TreeFam: a curated database of phylogenetic trees of animal gene families
DEFF Research Database (Denmark)
Li, Heng; Coghlan, Avril; Ruan, Jue
2006-01-01
TreeFam is a database of phylogenetic trees of gene families found in animals. It aims to develop a curated resource that presents the accurate evolutionary history of all animal gene families, as well as reliable ortholog and paralog assignments. Curated families are being added progressively......, based on seed alignments and trees in a similar fashion to Pfam. Release 1.1 of TreeFam contains curated trees for 690 families and automatically generated trees for another 11 646 families. These represent over 128 000 genes from nine fully sequenced animal genomes and over 45 000 other animal proteins...
The Caenorhabditis chemoreceptor gene families
Directory of Open Access Journals (Sweden)
Robertson Hugh M
2008-10-01
Full Text Available Abstract Background Chemoreceptor proteins mediate the first step in the transduction of environmental chemical stimuli, defining the breadth of detection and conferring stimulus specificity. Animal genomes contain families of genes encoding chemoreceptors that mediate taste, olfaction, and pheromone responses. The size and diversity of these families reflect the biology of chemoperception in specific species. Results Based on manual curation and sequence comparisons among putative G-protein-coupled chemoreceptor genes in the nematode Caenorhabditis elegans, we identified approximately 1300 genes and 400 pseudogenes in the 19 largest gene families, most of which fall into larger superfamilies. In the related species C. briggsae and C. remanei, we identified most or all genes in each of the 19 families. For most families, C. elegans has the largest number of genes and C. briggsae the smallest number, suggesting changes in the importance of chemoperception among the species. Protein trees reveal family-specific and species-specific patterns of gene duplication and gene loss. The frequency of strict orthologs varies among the families, from just over 50% in two families to less than 5% in three families. Several families include large species-specific expansions, mostly in C. elegans and C. remanei. Conclusion Chemoreceptor gene families in Caenorhabditis species are large and evolutionarily dynamic as a result of gene duplication and gene loss. These dynamics shape the chemoreceptor gene complements in Caenorhabditis species and define the receptor space available for chemosensory responses. To explain these patterns, we propose the gray pawn hypothesis: individual genes are of little significance, but the aggregate of a large number of diverse genes is required to cover a large phenotype space.
The Caenorhabditis chemoreceptor gene families.
Thomas, James H; Robertson, Hugh M
2008-10-06
Chemoreceptor proteins mediate the first step in the transduction of environmental chemical stimuli, defining the breadth of detection and conferring stimulus specificity. Animal genomes contain families of genes encoding chemoreceptors that mediate taste, olfaction, and pheromone responses. The size and diversity of these families reflect the biology of chemoperception in specific species. Based on manual curation and sequence comparisons among putative G-protein-coupled chemoreceptor genes in the nematode Caenorhabditis elegans, we identified approximately 1300 genes and 400 pseudogenes in the 19 largest gene families, most of which fall into larger superfamilies. In the related species C. briggsae and C. remanei, we identified most or all genes in each of the 19 families. For most families, C. elegans has the largest number of genes and C. briggsae the smallest number, suggesting changes in the importance of chemoperception among the species. Protein trees reveal family-specific and species-specific patterns of gene duplication and gene loss. The frequency of strict orthologs varies among the families, from just over 50% in two families to less than 5% in three families. Several families include large species-specific expansions, mostly in C. elegans and C. remanei. Chemoreceptor gene families in Caenorhabditis species are large and evolutionarily dynamic as a result of gene duplication and gene loss. These dynamics shape the chemoreceptor gene complements in Caenorhabditis species and define the receptor space available for chemosensory responses. To explain these patterns, we propose the gray pawn hypothesis: individual genes are of little significance, but the aggregate of a large number of diverse genes is required to cover a large phenotype space.
The Caenorhabditis chemoreceptor gene families
Robertson Hugh M; Thomas James H
2008-01-01
Abstract Background Chemoreceptor proteins mediate the first step in the transduction of environmental chemical stimuli, defining the breadth of detection and conferring stimulus specificity. Animal genomes contain families of genes encoding chemoreceptors that mediate taste, olfaction, and pheromone responses. The size and diversity of these families reflect the biology of chemoperception in specific species. Results Based on manual curation and sequence comparisons among putative G-protein-...
Early evolution of the LIM homeobox gene family
Energy Technology Data Exchange (ETDEWEB)
Srivastava, Mansi; Larroux, Claire; Lu, Daniel R; Mohanty, Kareshma; Chapman, Jarrod; Degnan, Bernard M; Rokhsar, Daniel S
2010-01-01
LIM homeobox (Lhx) transcription factors are unique to the animal lineage and have patterning roles during embryonic development in flies, nematodes and vertebrates, with a conserved role in specifying neuronal identity. Though genes of this family have been reported in a sponge and a cnidarian, the expression patterns and functions of the Lhx family during development in non-bilaterian phyla are not known. We identified Lhx genes in two cnidarians and a placozoan and report the expression of Lhx genes during embryonic development in Nematostella and the demosponge Amphimedon. Members of the six major LIM homeobox subfamilies are represented in the genomes of the starlet sea anemone, Nematostella vectensis, and the placozoan Trichoplax adhaerens. The hydrozoan cnidarian, Hydra magnipapillata, has retained four of the six Lhx subfamilies, but apparently lost two others. Only three subfamilies are represented in the haplosclerid demosponge Amphimedon queenslandica. A tandem cluster of three Lhx genes of different subfamilies and a gene containing two LIM domains in the genome of T. adhaerens (an animal without any neurons) indicates that Lhx subfamilies were generated by tandem duplication. This tandem cluster in Trichoplax is likely a remnant of the original chromosomal context in which Lhx subfamilies first appeared. Three of the six Trichoplax Lhx genes are expressed in animals in laboratory culture, as are all Lhx genes in Hydra. Expression patterns of Nematostella Lhx genes correlate with neural territories in larval and juvenile polyp stages. In the aneural demosponge, A. queenslandica, the three Lhx genes are expressed widely during development, including in cells that are associated with the larval photosensory ring. The Lhx family expanded and diversified early in animal evolution, with all six subfamilies already diverged prior to the cnidarian-placozoan-bilaterian last common ancestor. In Nematostella, Lhx gene expression is correlated with neural
Early evolution of the LIM homeobox gene family
Directory of Open Access Journals (Sweden)
Degnan Bernard M
2010-01-01
Full Text Available Abstract Background LIM homeobox (Lhx transcription factors are unique to the animal lineage and have patterning roles during embryonic development in flies, nematodes and vertebrates, with a conserved role in specifying neuronal identity. Though genes of this family have been reported in a sponge and a cnidarian, the expression patterns and functions of the Lhx family during development in non-bilaterian phyla are not known. Results We identified Lhx genes in two cnidarians and a placozoan and report the expression of Lhx genes during embryonic development in Nematostella and the demosponge Amphimedon. Members of the six major LIM homeobox subfamilies are represented in the genomes of the starlet sea anemone, Nematostella vectensis, and the placozoan Trichoplax adhaerens. The hydrozoan cnidarian, Hydra magnipapillata, has retained four of the six Lhx subfamilies, but apparently lost two others. Only three subfamilies are represented in the haplosclerid demosponge Amphimedon queenslandica. A tandem cluster of three Lhx genes of different subfamilies and a gene containing two LIM domains in the genome of T. adhaerens (an animal without any neurons indicates that Lhx subfamilies were generated by tandem duplication. This tandem cluster in Trichoplax is likely a remnant of the original chromosomal context in which Lhx subfamilies first appeared. Three of the six Trichoplax Lhx genes are expressed in animals in laboratory culture, as are all Lhx genes in Hydra. Expression patterns of Nematostella Lhx genes correlate with neural territories in larval and juvenile polyp stages. In the aneural demosponge, A. queenslandica, the three Lhx genes are expressed widely during development, including in cells that are associated with the larval photosensory ring. Conclusions The Lhx family expanded and diversified early in animal evolution, with all six subfamilies already diverged prior to the cnidarian-placozoan-bilaterian last common ancestor. In
Interferon induced IFIT family genes in host antiviral defense.
Zhou, Xiang; Michal, Jennifer J; Zhang, Lifan; Ding, Bo; Lunney, Joan K; Liu, Bang; Jiang, Zhihua
2013-01-01
Secretion of interferons (IFNs) from virus-infected cells is a hallmark of host antiviral immunity and in fact, IFNs exert their antiviral activities through the induction of antiviral proteins. The IFN-induced protein with tetratricopeptide repeats (IFITs) family is among hundreds of IFN-stimulated genes. This family contains a cluster of duplicated loci. Most mammals have IFIT1, IFIT2, IFIT3 and IFIT5; however, bird, marsupial, frog and fish have only IFIT5. Regardless of species, IFIT5 is always adjacent to SLC16A12. IFIT family genes are predominantly induced by type I and type III interferons and are regulated by the pattern recognition and the JAK-STAT signaling pathway. IFIT family proteins are involved in many processes in response to viral infection. However, some viruses can escape the antiviral functions of the IFIT family by suppressing IFIT family genes expression or methylation of 5' cap of viral molecules. In addition, the variants of IFIT family genes could significantly influence the outcome of hepatitis C virus (HCV) therapy. We believe that our current review provides a comprehensive picture for the community to understand the structure and function of IFIT family genes in response to pathogens in human, as well as in animals.
Evolutionary history of chordate PAX genes: dynamics of change in a complex gene family.
Directory of Open Access Journals (Sweden)
Vanessa Rodrigues Paixão-Côrtes
Full Text Available Paired box (PAX genes are transcription factors that play important roles in embryonic development. Although the PAX gene family occurs in animals only, it is widely distributed. Among the vertebrates, its 9 genes appear to be the product of complete duplication of an original set of 4 genes, followed by an additional partial duplication. Although some studies of PAX genes have been conducted, no comprehensive survey of these genes across the entire taxonomic unit has yet been attempted. In this study, we conducted a detailed comparison of PAX sequences from 188 chordates, which revealed restricted variation. The absence of PAX4 and PAX8 among some species of reptiles and birds was notable; however, all 9 genes were present in all 74 mammalian genomes investigated. A search for signatures of selection indicated that all genes are subject to purifying selection, with a possible constraint relaxation in PAX4, PAX7, and PAX8. This result indicates asymmetric evolution of PAX family genes, which can be associated with the emergence of adaptive novelties in the chordate evolutionary trajectory.
Gene cluster statistics with gene families.
Raghupathy, Narayanan; Durand, Dannie
2009-05-01
Identifying genomic regions that descended from a common ancestor is important for understanding the function and evolution of genomes. In distantly related genomes, clusters of homologous gene pairs are evidence of candidate homologous regions. Demonstrating the statistical significance of such "gene clusters" is an essential component of comparative genomic analyses. However, currently there are no practical statistical tests for gene clusters that model the influence of the number of homologs in each gene family on cluster significance. In this work, we demonstrate empirically that failure to incorporate gene family size in gene cluster statistics results in overestimation of significance, leading to incorrect conclusions. We further present novel analytical methods for estimating gene cluster significance that take gene family size into account. Our methods do not require complete genome data and are suitable for testing individual clusters found in local regions, such as contigs in an unfinished assembly. We consider pairs of regions drawn from the same genome (paralogous clusters), as well as regions drawn from two different genomes (orthologous clusters). Determining cluster significance under general models of gene family size is computationally intractable. By assuming that all gene families are of equal size, we obtain analytical expressions that allow fast approximation of cluster probabilities. We evaluate the accuracy of this approximation by comparing the resulting gene cluster probabilities with cluster probabilities obtained by simulating a realistic, power-law distributed model of gene family size, with parameters inferred from genomic data. Surprisingly, despite the simplicity of the underlying assumption, our method accurately approximates the true cluster probabilities. It slightly overestimates these probabilities, yielding a conservative test. We present additional simulation results indicating the best choice of parameter values for data
Plant ion channels: gene families, physiology, and functional genomics analyses.
Ward, John M; Mäser, Pascal; Schroeder, Julian I
2009-01-01
Distinct potassium, anion, and calcium channels in the plasma membrane and vacuolar membrane of plant cells have been identified and characterized by patch clamping. Primarily owing to advances in Arabidopsis genetics and genomics, and yeast functional complementation, many of the corresponding genes have been identified. Recent advances in our understanding of ion channel genes that mediate signal transduction and ion transport are discussed here. Some plant ion channels, for example, ALMT and SLAC anion channel subunits, are unique. The majority of plant ion channel families exhibit homology to animal genes; such families include both hyperpolarization- and depolarization-activated Shaker-type potassium channels, CLC chloride transporters/channels, cyclic nucleotide-gated channels, and ionotropic glutamate receptor homologs. These plant ion channels offer unique opportunities to analyze the structural mechanisms and functions of ion channels. Here we review gene families of selected plant ion channel classes and discuss unique structure-function aspects and their physiological roles in plant cell signaling and transport.
Genome-Wide Comparative Gene Family Classification
Frech, Christian; Chen, Nansheng
2010-01-01
Correct classification of genes into gene families is important for understanding gene function and evolution. Although gene families of many species have been resolved both computationally and experimentally with high accuracy, gene family classification in most newly sequenced genomes has not been done with the same high standard. This project has been designed to develop a strategy to effectively and accurately classify gene families across genomes. We first examine and compare the performance of computer programs developed for automated gene family classification. We demonstrate that some programs, including the hierarchical average-linkage clustering algorithm MC-UPGMA and the popular Markov clustering algorithm TRIBE-MCL, can reconstruct manual curation of gene families accurately. However, their performance is highly sensitive to parameter setting, i.e. different gene families require different program parameters for correct resolution. To circumvent the problem of parameterization, we have developed a comparative strategy for gene family classification. This strategy takes advantage of existing curated gene families of reference species to find suitable parameters for classifying genes in related genomes. To demonstrate the effectiveness of this novel strategy, we use TRIBE-MCL to classify chemosensory and ABC transporter gene families in C. elegans and its four sister species. We conclude that fully automated programs can establish biologically accurate gene families if parameterized accordingly. Comparative gene family classification finds optimal parameters automatically, thus allowing rapid insights into gene families of newly sequenced species. PMID:20976221
Molecular evolution of the major chemosensory gene families in insects.
Sánchez-Gracia, A; Vieira, F G; Rozas, J
2009-09-01
Chemoreception is a crucial biological process that is essential for the survival of animals. In insects, olfaction allows the organism to recognise volatile cues that allow the detection of food, predators and mates, whereas the sense of taste commonly allows the discrimination of soluble stimulants that elicit feeding behaviours and can also initiate innate sexual and reproductive responses. The most important proteins involved in the recognition of chemical cues comprise moderately sized multigene families. These families include odorant-binding proteins (OBPs) and chemosensory proteins (CSPs), which are involved in peripheral olfactory processing, and the chemoreceptor superfamily formed by the olfactory receptor (OR) and gustatory receptor (GR) families. Here, we review some recent evolutionary genomic studies of chemosensory gene families using the data from fully sequenced insect genomes, especially from the 12 newly available Drosophila genomes. Overall, the results clearly support the birth-and-death model as the major mechanism of evolution in these gene families. Namely, new members arise by tandem gene duplication, progressively diverge in sequence and function, and can eventually be lost from the genome by a deletion or pseudogenisation event. Adaptive changes fostered by environmental shifts are also observed in the evolution of chemosensory families in insects and likely involve reproductive, ecological or behavioural traits. Consequently, the current size of these gene families is mainly a result of random gene gain and loss events. This dynamic process may represent a major source of genetic variation, providing opportunities for FUTURE specific adaptations.
Specific genetic modifications of domestic animals by gene targeting and animal cloning
Directory of Open Access Journals (Sweden)
Zhou Jiangfeng
2003-11-01
Full Text Available Abstract The technology of gene targeting through homologous recombination has been extremely useful for elucidating gene functions in mice. The application of this technology was thought impossible in the large livestock species until the successful creation of the first mammalian clone "Dolly" the sheep. The combination of the technologies for gene targeting of somatic cells with those of animal cloning made it possible to introduce specific genetic mutations into domestic animals. In this review, the principles of gene targeting in somatic cells and the challenges of nuclear transfer using gene-targeted cells are discussed. The relevance of gene targeting in domestic animals for applications in bio-medicine and agriculture are also examined.
The Portrayal of Families across Generations in Disney Animated Films
Directory of Open Access Journals (Sweden)
Jessica D. Zurcher
2018-03-01
Full Text Available Disney animated films continue to serve as an influential form of media that shapes children’s development of beliefs about the world surrounding them, including the construct of the family. However, a census analysis as to how Disney animated films represent depictions of families has yet to be conducted. To fill this gap, we assessed the qualities of family demographics, structure, and function in a census analysis of 85 Disney animated films from the years 1937–2018. Results indicated that single parent families (41.3% was the most predominantly represented family structure, followed by nuclear (25% and guardian (19.2%. We also observed that the first depiction of a non-Caucasian family was presented in the 1990s, with a growing number of ethnically diverse families since that time. However, minimal interactions between families of differing ethnicities are noted. Overall, over 75% of all Disney animated films depicted warm and supportive familial interactions, with 78.8% of the films illustrating a positive relationship between the protagonist and his/her family. Analysis and implications are offered for parents and educators who wish to further understand the content Disney animated films offer in depicting families.
Whole genome duplications and expansion of the vertebrate GATA transcription factor gene family
Directory of Open Access Journals (Sweden)
Bowerman Bruce
2009-08-01
Full Text Available Abstract Background GATA transcription factors influence many developmental processes, including the specification of embryonic germ layers. The GATA gene family has significantly expanded in many animal lineages: whereas diverse cnidarians have only one GATA transcription factor, six GATA genes have been identified in many vertebrates, five in many insects, and eleven to thirteen in Caenorhabditis nematodes. All bilaterian animal genomes have at least one member each of two classes, GATA123 and GATA456. Results We have identified one GATA123 gene and one GATA456 gene from the genomic sequence of two invertebrate deuterostomes, a cephalochordate (Branchiostoma floridae and a hemichordate (Saccoglossus kowalevskii. We also have confirmed the presence of six GATA genes in all vertebrate genomes, as well as additional GATA genes in teleost fish. Analyses of conserved sequence motifs and of changes to the exon-intron structure, and molecular phylogenetic analyses of these deuterostome GATA genes support their origin from two ancestral deuterostome genes, one GATA 123 and one GATA456. Comparison of the conserved genomic organization across vertebrates identified eighteen paralogous gene families linked to multiple vertebrate GATA genes (GATA paralogons, providing the strongest evidence yet for expansion of vertebrate GATA gene families via genome duplication events. Conclusion From our analysis, we infer the evolutionary birth order and relationships among vertebrate GATA transcription factors, and define their expansion via multiple rounds of whole genome duplication events. As the genomes of four independent invertebrate deuterostome lineages contain single copy GATA123 and GATA456 genes, we infer that the 0R (pre-genome duplication invertebrate deuterostome ancestor also had two GATA genes, one of each class. Synteny analyses identify duplications of paralogous chromosomal regions (paralogons, from single ancestral vertebrate GATA123 and GATA456
The animal sialyltransferases and sialyltransferase-related genes: a phylogenetic approach.
Harduin-Lepers, Anne; Mollicone, Rosella; Delannoy, Philippe; Oriol, Rafael
2005-08-01
The animal sialyltransferases are Golgi type II transmembrane glycosyltransferases. Twenty distinct sialyltransferases have been identified in both human and murine genomes. These enzymes catalyze transfer of sialic acid from CMP-Neu5Ac to the glycan moiety of glycoconjugates. Despite low overall identities, they share four conserved peptide motifs [L (large), S (small), motif III, and motif VS (very small)] that are hallmarks for sialyltransferase identification. We have identified 155 new putative genes in 25 animal species, and we have exploited two lines of evidence: (1) sequence comparisons and (2) exon-intron organization of the genes. An ortholog to the ancestor present before the split of ST6Gal I and II subfamilies was detected in arthropods. An ortholog to the ancestor present before the split of ST6GalNAc III, IV, V, and VI subfamilies was detected in sea urchin. An ortholog to the ancestor present before the split of ST3Gal I and II subfamilies was detected in ciona, and an ortholog to the ancestor of all the ST8Sia was detected in amphioxus. Therefore, single examples of the four families (ST3Gal, ST6Gal, ST6GalNAc, and ST8Sia) have appeared in invertebrates, earlier than previously thought, whereas the four families were all detected in bony fishes, amphibians, birds, and mammals. As previously hypothesized, sequence similarities among sialyltransferases suggest a common genetic origin, by successive duplications of an ancestral gene, followed by divergent evolution. Finally, we propose predictions on these invertebrates sialyltransferase-related activities that have not previously been demonstrated and that will ultimately need to be substantiated by protein expression and enzymatic activity assays.
Liu, Ake; Wang, Yong; Zhang, Debao; Wang, Xuhua; Song, Huifang; Dang, Chunwang; Yao, Qin; Chen, Keping
2013-08-01
Helix-loop-helix (bHLH) proteins play essential regulatory roles in a variety of biological processes. These highly conserved proteins form a large transcription factor superfamily, and are commonly identified in large numbers within animal, plant, and fungal genomes. The bHLH domain has been well studied in many animal species, but has not yet been characterized in non-avian reptiles. In this study, we identified 102 putative bHLH genes in the genome of the green anole lizard, Anolis carolinensis. Based on phylogenetic analysis, these genes were classified into 43 families, with 43, 24, 16, 3, 10, and 3 members assigned into groups A, B, C, D, E, and F, respectively, and 3 members categorized as "orphans". Within-group evolutionary relationships inferred from the phylogenetic analysis were consistent with highly conserved patterns observed for introns and additional domains. Results from phylogenetic analysis of the H/E(spl) family suggest that genome and tandem gene duplications have contributed to this family's expansion. Our classification and evolutionary analysis has provided insights into the evolutionary diversification of animal bHLH genes, and should aid future studies on bHLH protein regulation of key growth and developmental processes.
Seidl, M.F.; Ackerveken, van den G.; Govers, F.; Snel, B.
2012-01-01
The taxonomic class of oomycetes contains numerous pathogens of plants and animals but is related to nonpathogenic diatoms and brown algae. Oomycetes have flexible genomes comprising large gene families that play roles in pathogenicity. The evolutionary processes that shaped the gene content have
Directory of Open Access Journals (Sweden)
Maria V. Fernández
2018-04-01
Full Text Available Gene-based tests to study the combined effect of rare variants on a particular phenotype have been widely developed for case-control studies, but their evolution and adaptation for family-based studies, especially studies of complex incomplete families, has been slower. In this study, we have performed a practical examination of all the latest gene-based methods available for family-based study designs using both simulated and real datasets. We examined the performance of several collapsing, variance-component, and transmission disequilibrium tests across eight different software packages and 22 models utilizing a cohort of 285 families (N = 1,235 with late-onset Alzheimer disease (LOAD. After a thorough examination of each of these tests, we propose a methodological approach to identify, with high confidence, genes associated with the tested phenotype and we provide recommendations to select the best software and model for family-based gene-based analyses. Additionally, in our dataset, we identified PTK2B, a GWAS candidate gene for sporadic AD, along with six novel genes (CHRD, CLCN2, HDLBP, CPAMD8, NLRP9, and MAS1L as candidate genes for familial LOAD.
Li, Qi; Zhang, Ning; Zhang, Liangsheng; Ma, Hong
2015-04-01
Rhomboid proteins are intramembrane serine proteases that are involved in a plethora of biological functions, but the evolutionary history of the rhomboid gene family is not clear. We performed a comprehensive molecular evolutionary analysis of the rhomboid gene family and also investigated the organization and sequence features of plant rhomboids in different subfamilies. Our results showed that eukaryotic rhomboids could be divided into five subfamilies (RhoA-RhoD and PARL). Most orthology groups appeared to be conserved only as single or low-copy genes in all lineages in RhoB-RhoD and PARL, whereas RhoA genes underwent several duplication events, resulting in multiple gene copies. These duplication events were due to whole genome duplications in plants and animals and the duplicates might have experienced functional divergence. We also identified a novel group of plant rhomboid (RhoB1) that might have lost their enzymatic activity; their existence suggests that they might have evolved new mechanisms. Plant and animal rhomboids have similar evolutionary patterns. In addition, there are mutations affecting key active sites in RBL8, RBL9 and one of the Brassicaceae PARL duplicates. This study delineates a possible evolutionary scheme for intramembrane proteins and illustrates distinct fates and a mechanism of evolution of gene duplicates. © 2014 The Authors. New Phytologist © 2014 New Phytologist Trust.
Evolution of the MAGUK protein gene family in premetazoan lineages
Directory of Open Access Journals (Sweden)
Ruiz-Trillo Iñaki
2010-04-01
Full Text Available Abstract Background Cell-to-cell communication is a key process in multicellular organisms. In multicellular animals, scaffolding proteins belonging to the family of membrane-associated guanylate kinases (MAGUK are involved in the regulation and formation of cell junctions. These MAGUK proteins were believed to be exclusive to Metazoa. However, a MAGUK gene was recently identified in an EST survey of Capsaspora owczarzaki, an unicellular organism that branches off near the metazoan clade. To further investigate the evolutionary history of MAGUK, we have undertook a broader search for this gene family using available genomic sequences of different opisthokont taxa. Results Our survey and phylogenetic analyses show that MAGUK proteins are present not only in Metazoa, but also in the choanoflagellate Monosiga brevicollis and in the protist Capsaspora owczarzaki. However, MAGUKs are absent from fungi, amoebozoans or any other eukaryote. The repertoire of MAGUKs in Placozoa and eumetazoan taxa (Cnidaria + Bilateria is quite similar, except for one class that is missing in Trichoplax, while Porifera have a simpler MAGUK repertoire. However, Vertebrata have undergone several independent duplications and exhibit two exclusive MAGUK classes. Three different MAGUK types are found in both M. brevicollis and C. owczarzaki: DLG, MPP and MAGI. Furthermore, M. brevicollis has suffered a lineage-specific diversification. Conclusions The diversification of the MAGUK protein gene family occurred, most probably, prior to the divergence between Metazoa+choanoflagellates and the Capsaspora+Ministeria clade. A MAGI-like, a DLG-like, and a MPP-like ancestral genes were already present in the unicellular ancestor of Metazoa, and new gene members have been incorporated through metazoan evolution within two major periods, one before the sponge-eumetazoan split and another within the vertebrate lineage. Moreover, choanoflagellates have suffered an independent MAGUK
Animal models of gene-environment interactions in schizophrenia.
Ayhan, Yavuz; Sawa, Akira; Ross, Christopher A; Pletnikov, Mikhail V
2009-12-07
The pathogenesis of schizophrenia and related mental illnesses likely involves multiple interactions between susceptibility genes of small effects and environmental factors. Gene-environment interactions occur across different stages of neurodevelopment to produce heterogeneous clinical and pathological manifestations of the disease. The main obstacle for mechanistic studies of gene-environment interplay has been the paucity of appropriate experimental systems for elucidating the molecular pathways that mediate gene-environment interactions relevant to schizophrenia. Recent advances in psychiatric genetics and a plethora of experimental data from animal studies allow us to suggest a new approach to gene-environment interactions in schizophrenia. We propose that animal models based on identified genetic mutations and measurable environment factors will help advance studies of the molecular mechanisms of gene-environment interplay.
The role of retrotransposons in gene family expansions: insights from the mouse Abp gene family.
Janoušek, Václav; Karn, Robert C; Laukaitis, Christina M
2013-05-29
Retrotransposons have been suggested to provide a substrate for non-allelic homologous recombination (NAHR) and thereby promote gene family expansion. Their precise role, however, is controversial. Here we ask whether retrotransposons contributed to the recent expansions of the Androgen-binding protein (Abp) gene families that occurred independently in the mouse and rat genomes. Using dot plot analysis, we found that the most recent duplication in the Abp region of the mouse genome is flanked by L1Md_T elements. Analysis of the sequence of these elements revealed breakpoints that are the relicts of the recombination that caused the duplication, confirming that the duplication arose as a result of NAHR using L1 elements as substrates. L1 and ERVII retrotransposons are considerably denser in the Abp regions than in one Mb flanking regions, while other repeat types are depleted in the Abp regions compared to flanking regions. L1 retrotransposons preferentially accumulated in the Abp gene regions after lineage separation and roughly followed the pattern of Abp gene expansion. By contrast, the proportion of shared vs. lineage-specific ERVII repeats in the Abp region resembles the rest of the genome. We confirmed the role of L1 repeats in Abp gene duplication with the identification of recombinant L1Md_T elements at the edges of the most recent mouse Abp gene duplication. High densities of L1 and ERVII repeats were found in the Abp gene region with abrupt transitions at the region boundaries, suggesting that their higher densities are tightly associated with Abp gene duplication. We observed that the major accumulation of L1 elements occurred after the split of the mouse and rat lineages and that there is a striking overlap between the timing of L1 accumulation and expansion of the Abp gene family in the mouse genome. Establishing a link between the accumulation of L1 elements and the expansion of the Abp gene family and identification of an NAHR-related breakpoint in
Massive expansion of the calpain gene family in unicellular eukaryotes
Directory of Open Access Journals (Sweden)
Zhao Sen
2012-09-01
Full Text Available Abstract Background Calpains are Ca2+-dependent cysteine proteases that participate in a range of crucial cellular processes. Dysfunction of these enzymes may cause, for instance, life-threatening diseases in humans, the loss of sex determination in nematodes and embryo lethality in plants. Although the calpain family is well characterized in animal and plant model organisms, there is a great lack of knowledge about these genes in unicellular eukaryote species (i.e. protists. Here, we study the distribution and evolution of calpain genes in a wide range of eukaryote genomes from major branches in the tree of life. Results Our investigations reveal 24 types of protein domains that are combined with the calpain-specific catalytic domain CysPc. In total we identify 41 different calpain domain architectures, 28 of these domain combinations have not been previously described. Based on our phylogenetic inferences, we propose that at least four calpain variants were established in the early evolution of eukaryotes, most likely before the radiation of all the major supergroups of eukaryotes. Many domains associated with eukaryotic calpain genes can be found among eubacteria or archaebacteria but never in combination with the CysPc domain. Conclusions The analyses presented here show that ancient modules present in prokaryotes, and a few de novo eukaryote domains, have been assembled into many novel domain combinations along the evolutionary history of eukaryotes. Some of the new calpain genes show a narrow distribution in a few branches in the tree of life, likely representing lineage-specific innovations. Hence, the functionally important classical calpain genes found among humans and vertebrates make up only a tiny fraction of the calpain family. In fact, a massive expansion of the calpain family occurred by domain shuffling among unicellular eukaryotes and contributed to a wealth of functionally different genes.
Massive expansion of the calpain gene family in unicellular eukaryotes.
Zhao, Sen; Liang, Zhe; Demko, Viktor; Wilson, Robert; Johansen, Wenche; Olsen, Odd-Arne; Shalchian-Tabrizi, Kamran
2012-09-29
Calpains are Ca2+-dependent cysteine proteases that participate in a range of crucial cellular processes. Dysfunction of these enzymes may cause, for instance, life-threatening diseases in humans, the loss of sex determination in nematodes and embryo lethality in plants. Although the calpain family is well characterized in animal and plant model organisms, there is a great lack of knowledge about these genes in unicellular eukaryote species (i.e. protists). Here, we study the distribution and evolution of calpain genes in a wide range of eukaryote genomes from major branches in the tree of life. Our investigations reveal 24 types of protein domains that are combined with the calpain-specific catalytic domain CysPc. In total we identify 41 different calpain domain architectures, 28 of these domain combinations have not been previously described. Based on our phylogenetic inferences, we propose that at least four calpain variants were established in the early evolution of eukaryotes, most likely before the radiation of all the major supergroups of eukaryotes. Many domains associated with eukaryotic calpain genes can be found among eubacteria or archaebacteria but never in combination with the CysPc domain. The analyses presented here show that ancient modules present in prokaryotes, and a few de novo eukaryote domains, have been assembled into many novel domain combinations along the evolutionary history of eukaryotes. Some of the new calpain genes show a narrow distribution in a few branches in the tree of life, likely representing lineage-specific innovations. Hence, the functionally important classical calpain genes found among humans and vertebrates make up only a tiny fraction of the calpain family. In fact, a massive expansion of the calpain family occurred by domain shuffling among unicellular eukaryotes and contributed to a wealth of functionally different genes.
Di, Chao; Xu, Wenying; Su, Zhen; Yuan, Joshua S
2010-10-07
PHB (Prohibitin) gene family is involved in a variety of functions important for different biological processes. PHB genes are ubiquitously present in divergent species from prokaryotes to eukaryotes. Human PHB genes have been found to be associated with various diseases. Recent studies by our group and others have shown diverse function of PHB genes in plants for development, senescence, defence, and others. Despite the importance of the PHB gene family, no comprehensive gene family analysis has been carried to evaluate the relatedness of PHB genes across different species. In order to better guide the gene function analysis and understand the evolution of the PHB gene family, we therefore carried out the comparative genome analysis of the PHB genes across different kingdoms. The relatedness, motif distribution, and intron/exon distribution all indicated that PHB genes is a relatively conserved gene family. The PHB genes can be classified into 5 classes and each class have a very deep evolutionary origin. The PHB genes within the class maintained the same motif patterns during the evolution. With Arabidopsis as the model species, we found that PHB gene intron/exon structure and domains are also conserved during the evolution. Despite being a conserved gene family, various gene duplication events led to the expansion of the PHB genes. Both segmental and tandem gene duplication were involved in Arabidopsis PHB gene family expansion. However, segmental duplication is predominant in Arabidopsis. Moreover, most of the duplicated genes experienced neofunctionalization. The results highlighted that PHB genes might be involved in important functions so that the duplicated genes are under the evolutionary pressure to derive new function. PHB gene family is a conserved gene family and accounts for diverse but important biological functions based on the similar molecular mechanisms. The highly diverse biological function indicated that more research needs to be carried out
DEFF Research Database (Denmark)
Safavi-Hemami, Helena; Li, Qing; Jackson, Ronneshia L.
2016-01-01
Formation of correct disulfide bonds in the endoplasmic reticulum is a crucial step for folding proteins destined for secretion. Protein disulfide isomerases (PDIs) play a central role in this process. We report a previously unidentified, hypervariable family of PDIs that represents the most...... diverse gene family of oxidoreductases described in a single genus to date. These enzymes are highly expressed specifically in the venom glands of predatory cone snails, animals that synthesize a remarkably diverse set of cysteine-rich peptide toxins (conotoxins). Enzymes in this PDI family, termed...
Contemporary Animal Models For Human Gene Therapy Applications.
Gopinath, Chitra; Nathar, Trupti Job; Ghosh, Arkasubhra; Hickstein, Dennis Durand; Nelson, Everette Jacob Remington
2015-01-01
Over the past three decades, gene therapy has been making considerable progress as an alternative strategy in the treatment of many diseases. Since 2009, several studies have been reported in humans on the successful treatment of various diseases. Animal models mimicking human disease conditions are very essential at the preclinical stage before embarking on a clinical trial. In gene therapy, for instance, they are useful in the assessment of variables related to the use of viral vectors such as safety, efficacy, dosage and localization of transgene expression. However, choosing a suitable disease-specific model is of paramount importance for successful clinical translation. This review focuses on the animal models that are most commonly used in gene therapy studies, such as murine, canine, non-human primates, rabbits, porcine, and a more recently developed humanized mice. Though small and large animals both have their own pros and cons as disease-specific models, the choice is made largely based on the type and length of study performed. While small animals with a shorter life span could be well-suited for degenerative/aging studies, large animals with longer life span could suit longitudinal studies and also help with dosage adjustments to maximize therapeutic benefit. Recently, humanized mice or mouse-human chimaeras have gained interest in the study of human tissues or cells, thereby providing a more reliable understanding of therapeutic interventions. Thus, animal models are of great importance with regard to testing new vector technologies in vivo for assessing safety and efficacy prior to a gene therapy clinical trial.
Gene family size conservation is a good indicator of evolutionary rates.
Chen, Feng-Chi; Chen, Chiuan-Jung; Li, Wen-Hsiung; Chuang, Trees-Juen
2010-08-01
The evolution of duplicate genes has been a topic of broad interest. Here, we propose that the conservation of gene family size is a good indicator of the rate of sequence evolution and some other biological properties. By comparing the human-chimpanzee-macaque orthologous gene families with and without family size conservation, we demonstrate that genes with family size conservation evolve more slowly than those without family size conservation. Our results further demonstrate that both family expansion and contraction events may accelerate gene evolution, resulting in elevated evolutionary rates in the genes without family size conservation. In addition, we show that the duplicate genes with family size conservation evolve significantly more slowly than those without family size conservation. Interestingly, the median evolutionary rate of singletons falls in between those of the above two types of duplicate gene families. Our results thus suggest that the controversy on whether duplicate genes evolve more slowly than singletons can be resolved when family size conservation is taken into consideration. Furthermore, we also observe that duplicate genes with family size conservation have the highest level of gene expression/expression breadth, the highest proportion of essential genes, and the lowest gene compactness, followed by singletons and then by duplicate genes without family size conservation. Such a trend accords well with our observations of evolutionary rates. Our results thus point to the importance of family size conservation in the evolution of duplicate genes.
Directory of Open Access Journals (Sweden)
Baumgarten Andrew
2004-06-01
Full Text Available Abstract Background Most genes in Arabidopsis thaliana are members of gene families. How do the members of gene families arise, and how are gene family copy numbers maintained? Some gene families may evolve primarily through tandem duplication and high rates of birth and death in clusters, and others through infrequent polyploidy or large-scale segmental duplications and subsequent losses. Results Our approach to understanding the mechanisms of gene family evolution was to construct phylogenies for 50 large gene families in Arabidopsis thaliana, identify large internal segmental duplications in Arabidopsis, map gene duplications onto the segmental duplications, and use this information to identify which nodes in each phylogeny arose due to segmental or tandem duplication. Examples of six gene families exemplifying characteristic modes are described. Distributions of gene family sizes and patterns of duplication by genomic distance are also described in order to characterize patterns of local duplication and copy number for large gene families. Both gene family size and duplication by distance closely follow power-law distributions. Conclusions Combining information about genomic segmental duplications, gene family phylogenies, and gene positions provides a method to evaluate contributions of tandem duplication and segmental genome duplication in the generation and maintenance of gene families. These differences appear to correspond meaningfully to differences in functional roles of the members of the gene families.
The diversity of antimicrobial resistance genes among staphylococci of animal origin.
Wendlandt, Sarah; Feßler, Andrea T; Monecke, Stefan; Ehricht, Ralf; Schwarz, Stefan; Kadlec, Kristina
2013-08-01
Staphylococci of animal origin harbor a wide variety of resistance genes. So far, more than 40 different resistance genes have been identified in staphylococci from animals. This includes genes that confer resistance to virtually all classes of antimicrobial agents approved for use in animals, such as penicillins, cephalosporins, tetracyclines, macrolides, lincosamides, phenicols, aminoglycosides, aminocyclitols, pleuromutilins, and diaminopyrimidines. The gene products of some of these resistance genes confer resistance to only specific members of a class of antimicrobial agents, whereas others confer resistance to the entire class or even to members of different classes of antimicrobial agents. The resistance mechanisms specified by the resistance genes fall into three major categories: (i) enzymatic inactivation, (ii) active efflux, or (iii) protection/modification/replacement of the cellular target sites of the antimicrobial agents. Mobile genetic elements, in particular plasmids and transposons, play a major role as carriers of antimicrobial resistance genes in animal staphylococci. They facilitate the exchange of resistance genes with staphylococci of human origin but also with other Gram-positive bacteria. Copyright © 2013 Elsevier GmbH. All rights reserved.
Zallot, Rémi; Brochier-Armanet, Céline; Gaston, Kirk W; Forouhar, Farhad; Limbach, Patrick A; Hunt, John F; de Crécy-Lagard, Valérie
2014-08-15
Queuosine (Q) is a modification found at the wobble position of tRNAs with GUN anticodons. Although Q is present in most eukaryotes and bacteria, only bacteria can synthesize Q de novo. Eukaryotes acquire queuine (q), the free base of Q, from diet and/or microflora, making q an important but under-recognized micronutrient for plants, animals, and fungi. Eukaryotic type tRNA-guanine transglycosylases (eTGTs) are composed of a catalytic subunit (QTRT1) and a homologous accessory subunit (QTRTD1) forming a complex that catalyzes q insertion into target tRNAs. Phylogenetic analysis of eTGT subunits revealed a patchy distribution pattern in which gene losses occurred independently in different clades. Searches for genes co-distributing with eTGT family members identified DUF2419 as a potential Q salvage protein family. This prediction was experimentally validated in Schizosaccharomyces pombe by confirming that Q was present by analyzing tRNA(Asp) with anticodon GUC purified from wild-type cells and by showing that Q was absent from strains carrying deletions in the QTRT1 or DUF2419 encoding genes. DUF2419 proteins occur in most Eukarya with a few possible cases of horizontal gene transfer to bacteria. The universality of the DUF2419 function was confirmed by complementing the S. pombe mutant with the Zea mays (maize), human, and Sphaerobacter thermophilus homologues. The enzymatic function of this family is yet to be determined, but structural similarity with DNA glycosidases suggests a ribonucleoside hydrolase activity.
Family context and externalizing correlates of childhood animal cruelty in adjudicated delinquents.
Walters, Glenn D; Noon, Alexandria
2015-05-01
The purpose of this study was to determine whether childhood animal cruelty is primarily a feature of family context or of externalizing behavior. Twenty measures of family context and proactive (fearlessness) and reactive (disinhibition) externalizing behavior were correlated with the retrospective accounts of childhood animal cruelty provided by 1,354 adjudicated delinquents. A cross-sectional analysis revealed that all 20 family context, proactive externalizing, and reactive externalizing variables correlated significantly with animal cruelty. Prospective analyses showed that when the animal cruelty variable was included in a regression equation with the 10 family context variables (parental arguing and fighting, parental drug use, parental hostility, and parental knowledge and monitoring of offspring behavior) or in a regression equation with the five reactive externalizing variables (interpersonal hostility, secondary psychopathy, weak impulse control, weak suppression of aggression, and short time horizon), it continued to predict future violent and income (property + drug) offending. The animal cruelty variable no longer predicted offending, however, when included in a regression equation with the five proactive externalizing variables (early onset behavioral problems, primary psychopathy, moral disengagement, positive outcome expectancies for crime, and lack of consideration for others). These findings suggest that while animal cruelty correlates with a wide range of family context and externalizing variables, it may serve as a marker of violent and nonviolent offending by virtue of its position on the proactive subdimension of the externalizing spectrum. © The Author(s) 2014.
Proudhon, D; Wei, J; Briat, J; Theil, E C
1996-03-01
Ferritin, a protein widespread in nature, concentrates iron approximately 10(11)-10(12)-fold above the solubility within a spherical shell of 24 subunits; it derives in plants and animals from a common ancestor (based on sequence) but displays a cytoplasmic location in animals compared to the plastid in contemporary plants. Ferritin gene regulation in plants and animals is altered by development, hormones, and excess iron; iron signals target DNA in plants but mRNA in animals. Evolution has thus conserved the two end points of ferritin gene expression, the physiological signals and the protein structure, while allowing some divergence of the genetic mechanisms. Comparison of ferritin gene organization in plants and animals, made possible by the cloning of a dicot (soybean) ferritin gene presented here and the recent cloning of two monocot (maize) ferritin genes, shows evolutionary divergence in ferritin gene organization between plants and animals but conservation among plants or among animals; divergence in the genetic mechanism for iron regulation is reflected by the absence in all three plant genes of the IRE, a highly conserved, noncoding sequence in vertebrate animal ferritin mRNA. In plant ferritin genes, the number of introns (n = 7) is higher than in animals (n = 3). Second, no intron positions are conserved when ferritin genes of plants and animals are compared, although all ferritin gene introns are in the coding region; within kingdoms, the intron positions in ferritin genes are conserved. Finally, secondary protein structure has no apparent relationship to intron/exon boundaries in plant ferritin genes, whereas in animal ferritin genes the correspondence is high. The structural differences in introns/exons among phylogenetically related ferritin coding sequences and the high conservation of the gene structure within plant or animal kingdoms of the gene structure within plant or animal kingdoms suggest that kingdom-specific functional constraints may
Directory of Open Access Journals (Sweden)
Fortunato Sofia
2012-07-01
Full Text Available Abstract Background Sox genes are HMG-domain containing transcription factors with important roles in developmental processes in animals; many of them appear to have conserved functions among eumetazoans. Demosponges have fewer Sox genes than eumetazoans, but their roles remain unclear. The aim of this study is to gain insight into the early evolutionary history of the Sox gene family by identification and expression analysis of Sox genes in the calcareous sponge Sycon ciliatum. Methods Calcaronean Sox related sequences were retrieved by searching recently generated genomic and transcriptome sequence resources and analyzed using variety of phylogenetic methods and identification of conserved motifs. Expression was studied by whole mount in situ hybridization. Results We have identified seven Sox genes and four Sox-related genes in the complete genome of Sycon ciliatum. Phylogenetic and conserved motif analyses showed that five of Sycon Sox genes represent groups B, C, E, and F present in cnidarians and bilaterians. Two additional genes are classified as Sox genes but cannot be assigned to specific subfamilies, and four genes are more similar to Sox genes than to other HMG-containing genes. Thus, the repertoire of Sox genes is larger in this representative of calcareous sponges than in the demosponge Amphimedon queenslandica. It remains unclear whether this is due to the expansion of the gene family in Sycon or a secondary reduction in the Amphimedon genome. In situ hybridization of Sycon Sox genes revealed a variety of expression patterns during embryogenesis and in specific cell types of adult sponges. Conclusions In this study, we describe a large family of Sox genes in Sycon ciliatum with dynamic expression patterns, indicating that Sox genes are regulators in development and cell type determination in sponges, as observed in higher animals. The revealed differences between demosponge and calcisponge Sox genes repertoire highlight the need to
A compendium of fossil marine animal families, 2nd edition
Sepkoski, J. J. Jr; Sepkoski JJ, J. r. (Principal Investigator)
1992-01-01
A comprehensive listing of 4075 taxonomic families of marine animals known from the fossil record is presented. This listing covers invertebrates, vertebrates, and animal-like protists, gives time intervals of apparent origination and extinction, and provides literature sources for these data. The time intervals are mostly 81 internationally recognized stratigraphic stages; more than half of the data are resolved to one of 145 substage divisions, providing more highly resolved data for studies of taxic macroevolution. Families are classified by order, class, and phylum, reflecting current classifications in the published literature. This compendium is a new edition of the 1982 publication, correcting errors and presenting greater stratigraphic resolution and more current ideas about acceptable families and their classification.
Wei, Ling; Yang, Chao; Tao, Wenjing; Wang, Deshou
2016-02-23
The Sox transcription factor family is characterized with the presence of a Sry-related high-mobility group (HMG) box and plays important roles in various biological processes in animals, including sex determination and differentiation, and the development of multiple organs. In this study, 27 Sox genes were identified in the genome of the Nile tilapia (Oreochromis niloticus), and were classified into seven groups. The members of each group of the tilapia Sox genes exhibited a relatively conserved exon-intron structure. Comparative analysis showed that the Sox gene family has undergone an expansion in tilapia and other teleost fishes following their whole genome duplication, and group K only exists in teleosts. Transcriptome-based analysis demonstrated that most of the tilapia Sox genes presented stage-specific and/or sex-dimorphic expressions during gonadal development, and six of the group B Sox genes were specifically expressed in the adult brain. Our results provide a better understanding of gene structure and spatio-temporal expression of the Sox gene family in tilapia, and will be useful for further deciphering the roles of the Sox genes during sex determination and gonadal development in teleosts.
Directory of Open Access Journals (Sweden)
Ling Wei
2016-02-01
Full Text Available The Sox transcription factor family is characterized with the presence of a Sry-related high-mobility group (HMG box and plays important roles in various biological processes in animals, including sex determination and differentiation, and the development of multiple organs. In this study, 27 Sox genes were identified in the genome of the Nile tilapia (Oreochromis niloticus, and were classified into seven groups. The members of each group of the tilapia Sox genes exhibited a relatively conserved exon-intron structure. Comparative analysis showed that the Sox gene family has undergone an expansion in tilapia and other teleost fishes following their whole genome duplication, and group K only exists in teleosts. Transcriptome-based analysis demonstrated that most of the tilapia Sox genes presented stage-specific and/or sex-dimorphic expressions during gonadal development, and six of the group B Sox genes were specifically expressed in the adult brain. Our results provide a better understanding of gene structure and spatio-temporal expression of the Sox gene family in tilapia, and will be useful for further deciphering the roles of the Sox genes during sex determination and gonadal development in teleosts.
Wong, J; Mellor, D; Richardson, B; Xu, X
2013-09-01
The current study broadened the general scope of research conducted on childhood cruelty to animals by examining the association between psychological adjustment, family functioning and animal cruelty in an Eastern context, China. The mothers and fathers of 729 children attending primary school in Chengdu, China participated in this study. Each parent completed the Strengths and Difficulties Questionnaire, the Chinese Family Assessment Instrument, and the Children's Attitudes and Behaviours towards Animals questionnaire. Findings from an actor partner interdependence model demonstrated that parents' ratings of family functioning and of their child's externalizing coping style predicted only modest amounts of variance in animal cruelty. In particular, parents' ratings of their child's externalizing coping style most consistently predicted animal cruelty. Family functioning, fathers' ratings in particular, played a minor role, more so for boys compared with girls. This study provided the first insight into childhood animal cruelty in China, and suggests that further research may enhance our understanding of these phenomena. © 2012 John Wiley & Sons Ltd.
Images of Couples and Families in Disney Feature-Length Animated Films.
Tanner, Litsa Renee; Haddock, Shelley A.; Zimmerman, Toni Schindler; Lund, Lori K.
2003-01-01
Examines themes about couples and families portrayed in 26 Disney animated classics and recent movies. Four overarching themes were identified: family relationships are a strong priority; families are diverse, but the diversity is often simplified; fathers are elevated, while mothers are marginalized; and couple relationships are created by…
Directory of Open Access Journals (Sweden)
Craxton Molly
2007-07-01
Full Text Available Abstract Background Synaptotagmin genes are found in animal genomes and are known to function in the nervous system. Genes with a similar domain architecture as well as sequence similarity to synaptotagmin C2 domains have also been found in plant genomes. The plant genes share an additional region of sequence similarity with a group of animal genes named FAM62. FAM62 genes also have a similar domain architecture. Little is known about the functions of the plant genes and animal FAM62 genes. Indeed, many members of the large and diverse Syt gene family await functional characterization. Understanding the evolutionary relationships among these genes will help to realize the full implications of functional studies and lead to improved genome annotation. Results I collected and compared plant Syt-like sequences from the primary nucleotide sequence databases at NCBI. The collection comprises six groups of plant genes conserved in embryophytes: NTMC2Type1 to NTMC2Type6. I collected and compared metazoan FAM62 sequences and identified some similar sequences from other eukaryotic lineages. I found evidence of RNA editing and alternative splicing. I compared the intron patterns of Syt genes. I also compared Rabphilin and Doc2 genes. Conclusion Genes encoding proteins with N-terminal-transmembrane-C2 domain architectures resembling synaptotagmins, are widespread in eukaryotes. A collection of these genes is presented here. The collection provides a resource for studies of intron evolution. I have classified the collection into homologous gene families according to distinctive patterns of sequence conservation and intron position. The evolutionary histories of these gene families are traceable through the appearance of family members in different eukaryotic lineages. Assuming an intron-rich eukaryotic ancestor, the conserved intron patterns distinctive of individual gene families, indicate independent origins of Syt, FAM62 and NTMC2 genes. Resemblances
Molecular cloning of RBCS genes in Selaginella and the evolution of the rbcS gene family
Directory of Open Access Journals (Sweden)
Wang Bo
2015-01-01
Full Text Available Rubisco small subunits (RBCS are encoded by a nuclear rbcS multigene family in higher plants and green algae. However, owing to the lack of rbcS sequences in lycophytes, the characteristics of rbcS genes in lycophytes is unclear. Recently, the complete genome sequence of the lycophyte Selaginella moellendorffii provided the first insight into the rbcS gene family in lycophytes. To understand further the characteristics of rbcS genes in other Selaginella, the full length of rbcS genes (rbcS1 and rbcS2 from two other Selaginella species were isolated. Both rbcS1 and rbcS2 genes shared more than 97% identity among three Selaginella species. RBCS proteins from Selaginella contained the Pfam RBCS domain F00101, which was a major domain of other plant RBCS proteins. To explore the evolution of the rbcS gene family across Selaginella and other plants, we identified and performed comparative analysis of the rbcS gene family among 16 model plants based on a genome-wide analysis. The results showed that (i two rbcS genes were obtained in Selaginella, which is the second fewest number of rbcS genes among the 16 representative plants; (ii an expansion of rbcS genes occurred in the moss Physcomitrella patens; (iii only RBCS proteins from angiosperms contained the Pfam PF12338 domains, and (iv a pattern of concerted evolution existed in the rbcS gene family. Our study provides new insights into the evolution of the rbcS gene family in Selaginella and other plants.
Love, Safety, and Companionship: The Human-Animal Bond and Latino Families
Faver, Catherine A.; Cavazos, Alonzo M., Jr.
2008-01-01
A survey found that 69.2% of a sample of 208 Latino university students in south Texas owned companion animals. Dogs were the most commonly owned companion animals, and 92% of dog and cat guardians regarded their companion animals as family members. Over 80% of the dog and cat guardians specified companionship and unconditional love as benefits…
Picard, Marion Anne-Lise; Cosseau, Céline; Mouahid, Gabriel; Duval, David; Grunau, Christoph; Toulza, Ève; Allienne, Jean-François; Boissier, Jérôme
2015-07-01
The Dmrt (Double sex/Male-abnormal-3 Related Transcription factor) genes have been intensively studied because they represent major transcription factors in the pathways governing sex determination and differentiation. These genes have been identified in animal groups ranging from cnidarians to mammals, and some of the genes functionally studied. Here, we propose to analyze (i) the presence/absence of various Dmrt gene groups in the different taxa across the animal kingdom; (ii) the relative expression levels of the Dmrt genes in each sex; (iii) the specific spatial (by organ) and temporal (by developmental stage) variations in gene expression. This review considers non-mammalian animals at all levels of study (i.e. no particular importance is given to animal models), and using all types of sexual strategy (hermaphroditic or gonochoric) and means of sex determination (i.e. genetic or environmental). To conclude this global comparison, we offer an analysis of the DM domains conserved among the different DMRT proteins, and propose a general sex-specific pattern for each member of the Dmrt gene family. Copyright © 2015 Académie des sciences. Published by Elsevier SAS. All rights reserved.
Karn, Robert C; Laukaitis, Christina M
2012-01-01
Three proteinaceous pheromone families, the androgen-binding proteins (ABPs), the exocrine-gland secreting peptides (ESPs) and the major urinary proteins (MUPs) are encoded by large gene families in the genomes of Mus musculus and Rattus norvegicus. We studied the evolutionary histories of the Mup and Esp genes and compared them with what is known about the Abp genes. Apparently gene conversion has played little if any role in the expansion of the mouse Class A and Class B Mup genes and pseudogenes, and the rat Mups. By contrast, we found evidence of extensive gene conversion in many Esp genes although not in all of them. Our studies of selection identified at least two amino acid sites in β-sheets as having evolved under positive selection in the mouse Class A and Class B MUPs and in rat MUPs. We show that selection may have acted on the ESPs by determining K(a)/K(s) for Exon 3 sequences with and without the converted sequence segment. While it appears that purifying selection acted on the ESP signal peptides, the secreted portions of the ESPs probably have undergone much more rapid evolution. When the inner gene converted fragment sequences were removed, eleven Esp paralogs were present in two or more pairs with K(a)/K(s) >1.0 and thus we propose that positive selection is detectable by this means in at least some mouse Esp paralogs. We compare and contrast the evolutionary histories of all three mouse pheromone gene families in light of their proposed functions in mouse communication.
Fabry, S; Müller, K; Lindauer, A; Park, P B; Cornelius, T; Schmitt, R
1995-09-01
The genome of the green alga Chlamydomonas reinhardtii contains approximately 15 gene clusters of the nucleosomal (or core) histone H2A, H2B, H3 and H4 genes and at least one histone H1 gene. Seven non-allelic histone gene loci were isolated from a genomic library, physically mapped, and the nucleotide sequences of three isotypes of each core histone gene species and one linked H1 gene determined. The core histone genes are organized in clusters of H2A-H2B and H3-H4 pairs, in which each gene pair shows outwardly divergent transcription from a short (< 300 bp) intercistronic region. These intercistronic regions contain typically conserved promoter elements, namely a TATA-box and the three motifs TGGCCAG-G(G/C)-CGAG, CGTTGACC and CGGTTG. Different from the genes of higher plants, but like those of animals and the related alga Volvox, the 3' untranslated regions contain no poly A signal, but a palindromic sequence (3' palindrome) essential for mRNA processing is present. One single H1 gene was found in close linkage to a H2A-H2B pair. The H1 upstream region contains the octameric promoter element GGTTGACC (also found upstream of the core histone genes) and two specific sequence motifs that are shared only with the Volvox H1 promoters. This suggests differential transcription of the H1 and the core histone genes. The H1 gene is interrupted by two introns. Unlike Volvox H3 genes, the three sequenced H3 isoforms are intron-free. Primer-directed PCR of genomic DNA demonstrated, however, that at least 8 of the about 15 H3 genes do contain one intron at a conserved position. In synchronized C. reinhardtii cells, H4 mRNA levels (representative of all core histone mRNAs) peak during cell division, suggesting strict replication-dependent gene control. The derived peptide sequences place C. reinhardtii core histones closer to plants than to animals, except that the H2A histones are more animal-like. The peptide sequence of histone H1 is closely related to the V. carteri VH1-II
Recurrent APC gene mutations in Polish FAP families
Directory of Open Access Journals (Sweden)
Pławski Andrzej
2007-12-01
Full Text Available Abstract The molecular diagnostics of genetically conditioned disorders is based on the identification of the mutations in the predisposing genes. Hereditary cancer disorders of the gastrointestinal tracts are caused by mutations of the tumour suppressor genes or the DNA repair genes. Occurrence of recurrent mutation allows improvement of molecular diagnostics. The mutation spectrum in the genes causing hereditary forms of colorectal cancers in the Polish population was previously described. In the present work an estimation of the frequency of the recurrent mutations of the APC gene was performed. Eight types of mutations occurred in 19.4% of our FAP families and these constitute 43% of all Polish diagnosed families.
The IQD gene family in soybean: structure, phylogeny, evolution and expression.
Directory of Open Access Journals (Sweden)
Lin Feng
Full Text Available Members of the plant-specific IQ67-domain (IQD protein family are involved in plant development and the basal defense response. Although systematic characterization of this family has been carried out in Arabidopsis, tomato (Solanum lycopersicum, Brachypodium distachyon and rice (Oryza sativa, systematic analysis and expression profiling of this gene family in soybean (Glycine max have not previously been reported. In this study, we identified and structurally characterized IQD genes in the soybean genome. A complete set of 67 soybean IQD genes (GmIQD1-67 was identified using Blast search tools, and the genes were clustered into four subfamilies (IQD I-IV based on phylogeny. These soybean IQD genes are distributed unevenly across all 20 chromosomes, with 30 segmental duplication events, suggesting that segmental duplication has played a major role in the expansion of the soybean IQD gene family. Analysis of the Ka/Ks ratios showed that the duplicated genes of the GmIQD family primarily underwent purifying selection. Microsynteny was detected in most pairs: genes in clade 1-3 might be present in genome regions that were inverted, expanded or contracted after the divergence; most gene pairs in clade 4 showed high conservation with little rearrangement among these gene-residing regions. Of the soybean IQD genes examined, six were most highly expressed in young leaves, six in flowers, one in roots and two in nodules. Our qRT-PCR analysis of 24 soybean IQD III genes confirmed that these genes are regulated by MeJA stress. Our findings present a comprehensive overview of the soybean IQD gene family and provide insights into the evolution of this family. In addition, this work lays a solid foundation for further experiments aimed at determining the biological functions of soybean IQD genes in growth and development.
Animal models of Duchenne muscular dystrophy: from basic mechanisms to gene therapy
McGreevy, Joe W.; Hakim, Chady H.; McIntosh, Mark A.; Duan, Dongsheng
2015-01-01
Duchenne muscular dystrophy (DMD) is a progressive muscle-wasting disorder. It is caused by loss-of-function mutations in the dystrophin gene. Currently, there is no cure. A highly promising therapeutic strategy is to replace or repair the defective dystrophin gene by gene therapy. Numerous animal models of DMD have been developed over the last 30 years, ranging from invertebrate to large mammalian models. mdx mice are the most commonly employed models in DMD research and have been used to lay the groundwork for DMD gene therapy. After ~30 years of development, the field has reached the stage at which the results in mdx mice can be validated and scaled-up in symptomatic large animals. The canine DMD (cDMD) model will be excellent for these studies. In this article, we review the animal models for DMD, the pros and cons of each model system, and the history and progress of preclinical DMD gene therapy research in the animal models. We also discuss the current and emerging challenges in this field and ways to address these challenges using animal models, in particular cDMD dogs. PMID:25740330
Animal models of Duchenne muscular dystrophy: from basic mechanisms to gene therapy.
McGreevy, Joe W; Hakim, Chady H; McIntosh, Mark A; Duan, Dongsheng
2015-03-01
Duchenne muscular dystrophy (DMD) is a progressive muscle-wasting disorder. It is caused by loss-of-function mutations in the dystrophin gene. Currently, there is no cure. A highly promising therapeutic strategy is to replace or repair the defective dystrophin gene by gene therapy. Numerous animal models of DMD have been developed over the last 30 years, ranging from invertebrate to large mammalian models. mdx mice are the most commonly employed models in DMD research and have been used to lay the groundwork for DMD gene therapy. After ~30 years of development, the field has reached the stage at which the results in mdx mice can be validated and scaled-up in symptomatic large animals. The canine DMD (cDMD) model will be excellent for these studies. In this article, we review the animal models for DMD, the pros and cons of each model system, and the history and progress of preclinical DMD gene therapy research in the animal models. We also discuss the current and emerging challenges in this field and ways to address these challenges using animal models, in particular cDMD dogs. © 2015. Published by The Company of Biologists Ltd.
PlantTribes: a gene and gene family resource for comparative genomics in plants
Wall, P. Kerr; Leebens-Mack, Jim; Müller, Kai F.; Field, Dawn; Altman, Naomi S.; dePamphilis, Claude W.
2007-01-01
The PlantTribes database (http://fgp.huck.psu.edu/tribe.html) is a plant gene family database based on the inferred proteomes of five sequenced plant species: Arabidopsis thaliana, Carica papaya, Medicago truncatula, Oryza sativa and Populus trichocarpa. We used the graph-based clustering algorithm MCL [Van Dongen (Technical Report INS-R0010 2000) and Enright et al. (Nucleic Acids Res. 2002; 30: 1575–1584)] to classify all of these species’ protein-coding genes into putative gene families, ca...
International Nuclear Information System (INIS)
Yanai, Itai; Camacho, Carlos J.; DeLisi, Charles
2000-01-01
A universal property of microbial genomes is the considerable fraction of genes that are homologous to other genes within the same genome. The process by which these homologues are generated is not well understood, but sequence analysis of 20 microbial genomes unveils a recurrent distribution of gene family sizes. We show that a simple evolutionary model based on random gene duplication and point mutations fully accounts for these distributions and permits predictions for the number of gene families in genomes not yet complete. Our findings are consistent with the notion that a genome evolves from a set of precursor genes to a mature size by gene duplications and increasing modifications. (c) 2000 The American Physical Society
Energy Technology Data Exchange (ETDEWEB)
Yanai, Itai; Camacho, Carlos J.; DeLisi, Charles
2000-09-18
A universal property of microbial genomes is the considerable fraction of genes that are homologous to other genes within the same genome. The process by which these homologues are generated is not well understood, but sequence analysis of 20 microbial genomes unveils a recurrent distribution of gene family sizes. We show that a simple evolutionary model based on random gene duplication and point mutations fully accounts for these distributions and permits predictions for the number of gene families in genomes not yet complete. Our findings are consistent with the notion that a genome evolves from a set of precursor genes to a mature size by gene duplications and increasing modifications. (c) 2000 The American Physical Society.
Ultra Large Gene Families: A Matter of Adaptation or Genomic Parasites?
Directory of Open Access Journals (Sweden)
Philipp H. Schiffer
2016-08-01
Full Text Available Gene duplication is an important mechanism of molecular evolution. It offers a fast track to modification, diversification, redundancy or rescue of gene function. However, duplication may also be neutral or (slightly deleterious, and often ends in pseudo-geneisation. Here, we investigate the phylogenetic distribution of ultra large gene families on long and short evolutionary time scales. In particular, we focus on a family of NACHT-domain and leucine-rich-repeat-containing (NLR-genes, which we previously found in large numbers to occupy one chromosome arm of the zebrafish genome. We were interested to see whether such a tight clustering is characteristic for ultra large gene families. Our data reconfirm that most gene family inflations are lineage-specific, but we can only identify very few gene clusters. Based on our observations we hypothesise that, beyond a certain size threshold, ultra large gene families continue to proliferate in a mechanism we term “run-away evolution”. This process might ultimately lead to the failure of genomic integrity and drive species to extinction.
Jiang, Feng; Liu, Qing; Wang, Yanli; Zhang, Jie; Wang, Huimin; Song, Tianqi; Yang, Meiling; Wang, Xianhui; Kang, Le
2017-06-01
The SET domain is an evolutionarily conserved motif present in histone lysine methyltransferases, which are important in the regulation of chromatin and gene expression in animals. In this study, we searched for SET domain-containing genes (SET genes) in all of the 147 arthropod genomes sequenced at the time of carrying out this experiment to understand the evolutionary history by which SET domains have evolved in insects. Phylogenetic and ancestral state reconstruction analysis revealed an arthropod-specific SET gene family, named SmydA, that is ancestral to arthropod animals and specifically diversified during insect evolution. Considering that pseudogenization is the most probable fate of the new emerging gene copies, we provided experimental and evolutionary evidence to demonstrate their essential functions. Fluorescence in situ hybridization analysis and in vitro methyltransferase activity assays showed that the SmydA-2 gene was transcriptionally active and retained the original histone methylation activity. Expression knockdown by RNA interference significantly increased mortality, implying that the SmydA genes may be essential for insect survival. We further showed predominantly strong purifying selection on the SmydA gene family and a potential association between the regulation of gene expression and insect phenotypic plasticity by transcriptome analysis. Overall, these data suggest that the SmydA gene family retains essential functions that may possibly define novel regulatory pathways in insects. This work provides insights into the roles of lineage-specific domain duplication in insect evolution. © The Authors 2017. Published by Oxford University Press.
The ALMT Gene Family Performs Multiple Functions in Plants
Directory of Open Access Journals (Sweden)
Jie Liu
2018-02-01
Full Text Available The aluminium activated malate transporter (ALMT gene family is named after the first member of the family identified in wheat (Triticum aestivum L.. The product of this gene controls resistance to aluminium (Al toxicity. ALMT genes encode transmembrane proteins that function as anion channels and perform multiple functions involving the transport of organic anions (e.g., carboxylates and inorganic anions in cells. They share a PF11744 domain and are classified in the Fusaric acid resistance protein-like superfamily, CL0307. The proteins typically have five to seven transmembrane regions in the N-terminal half and a long hydrophillic C-terminal tail but predictions of secondary structure vary. Although widely spread in plants, relatively little information is available on the roles performed by other members of this family. In this review, we summarized functions of ALMT gene families, including Al resistance, stomatal function, mineral nutrition, microbe interactions, fruit acidity, light response and seed development.
Repeat-associated plasticity in the Helicobacter pylori RD gene family.
Shak, Joshua R; Dick, Jonathan J; Meinersmann, Richard J; Perez-Perez, Guillermo I; Blaser, Martin J
2009-11-01
The bacterium Helicobacter pylori is remarkable for its ability to persist in the human stomach for decades without provoking sterilizing immunity. Since repetitive DNA can facilitate adaptive genomic flexibility via increased recombination, insertion, and deletion, we searched the genomes of two H. pylori strains for nucleotide repeats. We discovered a family of genes with extensive repetitive DNA that we have termed the H. pylori RD gene family. Each gene of this family is composed of a conserved 3' region, a variable mid-region encoding 7 and 11 amino acid repeats, and a 5' region containing one of two possible alleles. Analysis of five complete genome sequences and PCR genotyping of 42 H. pylori strains revealed extensive variation between strains in the number, location, and arrangement of RD genes. Furthermore, examination of multiple strains isolated from a single subject's stomach revealed intrahost variation in repeat number and composition. Despite prior evidence that the protein products of this gene family are expressed at the bacterial cell surface, enzyme-linked immunosorbent assay and immunoblot studies revealed no consistent seroreactivity to a recombinant RD protein by H. pylori-positive hosts. The pattern of repeats uncovered in the RD gene family appears to reflect slipped-strand mispairing or domain duplication, allowing for redundancy and subsequent diversity in genotype and phenotype. This novel family of hypervariable genes with conserved, repetitive, and allelic domains may represent an important locus for understanding H. pylori persistence in its natural host.
Lopes-Marques, Mónica; Machado, André M; Ruivo, Raquel; Fonseca, Elza; Carvalho, Estela; Castro, L Filipe C
2018-07-20
Fatty acids (FAs) constitute a considerable fraction of all lipid molecules with a fundamental role in numerous physiological processes. In animals, the majority of complex lipid molecules are derived from the transformation of FAs through several biochemical pathways. Yet, for FAs to enroll in these pathways they require an activation step. FA activation is catalyzed by the rate limiting action of Acyl-CoA synthases. Several Acyl-CoA enzyme families have been previously described and classified according to the chain length of FAs they process. Here, we address the evolutionary history of the ACSBG gene family which activates, FAs with >16 carbons. Currently, two different ACSBG gene families, ACSBG1 and ACSBG2, are recognized in vertebrates. We provide evidence that a wider and unequal ACSBG gene repertoire is present in vertebrate lineages. We identify a novel ACSBG-like gene lineage which occurs specifically in amphibians, ray finned fishes, coelacanths and cartilaginous fishes named ACSBG3. Also, we show that the ACSBG2 gene lineage duplicated in the Theria ancestor. Our findings, thus offer a far richer understanding on FA activation in vertebrates and provide key insights into the relevance of comparative and functional analysis to perceive physiological differences, namely those related with lipid metabolic pathways. Copyright © 2018 Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Shen, A.; Humphries, C.; Tucker, P.; Blattner, F.
1987-01-01
The authors have identified a family of human immunoglobulin heavy-chain variable-region (V/sub H/) genes, one member of which is rearranged in two affected members of a family in which the father and four of five siblings developed chronic lymphocytic leukemia. Cloning and sequencing of the rearranged V/sub H/ genes from leukemic lymphocytes of three affected siblings showed that two siblings had rearranged V/sub H/ genes (V/sub H/TS1 and V/sub H/WS1) that were 90% homologous. The corresponding germ-line gene, V/sub H/251, was found to part of a small (four gene) V/sub H/ gene family, which they term V/sub H/V. The DNA sequence homology to V/sub H/WS1 (95%) and V/sub H/TS1 (88%) and identical restriction sites on the 5' side of V/sub H/ confirm that rearrangement of V/sub H/251 followed by somatic mutation produced the identical V/sub H/ gene rearrangements in the two siblings. V/sub H/TS1 is not a functional V/sub H/ gene; a functional V/sub H/ rearrangement was found on the other chromosome of this patient. The other two siblings had different V/sub H/ gene rearrangements. All used different diversity genes. Mechanisms proposed for nonrandom selection of a single V/sub H/ gene include developmental regulation of this V/sub H/ gene rearrangement or selection of a subpopulation of B cells in which this V/sub H/ has been rearranged
The SPINK gene family and celiac disease susceptibility
Wapenaar, M.C.; Monsuur, A.J.; Poell, J.; Slot, R. van 't; Meijer, J.W.R.; Meijer, G.A.; Mulder, C.J.; Mearin, M.L.; Wijmenga, C.
2007-01-01
The gene family of serine protease inhibitors of the Kazal type (SPINK) are functional and positional candidate genes for celiac disease (CD). Our aim was to assess the gut mucosal gene expression and genetic association of SPINK1, -2, -4, and -5 in the Dutch CD population. Gene expression was
The SPINK gene family and celiac disease susceptibility
Wapenaar, Martin C.; Monsuur, Alienke J.; Poell, Jos; Slot, Ruben Van 't; Meijer, Jos W. R.; Meijer, Gerrit A.; Mulder, Chris J.; Mearin, Maria Luisa; Wijmenga, Cisca
The gene family of serine protease inhibitors of the Kazal type (SPINK) are functional and positional candidate genes for celiac disease (CD). Our aim was to assess the gut mucosal gene expression and genetic association of SPINK1, -2, -4, and -5 in the Dutch CD population. Gene expression was
Characterization of the MLO gene family in Rosaceae and gene expression analysis in Malus domestica.
Pessina, Stefano; Pavan, Stefano; Catalano, Domenico; Gallotta, Alessandra; Visser, Richard G F; Bai, Yuling; Malnoy, Mickael; Schouten, Henk J
2014-07-22
Powdery mildew (PM) is a major fungal disease of thousands of plant species, including many cultivated Rosaceae. PM pathogenesis is associated with up-regulation of MLO genes during early stages of infection, causing down-regulation of plant defense pathways. Specific members of the MLO gene family act as PM-susceptibility genes, as their loss-of-function mutations grant durable and broad-spectrum resistance. We carried out a genome-wide characterization of the MLO gene family in apple, peach and strawberry, and we isolated apricot MLO homologs through a PCR-approach. Evolutionary relationships between MLO homologs were studied and syntenic blocks constructed. Homologs that are candidates for being PM susceptibility genes were inferred by phylogenetic relationships with functionally characterized MLO genes and, in apple, by monitoring their expression following inoculation with the PM causal pathogen Podosphaera leucotricha. Genomic tools available for Rosaceae were exploited in order to characterize the MLO gene family. Candidate MLO susceptibility genes were identified. In follow-up studies it can be investigated whether silencing or a loss-of-function mutations in one or more of these candidate genes leads to PM resistance.
Mitochondrial Genomes of Kinorhyncha: trnM Duplication and New Gene Orders within Animals.
Popova, Olga V; Mikhailov, Kirill V; Nikitin, Mikhail A; Logacheva, Maria D; Penin, Aleksey A; Muntyan, Maria S; Kedrova, Olga S; Petrov, Nikolai B; Panchin, Yuri V; Aleoshin, Vladimir V
2016-01-01
Many features of mitochondrial genomes of animals, such as patterns of gene arrangement, nucleotide content and substitution rate variation are extensively used in evolutionary and phylogenetic studies. Nearly 6,000 mitochondrial genomes of animals have already been sequenced, covering the majority of animal phyla. One of the groups that escaped mitogenome sequencing is phylum Kinorhyncha-an isolated taxon of microscopic worm-like ecdysozoans. The kinorhynchs are thought to be one of the early-branching lineages of Ecdysozoa, and their mitochondrial genomes may be important for resolving evolutionary relations between major animal taxa. Here we present the results of sequencing and analysis of mitochondrial genomes from two members of Kinorhyncha, Echinoderes svetlanae (Cyclorhagida) and Pycnophyes kielensis (Allomalorhagida). Their mitochondrial genomes are circular molecules approximately 15 Kbp in size. The kinorhynch mitochondrial gene sequences are highly divergent, which precludes accurate phylogenetic inference. The mitogenomes of both species encode a typical metazoan complement of 37 genes, which are all positioned on the major strand, but the gene order is distinct and unique among Ecdysozoa or animals as a whole. We predict four types of start codons for protein-coding genes in E. svetlanae and five in P. kielensis with a consensus DTD in single letter code. The mitochondrial genomes of E. svetlanae and P. kielensis encode duplicated methionine tRNA genes that display compensatory nucleotide substitutions. Two distant species of Kinorhyncha demonstrate similar patterns of gene arrangements in their mitogenomes. Both genomes have duplicated methionine tRNA genes; the duplication predates the divergence of two species. The kinorhynchs share a few features pertaining to gene order that align them with Priapulida. Gene order analysis reveals that gene arrangement specific of Priapulida may be ancestral for Scalidophora, Ecdysozoa, and even Protostomia.
Mitochondrial Genomes of Kinorhyncha: trnM Duplication and New Gene Orders within Animals.
Directory of Open Access Journals (Sweden)
Olga V Popova
Full Text Available Many features of mitochondrial genomes of animals, such as patterns of gene arrangement, nucleotide content and substitution rate variation are extensively used in evolutionary and phylogenetic studies. Nearly 6,000 mitochondrial genomes of animals have already been sequenced, covering the majority of animal phyla. One of the groups that escaped mitogenome sequencing is phylum Kinorhyncha-an isolated taxon of microscopic worm-like ecdysozoans. The kinorhynchs are thought to be one of the early-branching lineages of Ecdysozoa, and their mitochondrial genomes may be important for resolving evolutionary relations between major animal taxa. Here we present the results of sequencing and analysis of mitochondrial genomes from two members of Kinorhyncha, Echinoderes svetlanae (Cyclorhagida and Pycnophyes kielensis (Allomalorhagida. Their mitochondrial genomes are circular molecules approximately 15 Kbp in size. The kinorhynch mitochondrial gene sequences are highly divergent, which precludes accurate phylogenetic inference. The mitogenomes of both species encode a typical metazoan complement of 37 genes, which are all positioned on the major strand, but the gene order is distinct and unique among Ecdysozoa or animals as a whole. We predict four types of start codons for protein-coding genes in E. svetlanae and five in P. kielensis with a consensus DTD in single letter code. The mitochondrial genomes of E. svetlanae and P. kielensis encode duplicated methionine tRNA genes that display compensatory nucleotide substitutions. Two distant species of Kinorhyncha demonstrate similar patterns of gene arrangements in their mitogenomes. Both genomes have duplicated methionine tRNA genes; the duplication predates the divergence of two species. The kinorhynchs share a few features pertaining to gene order that align them with Priapulida. Gene order analysis reveals that gene arrangement specific of Priapulida may be ancestral for Scalidophora, Ecdysozoa, and even
Cao, Yunpeng; Han, Yahui; Meng, Dandan; Abdullah, Muhammad; Li, Dahui; Jin, Qing; Lin, Yi; Cai, Yongping
2018-04-20
PHD-finger proteins, which belongs to the type of zinc finger family, and that play an important role in the regulation of both transcription and the chromatin state in eukaryotes. Currently, PHD-finger proteins have been well studied in animals, while few studies have been carried out on their function in plants. In the present study, 129 non-redundant PHD-finger genes were identified from 5 Rosaceae species (pear, apple, strawberry, mei, and peach); among them, 31 genes were identified in pear. Subsequently, we carried out a bioinformatics analysis of the PHD-finger genes. Thirty-one PbPHD genes were divided into 7 subfamilies based on the phylogenetic analysis, which are consistent with the intron-exon and conserved motif analyses. In addition, we identified five segmental duplication events, implying that the segmental duplications might be a crucial role in the expansion of the PHD-finger gene family in pear. The microsynteny analysis of five Rosaceae species showed that there were independent duplication events in addition to the genome-wide duplication of the pear genome. Subsequently, ten expressed PHD-finger genes of pear fruit were identified using qRT-PCR, and one of these genes, PbPHD10, was identified as an important candidate gene for the regulation of lignin synthesis. Our research provides useful information for the further analysis of the function of PHD-finger gene family in pear.
The nitrate transporter (NRT gene family in poplar.
Directory of Open Access Journals (Sweden)
Hua Bai
Full Text Available Nitrate is an important nutrient required for plant growth. It also acts as a signal regulating plant development. Nitrate is actively taken up and transported by nitrate transporters (NRT, which form a large family with many members and distinct functions. In contrast to Arabidopsis and rice there is little information about the NRT family in woody plants such as Populus. In this study, a comprehensive analysis of the Populus NRT family was performed. Sixty-eight PtNRT1/PTR, 6 PtNRT2, and 5 PtNRT3 genes were identified in the P. trichocarpa genome. Phylogenetic analysis confirmed that the genes of the NRT family are divided into three clades: NRT1/PTR with four subclades, NRT2, and NRT3. Topological analysis indicated that all members of PtNRT1/PTR and PtNRT2 have 8 to 12 trans-membrane domains, whereas the PtNRT3 proteins have no or up to two trans-membrane domains. Four PtNRT3 members were predicted as secreted proteins. Microarray analyses revealed tissue-specific expression patterns of PtNRT genes with distinct clusters of NRTs for roots, for the elongation zone of the apical stem segment and the developing xylem and a further cluster for leaves, bark and wood. A comparison of different poplar species (P. trichocarpa, P. tremula, P. euphratica, P. fremontii x P. angustifolia, and P. x canescens showed that the tissue-specific patterns of the NRT genes varied to some extent with species. Bioinformatic analysis of putative cis-regulatory elements in the promoter regions of PtNRT family retrieved motifs suggesting the regulation of the NRT genes by N metabolism, by energy and carbon metabolism, and by phytohormones and stress. Multivariate analysis suggested that the combination and abundance of motifs in distinct promoters may lead to tissue-specificity. Our genome wide analysis of the PtNRT genes provides a valuable basis for functional analysis towards understanding the role of nitrate transporters for tree growth.
Directory of Open Access Journals (Sweden)
Parker Nadeene
2004-01-01
Full Text Available Abstract Background The human 6–16 and ISG12 genes are transcriptionally upregulated in a variety of cell types in response to type I interferon (IFN. The predicted products of these genes are small (12.9 and 11.5 kDa respectively, hydrophobic proteins that share 36% overall amino acid identity. Gene disruption and over-expression studies have so far failed to reveal any biochemical or cellular roles for these proteins. Results We have used in silico analyses to identify a novel family of genes (the ISG12 gene family related to both the human 6–16 and ISG12 genes. Each ISG12 family member codes for a small hydrophobic protein containing a conserved ~80 amino-acid motif (the ISG12 motif. So far we have detected 46 family members in 25 organisms, ranging from unicellular eukaryotes to humans. Humans have four ISG12 genes: the 6–16 gene at chromosome 1p35 and three genes (ISG12(a, ISG12(b and ISG12(c clustered at chromosome 14q32. Mice have three family members (ISG12(a, ISG12(b1 and ISG12(b2 clustered at chromosome 12F1 (syntenic with human chromosome 14q32. There does not appear to be a murine 6–16 gene. On the basis of phylogenetic analyses, genomic organisation and intron-alignments we suggest that this family has arisen through divergent inter- and intra-chromosomal gene duplication events. The transcripts from human and mouse genes are detectable, all but two (human ISG12(b and ISG12(c being upregulated in response to type I IFN in the cell lines tested. Conclusions Members of the eukaryotic ISG12 gene family encode a small hydrophobic protein with at least one copy of a newly defined motif of ~80 amino-acids (the ISG12 motif. In higher eukaryotes, many of the genes have acquired a responsiveness to type I IFN during evolution suggesting that a role in resisting cellular or environmental stress may be a unifying property of all family members. Analysis of gene-function in higher eukaryotes is complicated by the possibility of
Improved animal models for testing gene therapy for atherosclerosis.
Du, Liang; Zhang, Jingwan; De Meyer, Guido R Y; Flynn, Rowan; Dichek, David A
2014-04-01
Gene therapy delivered to the blood vessel wall could augment current therapies for atherosclerosis, including systemic drug therapy and stenting. However, identification of clinically useful vectors and effective therapeutic transgenes remains at the preclinical stage. Identification of effective vectors and transgenes would be accelerated by availability of animal models that allow practical and expeditious testing of vessel-wall-directed gene therapy. Such models would include humanlike lesions that develop rapidly in vessels that are amenable to efficient gene delivery. Moreover, because human atherosclerosis develops in normal vessels, gene therapy that prevents atherosclerosis is most logically tested in relatively normal arteries. Similarly, gene therapy that causes atherosclerosis regression requires gene delivery to an existing lesion. Here we report development of three new rabbit models for testing vessel-wall-directed gene therapy that either prevents or reverses atherosclerosis. Carotid artery intimal lesions in these new models develop within 2-7 months after initiation of a high-fat diet and are 20-80 times larger than lesions in a model we described previously. Individual models allow generation of lesions that are relatively rich in either macrophages or smooth muscle cells, permitting testing of gene therapy strategies targeted at either cell type. Two of the models include gene delivery to essentially normal arteries and will be useful for identifying strategies that prevent lesion development. The third model generates lesions rapidly in vector-naïve animals and can be used for testing gene therapy that promotes lesion regression. These models are optimized for testing helper-dependent adenovirus (HDAd)-mediated gene therapy; however, they could be easily adapted for testing of other vectors or of different types of molecular therapies, delivered directly to the blood vessel wall. Our data also supports the promise of HDAd to deliver long
Gene therapy in animal models of autosomal dominant retinitis pigmentosa
Rossmiller, Brian; Mao, Haoyu
2012-01-01
Gene therapy for dominantly inherited genetic disease is more difficult than gene-based therapy for recessive disorders, which can be treated with gene supplementation. Treatment of dominant disease may require gene supplementation partnered with suppression of the expression of the mutant gene either at the DNA level, by gene repair, or at the RNA level by RNA interference or transcriptional repression. In this review, we examine some of the gene delivery approaches used to treat animal models of autosomal dominant retinitis pigmentosa, focusing on those models associated with mutations in the gene for rhodopsin. We conclude that combinatorial approaches have the greatest promise for success. PMID:23077406
Directory of Open Access Journals (Sweden)
Nishida Mutsumi
2007-11-01
Full Text Available Abstract Background The threespine stickleback (Gasterosteus aculeatus has a characteristic reproductive mode; mature males build nests using a secreted glue-like protein called spiggin. Although recent studies reported multiple occurrences of genes that encode this glue-like protein spiggin in threespine and ninespine sticklebacks, it is still unclear how many genes compose the spiggin multi-gene family. Results Genome sequence analysis of threespine stickleback showed that there are at least five spiggin genes and two pseudogenes, whereas a single spiggin homolog occurs in the genomes of other fishes. Comparative genome sequence analysis demonstrated that Muc19, a single-copy mucous gene in human and mouse, is an ortholog of spiggin. Phylogenetic and molecular evolutionary analyses of these sequences suggested that an ancestral spiggin gene originated from a member of the mucin gene family as a single gene in the common ancestor of teleosts, and gene duplications of spiggin have occurred in the stickleback lineage. There was inter-population variation in the copy number of spiggin genes and positive selection on some codons, indicating that additional gene duplication/deletion events and adaptive evolution at some amino acid sites may have occurred in each stickleback population. Conclusion A number of spiggin genes exist in the threespine stickleback genome. Our results provide insight into the origin and dynamic evolutionary process of the spiggin multi-gene family in the threespine stickleback lineage. The dramatic evolution of genes for mucous substrates may have contributed to the generation of distinct characteristics such as "bio-glue" in vertebrates.
Evolution of the YABBY gene family in seed plants.
Finet, Cédric; Floyd, Sandra K; Conway, Stephanie J; Zhong, Bojian; Scutt, Charles P; Bowman, John L
2016-01-01
Members of the YABBY gene family of transcription factors in angiosperms have been shown to be involved in the initiation of outgrowth of the lamina, the maintenance of polarity, and establishment of the leaf margin. Although most of the dorsal-ventral polarity genes in seed plants have homologs in non-spermatophyte lineages, the presence of YABBY genes is restricted to seed plants. To gain insight into the origin and diversification of this gene family, we reconstructed the evolutionary history of YABBY gene lineages in seed plants. Our findings suggest that either one or two YABBY genes were present in the last common ancestor of extant seed plants. We also examined the expression of YABBY genes in the gymnosperms Ephedra distachya (Gnetales), Ginkgo biloba (Ginkgoales), and Pseudotsuga menziesii (Coniferales). Our data indicate that some YABBY genes are expressed in a polar (abaxial) manner in leaves and female cones in gymnosperms. We propose that YABBY genes already acted as polarity genes in the last common ancestor of extant seed plants. © 2016 Wiley Periodicals, Inc.
Identification of a novel Gig2 gene family specific to non-amniote vertebrates.
Directory of Open Access Journals (Sweden)
Yi-Bing Zhang
Full Text Available Gig2 (grass carp reovirus (GCRV-induced gene 2 is first identified as a novel fish interferon (IFN-stimulated gene (ISG. Overexpression of a zebrafish Gig2 gene can protect cultured fish cells from virus infection. In the present study, we identify a novel gene family that is comprised of genes homologous to the previously characterized Gig2. EST/GSS search and in silico cloning identify 190 Gig2 homologous genes in 51 vertebrate species ranged from lampreys to amphibians. Further large-scale search of vertebrate and invertebrate genome databases indicate that Gig2 gene family is specific to non-amniotes including lampreys, sharks/rays, ray-finned fishes and amphibians. Phylogenetic analysis and synteny analysis reveal lineage-specific expansion of Gig2 gene family and also provide valuable evidence for the fish-specific genome duplication (FSGD hypothesis. Although Gig2 family proteins exhibit no significant sequence similarity to any known proteins, a typical Gig2 protein appears to consist of two conserved parts: an N-terminus that bears very low homology to the catalytic domains of poly(ADP-ribose polymerases (PARPs, and a novel C-terminal domain that is unique to this gene family. Expression profiling of zebrafish Gig2 family genes shows that some duplicate pairs have diverged in function via acquisition of novel spatial and/or temporal expression under stresses. The specificity of this gene family to non-amniotes might contribute to a large extent to distinct physiology in non-amniote vertebrates.
Enamelin/ameloblastin gene polymorphisms in autosomal amelogenesis imperfecta among Syrian families.
Dashash, Mayssoon; Bazrafshani, Mohamed Riza; Poulton, Kay; Jaber, Saaed; Naeem, Emad; Blinkhorn, Anthony Stevenson
2011-02-01
This study was undertaken to investigate whether a single G deletion within a series of seven G residues (codon 196) at the exon 9-intron 9 boundary of the enamelin gene ENAM and a tri-nucleotide deletion at codon 180 in exon 7 (GGA vs deletion) of ameloblastin gene AMBN could have a role in autosomal amelogenesis imperfecta among affected Syrian families. A new technique - size-dependent, deletion screening - was developed to detect nucleotide deletion in ENAM and AMBN genes. Twelve Syrian families with autosomal-dominant or -recessive amelogenesis imperfecta were included. A homozygous/heterozygous mutation in the ENAM gene (152/152, 152/153) was identified in affected members of three families with autosomal-dominant amelogenesis imperfecta and one family with autosomal-recessive amelogenesis imperfecta. A heterozygous mutation (222/225) in the AMBN gene was identified. However, no disease causing mutations was found. The present findings provide useful information for the implication of ENAM gene polymorphism in autosomal-dominant/-recessive amelogenesis imperfecta. Further investigations are required to identify other genes responsible for the various clinical phenotypes. © 2010 Blackwell Publishing Asia Pty Ltd.
Directory of Open Access Journals (Sweden)
Huang Yong
2009-11-01
Full Text Available Abstract Background Gene and genome duplication is the principle creative force in evolution. Recently, protein subcellular relocalization, or neolocalization was proposed as one of the mechanisms responsible for the retention of duplicated genes. This hypothesis received support from the analysis of yeast genomes, but has not been tested thoroughly on animal genomes. In order to evaluate the importance of subcellular relocalizations for retention of duplicated genes in animal genomes, we systematically analyzed nuclear encoded mitochondrial proteins in the human genome by reconstructing phylogenies of mitochondrial multigene families. Results The 456 human mitochondrial proteins selected for this study were clustered into 305 gene families including 92 multigene families. Among the multigene families, 59 (64% consisted of both mitochondrial and cytosolic (non-mitochondrial proteins (mt-cy families while the remaining 33 (36% were composed of mitochondrial proteins (mt-mt families. Phylogenetic analyses of mt-cy families revealed three different scenarios of their neolocalization following gene duplication: 1 relocalization from mitochondria to cytosol, 2 from cytosol to mitochondria and 3 multiple subcellular relocalizations. The neolocalizations were most commonly enabled by the gain or loss of N-terminal mitochondrial targeting signals. The majority of detected subcellular relocalization events occurred early in animal evolution, preceding the evolution of tetrapods. Mt-mt protein families showed a somewhat different pattern, where gene duplication occurred more evenly in time. However, for both types of protein families, most duplication events appear to roughly coincide with two rounds of genome duplications early in vertebrate evolution. Finally, we evaluated the effects of inaccurate and incomplete annotation of mitochondrial proteins and found that our conclusion of the importance of subcellular relocalization after gene duplication on
Synaptotagmin gene content of the sequenced genomes
Directory of Open Access Journals (Sweden)
Craxton Molly
2004-07-01
Full Text Available Abstract Background Synaptotagmins exist as a large gene family in mammals. There is much interest in the function of certain family members which act crucially in the regulated synaptic vesicle exocytosis required for efficient neurotransmission. Knowledge of the functions of other family members is relatively poor and the presence of Synaptotagmin genes in plants indicates a role for the family as a whole which is wider than neurotransmission. Identification of the Synaptotagmin genes within completely sequenced genomes can provide the entire Synaptotagmin gene complement of each sequenced organism. Defining the detailed structures of all the Synaptotagmin genes and their encoded products can provide a useful resource for functional studies and a deeper understanding of the evolution of the gene family. The current rapid increase in the number of sequenced genomes from different branches of the tree of life, together with the public deposition of evolutionarily diverse transcript sequences make such studies worthwhile. Results I have compiled a detailed list of the Synaptotagmin genes of Caenorhabditis, Anopheles, Drosophila, Ciona, Danio, Fugu, Mus, Homo, Arabidopsis and Oryza by examining genomic and transcript sequences from public sequence databases together with some transcript sequences obtained by cDNA library screening and RT-PCR. I have compared all of the genes and investigated the relationship between plant Synaptotagmins and their non-Synaptotagmin counterparts. Conclusions I have identified and compared 98 Synaptotagmin genes from 10 sequenced genomes. Detailed comparison of transcript sequences reveals abundant and complex variation in Synaptotagmin gene expression and indicates the presence of Synaptotagmin genes in all animals and land plants. Amino acid sequence comparisons indicate patterns of conservation and diversity in function. Phylogenetic analysis shows the origin of Synaptotagmins in multicellular eukaryotes and their
Wuest, Samuel E; Vijverberg, Kitty; Schmidt, Anja; Weiss, Manuel; Gheyselinck, Jacqueline; Lohr, Miriam; Wellmer, Frank; Rahnenführer, Jörg; von Mering, Christian; Grossniklaus, Ueli
2010-03-23
The development of multicellular organisms is controlled by differential gene expression whereby cells adopt distinct fates. A spatially resolved view of gene expression allows the elucidation of transcriptional networks that are linked to cellular identity and function. The haploid female gametophyte of flowering plants is a highly reduced organism: at maturity, it often consists of as few as three cell types derived from a common precursor [1, 2]. However, because of its inaccessibility and small size, we know little about the molecular basis of cell specification and differentiation in the female gametophyte. Here we report expression profiles of all cell types in the mature Arabidopsis female gametophyte. Differentially expressed posttranscriptional regulatory modules and metabolic pathways characterize the distinct cell types. Several transcription factor families are overrepresented in the female gametophyte in comparison to other plant tissues, e.g., type I MADS domain, RWP-RK, and reproductive meristem transcription factors. PAZ/Piwi-domain encoding genes are upregulated in the egg, indicating a role of epigenetic regulation through small RNA pathways-a feature paralleled in the germline of animals [3]. A comparison of human and Arabidopsis egg cells for enrichment of functional groups identified several similarities that may represent a consequence of coevolution or ancestral gametic features. 2010 Elsevier Ltd. All rights reserved.
Characterization of the avian Trojan gene family reveals contrasting evolutionary constraints.
Petrov, Petar; Syrjänen, Riikka; Smith, Jacqueline; Gutowska, Maria Weronika; Uchida, Tatsuya; Vainio, Olli; Burt, David W
2015-01-01
"Trojan" is a leukocyte-specific, cell surface protein originally identified in the chicken. Its molecular function has been hypothesized to be related to anti-apoptosis and the proliferation of immune cells. The Trojan gene has been localized onto the Z sex chromosome. The adjacent two genes also show significant homology to Trojan, suggesting the existence of a novel gene/protein family. Here, we characterize this Trojan family, identify homologues in other species and predict evolutionary constraints on these genes. The two Trojan-related proteins in chicken were predicted as a receptor-type tyrosine phosphatase and a transmembrane protein, bearing a cytoplasmic immuno-receptor tyrosine-based activation motif. We identified the Trojan gene family in ten other bird species and found related genes in three reptiles and a fish species. The phylogenetic analysis of the homologues revealed a gradual diversification among the family members. Evolutionary analyzes of the avian genes predicted that the extracellular regions of the proteins have been subjected to positive selection. Such selection was possibly a response to evolving interacting partners or to pathogen challenges. We also observed an almost complete lack of intracellular positively selected sites, suggesting a conserved signaling mechanism of the molecules. Therefore, the contrasting patterns of selection likely correlate with the interaction and signaling potential of the molecules.
Associations among Cruelty to Animals, Family Conflict, and Psychopathic Traits in Childhood
Dadds, Mark R.; Whiting, Clare; Hawes, David J.
2006-01-01
Previous research has produced mixed findings on the role of child and family factors in the genesis of childhood cruelty. The authors examined the relationships of cruelty to animals to a range of child and family factors. First, the authors test the idea that cruelty is a callous aggression that will be more strongly associated with psychopathic…
Prevalence of variations in melanoma susceptibility genes among Slovenian melanoma families
Directory of Open Access Journals (Sweden)
Besic Nikola
2008-09-01
Full Text Available Abstract Background Two high-risk genes have been implicated in the development of CM (cutaneous melanoma. Germline mutations of the CDKN2A gene are found in CDK4 gene reported to date. Beside those high penetrance genes, certain allelic variants of the MC1R gene modify the risk of developing the disease. The aims of our study were: to determine the prevalence of germline CDKN2A mutations and variants in members of families with familial CM and in patients with multiple primary CM; to search for possible CDK4 mutations, and to determine the frequency of variations in the MC1R gene. Methods From January 2001 until January 2007, 64 individuals were included in the study. The group included 28 patients and 7 healthy relatives belonging to 25 families, 26 patients with multiple primary tumors and 3 children with CM. Additionally 54 healthy individuals were included as a control group. Mutations and variants of the melanoma susceptibility genes were identified by direct sequencing. Results Seven families with CDKN2A mutations were discovered (7/25 or 28.0%. The L94Q mutation found in one family had not been previously reported in other populations. The D84N variant, with possible biological impact, was discovered in the case of patient without family history but with multiple primary CM. Only one mutation carrier was found in the control group. Further analysis revealed that c.540C>T heterozygous carriers were more common in the group of CM patients and their healthy relatives (11/64 vs. 2/54. One p14ARF variant was discovered in the control group and no mutations of the CDK4 gene were found. Most frequently found variants of the MC1R gene were T314T, V60L, V92M, R151C, R160W and R163Q with frequencies slightly higher in the group of patients and their relatives than in the group of controls, but the difference was statistically insignificant. Conclusion The present study has shown high prevalence of p16INK4A mutations in Slovenian population of
Analysis of factor VIII gene inversions in 164 unrelated hemophilia A families
Energy Technology Data Exchange (ETDEWEB)
Vnencak-Jones, L.; Phillips, J.A. III; Janco, R.L. [Vanderbilt Univ. School of Medicine, Nashville, TN (United States)] [and others
1994-09-01
Hemophilia A is an X-linked recessive disease with variable phenotype and both heterogeneous and wide spread mutations in the factor VIII (F8) gene. As a result, diagnostic carrier or prenatal testing often relies upon laborious DNA linkage analysis. Recently, inversion mutations resulting from an intrachromosomal recombination between DNA sequences in one of two A genes {approximately}500 kb upstream from the F8 gene and a homologous A gene in intron 22 of the F8 gene were identified and found in 45% of severe hemophiliacs. We have analyzed banked DNA collected since 1986 from affected males or obligate carrier females representing 164 unrelated hemophilia A families. The disease was sporadic in 37%, familial in 54% and in 10% of families incomplete information was given. A unique deletion was identified in 1/164, a normal pattern was observed in 110/164 (67%), and 53/164 (32%) families had inversion mutations with 43/53 (81%) involving the distal A gene (R3 pattern) and 10/53 (19%) involving the proximal A gene (R2 pattern). While 19% of all rearrangements were R2, in 35 families with severe disease (< 1% VIII:C activity) all 16 rearrangements seen were R3. In 18 families with the R3 pattern and known activities, 16 (89%) had levels < 1%, with the remaining 2 families having {le} 2.4% activity. Further, 18 referrals specifically noted the production of inhibitors and 8/18 (45%) had the R3 pattern. Our findings demonstrate that the R3 inversion mutation patterns is (1) only seen with VIII:C activity levels of {le} 2.4%, (2) seen in 46% of families with severe hemophilia, (3) seen in 45% of hemophiliacs known to have inhibitors, (4) not correlated with sporadic or familial disease and (5) not in disequilibrium with the Bcl I or Taq I intron 18 or ST14 polymorphisms. Finally, in families positive for an inversion mutation, direct testing offers a highly accurate and less expensive alternative to DNA linkage analysis.
The human protein disulfide isomerase gene family
Directory of Open Access Journals (Sweden)
Galligan James J
2012-07-01
Full Text Available Abstract Enzyme-mediated disulfide bond formation is a highly conserved process affecting over one-third of all eukaryotic proteins. The enzymes primarily responsible for facilitating thiol-disulfide exchange are members of an expanding family of proteins known as protein disulfide isomerases (PDIs. These proteins are part of a larger superfamily of proteins known as the thioredoxin protein family (TRX. As members of the PDI family of proteins, all proteins contain a TRX-like structural domain and are predominantly expressed in the endoplasmic reticulum. Subcellular localization and the presence of a TRX domain, however, comprise the short list of distinguishing features required for gene family classification. To date, the PDI gene family contains 21 members, varying in domain composition, molecular weight, tissue expression, and cellular processing. Given their vital role in protein-folding, loss of PDI activity has been associated with the pathogenesis of numerous disease states, most commonly related to the unfolded protein response (UPR. Over the past decade, UPR has become a very attractive therapeutic target for multiple pathologies including Alzheimer disease, Parkinson disease, alcoholic and non-alcoholic liver disease, and type-2 diabetes. Understanding the mechanisms of protein-folding, specifically thiol-disulfide exchange, may lead to development of a novel class of therapeutics that would help alleviate a wide range of diseases by targeting the UPR.
DEFF Research Database (Denmark)
Hansen, Martin A; Nielsen, John E; Retelska, Dorota
2008-01-01
, sequences corresponding to the shared promoter region of the CYPT family were identified at 39 loci. Most loci were located immediately upstream of genes belonging to the VCX/Y, SPANX, or CSAG gene families. Sequence comparison of the loci revealed a conserved CYPT promoter-like (CPL) element featuring TATA...... cell types. The genomic regions harboring the gene families were rich in direct and inverted segmental duplications (SD), which may facilitate gene conversion and rapid evolution. The conserved CPL and the common expression profiles suggest that the human VCX/Y, SPANX, and CSAG2 gene families together......Many testis-specific genes from the sex chromosomes are subject to rapid evolution, which can make it difficult to identify murine genes in the human genome. The murine CYPT gene family includes 15 members, but orthologs were undetectable in the human genome. However, using refined homology search...
Dichotomy in the NRT gene families of dicots and grass species.
Directory of Open Access Journals (Sweden)
Darren Plett
Full Text Available A large proportion of the nitrate (NO(3(- acquired by plants from soil is actively transported via members of the NRT families of NO(3(- transporters. In Arabidopsis, the NRT1 family has eight functionally characterised members and predominantly comprises low-affinity transporters; the NRT2 family contains seven members which appear to be high-affinity transporters; and there are two NRT3 (NAR2 family members which are known to participate in high-affinity transport. A modified reciprocal best hit (RBH approach was used to identify putative orthologues of the Arabidopsis NRT genes in the four fully sequenced grass genomes (maize, rice, sorghum, Brachypodium. We also included the poplar genome in our analysis to establish whether differences between Arabidopsis and the grasses may be generally applicable to monocots and dicots. Our analysis reveals fundamental differences between Arabidopsis and the grass species in the gene number and family structure of all three families of NRT transporters. All grass species possessed additional NRT1.1 orthologues and appear to lack NRT1.6/NRT1.7 orthologues. There is significant separation in the NRT2 phylogenetic tree between NRT2 genes from dicots and grass species. This indicates that determination of function of NRT2 genes in grass species will not be possible in cereals based simply on sequence homology to functionally characterised Arabidopsis NRT2 genes and that proper functional analysis will be required. Arabidopsis has a unique NRT3.2 gene which may be a fusion of the NRT3.1 and NRT3.2 genes present in all other species examined here. This work provides a framework for future analysis of NO(3(- transporters and NO(3(- transport in grass crop species.
Saltatory Evolution of the Ectodermal Neural Cortex Gene Family at the Vertebrate Origin
Feiner, Nathalie; Murakami, Yasunori; Breithut, Lisa; Mazan, Sylvie; Meyer, Axel; Kuraku, Shigehiro
2013-01-01
The ectodermal neural cortex (ENC) gene family, whose members are implicated in neurogenesis, is part of the kelch repeat superfamily. To date, ENC genes have been identified only in osteichthyans, although other kelch repeat-containing genes are prevalent throughout bilaterians. The lack of elaborate molecular phylogenetic analysis with exhaustive taxon sampling has obscured the possible link of the establishment of this gene family with vertebrate novelties. In this study, we identified ENC homologs in diverse vertebrates by means of database mining and polymerase chain reaction screens. Our analysis revealed that the ENC3 ortholog was lost in the basal eutherian lineage through single-gene deletion and that the triplication between ENC1, -2, and -3 occurred early in vertebrate evolution. Including our original data on the catshark and the zebrafish, our comparison revealed high conservation of the pleiotropic expression pattern of ENC1 and shuffling of expression domains between ENC1, -2, and -3. Compared with many other gene families including developmental key regulators, the ENC gene family is unique in that conventional molecular phylogenetic inference could identify no obvious invertebrate ortholog. This suggests a composite nature of the vertebrate-specific gene repertoire, consisting not only of de novo genes introduced at the vertebrate origin but also of long-standing genes with no apparent invertebrate orthologs. Some of the latter, including the ENC gene family, may be too rapidly evolving to provide sufficient phylogenetic signals marking orthology to their invertebrate counterparts. Such gene families that experienced saltatory evolution likely remain to be explored and might also have contributed to phenotypic evolution of vertebrates. PMID:23843192
Undefined familial colorectal cancer and the role of pleiotropism in cancer susceptibility genes.
Dobbins, Sara E; Broderick, Peter; Chubb, Daniel; Kinnersley, Ben; Sherborne, Amy L; Houlston, Richard S
2016-10-01
Although family history is a major risk factor for colorectal cancer (CRC) a genetic diagnosis cannot be obtained in over 50 % of familial cases when screened for known CRC cancer susceptibility genes. The genetics of undefined-familial CRC is complex and recent studies have implied additional clinically actionable mutations for CRC in susceptibility genes for other cancers. To clarify the contribution of non-CRC susceptibility genes to undefined-familial CRC we conducted a mutational screen of 114 cancer susceptibility genes in 847 patients with early-onset undefined-familial CRC and 1609 controls by analysing high-coverage exome sequencing data. We implemented American College of Medical Genetics and Genomics standards and guidelines for assigning pathogenicity to variants. Globally across all 114 cancer susceptibility genes no statistically significant enrichment of likely pathogenic variants was shown (6.7 % cases 57/847, 5.3 % controls 85/1609; P = 0.15). Moreover there was no significant enrichment of mutations in genes such as TP53 or BRCA2 which have been proposed for clinical testing in CRC. In conclusion, while we identified genes that may be considered interesting candidates as determinants of CRC risk warranting further research, there is currently scant evidence to support a role for genes other than those responsible for established CRC syndromes in the clinical management of familial CRC.
Aux/IAA Gene Family in Plants: Molecular Structure, Regulation, and Function
Directory of Open Access Journals (Sweden)
Jie Luo
2018-01-01
Full Text Available Auxin plays a crucial role in the diverse cellular and developmental responses of plants across their lifespan. Plants can quickly sense and respond to changes in auxin levels, and these responses involve several major classes of auxin-responsive genes, including the Auxin/Indole-3-Acetic Acid (Aux/IAA family, the auxin response factor (ARF family, small auxin upregulated RNA (SAUR, and the auxin-responsive Gretchen Hagen3 (GH3 family. Aux/IAA proteins are short-lived nuclear proteins comprising several highly conserved domains that are encoded by the auxin early response gene family. These proteins have specific domains that interact with ARFs and inhibit the transcription of genes activated by ARFs. Molecular studies have revealed that Aux/IAA family members can form diverse dimers with ARFs to regulate genes in various ways. Functional analyses of Aux/IAA family members have indicated that they have various roles in plant development, such as root development, shoot growth, and fruit ripening. In this review, recently discovered details regarding the molecular characteristics, regulation, and protein–protein interactions of the Aux/IAA proteins are discussed. These details provide new insights into the molecular basis of the Aux/IAA protein functions in plant developmental processes.
Lawton, Jennifer
2012-03-29
Background: The pir genes comprise the largest multi-gene family in Plasmodium, with members found in P. vivax, P. knowlesi and the rodent malaria species. Despite comprising up to 5% of the genome, little is known about the functions of the proteins encoded by pir genes. P. chabaudi causes chronic infection in mice, which may be due to antigenic variation. In this model, pir genes are called cirs and may be involved in this mechanism, allowing evasion of host immune responses. In order to fully understand the role(s) of CIR proteins during P. chabaudi infection, a detailed characterization of the cir gene family was required.Results: The cir repertoire was annotated and a detailed bioinformatic characterization of the encoded CIR proteins was performed. Two major sub-families were identified, which have been named A and B. Members of each sub-family displayed different amino acid motifs, and were thus predicted to have undergone functional divergence. In addition, the expression of the entire cir repertoire was analyzed via RNA sequencing and microarray. Up to 40% of the cir gene repertoire was expressed in the parasite population during infection, and dominant cir transcripts could be identified. In addition, some differences were observed in the pattern of expression between the cir subgroups at the peak of P. chabaudi infection. Finally, specific cir genes were expressed at different time points during asexual blood stages.Conclusions: In conclusion, the large number of cir genes and their expression throughout the intraerythrocytic cycle of development indicates that CIR proteins are likely to be important for parasite survival. In particular, the detection of dominant cir transcripts at the peak of P. chabaudi infection supports the idea that CIR proteins are expressed, and could perform important functions in the biology of this parasite. Further application of the methodologies described here may allow the elucidation of CIR sub-family A and B protein
Directory of Open Access Journals (Sweden)
Lawton Jennifer
2012-03-01
Full Text Available Abstract Background The pir genes comprise the largest multi-gene family in Plasmodium, with members found in P. vivax, P. knowlesi and the rodent malaria species. Despite comprising up to 5% of the genome, little is known about the functions of the proteins encoded by pir genes. P. chabaudi causes chronic infection in mice, which may be due to antigenic variation. In this model, pir genes are called cirs and may be involved in this mechanism, allowing evasion of host immune responses. In order to fully understand the role(s of CIR proteins during P. chabaudi infection, a detailed characterization of the cir gene family was required. Results The cir repertoire was annotated and a detailed bioinformatic characterization of the encoded CIR proteins was performed. Two major sub-families were identified, which have been named A and B. Members of each sub-family displayed different amino acid motifs, and were thus predicted to have undergone functional divergence. In addition, the expression of the entire cir repertoire was analyzed via RNA sequencing and microarray. Up to 40% of the cir gene repertoire was expressed in the parasite population during infection, and dominant cir transcripts could be identified. In addition, some differences were observed in the pattern of expression between the cir subgroups at the peak of P. chabaudi infection. Finally, specific cir genes were expressed at different time points during asexual blood stages. Conclusions In conclusion, the large number of cir genes and their expression throughout the intraerythrocytic cycle of development indicates that CIR proteins are likely to be important for parasite survival. In particular, the detection of dominant cir transcripts at the peak of P. chabaudi infection supports the idea that CIR proteins are expressed, and could perform important functions in the biology of this parasite. Further application of the methodologies described here may allow the elucidation of CIR sub-family
Lawton, Jennifer; Brugat, Thibaut; Yan, Yam Xue; Reid, Adam James; Bö hme, Ulrike; Otto, Thomas Dan; Pain, Arnab; Jackson, Andrew; Berriman, Matthew; Cunningham, Deirdre; Preiser, Peter; Langhorne, Jean
2012-01-01
Background: The pir genes comprise the largest multi-gene family in Plasmodium, with members found in P. vivax, P. knowlesi and the rodent malaria species. Despite comprising up to 5% of the genome, little is known about the functions of the proteins encoded by pir genes. P. chabaudi causes chronic infection in mice, which may be due to antigenic variation. In this model, pir genes are called cirs and may be involved in this mechanism, allowing evasion of host immune responses. In order to fully understand the role(s) of CIR proteins during P. chabaudi infection, a detailed characterization of the cir gene family was required.Results: The cir repertoire was annotated and a detailed bioinformatic characterization of the encoded CIR proteins was performed. Two major sub-families were identified, which have been named A and B. Members of each sub-family displayed different amino acid motifs, and were thus predicted to have undergone functional divergence. In addition, the expression of the entire cir repertoire was analyzed via RNA sequencing and microarray. Up to 40% of the cir gene repertoire was expressed in the parasite population during infection, and dominant cir transcripts could be identified. In addition, some differences were observed in the pattern of expression between the cir subgroups at the peak of P. chabaudi infection. Finally, specific cir genes were expressed at different time points during asexual blood stages.Conclusions: In conclusion, the large number of cir genes and their expression throughout the intraerythrocytic cycle of development indicates that CIR proteins are likely to be important for parasite survival. In particular, the detection of dominant cir transcripts at the peak of P. chabaudi infection supports the idea that CIR proteins are expressed, and could perform important functions in the biology of this parasite. Further application of the methodologies described here may allow the elucidation of CIR sub-family A and B protein
Characterization of the avian Trojan gene family reveals contrasting evolutionary constraints.
Directory of Open Access Journals (Sweden)
Petar Petrov
Full Text Available "Trojan" is a leukocyte-specific, cell surface protein originally identified in the chicken. Its molecular function has been hypothesized to be related to anti-apoptosis and the proliferation of immune cells. The Trojan gene has been localized onto the Z sex chromosome. The adjacent two genes also show significant homology to Trojan, suggesting the existence of a novel gene/protein family. Here, we characterize this Trojan family, identify homologues in other species and predict evolutionary constraints on these genes. The two Trojan-related proteins in chicken were predicted as a receptor-type tyrosine phosphatase and a transmembrane protein, bearing a cytoplasmic immuno-receptor tyrosine-based activation motif. We identified the Trojan gene family in ten other bird species and found related genes in three reptiles and a fish species. The phylogenetic analysis of the homologues revealed a gradual diversification among the family members. Evolutionary analyzes of the avian genes predicted that the extracellular regions of the proteins have been subjected to positive selection. Such selection was possibly a response to evolving interacting partners or to pathogen challenges. We also observed an almost complete lack of intracellular positively selected sites, suggesting a conserved signaling mechanism of the molecules. Therefore, the contrasting patterns of selection likely correlate with the interaction and signaling potential of the molecules.
Global Analysis of miRNA Gene Clusters and Gene Families Reveals Dynamic and Coordinated Expression
Directory of Open Access Journals (Sweden)
Li Guo
2014-01-01
Full Text Available To further understand the potential expression relationships of miRNAs in miRNA gene clusters and gene families, a global analysis was performed in 4 paired tumor (breast cancer and adjacent normal tissue samples using deep sequencing datasets. The compositions of miRNA gene clusters and families are not random, and clustered and homologous miRNAs may have close relationships with overlapped miRNA species. Members in the miRNA group always had various expression levels, and even some showed larger expression divergence. Despite the dynamic expression as well as individual difference, these miRNAs always indicated consistent or similar deregulation patterns. The consistent deregulation expression may contribute to dynamic and coordinated interaction between different miRNAs in regulatory network. Further, we found that those clustered or homologous miRNAs that were also identified as sense and antisense miRNAs showed larger expression divergence. miRNA gene clusters and families indicated important biological roles, and the specific distribution and expression further enrich and ensure the flexible and robust regulatory network.
Novel genetic variants in miR-191 gene and familial ovarian cancer
International Nuclear Information System (INIS)
Shen, Jie; DiCioccio, Richard; Odunsi, Kunle; Lele, Shashikant B; Zhao, Hua
2010-01-01
Half of the familial aggregation of ovarian cancer can't be explained by any known risk genes, suggesting the existence of other genetic risk factors. Some of these unknown factors may not be traditional protein encoding genes. MicroRNA (miRNA) plays a critical role in tumorigenesis, but it is still unknown if variants in miRNA genes lead to predisposition to cancer. Considering the fact that miRNA regulates a number of tumor suppressor genes (TSGs) and oncogenes, genetic variations in miRNA genes could affect the levels of expression of TSGs or oncogenes and, thereby, cancer risk. To test this hypothesis in familial ovarian cancer, we screened for genetic variants in thirty selected miRNA genes, which are predicted to regulate key ovarian cancer genes and are reported to be misexpressed in ovarian tumor tissues, in eighty-three patients with familial ovarian cancer. All of the patients are non-carriers of any known BRCA1/2 or mismatch repair (MMR) gene mutations. Seven novel genetic variants were observed in four primary or precursor miRNA genes. Among them, three rare variants were found in the precursor or primary precursor of the miR-191 gene. In functional assays, the one variant located in the precursor of miR-191 resulted in conformational changes in the predicted secondary structures, and consequently altered the expression of mature miR-191. In further analysis, we found that this particular variant exists in five family members who had ovarian cancer. Our findings suggest that there are novel genetic variants in miRNA genes, and those certain genetic variants in miRNA genes can affect the expression of mature miRNAs and, consequently, might alter the regulation of TSGs or oncogenes. Additionally, the variant might be potentially associated with the development of familial ovarian cancer
Molecular analysis of the NDP gene in two families with Norrie disease.
Rivera-Vega, M Refugio; Chiñas-Lopez, Silvet; Vaca, Ana Luisa Jimenez; Arenas-Sordo, M Luz; Kofman-Alfaro, Susana; Messina-Baas, Olga; Cuevas-Covarrubias, Sergio Alberto
2005-04-01
To describe the molecular defects in the Norrie disease protein (NDP) gene in two families with Norrie disease (ND). We analysed two families with ND at molecular level through polymerase chain reaction, DNA sequence analysis and GeneScan. Two molecular defects found in the NDP gene were: a missense mutation (265C > G) within codon 97 that resulted in the interchange of arginine by proline, and a partial deletion in the untranslated 3' region of exon 3 of the NDP gene. Clinical findings were more severe in the family that presented the partial deletion. We also diagnosed the carrier status of one daughter through GeneScan; this method proved to be a useful tool for establishing female carriers of ND. Here we report two novel mutations in the NDP gene in Mexican patients and propose that GeneScan is a viable mean of establishing ND carrier status.
Ancient signals: comparative genomics of plant MAPK and MAPKK gene families
DEFF Research Database (Denmark)
Hamel, Louis-Philippe; Nicole, Marie-Claude; Sritubtim, Somrudee
2006-01-01
MAPK signal transduction modules play crucial roles in regulating many biological processes in plants, and their components are encoded by highly conserved genes. The recent availability of genome sequences for rice and poplar now makes it possible to examine how well the previously described...... Arabidopsis MAPK and MAPKK gene family structures represent the broader evolutionary situation in plants, and analysis of gene expression data for MPK and MKK genes in all three species allows further refinement of those families, based on functionality. The Arabidopsis MAPK nomenclature appears sufficiently...
Evolution of the vertebrate insulin receptor substrate (Irs) gene family.
Al-Salam, Ahmad; Irwin, David M
2017-06-23
Insulin receptor substrate (Irs) proteins are essential for insulin signaling as they allow downstream effectors to dock with, and be activated by, the insulin receptor. A family of four Irs proteins have been identified in mice, however the gene for one of these, IRS3, has been pseudogenized in humans. While it is known that the Irs gene family originated in vertebrates, it is not known when it originated and which members are most closely related to each other. A better understanding of the evolution of Irs genes and proteins should provide insight into the regulation of metabolism by insulin. Multiple genes for Irs proteins were identified in a wide variety of vertebrate species. Phylogenetic and genomic neighborhood analyses indicate that this gene family originated very early in vertebrae evolution. Most Irs genes were duplicated and retained in fish after the fish-specific genome duplication. Irs genes have been lost of various lineages, including Irs3 in primates and birds and Irs1 in most fish. Irs3 and Irs4 experienced an episode of more rapid protein sequence evolution on the ancestral mammalian lineage. Comparisons of the conservation of the proteins sequences among Irs paralogs show that domains involved in binding to the plasma membrane and insulin receptors are most strongly conserved, while divergence has occurred in sequences involved in interacting with downstream effector proteins. The Irs gene family originated very early in vertebrate evolution, likely through genome duplications, and in parallel with duplications of other components of the insulin signaling pathway, including insulin and the insulin receptor. While the N-terminal sequences of these proteins are conserved among the paralogs, changes in the C-terminal sequences likely allowed changes in biological function.
Polymorphism in the interferon-{alpha} gene family
Energy Technology Data Exchange (ETDEWEB)
Golovleva, I.; Lundgren, E.; Beckman, L. [Univ. of Umea (Sweden); Kandefer-Szerszen, M. [Maria Curie-Sklodowska Univ., Lublin (Poland)
1996-09-01
A pronounced genetic polymorphism of the interferon type I gene family has been assumed on the basis of RFLP analysis of the genomic region as well as the large number of sequences published compared to the number of loci. However, IFNA2 is the only locus that has been carefully analyzed concerning gene frequency, and only naturally occurring rare alleles have been found. We have extended the studies on a variation of expressed sequences by studying the IFNA1, IFNA2, IFNA10, IFNA13, IFNA14, and IFNA17 genes. Genomic white-blood-cell DNA from a population sample of blood donors and from a family material were screened by single-nucleotide primer extension (allele-specific primer extension) of PCR fragments. Because of sequence similarities, in some cases {open_quotes}nested{close_quotes} PCR was used, and, when applicable, restriction analysis or control sequencing was performed. All individuals carried the interferon-{alpha} 1 and interferon-{alpha} 13 variants but not the LeIF D variant. At the IFNA2 and IFNA14 loci only one sequence variant was found, while in the IFNA10 and IFNA17 groups two alleles were detected in each group. The IFNA10 and IFNA17 alleles segregated in families and showed a close fit to the Hardy-Weinberg equilibrium. There was a significant linkage disequilibrium between IFNA10 and IFNA17 alleles. The fact that the extent of genetic polymorphism was lower than expected suggests that a majority of the previously described gene sequences represent nonpolymorphic rare mutants that may have arisen in tumor cell lines. 44 refs., 4 figs., 4 tabs.
msh/Msx gene family in neural development.
Ramos, Casto; Robert, Benoît
2005-11-01
The involvement of Msx homeobox genes in skull and tooth formation has received a great deal of attention. Recent studies also indicate a role for the msh/Msx gene family in development of the nervous system. In this article, we discuss the functions of these transcription factors in neural-tissue organogenesis. We will deal mainly with the interactions of the Drosophila muscle segment homeobox (msh) gene with other homeobox genes and the repressive cascade that leads to neuroectoderm patterning; the role of Msx genes in neural-crest induction, focusing especially on the differences between lower and higher vertebrates; their implication in patterning of the vertebrate neural tube, particularly in diencephalon midline formation. Finally, we will examine the distinct activities of Msx1, Msx2 and Msx3 genes during neurogenesis, taking into account their relationships with signalling molecules such as BMP.
Genome-Wide Identification and Analysis of the TIFY Gene Family in Grape
Zhang, Yucheng; Gao, Min; Singer, Stacy D.; Fei, Zhangjun; Wang, Hua; Wang, Xiping
2012-01-01
Background The TIFY gene family constitutes a plant-specific group of genes with a broad range of functions. This family encodes four subfamilies of proteins, including ZML, TIFY, PPD and JASMONATE ZIM-Domain (JAZ) proteins. JAZ proteins are targets of the SCFCOI1 complex, and function as negative regulators in the JA signaling pathway. Recently, it has been reported in both Arabidopsis and rice that TIFY genes, and especially JAZ genes, may be involved in plant defense against insect feeding, wounding, pathogens and abiotic stresses. Nonetheless, knowledge concerning the specific expression patterns and evolutionary history of plant TIFY family members is limited, especially in a woody species such as grape. Methodology/Principal Findings A total of two TIFY, four ZML, two PPD and 11 JAZ genes were identified in the Vitis vinifera genome. Phylogenetic analysis of TIFY protein sequences from grape, Arabidopsis and rice indicated that the grape TIFY proteins are more closely related to those of Arabidopsis than those of rice. Both segmental and tandem duplication events have been major contributors to the expansion of the grape TIFY family. In addition, synteny analysis between grape and Arabidopsis demonstrated that homologues of several grape TIFY genes were found in the corresponding syntenic blocks of Arabidopsis, suggesting that these genes arose before the divergence of lineages that led to grape and Arabidopsis. Analyses of microarray and quantitative real-time RT-PCR expression data revealed that grape TIFY genes are not a major player in the defense against biotrophic pathogens or viruses. However, many of these genes were responsive to JA and ABA, but not SA or ET. Conclusion The genome-wide identification, evolutionary and expression analyses of grape TIFY genes should facilitate further research of this gene family and provide new insights regarding their evolutionary history and regulatory control. PMID:22984514
Pittman, Jon K; Hirschi, Kendal D
2016-12-01
The Ca(2+)/Cation Antiporter (CaCA) superfamily is an ancient and widespread family of ion-coupled cation transporters found in nearly all kingdoms of life. In animals, K(+)-dependent and K(+)-indendent Na(+)/Ca(2+) exchangers (NCKX and NCX) are important CaCA members. Recently it was proposed that all rice and Arabidopsis CaCA proteins should be classified as NCX proteins. Here we performed phylogenetic analysis of CaCA genes and protein structure homology modelling to further characterise members of this transporter superfamily. Phylogenetic analysis of rice and Arabidopsis CaCAs in comparison with selected CaCA members from non-plant species demonstrated that these genes form clearly distinct families, with the H(+)/Cation exchanger (CAX) and cation/Ca(2+) exchanger (CCX) families dominant in higher plants but the NCKX and NCX families absent. NCX-related Mg(2+)/H(+) exchanger (MHX) and CAX-related Na(+)/Ca(2+) exchanger-like (NCL) proteins are instead present. Analysis of genomes of ten closely-related rice species and four Arabidopsis-related species found that CaCA gene family structures are highly conserved within related plants, apart from minor variation. Protein structures were modelled for OsCAX1a and OsMHX1. Despite exhibiting broad structural conservation, there are clear structural differences observed between the different CaCA types. Members of the CaCA superfamily form clearly distinct families with different phylogenetic, structural and functional characteristics, and therefore should not be simply classified as NCX proteins, which should remain as a separate gene family.
A comparison of brain gene expression levels in domesticated and wild animals.
Directory of Open Access Journals (Sweden)
Frank W Albert
2012-09-01
Full Text Available Domestication has led to similar changes in morphology and behavior in several animal species, raising the question whether similarities between different domestication events also exist at the molecular level. We used mRNA sequencing to analyze genome-wide gene expression patterns in brain frontal cortex in three pairs of domesticated and wild species (dogs and wolves, pigs and wild boars, and domesticated and wild rabbits. We compared the expression differences with those between domesticated guinea pigs and a distant wild relative (Cavia aperea as well as between two lines of rats selected for tameness or aggression towards humans. There were few gene expression differences between domesticated and wild dogs, pigs, and rabbits (30-75 genes (less than 1% of expressed genes were differentially expressed, while guinea pigs and C. aperea differed more strongly. Almost no overlap was found between the genes with differential expression in the different domestication events. In addition, joint analyses of all domesticated and wild samples provided only suggestive evidence for the existence of a small group of genes that changed their expression in a similar fashion in different domesticated species. The most extreme of these shared expression changes include up-regulation in domesticates of SOX6 and PROM1, two modulators of brain development. There was almost no overlap between gene expression in domesticated animals and the tame and aggressive rats. However, two of the genes with the strongest expression differences between the rats (DLL3 and DHDH were located in a genomic region associated with tameness and aggression, suggesting a role in influencing tameness. In summary, the majority of brain gene expression changes in domesticated animals are specific to the given domestication event, suggesting that the causative variants of behavioral domestication traits may likewise be different.
Zou, Zhi; Yang, Lifu; Wang, Danhua; Huang, Qixing; Mo, Yeyong; Xie, Guishui
2016-01-01
WRKY proteins comprise one of the largest transcription factor families in plants and form key regulators of many plant processes. This study presents the characterization of 58 WRKY genes from the castor bean (Ricinus communis L., Euphorbiaceae) genome. Compared with the automatic genome annotation, one more WRKY-encoding locus was identified and 20 out of the 57 predicted gene models were manually corrected. All RcWRKY genes were shown to contain at least one intron in their coding sequences. According to the structural features of the present WRKY domains, the identified RcWRKY genes were assigned to three previously defined groups (I-III). Although castor bean underwent no recent whole-genome duplication event like physic nut (Jatropha curcas L., Euphorbiaceae), comparative genomics analysis indicated that one gene loss, one intron loss and one recent proximal duplication occurred in the RcWRKY gene family. The expression of all 58 RcWRKY genes was supported by ESTs and/or RNA sequencing reads derived from roots, leaves, flowers, seeds and endosperms. Further global expression profiles with RNA sequencing data revealed diverse expression patterns among various tissues. Results obtained from this study not only provide valuable information for future functional analysis and utilization of the castor bean WRKY genes, but also provide a useful reference to investigate the gene family expansion and evolution in Euphorbiaceus plants.
Haack, Sheridan K.; Duris, Joseph W.; Kolpin, Dana W.; Focazio, Michael J.; Meyer, Michael T.; Johnson, Heather E.; Oster, Ryan J.; Foreman, William T.
2016-01-01
Animal waste, stream water, and streambed sediment from 19 small (animal agriculture (control, n = 4), or predominantly beef (n = 4), dairy (n = 3), swine (n = 5), or poultry (n = 3) were tested for: 1) cholesterol, coprostanol, estrone, and fecal indicator bacteria (FIB) concentrations, and 2) shiga-toxin producing and enterotoxigenic Escherichia coli, Salmonella, Campylobacter, and pathogenic and vancomycin-resistant enterococci by polymerase chain reaction (PCR) on enrichments, and/or direct quantitative PCR. Pathogen genes were most frequently detected in dairy wastes, followed by beef, swine and poultry wastes in that order; there was only one detection of an animal-source-specific pathogen gene (stx1) in any water or sediment sample in any control watershed. Post-rainfall pathogen gene numbers in stream water were significantly correlated with FIB, cholesterol and coprostanol concentrations, and were most highly correlated in dairy watershed samples collected from 3 different states. Although collected across multiple states and ecoregions, animal-waste gene profiles were distinctive via discriminant analysis. Stream water gene profiles could also be discriminated by the watershed animal type. Although pathogen genes were not abundant in stream water or streambed samples, PCR on enrichments indicated that many genes were from viable organisms, including several (shiga-toxin producing or enterotoxigenic E. coli, Salmonella, vancomycin-resistant enterococci) that could potentially affect either human or animal health. Pathogen gene numbers and types in stream water samples were influenced most by animal type, by local factors such as whether animals had stream access, and by the amount of local rainfall, and not by studied watershed soil or physical characteristics. Our results indicated that stream water in small agricultural U.S. watersheds was susceptible to pathogen gene inputs under typical agricultural practices and environmental conditions
Genome-wide identification of the SWEET gene family in wheat.
Gao, Yue; Wang, Zi Yuan; Kumar, Vikranth; Xu, Xiao Feng; Yuan, De Peng; Zhu, Xiao Feng; Li, Tian Ya; Jia, Baolei; Xuan, Yuan Hu
2018-02-05
The SWEET (sugars will eventually be exported transporter) family is a newly characterized group of sugar transporters. In plants, the key roles of SWEETs in phloem transport, nectar secretion, pollen nutrition, stress tolerance, and plant-pathogen interactions have been identified. SWEET family genes have been characterized in many plant species, but a comprehensive analysis of SWEET members has not yet been performed in wheat. Here, 59 wheat SWEETs (hereafter TaSWEETs) were identified through homology searches. Analyses of phylogenetic relationships, numbers of transmembrane helices (TMHs), gene structures, and motifs showed that TaSWEETs carrying 3-7 TMHs could be classified into four clades with 10 different types of motifs. Examination of the expression patterns of 18 SWEET genes revealed that a few are tissue-specific while most are ubiquitously expressed. In addition, the stem rust-mediated expression patterns of SWEET genes were monitored using a stem rust-susceptible cultivar, 'Little Club' (LC). The resulting data showed that the expression of five out of the 18 SWEETs tested was induced following inoculation. In conclusion, we provide the first comprehensive analysis of the wheat SWEET gene family. Information regarding the phylogenetic relationships, gene structures, and expression profiles of SWEET genes in different tissues and following stem rust disease inoculation will be useful in identifying the potential roles of SWEETs in specific developmental and pathogenic processes. Copyright © 2017 Elsevier B.V. All rights reserved.
A Study of Firesetting and Animal Cruelty in Children: Family Influences and Adolescent Outcomes.
Becker, Kimberly D.; Stuewig, Jeffrey; Herrera, Veronica M.; McCloskey, Laura A.
2004-01-01
Objective: To investigate relationships among family risk factors, childhood firesetting and animal cruelty, and adolescent delinquency. Method: In 1990, mothers and children participating in a 10-year prospective study provided information about family risk factors and childhood problem behavior. Subsequent interviews with 86% of the sample in…
Evolution of cholinesterases in the animal kingdom.
Pezzementi, Leo; Chatonnet, Arnaud
2010-09-06
Cholinesterases emerged from a family of enzymes and proteins with adhesion properties. This family is absent in plants and expanded in multicellular animals. True cholinesterases appeared in triploblastic animals together with the cholinergic system. Lineage specific duplications resulted in two acetylcholinesterases in most hexapods and in up to four genes in nematodes. In vertebrates the duplication leading to acetylcholinesterase (AChE) and butyrylcholinesterase (BChE) is now considered to be an ancient event which occurred before the split of osteichthyes. The product of one or the other of the paralogues is responsible for the physiological hydrolysis of acetylcholine, depending on the species lineage and tissue considered. The BChE gene seems to have been lost in some fish lineages. The complete genome of amphioxus (Branchiostoma floridae: cephalochordate) contains a large number of duplicated genes or pseudogenes of cholinesterases. Sequence comparison and tree constructions raise the question of considering the atypical ChE studied in this organism as a representative of ancient BChE. Thus nematodes, arthropods, annelids, molluscs, and vertebrates typically possess two paralogous genes coding for cholinesterases. The origin of the duplication(s) is discussed. The mode of attachment through alternative C-terminal coding exons seems to have evolved independently from the catalytic part of the gene. Copyright (c) 2010 Elsevier Ireland Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Walker Angela M
2009-04-01
Full Text Available Abstract Background The Pregnancy-associated glycoproteins (PAGs belong to a large family of aspartic peptidases expressed exclusively in the placenta of species in the Artiodactyla order. In cattle, the PAG gene family is comprised of at least 22 transcribed genes, as well as some variants. Phylogenetic analyses have shown that the PAG family segregates into 'ancient' and 'modern' groupings. Along with sequence differences between family members, there are clear distinctions in their spatio-temporal distribution and in their relative level of expression. In this report, 1 we performed an in silico analysis of the bovine genome to further characterize the PAG gene family, 2 we scrutinized proximal promoter sequences of the PAG genes to evaluate the evolution pressures operating on them and to identify putative regulatory regions, 3 we determined relative transcript abundance of selected PAGs during pregnancy and, 4 we performed preliminary characterization of the putative regulatory elements for one of the candidate PAGs, bovine (bo PAG-2. Results From our analysis of the bovine genome, we identified 18 distinct PAG genes and 14 pseudogenes. We observed that the first 500 base pairs upstream of the translational start site contained multiple regions that are conserved among all boPAGs. However, a preponderance of conserved regions, that harbor recognition sites for putative transcriptional factors (TFs, were found to be unique to the modern boPAG grouping, but not the ancient boPAGs. We gathered evidence by means of Q-PCR and screening of EST databases to show that boPAG-2 is the most abundant of all boPAG transcripts. Finally, we provided preliminary evidence for the role of ETS- and DDVL-related TFs in the regulation of the boPAG-2 gene. Conclusion PAGs represent a relatively large gene family in the bovine genome. The proximal promoter regions of these genes display differences in putative TF binding sites, likely contributing to observed
Identification and characterization of NF-YB family genes in tung tree.
Yang, Susu; Wang, Yangdong; Yin, Hengfu; Guo, Haobo; Gao, Ming; Zhu, Huiping; Chen, Yicun
2015-12-01
The NF-YB transcription factor gene family encodes a subunit of the CCAAT box-binding factor (CBF), a highly conserved trimeric activator that strongly binds to the CCAAT box promoter element. Studies on model plants have shown that NF-YB proteins participate in important developmental and physiological processes, but little is known about NF-YB proteins in trees. Here, we identified seven NF-YB transcription factor-encoding genes in Vernicia fordii, an important oilseed tree in China. A phylogenetic analysis separated the genes into two groups; non-LEC1 type (VfNF-YB1, 5, 7, 9, 11, 13) and LEC1-type (VfNF-YB 14). A gene structure analysis showed that VfNF-YB 5 has three introns and the other genes have no introns. The seven VfNF-YB sequences contain highly conserved domains, a disordered region at the N terminus, and two long helix structures at the C terminus. Phylogenetic analyses showed that VfNF-YB family genes are highly homologous to GmNF-YB genes, and many of them are closely related to functionally characterized NF-YBs. In expression analyses of various tissues (root, stem, leaf, and kernel) and the root during pathogen infection, VfNF-YB1, 5, and 11 were dominantly expressed in kernels, and VfNF-YB7 and 9 were expressed only in the root. Different VfNF-YB family genes showed different responses to pathogen infection, suggesting that they play different roles in the pathogen response. Together, these findings represent the first extensive evaluation of the NF-YB family in tung tree and provide a foundation for dissecting the functions of VfNF-YB genes in seed development, stress adaption, fatty acid synthesis, and pathogen response.
Role of methionine on epigenetic modification of DNA methylation and gene expression in animals
Directory of Open Access Journals (Sweden)
Naifeng Zhang
2018-03-01
Full Text Available DNA methylation is one of the main epigenetic phenomena affecting gene expression. It is an important mechanism for the development of embryo, growth and health of animals. As a key nutritional factor limiting the synthesis of protein, methionine serves as the precursor of S-adenosylmethionine (SAM in the hepatic one-carbon metabolism. The dietary fluctuation of methionine content can alter the levels of metabolic substrates in one-carbon metabolism, e.g., the SAM, S-adenosylhomocysteine (SAH, and change the expression of genes related to the growth and health of animals by DNA methylation reactions. The ratio of SAM to SAH is called ‘methylation index’ but it should be carefully explained because the complexity of methylation reaction. Alterations of methylation in a specific cytosine-guanine (CpG site, rather than the whole promoter region, might be enough to change gene expression. Aberrant methionine cycle may provoke molecular changes of one-carbon metabolism that results in deregulation of cellular hemostasis and health problems. The importance of DNA methylation has been underscored but the mechanisms of methionine affecting DNA methylation are poorly understood. Nutritional epigenomics provides a promising insight into the targeting epigenetic changes in animals from a nutritional standpoint, which will deepen and expand our understanding of genes, molecules, tissues, and animals in which methionine alteration influences DNA methylation and gene expression. Keywords: Epigenetics, Methionine, DNA methylation, Gene expression, Epigenetic modification
Duplications and losses in gene families of rust pathogens highlight putative effectors.
Pendleton, Amanda L; Smith, Katherine E; Feau, Nicolas; Martin, Francis M; Grigoriev, Igor V; Hamelin, Richard; Nelson, C Dana; Burleigh, J Gordon; Davis, John M
2014-01-01
Rust fungi are a group of fungal pathogens that cause some of the world's most destructive diseases of trees and crops. A shared characteristic among rust fungi is obligate biotrophy, the inability to complete a lifecycle without a host. This dependence on a host species likely affects patterns of gene expansion, contraction, and innovation within rust pathogen genomes. The establishment of disease by biotrophic pathogens is reliant upon effector proteins that are encoded in the fungal genome and secreted from the pathogen into the host's cell apoplast or within the cells. This study uses a comparative genomic approach to elucidate putative effectors and determine their evolutionary histories. We used OrthoMCL to identify nearly 20,000 gene families in proteomes of 16 diverse fungal species, which include 15 basidiomycetes and one ascomycete. We inferred patterns of duplication and loss for each gene family and identified families with distinctive patterns of expansion/contraction associated with the evolution of rust fungal genomes. To recognize potential contributors for the unique features of rust pathogens, we identified families harboring secreted proteins that: (i) arose or expanded in rust pathogens relative to other fungi, or (ii) contracted or were lost in rust fungal genomes. While the origin of rust fungi appears to be associated with considerable gene loss, there are many gene duplications associated with each sampled rust fungal genome. We also highlight two putative effector gene families that have expanded in Cqf that we hypothesize have roles in pathogenicity.
Genomewide analysis of TCP transcription factor gene family in ...
Indian Academy of Sciences (India)
Home; Journals; Journal of Genetics; Volume 93; Issue 3. Genomewide ... Teosinte branched1/cycloidea/proliferating cell factor1 (TCP) proteins are a large family of transcriptional regulators in angiosperms. They are ... To the best of our knowledge, this is the first study of a genomewide analysis of apple TCP gene family.
Incidence of the enterococcal surface protein (esp) gene in human and animal fecal sources
Whitman, R.L.; Przybyla-Kelly, K.; Shively, D.A.; Byappanahalli, M.N.
2007-01-01
The occurrence of the enterococcal surface protein (esp) gene in the opportunistic pathogens Enterococcus faecalis and E. faecium is well-documented in clinical research. Recently, the esp gene has been proposed as a marker of human pollution in environmental waters; however, information on its relative incidence in various human and animal fecal sources is limited. We have determined the occurrence of the esp gene in enterococci from human (n = 64) and animal (n = 233) fecal samples by polymerase chain reaction using two primer sets: one presumably specific for E. faecium (espfm) and the other for both E. faecalis and E. faecium (espfs/fm). We believe that this research is the first to explore the use of espfs/fm for the detection of human waste in natural environmental settings. The incidence in human sources was 93.1% espfm and 100% espfs/fm in raw sewage influent; 30% for both espfm and espfs/fm in septic waste; and 0% espfm and 80% espfs/fm in active pit toilets. The overall occurrence of the gene in animal feces was 7.7% (espfs/fm) and 4.7% (espfm); animal types with positive results included dogs (9/43, all espfm), gulls (10/34, espfs/fm; 2/34, espfm), mice (3/22, all espfs/fm), and songbirds (5/55, all espfs/fm). The esp gene was not detected in cat (0/34), deer (0/4), goose (0/18), or raccoon (0/23) feces. The inconsistent occurrence, especially in septic and pit toilet sewage, suggests a low statistical power of discrimination between animal and human sources, which means a large number of replicates should be collected. Both espfm and espfs/fm were common in raw sewage, but neither one efficiently differentiated between animal and other human sources.
Lv, Yunyun; Kawasaki, Kazuhiko; Li, Jia; Li, Yanping; Bian, Chao; Huang, Yu; You, Xinxin; Shi, Qiong
2017-11-16
The family of secretory calcium-binding phosphoproteins (SCPPs) have been considered vital to skeletal tissue mineralization. However, most previous SCPP studies focused on phylogenetically distant animals but not on those closely related species. Here we provide novel insights into the coevolution of SCPP genes and fish scales in 10 species from Otophysi . According to their scale phenotypes, these fishes can be divided into three groups, i.e., scaled, sparsely scaled, and scaleless. We identified homologous SCPP genes in the genomes of these species and revealed an absence of some SCPP members in some genomes, suggesting an uneven evolutionary history of SCPP genes in fishes. In addition, most of these SCPP genes, with the exception of SPP1 , individually form one or two gene cluster(s) on each corresponding genome. Furthermore, we constructed phylogenetic trees using maximum likelihood method to estimate their evolution. The phylogenetic topology mostly supports two subclasses in some species, such as Cyprinus carpio , Sinocyclocheilus anshuiensis , S. grahamin , and S. rhinocerous , but not in the other examined fishes. By comparing the gene structures of recently reported candidate genes, SCPP1 and SCPP5 , for determining scale phenotypes, we found that the hypothesis is suitable for Astyanax mexicanus , but denied by S. anshuiensis , even though they are both sparsely scaled for cave adaptation. Thus, we conclude that, although different fish species display similar scale phenotypes, the underlying genetic changes however might be diverse. In summary, this paper accelerates the recognition of the SCPP family in teleosts for potential scale evolution.
The antibiotic resistome: gene flow in environments, animals and human beings.
Hu, Yongfei; Gao, George F; Zhu, Baoli
2017-06-01
The antibiotic resistance is natural in bacteria and predates the human use of antibiotics. Numerous antibiotic resistance genes (ARGs) have been discovered to confer resistance to a wide range of antibiotics. The ARGs in natural environments are highly integrated and tightly regulated in specific bacterial metabolic networks. However, the antibiotic selection pressure conferred by the use of antibiotics in both human medicine and agriculture practice leads to a significant increase of antibiotic resistance and a steady accumulation of ARGs in bacteria. In this review, we summarized, with an emphasis on an ecological point of view, the important research progress regarding the collective ARGs (antibiotic resistome) in bacterial communities of natural environments, human and animals, i.e., in the one health settings.We propose that the resistance gene flow in nature is "from the natural environments" and "to the natural environments"; human and animals, as intermediate recipients and disseminators, contribute greatly to such a resistance gene "circulation."
Directory of Open Access Journals (Sweden)
Mohammad H Dezfulian
Full Text Available The Arabidopsis thaliana genome encodes several families of polypeptides that are known or predicted to participate in the formation of the SCF-class of E3-ubiquitin ligase complexes. One such gene family encodes the Skp1-like class of polypeptide subunits, where 21 genes have been identified and are known to be expressed in Arabidopsis. Phylogenetic analysis based on deduced polypeptide sequence organizes the family of ASK proteins into 7 clades. The complexity of the ASK gene family, together with the close structural similarity among its members raises the prospect of significant functional redundancy among select paralogs. We have assessed the potential for functional redundancy within the ASK gene family by analyzing an expanded set of criteria that define redundancy with higher resolution. The criteria used include quantitative expression of locus-specific transcripts using qRT-PCR, assessment of the sub-cellular localization of individual ASK:YFP auto-fluorescent fusion proteins expressed in vivo as well as the in planta assessment of individual ASK-F-Box protein interactions using bimolecular fluorescent complementation techniques in combination with confocal imagery in live cells. The results indicate significant functional divergence of steady state transcript abundance and protein-protein interaction specificity involving ASK proteins in a pattern that is poorly predicted by sequence-based phylogeny. The information emerging from this and related studies will prove important for defining the functional intersection of expression, localization and gene product interaction that better predicts the formation of discrete SCF complexes, as a prelude to investigating their molecular mode of action.
Davarniya, Behzad; Hu, Hao; Kahrizi, Kimia; Musante, Luciana; Fattahi, Zohreh; Hosseini, Masoumeh; Maqsoud, Fariba; Farajollahi, Reza; Wienker, Thomas F; Ropers, H Hilger; Najmabadi, Hossein
2015-01-01
Cognitive impairment or intellectual disability (ID) is a widespread neurodevelopmental disorder characterized by low IQ (below 70). ID is genetically heterogeneous and is estimated to affect 1-3% of the world's population. In affected children from consanguineous families, autosomal recessive inheritance is common, and identifying the underlying genetic cause is an important issue in clinical genetics. In the framework of a larger project, aimed at identifying candidate genes for autosomal recessive intellectual disorder (ARID), we recently carried out single nucleotide polymorphism-based genome-wide linkage analysis in several families from Ardabil province in Iran. The identification of homozygosity-by-descent loci in these families, in combination with whole exome sequencing, led us to identify possible causative homozygous changes in two families. In the first family, a missense variant was found in GRM1 gene, while in the second family, a frameshift alteration was identified in TRMT1, both of which were found to co-segregate with the disease. GRM1, a known causal gene for autosomal recessive spinocerebellar ataxia (SCAR13, MIM#614831), encodes the metabotropic glutamate receptor1 (mGluR1). This gene plays an important role in synaptic plasticity and cerebellar development. Conversely, the TRMT1 gene encodes a tRNA methyltransferase that dimethylates a single guanine residue at position 26 of most tRNAs using S-adenosyl methionine as the methyl group donor. We recently presented TRMT1 as a candidate gene for ARID in a consanguineous Iranian family (Najmabadi et al., 2011). We believe that this second Iranian family with a biallelic loss-of-function mutation in TRMT1 gene supports the idea that this gene likely has function in development of the disorder.
Identification of Acinetobacter baumannii of Human and Animal Origins by a Gene-Specific PCR.
Hamouda, Ahmed
2017-09-01
Acinetobacter baumannii is a notorious nosocomial pathogen known for its ability to cause severe infections, especially in intensive care units. The identification of a conserved gene encoding a hypothetical protein in A. baumannii isolates but not in other Acinetobacter species during a comparative genomic analysis was reported. For the purpose of this study, we call this gene, A.b_hyp gene. The aim of this study was to report the results of screening for the presence of the A.b_hyp gene in a worldwide collection of well-characterized A. baumannii collected from clinical and animal specimens. A total of 83 clinical, animal, and type strains were used. These comprised 73 A. baumannii isolates of clinical (n = 60) and animal origin (n = 13), and ten type strains, including a positive control strain, A. baumannii ATCC 19606. All isolates were examined by PCR amplification of the A.b_hyp gene. The A.b_hyp gene was detected in 72 isolates (99%) of A. baumannii but one clinical isolate failed to produce an amplicon. The control strain, A. baumannii ATCC 19606, was also positive for this gene. No bands were detected in non-A. baumannii species and therefore the isolates are thought to be negative for the gene. No bands were detected in non-A. baumannii isolates and therefore they are thought to be negative for the gene. The PCR A.b_ hyp method provides evidence that detection of this gene can be used as a reliable, easy, and low-cost biomarker for A. baumannii identification.
Mukhopadhyay, Saikat; Jackson, Peter K
2011-01-01
The tubby mouse shows a tripartite syndrome characterized by maturity-onset obesity, blindness and deafness. The causative gene Tub is the founding member of a family of related proteins present throughout the animal and plant kingdoms, each characterized by a signature carboxy-terminal tubby domain. This domain consists of a β barrel enclosing a central α helix and binds selectively to specific membrane phosphoinositides. The vertebrate family of tubby-like proteins (TULPs) includes the foun...
Conservation, Divergence, and Genome-Wide Distribution of PAL and POX A Gene Families in Plants.
Rawal, H C; Singh, N K; Sharma, T R
2013-01-01
Genome-wide identification and phylogenetic and syntenic comparison were performed for the genes responsible for phenylalanine ammonia lyase (PAL) and peroxidase A (POX A) enzymes in nine plant species representing very diverse groups like legumes (Glycine max and Medicago truncatula), fruits (Vitis vinifera), cereals (Sorghum bicolor, Zea mays, and Oryza sativa), trees (Populus trichocarpa), and model dicot (Arabidopsis thaliana) and monocot (Brachypodium distachyon) species. A total of 87 and 1045 genes in PAL and POX A gene families, respectively, have been identified in these species. The phylogenetic and syntenic comparison along with motif distributions shows a high degree of conservation of PAL genes, suggesting that these genes may predate monocot/eudicot divergence. The POX A family genes, present in clusters at the subtelomeric regions of chromosomes, might be evolving and expanding with higher rate than the PAL gene family. Our analysis showed that during the expansion of POX A gene family, many groups and subgroups have evolved, resulting in a high level of functional divergence among monocots and dicots. These results will act as a first step toward the understanding of monocot/eudicot evolution and functional characterization of these gene families in the future.
Conservation, Divergence, and Genome-Wide Distribution of PAL and POX A Gene Families in Plants
Directory of Open Access Journals (Sweden)
H. C. Rawal
2013-01-01
Full Text Available Genome-wide identification and phylogenetic and syntenic comparison were performed for the genes responsible for phenylalanine ammonia lyase (PAL and peroxidase A (POX A enzymes in nine plant species representing very diverse groups like legumes (Glycine max and Medicago truncatula, fruits (Vitis vinifera, cereals (Sorghum bicolor, Zea mays, and Oryza sativa, trees (Populus trichocarpa, and model dicot (Arabidopsis thaliana and monocot (Brachypodium distachyon species. A total of 87 and 1045 genes in PAL and POX A gene families, respectively, have been identified in these species. The phylogenetic and syntenic comparison along with motif distributions shows a high degree of conservation of PAL genes, suggesting that these genes may predate monocot/eudicot divergence. The POX A family genes, present in clusters at the subtelomeric regions of chromosomes, might be evolving and expanding with higher rate than the PAL gene family. Our analysis showed that during the expansion of POX A gene family, many groups and subgroups have evolved, resulting in a high level of functional divergence among monocots and dicots. These results will act as a first step toward the understanding of monocot/eudicot evolution and functional characterization of these gene families in the future.
Shiao, S Pamela K; Grayson, James; Yu, Chong Ho; Wasek, Brandi; Bottiglieri, Teodoro
2018-02-16
For the personalization of polygenic/omics-based health care, the purpose of this study was to examine the gene-environment interactions and predictors of colorectal cancer (CRC) by including five key genes in the one-carbon metabolism pathways. In this proof-of-concept study, we included a total of 54 families and 108 participants, 54 CRC cases and 54 matched family friends representing four major racial ethnic groups in southern California (White, Asian, Hispanics, and Black). We used three phases of data analytics, including exploratory, family-based analyses adjusting for the dependence within the family for sharing genetic heritage, the ensemble method, and generalized regression models for predictive modeling with a machine learning validation procedure to validate the results for enhanced prediction and reproducibility. The results revealed that despite the family members sharing genetic heritage, the CRC group had greater combined gene polymorphism rates than the family controls ( p relation to gene-environment interactions in the prevention of CRC.
Genomewide analysis of MATE-type gene family in maize reveals ...
Indian Academy of Sciences (India)
Huasheng Zhu and Jiandong Wu contributed equally to this work. As a group of secondary active transporters, the MATE gene family consists of multiple genes that widely exist in ..... Roots of the stress-treated plants were collected at 0,.
Genome-wide identification and characterization of WRKY gene family in Salix suchowensis.
Bi, Changwei; Xu, Yiqing; Ye, Qiaolin; Yin, Tongming; Ye, Ning
2016-01-01
WRKY proteins are the zinc finger transcription factors that were first identified in plants. They can specifically interact with the W-box, which can be found in the promoter region of a large number of plant target genes, to regulate the expressions of downstream target genes. They also participate in diverse physiological and growing processes in plants. Prior to this study, a plenty of WRKY genes have been identified and characterized in herbaceous species, but there is no large-scale study of WRKY genes in willow. With the whole genome sequencing of Salix suchowensis, we have the opportunity to conduct the genome-wide research for willow WRKY gene family. In this study, we identified 85 WRKY genes in the willow genome and renamed them from SsWRKY1 to SsWRKY85 on the basis of their specific distributions on chromosomes. Due to their diverse structural features, the 85 willow WRKY genes could be further classified into three main groups (group I-III), with five subgroups (IIa-IIe) in group II. With the multiple sequence alignment and the manual search, we found three variations of the WRKYGQK heptapeptide: WRKYGRK, WKKYGQK and WRKYGKK, and four variations of the normal zinc finger motif, which might execute some new biological functions. In addition, the SsWRKY genes from the same subgroup share the similar exon-intron structures and conserved motif domains. Further studies of SsWRKY genes revealed that segmental duplication events (SDs) played a more prominent role in the expansion of SsWRKY genes. Distinct expression profiles of SsWRKY genes with RNA sequencing data revealed that diverse expression patterns among five tissues, including tender roots, young leaves, vegetative buds, non-lignified stems and barks. With the analyses of WRKY gene family in willow, it is not only beneficial to complete the functional and annotation information of WRKY genes family in woody plants, but also provide important references to investigate the expansion and evolution of
Duplications and losses in gene families of rust pathogens highlight putative effectors
Directory of Open Access Journals (Sweden)
Amanda L. Pendleton
2014-06-01
Full Text Available Rust fungi are a group of fungal pathogens that cause some of the world’s most destructive diseases of trees and crops. A shared characteristic among rust fungi is obligate biotrophy, the inability to complete a lifecycle without a host. This dependence on a host species likely affects patterns of gene expansion, contraction, and innovation within rust pathogen genomes. The establishment of disease by biotrophic pathogens is reliant upon effector proteins that are encoded in the fungal genome and secreted from the pathogen into the host’s cell apoplast or within the cells. This study uses a comparative genomic approach to elucidate putative effectors and determine their evolutionary histories. We used OrthoMCL to identify nearly 20,000 gene families in proteomes of sixteen diverse fungal species, which include fifteen basidiomycetes and one ascomycete. We inferred patterns of duplication and loss for each gene family and identified families with distinctive patterns of expansion/contraction associated with the evolution of rust fungal genomes. To recognize potential contributors for the unique features of rust pathogens, we identified families harboring secreted proteins that: i arose or expanded in rust pathogens relative to other fungi, or ii contracted or were lost in rust fungal genomes. While the origin of rust fungi appears to be associated with considerable gene loss, there are many gene duplications associated with each sampled rust fungal genome. We also highlight two putative effector gene families that have expanded in Cqf that we hypothesize have roles in pathogenicity.
Phylogenetic detection of numerous gene duplications shared by animals, fungi and plants
Zhou, Xiaofan; Lin, Zhenguo; Ma, Hong
2010-01-01
Background Gene duplication is considered a major driving force for evolution of genetic novelty, thereby facilitating functional divergence and organismal diversity, including the process of speciation. Animals, fungi and plants are major eukaryotic kingdoms and the divergences between them are some of the most significant evolutionary events. Although gene duplications in each lineage have been studied extensively in various contexts, the extent of gene duplication prior to the split of pla...
Mutation analysis of pre-mRNA splicing genes in Chinese families with retinitis pigmentosa
Pan, Xinyuan; Chen, Xue; Liu, Xiaoxing; Gao, Xiang; Kang, Xiaoli; Xu, Qihua; Chen, Xuejuan; Zhao, Kanxing; Zhang, Xiumei; Chu, Qiaomei; Wang, Xiuying
2014-01-01
Purpose Seven genes involved in precursor mRNA (pre-mRNA) splicing have been implicated in autosomal dominant retinitis pigmentosa (adRP). We sought to detect mutations in all seven genes in Chinese families with RP, to characterize the relevant phenotypes, and to evaluate the prevalence of mutations in splicing genes in patients with adRP. Methods Six unrelated families from our adRP cohort (42 families) and two additional families with RP with uncertain inheritance mode were clinically characterized in the present study. Targeted sequence capture with next-generation massively parallel sequencing (NGS) was performed to screen mutations in 189 genes including all seven pre-mRNA splicing genes associated with adRP. Variants detected with NGS were filtered with bioinformatics analyses, validated with Sanger sequencing, and prioritized with pathogenicity analysis. Results Mutations in pre-mRNA splicing genes were identified in three individual families including one novel frameshift mutation in PRPF31 (p.Leu366fs*1) and two known mutations in SNRNP200 (p.Arg681His and p.Ser1087Leu). The patients carrying SNRNP200 p.R681H showed rapid disease progression, and the family carrying p.S1087L presented earlier onset ages and more severe phenotypes compared to another previously reported family with p.S1087L. In five other families, we identified mutations in other RP-related genes, including RP1 p. Ser781* (novel), RP2 p.Gln65* (novel) and p.Ile137del (novel), IMPDH1 p.Asp311Asn (recurrent), and RHO p.Pro347Leu (recurrent). Conclusions Mutations in splicing genes identified in the present and our previous study account for 9.5% in our adRP cohort, indicating the important role of pre-mRNA splicing deficiency in the etiology of adRP. Mutations in the same splicing gene, or even the same mutation, could correlate with different phenotypic severities, complicating the genotype–phenotype correlation and clinical prognosis. PMID:24940031
The Eucalyptus terpene synthase gene family.
Külheim, Carsten; Padovan, Amanda; Hefer, Charles; Krause, Sandra T; Köllner, Tobias G; Myburg, Alexander A; Degenhardt, Jörg; Foley, William J
2015-06-11
Terpenoids are abundant in the foliage of Eucalyptus, providing the characteristic smell as well as being valuable economically and influencing ecological interactions. Quantitative and qualitative inter- and intra- specific variation of terpenes is common in eucalypts. The genome sequences of Eucalyptus grandis and E. globulus were mined for terpene synthase genes (TPS) and compared to other plant species. We investigated the relative expression of TPS in seven plant tissues and functionally characterized five TPS genes from E. grandis. Compared to other sequenced plant genomes, Eucalyptus grandis has the largest number of putative functional TPS genes of any sequenced plant. We discovered 113 and 106 putative functional TPS genes in E. grandis and E. globulus, respectively. All but one TPS from E. grandis were expressed in at least one of seven plant tissues examined. Genomic clusters of up to 20 genes were identified. Many TPS are expressed in tissues other than leaves which invites a re-evaluation of the function of terpenes in Eucalyptus. Our data indicate that terpenes in Eucalyptus may play a wider role in biotic and abiotic interactions than previously thought. Tissue specific expression is common and the possibility of stress induction needs further investigation. Phylogenetic comparison of the two investigated Eucalyptus species gives insight about recent evolution of different clades within the TPS gene family. While the majority of TPS genes occur in orthologous pairs some clades show evidence of recent gene duplication, as well as loss of function.
DEFF Research Database (Denmark)
Christiansen, Michael W; Gregersen, Per L.
2014-01-01
-expressed with members of the NAC gene family. In conclusion, a list of up to 15 NAC genes from barley that are strong candidates for being regulatory factors of importance for senescence and biotic stress-related traits affecting the productivity of cereal crop plants has been generated. Furthermore, a list of 71...... in the NAC transcription factor family during senescence of barley flag leaves was studied. Several members of the NAC transcription factor gene family were up-regulated during senescence in a microarray experiment, together with a large range of senescence-associated genes, reflecting the coordinated...... activation of degradation processes in senescing barley leaf tissues. This picture was confirmed in a detailed quantitative reverse transcription–PCR (qRT–PCR) experiment, which also showed distinct gene expression patterns for different members of the NAC gene family, suggesting a group of ~15 out of the 47...
Directory of Open Access Journals (Sweden)
Behzad Davarniya
Full Text Available Cognitive impairment or intellectual disability (ID is a widespread neurodevelopmental disorder characterized by low IQ (below 70. ID is genetically heterogeneous and is estimated to affect 1-3% of the world's population. In affected children from consanguineous families, autosomal recessive inheritance is common, and identifying the underlying genetic cause is an important issue in clinical genetics. In the framework of a larger project, aimed at identifying candidate genes for autosomal recessive intellectual disorder (ARID, we recently carried out single nucleotide polymorphism-based genome-wide linkage analysis in several families from Ardabil province in Iran. The identification of homozygosity-by-descent loci in these families, in combination with whole exome sequencing, led us to identify possible causative homozygous changes in two families. In the first family, a missense variant was found in GRM1 gene, while in the second family, a frameshift alteration was identified in TRMT1, both of which were found to co-segregate with the disease. GRM1, a known causal gene for autosomal recessive spinocerebellar ataxia (SCAR13, MIM#614831, encodes the metabotropic glutamate receptor1 (mGluR1. This gene plays an important role in synaptic plasticity and cerebellar development. Conversely, the TRMT1 gene encodes a tRNA methyltransferase that dimethylates a single guanine residue at position 26 of most tRNAs using S-adenosyl methionine as the methyl group donor. We recently presented TRMT1 as a candidate gene for ARID in a consanguineous Iranian family (Najmabadi et al., 2011. We believe that this second Iranian family with a biallelic loss-of-function mutation in TRMT1 gene supports the idea that this gene likely has function in development of the disorder.
Kahrizi, Kimia; Musante, Luciana; Fattahi, Zohreh; Hosseini, Masoumeh; Maqsoud, Fariba; Farajollahi, Reza; Wienker, Thomas F.; Ropers, H. Hilger; Najmabadi, Hossein
2015-01-01
Cognitive impairment or intellectual disability (ID) is a widespread neurodevelopmental disorder characterized by low IQ (below 70). ID is genetically heterogeneous and is estimated to affect 1–3% of the world’s population. In affected children from consanguineous families, autosomal recessive inheritance is common, and identifying the underlying genetic cause is an important issue in clinical genetics. In the framework of a larger project, aimed at identifying candidate genes for autosomal recessive intellectual disorder (ARID), we recently carried out single nucleotide polymorphism-based genome-wide linkage analysis in several families from Ardabil province in Iran. The identification of homozygosity-by-descent loci in these families, in combination with whole exome sequencing, led us to identify possible causative homozygous changes in two families. In the first family, a missense variant was found in GRM1 gene, while in the second family, a frameshift alteration was identified in TRMT1, both of which were found to co-segregate with the disease. GRM1, a known causal gene for autosomal recessive spinocerebellar ataxia (SCAR13, MIM#614831), encodes the metabotropic glutamate receptor1 (mGluR1). This gene plays an important role in synaptic plasticity and cerebellar development. Conversely, the TRMT1 gene encodes a tRNA methyltransferase that dimethylates a single guanine residue at position 26 of most tRNAs using S-adenosyl methionine as the methyl group donor. We recently presented TRMT1 as a candidate gene for ARID in a consanguineous Iranian family (Najmabadi et al., 2011). We believe that this second Iranian family with a biallelic loss-of-function mutation in TRMT1 gene supports the idea that this gene likely has function in development of the disorder. PMID:26308914
The ACBP gene family in Rhodnius prolixus
DEFF Research Database (Denmark)
Majerowicz, David; Hannibal-Bach, Hans K; Castro, Rodolfo S C
2016-01-01
The acyl-CoA-binding proteins (ACBP) constitute a family of conserved proteins that bind acyl-CoA with high affinity and protect it from hydrolysis. Thus, ACBPs may have essential roles in basal cellular lipid metabolism. The genome of the insect Rhodnius prolixus encodes five ACBP genes similar...
Identification of the 14-3-3 gene family in Rafflesia cantleyi
Rosli, Khadijah; Wan, Kiew-Lian
2018-04-01
Rafflesia is known to be the largest flower in the world. Due to its size and appearance, it is considered to be very unique. Little is known about the molecular biology of this rare parasitic flowering plant as it is very difficult to locate and has a short life-span as a flower. Physiological activities in plants are regulated by signalling regulators such as the members of the 14-3-3 gene family. The number of members of this gene family varies in plants and there are thirteen known members in Arabidopsis thaliana. Their role is to bind to phosphorylated targets to complete signal transduction processes. Sequence comparison using BLAST of transcriptome data from three different Rafflesia cantleyi floral bud stages against the Swissprot database revealed 27 transcripts annotated as members of this gene family. All of the transcripts were expressed during floral bud stage 1 (S1) while 14 and four transcripts were expressed during floral bud stages 2 (S2) and 3 (S3), respectively. Significant downregulation was recorded for six and nine transcripts at S1 vs. S2 and S2 vs. S3 respectively. This gene family may play a critical role as signalling regulators during the development of Rafflesia floral bud.
Chai, Wenbo; Jiang, Pengfei; Huang, Guoyu; Jiang, Haiyang; Li, Xiaoyu
2017-10-01
The TCP family is a group of plant-specific transcription factors. TCP genes encode proteins harboring bHLH structure, which is implicated in DNA binding and protein-protein interactions and known as the TCP domain. TCP genes play important roles in plant development and have been evolutionarily and functionally elaborated in various plants, however, no overall phylogenetic analysis or expression profiling of TCP genes in Zea mays has been reported. In the present study, a systematic analysis of molecular evolution and functional prediction of TCP family genes in maize ( Z . mays L.) has been conducted. We performed a genome-wide survey of TCP genes in maize, revealing the gene structure, chromosomal location and phylogenetic relationship of family members. Microsynteny between grass species and tissue-specific expression profiles were also investigated. In total, 29 TCP genes were identified in the maize genome, unevenly distributed on the 10 maize chromosomes. Additionally, ZmTCP genes were categorized into nine classes based on phylogeny and purifying selection may largely be responsible for maintaining the functions of maize TCP genes. What's more, microsynteny analysis suggested that TCP genes have been conserved during evolution. Finally, expression analysis revealed that most TCP genes are expressed in the stem and ear, which suggests that ZmTCP genes influence stem and ear growth. This result is consistent with the previous finding that maize TCP genes represses the growth of axillary organs and enables the formation of female inflorescences. Altogether, this study presents a thorough overview of TCP family in maize and provides a new perspective on the evolution of this gene family. The results also indicate that TCP family genes may be involved in development stage in plant growing conditions. Additionally, our results will be useful for further functional analysis of the TCP gene family in maize.
APC gene mutations and extraintestinal phenotype of familial adenomatous polyposis
Giardiello, F. M.; Petersen, G. M.; Piantadosi, S.; Gruber, S. B.; Traboulsi, E. I.; Offerhaus, G. J.; Muro, K.; Krush, A. J.; Booker, S. V.; Luce, M. C.; Laken, S. J.; Kinzler, K. W.; Vogelstein, B.; Hamilton, S. R.
1997-01-01
Familial adenomatous polyposis (FAP) is caused by germline mutation of the adenomatous polyposis coli (APC) gene on chromosome 5q. This study assessed genotype-phenotype correlations for extraintestinal lesions in FAP. Mutations of the APC gene were compared with the occurrence of seven
Min, Hyemin; Kawasaki, Ichiro; Gong, Joomi; Shim, Yhong-Hee
2015-03-01
Intake of caffeine during pregnancy can cause retardation of fetal development. Although the significant influence of caffeine on animal development is widely recognized, much remains unknown about its mode of action because of its pleiotropic effects on living organisms. In the present study, by using Caenorhabditis elegans as a model organism, the effects of caffeine on development were examined. Brood size, embryonic lethality, and percent larval development were investigated, and caffeine was found to inhibit the development of C. elegans at most of the stages in a dosage-dependent fashion. Upon treatment with 30 mM caffeine, the majority (86.1 ± 3.4%) of the L1 larvae were irreversibly arrested without further development. In contrast, many of the late-stage larvae survived and grew to adults when exposed to the same 30 mM caffeine. These results suggest that early-stage larvae are more susceptible to caffeine than later-stage larvae. To understand the metabolic responses to caffeine treatment, the levels of expression of cytochrome P450 (cyp) genes were examined with or without caffeine treatment using comparative micro-array, and it was found that the expression of 24 cyp genes was increased by more than 2-fold (p family was the most prominent. Interestingly, depletion of the cyp-35A family genes one-by-one or in combination through RNA interference resulted in partial rescue from early larval developmental arrest caused by caffeine treatment, suggesting that the high-level induction of cyp-35A family genes can be fatal to the development of early-stage larvae.
Identification and analysis of YELLOW protein family genes in the silkworm, Bombyx mori
Directory of Open Access Journals (Sweden)
Yi Yong-Zhu
2006-08-01
Full Text Available Abstract Background The major royal jelly proteins/yellow (MRJP/YELLOW family possesses several physiological and chemical functions in the development of Apis mellifera and Drosophila melanogaster. Each protein of the family has a conserved domain named MRJP. However, there is no report of MRJP/YELLOW family proteins in the Lepidoptera. Results Using the YELLOW protein sequence in Drosophila melanogaster to BLAST silkworm EST database, we found a gene family composed of seven members with a conserved MRJP domain each and named it YELLOW protein family of Bombyx mori. We completed the cDNA sequences with RACE method. The protein of each member possesses a MRJP domain and a putative cleavable signal peptide consisting of a hydrophobic sequence. In view of genetic evolution, the whole Bm YELLOW protein family composes a monophyletic group, which is distinctly separate from Drosophila melanogaster and Apis mellifera. We then showed the tissue expression profiles of Bm YELLOW protein family genes by RT-PCR. Conclusion A Bombyx mori YELLOW protein family is found to be composed of at least seven members. The low homogeneity and unique pattern of gene expression by each member among the family ensure us to prophesy that the members of Bm YELLOW protein family would play some important physiological functions in silkworm development.
Directory of Open Access Journals (Sweden)
Iva Tomalova
Full Text Available Taxonomically restricted genes (TRGs, i.e., genes that are restricted to a limited subset of phylogenetically related organisms, may be important in adaptation. In parasitic organisms, TRG-encoded proteins are possible determinants of the specificity of host-parasite interactions. In the root-knot nematode (RKN Meloidogyne incognita, the map-1 gene family encodes expansin-like proteins that are secreted into plant tissues during parasitism, thought to act as effectors to promote successful root infection. MAP-1 proteins exhibit a modular architecture, with variable number and arrangement of 58 and 13-aa domains in their central part. Here, we address the evolutionary origins of this gene family using a combination of bioinformatics and molecular biology approaches. Map-1 genes were solely identified in one single member of the phylum Nematoda, i.e., the genus Meloidogyne, and not detected in any other nematode, thus indicating that the map-1 gene family is indeed a TRG family. A phylogenetic analysis of the distribution of map-1 genes in RKNs further showed that these genes are specifically present in species that reproduce by mitotic parthenogenesis, with the exception of M. floridensis, and could not be detected in RKNs reproducing by either meiotic parthenogenesis or amphimixis. These results highlight the divergence between mitotic and meiotic RKN species as a critical transition in the evolutionary history of these parasites. Analysis of the sequence conservation and organization of repeated domains in map-1 genes suggests that gene duplication(s together with domain loss/duplication have contributed to the evolution of the map-1 family, and that some strong selection mechanism may be acting upon these genes to maintain their functional role(s in the specificity of the plant-RKN interactions.
Search for intracranial aneurysm susceptibility gene(s using Finnish families
Directory of Open Access Journals (Sweden)
Ryynänen Markku
2002-08-01
Full Text Available Abstract Background Cerebrovascular disease is the third leading cause of death in the United States, and about one-fourth of cerebrovascular deaths are attributed to ruptured intracranial aneurysms (IA. Epidemiological evidence suggests that IAs cluster in families, and are therefore probably genetic. Identification of individuals at risk for developing IAs by genetic tests will allow concentration of diagnostic imaging on high-risk individuals. We used model-free linkage analysis based on allele sharing with a two-stage design for a genome-wide scan to identify chromosomal regions that may harbor IA loci. Methods We previously estimated sibling relative risk in the Finnish population at between 9 and 16, and proceeded with a genome-wide scan for loci predisposing to IA. In 85 Finnish families with two or more affected members, 48 affected sibling pairs (ASPs were available for our genetic study. Power calculations indicated that 48 ASPs were adequate to identify chromosomal regions likely to harbor predisposing genes and that a liberal stage I lod score threshold of 0.8 provided a reasonable balance between detection of false positive regions and failure to detect real loci with moderate effect. Results Seven chromosomal regions exceeded the stage I lod score threshold of 0.8 and five exceeded 1.0. The most significant region, on chromosome 19q, had a maximum multipoint lod score (MLS of 2.6. Conclusions Our study provides evidence for the locations of genes predisposing to IA. Further studies are necessary to elucidate the genes and their role in the pathophysiology of IA, and to design genetic tests.
Expressional and Biochemical Characterization of Rice Disease Resistance Gene Xa3/Xa26 Family
Institute of Scientific and Technical Information of China (English)
Songjie Xu; Yinglong Cao; Xianghua Li; Shiping Wang
2007-01-01
The rice (Oryza sativa L.) Xa3/Xa26 gene, conferring race-specific resistance to bacterial blight disease and encoding a leucine-rich repeat (LRR) receptor kinase-like protein, belongs to a multigene family consisting of tandem clustered homologous genes, colocalizing with several uncharacterized genes for resistance to bacterial blight or fungal blast. To provide more information on the expressional and biochemical characteristics of the Xa3/Xa26 family, we analyzed the family members. Four Xa3/Xa26 family members in the indica rice variety Teqing, which carries a bacterial blight resistance gene with a chromosomal location tightly linked to Xa3/Xa26, and five Xa3/Xa26 family members in the japonica rice variety Nipponbare, which carries at least one uncharacterized blast resistance gene, were constitutively expressed in leaf tissue. The result suggests that some of the family members may be candidates of these uncharacterized resistance genes. At least five putative N-glycosylation sites in the LRR domain of XA3/XA26 protein are not glycosylated. The XA3/XA26 and its family members MRKa and MRKc all possess the consensus sequences of paired cysteines, which putatively function in dimerization of the receptor proteins for signal transduction, immediately before the first LRR and immediately after the last LRR. However, no homo-dimer between the XA3/XA26 molecules or hetero-dimer between XA3/XA26 and MRKa or MRKc were formed, indicating that XA3/XA26 protein might function either as a monomer or a hetero-dimer formed with other protein outside of the XA3/XA26 family. These results provide valuable information for further extensive investigation into this multiple protein family.
A family with X-linked anophthalmia: exclusion of SOX3 as a candidate gene.
Slavotinek, Anne; Lee, Stephen S; Hamilton, Steven P
2005-10-01
We report on a four-generation family with X-linked anophthalmia in four affected males and show that this family has LOD scores consistent with linkage to Xq27, the third family reported to be linked to the ANOP1 locus. We sequenced the SOX3 gene at Xq27 as a candidate gene for the X-linked anophthalmia based on the high homology of this gene to SOX2, a gene previously mutated in bilateral anophthlamia. However, no amino acid sequence alterations were identified in SOX3. We have improved the definition of the phenotype in males with anophthalmia linked to the ANOP1 locus, as microcephaly, ocular colobomas, and severe renal malformations have not been described in families linked to ANOP1. (c) 2005 Wiley-Liss, Inc.
Natural killer cell receptor genes in the family Equidae: not only Ly49.
Directory of Open Access Journals (Sweden)
Jan Futas
Full Text Available Natural killer (NK cells have important functions in immunity. NK recognition in mammals can be mediated through killer cell immunoglobulin-like receptors (KIR and/or killer cell lectin-like Ly49 receptors. Genes encoding highly variable NK cell receptors (NKR represent rapidly evolving genomic regions. No single conservative model of NKR genes was observed in mammals. Single-copy low polymorphic NKR genes present in one mammalian species may expand into highly polymorphic multigene families in other species. In contrast to other non-rodent mammals, multiple Ly49-like genes appear to exist in the horse, while no functional KIR genes were observed in this species. In this study, Ly49 and KIR were sought and their evolution was characterized in the entire family Equidae. Genomic sequences retrieved showed the presence of at least five highly conserved polymorphic Ly49 genes in horses, asses and zebras. These findings confirmed that the expansion of Ly49 occurred in the entire family. Several KIR-like sequences were also identified in the genome of Equids. Besides a previously identified non-functional KIR-Immunoglobulin-like transcript fusion gene (KIR-ILTA and two putative pseudogenes, a KIR3DL-like sequence was analyzed. In contrast to previous observations made in the horse, the KIR3DL sequence, genomic organization and mRNA expression suggest that all Equids might produce a functional KIR receptor protein molecule with a single non-mutated immune tyrosine-based inhibition motif (ITIM domain. No evidence for positive selection in the KIR3DL gene was found. Phylogenetic analysis including rhinoceros and tapir genomic DNA and deduced amino acid KIR-related sequences showed differences between families and even between species within the order Perissodactyla. The results suggest that the order Perissodactyla and its family Equidae with expanded Ly49 genes and with a potentially functional KIR gene may represent an interesting model for
Natural Killer Cell Receptor Genes in the Family Equidae: Not only Ly49
Futas, Jan; Horin, Petr
2013-01-01
Natural killer (NK) cells have important functions in immunity. NK recognition in mammals can be mediated through killer cell immunoglobulin-like receptors (KIR) and/or killer cell lectin-like Ly49 receptors. Genes encoding highly variable NK cell receptors (NKR) represent rapidly evolving genomic regions. No single conservative model of NKR genes was observed in mammals. Single-copy low polymorphic NKR genes present in one mammalian species may expand into highly polymorphic multigene families in other species. In contrast to other non-rodent mammals, multiple Ly49-like genes appear to exist in the horse, while no functional KIR genes were observed in this species. In this study, Ly49 and KIR were sought and their evolution was characterized in the entire family Equidae. Genomic sequences retrieved showed the presence of at least five highly conserved polymorphic Ly49 genes in horses, asses and zebras. These findings confirmed that the expansion of Ly49 occurred in the entire family. Several KIR-like sequences were also identified in the genome of Equids. Besides a previously identified non-functional KIR-Immunoglobulin-like transcript fusion gene (KIR-ILTA) and two putative pseudogenes, a KIR3DL-like sequence was analyzed. In contrast to previous observations made in the horse, the KIR3DL sequence, genomic organization and mRNA expression suggest that all Equids might produce a functional KIR receptor protein molecule with a single non-mutated immune tyrosine-based inhibition motif (ITIM) domain. No evidence for positive selection in the KIR3DL gene was found. Phylogenetic analysis including rhinoceros and tapir genomic DNA and deduced amino acid KIR-related sequences showed differences between families and even between species within the order Perissodactyla. The results suggest that the order Perissodactyla and its family Equidae with expanded Ly49 genes and with a potentially functional KIR gene may represent an interesting model for evolutionary biology of
[Genome-wide identification and bioinformatic analysis of PPR gene family in tomato].
Ding, Anming; Li, Ling; Qu, Xu; Sun, Tingting; Chen, Yaqiong; Zong, Peng; Li, Zunqiang; Gong, Daping; Sun, Yuhe
2014-01-01
Pentatricopeptide repeats (PPRs) genes constitute one of the largest gene families in plants, which play a broad and essential role in plant growth and development. In this study, the protein sequences annotated by the tomato (S. lycopersicum L.) genome project were screened with the Pfam PPR sequences. A total of 471 putative PPR-encoding genes were identified. Based on the motifs defined in A. thaliana L., protein structure and conserved sequences for each tomato motif were analyzed. We also analyzed phylogenetic relationship, subcellular localization, expression and GO analysis of the identified gene sequences. Our results demonstrate that tomato PPR gene family contains two subfamilies, P and PLS, each accounting for half of the family. PLS subfamily can be divided into four subclasses i.e., PLS, E, E+ and DYW. Each subclass of sequences forms a clade in the phylogenetic tree. The PPR motifs were found highly conserved among plants. The tomato PPR genes were distributed over 12 chromosomes and most of them lack introns. The majority of PPR proteins harbor mitochondrial or chloroplast localization sequences, whereas GO analysis showed that most PPR proteins participate in RNA-related biological processes.
NDP gene mutations in 14 French families with Norrie disease.
Royer, Ghislaine; Hanein, Sylvain; Raclin, Valérie; Gigarel, Nadine; Rozet, Jean-Michel; Munnich, Arnold; Steffann, Julie; Dufier, Jean-Louis; Kaplan, Josseline; Bonnefont, Jean-Paul
2003-12-01
Norrie disease is a rare X-inked recessive condition characterized by congenital blindness and occasionally deafness and mental retardation in males. This disease has been ascribed to mutations in the NDP gene on chromosome Xp11.1. Previous investigations of the NDP gene have identified largely sixty disease-causing sequence variants. Here, we report on ten different NDP gene allelic variants in fourteen of a series of 21 families fulfilling inclusion criteria. Two alterations were intragenic deletions and eight were nucleotide substitutions or splicing variants, six of them being hitherto unreported, namely c.112C>T (p.Arg38Cys), c.129C>G (p.His43Gln), c.133G>A (p.Val45Met), c.268C>T (p.Arg90Cys), c.382T>C (p.Cys128Arg), c.23479-1G>C (unknown). No NDP gene sequence variant was found in seven of the 21 families. This observation raises the issue of misdiagnosis, phenocopies, or existence of other X-linked or autosomal genes, the mutations of which would mimic the Norrie disease phenotype. Copyright 2003 Wiley-Liss, Inc.
Huson, Daniel H; Tappu, Rewati; Bazinet, Adam L; Xie, Chao; Cummings, Michael P; Nieselt, Kay; Williams, Rohan
2017-01-25
Microbiome sequencing projects typically collect tens of millions of short reads per sample. Depending on the goals of the project, the short reads can either be subjected to direct sequence analysis or be assembled into longer contigs. The assembly of whole genomes from metagenomic sequencing reads is a very difficult problem. However, for some questions, only specific genes of interest need to be assembled. This is then a gene-centric assembly where the goal is to assemble reads into contigs for a family of orthologous genes. We present a new method for performing gene-centric assembly, called protein-alignment-guided assembly, and provide an implementation in our metagenome analysis tool MEGAN. Genes are assembled on the fly, based on the alignment of all reads against a protein reference database such as NCBI-nr. Specifically, the user selects a gene family based on a classification such as KEGG and all reads binned to that gene family are assembled. Using published synthetic community metagenome sequencing reads and a set of 41 gene families, we show that the performance of this approach compares favorably with that of full-featured assemblers and that of a recently published HMM-based gene-centric assembler, both in terms of the number of reference genes detected and of the percentage of reference sequence covered. Protein-alignment-guided assembly of orthologous gene families complements whole-metagenome assembly in a new and very useful way.
Diagnosing CADASIL using MRI: evidence from families with known mutations of Notch 3 gene
International Nuclear Information System (INIS)
Chawda, S.J.; Lange, R.P.J. de; St-Clair, D.; Hourihan, M.D.; Halpin, S.F.S.
2000-01-01
Clinical data and MRI findings are presented on 18 subjects from two families with neuropathologically confirmed CADASIL. DNA analysis revealed mutations in exon 4 of Notch 3 gene in both families. All family members with mutations in Notch 3 gene had extensive abnormalities on MRI, principally lesions in the white matter of the frontal lobes and in the external capsules. Of several family members in whom a diagnosis of CADASIL was suspected on the basis of minor symptoms, one had MRI changes consistent with CADASIL; none of these cases carried a mutation in the Notch 3 gene. MRI and clinical features that may alert the radiologist to the diagnosis of CADASIL are reviewed. However, a wide differential diagnosis exists for the MRI appearances of CADASIL, including multiple sclerosis and small-vessel disease secondary to hypertension. The definitive diagnosis cannot be made on MRI alone and requires additional evidence, where available, from a positive family history and by screening DNA for mutations of Notch 3 gene. (orig.)
Genome-wide analysis of the WRKY gene family in cotton.
Dou, Lingling; Zhang, Xiaohong; Pang, Chaoyou; Song, Meizhen; Wei, Hengling; Fan, Shuli; Yu, Shuxun
2014-12-01
WRKY proteins are major transcription factors involved in regulating plant growth and development. Although many studies have focused on the functional identification of WRKY genes, our knowledge concerning many areas of WRKY gene biology is limited. For example, in cotton, the phylogenetic characteristics, global expression patterns, molecular mechanisms regulating expression, and target genes/pathways of WRKY genes are poorly characterized. Therefore, in this study, we present a genome-wide analysis of the WRKY gene family in cotton (Gossypium raimondii and Gossypium hirsutum). We identified 116 WRKY genes in G. raimondii from the completed genome sequence, and we cloned 102 WRKY genes in G. hirsutum. Chromosomal location analysis indicated that WRKY genes in G. raimondii evolved mainly from segmental duplication followed by tandem amplifications. Phylogenetic analysis of alga, bryophyte, lycophyta, monocot and eudicot WRKY domains revealed family member expansion with increasing complexity of the plant body. Microarray, expression profiling and qRT-PCR data revealed that WRKY genes in G. hirsutum may regulate the development of fibers, anthers, tissues (roots, stems, leaves and embryos), and are involved in the response to stresses. Expression analysis showed that most group II and III GhWRKY genes are highly expressed under diverse stresses. Group I members, representing the ancestral form, seem to be insensitive to abiotic stress, with low expression divergence. Our results indicate that cotton WRKY genes might have evolved by adaptive duplication, leading to sensitivity to diverse stresses. This study provides fundamental information to inform further analysis and understanding of WRKY gene functions in cotton species.
Genome organization and expression of the rat ACBP gene family
DEFF Research Database (Denmark)
Mandrup, S; Andreasen, P H; Knudsen, J
1993-01-01
pool former. We have molecularly cloned and characterized the rat ACBP gene family which comprises one expressed and four processed pseudogenes. One of these was shown to exist in two allelic forms. A comprehensive computer-aided analysis of the promoter region of the expressed ACBP gene revealed...
Evolutionary relationship and structural characterization of the EPF/EPFL gene family.
Takata, Naoki; Yokota, Kiyonobu; Ohki, Shinya; Mori, Masashi; Taniguchi, Toru; Kurita, Manabu
2013-01-01
EPF1-EPF2 and EPFL9/Stomagen act antagonistically in regulating leaf stomatal density. The aim of this study was to elucidate the evolutionary functional divergence of EPF/EPFL family genes. Phylogenetic analyses showed that AtEPFL9/Stomagen-like genes are conserved only in vascular plants and are closely related to AtEPF1/EPF2-like genes. Modeling showed that EPF/EPFL peptides share a common 3D structure that is constituted of a scaffold and loop. Molecular dynamics simulation suggested that AtEPF1/EPF2-like peptides form an additional disulfide bond in their loop regions and show greater flexibility in these regions than AtEPFL9/Stomagen-like peptides. This study uncovered the evolutionary relationship and the conformational divergence of proteins encoded by the EPF/EPFL family genes.
[Study of gene mutation and pathogenetic mechanism for a family with Waardenburg syndrome].
Chen, Hongsheng; Liao, Xinbin; Liu, Yalan; He, Chufeng; Zhang, Hua; Jiang, Lu; Feng, Yong; Mei, Lingyun
2017-08-10
To explore the pathogenetic mechanism of a family affected with Waardenburg syndrome. Clinical data of the family was collected. Potential mutation of the MITF, SOX10 and SNAI2 genes were screened. Plasmids for wild type (WT) and mutant MITF proteins were constructed to determine their exogenous expression and subcellular distribution by Western blotting and immunofluorescence assay, respectively. A heterozygous c.763C>T (p.R255X) mutation was detected in exon 8 of the MITF gene in the proband and all other patients from the family. No pathological mutation of the SOX10 and SNAI2 genes was detected. The DNA sequences of plasmids of MITF wild and mutant MITF R255X were confirmed. Both proteins were detected with the expected size. WT MITF protein only localized in the nucleus, whereas R255X protein showed aberrant localization in the nucleus as well as the cytoplasm. The c.763C>T mutation of the MITF gene probably underlies the disease in this family. The mutation can affect the subcellular distribution of MITF proteins in vitro, which may shed light on the molecular mechanism of Waardenburg syndrome caused by mutations of the MITF gene.
A novel AVP gene mutation in a Turkish family with neurohypophyseal diabetes insipidus.
Ilhan, M; Tiryakioglu, N O; Karaman, O; Coskunpinar, E; Yildiz, R S; Turgut, S; Tiryakioglu, D; Toprak, H; Tasan, E
2016-03-01
Familial neurohypophyseal diabetes insipidus (FNDI) is a rare, autosomal dominant, inherited disorder which is characterized by severe polydipsia and polyuria generally presenting in early childhood. In the present study, we aimed to analyze the AVP gene in a Turkish family with FNDI. Four patients with neurohypophyseal diabetes insipidus and ten healthy members of the family were studied. Diabetes insipidus was diagnosed by the water deprivation test in affected family members. Mutation analysis was performed by sequencing the whole coding region of AVP-NPII gene using DNA isolated from peripheral blood samples. Urine osmolality was low (C in all patients. c.-3A>C mutation in 5'UTR of AVP gene in this family might lead to the truncation of signal peptide, aggregation of AVP in the cytoplasm instead of targeting in the endoplasmic reticulum, thereby could disrupt AVP secretion without causing neuronal cytotoxicity, which might explain the presence of bright spot. The predicted effect of this mutation should be investigated by further in vitro molecular studies.
The polyphenol oxidase gene family in land plants: Lineage-specific duplication and expansion
Directory of Open Access Journals (Sweden)
Tran Lan T
2012-08-01
Full Text Available Abstract Background Plant polyphenol oxidases (PPOs are enzymes that typically use molecular oxygen to oxidize ortho-diphenols to ortho-quinones. These commonly cause browning reactions following tissue damage, and may be important in plant defense. Some PPOs function as hydroxylases or in cross-linking reactions, but in most plants their physiological roles are not known. To better understand the importance of PPOs in the plant kingdom, we surveyed PPO gene families in 25 sequenced genomes from chlorophytes, bryophytes, lycophytes, and flowering plants. The PPO genes were then analyzed in silico for gene structure, phylogenetic relationships, and targeting signals. Results Many previously uncharacterized PPO genes were uncovered. The moss, Physcomitrella patens, contained 13 PPO genes and Selaginella moellendorffii (spike moss and Glycine max (soybean each had 11 genes. Populus trichocarpa (poplar contained a highly diversified gene family with 11 PPO genes, but several flowering plants had only a single PPO gene. By contrast, no PPO-like sequences were identified in several chlorophyte (green algae genomes or Arabidopsis (A. lyrata and A. thaliana. We found that many PPOs contained one or two introns often near the 3’ terminus. Furthermore, N-terminal amino acid sequence analysis using ChloroP and TargetP 1.1 predicted that several putative PPOs are synthesized via the secretory pathway, a unique finding as most PPOs are predicted to be chloroplast proteins. Phylogenetic reconstruction of these sequences revealed that large PPO gene repertoires in some species are mostly a consequence of independent bursts of gene duplication, while the lineage leading to Arabidopsis must have lost all PPO genes. Conclusion Our survey identified PPOs in gene families of varying sizes in all land plants except in the genus Arabidopsis. While we found variation in intron numbers and positions, overall PPO gene structure is congruent with the phylogenetic
Molecular evolution of the polyamine oxidase gene family in Metazoa
Directory of Open Access Journals (Sweden)
Polticelli Fabio
2012-06-01
Full Text Available Abstract Background Polyamine oxidase enzymes catalyze the oxidation of polyamines and acetylpolyamines. Since polyamines are basic regulators of cell growth and proliferation, their homeostasis is crucial for cell life. Members of the polyamine oxidase gene family have been identified in a wide variety of animals, including vertebrates, arthropodes, nematodes, placozoa, as well as in plants and fungi. Polyamine oxidases (PAOs from yeast can oxidize spermine, N1-acetylspermine, and N1-acetylspermidine, however, in vertebrates two different enzymes, namely spermine oxidase (SMO and acetylpolyamine oxidase (APAO, specifically catalyze the oxidation of spermine, and N1-acetylspermine/N1-acetylspermidine, respectively. Little is known about the molecular evolutionary history of these enzymes. However, since the yeast PAO is able to catalyze the oxidation of both acetylated and non acetylated polyamines, and in vertebrates these functions are addressed by two specialized polyamine oxidase subfamilies (APAO and SMO, it can be hypothesized an ancestral reference for the former enzyme from which the latter would have been derived. Results We analysed 36 SMO, 26 APAO, and 14 PAO homologue protein sequences from 54 taxa including various vertebrates and invertebrates. The analysis of the full-length sequences and the principal domains of vertebrate and invertebrate PAOs yielded consensus primary protein sequences for vertebrate SMOs and APAOs, and invertebrate PAOs. This analysis, coupled to molecular modeling techniques, also unveiled sequence regions that confer specific structural and functional properties, including substrate specificity, by the different PAO subfamilies. Molecular phylogenetic trees revealed a basal position of all the invertebrates PAO enzymes relative to vertebrate SMOs and APAOs. PAOs from insects constitute a monophyletic clade. Two PAO variants sampled in the amphioxus are basal to the dichotomy between two well supported
Linkage and candidate gene analysis of X-linked familial exudative vitreoretinopathy.
Shastry, B S; Hejtmancik, J F; Plager, D A; Hartzer, M K; Trese, M T
1995-05-20
Familial exudative vitreoretinopathy (FEVR) is a hereditary eye disorder characterized by avascularity of the peripheral retina, retinal exudates, tractional detachment, and retinal folds. The disorder is most commonly transmitted as an autosomal dominant trait, but X-linked transmission also occurs. To initiate the process of identifying the gene responsible for the X-linked disorder, linkage analysis has been performed with three previously unreported three- or four-generation families. Two-point analysis showed linkage to MAOA (Zmax = 2.1, theta max = 0) and DXS228 (Zmax = 0.5, theta max = 0.11), and this was further confirmed by multipoint analysis with these same markers (Zmax = 2.81 at MAOA), which both lie near the gene causing Norrie disease. Molecular genetic analysis further reveals a missense mutation (R121W) in the third exon of the Norrie's disease gene that perfectly cosegregates with the disease through three generations in one family. This mutation was not detected in the unaffected family members and six normal unrelated controls, suggesting that it is likely to be the pathogenic mutation. Additionally, a polymorphic missense mutation (H127R) was detected in a severely affected patient.
Li, Fupeng; Hao, Chaoyun; Yan, Lin; Wu, Baoduo; Qin, Xiaowei; Lai, Jianxiong; Song, Yinghui
2015-09-01
In higher plants, sucrose synthase (Sus, EC 2.4.1.13) is widely considered as a key enzyme involved in sucrose metabolism. Although, several paralogous genes encoding different isozymes of Sus have been identified and characterized in multiple plant genomes, to date detailed information about the Sus genes is lacking for cacao. This study reports the identification of six novel Sus genes from economically important cacao tree. Analyses of the gene structure and phylogeny of the Sus genes demonstrated evolutionary conservation in the Sus family across cacao and other plant species. The expression of cacao Sus genes was investigated via real-time PCR in various tissues, different developmental phases of leaf, flower bud and pod. The Sus genes exhibited distinct but partially redundant expression profiles in cacao, with TcSus1, TcSus5 and TcSus6, being the predominant genes in the bark with phloem, TcSus2 predominantly expressing in the seed during the stereotype stage. TcSus3 and TcSus4 were significantly detected more in the pod husk and seed coat along the pod development, and showed development dependent expression profiles in the cacao pod. These results provide new insights into the evolution, and basic information that will assist in elucidating the functions of cacao Sus gene family.
Mitochondrial Genomes of Kinorhyncha: trnM Duplication and New Gene Orders within Animals
Popova, Olga V.; Mikhailov, Kirill V.; Nikitin, Mikhail A.; Logacheva, Maria D.; Penin, Aleksey A.; Muntyan, Maria S.; Kedrova, Olga S.; Petrov, Nikolai B.; Panchin, Yuri V.; Aleoshin, Vladimir V.
2016-01-01
Many features of mitochondrial genomes of animals, such as patterns of gene arrangement, nucleotide content and substitution rate variation are extensively used in evolutionary and phylogenetic studies. Nearly 6,000 mitochondrial genomes of animals have already been sequenced, covering the majority of animal phyla. One of the groups that escaped mitogenome sequencing is phylum Kinorhyncha-an isolated taxon of microscopic worm-like ecdysozoans. The kinorhynchs are thought to be one of the earl...
Common mutations identified in the MLH1 gene in familial Lynch syndrome
Directory of Open Access Journals (Sweden)
Jisha Elias
2017-12-01
In this study we identified three families with Lynch syndrome from a rural cancer center in western India (KCHRC, Goraj, Gujarat, where 70-75 CRC patients are seen annually. DNA isolated from the blood of consented family members of all three families (8-10 members/family was subjected to NGS sequencing methods on an Illumina HiSeq 4000 platform. We identified unique mutations in the MLH1 gene in all three HNPCC family members. Two of the three unrelated families shared a common mutation (154delA and 156delA. Total 8 members of a family were identified as carriers for 156delA mutation of which 5 members were unaffected while 3 were affected (age of onset: 1 member <30yrs & 2 were>40yr. The family with 154delA mutation showed 2 affected members (>40yr carrying the mutations.LYS618DEL mutation found in 8 members of the third family showed that both affected and unaffected carried the mutation. Thus the common mutations identified in the MLH1 gene in two unrelated families had a high risk for lynch syndrome especially above the age of 40.
Harduin-Lepers, Anne; Petit, Daniel; Mollicone, Rosella; Delannoy, Philippe; Petit, Jean-Michel; Oriol, Rafael
2008-09-23
The animal sialyltransferases, which catalyze the transfer of sialic acid to the glycan moiety of glycoconjugates, are subdivided into four families: ST3Gal, ST6Gal, ST6GalNAc and ST8Sia, based on acceptor sugar specificity and glycosidic linkage formed. Despite low overall sequence identity between each sialyltransferase family, all sialyltransferases share four conserved peptide motifs (L, S, III and VS) that serve as hallmarks for the identification of the sialyltransferases. Currently, twenty subfamilies have been described in mammals and birds. Examples of the four sialyltransferase families have also been found in invertebrates. Focusing on the ST8Sia family, we investigated the origin of the three groups of alpha2,8-sialyltransferases demonstrated in vertebrates to carry out poly-, oligo- and mono-alpha2,8-sialylation. We identified in the genome of invertebrate deuterostomes, orthologs to the common ancestor for each of the three vertebrate ST8Sia groups and a set of novel genes named ST8Sia EX, not found in vertebrates. All these ST8Sia sequences share a new conserved family-motif, named "C-term" that is involved in protein folding, via an intramolecular disulfide bridge. Interestingly, sequences from Branchiostoma floridae orthologous to the common ancestor of polysialyltransferases possess a polysialyltransferase domain (PSTD) and those orthologous to the common ancestor of oligosialyltransferases possess a new ST8Sia III-specific motif similar to the PSTD. In osteichthyans, we have identified two new subfamilies. In addition, we describe the expression profile of ST8Sia genes in Danio rerio. Polysialylation appeared early in the deuterostome lineage. The recent release of several deuterostome genome databases and paralogons combined with synteny analysis allowed us to obtain insight into events at the gene level that led to the diversification of the ST8Sia genes, with their corresponding enzymatic activities, in both invertebrates and vertebrates. The
Directory of Open Access Journals (Sweden)
Petit Jean-Michel
2008-09-01
Full Text Available Abstract Background The animal sialyltransferases, which catalyze the transfer of sialic acid to the glycan moiety of glycoconjugates, are subdivided into four families: ST3Gal, ST6Gal, ST6GalNAc and ST8Sia, based on acceptor sugar specificity and glycosidic linkage formed. Despite low overall sequence identity between each sialyltransferase family, all sialyltransferases share four conserved peptide motifs (L, S, III and VS that serve as hallmarks for the identification of the sialyltransferases. Currently, twenty subfamilies have been described in mammals and birds. Examples of the four sialyltransferase families have also been found in invertebrates. Focusing on the ST8Sia family, we investigated the origin of the three groups of α2,8-sialyltransferases demonstrated in vertebrates to carry out poly-, oligo- and mono-α2,8-sialylation. Results We identified in the genome of invertebrate deuterostomes, orthologs to the common ancestor for each of the three vertebrate ST8Sia groups and a set of novel genes named ST8Sia EX, not found in vertebrates. All these ST8Sia sequences share a new conserved family-motif, named "C-term" that is involved in protein folding, via an intramolecular disulfide bridge. Interestingly, sequences from Branchiostoma floridae orthologous to the common ancestor of polysialyltransferases possess a polysialyltransferase domain (PSTD and those orthologous to the common ancestor of oligosialyltransferases possess a new ST8Sia III-specific motif similar to the PSTD. In osteichthyans, we have identified two new subfamilies. In addition, we describe the expression profile of ST8Sia genes in Danio rerio. Conclusion Polysialylation appeared early in the deuterostome lineage. The recent release of several deuterostome genome databases and paralogons combined with synteny analysis allowed us to obtain insight into events at the gene level that led to the diversification of the ST8Sia genes, with their corresponding enzymatic
The importance of melanoma inhibitory activity gene family in the tumor progression of oral cancer.
Sasahira, Tomonori; Bosserhoff, Anja Katrin; Kirita, Tadaaki
2018-05-01
Oral squamous cell carcinoma has a high potential for locoregional invasion and nodal metastasis. Consequently, early detection of such malignancies is of immense importance. The melanoma inhibitory activity (MIA) gene family comprises MIA, MIA2, transport and Golgi organization protein 1 (TANGO), and otoraplin (OTOR). These members of the MIA gene family have a highly conserved Src homology 3 (SH3)-like structure. Although the molecules of this family share 34-45% amino acid homology and 47-59% cDNA sequence homology, those members, excluding OTOR, play different tumor-associated functions. MIA has a pivotal role in the progression and metastasis of melanoma; MIA2 and TANGO have been suggested to possess tumor-suppressive functions; and OTOR is uniquely expressed in cochlea of the inner ear. Therefore, the definite functions of the MIA gene family in cancer cells remain unclear. Since the members of the MIA gene family are secreted proteins, these molecules might be useful tumor markers that can be detected in the body fluids, including serum and saliva. In this review, we described the molecular biological functions of the MIA gene family in oral cancer. © 2018 Japanese Society of Pathology and John Wiley & Sons Australia, Ltd.
Chevanne, Damien; Saupe, Sven J; Clavé, Corinne; Paoletti, Mathieu
2010-05-06
Genes involved in non-self recognition and host defence are typically capable of rapid diversification and exploit specialized genetic mechanism to that end. Fungi display a non-self recognition phenomenon termed heterokaryon incompatibility that operates when cells of unlike genotype fuse and leads to the cell death of the fusion cell. In the fungus Podospora anserina, three genes controlling this allorecognition process het-d, het-e and het-r are paralogs belonging to the same hnwd gene family. HNWD proteins are STAND proteins (signal transduction NTPase with multiple domains) that display a WD-repeat domain controlling recognition specificity. Based on genomic sequence analysis of different P. anserina isolates, it was established that repeat regions of all members of the gene family are extremely polymorphic and undergoing concerted evolution arguing for frequent recombination within and between family members. Herein, we directly analyzed the genetic instability and diversification of this allorecognition gene family. We have constituted a collection of 143 spontaneous mutants of the het-R (HNWD2) and het-E (hnwd5) genes with altered recognition specificities. The vast majority of the mutants present rearrangements in the repeat arrays with deletions, duplications and other modifications as well as creation of novel repeat unit variants. We investigate the extreme genetic instability of these genes and provide a direct illustration of the diversification strategy of this eukaryotic allorecognition gene family.
Evolutionary relationship and structural characterization of the EPF/EPFL gene family.
Directory of Open Access Journals (Sweden)
Naoki Takata
Full Text Available EPF1-EPF2 and EPFL9/Stomagen act antagonistically in regulating leaf stomatal density. The aim of this study was to elucidate the evolutionary functional divergence of EPF/EPFL family genes. Phylogenetic analyses showed that AtEPFL9/Stomagen-like genes are conserved only in vascular plants and are closely related to AtEPF1/EPF2-like genes. Modeling showed that EPF/EPFL peptides share a common 3D structure that is constituted of a scaffold and loop. Molecular dynamics simulation suggested that AtEPF1/EPF2-like peptides form an additional disulfide bond in their loop regions and show greater flexibility in these regions than AtEPFL9/Stomagen-like peptides. This study uncovered the evolutionary relationship and the conformational divergence of proteins encoded by the EPF/EPFL family genes.
Directory of Open Access Journals (Sweden)
Yan Liangzhen
2012-11-01
Full Text Available Abstract Background The genomes of three major mosquito vectors of human diseases, Anopheles gambiae, Aedes aegypti, and Culex pipiens quinquefasciatus, have been previously sequenced. C. p. quinquefasciatus has the largest number of predicted protein-coding genes, which partially results from the expansion of three detoxification gene families: cytochrome P450 monooxygenases (P450, glutathione S-transferases (GST, and carboxyl/cholinesterases (CCE. However, unlike An. gambiae and Ae. aegypti, which have large amounts of gene expression data, C. p. quinquefasciatus has limited transcriptomic resources. Knowledge of complete gene expression information is very important for the exploration of the functions of genes involved in specific biological processes. In the present study, the three detoxification gene families of C. p. quinquefasciatus were analyzed for phylogenetic classification and compared with those of three other dipteran insects. Gene expression during various developmental stages and the differential expression responsible for parathion resistance were profiled using the digital gene expression (DGE technique. Results A total of 302 detoxification genes were found in C. p. quinquefasciatus, including 71 CCE, 196 P450, and 35 cytosolic GST genes. Compared with three other dipteran species, gene expansion in Culex mainly occurred in the CCE and P450 families, where the genes of α-esterases, juvenile hormone esterases, and CYP325 of the CYP4 subfamily showed the most pronounced expansion on the genome. For the five DGE libraries, 3.5-3.8 million raw tags were generated and mapped to 13314 reference genes. Among 302 detoxification genes, 225 (75% were detected for expression in at least one DGE library. One fourth of the CCE and P450 genes were detected uniquely in one stage, indicating potential developmentally regulated expression. A total of 1511 genes showed different expression levels between a parathion-resistant and a
Alvarez, José M; Bueno, Natalia; Cañas, Rafael A; Avila, Concepción; Cánovas, Francisco M; Ordás, Ricardo J
2018-02-01
WUSCHEL-RELATED HOMEOBOX (WOX) genes are key players controlling stem cells in plants and can be divided into three clades according to the time of their appearance during plant evolution. Our knowledge of stem cell function in vascular plants other than angiosperms is limited, they separated from gymnosperms ca 300 million years ago and their patterning during embryogenesis differs significantly. For this reason, we have used the model gymnosperm Pinus pinaster to identify WOX genes and perform a thorough analysis of their gene expression patterns. Using transcriptomic data from a comprehensive range of tissues and stages of development we have shown three major outcomes: that the P. pinaster genome encodes at least fourteen members of the WOX family spanning all the major clades, that the genome of gymnosperms contains a WOX gene with no homologues in angiosperms representing a transitional stage between intermediate- and WUS-clade proteins, and that we can detect discrete WUS and WOX5 transcripts for the first time in a gymnosperm. Copyright © 2017 Elsevier Masson SAS. All rights reserved.
Schuurs-Hoeijmakers, Janneke H M; Vulto-van Silfhout, Anneke T; Vissers, Lisenka E L M; van de Vondervoort, Ilse I G M; van Bon, Bregje W M; de Ligt, Joep; Gilissen, Christian; Hehir-Kwa, Jayne Y; Neveling, Kornelia; del Rosario, Marisol; Hira, Gausiya; Reitano, Santina; Vitello, Aurelio; Failla, Pinella; Greco, Donatella; Fichera, Marco; Galesi, Ornella; Kleefstra, Tjitske; Greally, Marie T; Ockeloen, Charlotte W; Willemsen, Marjolein H; Bongers, Ernie M H F; Janssen, Irene M; Pfundt, Rolph; Veltman, Joris A; Romano, Corrado; Willemsen, Michèl A; van Bokhoven, Hans; Brunner, Han G; de Vries, Bert B A; de Brouwer, Arjan P M
2013-12-01
Intellectual disability (ID) is a common neurodevelopmental disorder affecting 1-3% of the general population. Mutations in more than 10% of all human genes are considered to be involved in this disorder, although the majority of these genes are still unknown. We investigated 19 small non-consanguineous families with two to five affected siblings in order to identify pathogenic gene variants in known, novel and potential ID candidate genes. Non-consanguineous families have been largely ignored in gene identification studies as small family size precludes prior mapping of the genetic defect. Using exome sequencing, we identified pathogenic mutations in three genes, DDHD2, SLC6A8, and SLC9A6, of which the latter two have previously been implicated in X-linked ID phenotypes. In addition, we identified potentially pathogenic mutations in BCORL1 on the X-chromosome and in MCM3AP, PTPRT, SYNE1, and ZNF528 on autosomes. We show that potentially pathogenic gene variants can be identified in small, non-consanguineous families with as few as two affected siblings, thus emphasising their value in the identification of syndromic and non-syndromic ID genes.
Santos, Maria C L G; Hart, P Suzanne; Ramaswami, Mukundhan; Kanno, Cláudia M; Hart, Thomas C; Line, Sergio R P
2007-01-31
Amelogenesis imperfecta (AI) is a genetically heterogeneous group of diseases that result in defective development of tooth enamel. Mutations in several enamel proteins and proteinases have been associated with AI. The object of this study was to evaluate evidence of etiology for the six major candidate gene loci in two Brazilian families with AI. Genomic DNA was obtained from family members and all exons and exon-intron boundaries of the ENAM, AMBN, AMELX, MMP20, KLK4 and Amelotin gene were amplified and sequenced. Each family was also evaluated for linkage to chromosome regions known to contain genes important in enamel development. The present study indicates that the AI in these two families is not caused by any of the known loci for AI or any of the major candidate genes proposed in the literature. These findings indicate extensive genetic heterogeneity for non-syndromic AI.
Genome-Wide Analysis of the Aquaporin Gene Family in Chickpea (Cicer arietinum L.).
Deokar, Amit A; Tar'an, Bunyamin
2016-01-01
Aquaporins (AQPs) are essential membrane proteins that play critical role in the transport of water and many other solutes across cell membranes. In this study, a comprehensive genome-wide analysis identified 40 AQP genes in chickpea ( Cicer arietinum L.). A complete overview of the chickpea AQP (CaAQP) gene family is presented, including their chromosomal locations, gene structure, phylogeny, gene duplication, conserved functional motifs, gene expression, and conserved promoter motifs. To understand AQP's evolution, a comparative analysis of chickpea AQPs with AQP orthologs from soybean, Medicago, common bean, and Arabidopsis was performed. The chickpea AQP genes were found on all of the chickpea chromosomes, except chromosome 7, with a maximum of six genes on chromosome 6, and a minimum of one gene on chromosome 5. Gene duplication analysis indicated that the expansion of chickpea AQP gene family might have been due to segmental and tandem duplications. CaAQPs were grouped into four subfamilies including 15 NOD26-like intrinsic proteins (NIPs), 13 tonoplast intrinsic proteins (TIPs), eight plasma membrane intrinsic proteins (PIPs), and four small basic intrinsic proteins (SIPs) based on sequence similarities and phylogenetic position. Gene structure analysis revealed a highly conserved exon-intron pattern within CaAQP subfamilies supporting the CaAQP family classification. Functional prediction based on conserved Ar/R selectivity filters, Froger's residues, and specificity-determining positions suggested wide differences in substrate specificity among the subfamilies of CaAQPs. Expression analysis of the AQP genes indicated that some of the genes are tissue-specific, whereas few other AQP genes showed differential expression in response to biotic and abiotic stresses. Promoter profiling of CaAQP genes for conserved cis -acting regulatory elements revealed enrichment of cis -elements involved in circadian control, light response, defense and stress responsiveness
IL26 gene inactivation in Equidae.
Shakhsi-Niaei, M; Drögemüller, M; Jagannathan, V; Gerber, V; Leeb, T
2013-12-01
Interleukin-26 (IL26) is a member of the IL10 cytokine family. The IL26 gene is located between two other well-known cytokines genes of this family encoding interferon-gamma (IFNG) and IL22 in an evolutionary conserved gene cluster. In contrast to humans and most other mammals, mice lack a functional Il26 gene. We analyzed the genome sequences of other vertebrates for the presence or absence of functional IL26 orthologs and found that the IL26 gene has also become inactivated in several equid species. We detected a one-base pair frameshift deletion in exon 2 of the IL26 gene in the domestic horse (Equus caballus), Przewalski horse (Equus przewalskii) and donkey (Equus asinus). The remnant IL26 gene in the horse is still transcribed and gives rise to at least five alternative transcripts. None of these transcripts share a conserved open reading frame with the human IL26 gene. A comparative analysis across diverse vertebrates revealed that the IL26 gene has also independently been inactivated in a few other mammals, including the African elephant and the European hedgehog. The IL26 gene thus appears to be highly variable, and the conserved open reading frame has been lost several times during mammalian evolution. © 2013 The Authors, Animal Genetics © 2013 Stichting International Foundation for Animal Genetics.
From animal models to human disease: a genetic approach for personalized medicine in ALS.
Picher-Martel, Vincent; Valdmanis, Paul N; Gould, Peter V; Julien, Jean-Pierre; Dupré, Nicolas
2016-07-11
Amyotrophic Lateral Sclerosis (ALS) is the most frequent motor neuron disease in adults. Classical ALS is characterized by the death of upper and lower motor neurons leading to progressive paralysis. Approximately 10 % of ALS patients have familial form of the disease. Numerous different gene mutations have been found in familial cases of ALS, such as mutations in superoxide dismutase 1 (SOD1), TAR DNA-binding protein 43 (TDP-43), fused in sarcoma (FUS), C9ORF72, ubiquilin-2 (UBQLN2), optineurin (OPTN) and others. Multiple animal models were generated to mimic the disease and to test future treatments. However, no animal model fully replicates the spectrum of phenotypes in the human disease and it is difficult to assess how a therapeutic effect in disease models can predict efficacy in humans. Importantly, the genetic and phenotypic heterogeneity of ALS leads to a variety of responses to similar treatment regimens. From this has emerged the concept of personalized medicine (PM), which is a medical scheme that combines study of genetic, environmental and clinical diagnostic testing, including biomarkers, to individualized patient care. In this perspective, we used subgroups of specific ALS-linked gene mutations to go through existing animal models and to provide a comprehensive profile of the differences and similarities between animal models of disease and human disease. Finally, we reviewed application of biomarkers and gene therapies relevant in personalized medicine approach. For instance, this includes viral delivering of antisense oligonucleotide and small interfering RNA in SOD1, TDP-43 and C9orf72 mice models. Promising gene therapies raised possibilities for treating differently the major mutations in familial ALS cases.
The SOD gene family in tomato: identification, phylogenetic relationships and expression patterns
Directory of Open Access Journals (Sweden)
kun feng
2016-08-01
Full Text Available Superoxide dismutases (SODs are critical antioxidant enzymes that protect organisms from reactive oxygen species (ROS caused by adverse conditions, and have been widely found in the cytoplasm, chloroplasts, and mitochondria of eukaryotic and prokaryotic cells. Tomato (Solanum lycopersicum L. is an important economic crop and is cultivated worldwide. However, abiotic and biotic stresses severely hinder growth and development of the plant, which affects the production and quality of the crop. To reveal the potential roles of SOD genes under various stresses, we performed a systematic analysis of the tomato SOD gene family and analyzed the expression patterns of SlSOD genes in response to abiotic stresses at the whole-genome level. The characteristics of the SlSOD gene family were determined by analyzing gene structure, conserved motifs, chromosomal distribution, phylogenetic relationships, and expression patterns. We determined that there are at least nine SOD genes in tomato, including four Cu/ZnSODs, three FeSODs, and one MnSOD, and they are unevenly distributed on 12 chromosomes. Phylogenetic analyses of SOD genes from tomato and other plant species were separated into two groups with a high bootstrap value, indicating that these SOD genes were present before the monocot-dicot split. Additionally, many cis-elements that respond to different stresses were found in the promoters of nine SlSOD genes. Gene expression analysis based on RNA-seq data showed that most genes were expressed in all tested tissues, with the exception of SlSOD6 and SlSOD8, which were only expressed in young fruits. Microarray data analysis showed that most members of the SlSOD gene family were altered under salt- and drought-stress conditions. This genome-wide analysis of SlSOD genes helps to clarify the function of SlSOD genes under different stress conditions and provides information to aid in further understanding the evolutionary relationships of SOD genes in plants.
Bioinformatics Analysis of MAPKKK Family Genes in Medicago truncatula
Directory of Open Access Journals (Sweden)
Wei Li
2016-04-01
Full Text Available Mitogen‐activated protein kinase kinase kinase (MAPKKK is a component of the MAPK cascade pathway that plays an important role in plant growth, development, and response to abiotic stress, the functions of which have been well characterized in several plant species, such as Arabidopsis, rice, and maize. In this study, we performed genome‐wide and systemic bioinformatics analysis of MAPKKK family genes in Medicago truncatula. In total, there were 73 MAPKKK family members identified by search of homologs, and they were classified into three subfamilies, MEKK, ZIK, and RAF. Based on the genomic duplication function, 72 MtMAPKKK genes were located throughout all chromosomes, but they cluster in different chromosomes. Using microarray data and high‐throughput sequencing‐data, we assessed their expression profiles in growth and development processes; these results provided evidence for exploring their important functions in developmental regulation, especially in the nodulation process. Furthermore, we investigated their expression in abiotic stresses by RNA‐seq, which confirmed their critical roles in signal transduction and regulation processes under stress. In summary, our genome‐wide, systemic characterization and expressional analysis of MtMAPKKK genes will provide insights that will be useful for characterizing the molecular functions of these genes in M. truncatula.
Directory of Open Access Journals (Sweden)
Luiz Lehmann Coutinho
2010-01-01
Full Text Available A biotecnologia animal tem fornecido novas ferramentas para os programas de melhoramento e, dessa forma, contribuído para melhorar a eficiência da produção dos produtos de origem animal. No entanto, os avanços têm sido mais lentos do que antecipados, especialmente em razão da dificuldade na identificação dos genes responsáveis pelas características fenotípicas de interesse zootécnico. Três estratégias principais têm sido utilizadas para identificar esses genes - mapeamento de QTL, genes candidatos e sequenciamento de DNA e mRNA - e cada uma tem suas vantagens e limitações. O mapeamento de QTL permite determinar as regiões genômicas que contêm genes, mas o intervalo de confiança do QTL pode ser grande e conter muitos genes. A estratégia de genes candidatos é limitada por causa do conhecimento ainda restrito das funções de todos os genes. Os sequenciamentos de genomas e de sequências expressas podem auxiliar na identificação da posição de genes e de vias metabólicas associadas à característica de interesse. A integração dessas estratégias por meio do desenvolvimento de programas de bioinformática permitirá a identificação de novos genes de interesse zootécnico. Assim, os programas de melhoramento genético se beneficiarão pela inclusão da informação obtida diretamente do DNA na avaliação do mérito genético dos plantéis disponíveis.Animal biotechnology is providing new tools for animal breeding and genetics and thus contributing to advances in production efficiency and quality of animal products. However, the progress is slower than anticipated, mainly because of the difficulty involved in identifying genes that control phenotypic characteristics of importance to the animal industry. Three main strategies: QTL mapping, candidate genes and DNA and mRNA sequencing have been used to identify genes of economic interest to animal breeding and each has advantages and disadvantages. QTL mapping allows
Endogenous viral elements in animal genomes.
Directory of Open Access Journals (Sweden)
Aris Katzourakis
2010-11-01
Full Text Available Integration into the nuclear genome of germ line cells can lead to vertical inheritance of retroviral genes as host alleles. For other viruses, germ line integration has only rarely been documented. Nonetheless, we identified endogenous viral elements (EVEs derived from ten non-retroviral families by systematic in silico screening of animal genomes, including the first endogenous representatives of double-stranded RNA, reverse-transcribing DNA, and segmented RNA viruses, and the first endogenous DNA viruses in mammalian genomes. Phylogenetic and genomic analysis of EVEs across multiple host species revealed novel information about the origin and evolution of diverse virus groups. Furthermore, several of the elements identified here encode intact open reading frames or are expressed as mRNA. For one element in the primate lineage, we provide statistically robust evidence for exaptation. Our findings establish that genetic material derived from all known viral genome types and replication strategies can enter the animal germ line, greatly broadening the scope of paleovirological studies and indicating a more significant evolutionary role for gene flow from virus to animal genomes than has previously been recognized.
Directory of Open Access Journals (Sweden)
Nordlund Henri R
2005-03-01
Full Text Available Abstract Background A chicken egg contains several biotin-binding proteins (BBPs, whose complete DNA and amino acid sequences are not known. In order to identify and characterise these genes and proteins we studied chicken cDNAs and genes available in the NCBI database and chicken genome database using the reported N-terminal amino acid sequences of chicken egg-yolk BBPs as search strings. Results Two separate hits showing significant homology for these N-terminal sequences were discovered. For one of these hits, the chromosomal location in the immediate proximity of the avidin gene family was found. Both of these hits encode proteins having high sequence similarity with avidin suggesting that chicken BBPs are paralogous to avidin family. In particular, almost all residues corresponding to biotin binding in avidin are conserved in these putative BBP proteins. One of the found DNA sequences, however, seems to encode a carboxy-terminal extension not present in avidin. Conclusion We describe here the predicted properties of the putative BBP genes and proteins. Our present observations link BBP genes together with avidin gene family and shed more light on the genetic arrangement and variability of this family. In addition, comparative modelling revealed the potential structural elements important for the functional and structural properties of the putative BBP proteins.
[Mutation analysis of FGFR3 gene in a family featuring hereditary dwarfism].
Zhang, Qiong; Jiang, Hai-ou; Quan, Qing-li; Li, Jun; He, Ting; Huang, Xue-shuang
2011-12-01
To investigate the clinical symptoms and potential mutation in FGFR3 gene for a family featuring hereditary dwarfism in order to attain diagnosis and provide prenatal diagnosis. Five patients and two unaffected relatives from the family, in addition with 100 healthy controls, were recruited. Genome DNA was extracted. Exons 10 and 13 of the FGFR3 gene were amplified using polymerase chain reaction (PCR). PCR products were sequenced in both directions. All patients had similar features including short stature, short limbs, lumbar hyperlordosis but normal craniofacial features. A heterozygous mutation G1620T (N540K) was identified in the cDNA from all patients but not in the unaffected relatives and 100 control subjects. A heterozygous G380R mutation was excluded. The hereditary dwarfism featured by this family has been caused by hypochondroplasia (HCH) due to a N540K mutation in the FGFR3 gene.
Thonberg, Håkan; Chiang, Huei-Hsin; Lilius, Lena; Forsell, Charlotte; Lindström, Anna-Karin; Johansson, Charlotte; Björkström, Jenny; Thordardottir, Steinunn; Sleegers, Kristel; Van Broeckhoven, Christine; Rönnbäck, Annica; Graff, Caroline
2017-06-09
Alzheimer disease (AD) is a progressive neurodegenerative disorder and the most common form of dementia. The majority of AD cases are sporadic, while up to 5% are families with an early onset AD (EOAD). Mutations in one of the three genes: amyloid beta precursor protein (APP), presenilin 1 (PSEN1) or presenilin 2 (PSEN2) can be disease causing. However, most EOAD families do not carry mutations in any of these three genes, and candidate genes, such as the sortilin-related receptor 1 (SORL1), have been suggested to be potentially causative. To identify AD causative variants, we performed whole-exome sequencing on five individuals from a family with EOAD and a missense variant, p.Arg1303Cys (c.3907C > T) was identified in SORL1 which segregated with disease and was further characterized with immunohistochemistry on two post mortem autopsy cases from the same family. In a targeted re-sequencing effort on independent index patients from 35 EOAD-families, a second SORL1 variant, c.3050-2A > G, was found which segregated with the disease in 3 affected and was absent in one unaffected family member. The c.3050-2A > G variant is located two nucleotides upstream of exon 22 and was shown to cause exon 22 skipping, resulting in a deletion of amino acids Gly1017- Glu1074 of SORL1. Furthermore, a third SORL1 variant, c.5195G > C, recently identified in a Swedish case control cohort included in the European Early-Onset Dementia (EU EOD) consortium study, was detected in two affected siblings in a third family with familial EOAD. The finding of three SORL1-variants that segregate with disease in three separate families with EOAD supports the involvement of SORL1 in AD pathology. The cause of these rare monogenic forms of EOAD has proven difficult to find and the use of exome and genome sequencing may be a successful route to target them.
Taghavi, Shaghayegh; Chaouni, Rita; Tafakhori, Abbas; Azcona, Luis J; Firouzabadi, Saghar Ghasemi; Omrani, Mir Davood; Jamshidi, Javad; Emamalizadeh, Babak; Shahidi, Gholam Ali; Ahmadi, Mona; Habibi, Seyed Amir Hassan; Ahmadifard, Azadeh; Fazeli, Atena; Motallebi, Marzieh; Petramfar, Peyman; Askarpour, Saeed; Askarpour, Shiva; Shahmohammadibeni, Hossein Ali; Shahmohammadibeni, Neda; Eftekhari, Hajar; Shafiei Zarneh, Amir Ehtesham; Mohammadihosseinabad, Saeed; Khorrami, Mehdi; Najmi, Safa; Chitsaz, Ahmad; Shokraeian, Parasto; Ehsanbakhsh, Hossein; Rezaeidian, Jalal; Ebrahimi Rad, Reza; Madadi, Faranak; Andarva, Monavvar; Alehabib, Elham; Atakhorrami, Minoo; Mortazavi, Seyed Erfan; Azimzadeh, Zahra; Bayat, Mahdis; Besharati, Amir Mohammad; Harati-Ghavi, Mohammad Ali; Omidvari, Samareh; Dehghani-Tafti, Zahra; Mohammadi, Faraz; Mohammad Hossein Pour, Banafsheh; Noorollahi Moghaddam, Hamid; Esmaili Shandiz, Ehsan; Habibi, Arman; Taherian-Esfahani, Zahra; Darvish, Hossein; Paisán-Ruiz, Coro
2018-04-01
In this study, the role of known Parkinson's disease (PD) genes was examined in families with autosomal recessive (AR) parkinsonism to assist with the differential diagnosis of PD. Some families without mutations in known genes were also subject to whole genome sequencing with the objective to identify novel parkinsonism-related genes. Families were selected from 4000 clinical files of patients with PD or parkinsonism. AR inheritance pattern, consanguinity, and a minimum of two affected individuals per family were used as inclusion criteria. For disease gene/mutation identification, multiplex ligation-dependent probe amplification, quantitative PCR, linkage, and Sanger and whole genome sequencing assays were carried out. A total of 116 patients (50 families) were examined. Fifty-four patients (46.55%; 22 families) were found to carry pathogenic mutations in known genes while a novel gene, not previously associated with parkinsonism, was found mutated in a single family (2 patients). Pathogenic mutations, including missense, nonsense, frameshift, and exon rearrangements, were found in Parkin, PINK1, DJ-1, SYNJ1, and VAC14 genes. In conclusion, variable phenotypic expressivity was seen across all families.
Dass, J Febin Prabhu; Sudandiradoss, C
2012-07-15
5-HT (5-Hydroxy-tryptamine) or serotonin receptors are found both in central and peripheral nervous system as well as in non-neuronal tissues. In the animal and human nervous system, serotonin produces various functional effects through a variety of membrane bound receptors. In this study, we focus on 5-HT receptor family from different mammals and examined the factors that account for codon and nucleotide usage variation. A total of 110 homologous coding sequences from 11 different mammalian species were analyzed using relative synonymous codon usage (RSCU), correspondence analysis (COA) and hierarchical cluster analysis together with nucleotide base usage frequency of chemically similar amino acid codons. The mean effective number of codon (ENc) value of 37.06 for 5-HT(6) shows very high codon bias within the family and may be due to high selective translational efficiency. The COA and Spearman's rank correlation reveals that the nucleotide compositional mutation bias as the major factors influencing the codon usage in serotonin receptor genes. The hierarchical cluster analysis suggests that gene function is another dominant factor that affects the codon usage bias, while species is a minor factor. Nucleotide base usage was reported using Goldman, Engelman, Stietz (GES) scale reveals the presence of high uracil (>45%) content at functionally important hydrophobic regions. Our in silico approach will certainly help for further investigations on critical inference on evolution, structure, function and gene expression aspects of 5-HT receptors family which are potential antipsychotic drug targets. Copyright © 2012 Elsevier B.V. All rights reserved.
Phylogenetic analysis of the expansion of the MATH-BTB gene family in the grasses.
Juranić, Martina; Dresselhaus, Thomas
2014-01-01
MATH-BTB proteins are known to act as substrate-specific adaptors of cullin3 (CUL3)-based ubiquitin E3 ligases to target protein for ubiquitination. In a previous study we reported the presence of 31 MATH-BTB genes in the maize genome and determined the regulatory role of the MATH-BTB protein MAB1 during meiosis to mitosis transition. In contrast to maize, there are only 6 homologous genes in the model plant Arabidopsis, while this family has largely expanded in grasses. Here, we report a phylogenetic analysis of the MATH-BTB gene family in 9 land plant species including various mosses, eudicots, and grasses. We extend a previous classification of the plant MATH-BTB family and additionally arrange the expanded group into 5 grass-specific clades. Synteny studies indicate that expansion occurred to a large extent due to local gene duplications. Expression studies of 3 closely related MATH-BTB genes in maize (MAB1-3) indicate highly specific expression pattern. In summary, this work provides a solid base for further studies comparing genetic and functional information of the MATH-BTB family especially in the grasses.
DEFF Research Database (Denmark)
Davis, Margaret R.; Andersson, Robin; Severin, Jessica
2014-01-01
in the structure of the extracellular matrix and controlling the bioavailability of TGFβ family members. Genes encoding these proteins show differential expression in mesenchymal cell types which synthesize the extracellular matrix. We have investigated the promoter regions of the seven gene family members using...... of the family members were expressed in a range of mesenchymal and other cell types, often associated with use of alternative promoters or transcription start sites within a promoter in different cell types. FBN3 was the lowest expressed gene, and was found only in embryonic and fetal tissues. The different...
Genome-wide analysis of the GRAS gene family in Prunus mume.
Lu, Jiuxing; Wang, Tao; Xu, Zongda; Sun, Lidan; Zhang, Qixiang
2015-02-01
Prunus mume is an ornamental flower and fruit tree in Rosaceae. We investigated the GRAS gene family to improve the breeding and cultivation of P. mume and other Rosaceae fruit trees. The GRAS gene family encodes transcriptional regulators that have diverse functions in plant growth and development, such as gibberellin and phytochrome A signal transduction, root radial patterning, and axillary meristem formation and gametogenesis in the P. mume genome. Despite the important roles of these genes in plant growth regulation, no findings on the GRAS genes of P. mume have been reported. In this study, we discerned phylogenetic relationships of P. mume GRAS genes, and their locations, structures in the genome and expression levels of different tissues. Out of 46 identified GRAS genes, 45 were located on the 8 P. mume chromosomes. Phylogenetic results showed that these genes could be classified into 11 groups. We found that Group X was P. mume-specific, and three genes of Group IX clustered with the rice-specific gene Os4. We speculated that these genes existed before the divergence of dicotyledons and monocotyledons and were lost in Arabidopsis. Tissue expression analysis indicated that 13 genes showed high expression levels in roots, stems, leaves, flowers and fruits, and were related to plant growth and development. Functional analysis of 24 GRAS genes and an orthologous relationship analysis indicated that many functioned during plant growth and flower and fruit development. Our bioinformatics analysis provides valuable information to improve the economic, agronomic and ecological benefits of P. mume and other Rosaceae fruit trees.
[Gene mutation analysis and prenatal diagnosis of a family with Bartter syndrome].
Li, Long; Ma, Na; Li, Xiu-Rong; Gong, Fei; DU, Juan
2016-08-01
To investigate the mutation of related genes and prenatal diagnosis of a family with Bartter syndrome (BS). The high-throughput capture sequencing technique and PCR-Sanger sequencing were used to detect pathogenic genes in the proband of this family and analyze the whole family at the genomic level. After the genetic cause was clarified, the amniotic fluid was collected from the proband's mother who was pregnant for 5 months for prenatal diagnosis. The proband carried compound heterozygous mutations of c.88C>T(p.Arg30*) and c.968+2T>A in the CLCNKB gene; c.88C>T(p.Arg30*) had been reported as a pathogenic mutation, and c.968+2T>A was a new mutation. Pedigree analysis showed that the two mutations were inherited from the mother and father, respectively. Prenatal diagnosis showed that the fetus did not inherit the mutations from parents and had no mutations at the two loci. The follow-up visit confirmed that the infant was in a healthy state, which proved the accuracy of genetic diagnosis and prenatal diagnosis. The compound heterozygous mutations c.88C>T(p.Arg30*) and c.968+2T>A in the CLCNKB gene are the cause of BS in the proband, and prenatal diagnosis can prevent the risk of recurrence of BS in this family.
Vaszkó, Tibor; Papp, János; Krausz, Csilla; Casamonti, Elena; Géczi, Lajos; Olah, Edith
2016-01-01
Due to its palindromic setup, AZFc (Azoospermia Factor c) region of chromosome Y is one of the most unstable regions of the human genome. It contains eight gene families expressed mainly in the testes. Several types of rearrangement resulting in changes in the cumulative copy number of the gene families were reported to be associated with diseases such as male infertility and testicular germ cell tumors. The best studied AZFc rearrangement is gr/gr deletion. Its carriers show widespread phenotypic variation from azoospermia to normospermia. This phenomenon was initially attributed to different gr/gr subtypes that would eliminate distinct members of the affected gene families. However, studies conducted to confirm this hypothesis have brought controversial results, perhaps, in part, due to the shortcomings of the utilized subtyping methodology. This proof-of-concept paper is meant to introduce here a novel method aimed at subtyping AZFc rearrangements. It is able to differentiate the partial deletion and partial duplication subtypes of the Deleted in Azoospermia (DAZ) gene family. The keystone of the method is the determination of the copy number of the gene family member-specific variant(s) in a series of sequence family variant (SFV) positions. Most importantly, we present a novel approach for the correct interpretation of the variant copy number data to determine the copy number of the individual DAZ family members in the context of frequent interloci gene conversion.Besides DAZ1/DAZ2 and DAZ3/DAZ4 deletions, not yet described rearrangements such as DAZ2/DAZ4 deletion and three duplication subtypes were also found by the utilization of the novel approach. A striking feature is the extremely high concordance among the individual data pointing to a certain type of rearrangement. In addition to being able to identify DAZ deletion subtypes more reliably than the methods used previously, this approach is the first that can discriminate DAZ duplication subtypes as well
Huang, Qin; Wang, Meiping; Xia, Zongliang
2018-01-01
Sulfur is an essential macronutrient required for plant growth, development and stress responses. The family of sulfate transporters (SULTRs) mediates the uptake and translocation of sulfate in higher plants. However, basic knowledge of the SULTR gene family in maize (Zea mays L.) is scarce. In this study, a genome-wide bioinformatic analysis of SULTR genes in maize was conducted, and the developmental expression patterns of the genes and their responses to sulfate starvation and abiotic stress were further investigated. The ZmSULTR family includes eight putative members in the maize genome and is clustered into four groups in the phylogenetic tree. These genes displayed differential expression patterns in various organs of maize. For example, expression of ZmSULTR1;1 and ZmSULTR4;1 was high in roots, and transcript levels of ZmSULTR3;1 and ZmSULTR3;3 were high in shoots. Expression of ZmSULTR1;2, ZmSULTR2;1, ZmSULTR3;3, and ZmSULTR4;1 was high in flowers. Also, these eight genes showed differential responses to sulfate deprivation in roots and shoots of maize seedlings. Transcript levels of ZmSULTR1;1, ZmSULTR1;2, and ZmSULTR3;4 were significantly increased in roots during 12-day-sulfate starvation stress, while ZmSULTR3;3 and ZmSULTR3;5 only showed an early response pattern in shoots. In addition, dynamic transcriptional changes determined via qPCR revealed differential expression profiles of these eight ZmSULTR genes in response to environmental stresses such as salt, drought, and heat stresses. Notably, all the genes, except for ZmSULTR3;3, were induced by drought and heat stresses. However, a few genes were induced by salt stress. Physiological determination showed that two important thiol-containing compounds, cysteine and glutathione, increased significantly under these abiotic stresses. The results suggest that members of the SULTR family might function in adaptations to sulfur deficiency stress and adverse growing environments. This study will lay a
The sieve element occlusion gene family in dicotyledonous plants.
Ernst, Antonia M; Rüping, Boris; Jekat, Stephan B; Nordzieke, Steffen; Reineke, Anna R; Müller, Boje; Bornberg-Bauer, Erich; Prüfer, Dirk; Noll, Gundula A
2011-01-01
Sieve element occlusion (SEO) genes encoding forisome subunits have been identified in Medicago truncatula and other legumes. Forisomes are structural phloem proteins uniquely found in Fabaceae sieve elements. They undergo a reversible conformational change after wounding, from a condensed to a dispersed state, thereby blocking sieve tube translocation and preventing the loss of photoassimilates. Recently, we identified SEO genes in several non-Fabaceae plants (lacking forisomes) and concluded that they most probably encode conventional non-forisome P-proteins. Molecular and phylogenetic analysis of the SEO gene family has identified domains that are characteristic for SEO proteins. Here, we extended our phylogenetic analysis by including additional SEO genes from several diverse species based on recently published genomic data. Our results strengthen the original assumption that SEO genes seem to be widespread in dicotyledonous angiosperms, and further underline the divergent evolution of SEO genes within the Fabaceae.
X-exome sequencing of 405 unresolved families identifies seven novel intellectual disability genes.
Hu, H; Haas, S A; Chelly, J; Van Esch, H; Raynaud, M; de Brouwer, A P M; Weinert, S; Froyen, G; Frints, S G M; Laumonnier, F; Zemojtel, T; Love, M I; Richard, H; Emde, A-K; Bienek, M; Jensen, C; Hambrock, M; Fischer, U; Langnick, C; Feldkamp, M; Wissink-Lindhout, W; Lebrun, N; Castelnau, L; Rucci, J; Montjean, R; Dorseuil, O; Billuart, P; Stuhlmann, T; Shaw, M; Corbett, M A; Gardner, A; Willis-Owen, S; Tan, C; Friend, K L; Belet, S; van Roozendaal, K E P; Jimenez-Pocquet, M; Moizard, M-P; Ronce, N; Sun, R; O'Keeffe, S; Chenna, R; van Bömmel, A; Göke, J; Hackett, A; Field, M; Christie, L; Boyle, J; Haan, E; Nelson, J; Turner, G; Baynam, G; Gillessen-Kaesbach, G; Müller, U; Steinberger, D; Budny, B; Badura-Stronka, M; Latos-Bieleńska, A; Ousager, L B; Wieacker, P; Rodríguez Criado, G; Bondeson, M-L; Annerén, G; Dufke, A; Cohen, M; Van Maldergem, L; Vincent-Delorme, C; Echenne, B; Simon-Bouy, B; Kleefstra, T; Willemsen, M; Fryns, J-P; Devriendt, K; Ullmann, R; Vingron, M; Wrogemann, K; Wienker, T F; Tzschach, A; van Bokhoven, H; Gecz, J; Jentsch, T J; Chen, W; Ropers, H-H; Kalscheuer, V M
2016-01-01
X-linked intellectual disability (XLID) is a clinically and genetically heterogeneous disorder. During the past two decades in excess of 100 X-chromosome ID genes have been identified. Yet, a large number of families mapping to the X-chromosome remained unresolved suggesting that more XLID genes or loci are yet to be identified. Here, we have investigated 405 unresolved families with XLID. We employed massively parallel sequencing of all X-chromosome exons in the index males. The majority of these males were previously tested negative for copy number variations and for mutations in a subset of known XLID genes by Sanger sequencing. In total, 745 X-chromosomal genes were screened. After stringent filtering, a total of 1297 non-recurrent exonic variants remained for prioritization. Co-segregation analysis of potential clinically relevant changes revealed that 80 families (20%) carried pathogenic variants in established XLID genes. In 19 families, we detected likely causative protein truncating and missense variants in 7 novel and validated XLID genes (CLCN4, CNKSR2, FRMPD4, KLHL15, LAS1L, RLIM and USP27X) and potentially deleterious variants in 2 novel candidate XLID genes (CDK16 and TAF1). We show that the CLCN4 and CNKSR2 variants impair protein functions as indicated by electrophysiological studies and altered differentiation of cultured primary neurons from Clcn4(-/-) mice or after mRNA knock-down. The newly identified and candidate XLID proteins belong to pathways and networks with established roles in cognitive function and intellectual disability in particular. We suggest that systematic sequencing of all X-chromosomal genes in a cohort of patients with genetic evidence for X-chromosome locus involvement may resolve up to 58% of Fragile X-negative cases.
Embryonic expression of zebrafish MiT family genes tfe3b, tfeb, and tfec.
Lister, James A; Lane, Brandon M; Nguyen, Anhthu; Lunney, Katherine
2011-11-01
The MiT family comprises four genes in mammals: Mitf, Tfe3, Tfeb, and Tfec, which encode transcription factors of the basic-helix-loop-helix/leucine zipper class. Mitf is well-known for its essential role in the development of melanocytes, however the functions of the other members of this family, and of interactions between them, are less well understood. We have now characterized the complete set of MiT genes from zebrafish, which totals six instead of four. The zebrafish genome contain two mitf (mitfa and mitfb), two tfe3 (tfe3a and tfe3b), and single tfeb and tfec genes; this distribution is shared with other teleosts. We present here the sequence and embryonic expression patterns for the zebrafish tfe3b, tfeb, and tfec genes, and identify a new isoform of tfe3a. These findings will assist in elucidating the roles of the MiT gene family over the course of vertebrate evolution. Copyright © 2011 Wiley-Liss, Inc.
Characterization of vNr-13, the first alphaherpesvirus gene of the bcl-2 family
International Nuclear Information System (INIS)
Aouacheria, Abdel; Banyai, Michelle; Rigal, Dominique; Schmidt, Carl J.; Gillet, Germain
2003-01-01
The Bcl-2 family, including antiapoptotic and proapoptotic members, plays key regulating roles in programmed cell death. We report the characterization of a new member of the bcl-2 family, encoded by herpesvirus of turkeys (HVT). The product of this gene shares 80% homology with Nr-13, an apoptosis inhibitor, which is overexpressed in avian cells transformed by the v-src oncogene. This new gene, that we propose to call vnr-13, is the first member of the bcl-2 family to be isolated among α-herpesviruses. Results from cells expressing the HVT-vnr-13 gene product show that the encoded protein inhibits apoptosis and also reduces the rate of cellular proliferation. Contrary to all bcl-2 homologues found in γ-herpesvirus, which are intronless, vnr-13 has the same organization as the cellular nr-13 gene. Hence, the HVT vnr-13 gene may have been acquired from a reverse transcriptase product of an unspliced precursor RNA, or via direct recombination with the host chromosomal DNA
Characterization of the Pichia pastoris protein-O-mannosyltransferase gene family.
Directory of Open Access Journals (Sweden)
Juergen H Nett
Full Text Available The methylotrophic yeast, Pichiapastoris, is an important organism used for the production of therapeutic proteins. However, the presence of fungal-like glycans, either N-linked or O-linked, can elicit an immune response or enable the expressed protein to bind to mannose receptors, thus reducing their efficacy. Previously we have reported the elimination of β-linked glycans in this organism. In the current report we have focused on reducing the O-linked mannose content of proteins produced in P. pastoris, thereby reducing the potential to bind to mannose receptors. The initial step in the synthesis of O-linked glycans in P. pastoris is the transfer of mannose from dolichol-phosphomannose to a target protein in the yeast secretory pathway by members of the protein-O-mannosyltransferase (PMT family. In this report we identify and characterize the members of the P. pastoris PMT family. Like Candida albicans, P. pastoris has five PMT genes. Based on sequence homology, these PMTs can be grouped into three sub-families, with both PMT1 and PMT2 sub-families possessing two members each (PMT1 and PMT5, and PMT2 and PMT6, respectively. The remaining sub-family, PMT4, has only one member (PMT4. Through gene knockouts we show that PMT1 and PMT2 each play a significant role in O-glycosylation. Both, by gene knockouts and the use of Pmt inhibitors we were able to significantly reduce not only the degree of O-mannosylation, but also the chain-length of these glycans. Taken together, this reduction of O-glycosylation represents an important step forward in developing the P. pastoris platform as a suitable system for the production of therapeutic glycoproteins.
International Nuclear Information System (INIS)
Makkar, H.P.S.; Viljoen, G.J.
2005-01-01
This book provides a compilation of peer-reviewed scientific contributions from authoritative researchers attending an international symposium convened by the Animal Production and Health Sub-programme of the Animal Production and Health (APH), Joint FAO/IAEA Programme in cooperation with the Animal Production and Health Division of the FAO. These Proceedings contain invaluable information on the role and future potential of gene-based technologies for improving animal production and health, possible applications and constraints in the use of this technology in developing countries and their specific research needs
Lin, Yanping; Wang, Kangyu; Li, Xiangyu; Sun, Chunyu; Yin, Rui; Wang, Yanfang; Wang, Yi; Zhang, Meiping
2018-02-21
Most genes in a genome exist in the form of a gene family; therefore, it is necessary to have knowledge of how a gene family functions to comprehensively understand organismal biology. The receptor-like kinase (RLK)-encoding gene family is one of the most important gene families in plants. It plays important roles in biotic and abiotic stress tolerances, and growth and development. However, little is known about the functional differentiation and relationships among the gene members within a gene family in plants. This study has isolated 563 RLK genes (designated as PgRLK genes) expressed in Jilin ginseng (Panax ginseng C.A. Meyer), investigated their evolution, and deciphered their functional diversification and relationships. The PgRLK gene family is highly diverged and formed into eight types. The LRR type is the earliest and most prevalent, while only the Lec type originated after P. ginseng evolved. Furthermore, although the members of the PgRLK gene family all encode receptor-like protein kinases and share conservative domains, they are functionally very diverse, participating in numerous biological processes. The expressions of different members of the PgRLK gene family are extremely variable within a tissue, at a developmental stage and in the same cultivar, but most of the genes tend to express correlatively, forming a co-expression network. These results not only provide a deeper and comprehensive understanding of the evolution, functional differentiation and correlation of a gene family in plants, but also an RLK genic resource useful for enhanced ginseng genetic improvement.
A Patient With Desmoid Tumors and Familial FAP Having Frame Shift Mutation of the APC Gene
Directory of Open Access Journals (Sweden)
Sanambar Sadighi
2017-02-01
Full Text Available Desmoids tumors, characterized by monoclonal proliferation of myofibroblasts, could occur in 5-10% of patients with familial adenomatous polyposis (FAP as an extra-colonic manifestation of the disease. FAP can develop when there is a germ-line mutation in the adenomatous polyposis coli gene. Although mild or attenuated FAP may follow mutations in 5΄ extreme of the gene, it is more likely that 3΄ extreme mutations haveamore severe manifestation of thedisease. A 28-year-old woman was admitted to the Cancer Institute of Iran with an abdominal painful mass. She had strong family history of FAP and underwent prophylactic total colectomy. Pre-operative CT scans revealed a large mass. Microscopic observation showed diffuse fibroblast cell infiltration of the adjacent tissue structures. Peripheral blood DNA extraction followed by adenomatous polyposis coli gene exon by exon sequencing was performed to investigate the mutation in adenomatous polyposis coli gene. Analysis of DNA sequencing demonstrated a mutation of 4 bpdeletions at codon 1309-1310 of the exon 16 of adenomatous polyposis coli gene sequence which was repeated in 3 members of the family. Some of them had desmoid tumor without classical FAP history. Even when there is no familial history of adenomatous polyposis, the adenomatous polyposis coli gene mutation should be investigated in cases of familial desmoids tumors for a suitable prevention. The 3΄ extreme of the adenomatous polyposis coli gene is still the best likely location in such families.
Genomewide analysis of TCP transcription factor gene family in ...
Indian Academy of Sciences (India)
2014-12-09
Dec 9, 2014 ... study of a genomewide analysis of apple TCP gene family. These results provide .... synthesize the first-strand cDNA using the PrimeScript First. Strand cDNA ..... only detected in the stem, leaf and fruit (figure 8). When.
Directory of Open Access Journals (Sweden)
Chen Wei-Chung
2009-09-01
Full Text Available Abstract Background Since the drastic reorganisation of the phylogeny of the animal kingdom into three major clades of bilaterians; Ecdysozoa, Lophotrochozoa and Deuterostomia, it became glaringly obvious that the selection of model systems with extensive molecular resources was heavily biased towards only two of these three clades, namely the Ecdysozoa and Deuterostomia. Increasing efforts have been put towards redressing this imbalance in recent years, and one of the principal phyla in the vanguard of this endeavour is the Annelida. Results In the context of this effort we here report our characterisation of an Expressed Sequence Tag (EST screen in the serpulid annelid, Pomatoceros lamarckii. We have sequenced over 5,000 ESTs which consolidate into over 2,000 sequences (clusters and singletons. These sequences are used to build phylogenetic trees to estimate relative branch lengths amongst different taxa and, by comparison to genomic data from other animals, patterns of gene retention and loss are deduced. Conclusion The molecular phylogenetic trees including the P. lamarckii sequences extend early observations that polychaetes tend to have relatively short branches in such trees, and hence are useful taxa with which to reconstruct gene family evolution. Also, with the availability of lophotrochozoan data such as that of P. lamarckii, it is now possible to make much more accurate reconstructions of the gene complement of the ancestor of the bilaterians than was previously possible from comparisons of ecdysozoan and deuterostome genomes to non-bilaterian outgroups. It is clear that the traditional molecular model systems for protostomes (e.g. Drosophila melanogaster and Caenorhabditis elegans, which are restricted to the Ecdysozoa, have undergone extensive gene loss during evolution. These ecdysozoan systems, in terms of gene content, are thus more derived from the bilaterian ancestral condition than lophotrochozoan systems like the polychaetes
Deb, Rajib; Sajjanar, Basavaraj; Singh, Umesh; Alex, Rani; Raja, T V; Alyethodi, Rafeeque R; Kumar, Sushil; Sengar, Gyanendra; Sharma, Sheetal; Singh, Rani; Prakash, B
2015-12-01
Na+/K+-ATPase is an integral membrane protein composed of a large catalytic subunit (alpha), a smaller glycoprotein subunit (beta), and gamma subunit. The beta subunit is essential for ion recognition as well as maintenance of the membrane integrity. Present study was aimed to analyze the expression pattern of ATPase beta subunit genes (ATPase B1, ATPase B2, and ATPase B3) among the crossbred bulls under different ambient temperatures (20-44 °C). The present study was also aimed to look into the relationship of HSP70 with the ATPase beta family genes. Our results demonstrated that among beta family genes, transcript abundance of ATPase B1 and ATPase B2 is significantly (P ATPase Β1, ATPase B2, and ATPase B3 is highly correlated (P ATPase beta family genes for cellular thermotolerance in cattle.
Directory of Open Access Journals (Sweden)
Glen Peter
2009-12-01
Full Text Available Abstract Background In recent years, the relaxin family of signaling molecules has been shown to play diverse roles in mammalian physiology, but little is known about its diversity or physiology in teleosts, an infraclass of the bony fishes comprising ~ 50% of all extant vertebrates. In this paper, 32 relaxin family sequences were obtained by searching genomic and cDNA databases from eight teleost species; phylogenetic, molecular evolutionary, and syntenic data analyses were conducted to understand the relationship and differential patterns of evolution of relaxin family genes in teleosts compared with mammals. Additionally, real-time quantitative PCR was used to confirm and assess the tissues of expression of five relaxin family genes in Danio rerio and in situ hybridization used to assess the site-specific expression of the insulin 3-like gene in D. rerio testis. Results Up to six relaxin family genes were identified in each teleost species. Comparative syntenic mapping revealed that fish possess two paralogous copies of human RLN3, which we call rln3a and rln3b, an orthologue of human RLN2, rln, two paralogous copies of human INSL5, insl5a and insl5b, and an orthologue of human INSL3, insl3. Molecular evolutionary analyses indicated that: rln3a, rln3b and rln are under strong evolutionary constraint, that insl3 has been subject to moderate rates of sequence evolution with two amino acids in insl3/INSL3 showing evidence of positively selection, and that insl5b exhibits a higher rate of sequence evolution than its paralogue insl5a suggesting that it may have been neo-functionalized after the teleost whole genome duplication. Quantitative PCR analyses in D. rerio indicated that rln3a and rln3b are expressed in brain, insl3 is highly expressed in gonads, and that there was low expression of both insl5 genes in adult zebrafish. Finally, in situ hybridization of insl3 in D. rerio testes showed highly specific hybridization to interstitial Leydig
Huang, Zejun; Van Houten, Jason; Gonzalez, Geoffrey; Xiao, Han; van der Knaap, Esther
2013-04-01
Members of the plant-specific gene families IQD/SUN, OFP and YABBY are thought to play important roles in plant growth and development. YABBY family members are involved in lateral organ polarity and growth; OFP members encode transcriptional repressors, whereas the role of IQD/SUN members is less clear. The tomato fruit shape genes SUN, OVATE, and FASCIATED belong to IQD/SUN, OFP and the YABBY gene family, respectively. A gene duplication resulting in high expression of SUN leads to elongated fruit, whereas a premature stop codon in OVATE and a large inversion within FASCIATED control fruit elongation and a flat fruit shape, respectively. In this study, we identified 34 SlSUN, 31 SlOFP and 9 SlYABBY genes in tomato and identified their position on 12 chromosomes. Genome mapping analysis showed that the SlSUN, SlOFP, and SlYABBY genes were enriched on the top and bottom segments of several chromosomes. In particular, on chromosome 10, a cluster of SlOFPs were found to originate from tandem duplication events. We also constructed three phylogenetic trees based on the protein sequences of the IQ67, OVATE and YABBY domains, respectively, from members of these families in Arabidopsis and tomato. The closest putative orthologs of the Arabidopsis and tomato genes were determined by the position on the phylogenetic tree and sequence similarity. Furthermore, expression analysis showed that some family members exhibited tissue-specific expression, whereas others were more ubiquitously expressed. Also, certain family members overlapped with known QTLs controlling fruit shape in Solanaceous plants. Combined, these results may help elucidate the roles of SUN, OFP and YABBY family members in plant growth and development.
Evaluation of the norrie disease gene in a family with incontinentia pigmenti.
Shastry, B S; Trese, M T
2000-01-01
Incontinentia pigmenti (IP) is an ectodermal multisystem disorder which can affect dental, ocular, cardiac and neurologic structures. The ocular changes of IP can have a very similar appearance to the retinal detachment of X-linked familial exudative vitreoretinopathy, which has been shown to be caused by the mutations in the Norrie disease gene. Therefore, it is of interest to determine whether similar mutations in the gene can account for the retinal pathology in patients with IP. To test our hypothesis, we have analyzed the entire Norrie disease gene for a family with IP, by single strand conformational polymorphism followed by DNA sequencing. The sequencing data revealed no disease-specific sequence alterations. These data suggest that ocular findings of IP are perhaps associated with different genes and there is no direct relationship between the genotype and phenotype. Copyright 2000 S. Karger AG, Basel
Matsui, Mariko; Soupé, Marie-Estelle; Becam, Jérôme; Goarant, Cyrille
2012-09-01
Transcripts of Leptospira 16S rRNA, FlaB, LigB, LipL21, LipL32, LipL36, LipL41, and OmpL37 were quantified in the blood of susceptible (hamsters) and resistant (mice) animal models of leptospirosis. We first validated adequate reference genes and then evaluated expression patterns in vivo compared to in vitro cultures. LipL32 expression was downregulated in vivo and differentially regulated in resistant and susceptible animals. FlaB expression was also repressed in mice but not in hamsters. In contrast, LigB and OmpL37 were upregulated in vivo. Thus, we demonstrated that a virulent strain of Leptospira differentially adapts its gene expression in the blood of infected animals.
The claudin gene family: expression in normal and neoplastic tissues
International Nuclear Information System (INIS)
Hewitt, Kyle J; Agarwal, Rachana; Morin, Patrice J
2006-01-01
The claudin (CLDN) genes encode a family of proteins important in tight junction formation and function. Recently, it has become apparent that CLDN gene expression is frequently altered in several human cancers. However, the exact patterns of CLDN expression in various cancers is unknown, as only a limited number of CLDN genes have been investigated in a few tumors. We identified all the human CLDN genes from Genbank and we used the large public SAGE database to ascertain the gene expression of all 21 CLDN in 266 normal and neoplastic tissues. Using real-time RT-PCR, we also surveyed a subset of 13 CLDN genes in 24 normal and 24 neoplastic tissues. We show that claudins represent a family of highly related proteins, with claudin-16, and -23 being the most different from the others. From in silico analysis and RT-PCR data, we find that most claudin genes appear decreased in cancer, while CLDN3, CLDN4, and CLDN7 are elevated in several malignancies such as those originating from the pancreas, bladder, thyroid, fallopian tubes, ovary, stomach, colon, breast, uterus, and the prostate. Interestingly, CLDN5 is highly expressed in vascular endothelial cells, providing a possible target for antiangiogenic therapy. CLDN18 might represent a biomarker for gastric cancer. Our study confirms previously known CLDN gene expression patterns and identifies new ones, which may have applications in the detection, prognosis and therapy of several human cancers. In particular we identify several malignancies that express CLDN3 and CLDN4. These cancers may represent ideal candidates for a novel therapy being developed based on CPE, a toxin that specifically binds claudin-3 and claudin-4
Genome-wide identification and expression analysis of the WRKY gene family in cassava
Directory of Open Access Journals (Sweden)
Yunxie eWei
2016-02-01
Full Text Available The WRKY family, a large family of transcription factors (TFs found in higher plants, plays central roles in many aspects of physiological processes and adaption to environment. However, little information is available regarding the WRKY family in cassava (Manihot esculenta. In the present study, 85 WRKY genes were identified from the cassava genome and classified into three groups according to conserved WRKY domains and zinc-finger structure. Conserved motif analysis showed that all of the identified MeWRKYs had the conserved WRKY domain. Gene structure analysis suggested that the number of introns in MeWRKY genes varied from 1 to 5, with the majority of MeWRKY genes containing 3 exons. Expression profiles of MeWRKY genes in different tissues and in response to drought stress were analyzed using the RNA-seq technique. The results showed that 72 MeWRKY genes had differential expression in their transcript abundance and 78 MeWRKY genes were differentially expressed in response to drought stresses in different accessions, indicating their contribution to plant developmental processes and drought stress resistance in cassava. Finally, the expression of 9 WRKY genes was analyzed by qRT-PCR under osmotic, salt, ABA, H2O2, and cold treatments, indicating that MeWRKYs may be involved in different signaling pathways. Taken together, this systematic analysis identifies some tissue-specific and abiotic stress-responsive candidate MeWRKY genes for further functional assays in planta, and provides a solid foundation for understanding of abiotic stress responses and signal transduction mediated by WRKYs in cassava.
Genome-Wide Identification and Expression Analysis of the WRKY Gene Family in Cassava.
Wei, Yunxie; Shi, Haitao; Xia, Zhiqiang; Tie, Weiwei; Ding, Zehong; Yan, Yan; Wang, Wenquan; Hu, Wei; Li, Kaimian
2016-01-01
The WRKY family, a large family of transcription factors (TFs) found in higher plants, plays central roles in many aspects of physiological processes and adaption to environment. However, little information is available regarding the WRKY family in cassava (Manihot esculenta). In the present study, 85 WRKY genes were identified from the cassava genome and classified into three groups according to conserved WRKY domains and zinc-finger structure. Conserved motif analysis showed that all of the identified MeWRKYs had the conserved WRKY domain. Gene structure analysis suggested that the number of introns in MeWRKY genes varied from 1 to 5, with the majority of MeWRKY genes containing three exons. Expression profiles of MeWRKY genes in different tissues and in response to drought stress were analyzed using the RNA-seq technique. The results showed that 72 MeWRKY genes had differential expression in their transcript abundance and 78 MeWRKY genes were differentially expressed in response to drought stresses in different accessions, indicating their contribution to plant developmental processes and drought stress resistance in cassava. Finally, the expression of 9 WRKY genes was analyzed by qRT-PCR under osmotic, salt, ABA, H2O2, and cold treatments, indicating that MeWRKYs may be involved in different signaling pathways. Taken together, this systematic analysis identifies some tissue-specific and abiotic stress-responsive candidate MeWRKY genes for further functional assays in planta, and provides a solid foundation for understanding of abiotic stress responses and signal transduction mediated by WRKYs in cassava.
CRDB: database of chemosensory receptor gene families in vertebrate.
Directory of Open Access Journals (Sweden)
Dong Dong
Full Text Available Chemosensory receptors (CR are crucial for animals to sense the environmental changes and survive on earth. The emergence of whole-genome sequences provides us an opportunity to identify the entire CR gene repertoires. To completely gain more insight into the evolution of CR genes in vertebrates, we identified the nearly all CR genes in 25 vertebrates using homology-based approaches. Among these CR gene repertoires, nearly half of them were identified for the first time in those previously uncharacterized species, such as the guinea pig, giant panda and elephant, etc. Consistent with previous findings, we found that the numbers of CR genes vary extensively among different species, suggesting an extreme form of 'birth-and-death' evolution. For the purpose of facilitating CR gene analysis, we constructed a database with the goals to provide a resource for CR genes annotation and a web tool for exploring their evolutionary patterns. Besides a search engine for the gene extraction from a specific chromosome region, an easy-to-use phylogenetic analysis tool was also provided to facilitate online phylogeny study of CR genes. Our work can provide a rigorous platform for further study on the evolution of CR genes in vertebrates.
Directory of Open Access Journals (Sweden)
LISTYA UTAMI KARMAWAN
2009-03-01
Full Text Available Musa acuminata cultivar pisang ambon lumut is a native climacteric fruit from Indonesia. Climacteric fruit ripening process is triggered by the gaseous plant hormone ethylene. The rate limiting enzyme involved in ethylene biosynthesis is ACC synthase (ACS which is encoded by ACS gene family. The objective of this study is to identify MA-ACS gene family in M. acuminata cultivar pisang ambon lumut and to study the MA-ACS1 gene expression. The result showed that there were nine M. acuminata ACS gene family members called MA-ACS1–9. Two of them (MA-ACS1 and MA-ACS2 were assessed using reverse transcriptase PCR (RT-PCR for gene expression study and it was only MA-ACS1 correlated with fruit ripening. The MA-ACS1 gene fragment has been successfully isolated and characterized and it has three introns, four exons, and one stop codon. It also shows highest homology with MACS1 gene from M. acuminata cultivar Hsian Jien Chiao (GenBank accession number AF056164. Expression analysis of MA-ACS1 using quantitative PCR (qPCR showed that MA-ACS1 gene expression increased significantly in the third day, reached maximum at the fifth day, and then decreased in the seventh day after harvesting. The qPCR expression analysis result correlated with the result of physical analysis during fruit ripening.
FGF: A web tool for Fishing Gene Family in a whole genome database
DEFF Research Database (Denmark)
Zheng, Hongkun; Shi, Junjie; Fang, Xiaodong
2007-01-01
to efficiently search for and identify gene families. The FGF output displays the results as visual phylogenetic trees including information on gene structure, chromosome position, duplication fate and selective pressure. It is particularly useful to identify pseudogenes and detect changes in gene structure. FGF...
Diverse roles of ERECTA family genes in plant development.
Shpak, Elena D
2013-12-01
Multiple receptor-like kinases (RLKs) enable intercellular communication that coordinates growth and development of plant tissues. ERECTA family receptors (ERfs) are an ancient family of leucine-rich repeat RLKs that in Arabidopsis consists of three genes: ERECTA, ERL1, and ERL2. ERfs sense secreted cysteine-rich peptides from the EPF/EPFL family and transmit the signal through a MAP kinase cascade. This review discusses the functions of ERfs in stomata development, in regulation of longitudinal growth of aboveground organs, during reproductive development, and in the shoot apical meristem. In addition the role of ERECTA in plant responses to biotic and abiotic factors is examined. Elena D. Shpak (Corresponding author). © 2013 Institute of Botany, Chinese Academy of Sciences.
Directory of Open Access Journals (Sweden)
Atanassova Rossitza
2010-11-01
Full Text Available Abstract Background In higher plants, sugars are not only nutrients but also important signal molecules. They are distributed through the plant via sugar transporters, which are involved not only in sugar long-distance transport via the loading and the unloading of the conducting complex, but also in sugar allocation into source and sink cells. The availability of the recently released grapevine genome sequence offers the opportunity to identify sucrose and monosaccharide transporter gene families in a woody species and to compare them with those of the herbaceous Arabidopsis thaliana using a phylogenetic analysis. Results In grapevine, one of the most economically important fruit crop in the world, it appeared that sucrose and monosaccharide transporter genes are present in 4 and 59 loci, respectively and that the monosaccharide transporter family can be divided into 7 subfamilies. Phylogenetic analysis of protein sequences has indicated that orthologs exist between Vitis and Arabidospis. A search for cis-regulatory elements in the promoter sequences of the most characterized transporter gene families (sucrose, hexoses and polyols transporters, has revealed that some of them might probably be regulated by sugars. To profile several genes simultaneously, we created a macroarray bearing cDNA fragments specific to 20 sugar transporter genes. This macroarray analysis has revealed that two hexose (VvHT1, VvHT3, one polyol (VvPMT5 and one sucrose (VvSUC27 transporter genes, are highly expressed in most vegetative organs. The expression of one hexose transporter (VvHT2 and two tonoplastic monosaccharide transporter (VvTMT1, VvTMT2 genes are regulated during berry development. Finally, three putative hexose transporter genes show a preferential organ specificity being highly expressed in seeds (VvHT3, VvHT5, in roots (VvHT2 or in mature leaves (VvHT5. Conclusions This study provides an exhaustive survey of sugar transporter genes in Vitis vinifera and
Lemery-Chalfant, Kathryn; Kao, Karen; Swann, Gregory; Goldsmith, H Hill
2013-02-01
Biological parents pass on genotypes to their children, as well as provide home environments that correlate with their genotypes; thus, the association between the home environment and children's temperament can be genetically (i.e., passive gene-environment correlation) or environmentally mediated. Furthermore, family environments may suppress or facilitate the heritability of children's temperament (i.e., gene-environment interaction). The sample comprised 807 twin pairs (mean age = 7.93 years) from the longitudinal Wisconsin Twin Project. Important passive gene-environment correlations emerged, such that home environments were less chaotic for children with high effortful control, and this association was genetically mediated. Children with high extraversion/surgency experienced more chaotic home environments, and this correlation was also genetically mediated. In addition, heritability of children's temperament was moderated by home environments, such that effortful control and extraversion/surgency were more heritable in chaotic homes, and negative affectivity was more heritable under crowded or unsafe home conditions. Modeling multiple types of gene-environment interplay uncovered the complex role of genetic factors and the hidden importance of the family environment for children's temperament and development more generally.
Directory of Open Access Journals (Sweden)
Preeti Arya
Full Text Available Nucleotide binding site leucine-rich repeats (NBS-LRR disease resistance proteins play an important role in plant defense against pathogen attack. A number of recent studies have been carried out to identify and characterize NBS-LRR gene families in many important plant species. In this study, we identified NBS-LRR gene family comprising of 1015 NBS-LRRs using highly stringent computational methods. These NBS-LRRs were characterized on the basis of conserved protein motifs, gene duplication events, chromosomal locations, phylogenetic relationships and digital gene expression analysis. Surprisingly, equal distribution of Toll/interleukin-1 receptor (TIR and coiled coil (CC (1 ∶ 1 was detected in apple while the unequal distribution was reported in majority of all other known plant genome studies. Prediction of gene duplication events intriguingly revealed that not only tandem duplication but also segmental duplication may equally be responsible for the expansion of the apple NBS-LRR gene family. Gene expression profiling using expressed sequence tags database of apple and quantitative real-time PCR (qRT-PCR revealed the expression of these genes in wide range of tissues and disease conditions, respectively. Taken together, this study will provide a blueprint for future efforts towards improvement of disease resistance in apple.
Arya, Preeti; Kumar, Gulshan; Acharya, Vishal; Singh, Anil K
2014-01-01
Nucleotide binding site leucine-rich repeats (NBS-LRR) disease resistance proteins play an important role in plant defense against pathogen attack. A number of recent studies have been carried out to identify and characterize NBS-LRR gene families in many important plant species. In this study, we identified NBS-LRR gene family comprising of 1015 NBS-LRRs using highly stringent computational methods. These NBS-LRRs were characterized on the basis of conserved protein motifs, gene duplication events, chromosomal locations, phylogenetic relationships and digital gene expression analysis. Surprisingly, equal distribution of Toll/interleukin-1 receptor (TIR) and coiled coil (CC) (1 ∶ 1) was detected in apple while the unequal distribution was reported in majority of all other known plant genome studies. Prediction of gene duplication events intriguingly revealed that not only tandem duplication but also segmental duplication may equally be responsible for the expansion of the apple NBS-LRR gene family. Gene expression profiling using expressed sequence tags database of apple and quantitative real-time PCR (qRT-PCR) revealed the expression of these genes in wide range of tissues and disease conditions, respectively. Taken together, this study will provide a blueprint for future efforts towards improvement of disease resistance in apple.
Molecular study of the perforin gene in familial hematological malignancies
Directory of Open Access Journals (Sweden)
El Abed Rim
2011-09-01
Full Text Available Abstract Perforin gene (PRF1 mutations have been identified in some patients diagnosed with the familial form of hemophagocytic lymphohistiocytosis (HLH and in patients with lymphoma. The aim of the present study was to determine whether patients with a familial aggregation of hematological malignancies harbor germline perforin gene mutations. For this purpose, 81 unrelated families from Tunisia and France with aggregated hematological malignancies were investigated. The variants detected in the PRF1 coding region amounted to 3.7% (3/81. Two of the three variants identified were previously described: the p.Ala91Val pathogenic mutation and the p.Asn252Ser polymorphism. A new p.Ala 211Val missense substitution was identified in two related Tunisian patients. In order to assess the pathogenicity of this new variation, bioinformatic tools were used to predict its effects on the perforin protein structure and at the mRNA level. The segregation of the mutant allele was studied in the family of interest and a control population was screened. The fact that this variant was not found to occur in 200 control chromosomes suggests that it may be pathogenic. However, overexpression of mutated PRF1 in rat basophilic leukemia cells did not affect the lytic function of perforin differently from the wild type protein.
Evolution of the defensin-like gene family in grass genomes
Indian Academy of Sciences (India)
that the DEFL gene family is subjected to purifying selection. However, sliding window analysis .... sorghum from DOE-JGI Community Sequencing Program ..... This work was supported by the National Key Technologies Re- search and ...
Directory of Open Access Journals (Sweden)
Jackson Brian C
2011-10-01
Full Text Available Abstract The secretoglobins (SCGBs comprise a family of small, secreted proteins found in animals exclusively of mammalian lineage. There are 11 human SCGB genes and five pseudogenes. Interestingly, mice have 68 Scgb genes, four of which are highly orthologous to human SCGB genes; the remainder represent an 'evolutionary bloom' and make up a large gene family represented by only six counterparts in humans. SCGBs are found in high concentrations in many mammalian secretions, including fluids of the lung, lacrimal gland, salivary gland, prostate and uterus. Whereas the biological activities of most individual SCGBs have not been fully characterised, what already has been discovered suggests that this family has an important role in the modulation of inflammation, tissue repair and tumorigenesis. In mice, the large Scgb1b and Scgb2b gene families encode the androgen-binding proteins, which have been shown to play a role in mate selection. Although much has been learned about SCGBs in recent years, clearly more research remains to be done to allow a better understanding of the roles of these proteins in human health and disease. Such information is predicted to reveal valuable novel drug targets for the treatment of inflammation, as well as designing biomarkers that might identify tissue damage or cancer.
Chitinase family GH18: evolutionary insights from the genomic history of a diverse protein family
Directory of Open Access Journals (Sweden)
Aronson Nathan N
2007-06-01
Full Text Available Abstract Background Chitinases (EC.3.2.1.14 hydrolyze the β-1,4-linkages in chitin, an abundant N-acetyl-β-D-glucosamine polysaccharide that is a structural component of protective biological matrices such as insect exoskeletons and fungal cell walls. The glycoside hydrolase 18 (GH18 family of chitinases is an ancient gene family widely expressed in archea, prokaryotes and eukaryotes. Mammals are not known to synthesize chitin or metabolize it as a nutrient, yet the human genome encodes eight GH18 family members. Some GH18 proteins lack an essential catalytic glutamic acid and are likely to act as lectins rather than as enzymes. This study used comparative genomic analysis to address the evolutionary history of the GH18 multiprotein family, from early eukaryotes to mammals, in an effort to understand the forces that shaped the human genome content of chitinase related proteins. Results Gene duplication and loss according to a birth-and-death model of evolution is a feature of the evolutionary history of the GH18 family. The current human family likely originated from ancient genes present at the time of the bilaterian expansion (approx. 550 mya. The family expanded in the chitinous protostomes C. elegans and D. melanogaster, declined in early deuterostomes as chitin synthesis disappeared, and expanded again in late deuterostomes with a significant increase in gene number after the avian/mammalian split. Conclusion This comprehensive genomic study of animal GH18 proteins reveals three major phylogenetic groups in the family: chitobiases, chitinases/chitolectins, and stabilin-1 interacting chitolectins. Only the chitinase/chitolectin group is associated with expansion in late deuterostomes. Finding that the human GH18 gene family is closely linked to the human major histocompatibility complex paralogon on chromosome 1, together with the recent association of GH18 chitinase activity with Th2 cell inflammation, suggests that its late expansion
Genome-Wide Analysis of the RNA Helicase Gene Family in Gossypium raimondii
Directory of Open Access Journals (Sweden)
Jie Chen
2014-03-01
Full Text Available The RNA helicases, which help to unwind stable RNA duplexes, and have important roles in RNA metabolism, belong to a class of motor proteins that play important roles in plant development and responses to stress. Although this family of genes has been the subject of systematic investigation in Arabidopsis, rice, and tomato, it has not yet been characterized in cotton. In this study, we identified 161 putative RNA helicase genes in the genome of the diploid cotton species Gossypium raimondii. We classified these genes into three subfamilies, based on the presence of either a DEAD-box (51 genes, DEAH-box (52 genes, or DExD/H-box (58 genes in their coding regions. Chromosome location analysis showed that the genes that encode RNA helicases are distributed across all 13 chromosomes of G. raimondii. Syntenic analysis revealed that 62 of the 161 G. raimondii helicase genes (38.5% are within the identified syntenic blocks. Sixty-six (40.99% helicase genes from G. raimondii have one or several putative orthologs in tomato. Additionally, GrDEADs have more conserved gene structures and more simple domains than GrDEAHs and GrDExD/Hs. Transcriptome sequencing data demonstrated that many of these helicases, especially GrDEADs, are highly expressed at the fiber initiation stage and in mature leaves. To our knowledge, this is the first report of a genome-wide analysis of the RNA helicase gene family in cotton.
Wen, Feng; Zhu, Hong; Li, Peng; Jiang, Min; Mao, Wenqing; Ong, Chermaine; Chu, Zhaoqing
2014-06-01
Members of plant WRKY gene family are ancient transcription factors that function in plant growth and development and respond to biotic and abiotic stresses. In our present study, we have investigated WRKY family genes in Brachypodium distachyon, a new model plant of family Poaceae. We identified a total of 86 WRKY genes from B. distachyon and explored their chromosomal distribution and evolution, domain alignment, promoter cis-elements, and expression profiles. Combining the analysis of phylogenetic tree of BdWRKY genes and the result of expression profiling, results showed that most of clustered gene pairs had higher similarities in the WRKY domain, suggesting that they might be functionally redundant. Neighbour-joining analysis of 301 WRKY domains from Oryza sativa, Arabidopsis thaliana, and B. distachyon suggested that BdWRKY domains are evolutionarily more closely related to O. sativa WRKY domains than those of A. thaliana. Moreover, tissue-specific expression profile of BdWRKY genes and their responses to phytohormones and several biotic or abiotic stresses were analysed by quantitative real-time PCR. The results showed that the expression of BdWRKY genes was rapidly regulated by stresses and phytohormones, and there was a strong correlation between promoter cis-elements and the phytohormones-induced BdWRKY gene expression. © The Author 2014. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.
A comprehensive family-based replication study of schizophrenia genes
DEFF Research Database (Denmark)
Aberg, Karolina A; Liu, Youfang; Bukszár, Jozsef
2013-01-01
768 control subjects from 6 databases and, after quality control 6298 individuals (including 3286 cases) from 1811 nuclear families. MAIN OUTCOMES AND MEASURES Case-control status for SCZ. RESULTS Replication results showed a highly significant enrichment of SNPs with small P values. Of the SNPs...... in an independent family-based replication study that, after quality control, consisted of 8107 SNPs. SETTING Linkage meta-analysis, brain transcriptome meta-analysis, candidate gene database, OMIM, relevant mouse studies, and expression quantitative trait locus databases. PATIENTS We included 11 185 cases and 10...
X-exome sequencing of 405 unresolved families identifies seven novel intellectual disability genes
Hu, H.; Haas, S.A.; Chelly, J.; Van Esch, H.; Raynaud, M.; de Brouwer, A.P.M.; Weinert, S.; Froyen, G.; Frints, S.G.M.; Laumonnier, F.; Zemojtel, T.; Love, M.I.; Richard, H.; Emde, A.K.; Bienek, M.
2016-01-01
X-linked intellectual disability (XLID) is a clinically and genetically heterogeneous disorder. During the past two decades in excess of 100 X-chromosome ID genes have been identified. Yet, a large number of families mapping to the X-chromosome remained unresolved suggesting that more XLID genes or loci are yet to be identified. Here, we have investigated 405 unresolved families with XLID. We employed massively parallel sequencing of all X-chromosome exons in the index males. The majority of ...
Distinct Gene Expression Signatures in Lynch Syndrome and Familial Colorectal Cancer Type X
DEFF Research Database (Denmark)
Valentin, Mev; Therkildsen, Christina; Veerla, Srinivas
2013-01-01
Heredity is estimated to cause at least 20% of colorectal cancer. The hereditary nonpolyposis colorectal cancer subset is divided into Lynch syndrome and familial colorectal cancer type X (FCCTX) based on presence of mismatch repair (MMR) gene defects.......Heredity is estimated to cause at least 20% of colorectal cancer. The hereditary nonpolyposis colorectal cancer subset is divided into Lynch syndrome and familial colorectal cancer type X (FCCTX) based on presence of mismatch repair (MMR) gene defects....
P63 gene mutations and human developmental syndromes.
Brunner, H.G.; Hamel, B.C.J.; Bokhoven, J.H.L.M. van
2002-01-01
The P63 gene is a recently discovered member of the p53 family. While P53 is ubiquitously expressed, p63 is expressed specifically in embryonic ectoderm and in the basal regenerative layers of epithelial tissues in the adult. Complete abrogation of P63 gene function in an animal model points to the
Small Mutations of the DMD Gene in Taiwanese Families
Directory of Open Access Journals (Sweden)
Hsiao-Lin Hwa
2008-06-01
Conclusion: Most identified mutations either led to a predictable premature stop codon or resulted in splicing defects, which caused defective function of dystrophin. Our findings extend the mutation spectrum of the DMD gene. Molecular characterization of the affected families is important for genetic counseling and prenatal diagnosis.
Cytokinin Regulation of Gene Expression in the AHP Gene Family in Arabidopsis thaliana
Czech Academy of Sciences Publication Activity Database
Hradilová, Jana; Malbeck, Jiří; Brzobohatý, Břetislav
2007-01-01
Roč. 26, č. 3 (2007), s. 229-244 ISSN 0721-7595 R&D Projects: GA MŠk LN00A081; GA MŠk 1M06030; GA MŠk(CZ) LC06034; GA AV ČR(CZ) IAA600380507; GA AV ČR IAA600040612 Institutional research plan: CEZ:AV0Z50380511; CEZ:AV0Z50040702 Source of funding: V - iné verejné zdroje ; V - iné verejné zdroje ; V - iné verejné zdroje ; V - iné verejné zdroje Keywords : gene expression * AHP gene family * cytokinin signal transduction Subject RIV: EF - Botanics Impact factor: 2.220, year: 2007
GDNF gene is associated with tourette syndrome in a family study.
Huertas-Fernández, Ismael; Gómez-Garre, Pilar; Madruga-Garrido, Marcos; Bernal-Bernal, Inmaculada; Bonilla-Toribio, Marta; Martín-Rodríguez, Juan Francisco; Cáceres-Redondo, María Teresa; Vargas-González, Laura; Carrillo, Fátima; Pascual, Alberto; Tischfield, Jay A; King, Robert A; Heiman, Gary A; Mir, Pablo
2015-07-01
Tourette syndrome is a disorder characterized by persistent motor and vocal tics, and frequently accompanied by the comorbidities attention deficit hyperactivity disorder and obsessive-compulsive disorder. Impaired synaptic neurotransmission has been implicated in its pathogenesis. Our aim was to investigate the association of 28 candidate genes, including genes related to synaptic neurotransmission and neurotrophic factors, with Tourette syndrome. We genotyped 506 polymorphisms in a discovery cohort from the United States composed of 112 families and 47 unrelated singletons with Tourette syndrome (201 cases and 253 controls). Genes containing significant polymorphisms were imputed to fine-map the signal(s) to potential causal variants. Allelic analyses in Tourette syndrome cases were performed to check the role in attention deficit hyperactivity disorder and obsessive-compulsive disorder comorbidities. Target polymorphisms were further studied in a replication cohort from southern Spain composed of 37 families and three unrelated singletons (44 cases and 73 controls). The polymorphism rs3096140 in glial cell line-derived neurotrophic factor gene (GDNF) was significant in the discovery cohort after correction (P = 1.5 × 10(-4) ). No linkage disequilibrium was found between rs3096140 and other functional variants in the gene. We selected rs3096140 as target polymorphism, and the association was confirmed in the replication cohort (P = 0.01). No association with any comorbidity was found. As a conclusion, a common genetic variant in GDNF is associated with Tourette syndrome. A defect in the production of GDNF could compromise the survival of parvalbumin interneurons, thus altering the excitatory/inhibitory balance in the corticostriatal circuitry. Validation of this variant in other family cohorts is necessary. © 2015 International Parkinson and Movement Disorder Society.
GDNF Gene Is Associated With Tourette Syndrome in a Family Study
Huertas-Fernández, Ismael; Gómez-Garre, Pilar; Madruga-Garrido, Marcos; Bernal-Bernal, Inmaculada; Bonilla-Toribio, Marta; Martín-Rodríguez, Juan Francisco; Cáceres-Redondo, María Teresa; Vargas-González, Laura; Carrillo, Fátima; Pascual, Alberto; Tischfield, Jay A.; King, Robert A.; Heiman, Gary A.; Mir, Pablo
2016-01-01
Background Tourette syndrome is a disorder characterized by persistent motor and vocal tics, and frequently accompanied by the comorbidities attention deficit hyperactivity disorder and obsessive-compulsive disorder. Impaired synaptic neurotransmission has been implicated in its pathogenesis. Our aim was to investigate the association of 28 candidate genes, including genes related to synaptic neurotransmission and neurotrophic factors, with Tourette syndrome. Methods We genotyped 506 polymorphisms in a discovery cohort from the United States composed of 112 families and 47 unrelated singletons with Tourette syndrome (201 cases and 253 controls). Genes containing significant polymorphisms were imputed to fine-map the signal(s) to potential causal variants. Allelic analyses in Tourette syndrome cases were performed to check the role in attention deficit hyperactivity disorder and obsessive-compulsive disorder comorbidities. Target polymorphisms were further studied in a replication cohort from southern Spain composed of 37 families and three unrelated singletons (44 cases and 73 controls). Results The polymorphism rs3096140 in glial cell line–derived neurotrophic factor gene (GDNF) was significant in the discovery cohort after correction (P = 1.5 × 10−4). No linkage disequilibrium was found between rs3096140 and other functional variants in the gene. We selected rs3096140 as target polymorphism, and the association was confirmed in the replication cohort (P = 0.01). No association with any comorbidity was found. Conclusions As a conclusion, a common genetic variant in GDNF is associated with Tourette syndrome. A defect in the production of GDNF could compromise the survival of parvalbumin interneurons, thus altering the excitatory/inhibitory balance in the corticostriatal circuitry. Validation of this variant in other family cohorts is necessary. PMID:26096985
Directory of Open Access Journals (Sweden)
S. Pamela K. Shiao
2018-02-01
Full Text Available For the personalization of polygenic/omics-based health care, the purpose of this study was to examine the gene–environment interactions and predictors of colorectal cancer (CRC by including five key genes in the one-carbon metabolism pathways. In this proof-of-concept study, we included a total of 54 families and 108 participants, 54 CRC cases and 54 matched family friends representing four major racial ethnic groups in southern California (White, Asian, Hispanics, and Black. We used three phases of data analytics, including exploratory, family-based analyses adjusting for the dependence within the family for sharing genetic heritage, the ensemble method, and generalized regression models for predictive modeling with a machine learning validation procedure to validate the results for enhanced prediction and reproducibility. The results revealed that despite the family members sharing genetic heritage, the CRC group had greater combined gene polymorphism rates than the family controls (p < 0.05, on MTHFR C677T, MTR A2756G, MTRR A66G, and DHFR 19 bp except MTHFR A1298C. Four racial groups presented different polymorphism rates for four genes (all p < 0.05 except MTHFR A1298C. Following the ensemble method, the most influential factors were identified, and the best predictive models were generated by using the generalized regression models, with Akaike’s information criterion and leave-one-out cross validation methods. Body mass index (BMI and gender were consistent predictors of CRC for both models when individual genes versus total polymorphism counts were used, and alcohol use was interactive with BMI status. Body mass index status was also interactive with both gender and MTHFR C677T gene polymorphism, and the exposure to environmental pollutants was an additional predictor. These results point to the important roles of environmental and modifiable factors in relation to gene–environment interactions in the prevention of CRC.
[The mutation analysis of PAH gene and prenatal diagnosis in classical phenylketonuria family].
Yan, Yousheng; Hao, Shengju; Yao, Fengxia; Sun, Qingmei; Zheng, Lei; Zhang, Qinghua; Zhang, Chuan; Yang, Tao; Huang, Shangzhi
2014-12-01
To characterize the mutation spectrum of phenylalanine hydroxylase (PAH) gene and perform prenatal diagnosis for families with classical phenylketonuria. By stratified sequencing, mutations were detected in the exons and flaking introns of PAH gene of 44 families with classical phenylketonuria. 47 fetuses were diagnosed by combined sequencing with linkage analysis of three common short tandem repeats (STR) (PAH-STR, PAH-26 and PAH-32) in the PAH gene. Thirty-one types of mutations were identified. A total of 84 mutations were identified in 88 alleles (95.45%), in which the most common mutation have been R243Q (21.59%), EX6-96A>G (6.82%), IVS4-1G>A (5.86%) and IVS7+2T>A (5.86%). Most mutations were found in exons 3, 5, 6, 7, 11 and 12. The polymorphism information content (PIC) of these three STR markers was 0.71 (PAH-STR), 0.48 (PAH-26) and 0.40 (PAH-32), respectively. Prenatal diagnosis was performed successfully with the combined method in 47 fetuses of 44 classical phenylketonuria families. Among them, 11 (23.4%) were diagnosed as affected, 24 (51.1%) as carriers, and 12 (25.5%) as unaffected. Prenatal diagnosis can be achieved efficiently and accurately by stratified sequencing of PAH gene and linkage analysis of STR for classical phenylketonuria families.
Two Paralogous Families of a Two-Gene Subtilisin Operon Are Widely Distributed in Oral Treponemes
Correia, Frederick F.; Plummer, Alvin R.; Ellen, Richard P.; Wyss, Chris; Boches, Susan K.; Galvin, Jamie L.; Paster, Bruce J.; Dewhirst, Floyd E.
2003-01-01
Certain oral treponemes express a highly proteolytic phenotype and have been associated with periodontal diseases. The periodontal pathogen Treponema denticola produces dentilisin, a serine protease of the subtilisin family. The two-gene operon prcA-prtP is required for expression of active dentilisin (PrtP), a putative lipoprotein attached to the treponeme's outer membrane or sheath. The purpose of this study was to examine the diversity and structure of treponemal subtilisin-like proteases in order to better understand their distribution and function. The complete sequences of five prcA-prtP operons were determined for Treponema lecithinolyticum, “Treponema vincentii,” and two canine species. Partial operon sequences were obtained for T. socranskii subsp. 04 as well as 450- to 1,000-base fragments of prtP genes from four additional treponeme strains. Phylogenetic analysis demonstrated that the sequences fall into two paralogous families. The first family includes the sequence from T. denticola. Treponemes possessing this operon family express chymotrypsin-like protease activity and can cleave the substrate N-succinyl-alanyl-alanyl-prolyl-phenylalanine-p-nitroanilide (SAAPFNA). Treponemes possessing the second paralog family do not possess chymotrypsin-like activity or cleave SAAPFNA. Despite examination of a range of protein and peptide substrates, the specificity of the second protease family remains unknown. Each of the fully sequenced prcA and prtP genes contains a 5′ hydrophobic leader sequence with a treponeme lipobox. The two paralogous families of treponeme subtilisins represent a new subgroup within the subtilisin family of proteases and are the only subtilisin lipoprotein family. The present study demonstrated that the subtilisin paralogs comprising a two-gene operon are widely distributed among treponemes. PMID:14617650
Directory of Open Access Journals (Sweden)
Rahil Taujale
Full Text Available The glycosyltransferase family 43 (GT43 has been suggested to be involved in the synthesis of xylans in plant cell walls and proteoglycans in animals. Very recently GT43 family was also found in Charophycean green algae (CGA, the closest relatives of extant land plants. Here we present evidence that non-plant and non-animal early eukaryotes such as fungi, Haptophyceae, Choanoflagellida, Ichthyosporea and Haptophyceae also have GT43-like genes, which are phylogenetically close to animal GT43 genes. By mining RNA sequencing data (RNA-Seq of selected plants, we showed that CGA have evolved three major groups of GT43 genes, one orthologous to IRX14 (IRREGULAR XYLEM14, one orthologous to IRX9/IRX9L and the third one ancestral to all land plant GT43 genes. We confirmed that land plant GT43 has two major clades A and B, while in angiosperms, clade A further evolved into three subclades and the expression and motif pattern of A3 (containing IRX9 are fairly different from the other two clades likely due to rapid evolution. Our in-depth sequence analysis contributed to our overall understanding of the early evolution of GT43 family and could serve as an example for the study of other plant cell wall-related enzyme families.
Holland, Peter W H
2013-01-01
Many homeobox genes encode transcription factors with regulatory roles in animal and plant development. Homeobox genes are found in almost all eukaryotes, and have diversified into 11 gene classes and over 100 gene families in animal evolution, and 10 to 14 gene classes in plants. The largest group in animals is the ANTP class which includes the well-known Hox genes, plus other genes implicated in development including ParaHox (Cdx, Xlox, Gsx), Evx, Dlx, En, NK4, NK3, Msx, and Nanog. Genomic data suggest that the ANTP class diversified by extensive tandem duplication to generate a large array of genes, including an NK gene cluster and a hypothetical ProtoHox gene cluster that duplicated to generate Hox and ParaHox genes. Expression and functional data suggest that NK, Hox, and ParaHox gene clusters acquired distinct roles in patterning the mesoderm, nervous system, and gut. The PRD class is also diverse and includes Pax2/5/8, Pax3/7, Pax4/6, Gsc, Hesx, Otx, Otp, and Pitx genes. PRD genes are not generally arranged in ancient genomic clusters, although the Dux, Obox, and Rhox gene clusters arose in mammalian evolution as did several non-clustered PRD genes. Tandem duplication and genome duplication expanded the number of homeobox genes, possibly contributing to the evolution of developmental complexity, but homeobox gene loss must not be ignored. Evolutionary changes to homeobox gene expression have also been documented, including Hox gene expression patterns shifting in concert with segmental diversification in vertebrates and crustaceans, and deletion of a Pitx1 gene enhancer in pelvic-reduced sticklebacks. WIREs Dev Biol 2013, 2:31-45. doi: 10.1002/wdev.78 For further resources related to this article, please visit the WIREs website. The author declares that he has no conflicts of interest. Copyright © 2012 Wiley Periodicals, Inc.
Gene screening in a Chinese family with Marfan syndrome
Directory of Open Access Journals (Sweden)
Wen-Jiao Xia
2016-05-01
Full Text Available AIM:To analyze the causative gene mutation for Marfan syndrome(MFSwith autosomal dominant hereditary in a Chinese family in Liaoning Province,China. METHODS: Venous blood was collected and candidate gene was selected to design primers according to the clinical phenotype. With genomic polymerase chain reaction(PCRperformed, the coding exons and their flanking intron in sequences of candidate gene were sequenced,DNA fragments separated by agarose gel electrophoresis and direct sequencing method was used to determine the pathogenic gene.RESULTS:Phenotype of the proband was presented as ectopic lentis. Sequencing of the coding regions of FBN1 gene showed the presence of a heterozygous A→G transversion at nucleotide 640 in the 7 exon of FBN1 and the missense mutation made for Glycine into Serine(G214S. CONCLUSION:A heterozygous mutation of FBN1 c.A640G(p.G214Sis responsible for the Marfan syndrome in the four generation Chinese pedigree.
Molecular characterization and expression analysis of WRKY family genes in Dendrobium officinale.
Wang, Tao; Song, Zheng; Wei, Li; Li, Lubin
2018-03-01
The WRKY family of transcription factors is one of the most important families of plant transcriptional regulators, and the members regulate multiple biological processes. However, there is limited information on WRKYs in Dendrobium officinale. In this study, 52 WRKY family genes of D. officinale were surveyed for the first time. Conserved domain, phylogenetic, exon-intron construction, and expression analyses were performed for the DoWRKY genes. Two major types of intron splicing (PR and VQR introns) were found, and the intron insertion position was observed to be relatively conserved in the conserved DoWRKY domains. The expression profiles of nine DoWRKYs were analyzed in cold- and methyl jasmonate (MeJA)-treated D. officinale seedlings; the DoWRKYs showed significant expression changes at different levels, which suggested their vital roles in stress tolerance. Moreover, the expression trends of most of the DoWRKYs after the simultaneous cold stress and MeJA treatment were the opposite of those of DoWRKYs after the individual cold stress and MeJA treatments, suggesting that the two stresses might have antagonistic effects and affect the adaptive capacity of the plants to stresses. Twelve DoWRKY genes were differentially expressed between symbiotic and asymbiotic germinated seeds; all were upregulated in the symbiotic germinated seeds except DoWRKY16. These differences in expression of DoWRKYs might be involved in promoting in vitro symbiotic germination of seeds with Tulasnella-like fungi. Our findings will be useful for further studies on the WRKY family genes in orchids.
He, Chunmei; Teixeira da Silva, Jaime A; Tan, Jianwen; Zhang, Jianxia; Pan, Xiaoping; Li, Mingzhi; Luo, Jianping; Duan, Jun
2017-08-23
The WRKY family, one of the largest families of transcription factors, plays important roles in the regulation of various biological processes, including growth, development and stress responses in plants. In the present study, 63 DoWRKY genes were identified from the Dendrobium officinale genome. These were classified into groups I, II, III and a non-group, each with 14, 28, 10 and 11 members, respectively. ABA-responsive, sulfur-responsive and low temperature-responsive elements were identified in the 1-k upstream regulatory region of DoWRKY genes. Subsequently, the expression of the 63 DoWRKY genes under cold stress was assessed, and the expression profiles of a large number of these genes were regulated by low temperature in roots and stems. To further understand the regulatory mechanism of DoWRKY genes in biological processes, potential WRKY target genes were investigated. Among them, most stress-related genes contained multiple W-box elements in their promoters. In addition, the genes involved in polysaccharide synthesis and hydrolysis contained W-box elements in their 1-k upstream regulatory regions, suggesting that DoWRKY genes may play a role in polysaccharide metabolism. These results provide a basis for investigating the function of WRKY genes and help to understand the downstream regulation network in plants within the Orchidaceae.
Bai, Y; Liu, N; Kong, X D; Yan, J; Qin, Z B; Wang, B
2016-12-07
Objective: To analyze the mutations of PAX3 gene in two Waardenburg syndrome type Ⅰ (WS1) pedigrees and make prenatal diagnosis for the high-risk 18-week-old fetus. Methods: PAX3 gene was first analyzed by Sanger sequencing and multiplex ligation-dependent probe amplification(MLPA) for detecting pathogenic mutation of the probands of the two pedigrees. The mutations were confirmed by MLPA and Sanger in parents and unrelated healthy individuals.Prenatal genetic diagnosis for the high-risk fetus was performed by amniotic fluid cell after genotyping. Results: A heterozygous PAX3 gene gross deletion (E7 deletion) was identified in all patients from WS1-01 family, and not found in 20 healthy individuals.Prenatal diagnosis in WS1-01 family indicated that the fetus was normal. Molecular studies identified a novel deletion mutation c. 1385_1386delCT within the PAX3 gene in all affected WS1-02 family members, but in none of the unaffected relatives and 200 healthy individuals. Conclusions: PAX3 gene mutation is etiological for two WS1 families. Sanger sequencing plus MLPA is effective and accurate for making gene diagnosis and prenatal diagnosis.
Wang, Dan; Zhang, Lin; Hu, JunFeng; Gao, Dianshuai; Liu, Xin; Sha, Yan
2018-04-01
Lipases are physiologically important and ubiquitous enzymes that share a conserved domain and are classified into eight different families based on their amino acid sequences and fundamental biological properties. The Lipase3 family of lipases was reported to possess a canonical fold typical of α/β hydrolases and a typical catalytic triad, suggesting a distinct evolutionary origin for this family. Genes in the Lipase3 family do not have the same functions, but maintain the conserved Lipase3 domain. There have been extensive studies of Lipase3 structures and functions, but little is known about their evolutionary histories. In this study, all lipases within five plant species were identified, and their phylogenetic relationships and genetic properties were analyzed and used to group them into distinct evolutionary families. Each identified lipase family contained at least one dicot and monocot Lipase3 protein, indicating that the gene family was established before the split of dicots and monocots. Similar intron/exon numbers and predicted protein sequence lengths were found within individual groups. Twenty-four tandem Lipase3 gene duplications were identified, implying that the distinctive function of Lipase3 genes appears to be a consequence of translocation and neofunctionalization after gene duplication. The functional genes EDS1, PAD4, and SAG101 that are reportedly involved in pathogen response were all located in the same group. The nucleotide diversity (Dxy) and the ratio of nonsynonymous to synonymous nucleotide substitutions rates (Ka/Ks) of the three genes were significantly greater than the average across the genomes. We further observed evidence for selection maintaining diversity on three genes in the Toll-Interleukin-1 receptor type of nucleotide binding/leucine-rich repeat immune receptor (TIR-NBS LRR) immunity-response signaling pathway, indicating that they could be vulnerable to pathogen effectors.
Sun, Tingting; Li, Mingjun; Shao, Yun; Yu, Lingyan; Ma, Fengwang
2017-01-01
Elemental phosphorus (Pi) is essential to plant growth and development. The family of phosphate transporters (PHTs) mediates the uptake and translocation of Pi inside the plants. Members include five sub-cellular phosphate transporters that play different roles in Pi uptake and transport. We searched the Genome Database for Rosaceae and identified five clusters of phosphate transporters in apple ( Malus domestica ), including 37 putative genes. The MdPHT1 family contains 14 genes while MdPHT2 has two, MdPHT3 has seven, MdPHT4 has 11, and MdPHT5 has three. Our overview of this gene family focused on structure, chromosomal distribution and localization, phylogenies, and motifs. These genes displayed differential expression patterns in various tissues. For example, expression was high for MdPHT1;12, MdPHT3;6 , and MdPHT3;7 in the roots, and was also increased in response to low-phosphorus conditions. In contrast, MdPHT4;1, MdPHT4;4 , and MdPHT4;10 were expressed only in the leaves while transcript levels of MdPHT1;4, MdPHT1;12 , and MdPHT5;3 were highest in flowers. In general, these 37 genes were regulated significantly in either roots or leaves in response to the imposition of phosphorus and/or drought stress. The results suggest that members of the PHT family function in plant adaptations to adverse growing environments. Our study will lay a foundation for better understanding the PHT family evolution and exploring genes of interest for genetic improvement in apple.
Mutation analysis of the cathepsin C gene in Indian families with Papillon-Lefèvre syndrome
Directory of Open Access Journals (Sweden)
Srivastava Satish
2003-07-01
Full Text Available Abstract Background PLS is a rare autosomal recessive disorder characterized by early onset periodontopathia and palmar plantar keratosis. PLS is caused by mutations in the cathepsin C (CTSC gene. Dipeptidyl-peptidase I encoded by the CTSC gene removes dipeptides from the amino-terminus of protein substrates and mainly plays an immune and inflammatory role. Several mutations have been reported in this gene in patients from several ethnic groups. We report here mutation analysis of the CTSC gene in three Indian families with PLS. Methods Peripheral blood samples were obtained from individuals belonging to three Indian families with PLS for genomic DNA isolation. Exon-specific intronic primers were used to amplify DNA samples from individuals. PCR products were subsequently sequenced to detect mutations. PCR-SCCP and ASOH analyses were used to determine if mutations were present in normal control individuals. Results All patients from three families had a classic PLS phenotype, which included palmoplantar keratosis and early-onset severe periodontitis. Sequence analysis of the CTSC gene showed three novel nonsense mutations (viz., p.Q49X, p.Q69X and p.Y304X in homozygous state in affected individuals from these Indian families. Conclusions This study reported three novel nonsense mutations in three Indian families. These novel nonsense mutations are predicted to produce truncated dipeptidyl-peptidase I causing PLS phenotype in these families. A review of the literature along with three novel mutations reported here showed that the total number of mutations in the CTSC gene described to date is 41 with 17 mutations being located in exon 7.
DAZ Family Proteins, Key Players for Germ Cell Development
Fu, Xia-Fei; Cheng, Shun-Feng; Wang, Lin-Qing; Yin, Shen; De Felici, Massimo; Shen, Wei
2015-01-01
DAZ family proteins are found almost exclusively in germ cells in distant animal species. Deletion or mutations of their encoding genes usually severely impair either oogenesis or spermatogenesis or both. The family includes Boule (or Boll), Dazl (or Dazla) and DAZ genes. Boule and Dazl are situated on autosomes while DAZ, exclusive of higher primates, is located on the Y chromosome. Deletion of DAZ gene is the most common causes of infertility in humans. These genes, encoding for RNA binding proteins, contain a highly conserved RNA recognition motif and at least one DAZ repeat encoding for a 24 amino acids sequence able to bind other mRNA binding proteins. Basically, Daz family proteins function as adaptors for target mRNA transport and activators of their translation. In some invertebrate species, BOULE protein play a pivotal role in germline specification and a conserved regulatory role in meiosis. Depending on the species, DAZL is expressed in primordial germ cells (PGCs) and/or pre-meiotic and meiotic germ cells of both sexes. Daz is found in fetal gonocytes, spermatogonia and spermatocytes of adult testes. Here we discuss DAZ family genes in a phylogenic perspective, focusing on the common and distinct features of these genes, and their pivotal roles during gametogenesis evolved during evolution. PMID:26327816
Distribution of mutations in the PEX gene in families with X-linked hypophosphataemic rickets (HYP).
Rowe, P S; Oudet, C L; Francis, F; Sinding, C; Pannetier, S; Econs, M J; Strom, T M; Meitinger, T; Garabedian, M; David, A; Macher, M A; Questiaux, E; Popowska, E; Pronicka, E; Read, A P; Mokrzycki, A; Glorieux, F H; Drezner, M K; Hanauer, A; Lehrach, H; Goulding, J N; O'Riordan, J L
1997-04-01
Mutations in the PEX gene at Xp22.1 (phosphate-regulating gene with homologies to endopeptidases, on the X-chromosome), are responsible for X-linked hypophosphataemic rickets (HYP). Homology of PEX to the M13 family of Zn2+ metallopeptidases which include neprilysin (NEP) as prototype, has raised important questions regarding PEX function at the molecular level. The aim of this study was to analyse 99 HYP families for PEX gene mutations, and to correlate predicted changes in the protein structure with Zn2+ metallopeptidase gene function. Primers flanking 22 characterised exons were used to amplify DNA by PCR, and SSCP was then used to screen for mutations. Deletions, insertions, nonsense mutations, stop codons and splice mutations occurred in 83% of families screened for in all 22 exons, and 51% of a separate set of families screened in 17 PEX gene exons. Missense mutations in four regions of the gene were informative regarding function, with one mutation in the Zn2+-binding site predicted to alter substrate enzyme interaction and catalysis. Computer analysis of the remaining mutations predicted changes in secondary structure, N-glycosylation, protein phosphorylation and catalytic site molecular structure. The wide range of mutations that align with regions required for protease activity in NEP suggests that PEX also functions as a protease, and may act by processing factor(s) involved in bone mineral metabolism.
AHSG gene polymorphisms are associated with bone mineral density in Caucasian nuclear families
International Nuclear Information System (INIS)
Yang Yanjun; Wang Yanbo; Lei Shufeng; Long Jirong; Shen Hui; Zhao Lanjuan; Jiang Deke; Xiao Sumei; Chen Xiangding; Chen Yuan; Deng Hongwen
2007-01-01
Purpose. To investigate the role of alpha2-HS glycoprotein (AHSG) gene on bone mineral density (BMD) variation. Methods. A total of 665 subjects from 157 Caucasian nuclear families were genotyped at the AHSG NlaIII, SacI sites. The association and linkage between the single SNP markers and haplotypes constructed by two markers in this gene and BMDs at the spine and hip were determined by using quantitative transmission disequilibrium test (QTDT). Results. Significant within-family associations were obtained for spine BMD at both of studied markers (P = 0.036 and 0.005 at the NlaIII and SacI sites, respectively). Significant (P = 0.008 at the NlaIII locus) (P = 0.004 at the SacI locus) total associations at spine BMD were detected. Haplotype analyses confirmed those within-family and total association. Conclusions. These data suggest the polymorphisms in the AHSG gene may have effects on BMD variation in Caucasian population
Directory of Open Access Journals (Sweden)
Rebecca S Bart
2010-09-01
Full Text Available Rice NH1 (NPR1 homolog 1 is a key mediator of innate immunity. In both plants and animals, the innate immune response is often accompanied by rapid cell death at the site of pathogen infection. Over-expression of NH1 in rice results in resistance to the bacterial pathogen, Xanthomonas oryzae pv. oryzae (Xoo, constitutive expression of defense related genes and enhanced benzothiadiazole (BTH- mediated cell death. Here we describe a forward genetic screen that identified a suppressor of NH1-mediated lesion formation and resistance, snl6. Comparative genome hybridization and fine mapping rapidly identified the genomic location of the Snl6 gene. Snl6 is a member of the cinnamoyl-CoA reductase (CCR-like gene family. We show that Snl6 is required for NH1-mediated resistance to Xoo. Further, we show that Snl6 is required for pathogenesis-related gene expression. In contrast to previously described CCR family members, disruption of Snl6 does not result in an obvious morphologic phenotype. Snl6 mutants have reduced lignin content and increased sugar extractability, an important trait for the production of cellulosic biofuels. These results suggest the existence of a conserved group of CCR-like genes involved in the defense response, and with the potential to alter lignin content without affecting development.
[Analysis of gene mutation in a Chinese family with Norrie disease].
Zhang, Tian-xiao; Zhao, Xiu-li; Hua, Rui; Zhang, Jin-song; Zhang, Xue
2012-09-01
To detect the pathogenic mutation in a Chinese family with Norrie disease. Clinical diagnosis was based on familial history, clinical sign and B ultrasonic examination. Peripheral blood samples were obtained from all available members in a Chinese family with Norrie disease. Genomic DNA was extracted from lymphocytes by the standard SDS-proteinase K-phenol/chloroform method. Two coding exons and all intron-exon boundaries of the NDP gene were PCR amplified using three pairs of primers and subjected to automatic DNA sequence. The causative mutation was confirmed by restriction enzyme analysis and genotyping analysis in all members. Sequence analysis of NDP gene revealed a missense mutation c.220C > T (p.Arg74Cys) in the proband and his mother. Further mutation identification by restriction enzyme analysis and genotyping analysis showed that the proband was homozygote of this mutation. His mother and other four unaffected members (III3, IV4, III5 and II2) were carriers of this mutation. The mutant amino acid located in the C-terminal cystine knot-like domain, which was critical motif for the structure and function of NDP. A NDP missense mutation was identified in a Chinese family with Norrie disease.
Tang, Xin; Liu, Huawei; Chen, Quanmei; Wang, Xin; Xiong, Ying; Zhao, Ping
2016-10-03
The solute carrier 6 (SLC6) gene family, initially known as the neurotransmitter transporters, plays vital roles in the regulation of neurotransmitter signaling, nutrient absorption and motor behavior. In this study, a total of 16 candidate genes were identified as SLC6 family gene homologs in the silkworm (Bombyx mori) genome. Spatio-temporal expression patterns of silkworm SLC6 gene transcripts indicated that these genes were highly and specifically expressed in midgut, brain and gonads; moreover, these genes were expressed primarily at the feeding stage or adult stage. Levels of expression for most midgut-specific and midgut-enriched gene transcripts were down-regulated after starvation but up-regulated after re-feeding. In addition, we observed that expression levels of these genes except for BmSLC6-15 and BmGT1 were markedly up-regulated by a juvenile hormone analog. Moreover, brain-enriched genes showed differential expression patterns during wandering and mating processes, suggesting that these genes may be involved in modulating wandering and mating behaviors. Our results improve our understanding of the expression patterns and potential physiological functions of the SLC6 gene family, and provide valuable information for the comprehensive functional analysis of the SLC6 gene family.
Vears, Danya F; Dunn, Karen L; Wake, Samantha A; Scheffer, Ingrid E
2015-05-01
Recognition of the role of genetics in the epilepsies has increased dramatically, impacting on clinical practice across many epilepsy syndromes. There is limited research investigating the impact of gene identification on individuals and families with epilepsy. While research has focused on the impact of delivering genetic information to families at the time of diagnosis in genetic diseases more broadly, little is known about how genetic results in epileptic diseases influences people's lives many years after it has been conveyed. This study used qualitative methods to explore the experience of receiving a genetic result in people with familial epilepsy. Interviews were conducted with individuals with familial epilepsies in whom the underlying genetic mutation had been identified. Recorded interviews underwent thematic analysis. 20 individuals from three families with different epilepsy syndromes and causative genes were interviewed. Multiple generations within families were studied. The mean time from receiving the genetic result prior to interview was 10.9 years (range 5-14 years). Three major themes were identified: 1) living with epilepsy: an individual's experience of the severity of epilepsy in their family influenced their view. 2) Clinical utility of the test: participants expressed varying reactions to receiving a genetic result. While for some it provided helpful information and relief, others were not surprised by the finding given the familial context. Some valued the use of genetic information for reproductive decision-making, particularly in the setting of severely affected family members. While altruistic reasons for participating in genetic research were discussed, participants emphasised the benefit of participation to them and their families. 3) 'Talking about the family genes': individuals reported poor communication between family members about their epilepsy and its genetic implications. The results provide important insights into the family
Dong, Heng; Liu, Dandan; Han, Tianyu; Zhao, Yuxue; Sun, Ji; Lin, Sue; Cao, Jiashu; Chen, Zhong-Hua; Huang, Li
2015-11-24
Histone lysine methylation, controlled by the SET Domain Group (SDG) gene family, is part of the histone code that regulates chromatin function and epigenetic control of gene expression. Analyzing the SDG gene family in Brassica rapa for their gene structure, domain architecture, subcellular localization, rate of molecular evolution and gene expression pattern revealed common occurrences of subfunctionalization and neofunctionalization in BrSDGs. In comparison with Arabidopsis thaliana, the BrSDG gene family was found to be more divergent than AtSDGs, which might partly explain the rich variety of morphotypes in B. rapa. In addition, a new evolutionary pattern of the four main groups of SDGs was presented, in which the Trx group and the SUVR subgroup evolved faster than the E(z), Ash groups and the SUVH subgroup. These differences in evolutionary rate among the four main groups of SDGs are perhaps due to the complexity and variability of the regions that bind with biomacromolecules, which guide SDGs to their target loci.
Gambhir, Sanjiv [Portola Valley, CA; Pritha, Ray [Mountain View, CA
2011-06-07
Novel double and triple fusion reporter gene constructs harboring distinct imagable reporter genes are provided, as well as applications for the use of such double and triple fusion constructs in living cells and in living animals using distinct imaging technologies.
Mizoshiri, N; Kishida, T; Yamamoto, K; Shirai, T; Terauchi, R; Tsuchida, S; Mori, Y; Ejima, A; Sato, Y; Arai, Y; Fujiwara, H; Yamamoto, T; Kanamura, N; Mazda, O; Kubo, T
2015-11-27
Osteoblasts play essential roles in bone formation and regeneration, while they have low proliferation potential. Recently we established a procedure to directly convert human fibroblasts into osteoblasts (dOBs). Transduction of Runx2 (R), Osterix (X), Oct3/4 (O) and L-myc (L) genes followed by culturing under osteogenic conditions induced normal human fibroblasts to express osteoblast-specific genes and produce calcified bone matrix both in vitro and in vivo Intriguingly, a combination of only two factors, Oct3/4 and L-myc, significantly induced osteoblast-like phenotype in fibroblasts, but the mechanisms underlying the direct conversion remains to be unveiled. We examined which Oct family genes and Myc family genes are capable of inducing osteoblast-like phenotypic conversion. As result Oct3/4, Oct6 and Oct9, among other Oct family members, had the capability, while N-myc was the most effective Myc family gene. The Oct9 plus N-myc was the best combination to induce direct conversion of human fibroblasts into osteoblast-like cells. The present findings may greatly contribute to the elucidation of the roles of the Oct and Myc proteins in osteoblast direct reprogramming. The results may also lead to establishment of novel regenerative therapy for various bone resorption diseases. Copyright © 2015 Elsevier Inc. All rights reserved.
DeGue, Sarah; DiLillo, David
2009-01-01
Cross-reporting legislation, which permits child and animal welfare investigators to refer families with substantiated child maltreatment or animal cruelty for investigation by parallel agencies, has recently been adopted in several U.S. jurisdictions. The current study sheds light on the underlying assumption of these policies--that animal…
International Nuclear Information System (INIS)
Mizoshiri, N.; Kishida, T.; Yamamoto, K.; Shirai, T.; Terauchi, R.; Tsuchida, S.; Mori, Y.; Ejima, A.; Sato, Y.; Arai, Y.; Fujiwara, H.; Yamamoto, T.; Kanamura, N.; Mazda, O.; Kubo, T.
2015-01-01
Introduction: Osteoblasts play essential roles in bone formation and regeneration, while they have low proliferation potential. Recently we established a procedure to directly convert human fibroblasts into osteoblasts (dOBs). Transduction of Runx2 (R), Osterix (X), Oct3/4 (O) and L-myc (L) genes followed by culturing under osteogenic conditions induced normal human fibroblasts to express osteoblast-specific genes and produce calcified bone matrix both in vitro and in vivo Intriguingly, a combination of only two factors, Oct3/4 and L-myc, significantly induced osteoblast-like phenotype in fibroblasts, but the mechanisms underlying the direct conversion remains to be unveiled. Materials and Methods: We examined which Oct family genes and Myc family genes are capable of inducing osteoblast-like phenotypic conversion. Results: As result Oct3/4, Oct6 and Oct9, among other Oct family members, had the capability, while N-myc was the most effective Myc family gene. The Oct9 plus N-myc was the best combination to induce direct conversion of human fibroblasts into osteoblast-like cells. Discussion: The present findings may greatly contribute to the elucidation of the roles of the Oct and Myc proteins in osteoblast direct reprogramming. The results may also lead to establishment of novel regenerative therapy for various bone resorption diseases. - Highlights: • Introducing L-myc in a combination with either Oct3/4, Oct6 or Oct9 enables the conversion of fibroblasts to osteoblasts. • A combination of L-myc with Oct3/4 or Oct9 can induce the cells to a phenotype closer to normal osteoblasts. • N-myc was considered the most appropriate Myc family gene for induction of osteoblast-like phenotype in fibroblasts. • The combination of Oct9 plus N-myc has the strongest capability of inducing osteoblast-like phenotype.
Energy Technology Data Exchange (ETDEWEB)
Mizoshiri, N. [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Department of Orthopaedics, Kyoto Prefectural University of Medicine, Kyoto (Japan); Kishida, T. [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Yamamoto, K. [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Department of Dental Medicine, Kyoto Prefectural University of Medicine, Kyoto (Japan); Shirai, T.; Terauchi, R.; Tsuchida, S. [Department of Orthopaedics, Kyoto Prefectural University of Medicine, Kyoto (Japan); Mori, Y. [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Department of Orthopaedics, Kyoto Prefectural University of Medicine, Kyoto (Japan); Ejima, A. [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Sato, Y. [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Department of Dental Medicine, Kyoto Prefectural University of Medicine, Kyoto (Japan); Arai, Y.; Fujiwara, H. [Department of Orthopaedics, Kyoto Prefectural University of Medicine, Kyoto (Japan); Yamamoto, T.; Kanamura, N. [Department of Dental Medicine, Kyoto Prefectural University of Medicine, Kyoto (Japan); Mazda, O., E-mail: mazda@koto.kpu-m.ac.jp [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Kubo, T. [Department of Orthopaedics, Kyoto Prefectural University of Medicine, Kyoto (Japan)
2015-11-27
Introduction: Osteoblasts play essential roles in bone formation and regeneration, while they have low proliferation potential. Recently we established a procedure to directly convert human fibroblasts into osteoblasts (dOBs). Transduction of Runx2 (R), Osterix (X), Oct3/4 (O) and L-myc (L) genes followed by culturing under osteogenic conditions induced normal human fibroblasts to express osteoblast-specific genes and produce calcified bone matrix both in vitro and in vivo Intriguingly, a combination of only two factors, Oct3/4 and L-myc, significantly induced osteoblast-like phenotype in fibroblasts, but the mechanisms underlying the direct conversion remains to be unveiled. Materials and Methods: We examined which Oct family genes and Myc family genes are capable of inducing osteoblast-like phenotypic conversion. Results: As result Oct3/4, Oct6 and Oct9, among other Oct family members, had the capability, while N-myc was the most effective Myc family gene. The Oct9 plus N-myc was the best combination to induce direct conversion of human fibroblasts into osteoblast-like cells. Discussion: The present findings may greatly contribute to the elucidation of the roles of the Oct and Myc proteins in osteoblast direct reprogramming. The results may also lead to establishment of novel regenerative therapy for various bone resorption diseases. - Highlights: • Introducing L-myc in a combination with either Oct3/4, Oct6 or Oct9 enables the conversion of fibroblasts to osteoblasts. • A combination of L-myc with Oct3/4 or Oct9 can induce the cells to a phenotype closer to normal osteoblasts. • N-myc was considered the most appropriate Myc family gene for induction of osteoblast-like phenotype in fibroblasts. • The combination of Oct9 plus N-myc has the strongest capability of inducing osteoblast-like phenotype.
Bright, Melissa A; Huq, Mona Sayedul; Spencer, Terry; Applebaum, Jennifer W; Hardt, Nancy
2018-02-01
Youth who engage in animal cruelty are known to be at increased risk of perpetrating violence on other people in their lives including peers, loved ones, and elder family members. These youths have often been exposed to family violence, including animal cruelty perpetrated on their beloved pets by violent adults. The current study utilizes a data set of 81,000 juvenile offenders whose adverse childhood experiences are known and includes 466 youth who self-report engaging in animal cruelty. Compared to the larger group of juvenile offenders, the children admitting to engaging in animal cruelty are younger at time of first arrest, more likely to be male, and more likely to be White. When looking at their reports of adverse childhood experiences (ACEs), they are more likely than other juvenile offenders to have an array of adverse experiences beyond family violence and to have four or more ACEs. Although the youth who are cruel to animals are already troubled, the fact that they present to law enforcement at early ages provides early opportunities for intervention. Service providers outside the law enforcement field, such as teachers, physicians, veterinarians and animal control officers may be able to identify these vulnerable youth, and refer them to needed services before violence is visited on other humans. Copyright © 2017 Elsevier Ltd. All rights reserved.
Evolutionary Relationship and Structural Characterization of the EPF/EPFL Gene Family
Takata, Naoki; Yokota, Kiyonobu; Ohki, Shinya; Mori, Masashi; Taniguchi, Toru; Kurita, Manabu
2013-01-01
EPF1-EPF2 and EPFL9/Stomagen act antagonistically in regulating leaf stomatal density. The aim of this study was to elucidate the evolutionary functional divergence of EPF/EPFL family genes. Phylogenetic analyses showed that AtEPFL9/Stomagen-like genes are conserved only in vascular plants and are closely related to AtEPF1/EPF2-like genes. Modeling showed that EPF/EPFL peptides share a common 3D structure that is constituted of a scaffold and loop. Molecular dynamics simulation suggested that...
FGF: A web tool for Fishing Gene Family in a whole genome database
DEFF Research Database (Denmark)
Zheng, Hongkun; Shi, Junjie; Fang, Xiaodong
2007-01-01
Gene duplication is an important process in evolution. The availability of genome sequences of a number of organisms has made it possible to conduct comprehensive searches for duplicated genes enabling informative studies of their evolution. We have established the FGF (Fishing Gene Family) progr...... is freely available on a web server at http://fgf.genomics.org.cn/...
Energy Technology Data Exchange (ETDEWEB)
Kang, Qing-lin [Department of Orthopedic Surgery, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Xu, Jia [Department of Orthopedic Surgery, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Medical College of Soochow University, Suzhou, Jiangsu province 215000 (China); Zhang, Zeng [Department of Orthopedic Surgery, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); He, Jin-wei [Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Lu, Lian-song [Department of Orthopedic Surgery, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Medical College of Soochow University, Suzhou, Jiangsu province 215000 (China); Fu, Wen-zhen [Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Zhang, Zhen-lin, E-mail: zzl2002@medmail.com.cn [Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China)
2012-07-13
Highlights: Black-Right-Pointing-Pointer In our study, all of the patients were of Han Chinese ethnicity, which were rarely reported. Black-Right-Pointing-Pointer We identified three novel PHEX gene mutations in four unrelated families with XLH. Black-Right-Pointing-Pointer We found that the relationship between the phenotype and genotype of the PHEX gene was not invariant. Black-Right-Pointing-Pointer We found that two PHEX gene sites, p.534 and p.731, were conserved. -- Abstract: Background: X-linked hypophosphatemia (XLH), the most common form of inherited rickets, is a dominant disorder that is characterized by renal phosphate wasting with hypophosphatemia, abnormal bone mineralization, short stature, and rachitic manifestations. The related gene with inactivating mutations associated with XLH has been identified as PHEX, which is a phosphate-regulating gene with homologies to endopeptidases on the X chromosome. In this study, a variety of PHEX mutations were identified in four Chinese families with XLH. Methods: We investigated four unrelated Chinese families who exhibited typical features of XLH by using PCR to analyze mutations that were then sequenced. The laboratory and radiological investigations were conducted simultaneously. Results: Three novel mutations were found in these four families: one frameshift mutation, c.2033dupT in exon 20, resulting in p.T679H; one nonsense mutation, c.1294A > T in exon 11, resulting in p.K432X; and one missense mutation, c.2192T > C in exon 22, resulting in p.F731S. Conclusions: We found that the PHEX gene mutations were responsible for XLH in these Chinese families. Our findings are useful for understanding the genetic basis of Chinese patients with XLH.
International Nuclear Information System (INIS)
Kang, Qing-lin; Xu, Jia; Zhang, Zeng; He, Jin-wei; Lu, Lian-song; Fu, Wen-zhen; Zhang, Zhen-lin
2012-01-01
Highlights: ► In our study, all of the patients were of Han Chinese ethnicity, which were rarely reported. ► We identified three novel PHEX gene mutations in four unrelated families with XLH. ► We found that the relationship between the phenotype and genotype of the PHEX gene was not invariant. ► We found that two PHEX gene sites, p.534 and p.731, were conserved. -- Abstract: Background: X-linked hypophosphatemia (XLH), the most common form of inherited rickets, is a dominant disorder that is characterized by renal phosphate wasting with hypophosphatemia, abnormal bone mineralization, short stature, and rachitic manifestations. The related gene with inactivating mutations associated with XLH has been identified as PHEX, which is a phosphate-regulating gene with homologies to endopeptidases on the X chromosome. In this study, a variety of PHEX mutations were identified in four Chinese families with XLH. Methods: We investigated four unrelated Chinese families who exhibited typical features of XLH by using PCR to analyze mutations that were then sequenced. The laboratory and radiological investigations were conducted simultaneously. Results: Three novel mutations were found in these four families: one frameshift mutation, c.2033dupT in exon 20, resulting in p.T679H; one nonsense mutation, c.1294A > T in exon 11, resulting in p.K432X; and one missense mutation, c.2192T > C in exon 22, resulting in p.F731S. Conclusions: We found that the PHEX gene mutations were responsible for XLH in these Chinese families. Our findings are useful for understanding the genetic basis of Chinese patients with XLH.
Identification of Candidate Gene Variants in Korean MODY Families by Whole-Exome Sequencing.
Shim, Ye Jee; Kim, Jung Eun; Hwang, Su-Kyeong; Choi, Bong Seok; Choi, Byung Ho; Cho, Eun-Mi; Jang, Kyoung Mi; Ko, Cheol Woo
2015-01-01
To date, 13 genes causing maturity-onset diabetes of the young (MODY) have been identified. However, there is a big discrepancy in the genetic locus between Asian and Caucasian patients with MODY. Thus, we conducted whole-exome sequencing in Korean MODY families to identify causative gene variants. Six MODY probands and their family members were included. Variants in the dbSNP135 and TIARA databases for Koreans and the variants with minor allele frequencies >0.5% of the 1000 Genomes database were excluded. We selected only the functional variants (gain of stop codon, frameshifts and nonsynonymous single-nucleotide variants) and conducted a case-control comparison in the family members. The selected variants were scanned for the previously introduced gene set implicated in glucose metabolism. Three variants c.620C>T:p.Thr207Ile in PTPRD, c.559C>G:p.Gln187Glu in SYT9, and c.1526T>G:p.Val509Gly in WFS1 were respectively identified in 3 families. We could not find any disease-causative alleles of known MODY 1-13 genes. Based on the predictive program, Thr207Ile in PTPRD was considered pathogenic. Whole-exome sequencing is a valuable method for the genetic diagnosis of MODY. Further evaluation is necessary about the role of PTPRD, SYT9 and WFS1 in normal insulin release from pancreatic beta cells. © 2015 S. Karger AG, Basel.
Tan, Hua-Wei; Song, Xiao-Ming; Duan, Wei-Ke; Wang, Yan; Hou, Xi-Lin
2015-11-01
The SQUAMOSA PROMOTER BINDING PROTEIN (SBP)-box gene family contains highly conserved plant-specific transcription factors that play an important role in plant development, especially in flowering. Chinese cabbage (Brassica rapa subsp. pekinensis) is a leafy vegetable grown worldwide and is used as a model crop for research in genome duplication. The present study aimed to characterize the SBP-box transcription factor genes in Chinese cabbage. Twenty-nine SBP-box genes were identified in the Chinese cabbage genome and classified into six groups. We identified 23 orthologous and 5 co-orthologous SBP-box gene pairs between Chinese cabbage and Arabidopsis. An interaction network among these genes was constructed. Sixteen SBP-box genes were expressed more abundantly in flowers than in other tissues, suggesting their involvement in flowering. We show that the MiR156/157 family members may regulate the coding regions or 3'-UTR regions of Chinese cabbage SBP-box genes. As SBP-box genes were found to potentially participate in some plant development pathways, quantitative real-time PCR analysis was performed and showed that Chinese cabbage SBP-box genes were also sensitive to the exogenous hormones methyl jasmonic acid and salicylic acid. The SBP-box genes have undergone gene duplication and loss, evolving a more refined regulation for diverse stimulation in plant tissues. Our comprehensive genome-wide analysis provides insights into the SBP-box gene family of Chinese cabbage.
Threonine 53 in α-synuclein is conserved in long-living non-primate animals
DEFF Research Database (Denmark)
Larsen, Knud; Hedegaard, Claus; Bertelsen, Mads Frost
2009-01-01
α-Synuclein is the main constituent of Lewy bodies in familial and sporadic cases of Parkinson's disease (PD). Autosomal dominant point mutations, gene duplications or triplications in the α-synuclein (SNCA) gene cause hereditary forms of PD. One of the α-synuclein point mutations, Ala53Thr, is a...... that 53Thr is not a molecular adaptation for long-living animals to minimize the risk of developing PD...
Riazuddin, S; Hussain, M; Razzaq, A; Iqbal, Z; Shahzad, M; Polla, D L; Song, Y; van Beusekom, E; Khan, A A; Tomas-Roca, L; Rashid, M; Zahoor, M Y; Wissink-Lindhout, W M; Basra, M A R; Ansar, M; Agha, Z; van Heeswijk, K; Rasheed, F; Van de Vorst, M; Veltman, J A; Gilissen, C; Akram, J; Kleefstra, T; Assir, M Z; Grozeva, D; Carss, K; Raymond, F L; O'Connor, T D; Riazuddin, S A; Khan, S N; Ahmed, Z M; de Brouwer, A P M; van Bokhoven, H; Riazuddin, S
2017-11-01
Intellectual disability (ID) is a clinically and genetically heterogeneous disorder, affecting 1-3% of the general population. Although research into the genetic causes of ID has recently gained momentum, identification of pathogenic mutations that cause autosomal recessive ID (ARID) has lagged behind, predominantly due to non-availability of sizeable families. Here we present the results of exome sequencing in 121 large consanguineous Pakistani ID families. In 60 families, we identified homozygous or compound heterozygous DNA variants in a single gene, 30 affecting reported ID genes and 30 affecting novel candidate ID genes. Potential pathogenicity of these alleles was supported by co-segregation with the phenotype, low frequency in control populations and the application of stringent bioinformatics analyses. In another eight families segregation of multiple pathogenic variants was observed, affecting 19 genes that were either known or are novel candidates for ID. Transcriptome profiles of normal human brain tissues showed that the novel candidate ID genes formed a network significantly enriched for transcriptional co-expression (P<0.0001) in the frontal cortex during fetal development and in the temporal-parietal and sub-cortex during infancy through adulthood. In addition, proteins encoded by 12 novel ID genes directly interact with previously reported ID proteins in six known pathways essential for cognitive function (P<0.0001). These results suggest that disruptions of temporal parietal and sub-cortical neurogenesis during infancy are critical to the pathophysiology of ID. These findings further expand the existing repertoire of genes involved in ARID, and provide new insights into the molecular mechanisms and the transcriptome map of ID.
Lorin, Thibault; Brunet, Frédéric G.; Laudet, Vincent; Volff, Jean-Nicolas
2018-01-01
Vertebrate pigmentation is a highly diverse trait mainly determined by neural crest cell derivatives. It has been suggested that two rounds (1R/2R) of whole-genome duplications (WGDs) at the basis of vertebrates allowed changes in gene regulation associated with neural crest evolution. Subsequently, the teleost fish lineage experienced other WGDs, including the teleost-specific Ts3R before teleost radiation and the more recent Ss4R at the basis of salmonids. As the teleost lineage harbors the highest number of pigment cell types and pigmentation diversity in vertebrates, WGDs might have contributed to the evolution and diversification of the pigmentation gene repertoire in teleosts. We have compared the impact of the basal vertebrate 1R/2R duplications with that of the teleost-specific Ts3R and salmonid-specific Ss4R WGDs on 181 gene families containing genes involved in pigmentation. We show that pigmentation genes (PGs) have been globally more frequently retained as duplicates than other genes after Ts3R and Ss4R but not after the early 1R/2R. This is also true for non-pigmentary paralogs of PGs, suggesting that the function in pigmentation is not the sole key driver of gene retention after WGDs. On the long-term, specific categories of PGs have been repeatedly preferentially retained after ancient 1R/2R and Ts3R WGDs, possibly linked to the molecular nature of their proteins (e.g., DNA binding transcriptional regulators) and their central position in protein-protein interaction networks. Taken together, our results support a major role of WGDs in the diversification of the pigmentation gene repertoire in the teleost lineage, with a possible link with the diversity of pigment cell lineages observed in these animals compared to other vertebrates. PMID:29599177
[Progress in the study on diacylgycerol acyltransferase (DGAT)-related genes].
Ma, Hai-Ming; Shi, Qi-Shun; Liu, Xiao-Chun
2005-12-01
Diacylgycerol Acyltransferase (DGAT) plays an important role in the formation of lipid in different tissues of biological body. DGAT catalyzes the final step in triacylglycerol (TAG) biosynthesis by converting diacylgycerol (DAG) and fatty acyl-coenzyme A (CoA) into triacylglycerol. This enzyme is coded by both DGAT1 and DGAT2. DGAT1 belongs to the gene family of cholesterol acyltransferase (ACAT). DGAT2 belongs to the gene family of monoacylgycerol acyltransferases (MGAT1). This paper reviewed the structure, location on chromosome and biological effect of DGAT-related genes. The relationship between polymorphism and performance of animal was also discussed.
DEFF Research Database (Denmark)
Bisgaard, Marie Luise; Ripa, Rasmus S; Bülow, Steffen
2004-01-01
Development of one hundred or more adenomas in the colon and rectum is diagnostic for the dominantly inherited, autosomal disease Familial Adenomatous Polyposis (FAP). It is possible to identify a mutation in the Adenomatous Polyposis Coli (APC) gene in approximately 80% of the patients, and almost...... 1,000 different pathogenic mutations have been identified in the APC gene up till now. We report 12 novel and 24' previously described germline APC mutations from 48 unrelated Danish families. Four families with the mutation localized in the 3' region of the gene showed great variance in phenotypic...
Identification of the trehalose-6-phosphate synthase gene family in ...
Indian Academy of Sciences (India)
2015-03-04
Mar 4, 2015 ... stress, however, our study mainly analysed the TPS gene family under freezing conditions in winter wheat .... size the first-strand cDNA using the Fermentas RevertAid ..... In the stem of Dongnongdongmai 1, TaTPS1, 2, 3, 4, 8,.
Phylogenetic analysis of the MS4A and TMEM176 gene families.
Directory of Open Access Journals (Sweden)
Jonathan Zuccolo
2010-02-01
Full Text Available The MS4A gene family in humans includes CD20 (MS4A1, FcRbeta (MS4A2, Htm4 (MS4A3, and at least 13 other syntenic genes encoding membrane proteins, most having characteristic tetraspanning topology. Expression of MS4A genes is variable in tissues throughout the body; however, several are limited to cells in the hematopoietic system where they have known roles in immune cell functions. Genes in the small TMEM176 group share significant sequence similarity with MS4A genes and there is evidence of immune function of at least one of the encoded proteins. In this study, we examined the evolutionary history of the MS4A/TMEM176 families as well as tissue expression of the phylogenetically earliest members, in order to investigate their possible origins in immune cells.Orthologs of human MS4A genes were found only in mammals; however, MS4A gene homologs were found in most jawed vertebrates. TMEM176 genes were found only in mammals and bony fish. Several unusual MS4A genes having 2 or more tandem MS4A sequences were identified in the chicken (Gallus gallus and early mammals (opossum, Monodelphis domestica and platypus, Ornithorhyncus anatinus. A large number of highly conserved MS4A and TMEM176 genes was found in zebrafish (Danio rerio. The most primitive organism identified to have MS4A genes was spiny dogfish (Squalus acanthus. Tissue expression of MS4A genes in S. acanthias and D. rerio showed no evidence of expression restricted to the hematopoietic system.Our findings suggest that MS4A genes first appeared in cartilaginous fish with expression outside of the immune system, and have since diversified in many species into their modern forms with expression and function in both immune and nonimmune cells.
Expression of REG family genes in human inflammatory bowel diseases and its regulation
Directory of Open Access Journals (Sweden)
Chikatsugu Tsuchida
2017-12-01
Full Text Available The pathophysiology of inflammatory bowel disease (IBD reflects a balance between mucosal injury and reparative mechanisms. Some regenerating gene (Reg family members have been reported to be expressed in Crohn's disease (CD and ulcerative colitis (UC and to be involved as proliferative mucosal factors in IBD. However, expression of all REG family genes in IBD is still unclear. Here, we analyzed expression of all REG family genes (REG Iα, REG Iβ, REG III, HIP/PAP, and REG IV in biopsy specimens of UC and CD by real-time RT-PCR. REG Iα, REG Iβ, and REG IV genes were overexpressed in CD samples. REG IV gene was also overexpressed in UC samples. We further analyzed the expression mechanisms of REG Iα, REG Iβ, and REG IV genes in human colon cells. The expression of REG Iα was significantly induced by IL-6 or IL-22, and REG Iβ was induced by IL-22. Deletion analyses revealed that three regions (− 220 to − 211, − 179 to − 156, and − 146 to − 130 in REG Iα and the region (− 274 to− 260 in REG Iβ promoter were responsible for the activation by IL-22/IL-6. The promoters contain consensus transcription factor binding sequences for MZF1, RTEF1/TEAD4, and STAT3 in REG Iα, and HLTF/FOXN2F in REG Iβ, respectively. The introduction of siRNAs for MZF1, RTEF1/TEAD4, STAT3, and HLTF/FOXN2F abolished the transcription of REG Iα and REG Iβ. The gene activation mechanisms of REG Iα/REG Iβ may play a role in colon mucosal regeneration in IBD.
Genomic Survey and Expression Profiling of the MYB Gene Family in Watermelon
Directory of Open Access Journals (Sweden)
Qing XU
2018-01-01
Full Text Available Myeloblastosis (MYB proteins constitute one of the largest transcription factor (TF families in plants. They are functionally diverse in regulating plant development, metabolism, and multiple stress responses. However, the function of watermelon MYB proteins remains elusive to date. Here, a genome-wide identification of watermelon MYB TFs was performed by bioinformatics analysis. A total of 162 MYB genes were identified from watermelon (ClaMYB. A comprehensive overview of the ClaMYB genes was undertaken, including the gene structures, chromosomal distribution, gene duplication, conserved protein motif, and phylogenetic relationship. According to the analyses, the watermelon MYB genes were categorized into three groups (R1R2R3-MYB, R2R3-MYB, and MYB-related. Amino acid alignments for all MYB motifs of ClaMYBs demonstrated high conservation. Investigation of their chromosomal localization revealed that these ClaMYB genes distributed across the 11 watermelon chromosomes. Gene duplication analyses showed that tandem duplication events contributed predominantly to the expansion of the MYB gene family in the watermelon genome. Phylogenetic comparison of the ClaMYB proteins with Arabidopsis MYB proteins revealed that watermelon MYB proteins underwent a more diverse evolution after divergence from Arabidopsis. Some watermelon MYBs were found to cluster into the functional clades of Arabidopsis MYB proteins. Expression analysis under different stress conditions identified a group of watermelon MYB proteins implicated in the plant stress responses. The comprehensive investigation of watermelon MYB genes in this study provides a useful reference for future cloning and functional analysis of watermelon MYB proteins. Keywords: watermelon, MYB transcription factor, abiotic stress, phylogenetic analysis
Directory of Open Access Journals (Sweden)
Sergey Yegorov
Full Text Available Recent progress in the analysis of whole genome sequencing data has resulted in the emergence of paleogenomics, a field devoted to the reconstruction of ancestral genomes. Ancestral karyotype reconstructions have been used primarily to illustrate the dynamic nature of genome evolution. In this paper, we demonstrate how they can also be used to study individual gene families by examining the evolutionary history of relaxin hormones (RLN/INSL and relaxin family peptide receptors (RXFP. Relaxin family hormones are members of the insulin superfamily, and are implicated in the regulation of a variety of primarily reproductive and neuroendocrine processes. Their receptors are G-protein coupled receptors (GPCR's and include members of two distinct evolutionary groups, an unusual characteristic. Although several studies have tried to elucidate the origins of the relaxin peptide family, the evolutionary origin of their receptors and the mechanisms driving the diversification of the RLN/INSL-RXFP signaling systems in non-placental vertebrates has remained elusive. Here we show that the numerous vertebrate RLN/INSL and RXFP genes are products of an ancestral receptor-ligand system that originally consisted of three genes, two of which apparently trace their origins to invertebrates. Subsequently, diversification of the system was driven primarily by whole genome duplications (WGD, 2R and 3R followed by almost complete retention of the ligand duplicates in most vertebrates but massive loss of receptor genes in tetrapods. Interestingly, the majority of 3R duplicates retained in teleosts are potentially involved in neuroendocrine regulation. Furthermore, we infer that the ancestral AncRxfp3/4 receptor may have been syntenically linked to the AncRln-like ligand in the pre-2R genome, and show that syntenic linkages among ligands and receptors have changed dynamically in different lineages. This study ultimately shows the broad utility, with some caveats, of
AtTZF gene family localizes to cytoplasmic foci
Pomeranz, Marcelo; Lin, Pei-Chi; Finer, John; Jang, Jyan-Chyun
2010-01-01
In eukaryotes, mRNA turnover and translational repression represent important regulatory steps in gene expression. Curiously, when under cellular stresses, factors involved in these processes aggregate into cytoplasmic foci known as Processing bodies (P-bodies) and Stress Granules (SGs). In animals, CCCH Tandem Zinc Finger (TZF) proteins play important roles in mRNA decay within P-bodies. TTP, a P-body localized mammalian TZF, can bind to the 3'UTRs of mRNAs containing AU-rich elements (AREs)...
Genome-wide identification and characterization of the SBP-box gene family in Petunia.
Zhou, Qin; Zhang, Sisi; Chen, Feng; Liu, Baojun; Wu, Lan; Li, Fei; Zhang, Jiaqi; Bao, Manzhu; Liu, Guofeng
2018-03-12
SQUAMOSA PROMOTER BINDING PROTEIN (SBP)-box genes encode a family of plant-specific transcription factors (TFs) that play important roles in many growth and development processes including phase transition, leaf initiation, shoot and inflorescence branching, fruit development and ripening etc. The SBP-box gene family has been identified and characterized in many species, but has not been well studied in Petunia, an important ornamental genus. We identified 21 putative SPL genes of Petunia axillaris and P. inflata from the reference genome of P. axillaris N and P. inflata S6, respectively, which were supported by the transcriptome data. For further confirmation, all the 21 genes were also cloned from P. hybrida line W115 (Mitchel diploid). Phylogenetic analysis based on the highly conserved SBP domains arranged PhSPLs in eight groups, analogous to those from Arabidopsis and tomato. Furthermore, the Petunia SPL genes had similar exon-intron structure and the deduced proteins contained very similar conserved motifs within the same subgroup. Out of 21 PhSPL genes, fourteen were predicted to be potential targets of PhmiR156/157, and the putative miR156/157 response elements (MREs) were located in the coding region of group IV, V, VII and VIII genes, but in the 3'-UTR regions of group VI genes. SPL genes were also identified from another two wild Petunia species, P. integrifolia and P. exserta, based on their transcriptome databases to investigate the origin of PhSPLs. Phylogenetic analysis and multiple alignments of the coding sequences of PhSPLs and their orthologs from wild species indicated that PhSPLs were originated mainly from P. axillaris. qRT-PCR analysis demonstrated differential spatiotemperal expression patterns of PhSPL genes in petunia and many were expressed predominantly in the axillary buds and/or inflorescences. In addition, overexpression of PhSPL9a and PhSPL9b in Arabidopsis suggested that these genes play a conserved role in promoting the vegetative
Dlx homeobox gene family expression in osteoclasts.
Lézot, F; Thomas, B L; Blin-Wakkach, C; Castaneda, B; Bolanos, A; Hotton, D; Sharpe, P T; Heymann, D; Carles, G F; Grigoriadis, A E; Berdal, A
2010-06-01
Skeletal growth and homeostasis require the finely orchestrated secretion of mineralized tissue matrices by highly specialized cells, balanced with their degradation by osteoclasts. Time- and site-specific expression of Dlx and Msx homeobox genes in the cells secreting these matrices have been identified as important elements in the regulation of skeletal morphology. Such specific expression patterns have also been reported in osteoclasts for Msx genes. The aim of the present study was to establish the expression patterns of Dlx genes in osteoclasts and identify their function in regulating skeletal morphology. The expression patterns of all Dlx genes were examined during the whole osteoclastogenesis using different in vitro models. The results revealed that Dlx1 and Dlx2 are the only Dlx family members with a possible function in osteoclastogenesis as well as in mature osteoclasts. Dlx5 and Dlx6 were detected in the cultures but appear to be markers of monocytes and their derivatives. In vivo, Dlx2 expression in osteoclasts was examined using a Dlx2/LacZ transgenic mouse. Dlx2 is expressed in a subpopulation of osteoclasts in association with tooth, brain, nerve, and bone marrow volumetric growths. Altogether the present data suggest a role for Dlx2 in regulation of skeletal morphogenesis via functions within osteoclasts. (c) 2010 Wiley-Liss, Inc.
Directory of Open Access Journals (Sweden)
Yong Guo
Full Text Available The Dof domain protein family is a classic plant-specific zinc-finger transcription factor family involved in a variety of biological processes. There is great diversity in the number of Dof genes in different plants. However, there are only very limited reports on the characterization of Dof transcription factors in soybean (Glycine max. In the present study, 78 putative Dof genes were identified from the whole-genome sequence of soybean. The predicted GmDof genes were non-randomly distributed within and across 19 out of 20 chromosomes and 97.4% (38 pairs were preferentially retained duplicate paralogous genes located in duplicated regions of the genome. Soybean-specific segmental duplications contributed significantly to the expansion of the soybean Dof gene family. These Dof proteins were phylogenetically clustered into nine distinct subgroups among which the gene structure and motif compositions were considerably conserved. Comparative phylogenetic analysis of these Dof proteins revealed four major groups, similar to those reported for Arabidopsis and rice. Most of the GmDofs showed specific expression patterns based on RNA-seq data analyses. The expression patterns of some duplicate genes were partially redundant while others showed functional diversity, suggesting the occurrence of sub-functionalization during subsequent evolution. Comprehensive expression profile analysis also provided insights into the soybean-specific functional divergence among members of the Dof gene family. Cis-regulatory element analysis of these GmDof genes suggested diverse functions associated with different processes. Taken together, our results provide useful information for the functional characterization of soybean Dof genes by combining phylogenetic analysis with global gene-expression profiling.
Xu, Zongda; Zhang, Qixiang; Sun, Lidan; Du, Dongliang; Cheng, Tangren; Pan, Huitang; Yang, Weiru; Wang, Jia
2014-10-01
MADS-box genes encode transcription factors that play crucial roles in plant development, especially in flower and fruit development. To gain insight into this gene family in Prunus mume, an important ornamental and fruit plant in East Asia, and to elucidate their roles in flower organ determination and fruit development, we performed a genome-wide identification, characterisation and expression analysis of MADS-box genes in this Rosaceae tree. In this study, 80 MADS-box genes were identified in P. mume and categorised into MIKC, Mα, Mβ, Mγ and Mδ groups based on gene structures and phylogenetic relationships. The MIKC group could be further classified into 12 subfamilies. The FLC subfamily was absent in P. mume and the six tandemly arranged DAM genes might experience a species-specific evolution process in P. mume. The MADS-box gene family might experience an evolution process from MIKC genes to Mδ genes to Mα, Mβ and Mγ genes. The expression analysis suggests that P. mume MADS-box genes have diverse functions in P. mume development and the functions of duplicated genes diverged after the duplication events. In addition to its involvement in the development of female gametophytes, type I genes also play roles in male gametophytes development. In conclusion, this study adds to our understanding of the roles that the MADS-box genes played in flower and fruit development and lays a foundation for selecting candidate genes for functional studies in P. mume and other species. Furthermore, this study also provides a basis to study the evolution of the MADS-box family.
Familial Dilated Cardiomyopathy Caused by a Novel Frameshift in the BAG3 Gene.
Directory of Open Access Journals (Sweden)
Rocio Toro
Full Text Available Dilated cardiomyopathy, a major cause of chronic heart failure and cardiac transplantation, is characterized by left ventricular or biventricular heart dilatation. In nearly 50% of cases the pathology is inherited, and more than 60 genes have been reported as disease-causing. However, in 30% of familial cases the mutation remains unidentified even after comprehensive genetic analysis. This study clinically and genetically assessed a large Spanish family affected by dilated cardiomyopathy to search for novel variations.Our study included a total of 100 family members. Clinical assessment was performed in alive, and genetic analysis was also performed in alive and 1 deceased relative. Genetic screening included resequencing of 55 genes associated with sudden cardiac death, and Sanger sequencing of main disease-associated genes. Genetic analysis identified a frame-shift variation in BAG3 (p.H243Tfr*64 in 32 patients. Genotype-phenotype correlation identified substantial heterogeneity in disease expression. Of 32 genetic carriers (one deceased, 21 relatives were clinically affected, and 10 were asymptomatic. Seventeen of the symptomatic genetic carriers exhibited proto-diastolic septal knock by echocardiographic assessment.We report p.H243Tfr*64_BAG3 as a novel pathogenic variation responsible for familial dilated cardiomyopathy. This variation correlates with a more severe phenotype of the disease, mainly in younger individuals. Genetic analysis in families, even asymptomatic individuals, enables early identification of individuals at risk and allows implementation of preventive measures.
International Nuclear Information System (INIS)
Macqueen, Daniel J.; Bower, Neil I.; Johnston, Ian A.
2010-01-01
Research highlights: → The expanded akirin gene family of Atlantic salmon was characterised. → akirin paralogues are regulated between mono- and multi-nucleated muscle cells. → akirin paralogues positioned within known genetic networks controlling myogenesis. → Co-expression of akirin paralogues is evident across cell types/during myogenesis. → Selection has likely maintained common regulatory elements among akirin paralogues. -- Abstract: Vertebrate akirin genes usually form a family with one-to-three members that regulate gene expression during the innate immune response, carcinogenesis and myogenesis. We recently established that an expanded family of eight akirin genes is conserved across salmonid fish. Here, we measured mRNA levels of the akirin family of Atlantic salmon (Salmo salar L.) during the differentiation of primary myoblasts cultured from fast-skeletal muscle. Using hierarchical clustering and correlation, the data was positioned into a network of expression profiles including twenty further genes that regulate myogenesis. akirin1(2b) was not significantly regulated during the maturation of the cell culture. akirin2(1a) and 2(1b), along with IGF-II and several igfbps, were most highly expressed in mononuclear cells, then significantly and constitutively downregulated as differentiation proceeded and myotubes formed/matured. Conversely, akirin1(1a), 1(1b), 1(2a), 2(2a) and 2(2b) were expressed at lowest levels when mononuclear cells dominated the culture and highest levels when confluent layers of myotubes were evident. However, akirin1(2a) and 2(2a) were first upregulated earlier than akirin1(1a), 1(1b) and 2(2b), when rates of myoblast proliferation were highest. Interestingly, akirin1(1b), 1(2a), 2(2a) and 2(2b) formed part of a module of co-expressed genes involved in muscle differentiation, including myod1a, myog, mef2a, 14-3-3β and 14-3-3γ. All akirin paralogues were expressed ubiquitously across ten tissues, although mRNA levels
Energy Technology Data Exchange (ETDEWEB)
Macqueen, Daniel J., E-mail: djm59@st-andrews.ac.uk [Laboratory of Physiological and Evolutionary Genomics, Scottish Oceans Institute, University of St Andrews, St Andrews, Fife KY16 8LB (United Kingdom); Bower, Neil I., E-mail: nib@st-andrews.ac.uk [Laboratory of Physiological and Evolutionary Genomics, Scottish Oceans Institute, University of St Andrews, St Andrews, Fife KY16 8LB (United Kingdom); Johnston, Ian A., E-mail: iaj@st-andrews.ac.uk [Laboratory of Physiological and Evolutionary Genomics, Scottish Oceans Institute, University of St Andrews, St Andrews, Fife KY16 8LB (United Kingdom)
2010-10-01
Research highlights: {yields} The expanded akirin gene family of Atlantic salmon was characterised. {yields} akirin paralogues are regulated between mono- and multi-nucleated muscle cells. {yields} akirin paralogues positioned within known genetic networks controlling myogenesis. {yields} Co-expression of akirin paralogues is evident across cell types/during myogenesis. {yields} Selection has likely maintained common regulatory elements among akirin paralogues. -- Abstract: Vertebrate akirin genes usually form a family with one-to-three members that regulate gene expression during the innate immune response, carcinogenesis and myogenesis. We recently established that an expanded family of eight akirin genes is conserved across salmonid fish. Here, we measured mRNA levels of the akirin family of Atlantic salmon (Salmo salar L.) during the differentiation of primary myoblasts cultured from fast-skeletal muscle. Using hierarchical clustering and correlation, the data was positioned into a network of expression profiles including twenty further genes that regulate myogenesis. akirin1(2b) was not significantly regulated during the maturation of the cell culture. akirin2(1a) and 2(1b), along with IGF-II and several igfbps, were most highly expressed in mononuclear cells, then significantly and constitutively downregulated as differentiation proceeded and myotubes formed/matured. Conversely, akirin1(1a), 1(1b), 1(2a), 2(2a) and 2(2b) were expressed at lowest levels when mononuclear cells dominated the culture and highest levels when confluent layers of myotubes were evident. However, akirin1(2a) and 2(2a) were first upregulated earlier than akirin1(1a), 1(1b) and 2(2b), when rates of myoblast proliferation were highest. Interestingly, akirin1(1b), 1(2a), 2(2a) and 2(2b) formed part of a module of co-expressed genes involved in muscle differentiation, including myod1a, myog, mef2a, 14-3-3{beta} and 14-3-3{gamma}. All akirin paralogues were expressed ubiquitously across ten
Chen, Z Y; Battinelli, E M; Fielder, A; Bundey, S; Sims, K; Breakefield, X O; Craig, I W
1993-10-01
Familial exudative vitreoretinopathy (FEVR) is a hereditary disorder characterized by an abnormality of the peripheral retina. Both autosomal dominant (adFEVR) and X-linked (XLFEVR) forms have been described, but the biochemical defect(s) underlying the symptoms are unknown. Molecular analysis of the Norrie gene locus (NDP) in a four generation FEVR family (shown previously to exhibit linkage to the X-chromosome markers DXS228 and MAOA (Xp11.4-p11.3)) reveals a missense mutation in the highly conserved region of the NDP gene, which caused a neutral amino acid substitution (Leu124Phe), was detected in all of the affected males, but not in the unaffected family members, nor in normal controls. The observations suggest that phenotypes of both XLFEVR and Norrie disease can result from mutations in the same gene.
Directory of Open Access Journals (Sweden)
Sierra M Li
Full Text Available Monoallelic expression is an integral component of regulation of a number of essential genes and gene families. To probe for allele-specific expression in cells of CNS origin, we used next-generation sequencing (RNA-seq to analyze four clonal neural stem cell (NSC lines derived from Mus musculus C57BL/6 (B6×Mus musculus molossinus (JF1 adult female mice. We established a JF1 cSNP library, then ascertained transcriptome-wide expression from B6 vs. JF1 alleles in the NSC lines. Validating the assay, we found that 262 of 268 X-linked genes evaluable in at least one cell line showed monoallelic expression (at least 85% expression of the predominant allele, p-value<0.05. For autosomal genes 170 of 7,198 genes (2.4% of the total showed monoallelic expression in at least 2 evaluable cell lines. The group included eight known imprinted genes with the expected pattern of allele-specific expression. Among the other autosomal genes with monoallelic expression were five members of the glutathione transferase gene superfamily, which processes xenobiotic compounds as well as carcinogens and cancer therapeutic agents. Monoallelic expression within this superfamily thus may play a functional role in the response to diverse and potentially lethal exogenous factors, as is the case for the immunoglobulin and olfactory receptor superfamilies. Other genes and gene families showing monoallelic expression include the annexin gene family and the Thy1 gene, both linked to inflammation and cancer, as well as genes linked to alcohol dependence (Gabrg1 and epilepsy (Kcnma1. The annotated set of genes will provide a resource for investigation of mechanisms underlying certain cases of these and other major disorders.
[Analysis of the NDP gene in a Chinese family with X-linked recessive Norrie disease].
Mei, Libin; Huang, Yanru; Pan, Qian; Liang, Desheng; Wu, Lingqian
2015-05-01
The purpose of the current research was to investigate the NDP (Norrie disease protein) gene in one Chinese family with Norrie disease (ND) and to characterize the related clinical features. Clinical data of the proband and his family members were collected. Complete ophthalmic examinations were carried out on the proband. Genomic DNA was extracted from peripheral blood leukocytes of 35 family members. Molecular analysis of the NDP gene was performed by polymerase chain reaction and direct sequencing of all exons and flanking regions. A hemizygous NDP missense mutation c.362G > A (p.Arg121Gln) in exon 3 was identified in the affected members, but not in any of the unaffected family individuals. The missense mutation c.362G > A in NDP is responsible for the Norrie disease in this family. This discovery will help provide the family members with accurate and reliable genetic counseling and prenatal diagnosis.
The Toll-like receptor gene family is integrated into human DNA damage and p53 networks.
Directory of Open Access Journals (Sweden)
Daniel Menendez
2011-03-01
Full Text Available In recent years the functions that the p53 tumor suppressor plays in human biology have been greatly extended beyond "guardian of the genome." Our studies of promoter response element sequences targeted by the p53 master regulatory transcription factor suggest a general role for this DNA damage and stress-responsive regulator in the control of human Toll-like receptor (TLR gene expression. The TLR gene family mediates innate immunity to a wide variety of pathogenic threats through recognition of conserved pathogen-associated molecular motifs. Using primary human immune cells, we have examined expression of the entire TLR gene family following exposure to anti-cancer agents that induce the p53 network. Expression of all TLR genes, TLR1 to TLR10, in blood lymphocytes and alveolar macrophages from healthy volunteers can be induced by DNA metabolic stressors. However, there is considerable inter-individual variability. Most of the TLR genes respond to p53 via canonical as well as noncanonical promoter binding sites. Importantly, the integration of the TLR gene family into the p53 network is unique to primates, a recurrent theme raised for other gene families in our previous studies. Furthermore, a polymorphism in a TLR8 response element provides the first human example of a p53 target sequence specifically responsible for endogenous gene induction. These findings-demonstrating that the human innate immune system, including downstream induction of cytokines, can be modulated by DNA metabolic stress-have many implications for health and disease, as well as for understanding the evolution of damage and p53 responsive networks.
Huang, Xiaoyan; Tian, Mao; Li, Jiankang; Cui, Ling; Li, Min; Zhang, Jianguo
2017-11-01
Norrie disease (ND) is a rare X-linked genetic disorder, the main symptoms of which are congenital blindness and white pupils. It has been reported that ND is caused by mutations in the NDP gene. Although many mutations in NDP have been reported, the genetic cause for many patients remains unknown. In this study, the aim is to investigate the genetic defect in a five-generation family with typical symptoms of ND. To identify the causative gene, next-generation sequencing based target capture sequencing was performed. Segregation analysis of the candidate variant was performed in additional family members using Sanger sequencing. We identified a novel missense variant (c.314C>A) located within the NDP gene. The mutation cosegregated within all affected individuals in the family and was not found in unaffected members. By happenstance, in this family, we also detected a known pathogenic variant of retinitis pigmentosa in a healthy individual. c.314C>A mutation of NDP gene is a novel mutation and broadens the genetic spectrum of ND.
Next-generation sequencing reveals a novel NDP gene mutation in a Chinese family with Norrie disease
Directory of Open Access Journals (Sweden)
Xiaoyan Huang
2017-01-01
Full Text Available Purpose: Norrie disease (ND is a rare X-linked genetic disorder, the main symptoms of which are congenital blindness and white pupils. It has been reported that ND is caused by mutations in the NDP gene. Although many mutations in NDP have been reported, the genetic cause for many patients remains unknown. In this study, the aim is to investigate the genetic defect in a five-generation family with typical symptoms of ND. Methods: To identify the causative gene, next-generation sequencing based target capture sequencing was performed. Segregation analysis of the candidate variant was performed in additional family members using Sanger sequencing. Results: We identified a novel missense variant (c.314C>A located within the NDP gene. The mutation cosegregated within all affected individuals in the family and was not found in unaffected members. By happenstance, in this family, we also detected a known pathogenic variant of retinitis pigmentosa in a healthy individual. Conclusion: c.314C>A mutation of NDP gene is a novel mutation and broadens the genetic spectrum of ND.
Molecular Evolution of the Glycosyltransferase 6 Gene Family in Primates
Directory of Open Access Journals (Sweden)
Eliane Evanovich
2016-01-01
Full Text Available Glycosyltransferase 6 gene family includes ABO, Ggta1, iGb3S, and GBGT1 genes and by three putative genes restricted to mammals, GT6m6, GTm6, and GT6m7, only the latter is found in primates. GT6 genes may encode functional and nonfunctional proteins. Ggta1 and GBGT1 genes, for instance, are pseudogenes in catarrhine primates, while iGb3S gene is only inactive in human, bonobo, and chimpanzee. Even inactivated, these genes tend to be conversed in primates. As some of the GT6 genes are related to the susceptibility or resistance to parasites, we investigated (i the selective pressure on the GT6 paralogs genes in primates; (ii the basis of the conservation of iGb3S in human, chimpanzee, and bonobo; and (iii the functional potential of the GBGT1 and GT6m7 in catarrhines. We observed that the purifying selection is prevalent and these genes have a low diversity, though ABO and Ggta1 genes have some sites under positive selection. GT6m7, a putative gene associated with aggressive periodontitis, may have regulatory function, but experimental studies are needed to assess its function. The evolutionary conservation of iGb3S in humans, chimpanzee, and bonobo seems to be the result of proximity to genes with important biological functions.
Genome-wide analysis of the WRKY gene family in physic nut (Jatropha curcas L.).
Xiong, Wangdan; Xu, Xueqin; Zhang, Lin; Wu, Pingzhi; Chen, Yaping; Li, Meiru; Jiang, Huawu; Wu, Guojiang
2013-07-25
The WRKY proteins, which contain highly conserved WRKYGQK amino acid sequences and zinc-finger-like motifs, constitute a large family of transcription factors in plants. They participate in diverse physiological and developmental processes. WRKY genes have been identified and characterized in a number of plant species. We identified a total of 58 WRKY genes (JcWRKY) in the genome of the physic nut (Jatropha curcas L.). On the basis of their conserved WRKY domain sequences, all of the JcWRKY proteins could be assigned to one of the previously defined groups, I-III. Phylogenetic analysis of JcWRKY genes with Arabidopsis and rice WRKY genes, and separately with castor bean WRKY genes, revealed no evidence of recent gene duplication in JcWRKY gene family. Analysis of transcript abundance of JcWRKY gene products were tested in different tissues under normal growth condition. In addition, 47 WRKY genes responded to at least one abiotic stress (drought, salinity, phosphate starvation and nitrogen starvation) in individual tissues (leaf, root and/or shoot cortex). Our study provides a useful reference data set as the basis for cloning and functional analysis of physic nut WRKY genes. Copyright © 2013 Elsevier B.V. All rights reserved.
Complexity of rice Hsp100 gene family: lessons from rice genome ...
Indian Academy of Sciences (India)
Madhu Sudhan
2007-03-29
Mar 29, 2007 ... Chaperonins are a class of molecular chaperones found in prokaryotes and in the ... Keywords. Chaperone, gene family, Hsp100, Oryza sativa ..... Sculpting the proteome with AAA+ proteases and disassembly machines; Cell ...
Solyom, Szilvia; Winqvist, Robert; Nikkilä, Jenni; Rapakko, Katrin; Hirvikoski, Pasi; Kokkonen, Hannaleena; Pylkäs, Katri
2011-03-28
A portion of familial breast cancer cases are caused by mutations in the same genes that are inactivated in the downstream part of Fanconi anemia (FA) signaling pathway. Here we have assessed the FANCA gene for breast cancer susceptibility by examining blood DNA for aberrations from 100 Northern Finnish breast cancer families using the MLPA method. We identified a novel heterozygous deletion, removing the promoter and 12 exons of the gene in one family. This allele was absent from 124 controls. We conclude that FANCA deletions might contribute to breast cancer susceptibility, potentially in combination with other germline mutations. To our knowledge, this is the first study reporting a large deletion in an upstream FA gene in familial breast cancer. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.
Neurexin gene family variants as risk factors for autism spectrum disorder.
Wang, Jia; Gong, Jianhua; Li, Li; Chen, Yanlin; Liu, Lingfei; Gu, HuaiTing; Luo, Xiu; Hou, Fang; Zhang, Jiajia; Song, Ranran
2018-01-01
Increasing evidence suggests that abnormal synaptic function leads to neuronal developmental disorders and is an important component of the etiology of autism spectrum disorder (ASD). Neurexins are presynaptic cell-adhesion molecules that affect the function of synapses and mediate the conduction of nerve signals. Thus, neurexins are attractive candidate genes for autism. Since gene families have greater power to reveal genetic association than single genes, we designed this case-control study to investigate six genetic variants in three neurexin genes (NRXN1, NRXN2, and NRXN3) in a Chinese population including 529 ASD patients and 1,923 healthy controls. We found that two SNPs were significantly associated with ASD after false discovery rate (FDR) adjustment for multiple comparisons. The NRXN2 rs12273892 polymorphism T allele and AT genotype were significantly associated with increased risk of ASD (respectively: OR = 1.328, 95% CI = 1.133-1.557, P Autism Res 2018, 11: 37-43. © 2017 International Society for Autism Research, Wiley Periodicals, Inc. Autism spectrum disorder (ASD) is a neurodevelopmental disorder that is highly heritable, and studies have found a number of candidate genes that might contribute to ASD. Neurexins are presynaptic cell-adhesion molecules that affect the function of synapses and mediate the conduction of nerve signals, and they play an important role in normal brain development and become candidate genes for autism. The purpose of our study is to explore the association between variants of the neurexins gene family and ASD in a Chinese population through a case-control study. © 2017 International Society for Autism Research, Wiley Periodicals, Inc.
Genetic diversity of bitter taste receptor gene family in Sichuan
Indian Academy of Sciences (India)
Genetic diversity of bitter taste receptor gene family in Sichuan domestic and Tibetan chicken populations. YUAN SU DIYAN LI UMA GAUR YAN WANG NAN WU BINLONG CHEN HONGXIAN XU HUADONG YIN YAODONG HU QING ZHU. RESEARCH ARTICLE Volume 95 Issue 3 September 2016 pp 675-681 ...
X-exome sequencing of 405 unresolved families identifies seven novel intellectual disability genes
Hu, H; Haas, S.A.; Chelly, J.; Esch, H. Van; Raynaud, M.; Brouwer, A.P. de; Weinert, S.; Froyen, G.; Frints, S.G.; Laumonnier, F.; Zemojtel, T.; Love, M.I.; Richard, H.; Emde, A.K.; Bienek, M.; Jensen, C.; Hambrock, M.; Fischer, U.; Langnick, C.; Feldkamp, M.; Wissink-Lindhout, W.; Lebrun, N.; Castelnau, L.; Rucci, J.; Montjean, R.; Dorseuil, O.; Billuart, P.; Stuhlmann, T.; Shaw, M.; Corbett, M.A.; Gardner, A.; Willis-Owen, S.; Tan, C.; Friend, K.L.; Belet, S.; Roozendaal, K.E. van; Jimenez-Pocquet, M.; Moizard, M.P.; Ronce, N.; Sun, R.; O'Keeffe, S.; Chenna, R.; Bommel, A. van; Goke, J.; Hackett, A.; Field, M.; Christie, L.; Boyle, J.; Haan, E.; Nelson, J.; Turner, G.; Baynam, G.; Gillessen-Kaesbach, G.; Muller, U.; Steinberger, D.; Budny, B.; Badura-Stronka, M.; Latos-Bielenska, A.; Ousager, L.B.; Wieacker, P.; Rodriguez Criado, G.; Bondeson, M.L.; Anneren, G.; Dufke, A.; Cohen, M.; Maldergem, L. Van; Vincent-Delorme, C.; Echenne, B.; Simon-Bouy, B.; Kleefstra, T.; Willemsen, M.H.; Fryns, J.P.; Devriendt, K.; Ullmann, R.; Vingron, M.; Wrogemann, K.; Wienker, T.F.; Tzschach, A.; Bokhoven, H. van; Gecz, J.; Jentsch, T.J.; Chen, W.; Ropers, H.H.; Kalscheuer, V.M.
2016-01-01
X-linked intellectual disability (XLID) is a clinically and genetically heterogeneous disorder. During the past two decades in excess of 100 X-chromosome ID genes have been identified. Yet, a large number of families mapping to the X-chromosome remained unresolved suggesting that more XLID genes or
X-exome sequencing of 405 unresolved families identifies seven novel intellectual disability genes
DEFF Research Database (Denmark)
Hu, H; Haas, S A; Chelly, J
2016-01-01
X-linked intellectual disability (XLID) is a clinically and genetically heterogeneous disorder. During the past two decades in excess of 100 X-chromosome ID genes have been identified. Yet, a large number of families mapping to the X-chromosome remained unresolved suggesting that more XLID genes...
Lineage-Specific Expansion of the Chalcone Synthase Gene Family in Rosids.
Directory of Open Access Journals (Sweden)
Kattina Zavala
Full Text Available Rosids are a monophyletic group that includes approximately 70,000 species in 140 families, and they are found in a variety of habitats and life forms. Many important crops such as fruit trees and legumes are rosids. The evolutionary success of this group may have been influenced by their ability to produce flavonoids, secondary metabolites that are synthetized through a branch of the phenylpropanoid pathway where chalcone synthase is a key enzyme. In this work, we studied the evolution of the chalcone synthase gene family in 12 species belonging to the rosid clade. Our results show that the last common ancestor of the rosid clade possessed six chalcone synthase gene lineages that were differentially retained during the evolutionary history of the group. In fact, of the six gene lineages that were present in the last common ancestor, 7 species retained 2 of them, whereas the other 5 only retained one gene lineage. We also show that one of the gene lineages was disproportionately expanded in species that belonged to the order Fabales (soybean, barrel medic and Lotus japonicas. Based on the available literature, we suggest that this gene lineage possesses stress-related biological functions (e.g., response to UV light, pathogen defense. We propose that the observed expansion of this clade was a result of a selective pressure to increase the amount of enzymes involved in the production of phenylpropanoid pathway-derived secondary metabolites, which is consistent with the hypothesis that suggested that lineage-specific expansions fuel plant adaptation.
Directory of Open Access Journals (Sweden)
Carolina eRípodas
2015-01-01
Full Text Available In the past decade, plant nuclear factor Y (NF-Y genes have gained major interest due to their roles in many biological processes in plant development or adaptation to environmental conditions, particularly in the root nodule symbiosis established between legume plants and nitrogen fixing bacteria. NF-Ys are heterotrimeric transcriptional complexes composed of three subunits, NF-YA, NF-YB and NF-YC, which bind with high affinity and specificity to the CCAAT box, a cis element present in many eukaryotic promoters. In plants, NF-Y subunits consist of gene families with about ten members each. In this study, we have identified and characterized the NF-Y gene families of common bean (Phaseolus vulgaris, a grain legume of worldwide economical importance and the main source of dietary protein of developing countries. Expression analysis showed that some members of each family are up-regulated at early or late stages of the nitrogen fixing symbiotic interaction with its partner Rhizobium etli. We also showed that some genes are differentially accumulated in response to inoculation with high or less efficient R. etli strains, constituting excellent candidates to participate in the strain-specific response during symbiosis. Genes of the NF-YA family exhibit a highly structured intron-exon organization. Moreover, this family is characterized by the presence of upstream ORFs when introns in the 5' UTR are retained and miRNA target sites in their 3' UTR, suggesting that these genes might be subjected to a complex post-transcriptional regulation. Multiple protein alignments indicated the presence of highly conserved domains in each of the NF-Y families, presumably involved in subunit interactions and DNA binding. The analysis presented here constitutes a starting point to understand the regulation and biological function of individual members of the NF-Y families in different developmental processes in this grain legume.
Molecular evolution of the actin-like MreB protein gene family in wall-less bacteria.
Ku, Chuan; Lo, Wen-Sui; Kuo, Chih-Horng
2014-04-18
The mreB gene family encodes actin-like proteins that determine cell shape by directing cell wall synthesis and often exists in one to three copies in the genomes of non-spherical bacteria. Intriguingly, while most wall-less bacteria do not have this gene, five to seven mreB homologs are found in Spiroplasma and Haloplasma, which are both characterized by cell contractility. To investigate the molecular evolution of this gene family in wall-less bacteria, we sampled the available genome sequences from these two genera and other related lineages for comparative analysis. The gene phylogenies indicated that the mreB homologs in Haloplasma are more closely related to those in Firmicutes, whereas those in Spiroplasma form a separate clade. This finding suggests that the gene family expansions in these two lineages are the results of independent ancient duplications. Moreover, the Spiroplasma mreB homologs can be classified into five clades, of which the genomic positions are largely conserved. The inference of gene gains and losses suggests that there has been an overall trend to retain only one homolog from each of the five mreB clades in the evolutionary history of Spiroplasma. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Ashutosh ePandey
2016-02-01
Full Text Available The homedodomain zipper family (HD-ZIP of transcription factors is present only in plants and plays important role in the regulation of plant-specific processes. The subfamily IV of HDZ transcription factors (HD-ZIP IV has primarily been implicated in the regulation of epidermal structure development. Though this gene family is present in all lineages of land plants, members of this gene family have not been identified in banana, which is one of the major staple fruit crops. In the present work, we identified 21 HDZIV genes in banana by the computational analysis of banana genome resource. Our analysis suggested that these genes putatively encode proteins having all the characteristic domains of HDZIV transcription factors. The phylogenetic analysis of the banana HDZIV family genes further confirmed that after separation from a common ancestor, the banana and poales lineages might have followed distinct evolutionary paths. Further, we conclude that segmental duplication played a major role in the evolution of banana HDZIV genes. All the identified banana HDZIV genes expresses in different banana tissue, however at varying levels. The transcript levels of some of the banana HDZIV genes were also detected in banana fruit pulp, suggesting their putative role in fruit attributes. A large number of genes of this family showed modulated expression under drought and salinity stress. Taken together, the present work lays a foundation for elucidation of functional aspects of the banana HDZIV genes and for their possible use in the banana improvement programs.
Zhu, Dan; Bai, Xi; Luo, Xiao; Chen, Qin; Cai, Hua; Ji, Wei; Zhu, Yanming
2013-02-01
Wild soybean (Glycine soja L. G07256) exhibits a greater adaptability to soil bicarbonate stress than cultivated soybean, and recent discoveries show that TIFY family genes are involved in the response to several abiotic stresses. A genomic and transcriptomic analysis of all TIFY genes in G. soja, compared with G. max, will provide insight into the function of this gene family in plant bicarbonate stress response. This article identified and characterized 34 TIFY genes in G. soja. Sequence analyses indicated that most GsTIFY proteins had two conserved domains: TIFY and Jas. Phylogenetic analyses suggested that these GsTIFY genes could be classified into two groups. A clustering analysis of all GsTIFY transcript expression profiles from bicarbonate stress treated G. soja showed that there were five different transcript patterns in leaves and six different transcript patterns in roots when the GsTIFY family responds to bicarbonate stress. Moreover, the expression level changes of all TIFY genes in cultivated soybean, treated with bicarbonate stress, were also verified. The expression comparison analysis of TIFYs between wild and cultivated soybeans confirmed that, different from the cultivated soybean, GsTIFY (10a, 10b, 10c, 10d, 10e, 10f, 11a, and 11b) were dramatically up-regulated at the early stage of stress, while GsTIFY 1c and 2b were significantly up-regulated at the later period of stress. The frequently stress responsive and diverse expression profiles of the GsTIFY gene family suggests that this family may play important roles in plant environmental stress responses and adaptation.
[Genome-wide identification and expression analysis of the WRKY gene family in peach].
Gu, Yan-bing; Ji, Zhi-rui; Chi, Fu-mei; Qiao, Zhuang; Xu, Cheng-nan; Zhang, Jun-xiang; Zhou, Zong-shan; Dong, Qing-long
2016-03-01
The WRKY transcription factors are one of the largest families of transcriptional regulators and play diverse regulatory roles in biotic and abiotic stresses, plant growth and development processes. In this study, the WRKY DNA-binding domain (Pfam Database number: PF03106) downloaded from Pfam protein families database was exploited to identify WRKY genes from the peach (Prunus persica 'Lovell') genome using HMMER 3.0. The obtained amino acid sequences were analyzed with DNAMAN 5.0, WebLogo 3, MEGA 5.1, MapInspect and MEME bioinformatics softwares. Totally 61 peach WRKY genes were found in the peach genome. Our phylogenetic analysis revealed that peach WRKY genes were classified into three Groups: Ⅰ, Ⅱ and Ⅲ. The WRKY N-terminal and C-terminal domains of Group Ⅰ (group I-N and group I-C) were monophyletic. The Group Ⅱ was sub-divided into five distinct clades (groupⅡ-a, Ⅱ-b, Ⅱ-c, Ⅱ-d and Ⅱ-e). Our domain analysis indicated that the WRKY regions contained a highly conserved heptapeptide stretch WRKYGQK at its N-terminus followed by a zinc-finger motif. The chromosome mapping analysis showed that peach WRKY genes were distributed with different densities over 8 chromosomes. The intron-exon structure analysis revealed that structures of the WRKY gene were highly conserved in the peach. The conserved motif analysis showed that the conserved motifs 1, 2 and 3, which specify the WRKY domain, were observed in all peach WRKY proteins, motif 5 as the unknown domain was observed in group Ⅱ-d, two WRKY domains were assigned to GroupⅠ. SqRT-PCR and qRT-PCR results indicated that 16 PpWRKY genes were expressed in roots, stems, leaves, flowers and fruits at various expression levels. Our analysis thus identified the PpWRKY gene families, and future functional studies are needed to reveal its specific roles.
Genome-wide identification and expression analysis of the CIPK gene family in cassava
Directory of Open Access Journals (Sweden)
Wei eHu
2015-10-01
Full Text Available Cassava is an important food and potential biofuel crop that is tolerant to multiple abiotic stressors. The mechanisms underlying these tolerances are currently less known. CBL-interacting protein kinases (CIPKs have been shown to play crucial roles in plant developmental processes, hormone signaling transduction, and in the response to abiotic stress. However, no data is currently available about the CPK family in cassava. In this study, a total of 25 CIPK genes were identified from cassava genome based on our previous genome sequencing data. Phylogenetic analysis suggested that 25 MeCIPKs could be classified into four subfamilies, which was supported by exon-intron organizations and the architectures of conserved protein motifs. Transcriptomic analysis of a wild subspecies and two cultivated varieties showed that most MeCIPKs had different expression patterns between wild subspecies and cultivatars in different tissues or in response to drought stress. Some orthologous genes involved in CIPK interaction networks were identified between Arabidopsis and cassava. The interaction networks and co-expression patterns of these orthologous genes revealed that the crucial pathways controlled by CIPK networks may be involved in the differential response to drought stress in different accessions of cassava. Nine MeCIPK genes were selected to investigate their transcriptional response to various stimuli and the results showed the comprehensive response of the tested MeCIPK genes to osmotic, salt, cold, oxidative stressors, and ABA signaling. The identification and expression analysis of CIPK family suggested that CIPK genes are important components of development and multiple signal transduction pathways in cassava. The findings of this study will help lay a foundation for the functional characterization of the CIPK gene family and provide an improved understanding of abiotic stress responses and signaling transduction in cassava.
Song, Jiancheng; Jiang, Lijun; Jameson, Paula Elizabeth
2012-06-06
As the global population continues to expand, increasing yield in bread wheat is of critical importance as 20% of the world's food supply is sourced from this cereal. Several recent studies of the molecular basis of grain yield indicate that the cytokinins are a key factor in determining grain yield. In this study, cytokinin gene family members in bread wheat were isolated from four multigene families which regulate cytokinin synthesis and metabolism, the isopentenyl transferases (IPT), cytokinin oxidases (CKX), zeatin O-glucosyltransferases (ZOG), and β-glucosidases (GLU). As bread wheat is hexaploid, each gene family is also likely to be represented on the A, B and D genomes. By using a novel strategy of qRT-PCR with locus-specific primers shared among the three homoeologues of each family member, detailed expression profiles are provided of family members of these multigene families expressed during leaf, spike and seed development. The expression patterns of individual members of the IPT, CKX, ZOG, and GLU multigene families in wheat are shown to be tissue- and developmentally-specific. For instance, TaIPT2 and TaCKX1 were the most highly expressed family members during early seed development, with relative expression levels of up to 90- and 900-fold higher, respectively, than those in the lowest expressed samples. The expression of two cis-ZOG genes was sharply increased in older leaves, while an extremely high mRNA level of TaGLU1-1 was detected in young leaves. Key genes with tissue- and developmentally-specific expression have been identified which would be prime targets for genetic manipulation towards yield improvement in bread wheat breeding programmes, utilising TILLING and MAS strategies.
Reitzel, Adam M; Pang, Kevin; Martindale, Mark Q
2016-01-01
An essential developmental pathway in sexually reproducing animals is the specification of germ cells and the differentiation of mature gametes, sperm and oocytes. The "germline" genes vasa, nanos and piwi are commonly identified in primordial germ cells, suggesting a molecular signature for the germline throughout animals. However, these genes are also expressed in a diverse set of somatic stem cells throughout the animal kingdom leaving open significant questions for whether they are required for germline specification. Similarly, members of the Dmrt gene family are essential components regulating sex determination and differentiation in bilaterian animals, but the functions of these transcription factors, including potential roles in sex determination, in early diverging animals remain unknown. The phylogenetic position of ctenophores and the genome sequence of the lobate Mnemiopsis leidyi motivated us to determine the compliment of these gene families in this species and determine expression patterns during development. Our phylogenetic analyses of the vasa, piwi and nanos gene families show that Mnemiopsis has multiple genes in each family with multiple lineage-specific paralogs. Expression domains of Mnemiopsis nanos, vasa and piwi, during embryogenesis from fertilization to the cydippid stage, were diverse, with little overlapping expression and no or little expression in what we think are the germ cells or gametogenic regions. piwi paralogs in Mnemiopsis had distinct expression domains in the ectoderm during development. We observed overlapping expression domains in the apical organ and tentacle apparatus of the cydippid for a subset of "germline genes," which are areas of high cell proliferation, suggesting that these genes are involved with "stem cell" specification and maintenance. Similarly, the five Dmrt genes show diverse non-overlapping expression domains, with no clear evidence for expression in future gametogenic regions of the adult. We also
Lan, Yi; Sun, Jin; Tian, Renmao; Bartlett, Douglas H; Li, Runsheng; Wong, Yue Him; Zhang, Weipeng; Qiu, Jian-Wen; Xu, Ting; He, Li-Sheng; Tabata, Harry G; Qian, Pei-Yuan
2017-07-01
The Challenger Deep in the Mariana Trench is the deepest point in the oceans of our planet. Understanding how animals adapt to this harsh environment characterized by high hydrostatic pressure, food limitation, dark and cold is of great scientific interest. Of the animals dwelling in the Challenger Deep, amphipods have been captured using baited traps. In this study, we sequenced the transcriptome of the amphipod Hirondellea gigas collected at a depth of 10,929 m from the East Pond of the Challenger Deep. Assembly of these sequences resulted in 133,041 contigs and 22,046 translated proteins. Functional annotation of these contigs was made using the go and kegg databases. Comparison of these translated proteins with those of four shallow-water amphipods revealed 10,731 gene families, of which 5659 were single-copy orthologs. Base substitution analysis on these single-copy orthologs showed that 62 genes are positively selected in H. gigas, including genes related to β-alanine biosynthesis, energy metabolism and genetic information processing. For multiple-copy orthologous genes, gene family expansion analysis revealed that cold-inducible proteins (i.e., transcription factors II A and transcription elongation factor 1) as well as zinc finger domains are expanded in H. gigas. Overall, our results indicate that genetic adaptation to the hadal environment by H. gigas may be mediated by both gene family expansion and amino acid substitutions of specific proteins. © 2017 John Wiley & Sons Ltd.
Chromosomal evolution of the PKD1 gene family in primates
Directory of Open Access Journals (Sweden)
Krawczak Michael
2008-09-01
Full Text Available Abstract Background The autosomal dominant polycystic kidney disease (ADPKD is mostly caused by mutations in the PKD1 (polycystic kidney disease 1 gene located in 16p13.3. Moreover, there are six pseudogenes of PKD1 that are located proximal to the master gene in 16p13.1. In contrast, no pseudogene could be detected in the mouse genome, only a single copy gene on chromosome 17. The question arises how the human situation originated phylogenetically. To address this question we applied comparative FISH-mapping of a human PKD1-containing genomic BAC clone and a PKD1-cDNA clone to chromosomes of a variety of primate species and the dog as a non-primate outgroup species. Results Comparative FISH with the PKD1-cDNA clone clearly shows that in all primate species studied distinct single signals map in subtelomeric chromosomal positions orthologous to the short arm of human chromosome 16 harbouring the master PKD1 gene. Only in human and African great apes, but not in orangutan, FISH with both BAC and cDNA clones reveals additional signal clusters located proximal of and clearly separated from the PKD1 master genes indicating the chromosomal position of PKD1 pseudogenes in 16p of these species, respectively. Indeed, this is in accordance with sequencing data in human, chimpanzee and orangutan. Apart from the master PKD1 gene, six pseudogenes are identified in both, human and chimpanzee, while only a single-copy gene is present in the whole-genome sequence of orangutan. The phylogenetic reconstruction of the PKD1-tree reveals that all human pseudogenes are closely related to the human PKD1 gene, and all chimpanzee pseudogenes are closely related to the chimpanzee PKD1 gene. However, our statistical analyses provide strong indication that gene conversion events may have occurred within the PKD1 family members of human and chimpanzee, respectively. Conclusion PKD1 must have undergone amplification very recently in hominid evolution. Duplicative
Directory of Open Access Journals (Sweden)
Serbielle Céline
2012-12-01
Full Text Available Abstract Background Gene duplications have been proposed to be the main mechanism involved in genome evolution and in acquisition of new functions. Polydnaviruses (PDVs, symbiotic viruses associated with parasitoid wasps, are ideal model systems to study mechanisms of gene duplications given that PDV genomes consist of virulence genes organized into multigene families. In these systems the viral genome is integrated in a wasp chromosome as a provirus and virus particles containing circular double-stranded DNA are injected into the parasitoids’ hosts and are essential for parasitism success. The viral virulence factors, organized in gene families, are required collectively to induce host immune suppression and developmental arrest. The gene family which encodes protein tyrosine phosphatases (PTPs has undergone spectacular expansion in several PDV genomes with up to 42 genes. Results Here, we present strong indications that PTP gene family expansion occurred via classical mechanisms: by duplication of large segments of the chromosomally integrated form of the virus sequences (segmental duplication, by tandem duplications within this form and by dispersed duplications. We also propose a novel duplication mechanism specific to PDVs that involves viral circle reintegration into the wasp genome. The PTP copies produced were shown to undergo conservative evolution along with episodes of adaptive evolution. In particular recently produced copies have undergone positive selection in sites most likely involved in defining substrate selectivity. Conclusion The results provide evidence about the dynamic nature of polydnavirus proviral genomes. Classical and PDV-specific duplication mechanisms have been involved in the production of new gene copies. Selection pressures associated with antagonistic interactions with parasitized hosts have shaped these genes used to manipulate lepidopteran physiology with evidence for positive selection involved in
Directory of Open Access Journals (Sweden)
Saleha S
2016-06-01
Full Text Available Clinical anophthalmia is a rare inherited disease of the eye and phenotype refers to the absence of ocular tissue in the orbit of eye. Patients may have unilateral or bilateral anophthalmia, and generally have short palpebral fissures and small orbits. Anophthalmia may be isolated or associated with a broader syndrome and may have genetic or environmental causes. However, genetic cause has been defined in only a small proportion of cases, therefore, a consanguineous Pakistani family of the Pashtoon ethnic group, with isolated clinical anophthalmia was investigated using linkage mapping. A family pedigree was created to trace the possible mode of inheritance of the disease. Blood samples were collected from affected as well as normal members of this family, and screened for disease-associated mutations. This family was analyzed for linkage to all the known loci of clinical anophthalmia, using microsatellite short tandem repeat (STR markers. Direct sequencing was performed to find out disease-associated mutations in the candidate gene. This family with isolated clinical anophthalmia, was mapped to the SOX2 gene that is located at chromosome 3q26.3-q27. However, on exonic and regulatory regions mutation screening of the SOX2 gene, the disease-associated mutation was not identified. It showed that another gene responsible for development of the eye might be present at chromosome 3q26.3-q27 and needs to be identified and screened for the disease-associated mutation in this family.
Ajmal, M; Zafar, S; Hameed, A
2016-01-01
ABSTRACT Clinical anophthalmia is a rare inherited disease of the eye and phenotype refers to the absence of ocular tissue in the orbit of eye. Patients may have unilateral or bilateral anophthalmia, and generally have short palpebral fissures and small orbits. Anophthalmia may be isolated or associated with a broader syndrome and may have genetic or environmental causes. However, genetic cause has been defined in only a small proportion of cases, therefore, a consanguineous Pakistani family of the Pashtoon ethnic group, with isolated clinical anophthalmia was investigated using linkage mapping. A family pedigree was created to trace the possible mode of inheritance of the disease. Blood samples were collected from affected as well as normal members of this family, and screened for disease-associated mutations. This family was analyzed for linkage to all the known loci of clinical anophthalmia, using microsatellite short tandem repeat (STR) markers. Direct sequencing was performed to find out disease-associated mutations in the candidate gene. This family with isolated clinical anophthalmia, was mapped to the SOX2 gene that is located at chromosome 3q26.3-q27. However, on exonic and regulatory regions mutation screening of the SOX2 gene, the disease-associated mutation was not identified. It showed that another gene responsible for development of the eye might be present at chromosome 3q26.3-q27 and needs to be identified and screened for the disease-associated mutation in this family. PMID:27785411
Genome-Wide Identification and Expression Analysis of WRKY Gene Family in Capsicum annuum L.
Diao, Wei-Ping; Snyder, John C; Wang, Shu-Bin; Liu, Jin-Bing; Pan, Bao-Gui; Guo, Guang-Jun; Wei, Ge
2016-01-01
The WRKY family of transcription factors is one of the most important families of plant transcriptional regulators with members regulating multiple biological processes, especially in regulating defense against biotic and abiotic stresses. However, little information is available about WRKYs in pepper (Capsicum annuum L.). The recent release of completely assembled genome sequences of pepper allowed us to perform a genome-wide investigation for pepper WRKY proteins. In the present study, a total of 71 WRKY genes were identified in the pepper genome. According to structural features of their encoded proteins, the pepper WRKY genes (CaWRKY) were classified into three main groups, with the second group further divided into five subgroups. Genome mapping analysis revealed that CaWRKY were enriched on four chromosomes, especially on chromosome 1, and 15.5% of the family members were tandemly duplicated genes. A phylogenetic tree was constructed depending on WRKY domain' sequences derived from pepper and Arabidopsis. The expression of 21 selected CaWRKY genes in response to seven different biotic and abiotic stresses (salt, heat shock, drought, Phytophtora capsici, SA, MeJA, and ABA) was evaluated by quantitative RT-PCR; Some CaWRKYs were highly expressed and up-regulated by stress treatment. Our results will provide a platform for functional identification and molecular breeding studies of WRKY genes in pepper.
Directory of Open Access Journals (Sweden)
Tianyu Zhou
2015-01-01
Full Text Available Peroxisome proliferators-activated receptor (PPAR gene family members exhibit distinct patterns of distribution in tissues and differ in functions. The purpose of this study is to investigate the evolutionary impacts on diversity functions of PPAR members and the regulatory differences on gene expression patterns. 63 homology sequences of PPAR genes from 31 species were collected and analyzed. The results showed that three isolated types of PPAR gene family may emerge from twice times of gene duplication events. The conserved domains of HOLI (ligand binding domain of hormone receptors domain and ZnF_C4 (C4 zinc finger in nuclear in hormone receptors are essential for keeping basic roles of PPAR gene family, and the variant domains of LCRs may be responsible for their divergence in functions. The positive selection sites in HOLI domain are benefit for PPARs to evolve towards diversity functions. The evolutionary variants in the promoter regions and 3′ UTR regions of PPARs result into differential transcription factors and miRNAs involved in regulating PPAR members, which may eventually affect their expressions and tissues distributions. These results indicate that gene duplication event, selection pressure on HOLI domain, and the variants on promoter and 3′ UTR are essential for PPARs evolution and diversity functions acquired.
Zhou, Tianyu; Yan, Xiping; Wang, Guosong; Liu, Hehe; Gan, Xiang; Zhang, Tao; Wang, Jiwen; Li, Liang
2015-01-01
Peroxisome proliferators-activated receptor (PPAR) gene family members exhibit distinct patterns of distribution in tissues and differ in functions. The purpose of this study is to investigate the evolutionary impacts on diversity functions of PPAR members and the regulatory differences on gene expression patterns. 63 homology sequences of PPAR genes from 31 species were collected and analyzed. The results showed that three isolated types of PPAR gene family may emerge from twice times of gene duplication events. The conserved domains of HOLI (ligand binding domain of hormone receptors) domain and ZnF_C4 (C4 zinc finger in nuclear in hormone receptors) are essential for keeping basic roles of PPAR gene family, and the variant domains of LCRs may be responsible for their divergence in functions. The positive selection sites in HOLI domain are benefit for PPARs to evolve towards diversity functions. The evolutionary variants in the promoter regions and 3' UTR regions of PPARs result into differential transcription factors and miRNAs involved in regulating PPAR members, which may eventually affect their expressions and tissues distributions. These results indicate that gene duplication event, selection pressure on HOLI domain, and the variants on promoter and 3' UTR are essential for PPARs evolution and diversity functions acquired.
Novel duplication mutation of the DYSF gene in a Pakistani family with Miyoshi Myopathy
Directory of Open Access Journals (Sweden)
Muhammad I. Ullah
2017-12-01
Full Text Available Objectives: To identify the underlying gene mutation in a large consanguineous Pakistani family. Methods: This is an observational descriptive study carried out at the Department of Biochemistry, Shifa International Hospital, Quaid-i-Azam University, and Atta-ur-Rahman School of Applied Biosciences, National University of Sciences and Technology, Islamabad, Pakistan from 2013-2016. Genomic DNA of all recruited family members was extracted and the Trusight one sequencing panel was used to assess genes associated with a neuro-muscular phenotype. Comparative modeling of mutated and wild-type protein was carried out by PyMOL tool. Results: Clinical investigations of an affected individual showed typical features of Miyoshi myopathy (MM like elevated serum creatine kinase (CK levels, distal muscle weakness, myopathic changes in electromyography (EMG and muscle histopathology. Sequencing with the Ilumina Trusight one sequencing panel revealed a novel 22 nucleotide duplication (CTTCAACTTGTTTGACTCTCCT in the DYSF gene (NM_001130987.1_c.897-918dup; p.Gly307Leufs5X, which results in a truncating frameshift mutation and perfectly segregated with the disease in this family. Protein modeling studies suggested a disruption in spatial configuration of the putative mutant protein. Conclusion: A novel duplication of 22 bases (c.897_918dup; p.Gly307Leufs5X in the DYSF gene was identified in a family suffering from Miyoshi myopathy. Protein homology analysis proposes a disruptive impact of this mutation on protein function.
DEFF Research Database (Denmark)
Jørgensen, H. B. H.; Sørensen, P.; Cooper, G. A.
2011-01-01
challenge) and a relatively high susceptibility (18% survival following challenge) trout family that were both split into a group exposed to virus and a non-exposed control group. In total, 939 genes were differentially expressed between infected and non-infected fish (FDR p = 0.05). Five groups of Gene...... Ontology categories were involved in immune-related processes and over-represented in infected fish: (i) stress and defense response, (ii) NFkappaB signal transduction, (iii) response to non-self, (iv) antigen processing and presentation, and (v) proteasome complexes. The first four categories were also...... over-represented among the 642 differentially expressed genes in the low-susceptibility trout family but not among the 556 differentially expressed genes in the high-susceptibility trout family. Expression profiles for most immune genes discussed showed increased transcription from day 3 post...
Phylogenetic Analysis of the MS4A and TMEM176 Gene Families
Zuccolo, Jonathan; Bau, Jeremy; Childs, Sarah J.; Goss, Greg G.; Sensen, Christoph W.; Deans, Julie P.
2010-01-01
Background The MS4A gene family in humans includes CD20 (MS4A1), FcRβ (MS4A2), Htm4 (MS4A3), and at least 13 other syntenic genes encoding membrane proteins, most having characteristic tetraspanning topology. Expression of MS4A genes is variable in tissues throughout the body; however, several are limited to cells in the hematopoietic system where they have known roles in immune cell functions. Genes in the small TMEM176 group share significant sequence similarity with MS4A genes and there is evidence of immune function of at least one of the encoded proteins. In this study, we examined the evolutionary history of the MS4A/TMEM176 families as well as tissue expression of the phylogenetically earliest members, in order to investigate their possible origins in immune cells. Principal Findings Orthologs of human MS4A genes were found only in mammals; however, MS4A gene homologs were found in most jawed vertebrates. TMEM176 genes were found only in mammals and bony fish. Several unusual MS4A genes having 2 or more tandem MS4A sequences were identified in the chicken (Gallus gallus) and early mammals (opossum, Monodelphis domestica and platypus, Ornithorhyncus anatinus). A large number of highly conserved MS4A and TMEM176 genes was found in zebrafish (Danio rerio). The most primitive organism identified to have MS4A genes was spiny dogfish (Squalus acanthus). Tissue expression of MS4A genes in S. acanthias and D. rerio showed no evidence of expression restricted to the hematopoietic system. Conclusions/Significance Our findings suggest that MS4A genes first appeared in cartilaginous fish with expression outside of the immune system, and have since diversified in many species into their modern forms with expression and function in both immune and nonimmune cells. PMID:20186339
Genome-wide analysis of Aux/IAA gene family in Solanaceae species using tomato as a model.
Wu, Jian; Peng, Zhen; Liu, Songyu; He, Yanjun; Cheng, Lin; Kong, Fuling; Wang, Jie; Lu, Gang
2012-04-01
Auxin plays key roles in a wide variety of plant activities, including embryo development, leaf formation, phototropism, fruit development and root initiation and development. Auxin/indoleacetic acid (Aux/IAA) genes, encoding short-lived nuclear proteins, are key regulators in the auxin transduction pathway. But how they work is still unknown. In order to conduct a systematic analysis of this gene family in Solanaceae species, a genome-wide search for the homologues of auxin response genes was carried out. Here, 26 and 27 non redundant AUX/IAAs were identified in tomato and potato, respectively. Using tomato as a model, a comprehensive overview of SlIAA gene family is presented, including the gene structures, phylogeny, chromosome locations, conserved motifs and cis-elements in promoter sequences. A phylogenetic tree generated from alignments of the predicted protein sequences of 31 OsIAAs, 29 AtIAAs, 31 ZmIAAs, and 26 SlIAAs revealed that these IAAs were clustered into three major groups and ten subgroups. Among them, seven subgroups were present in both monocot and dicot species, which indicated that the major functional diversification within the IAA family predated the monocot/dicot divergence. In contrast, group C and some other subgroups seemed to be species-specific. Quantitative real-time PCR (qRT-PCR) analysis showed that 19 of the 26 SlIAA genes could be detected in all tomato organs/tissues, however, seven of them were specifically expressed in some of tomato tissues. The transcript abundance of 17 SlIAA genes were increased within a few hours when the seedlings were treated with exogenous IAA. However, those of other six SlIAAs were decreased. The results of stress treatments showed that most SIIAA family genes responded to at least one of the three stress treatments, however, they exhibited diverse expression levels under different abiotic stress conditions in tomato seedlings. SlIAA20, SlIAA21 and SlIAA22 were not significantly influenced by stress
Ma, Jin-Qi; Jian, Hong-Ju; Yang, Bo; Lu, Kun; Zhang, Ao-Xiang; Liu, Pu; Li, Jia-Na
2017-07-15
Growth regulating-factors (GRFs) are plant-specific transcription factors that help regulate plant growth and development. Genome-wide identification and evolutionary analyses of GRF gene families have been performed in Arabidopsis thaliana, Zea mays, Oryza sativa, and Brassica rapa, but a comprehensive analysis of the GRF gene family in oilseed rape (Brassica napus) has not yet been reported. In the current study, we identified 35 members of the BnGRF family in B. napus. We analyzed the chromosomal distribution, phylogenetic relationships (Bayesian Inference and Neighbor Joining method), gene structures, and motifs of the BnGRF family members, as well as the cis-acting regulatory elements in their promoters. We also analyzed the expression patterns of 15 randomly selected BnGRF genes in various tissues and in plant varieties with different harvest indices and gibberellic acid (GA) responses. The expression levels of BnGRFs under GA treatment suggested the presence of possible negative feedback regulation. The evolutionary patterns and expression profiles of BnGRFs uncovered in this study increase our understanding of the important roles played by these genes in oilseed rape. Copyright © 2017. Published by Elsevier B.V.
MORC Proteins: Novel Players in Plant and Animal Health.
Koch, Aline; Kang, Hong-Gu; Steinbrenner, Jens; Dempsey, D'Maris A; Klessig, Daniel F; Kogel, Karl-Heinz
2017-01-01
Microrchidia (MORC) proteins comprise a family of proteins that have been identified in prokaryotes and eukaryotes. They are defined by two hallmark domains: a GHKL-type ATPase and an S5 fold. MORC proteins in plants were first discovered via a genetic screen for Arabidopsis mutants compromised for resistance to a viral pathogen. Subsequent studies expanded their role in plant immunity and revealed their involvement in gene silencing and transposable element repression. Emerging data suggest that MORC proteins also participate in pathogen-induced chromatin remodeling and epigenetic gene regulation. In addition, biochemical analyses recently demonstrated that plant MORCs have topoisomerase II (topo II)-like DNA modifying activities that may be important for their function. Interestingly, animal MORC proteins exhibit many parallels with their plant counterparts, as they have been implicated in disease development and gene silencing. In addition, human MORCs, like plant MORCs, bind salicylic acid and this inhibits some of their topo II-like activities. In this review, we will focus primarily on plant MORCs, although relevant comparisons with animal MORCs will be provided.
MORC Proteins: Novel Players in Plant and Animal Health
Directory of Open Access Journals (Sweden)
Aline Koch
2017-10-01
Full Text Available Microrchidia (MORC proteins comprise a family of proteins that have been identified in prokaryotes and eukaryotes. They are defined by two hallmark domains: a GHKL-type ATPase and an S5 fold. MORC proteins in plants were first discovered via a genetic screen for Arabidopsis mutants compromised for resistance to a viral pathogen. Subsequent studies expanded their role in plant immunity and revealed their involvement in gene silencing and transposable element repression. Emerging data suggest that MORC proteins also participate in pathogen-induced chromatin remodeling and epigenetic gene regulation. In addition, biochemical analyses recently demonstrated that plant MORCs have topoisomerase II (topo II-like DNA modifying activities that may be important for their function. Interestingly, animal MORC proteins exhibit many parallels with their plant counterparts, as they have been implicated in disease development and gene silencing. In addition, human MORCs, like plant MORCs, bind salicylic acid and this inhibits some of their topo II-like activities. In this review, we will focus primarily on plant MORCs, although relevant comparisons with animal MORCs will be provided.
Rinke de Wit, T. F.; Bekelie, S.; Osland, A.; Wieles, B.; Janson, A. A.; Thole, J. E.
1993-01-01
The genes for two novel members (designated 85A and 85C) of the Mycobacterium leprae antigen 85 complex family of proteins and the gene for the closely related M. leprae MPT51 protein were isolated. The complete DNA sequence of the M. leprae 85C gene and partial sequences of the 85A and MPT51 genes
Directory of Open Access Journals (Sweden)
Libia Sanz
2016-07-01
Full Text Available The molecular events underlying the evolution of the Snake Venom Metalloproteinase (SVMP family from an A Disintegrin And Metalloproteinase (ADAM ancestor remain poorly understood. Comparative genomics may provide decisive information to reconstruct the evolutionary history of this multi-locus toxin family. Here, we report the genomic organization of Echis ocellatus genes encoding SVMPs from the PII and PI classes. Comparisons between them and between these genes and the genomic structures of Anolis carolinensis ADAM28 and E. ocellatus PIII-SVMP EOC00089 suggest that insertions and deletions of intronic regions played key roles along the evolutionary pathway that shaped the current diversity within the multi-locus SVMP gene family. In particular, our data suggest that emergence of EOC00028-like PI-SVMP from an ancestral PII(e/d-type SVMP involved splicing site mutations that abolished both the 3′ splice AG acceptor site of intron 12* and the 5′ splice GT donor site of intron 13*, and resulted in the intronization of exon 13* and the consequent destruction of the structural integrity of the PII-SVMP characteristic disintegrin domain.
Genome-wide investigation and transcriptome analysis of the WRKY gene family in Gossypium.
Ding, Mingquan; Chen, Jiadong; Jiang, Yurong; Lin, Lifeng; Cao, YueFen; Wang, Minhua; Zhang, Yuting; Rong, Junkang; Ye, Wuwei
2015-02-01
WRKY transcription factors play important roles in various stress responses in diverse plant species. In cotton, this family has not been well studied, especially in relation to fiber development. Here, the genomes and transcriptomes of Gossypium raimondii and Gossypium arboreum were investigated to identify fiber development related WRKY genes. This represents the first comprehensive comparative study of WRKY transcription factors in both diploid A and D cotton species. In total, 112 G. raimondii and 109 G. arboreum WRKY genes were identified. No significant gene structure or domain alterations were detected between the two species, but many SNPs distributed unequally in exon and intron regions. Physical mapping revealed that the WRKY genes in G. arboreum were not located in the corresponding chromosomes of G. raimondii, suggesting great chromosome rearrangement in the diploid cotton genomes. The cotton WRKY genes, especially subgroups I and II, have expanded through multiple whole genome duplications and tandem duplications compared with other plant species. Sequence comparison showed many functionally divergent sites between WRKY subgroups, while the genes within each group are under strong purifying selection. Transcriptome analysis suggested that many WRKY genes participate in specific fiber development processes such as fiber initiation, elongation and maturation with different expression patterns between species. Complex WRKY gene expression such as differential Dt and At allelic gene expression in G. hirsutum and alternative splicing events were also observed in both diploid and tetraploid cottons during fiber development process. In conclusion, this study provides important information on the evolution and function of WRKY gene family in cotton species.
Comparative genomic analysis of the WRKY III gene family in populus, grape, arabidopsis and rice.
Wang, Yiyi; Feng, Lin; Zhu, Yuxin; Li, Yuan; Yan, Hanwei; Xiang, Yan
2015-09-08
WRKY III genes have significant functions in regulating plant development and resistance. In plant, WRKY gene family has been studied in many species, however, there still lack a comprehensive analysis of WRKY III genes in the woody plant species poplar, three representative lineages of flowering plant species are incorporated in most analyses: Arabidopsis (a model plant for annual herbaceous dicots), grape (one model plant for perennial dicots) and Oryza sativa (a model plant for monocots). In this study, we identified 10, 6, 13 and 28 WRKY III genes in the genomes of Populus trichocarpa, grape (Vitis vinifera), Arabidopsis thaliana and rice (Oryza sativa), respectively. Phylogenetic analysis revealed that the WRKY III proteins could be divided into four clades. By microsynteny analysis, we found that the duplicated regions were more conserved between poplar and grape than Arabidopsis or rice. We dated their duplications by Ks analysis of Populus WRKY III genes and demonstrated that all the blocks were formed after the divergence of monocots and dicots. Strong purifying selection has played a key role in the maintenance of WRKY III genes in Populus. Tissue expression analysis of the WRKY III genes in Populus revealed that five were most highly expressed in the xylem. We also performed quantitative real-time reverse transcription PCR analysis of WRKY III genes in Populus treated with salicylic acid, abscisic acid and polyethylene glycol to explore their stress-related expression patterns. This study highlighted the duplication and diversification of the WRKY III gene family in Populus and provided a comprehensive analysis of this gene family in the Populus genome. Our results indicated that the majority of WRKY III genes of Populus was expanded by large-scale gene duplication. The expression pattern of PtrWRKYIII gene identified that these genes play important roles in the xylem during poplar growth and development, and may play crucial role in defense to drought
Bonneau, Julien; Baumann, Ute; Beasley, Jesse; Li, Yuan; Johnson, Alexander A T
2016-12-01
Nicotianamine (NA) is a non-protein amino acid involved in fundamental aspects of metal uptake, transport and homeostasis in all plants and constitutes the biosynthetic precursor of mugineic acid family phytosiderophores (MAs) in graminaceous plant species. Nicotianamine synthase (NAS) genes, which encode enzymes that synthesize NA from S-adenosyl-L-methionine (SAM), are differentially regulated by iron (Fe) status in most plant species and plant genomes have been found to contain anywhere from 1 to 9 NAS genes. This study describes the identification of 21 NAS genes in the hexaploid bread wheat (Triticum aestivum L.) genome and their phylogenetic classification into two distinct clades. The TaNAS genes are highly expressed during germination, seedling growth and reproductive development. Fourteen of the clade I NAS genes were up-regulated in root tissues under conditions of Fe deficiency. Protein sequence analyses revealed the presence of endocytosis motifs in all of the wheat NAS proteins as well as chloroplast, mitochondrial and secretory transit peptide signals in four proteins. These results greatly expand our knowledge of NAS gene families in graminaceous plant species as well as the genetics underlying Fe nutrition in bread wheat. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.
Raskin, Leon; Guo, Yan; Du, Liping; Clendenning, Mark; Rosty, Christophe; Lindor, Noralane M; Gruber, Stephen B; Buchanan, Daniel D
2017-11-07
The underlying genetic cause of colorectal cancer (CRC) can be identified for 5-10% of all cases, while at least 20% of CRC cases are thought to be due to inherited genetic factors. Screening for highly penetrant mutations in genes associated with Mendelian cancer syndromes using next-generation sequencing (NGS) can be prohibitively expensive for studies requiring large samples sizes. The aim of the study was to identify rare single nucleotide variants and small indels in 40 established or candidate CRC susceptibility genes in 1,046 familial CRC cases (including both MSS and MSI-H tumor subtypes) and 1,006 unrelated controls from the Colon Cancer Family Registry Cohort using a robust and cost-effective DNA pooling NGS strategy. We identified 264 variants in 38 genes that were observed only in cases, comprising either very rare (minor allele frequency cancer susceptibility genes BAP1, CDH1, CHEK2, ENG, and MSH3 . For the candidate CRC genes, we identified likely pathogenic variants in the helicase domain of POLQ and in the LRIG1 , SH2B3 , and NOS1 genes and present their clinicopathological characteristics. Using a DNA pooling NGS strategy, we identified novel germline mutations in established CRC susceptibility genes in familial CRC cases. Further studies are required to support the role of POLQ , LRIG1 , SH2B3 and NOS1 as CRC susceptibility genes.
Sui, Jin-Lei; Xiao, Xiao-Hu; Qi, Ji-Yan; Fang, Yong-Jun; Tang, Chao-Rong
2017-12-01
SWEET proteins play an indispensable role as a sugar efflux transporter in plant development and stress responses. The SWEET genes have previously been characterized in several plants. Here, we present a comprehensive analysis of this gene family in the rubber tree, Hevea brasiliensis . There are 36 members of the SWEET gene family in this species, making it one of the largest families in plant genomes sequenced so far. Structure and phylogeny analyses of these genes in Hevea and in other species demonstrated broad evolutionary conservation. RNA-seq analyses revealed that SWEET2, 16, and 17 might represent the main evolutionary direction of SWEET genes in plants. Our results in Hevea suggested the involvement of HbSWEET1a , 2e , 2f , and 3b in phloem loading, HbSWEET10a and 16b in laticifer sugar transport , and HbSWEET9a in nectary-specific sugar transport. Parallel studies of RNA-seq analyses extended to three other plant species ( Manihot esculenta , Populus trichocarpa , and Arabidopsis thaliana ) produced findings which implicated MeSWEET10a, 3a, and 15b in M. esculenta storage root development, and the involvement of PtSWEET16b and PtSWEET16d in P. trichocarpa xylem development. RT-qPCR results further revealed that HbSWEET10a, 16b, and 1a play important roles in phloem sugar transport. The results from this study provide a foundation not only for further investigation into the functionality of the SWEET gene family in Hevea, especially in its sugar transport for latex production, but also for related studies of this gene family in the plant kingdom.
Moran, Yehu; Weinberger, Hagar; Sullivan, James C; Reitzel, Adam M; Finnerty, John R; Gurevitz, Michael
2008-04-01
Gene families, which encode toxins, are found in many poisonous animals, yet there is limited understanding of their evolution at the nucleotide level. The release of the genome draft sequence for the sea anemone Nematostella vectensis enabled a comprehensive study of a gene family whose neurotoxin products affect voltage-gated sodium channels. All gene family members are clustered in a highly repetitive approximately 30-kb genomic region and encode a single toxin, Nv1. These genes exhibit extreme conservation at the nucleotide level which cannot be explained by purifying selection. This conservation greatly differs from the toxin gene families of other animals (e.g., snakes, scorpions, and cone snails), whose evolution was driven by diversifying selection, thereby generating a high degree of genetic diversity. The low nucleotide diversity at the Nv1 genes is reminiscent of that reported for DNA encoding ribosomal RNA (rDNA) and 2 hsp70 genes from Drosophila, which have evolved via concerted evolution. This evolutionary pattern was experimentally demonstrated in yeast rDNA and was shown to involve unequal crossing-over. Through sequence analysis of toxin genes from multiple N. vectensis populations and 2 other anemone species, Anemonia viridis and Actinia equina, we observed that the toxin genes for each sea anemone species are more similar to one another than to those of other species, suggesting they evolved by manner of concerted evolution. Furthermore, in 2 of the species (A. viridis and A. equina) we found genes that evolved under diversifying selection, suggesting that concerted evolution and accelerated evolution may occur simultaneously.
Luo, Arong; Zhang, Aibing; Ho, Simon Yw; Xu, Weijun; Zhang, Yanzhou; Shi, Weifeng; Cameron, Stephen L; Zhu, Chaodong
2011-01-28
A well-informed choice of genetic locus is central to the efficacy of DNA barcoding. Current DNA barcoding in animals involves the use of the 5' half of the mitochondrial cytochrome oxidase 1 gene (CO1) to diagnose and delimit species. However, there is no compelling a priori reason for the exclusive focus on this region, and it has been shown that it performs poorly for certain animal groups. To explore alternative mitochondrial barcoding regions, we compared the efficacy of the universal CO1 barcoding region with the other mitochondrial protein-coding genes in eutherian mammals. Four criteria were used for this comparison: the number of recovered species, sequence variability within and between species, resolution to taxonomic levels above that of species, and the degree of mutational saturation. Based on 1,179 mitochondrial genomes of eutherians, we found that the universal CO1 barcoding region is a good representative of mitochondrial genes as a whole because the high species-recovery rate (> 90%) was similar to that of other mitochondrial genes, and there were no significant differences in intra- or interspecific variability among genes. However, an overlap between intra- and interspecific variability was still problematic for all mitochondrial genes. Our results also demonstrated that any choice of mitochondrial gene for DNA barcoding failed to offer significant resolution at higher taxonomic levels. We suggest that the CO1 barcoding region, the universal DNA barcode, is preferred among the mitochondrial protein-coding genes as a molecular diagnostic at least for eutherian species identification. Nevertheless, DNA barcoding with this marker may still be problematic for certain eutherian taxa and our approach can be used to test potential barcoding loci for such groups.
Amelogenesis Imperfecta: 1 Family, 2 Phenotypes, and 2 Mutated Genes.
Prasad, M K; Laouina, S; El Alloussi, M; Dollfus, H; Bloch-Zupan, A
2016-12-01
Amelogenesis imperfecta (AI) is a clinically and genetically heterogeneous group of diseases characterized by enamel defects. The authors have identified a large consanguineous Moroccan family segregating different clinical subtypes of hypoplastic and hypomineralized AI in different individuals within the family. Using targeted next-generation sequencing, the authors identified a novel heterozygous nonsense mutation in COL17A1 (c.1873C>T, p.R625*) segregating with hypoplastic AI and a novel homozygous 8-bp deletion in C4orf26 (c.39_46del, p.Cys14Glyfs*18) segregating with hypomineralized-hypoplastic AI in this family. This study highlights the phenotypic and genotypic heterogeneity of AI that can exist even within a single consanguineous family. Furthermore, the identification of novel mutations in COL17A1 and C4orf26 and their correlation with distinct AI phenotypes can contribute to a better understanding of the pathophysiology of AI and the contribution of these genes to amelogenesis. © International & American Associations for Dental Research 2016.
The MB2 gene family of Plasmodium species has a unique combination of S1 and GTP-binding domains
Directory of Open Access Journals (Sweden)
Ogunjumo Oluwasanmi
2004-06-01
Full Text Available Abstract Background Identification and characterization of novel Plasmodium gene families is necessary for developing new anti-malarial therapeutics. The products of the Plasmodium falciparum gene, MB2, were shown previously to have a stage-specific pattern of subcellular localization and proteolytic processing. Results Genes homologous to MB2 were identified in five additional parasite species, P. knowlesi, P. gallinaceum, P. berghei, P. yoelii, and P. chabaudi. Sequence comparisons among the MB2 gene products reveal amino acid conservation of structural features, including putative S1 and GTP-binding domains, and putative signal peptides and nuclear localization signals. Conclusions The combination of domains is unique to this gene family and indicates that MB2 genes comprise a novel family and therefore may be a good target for drug development.
The MB2 gene family of Plasmodium species has a unique combination of S1 and GTP-binding domains
Romero, Lisa C; Nguyen, Thanh V; Deville, Benoit; Ogunjumo, Oluwasanmi; James, Anthony A
2004-01-01
Background Identification and characterization of novel Plasmodium gene families is necessary for developing new anti-malarial therapeutics. The products of the Plasmodium falciparum gene, MB2, were shown previously to have a stage-specific pattern of subcellular localization and proteolytic processing. Results Genes homologous to MB2 were identified in five additional parasite species, P. knowlesi, P. gallinaceum, P. berghei, P. yoelii, and P. chabaudi. Sequence comparisons among the MB2 gene products reveal amino acid conservation of structural features, including putative S1 and GTP-binding domains, and putative signal peptides and nuclear localization signals. Conclusions The combination of domains is unique to this gene family and indicates that MB2 genes comprise a novel family and therefore may be a good target for drug development. PMID:15222903
Hobson, Neil; Deyholos, Michael K
2013-05-23
Several β-galactosidases of the Glycosyl Hydrolase 35 (GH35) family have been characterized, and many of these modify cell wall components, including pectins, xyloglucans, and arabinogalactan proteins. The phloem fibres of flax (Linum usitatissimum) have gelatinous-type cell walls that are rich in crystalline cellulose and depend on β-galactosidase activity for their normal development. In this study, we investigate the transcript expression patterns and inferred evolutionary relationships of the complete set of flax GH35 genes, to better understand the functions of these genes in flax and other species. Using the recently published flax genome assembly, we identified 43 β-galactosidase-like (BGAL) genes, based on the presence of a GH35 domain. Phylogenetic analyses of their protein sequences clustered them into eight sub-families. Sub-family B, whose members in other species were known to be expressed in developing flowers and pollen, was greatly under represented in flax (p-value < 0.01). Sub-family A5, whose sole member from arabidopsis has been described as its primary xyloglucan BGAL, was greatly expanded in flax (p-value < 0.01). A number of flax BGALs were also observed to contain non-consensus GH35 active sites. Expression patterns of the flax BGALs were investigated using qRT-PCR and publicly available microarray data. All predicted flax BGALs showed evidence of expression in at least one tissue. Flax has a large number of BGAL genes, which display a distinct distribution among the BGAL sub-families, in comparison to other closely related species with available whole genome assemblies. Almost every flax BGAL was expressed in fibres, the majority of which expressed predominately in fibres as compared to other tissues, suggesting an important role for the expansion of this gene family in the development of this species as a fibre crop. Variations displayed in the canonical GH35 active site suggest a variety of roles unique to flax, which will require
Kondo, Hiroyuki; Qin, Minghui; Kusaka, Shunji; Tahira, Tomoko; Hasebe, Haruyuki; Hayashi, Hideyuki; Uchio, Eiichi; Hayashi, Kenshi
2007-03-01
To search for mutations in the Norrie disease gene (NDP) in Japanese patients with familial exudative vitreoretinopathy (FEVR) and Norrie disease (ND) and to delineate the mutation-associated clinical features. Direct sequencing after polymerase chain reaction of all exons of the NDP gene was performed on blood collected from 62 probands (31 familial and 31 simplex) with FEVR, from 3 probands with ND, and from some of their family members. The clinical symptoms and signs in the patients with mutations were assessed. X-inactivation in the female carriers was examined in three FEVR families by using leukocyte DNA. Four novel mutations-I18K, K54N, R115L, and IVS2-1G-->A-and one reported mutation, R97P, in the NDP gene were identified in six families. The severity of vitreoretinopathy varied among these patients. Three probands with either K54N or R115L had typical features of FEVR, whereas the proband with R97P had those of ND. Families with IVS2-1G-->A exhibited either ND or FEVR characteristics. A proband with I18K presented with significant phenotypic heterogeneity between the two eyes. In addition, affected female carriers in a family harboring the K54N mutation presented with different degrees of vascular abnormalities in the periphery of the retina. X-inactivation profiles indicated that the skewing was not significantly different between affected and unaffected women. These observations indicate that mutations of the NDP gene can cause ND and 6% of FEVR cases in the Japanese population. The X-inactivation assay with leukocytes may not be predictive of the presence of a mutation in affected female carriers.
The evolutionary history of the SAL1 gene family in eutherian mammals
Directory of Open Access Journals (Sweden)
Callebaut Isabelle
2011-05-01
Full Text Available Abstract Background SAL1 (salivary lipocalin is a member of the OBP (Odorant Binding Protein family and is involved in chemical sexual communication in pig. SAL1 and its relatives may be involved in pheromone and olfactory receptor binding and in pre-mating behaviour. The evolutionary history and the selective pressures acting on SAL1 and its orthologous genes have not yet been exhaustively described. The aim of the present work was to study the evolution of these genes, to elucidate the role of selective pressures in their evolution and the consequences for their functions. Results Here, we present the evolutionary history of SAL1 gene and its orthologous genes in mammals. We found that (1 SAL1 and its related genes arose in eutherian mammals with lineage-specific duplications in rodents, horse and cow and are lost in human, mouse lemur, bushbaby and orangutan, (2 the evolution of duplicated genes of horse, rat, mouse and guinea pig is driven by concerted evolution with extensive gene conversion events in mouse and guinea pig and by positive selection mainly acting on paralogous genes in horse and guinea pig, (3 positive selection was detected for amino acids involved in pheromone binding and amino acids putatively involved in olfactory receptor binding, (4 positive selection was also found for lineage, indicating a species-specific strategy for amino acid selection. Conclusions This work provides new insights into the evolutionary history of SAL1 and its orthologs. On one hand, some genes are subject to concerted evolution and to an increase in dosage, suggesting the need for homogeneity of sequence and function in certain species. On the other hand, positive selection plays a role in the diversification of the functions of the family and in lineage, suggesting adaptive evolution, with possible consequences for speciation and for the reinforcement of prezygotic barriers.
Goel, Ridhi; Pandey, Ashutosh; Trivedi, Prabodh K; Asif, Mehar H
2016-01-01
The WRKY gene family plays an important role in the development and stress responses in plants. As information is not available on the WRKY gene family in Musa species, genome-wide analysis has been carried out in this study using available genomic information from two species, Musa acuminata and Musa balbisiana. Analysis identified 147 and 132 members of the WRKY gene family in M. acuminata and M. balbisiana, respectively. Evolutionary analysis suggests that the WRKY gene family expanded much before the speciation in both the species. Most of the orthologs retained in two species were from the γ duplication event which occurred prior to α and β genome-wide duplication (GWD) events. Analysis also suggests that subtle changes in nucleotide sequences during the course of evolution have led to the development of new motifs which might be involved in neo-functionalization of different WRKY members in two species. Expression and cis-regulatory motif analysis suggest possible involvement of Group II and Group III WRKY members during various stresses and growth/development including fruit ripening process respectively.
Directory of Open Access Journals (Sweden)
Ridhi eGoel
2016-03-01
Full Text Available The WRKY gene family plays an important role in the development and stress responses in plants. As information is not available on the WRKY gene family in Musa species, genome-wide analysis has been carried out in this study using available genomic information from two species, Musa acuminata and Musa balbisiana. Analysis identified 147 and 132 members of the WRKY gene family in M. acuminata and M. balbisiana respectively. Evolutionary analysis suggests that the WRKY gene family expanded much before the speciation in both the species. Most of the orthologs retained in two species were from the γ duplication event which occurred prior to α and β genome-wide duplication (GWD events. Analysis also suggests that subtle changes in nucleotide sequences during the course of evolution have led to the development of new motifs which might be involved in neo-functionalization of different WRKY members in two species. Expression and cis-regulatory motif analysis suggest possible involvement of Group II and Group III WRKY members during various stresses and growth/ development including fruit ripening process respectively.
The Role of the S40 Gene Family in Leaf Senescence
Directory of Open Access Journals (Sweden)
Muhammad Jehanzeb
2017-10-01
Full Text Available Senescence affect different traits of plants, such as the ripening of fruit, number, quality and timing of seed maturation. While senescence is induced by age, growth hormones and different environmental stresses, a highly organized genetic mechanism related to substantial changes in gene expression regulates the process. Only a few genes associated to senescence have been identified in crop plants despite the vital significance of senescence for crop yield. The S40 gene family has been shown to play a role in leaf senescence. The barley HvS40 gene is one of the senescence marker genes which shows expression during age-dependent as well as dark-induced senescence. Like barley HvS40, the Arabidopsis AtS40-3 gene is also induced during natural senescence as well as in response to treatment with abscisic acid, salicylic acid, darkness and pathogen attack. It is speculated that rice OsS40 has a similar function in the leaf senescence of rice.
Gene number determination and genetic polymorphism of the gamma delta T cell co-receptor WC1 genes
Directory of Open Access Journals (Sweden)
Chen Chuang
2012-10-01
Full Text Available Abstract Background WC1 co-receptors belong to the scavenger receptor cysteine-rich (SRCR superfamily and are encoded by a multi-gene family. Expression of particular WC1 genes defines functional subpopulations of WC1+ γδ T cells. We have previously identified partial or complete genomic sequences for thirteen different WC1 genes through annotation of the bovine genome Btau_3.1 build. We also identified two WC1 cDNA sequences from other cattle that did not correspond to sequences in the Btau_3.1 build. Their absence in the Btau_3.1 build may have reflected gaps in the genome assembly or polymorphisms among animals. Since the response of γδ T cells to bacterial challenge is determined by WC1 gene expression, it was critical to understand whether individual cattle or breeds differ in the number of WC1 genes or display polymorphisms. Results Real-time quantitative PCR using DNA from the animal whose genome was sequenced (“Dominette” and sixteen other animals representing ten breeds of cattle, showed that the number of genes coding for WC1 co-receptors is thirteen. The complete coding sequences of those thirteen WC1 genes is presented, including the correction of an error in the WC1-2 gene due to mis-assembly in the Btau_3.1 build. All other cDNA sequences were found to agree with the previous annotation of complete or partial WC1 genes. PCR amplification and sequencing of the most variable N-terminal SRCR domain (domain 1 which has the SRCR “a” pattern of each of the thirteen WC1 genes showed that the sequences are highly conserved among individuals and breeds. Of 160 sequences of domain 1 from three breeds of cattle, no additional sequences beyond the thirteen described WC1 genes were found. Analysis of the complete WC1 cDNA sequences indicated that the thirteen WC1 genes code for three distinct WC1 molecular forms. Conclusion The bovine WC1 multi-gene family is composed of thirteen genes coding for three structural forms whose
[Analysis of USH2A gene mutation in a Chinese family affected with Usher syndrome].
Li, Pengcheng; Liu, Fei; Zhang, Mingchang; Wang, Qiufen; Liu, Mugen
2015-08-01
To investigate the disease-causing mutation in a Chinese family affected with Usher syndrome type II. All of the 11 members from the family underwent comprehensive ophthalmologic examination and hearing test, and their genomic DNA were isolated from venous leukocytes. PCR and direct sequencing of USH2A gene were performed for the proband. Wild type and mutant type minigene vectors containing exon 42, intron 42 and exon 43 of the USH2A gene were constructed and transfected into Hela cells by lipofectamine reagent. Reverse transcription (RT)-PCR was carried out to verify the splicing of the minigenes. Pedigree analysis and clinical diagnosis indicated that the patients have suffered from autosomal recessive Usher syndrome type II. DNA sequencing has detected a homozygous c.8559-2A>G mutation of the USH2A gene in the proband, which has co-segregated with the disease in the family. The mutation has affected a conserved splice site in intron 42, which has led to inactivation of the splice site. Minigene experiment has confirmed the retaining of intron 42 in mature mRNA. The c.8559-2A>G mutation in the USH2A gene probably underlies the Usher syndrome type II in this family. The splice site mutation has resulted in abnormal splicing of USH2A pre-mRNA.
New mutations in the NHS gene in Nance-Horan Syndrome families from the Netherlands
Florijn, Ralph J.; Loves, Willem; Maillette de Buy Wenniger-Prick, Liesbeth J. J. M.; Mannens, Marcel M. A. M.; Tijmes, Nel; Brooks, Simon P.; Hardcastle, Alison J.; Bergen, Arthur A. B.
2006-01-01
Mutations in the NHS gene cause Nance-Horan Syndrome (NHS), a rare X-chromosomal recessive disorder with variable features, including congenital cataract, microphthalmia, a peculiar form of the ear and dental anomalies. We investigated the NHS gene in four additional families with NHS from the
Institute of Scientific and Technical Information of China (English)
Zhen-lin ZHANG; Jin-wei HE; Yue-juan QIN; Yun-qiu HU; Miao LI; Yu-juan LIU; Hao ZHANG; Wei-wei HU
2007-01-01
Aim: To assess the contribution of single nucleotide polymorphisms (SNP) and haplotypes in the peroxisome proliferator-activated receptor-γ co-activator-1(PPARGC1) and adiponectin genes to normal bone mineral density (BMD) variation in healthy Chinese women and men. Methods: We performed population-based (ANOVA) and family-based (quantitative trait locus transmission disequi-librium test) association studies of PPARGC1 and adiponectin genes. SNP in the 2 genes were genotyped. BMD was measured using dual-energy X-ray absorptiometry in the lumbar spine and hip in 401 nuclear families with a total of1260 subjects, including 458 premenopausal women, 20-40 years of age; 401 post-menopausal women (mothers), 43-74 years of age; and 401 men (fathers), 49-76years of age. Results: Significant within-family association was found between the Thr394Thr polymorphism in the PPGAGC1 gene and peak BMD in the femoral neck (P=0.026). Subsequent permutations were in agreement with this significant within-family association result (P=0.016), but Thr394Thr SNP only accounted for0.7% of the variation in femoral neck peak BMD. However, no significant within-family association was detected between each SNP in the adiponect in gene and peak BMD. Although no significant association was found between BMD and SNP in the PPARGC1 and adiponectin genes in both men and postmenopausal women, haplotype 2 (T-T) in the adiponect in gene was associated with lumbar spine BMD in postmenopausal women (P=0.019). Conclusion: Our findings sug-gest that Thr394Thr SNP in the PPARGC1 gene was associated with peak BMD in the femoral neck in Chinese women. Confirmation of our results is needed in other populations and with more functional markers within and flanking the PPARGC1 or adiponectin genes region.
Moore, Abigail J; Vos, Jurriaan M De; Hancock, Lillian P; Goolsby, Eric; Edwards, Erika J
2018-05-01
Hybrid enrichment is an increasingly popular approach for obtaining hundreds of loci for phylogenetic analysis across many taxa quickly and cheaply. The genes targeted for sequencing are typically single-copy loci, which facilitate a more straightforward sequence assembly and homology assignment process. However, this approach limits the inclusion of most genes of functional interest, which often belong to multi-gene families. Here, we demonstrate the feasibility of including large gene families in hybrid enrichment protocols for phylogeny reconstruction and subsequent analyses of molecular evolution, using a new set of bait sequences designed for the "portullugo" (Caryophyllales), a moderately sized lineage of flowering plants (~ 2200 species) that includes the cacti and harbors many evolutionary transitions to C$_{\\mathrm{4}}$ and CAM photosynthesis. Including multi-gene families allowed us to simultaneously infer a robust phylogeny and construct a dense sampling of sequences for a major enzyme of C$_{\\mathrm{4}}$ and CAM photosynthesis, which revealed the accumulation of adaptive amino acid substitutions associated with C$_{\\mathrm{4}}$ and CAM origins in particular paralogs. Our final set of matrices for phylogenetic analyses included 75-218 loci across 74 taxa, with ~ 50% matrix completeness across data sets. Phylogenetic resolution was greatly improved across the tree, at both shallow and deep levels. Concatenation and coalescent-based approaches both resolve the sister lineage of the cacti with strong support: Anacampserotaceae $+$ Portulacaceae, two lineages of mostly diminutive succulent herbs of warm, arid regions. In spite of this congruence, BUCKy concordance analyses demonstrated strong and conflicting signals across gene trees. Our results add to the growing number of examples illustrating the complexity of phylogenetic signals in genomic-scale data.
Directory of Open Access Journals (Sweden)
Wentao Wu
2017-10-01
Full Text Available The plant hormone auxin plays pivotal roles in many aspects of plant growth and development. The auxin/indole-3-acetic acid (Aux/IAA gene family encodes short-lived nuclear proteins acting on auxin perception and signaling, but the evolutionary history of this gene family remains to be elucidated. In this study, the Aux/IAA gene family in 17 plant species covering all major lineages of plants is identified and analyzed by using multiple bioinformatics methods. A total of 434 Aux/IAA genes was found among these plant species, and the gene copy number ranges from three (Physcomitrella patens to 63 (Glycine max. The phylogenetic analysis shows that the canonical Aux/IAA proteins can be generally divided into five major clades, and the origin of Aux/IAA proteins could be traced back to the common ancestor of land plants and green algae. Many truncated Aux/IAA proteins were found, and some of these truncated Aux/IAA proteins may be generated from the C-terminal truncation of auxin response factor (ARF proteins. Our results indicate that tandem and segmental duplications play dominant roles for the expansion of the Aux/IAA gene family mainly under purifying selection. The putative nuclear localization signals (NLSs in Aux/IAA proteins are conservative, and two kinds of new primordial bipartite NLSs in P. patens and Selaginella moellendorffii were discovered. Our findings not only give insights into the origin and expansion of the Aux/IAA gene family, but also provide a basis for understanding their functions during the course of evolution.
Wu, Wentao; Liu, Yaxue; Wang, Yuqian; Li, Huimin; Liu, Jiaxi; Tan, Jiaxin; He, Jiadai; Bai, Jingwen; Ma, Haoli
2017-10-08
The plant hormone auxin plays pivotal roles in many aspects of plant growth and development. The auxin/indole-3-acetic acid (Aux/IAA) gene family encodes short-lived nuclear proteins acting on auxin perception and signaling, but the evolutionary history of this gene family remains to be elucidated. In this study, the Aux/IAA gene family in 17 plant species covering all major lineages of plants is identified and analyzed by using multiple bioinformatics methods. A total of 434 Aux/IAA genes was found among these plant species, and the gene copy number ranges from three ( Physcomitrella patens ) to 63 ( Glycine max ). The phylogenetic analysis shows that the canonical Aux/IAA proteins can be generally divided into five major clades, and the origin of Aux/IAA proteins could be traced back to the common ancestor of land plants and green algae. Many truncated Aux/IAA proteins were found, and some of these truncated Aux/IAA proteins may be generated from the C-terminal truncation of auxin response factor (ARF) proteins. Our results indicate that tandem and segmental duplications play dominant roles for the expansion of the Aux/IAA gene family mainly under purifying selection. The putative nuclear localization signals (NLSs) in Aux/IAA proteins are conservative, and two kinds of new primordial bipartite NLSs in P. patens and Selaginella moellendorffii were discovered. Our findings not only give insights into the origin and expansion of the Aux/IAA gene family, but also provide a basis for understanding their functions during the course of evolution.
Leiomodins: larger members of the tropomodulin (Tmod) gene family
Conley, C. A.; Fritz-Six, K. L.; Almenar-Queralt, A.; Fowler, V. M.
2001-01-01
The 64-kDa autoantigen D1 or 1D, first identified as a potential autoantigen in Graves' disease, is similar to the tropomodulin (Tmod) family of actin filament pointed end-capping proteins. A novel gene with significant similarity to the 64-kDa human autoantigen D1 has been cloned from both humans and mice, and the genomic sequences of both genes have been identified. These genes form a subfamily closely related to the Tmods and are here named the Leiomodins (Lmods). Both Lmod genes display a conserved intron-exon structure, as do three Tmod genes, but the intron-exon structure of the Lmods and the Tmods is divergent. mRNA expression analysis indicates that the gene formerly known as the 64-kDa autoantigen D1 is most highly expressed in a variety of human tissues that contain smooth muscle, earning it the name smooth muscle Leiomodin (SM-Lmod; HGMW-approved symbol LMOD1). Transcripts encoding the novel Lmod gene are present exclusively in fetal and adult heart and adult skeletal muscle, and it is here named cardiac Leiomodin (C-Lmod; HGMW-approved symbol LMOD2). Human C-Lmod is located near the hypertrophic cardiomyopathy locus CMH6 on human chromosome 7q3, potentially implicating it in this disease. Our data demonstrate that the Lmods are evolutionarily related and display tissue-specific patterns of expression distinct from, but overlapping with, the expression of Tmod isoforms. Copyright 2001 Academic Press.
Directory of Open Access Journals (Sweden)
Mathieu Marella
2010-07-01
Full Text Available Leber's hereditary optic neuropathy (LHON is a maternally inherited disorder with point mutations in mitochondrial DNA which result in loss of vision in young adults. The majority of mutations reported to date are within the genes encoding the subunits of the mitochondrial NADH-quinone oxidoreductase, complex I. Establishment of animal models of LHON should help elucidate mechanism of the disease and could be utilized for possible development of therapeutic strategies.We established a rat model which involves injection of rotenone-loaded microspheres into the optic layer of the rat superior colliculus. The animals exhibited the most common features of LHON. Visual loss was observed within 2 weeks of rotenone administration with no apparent effect on retinal ganglion cells. Death of retinal ganglion cells occurred at a later stage. Using our rat model, we investigated the effect of the yeast alternative NADH dehydrogenase, Ndi1. We were able to achieve efficient expression of the Ndi1 protein in the mitochondria of all regions of retinal ganglion cells and axons by delivering the NDI1 gene into the optical layer of the superior colliculus. Remarkably, even after the vision of the rats was severely impaired, treatment of the animals with the NDI1 gene led to a complete restoration of the vision to the normal level. Control groups that received either empty vector or the GFP gene had no effects.The present study reports successful manifestation of LHON-like symptoms in rats and demonstrates the potential of the NDI1 gene therapy on mitochondrial optic neuropathies. Our results indicate a window of opportunity for the gene therapy to be applied successfully after the onset of the disease symptoms.
Directory of Open Access Journals (Sweden)
Haga Christopher L
2007-09-01
Full Text Available Abstract Background In mouse the cytokine interleukin-7 (IL-7 is required for generation of B lymphocytes, but human IL-7 does not appear to have this function. A bioinformatics approach was therefore used to identify IL-7 receptor related genes in the hope of identifying the elusive human cytokine. Results Our database search identified a family of nine gene candidates, which we have provisionally named fibronectin immunoglobulin leucine-rich repeat (FIGLER. The FIGLER 1–9 genes are predicted to encode type I transmembrane glycoproteins with 6–12 leucine-rich repeats (LRR, a C2 type Ig domain, a fibronectin type III domain, a hydrophobic transmembrane domain, and a cytoplasmic domain containing one to four tyrosine residues. Members of this multichromosomal gene family possess 20–47% overall amino acid identity and are differentially expressed in cell lines and primary hematopoietic lineage cells. Genes for FIGLER homologs were identified in macaque, orangutan, chimpanzee, mouse, rat, dog, chicken, toad, and puffer fish databases. The non-human FIGLER homologs share 38–99% overall amino acid identity with their human counterpart. Conclusion The extracellular domain structure and absence of recognizable cytoplasmic signaling motifs in members of the highly conserved FIGLER gene family suggest a trophic or cell adhesion function for these molecules.
Li, Jun; Hou, Hongmin; Li, Xiaoqin; Xiang, Jiang; Yin, Xiangjing; Gao, Hua; Zheng, Yi; Bassett, Carole L; Wang, Xiping
2013-09-01
SQUAMOSA promoter binding protein (SBP)-box genes encode a family of plant-specific transcription factors and play many crucial roles in plant development. In this study, 27 SBP-box gene family members were identified in the apple (Malus × domestica Borkh.) genome, 15 of which were suggested to be putative targets of MdmiR156. Plant SBPs were classified into eight groups according to the phylogenetic analysis of SBP-domain proteins. Gene structure, gene chromosomal location and synteny analyses of MdSBP genes within the apple genome demonstrated that tandem and segmental duplications, as well as whole genome duplications, have likely contributed to the expansion and evolution of the SBP-box gene family in apple. Additionally, synteny analysis between apple and Arabidopsis indicated that several paired homologs of MdSBP and AtSPL genes were located in syntenic genomic regions. Tissue-specific expression analysis of MdSBP genes in apple demonstrated their diversified spatiotemporal expression patterns. Most MdmiR156-targeted MdSBP genes, which had relatively high transcript levels in stems, leaves, apical buds and some floral organs, exhibited a more differential expression pattern than most MdmiR156-nontargeted MdSBP genes. Finally, expression analysis of MdSBP genes in leaves upon various plant hormone treatments showed that many MdSBP genes were responsive to different plant hormones, indicating that MdSBP genes may be involved in responses to hormone signaling during stress or in apple development. Copyright © 2013 Elsevier Masson SAS. All rights reserved.
[New advances in animal transgenic technology].
Sun, Zhen-Hong; Miao, Xiang-Yang; Zhu, Rui-Liang
2010-06-01
Animal transgenic technology is one of the fastest growing biotechnology in the 21st century. It is used to integrate foreign genes into the animal genome by genetic engineering technology so that foreign genes can be expressed and inherited to the offspring. The transgenic efficiency and precise control of gene expression are the key limiting factors on preparation of transgenic animals. A variety of transgenic techniques are available, each of which has its own advantages and disadvantages and still needs further study because of unresolved technical and safety issues. With the in-depth research, the transgenic technology will have broad application prospects in the fields of exploration of gene function, animal genetic improvement, bioreactor, animal disease models, organ transplantation and so on. This article reviews the recently developed animal gene transfer techniques, including germline stem cell mediated method to improve the efficiency, gene targeting to improve the accuracy, RNA interference (RNAi)-mediated gene silencing technology, and the induced pluripotent stem cells (iPS) transgenic technology. The new transgenic techniques can provide a better platform for the study of trans-genic animals and promote the development of medical sciences, livestock production, and other fields.
Directory of Open Access Journals (Sweden)
Myo-Jing Kim
2014-12-01
Full Text Available Autosomal dominant neurohypophyseal diabetes insipidus is a rare form of central diabetes insipidus that is caused by mutations in the vasopressin-neurophysin II (AVP-NPII gene. It is characterized by persistent polydipsia and polyuria induced by deficient or absent secretion of arginine vasopressin (AVP. Here we report a case of familial neurohypophyseal diabetes insipidus in four generations of a Korean family, caused by heterozygous missense mutation in exon 2 of the AVP-NPII gene (c.286G>T. This is the first report of such a case in Korea.
Burrows, Emma L; Hannan, Anthony J
2016-04-01
Schizophrenia is a devastating brain disorder caused by a complex and heterogeneous combination of genetic and environmental factors. In order to develop effective new strategies to prevent and treat schizophrenia, valid animal models are required which accurately model the disorder, and ideally provide construct, face and predictive validity. The cognitive deficits in schizophrenia represent some of the most debilitating symptoms and are also currently the most poorly treated. Therefore it is crucial that animal models are able to capture the cognitive dysfunction that characterizes schizophrenia, as well as the negative and psychotic symptoms. The genomes of mice have, prior to the recent gene-editing revolution, proven the most easily manipulable of mammalian laboratory species, and hence most genetic targeting has been performed using mouse models. Importantly, when key environmental factors of relevance to schizophrenia are experimentally manipulated, dramatic changes in the phenotypes of these animal models are often observed. We will review recent studies in rodent models which provide insight into gene-environment interactions in schizophrenia. We will focus specifically on environmental factors which modulate levels of experience-dependent plasticity, including environmental enrichment, cognitive stimulation, physical activity and stress. The insights provided by this research will not only help refine the establishment of optimally valid animal models which facilitate development of novel therapeutics, but will also provide insight into the pathogenesis of schizophrenia, thus identifying molecular and cellular targets for future preclinical and clinical investigations. Copyright © 2015 Elsevier B.V. All rights reserved.
Phylogenetic relationships of the Fox (Forkhead) gene family in the Bilateria
Mazet, Francoise; Yu, Jr Kai; Liberles, David A.; Holland, Linda Z.; Shimeld, Sebastian M.
2003-01-01
The Forkhead or Fox gene family encodes putative transcription factors. There are at least four Fox genes in yeast, 16 in Drosophila melanogaster (Dm) and 42 in humans. Recently, vertebrate Fox genes have been classified into 17 groups named FoxA to FoxQ. Here, we extend this analysis to invertebrates, using available sequences from D. melanogaster, Anopheles gambiae (Ag), Caenorhabditis elegans (Ce), the sea squirt Ciona intestinalis (Ci) and amphioxus Branchiostoma floridae (Bf), from which we also cloned several Fox genes. Phylogenetic analyses lend support to the previous overall subclassification of vertebrate genes, but suggest that four subclasses (FoxJ, L, N and Q) could be further subdivided to reflect their relationships to invertebrate genes. We were unable to identify orthologs of Fox subclasses E, H, I, J, M and Q1 in D. melanogaster, A. gambiae or C. elegans, suggesting either considerable loss in ecdysozoans or the evolution of these subclasses in the deuterostome lineage. Our analyses suggest that the common ancestor of protostomes and deuterostomes had a minimum complement of 14 Fox genes.
Tavera-Tapia, A; Pérez-Cabornero, L; Macías, J A; Ceballos, M I; Roncador, G; de la Hoya, M; Barroso, A; Felipe-Ponce, V; Serrano-Blanch, R; Hinojo, C; Miramar-Gallart, M D; Urioste, M; Caldés, T; Santillan-Garzón, S; Benitez, J; Osorio, A
2017-02-01
There is still a considerable percentage of hereditary breast and ovarian cancer (HBOC) cases not explained by BRCA1 and BRCA2 genes. In this report, next-generation sequencing (NGS) techniques were applied to identify novel variants and/or genes involved in HBOC susceptibility. Using whole exome sequencing, we identified a novel germline mutation in the moderate-risk gene ATM (c.5441delT; p.Leu1814Trpfs*14) in a family negative for mutations in BRCA1/2 (BRCAX). A case-control association study was performed to establish its prevalence in Spanish population, in a series of 1477 BRCAX families and 589 controls further screened, and NGS panels were used for ATM mutational screening in a cohort of 392 HBOC Spanish BRCAX families and 350 patients affected with diseases not related to breast cancer. Although the interrogated mutation was not prevalent in case-control association study, a comprehensive mutational analysis of the ATM gene revealed 1.78% prevalence of mutations in the ATM gene in HBOC and 1.94% in breast cancer-only BRCAX families in Spanish population, where data about ATM mutations were very limited. ATM mutation prevalence in Spanish population highlights the importance of considering ATM pathogenic variants linked to breast cancer susceptibility.
Jiang, Chunmiao; Shen, Qingxi J; Wang, Bo; He, Bin; Xiao, Suqin; Chen, Ling; Yu, Tengqiong; Ke, Xue; Zhong, Qiaofang; Fu, Jian; Chen, Yue; Wang, Lingxian; Yin, Fuyou; Zhang, Dunyu; Ghidan, Walid; Huang, Xingqi; Cheng, Zaiquan
2017-01-01
Oryza officinalis Wall ex Watt, a very important and special wild rice species, shows abundant genetic diversity and disease resistance features, especially high resistance to bacterial blight. The molecular mechanisms of bacterial blight resistance in O. officinalis have not yet been elucidated. The WRKY transcription factor family is one of the largest gene families involved in plant growth, development and stress response. However, little is known about the numbers, structure, molecular phylogenetics, and expression of the WRKY genes under Xanthomonas oryzae pv. oryzae (Xoo) stress in O. officinalis due to lacking of O. officinalis genome. Therefore, based on the RNA-sequencing data of O. officinalis, we performed a comprehensive study of WRKY genes in O. officinalis and identified 89 OoWRKY genes. Then 89 OoWRKY genes were classified into three groups based on the WRKY domains and zinc finger motifs. Phylogenetic analysis strongly supported that the evolution of OoWRKY genes were consistent with previous studies of WRKYs, and subgroup IIc OoWRKY genes were the original ancestors of some group II and group III OoWRKYs. Among the 89 OoWRKY genes, eight OoWRKYs displayed significantly different expression (>2-fold, pWRKY family of transcription factors in O.officinalis. Insight was gained into the classification, evolution, and function of the OoWRKY genes, revealing the putative roles of eight significantly different expression OoWRKYs in Xoo strains PXO99 and C5 stress responses in O.officinalis. This study provided a better understanding of the evolution and functions of O. officinalis WRKY genes, and suggested that manipulating eight significantly different expression OoWRKYs would enhance resistance to bacterial blight.
da Silva, Danielle Costenaro; da Silveira Falavigna, Vítor; Fasoli, Marianna; Buffon, Vanessa; Porto, Diogo Denardi; Pappas, Georgios Joannis; Pezzotti, Mario; Pasquali, Giancarlo; Revers, Luís Fernando
2016-01-01
The Dof (DNA-binding with one finger) protein family spans a group of plant transcription factors involved in the regulation of several functions, such as plant responses to stress, hormones and light, phytochrome signaling and seed germination. Here we describe the Dof-like gene family in grapevine (Vitis vinifera L.), which consists of 25 genes coding for Dof. An extensive in silico characterization of the VviDofL gene family was performed. Additionally, the expression of the entire gene family was assessed in 54 grapevine tissues and organs using an integrated approach with microarray (cv Corvina) and real-time PCR (cv Pinot Noir) analyses. The phylogenetic analysis comparing grapevine sequences with those of Arabidopsis, tomato, poplar and already described Dof genes in other species allowed us to identify several duplicated genes. The diversification of grapevine DofL genes during evolution likely resulted in a broader range of biological roles. Furthermore, distinct expression patterns were identified between samples analyzed, corroborating such hypothesis. Our expression results indicate that several VviDofL genes perform their functional roles mainly during flower, berry and seed development, highlighting their importance for grapevine growth and production. The identification of similar expression profiles between both approaches strongly suggests that these genes have important regulatory roles that are evolutionally conserved between grapevine cvs Corvina and Pinot Noir.
Directory of Open Access Journals (Sweden)
Sandra Gutiérrez
2012-01-01
Full Text Available In this study, we analyzed the phenotype, clinical characteristics and presence of mutations in the enamelin gene ENAM in five Colombian families with autosomal dominant amelogenesis imperfecta (ADAI. 22 individuals (15 affected and seven unaffected belonging to five Colombian families with ADAI and eight individuals (three affected and five unaffected belonging to three Colombian families with autosomal recessive amelogenesis imperfecta (ARAI that served as controls for molecular alterations and inheritance patterns were studied. Clinical, radiographic and genetic evaluations were done in all individuals. Eight exons and three intron-exon boundaries were sequenced for mutation analysis. Two of the five families with ADAI had the hypoplasic phenotype, two had the hypocalcified phenotype and one had the hypomaturative phenotype. Anterior open bite and mandibular retrognathism were the most frequent skeletal abnormalities in the families with ADAI. No mutations were found. These findings suggest that ADAI in these Colombian families was unrelated to previously described mutations in the ENAM gene. These results also indicate that other regions not included in this investigation, such as the promoter region, introns and other genes should be considered as potential ADAI candidates.
Directory of Open Access Journals (Sweden)
Adam M. Reitzel
2016-08-01
Full Text Available Abstract Background An essential developmental pathway in sexually reproducing animals is the specification of germ cells and the differentiation of mature gametes, sperm and oocytes. The “germline” genes vasa, nanos and piwi are commonly identified in primordial germ cells, suggesting a molecular signature for the germline throughout animals. However, these genes are also expressed in a diverse set of somatic stem cells throughout the animal kingdom leaving open significant questions for whether they are required for germline specification. Similarly, members of the Dmrt gene family are essential components regulating sex determination and differentiation in bilaterian animals, but the functions of these transcription factors, including potential roles in sex determination, in early diverging animals remain unknown. The phylogenetic position of ctenophores and the genome sequence of the lobate Mnemiopsis leidyi motivated us to determine the compliment of these gene families in this species and determine expression patterns during development. Results Our phylogenetic analyses of the vasa, piwi and nanos gene families show that Mnemiopsis has multiple genes in each family with multiple lineage-specific paralogs. Expression domains of Mnemiopsis nanos, vasa and piwi, during embryogenesis from fertilization to the cydippid stage, were diverse, with little overlapping expression and no or little expression in what we think are the germ cells or gametogenic regions. piwi paralogs in Mnemiopsis had distinct expression domains in the ectoderm during development. We observed overlapping expression domains in the apical organ and tentacle apparatus of the cydippid for a subset of “germline genes,” which are areas of high cell proliferation, suggesting that these genes are involved with “stem cell” specification and maintenance. Similarly, the five Dmrt genes show diverse non-overlapping expression domains, with no clear evidence for
New mutations in the NHS gene in Nance-Horan Syndrome families from the Netherlands.
Florijn, Ralph J; Loves, Willem; Maillette de Buy Wenniger-Prick, Liesbeth J J M; Mannens, Marcel M A M; Tijmes, Nel; Brooks, Simon P; Hardcastle, Alison J; Bergen, Arthur A B
2006-09-01
Mutations in the NHS gene cause Nance-Horan Syndrome (NHS), a rare X-chromosomal recessive disorder with variable features, including congenital cataract, microphthalmia, a peculiar form of the ear and dental anomalies. We investigated the NHS gene in four additional families with NHS from the Netherlands, by dHPLC and direct sequencing. We identified an unique mutation in each family. Three out of these four mutations were not reported before. We report here the first splice site sequence alteration mutation and three protein truncating mutations. Our results suggest that X-linked cataract and NHS are allelic disorders.
Gene-expression patterns in peripheral blood classify familial breast cancer susceptibility.
Piccolo, Stephen R; Andrulis, Irene L; Cohen, Adam L; Conner, Thomas; Moos, Philip J; Spira, Avrum E; Buys, Saundra S; Johnson, W Evan; Bild, Andrea H
2015-11-04
Women with a family history of breast cancer face considerable uncertainty about whether to pursue standard screening, intensive screening, or prophylactic surgery. Accurate and individualized risk-estimation approaches may help these women make more informed decisions. Although highly penetrant genetic variants have been associated with familial breast cancer (FBC) risk, many individuals do not carry these variants, and many carriers never develop breast cancer. Common risk variants have a relatively modest effect on risk and show limited potential for predicting FBC development. As an alternative, we hypothesized that additional genomic data types, such as gene-expression levels, which can reflect genetic and epigenetic variation, could contribute to classifying a person's risk status. Specifically, we aimed to identify common patterns in gene-expression levels across individuals who develop FBC. We profiled peripheral blood mononuclear cells from women with a family history of breast cancer (with or without a germline BRCA1/2 variant) and from controls. We used the support vector machines algorithm to differentiate between patients who developed FBC and those who did not. Our study used two independent datasets, a training set of 124 women from Utah (USA) and an external validation (test) set from Ontario (Canada) of 73 women (197 total). We controlled for expression variation associated with clinical, demographic, and treatment variables as well as lymphocyte markers. Our multigene biomarker provided accurate, individual-level estimates of FBC occurrence for the Utah cohort (AUC = 0.76 [0.67-84]) . Even at their lower confidence bounds, these accuracy estimates meet or exceed estimates from alternative approaches. Our Ontario cohort resulted in similarly high levels of accuracy (AUC = 0.73 [0.59-0.86]), thus providing external validation of our findings. Individuals deemed to have "high" risk by our model would have an estimated 2.4 times greater odds of
Dong, Chun-Juan; Shang, Qing-Mao
2013-07-01
Phenylalanine ammonia-lyase (PAL), the first enzyme in the phenylpropanoid pathway, plays a critical role in plant growth, development, and adaptation. PAL enzymes are encoded by a gene family in plants. Here, we report a genome-wide search for PAL genes in watermelon. A total of 12 PAL genes, designated ClPAL1-12, are identified . Nine are arranged in tandem in two duplication blocks located on chromosomes 4 and 7, and the other three ClPAL genes are distributed as single copies on chromosomes 2, 3, and 8. Both the cDNA and protein sequences of ClPALs share an overall high identity with each other. A phylogenetic analysis places 11 of the ClPALs into a separate cucurbit subclade, whereas ClPAL2, which belongs to neither monocots nor dicots, may serve as an ancestral PAL in plants. In the cucurbit subclade, seven ClPALs form homologous pairs with their counterparts from cucumber. Expression profiling reveals that 11 of the ClPAL genes are expressed and show preferential expression in the stems and male and female flowers. Six of the 12 ClPALs are moderately or strongly expressed in the fruits, particularly in the pulp, suggesting the potential roles of PAL in the development of fruit color and flavor. A promoter motif analysis of the ClPAL genes implies redundant but distinctive cis-regulatory structures for stress responsiveness. Finally, duplication events during the evolution and expansion of the ClPAL gene family are discussed, and the relationships between the ClPAL genes and their cucumber orthologs are estimated.
Directory of Open Access Journals (Sweden)
Thomas Ann
2009-07-01
Full Text Available Abstract Background Polyphenol oxidase (PPO activity in plants is a trait with potential economic, agricultural and environmental impact. In relation to the food industry, PPO-induced browning causes unacceptable discolouration in fruit and vegetables: from an agriculture perspective, PPO can protect plants against pathogens and environmental stress, improve ruminant growth by increasing nitrogen absorption and decreasing nitrogen loss to the environment through the animal's urine. The high PPO legume, red clover, has a significant economic and environmental role in sustaining low-input organic and conventional farms. Molecular markers for a range of important agricultural traits are being developed for red clover and improved knowledge of PPO genes and their structure will facilitate molecular breeding. Results A bacterial artificial chromosome (BAC library comprising 26,016 BAC clones with an average 135 Kb insert size, was constructed from Trifolium pratense L. (red clover, a diploid legume with a haploid genome size of 440–637 Mb. Library coverage of 6–8 genome equivalents ensured good representation of genes: the library was screened for polyphenol oxidase (PPO genes. Two single copy PPO genes, PPO4 and PPO5, were identified to add to a family of three, previously reported, paralogous genes (PPO1–PPO3. Multiple PPO1 copies were identified and characterised revealing a subfamily comprising three variants PPO1/2, PPO1/4 and PPO1/5. Six PPO genes clustered within the genome: four separate BAC clones could be assembled onto a predicted 190–510 Kb single BAC contig. Conclusion A PPO gene family in red clover resides as a cluster of at least 6 genes. Three of these genes have high homology, suggesting a more recent evolutionary event. This PPO cluster covers a longer region of the genome than clusters detected in rice or previously reported in tomato. Full-length coding sequences from PPO4, PPO5, PPO1/5 and PPO1/4 will facilitate
Energy Technology Data Exchange (ETDEWEB)
Vamathevan, Jessica J., E-mail: jessica.j.vamathevan@gsk.com [Computational Biology, Quantitative Sciences, GlaxoSmithKline, Stevenage (United Kingdom); Hall, Matthew D.; Hasan, Samiul; Woollard, Peter M. [Computational Biology, Quantitative Sciences, GlaxoSmithKline, Stevenage (United Kingdom); Xu, Meng; Yang, Yulan; Li, Xin; Wang, Xiaoli [BGI-Shenzen, Shenzhen (China); Kenny, Steve [Safety Assessment, PTS, GlaxoSmithKline, Ware (United Kingdom); Brown, James R. [Computational Biology, Quantitative Sciences, GlaxoSmithKline, Collegeville, PA (United States); Huxley-Jones, Julie [UK Platform Technology Sciences (PTS) Operations and Planning, PTS, GlaxoSmithKline, Stevenage (United Kingdom); Lyon, Jon; Haselden, John [Safety Assessment, PTS, GlaxoSmithKline, Ware (United Kingdom); Min, Jiumeng [BGI-Shenzen, Shenzhen (China); Sanseau, Philippe [Computational Biology, Quantitative Sciences, GlaxoSmithKline, Stevenage (United Kingdom)
2013-07-15
Improving drug attrition remains a challenge in pharmaceutical discovery and development. A major cause of early attrition is the demonstration of safety signals which can negate any therapeutic index previously established. Safety attrition needs to be put in context of clinical translation (i.e. human relevance) and is negatively impacted by differences between animal models and human. In order to minimize such an impact, an earlier assessment of pharmacological target homology across animal model species will enhance understanding of the context of animal safety signals and aid species selection during later regulatory toxicology studies. Here we sequenced the genomes of the Sus scrofa Göttingen minipig and the Canis familiaris beagle, two widely used animal species in regulatory safety studies. Comparative analyses of these new genomes with other key model organisms, namely mouse, rat, cynomolgus macaque, rhesus macaque, two related breeds (S. scrofa Duroc and C. familiaris boxer) and human reveal considerable variation in gene content. Key genes in toxicology and metabolism studies, such as the UGT2 family, CYP2D6, and SLCO1A2, displayed unique duplication patterns. Comparisons of 317 known human drug targets revealed surprising variation such as species-specific positive selection, duplication and higher occurrences of pseudogenized targets in beagle (41 genes) relative to minipig (19 genes). These data will facilitate the more effective use of animals in biomedical research. - Highlights: • Genomes of the minipig and beagle dog, two species used in pharmaceutical studies. • First systematic comparative genome analysis of human and six experimental animals. • Key drug toxicology genes display unique duplication patterns across species. • Comparison of 317 drug targets show species-specific evolutionary patterns.
International Nuclear Information System (INIS)
Vamathevan, Jessica J.; Hall, Matthew D.; Hasan, Samiul; Woollard, Peter M.; Xu, Meng; Yang, Yulan; Li, Xin; Wang, Xiaoli; Kenny, Steve; Brown, James R.; Huxley-Jones, Julie; Lyon, Jon; Haselden, John; Min, Jiumeng; Sanseau, Philippe
2013-01-01
Improving drug attrition remains a challenge in pharmaceutical discovery and development. A major cause of early attrition is the demonstration of safety signals which can negate any therapeutic index previously established. Safety attrition needs to be put in context of clinical translation (i.e. human relevance) and is negatively impacted by differences between animal models and human. In order to minimize such an impact, an earlier assessment of pharmacological target homology across animal model species will enhance understanding of the context of animal safety signals and aid species selection during later regulatory toxicology studies. Here we sequenced the genomes of the Sus scrofa Göttingen minipig and the Canis familiaris beagle, two widely used animal species in regulatory safety studies. Comparative analyses of these new genomes with other key model organisms, namely mouse, rat, cynomolgus macaque, rhesus macaque, two related breeds (S. scrofa Duroc and C. familiaris boxer) and human reveal considerable variation in gene content. Key genes in toxicology and metabolism studies, such as the UGT2 family, CYP2D6, and SLCO1A2, displayed unique duplication patterns. Comparisons of 317 known human drug targets revealed surprising variation such as species-specific positive selection, duplication and higher occurrences of pseudogenized targets in beagle (41 genes) relative to minipig (19 genes). These data will facilitate the more effective use of animals in biomedical research. - Highlights: • Genomes of the minipig and beagle dog, two species used in pharmaceutical studies. • First systematic comparative genome analysis of human and six experimental animals. • Key drug toxicology genes display unique duplication patterns across species. • Comparison of 317 drug targets show species-specific evolutionary patterns
Unequal rates of Y chromosome gene divergence during speciation of the family Ursidae.
Nakagome, Shigeki; Pecon-Slattery, Jill; Masuda, Ryuichi
2008-07-01
Evolution of the bear family Ursidae is well investigated in terms of morphological, paleontological, and genetic features. However, several phylogenetic ambiguities occur within the subfamily Ursinae (the family Ursidae excluding the giant panda and spectacled bear), which may correlate with behavioral traits of female philopatry and male-biased dispersal which form the basis of the observed matriarchal population structure in these species. In the process of bear evolution, we investigate the premise that such behavioral traits may be reflected in patterns of variation among genes with different modes of inheritance: matrilineal mitochondrial DNA (mtDNA), patrilineal Y chromosome, biparentally inherited autosomes, and the X chromosome. In the present study, we sequenced 3 Y-linked genes (3,453 bp) and 4 X-linked genes (4,960 bp) and reanalyzed previously published sequences from autosome genes (2,347 bp) in ursid species to investigate differences in evolutionary rates associated with patterns of inheritance. The results describe topological incongruence between sex-linked genes and autosome genes and between nuclear DNA and mtDNA. In more ancestral branches within the bear phylogeny, Y-linked genes evolved faster than autosome and X-linked genes, consistent with expectations based on male-driven evolution. However, this pattern changes among branches leading to each species within the lineage of Ursinae whereby the evolutionary rates of Y-linked genes have fewer than expected substitutions. This inconsistency between more recent nodes of the bear phylogeny with more ancestral nodes may reflect the influences of sex-biased dispersal as well as molecular evolutionary characteristics of the Y chromosome, and stochastic events in species natural history, and phylogeography unique to ursine bears.
Directory of Open Access Journals (Sweden)
Zhi Zou
Full Text Available Aquaporins (AQPs are a class of integral membrane proteins that facilitate the passive transport of water and other small solutes across biological membranes. Castor bean (Ricinus communis L., Euphobiaceae, an important non-edible oilseed crop, is widely cultivated for industrial, medicinal and cosmetic purposes. Its recently available genome provides an opportunity to analyze specific gene families. In this study, a total of 37 full-length AQP genes were identified from the castor bean genome, which were assigned to five subfamilies, including 10 plasma membrane intrinsic proteins (PIPs, 9 tonoplast intrinsic proteins (TIPs, 8 NOD26-like intrinsic proteins (NIPs, 6 X intrinsic proteins (XIPs and 4 small basic intrinsic proteins (SIPs on the basis of sequence similarities. Functional prediction based on the analysis of the aromatic/arginine (ar/R selectivity filter, Froger's positions and specificity-determining positions (SDPs showed a remarkable difference in substrate specificity among subfamilies. Homology analysis supported the expression of all 37 RcAQP genes in at least one of examined tissues, e.g., root, leaf, flower, seed and endosperm. Furthermore, global expression profiles with deep transcriptome sequencing data revealed diverse expression patterns among various tissues. The current study presents the first genome-wide analysis of the AQP gene family in castor bean. Results obtained from this study provide valuable information for future functional analysis and utilization.
International Nuclear Information System (INIS)
Zhu, Dan; Cai, Hua; Luo, Xiao; Bai, Xi; Deyholos, Michael K.; Chen, Qin; Chen, Chao; Ji, Wei; Zhu, Yanming
2012-01-01
Highlights: ► We isolated and characterized a novel JAZ family gene, GsJAZ2, from Glycine soja. ► Overexpression of GsJAZ2 enhanced plant tolerance to salt and alkali stress. ► The transcriptions of stress marker genes were higher in GsJAZ2 overexpression lines. ► GsJAZ2 was localized to nucleus. -- Abstract: Salt and alkali stress are two of the main environmental factors limiting crop production. Recent discoveries show that the JAZ family encodes plant-specific genes involved in jasmonate signaling. However, there is only limited information about this gene family in abiotic stress response, and in wild soybean (Glycine soja), which is a species noted for its tolerance to alkali and salinity. Here, we isolated and characterized a novel JAZ family gene, GsJAZ2, from G. soja. Transcript abundance of GsJAZ2 increased following exposure to salt, alkali, cold and drought. Over-expression of GsJAZ2 in Arabidopsis resulted in enhanced plant tolerance to salt and alkali stress. The expression levels of some alkali stress response and stress-inducible marker genes were significantly higher in the GsJAZ2 overexpression lines as compared to wild-type plants. Subcellular localization studies using a GFP fusion protein showed that GsJAZ2 was localized to the nucleus. These results suggest that the newly isolated wild soybean GsJAZ2 is a positive regulator of plant salt and alkali stress tolerance.
Sexy gene conversions: locating gene conversions on the X-chromosome.
Lawson, Mark J; Zhang, Liqing
2009-08-01
Gene conversion can have a profound impact on both the short- and long-term evolution of genes and genomes. Here, we examined the gene families that are located on the X-chromosomes of human (Homo sapiens), chimpanzee (Pan troglodytes), mouse (Mus musculus) and rat (Rattus norvegicus) for evidence of gene conversion. We identified seven gene families (WD repeat protein family, Ferritin Heavy Chain family, RAS-related Protein RAB-40 family, Diphosphoinositol polyphosphate phosphohydrolase family, Transcription Elongation Factor A family, LDOC1-related family, Zinc Finger Protein ZIC, and GLI family) that show evidence of gene conversion. Through phylogenetic analyses and synteny evidence, we show that gene conversion has played an important role in the evolution of these gene families and that gene conversion has occurred independently in both primates and rodents. Comparing the results with those of two gene conversion prediction programs (GENECONV and Partimatrix), we found that both GENECONV and Partimatrix have very high false negative rates (i.e. failed to predict gene conversions), which leads to many undetected gene conversions. The combination of phylogenetic analyses with physical synteny evidence exhibits high resolution in the detection of gene conversions.
Directory of Open Access Journals (Sweden)
Dandan eLi
2015-12-01
Full Text Available The heavy metal ATPase (HMA family plays an important role in transition metal transport in plants. However, this gene family has not been extensively studied in Populus trichocarpa. We identified 17 HMA genes in P. trichocarpa (PtHMAs, of which PtHMA1–PtHMA4 belonged to the zinc (Zn/cobalt (Co/cadmium (Cd/lead (Pb subgroup, and PtHMA5–PtHMA8 were members of the copper (Cu/silver (Ag subgroup. Most of the genes were localized to chromosomes I and III. Gene structure, gene chromosomal location, and synteny analyses of PtHMAs indicated that tandem and segmental duplications likely contributed to the expansion and evolution of the PtHMAs. Most of the HMA genes contained abiotic stress-related cis-elements. Tissue-specific expression of PtHMA genes showed that PtHMA1 and PtHMA4 had relatively high expression levels in the leaves, whereas Cu/Ag subgroup (PtHMA5.1- PtHMA8 genes were upregulated in the roots. High concentrations of Cu, Ag, Zn, Cd, Co, Pb and Mn differentially regulated the expression of PtHMAs in various tissues. The preliminary results of the present study generated basic information on the HMA family of Populus that may serve as foundation for future functional studies.
Energy Technology Data Exchange (ETDEWEB)
Strauss, Ludwig G. [German Cancer Research Center, Clinical Cooperation Unit Nuclear Medicine, Heidelberg (Germany); German Cancer Research Center, Medical PET Group - Biological Imaging, Clinical Cooperation Unit Nuclear Medicine, Heidelberg (Germany); Hoffend, Johannes [Klinikum Ludwigshafen, Institute of Diagnostic and Interventional Radiology, Ludwigshafen (Germany); Koczan, Dirk [University of Rostock, Institute of Immunology, Rostock (Germany); Pan, Leyun; Dimitrakopoulou-Strauss, Antonia [German Cancer Research Center, Clinical Cooperation Unit Nuclear Medicine, Heidelberg (Germany); Haberkorn, Uwe [German Cancer Research Center, Clinical Cooperation Unit Nuclear Medicine, Heidelberg (Germany); University of Heidelberg, Department of Nuclear Medicine, Heidelberg (Germany)
2009-08-15
The very early chemotherapeutic effects of the FOLFOX (fluorouracil, folinic acid, oxaliplatin) protocol were assessed in mice implanted with a human colorectal cell line. The aim of this study was to identify changes in gene expression patterns and to detect combinations of PET parameters that may be helpful in identifying treated tumours early after chemotherapy using dynamic PET studies. A human colorectal cell line (HCT 116) was used in nude mice. Dynamic PET studies were performed in untreated (n=13) and treated (n=12) animals. The data were assessed using compartmental and noncompartmental analysis. The removed tumour specimens were assessed by gene array analysis to obtain quantitative information on gene expression. One chemotherapeutic treatment using the FOLFOX protocol resulted in an upregulation of 2,078 gene probes by more than 25%, while 2,254 probes were downregulated following treatment. The gene array data demonstrated primarily an enhancement of genes related to apoptosis. In particular, the apoptosis antigen 1 (APO-1), p21 and the G protein-coupled receptor 87 (G-87) were 2.6- to 3.3-fold upregulated as compared to the expression in untreated animals. There was a 100% separation of untreated and treated animals on the basis of these three genes. The SUV and the FDG kinetic parameters obtained by compartmental and noncompartmental fitting were not significantly different when individual parameters were compared between groups. However, classification analysis of the combination of the PET parameters VB, K1, k3, and influx revealed an overall accuracy of 84%. We were able to identify 91.7% (11/12) of the treated animals and 76.9% (10/13) of the untreated animals correctly using the classification analysis of PET data. Even one chemotherapeutic treatment using FOLFOX has an impact on gene expression and significantly modulates FDG kinetics. Quantitative assessment of the tracer kinetics and the application of classification analysis to the data are
Zhang, C H; Ma, R J; Shen, Z J; Sun, X; Korir, N K; Yu, M L
2014-04-08
In this study, 33 homeodomain-leucine zipper (HD-ZIP) genes were identified in peach using the HD-ZIP amino acid sequences of Arabidopsis thaliana as a probe. Based on the phylogenetic analysis and the individual gene or protein characteristics, the HD-ZIP gene family in peach can be classified into 4 subfamilies, HD-ZIP I, II, III, and IV, containing 14, 7, 4, and 8 members, respectively. The most closely related peach HD-ZIP members within the same subfamilies shared very similar gene structure in terms of either intron/exon numbers or lengths. Almost all members of the same subfamily shared common motif compositions, thereby implying that the HD-ZIP proteins within the same subfamily may have functional similarity. The 33 peach HD-ZIP genes were distributed across scaffolds 1 to 7. Although the primary structure varied among HD-ZIP family proteins, their tertiary structures were similar. The results from this study will be useful in selecting candidate genes from specific subfamilies for functional analysis.
NHS Gene Mutations in Ashkenazi Jewish Families with Nance-Horan Syndrome.
Shoshany, Nadav; Avni, Isaac; Morad, Yair; Weiner, Chen; Einan-Lifshitz, Adi; Pras, Eran
2017-09-01
To describe ocular and extraocular abnormalities in two Ashkenazi Jewish families with infantile cataract and X-linked inheritance, and to identify their underlying mutations. Seven affected members were recruited. Medical history, clinical findings, and biometric measurements were recorded. Mutation analysis of the Nance-Horan syndrome (NHS) gene was performed by direct sequencing of polymerase chain reaction-amplified exons. An unusual anterior Y-sutural cataract was documented in the affected male proband. Other clinical features among examined patients included microcorneas, long and narrow faces, and current or previous dental anomalies. A nonsense mutation was identified in each family, including a previously described 742 C>T, p.(Arg248*) mutation in Family A, and a novel mutation 2915 C>A, p.(Ser972*) in Family B. Our study expands the repertoire of NHS mutations and the related phenotype, including newly described anterior Y-sutural cataract and dental findings.
The Tomato Terpene Synthase Gene Family1[W][OA
Falara, Vasiliki; Akhtar, Tariq A.; Nguyen, Thuong T.H.; Spyropoulou, Eleni A.; Bleeker, Petra M.; Schauvinhold, Ines; Matsuba, Yuki; Bonini, Megan E.; Schilmiller, Anthony L.; Last, Robert L.; Schuurink, Robert C.; Pichersky, Eran
2011-01-01
Compounds of the terpenoid class play numerous roles in the interactions of plants with their environment, such as attracting pollinators and defending the plant against pests. We show here that the genome of cultivated tomato (Solanum lycopersicum) contains 44 terpene synthase (TPS) genes, including 29 that are functional or potentially functional. Of these 29 TPS genes, 26 were expressed in at least some organs or tissues of the plant. The enzymatic functions of eight of the TPS proteins were previously reported, and here we report the specific in vitro catalytic activity of 10 additional tomato terpene synthases. Many of the tomato TPS genes are found in clusters, notably on chromosomes 1, 2, 6, 8, and 10. All TPS family clades previously identified in angiosperms are also present in tomato. The largest clade of functional TPS genes found in tomato, with 12 members, is the TPS-a clade, and it appears to encode only sesquiterpene synthases, one of which is localized to the mitochondria, while the rest are likely cytosolic. A few additional sesquiterpene synthases are encoded by TPS-b clade genes. Some of the tomato sesquiterpene synthases use z,z-farnesyl diphosphate in vitro as well, or more efficiently than, the e,e-farnesyl diphosphate substrate. Genes encoding monoterpene synthases are also prevalent, and they fall into three clades: TPS-b, TPS-g, and TPS-e/f. With the exception of two enzymes involved in the synthesis of ent-kaurene, the precursor of gibberellins, no other tomato TPS genes could be demonstrated to encode diterpene synthases so far. PMID:21813655
Singh, Uma M; Metwal, Mamta; Singh, Manoj; Taj, Gohar; Kumar, Anil
2015-07-15
Calcium (Ca) is an essential mineral for proper growth and development of plants as well as animals. In plants including cereals, calcium is deposited in seed during its development which is mediated by specialized Ca transporters. Common cereal seeds contain very low amounts of Ca while the finger millet (Eleusine coracana) contains exceptionally high amounts of Ca in seed. In order to understand the role of Ca transporters in grain Ca accumulation, developing seed transcriptome of two finger millet genotypes (GP-1, low Ca and GP-45 high Ca) differing in seed Ca content was sequenced using Illumina paired-end sequencing technology and members of Ca transporter gene family were identified. Out of 109,218 and 120,130 contigs, 86 and 81 contigs encoding Ca transporters were identified in GP-1 and GP-45, respectively. After removal of redundant sequences, a total of 19 sequences were confirmed as Ca transporter genes, which includes 11 Ca(2+) ATPases, 07 Ca(2+)/cation exchangers and 01 Ca(2+) channel. The differential expressions of all genes were analyzed from transcriptome data and it was observed that 9 and 3 genes were highly expressed in GP-45 and GP-1 genotypes respectively. Validation of transcriptome expression data of selected Ca transporter genes was performed on different stages of developing spikes of both genotypes grown under different concentrations of exogenous Ca. In both genotypes, significant correlation was observed between the expression of these genes, especially EcCaX3, and on the amount of Ca accumulated in seed. The positive correlation of seed mass with the amount of Ca concentration was also observed. The efficient Ca transport property and responsiveness of EcCAX3 towards exogenous Ca could be utilized in future biofortification program. Copyright © 2015 Elsevier B.V. All rights reserved.
Beauparlant, Marc A; Drouin, Guy
2014-02-01
Analyses of the 5S rRNA genes found in the spliced-leader (SL) gene repeat units of numerous trypanosome species suggest that such linkages were not inherited from a common ancestor, but were the result of independent 5S rRNA gene insertions. In trypanosomes, 5S rRNA genes are found either in the tandemly repeated units coding for SL genes or in independent tandemly repeated units. Given that trypanosome species where 5S rRNA genes are within the tandemly repeated units coding for SL genes are phylogenetically related, one might hypothesize that this arrangement is the result of an ancestral insertion of 5S rRNA genes into the tandemly repeated SL gene family of trypanosomes. Here, we use the types of 5S rRNA genes found associated with SL genes, the flanking regions of the inserted 5S rRNA genes and the position of these insertions to show that most of the 5S rRNA genes found within SL gene repeat units of trypanosome species were not acquired from a common ancestor but are the results of independent insertions. These multiple 5S rRNA genes insertion events in trypanosomes are likely the result of frequent founder events in different hosts and/or geographical locations in species having short generation times.
Genomic sequence and organization of two members of a human lectin gene family
International Nuclear Information System (INIS)
Gitt, M.A.; Barondes, S.H.
1991-01-01
The authors have isolated and sequenced the genomic DNA encoding a human dimeric soluble lactose-binding lectin. The gene has four exons, and its upstream region contains sequences that suggest control by glucocorticoids, heat (environmental) shock, metals, and other factors. They have also isolated and sequenced three exons of the gene encoding another human putative lectin, the existence of which was first indicated by isolation of its cDNA. Comparisons suggest a general pattern of genomic organization of members of this lectin gene family
International Nuclear Information System (INIS)
Pylkäs, Katri; Erkko, Hannele; Nikkilä, Jenni; Sólyom, Szilvia; Winqvist, Robert
2008-01-01
BRCA1 and BRCA2 are the two most important genes associated with familial breast and ovarian cancer susceptibility. In addition, PALB2 has recently been identified as a breast cancer susceptibility gene in several populations. Here we have evaluated whether large genomic rearrangement in these genes could explain some of Finnish breast and/or ovarian cancer families. Altogether 61 index patients of Northern Finnish breast and/or ovarian cancer families were analyzed by Multiplex ligation-dependent probe amplification (MLPA) method in order to identify exon deletions and duplications in BRCA1, BRCA2 and PALB2. The families have been comprehensively screened for germline mutation in these genes by conventional methods of mutation analysis and were found negative. We identified one large deletion in BRCA1, deleting the most part of the gene (exon 1A-13) in one family with family history of ovarian cancer. No large genomic rearrangements were identified in either BRCA2 or PALB2. In Finland, women eligible for BRCA1 or BRCA2 mutation screening, when found negative, could benefit from screening for large genomic rearrangements at least in BRCA1. On the contrary, the genomic rearrangements in PALB2 seem not to contribute to the hereditary breast cancer susceptibility
Microevolution of Virulence-Related Genes in Helicobacter pylori Familial Infection.
Directory of Open Access Journals (Sweden)
Yoshikazu Furuta
Full Text Available Helicobacter pylori, a bacterial pathogen that can infect human stomach causing gastritis, ulcers and cancer, is known to have a high degree of genome/epigenome diversity as the result of mutation and recombination. The bacteria often infect in childhood and persist for the life of the host. One of the reasons of the rapid evolution of H. pylori is that it changes its genome drastically for adaptation to a new host. To investigate microevolution and adaptation of the H. pylori genome, we undertook whole genome sequencing of the same or very similar sequence type in multi-locus sequence typing (MLST with seven genes in members of the same family consisting of parents and children in Japan. Detection of nucleotide substitutions revealed likely transmission pathways involving children. Nonsynonymous (amino acid changing mutations were found in virulence-related genes (cag genes, vacA, hcpDX, tnfα, ggt, htrA and the collagenase gene, outer membrane protein (OMP genes and other cell surface-related protein genes, signal transduction genes and restriction-modification genes. We reconstructed various pathways by which H. pylori can adapt to a new human host, and our results raised the possibility that the mutational changes in virulence-related genes have a role in adaptation to a child host. Changes in restriction-modification genes might remodel the methylome and transcriptome to help adaptation. This study has provided insights into H. pylori transmission and virulence and has implications for basic research as well as clinical practice.
Genome-wide analysis of the GRAS gene family in physic nut (Jatropha curcas L.).
Wu, Z Y; Wu, P Z; Chen, Y P; Li, M R; Wu, G J; Jiang, H W
2015-12-29
GRAS proteins play vital roles in plant growth and development. Physic nut (Jatropha curcas L.) was found to have a total of 48 GRAS family members (JcGRAS), 15 more than those found in Arabidopsis. The JcGRAS genes were divided into 12 subfamilies or 15 ancient monophyletic lineages based on the phylogenetic analysis of GRAS proteins from both flowering and lower plants. The functions of GRAS genes in 9 subfamilies have been reported previously for several plants, while the genes in the remaining 3 subfamilies were of unknown function; we named the latter families U1 to U3. No member of U3 subfamily is present in Arabidopsis and Poaceae species according to public genome sequence data. In comparison with the number of GRAS genes in Arabidopsis, more were detected in physic nut, resulting from the retention of many ancient GRAS subfamilies and the formation of tandem repeats during evolution. No evidence of recent duplication among JcGRAS genes was observed in physic nut. Based on digital gene expression data, 21 of the 48 genes exhibited differential expression in four tissues analyzed. Two members of subfamily U3 were expressed only in buds and flowers, implying that they may play specific roles. Our results provide valuable resources for future studies on the functions of GRAS proteins in physic nut.
Directory of Open Access Journals (Sweden)
Fang Hu
2014-10-01
Full Text Available AIM: To make comprehensive molecular diagnosis for retinitis pigmentosa (RP patients in a consanguineous Han Chinese family using next generation sequencing based Capture-NGS screen technology. METHODS: A five-generation Han Chinese family diagnosed as non-syndromic X-linked recessive RP (XLRP was recruited, including four affected males, four obligate female carriers and eleven unaffected family members. Capture-NGS was performed using a custom designed capture panel covers 163 known retinal disease genes including 47 RP genes, followed by the validation of detected mutation using Sanger sequencing in all recruited family members. RESULTS: Capture-NGS in one affected 47-year-old male reveals a novel mutation, c.2417_2418insG:p.E806fs, in exon ORF15 of RP GTPase regulator (RPGR gene results in a frameshift change that results in a premature stop codon and a truncated protein product. The mutation was further validated in three of four affected males and two of four female carriers but not in the other unaffected family members. CONCLUSION: We have identified a novel mutation, c.2417_2418insG:p.E806fs, in a Han Chinese family with XLRP. Our findings expand the mutation spectrum of RPGR and the phenotypic spectrum of XLRP in Han Chinese families, and confirms Capture-NGS could be an effective and economic approach for the comprehensive molecular diagnosis of RP.
Positive selection in the SLC11A1 gene in the family Equidae.
Bayerova, Zuzana; Janova, Eva; Matiasovic, Jan; Orlando, Ludovic; Horin, Petr
2016-05-01
Immunity-related genes are a suitable model for studying effects of selection at the genomic level. Some of them are highly conserved due to functional constraints and purifying selection, while others are variable and change quickly to cope with the variation of pathogens. The SLC11A1 gene encodes a transporter protein mediating antimicrobial activity of macrophages. Little is known about the patterns of selection shaping this gene during evolution. Although it is a typical evolutionarily conserved gene, functionally important polymorphisms associated with various diseases were identified in humans and other species. We analyzed the genomic organization, genetic variation, and evolution of the SLC11A1 gene in the family Equidae to identify patterns of selection within this important gene. Nucleotide SLC11A1 sequences were shown to be highly conserved in ten equid species, with more than 97 % sequence identity across the family. Single nucleotide polymorphisms (SNPs) were found in the coding and noncoding regions of the gene. Seven codon sites were identified to be under strong purifying selection. Codons located in three regions, including the glycosylated extracellular loop, were shown to be under diversifying selection. A 3-bp indel resulting in a deletion of the amino acid 321 in the predicted protein was observed in all horses, while it has been maintained in all other equid species. This codon comprised in an N-glycosylation site was found to be under positive selection. Interspecific variation in the presence of predicted N-glycosylation sites was observed.
Genome-wide analysis of WRKY gene family in Cucumis sativus.
Ling, Jian; Jiang, Weijie; Zhang, Ying; Yu, Hongjun; Mao, Zhenchuan; Gu, Xingfang; Huang, Sanwen; Xie, Bingyan
2011-09-28
WRKY proteins are a large family of transcriptional regulators in higher plant. They are involved in many biological processes, such as plant development, metabolism, and responses to biotic and abiotic stresses. Prior to the present study, only one full-length cucumber WRKY protein had been reported. The recent publication of the draft genome sequence of cucumber allowed us to conduct a genome-wide search for cucumber WRKY proteins, and to compare these positively identified proteins with their homologs in model plants, such as Arabidopsis. We identified a total of 55 WRKY genes in the cucumber genome. According to structural features of their encoded proteins, the cucumber WRKY (CsWRKY) genes were classified into three groups (group 1-3). Analysis of expression profiles of CsWRKY genes indicated that 48 WRKY genes display differential expression either in their transcript abundance or in their expression patterns under normal growth conditions, and 23 WRKY genes were differentially expressed in response to at least one abiotic stresses (cold, drought or salinity). The expression profile of stress-inducible CsWRKY genes were correlated with those of their putative Arabidopsis WRKY (AtWRKY) orthologs, except for the group 3 WRKY genes. Interestingly, duplicated group 3 AtWRKY genes appear to have been under positive selection pressure during evolution. In contrast, there was no evidence of recent gene duplication or positive selection pressure among CsWRKY group 3 genes, which may have led to the expressional divergence of group 3 orthologs. Fifty-five WRKY genes were identified in cucumber and the structure of their encoded proteins, their expression, and their evolution were examined. Considering that there has been extensive expansion of group 3 WRKY genes in angiosperms, the occurrence of different evolutionary events could explain the functional divergence of these genes.
Mazo Lopera, Mauricio A; Coombes, Brandon J; de Andrade, Mariza
2017-09-27
Gene-environment (GE) interaction has important implications in the etiology of complex diseases that are caused by a combination of genetic factors and environment variables. Several authors have developed GE analysis in the context of independent subjects or longitudinal data using a gene-set. In this paper, we propose to analyze GE interaction for discrete and continuous phenotypes in family studies by incorporating the relatedness among the relatives for each family into a generalized linear mixed model (GLMM) and by using a gene-based variance component test. In addition, we deal with collinearity problems arising from linkage disequilibrium among single nucleotide polymorphisms (SNPs) by considering their coefficients as random effects under the null model estimation. We show that the best linear unbiased predictor (BLUP) of such random effects in the GLMM is equivalent to the ridge regression estimator. This equivalence provides a simple method to estimate the ridge penalty parameter in comparison to other computationally-demanding estimation approaches based on cross-validation schemes. We evaluated the proposed test using simulation studies and applied it to real data from the Baependi Heart Study consisting of 76 families. Using our approach, we identified an interaction between BMI and the Peroxisome Proliferator Activated Receptor Gamma ( PPARG ) gene associated with diabetes.
Differential roles of TGIF family genes in mammalian reproduction
Directory of Open Access Journals (Sweden)
Renfree Marilyn B
2011-09-01
Full Text Available Abstract Background TG-interacting factors (TGIFs belong to a family of TALE-homeodomain proteins including TGIF1, TGIF2 and TGIFLX/Y in human. Both TGIF1 and TGIF2 act as transcription factors repressing TGF-β signalling. Human TGIFLX and its orthologue, Tex1 in the mouse, are X-linked genes that are only expressed in the adult testis. TGIF2 arose from TGIF1 by duplication, whereas TGIFLX arose by retrotransposition to the X-chromosome. These genes have not been characterised in any non-eutherian mammals. We therefore studied the TGIF family in the tammar wallaby (a marsupial mammal to investigate their roles in reproduction and how and when these genes may have evolved their functions and chromosomal locations. Results Both TGIF1 and TGIF2 were present in the tammar genome on autosomes but TGIFLX was absent. Tammar TGIF1 shared a similar expression pattern during embryogenesis, sexual differentiation and in adult tissues to that of TGIF1 in eutherian mammals, suggesting it has been functionally conserved. Tammar TGIF2 was ubiquitously expressed throughout early development as in the human and mouse, but in the adult, it was expressed only in the gonads and spleen, more like the expression pattern of human TGIFLX and mouse Tex1. Tammar TGIF2 mRNA was specifically detected in round and elongated spermatids. There was no mRNA detected in mature spermatozoa. TGIF2 protein was specifically located in the cytoplasm of spermatids, and in the residual body and the mid-piece of the mature sperm tail. These data suggest that tammar TGIF2 may participate in spermiogenesis, like TGIFLX does in eutherians. TGIF2 was detected for the first time in the ovary with mRNA produced in the granulosa and theca cells, suggesting it may also play a role in folliculogenesis. Conclusions The restricted and very similar expression of tammar TGIF2 to X-linked paralogues in eutherians suggests that the evolution of TGIF1, TGIF2 and TGIFLX in eutherians was accompanied by
Zhang, Tianxiao; Hou, Liping; Chen, David T; McMahon, Francis J; Wang, Jen-Chyong; Rice, John P
2018-03-01
Bipolar disorder is a mental illness with lifetime prevalence of about 1%. Previous genetic studies have identified multiple chromosomal linkage regions and candidate genes that might be associated with bipolar disorder. The present study aimed to identify potential susceptibility variants for bipolar disorder using 6 related case samples from a four-generation family. A combination of exome sequencing and linkage analysis was performed to identify potential susceptibility variants for bipolar disorder. Our study identified a list of five potential candidate genes for bipolar disorder. Among these five genes, GRID1(Glutamate Receptor Delta-1 Subunit), which was previously reported to be associated with several psychiatric disorders and brain related traits, is particularly interesting. Variants with functional significance in this gene were identified from two cousins in our bipolar disorder pedigree. Our findings suggest a potential role for these genes and the related rare variants in the onset and development of bipolar disorder in this one family. Additional research is needed to replicate these findings and evaluate their patho-biological significance. Copyright © 2017 Elsevier B.V. All rights reserved.
A novel ATP1A2 gene mutation in an Irish familial hemiplegic migraine kindred.
LENUS (Irish Health Repository)
Fernandez, Desiree M
2012-02-03
OBJECTIVE: We studied a large Irish Caucasian pedigree with familial hemiplegic migraine (FHM) with the aim of finding the causative gene mutation. BACKGROUND: FHM is a rare autosomal-dominant subtype of migraine with aura, which is linked to 4 loci on chromosomes 19p13, 1q23, 2q24, and 1q31. The mutations responsible for hemiplegic migraine have been described in the CACNA1A gene (chromosome 19p13), ATP1A2 gene (chromosome 1q23), and SCN1A gene (chromosome 2q24). METHODS: We performed linkage analyses in this family for chromosome 1q23 and performed mutation analysis of the ATP1A2 gene. RESULTS: Linkage to the FHM2 locus on chromosome 1 was demonstrated. Mutation screening of the ATP1A2 gene revealed a G to C substitution in exon 22 resulting in a novel protein variant, D999H, which co-segregates with FHM within this pedigree and is absent in 50 unaffected individuals. This residue is also highly conserved across species. CONCLUSIONS: We propose that D999H is a novel FHM ATP1A2 mutation.
Evolutionary study of vertebrate and invertebrate members of the dystrophin and utrophin gene family
Energy Technology Data Exchange (ETDEWEB)
Roberts, R.G.; Nicholson, L.; Bobrow, M. [Paediatric Research Unit, London (United Kingdom)] [and others
1994-09-01
Vertebrates express two members of the dystrophin gene family. The prototype, dystrophin, is expressed in muscle and neural tissue, and is defective in the human disorders Duchenne and Becker muscular dystrophy (DMD, BMD). The dystrophin homologue utrophin is more generally expressed but has not yet been associated with a genetic disorder. The function of neither protein is clear. A comparison of human utrophin with the known dystrophins (human, mouse, chicken, Torpedo) suggests that dystrophin and utrophin diverged before the vertebrate radiation. We have used reverse-transcript PCR (RT-PCR) directed by degenerate primers to characterize dystrophin and utrophin transcripts from a range of vertebrate and invertebrate animals. Our results suggest that the duplication leading to distinct dystrophin and utrophin genes occurred close to the point of divergence of urochordates from the cephalochordate-vertebrate lineage. This divergence may have occurred to fulfill a novel role which arose at this point, or may reflect a need for separate regulation of the neuromuscular and other functions of the ancient dystrophin. Our data include sequences of the first non-human utrophins to be characterized, and show these to be substantially more divergent than their cognate dystrophins. In addition, our results provide a large body of information regarding the tolerance of amino acid positions in the cysteine-rich and C-terminal domains to substitution. This will aid the interpretations of DMD and BMD missense mutations in these regions.
Repair of DNA damage in the human metallothionein gene family
International Nuclear Information System (INIS)
Leadon, S.A.; Snowden, M.M.
1987-01-01
In order to distinguish enhanced repair of a sequence due to its transcriptional activity from enhanced repair due to chromatin alterations brought about by integration of a sequence into the genome, we have investigated the repair of damage both in endogenous genes and in cell lines that contain an integrated gene with an inducible promoter. The endogenous genes we are studying are the metallothioneins (MTs), a multigene family in man consisting of about 10-12 members. Cultured cells were exposed to 10-J/m 2 uv light and allowed to repair in the presence of bromodeoxyuridine. The DNA was then isolated, digested with Eco RI, and fully hybrid density DNA made by semiconservative synthesis was separated from unreplicated DNA by centrifugation in CsCl density gradients. Unreplicated, parental-density DNA was then reacted with a monoclonal antibody against bromouracil. 1 ref., 1 fig., 1 tab
International Nuclear Information System (INIS)
Zhang, Zhongbao; Li, Xianglong; Zhang, Chun; Zou, Huawen; Wu, Zhongyi
2016-01-01
NUCLEAR FACTOR-Y (NF-Y) has been shown to play an important role in growth, development, and response to environmental stress. A NF-Y complex, which consists of three subunits, NF-YA, NF-YB, and, NF-YC, binds to CCAAT sequences in a promoter to control the expression of target genes. Although NF-Y proteins have been reported in Arabidopsis and rice, a comprehensive and systematic analysis of ZmNF-Y genes has not yet been performed. To examine the functions of ZmNF-Y genes in this family, we isolated and characterized 50 ZmNF-Y (14 ZmNF-YA, 18 ZmNF-YB, and 18 ZmNF-YC) genes in an analysis of the maize genome. The 50 ZmNF-Y genes were distributed on all 10 maize chromosomes, and 12 paralogs were identified. Multiple alignments showed that maize ZmNF-Y family proteins had conserved regions and relatively variable N-terminal or C-terminal domains. The comparative syntenic map illustrated 40 paralogous NF-Y gene pairs among the 10 maize chromosomes. Microarray data showed that the ZmNF-Y genes had tissue-specific expression patterns in various maize developmental stages and in response to biotic and abiotic stresses. The results suggested that ZmNF-YB2, 4, 8, 10, 13, and 16 and ZmNF-YC6, 8, and 15 were induced, while ZmNF-YA1, 3, 4, 6, 7, 10, 12, and 13, ZmNF-YB15, and ZmNF-YC3 and 9 were suppressed by drought stress. ZmNF-YA3, ZmNF-YA8 and ZmNF-YA12 were upregulated after infection by the three pathogens, while ZmNF-YA1 and ZmNF-YB2 were suppressed. These results indicate that the ZmNF-Ys may have significant roles in the response to abiotic and biotic stresses. - Highlights: • We indicated a total of 50 members of ZmNF-Y gene family in maize genome. • We analyzed gene structure, protein architecture of ZmNF-Y genes. • Evolution pattern and phylogenic relationships were analyzed among 50 ZmNF-Y genes. • Expression pattern of ZmNF-Ys were detected in various maize tissues. • Transcript levels of ZmNF-Ys were measured under various abiotic and biotic stresses.
Directory of Open Access Journals (Sweden)
Schirmacher Peter
2008-09-01
Full Text Available Abstract Background Invasion-related genes over-expressed by tumor cells as well as by reacting host cells represent promising drug targets for anti-cancer therapy. Such candidate genes need to be validated in appropriate animal models. Results This study examined the suitability of a murine model (CT26/Balb/C of colorectal liver metastasis to represent clinical liver metastasis specimens using a global gene expression approach. Cross-species similarity was examined between pure liver, liver invasion, tumor invasion and pure tumor compartments through overlap of up-regulated genes and gene ontology (GO-based biological themes on the level of single GO-terms and of condensed GO-term families. Three out of four GO-term families were conserved in a compartment-specific way between the species: secondary metabolism (liver, invasion (invasion front, and immune response (invasion front and liver. Among the individual GO-terms over-represented in the invasion compartments in both species were "extracellular matrix", "cell motility", "cell adhesion" and "antigen presentation" indicating that typical invasion related processes are operating in both species. This was reflected on the single gene level as well, as cross-species overlap of potential target genes over-expressed in the combined invasion front compartments reached up to 36.5%. Generally, histopathology and gene expression correlated well as the highest single gene overlap was found to be 44% in syn-compartmental comparisons (liver versus liver whereas cross-compartmental overlaps were much lower (e.g. liver versus tumor: 9.7%. However, single gene overlap was surprisingly high in some cross-compartmental comparisons (e.g. human liver invasion compartment and murine tumor invasion compartment: 9.0% despite little histolopathologic similarity indicating that invasion relevant genes are not necessarily confined to histologically defined compartments. Conclusion In summary, cross
The nuclear IκB family of proteins controls gene regulation and immune homeostasis.
MaruYama, Takashi
2015-10-01
The inhibitory IκB family of proteins is subdivided into two groups based on protein localization in the cytoplasm or in the nucleus. These proteins interact with NF-κB, a major transcription factor regulating the expression of many inflammatory cytokines, by modulating its transcriptional activity. However, nuclear IκB family proteins not only interact with NF-κB to change its transcriptional activity, but they also bind to chromatin and control gene expression. This review provides an overview of nuclear IκB family proteins and their role in immune homeostasis. Copyright © 2015 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Iryna Petrivna Vovk
2017-05-01
Full Text Available The development of family leisure activities in the hotel and restaurant businesses with consideration of psychological and pedagogical aspects of animation activity is an actual task facing modern managers. The purpose of the study is to substantiate the relevance and identify the psychological and pedagogical aspects for designing a program of leisure activities in animation service. The challenge is to substantiate the need for a psychological and pedagogical approach to the work of a manager who develops and performs animation activities in the hospitality industry, as well as to show the impact of the animation service on the quality of service. The factors influencing the formation of animation services are analysed in the article; the main functions and trends of animation activity are highlighted; the ways of introducing animation programs into the domestic tourism activity are identified. The tourism industry development in the general infrastructure of the hospitality industry will help solve various problems: upbringing, culture developing, strength-recreating, mood raising, creating a unique recreation program to attract more guests.
International Nuclear Information System (INIS)
Egerton, J.R.
2005-01-01
For vaccine production, recombinant antigens must be protective. Identifying protective antigens or candidate antigens is an essential precursor to vaccine development. Even when a protective antigen has been identified, cloning of its gene does not lead directly to vaccine development. The fimbrial protein of Dichelobacter nodosus, the agent of foot-rot in ruminants, was known to be protective. Recombinant vaccines against this infection are ineffective if expressed protein subunits are not assembled as mature fimbriae. Antigenic competition between different, but closely related, recombinant antigens limited the use of multivalent vaccines based on this technology. Recombinant antigens may need adjuvants to enhance response. DNA vaccines, potentiated with genes for different cytokines, may replace the need for aggressive adjuvants, and especially where cellular immunity is essential for protection. The expression of antigens from animal pathogens in plants and the demonstration of some immunity to a disease like rinderpest after ingestion of these, suggests an alternative approach to vaccination by injection. Research on disease pathogenesis and the identification of candidate antigens is specific to the disease agent. The definition of expression systems and the formulation of a vaccine for each disease must be followed by research to establish safety and efficacy. Where vaccines are based on unique gene sequences, the intellectual property is likely to be protected by patent. Organizations, licensed to produce recombinant vaccines, expect to recover their costs and to make a profit. The consequence is that genetically-derived vaccines are expensive. The capacity of vaccines to help animal owners of poorer countries depends not only on quality and cost but also on the veterinary infrastructure where they are used. Ensuring the existence of an effective animal health infrastructure in developing countries is as great a challenge for the developed world as
Directory of Open Access Journals (Sweden)
Pravas Ranjan Sahoo
2016-05-01
Full Text Available India being a developing country mainly depends on livestock sector for its economy. However, nowadays, there is emergence and reemergence of more transboundary animal diseases. The existing diagnostic techniques are not so quick and with less specificity. To reduce the economy loss, there should be a development of rapid, reliable, robust diagnostic technique, which can work with high degree of sensitivity and specificity. Loop mediated isothermal amplification assay is a rapid gene amplification technique that amplifies nucleic acid under an isothermal condition with a set of designed primers spanning eight distinct sequences of the target. This assay can be used as an emerging powerful, innovative gene amplification diagnostic tool against various pathogens of livestock diseases. This review is to highlight the basic concept and methodology of this assay in livestock disease.
Sahoo, Pravas Ranjan; Sethy, Kamadev; Mohapatra, Swagat; Panda, Debasis
2016-05-01
India being a developing country mainly depends on livestock sector for its economy. However, nowadays, there is emergence and reemergence of more transboundary animal diseases. The existing diagnostic techniques are not so quick and with less specificity. To reduce the economy loss, there should be a development of rapid, reliable, robust diagnostic technique, which can work with high degree of sensitivity and specificity. Loop mediated isothermal amplification assay is a rapid gene amplification technique that amplifies nucleic acid under an isothermal condition with a set of designed primers spanning eight distinct sequences of the target. This assay can be used as an emerging powerful, innovative gene amplification diagnostic tool against various pathogens of livestock diseases. This review is to highlight the basic concept and methodology of this assay in livestock disease.
Occurrence of Putative Virulence Genes in Arcobacter Species Isolated from Humans and Animals
Douidah, Laid; de Zutter, Lieven; Baré, Julie; De Vos, Paul; Vandamme, Peter; Vandenberg, Olivier; Van den Abeele, Anne-Marie
2012-01-01
Interest in arcobacters in veterinary and human public health has increased since the first report of the isolation of arcobacters from food of animal origin. Since then, studies worldwide have reported the occurrence of arcobacters on food and in food production animals and have highlighted possible transmission, especially of Arcobacter butzleri, to the human population. In humans, arcobacters are associated with enteritis and septicemia. To assess their clinical relevance for humans and animals, evaluation of potential virulence factors is required. However, up to now, little has been known about the mechanisms of pathogenicity. Because of their close phylogenetic affiliation to the food-borne pathogen Campylobacter and their similar clinical manifestations, the presence of nine putative Campylobacter virulence genes (cadF, ciaB, cj1349, hecA, hecB, irgA, mviN, pldA, and tlyA) previously identified in the recent Arcobacter butzleri ATCC 49616 genome sequence was determined in a large set of human and animal Arcobacter butzleri, Arcobacter cryaerophilus, and Arcobacter skirrowii strains after the development of rapid and accurate PCR assays and confirmed by sequencing and dot blot hybridization. PMID:22170914
Directory of Open Access Journals (Sweden)
Chepyshko Hanna
2012-07-01
Full Text Available Abstract Background GDSL esterases/lipases are a newly discovered subclass of lipolytic enzymes that are very important and attractive research subjects because of their multifunctional properties, such as broad substrate specificity and regiospecificity. Compared with the current knowledge regarding these enzymes in bacteria, our understanding of the plant GDSL enzymes is very limited, although the GDSL gene family in plant species include numerous members in many fully sequenced plant genomes. Only two genes from a large rice GDSL esterase/lipase gene family were previously characterised, and the majority of the members remain unknown. In the present study, we describe the rice OsGELP (Oryza sativa GDSL esterase/lipase protein gene family at the genomic and proteomic levels, and use this knowledge to provide insights into the multifunctionality of the rice OsGELP enzymes. Results In this study, an extensive bioinformatics analysis identified 114 genes in the rice OsGELP gene family. A complete overview of this family in rice is presented, including the chromosome locations, gene structures, phylogeny, and protein motifs. Among the OsGELPs and the plant GDSL esterase/lipase proteins of known functions, 41 motifs were found that represent the core secondary structure elements or appear specifically in different phylogenetic subclades. The specification and distribution of identified putative conserved clade-common and -specific peptide motifs, and their location on the predicted protein three dimensional structure may possibly signify their functional roles. Potentially important regions for substrate specificity are highlighted, in accordance with protein three-dimensional model and location of the phylogenetic specific conserved motifs. The differential expression of some representative genes were confirmed by quantitative real-time PCR. The phylogenetic analysis, together with protein motif architectures, and the expression profiling were
Patil, Gunvant; Valliyodan, Babu; Deshmukh, Rupesh; Prince, Silvas; Nicander, Bjorn; Zhao, Mingzhe; Sonah, Humira; Song, Li; Lin, Li; Chaudhary, Juhi; Liu, Yang; Joshi, Trupti; Xu, Dong; Nguyen, Henry T
2015-07-11
SWEET (MtN3_saliva) domain proteins, a recently identified group of efflux transporters, play an indispensable role in sugar efflux, phloem loading, plant-pathogen interaction and reproductive tissue development. The SWEET gene family is predominantly studied in Arabidopsis and members of the family are being investigated in rice. To date, no transcriptome or genomics analysis of soybean SWEET genes has been reported. In the present investigation, we explored the evolutionary aspect of the SWEET gene family in diverse plant species including primitive single cell algae to angiosperms with a major emphasis on Glycine max. Evolutionary features showed expansion and duplication of the SWEET gene family in land plants. Homology searches with BLAST tools and Hidden Markov Model-directed sequence alignments identified 52 SWEET genes that were mapped to 15 chromosomes in the soybean genome as tandem duplication events. Soybean SWEET (GmSWEET) genes showed a wide range of expression profiles in different tissues and developmental stages. Analysis of public transcriptome data and expression profiling using quantitative real time PCR (qRT-PCR) showed that a majority of the GmSWEET genes were confined to reproductive tissue development. Several natural genetic variants (non-synonymous SNPs, premature stop codons and haplotype) were identified in the GmSWEET genes using whole genome re-sequencing data analysis of 106 soybean genotypes. A significant association was observed between SNP-haplogroup and seed sucrose content in three gene clusters on chromosome 6. Present investigation utilized comparative genomics, transcriptome profiling and whole genome re-sequencing approaches and provided a systematic description of soybean SWEET genes and identified putative candidates with probable roles in the reproductive tissue development. Gene expression profiling at different developmental stages and genomic variation data will aid as an important resource for the soybean research
The FTF gene family regulates virulence and expression of SIX effectors in Fusarium oxysporum.
Niño-Sánchez, Jonathan; Casado-Del Castillo, Virginia; Tello, Vega; De Vega-Bartol, José J; Ramos, Brisa; Sukno, Serenella A; Díaz Mínguez, José María
2016-09-01
The FTF (Fusarium transcription factor) gene family comprises a single copy gene, FTF2, which is present in all the filamentous ascomycetes analysed, and several copies of a close relative, FTF1, which is exclusive to Fusarium oxysporum. An RNA-mediated gene silencing system was developed to target mRNA produced by all the FTF genes, and tested in two formae speciales: F. oxysporum f. sp. phaseoli (whose host is common bean) and F. oxysporum f. sp. lycopersici (whose host is tomato). Quantification of the mRNA levels showed knockdown of FTF1 and FTF2 in randomly isolated transformants of both formae speciales. The attenuation of FTF expression resulted in a marked reduction in virulence, a reduced expression of several SIX (Secreted In Xylem) genes, the best studied family of effectors in F. oxysporum, and lower levels of SGE1 (Six Gene Expression 1) mRNA, the presumptive regulator of SIX expression. Moreover, the knockdown mutants showed a pattern of colonization of the host plant similar to that displayed by strains devoid of FTF1 copies (weakly virulent strains). Gene knockout of FTF2 also resulted in a reduction in virulence, but to a lesser extent. These results demonstrate the role of the FTF gene expansion, mostly the FTF1 paralogues, as a regulator of virulence in F. oxysporum and suggest that the control of effector expression is the mechanism involved. © 2016 The Authors Molecular Plant Pathology Published by British Society for Plant Pathology and John Wiley & Sons Ltd.
Apsalikov, Bakytbek; Manambaeva, Zukhra; Ospanov, Erlan; Massabayeva, Meruyert; Zhabagin, Kuantkan; Zhagiparova, Zhanar; Maximov, Vladymir; Voropaeva, Elena; Apsalikov, Kazbek; Belikhina, Tatiana; Abdrahmanov, Ramil; Cherepkova, Elena; Tanatarov, Sayat; Massadykov, Adilzhan; Urazalina, Naylia
2016-01-01
Frequencies of polymorphisms of genes BRCA1 and TP53 in breast cancer (BC) patients with a BC family history and radiation history were assessed and compared in the Semey region of Kazakhstan. The study included 60 women directly irradiated by the activities of the Semipalatinsk test site with a calculated effective equivalent dose of 500 mSv and their first generation descendants (group BC+Her+Exp); 65 women with family BC and absence of radiological history - the effective equivalent dose due to anthropogenic sources not exceeding 50 mSv (group BC+Her-Exp). The comparison group consisted of 65 women patients with breast cancer without family and radiological history (BC-Her-Exp). The control group comprised 60 women without breast cancer and without family and radiological history (nonBC). We carried out the genotyping of the polymorphisms c.2311T>C, c.4308T>C and 5382insC of the BRCA1 gene and rs1042522 of the TP53 gene. The frequency of the polymorphism c.2311T>C was significantly higher in patients of the group BC+Her+Exp than in healthy women, and of the polymorphism 5382insC in BC+Her+Exp compared to all other groups. The frequency of the rs1042522 polymorphism of TP53 was significantly higher in all groups of patients with breast cancer compared with the control group. Differences between groups of women with breast cancer were significant only in BC+Her+Exp vs. BC+Her-Exp. Combinations of polymorphisms of the genes BRCA1 and TP53 predominated in women with a family and radiological history.
Positive selection in the SLC11A1 gene in the family Equidae
DEFF Research Database (Denmark)
Bayerova, Zuzana; Janova, Eva; Matiasovic, Jan
2016-01-01
Immunity-related genes are a suitable model for studying effects of selection at the genomic level. Some of them are highly conserved due to functional constraints and purifying selection, while others are variable and change quickly to cope with the variation of pathogens. The SLC11A1 gene encodes...... a transporter protein mediating antimicrobial activity of macrophages. Little is known about the patterns of selection shaping this gene during evolution. Although it is a typical evolutionarily conserved gene, functionally important polymorphisms associated with various diseases were identified in humans...... and other species. We analyzed the genomic organization, genetic variation, and evolution of the SLC11A1 gene in the family Equidae to identify patterns of selection within this important gene. Nucleotide SLC11A1 sequences were shown to be highly conserved in ten equid species, with more than 97 % sequence...
NUCLEOTIDE COMPARISON OF GDF9 GENE IN INDIAN YAK AND GADDI GOAT: HIGH ALTITUDE LIVESTOCK ANIMALS
Directory of Open Access Journals (Sweden)
Lakshya Veer Singh
2013-06-01
Full Text Available The present study was undertaken to characterize exon 1 and exon 2 sequence of one of fecundity genes: GDF9 (Growth differentiation factor 9, in high altitude livestock animal (Yak and Gaddi goat. Six nucleotide differences were identified between sheep (AF078545 and goats (EF446168 in exon 1 and exon 2. Sequencing revealed nine novel single nucleotide mutations in exon 1 and exon 2 of Indian yak that compared with Bos taurus (GQ922451. These results preliminarily showed that the GDF9 gene might be a major gene that influences prolificacy of Gaddi goats and Indian yak.
Liu, Xiuying; Luo, GuanZheng; Bai, Xiujuan; Wang, Xiu-Jie
2009-10-01
MicroRNAs are approximately 22 nt long small non-coding RNAs that play important regulatory roles in eukaryotes. The biogenesis and functional processes of microRNAs require the participation of many proteins, of which, the well studied ones are Dicer, Drosha, Argonaute and Exportin 5. To systematically study these four protein families, we screened 11 animal genomes to search for genes encoding above mentioned proteins, and identified some new members for each family. Domain analysis results revealed that most proteins within the same family share identical or similar domains. Alternative spliced transcript variants were found for some proteins. We also examined the expression patterns of these proteins in different human tissues and identified other proteins that could potentially interact with these proteins. These findings provided systematic information on the four key proteins involved in microRNA biogenesis and functional pathways in animals, and will shed light on further functional studies of these proteins.
Understanding familial and non-familial renal cell cancer.
Bodmer, Daniëlle; van den Hurk, Wilhelmina; van Groningen, Jan J M; Eleveld, Marc J; Martens, Gerard J M; Weterman, Marian A J; van Kessel, Ad Geurts
2002-10-01
Molecular genetic analysis of familial and non-familial cases of conventional renal cell carcinoma (RCC) revealed a critical role(s) for multiple genes on human chromosome 3. For some of these genes, e.g. VHL, such a role has been firmly established, whereas for others, definite confirmation is still pending. Additionally, a novel role for constitutional chromosome 3 translocations as risk factors for conventional RCC development is rapidly emerging. Also, several candidate loci have been mapped to other chromosomes in both familial and non-familial RCCs of distinct histologic subtypes. The MET gene on chromosome 7, for example, was found to be involved in both forms of papillary RCC. A PRCC-TFE3 fusion gene is typically encountered in t(X;1)-positive non-familial papillary RCCs and results in abrogation of the cell cycle mitotic spindle checkpoint in a dominant-negative fashion, thus leading to RCC. Together, these data turn human RCC into a model system in which different aspects of both familial and non-familial syndromes may act as novel paradigms for cancer development.
Directory of Open Access Journals (Sweden)
Hong-Yang Wang
2015-01-01
Full Text Available Background: There are more than 300 genetic loci that have been found to be related to hereditary hearing impairment (HHI, including 92 causative genes for nonsyndromic hearing loss, among which 34 genes are related to autosomal dominant nonsyndromic HHI (ADNSHHI. Traditional linkage analysis and candidate gene sequencing are not effective at detecting the ADNSHHI, especially for the unconditional families that may have more than one pathogenic cause. This study identified two disease-causing genes TJP2 and GJB2 in a Chinese family with unconditional ADNSHHI. Methods: To decipher the genetic code of a Chinese family (family 686 with ADNSHHI, different gene screening techniques have been performed, including linkage analysis, candidate genes screening, high-throughput sequencing and Sanger sequencing. These techniques were done on samples obtained from this family over a period of 10 years. Results: We identified a pathogenic missense mutation, c. 2081G>A (p.G694E, in TJP2, a gene that plays a crucial role in apoptosis and age-related hearing loss (ARHL. The mutation was co-segregated in this pedigree in all, but not in the two patients who presented with different phenotypes from the other affected family members. In one of the two patients, we confirmed that the compound heterozygosity for p.Y136FNx01 and p.G45E in the GJB2 gene may account for the phenotype shown in this patient. Conclusions: We identified the co-occurrence of two genetic causes in family 686. The possible disease-causing missense mutation of TJP2 in family 686 presents an opportunity for further investigation into ARHL. It is necessary to combine various genes screening methods, especially for some unconventional cases.
Directory of Open Access Journals (Sweden)
Adam Paré
Full Text Available The Grainy head (GRH family of transcription factors are crucial for the development and repair of epidermal barriers in all animals in which they have been studied. This is a high-level functional conservation, as the known structural and enzymatic genes regulated by GRH proteins differ between species depending on the type of epidermal barrier being formed. Interestingly, members of the CP2 superfamily of transcription factors, which encompasses the GRH and LSF families in animals, are also found in fungi--organisms that lack epidermal tissues. To shed light on CP2 protein function in fungi, we characterized a Neurospora crassa mutant lacking the CP2 member we refer to as grainy head-like (grhl. We show that Neurospora GRHL has a DNA-binding specificity similar to that of animal GRH proteins and dissimilar to that of animal LSF proteins. Neurospora grhl mutants are defective in conidial-spore dispersal due to an inability to remodel the cell wall, and we show that grhl mutants and the long-known conidial separation-2 (csp-2 mutants are allelic. We then characterized the transcriptomes of both Neurospora grhl mutants and Drosophila grh mutant embryos to look for similarities in the affected genes. Neurospora grhl appears to play a role in the development and remodeling of the cell wall, as well as in the activation of genes involved in defense and virulence. Drosophila GRH is required to activate the expression of many genes involved in cuticular/epidermal-barrier formation. We also present evidence that GRH plays a role in adult antimicrobial defense. These results, along with previous studies of animal GRH proteins, suggest the fascinating possibility that the apical extracellular barriers of some animals and fungi might share an evolutionary connection, and that the formation of physical barriers in the last common ancestor was under the control of a transcriptional code that included GRH-like proteins.
Pezer, Željka; Chung, Amanda G; Karn, Robert C; Laukaitis, Christina M
2017-06-01
The Androgen-binding protein ( Abp ) gene region of the mouse genome contains 64 genes, some encoding pheromones that influence assortative mating between mice from different subspecies. Using CNVnator and quantitative PCR, we explored copy number variation in this gene family in natural populations of Mus musculus domesticus ( Mmd ) and Mus musculus musculus ( Mmm ), two subspecies of house mice that form a narrow hybrid zone in Central Europe. We found that copy number variation in the center of the Abp gene region is very common in wild Mmd , primarily representing the presence/absence of the final duplications described for the mouse genome. Clustering of Mmd individuals based on this variation did not reflect their geographical origin, suggesting no population divergence in the Abp gene cluster. However, copy number variation patterns differ substantially between Mmd and other mouse taxa. Large blocks of Abp genes are absent in Mmm , Mus musculus castaneus and an outgroup, Mus spretus , although with differences in variation and breakpoint locations. Our analysis calls into question the reliance on a reference genome for interpreting the detailed organization of genes in taxa more distant from the Mmd reference genome. The polymorphic nature of the gene family expansion in all four taxa suggests that the number of Abp genes, especially in the central gene region, is not critical to the survival and reproduction of the mouse. However, Abp haplotypes of variable length may serve as a source of raw genetic material for new signals influencing reproductive communication and thus speciation of mice. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Directory of Open Access Journals (Sweden)
Sandra Prüller
Full Text Available Bordetella bronchiseptica causes infections of the respiratory tract in swine and other mammals and is a precursor for secondary infections with Pasteurella multocida. Treatment of B. bronchiseptica infections is conducted primarily with antimicrobial agents. Therefore it is essential to get an overview of the susceptibility status of these bacteria. The aim of this study was to comparatively analyse broth microdilution susceptibility testing according to CLSI recommendations with an incubation time of 16 to 20 hours and a longer incubation time of 24 hours, as recently proposed to obtain more homogenous MICs. Susceptibility testing against a panel of 22 antimicrobial agents and two fixed combinations was performed with 107 porcine isolates from different farms and regions in Germany and 43 isolates obtained from companion animals in Germany and other European countries. Isolates with increased MICs were investigated by PCR assays for the presence of resistance genes. For ampicillin, all 107 porcine isolates were classified as resistant, whereas only a single isolate was resistant to florfenicol. All isolates obtained from companion animals showed elevated MICs for β-lactam antibiotics and demonstrated an overall low susceptibility to cephalosporines. Extension of the incubation time resulted in 1-2 dilution steps higher MIC50 values of porcine isolates for seven antimicrobial agents tested, while isolates from companion animals exhibited twofold higher MIC50/90 values only for tetracycline and cefotaxime. For three antimicrobial agents, lower MIC50 and MIC90 values were detected for both, porcine and companion animal isolates. Among the 150 isolates tested, the resistance genes blaBOR-1 (n = 147, blaOXA-2, (n = 4, strA and strB (n = 17, sul1 (n = 10, sul2 (n = 73, dfrA7 (n = 3 and tet(A (n = 8 were detected and a plasmid localisation was identified for several of the resistance genes.
Smant, Geert; Stokkermans, Jack P. W. G.; Yan, Yitang; de Boer, Jan M.; Baum, Thomas J.; Wang, Xiaohong; Hussey, Richard S.; Gommers, Fred J.; Henrissat, Bernard; Davis, Eric L.; Helder, Johannes; Schots, Arjen; Bakker, Jaap
1998-01-01
β-1,4-Endoglucanases (EGases, EC 3.2.1.4) degrade polysaccharides possessing β-1,4-glucan backbones such as cellulose and xyloglucan and have been found among extremely variegated taxonomic groups. Although many animal species depend on cellulose as their main energy source, most omnivores and herbivores are unable to produce EGases endogenously. So far, all previously identified EGase genes involved in the digestive system of animals originate from symbiotic microorganisms. Here we report on the synthesis of EGases in the esophageal glands of the cyst nematodes Globodera rostochiensis and Heterodera glycines. From each of the nematode species, two cDNAs were characterized and hydrophobic cluster analysis revealed that the four catalytic domains belong to family 5 of the glycosyl hydrolases (EC 3.2.1, 3.2.2, and 3.2.3). These domains show 37–44% overall amino acid identity with EGases from the bacteria Erwinia chrysanthemi, Clostridium acetobutylicum, and Bacillus subtilis. One EGase with a bacterial type of cellulose-binding domain was identified for each nematode species. The leucine-rich hydrophobic core of the signal peptide and the presence of a polyadenylated 3′ end precluded the EGases from being of bacterial origin. Cyst nematodes are obligatory plant parasites and the identified EGases presumably facilitate the intracellular migration through plant roots by partial cell wall degradation. PMID:9560201
Yao, Qiu-Yang; Xia, En-Hua; Liu, Fei-Hu; Gao, Li-Zhi
2015-02-15
WRKY transcription factors (TFs), one of the ten largest TF families in higher plants, play important roles in regulating plant development and resistance. To date, little is known about the WRKY TF family in Brassica oleracea. Recently, the completed genome sequence of cabbage (B. oleracea var. capitata) allows us to systematically analyze WRKY genes in this species. A total of 148 WRKY genes were characterized and classified into seven subgroups that belong to three major groups. Phylogenetic and synteny analyses revealed that the repertoire of cabbage WRKY genes was derived from a common ancestor shared with Arabidopsis thaliana. The B. oleracea WRKY genes were found to be preferentially retained after the whole-genome triplication (WGT) event in its recent ancestor, suggesting that the WGT event had largely contributed to a rapid expansion of the WRKY gene family in B. oleracea. The analysis of RNA-Seq data from various tissues (i.e., roots, stems, leaves, buds, flowers and siliques) revealed that most of the identified WRKY genes were positively expressed in cabbage, and a large portion of them exhibited patterns of differential and tissue-specific expression, demonstrating that these gene members might play essential roles in plant developmental processes. Comparative analysis of the expression level among duplicated genes showed that gene expression divergence was evidently presented among cabbage WRKY paralogs, indicating functional divergence of these duplicated WRKY genes. Copyright © 2014 Elsevier B.V. All rights reserved.
Masters, N; Christie, M; Katouli, M; Stratton, H
2015-06-01
We investigated the usefulness of the β-d-glucuronidase gene variance in Escherichia coli as a microbial source tracking tool using a novel algorithm for comparison of sequences from a prescreened set of host-specific isolates using a high-resolution PhP typing method. A total of 65 common biochemical phenotypes belonging to 318 E. coli strains isolated from humans and domestic and wild animals were analysed for nucleotide variations at 10 loci along a 518 bp fragment of the 1812 bp β-d-glucuronidase gene. Neighbour-joining analysis of loci variations revealed 86 (76.8%) human isolates and 91.2% of animal isolates were correctly identified. Pairwise hierarchical clustering improved assignment; where 92 (82.1%) human and 204 (99%) animal strains were assigned to their respective cluster. Our data show that initial typing of isolates and selection of common types from different hosts prior to analysis of the β-d-glucuronidase gene sequence improves source identification. We also concluded that numerical profiling of the nucleotide variations can be used as a valuable approach to differentiate human from animal E. coli. This study signifies the usefulness of the β-d-glucuronidase gene as a marker for differentiating human faecal pollution from animal sources.
Genome-wide Identification and Expression Analysis of the CDPK Gene Family in Grape, Vitis spp.
Zhang, Kai; Han, Yong-Tao; Zhao, Feng-Li; Hu, Yang; Gao, Yu-Rong; Ma, Yan-Fei; Zheng, Yi; Wang, Yue-Jin; Wen, Ying-Qiang
2015-06-30
Calcium-dependent protein kinases (CDPKs) play vital roles in plant growth and development, biotic and abiotic stress responses, and hormone signaling. Little is known about the CDPK gene family in grapevine. In this study, we performed a genome-wide analysis of the 12X grape genome (Vitis vinifera) and identified nineteen CDPK genes. Comparison of the structures of grape CDPK genes allowed us to examine their functional conservation and differentiation. Segmentally duplicated grape CDPK genes showed high structural conservation and contributed to gene family expansion. Additional comparisons between grape and Arabidopsis thaliana demonstrated that several grape CDPK genes occured in the corresponding syntenic blocks of Arabidopsis, suggesting that these genes arose before the divergence of grapevine and Arabidopsis. Phylogenetic analysis divided the grape CDPK genes into four groups. Furthermore, we examined the expression of the corresponding nineteen homologous CDPK genes in the Chinese wild grape (Vitis pseudoreticulata) under various conditions, including biotic stress, abiotic stress, and hormone treatments. The expression profiles derived from reverse transcription and quantitative PCR suggested that a large number of VpCDPKs responded to various stimuli on the transcriptional level, indicating their versatile roles in the responses to biotic and abiotic stresses. Moreover, we examined the subcellular localization of VpCDPKs by transiently expressing six VpCDPK-GFP fusion proteins in Arabidopsis mesophyll protoplasts; this revealed high variability consistent with potential functional differences. Taken as a whole, our data provide significant insights into the evolution and function of grape CDPKs and a framework for future investigation of grape CDPK genes.
Isolation and expression analysis of four HD-ZIP III family genes targeted by microRNA166 in peach.
Zhang, C H; Zhang, B B; Ma, R J; Yu, M L; Guo, S L; Guo, L
2015-10-30
MicroRNA166 (miR166) is known to have highly conserved targets that encode proteins of the class III homeodomain-leucine zipper (HD-ZIP III) family, in a broad range of plant species. To further understand the relationship between HD-ZIP III genes and miR166, four HD-ZIP III family genes (PpHB14, PpHB15, PpHB8, and PpREV) were isolated from peach (Prunus persica) tissue and characterized. Spatio-temporal expression profiles of the genes were analyzed. Genes of the peach HD-ZIP III family were predicted to encode five conserved domains. Deduced amino acid sequences and tertiary structures of the four peach HD-ZIP III genes were highly conserved, with corresponding genes in Arabidopsis thaliana. The expression level of four targets displayed the opposite trend to that of miR166 throughout fruit development, with the exception of PpHB14 from 35 to 55 days after full bloom (DAFB). This finding indicates that miR166 may negatively regulate its four targets throughout fruit development. As for leaf and phloem, the same trend in expression level was observed between four targets and miR166 from 75 to 105 DAFB. However, the opposite trend was observed for the transcript level between four targets and miR166 from 35 to 55 DAFB. miRNA166 may negatively regulate four targets in some but not all developmental stages for a given tissue. The four genes studied were observed to have, exactly or generally, the same change tendency as individual tissue development, a finding that suggests genes of the HD-ZIP III family in peach may have complementary or cooperative functions in various tissues.
Energy Technology Data Exchange (ETDEWEB)
Brandt, C.C.; Weinstein, D.A.; Shugart, H.H.; Simmons, B.
1980-10-01
The Quechua Indians of the Peruvian Andes are an example of a human population which has developed special cultural adaptations to deal with hypocaloric stress imposed by a harsh environment. A highly detailed human ecosystem model, NUNOA, which simulates the yearly energy balance of individuals, families, and extended families in a hypothetical farming and herding Quechua community of the high Andes was developed. Unlike most population models which use sets of differential equations in which individuals are aggregated into groups, this model considers the response of each individual to a stochastic environment. The model calculates the yearly energy demand for each family based on caloric requirements of its members. For each family, the model simulates the cultivation of seven different crops and the impact of precipitation, temperature, and disease on yield. Herding, slaughter, and market sales of three different animal species are also simulated. Any energy production in excess of the family's energy demand is placed into extended family storage for possible redistribution. A family failing to meet their annual energy demand may slaughter additional herd animals, temporarily migrate from the community, or borrow food from the extended family storage. The energy balance is used in determining births, deaths, marriages, and resource sharing in the Indian community. In addition, the model maintains a record of each individual's ancestry as well as seven genetic traits for use in tracing lineage and gene flow. The model user has the opportunity to investigate the effect of changes in marriage patterns, resource sharing patterns, or subsistence activities on the ability of the human population to survive in the harsh Andean environment. In addition, the user may investigate the impact of external technology on the Indian culture.
Yu, Hong; Soler, Marçal; Mila, Isabelle; San Clemente, Hélène; Savelli, Bruno; Dunand, Christophe; Paiva, Jorge A. P.; Myburg, Alexander A.; Bouzayen, Mondher; Grima-Pettenati, Jacqueline; Cassan-Wang, Hua
2014-01-01
Auxin is a central hormone involved in a wide range of developmental processes including the specification of vascular stem cells. Auxin Response Factors (ARF) are important actors of the auxin signalling pathway, regulating the transcription of auxin-responsive genes through direct binding to their promoters. The recent availability of the Eucalyptus grandis genome sequence allowed us to examine the characteristics and evolutionary history of this gene family in a woody plant of high economic importance. With 17 members, the E. grandis ARF gene family is slightly contracted, as compared to those of most angiosperms studied hitherto, lacking traces of duplication events. In silico analysis of alternative transcripts and gene truncation suggested that these two mechanisms were preeminent in shaping the functional diversity of the ARF family in Eucalyptus. Comparative phylogenetic analyses with genomes of other taxonomic lineages revealed the presence of a new ARF clade found preferentially in woody and/or perennial plants. High-throughput expression profiling among different organs and tissues and in response to environmental cues highlighted genes expressed in vascular cambium and/or developing xylem, responding dynamically to various environmental stimuli. Finally, this study allowed identification of three ARF candidates potentially involved in the auxin-regulated transcriptional program underlying wood formation. PMID:25269088
Directory of Open Access Journals (Sweden)
Hong Yu
Full Text Available Auxin is a central hormone involved in a wide range of developmental processes including the specification of vascular stem cells. Auxin Response Factors (ARF are important actors of the auxin signalling pathway, regulating the transcription of auxin-responsive genes through direct binding to their promoters. The recent availability of the Eucalyptus grandis genome sequence allowed us to examine the characteristics and evolutionary history of this gene family in a woody plant of high economic importance. With 17 members, the E. grandis ARF gene family is slightly contracted, as compared to those of most angiosperms studied hitherto, lacking traces of duplication events. In silico analysis of alternative transcripts and gene truncation suggested that these two mechanisms were preeminent in shaping the functional diversity of the ARF family in Eucalyptus. Comparative phylogenetic analyses with genomes of other taxonomic lineages revealed the presence of a new ARF clade found preferentially in woody and/or perennial plants. High-throughput expression profiling among different organs and tissues and in response to environmental cues highlighted genes expressed in vascular cambium and/or developing xylem, responding dynamically to various environmental stimuli. Finally, this study allowed identification of three ARF candidates potentially involved in the auxin-regulated transcriptional program underlying wood formation.
Directory of Open Access Journals (Sweden)
Anna Bachmann
Full Text Available BACKGROUND: To avoid spleen-dependent killing mechanisms parasite-infected erythrocytes (IE of Plasmodium falciparum malaria patients have the capacity to bind to endothelial receptors. This binding also known as sequestration, is mediated by parasite proteins, which are targeted to the erythrocyte surface. Candidate proteins are those encoded by P. falciparum multicopy gene families, such as var, rif, stevor or PfMC-2TM. However, a direct in vivo proof of IE sequestration and expression of multicopy gene families is still lacking. Here, we report on the analysis of IE from a black African immigrant, who received the diagnosis of a malignant lymphoproliferative disorder and subsequently underwent splenectomy. Three weeks after surgery, the patient experienced clinical falciparum malaria with high parasitemia and circulating developmental parasite stages usually sequestered to the vascular endothelium such as late trophozoites, schizonts or immature gametocytes. METHODOLOGY/PRINCIPAL FINDINGS: Initially, when isolated from the patient, the infected erythrocytes were incapable to bind to various endothelial receptors in vitro. Moreover, the parasites failed to express the multicopy gene families var, A-type rif and stevor but expression of B-type rif and PfMC-2TM genes were detected. In the course of in vitro cultivation, the parasites started to express all investigated multicopy gene families and concomitantly developed the ability to adhere to endothelial receptors such as CD36 and ICAM-1, respectively. CONCLUSION/SIGNIFICANCE: This case strongly supports the hypothesis that parasite surface proteins such as PfEMP1, A-type RIFIN or STEVOR are involved in interactions of infected erythrocytes with endothelial receptors mediating sequestration of mature asexual and immature sexual stages of P. falciparum. In contrast, multicopy gene families coding for B-type RIFIN and PfMC-2TM proteins may not be involved in sequestration, as these genes were
Urbani, C; Russo, D; Raggi, F; Lombardi, M; Sardella, C; Scattina, I; Lupi, I; Manetti, L; Tomisti, L; Marcocci, C; Martino, E; Bogazzi, F
2014-10-01
Acromegaly usually occurs as a sporadic disease, but it may be a part of familial pituitary tumor syndromes in rare cases. Germline mutations in the aryl hydrocarbon receptor-interacting protein (AIP) gene have been associated with a predisposition to familial isolated pituitary adenoma. The aim of the present study was to evaluate the AIP gene in a patient with gigantism and in her relatives. Direct sequencing of AIP gene was performed in fourteen members of the family, spanning among three generations. The index case was an 18-year-old woman with gigantism due to an invasive GH-secreting pituitary adenoma and a concomitant tall-cell variant of papillary thyroid carcinoma. A novel germline mutation in the AIP gene (c.685C>T, p.Q229X) was identified in the proband and in two members of her family, who did not present clinical features of acromegaly or other pituitary disorders. Eleven subjects had no mutation in the AIP gene. Two members of the family with clinical features of acromegaly refused either the genetic or the biochemical evaluation. The Q229X mutation was predicted to generate a truncated AIP protein, lacking the last two tetratricopeptide repeat domains and the final C-terminal α-7 helix. We identified a new AIP germline mutation predicted to produce a truncated AIP protein, lacking its biological properties due to the disruption of the C-terminus binding sites for both the chaperones and the client proteins of AIP.
Directory of Open Access Journals (Sweden)
Dorian Moro
2018-01-01
Full Text Available Invasive animals have been linked to the extinctions of native wildlife, and to significant agricultural financial losses or impacts. Current approaches to control invasive species require ongoing resources and management over large geographic scales, and often result in the short-term suppression of populations. New and innovative approaches are warranted. Recently, the RNA guided gene drive system based on CRISPR/Cas9 is being proposed as a potential gene editing tool that could be used by wildlife managers as a non-lethal addition or alternative to help reduce pest animal populations. While regulatory control and social acceptance are crucial issues that must be addressed, there is an opportunity now to identify the knowledge and research gaps that exist for some important invasive species. Here we systematically determine the knowledge gaps for pest species for which gene drives could potentially be applied. We apply a conceptual ecological risk framework within the gene drive context within an Australian environment to identify key requirements for undertaking work on seven exemplar invasive species in Australia. This framework allows an evaluation of the potential research on an invasive species of interest and within a gene drive and risk context. We consider the currently available biological, genetic and ecological information for the house mouse, European red fox, feral cat, European rabbit, cane toad, black rat and European starling to evaluate knowledge gaps and identify candidate species for future research. We discuss these findings in the context of future thematic areas of research worth pursuing in preparation for a more formal assessment of the use of gene drives as a novel strategy for the control of these and other invasive species. Keywords: Invasive species, Gene drive, CRISPR, Pest management, Islands
Differential expression pattern of UBX family genes in Caenorhabditis elegans
International Nuclear Information System (INIS)
Yamauchi, Seiji; Sasagawa, Yohei; Ogura, Teru; Yamanaka, Kunitoshi
2007-01-01
UBX (ubiquitin regulatory X)-containing proteins belong to an evolutionary conserved protein family and determine the specificity of p97/VCP/Cdc48p function by binding as its adaptors. Caenorhabditis elegans was found to possess six UBX-containing proteins, named UBXN-1 to -6. However, no general or specific function of them has been revealed. During the course of understanding not only their function but also specified function of p97, we investigated spatial and temporal expression patterns of six ubxn genes in this study. Transcript analyses showed that the expression pattern of each ubxn gene was different throughout worm's development and may show potential developmental dynamics in their function, especially ubxn-5 was expressed specifically in the spermatogenic germline, suggesting a crucial role in spermatogenesis. In addition, as ubxn-4 expression was induced by ER stress, it would function as an ERAD factor in C. elegans. In vivo expression analysis by using GFP translational fusion constructs revealed that six ubxn genes show distinct expression patterns. These results altogether demonstrate that the expression of all six ubxn genes of C. elegans is differently regulated
Svanem, Britt Iren Glærum; Skjåk-Bræk, Gudmund; Ertesvåg, Helga; Valla, Svein
1999-01-01
The cloning and expression of a family of five modular-type mannuronan C-5-epimerase genes from Azotobacter vinelandii (algE1 to -5) has previously been reported. The corresponding proteins catalyze the Ca2+-dependent polymer-level epimerization of β-d-mannuronic acid to α-l-guluronic acid (G) in the commercially important polysaccharide alginate. Here we report the identification of three additional structurally similar genes, designated algE6, algE7, and algY. All three genes were sequenced...
Genome-wide identification and characterization of WRKY gene family in peanut
Directory of Open Access Journals (Sweden)
Hui eSong
2016-04-01
Full Text Available WRKY, an important transcription factor family, is widely distributed in the plant kingdom. Many reports focused on analysis of phylogenetic relationship and biological function of WRKY protein at the whole genome level in different plant species. However, little is known about WRKY proteins in the genome of Arachis species and their response to salicylic acid (SA and jasmonic acid (JA treatment. In this study, we identified 77 and 75 WRKY proteins from the two wild ancestral diploid genomes of cultivated tetraploid peanut, Arachis duranensis and Arachis ipaënsis, using bioinformatics approaches. Most peanut WRKY coding genes were located on A. duranensis chromosome A6 and A. ipaënsis chromosome B3, while the least number of WRKY genes was found in chromosome 9. The WRKY orthologous gene pairs in A. duranensis and A. ipaënsis chromosomes were highly syntenic. Our analysis indicated that segmental duplication events played a major role in AdWRKY and AiWRKY genes, and strong purifying selection was observed in gene duplication pairs. Furthermore, we translate the knowledge gained from the genome-wide analysis result of wild ancestral peanut to cultivated peanut to reveal that gene activities of specific cultivated peanut WRKY gene were changed due to SA and JA treatment. Peanut WRKY7, 8 and 13 genes were down-regulated, whereas WRKY1 and 12 genes were up-regulated with SA and JA treatment. These results could provide valuable information for peanut improvement.
Genome-Wide Identification and Characterization of WRKY Gene Family in Peanut.
Song, Hui; Wang, Pengfei; Lin, Jer-Young; Zhao, Chuanzhi; Bi, Yuping; Wang, Xingjun
2016-01-01
WRKY, an important transcription factor family, is widely distributed in the plant kingdom. Many reports focused on analysis of phylogenetic relationship and biological function of WRKY protein at the whole genome level in different plant species. However, little is known about WRKY proteins in the genome of Arachis species and their response to salicylic acid (SA) and jasmonic acid (JA) treatment. In this study, we identified 77 and 75 WRKY proteins from the two wild ancestral diploid genomes of cultivated tetraploid peanut, Arachis duranensis and Arachis ipaënsis, using bioinformatics approaches. Most peanut WRKY coding genes were located on A. duranensis chromosome A6 and A. ipaënsis chromosome B3, while the least number of WRKY genes was found in chromosome 9. The WRKY orthologous gene pairs in A. duranensis and A. ipaënsis chromosomes were highly syntenic. Our analysis indicated that segmental duplication events played a major role in AdWRKY and AiWRKY genes, and strong purifying selection was observed in gene duplication pairs. Furthermore, we translate the knowledge gained from the genome-wide analysis result of wild ancestral peanut to cultivated peanut to reveal that gene activities of specific cultivated peanut WRKY gene were changed due to SA and JA treatment. Peanut WRKY7, 8 and 13 genes were down-regulated, whereas WRKY1 and 12 genes were up-regulated with SA and JA treatment. These results could provide valuable information for peanut improvement.
Multiple genes encode the major surface glycoprotein of Pneumocystis carinii
DEFF Research Database (Denmark)
Kovacs, J A; Powell, F; Edman, J C
1993-01-01
hydrophobic region at the carboxyl terminus. The presence of multiple related msg genes encoding the major surface glycoprotein of P. carinii suggests that antigenic variation is a possible mechanism for evading host defenses. Further characterization of this family of genes should allow the development......The major surface antigen of Pneumocystis carinii, a life-threatening opportunistic pathogen in human immunodeficiency virus-infected patients, is an abundant glycoprotein that functions in host-organism interactions. A monoclonal antibody to this antigen is protective in animals, and thus...... blot studies using chromosomal or restricted DNA, the major surface glycoproteins are the products of a multicopy family of genes. The predicted protein has an M(r) of approximately 123,000, is relatively rich in cysteine residues (5.5%) that are very strongly conserved, and contains a well conserved...
Immanen, Juha; Nieminen, Kaisa; Duchens Silva, Héctor; Rodríguez Rojas, Fernanda; Meisel, Lee A; Silva, Herman; Albert, Victor A; Hvidsten, Torgeir R; Helariutta, Ykä
2013-12-16
Through the diversity of cytokinin regulated processes, this phytohormone has a profound impact on plant growth and development. Cytokinin signaling is involved in the control of apical and lateral meristem activity, branching pattern of the shoot, and leaf senescence. These processes influence several traits, including the stem diameter, shoot architecture, and perennial life cycle, which define the development of woody plants. To facilitate research about the role of cytokinin in regulation of woody plant development, we have identified genes associated with cytokinin signaling and homeostasis pathways from two hardwood tree species. Taking advantage of the sequenced black cottonwood (Populus trichocarpa) and peach (Prunus persica) genomes, we have compiled a comprehensive list of genes involved in these pathways. We identified genes belonging to the six families of cytokinin oxidases (CKXs), isopentenyl transferases (IPTs), LONELY GUY genes (LOGs), two-component receptors, histidine containing phosphotransmitters (HPts), and response regulators (RRs). All together 85 Populus and 45 Prunus genes were identified, and compared to their Arabidopsis orthologs through phylogenetic analyses. In general, when compared to Arabidopsis, differences in gene family structure were often seen in only one of the two tree species. However, one class of genes associated with cytokinin signal transduction, the CKI1-like family of two-component histidine kinases, was larger in both Populus and Prunus than in Arabidopsis.
He, Peng; Zhao, Peng; Wang, Limin; Zhang, Yuzhou; Wang, Xiaosi; Xiao, Hui; Yu, Jianing; Xiao, Guanghui
2017-07-03
Cell elongation and expansion are significant contributors to plant growth and morphogenesis, and are often regulated by environmental cues and endogenous hormones. Auxin is one of the most important phytohormones involved in the regulation of plant growth and development and plays key roles in plant cell expansion and elongation. Cotton fiber cells are a model system for studying cell elongation due to their large size. Cotton is also the world's most utilized crop for the production of natural fibers for textile and garment industries, and targeted expression of the IAA biosynthetic gene iaaM increased cotton fiber initiation. Polar auxin transport, mediated by PIN and AUX/LAX proteins, plays a central role in the control of auxin distribution. However, very limited information about PIN-FORMED (PIN) efflux carriers in cotton is known. In this study, 17 PIN-FORMED (PIN) efflux carrier family members were identified in the Gossypium hirsutum (G. hirsutum) genome. We found that PIN1-3 and PIN2 genes originated from the At subgenome were highly expressed in roots. Additionally, evaluation of gene expression patterns indicated that PIN genes are differentially induced by various abiotic stresses. Furthermore, we found that the majority of cotton PIN genes contained auxin (AuxREs) and salicylic acid (SA) responsive elements in their promoter regions were significantly up-regulated by exogenous hormone treatment. Our results provide a comprehensive analysis of the PIN gene family in G. hirsutum, including phylogenetic relationships, chromosomal locations, and gene expression and gene duplication analyses. This study sheds light on the precise roles of PIN genes in cotton root development and in adaption to stress responses.
Energy Technology Data Exchange (ETDEWEB)
Bonaventure, J.; Lasselin, C. [Hopital Necker, Paris (France); Toutain, A. [CHU Bretonneau, Tours (France)] [and others
1994-09-01
The Stickler syndrome is an arthro-ophthalmopathy which associates progressive myopia with vitreal degeneration and retinal detachment. Cleft palate, cranio-facial abnormalities, deafness and osteoarthritis are often associated symptoms. Genetic heterogeneity of this autosomal dominant disease was consistent with its large clinical variability. Linkage studies have provided evidence for cosegregation of the disease with COL2A1, the gene coding for type II collagen, in about 50% of the families. Four additional families are reported here. Linkage analyses by using a VNTR located in the 3{prime} region of the gene were achieved. In three families, positive lod scores were obtained with a cumulative maximal value of 3.5 at a recombination fraction of 0. In one of these families, single strand conformation analysis of 25 exons disclosed a new mutation in exon 42. Codon for glutamic acid at position a1-803 was converted into a stop codon. The mutation was detected in DNA samples from all the affected members of the family but not in the unaffected. This result confirms that most of the Stickler syndromes linked to COL2A1 are due to premature stop codons. In a second family, an abnormal SSCP pattern of exon 34 was detected in all the affected individuals. The mutation is likely to correspond to a splicing defect in the acceptor site of intron 33. In one family the disease did not segregate with the COL2A1 locus. Further linkage studies with intragenic dimorphic sites in the COL10A1 gene and highly polymorphic markers close to the COL9A1 locus indicated that this disorder did not result from defects in these two genes.
Xia, Qiu-Yuan; Wang, Xiao-Tong; Ye, Sheng-Bing; Wang, Xuan; Li, Rui; Shi, Shan-Shan; Fang, Ru; Zhang, Ru-Song; Ma, Heng-Hui; Lu, Zhen-Feng; Shen, Qin; Bao, Wei; Zhou, Xiao-Jun; Rao, Qiu
2018-04-01
MITF, TFE3, TFEB and TFEC belong to the same microphthalmia-associated transcription factor family (MiT). Two transcription factors in this family have been identified in two unusual types of renal cell carcinoma (RCC): Xp11 translocation RCC harbouring TFE3 gene fusions and t(6;11) RCC harbouring a MALAT1-TFEB gene fusion. The 2016 World Health Organisation classification of renal neoplasia grouped these two neoplasms together under the category of MiT family translocation RCC. RCCs associated with the other two MiT family members, MITF and TFEC, have rarely been reported. Herein, we identify a case of MITF translocation RCC with the novel PRCC-MITF gene fusion by RNA sequencing. Histological examination of the present tumour showed typical features of MiT family translocation RCCs, overlapping with Xp11 translocation RCC and t(6;11) RCC. However, this tumour showed negative results in TFE3 and TFEB immunochemistry and split fluorescence in-situ hybridisation (FISH) assays. The other MiT family members, MITF and TFEC, were tested further immunochemically and also showed negative results. RNA sequencing and reverse transcription-polymerase chain reaction confirmed the presence of a PRCC-MITF gene fusion: a fusion of PRCC exon 5 to MITF exon 4. We then developed FISH assays covering MITF break-apart probes and PRCC-MITF fusion probes to detect the MITF gene rearrangement. This study both proves the recurring existence of MITF translocation RCC and expands the genotype spectrum of MiT family translocation RCCs. © 2017 John Wiley & Sons Ltd.
Dias, Raquel; Manny, Austin; Kolaczkowski, Oralia; Kolaczkowski, Bryan
2017-06-01
Reconstruction of ancestral protein sequences using phylogenetic methods is a powerful technique for directly examining the evolution of molecular function. Although ancestral sequence reconstruction (ASR) is itself very efficient, downstream functional, and structural studies necessary to characterize when and how changes in molecular function occurred are often costly and time-consuming, currently limiting ASR studies to examining a relatively small number of discrete functional shifts. As a result, we have very little direct information about how molecular function evolves across large protein families. Here we develop an approach combining ASR with structure and function prediction to efficiently examine the evolution of ligand affinity across a large family of double-stranded RNA binding proteins (DRBs) spanning animals and plants. We find that the characteristic domain architecture of DRBs-consisting of 2-3 tandem double-stranded RNA binding motifs (dsrms)-arose independently in early animal and plant lineages. The affinity with which individual dsrms bind double-stranded RNA appears to have increased and decreased often across both animal and plant phylogenies, primarily through convergent structural mechanisms involving RNA-contact residues within the β1-β2 loop and a small region of α2. These studies provide some of the first direct information about how protein function evolves across large gene families and suggest that changes in molecular function may occur often and unassociated with major phylogenetic events, such as gene or domain duplications. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Directory of Open Access Journals (Sweden)
Raherison Elie
2012-08-01
Full Text Available Abstract Background Conifers have very large genomes (13 to 30 Gigabases that are mostly uncharacterized although extensive cDNA resources have recently become available. This report presents a global overview of transcriptome variation in a conifer tree and documents conservation and diversity of gene expression patterns among major vegetative tissues. Results An oligonucleotide microarray was developed from Picea glauca and P. sitchensis cDNA datasets. It represents 23,853 unique genes and was shown to be suitable for transcriptome profiling in several species. A comparison of secondary xylem and phelloderm tissues showed that preferential expression in these vascular tissues was highly conserved among Picea spp. RNA-Sequencing strongly confirmed tissue preferential expression and provided a robust validation of the microarray design. A small database of transcription profiles called PiceaGenExpress was developed from over 150 hybridizations spanning eight major tissue types. In total, transcripts were detected for 92% of the genes on the microarray, in at least one tissue. Non-annotated genes were predominantly expressed at low levels in fewer tissues than genes of known or predicted function. Diversity of expression within gene families may be rapidly assessed from PiceaGenExpress. In conifer trees, dehydrins and late embryogenesis abundant (LEA osmotic regulation proteins occur in large gene families compared to angiosperms. Strong contrasts and low diversity was observed in the dehydrin family, while diverse patterns suggested a greater degree of diversification among LEAs. Conclusion Together, the oligonucleotide microarray and the PiceaGenExpress database represent the first resource of this kind for gymnosperm plants. The spruce transcriptome analysis reported here is expected to accelerate genetic studies in the large and important group comprised of conifer trees.
Ramprasad, Vedam Lakshmi; Thool, Alka; Murugan, Sakthivel; Nancarrow, Derek; Vyas, Prateep; Rao, Srinivas Kamalakar; Vidhya, Authiappan; Ravishankar, Krishnamoorthy; Kumaramanickavel, Govindasamy
2005-01-01
A four-generation family containing eight affected males who inherited X-linked developmental lens opacity and microcornea was studied. Some members in the family had mild to moderate nonocular clinical features suggestive of Nance-Horan syndrome. The purpose of the study was to map genetically the gene in the large 57-live-member Asian-Indian pedigree. PCR-based genotyping was performed on the X-chromosome, by using fluorescent microsatellite markers (10-cM intervals). Parametric linkage analysis was performed by using two disease models, assuming either recessive or dominant X-linked transmission by the MLINK/ILINK and FASTLINK (version 4.1P) programs (http:www.hgmp.mrc.ac.uk/; provided in the public domain by the Human Genome Mapping Project Resources Centre, Cambridge, UK). The NHS gene at the linked region was screened for mutation. By fine mapping, the disease gene was localized to Xp22.13. Multipoint analysis placed the peak LOD of 4.46 at DSX987. The NHS gene mapped to this region. Mutational screening in all the affected males and carrier females (heterozygous form) revealed a truncating mutation 115C-->T in exon 1, resulting in conversion of glutamine to stop codon (Q39X), but was not observed in unaffected individuals and control subjects. conclusions. A family with X-linked Nance-Horan syndrome had severe ocular, but mild to moderate nonocular, features. The clinical phenotype of the truncating mutation (Q39X) in the NHS gene suggests allelic heterogeneity at the NHS locus or the presence of modifier genes. X-linked families with cataract should be carefully examined for both ocular and nonocular features, to exclude Nance-Horan syndrome. RT-PCR analysis did not suggest nonsense-mediated mRNA decay as the possible mechanism for clinical heterogeneity.
Yu, Liying; Tang, Weiqi; He, Weiyi; Ma, Xiaoli; Vasseur, Liette; Baxter, Simon W; Yang, Guang; Huang, Shiguo; Song, Fengqin; You, Minsheng
2015-03-10
Cytochrome P450 monooxygenases are present in almost all organisms and can play vital roles in hormone regulation, metabolism of xenobiotics and in biosynthesis or inactivation of endogenous compounds. In the present study, a genome-wide approach was used to identify and analyze the P450 gene family of diamondback moth, Plutella xylostella, a destructive worldwide pest of cruciferous crops. We identified 85 putative cytochrome P450 genes from the P. xylostella genome, including 84 functional genes and 1 pseudogene. These genes were classified into 26 families and 52 subfamilies. A phylogenetic tree constructed with three additional insect species shows extensive gene expansions of P. xylostella P450 genes from clans 3 and 4. Gene expression of cytochrome P450s was quantified across multiple developmental stages (egg, larva, pupa and adult) and tissues (head and midgut) using P. xylostella strains susceptible or resistant to insecticides chlorpyrifos and fiprinol. Expression of the lepidopteran specific CYP367s predominantly occurred in head tissue suggesting a role in either olfaction or detoxification. CYP340s with abundant transposable elements and relatively high expression in the midgut probably contribute to the detoxification of insecticides or plant toxins in P. xylostella. This study will facilitate future functional studies of the P. xylostella P450s in detoxification.
Directory of Open Access Journals (Sweden)
Escalante Ricardo
2008-01-01
Full Text Available Abstract Background The social amoeba Dictyostelium discoideum executes a multicellular development program upon starvation. This morphogenetic process requires the differential regulation of a large number of genes and is coordinated by extracellular signals. The MADS-box transcription factor SrfA is required for several stages of development, including slug migration and spore terminal differentiation. Results Subtractive hybridization allowed the isolation of a gene, sigN (SrfA-induced gene N, that was dependent on the transcription factor SrfA for expression at the slug stage of development. Homology searches detected the existence of a large family of sigN-related genes in the Dictyostelium discoideum genome. The 13 most similar genes are grouped in two regions of chromosome 2 and have been named Group1 and Group2 sigN genes. The putative encoded proteins are 87–89 amino acids long. All these genes have a similar structure, composed of a first exon containing a 13 nucleotides long open reading frame and a second exon comprising the remaining of the putative coding region. The expression of these genes is induced at10 hours of development. Analyses of their promoter regions indicate that these genes are expressed in the prestalk region of developing structures. The addition of antibodies raised against SigN Group 2 proteins induced disintegration of multi-cellular structures at the mound stage of development. Conclusion A large family of genes coding for small proteins has been identified in D. discoideum. Two groups of very similar genes from this family have been shown to be specifically expressed in prestalk cells during development. Functional studies using antibodies raised against Group 2 SigN proteins indicate that these genes could play a role during multicellular development.
Directory of Open Access Journals (Sweden)
Hewitt Jane E
2010-11-01
Full Text Available Abstract Background DUX4 is causally involved in the molecular pathogenesis of the neuromuscular disorder facioscapulohumeral muscular dystrophy (FSHD. It has previously been proposed to have arisen by retrotransposition of DUXC, one of four known intron-containing DUX genes. Here, we investigate the evolutionary history of this multi-member double-homeobox gene family in eutherian mammals. Results Our analysis of the DUX family shows the distribution of different homologues across the mammalian class, including events of secondary loss. Phylogenetic comparison, analysis of gene structures and information from syntenic regions confirm the paralogous relationship of Duxbl and DUXB and characterize their relationship with DUXA and DUXC. We further identify Duxbl pseudogene orthologues in primates. A survey of non-mammalian genomes identified a single-homeobox gene (sDUX as a likely representative homologue of the mammalian DUX ancestor before the homeobox duplication. Based on the gene structure maps, we suggest a possible mechanism for the generation of the DUX gene structure. Conclusions Our study underlines how secondary loss of orthologues can obscure the true ancestry of individual gene family members. Their relationships should be considered when interpreting the relevance of functional data from DUX4 homologues such as Dux and Duxbl to FSHD.
Zhao, Ge; Song, Yun; Wang, Caixiang; Butt, Hamama Islam; Wang, Qianhua; Zhang, Chaojun; Yang, Zuoren; Liu, Zhao; Chen, Eryong; Zhang, Xueyan; Li, Fuguang
2016-12-01
Jasmonates control many aspects of plant biological processes. They are important for regulating plant responses to various biotic and abiotic stresses, including drought, which is one of the most serious threats to sustainable agricultural production. However, little is known regarding how jasmonate ZIM-domain (JAZ) proteins mediate jasmonic acid signals to improve stress tolerance in cotton. This represents the first comprehensive comparative study of TIFY transcription factors in both diploid A, D and tetraploid AD cotton species. In this study, we identified 21 TIFY family members in the genome of Gossypium arboretum, 28 members from Gossypium raimondii and 50 TIFY genes in Gossypium hirsutum. The phylogenetic analyses indicated the TIFY gene family could be divided into the following four subfamilies: TIFY, PPD, ZML, and JAZ subfamilies. The cotton TIFY genes have expanded through tandem duplications and segmental duplications compared with other plant species. Gene expression profile revealed temporal and tissue specificities for TIFY genes under simulated drought conditions in Gossypium arboretum. The JAZ subfamily members were the most highly expressed genes, suggesting that they have a vital role in responses to drought stress. Over-expression of GaJAZ5 gene decreased water loss, stomatal openings, and the accumulation of H 2 O 2 in Arabidopsis thaliana. Additionally, the results of drought tolerance assays suggested that this subfamily might be involved in increasing drought tolerance. Our study provides new data regarding the genome-wide analysis of TIFY gene families and their important roles in drought tolerance in cotton species. These data may form the basis of future studies regarding the relationship between drought and jasmonic acid.
Zhu, Dan; Cai, Hua; Luo, Xiao; Bai, Xi; Deyholos, Michael K; Chen, Qin; Chen, Chao; Ji, Wei; Zhu, Yanming
2012-09-21
Salt and alkali stress are two of the main environmental factors limiting crop production. Recent discoveries show that the JAZ family encodes plant-specific genes involved in jasmonate signaling. However, there is only limited information about this gene family in abiotic stress response, and in wild soybean (Glycine soja), which is a species noted for its tolerance to alkali and salinity. Here, we isolated and characterized a novel JAZ family gene, GsJAZ2, from G. soja. Transcript abundance of GsJAZ2 increased following exposure to salt, alkali, cold and drought. Over-expression of GsJAZ2 in Arabidopsis resulted in enhanced plant tolerance to salt and alkali stress. The expression levels of some alkali stress response and stress-inducible marker genes were significantly higher in the GsJAZ2 overexpression lines as compared to wild-type plants. Subcellular localization studies using a GFP fusion protein showed that GsJAZ2 was localized to the nucleus. These results suggest that the newly isolated wild soybean GsJAZ2 is a positive regulator of plant salt and alkali stress tolerance. Crown Copyright © 2012. Published by Elsevier Inc. All rights reserved.
Identification of a novel FBN1 gene mutation in a large Pakistani family with Marfan syndrome
Micheal, S.; Khan, M.I.; Akhtar, F.; Weiss, M.M.; Islam, F.; Ali, M.; Qamar, R.; Maugeri, A.; Hollander, A.I. den
2012-01-01
PURPOSE: To describe a novel mutation in the fibrillin-1 (FBN1) gene in a large Pakistani family with autosomal dominant Marfan syndrome (MFS). METHODS: Blood samples were collected of 11 family members affected with Marfan syndrome, and DNA was isolated by phenol-extraction. The coding exons of
DEFF Research Database (Denmark)
Fager Ferrari, Marcus; Leinoe, Eva; Rossing, Maria
2018-01-01
Familial hemophagocytic lymphohistiocytosis (FHL) is caused by biallelic variants in genes regulating granule secretion in cytotoxic lymphocytes. In FHL3-5, the affected genes UNC13D, STX11 and STXBP2 have further been shown to regulate the secretion of platelet granules, giving rise to compromised...
Chakravorty, S; Sarkar, S; Gachhui, R
2015-01-01
The Acetobacteraceae family of the class Alpha Proteobacteria is comprised of high sugar and acid tolerant bacteria. The Acetic Acid Bacteria are the economically most significant group of this family because of its association with food products like vinegar, wine etc. Acetobacteraceae are often hard to culture in laboratory conditions and they also maintain very low abundances in their natural habitats. Thus identification of the organisms in such environments is greatly dependent on modern tools of molecular biology which require a thorough knowledge of specific conserved gene sequences that may act as primers and or probes. Moreover unconserved domains in genes also become markers for differentiating closely related genera. In bacteria, the 16S rRNA gene is an ideal candidate for such conserved and variable domains. In order to study the conserved and variable domains of the 16S rRNA gene of Acetic Acid Bacteria and the Acetobacteraceae family, sequences from publicly available databases were aligned and compared. Near complete sequences of the gene were also obtained from Kombucha tea biofilm, a known Acetobacteraceae family habitat, in order to corroborate the domains obtained from the alignment studies. The study indicated that the degree of conservation in the gene is significantly higher among the Acetic Acid Bacteria than the whole Acetobacteraceae family. Moreover it was also observed that the previously described hypervariable regions V1, V3, V5, V6 and V7 were more or less conserved in the family and the spans of the variable regions are quite distinct as well.
Zhao, Peng; Wang, Dongdong; Wang, Ruoqiu; Kong, Nana; Zhang, Chao; Yang, Chenghui; Wu, Wentao; Ma, Haoli; Chen, Qin
2018-01-18
Heat shock proteins (Hsps) are essential components in plant tolerance mechanism under various abiotic stresses. Hsp20 is the major family of heat shock proteins, but little of Hsp20 family is known in potato (Solanum tuberosum), which is an important vegetable crop that is thermosensitive. To reveal the mechanisms of potato Hsp20s coping with abiotic stresses, analyses of the potato Hsp20 gene family were conducted using bioinformatics-based methods. In total, 48 putative potato Hsp20 genes (StHsp20s) were identified and named according to their chromosomal locations. A sequence analysis revealed that most StHsp20 genes (89.6%) possessed no, or only one, intron. A phylogenetic analysis indicated that all of the StHsp20 genes, except 10, were grouped into 12 subfamilies. The 48 StHsp20 genes were randomly distributed on 12 chromosomes. Nineteen tandem duplicated StHsp20s and one pair of segmental duplicated genes (StHsp20-15 and StHsp20-48) were identified. A cis-element analysis inferred that StHsp20s, except for StHsp20-41, possessed at least one stress response cis-element. A heatmap of the StHsp20 gene family showed that the genes, except for StHsp20-2 and StHsp20-45, were expressed in various tissues and organs. Real-time quantitative PCR was used to detect the expression level of StHsp20 genes and demonstrated that the genes responded to multiple abiotic stresses, such as heat, salt or drought stress. The relative expression levels of 14 StHsp20 genes (StHsp20-4, 6, 7, 9, 20, 21, 33, 34, 35, 37, 41, 43, 44 and 46) were significantly up-regulated (more than 100-fold) under heat stress. These results provide valuable information for clarifying the evolutionary relationship of the StHsp20 family and in aiding functional characterization of StHsp20 genes in further research.
Li, Donghua; Liu, Pan; Yu, Jingyin; Wang, Linhai; Dossa, Komivi; Zhang, Yanxin; Zhou, Rong; Wei, Xin; Zhang, Xiurong
2017-09-11
Sesame (Sesamum indicum L.) is one of the world's most important oil crops. However, it is susceptible to abiotic stresses in general, and to waterlogging and drought stresses in particular. The molecular mechanisms of abiotic stress tolerance in sesame have not yet been elucidated. The WRKY domain transcription factors play significant roles in plant growth, development, and responses to stresses. However, little is known about the number, location, structure, molecular phylogenetics, and expression of the WRKY genes in sesame. We performed a comprehensive study of the WRKY gene family in sesame and identified 71 SiWRKYs. In total, 65 of these genes were mapped to 15 linkage groups within the sesame genome. A phylogenetic analysis was performed using a related species (Arabidopsis thaliana) to investigate the evolution of the sesame WRKY genes. Tissue expression profiles of the WRKY genes demonstrated that six SiWRKY genes were highly expressed in all organs, suggesting that these genes may be important for plant growth and organ development in sesame. Analysis of the SiWRKY gene expression patterns revealed that 33 and 26 SiWRKYs respond strongly to waterlogging and drought stresses, respectively. Changes in the expression of 12 SiWRKY genes were observed at different times after the waterlogging and drought treatments had begun, demonstrating that sesame gene expression patterns vary in response to abiotic stresses. In this study, we analyzed the WRKY family of transcription factors encoded by the sesame genome. Insight was gained into the classification, evolution, and function of the SiWRKY genes, revealing their putative roles in a variety of tissues. Responses to abiotic stresses in different sesame cultivars were also investigated. The results of our study provide a better understanding of the structures and functions of sesame WRKY genes and suggest that manipulating these WRKYs could enhance resistance to waterlogging and drought.
Directory of Open Access Journals (Sweden)
Gianluigi Laccetta
2017-11-01
Full Text Available Sotos syndrome (SoS is characterized by overgrowth of prenatal onset, learning disability, and characteristic facial appearance; it is usually due to haploinsufficiency of NSD1 gene at chromosome 5q35. An Italian child was born at 37 weeks of gestation (weight 2,910 g, 25th–50th centiles; length 50 cm, 75th centile; head circumference 36 cm, 97th centile showing cryptorchidism on the right side, hypertelorism, dolichocephaly, broad and prominent forehead, and narrow jaw; the pregnancy was worsened by maternal preeclampsia and gestational diabetes, and his mother had a previous history of four early miscarriages. The patient showed neonatal jaundice, hypotonia, feeding difficulties, frequent vomiting, and gastroesophageal reflux. After the age of 6 months, his weight, length, and head circumference were above the 97th centile; psychomotor development was delayed. At the age of 9 years, the patient showed also joint laxity and scoliosis. DNA sequence analysis of NSD1 gene detected a novel heterozygous mutation (c.521T>A, p.Val174Asp in exon 2. The same mutant allele was also found in the mother and in the maternal grandfather of the proband; both the mother and the maternal grandfather of the proband showed isolated overgrowth with height above the 97th centile in absence of other features of SoS. At present 23 familial cases of SoS have been described (two cases with mutation in exon 2 of NSD1 gene; no familial cases of SoS with mutation of NSD1 gene and isolated overgrowth have been reported. Probably, point mutations of NSD1 gene, and particularly mutations between exon 20 and exon 23, are not likely to affect reproductive fitness. Epigenetic mechanisms and intrauterine environment may influence phenotypes, therefore genetic tests are not useful to predict the phenotype but they are indispensable for the diagnosis of SoS. This is the first Italian familial case of SoS with genetic confirmation and the third report in which a
Directory of Open Access Journals (Sweden)
Qian Yan
Full Text Available Basic/helix-loop-helix (bHLH proteins comprise one of the largest transcription factor families and play important roles in diverse cellular and molecular processes. Comprehensive analyses of the composition and evolution of the bHLH family in cotton are essential to elucidate their functions and the molecular basis of cotton development. By searching bHLH homologous genes in sequenced diploid cotton genomes (Gossypium raimondii and G. arboreum, a set of cotton bHLH reference genes containing 289 paralogs were identified and named as GobHLH001-289. Based on their phylogenetic relationships, these cotton bHLH proteins were clustered into 27 subfamilies. Compared to those in Arabidopsis and cacao, cotton bHLH proteins generally increased in number, but unevenly in different subfamilies. To further uncover evolutionary changes of bHLH genes during tetraploidization of cotton, all genes of S5a and S5b subfamilies in upland cotton and its diploid progenitors were cloned and compared, and their transcript profiles were determined in upland cotton. A total of 10 genes of S5a and S5b subfamilies (doubled from A- and D-genome progenitors maintained in tetraploid cottons. The major sequence changes in upland cotton included a 15-bp in-frame deletion in GhbHLH130D and a long terminal repeat retrotransposon inserted in GhbHLH062A, which eliminated GhbHLH062A expression in various tissues. The S5a and S5b bHLH genes of A and D genomes (except GobHLH062 showed similar transcription patterns in various tissues including roots, stems, leaves, petals, ovules, and fibers, while the A- and D-genome genes of GobHLH110 and GobHLH130 displayed clearly different transcript profiles during fiber development. In total, this study represented a genome-wide analysis of cotton bHLH family, and revealed significant changes in sequence and expression of these genes in tetraploid cottons, which paved the way for further functional analyses of bHLH genes in the cotton genus.
Ohtsuka, Hokuto; Takinami, Masahiro; Shimasaki, Takafumi; Hibi, Takahide; Murakami, Hiroshi; Aiba, Hirofumi
2017-07-01
Nutritional restrictions such as calorie restrictions are known to increase the lifespan of various organisms. Here, we found that a restriction of sulfur extended the chronological lifespan (CLS) of the fission yeast Schizosaccharomyces pombe. The restriction decreased cellular size, RNA content, and ribosomal proteins and increased sporulation rate. These responses depended on Ecl1 family genes, the overexpression of which results in the extension of CLS. We also showed that the Zip1 transcription factor results in the sulfur restriction-dependent expression of the ecl1 + gene. We demonstrated that a decrease in ribosomal activity results in the extension of CLS. Based on these observations, we propose that sulfur restriction extends CLS through Ecl1 family genes in a ribosomal activity-dependent manner. © 2017 John Wiley & Sons Ltd.
Modification of the Genome of Domestic Animals.
Lotti, Samantha N; Polkoff, Kathryn M; Rubessa, Marcello; Wheeler, Matthew B
2017-07-03
In the past few years, new technologies have arisen that enable higher efficiency of gene editing. With the increase ease of using gene editing technologies, it is important to consider the best method for transferring new genetic material to livestock animals. Microinjection is a technique that has proven to be effective in mice but is less efficient in large livestock animals. Over the years, a variety of methods have been used for cloning as well as gene transfer including; nuclear transfer, sperm mediated gene transfer (SMGT), and liposome-mediated DNA transfer. This review looks at the different success rate of these methods and how they have evolved to become more efficient. As well as gene editing technologies, including Zinc-finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and the most recent clustered regulatory interspaced short palindromic repeats (CRISPRs). Through the advancements in gene-editing technologies, generating transgenic animals is now more accessible and affordable. The goals of producing transgenic animals are to 1) increase our understanding of biology and biomedical science; 2) increase our ability to produce more efficient animals; and 3) produce disease resistant animals. ZFNs, TALENs, and CRISPRs combined with gene transfer methods increase the possibility of achieving these goals.
1990-05-01
encoding the animals have shown that both cellular and humoral immune Sta58 protein antigen in E. coli. DNA sequence analysis of a responses occur after...infection, with the cellular immune 2.9-kilobase (kb) HindIl fragment carrying the Sta58 gene response being required for protection (16, 19, 25, 42...The first evidence of a 60-kDa common HtpB antigen) reacted strongly with protein antigens in the antigen family (Hsp6O) among procaryotes was based
Ren, Jianfeng; Chung-Davidson, Yu-Wen; Yeh, Chu-Yin; Scott, Camille; Brown, Titus; Li, Weiming
2015-06-06
Lampreys are extant representatives of the jawless vertebrate lineage that diverged from jawed vertebrates around 500 million years ago. Lamprey genomes contain information crucial for understanding the evolution of gene families in vertebrates. The ATP-binding cassette (ABC) gene family is found from prokaryotes to eukaryotes. The recent availability of two lamprey draft genomes from sea lamprey Petromyzon marinus and Japanese lamprey Lethenteron japonicum presents an opportunity to infer early evolutionary events of ABC genes in vertebrates. We conducted a genome-wide survey of the ABC gene family in two lamprey draft genomes. A total of 37 ABC transporters were identified and classified into seven subfamilies; namely seven ABCA genes, 10 ABCB genes, 10 ABCC genes, three ABCD genes, one ABCE gene, three ABCF genes, and three ABCG genes. The ABCA subfamily has expanded from three genes in sea squirts, seven and nine in lampreys and zebrafish, to 13 and 16 in human and mouse. Conversely, the multiple copies of ABCB1-, ABCG1-, and ABCG2-like genes found in sea squirts have contracted in the other species examined. ABCB2 and ABCB3 seem to be new additions in gnathostomes (not in sea squirts or lampreys), which coincides with the emergence of the gnathostome-specific adaptive immune system. All the genes in the ABCD, ABCE and ABCF subfamilies were conserved and had undergone limited duplication and loss events. In the sea lamprey transcriptomes, the ABCE and ABCF gene subfamilies were ubiquitously and highly expressed in all tissues while the members in other gene subfamilies were differentially expressed. Thirteen more lamprey ABC transporter genes were identified in this study compared with a previous study. By concatenating the same gene sequences from the two lampreys, more full length sequences were obtained, which significantly improved both the assignment of gene names and the phylogenetic trees compared with a previous analysis using partial sequences. The ABC
Ma, Yalin; Xiao, Yun; Zhang, Fengguo; Han, Yuechen; Li, Jianfeng; Xu, Lei; Bai, Xiaohui; Wang, Haibo
2016-04-01
Mutations in MYO7A gene have been reported to be associated with Usher Syndrome type 1B (USH1B) and nonsyndromic hearing loss (DFNB2, DFNA11). Most mutations in MYO7A gene caused USH1B, whereas only a few reported mutations led to DFNB2 and DFNA11. The current study was designed to investigate the mutations among a Chinese family with autosomal recessive hearing loss. In this study, we present the clinical, genetic and molecular characteristics of a Chinese family. Targeted capture of 127 known deafness genes and next-generation sequencing were employed to study the genetic causes of two siblings in the Chinese family. Sanger sequencing was employed to examine those variant mutations in the members of this family and other ethnicity-matched controls. We identified the novel compound heterozygous mutant alleles of MYO7A gene: a novel missense mutation c.3671C>A (p.A1224D) and a reported insert mutation c.390_391insC (p.P131PfsX9). Variants were further confirmed by Sanger sequencing. These two compound heterozygous variants were co-segregated with autosomal recessive hearing loss phenotype. The gene mutation analysis and protein sequence alignment further supported that the novel compound heterozygous mutations were pathogenic. The novel compound heterozygous mutations (c.3671C>A and c.390_391insC) in MYO7A gene identified in this study were responsible for the autosomal recessive sensorineural hearing loss of this Chinese family. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.
Animal model for schizophrenia that reflects gene-environment interactions.
Nagai, Taku; Ibi, Daisuke; Yamada, Kiyofumi
2011-01-01
Schizophrenia is a devastating psychiatric disorder that impairs mental and social functioning and affects approximately 1% of the population worldwide. Genetic susceptibility factors for schizophrenia have recently been reported, some of which are known to play a role in neurodevelopment; these include neuregulin-1, dysbindin, and disrupted-in-schizophrenia 1 (DISC1). Moreover, epidemiologic studies suggest that environmental insults, such as prenatal infection and perinatal complication, are involved in the development of schizophrenia. The possible interaction between environment and genetic susceptibility factors, especially during neurodevelopment, is proposed as a promising disease etiology of schizophrenia. Polyriboinosinic-polyribocytidilic acid (polyI : C) is a synthetic analogue of double-stranded RNA that leads to the pronounced but time-limited production of pro-inflammatory cytokines. Maternal immune activation by polyI : C exposure in rodents is known to precipitate a wide spectrum of behavioral, cognitive, and pharmacological abnormalities in adult offspring. Recently, we have reported that neonatal injection of polyI : C in mice results in schizophrenia-like behavioral alterations in adulthood. In this review, we show how gene-environment interactions during neurodevelopment result in phenotypic changes in adulthood by injecting polyI : C into transgenic mice that express a dominant-negative form of human DISC1 (DN-DISC1). Our findings suggest that polyI : C-treated DN-DISC1 mice are a well-validated animal model for schizophrenia that reflects gene-environment interactions.
A large and functionally diverse family of Fad2 genes in safflower (Carthamus tinctorius L.
Directory of Open Access Journals (Sweden)
Cao Shijiang
2013-01-01
Full Text Available Abstract Background The application and nutritional value of vegetable oil is highly dependent on its fatty acid composition, especially the relative proportion of its two major fatty acids, i.e oleic acid and linoleic acid. Microsomal oleoyl phosphatidylcholine desaturase encoded by FAD2 gene is known to introduce a double bond at the Δ12 position of an oleic acid on phosphatidylcholine and convert it to linoleic acid. The known plant FAD2 enzymes are encoded by small gene families consisting of 1-4 members. In addition to the classic oleate Δ12-desaturation activity, functional variants of FAD2 that are capable of undertaking additional or alternative acyl modifications have also been reported in a limited number of plant species. In this study, our objective was to identify FAD2 genes from safflower and analyse their differential expression profile and potentially diversified functionality. Results We report here the characterization and functional expression of an exceptionally large FAD2 gene family from safflower, and the temporal and spatial expression profiles of these genes as revealed through Real-Time quantitative PCR. The diversified functionalities of some of the safflower FAD2 gene family members were demonstrated by ectopic expression in yeast and transient expression in Nicotiana benthamiana leaves. CtFAD2-1 and CtFAD2-10 were demonstrated to be oleate desaturases specifically expressed in developing seeds and flower head, respectively, while CtFAD2-2 appears to have relatively low oleate desaturation activity throughout the plant. CtFAD2-5 and CtFAD2-8 are specifically expressed in root tissues, while CtFAD2-3, 4, 6, 7 are mostly expressed in the cotyledons and hypocotyls in young safflower seedlings. CtFAD2-9 was found to encode a novel desaturase operating on C16:1 substrate. CtFAD2-11 is a tri-functional enzyme able to introduce a carbon double bond in either cis or trans configuration, or a carbon triple (acetylenic bond
Yang, Z.; Ma, Y.; Chen, L.; Xie, R.; Zhang, X.; Zhang, B.; Lu, M.; Wu, S.; Gilissen, L.J.W.J.; Ree, van R.; Gao, Z.
2011-01-01
We analysed the temporal and spatial transcript expression of the panel of 18 putative isoallergens from four gene families (Pru p 1–4) in the peach fruit, anther and leaf of two melting cultivars, to gain insight into their expression profiles and to identify the key family members. Genotypic
Li, He; Li, Xin; Smerin, Stanley E; Zhang, Lei; Jia, Min; Xing, Guoqiang; Su, Yan A; Wen, Jillian; Benedek, David; Ursano, Robert
2014-01-01
The metabolic mechanisms underlying the development of exaggerated fear in post-traumatic stress disorder (PTSD) are not well defined. In the present study, alteration in the expression of genes associated with mitochondrial function in the amygdala of an animal model of PTSD was determined. Amygdala tissue samples were excised from 10 non-stressed control rats and 10 stressed rats, 14 days post-stress treatment. Total RNA was isolated, cDNA was synthesized, and gene expression levels were determined using a cDNA microarray. During the development of the exaggerated fear associated with PTSD, 48 genes were found to be significantly upregulated and 37 were significantly downregulated in the amygdala complex based on stringent criteria (p metabolism, one with transcriptional factors, and one with chromatin remodeling. Thus, informatics of a neuronal gene array allowed us to determine the expression profile of mitochondrial genes in the amygdala complex of an animal model of PTSD. The result is a further understanding of the metabolic and neuronal signaling mechanisms associated with delayed and exaggerated fear.
Wroblewski, Tadeusz; Piskurewicz, Urszula; Tomczak, Anna; Ochoa, Oswaldo; Michelmore, Richard W
2007-09-01
The RGC2 gene cluster in lettuce (Lactuca sativa) is one of the largest known families of genes encoding nucleotide binding site-leucine-rich repeat (NBS-LRR) proteins. One of its members, RGC2B, encodes Dm3 which determines resistance to downy mildew caused by the oomycete Bremia lactucae carrying the cognate avirulence gene, Avr3. We developed an efficient strategy for analysis of this large family of low expressed genes using post-transcriptional gene silencing (PTGS). We transformed lettuce cv. Diana (carrying Dm3) using chimeric gene constructs designed to simultaneously silence RGC2B and the GUS reporter gene via the production of interfering hairpin RNA (ihpRNA). Transient assays of GUS expression in leaves accurately predicted silencing of both genes and were subsequently used to assay silencing in transgenic T(1) plants and their offspring. Levels of mRNA were reduced not only for RGC2B but also for all seven diverse RGC2 family members tested. We then used the same strategy to show that the resistance specificity encoded by the genetically defined Dm18 locus in lettuce cv. Mariska is the result of two resistance specificities, only one of which was silenced by ihpRNA derived from RGC2B. Analysis of progeny from crosses between transgenic, silenced tester stocks and lettuce accessions carrying other resistance genes previously mapped to the RGC2 locus indicated that two additional resistance specificities to B. lactucae, Dm14 and Dm16, as well as resistance to lettuce root aphid (Pemphigus bursarius L.), Ra, are encoded by RGC2 family members.
Directory of Open Access Journals (Sweden)
jiahong yu
2016-08-01
Full Text Available The Hsp20 genes are involved in the response of plants to environment stresses including heat shock and also play a vital role in plant growth and development. They represent the most abundant small heat shock proteins (sHsps in plants, but little is known about this family in tomato (Solanum lycopersicum, an important vegetable crop in the world. Here, we characterized heat shock protein 20 (SlHsp20 gene family in tomato through integration of gene structure, chromosome location, phylogenetic relationship and expression profile. Using bioinformatics-based methods, we identified at least 42 putative SlHsp20 genes in tomato. Sequence analysis revealed that most of SlHsp20 genes possessed no intron or a relatively short intron in length. Chromosome mapping indicated that inter-arm and intra-chromosome duplication events contributed remarkably to the expansion of SlHsp20 genes. Phylogentic tree of Hsp20 genes from tomato and other plant species revealed that SlHsp20 genes were grouped into 13 subfamilies, indicating that these genes may have a common ancestor that generated diverse subfamilies prior to the mono-dicot split. In addition, expression analysis using RNA-seq in various tissues and developmental stages of cultivated tomato and the wild relative Solanum pimpinellifolium revealed that most of these genes (83% were expressed in at least one stage from at least one genotype. Out of 42 genes, 4 genes were expressed constitutively in almost all the tissues analyzed, implying that these genes might have specific housekeeping function in tomato cell under normal growth conditions. Two SlHsp20 genes displayed differential expression levels between cultivated tomato and S. pimpinellifolium in vegetative (leaf and root and reproductive organs (floral bud and flower, suggesting inter-species diversification for functional specialization during the process of domestication. Based on genome-wide microarray analysis, we showed that the transcript
Yu, Jiahong; Cheng, Yuan; Feng, Kun; Ruan, Meiying; Ye, Qingjing; Wang, Rongqing; Li, Zhimiao; Zhou, Guozhi; Yao, Zhuping; Yang, Yuejian; Wan, Hongjian
2016-01-01
The Hsp20 genes are involved in the response of plants to environment stresses including heat shock and also play a vital role in plant growth and development. They represent the most abundant small heat shock proteins (sHsps) in plants, but little is known about this family in tomato (Solanum lycopersicum), an important vegetable crop in the world. Here, we characterized heat shock protein 20 (SlHsp20) gene family in tomato through integration of gene structure, chromosome location, phylogenetic relationship, and expression profile. Using bioinformatics-based methods, we identified at least 42 putative SlHsp20 genes in tomato. Sequence analysis revealed that most of SlHsp20 genes possessed no intron or a relatively short intron in length. Chromosome mapping indicated that inter-arm and intra-chromosome duplication events contributed remarkably to the expansion of SlHsp20 genes. Phylogentic tree of Hsp20 genes from tomato and other plant species revealed that SlHsp20 genes were grouped into 13 subfamilies, indicating that these genes may have a common ancestor that generated diverse subfamilies prior to the mono-dicot split. In addition, expression analysis using RNA-seq in various tissues and developmental stages of cultivated tomato and the wild relative Solanum pimpinellifolium revealed that most of these genes (83%) were expressed in at least one stage from at least one genotype. Out of 42 genes, 4 genes were expressed constitutively in almost all the tissues analyzed, implying that these genes might have specific housekeeping function in tomato cell under normal growth conditions. Two SlHsp20 genes displayed differential expression levels between cultivated tomato and S. pimpinellifolium in vegetative (leaf and root) and reproductive organs (floral bud and flower), suggesting inter-species diversification for functional specialization during the process of domestication. Based on genome-wide microarray analysis, we showed that the transcript levels of SlHsp20
Selection signature in domesticated animals.
Pan, Zhang-yuan; He, Xiao-yun; Wang, Xiang-yu; Guo, Xiao-fei; Cao, Xiao-han; Hu, Wen-ping; Di, Ran; Liu, Qiu-yue; Chu, Ming-xing
2016-12-20
Domesticated animals play an important role in the life of humanity. All these domesticated animals undergo same process, first domesticated from wild animals, then after long time natural and artificial selection, formed various breeds that adapted to the local environment and human needs. In this process, domestication, natural and artificial selection will leave the selection signal in the genome. The research on these selection signals can find functional genes directly, is one of the most important strategies in screening functional genes. The current studies of selection signal have been performed in pigs, chickens, cattle, sheep, goats, dogs and other domestic animals, and found a great deal of functional genes. This paper provided an overview of the types and the detected methods of selection signal, and outlined researches of selection signal in domestic animals, and discussed the key issues in selection signal analysis and its prospects.
Mutation analysis of GJB2 gene and prenatal diagnosis in a non-syndromic deafness family
Directory of Open Access Journals (Sweden)
Xiao-hua CHEN
2014-08-01
Full Text Available Objective To identify the pathogenic gene in a non-syndromic deafness family, provide an accurate genetic consultation and early intervention for deaf family to reduce the incidence of congenital deafness. Methods Mutation analysis was carried out by polymerase chain reaction followed by DNA sequencing of coding region of GJB2 gene. The fetal DNA was extracted from the amniotic fluid cells by amniocentesis at 20 weeks during pregnancy. The genotype of the fetus was characterized for predicting the status of hearing. Results Complex heterozygous mutations 235delC and 176-191del16bp were detected in the proband of the family, heterozygous mutation 176-191del16bp was detected in the father, and 235delC was detected in the mother. Fetus carried 235delC heterozygous mutation inherited from his mother. Conclusions The proband's hearing loss is resulted from the complex heterozygous mutations 235delC and 176-191del16bp in GJB2 gene. Fetus is a heterozygous mutation 235delC carrier. Prenatal diagnosis for deafness assisted by genetic test can provide efficient guidance about offspring's hearing condition, and prevent another deaf-mute member from birth. DOI: 10.11855/j.issn.0577-7402.2014.07.09
Lifescience Database Archive (English)
Full Text Available ineryof gene regulation by the IRF family of transcription factors. Taniguchi T, Takaoka A. Curr Opin Immuno...sponses: a multimodal machineryof gene regulation by the IRF family of transcript...achineryof gene regulation by the IRF family of transcription factors. Authors Taniguchi T, Takaoka A. Publi
Sharma, Ranu; Rawat, Vimal; Suresh, C G
2017-12-01
The nucleotide binding site-leucine rich repeat (NBS-LRR) proteins play an important role in the defense mechanisms against pathogens. Using bioinformatics approach, we identified and annotated 104 NBS-LRR genes in chickpea. Phylogenetic analysis points to their diversification into two families namely TIR-NBS-LRR and non-TIR-NBS-LRR. Gene architecture revealed intron gain/loss events in this resistance gene family during their independent evolution into two families. Comparative genomics analysis elucidated its evolutionary relationship with other fabaceae species. Around 50% NBS-LRRs reside in macro-syntenic blocks underlining positional conservation along with sequence conservation of NBS-LRR genes in chickpea. Transcriptome sequencing data provided evidence for their transcription and tissue-specific expression. Four cis -regulatory elements namely WBOX, DRE, CBF, and GCC boxes, that commonly occur in resistance genes, were present in the promoter regions of these genes. Further, the findings will provide a strong background to use candidate disease resistance NBS-encoding genes and identify their specific roles in chickpea.
DEFF Research Database (Denmark)
Aoude, Lauren G; Wadt, Karin A W; Pritchard, Antonia L
2015-01-01
Twenty years ago, the first familial melanoma susceptibility gene, CDKN2A, was identified. Two years later, another high-penetrance gene, CDK4, was found to be responsible for melanoma development in some families. Progress in identifying new familial melanoma genes was subsequently slow; however...
Pérez-Bravo, Francisco; Martinez-Laso, Jorge; Martin-Villa, Jose M; Moscoso, Juan; Moreno, Almudena; Serrano-Vela, Juan I; Zamora, Jorge; Asenjo, Silvia; Gleisner, Andrea; Arnaiz-Villena, Antonio
2006-01-01
A rare case of type I diabetes is studied in an Amerindian (Mapuche) family from Chile, analyzing glutamic acid decarboxylase, islet-cell autoantibodies and human leukocyte antigen (HLA) genes. The affected sib is the only one that has one specific HLA haplotype combination that differs from the other sibs only in the HLA class I genes. It is concluded that HLA diabetes susceptibility factors may be placed outside the class II region or even that susceptibility factors do not exist in the HLA region in this Amerindian family.
[Phylogeny of protostome moulting animals (Ecdysozoa) inferred from 18 and 28S rRNA gene sequences].
Petrov, N B; Vladychenskaia, N S
2005-01-01
Reliability of reconstruction of phylogenetic relationships within a group of protostome moulting animals was evaluated by means of comparison of 18 and 28S rRNA gene sequences sets both taken separately and combined. Reliability of reconstructions was evaluated by values of the bootstrap support of major phylogenetic tree nodes and by degree of congruence of phylogenetic trees inferred by various methods. By both criteria, phylogenetic trees reconstructed from the combined 18 and 28S rRNA gene sequences were better than those inferred from 18 and 28S sequences taken separately. Results obtained are consistent with phylogenetic hypothesis separating protostome animals into two major clades, moulting Ecdysozoa (Priapulida + Kinorhyncha, Nematoda + Nematomorpha, Onychophora + Tardigrada, Myriapoda + Chelicerata, Crustacea + Hexapoda) and unmoulting Lophotrochozoa (Plathelminthes, Nemertini, Annelida, Mollusca, Echiura, Sipuncula). Clade Cephalorhyncha does not include nematomorphs (Nematomorpha). Conclusion was taken that it is necessary to use combined 18 and 28S data in phylogenetic studies.
Institute of Scientific and Technical Information of China (English)
Yao-hua KE; Chun WANG; Yun-qiu HU; Miao LI; Yu-juan LIU; Wen-zhen FU; Zhen-lin ZHANG; Wen-jin XIAO; Jin-wei HE; Hao ZHANG; Jin-bo YU; Wei-wei HU; Jie-mei GU; Gao GAO; Hua YUE
2012-01-01
Aim:Genetic variation in ALOX12,which encoded human 12-lipoxygenase,was found to be associated with fat mass in young Chinese men.The objective of this study was to investigate the relationship between single nucleotide polymorphisms (SNPs) and haplotypes in the ALOX15 gene and obesity-related phenotypes in Chinese nuclear families with male offspring.Methods:We recruited 1,296 subjects from 427 nuclear families with male offspring and genotyped five SNPs (rs9894225,rs748694,rs2619112,rs2619118,and rs916055) in the ALOX15 gene locus.The total fat mass (TFM),trunk fat mass (tFM),leg fat mass (LFM) and arm fat mass (AFM) were measured using dual-energy X-ray absorptiometry (DXA).The percentage of fat mass (PFM) was the ratio of TFM and body weight.The association between SNPs and haplotypes of ALOX15 and obesity-related phenotypic variation was measured using quantitative transmission disequilibrium test (QTDT).Results:Using QTDT to measure family-based genetic association,we found that rs916055 had a statistically significant association with PFM (P=0.038),whereas rs916055 had a marginal but statistically insignificant association with tFM (P=0.093).The multipleparameter 1000 permutations test agreed with the family-based association results:both showed that rs916055 had a statistically significant association with PFM (P=0.033).Conclusion:rs916055 in ALOX15 gene was significantly associated with the percentage of fat mass in Chinese nuclear families with male offspring in the family-based association study using QTDT approach.
Identification of ALK as the Major Familial Neuroblastoma Predisposition Gene
Mossë, Yalë P; Laudenslager, Marci; Longo, Luca; Cole, Kristina A; Wood, Andrew; Attiyeh, Edward F; Laquaglia, Michael J; Sennett, Rachel; Lynch, Jill E; Perri, Patrizia; Laureys, Geneviève; Speleman, Frank; Hakonarson, Hakon; Torkamani, Ali; Schork, Nicholas J; Brodeur, Garrett M; Tonini, Gian Paolo; Rappaport, Eric; Devoto, Marcella; Maris, John M
2009-01-01
SUMMARY Survival rates for the childhood cancer neuroblastoma have not substantively improved despite dramatic escalation in chemotherapy intensity. Like most human cancers, this embryonal malignancy can be inherited, but the genetic etiology of familial and sporadically occurring neuroblastoma was largely unknown. Here we show that germline mutations in the anaplastic lymphoma kinase gene (ALK) explain the majority of hereditary neuroblastomas, and that activating mutations can also be somatically acquired. We first identified a significant linkage signal at the short arm of chromosome 2 (maximum nonparametric LOD=4.23 at rs1344063) using a whole-genome scan in neuroblastoma pedigrees. Resequencing of regional candidate genes identified three separate missense mutations in the tyrosine kinase domain of ALK (G1128A, R1192P and R1275Q) that segregated with the disease in eight separate families. Examination of 491 sporadically occurring human neuroblastoma samples showed that the ALK locus was gained in 22.8%, and highly amplified in an additional 3.3%, and that these aberrations were highly associated with death from disease (P=0.0003). Resequencing of 194 high-risk neuroblastoma samples showed somatically acquired mutations within the tyrosine kinase domain in 12.4%. Nine of the ten mutations map to critical regions of the kinase domain and were predicted to be oncogenic drivers with high probability. Mutations resulted in constitutive phosphorylation consistent with activation, and targeted knockdown of ALK mRNA resulted in profound growth inhibition of 4 of 4 cell lines harboring mutant or amplified ALK, as well as 2 of 6 wild type for ALK. Our results demonstrate that heritable mutations of ALK are the major cause of familial neuroblastoma, and that germline or acquired activation of this cell surface kinase is a tractable therapeutic target for this lethal pediatric malignancy. PMID:18724359
Directory of Open Access Journals (Sweden)
Gadagkar Sudhindra R
2010-04-01
Full Text Available Abstract Background The completion of 19 insect genome sequencing projects spanning six insect orders provides the opportunity to investigate the evolution of important gene families, here tubulins. Tubulins are a family of eukaryotic structural genes that form microtubules, fundamental components of the cytoskeleton that mediate cell division, shape, motility, and intracellular trafficking. Previous in vivo studies in Drosophila find a stringent relationship between tubulin structure and function; small, biochemically similar changes in the major alpha 1 or testis-specific beta 2 tubulin protein render each unable to generate a motile spermtail axoneme. This has evolutionary implications, not a single non-synonymous substitution is found in beta 2 among 17 species of Drosophila and Hirtodrosophila flies spanning 60 Myr of evolution. This raises an important question, How do tubulins evolve while maintaining their function? To answer, we use molecular evolutionary analyses to characterize the evolution of insect tubulins. Results Sixty-six alpha tubulins and eighty-six beta tubulin gene copies were retrieved and subjected to molecular evolutionary analyses. Four ancient clades of alpha and beta tubulins are found in insects, a major isoform clade (alpha 1, beta 1 and three minor, tissue-specific clades (alpha 2-4, beta 2-4. Based on a Homarus americanus (lobster outgroup, these were generated through gene duplication events on major beta and alpha tubulin ancestors, followed by subfunctionalization in expression domain. Strong purifying selection acts on all tubulins, yet maximum pairwise amino acid distances between tubulin paralogs are large (0.464 substitutions/site beta tubulins, 0.707 alpha tubulins. Conversely orthologs, with the exception of reproductive tissue isoforms, show little sequence variation except in the last 15 carboxy terminus tail (CTT residues, which serve as sites for post-translational modifications (PTMs and interactions
Lalwani, A K; Attaie, A; Randolph, F T; Deshmukh, D; Wang, C; Mhatre, A; Wilcox, E
1998-12-04
Waardenburg syndrome (WS) is an autosomal-dominant neural crest cell disorder phenotypically characterized by hearing impairment and disturbance of pigmentation. A presence of dystopia canthorum is indicative of WS type 1, caused by loss of function mutation in the PAX3 gene. In contrast, type 2 WS (WS2) is characterized by normally placed medial canthi and is genetically heterogeneous; mutations in MITF (microphthalmia associated transcription factor) associated with WS2 have been identified in some but not all affected families. Here, we report on a three-generation Indian family with a point mutation in the MITF gene causing WS2. This mutation, initially reported in a Northern European family, creates a stop codon in exon 7 and is predicted to result in a truncated protein lacking the HLH-Zip or Zip structure necessary for normal interaction with its target DNA motif. Comparison of the phenotype between the two families demonstrates a significant difference in pigmentary disturbance of the eye. This family, with the first documented case of two unrelated WS2 families harboring identical mutations, provides additional evidence for the importance of genetic background on the clinical phenotype.
Directory of Open Access Journals (Sweden)
Naeem Muhammad
2011-07-01
Full Text Available Abstract Lipoid proteinosis is a rare autosomal recessive disease characterized by cutaneous and mucosal lesions and hoarseness appearing in early childhood that is caused by homozygous or compound heterozygous mutations in the ECM1 gene located on chromosome 1q21. The aim of the study was to investigate the molecular genetic defect underlying lipoid proteinosis in a consanguineous Pakistani family. Methods Genotyping of seven members of the family was performed by amplifying microsatellite markers, tightly linked to the ECM1 gene. To screen for mutations in the ECM1 gene, all of its exons and splice junctions were PCR amplified from genomic DNA and analyzed by SSCP and sequenced directly in an ABI 3130 genetic analyzer. Results The results revealed linkage of the LP family to the ECM1 locus. Sequence analysis of the coding exons and splice junctions of the ECM1 gene revealed a novel homozygous mutation (c.616C > T in exon 6, predicted to replace glutamine with stop codon (p.Q206X at amino acid position 206. Conclusions The finding of a novel mutation in Pakistani family extends the body of evidence that supports the importance of ECM1 gene for the development of lipoid proteinosis.
Directory of Open Access Journals (Sweden)
Toub Omid
2010-10-01
Full Text Available Abstract Background Terpenoids are among the most important constituents of grape flavour and wine bouquet, and serve as useful metabolite markers in viticulture and enology. Based on the initial 8-fold sequencing of a nearly homozygous Pinot noir inbred line, 89 putative terpenoid synthase genes (VvTPS were predicted by in silico analysis of the grapevine (Vitis vinifera genome assembly 1. The finding of this very large VvTPS family, combined with the importance of terpenoid metabolism for the organoleptic properties of grapevine berries and finished wines, prompted a detailed examination of this gene family at the genomic level as well as an investigation into VvTPS biochemical functions. Results We present findings from the analysis of the up-dated 12-fold sequencing and assembly of the grapevine genome that place the number of predicted VvTPS genes at 69 putatively functional VvTPS, 20 partial VvTPS, and 63 VvTPS probable pseudogenes. Gene discovery and annotation included information about gene architecture and chromosomal location. A dense cluster of 45 VvTPS is localized on chromosome 18. Extensive FLcDNA cloning, gene synthesis, and protein expression enabled functional characterization of 39 VvTPS; this is the largest number of functionally characterized TPS for any species reported to date. Of these enzymes, 23 have unique functions and/or phylogenetic locations within the plant TPS gene family. Phylogenetic analyses of the TPS gene family showed that while most VvTPS form species-specific gene clusters, there are several examples of gene orthology with TPS of other plant species, representing perhaps more ancient VvTPS, which have maintained functions independent of speciation. Conclusions The highly expanded VvTPS gene family underpins the prominence of terpenoid metabolism in grapevine. We provide a detailed experimental functional annotation of 39 members of this important gene family in grapevine and comprehensive information
Expression analysis of the CLCA gene family in mouse and human with emphasis on the nervous system
M. Piirsoo (Marko); D. Meijer (Daniëlle); T. Timmusk (Tnis)
2009-01-01
textabstractBackground. Members of the calcium-activated chloride channel (CLCA) gene family have been suggested to possess a variety of functions including cell adhesion and tumor suppression. Expression of CLCA family members has mostly been analyzed in non-neural tissues. Here we describe the
2012-01-01
Background The glycosylation process, catalyzed by ubiquitous glycosyltransferase (GT) family enzymes, is a prevalent modification of plant secondary metabolites that regulates various functions such as hormone homeostasis, detoxification of xenobiotics and biosynthesis and storage of secondary metabolites. Flax (Linum usitatissimum L.) is a commercially grown oilseed crop, important because of its essential fatty acids and health promoting lignans. Identification and characterization of UDP glycosyltransferase (UGT) genes from flax could provide valuable basic information about this important gene family and help to explain the seed specific glycosylated metabolite accumulation and other processes in plants. Plant genome sequencing projects are useful to discover complexity within this gene family and also pave way for the development of functional genomics approaches. Results Taking advantage of the newly assembled draft genome sequence of flax, we identified 137 UDP glycosyltransferase (UGT) genes from flax using a conserved signature motif. Phylogenetic analysis of these protein sequences clustered them into 14 major groups (A-N). Expression patterns of these genes were investigated using publicly available expressed sequence tag (EST), microarray data and reverse transcription quantitative real time PCR (RT-qPCR). Seventy-three per cent of these genes (100 out of 137) showed expression evidence in 15 tissues examined and indicated varied expression profiles. The RT-qPCR results of 10 selected genes were also coherent with the digital expression analysis. Interestingly, five duplicated UGT genes were identified, which showed differential expression in various tissues. Of the seven intron loss/gain positions detected, two intron positions were conserved among most of the UGTs, although a clear relationship about the evolution of these genes could not be established. Comparison of the flax UGTs with orthologs from four other sequenced dicot genomes indicated that
Directory of Open Access Journals (Sweden)
Barvkar Vitthal T
2012-05-01
Full Text Available Abstract Background The glycosylation process, catalyzed by ubiquitous glycosyltransferase (GT family enzymes, is a prevalent modification of plant secondary metabolites that regulates various functions such as hormone homeostasis, detoxification of xenobiotics and biosynthesis and storage of secondary metabolites. Flax (Linum usitatissimum L. is a commercially grown oilseed crop, important because of its essential fatty acids and health promoting lignans. Identification and characterization of UDP glycosyltransferase (UGT genes from flax could provide valuable basic information about this important gene family and help to explain the seed specific glycosylated metabolite accumulation and other processes in plants. Plant genome sequencing projects are useful to discover complexity within this gene family and also pave way for the development of functional genomics approaches. Results Taking advantage of the newly assembled draft genome sequence of flax, we identified 137 UDP glycosyltransferase (UGT genes from flax using a conserved signature motif. Phylogenetic analysis of these protein sequences clustered them into 14 major groups (A-N. Expression patterns of these genes were investigated using publicly available expressed sequence tag (EST, microarray data and reverse transcription quantitative real time PCR (RT-qPCR. Seventy-three per cent of these genes (100 out of 137 showed expression evidence in 15 tissues examined and indicated varied expression profiles. The RT-qPCR results of 10 selected genes were also coherent with the digital expression analysis. Interestingly, five duplicated UGT genes were identified, which showed differential expression in various tissues. Of the seven intron loss/gain positions detected, two intron positions were conserved among most of the UGTs, although a clear relationship about the evolution of these genes could not be established. Comparison of the flax UGTs with orthologs from four other sequenced dicot
Ampomah-Dwamena, Charles; Driedonks, Nicky; Lewis, David; Shumskaya, Maria; Chen, Xiuyin; Wurtzel, Eleanore T; Espley, Richard V; Allan, Andrew C
2015-07-28
Carotenoid compounds play essential roles in plants such as protecting the photosynthetic apparatus and in hormone signalling. Coloured carotenoids provide yellow, orange and red colour to plant tissues, as well as offering nutritional benefit to humans and animals. The enzyme phytoene synthase (PSY) catalyses the first committed step of the carotenoid biosynthetic pathway and has been associated with control of pathway flux. We characterised four PSY genes found in the apple genome to further understand their involvement in fruit carotenoid accumulation. The apple PSY gene family, containing six members, was predicted to have three functional members, PSY1, PSY2, and PSY4, based on translation of the predicted gene sequences and/or corresponding cDNAs. However, only PSY1 and PSY2 showed activity in a complementation assay. Protein localisation experiments revealed differential localization of the PSY proteins in chloroplasts; PSY1 and PSY2 localized to the thylakoid membranes, while PSY4 localized to plastoglobuli. Transcript levels in 'Granny Smith' and 'Royal Gala' apple cultivars showed PSY2 was most highly expressed in fruit and other vegetative tissues. We tested the transient activation of the apple PSY1 and PSY2 promoters and identified potential and differential regulation by AP2/ERF transcription factors, which suggested that the PSY genes are controlled by different transcriptional mechanisms. The first committed carotenoid pathway step in apple is controlled by MdPSY1 and MdPSY2, while MdPSY4 play little or no role in this respect. This has implications for apple breeding programmes where carotenoid enhancement is a target and would allow co-segregation with phenotypes to be tested during the development of new cultivars.
Directory of Open Access Journals (Sweden)
James Timothy Y
2009-06-01
Full Text Available Abstract Background Many fungi are obligate biotrophs of plants, growing in live plant tissues, gaining direct access to recently photosynthesized carbon. Photosynthate within plants is transported from source to sink tissues as sucrose, which is hydrolyzed by plant glycosyl hydrolase family 32 enzymes (GH32 into its constituent monosaccharides to meet plant cellular demands. A number of plant pathogenic fungi also use GH32 enzymes to access plant-derived sucrose, but less is known about the sucrose utilization ability of mutualistic and commensal plant biotrophic fungi, such as mycorrhizal and endophytic fungi. The aim of this study was to explore the distribution and abundance of GH32 genes in fungi to understand how sucrose utilization is structured within and among major ecological guilds and evolutionary lineages. Using bioinformatic and PCR-based analyses, we tested for GH32 gene presence in all available fungal genomes and an additional 149 species representing a broad phylogenetic and ecological range of biotrophic fungi. Results We detected 9 lineages of GH32 genes in fungi, 4 of which we describe for the first time. GH32 gene number in fungal genomes ranged from 0–12. Ancestral state reconstruction of GH32 gene abundance showed a strong correlation with nutritional mode, and gene family expansion was observed in several clades of pathogenic filamentous Ascomycota species. GH32 gene number was negatively correlated with animal pathogenicity and positively correlated with plant biotrophy, with the notable exception of mycorrhizal taxa. Few mycorrhizal species were found to have GH32 genes as compared to other guilds of plant-associated fungi, such as pathogens, endophytes and lichen-forming fungi. GH32 genes were also more prevalent in the Ascomycota than in the Basidiomycota. Conclusion We found a strong signature of both ecological strategy and phylogeny on GH32 gene number in fungi. These data suggest that plant biotrophic fungi
Hou, Hongmin; Li, Jun; Gao, Min; Singer, Stacy D.; Wang, Hao; Mao, Linyong; Fei, Zhangjun; Wang, Xiping
2013-01-01
Background The SBP-box gene family is specific to plants and encodes a class of zinc finger-containing transcription factors with a broad range of functions. Although SBP-box genes have been identified in numerous plants including green algae, moss, silver birch, snapdragon, Arabidopsis, rice and maize, there is little information concerning SBP-box genes, or the corresponding miR156/157, function in grapevine. Methodology/Principal Findings Eighteen SBP-box gene family members were identified in Vitis vinifera, twelve of which bore sequences that were complementary to miRNA156/157. Phylogenetic reconstruction demonstrated that plant SBP-domain proteins could be classified into seven subgroups, with the V. vinifera SBP-domain proteins being more closely related to SBP-domain proteins from dicotyledonous angiosperms than those from monocotyledonous angiosperms. In addition, synteny analysis between grape and Arabidopsis demonstrated that homologs of several grape SBP genes were found in corresponding syntenic blocks of Arabidopsis. Expression analysis of the grape SBP-box genes in various organs and at different stages of fruit development in V. quinquangularis ‘Shang-24’ revealed distinct spatiotemporal patterns. While the majority of the grape SBP-box genes lacking a miR156/157 target site were expressed ubiquitously and constitutively, most genes bearing a miR156/157 target site exhibited distinct expression patterns, possibly due to the inhibitory role of the microRNA. Furthermore, microarray data mining and quantitative real-time RT-PCR analysis identified several grape SBP-box genes that are potentially involved in the defense against biotic and abiotic stresses. Conclusion The results presented here provide a further understanding of SBP-box gene function in plants, and yields additional insights into the mechanism of stress management in grape, which may have important implications for the future success of this crop. PMID:23527172
Baroncelli, Riccardo; Amby, Daniel Buchvaldt; Zapparata, Antonio; Sarrocco, Sabrina; Vannacci, Giovanni; Le Floch, Gaétan; Harrison, Richard J; Holub, Eric; Sukno, Serenella A; Sreenivasaprasad, Surapareddy; Thon, Michael R
2016-08-05
Many species belonging to the genus Colletotrichum cause anthracnose disease on a wide range of plant species. In addition to their economic impact, the genus Colletotrichum is a useful model for the study of the evolution of host specificity, speciation and reproductive behaviors. Genome projects of Colletotrichum species have already opened a new era for studying the evolution of pathogenesis in fungi. We sequenced and annotated the genomes of four strains in the Colletotrichum acutatum species complex (CAsc), a clade of broad host range pathogens within the genus. The four CAsc proteomes and secretomes along with those representing an additional 13 species (six Colletotrichum spp. and seven other Sordariomycetes) were classified into protein families using a variety of tools. Hierarchical clustering of gene family and functional domain assignments, and phylogenetic analyses revealed lineage specific losses of carbohydrate-active enzymes (CAZymes) and proteases encoding genes in Colletotrichum species that have narrow host range as well as duplications of these families in the CAsc. We also found a lineage specific expansion of necrosis and ethylene-inducing peptide 1 (Nep1)-like protein (NLPs) families within the CAsc. This study illustrates the plasticity of Colletotrichum genomes, and shows that major changes in host range are associated with relatively recent changes in gene content.
Novel glucokinase gene mutation in the first Macedonian family tested for MODY.
Kocova, M; Elblova, L; Pruhova, S; Lebl, J; Dusatkova, P
2017-08-01
We present a boy with mild hyperglycemia detected during an upper respiratory infection. Novel splicing mutation in the intron 1 of the GCK gene (c.45+1G>A) was detected, and was subsequently confirmed in his father. This is the first case of genetically confirmed Macedonian family with MODY. Copyright © 2017 Elsevier B.V. All rights reserved.
Molecular Evolution and Expression Divergence of HMT Gene Family in Plants
Directory of Open Access Journals (Sweden)
Man Zhao
2018-04-01
Full Text Available Homocysteine methyltransferase (HMT converts homocysteine to methionine using S-methylmethionine (SMM or S-adenosylmethionine (SAM as methyl donors in organisms, playing an important role in supplying methionine for the growth and the development of plants. To better understand the functions of the HMT genes in plants, we conducted a wide evolution and expression analysis of these genes. Reconstruction of the phylogenetic relationship showed that the HMT gene family was divided into Class 1 and Class 2. In Class 1, HMTs were only found in seed plants, while Class 2 presented in all land plants, which hinted that the HMT genes might have diverged in seed plants. The analysis of gene structures and selection pressures showed that they were relatively conserved during evolution. However, type I functional divergence had been detected in the HMTs. Furthermore, the expression profiles of HMTs showed their distinct expression patterns in different tissues, in which some HMTs were widely expressed in various organs, whereas the others were highly expressed in some specific organs, such as seeds or leaves. Therefore, according to our results in the evolution, functional divergence, and expression, the HMT genes might have diverged during evolution. Further analysis in the expression patterns of AthHMTs with their methyl donors suggested that the diverged HMTs might be related to supply methionine for the development of plant seeds.
Directory of Open Access Journals (Sweden)
Power Deborah M
2010-12-01
Full Text Available Abstract Background Parathyroid hormone (PTH and PTH-related peptide (PTHrP belong to a family of endocrine factors that share a highly conserved N-terminal region (amino acids 1-34 and play key roles in calcium homeostasis, bone formation and skeletal development. Recently, PTH-like peptide (PTH-L was identified in teleost fish raising questions about the evolution of these proteins. Although PTH and PTHrP have been intensively studied in mammals their function in other vertebrates is poorly documented. Amphibians and birds occupy unique phylogenetic positions, the former at the transition of aquatic to terrestrial life and the latter at the transition to homeothermy. Moreover, both organisms have characteristics indicative of a complex system in calcium regulation. This study investigated PTH family evolution in vertebrates with special emphasis on Xenopus and chicken. Results The PTH-L gene is present throughout the vertebrates with the exception of placental mammals. Gene structure of PTH and PTH-L seems to be conserved in vertebrates while PTHrP gene structure is divergent and has acquired new exons and alternative promoters. Splice variants of PTHrP and PTH-L are common in Xenopus and chicken and transcripts of the former have a widespread tissue distribution, although PTH-L is more restricted. PTH is widely expressed in fish tissue but from Xenopus to mammals becomes largely restricted to the parathyroid gland. The N-terminal (1-34 region of PTH, PTHrP and PTH-L in Xenopus and chicken share high sequence conservation and the capacity to modify calcium fluxes across epithelia suggesting a conserved role in calcium metabolism possibly via similar receptors. Conclusions The parathyroid hormone family contains 3 principal members, PTH, PTHrP and the recently identified PTH-L. In teleosts there are 5 genes which encode PTHrP (2, PTH (2 and PTH-L and in tetrapods there are 3 genes (PTHrP, PTH and PTH-L, the exception is placental mammals which
International Nuclear Information System (INIS)
Graña, Martin; Bellinzoni, Marco; Miras, Isabelle; Fiez-Vandal, Cedric; Haouz, Ahmed; Shepard, William; Buschiazzo, Alejandro; Alzari, Pedro M.
2009-01-01
The crystal structure of Rv2714, a protein of unknown function from M. tuberculosis, has been determined at 2.6 Å resolution using single-wavelength anomalous diffraction methods. The gene Rv2714 from Mycobacterium tuberculosis, which codes for a hypothetical protein of unknown function, is a representative member of a gene family that is largely confined to the order Actinomycetales of Actinobacteria. Sequence analysis indicates the presence of two paralogous genes in most mycobacterial genomes and suggests that gene duplication was an ancient event in bacterial evolution. The crystal structure of Rv2714 has been determined at 2.6 Å resolution, revealing a trimer in which the topology of the protomer core is similar to that observed in a functionally diverse set of enzymes, including purine nucleoside phosphorylases, some carboxypeptidases, bacterial peptidyl-tRNA hydrolases and even the plastidic form of an intron splicing factor. However, some structural elements, such as a β-hairpin insertion involved in protein oligomerization and a C-terminal α-helical domain that serves as a lid to the putative substrate-binding (or ligand-binding) site, are only found in Rv2714 bacterial homologues and represent specific signatures of this protein family
Energy Technology Data Exchange (ETDEWEB)
Graña, Martin; Bellinzoni, Marco [Institut Pasteur, Unité de Biochimie Structurale, URA CNRS 2185, 25 Rue du Dr Roux, 75724 Paris (France); Miras, Isabelle; Fiez-Vandal, Cedric; Haouz, Ahmed; Shepard, William [Institut Pasteur, Plate-forme de Cristallogenèse et Diffraction des Rayons X, 25 Rue du Dr Roux, 75724 Paris (France); Buschiazzo, Alejandro; Alzari, Pedro M., E-mail: alzari@pasteur.fr [Institut Pasteur, Unité de Biochimie Structurale, URA CNRS 2185, 25 Rue du Dr Roux, 75724 Paris (France)
2009-10-01
The crystal structure of Rv2714, a protein of unknown function from M. tuberculosis, has been determined at 2.6 Å resolution using single-wavelength anomalous diffraction methods. The gene Rv2714 from Mycobacterium tuberculosis, which codes for a hypothetical protein of unknown function, is a representative member of a gene family that is largely confined to the order Actinomycetales of Actinobacteria. Sequence analysis indicates the presence of two paralogous genes in most mycobacterial genomes and suggests that gene duplication was an ancient event in bacterial evolution. The crystal structure of Rv2714 has been determined at 2.6 Å resolution, revealing a trimer in which the topology of the protomer core is similar to that observed in a functionally diverse set of enzymes, including purine nucleoside phosphorylases, some carboxypeptidases, bacterial peptidyl-tRNA hydrolases and even the plastidic form of an intron splicing factor. However, some structural elements, such as a β-hairpin insertion involved in protein oligomerization and a C-terminal α-helical domain that serves as a lid to the putative substrate-binding (or ligand-binding) site, are only found in Rv2714 bacterial homologues and represent specific signatures of this protein family.
Calcitonin gene related family peptides: importance in normal placental and fetal development.
Yallampalli, Chandra; Chauhan, Madhu; Endsley, Janice; Sathishkumar, Kunju
2014-01-01
Synchronized molecular and cellular events occur between the uterus and the implanting embryo to facilitate successful pregnancy outcome. Nevertheless, the molecular signaling network that coordinates strategies for successful decidualization, placentation and fetal growth are not well understood. The discovery of calcitonin/calcitonin gene-related peptides (CT/CGRP) highlighted new signaling mediators in various physiological processes, including reproduction. It is known that CGRP family peptides including CGRP, adrenomedulin and intermedin play regulatory functions during implantation, trophoblast proliferation and invasion, and fetal organogenesis. In addition, all the CGRP family peptides and their receptor components are found to be expressed in decidual, placental and fetal tissues. Additionally, plasma levels of peptides of the CGRP family were found to fluctuate during normal gestation and to induce placental cellular differentiation, proliferation, and critical hormone signaling. Moreover, aberrant signaling of these CGRP family peptides during gestation has been associated with pregnancy disorders. It indicates the existence of a possible regulatory role for these molecules during decidualization and placentation processes, which are known to be particularly vulnerable. In this review, the influence of the CGRP family peptides in these critical processes is explored and discussed.
Shaw, Lindsay M; McIntyre, C Lynne; Gresshoff, Peter M; Xue, Gang-Ping
2009-11-01
DNA binding with One Finger (Dof) protein is a plant-specific transcription factor implicated in the regulation of many important plant-specific processes, including photosynthesis and carbohydrate metabolism. This study has identified 31 Dof genes (TaDof) in bread wheat through extensive analysis of current nucleotide databases. Phylogenetic analysis suggests that the TaDof family can be divided into four clades. Expression analysis of the TaDof family across all major organs using quantitative RT-PCR and searches of the wheat genome array database revealed that the majority of TaDof members were predominately expressed in vegetative organs. A large number of TaDof members were down-regulated by drought and/or were responsive to the light and dark cycle. Further expression analysis revealed that light up-regulated TaDof members were highly correlated in expression with a number of genes that are involved in photosynthesis or sucrose transport. These data suggest that the TaDof family may have an important role in light-mediated gene regulation, including involvement in the photosynthetic process.
Recent advances in the development of new transgenic animal technology.
Miao, Xiangyang
2013-03-01
Transgenic animal technology is one of the fastest growing biotechnology areas. It is used to integrate exogenous genes into the animal genome by genetic engineering technology so that these genes can be inherited and expressed by offspring. The transgenic efficiency and precise control of gene expression are the key limiting factors in the production of transgenic animals. A variety of transgenic technologies are available. Each has its own advantages and disadvantages and needs further study because of unresolved technical and safety issues. Further studies will allow transgenic technology to explore gene function, animal genetic improvement, bioreactors, animal disease models, and organ transplantation. This article reviews the recently developed animal transgenic technologies, including the germ line stem cell-mediated method to improve efficiency, gene targeting to improve accuracy, RNA interference-mediated gene silencing technology, zinc-finger nuclease gene targeting technology and induced pluripotent stem cell technology. These new transgenic techniques can provide a better platform to develop transgenic animals for breeding new animal varieties and promote the development of medical sciences, livestock production, and other fields.
Mechanisms and genes in human strial presbycusis from animal models.
Ohlemiller, Kevin K
2009-06-24
Schuknecht proposed a discrete form of presbycusis in which hearing loss results principally from degeneration of cochlear stria vascularis and decline of the endocochlear potential (EP). This form was asserted to be genetically linked, and to arise independently from age-related pathology of either the organ of Corti or cochlear neurons. Although extensive strial degeneration in humans coincides with hearing loss, EPs have never been measured in humans, and age-related EP reduction has never been verified. No human genes that promote strial presbycusis have been identified, nor is its pathophysiology well understood. Effective application of animal models to this issue requires models demonstrating EP decline, and preferably, genetically distinct strains that vary in patterns of EP decline and its cellular correlates. Until recently, only two models, Mongolian gerbils and Tyrp1(B-lt) mice, were known to undergo age-associated EP reduction. Detailed studies of seven inbred mouse strains have now revealed three strains (C57BL/6J, B6.CAST-Cdh23(CAST), CBA/J) showing essentially no EP decline with age, and four strains ranging from modest to severe EP reduction (C57BL/6-Tyr(c-2J), BALB/cJ, CBA/CaJ, NOD.NON-H2(nbl)/LtJ). Collectively, animal models support five basic principles regarding a strial form of presbycusis: 1) Progressive EP decline from initially normal levels as a defining characteristic; 2) Non-universality, not all age-associated hearing loss involves EP decline; 3) A clear genetic basis; 4) Modulation by environment or stochastic events; and 5) Independent strial, organ of Corti, and neural pathology. Shared features between human strial presbycusis, gerbils, and BALB/cJ and C57BL/6-Tyr(c-2J) mice further suggest this condition frequently begins with strial marginal cell dysfunction and loss. By contrast, NOD.NON-H2(nbl) mice may model a sequence more closely associated with strial microvascular disease. Additional studies of these and other inbred mouse
Rajendran, Bhagya; Janakarajan, Veeramahali Natarajan
2016-01-01
Polymorphisms in aryl hydrocarbon receptor nuclear translocator-like (ARNTL) gene, the key component of circadian clock manifests circadian rhythm abnormalities. As seasonal affective disorder (SAD) is associated with disrupted circadian rhythms, the main objective of this study was to screen an Indian family with SAD for ARNTL gene polymorphisms. In this study, 30 members of close-knit family with SAD, 30 age- and sex-matched controls of the same caste with no prior history of psychiatric illness and 30 age- and sex-matched controls belonging to 17 different castes with no prior history of psychiatric illness were genotyped for five different single nucleotide polymorphisms (SNPs) in ARNTL gene by TaqMan allele-specific genotyping assay. Statistical significance was assessed by more powerful quasi-likelihood score test-XM. Most of the family members carried the risk alleles and we observed a highly significant SNP rs2279287 (A/G) in ARNTL gene with an allelic frequency of 0.75. Polymorphisms in ARNTL gene disrupt circadian rhythms causing SAD and genetic predisposition becomes more deleterious in the presence of adverse environment.
Zhong , Lei; Yu , Xiaomu; Tong , Jingou
2006-01-01
Abstract The Sox gene family is found in a broad range of animal taxa and encodes important gene regulatory proteins involved in a variety of developmental processes. We have obtained clones representing the HMG boxes of twelve Sox genes from grass carp (Ctenopharyngodon idella), one of the four major domestic carps in China. The cloned Sox genes belong to group B1, B2 and C. Our analyses show that whereas the human genome contains a single copy of Sox4, Sox11 and Sox14, each of these genes h...
DEFF Research Database (Denmark)
Brier, Ann-Sofie B; Loft, Anne; Madsen, Jesper G S
2017-01-01
The KDM5 family of histone demethylases removes the H3K4 tri-methylation (H3K4me3) mark frequently found at promoter regions of actively transcribed genes and is therefore generally considered to contribute to corepression. In this study, we show that knockdown (KD) of all expressed members...... of the KDM5 family in white and brown preadipocytes leads to deregulated gene expression and blocks differentiation to mature adipocytes. KDM5 KD leads to a considerable increase in H3K4me3 at promoter regions; however, these changes in H3K4me3 have a limited effect on gene expression per se. By contrast......, genome-wide analyses demonstrate that KDM5A is strongly enriched at KDM5-activated promoters, which generally have high levels of H3K4me3 and are associated with highly expressed genes. We show that KDM5-activated genes include a large set of cell cycle regulators and that the KDM5s are necessary...
DEFF Research Database (Denmark)
Riess, O; Weber, B; Nørremølle, Anne
1992-01-01
as to whether mutations in the human PDEB gene might cause LCA. We have previously cloned and characterized the human homologue of the mouse Pdeb gene and have mapped it to chromosome 4p16.3. In this study, a total of 23 LCA families of various ethnic backgrounds have been investigated. Linkage analysis using...
DEFF Research Database (Denmark)
Janeček, Štefan; Svensson, Birte; MacGregor, E. Ann
2011-01-01
kinase SNF1 complex, and an adaptor–regulator related to the SNF1/AMPK family, AKINβγ. CBM20s and CBM48s of amylolytic enzymes occur predominantly in the microbial world, whereas the non-amylolytic proteins containing these modules are mostly of plant and animal origin. Comparison of amino acid sequences...... that they exhibit independent behaviour, i.e. each family forms its own part in an evolutionary tree, with enzyme specificity (protein function) being well represented within each family. The distinction between CBM20 and CBM48 families is not sharp since there are representatives in both CBM families that possess...
Species-independent MicroRNA Gene Discovery
Kamanu, Timothy K.
2012-12-01
MicroRNA (miRNA) are a class of small endogenous non-coding RNA that are mainly negative transcriptional and post-transcriptional regulators in both plants and animals. Recent studies have shown that miRNA are involved in different types of cancer and other incurable diseases such as autism and Alzheimer’s. Functional miRNAs are excised from hairpin-like sequences that are known as miRNA genes. There are about 21,000 known miRNA genes, most of which have been determined using experimental methods. miRNA genes are classified into different groups (miRNA families). This study reports about 19,000 unknown miRNA genes in nine species whereby approximately 15,300 predictions were computationally validated to contain at least one experimentally verified functional miRNA product. The predictions are based on a novel computational strategy which relies on miRNA family groupings and exploits the physics and geometry of miRNA genes to unveil the hidden palindromic signals and symmetries in miRNA gene sequences. Unlike conventional computational miRNA gene discovery methods, the algorithm developed here is species-independent: it allows prediction at higher accuracy and resolution from arbitrary RNA/DNA sequences in any species and thus enables examination of repeat-prone genomic regions which are thought to be non-informative or ’junk’ sequences. The information non-redundancy of uni-directional RNA sequences compared to information redundancy of bi-directional DNA is demonstrated, a fact that is overlooked by most pattern discovery algorithms. A novel method for computing upstream and downstream miRNA gene boundaries based on mathematical/statistical functions is suggested, as well as cutoffs for annotation of miRNA genes in different miRNA families. Another tool is proposed to allow hypotheses generation and visualization of data matrices, intra- and inter-species chromosomal distribution of miRNA genes or miRNA families. Our results indicate that: miRNA and mi
Iovieno, Paolo; Andolfo, Giuseppe; Schiavulli, Adalgisa; Catalano, Domenico; Ricciardi, Luigi; Frusciante, Luigi; Ercolano, Maria Raffaella; Pavan, Stefano
2015-12-29
The powdery mildew disease affects thousands of plant species and arguably represents the major fungal threat for many Cucurbitaceae crops, including melon (Cucumis melo L.), watermelon (Citrullus lanatus L.) and zucchini (Cucurbita pepo L.). Several studies revealed that specific members of the Mildew Locus O (MLO) gene family act as powdery mildew susceptibility factors. Indeed, their inactivation, as the result of gene knock-out or knock-down, is associated with a peculiar form of resistance, referred to as mlo resistance. We exploited recently available genomic information to provide a comprehensive overview of the MLO gene family in Cucurbitaceae. We report the identification of 16 MLO homologs in C. melo, 14 in C. lanatus and 18 in C. pepo genomes. Bioinformatic treatment of data allowed phylogenetic inference and the prediction of several ortholog pairs and groups. Comparison with functionally characterized MLO genes and, in C. lanatus, gene expression analysis, resulted in the detection of candidate powdery mildew susceptibility factors. We identified a series of conserved amino acid residues and motifs that are likely to play a major role for the function of MLO proteins. Finally, we performed a codon-based evolutionary analysis indicating a general high level of purifying selection in the three Cucurbitaceae MLO gene families, and the occurrence of regions under diversifying selection in candidate susceptibility factors. Results of this study may help to address further biological questions concerning the evolution and function of MLO genes. Moreover, data reported here could be conveniently used by breeding research, aiming to select powdery mildew resistant cultivars in Cucurbitaceae.
Yang, Yan; Zhou, Yuan; Chi, Yingjun; Fan, Baofang; Chen, Zhixiang
2017-12-19
WRKY proteins are a superfamily of plant transcription factors with important roles in plants. WRKY proteins have been extensively analyzed in plant species including Arabidopsis and rice. Here we report characterization of soybean WRKY gene family and their functional analysis in resistance to soybean cyst nematode (SCN), the most important soybean pathogen. Through search of the soybean genome, we identified 174 genes encoding WRKY proteins that can be classified into seven groups as established in other plants. WRKY variants including a WRKY-related protein unique to legumes have also been identified. Expression analysis reveals both diverse expression patterns in different soybean tissues and preferential expression of specific WRKY groups in certain tissues. Furthermore, a large number of soybean WRKY genes were responsive to salicylic acid. To identify soybean WRKY genes that promote soybean resistance to SCN, we first screened soybean WRKY genes for enhancing SCN resistance when over-expressed in transgenic soybean hairy roots. To confirm the results, we transformed five WRKY genes into a SCN-susceptible soybean cultivar and generated transgenic soybean lines. Transgenic soybean lines overexpressing three WRKY transgenes displayed increased resistance to SCN. Thus, WRKY genes could be explored to develop new soybean cultivars with enhanced resistance to SCN.
Runx family genes in a cartilaginous fish, the elephant shark (Callorhinchus milii.
Directory of Open Access Journals (Sweden)
Giselle Sek Suan Nah
Full Text Available The Runx family genes encode transcription factors that play key roles in hematopoiesis, skeletogenesis and neurogenesis and are often implicated in diseases. We describe here the cloning and characterization of Runx1, Runx2, Runx3 and Runxb genes in the elephant shark (Callorhinchus milii, a member of Chondrichthyes, the oldest living group of jawed vertebrates. Through the use of alternative promoters and/or alternative splicing, each of the elephant shark Runx genes expresses multiple isoforms similar to their orthologs in human and other bony vertebrates. The expression profiles of elephant shark Runx genes are similar to those of mammalian Runx genes. The syntenic blocks of genes at the elephant shark Runx gene loci are highly conserved in human, but represented by shorter conserved blocks in zebrafish indicating a higher degree of rearrangements in this teleost fish. Analysis of promoter regions revealed conservation of binding sites for transcription factors, including two tandem binding sites for Runx that are totally conserved in the distal promoter regions of elephant shark Runx1-3. Several conserved noncoding elements (CNEs, which are putative cis-regulatory elements, and miRNA binding sites were identified in the elephant shark and human Runx gene loci. Some of these CNEs and miRNA binding sites are absent in teleost fishes such as zebrafish and fugu. In summary, our analysis reveals that the genomic organization and expression profiles of Runx genes were already complex in the common ancestor of jawed vertebrates.
Disruption of the APC gene by t(5;7) translocation in a Turcot family.
Sahnane, Nora; Bernasconi, Barbara; Carnevali, Ileana; Furlan, Daniela; Viel, Alessandra; Sessa, Fausto; Tibiletti, Maria Grazia
2016-03-01
Turcot syndrome (TS) refers to the combination of colorectal polyps and primary tumours of the central nervous system. TS is a heterogeneous genetic condition due to APC and/or mismatch repair germline mutations. When APC is involved the vast majority of mutations are truncating, but in approximately 20%-30% of patients with familial polyposis no germline mutation can be found. A 30-year-old Caucasian woman with a positive pedigree for TS was referred to our Genetic Counselling Service. She was negative for APC and MUTYH but showed a reciprocal balanced translocation t(5;7)(q22;p15) at chromosome analysis. FISH analysis using specific BAC probes demonstrated that 5q22 breakpoint disrupted the APC gene. Transcript analysis by MLPA and digital PCR revealed that the cytogenetic rearrangement involving the 3' end of the APC gene caused a defective expression of a truncated transcript. This result allowed cytogenetic analysis to be offered to all the other family members and segregation analysis clearly demonstrated that all the carriers were affected, whereas non-carriers did not have the polyposis. A cytogenetic approach permitted the identification of the mutation-causing disease in this family, and the segregation analysis together with the transcript study supported the pathogenetic role of this mutation. Karyotype analysis was used as a predictive test in all members of this family. This family suggests that clinically positive TS and FAP cases, which test negative with standard molecular analysis, could be easily and cost-effectively resolved by a classical and molecular cytogenetic approach. Copyright © 2015 Elsevier Inc. All rights reserved.
Interleukin-6 Gene Promoter Polymorphisms and Cardiovascular Risk Factors. A family study
Directory of Open Access Journals (Sweden)
Iris Paola Guzmán-Guzmán
2010-01-01
Full Text Available Interleukin-6 (IL-6 is a cytokine involved in inflammatory process, as well as in glucose and lipid metabolism. Several studies of the biological relevance of IL-6 gene polymorphisms have indicated a relationship with cardiovascular disease. The aim of this study was to assess whether the –174 G/C and –572 G/C of IL-6 gene polymorphisms are associated with cardiovascular risk factors in Mexican families. Ninety members of 30 Mexican families, in which an index case (proband had obesity, were included in the study. We evaluated the body composition by bioelectrical impedance. Peripheral blood samples were collected to determine biochemical and hematological parameters. High sensitivity C- reactive protein levels were measurement for nephelometric analysis. Screening for both polymorphisms studied was performed by PCR-RFLP. In the parents, both polymorphisms were in Hardy-Weinberg's equilibrium. The genotypes –174 GC/CC were associated with T2D (OR = 1.23, IC95% 1.01–1.5 and highest levels of hsCRP (p = 0.02, whereas genotype –572 GG was associated with T2D (OR = 1.24, IC95% 1.04–1.47 with an inflammatory state determined by the increase in the leukocyte count (OR = 1.24, IC95% 1.02–1.51. The genotypes –174 GC/CC and –572 GG may confer susceptibility for the development of subclinical inflammation and type 2 diabetes in Mexican families.
Characterization of Urtica dioica agglutinin isolectins and the encoding gene family.
Does, M P; Ng, D K; Dekker, H L; Peumans, W J; Houterman, P M; Van Damme, E J; Cornelissen, B J
1999-01-01
Urtica dioica agglutinin (UDA) has previously been found in roots and rhizomes of stinging nettles as a mixture of UDA-isolectins. Protein and cDNA sequencing have shown that mature UDA is composed of two hevein domains and is processed from a precursor protein. The precursor contains a signal peptide, two in-tandem hevein domains, a hinge region and a carboxyl-terminal chitinase domain. Genomic fragments encoding precursors for UDA-isolectins have been amplified by five independent polymerase chain reactions on genomic DNA from stinging nettle ecotype Weerselo. One amplified gene was completely sequenced. As compared to the published cDNA sequence, the genomic sequence contains, besides two basepair substitutions, two introns located at the same positions as in other plant chitinases. By partial sequence analysis of 40 amplified genes, 16 different genes were identified which encode seven putative UDA-isolectins. The deduced amino acid sequences share 78.9-98.9% identity. In extracts of roots and rhizomes of stinging nettle ecotype Weerselo six out of these seven isolectins were detected by mass spectrometry. One of them is an acidic form, which has not been identified before. Our results demonstrate that UDA is encoded by a large gene family.
Evolution of the vertebrate claudin gene family: insights from a basal vertebrate, the sea lamprey.
Mukendi, Christian; Dean, Nicholas; Lala, Rushil; Smith, Jeramiah; Bronner, Marianne E; Nikitina, Natalya V
2016-01-01
Claudins are major constituents of tight junctions, contributing both to their intercellular sealing and selective permeability properties. While claudins and claudin-like molecules are present in some invertebrates, the association of claudins with tight junctions has been conclusively documented only in vertebrates. Here we report the sequencing, phylogenetic analysis and comprehensive spatiotemporal expression analysis of the entire claudin gene family in the basal extant vertebrate, the sea lamprey. Our results demonstrate that clear orthologues to about half of all mammalian claudins are present in the lamprey, suggesting that at least one round of whole genome duplication contributed to the diversification of this gene family. Expression analysis revealed that claudins are expressed in discrete and specific domains, many of which represent vertebrate-specific innovations, such as in cranial ectodermal placodes and the neural crest; whereas others represent structures characteristic of chordates, e.g. pronephros, notochord, somites, endostyle and pharyngeal arches. By comparing the embryonic expression of claudins in the lamprey to that of other vertebrates, we found that ancestral expression patterns were often preserved in higher vertebrates. Morpholino mediated loss of Cldn3b demonstrated a functional role for this protein in placode and pharyngeal arch morphogenesis. Taken together, our data provide novel insights into the origins and evolution of the claudin gene family and the significance of claudin proteins in the evolution of vertebrates.
Côté, Olivier; Viel, Laurent; Bienzle, Dorothee
2013-12-01
Secretoglobin family 1A member 1 (SCGB 1A1) is a small anti-inflammatory and immunomodulatory protein that is abundantly secreted in airway surface fluids. We recently reported the existence of three distinct SCGB1A1 genes in the domestic horse genome as opposed to the single gene copy consensus present in other mammals. The origin of SCGB1A1 gene triplication and the evolutionary relationship of the three genes amongst Equidae family members are unknown. For this study, SCGB1A1 genomic data were collected from various Equus individuals including E. caballus, E. przewalskii, E. asinus, E. grevyi, and E. quagga. Three SCGB1A1 genes in E. przewalskii, two SCGB1A1 genes in E. asinus, and a single SCGB1A1 gene in E. grevyi and E. quagga were identified. Sequence analysis revealed that the non-synonymous nucleotide substitutions between the different equid genes coded for 17 amino acid changes. Most of these changes localized to the SCGB 1A1 central cavity that binds hydrophobic ligands, suggesting that this area of SCGB 1A1 evolved to accommodate diverse molecular interactions. Three-dimensional modeling of the proteins revealed that the size of the SCGB 1A1 central cavity is larger than that of SCGB 1A1A. Altogether, these findings suggest that evolution of the SCGB1A1 gene may parallel the separation of caballine and non-caballine species amongst Equidae, and may indicate an expansion of function for SCGB1A1 gene products. Copyright © 2013 Elsevier Inc. All rights reserved.
[Expression of angiopoietin-like proteins for animal breeding: a review].
Fu, Weiwei; Ma, Yun; Chen, Ningbo; Li, He; Bai, Yueyu
2015-11-01
Angiopoietin-like proteins are a family of proteins that are closely related to lipid, glucose and energy metabolism, as well as angiogenesis. To date, eight Angptls have been discovered, namely Angptl1 to Angptl8 that play key roles in metabolic regulation and marker assisted selection. In this review, we summarized current progress on the structure, signaling pathways, upstream regulatory genes and metabolic network of Angptl1-8. Finally, in combination with our work, the status and problems of animal breeding as well as the future prospects for Angptls were discussed.
miR-92a family and their target genes in tumorigenesis and metastasis
Energy Technology Data Exchange (ETDEWEB)
Li, Molin, E-mail: molin_li@hotmail.com [Department of Pathophysiology, Basic Medical Science of Dalian Medical University, Dalian 116044 (China); Institute of Cancer Stem Cell, Dalian Medical University Cancer Center, Dalian 116044 (China); Guan, Xingfang; Sun, Yuqiang [Department of Pathophysiology, Basic Medical Science of Dalian Medical University, Dalian 116044 (China); Mi, Jun [Institute of Cancer Stem Cell, Dalian Medical University Cancer Center, Dalian 116044 (China); Shu, Xiaohong [College of Pharmacy, Dalian Medical University Cancer Center, Dalian 116044 (China); Liu, Fang [Department of Surgery, The Second Affiliated Hospital of Dalian Medical University, Dalian 116027 (China); Li, Chuangang, E-mail: li_chuangang@sina.com [Department of Surgery, The Second Affiliated Hospital of Dalian Medical University, Dalian 116027 (China)
2014-04-15
The miR-92a family, including miR-25, miR-92a-1, miR-92a-2 and miR-363, arises from three different paralog clusters miR-17-92, miR-106a-363, and miR-106b-25 that are highly conservative in the process of evolution, and it was thought as a group of microRNAs (miRNAs) correlated with endothelial cells. Aberrant expression of miR-92a family was detected in multiple cancers, and the disturbance of miR-92a family was related with tumorigenesis and tumor development. In this review, the progress on the relationship between miR-92a family and their target genes and malignant tumors will be summarized. - Highlights: • Aberrant expression of miR-92a, miR-25 and miR-363 can be observed in many kinds of malignant tumors. • The expression of miR-92a family is regulated by LOH, epigenetic alteration, transcriptional factors such as SP1, MYC, E2F, wild-type p53 etc. • Roles of miR-92a family in tumorigenesis and development: promoting cell proliferation, invasion and metastasis, inhibiting cell apoptosis.
miR-92a family and their target genes in tumorigenesis and metastasis
International Nuclear Information System (INIS)
Li, Molin; Guan, Xingfang; Sun, Yuqiang; Mi, Jun; Shu, Xiaohong; Liu, Fang; Li, Chuangang
2014-01-01
The miR-92a family, including miR-25, miR-92a-1, miR-92a-2 and miR-363, arises from three different paralog clusters miR-17-92, miR-106a-363, and miR-106b-25 that are highly conservative in the process of evolution, and it was thought as a group of microRNAs (miRNAs) correlated with endothelial cells. Aberrant expression of miR-92a family was detected in multiple cancers, and the disturbance of miR-92a family was related with tumorigenesis and tumor development. In this review, the progress on the relationship between miR-92a family and their target genes and malignant tumors will be summarized. - Highlights: • Aberrant expression of miR-92a, miR-25 and miR-363 can be observed in many kinds of malignant tumors. • The expression of miR-92a family is regulated by LOH, epigenetic alteration, transcriptional factors such as SP1, MYC, E2F, wild-type p53 etc. • Roles of miR-92a family in tumorigenesis and development: promoting cell proliferation, invasion and metastasis, inhibiting cell apoptosis
Gurbuz, F; Desai, S; Diao, F; Turkkahraman, D; Wranitz, F; Wood-Trageser, M; Shin, Y-H; Kotan, L D; Jiang, H; Witchel, S; Gurtunca, N; Yatsenko, S; Mysliwec, D; Topaloglu, K; Rajkovic, A
2018-04-01
Loss-of-function DCAF17 variants cause hypogonadism, partial alopecia, diabetes mellitus, mental retardation, and deafness with variable clinical presentation. DCAF17 pathogenic variants have been largely reported in the Middle Eastern populations, but the incidence in American families is rare and animal models are lacking. Exome sequencing in 5 women with syndromic hypergonadotropic hypogonadism from 2 unrelated families revealed novel pathogenic variants in the DCAF17 gene. DCAF17 exon 2 (c.127-1G > C) novel homozygous variants were discovered in 4 Turkish siblings, while 1 American was compound heterozygous for 1-stop gain variant in exon 5 (c.C535T; p.Gln179*) and previously described stop gain variant in exon 9 (c.G906A; p.Trp302*). A mouse model mimicking loss of function in exon 2 of Dcaf17 was generated using CRISPR/Cas9 and showed female subfertility and male infertility. Our results identify 2 novel variants, and show that Dcaf17 plays a significant role in mammalian gonadal development and infertility. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Upregulation of human heme oxygenase gene expression by Ets-family proteins.
Deramaudt, B M; Remy, P; Abraham, N G
1999-03-01
Overexpression of human heme oxygenase-1 has been shown to have the potential to promote EC proliferation and angiogenesis. Since Ets-family proteins have been shown to play an important role in angiogenesis, we investigated the presence of ETS binding sites (EBS), GGAA/T, and ETS protein contributing to human HO-1 gene expression. Several chloramphenicol acetyltransferase constructs were examined in order to analyze the effect of ETS family proteins on the transduction of HO-1 in Xenopus oocytes and in microvessel endothelial cells. Heme oxygenase promoter activity was up-regulated by FLI-1ERGETS-1 protein(s). Chloramphenicol acetyltransferase (CAT) assays demonstrated that the promoter region (-1500 to +19) contains positive and negative control elements and that all three members of the ETS protein family were responsible for the up-regulation of HHO-1. Electrophoretic mobility shift assays (EMSA), performed with nuclear extracts from endothelial cells overexpressing HHO-1 gene, and specific HHO-1 oligonucleotides probes containing putative EBS resulted in a specific and marked bandshift. Synergistic binding was observed in EMSA between AP-1 on the one hand, FLI-1, ERG, and ETS-1 protein on the other. Moreover, 5'-deletion analysis demonstrated the existence of a negative control element of HHO-1 expression located between positions -1500 and -120 on the HHO-1 promoter. The presence of regulatory sequences for transcription factors such as ETS-1, FLI-1, or ERG, whose activity is associated with cell proliferation, endothelial cell differentiation, and matrix metalloproteinase transduction, may be an indication of the important role that HO-1 may play in coronary collateral circulation, tumor growth, angiogenesis, and hemoglobin-induced endothelial cell injuries.
Directory of Open Access Journals (Sweden)
Koch Wolfgang
2008-07-01
Full Text Available Abstract Background In Arabidopsis six genes group into the gene family of the organic cation transporters (OCTs. In animals the members of the OCT-family are mostly characterized as polyspecific transporters involved in the homeostasis of solutes, the transport of monoamine neurotransmitters and the transport of choline and carnitine. In plants little is known about function, localisation and regulation of this gene family. Only one protein has been characterized as a carnitine transporter at the plasma membrane so far. Findings We localized the five uncharacterized members of the Arabidopsis OCT family, designated OCT2-OCT6, via GFP fusions and protoplast transformation to the tonoplast. Expression analysis with RNA Gel Blots showed a distinct, organ-specific expression pattern of the individual genes. With reporter gene fusion of four members we analyzed the tissue specific distribution of OCT2, 3, 4, and 6. In experiments with salt, drought and cold stress, we could show that AtOCT4, 5 and 6 are up-regulated during drought stress, AtOCT3 and 5 during cold stress and AtOCT 5 and 6 during salt stress treatments. Conclusion Localisation of the proteins at the tonoplast and regulation of the gene expression under stress conditions suggests a specific role for the transporters in plant adaptation to environmental stress.
Transcriptional Activity of Nuclear Factor κB Family Genes in Patients with Systemic Sclerosis.
Lis-Święty, Anna; Gola, Joanna; Mazurek, Urszula; Brzezińska-Wcisło, Ligia
2017-05-01
Systemic sclerosis (SSc) is a connective tissue disease of unknown etiology and unclear pathogenesis. Evaluation of the activation of nuclear factor κB (NF-κB) family genes IκBα, p50, p52, p65, and c-Rel, potentially involved in the regulation of immunity, inflammation, angiogenesis, and tissue remodeling in SSc, was carried out. The study included 19 patients with limited SSc, 11 patients with early SSc, and 10 healthy persons constituting the control group. Real-time QRT-PCR was used to evaluate the mRNAs in peripheral blood samples. The patients with early SSc showed a decrease in transcriptional activity of IκBα inhibitor and c-Rel subunit. Transcriptional activity decrease in the other patients with limited SSc included genes encoding c-Rel and p50, subunits of NF-κB factor. Deregulation of intracellular signal transduction by NF-κB takes place at the beginning of SSc and in its fibrosis stage. Associations between clinical variables and NF-κB related gene expression as well as the activation of NF-κB family members in SSc patients should be addressed in future studies. © 2017 by the Association of Clinical Scientists, Inc.
Understanding familial and non-familial renal cell cancer
Bodmer, Daniëlle; van den Hurk, Wilhelmina; van Groningen, Jan J. M.; Eleveld, Marc J.; Martens, Gerard J. M.; Weterman, Marian A. J.; van Kessel, Ad Geurts
2002-01-01
Molecular genetic analysis of familial and non-familial cases of conventional renal cell carcinoma (RCC) revealed a critical role(s) for multiple genes on human chromosome 3. For some of these genes, e.g. VHL, such a role has been firmly established, whereas for others, definite confirmation is
Understanding familial and non-familial renal cell cancer.
Bodmer, D.; Hurk, W.H. van den; Groningen, J.J.M. van; Eleveld, M.J.; Martens, G.J.M.; Weterman, M.A.J.; Geurts van Kessel, A.H.M.
2002-01-01
Molecular genetic analysis of familial and non-familial cases of conventional renal cell carcinoma (RCC) revealed a critical role(s) for multiple genes on human chromosome 3. For some of these genes, e.g. VHL, such a role has been firmly established, whereas for others, definite confirmation is
The Organization of the Quorum Sensing luxI/R Family Genes in Burkholderia
Directory of Open Access Journals (Sweden)
Sándor Pongor
2013-07-01
Full Text Available Members of the Burkholderia genus of Proteobacteria are capable of living freely in the environment and can also colonize human, animal and plant hosts. Certain members are considered to be clinically important from both medical and veterinary perspectives and furthermore may be important modulators of the rhizosphere. Quorum sensing via N-acyl homoserine lactone signals (AHL QS is present in almost all Burkholderia species and is thought to play important roles in lifestyle changes such as colonization and niche invasion. Here we present a census of AHL QS genes retrieved from public databases and indicate that the local arrangement (topology of QS genes, their location within chromosomes and their gene neighborhoods show characteristic patterns that differ between the known Burkholderia clades. In sequence phylogenies, AHL QS genes seem to cluster according to the local gene topology rather than according to the species, which suggests that the basic topology types were present prior to the appearance of current Burkholderia species. The data are available at http://net.icgeb.org/burkholderia/.
The Organization of the Quorum Sensing luxI/R Family Genes in Burkholderia
Choudhary, Kumari Sonal; Hudaiberdiev, Sanjarbek; Gelencsér, Zsolt; Coutinho, Bruna Gonçalves; Venturi, Vittorio; Pongor, Sándor
2013-01-01
Members of the Burkholderia genus of Proteobacteria are capable of living freely in the environment and can also colonize human, animal and plant hosts. Certain members are considered to be clinically important from both medical and veterinary perspectives and furthermore may be important modulators of the rhizosphere. Quorum sensing via N-acyl homoserine lactone signals (AHL QS) is present in almost all Burkholderia species and is thought to play important roles in lifestyle changes such as colonization and niche invasion. Here we present a census of AHL QS genes retrieved from public databases and indicate that the local arrangement (topology) of QS genes, their location within chromosomes and their gene neighborhoods show characteristic patterns that differ between the known Burkholderia clades. In sequence phylogenies, AHL QS genes seem to cluster according to the local gene topology rather than according to the species, which suggests that the basic topology types were present prior to the appearance of current Burkholderia species. The data are available at http://net.icgeb.org/burkholderia/. PMID:23820583