocol, where a cellular device can take the role of: announcer (which......Device-to-Device communications are expected to play an important role in current and future cellular generations, by increasing the spatial reuse of spectrum resources and enabling lower latency communication links. This paradigm has two fundamental building blocks: (i) proximity discovery and (ii......, we consider the case where the announcers underlay their messages in the downlink transmissions that are directed towards the monitoring devices. We propose a power control scheme applied to the downlink transmission, which copes with the underlay transmission via additional power expenditure, while...
CIRSE Vascular Closure Device Registry
Reekers, Jim A.; Müller-Hülsbeck, Stefan; Libicher, Martin; Atar, Eli; Trentmann, Jens; Goffette, Pierre; Borggrefe, Jan; Zeleňák, Kamil; Hooijboer, Pieter; Belli, Anna-Maria
2011-01-01
Vascular closure devices are routinely used after many vascular interventional radiology procedures. However, there have been no major multicenter studies to assess the safety and effectiveness of the routine use of closure devices in interventional radiology. The CIRSE registry of closure devices
Case outsourcing medical device reprocessing.
Haley, Deborah
2004-04-01
IN THE INTEREST OF SAVING MONEY, many hospitals are considering extending the life of some single-use medical devices by using medical device reprocessing programs. FACILITIES OFTEN LACK the resources required to meet the US Food and Drug Administration's tough quality assurance standards. BY OUTSOURCING, hospitals can reap the benefits of medical device reprocessing without assuming additional staffing and compliance burdens. OUTSOURCING enables hospitals to implement a medical device reprocessing program quickly, with no capital investment and minimal effort.
Compressed optimization of device architectures
Energy Technology Data Exchange (ETDEWEB)
Frees, Adam [Univ. of Wisconsin, Madison, WI (United States). Dept. of Physics; Gamble, John King [Microsoft Research, Redmond, WA (United States). Quantum Architectures and Computation Group; Ward, Daniel Robert [Sandia National Laboratories (SNL-NM), Albuquerque, NM (United States). Center for Computing Research; Blume-Kohout, Robin J [Sandia National Laboratories (SNL-NM), Albuquerque, NM (United States). Center for Computing Research; Eriksson, M. A. [Univ. of Wisconsin, Madison, WI (United States). Dept. of Physics; Friesen, Mark [Univ. of Wisconsin, Madison, WI (United States). Dept. of Physics; Coppersmith, Susan N. [Univ. of Wisconsin, Madison, WI (United States). Dept. of Physics
2014-09-01
Recent advances in nanotechnology have enabled researchers to control individual quantum mechanical objects with unprecedented accuracy, opening the door for both quantum and extreme- scale conventional computation applications. As these devices become more complex, designing for facility of control becomes a daunting and computationally infeasible task. Here, motivated by ideas from compressed sensing, we introduce a protocol for the Compressed Optimization of Device Architectures (CODA). It leads naturally to a metric for benchmarking and optimizing device designs, as well as an automatic device control protocol that reduces the operational complexity required to achieve a particular output. Because this protocol is both experimentally and computationally efficient, it is readily extensible to large systems. For this paper, we demonstrate both the bench- marking and device control protocol components of CODA through examples of realistic simulations of electrostatic quantum dot devices, which are currently being developed experimentally for quantum computation.
Baking exhaustion device in thermonuclear device
Energy Technology Data Exchange (ETDEWEB)
Kondo, Mitsunori.
1987-02-02
Purpose: To rapidly remove tritium and impurity from the vacuum region in the access port of the baking exhaustion device in a thermonuclear device. Constitution: Each of the gaps at the boundary between a fixed shielding member and a blanket module and at the boundary between the blanket and a divertor is made extremely small so as to minimize the neutron streaming from plasmas. Accordingly, in the case of evacuating the vacuum region in the access port, the gap conductance is extremely poor and the exhaustion speed is low. Then, baking pipeways for flowing high temperature fluids are embedded to the surface layer at the position facing to the vacuum region and the plasma evacuation duct and the vacuum region are connected with an evacuation duct of the access port. By flowing high temperature fluids in the pipeways and conducting evacuation, baking exhaustion can be carried out rapidly. (Kamimura, M.).
Directory of Open Access Journals (Sweden)
Masayoshi Takeuchi
Full Text Available Dietary consumption has recently been identified as a major environmental source of pro-inflammatory advanced glycation end-products (AGEs in humans. It is disputed whether dietary AGEs represent a risk to human health. Nε-(carboxymethyllysine (CML, a representative AGE compound found in food, has been suggested to make a significant contribution to circulating CML levels. However, recent studies have found that the dietary intake of AGEs is not associated with plasma CML concentrations. We have shown that the serum levels of glyceraldehyde-derived AGEs (Glycer-AGEs, but not hemoglobin A1c, glucose-derived AGEs (Glu-AGEs, or CML, could be used as biomarkers for predicting the progression of atherosclerosis and future cardiovascular events. We also detected the production/accumulation of Glycer-AGEs in normal rats administered Glu-AGE-rich beverages. Therefore, we assessed the concentrations of various AGEs in a total of 1,650 beverages and foods that are commonly consumed in Japan. The concentrations of four kinds of AGEs (Glu-AGEs, fructose-derived AGEs (Fru-AGEs, CML, and Glycer-AGEs were measured with competitive enzyme-linked immunosorbent assays involving immunoaffinity-purified specific antibodies. The results of the latter assays indicated that Glu-AGEs and Fru-AGEs (especially Glu-AGEs, but not CML or Glycer-AGEs, are present at appreciable levels in beverages and foods that are commonly consumed by Japanese. Glu-AGEs, Fru-AGEs, CML, and Glycer-AGEs exhibited concentrations of ≥85%, 2-12%, <3%, and trace amounts in the examined beverages and ≥82%, 5-15%, <3%, and trace amounts in the tested foods, respectively. The results of the present study indicate that some lactic acid bacteria beverages, carbonated drinks, sugar-sweetened fruit drinks, sports drinks, mixed fruit juices, confectionery (snacks, dried fruits, cakes, cereals, and prepared foods contain markedly higher Glu-AGE levels than other classes of beverages and foods. We
Ochiai, T.; Nacher, J. C.
2011-09-01
Recently, the application of geometry and conformal mappings to artificial materials (metamaterials) has attracted the attention in various research communities. These materials, characterized by a unique man-made structure, have unusual optical properties, which materials found in nature do not exhibit. By applying the geometry and conformal mappings theory to metamaterial science, it may be possible to realize so-called "Harry Potter cloaking device". Although such a device is still in the science fiction realm, several works have shown that by using such metamaterials it may be possible to control the direction of the electromagnetic field at will. We could then make an object hidden inside of a cloaking device. Here, we will explain how to design invisibility device using differential geometry and conformal mappings.
Nuclear reactor monitoring device
International Nuclear Information System (INIS)
Mihashi, Ishi; Honma, Hitoshi.
1993-01-01
The monitoring device of the present invention comprises a reactor core/reactor system data measuring and controlling device, a radioactivity concentration calculation device for activated coolants for calculating a radioactivity concentration of activated coolants in a main steam and reactor water by using an appropriate physical model, a radioactivity concentration correlation and comparison device for activated coolants for comparing correlationship with a radiation dose and an abnormality alarm device. Since radioactivity of activated primary coolants is monitored at each of positions in the reactor system and occurrence of leakage and the amount thereof from a primary circuit to a secondary circuit is monitored if the reactor has secondary circuit, integrity of the reactor system can be ensured and an abnormality can be detected rapidly. Further, radioactivity concentration of activated primary circuit coolants, represented by 16 N or 15 C, is always monitored at each of positions of PWR primary circuits. When a heat transfer pipe is ruptured in a steam generator, leakage of primary circuit coolants is detected rapidly, as well as the amount of the leakage can be informed. (N.H.)
Mathew, J Itty; Cadnum, Jennifer L; Sankar, Thriveen; Jencson, Annette L; Kundrapu, Sirisha; Donskey, Curtis J
2016-06-01
Mobile handheld devices used in health care settings may become contaminated with health care-associated pathogens. We demonstrated that an enclosed ultraviolet-C radiation device was effective in rapidly reducing methicillin-resistant Staphylococcus aureus, and with longer exposure times, Clostridium difficile spores, on glass slides and reducing contamination on in-use mobile handheld devices. Published by Elsevier Inc.
Encapsulation methods for organic electrical devices
Blum, Yigal D.; Chu, William Siu-Keung; MacQueen, David Brent; Shi, Yijian
2013-06-18
The disclosure provides methods and materials suitable for use as encapsulation barriers in electronic devices. In one embodiment, for example, there is provided an electroluminescent device or other electronic device encapsulated by alternating layers of a silicon-containing bonding material and a ceramic material. The encapsulation methods provide, for example, electronic devices with increased stability and shelf-life. The invention is useful, for example, in the field of microelectronic devices.
Implantation damage in silicon devices
International Nuclear Information System (INIS)
Nicholas, K.H.
1977-01-01
Ion implantation, is an attractive technique for producing doped layers in silicon devices but the implantation process involves disruption of the lattice and defects are formed, which can degrade device properties. Methods of minimizing such damage are discussed and direct comparisons made between implantation and diffusion techniques in terms of defects in the final devices and the electrical performance of the devices. Defects are produced in the silicon lattice during implantation but they are annealed to form secondary defects even at room temperature. The annealing can be at a low temperature ( 0 C) when migration of defects in silicon in generally small, or at high temperature when they can grow well beyond the implanted region. The defect structures can be complicated by impurity atoms knocked into the silicon from surface layers by the implantation. Defects can also be produced within layers on top of the silicon and these can be very important in device fabrication. In addition to affecting the electrical properties of the final device, defects produced during fabrication may influence the chemical properties of the materials. The use of these properties to improve devices are discussed as well as the degradation they can cause. (author)
An introduction to electrooptic devices
Kaminow, Ivan P
1974-01-01
An Introduction to Electrooptic Devices aims to present an introduction to the electrooptic effect and to summarize work on devices employing the electrooptic effect. The book provides the necessary background in classical crystal optics. The text then discusses topics including crystal symmetry, the tensor description of linear dielectric properties, propagation in anisotropic media, and passive crystal optic devices. The book also describes the phenomenological description of tensor nonlinear dielectric properties of crystals, with emphasis on the electrooptic effect; device design and appli
2017-12-19
The Food and Drug Administration (FDA or we) is classifying the fetal head elevator into class II (special controls). The special controls that apply to the device type are identified in this order and will be part of the codified language for the fetal head elevator's classification. We are taking this action because we have determined that classifying the device into class II (special controls) will provide a reasonable assurance of safety and effectiveness of the device. We believe this action will also enhance patients' access to beneficial innovative devices, in part by reducing regulatory burdens.
A microfluidic device with pillars
DEFF Research Database (Denmark)
2014-01-01
The invention provides a microfluidic device for mixing liquid reagents, the device comprises, a chip forming at least one reaction chamber between a bottom and a top and extending between an inlet and an outlet. To enable manufacturing from less rigid materials, the device comprises pillars...
2011-07-26
... is an external device that delivers transcranial repetitive pulsed magnetic fields of sufficient... premarket notification, prior to marketing the device, which contains information about the rTMS system they... significant effect on the human environment. Thus, neither an environmental assessment nor an environmental...
International Nuclear Information System (INIS)
Tanaka, Koji; Egashira, Yasuo; Shimada, Fumie; Igarashi, Noboru.
1983-01-01
Purpose: To save a low temperature reactor water clean-up system indispensable so far and significantly simplify the system by carrying out the reactor water clean-up solely in a high temperature reactor water clean-up system. Constitution: The reactor water clean-up device comprises a high temperature clean-up pump and a high temperature adsorption device for inorganic adsorbents. The high temperature adsorption device is filled with amphoteric ion adsorbing inorganic adsorbents, or amphoteric ion adsorbing inorganic adsorbents and anionic adsorbing inorganic adsorbents. The reactor water clean-up device introduces reactor water by the high temperature clean-up pump through a recycling system to the high temperature adsorption device for inorganic adsorbents. Since cations such as cobalt ions and anions such as chlorine ions in the reactor water are simultaneously removed in the device, a low temperature reactor water clean-up system which has been indispensable so far can be saved to realize the significant simplification for the entire system. (Seki, T.)
Graphene nanoribbons for electronic devices
Energy Technology Data Exchange (ETDEWEB)
Geng, Zhansong; Granzner, Ralf; Kittler, Mario; Schwierz, Frank [FG Festkoerperelektronik, Institut fuer Mikro- und Nanoelektronik und Institut fuer Mikro- und Nanotechnologien MacroNano registered, Technische Universitaet Ilmenau (Germany); Haehnlein, Bernd; Auge, Manuel; Pezoldt, Joerg [FG Nanotechnologie, Institut fuer Mikro- und Nanoelektronik und Institut fuer Mikro- und Nanotechnologien MacroNano registered, Technische Universitaet Ilmenau (Germany); Lebedev, Alexander A. [National Research University of Information Technologies, Mechanics and Optics, St. Petersburg (Russian Federation); Division Solid State Electronics, Ioffe Institute, Sankt-Peterburg (Russian Federation); Davydov, Valery Y. [Division Solid State Electronics, Ioffe Institute, Sankt-Peterburg (Russian Federation)
2017-11-15
Graphene nanoribbons show unique properties and have attracted a lot of attention in the recent past. Intensive theoretical and experimental studies on such nanostructures at both the fundamental and application-oriented levels have been performed. The present paper discusses the suitability of graphene nanoribbons devices for nanoelectronics and focuses on three specific device types - graphene nanoribbon MOSFETs, side-gate transistors, and three terminal junctions. It is shown that, on the one hand, experimental devices of each type of the three nanoribbon-based structures have been reported, that promising performance of these devices has been demonstrated and/or predicted, and that in part they possess functionalities not attainable with conventional semiconductor devices. On the other hand, it is emphasized that - in spite of the remarkable progress achieved during the past 10 years - graphene nanoribbon devices still face a lot of problems and that their prospects for future applications remain unclear. (copyright 2017 by WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)
Trippoli, Sabrina; Caccese, Erminia; Marinai, Claudio; Messori, Andrea
2018-03-01
In the acute ischemic stroke, endovascular devices have shown promising clinical results and are also likely to represent value for money, as several modeling studies have shown. Pharmacoeconomic evaluations in this field, however, have little impact on the procurement of these devices. The present study explored how complex pharmacoeconomic models that evaluate effectiveness and cost can be incorporated into the in-hospital procurement of thrombectomy devices. As regards clinical modeling, we extracted outcomes at three months from randomized trials conducted for four thrombectomy devices, and we projected long-term results using standard Markov modeling. In estimating QALYs, the same model was run for the four devices. As regards economic modeling, we firstly estimated for each device the net monetary benefit (NMB) per patient (threshold = $60,000 per QALY); then, we simulated a competitive tender across the four products by determining the tender-based score (on a 0-to-100 scale). Prices of individual devices were obtained from manufacturers. Extensive sensitivity testing was applied to our analyses. For the four devices (Solitaire, Trevo, Penumbra, Solumbra), QALYs were 1.86, 1.52, 1,79, 1.35, NMB was $101,824, $83,546, $101,923, $69,440, and tender-based scores were 99.70, 43.43, 100, 0, respectively. Sensitivity analysis confirmed findings from base-case. Our results indicate that, in the field of thrombectomy devices, incorporating the typical tools of cost-effectiveness into the processes of tenders and procurement is feasible. Bridging the methodology of cost-effectiveness with the every-day practice of in-hospital procurement can contribute to maximizing the health returns that are generated by in-hospital expenditures for medical devices. Copyright © 2018 Elsevier B.V. All rights reserved.
Payne, Lloyd R.; Cole, David L.
2010-03-30
A fragment capture device for use in explosive containment. The device comprises an assembly of at least two rows of bars positioned to eliminate line-of-sight trajectories between the generation point of fragments and a surrounding containment vessel or asset. The device comprises an array of at least two rows of bars, wherein each row is staggered with respect to the adjacent row, and wherein a lateral dimension of each bar and a relative position of each bar in combination provides blockage of a straight-line passage of a solid fragment through the adjacent rows of bars, wherein a generation point of the solid fragment is located within a cavity at least partially enclosed by the array of bars.
Bolometric Device Based on Fluxoid Quantization
Bonetti, Joseph A.; Kenyon, Matthew E.; Leduc, Henry G.; Day, Peter K.
2010-01-01
The temperature dependence of fluxoid quantization in a superconducting loop. The sensitivity of the device is expected to surpass that of other superconducting- based bolometric devices, such as superconducting transition-edge sensors and superconducting nanowire devices. Just as important, the proposed device has advantages in sample fabrication.
National Research Council Canada - National Science Library
Ellch, Jonathan P
2006-01-01
The research presented in this thesis provides the reader with a set of algorithms and techniques that enable the user to remotely determine what chipset and device driver an 802.11 device is using...
Device Applications of Nonlinear Dynamics
Baglio, Salvatore
2006-01-01
This edited book is devoted specifically to the applications of complex nonlinear dynamic phenomena to real systems and device applications. While in the past decades there has been significant progress in the theory of nonlinear phenomena under an assortment of system boundary conditions and preparations, there exist comparatively few devices that actually take this rich behavior into account. "Device Applications of Nonlinear Dynamics" applies and exploits this knowledge to make devices which operate more efficiently and cheaply, while affording the promise of much better performance. Given the current explosion of ideas in areas as diverse as molecular motors, nonlinear filtering theory, noise-enhanced propagation, stochastic resonance and networked systems, the time is right to integrate the progress of complex systems research into real devices.
Electronic Payments using Mobile Communication Devices
Waaij, B.D. van der; Siljee, B.I.J.; Broekhuijsen, B.J.; Ponsioen, C.; Maas, A.; Aten, R.M.; Hoepman, J.H.; Loon, J.H. van; Smit, M.
2009-01-01
A method of making a payment uses a first mobile communication device (1) and a second mobile communication device (2), each mobile communication device being provided with a respective near field communication unit (11, 21) and at least one of the mobile communication devices being provided with an
Nanoscale MOS devices: device parameter fluctuations and low-frequency noise (Invited Paper)
Wong, Hei; Iwai, Hiroshi; Liou, J. J.
2005-05-01
It is well-known in conventional MOS transistors that the low-frequency noise or flicker noise is mainly contributed by the trapping-detrapping events in the gate oxide and the mobility fluctuation in the surface channel. In nanoscale MOS transistors, the number of trapping-detrapping events becomes less important because of the large direct tunneling current through the ultrathin gate dielectric which reduces the probability of trapping-detrapping and the level of leakage current fluctuation. Other noise sources become more significant in nanoscale devices. The source and drain resistance noises have greater impact on the drain current noise. Significant contribution of the parasitic bipolar transistor noise in ultra-short channel and channel mobility fluctuation to the channel noise are observed. The channel mobility fluctuation in nanoscale devices could be due to the local composition fluctuation of the gate dielectric material which gives rise to the permittivity fluctuation along the channel and results in gigantic channel potential fluctuation. On the other hand, the statistical variations of the device parameters across the wafer would cause the noise measurements less accurate which will be a challenge for the applicability of analytical flicker noise model as a process or device evaluation tool for nanoscale devices. Some measures for circumventing these difficulties are proposed.
Device independence for two-party cryptography and position verification with memoryless devices
Ribeiro, Jérémy; Thinh, Le Phuc; Kaniewski, Jedrzej; Helsen, Jonas; Wehner, Stephanie
2018-06-01
Quantum communication has demonstrated its usefulness for quantum cryptography far beyond quantum key distribution. One domain is two-party cryptography, whose goal is to allow two parties who may not trust each other to solve joint tasks. Another interesting application is position-based cryptography whose goal is to use the geographical location of an entity as its only identifying credential. Unfortunately, security of these protocols is not possible against an all powerful adversary. However, if we impose some realistic physical constraints on the adversary, there exist protocols for which security can be proven, but these so far relied on the knowledge of the quantum operations performed during the protocols. In this work we improve the device-independent security proofs of Kaniewski and Wehner [New J. Phys. 18, 055004 (2016), 10.1088/1367-2630/18/5/055004] for two-party cryptography (with memoryless devices) and we add a security proof for device-independent position verification (also memoryless devices) under different physical constraints on the adversary. We assess the quality of the devices by observing a Bell violation, and, as for Kaniewski and Wehner [New J. Phys. 18, 055004 (2016), 10.1088/1367-2630/18/5/055004], security can be attained for any violation of the Clauser-Holt-Shimony-Horne inequality.
Location tracking forensics on mobile devices
Sack, Stefan; Kröger, Knut; Creutzburg, Reiner
2013-03-01
The spread of navigation devices has increased significantly over the last 10 years. With the help of the current development of even smaller navigation receiver units it is to navigate with almost any current smart phone. Modern navigation systems are no longer limited to satellite navigation, but use current techniques, e.g. WLAN localization. Due to the increased use of navigation devices their relevance to forensic investigations has risen rapidly. Because navigation, for example with navigation equipment and smartphones, have become common place these days, also the amount of saved navigation data has risen rapidly. All of these developments lead to a necessary forensic analysis of these devices. However, there are very few current procedures for investigating of navigation devices. Navigation data is forensically interesting because by the position of the devices in most cases the location and the traveled path of the owner can be reconstructed. In this work practices for forensic analysis of navigation devices are developed. Different devices will be analyzed and it is attempted, by means of forensic procedures to restore the traveled path of the mobile device. For analysis of the various devices different software and hardware is used. There will be presented common procedures for securing and testing of mobile devices. Further there will be represented the specials in the investigation of each device. The different classes considered are GPS handhelds, mobile navigation devices and smartphones. It will be attempted, wherever possible, to read all data of the device. The aim is to restore complete histories of the navigation data and to forensically study and analyze these data. This is realized by the usage of current forensic software e.g. TomTology or Oxygen Forensic Suite. It is also attempted to use free software whenever possible. Further alternative methods are used (e.g. rooting) to access locked data of the unit. To limit the practical work the
2010-08-06
... DEPARTMENT OF HEALTH AND HUMAN SERVICES Food and Drug Administration [Docket No. FDA-2010-N-0001] General and Plastic Surgery Devices Panel of the Medical Devices Advisory Committee; Notice of... General and Plastic Surgery Devices Panel of the Medical Devices Advisory Committee scheduled for August...
Real-time algorithms for JET hard X-ray and gamma-ray profile monitor
International Nuclear Information System (INIS)
Fernandes, A.; Pereira, R.C.; Valcárcel, D.F.; Alves, D.; Carvalho, B.B.; Sousa, J.; Kiptily, V.; Correia, C.M.B.A.; Gonçalves, B.
2014-01-01
Highlights: • Real-time tools and mechanisms are required for data handling and machine control. • A new DAQ system, ATCA based, with embedded FPGAs, was installed at JET. • Different real-time algorithms were developed for FPGAs and MARTe application. • MARTe provides the interface to CODAS and to the JET real-time network. • The new DAQ system is capable to process and deliver data in real-time. - Abstract: The steady state operation with high energy content foreseen for future generation of fusion devices will necessarily demand dedicated real-time tools and mechanisms for data handling and machine control. Consequently, the real-time systems for those devices should be carefully selected and their capabilities previously established. The Joint European Torus (JET) is undertaking an enhancement program, which includes tests of relevant real-time tools for the International Thermonuclear Experimental Reactor (ITER), a key experiment for future fusion devices. In these enhancements a new Data AcQuisition (DAQ) system is included, with real-time processing capabilities, for the JET hard X-ray and gamma-ray profile monitor. The DAQ system is composed of dedicated digitizer modules with embedded Field Programmable Gate Array (FPGA) devices. The interface between the DAQ system, the JET control and data acquisition system and the JET real-time data network is provided by the Multithreaded Application Real-Time executor (MARTe). This paper describes the real-time algorithms, developed for both digitizers’ FPGAs and MARTe application, capable of meeting the DAQ real-time requirements. The new DAQ system, including the embedded real-time features, was commissioned during the 2012 experiments. Results achieved with these real-time algorithms during experiments are presented
Real-time algorithms for JET hard X-ray and gamma-ray profile monitor
Energy Technology Data Exchange (ETDEWEB)
Fernandes, A., E-mail: anaf@ipfn.ist.utl.pt [Associação EURATOM/IST, Instituto de Plasmas e Fusão Nuclear, Instituto Superior Técnico, Universidade Técnica de Lisboa, 1049-001 Lisboa (Portugal); Pereira, R.C.; Valcárcel, D.F.; Alves, D.; Carvalho, B.B.; Sousa, J. [Associação EURATOM/IST, Instituto de Plasmas e Fusão Nuclear, Instituto Superior Técnico, Universidade Técnica de Lisboa, 1049-001 Lisboa (Portugal); Kiptily, V. [EURATOM/CCFE Fusion Association, Culham Centre for Fusion Energy, Culham Science Centre, Abingdon OX14 3DB (United Kingdom); Correia, C.M.B.A. [Centro de Instrumentação, Dept. de Física, Universidade de Coimbra, 3004-516 Coimbra (Portugal); Gonçalves, B. [Associação EURATOM/IST, Instituto de Plasmas e Fusão Nuclear, Instituto Superior Técnico, Universidade Técnica de Lisboa, 1049-001 Lisboa (Portugal)
2014-03-15
Highlights: • Real-time tools and mechanisms are required for data handling and machine control. • A new DAQ system, ATCA based, with embedded FPGAs, was installed at JET. • Different real-time algorithms were developed for FPGAs and MARTe application. • MARTe provides the interface to CODAS and to the JET real-time network. • The new DAQ system is capable to process and deliver data in real-time. - Abstract: The steady state operation with high energy content foreseen for future generation of fusion devices will necessarily demand dedicated real-time tools and mechanisms for data handling and machine control. Consequently, the real-time systems for those devices should be carefully selected and their capabilities previously established. The Joint European Torus (JET) is undertaking an enhancement program, which includes tests of relevant real-time tools for the International Thermonuclear Experimental Reactor (ITER), a key experiment for future fusion devices. In these enhancements a new Data AcQuisition (DAQ) system is included, with real-time processing capabilities, for the JET hard X-ray and gamma-ray profile monitor. The DAQ system is composed of dedicated digitizer modules with embedded Field Programmable Gate Array (FPGA) devices. The interface between the DAQ system, the JET control and data acquisition system and the JET real-time data network is provided by the Multithreaded Application Real-Time executor (MARTe). This paper describes the real-time algorithms, developed for both digitizers’ FPGAs and MARTe application, capable of meeting the DAQ real-time requirements. The new DAQ system, including the embedded real-time features, was commissioned during the 2012 experiments. Results achieved with these real-time algorithms during experiments are presented.
Control rod selecting and driving device
International Nuclear Information System (INIS)
Isobe, Hideo.
1981-01-01
Purpose: To simultaneously drive a predetermined number of control rods in a predetermined mode by the control of addresses for predetermined number of control rods and read or write of driving codified data to and from the memory by way of a memory controller. Constitution: The system comprises a control rod information selection device for selecting predetermined control rods from a plurality of control rods disposed in a reactor and outputting information for driving them in a predetermined mode, a control rod information output device for codifying the information outputted from the above device and outputting the addresses to the predetermined control rods and driving mode coded data, and a driving device for driving said predetermined control rods in a predetermined mode in accordance with the codified data outputted from the above device, said control rod infromation output device comprising a memory device capable of storing a predetermined number of the codified data and a memory control device for storing the predetermined number of data into the above memory device at a predetermined timing while successively outputting the thus stored predetermined number of data at a predetermined timing. (Seki, T.)
Providing Device Independence to Mobile Services
Nylander, Stina; Bylund, Markus
2002-01-01
People want user interfaces to services that are functional and well suited to the device they choose for access. To provide this, services must be able to offer device specific user interfaces for the wide range of devices available today. We propose to combine the two dominant approaches to platform independence, "Write Once, Run Every-where" and "different version for each device", to create multiple device specific user interfaces for mobile services. This gives possibilities to minimize...
Streamline-based microfluidic device
Tai, Yu-Chong (Inventor); Zheng, Siyang (Inventor); Kasdan, Harvey (Inventor)
2013-01-01
The present invention provides a streamline-based device and a method for using the device for continuous separation of particles including cells in biological fluids. The device includes a main microchannel and an array of side microchannels disposed on a substrate. The main microchannel has a plurality of stagnation points with a predetermined geometric design, for example, each of the stagnation points has a predetermined distance from the upstream edge of each of the side microchannels. The particles are separated and collected in the side microchannels.
Chuang, Shun Lien
2009-01-01
The most up-to-date book available on the physics of photonic devices This new edition of Physics of Photonic Devices incorporates significant advancements in the field of photonics that have occurred since publication of the first edition (Physics of Optoelectronic Devices). New topics covered include a brief history of the invention of semiconductor lasers, the Lorentz dipole method and metal plasmas, matrix optics, surface plasma waveguides, optical ring resonators, integrated electroabsorption modulator-lasers, and solar cells. It also introduces exciting new fields of research such as:
Nanoelectronic device applications handbook
Morris, James E
2013-01-01
Nanoelectronic Device Applications Handbook gives a comprehensive snapshot of the state of the art in nanodevices for nanoelectronics applications. Combining breadth and depth, the book includes 68 chapters on topics that range from nano-scaled complementary metal-oxide-semiconductor (CMOS) devices through recent developments in nano capacitors and AlGaAs/GaAs devices. The contributors are world-renowned experts from academia and industry from around the globe. The handbook explores current research into potentially disruptive technologies for a post-CMOS world.These include: Nanoscale advance
Digital forensics for handheld devices
Doherty, Eamon P
2012-01-01
Approximately 80 percent of the world's population now owns a cell phone, which can hold evidence or contain logs about communications concerning a crime. Cameras, PDAs, and GPS devices can also contain information related to corporate policy infractions and crimes. Aimed to prepare investigators in the public and private sectors, Digital Forensics for Handheld Devices examines both the theoretical and practical aspects of investigating handheld digital devices. This book touches on all areas of mobile device forensics, including topics from the legal, technical, academic, and social aspects o
Mobile device security for dummies
Campagna, Rich; Krishnan, Ashwin
2011-01-01
The information you need to avoid security threats on corporate mobile devices Mobile devices have essentially replaced computers for corporate users who are on the go and there are millions of networks that have little to no security. This essential guide walks you through the steps for securing a network and building a bulletproof framework that will protect and support mobile devices in the enterprise. Featuring real-world case scenarios, this straightforward guide shares invaluable advice for protecting mobile devices from the loss of sensitive and confidential corporate informati
2013-03-18
... DEPARTMENT OF HEALTH AND HUMAN SERVICES Food and Drug Administration [Docket No. FDA-2013-N-0001] General and Plastic Surgery Devices Panel of the Medical Devices Advisory Committee; Notice of Meeting... the public. Name of Committee: General and Plastic Surgery Devices Panel of the Medical Devices...
2012-04-05
... DEPARTMENT OF HEALTH AND HUMAN SERVICES Food and Drug Administration [Docket No. FDA-2012-N-0001] General and Plastic Surgery Devices Panel of the Medical Devices Advisory Committee; Notice of Meeting... the public. Name of Committee: General and Plastic Surgery Devices Panel of the Medical Devices...
2011-03-16
... DEPARTMENT OF HEALTH AND HUMAN SERVICES Food and Drug Administration [Docket No. FDA-2011-N-0002] General and Plastic Surgery Devices Panel of the Medical Devices Advisory Committee; Notice of Meeting... the public. Name of Committee: General and Plastic Surgery Devices Panel of the Medical Devices...
2011-10-07
... DEPARTMENT OF HEALTH AND HUMAN SERVICES Food and Drug Administration [Docket No. FDA-2011-N-0002] General and Plastic Surgery Devices Panel of the Medical Devices Advisory Committee; Notice of Meeting... the public. Name of Committee: General and Plastic Surgery Devices Panel of the Medical Devices...
2010-08-16
... DEPARTMENT OF HEALTH AND HUMAN SERVICES Food and Drug Administration [Docket No. FDA-2010-N-0001] General and Plastic Surgery Devices Panel of the Medical Devices Advisory Committee; Notice of Meeting... the public. Name of Committee: General and Plastic Surgery Devices Panel of the Medical Devices...
2013-05-23
... DEPARTMENT OF HEALTH AND HUMAN SERVICES Food and Drug Administration [Docket No. FDA-2013-N-0001] General and Plastic Surgery Devices Panel of the Medical Devices Advisory Committee; Notice of Meeting... the public. Name of Committee: General and Plastic Surgery Devices Panel of the Medical Devices...
2011-07-07
... DEPARTMENT OF HEALTH AND HUMAN SERVICES Food and Drug Administration [Docket No. FDA-2011-N-0478] General and Plastic Surgery Devices Panel of the Medical Devices Advisory Committee; Notice of Meeting... the public. Name of Committee: General and Plastic Surgery Devices Panel of the Medical Devices...
A new high speed, Ultrascale+ based board for the ATLAS jet calorimeter trigger system
Rocco, Elena; The ATLAS collaboration
2018-01-01
To cope with the enhanced luminosity at the Large Hadron Collider (LHC) in 2021, the ATLAS collaboration is planning a major detector upgrade. As a part of this, the Level 1 trigger based on calorimeter data will be upgraded to exploit the fine granularity readout using a new system of Feature EXtractors (FEX), which each reconstruct different physics objects for the trigger selection. The jet FEX (jFEX) system is conceived to provide jet identification (including large area jets) and measurements of global variables within a latency budget of less then 400ns. It consists of 6 modules. A single jFEX module is an ATCA board with 4 large FPGAs of the Xilinx Ultrascale+ family, that can digest a total input data rate of ~3.6 Tb/s using up to 120 Multi Gigabit Transceiver (MGT), 24 electrical optical devices, board control and power on the mezzanines to allow flexibility in upgrading controls functions and components without affecting the main board. The 24-layers stack-up was carefully designed to preserve the s...
A new high speed, Ultrascale+ based board for the ATLAS jet calorimeter trigger system
Rocco, Elena; The ATLAS collaboration
2018-01-01
A new high speed Ultrascale+ based board for the ATLAS jet calorimeter trigger system To cope with the enhanced luminosity at the Large Hadron Collider (LHC) in 2021, the ATLAS collaboration is planning a major detector upgrade. As a part of this, the Level 1 trigger based on calorimeter data will be upgraded to exploit the fine granularity readout using a new system of Feature EXtractors (FEX), which each reconstruct different physics objects for the trigger selection. The jet FEX (jFEX) system is conceived to provide jet identification (including large area jets) and measurements of global variables within a latency budget of less then 400ns. It consists of 6 modules. A single jFEX module is an ATCA board with 4 large FPGAs of the Xilinx Ultrascale+ family, that can digest a total input data rate of ~3.6 Tb/s using up to 120 Multi Gigabit Transceiver (MGT), 24 electrical optical devices, board control and power on the mezzanines to allow flexibility in upgrading controls functions and components without aff...
... the sounds you want to hear. Assistive listening devices bring certain sounds directly to your ears. This can ... a small room or on a stage. Other devices can bring the sound from your TV, radio, or music ...
Secure-Network-Coding-Based File Sharing via Device-to-Device Communication
Directory of Open Access Journals (Sweden)
Lei Wang
2017-01-01
Full Text Available In order to increase the efficiency and security of file sharing in the next-generation networks, this paper proposes a large scale file sharing scheme based on secure network coding via device-to-device (D2D communication. In our scheme, when a user needs to share data with others in the same area, the source node and all the intermediate nodes need to perform secure network coding operation before forwarding the received data. This process continues until all the mobile devices in the networks successfully recover the original file. The experimental results show that secure network coding is very feasible and suitable for such file sharing. Moreover, the sharing efficiency and security outperform traditional replication-based sharing scheme.
International Nuclear Information System (INIS)
McKague, Matthew
2009-01-01
Device independent quantum key distribution (QKD) aims to provide a higher degree of security than traditional QKD schemes by reducing the number of assumptions that need to be made about the physical devices used. The previous proof of security by Pironio et al (2009 New J. Phys. 11 045021) applies only to collective attacks where the state is identical and independent and the measurement devices operate identically for each trial in the protocol. We extend this result to a more general class of attacks where the state is arbitrary and the measurement devices have no memory. We accomplish this by a reduction of arbitrary adversary strategies to qubit strategies and a proof of security for qubit strategies based on the previous proof by Pironio et al and techniques adapted from Renner.
Mobile Device Usage in Higher Education
Delcker, Jan; Honal, Andrea; Ifenthaler, Dirk
2016-01-01
This paper focuses on mobile device usage of students in higher education. While more and more students embrace mobile devices in their daily life, institutions attempt to profit from those devices for educational purposes. It is therefore crucial for institutional development to identify students' needs and how mobile devices may facilitate these…
Electrical device fabrication from nanotube formations
Nicholas, Nolan Walker; Kittrell, W. Carter; Kim, Myung Jong; Schmidt, Howard K.
2013-03-12
A method for forming nanotube electrical devices, arrays of nanotube electrical devices, and device structures and arrays of device structures formed by the methods. Various methods of the present invention allow creation of semiconducting and/or conducting devices from readily grown SWNT carpets rather than requiring the preparation of a patterned growth channel and takes advantage of the self-controlling nature of these carpet heights to ensure a known and controlled channel length for reliable electronic properties as compared to the prior methods.
International Nuclear Information System (INIS)
Nomura, Hiroshi.
1992-01-01
The device of the present invention estimates a place where loose parts occur and structural components as the loose parts in a fluid flow channel of a reactor device, to provide information thereof to a plant operator. That is, the device of the present invention comprises (1) a plurality of detectors disposed to each of equipments constituting fluid channels, (2) an abnormal sound sensing device for sensing signals from the detectors, (3) an estimation section for estimating the place where the loose parts occur and the structural components thereof based on the signals sensed by the abnormal sound sensing section, (4) a memory section for storing data of the plant structure necessary for the estimation, and (5) a display section for displaying the result of the estimation. In such a device, the position where the loose parts collide against the plant structural component and the energy thereof are estimated. The dropping path of the loose parts is estimated from the estimation position. Parts to be loose parts in the path are listed up. The parts on the list is selected based on the estimated energy thereby enabling to determine the loose parts. (I.S.)
Reactor container cooling device
Energy Technology Data Exchange (ETDEWEB)
Ando, Koji; Kinoshita, Shoichiro
1995-11-10
The device of the present invention efficiently lowers pressure and temperature in a reactor container upon occurrence of a severe accident in a BWR-type reactor and can cool the inside of the container for a long period of time. That is, (1) pipelines on the side of an exhaustion tower of a filter portion in a filter bent device of the reactor container are in communication with pipelines on the side of a steam inlet of a static container cooling device by way of horizontal pipelines, (2) a back flow check valve is disposed to horizontal pipelines, (3) a steam discharge valve for a pressure vessel is disposed closer to the reactor container than the joint portion between the pipelines on the side of the steam inlet and the horizontal pipelines. Upon occurrence of a severe accident, when the pressure vessel should be ruptured and steams containing aerosol in the reactor core should be filled in the reactor container, the inlet valve of the static container cooling device is closed. Steams are flown into the filter bent device of the reactor container, where the aerosols can be removed. (I.S.).
MRI-powered biomedical devices.
Hovet, Sierra; Ren, Hongliang; Xu, Sheng; Wood, Bradford; Tokuda, Junichi; Tse, Zion Tsz Ho
2017-11-16
Magnetic resonance imaging (MRI) is beneficial for imaging-guided procedures because it provides higher resolution images and better soft tissue contrast than computed tomography (CT), ultrasound, and X-ray. MRI can be used to streamline diagnostics and treatment because it does not require patients to be repositioned between scans of different areas of the body. It is even possible to use MRI to visualize, power, and control medical devices inside the human body to access remote locations and perform minimally invasive procedures. Therefore, MR conditional medical devices have the potential to improve a wide variety of medical procedures; this potential is explored in terms of practical considerations pertaining to clinical applications and the MRI environment. Recent advancements in this field are introduced with a review of clinically relevant research in the areas of interventional tools, endovascular microbots, and closed-loop controlled MRI robots. Challenges related to technology and clinical feasibility are discussed, including MRI based propulsion and control, navigation of medical devices through the human body, clinical adoptability, and regulatory issues. The development of MRI-powered medical devices is an emerging field, but the potential clinical impact of these devices is promising.
Reactor noise monitoring device
International Nuclear Information System (INIS)
Yamanaka, Hiroto.
1990-01-01
The present invention concerns a reactor noise monitoring device by detecting abnormal sounds in background noises. Vibration sounds detected by accelerometers are applied to a loose parts detector. The detector generates high alarm if there are sudden impact sounds in the background noises and applies output signals to an accumulation device. If there is slight impact sounds in the vicinity of any of the accelerometers, the accumulation device accumulates the abnormal sounds assumed to be generated from an identical site while synchronizing the waveforms for all of the channels. Then, the device outputs signals in which the background noises are cancelled, as detection signals. Therefore, S/N ratio can be improved and the abnormal sounds contained in the background noises can be detected, to thereby improve the accuracy for estimating the position where the abnormal sounds are generated. (I.S.)
Integrated Ultrasonic-Photonic Devices
DEFF Research Database (Denmark)
Barretto, Elaine Cristina Saraiva
in channel waveguides and Mach-Zehnder interferometers. Numerical models are developed based on the finite element method, and applied to several scenarios, such as optimization of the geometrical parameters of waveguides, use of slow light in photonic crystal waveguides and use of Lamb waves in membranized......This thesis deals with the modeling, design, fabrication and characterization of integrated ultrasonic-photonic devices, with particular focus on the use of standard semiconductor materials such as GaAs and silicon. The devices are based on the use of guided acoustic waves to modulate the light...... investigated. Comparisons are made with the numerical and experimental results, and they validate the obtained response of the acoustic and photonic components of the device. Finally, a new design for an optical frequency shifter is proposed, posing several advantages over existing devices in terms of size...
[Design of SCM inoculation device].
Qian, Mingli; Xie, Haiyuan
2014-01-01
The first step of bacilli culture is inoculation bacteria on culture medium. Designing a device to increase efficiency of inoculation is significative. The new device is controlled by SCM. The stepper motor can drive the culture medium rotating, accelerating, decelerating, overturn and suspending. The device is high practicability and efficient, let inoculation easy for operator.
Spill-Detector-and-Shutoff Device
Jarvis, M. R.; Fulton, D. S.
1985-01-01
Overflow in liquid chromatography systems rapidly detected and stopped. Spill-detector-and-shutoff device incorporated into liquid-chromatography system. When liquid from output nozzle spills on liquid sensor, device automatically shuts off pump and releases solenoid to pinch off flow in tube. Device uses common type of alarm circuit reset manually before normal operation resumes.
Evolution of atherectomy devices.
Al Khoury, G; Chaer, R
2011-08-01
Percutaneous atherectomy provides an alternative approach to the endovascular treatment of peripheral atherosclerotic occlusive disease beyond angioplasty and stenting, and has the theoretical advantage of lesion debulking and minimizing barotrauma to the vessel wall. Atherectomy has evolved greatly during the last decade, with currently four FDA approved devices for the treatment of peripheral arterial disease. Several reports have focused on the initial technical success rates, and demonstrated the safety and short as well as mid-term efficacy of atherectomy devices. This article will review the evolution of current atherectomy devices and the associated literature.
Fundamentals of semiconductor devices
Lindmayer, Joseph
1965-01-01
Semiconductor properties ; semiconductor junctions or diodes ; transistor fundamentals ; inhomogeneous impurity distributions, drift or graded-base transistors ; high-frequency properties of transistors ; band structure of semiconductors ; high current densities and mechanisms of carrier transport ; transistor transient response and recombination processes ; surfaces, field-effect transistors, and composite junctions ; additional semiconductor characteristics ; additional semiconductor devices and microcircuits ; more metal, insulator, and semiconductor combinations for devices ; four-pole parameters and configuration rotation ; four-poles of combined networks and devices ; equivalent circuits ; the error function and its properties ; Fermi-Dirac statistics ; useful physical constants.
Electronic devices and circuits
Pridham, Gordon John
1972-01-01
Electronic Devices and Circuits, Volume 3 provides a comprehensive account on electronic devices and circuits and includes introductory network theory and physics. The physics of semiconductor devices is described, along with field effect transistors, small-signal equivalent circuits of bipolar transistors, and integrated circuits. Linear and non-linear circuits as well as logic circuits are also considered. This volume is comprised of 12 chapters and begins with an analysis of the use of Laplace transforms for analysis of filter networks, followed by a discussion on the physical properties of
Compound semiconductor device physics
Tiwari, Sandip
2013-01-01
This book provides one of the most rigorous treatments of compound semiconductor device physics yet published. A complete understanding of modern devices requires a working knowledge of low-dimensional physics, the use of statistical methods, and the use of one-, two-, and three-dimensional analytical and numerical analysis techniques. With its systematic and detailed**discussion of these topics, this book is ideal for both the researcher and the student. Although the emphasis of this text is on compound semiconductor devices, many of the principles discussed will also be useful to those inter
Multifunctional Energy Storage and Conversion Devices.
Huang, Yan; Zhu, Minshen; Huang, Yang; Pei, Zengxia; Li, Hongfei; Wang, Zifeng; Xue, Qi; Zhi, Chunyi
2016-10-01
Multifunctional energy storage and conversion devices that incorporate novel features and functions in intelligent and interactive modes, represent a radical advance in consumer products, such as wearable electronics, healthcare devices, artificial intelligence, electric vehicles, smart household, and space satellites, etc. Here, smart energy devices are defined to be energy devices that are responsive to changes in configurational integrity, voltage, mechanical deformation, light, and temperature, called self-healability, electrochromism, shape memory, photodetection, and thermal responsivity. Advisable materials, device designs, and performances are crucial for the development of energy electronics endowed with these smart functions. Integrating these smart functions in energy storage and conversion devices gives rise to great challenges from the viewpoint of both understanding the fundamental mechanisms and practical implementation. Current state-of-art examples of these smart multifunctional energy devices, pertinent to materials, fabrication strategies, and performances, are highlighted. In addition, current challenges and potential solutions from materials synthesis to device performances are discussed. Finally, some important directions in this fast developing field are considered to further expand their application. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Testing device for pipeline groups and control method for testing device
International Nuclear Information System (INIS)
Naito, Shinji; Kajiyama, Shigeru; Takahashi, Fuminobu; Tsuchida, Kenji; Tachibana, Yukio; Shigehiro, Katsuya; Mahara, Yoichi.
1995-01-01
The device of the present invention comprises a testing device main body disposed to a rail, a movable mechanism positioning from a reference point, a circumferential direction scanning mechanism, an axial direction scanning mechanism, a posture control mechanism, and a testing probe. Upon testing of pipelines, the detection device main body and auxiliary members are moved from a reference point previously set on a rail for numerical control toward pipelines to be tested in a state where the axial direction scanning mechanism and the testing probe are suspended in the axial direction. The testing is conducted by controlling the position of the testing probe in the axial direction of the pipeline by means of the axial direction scanning mechanism, and scanning the testing probe to the outer circumference of the pipeline along the circumferential track by way of the circumferential direction scanning mechanism. The device can be extremely reduced in the thickness, and can be moved with no interference with pipelines and other obstacles by remote operation even under such undesired condition as the pipelines being crowded, so that non-destructive testing can be conducted accurately. (N.H.)
RF and dc desensitized electroexplosive device
Krainiak, John W.; Speaks, Paul D.; Cornett, Michael S.
1989-07-01
This patent application relates to electroexplosive devices (EEDs) such as detonators, blasting caps and squibs, in particular to a method and device for desensitizing EEDs to electromagnetic radiation and electrostatic charges with the added ability to desensitize the device to essentially dc currents. An insensitive electroexplosive device to electrically ignite explosive is disclosed. This device is inherently immune to radio frequency (RF) radiation, and also provides protection against dc or very low frequency RF induced by arcing. A central feature is use of zeners and capacitors to form a reactively balanced bridge circuit. When constructed in semiconductor form, as described in this application, the device is capable of incorporation in small caliber ordnance.
Unconventional device concepts for polymer solar cells
Energy Technology Data Exchange (ETDEWEB)
Veenstra, S.C.; Slooff, L.H.; Verhees, W.J.H.; Cobussen-Pool, E.M.; Lenzmann, F.O.; Kroon, J.M. [ECN Solar Energy, Petten (Netherlands); Sessolo, M.; Bolink, H.J. [Instituto de Ciencia Molecular, Universidad de Valencia, Valencia (Spain)
2009-09-15
The inclusion of metal-oxide layers in polymer solar cells enables the fabrication of a series of unconventional device architectures. These devices include: semi-transparent polymer solar cells, devices with inverted polarity, as well as devices with air stable electrodes. A proof-of-principle of these devices is presented. The anticipated benefits of these novel device structures over conventional polymer solar cells are discussed.
Unconventional Quantum Computing Devices
Lloyd, Seth
2000-01-01
This paper investigates a variety of unconventional quantum computation devices, including fermionic quantum computers and computers that exploit nonlinear quantum mechanics. It is shown that unconventional quantum computing devices can in principle compute some quantities more rapidly than `conventional' quantum computers.
Radiation effects in optoelectronic devices
International Nuclear Information System (INIS)
Barnes, C.E.
1977-03-01
A summary is given of studies on radiation effects in light-emitting diodes, laser diodes, detectors, optical isolators and optical fibers. It is shown that the study of radiation damage in these devices can provide valuable information concerning the nature of the devices themselves, as well as methods of hardening these devices for applications in radiation environments
Digital device for synchronous storage
International Nuclear Information System (INIS)
Kobzar', Yu.M.; Kovtun, V.G.; Pashechko, N.I.
1991-01-01
Synchronous storage digital device for IR electron-photon emission spectrometer operating with analogue-to-digital converter F4223 or monocrystal converter K572PV1 is described. The device accomplished deduction of noise-background in each storage cycle. Summation and deduction operational time equals 90 ns, device output code discharge - 20, number of storages -2 23
Social-Aware Relay Selection for Cooperative Multicast Device-to-Device Communications
Directory of Open Access Journals (Sweden)
Francesco Chiti
2017-12-01
Full Text Available The increasing use of social networks such as Facebook, Twitter, and Instagram to share photos, video streaming, and music among friends has generated a huge increase in the amount of data traffic over wireless networks. This social behavior has triggered new communication paradigms such as device-to-device (D2D and relaying communication schemes, which are both considered as strong drivers for the next fifth-generation (5G cellular systems. Recently, the social-aware layer and its relationship to and influence on the physical communications layer have gained great attention as emerging focus points. We focus here on the case of relaying communications to pursue the multicast data dissemination to a group of users forming a social community through a relay node, according to the extension of the D2D mode to the case of device-to-many devices. Moreover, in our case, the source selects the device to act as the relay among different users of the multicast group by taking into account both the propagation link conditions and the relay social-trust level with the constraint of minimizing the end-to-end content delivery delay. An optimization procedure is also proposed in order to achieve the best performance. Finally, numerical results are provided to highlight the advantages of considering the impact of social level on the end-to-end delivery delay in the integrated social–physical network in comparison with the classical relay-assisted multicast communications for which the relay social-trust level is not considered.
Energy Technology Data Exchange (ETDEWEB)
Ibrahim, Yehia M.; Chen, Tsung-Chi; Harrer, Marques B.; Tang, Keqi; Smith, Richard D.
2017-11-21
An ion funnel device is disclosed. A first pair of electrodes is positioned in a first direction. A second pair of electrodes is positioned in a second direction. The device includes an RF voltage source and a DC voltage source. A RF voltage with a superimposed DC voltage gradient is applied to the first pair of electrodes, and a DC voltage gradient is applied to the second pair of electrodes.
Automatic liquid nitrogen feeding device
International Nuclear Information System (INIS)
Gillardeau, J.; Bona, F.; Dejachy, G.
1963-01-01
An automatic liquid nitrogen feeding device has been developed (and used) in the framework of corrosion tests realized with constantly renewed uranium hexafluoride. The issue was to feed liquid nitrogen to a large capacity metallic trap in order to condensate uranium hexafluoride at the exit of the corrosion chambers. After having studied various available devices, a feeding device has been specifically designed to be robust, secure and autonomous, as well as ensuring a high liquid nitrogen flowrate and a highly elevated feeding frequency. The device, made of standard material, has been used during 4000 hours without any problem [fr
Detecting device of atomic probe
International Nuclear Information System (INIS)
Nikonenkov, N.V.
1979-01-01
Operation of an atomic-probe recording device is discussed in detail and its flowsheet is given. The basic elements of the atomic-probe recording device intented for microanalysis of metals and alloys in an atomic level are the storage oscillograph with a raster-sweep unit, a two-channel timer using frequency meters, a digital printer, and a control unit. The digital printer records information supplied by four digital devices (two frequency meters and two digital voltmeters) in a four-digit binary-decimal code. The described device provides simultaneous recording of two ions produced per one vaporation event
Haghi, Mostafa; Thurow, Kerstin; Stoll, Regina
2017-01-01
Wearable devices are currently at the heart of just about every discussion related to the Internet of Things. The requirement for self-health monitoring and preventive medicine is increasing due to the projected dramatic increase in the number of elderly people until 2020. Developed technologies are truly able to reduce the overall costs for prevention and monitoring. This is possible by constantly monitoring health indicators in various areas, and in particular, wearable devices are considered to carry this task out. These wearable devices and mobile apps now have been integrated with telemedicine and telehealth efficiently, to structure the medical Internet of Things. This paper reviews wearable health care devices both in scientific papers and commercial efforts. MIoT is demonstrated through a defined architecture design, including hardware and software dealing with wearable devices, sensors, smart phones, medical application, and medical station analyzers for further diagnosis and data storage. Wearables, with the help of improved technology have been developed greatly and are considered reliable tools for long-term health monitoring systems. These are applied in the observation of a large variety of health monitoring indicators in the environment, vital signs, and fitness. Wearable devices are now used for a wide range of healthcare observation. One of the most important elements essential in data collection is the sensor. During recent years with improvement in semiconductor technology, sensors have made investigation of a full range of parameters closer to realization.
Progress and Prospects in Stretchable Electroluminescent Devices
Directory of Open Access Journals (Sweden)
Wang Jiangxin
2017-03-01
Full Text Available Stretchable electroluminescent (EL devices are a new form of mechanically deformable electronics that are gaining increasing interests and believed to be one of the essential technologies for next generation lighting and display applications. Apart from the simple bending capability in flexible EL devices, the stretchable EL devices are required to withstand larger mechanical deformations and accommodate stretching strain beyond 10%. The excellent mechanical conformability in these devices enables their applications in rigorous mechanical conditions such as flexing, twisting, stretching, and folding.The stretchable EL devices can be conformably wrapped onto arbitrary curvilinear surface and respond seamlessly to the external or internal forces, leading to unprecedented applications that cannot be addressed with conventional technologies. For example, they are in demand for wide applications in biomedical-related devices or sensors and soft interactive display systems, including activating devices for photosensitive drug, imaging apparatus for internal tissues, electronic skins, interactive input and output devices, robotics, and volumetric displays. With increasingly stringent demand on the mechanical requirements, the fabrication of stretchable EL device is encountering many challenges that are difficult to resolve. In this review, recent progresses in the stretchable EL devices are covered with a focus on the approaches that are adopted to tackle materials and process challenges in stretchable EL devices and delineate the strategies in stretchable electronics. We first introduce the emission mechanisms that have been successfully demonstrated on stretchable EL devices. Limitations and advantages of the different mechanisms for stretchable EL devices are also discussed. Representative reports are reviewed based on different structural and material strategies. Unprecedented applications that have been enabled by the stretchable EL devices are
Drug delivery device including electrolytic pump
Foulds, Ian G.; Buttner, Ulrich; Yi, Ying
2016-01-01
Systems and methods are provided for a drug delivery device and use of the device for drug delivery. In various aspects, the drug delivery device combines a “solid drug in reservoir” (SDR) system with an electrolytic pump. In various aspects an improved electrolytic pump is provided including, in particular, an improved electrolytic pump for use with a drug delivery device, for example an implantable drug delivery device. A catalytic reformer can be incorporated in a periodically pulsed electrolytic pump to provide stable pumping performance and reduced actuation cycle.
Drug delivery device including electrolytic pump
Foulds, Ian G.
2016-03-31
Systems and methods are provided for a drug delivery device and use of the device for drug delivery. In various aspects, the drug delivery device combines a “solid drug in reservoir” (SDR) system with an electrolytic pump. In various aspects an improved electrolytic pump is provided including, in particular, an improved electrolytic pump for use with a drug delivery device, for example an implantable drug delivery device. A catalytic reformer can be incorporated in a periodically pulsed electrolytic pump to provide stable pumping performance and reduced actuation cycle.
Pressurized waterproof case electronic device
Berumen, Michael L.
2013-01-31
A pressurized waterproof case for an electronic device is particularly adapted for fluid-tight containment and operation of a touch-screen electronic device or the like therein at some appreciable water depth. In one example, the case may be formed as an enclosure having an open top panel or face covered by a flexible, transparent membrane or the like for the operation of the touchscreen device within the case. A pressurizing system is provided for the case to pressurize the case and the electronic device therein to slightly greater than ambient in order to prevent the external water pressure from bearing against the transparent membrane and pressing it against the touch screen, thereby precluding operation of the touch screen device within the case. The pressurizing system may include a small gas cartridge or may be provided from an external source.
Projected phase-change memory devices.
Koelmans, Wabe W; Sebastian, Abu; Jonnalagadda, Vara Prasad; Krebs, Daniel; Dellmann, Laurent; Eleftheriou, Evangelos
2015-09-03
Nanoscale memory devices, whose resistance depends on the history of the electric signals applied, could become critical building blocks in new computing paradigms, such as brain-inspired computing and memcomputing. However, there are key challenges to overcome, such as the high programming power required, noise and resistance drift. Here, to address these, we present the concept of a projected memory device, whose distinguishing feature is that the physical mechanism of resistance storage is decoupled from the information-retrieval process. We designed and fabricated projected memory devices based on the phase-change storage mechanism and convincingly demonstrate the concept through detailed experimentation, supported by extensive modelling and finite-element simulations. The projected memory devices exhibit remarkably low drift and excellent noise performance. We also demonstrate active control and customization of the programming characteristics of the device that reliably realize a multitude of resistance states.
21 CFR 864.6100 - Bleeding time device.
2010-04-01
... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Bleeding time device. 864.6100 Section 864.6100 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES HEMATOLOGY AND PATHOLOGY DEVICES Manual Hematology Devices § 864.6100 Bleeding time device...
Smoothing type buffer memory device
International Nuclear Information System (INIS)
Podorozhnyj, D.M.; Yashin, I.V.
1990-01-01
The layout of the micropower 4-bit smoothing type buffer memory device allowing one to record without counting the sequence of input randomly distributed pulses in multi-channel devices with serial poll, is given. The power spent by a memory cell for one binary digit recording is not greater than 0.15 mW, the device dead time is 10 mus
47 CFR 2.801 - Radiofrequency device defined.
2010-10-01
... 47 Telecommunication 1 2010-10-01 2010-10-01 false Radiofrequency device defined. 2.801 Section 2... MATTERS; GENERAL RULES AND REGULATIONS Marketing of Radio-frequency Devices § 2.801 Radiofrequency device defined. As used in this part, a radiofrequency device is any device which in its operation is capable of...
2014-07-08
The Food and Drug Administration (FDA) is classifying the transcranial magnetic stimulator for headache into class II (special controls). The special controls that will apply to the device are identified in this order, and will be part of the codified language for the transcranial magnetic stimulator for headache classification. The Agency is classifying the device into class II (special controls) in order to provide a reasonable assurance of safety and effectiveness of the device.
Analysis and simulation of semiconductor devices
Selberherr, Siegfried
1984-01-01
The invention of semiconductor devices is a fairly recent one, considering classical time scales in human life. The bipolar transistor was announced in 1947, and the MOS transistor, in a practically usable manner, was demonstrated in 1960. From these beginnings the semiconductor device field has grown rapidly. The first integrated circuits, which contained just a few devices, became commercially available in the early 1960s. Immediately thereafter an evolution has taken place so that today, less than 25 years later, the manufacture of integrated circuits with over 400.000 devices per single chip is possible. Coincident with the growth in semiconductor device development, the literature concerning semiconductor device and technology issues has literally exploded. In the last decade about 50.000 papers have been published on these subjects. The advent of so called Very-Large-Scale-Integration (VLSI) has certainly revealed the need for a better understanding of basic device behavior. The miniaturization of the s...
[Medical Devices Law for pain therapists].
Regner, M; Sabatowski, R
2016-08-01
Medical Devices Law is a relatively new legal system, which has replaced the Medical Devices Regulations still well-known in Germany. German Medical Devices Law is based on European directives, which are, in turn, incorporated into national law by the Medical Devices Act. The Medical Devices Act is a framework law and covers a number of regulations that address specific topics within Medical Devices Law. In turn, in individual regulations, reference is made to guidelines, recommendations, etc. from other sources that provide detailed technical information on specific topics. Medical Devices Law is a very complex legal system, which needs to be permanently observed due to constant updating and adjustment. In the current article, the design and the structure of the system will be described, but special emphasis will be laid on important problem areas that need to be considered when applying and operating medical products, in this case by pain therapists in particular.
2017-12-27
The Food and Drug Administration (FDA or we) is classifying the external vagal nerve stimulator for headache into class II (special controls). The special controls that apply to the device type are identified in this order and will be part of the codified language for the external vagal nerve stimulator for headache's classification. We are taking this action because we have determined that classifying the device into class II (special controls) will provide a reasonable assurance of safety and effectiveness of the device. We believe this action will also enhance patients' access to beneficial innovative devices, in part by reducing regulatory burdens.
Processes for multi-layer devices utilizing layer transfer
Nielson, Gregory N; Sanchez, Carlos Anthony; Tauke-Pedretti, Anna; Kim, Bongsang; Cederberg, Jeffrey; Okandan, Murat; Cruz-Campa, Jose Luis; Resnick, Paul J
2015-02-03
A method includes forming a release layer over a donor substrate. A plurality of devices made of a first semiconductor material are formed over the release layer. A first dielectric layer is formed over the plurality of devices such that all exposed surfaces of the plurality of devices are covered by the first dielectric layer. The plurality of devices are chemically attached to a receiving device made of a second semiconductor material different than the first semiconductor material, the receiving device having a receiving substrate attached to a surface of the receiving device opposite the plurality of devices. The release layer is etched to release the donor substrate from the plurality of devices. A second dielectric layer is applied over the plurality of devices and the receiving device to mechanically attach the plurality of devices to the receiving device.
Gibelli, Daniele; Pucciarelli, Valentina; Cappella, Annalisa; Dolci, Claudia; Sforza, Chiarella
2018-01-31
Modern 3-dimensional (3D) image acquisition systems represent a crucial technologic development in facial anatomy because of their accuracy and precision. The recently introduced portable devices can improve facial databases by increasing the number of applications. In the present study, the VECTRA H1 portable stereophotogrammetric device was validated to verify its applicability to 3D facial analysis. Fifty volunteers underwent 4 facial scans using portable VECTRA H1 and static VECTRA M3 devices (2 for each instrument). Repeatability of linear, angular, surface area, and volume measurements was verified within the device and between devices using the Bland-Altman test and the calculation of absolute and relative technical errors of measurement (TEM and rTEM, respectively). In addition, the 2 scans obtained by the same device and the 2 scans obtained by different devices were registered and superimposed to calculate the root mean square (RMS; point-to-point) distance between the 2 surfaces. Most linear, angular, and surface area measurements had high repeatability in M3 versus M3, H1 versus H1, and M3 versus H1 comparisons (range, 82.2 to 98.7%; TEM range, 0.3 to 2.0 mm, 0.4° to 1.8°; rTEM range, 0.2 to 3.1%). In contrast, volumes and RMS distances showed evident differences in M3 versus M3 and H1 versus H1 comparisons and reached the maximum when scans from the 2 different devices were compared. The portable VECTRA H1 device proved reliable for assessing linear measurements, angles, and surface areas; conversely, the influence of involuntary facial movements on volumes and RMS distances was more important compared with the static device. Copyright © 2018 American Association of Oral and Maxillofacial Surgeons. Published by Elsevier Inc. All rights reserved.
Giant magneto-resistance devices
Hirota, Eiichi; Inomata, Koichiro
2002-01-01
This book deals with the application of giant magneto-resistance (GMR) effects to electronic devices. It will appeal to engineers and graduate students in the fields of electronic devices and materials. The main subjects are magnetic sensors with high resolution and magnetic read heads with high sensitivity, required for hard-disk drives with recording densities of several gigabytes. Another important subject is novel magnetic random-access memories (MRAM) with non-volatile non-destructive and radiation-resistant characteristics. Other topics include future GMR devices based on bipolar spin transistors, spin field-effect transistors (FETs) and double-tunnel junctions.
International Nuclear Information System (INIS)
Yoshimura, Sadanori.
1994-01-01
The device of the present invention evaluates the propriety of an operation which is conducted optionally by a trainee depending on the state of the plant, analyzes the cause of an operation error and aids the preparation of training policy and teaching materials based on the results of the evaluation and the analysis. Namely, an operation data collection device collects operation data for the plant operation conducted by the trainee and the state of the plant during the operation. Since an operation evaluation device evaluates the plant operation in a short period of time based on the evaluation criteria of an operation evaluation knowledge base, an operation error is never overlooked. Accordingly, uniform and highly reliable operation training at definite evaluation criteria can be obtained. In addition, an error-cause analyzing device and a training policy knowledge base analyze the cause of an error inherent to each of the trainee, and it is recorded systematically independently on every trainees. Since a training policy guide device retrieves and presents an operation error and a cause of the error, there can be prepared a training policy incorporating training with respect to the operation error that each of the trainee tends to commit. (I.S.)
Surgical tools and medical devices
Jackson, Mark
2016-01-01
This new edition presents information and knowledge on the field of biomedical devices and surgical tools. The authors look at the interactions between nanotechnology, nanomaterials, design, modeling, and tools for surgical and dental applications, as well as how nanostructured surfaces can be created for the purposes of improving cell adhesion between medical devices and the human body. Each original chapter is revised in this second edition and describes developments in coatings for heart valves, stents, hip and knee joints, cardiovascular devices, orthodontic applications, and regenerative materials such as bone substitutes. There are also 8 new chapters that address: Microvascular anastomoses Inhaler devices used for pulmonary delivery of medical aerosols Surface modification of interference screws Biomechanics of the mandible (a detailed case study) Safety and medical devices The synthesis of nanostructured material Delivery of anticancer molecules using carbon nanotubes Nano and micro coatings for medic...
Microfluidic chip-capillary electrophoresis devices
Fung, Ying Sing; Du, Fuying; Guo, Wenpeng; Ma, Tongmei; Nie, Zhou; Sun, Hui; Wu, Ruige; Zhao, Wenfeng
2015-01-01
Capillary electrophoresis (CE) and microfluidic chip (MC) devices are relatively mature technologies, but this book demonstrates how they can be integrated into a single, revolutionary device that can provide on-site analysis of samples when laboratory services are unavailable. By introducing the combination of CE and MC technology, Microfluidic Chip-Capillary Electrophoresis Devices broadens the scope of chemical analysis, particularly in the biomedical, food, and environmental sciences. The book gives an overview of the development of MC and CE technology as well as technology that now allows for the fabrication of MC-CE devices. It describes the operating principles that make integration possible and illustrates some achievements already made by the application of MC-CE devices in hospitals, clinics, food safety, and environmental research. The authors envision further applications for private and public use once the proof-of-concept stage has been passed and obstacles to increased commercialization are ad...
2012-04-02
... DEPARTMENT OF HEALTH AND HUMAN SERVICES Food and Drug Administration 21 CFR Part 866 [Docket No. FDA-2012-N-0165] Medical Devices; Immunology and Microbiology Devices; Classification of Norovirus Serological Reagents; Correction AGENCY: Food and Drug Administration, HHS. ACTION: Final rule; correction...
2011-04-15
... type of device must submit to FDA a premarket notification, prior to marketing the device, which... directs agencies to assess all costs and benefits of available regulatory alternatives and, when... economic, environmental, public health and safety, and other advantages; distributive impacts; and equity...
Fibre Optic Communication Key Devices
Grote, Norbert
2012-01-01
The book gives an in-depth description of the key devices of current and next generation fibre optic communication networks. In particular, the book covers devices such as semiconductor lasers, optical amplifiers, modulators, wavelength filters, and detectors but the relevant properties of optical fibres as well. The presentations include the physical principles underlying the various devices, the technologies used for the realization of the different devices, typical performance characteristics and limitations, and development trends towards more advanced components are also illustrated. Thus the scope of the book spans relevant principles, state-of-the-art implementations, the status of current research and expected future components.
21 CFR 892.2040 - Medical image hardcopy device.
2010-04-01
... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Medical image hardcopy device. 892.2040 Section... (CONTINUED) MEDICAL DEVICES RADIOLOGY DEVICES Diagnostic Devices § 892.2040 Medical image hardcopy device. (a) Identification. A medical image hardcopy device is a device that produces a visible printed record of a medical...
Plant abnormality inspection device
International Nuclear Information System (INIS)
Takenaka, Toshio.
1990-01-01
The present invention concerns a plant abnormality inspection device for conducting remote or automatic patrolling inspection in a plant and, more particularly, relates to such a device as capable of detecting abnormal odors. That is, the device comprises a moving device for moving to a predetermined position in the plant, a plurality of gas sensors for different kind of gases to be inspected mounted thereon, a comparator for comparing the concentration of a gas detected by the gas sensor with the normal gas concentration at the predetermined position and a judging means for judging the absence or presence of abnormality depending on the combination of the result of the comparison and deliverying a signal if the state is abnormal. As a result, a slight amount of gas responsible to odors released upon abnormality of the plant can be detected by a plurality of gas sensors for different kinds gases to rapidly and easily find abnormal portions in the plant. (I.S.)
Authenticated sensor interface device
Energy Technology Data Exchange (ETDEWEB)
Coleman, Jody Rustyn; Poland, Richard W.
2018-05-01
A system and method for the secure storage and transmission of data is provided. A data aggregate device can be configured to receive secure data from a data source, such as a sensor, and encrypt the secure data using a suitable encryption technique, such as a shared private key technique, a public key encryption technique, a Diffie-Hellman key exchange technique, or other suitable encryption technique. The encrypted secure data can be provided from the data aggregate device to different remote devices over a plurality of segregated or isolated data paths. Each of the isolated data paths can include an optoisolator that is configured to provide one-way transmission of the encrypted secure data from the data aggregate device over the isolated data path. External data can be received through a secure data filter which, by validating the external data, allows for key exchange and other various adjustments from an external source.
Energy Technology Data Exchange (ETDEWEB)
Brocato, Robert W. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States)
2018-02-01
This report describes an unpowered radio receiver capable of detecting and responding to weak signals transmit ted from comparatively long distances . This radio receiver offers key advantages over a short range zero - power radio receiver previously described in SAND2004 - 4610, A Zero - Power Radio Receiver . The device described here can be fabricated as an integrated circuit for use in portable wireless devices, as a wake - up circuit, or a s a stand - alone receiver operating in conjunction with identification decoders or other electroni cs. It builds on key sub - components developed at Sandia National Laboratories over many years. It uses surface acoustic wave (SAW) filter technology. It uses custom component design to enable the efficient use of small aperture antennas. This device uses a key component, the pyroelectric demodulator , covered by Sandia owned U.S. Patent 7397301, Pyroelectric Demodulating Detector [1] . This device is also described in Sandia owned U.S. Patent 97266446, Zero Power Receiver [2].
Three-terminal superconducting devices
International Nuclear Information System (INIS)
Gallagher, W.J.
1985-01-01
The transistor has a number of properties that make it so useful. The authors discuss these and the additional properties a transistor would need to have for high performance applications at temperatures where superconductivity could contribute advantages to system-level performance. These properties then serve as criteria by which to evaluate three-terminal devices that have been proposed for applications at superconducting temperatures. FETs can retain their transistor properties at low temperatures, but their power consumption is too large for high-speed, high-density cryogenic applications. They discuss in detail why demonstrated superconducting devices with three terminals -Josephson effect based devices, injection controlled weak links, and stacked tunnel junction devices such as the superconducting transistor proposed by K. Gray and the quiteron -- each fail to have true transistor-like properties. They conclude that the potentially very rewarding search for a transistor compatible with superconductivity in high performance applications must be in new directions
Fabrication of integrated metallic MEMS devices
DEFF Research Database (Denmark)
Yalcinkaya, Arda Deniz; Ravnkilde, Jan Tue; Hansen, Ole
2002-01-01
A simple and complementary metal oxide semiconductor (CMOS) compatible fabrication technique for microelectromechanical (MEMS) devices is presented. The fabrication technology makes use of electroplated metal layers. Among the fabricated devices, high quality factor microresonators are characteri......A simple and complementary metal oxide semiconductor (CMOS) compatible fabrication technique for microelectromechanical (MEMS) devices is presented. The fabrication technology makes use of electroplated metal layers. Among the fabricated devices, high quality factor microresonators...
Control method for prosthetic devices
Bozeman, Richard J., Jr. (Inventor)
1995-01-01
A control system and method for prosthetic devices is provided. The control system comprises a transducer for receiving movement from a body part for generating a sensing signal associated with that movement. The sensing signal is processed by a linearizer for linearizing the sensing signal to be a linear function of the magnitude of the distance moved by the body part. The linearized sensing signal is normalized to be a function of the entire range of body part movement from the no-shrug position of the moveable body part. The normalized signal is divided into a plurality of discrete command signals. The discrete command signals are used by typical converter devices which are in operational association with the prosthetic device. The converter device uses the discrete command signals for driving the moveable portions of the prosthetic device and its sub-prosthesis. The method for controlling a prosthetic device associated with the present invention comprises the steps of receiving the movement from the body part, generating a sensing signal in association with the movement of the body part, linearizing the sensing signal to be a linear function of the magnitude of the distance moved by the body part, normalizing the linear signal to be a function of the entire range of the body part movement, dividing the normalized signal into a plurality of discrete command signals, and implementing the plurality of discrete command signals for driving the respective moveable prosthesis device and its sub-prosthesis.
Flexible devices: from materials, architectures to applications
Zou, Mingzhi; Ma, Yue; Yuan, Xin; Hu, Yi; Liu, Jie; Jin, Zhong
2018-01-01
Flexible devices, such as flexible electronic devices and flexible energy storage devices, have attracted a significant amount of attention in recent years for their potential applications in modern human lives. The development of flexible devices is moving forward rapidly, as the innovation of methods and manufacturing processes has greatly encouraged the research of flexible devices. This review focuses on advanced materials, architecture designs and abundant applications of flexible devices, and discusses the problems and challenges in current situations of flexible devices. We summarize the discovery of novel materials and the design of new architectures for improving the performance of flexible devices. Finally, we introduce the applications of flexible devices as key components in real life. Project supported by the National Key R&D Program of China (Nos. 2017YFA0208200, 2016YFB0700600, 2015CB659300), the National Natural Science Foundation of China (Nos. 21403105, 21573108), and the Fundamental Research Funds for the Central Universities (No. 020514380107).
DEFF Research Database (Denmark)
König, S; Greve, T R; Seymour, N
2012-01-01
density, temperature, ambient UV-field) prevailing in the interstellar medium (ISM) of these objects. Here we report on ongoing CI, [CII] and CO observations of TNJ 1338–1942 at z = 4.11 with the IRAM 30m telescope, the JCMT and ATCA. With these observations we will make a first attempt at constraining...... the average ISM conditions in TNJ 1338–1942....
An evaluation of sharp safety blood evacuation devices.
Ford, Joanna; Phillips, Peter
This article describes an evaluation of three sharp safety blood evacuation devices in seven Welsh NHS boards and the Welsh Blood Service. Products consisted of two phlebotomy needles possessing safety shields and one phlebotomy device with wings, tubing and a retractable needle. The device companies provided the devices and appropriate training. Participating healthcare workers used the safety device instead of the conventional device to sample blood during the evaluation period and each type of device was evaluated in random order. Participants filled in a questionnaire for each type of device and then a further questionnaire comparing the two shielded evacuation needles with each other Results showed that responses to all three products were fairly positive, although each device was not liked by everyone who used it. When the two shielded evacuation devices were compared with each other, most users preferred the device with the shield positioned directly above the needle to the device with the shield at the side. However, in laboratory tests, the preferred device produced more fluid splatter than the other shielded device on activation.
Wireless device connection problems and design solutions
Song, Ji-Won; Norman, Donald; Nam, Tek-Jin; Qin, Shengfeng
2016-09-01
Users, especially the non-expert users, commonly experience problems when connecting multiple devices with interoperability. While studies on multiple device connections are mostly concentrated on spontaneous device association techniques with a focus on security aspects, the research on user interaction for device connection is still limited. More research into understanding people is needed for designers to devise usable techniques. This research applies the Research-through-Design method and studies the non-expert users' interactions in establishing wireless connections between devices. The "Learning from Examples" concept is adopted to develop a study focus line by learning from the expert users' interaction with devices. This focus line is then used for guiding researchers to explore the non-expert users' difficulties at each stage of the focus line. Finally, the Research-through-Design approach is used to understand the users' difficulties, gain insights to design problems and suggest usable solutions. When connecting a device, the user is required to manage not only the device's functionality but also the interaction between devices. Based on learning from failures, an important insight is found that the existing design approach to improve single-device interaction issues, such as improvements to graphical user interfaces or computer guidance, cannot help users to handle problems between multiple devices. This study finally proposes a desirable user-device interaction in which images of two devices function together with a system image to provide the user with feedback on the status of the connection, which allows them to infer any required actions.
High speed serdes devices and applications
Stauffer, David R; Sorna, Michael A; Dramstad, Kent; Ogilvie, Clarence Rosser; Amanullah, Mohammad; Rockrohr, James Donald
2008-01-01
Offers an understanding of the features and functions typically found on HSS devices. This book explains how these HSS devices are used in protocol applications and the analysis which must be performed to use such HSS devices.
International Nuclear Information System (INIS)
Elshurafa, Amro M; El-Masry, Ezz I
2010-01-01
This paper, the first in a series of two, presents a paradigm shift in the design of MEMS parallel plate PolyMUMPS variable capacitance devices by proposing two structures that utilize the substrate and are able to provide predetermined, customizable, tuning ranges and/or ratios. The proposed structures can provide theoretical tuning ranges anywhere from 4.9 to 35 and from 3.4 to 26 respectively with a simple, yet effective, layout modification as opposed to the previously reported devices where the tuning range is fixed and cannot be varied. Theoretical analysis is carried out and verified with measurements of fabricated devices. The first proposed device possessed initially a tuning range of 4.4. Two variations of the structure having tuning ranges of 3 and 3.4, all at 1 GHz, were also successfully developed and tested. The second proposed variable capacitance device behaved as a switch.
2011-06-22
... information related to the humanitarian device exemption for the Berlin Heart EXCOR Pediatric Ventricular Assist Device (VAD) sponsored by Berlin Heart, Inc. The Berlin Heart EXCOR Pediatric VAD device is a..., please contact AnnMarie Williams, Conference Management Staff, at 301-796-5966, at least 7 days in...
International Nuclear Information System (INIS)
Hoyer, E.; Chin, J.; Halbach, K.; Hassenzahl, W.V.; Humphries, D.; Kincaid, B.; Lancaster, H.; Plate, D.
1990-11-01
The Advanced Light Source (ALS), the first US third generation synchrotron radiation source, is currently under construction at the Lawrence Berkeley Laboratory. The low-emittance, 1.5 GeV electron storage ring and the insertion devices are specifically designed to produce high brightness beams in the UV to soft X-Ray range. The planned initial complement of insertion devices includes four 4.6 m long undulators, with period lengths of 3.9 cm, 5.0 cm (2) and 8.0 cm, and a 2.9 m long wiggler of 16 cm period length. Undulator design is well advanced and fabrication has begun on the 5.0 cm and 8.0 cm period length undulators. This paper discusses ALS insertion device requirements; general design philosophy; and design of the magnetic structure, support structure/drive systems, control system and vacuum system. 18 refs., 9 figs., 5 tabs
Performance of Installed Cooking Exhaust Devices
Energy Technology Data Exchange (ETDEWEB)
Singer, Brett C.; Delp, William W.; Apte, Michael G.; Price, Philip N.
2011-11-01
The performance metrics of airflow, sound, and combustion product capture efficiency (CE) were measured for a convenience sample of fifteen cooking exhaust devices, as installed in residences. Results were analyzed to quantify the impact of various device- and installation-dependent parameters on CE. Measured maximum airflows were 70% or lower than values noted on product literature for 10 of the devices. Above-the-cooktop devices with flat bottom surfaces (no capture hood) – including exhaust fan/microwave combination appliances – were found to have much lower CE at similar flow rates, compared to devices with capture hoods. For almost all exhaust devices and especially for rear-mounted downdraft exhaust and microwaves, CE was substantially higher for back compared with front burner use. Flow rate, and the extent to which the exhaust device extends over the burners that are in use, also had a large effect on CE. A flow rate of 95 liters per second (200 cubic feet per minute) was necessary, but not sufficient, to attain capture efficiency in excess of 75% for the front burners. A-weighted sound levels in kitchens exceeded 57 dB when operating at the highest fan setting for all 14 devices evaluated for sound performance.
Building Evacuation with Mobile Devices
Merkel, Sabrina
2014-01-01
The rapidly growing world population and increasingly dense settlements demand ever-larger and more complex buildings from today's engineers. In comparison to this technological progress, a building's equipment for emergency evacuation has been hardly developed further. This work presents a concept for a building evacuation system based on mobile devices. Furthermore, various algorithms for route planning with mobile devices and for indoor localization of mobile devices are addressed.
Scanning device for a spectrometer
International Nuclear Information System (INIS)
Ignat'ev, V.M.
1982-01-01
The invention belongs to scanning devices and is intended for spectrum scanning in spectral devices. The purpose of the invention is broadening of spectral scanning range. The device construction ensures the spectrum scanning range determined from revolution fractions to several revolutions of the monochromator drum head, any number of the drum head revolutions determined by integral number with addition of the drum revolution fractions with high degree of accuracy being possible
Floating Oil-Spill Containment Device
Jones, Jack A.
2012-01-01
Previous oil containment booms have an open top that allows natural gas to escape, and have significant oil leakage due to wave action. Also, a subsea pyramid oil trap exists, but cannot move relative to moving oil plumes from deepsea oil leaks. The solution is to have large, moveable oil traps. One version floats on the sea surface and has a flexible tarp cover and a lower weighted skirt to completely entrap the floating oil and natural gas. The device must have at least three sides with boats pulling at each apex, and sonar or other system to track the slowly moving oil plume, so that the boats can properly locate the booms. The oil trap device must also have a means for removal of the oil and the natural gas. A second design version has a flexible pyramid cover that is attached by lines to ballast on the ocean floor. This is similar to fixed, metal pyramid oil capture devices in the Santa Barbara Channel off the coast of California. The ballast lines for the improved design, however, would have winches that can move the pyramid to always be located above the oil and gas plume. A third design is a combination of the first two. It uses a submerged pyramid to trap oil, but has no anchor and uses boats to locate the trap. It has ballast weights located along the bottom of the tarp and/or at the corners of the trap. The improved floating oil-spill containment device has a large floating boom and weighted skirt surrounding the oil and gas entrapment area. The device is triangular (or more than three sides) and has a flexible tarp cover with a raised gas vent area. Boats pull on the apex of the triangles to maintain tension and to allow the device to move to optimum locations to trap oil and gas. The gas is retrieved from a higher buoyant part of the tarp, and oil is retrieved from the floating oil layer contained in the device. These devices can be operated in relatively severe weather, since waves will break over the devices without causing oil leaking. Also, natural
A monitoring device for pressurised-air-driven diaphragm-based artificial heart assist devices
Hoeben, F.P.; Hoeben, F.P.; de Mul, F.F.M.; Stokkink, J.S.D.; Stokkink, H.S.D.; Koelink, M.H.; Koelink, M.H.; Greve, Jan
1992-01-01
A non-invasive device has been developed to monitor the diaphragm position and the blood flow in artificial heart assist devices equipped with a pressurised-air-driven diaphragm. Light scattering from the diaphragm is used as a mechanism for measuring. Information about the position of several
Structure and application of galvanomagnetic devices
Weiss, H
1969-01-01
International Series of Monographs on Semiconductors, Volume 8: Structure and Application of Galvanomagnetic Devices focuses on the composition, reactions, transformations, and applications of galvanomagnetic devices. The book first ponders on basic physical concepts, design and fabrication of galvanomagnetic devices, and properties of galvanomagnetic devices. Discussions focus on changes in electrical properties on irradiation with high-energy particles, magnetoresistor field-plate, Hall generator, preparation of semiconductor films by vacuum deposition, structure of field-plate magnetoresist
Introduction to Semiconductor Devices
Brennan, Kevin F.
2005-03-01
This volume offers a solid foundation for understanding the most important devices used in the hottest areas of electronic engineering today, from semiconductor fundamentals to state-of-the-art semiconductor devices in the telecommunications and computing industries. Kevin Brennan describes future approaches to computing hardware and RF power amplifiers, and explains how emerging trends and system demands of computing and telecommunications systems influence the choice, design and operation of semiconductor devices. In addition, he covers MODFETs and MOSFETs, short channel effects, and the challenges faced by continuing miniaturization. His book is both an excellent senior/graduate text and a valuable reference for practicing engineers and researchers.
Wireless Communications Device Wakeup Method and System
Drago, S.; Sebastiano, F.; Leenaerts, D.M.W.; Breems, L.J.
2008-01-01
Abstract of WO 2009044368 Disclosed are wakeable wireless communications devices, and methods for waking wireless communications devices, for use in a wireless network of such devices. The devices communicate during respectively-designated timeslots according to a communications protocol. The
Breüner, Anne; Frees, Dorte; Varmanen, Pekka; Boguta, Anna Monika; Hammer, Karin; Martinussen, Jan; Kilstrup, Mogens
2016-10-01
We analysed the response of the model bacterium Lactococcus lactis to abrupt depletion of glucose after several generations of exponential growth. Glucose depletion resulted in a drastic drop in the energy charge accompanied by an extremely low GTP level and an almost total arrest of protein synthesis. Strikingly, the cell prioritized the continued synthesis of a few proteins, of which the ribosomal dimerization factor YfiA was the most highly expressed. Transcriptome analysis showed no immediate decrease in total mRNA levels despite the lowered nucleotide pools and only marginally increased levels of the yfiA transcript. Severe up-regulation of genes in the FruR, CcpA, ArgR and AhrC regulons were consistent with a downshift in carbon and energy source. Based upon the results, we suggest that transcription proceeded long enough to record the transcriptome changes from activation of the FruR, CcpA, ArgR and AhrC regulons, while protein synthesis stopped due to an extremely low GTP concentration emerging a few minutes after glucose depletion. The yfiA deletion mutant exhibited a longer lag phase upon replenishment of glucose and a faster death rate after prolonged starvation supporting that YfiA-mediated ribosomal dimerization is important for keeping long-term starved cells viable and competent for growth initiation.
Chung, Hyemoon; Jeon, Byunghwan; Chang, Hyuk-Jae; Han, Dongjin; Shim, Hackjoon; Cho, In Jeong; Shim, Chi Young; Hong, Geu-Ru; Kim, Jung-Sun; Jang, Yangsoo; Chung, Namsik
2015-12-01
After left atrial appendage (LAA) device closure, peri-device leakage into the LAA persists due to incomplete occlusion. We hypothesized that pre-procedural three-dimensional (3D) geometric analysis of the interatrial septum (IAS) and LAA orifice can predict this leakage. We investigated the predictive parameters of LAA device closure obtained from baseline cardiac computerized tomography (CT) using a novel 3D analysis system. We conducted a retrospective study of 22 patients who underwent LAA device closure. We defined peri-device leakage as the presence of a Doppler signal inside the LAA after device deployment (group 2, n = 5) compared with patients without peri-device leakage (group 1, n = 17). Conventional parameters were measured by cardiac CT. Angles θ and φ were defined between the IAS plane and the line, linking the LAA orifice center and foramen ovale. Group 2 exhibited significantly better left atrial (LA) function than group 1 (p = 0.031). Pre-procedural θ was also larger in this group (41.9° vs. 52.3°, p = 0.019). The LAA cauliflower-type morphology was more common in group 2. Overall, the patients' LA reserve significantly decreased after the procedure (21.7 mm(3) vs. 17.8 mm(3), p = 0.035). However, we observed no significant interval changes in pre- and post-procedural values of θ and φ in either group (all p > 0.05). Angles between the IAS and LAA orifice might be a novel anatomical parameter for predicting peri-device leakage after LAA device closure. In addition, 3D CT analysis of the LA and LAA orifice could be used to identify clinically favorable candidates for LAA device closure.
Design of wheel-type walking-assist device
International Nuclear Information System (INIS)
Jung, Seung Ho; Kim, Seung Ho; Kim, Chang Hoi; Seo, Yong Chil; Jung, Kyung Min; Lee, Sung Uk
2006-03-01
In this research, a outdoor wheel-type walking-assist device is developed to help an elder having a poor muscular strength at legs for walking, sitting and standing up easily at outdoors, and also for going and downing stairs. In conceptually designing, the environments of an elder's activity, the size of an elder's body and a necessary function of helping an elder are considered. This device has 4 wheels for stability. When an elder walks in incline plane with the proposed device, a rear-wing is rotated to keep the supporting device horizontal, regardless of an angle of inclination. A height-controlling device, which can control the height of the supporting device for adjusting an elder's height, is varied vertically to help an elder to sit and stand-up easily. Moreover, a outdoor wheel-type walking-assist device is conceptually designed and is made. In order to design it, the preview research is investigated firstly. On the basis of the proposed walking-assist device, the outdoor walking-assist device is designed and made. The outdoor wheel-type walking-assist device can go and down stairs automatically. This device go up and down the stair of having maximum 20cm height and an angle of 25 degrees with maximum 4 sec/stairs speed, and move at flatland with 60cm/sec speed
Elshurafa, Amro M.
2010-03-22
This paper, the first in a series of two, presents a paradigm shift in the design of MEMS parallel plate PolyMUMPS variable capacitance devices by proposing two structures that utilize the substrate and are able to provide predetermined, customizable, tuning ranges and/or ratios. The proposed structures can provide theoretical tuning ranges anywhere from 4.9 to 35 and from 3.4 to 26 respectively with a simple, yet effective, layout modification as opposed to the previously reported devices where the tuning range is fixed and cannot be varied. Theoretical analysis is carried out and verified with measurements of fabricated devices. The first proposed device possessed initially a tuning range of 4.4. Two variations of the structure having tuning ranges of 3 and 3.4, all at 1 GHz, were also successfully developed and tested. The second proposed variable capacitance device behaved as a switch. © 2010 IOP Publishing Ltd.
International Nuclear Information System (INIS)
Flaherty, Robert.
1986-01-01
A flexural pivot device or rotational actuator comprises first and sceond tubular members connected by flexural members of shape-memory-alloy. These are curved in the austenitic phase at a first temperature and after cooling to the martensitic phase are flattened. On heating one of the flexural members, it bends causing relative rotation of the tubular members. Heating of another member can produce opposite rotation. Heating is electrical or by hot gas. The device may be used in a nuclear reactor. (author)
47 CFR 15.103 - Exempted devices.
2010-10-01
... any transportation vehicle including motor vehicles and aircraft. (b) A digital device used... digital device utilized exclusively in an appliance, e.g., microwave oven, dishwasher, clothes dryer, air conditioner (central or window), etc. (e) Specialized medical digital devices (generally used at the direction...
S-Band POSIX Device Drivers for RTEMS
Lux, James P.; Lang, Minh; Peters, Kenneth J.; Taylor, Gregory H.
2011-01-01
This is a set of POSIX device driver level abstractions in the RTEMS RTOS (Real-Time Executive for Multiprocessor Systems real-time operating system) to SBand radio hardware devices that have been instantiated in an FPGA (field-programmable gate array). These include A/D (analog-to-digital) sample capture, D/A (digital-to-analog) sample playback, PLL (phase-locked-loop) tuning, and PWM (pulse-width-modulation)-controlled gain. This software interfaces to Sband radio hardware in an attached Xilinx Virtex-2 FPGA. It uses plug-and-play device discovery to map memory to device IDs. Instead of interacting with hardware devices directly, using direct-memory mapped access at the application level, this driver provides an application programming interface (API) offering that easily uses standard POSIX function calls. This simplifies application programming, enables portability, and offers an additional level of protection to the hardware. There are three separate device drivers included in this package: sband_device (ADC capture and DAC playback), pll_device (RF front end PLL tuning), and pwm_device (RF front end AGC control).
Memory attacks on device-independent quantum cryptography.
Barrett, Jonathan; Colbeck, Roger; Kent, Adrian
2013-01-04
Device-independent quantum cryptographic schemes aim to guarantee security to users based only on the output statistics of any components used, and without the need to verify their internal functionality. Since this would protect users against untrustworthy or incompetent manufacturers, sabotage, or device degradation, this idea has excited much interest, and many device-independent schemes have been proposed. Here we identify a critical weakness of device-independent protocols that rely on public communication between secure laboratories. Untrusted devices may record their inputs and outputs and reveal information about them via publicly discussed outputs during later runs. Reusing devices thus compromises the security of a protocol and risks leaking secret data. Possible defenses include securely destroying or isolating used devices. However, these are costly and often impractical. We propose other more practical partial defenses as well as a new protocol structure for device-independent quantum key distribution that aims to achieve composable security in the case of two parties using a small number of devices to repeatedly share keys with each other (and no other party).
CDC field mapping device - ''ROTOTRACK''
International Nuclear Information System (INIS)
Yamada, R.; Hawtree, J.; Kaczar, K.; Leverence, R.; McGuire, K.; Newman-Holmes, C.; Schmidt, E.E.; Shallenberger, J.
1985-10-01
A field mapping device for the magnet of the Collider Detector at Fermilab (CDF) was constructed. The device was used for extensive study of the CDF magnetic field distribution. The mechanical and electrical features of the device, as well as the data acquisition system and software, are described. The mechanical system was designed so that the errors on the position and angle of the probe were +-0.75 mm and +-1 mrad, respectively
International Nuclear Information System (INIS)
1981-01-01
Improvements are described in an X-ray spot film device which is used in conjunction with an X-ray table to make a selected number of radiographic exposures on a single film and to perform fluoroscopic examinations. To date, the spot film devices consist of two X-ray field defining masks, one of which is moved manually. The present device is more convenient to use and speeds up the procedure. (U.K.)
de Graaff, W; Grimard, B
2018-05-01
Synchronization programs using progesterone-releasing intravaginal devices that allow for fixed time artificial insemination are still finding increasing application in bovine reproduction. This practice is useful for rationalizing livestock management because an increased number of cows can be inseminated in one session without the need for estrus detection. Although much of the innovation related to the design and development of intravaginal devices for use in cattle took place in the previous century, progress in understanding the physiology of the bovine estrous cycle resulted in shorter treatment durations, a trend which is still continuing. In this competitive market, with little functional differentiation between the existing devices, the shorter treatment duration prompted for optimization of the progesterone content in the device, as the cost of the drug significantly contributes to the price per unit. For CIDR ® a reduction of the progesterone content of about 30 per cent was realized. Price reduction remained an important target for further device development. Next to reduction of progesterone content, cheaper and easier to process materials like polyethylene vinyl acetate (EVA) copolymers have been explored to replace the commonly used silicone elastomers. The reengineering effort of CIDR ® demonstrated that knowledge of release kinetics and insight into gradual depletion patterns in the device is critical for optimization of drug content without compromising performance (blood levels). More recent publications related to the use of alternative polymers like EVA and polyisoprene (IP) indicated encouraging results regarding further reduction of progesterone content. The use of EVA seems most promising, because it is in principle a low-cost polymer available in many grades and this thermoplastic polymer can be processed easily by means of commonly used techniques like injection molding and extrusion. The use of thermoplastic polymers, however, requires
Synaptic electronics: materials, devices and applications.
Kuzum, Duygu; Yu, Shimeng; Wong, H-S Philip
2013-09-27
In this paper, the recent progress of synaptic electronics is reviewed. The basics of biological synaptic plasticity and learning are described. The material properties and electrical switching characteristics of a variety of synaptic devices are discussed, with a focus on the use of synaptic devices for neuromorphic or brain-inspired computing. Performance metrics desirable for large-scale implementations of synaptic devices are illustrated. A review of recent work on targeted computing applications with synaptic devices is presented.
CERN. Geneva
2018-01-01
CERN has more than 1000 Internet of Things (IoT) devices, which are connected to the office network. We have been doing the research to find all vulnerable IoT devices in CERN and mitigated them. We are currently working on detecting IoT devices automatically and, moreover, identifying the manufacturer, model and the running firmware version. This will help the CERN Computer Security Team to spot vulnerable devices and to show the security risks associated with them.
Synaptic electronics: materials, devices and applications
International Nuclear Information System (INIS)
Kuzum, Duygu; Yu, Shimeng; Philip Wong, H-S
2013-01-01
In this paper, the recent progress of synaptic electronics is reviewed. The basics of biological synaptic plasticity and learning are described. The material properties and electrical switching characteristics of a variety of synaptic devices are discussed, with a focus on the use of synaptic devices for neuromorphic or brain-inspired computing. Performance metrics desirable for large-scale implementations of synaptic devices are illustrated. A review of recent work on targeted computing applications with synaptic devices is presented. (topical review)
Flaw detection device for plasma facing wall in thermonuclear device
International Nuclear Information System (INIS)
Doi, Akira.
1996-01-01
The present invention concerns plasma facing walls of a thermonuclear device and provides a device for detecting a thickness of amour tiles accurately and efficiently with no manual operation. Namely, the position of the plasma facing surface of the amour tile is measured using a structure to which the amour tiles are to be disposed as a reference. Also in a case of disposing new armor tiles, the position of the plasma facing surface of the armor tiles is measured to thereby measure the wearing amount of the amour tiles based on the difference between the reference and the measured value. If a measuring means capable of measuring a plurality of amour tiles at once is used efficiency of the measurement and the detection can be enhanced. Several ten thousands of amour tiles are disposed to the plasma facing wall in a large scaled thermonuclear device, and a plenty of time was required for the detection. However, the present invention can improve the accuracy for the measurement and detection and provide time and labors-saving. (I.S.)
Optoelectronic Devices Advanced Simulation and Analysis
Piprek, Joachim
2005-01-01
Optoelectronic devices transform electrical signals into optical signals and vice versa by utilizing the sophisticated interaction of electrons and light within micro- and nano-scale semiconductor structures. Advanced software tools for design and analysis of such devices have been developed in recent years. However, the large variety of materials, devices, physical mechanisms, and modeling approaches often makes it difficult to select appropriate theoretical models or software packages. This book presents a review of devices and advanced simulation approaches written by leading researchers and software developers. It is intended for scientists and device engineers in optoelectronics, who are interested in using advanced software tools. Each chapter includes the theoretical background as well as practical simulation results that help to better understand internal device physics. The software packages used in the book are available to the public, on a commercial or noncommercial basis, so that the interested r...
Microfabricated fuel heating value monitoring device
Robinson, Alex L [Albuquerque, NM; Manginell, Ronald P [Albuquerque, NM; Moorman, Matthew W [Albuquerque, NM
2010-05-04
A microfabricated fuel heating value monitoring device comprises a microfabricated gas chromatography column in combination with a catalytic microcalorimeter. The microcalorimeter can comprise a reference thermal conductivity sensor to provide diagnostics and surety. Using microfabrication techniques, the device can be manufactured in production quantities at a low per-unit cost. The microfabricated fuel heating value monitoring device enables continuous calorimetric determination of the heating value of natural gas with a 1 minute analysis time and 1.5 minute cycle time using air as a carrier gas. This device has applications in remote natural gas mining stations, pipeline switching and metering stations, turbine generators, and other industrial user sites. For gas pipelines, the device can improve gas quality during transfer and blending, and provide accurate financial accounting. For industrial end users, the device can provide continuous feedback of physical gas properties to improve combustion efficiency during use.
Control System for Prosthetic Devices
Bozeman, Richard J. (Inventor)
1996-01-01
A control system and method for prosthetic devices is provided. The control system comprises a transducer for receiving movement from a body part for generating a sensing signal associated with that of movement. The sensing signal is processed by a linearizer for linearizing the sensing signal to be a linear function of the magnitude of the distance moved by the body part. The linearized sensing signal is normalized to be a function of the entire range of body part movement from the no-shrug position of the moveable body part through the full-shrg position of the moveable body part. The normalized signal is divided into a plurality of discrete command signals. The discrete command signals are used by typical converter devices which are in operational association with the prosthetic device. The converter device uses the discrete command signals for driving the moveable portions of the prosthetic device and its sub-prosthesis. The method for controlling a prosthetic device associated with the present invention comprises the steps of receiving the movement from the body part, generating a sensing signal in association with the movement of the body part, linearizing the sensing signal to be a linear function of the magnitude of the distance moved by the body part, normalizing the linear signal to be a function of the entire range of the body part movement, dividing the normalized signal into a plurality of discrete command signals, and implementing the plurality of discrete command signals for driving the respective moveable prosthesis device and its sub-prosthesis.
Digital Device Architecture and the Safe Use of Flash Devices in Munitions
Katz, Richard B.; Flowers, David; Bergevin, Keith
2017-01-01
Flash technology is being utilized in fuzed munition applications and, based on the development of digital logic devices in the commercial world, usage of flash technology will increase. Digital devices of interest to designers include flash-based microcontrollers and field programmable gate arrays (FPGAs). Almost a decade ago, a study was undertaken to determine if flash-based microcontrollers could be safely used in fuzes and, if so, how should such devices be applied. The results were documented in the Technical Manual for the Use of Logic Devices in Safety Features. This paper will first review the Technical Manual and discuss the rationale behind the suggested architectures for microcontrollers and a brief review of the concern about data retention in flash cells. An architectural feature in the microcontroller under study will be discussed and its use will show how to screen for weak or failed cells during manufacture, storage, or immediately prior to use. As was done for microcontrollers a decade ago, architectures for a flash-based FPGA will be discussed, showing how it can be safely used in fuzes. Additionally, architectures for using non-volatile (including flash-based) storage will be discussed for SRAM-based FPGAs.
Medical device software: defining key terms.
Pashkov, Vitalii; Gutorova, Nataliya; Harkusha, Andrii
one of the areas of significant growth in medical devices has been the role of software - as an integral component of a medical device, as a standalone device and more recently as applications on mobile devices. The risk related to a malfunction of the standalone software used within healthcare is in itself not a criterion for its qualification or not as a medical device. It is therefore, necessary to clarify some criteria for the qualification of stand-alone software as medical devices Materials and methods: Ukrainian, European Union, United States of America legislation, Guidelines developed by European Commission and Food and Drug Administration's, recommendations represented by international voluntary group and scientific works. This article is based on dialectical, comparative, analytic, synthetic and comprehensive research methods. the legal regulation of software which is used for medical purpose in Ukraine limited to one definition. In European Union and United States of America were developed and applying special guidelines that help developers, manufactures and end users to difference software on types standing on medical purpose criteria. Software becomes more and more incorporated into medical devices. Developers and manufacturers may not have initially appreciated potential risks to patients and users such situation could have dangerous results for patients or users. It is necessary to develop and adopt the legislation that will intend to define the criteria for the qualification of medical device software and the application of the classification criteria to such software, provide some illustrative examples and step by step recommendations to qualify software as medical device.
Nanostructured transparent conducting oxide electrochromic device
Milliron, Delia; Tangirala, Ravisubhash; Llordes, Anna; Buonsanti, Raffaella; Garcia, Guillermo
2016-05-17
The embodiments described herein provide an electrochromic device. In an exemplary embodiment, the electrochromic device includes (1) a substrate and (2) a film supported by the substrate, where the film includes transparent conducting oxide (TCO) nanostructures. In a further embodiment, the electrochromic device further includes (a) an electrolyte, where the nanostructures are embedded in the electrolyte, resulting in an electrolyte, nanostructure mixture positioned above the substrate and (b) a counter electrode positioned above the mixture. In a further embodiment, the electrochromic device further includes a conductive coating deposited on the substrate between the substrate and the mixture. In a further embodiment, the electrochromic device further includes a second substrate positioned above the mixture.
International Nuclear Information System (INIS)
Karaki, Mikio; Muraoka, Shoichi.
1985-01-01
Purpose: To clean complicated and long objects to be cleaned having a structure like that of nuclear reactor fuel assembly. Constitution: Steams are blown from the bottom of a fuel assembly and soon condensated initially at the bottom of a vertical water tank due to water filled therein. Then, since water in the tank is warmed nearly to the saturation temperature, purified water is supplied from a injection device below to the injection device above the water tank on every device. In this way, since purified water is sprayed successively from below to above and steams are condensated in each of the places, the entire fuel assembly elongated in the vertical direction can be cleaned completely. Water in the reservoir goes upward like the steam flow and is drained together with the eliminated contaminations through an overflow pipe. After the cleaning has been completed, a main steam valve is closed and the drain valve is opened to drain water. (Kawakami, Y.)
Energy Technology Data Exchange (ETDEWEB)
Shinomiya, Takuji; Murao, Fumihide
1987-12-07
Concerning the conventional photoelectric transfer device, a short-circuit current of photodiodes is switched over with MOS transistors. However, since the backgate voltage of the MOS transistor which is to be used as the switching element, is provided by the source voltage, the leakage current between the backgate and the source/drain/ channel is great and due to this leakage current, errors occur in the photoelectric transfer power output. Especially, when the leakage current of the photodiodes is small, the error becomes large. In order to solve the above problem, this invention aims at offering a photoelectric transfer device which can provide the high precision photoelectric transfer even the short-circuit current generated in the photodiodes is small and proposes a photoelectric transfer device in which the backgate voltage of the MOS transistor switching over the short-circuit current of the photodiodes is made equal to the electric potential of the mutually connected anodes (or cathodes) of the photodiodes. (3 figs)
Assistive Devices for Students with Disabilities.
Wisniewski, Lech; Sedlak, Robert
1992-01-01
Describes a variety of devices that can assist students with disabilities. Highlights recently developed devices for students with specific learning disabilities, and with vision, hearing, health, physical, and speech and language impairments. The devices can help rehabilitate, reeducate, facilitate normalcy, or augment current functioning. (GLR)
Safety lock for radiography exposure device
International Nuclear Information System (INIS)
Gaines, T.M.
1982-01-01
A safety lock for securing a radiation source in a radiography exposure device is disclosed. The safety lock prevents the inadvertent extension of the radiation source from the exposure device. The exposure devices are used extensively in industry for nondestructive testing of metal materials for defect. Unnecessary exposure of the radiographer or operator occurs not infrequently due to operator's error in believing that the radiation source is secured in the exposure device when, in fact, it is not. The present invention solves this problem of unnecessary exposure by releasingly trapping the radiation source in the shield of the radiography exposure device each time the source is retracted therein so that it is not inadvertently extended therefrom without the operator resetting the safety lock, thereby releasing the radiation source. Further, the safety lock includes an indicator which indicates when the source is trapped in the exposure device and also when it is untrapped. The safety lock is so designed that it does not prevent the return of the source to the trapped, shielded position in the exposure device. Further the safety lock includes a key means for locking the radiation source in the trapped position. The key means cannot be actuated until said radiation source is in said trapped position to further insure the safety lock cannot be inadvertently locked with the source untrapped and thus still extendable from the exposure device
Virtual Reality Interaction Using Mobile Devices
Aseeri, Sahar A.
2013-07-01
With the use of an immersive display system such as CAVE system, the user is able to realize a 3D immersive virtual environment realistically. However, interacting with virtual worlds in CAVE systems using traditional input devices to perform easy operations such as manipulation, object selection, and navigation is often difficult. This difficulty could diminish the immersion and sense of presence when it comes to 3D virtual environment tasks. Our research aims to implement and evaluate alternative approaches of interaction with immersive virtual environments on mobile devices for manipulation and object selection tasks. As many researchers have noted, using a mobile device as an interaction device has a number of advantages, including built-in display, built-in control, and touch screen facility. These advantages facilitate simple tasks within immersive virtual environments. This research proposes new methods using mobile devices like Smart-phones to perform di↵erent kinds of interactions both as an input device, (e.g. performing selection and manipulation of objects) and as an output device (e.g. utilizing the screen as an extra view for a virtual camera or information display). Moreover, we developed a prototype system to demonstrate and informally evaluate these methods. The research conclusion suggests using mobile devices as a 3D-controller. This will be a more intuitive approach to interact within the virtual environment.
Standardization of splash device
Fernández Raga, María; Peters, Piet
2017-04-01
The erosion is a complex process that has been studied extensively by numerous researchers, requiring a prolongued time effort and a large economic investment. To be effective, the measurements of erosion should be precise, controlled and replicable, and to assure efectiveness, measurement devices of erosion should be properly designed, constructed, well calibrated and also they should be operated by a trained person (Stroosnijder, 2005). Because researchers try to improve old devices, the equipment is constantly being redesigned, making the measurements not comparable and furthermore, producing a lack of available standarized device. The lack of standardization of erosion equipment is more obvious in the case of the local splash erosion, where the nature of the process makes very difficult to isolate its effects. In this article we compare the results obtained from five of the most common splash erosion devices (selected from more than 16 different currently types), under the same rain conditions, with the objective of facilitate the standardization of the method that will be more easy to build, minimizing the error. A set of six splash devices were setted in well known positions under simulated rain, to measured the differences, among devices and the accuracy of the data recovered after 10 minutes of rainfall simulation under different intensities (from 60 to 130 mm/h). The rainfall simulator of Wageningen was used, using sand as splash erosion source. Differences in the infiltration were also measured, and a calibration of sizes and speeds of the raindrops was done using the photography method (Hamidreza-Sadeghi et al., 2013). The splash devices selected for this study were unbounded splash devices (like the funnel, the cup (Fernandez-Raga et al., 2010) and the splash flume (Jomaa et al., 2010)), and bounded devices that allow the calculation of splash rate, (like the new cup (Scholten et al., 2011) and the Morgan tray). The behaviour of different splash devices