Depletion of the AP-1 repressor JDP2 induces cell death similar to apoptosis
DEFF Research Database (Denmark)
Lerdrup, Mads; Holmberg, Christian Henrik; Dietrich, Nikolaj
2005-01-01
JDP2 is a ubiquitously expressed nuclear protein that efficiently represses the activity of the transcription factor AP-1. Thus far, all studies of JDP2 function have relied on the ectopic expression of the protein. In this study, we use a different approach: depletion of JDP2 from cells. Specific...... depletion of JDP2 resulted in p53-independent cell death that resembles apoptosis and was evident at 72 h. The death mechanism was caspase dependent as the cells could be rescued by treatment with caspase inhibitor zVAD. Our studies suggest that JDP2 functions as a general survival protein, not only...
Maruyama, Kenta; Fukasaka, Masahiro; Vandenbon, Alexis; Saitoh, Tatsuya; Kawasaki, Takumi; Kondo, Takeshi; Yokoyama, Kazunari K; Kidoya, Hiroyasu; Takakura, Nobuyuki; Standley, Daron; Takeuchi, Osamu; Akira, Shizuo
2012-12-14
Jdp2 is an AP-1 family transcription factor that regulates the epigenetic status of histones. Previous in vitro studies revealed that Jdp2 is involved in osteoclastogenesis. However, the roles of Jdp2 in vivo and its pleiotropic functions are largely unknown. Here we generated Jdp2(-/-) mice and discovered its crucial roles not only in bone metabolism but also in differentiation of neutrophils. Jdp2(-/-) mice exhibited osteopetrosis resulting from impaired osteoclastogenesis. Jdp2(-/-) neutrophils were morphologically normal but had impaired surface expression of Ly6G, bactericidal function, and apoptosis. We also found that ATF3 was an inhibitor of neutrophil differentiation and that Jdp2 directly suppresses its expression via inhibition of histone acetylation. Strikingly, Jdp2(-/-) mice were highly susceptible to Staphylococcus aureus and Candida albicans infection. Thus, Jdp2 plays pivotal roles in in vivo bone homeostasis and host defense by regulating osteoclast and neutrophil differentiation. Copyright © 2012 Elsevier Inc. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Nagamine, Tadashi; Nomada, Shohgo; Onouchi, Takashi; Kameshita, Isamu; Sueyoshi, Noriyuki, E-mail: sueyoshi@ag.kagawa-u.ac.jp
2014-03-28
Highlights: • Doublecortin-like protein kinase (DCLK) is a microtubule-associated protein kinase. • In living cells, DCLK was cleaved into two functional fragments. • zDCLK(kinase) was translocated into the nucleus by osmotic stresses. • Jun dimerization protein 2 (JDP2) was identified as zDCLK(kinase)-binding protein. • JDP2 was efficiently phosphorylated by zDCLK(kinase) only when histone was present. - Abstract: Doublecortin-like protein kinase (DCLK) is a microtubule-associated protein kinase predominantly expressed in brain. In a previous paper, we reported that zebrafish DCLK2 (zDCLK) was cleaved into two functional fragments; the N-terminal zDCLK(DC + SP) with microtubule-binding activity and the C-terminal zDCLK(kinase) with a Ser/Thr protein kinase activity. In this study, we demonstrated that zDCLK(kinase) was widely distributed in the cytoplasm and translocated into the nucleus when the cells were treated under hyperosmotic conditions with NaCl or mannitol. By two-hybrid screening using the C-terminal domain of DCLK, Jun dimerization protein 2 (JDP2), a nuclear transcription factor, was identified as zDCLK(kinase)-binding protein. Furthermore, JDP2 served as an efficient substrate for zDCLK(kinase) only when histone was present. These results suggest that the kinase fragment of DCLK is translocated into the nucleus upon hyperosmotic stresses and that the kinase efficiently phosphorylates JDP2, a possible target in the nucleus, with the aid of histones.
Directory of Open Access Journals (Sweden)
Erdal Dağtaş
2015-09-01
Full Text Available Public sphere is a social space, open to active individual access and free discussion, rescued from state intervention, where communicative action free from violence and individual benefits is undertaken; and rational-critical discourse is built. Political advertisement is the type advertising which aims at directing voters or the government to a particular action, having them adopt a certain view or approach. The concept of political advertising emerged with the practice of using commercial advertising techniques to promote a party, candidate or an idea. Justice and Development Party (JDP, has been ruling Turkey since 2002. The leader of the party is Prime Minister Recep Tayyip Erdoğan. It is a conservative party and has carried out some practices that could be regarded as negative. Anti-secular attitudes are also among these practices. Thus, analysing the political advertisements of JDP has proved to be interesting. Public sphere studies are mostly conducted through news stories and columns in media. In that sense, it is significant to analyse political advertisements in terms of public sphere. In this study, the political advertisements of the ruling Justice and Development Party (JDP in the process of Turkish General Parliamentary Election, 2011 have been analysed. The political advertisements in question have been analysed via Sabah newspaper. The reason for choosing Sabah is that it supports JDP as an example of partisan press. The samples have been taken from 2 weeks before the elections. Accordingly, as a full-page advertisement is published every day, 14 political advertisement analyses have been conducted in total. Political advertisements have been analysed using qualitative text analysis. As the study follows the path of public place-political advertising relationship, it finds meaning in itself.
Energy Technology Data Exchange (ETDEWEB)
Chiou, Shyh-Shin, E-mail: chiouss@kmu.edu.tw [Division of Hematology-Oncology, Department of Pediatrics, Kaohsiung Medical University Hospital, Kaohsiung 807, Taiwan (China); Department of Pediatrics, Faculty of Medicine, School of Medicine, Kaohsiung Medical University, 807 Kaohsiung 807, Taiwan (China); Wang, Sophie Sheng-Wen; Wu, Deng-Chyang [Department of Gastroenterology, Kaohsiung Medical University Hospital, Kaohsiung 807, Taiwan (China); Lin, Ying-Chu [School of Dentistry, College of Dentistry, Kaohsiung Medical University, Kaohsiung 807, Taiwan (China); Kao, Li-Pin [Graduate Institute of Medicine, College of Medicine, Kaohsiung Medical University, 807 Kaohsiung 807, Taiwan (China)
2013-07-26
We report here that the Jun dimerization protein 2 (JDP2) plays a critical role as a cofactor for the transcription factors nuclear factor-erythroid 2-related factor 2 (Nrf2) and MafK in the regulation of the antioxidants and production of reactive oxygen species (ROS). JDP2 associates with Nrf2 and MafK (Nrf2-MafK) to increase the transcription of antioxidant response element-dependent genes. Oxidative-stress-inducing reagent led to an increase in the intracellular accumulation of ROS and cell proliferation in Jdp2 knock-out mouse embryonic fibroblasts. In Jdp2-Cre mice mated with reporter mice, the expression of JDP2 was restricted to granule cells in the brain cerebellum. The induced pluripotent stem cells (iPSC)-like cells were generated from DAOY medulloblastoma cell by introduction of JDP2, and the defined factor OCT4. iPSC-like cells expressed stem cell-like characteristics including alkaline phosphatase activity and some stem cell markers. However, such iPSC-like cells also proliferated rapidly, became neoplastic, and potentiated cell malignancy at a later stage in SCID mice. This study suggests that medulloblastoma cells can be reprogrammed successfully by JDP2 and OCT4 to become iPSC-like cells. These cells will be helpful for studying the generation of cancer stem cells and ROS homeostasis.
Directory of Open Access Journals (Sweden)
Naoto Yamaguchi
2013-07-01
Full Text Available We report here that the Jun dimerization protein 2 (JDP2 plays a critical role as a cofactor for the transcription factors nuclear factor-erythroid 2-related factor 2 (Nrf2 and MafK in the regulation of the antioxidants and production of reactive oxygen species (ROS. JDP2 associates with Nrf2 and MafK (Nrf2-MafK to increase the transcription of antioxidant response element-dependent genes. Oxidative-stress-inducing reagent led to an increase in the intracellular accumulation of ROS and cell proliferation in Jdp2 knock-out mouse embryonic fibroblasts. In Jdp2-Cre mice mated with reporter mice, the expression of JDP2 was restricted to granule cells in the brain cerebellum. The induced pluripotent stem cells (iPSC-like cells were generated from DAOY medulloblastoma cell by introduction of JDP2, and the defined factor OCT4. iPSC-like cells expressed stem cell-like characteristics including alkaline phosphatase activity and some stem cell markers. However, such iPSC-like cells also proliferated rapidly, became neoplastic, and potentiated cell malignancy at a later stage in SCID mice. This study suggests that medulloblastoma cells can be reprogrammed successfully by JDP2 and OCT4 to become iPSC-like cells. These cells will be helpful for studying the generation of cancer stem cells and ROS homeostasis.
International Nuclear Information System (INIS)
Asting, Annika Gustafsson; Carén, Helena; Andersson, Marianne; Lönnroth, Christina; Lagerstedt, Kristina; Lundholm, Kent
2011-01-01
Increased cyclooxygenase activity promotes progression of colorectal cancer, but the mechanisms behind COX-2 induction remain elusive. This study was therefore aimed to define external cell signaling and transcription factors relating to high COX-2 expression in colon cancer tissue. Tumor and normal colon tissue were collected at primary curative operation in 48 unselected patients. COX-2 expression in tumor and normal colon tissue was quantified including microarray analyses on tumor mRNA accounting for high and low tumor COX-2 expression. Cross hybridization was performed between tumor and normal colon tissue. Methylation status of up-stream COX-2 promoter region was evaluated. Tumors with high COX-2 expression displayed large differences in gene expression compared to normal colon. Numerous genes with altered expression appeared in tumors of high COX-2 expression compared to tumors of low COX-2. COX-2 expression in normal colon was increased in patients with tumors of high COX-2 compared to normal colon from patients with tumors of low COX-2. IL1β, IL6 and iNOS transcripts were up-regulated among external cell signaling factors; nine transcription factors (ATF3, C/EBP, c-Fos, Fos-B, JDP2, JunB, c-Maf, NF-κB, TCF4) showed increased expression and 5 (AP-2, CBP, Elk-1, p53, PEA3) were decreased in tumors with high COX-2. The promoter region of COX-2 gene did not show consistent methylation in tumor or normal colon tissue. Transcription and external cell signaling factors are altered as covariates to COX-2 expression in colon cancer tissue, but DNA methylation of the COX-2 promoter region was not a significant factor behind COX-2 expression in tumor and normal colon tissue
Directory of Open Access Journals (Sweden)
Lagerstedt Kristina
2011-06-01
Full Text Available Abstract Background Increased cyclooxygenase activity promotes progression of colorectal cancer, but the mechanisms behind COX-2 induction remain elusive. This study was therefore aimed to define external cell signaling and transcription factors relating to high COX-2 expression in colon cancer tissue. Method Tumor and normal colon tissue were collected at primary curative operation in 48 unselected patients. COX-2 expression in tumor and normal colon tissue was quantified including microarray analyses on tumor mRNA accounting for high and low tumor COX-2 expression. Cross hybridization was performed between tumor and normal colon tissue. Methylation status of up-stream COX-2 promoter region was evaluated. Results Tumors with high COX-2 expression displayed large differences in gene expression compared to normal colon. Numerous genes with altered expression appeared in tumors of high COX-2 expression compared to tumors of low COX-2. COX-2 expression in normal colon was increased in patients with tumors of high COX-2 compared to normal colon from patients with tumors of low COX-2. IL1β, IL6 and iNOS transcripts were up-regulated among external cell signaling factors; nine transcription factors (ATF3, C/EBP, c-Fos, Fos-B, JDP2, JunB, c-Maf, NF-κB, TCF4 showed increased expression and 5 (AP-2, CBP, Elk-1, p53, PEA3 were decreased in tumors with high COX-2. The promoter region of COX-2 gene did not show consistent methylation in tumor or normal colon tissue. Conclusions Transcription and external cell signaling factors are altered as covariates to COX-2 expression in colon cancer tissue, but DNA methylation of the COX-2 promoter region was not a significant factor behind COX-2 expression in tumor and normal colon tissue.
Promotion of alternative-sized personal protective equipment.
Flynn, Michael A; Keller, Brenna; DeLaney, Sheli C
2017-12-01
With more diversity in the workforce, companies are producing PPE such as hard hats, safety glasses, coveralls, foot protection, and safety harnesses for a larger range of body shapes and sizes. However, gray literature reports suggest that barriers exist to getting alternate sized PPE from the manufacturer to the workers who need it. The purpose of this study is to determine the extent to which alternative-sized PPE is marketed. A web-based review of seven major manufacturers of PPE was conducted to determine: (a) whether or not they offer alternative-sized products, (b) if these products are clearly labeled, and (c) if images used to display PPE are representative of a diverse workforce. Of the seven PPE manufacturers investigated, six had at least one product that was marketed as gender and/or size alternatives however, alternative sizes were more common for larger body types. Alternative-sized products rarely included size charts, and the models used to display PPE were overwhelmingly white males of average size. Despite the growing availability of alternative-sized PPE, it can be difficult to find these products, which suggests that they are rarely promoted or labeled as alternative-sized. Our study indicates that companies should expand their product lines and more aggressively market and promote these items. Guidance on how to properly fit their products would also be extremely helpful to the end-user. Manufacturers could improve the availability of alternative-sized PPE and increase their promotion of these products on their websites and in their catalogs. Individual companies and safety professionals may assist in this process by demonstrating demand for alternative-sized PPE. Published by Elsevier Ltd.
Lan, Xingguo; Yang, Jia; Cao, Mingming; Wang, Yanhong; Kawabata, Saneyuki; Li, Yuhua
2015-05-01
A novel J domain protein, JDP1, was isolated from ornamental kale. The C-terminus of JDP1 specifically interacted with ARC1, which has a conserved role in self-incompatibility signaling. Armadillo (ARM)-repeat containing 1 (ARC1) plays a conserved role in self-incompatibility signaling across the Brassicaceae and functions downstream of the S-locus receptor kinase. Here, we identified a J domain protein 1 (JDP1) that interacts with ARC1 using a yeast two-hybrid screen against a stigma cDNA library from ornamental kale (Brassica oleracea var. acephala). JDP1, a 38.4-kDa protein with 344 amino acids, is a member of the Hsp40 family. Fragment JDP1(57-344), originally isolated from a yeast two-hybrid cDNA library, interacted specifically with ARC1 in yeast two-hybrid assays. The N-terminus of JDP1 (JDP1(1-68)) contains a J domain, and the C-terminus of JDP1 (JDP1(69-344)) contains an X domain of unknown function. However, JDP1(69-344) was required and sufficient for interaction with ARC1 in yeast two-hybrid assays and in vitro binding assays. Moreover, JDP1(69-344) regulated the trafficking of ARC1 from the cytoplasm to the plasma membrane by interacting with ARC1 in Arabidopsis mesophyll protoplasts. Finally, Tyr(8) in the JDP1 N-terminal region was identified to be the specific site for regulating the interaction between JDP1 and BoARC1 in yeast two-hybrid assays. Possible roles of JDP1 as an interactor with ARC1 in Brassica are discussed.
Alternative Splicing of CHEK2 and Codeletion with NF2 Promote Chromosomal Instability in Meningioma
Directory of Open Access Journals (Sweden)
Hong Wei Yang
2012-01-01
Full Text Available Mutations of the NF2 gene on chromosome 22q are thought to initiate tumorigenesis in nearly 50% of meningiomas, and 22q deletion is the earliest and most frequent large-scale chromosomal abnormality observed in these tumors. In aggressive meningiomas, 22q deletions are generally accompanied by the presence of large-scale segmental abnormalities involving other chromosomes, but the reasons for this association are unknown. We find that large-scale chromosomal alterations accumulate during meningioma progression primarily in tumors harboring 22q deletions, suggesting 22q-associated chromosomal instability. Here we show frequent codeletion of the DNA repair and tumor suppressor gene, CHEK2, in combination with NF2 on chromosome 22q in a majority of aggressive meningiomas. In addition, tumor-specific splicing of CHEK2 in meningioma leads to decreased functional Chk2 protein expression. We show that enforced Chk2 knockdown in meningioma cells decreases DNA repair. Furthermore, Chk2 depletion increases centrosome amplification, thereby promoting chromosomal instability. Taken together, these data indicate that alternative splicing and frequent codeletion of CHEK2 and NF2 contribute to the genomic instability and associated development of aggressive biologic behavior in meningiomas.
Alternative Promoter Usage in Healthy and Inflamed Tissue
DEFF Research Database (Denmark)
Lilje, Berit
and cell-lines covering the entire human body. This provides a unique dataset to study gene expression, with promoter level precision. Here we use this large collection of data to study alternative transcription start site usage throughout the human body. We find that many alternative transcription start...... with tumour necrosis factor alpha, and on tissue from mice subjected to carbon nanotubes. Both systems show a strong response, with especially alternative transcription start sites being differentially regulated. Taken together this shows that alternative transcription start sites add an important layer...
Cozigou, Gwenole; Crozier, Jonathan; Hendriksen, Coenraad; Manou, Irene; Ramirez-Hernandez, Tzutzuy; Weissenhorn, Renate
2015-03-01
Here in we introduce the European Partnership for Alternative Approaches to Animal Testing (EPAA) and its activities, which are focused on international cooperation toward alternative methods. The EPAA is one of the leading organizations in Europe for the promotion of alternative approaches to animal testing. Its innovative public-private partnership structure enables a consensus-driven dialogue across 7 industry sectors to facilitate interaction between regulators and regulated stakeholders. Through a brief description of EPAA's activities and organizational structure, we first articulate the value of this collaboration; we then focus on 2 key projects driven by EPAA. The first project aims to address research gaps on stem cells for safety testing, whereas the second project strives for an approach toward demonstration of consistency in vaccine batch release testing. We highlight the growing need for harmonization of international acceptance and implementation of alternative approaches and for increased international collaboration to foster progress on nonanimal alternatives.
Directory of Open Access Journals (Sweden)
Zeina Kais
2016-06-01
Full Text Available BRCA1/2 proteins function in homologous recombination (HR-mediated DNA repair and cooperate with Fanconi anemia (FA proteins to maintain genomic integrity through replication fork stabilization. Loss of BRCA1/2 proteins results in DNA repair deficiency and replicative stress, leading to genomic instability and enhanced sensitivity to DNA-damaging agents. Recent studies have shown that BRCA1/2-deficient tumors upregulate Polθ-mediated alternative end-joining (alt-EJ repair as a survival mechanism. Whether other mechanisms maintain genomic integrity upon loss of BRCA1/2 proteins is currently unknown. Here we show that BRCA1/2-deficient tumors also upregulate FANCD2 activity. FANCD2 is required for fork protection and fork restart in BRCA1/2-deficient tumors. Moreover, FANCD2 promotes Polθ recruitment at sites of damage and alt-EJ repair. Finally, loss of FANCD2 in BRCA1/2-deficient tumors enhances cell death. These results reveal a synthetic lethal relationship between FANCD2 and BRCA1/2, and they identify FANCD2 as a central player orchestrating DNA repair pathway choice at the replication fork.
Alternative promoter usage of the membrane glycoprotein CD36
Directory of Open Access Journals (Sweden)
Whatling Carl
2006-03-01
Full Text Available Abstract Background CD36 is a membrane glycoprotein involved in a variety of cellular processes such as lipid transport, immune regulation, hemostasis, adhesion, angiogenesis and atherosclerosis. It is expressed in many tissues and cell types, with a tissue specific expression pattern that is a result of a complex regulation for which the molecular mechanisms are not yet fully understood. There are several alternative mRNA isoforms described for the gene. We have investigated the expression patterns of five alternative first exons of the CD36 gene in several human tissues and cell types, to better understand the molecular details behind its regulation. Results We have identified one novel alternative first exon of the CD36 gene, and confirmed the expression of four previously known alternative first exons of the gene. The alternative transcripts are all expressed in more than one human tissue and their expression patterns vary highly in skeletal muscle, heart, liver, adipose tissue, placenta, spinal cord, cerebrum and monocytes. All alternative first exons are upregulated in THP-1 macrophages in response to oxidized low density lipoproteins. The alternative promoters lack TATA-boxes and CpG islands. The upstream region of exon 1b contains several features common for house keeping gene and monocyte specific gene promoters. Conclusion Tissue-specific expression patterns of the alternative first exons of CD36 suggest that the alternative first exons of the gene are regulated individually and tissue specifically. At the same time, the fact that all first exons are upregulated in THP-1 macrophages in response to oxidized low density lipoproteins may suggest that the alternative first exons are coregulated in this cell type and environmental condition. The molecular mechanisms regulating CD36 thus appear to be unusually complex, which might reflect the multifunctional role of the gene in different tissues and cellular conditions.
International Nuclear Information System (INIS)
Bouhlel, Mohamed Amine; Brozek, John; Derudas, Bruno; Zawadzki, Christophe; Jude, Brigitte; Staels, Bart; Chinetti-Gbaguidi, Giulia
2009-01-01
Macrophages adapt their response to micro-environmental signals. While Th1 cytokines promote pro-inflammatory M1 macrophages, Th2 cytokines promote an 'alternative' anti-inflammatory M2 macrophage phenotype. Peroxisome proliferator-activated receptors (PPARs) are ligand-activated transcription factors expressed in macrophages where they control the inflammatory response. It has been shown that PPARγ promotes the differentiation of monocytes into anti-inflammatory M2 macrophages in humans and mice, while a role for PPARβ/δ in this process has been reported only in mice and no data are available for PPARα. Here, we show that in contrast to PPARγ, expression of PPARα and PPARβ/δ overall does not correlate with the expression of M2 markers in human atherosclerotic lesions, whereas a positive correlation with genes of lipid metabolism exists. Moreover, unlike PPARγ, PPARα or PPARβ/δ activation does not influence human monocyte differentiation into M2 macrophages in vitro. Thus, PPARα and PPARβ/δ do not appear to modulate the alternative differentiation of human macrophages.
Directory of Open Access Journals (Sweden)
Rosner William
2009-05-01
Full Text Available Abstract Background Human sex hormone-binding globulin (SHBG regulates free sex steroid concentrations in plasma and modulates rapid, membrane based steroid signaling. SHBG is encoded by an eight exon-long transcript whose expression is regulated by a downstream promoter (PL. The SHBG gene was previously shown to express a second major transcript of unknown function, derived from an upstream promoter (PT, and two minor transcripts. Results We report that transcriptional expression of the human SHBG gene is far more complex than previously described. PL and PT direct the expression of at least six independent transcripts each, resulting from alternative splicing of exons 4, 5, 6, and/or 7. We mapped two transcriptional start sites downstream of PL and PT, and present evidence for a third SHBG gene promoter (PN within the neighboring FXR2 gene; PN regulates the expression of at least seven independent SHBG gene transcripts, each possessing a novel, 164-nt first exon (1N. Transcriptional expression patterns were generated for human prostate, breast, testis, liver, and brain, and the LNCaP, MCF-7, and HepG2 cell lines. Each expresses the SHBG transcript, albeit in varying abundance. Alternative splicing was more pronounced in the cancer cell lines. PL- PT- and PN-derived transcripts were most abundant in liver, testis, and prostate, respectively. Initial findings reveal the existence of a smaller immunoreactive SHBG species in LNCaP, MCF-7, and HepG2 cells. Conclusion These results extend our understanding of human SHBG gene transcription, and raise new and important questions regarding the role of novel alternatively spliced transcripts, their function in hormonally responsive tissues including the breast and prostate, and the role that aberrant SHBG gene expression may play in cancer.
Alternative depreciation policies for promoting combined heat and power (CHP) development in Brazil
International Nuclear Information System (INIS)
Soares, Jeferson Borghetti; Szklo, Alexandre Salem; Tolmasquim, Mauricio Tiomno
2006-01-01
This paper assessed the economic impact of alternative depreciation methods on the development of combined heat-and-power (CHP) systems in the Brazilian industrial sector. Alternative depreciation methods were proposed and the case study of a Brazilian chemical plant showed that the most effective depreciation method for the promotion of CHP plants in Brazil was the Matheson method with an accelerated depreciation schedule of 7 years. This alternative method was then applied to the Brazilian chemical industry as a whole, increasing its installed capacity in CHP systems by 24%. Therefore, fiscal incentives can be an interesting tool for promoting energy efficiency in the Brazilian industrial sector, promoting the expansion of CHP plants. It reduces government fiscal revenues, but it also induces the technological reposition and improves the feasibility of ventures that are not installed without this kind of incentive
Huin, Vincent; Buée, Luc; Behal, Hélène; Labreuche, Julien; Sablonnière, Bernard; Dhaenens, Claire-Marie
2017-10-03
Alternative promoter usage is an important mechanism for transcriptome diversity and the regulation of gene expression. Indeed, this alternative usage may influence tissue/subcellular specificity, protein translation and function of the proteins. The existence of an alternative promoter for MAPT gene was considered for a long time to explain differential tissue specificity and differential response to transcription and growth factors between mRNA transcripts. The alternative promoter usage could explain partly the different tau proteins expression patterns observed in tauopathies. Here, we report on our discovery of a functional alternative promoter for MAPT, located upstream of the gene's second exon (exon 1). By analyzing genome databases and brain tissue from control individuals and patients with Alzheimer's disease or progressive supranuclear palsy, we identified novel shorter transcripts derived from this alternative promoter. These transcripts are increased in patients' brain tissue as assessed by 5'RACE-PCR and qPCR. We suggest that these new MAPT isoforms can be translated into normal or amino-terminal-truncated tau proteins. We further suggest that activation of MAPT's alternative promoter under pathological conditions leads to the production of truncated proteins, changes in protein localization and function, and thus neurodegeneration.
Doll, Gayle A; Cornelison, Laci J; Rath, Heath; Syme, Maggie L
2017-08-01
Nursing homes have been challenged in their attempts to achieve deep, organizational change (i.e., culture change) aimed at providing quality of care and quality of life for nursing home residents through person-centered care. To attain deep change, 2 well-defined components must be in place: a shared understanding of (a) the what, or content goals, and (b) the how, or process of change. However, there are few examples of this at a macro or micro level in long-term care. In an effort to enact true culture change in nursing homes statewide, the Kansas Department for Aging and Disability Services implemented the Promoting Excellent Alternatives in Kansas Nursing Homes program. This program is a Medicaid, pay-for-performance program that formalizes the content and process of achieving culture change through person-centered care principles. This article aims to detail the content (what) and process (how) of a model macro-level program of culture change throughout the State of Kansas. Applications to the micro level (individual homes) are presented, and implications for psychologists' roles in facilitating culture change are discussed. (PsycINFO Database Record (c) 2017 APA, all rights reserved).
Effects of alternative promoters of growth on the performance and cost of production of broilers
Directory of Open Access Journals (Sweden)
Patrícia Tomazini Medeiros
2009-09-01
Full Text Available Probiotics and prebiotics were compared to antimicrobials as alternative growth promoters in male broilers grown from 1 to 42 days of age. Eight treatments were evaluated: a control feed without antimicrobials or alternative growth promoters, a control feed with antimicrobials, a control feed with the antimicrobials colistine and avilamicine, three rations with probiotic Bacillus subtilis in different concentrations and/or under recommended usage, one ration with probiotic Saccharomyces cerevisiae in addition to a mixture of probiotic Bacillus subtilis, Saccharomyces cerevisiae and Aspergillus oryzae, and one ration with mananoligossacarids (MOS plus betaglutanes. Antimicrobials and alternative growth promoters were added to an initial feed and to a growth feed common to all birds. Thirteen to 17 replicates of 50 birds of a Cobb line were utilized per treatment in a completely randomized design. Feed consumption, feed conversion and production costs did not significantly differ among treatments. The weights of 42-day-old birds fed on Bacillus subtilis (1,6 x 109CFU/g or the mixture of probiotics were higher or similar to the weights of birds fed on ration with antimicrobials. It was concluded that probiotics can replace antimicrobials as growth promoters for broilers up to 42 days of age without negative effects on growth performance and production cost.
Molecular and functional characterization of the promoter of ETS2, the human c-ets-2 gene
International Nuclear Information System (INIS)
Mavrothalassitis, G.J.; Watson, D.K.; Papas, T.S.
1990-01-01
The 5' end of the human c-ets-2 gene, ETS2, was cloned and characterized. The major transcription initiation start sites were identified, and the pertinent sequences surrounding the ETS2 promoter were determined. The promoter region of ETS2 does not possess typical TATA and CAAT elements. However, this promoter contains several repeat regions, as well as two consensus AP2 binding sites and three putative Sp1 sites. There is also a palindromic region similar to the serum response element of the c-fos gene, located 1,400 base pairs (bp) upstream from the first major transcription initiation site. A G+C-rich sequence (GC element) with dyad symmetry can be seen in the ETS2 promoter, immediately following an unusually long polypurine-polypyrimidine tract. A series of deletion fragments from the putative promoter region were ligated in front of the bacterial chloramphenicol acetyltransferase gene and tested for activity following transfection into HeLa cells. The 5' boundary of the region needed for maximum promoter activity was found to be 159 bp upstream of the major initiation site. The promoter of ETS2 (within the polypyrimidine tract) serves to illustrate an alternative structure that may be present in genes with TATA-less promoters
CRE promoter sites modulate alternative splicing via p300-mediated histone acetylation
Czech Academy of Sciences Publication Activity Database
Dušková, Eva; Hnilicová, Jarmila; Staněk, David
2014-01-01
Roč. 11, č. 7 (2014), s. 865-874 ISSN 1547-6286 R&D Projects: GA ČR(CZ) GBP305/12/G034 Institutional support: RVO:68378050 Keywords : alternative splicing * fibronectin * p300 * histone acetylation * promoter Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 4.974, year: 2014
A novel CDX2 isoform regulates alternative splicing.
Directory of Open Access Journals (Sweden)
Matthew E Witek
Full Text Available Gene expression is a dynamic and coordinated process coupling transcription with pre-mRNA processing. This regulation enables tissue-specific transcription factors to induce expression of specific transcripts that are subsequently amplified by alternative splicing allowing for increased proteome complexity and functional diversity. The intestine-specific transcription factor CDX2 regulates development and maintenance of the intestinal epithelium by inducing expression of genes characteristic of the mature enterocyte phenotype. Here, sequence analysis of CDX2 mRNA from colonic mucosa-derived tissues revealed an alternatively spliced transcript (CDX2/AS that encodes a protein with a truncated homeodomain and a novel carboxy-terminal domain enriched in serine and arginine residues (RS domain. CDX2 and CDX2/AS exhibited distinct nuclear expression patterns with minimal areas of co-localization. CDX2/AS did not activate the CDX2-dependent promoter of guanylyl cyclase C nor inhibit transcriptional activity of CDX2. Unlike CDX2, CDX2/AS co-localized with the putative splicing factors ASF/SF2 and SC35. CDX2/AS altered splicing patterns of CD44v5 and Tra2-β1 minigenes in Lovo colon cancer cells independent of CDX2 expression. These data demonstrate unique dual functions of the CDX2 gene enabling it to regulate gene expression through both transcription (CDX2 and pre-mRNA processing (CDX2/AS.
BIOGAS AS AN ALTERNATIVE ENERGY SOURCE TO PROMOTE INDIGENOUS COMMUNITIES DEVELOPMENT
Directory of Open Access Journals (Sweden)
Carlos SABORÍO VÍQUEZ
2013-01-01
Full Text Available The key areas that determine the food and nutrition security are: availability, access, consumption and biological utilization. For this reason it is necessary to promote the health of vulnerable groups, in this case, indigenous communities, protecting and establishing conditions to ensure the human right to food. The initial plan focuses ondeveloping facilities for small swine and poultry farms, familiar, non-commercial. The main objective of the pigs raised at the site will be the production of animal waste in order to implement digesters for the production of biogas as an alternative energy source, the production of meat stays in the background, thinking only about the community consumption and helping to ensure their food source, from this perspective, the technologies applied to rural and indigenous progress are environmentally friendly, socially just, economically viable and culturally acceptable. The theme of rural and indigenous Development is focused on their food security and the use of alternative energies, considering that energy is a key element in achieving sustainable development in all sectors, therefore sought from a broad perspective solidarity and actively promote greater and more rational use of energy and the environment in remote communities, through diversification of supply sources and efficient use, thereby contributing toenvironmental conservation and reduction of health problems through the use of appropriate technologies.
CO2 methanation on the catalyst of Ni/MCM-41 promoted with CeO2.
Wang, Xiaoliu; Zhu, Lingjun; Liu, Yincong; Wang, Shurong
2018-06-01
CO 2 as a raw feed combined with renewable hydrogen for the production of useful chemicals and alternative energy products is one of the solutions to environmental and energy problems. In this study, a series of Ni-xCeO 2 /MCM-41 catalysts with a nickel content of 20wt% were prepared through deposition precipitation method for CO 2 methanation. Different characterization methods, including BET, XRD, TEM, SEM, H 2 -TPR and H 2 -TPD were applied to help explore the influence mechanism of CeO 2 on Ni/MCM-41 in CO 2 methanation. It was found that all CeO 2 -promoted catalysts exhibited enhanced catalytic activity when compared to Ni/MCM-41. The catalyst modified with 20wt% CeO 2 showed the best catalytic performance, with CO 2 conversion and CH 4 selectivity of 85.6% and 99.8%, respectively, at the temperature of 380°C under atmospheric pressure. The synergetic effects among Ni 0 active sites, the promoter and the support, including nickel dispersion improvement and increased CO 2 adsorption sites due to the addition of CeO 2 , were considered as important factors for high reactivity of the promoted catalysts. The stability test showed that the promoted catalyst maintained its high reactivity after 30h. Copyright © 2017 Elsevier B.V. All rights reserved.
DEFF Research Database (Denmark)
Putluru, Siva Sankar Reddy; Jensen, Anker Degn; Riisager, Anders
2011-01-01
V2O5/TiO2 and heteropoly acid promoted V2O5/TiO2 catalysts were prepared and characterized by N2 physisorption, XRPD and NH3-TPD. The influence of the calcination temperature from 400 to 700 1C on crystallinity and acidic properties was studied and compared with the activity for the selective...... catalytic reduction (SCR) of NO with ammonia. The SCR activity of heteropoly acid promoted catalysts was found to be much higher than for unpromoted catalysts. The stability of heteropoly acid promoted catalysts is dependent on calcination temperature and there is a gradual decrease in SCR activity...... and acidity with increase in calcination temperatures. Furthermore, the heteropoly acid promoted V2O5/TiO2 catalysts showed excellent alkali deactivation resistance and might therefore be alternative deNOx catalysts in biomass fired power plants....
Energy Technology Data Exchange (ETDEWEB)
Pohekar, S.D. [Birla Institute of Technology and Science, Pilani (India). CREED; Ramachandran, M. [Birla Institute of Technology and Science, Dubai (United Arab Emirates)
2004-07-01
The policy formulation for cooking energy substitution by renewables is addressed in multi-criteria context. A survey is conducted to know the perceptions of different decision making groups on present dissemination of various cooking energy alternatives in India. Nine cooking energy alternatives are evaluated on 30 different criteria comprising of technical, economic, environmental/social, behavioural and commercial issues. Preference Ranking Organization METHod for Enrichment Evaluation (PROMETHEE), a multi-criteria decision making method of outranking nature is used to rank the alternatives. It is found that liquefied petroleum gas (LPG) stove is the most preferred device, followed by kerosene stove, solar box cooker and parabolic solar cooker (PSC) in that order. A sensitivity analysis is also carried out for identifying potential areas for improvement for PSC. On the basis of results, strategies for promoting wide spread use of PSC are formulated. (author)
Loss of Endocan tumorigenic properties after alternative splicing of exon 2
International Nuclear Information System (INIS)
Depontieu, Florence; Grigoriu, Bogdan-Dragos; Scherpereel, Arnaud; Adam, Estelle; Delehedde, Maryse; Gosset, Philippe; Lassalle, Philippe
2008-01-01
Endocan was originally described as a dermatan sulfate proteoglycan found freely circulating in the blood. Endocan expression confers tumorigenic properties to epithelial cell lines or accelerate the growth of already tumorigenic cells. This molecule is the product of a single gene composed of 3 exons. Previous data showed that endocan mRNA is subject to alternative splicing with possible generation of two protein products. In the present study we identified, and functionally characterized, the alternative spliced product of the endocan gene: the exon 2-deleted endocan, called endocanΔ2. Stable, endocanΔ2-overexpressing cell lines were generated to investigate the biological activities of this new alternatively spliced product of endocan gene. Tumorigenesis was studied by inoculating endocan and endocanΔ2 expressing cell lines subcutaneously in SCID mice. Biochemical properties of endocan and endocanΔ2 were studied after production of recombinant proteins in various cell lines of human and murine origin. Our results showed that the exon 2 deletion impairs synthesis of the glycan chain, known to be involved in the pro-tumoral effect of endocan. EndocanΔ2 did not promote tumor formation by 293 cells implanted in the skin of severe combined immunodeficient (SCID) mice. Our results emphasize the key role of the polypeptide sequence encoded by the exon 2 of endocan gene in tumorigenesis, and suggest that this sequence could be a target for future therapies against cancer
Effect of TNFα on activities of different promoters of human apolipoprotein A-I gene
International Nuclear Information System (INIS)
Orlov, Sergey V.; Mogilenko, Denis A.; Shavva, Vladimir S.; Dizhe, Ella B.; Ignatovich, Irina A.; Perevozchikov, Andrej P.
2010-01-01
Research highlights: → TNFα stimulates the distal alternative promoter of human apoA-I gene. → TNFα acts by weakening of promoter competition within apoA-I gene (promoter switching). → MEK1/2 and nuclear receptors PPARα and LXRs take part in apoA-I promoter switching. -- Abstract: Human apolipoprotein A-I (ApoA-I) is a major structural and functional protein component of high-density lipoproteins. The expression of the apolipoprotein A-I gene (apoA-I) in hepatocytes is repressed by pro-inflammatory cytokines such as IL-1β and TNFα. Recently, two novel additional (alternative) promoters for human apoA-I gene have been identified. Nothing is known about the role of alternative promoters in TNFα-mediated downregulation of apoA-I gene. In this article we report for the first time about the different effects of TNFα on two alternative promoters of human apoA-I gene. Stimulation of HepG2 cells by TNFα leads to activation of the distal alternative apoA-I promoter and downregulation of the proximal alternative and the canonical apoA-I promoters. This effect is mediated by weakening of the promoter competition within human apoA-I 5'-regulatory region (apoA-I promoter switching) in the cells treated by TNFα. The MEK1/2-ERK1/2 cascade and nuclear receptors PPARα and LXRs are important for TNFα-mediated apoA-I promoter switching.
DEFF Research Database (Denmark)
Nielsen, C H; Marquart, H V; Prodinger, W M
2001-01-01
the alternative pathway. Blockade of the CR2 ligand-binding site with the monoclonal antibody FE8 resulted in 56 +/- 13% and 71 +/- 9% inhibition of the C3-fragment and MAC deposition, respectively, whereas the monoclonal antibody HB135, directed against an irrelevant CR2 epitope, had no effect. Blockade......Normal human B lymphocytes activate the alternative pathway of complement via complement receptor type 2 (CR2, CD21), that binds hydrolysed C3 (iC3) and thereby promotes the formation of a membrane-bound C3 convertase. We have investigated whether this might lead to the generation of a C5...... processes on CR2, indicate that MAC formation is a consequence of alternative pathway activation....
Promoter2.0: for the recognition of PolII promoter sequences
DEFF Research Database (Denmark)
Knudsen, Steen; Knudsen, Steen
1999-01-01
transcription start sites. On standardized test setsconsisting of human genomic DNA, the performance of Promoter2.0 compares well with other softwaredeveloped for the same purpose. Availability : Promoter2.0 is available as a Web server at http://www.cbs.dtu.dk/services/promoter/ Contact : steen@cbs.dtu.dk...
Opioid inhibition of N-type Ca2+ channels and spinal analgesia couple to alternative splicing.
Andrade, Arturo; Denome, Sylvia; Jiang, Yu-Qiu; Marangoudakis, Spiro; Lipscombe, Diane
2010-10-01
Alternative pre-mRNA splicing occurs extensively in the nervous systems of complex organisms, including humans, considerably expanding the potential size of the proteome. Cell-specific alternative pre-mRNA splicing is thought to optimize protein function for specialized cellular tasks, but direct evidence for this is limited. Transmission of noxious thermal stimuli relies on the activity of N-type Ca(V)2.2 calcium channels in nociceptors. Using an exon-replacement strategy in mice, we show that mutually exclusive splicing patterns in the Ca(V)2.2 gene modulate N-type channel function in nociceptors, leading to a change in morphine analgesia. Exon 37a (e37a) enhances μ-opioid receptor-mediated inhibition of N-type calcium channels by promoting activity-independent inhibition. In the absence of e37a, spinal morphine analgesia is weakened in vivo but the basal response to noxious thermal stimuli is not altered. Our data suggest that highly specialized, discrete cellular responsiveness in vivo can be attributed to alternative splicing events regulated at the level of individual neurons.
Alternative Splicing of MBD2 Supports Self-Renewal in Human Pluripotent Stem Cells
Lu, Yu; Loh, Yuin-Han; Li, Hu; Cesana, Marcella; Ficarro, Scott B.; Parikh, Jignesh R.; Salomonis, Nathan; Toh, Cheng-Xu Delon; Andreadis, Stelios T.; Luckey, C. John; Collins, James J.; Daley, George Q.; Marto, Jarrod A.
2014-01-01
Summary Alternative RNA splicing (AS) regulates proteome diversity, including isoform-specific expression of several pluripotency genes. Here, we integrated global gene expression and proteomic analyses and identified a molecular signature suggesting a central role for AS in maintaining human pluripotent stem cell (hPSC) self-renewal. We demonstrate the splicing factor SFRS2 is an OCT4 target gene required for pluripotency. SFRS2 regulates AS of the methyl-CpG-binding protein MBD2, whose isoforms play opposing roles in maintenance of, and reprogramming to, pluripotency. While both MDB2a and MBD2c are enriched at the OCT4 and NANOG promoters, MBD2a preferentially interacts with repressive NuRD chromatin remodeling factors and promotes hPSC differentiation, whereas overexpression of MBD2c enhances reprogramming of fibroblasts to pluripotency. The miR-301 and miR-302 families provide additional regulation by targeting SFRS2 and MDB2a. These data suggest that OCT4, SFRS2, and MBD2 participate in a positive feedback loop, regulating proteome diversity complexity in support of hPSC self-renewal and reprogramming. PMID:24813856
Directory of Open Access Journals (Sweden)
Karsten Kieckhäfer
2018-01-01
Full Text Available The mid-term framework of global aviation is shaped by air travel demand growth rates of 2–5% p.a. and ambitious targets to reduce aviation-related CO2 emissions by up to 50% until 2050. Alternative jet fuels such as bio- or electrofuels can be considered as a potential means towards low-emission aviation. While these fuels offer significant emission reduction potential, their market success depends on manifold influencing factors like the maturity of the production technology or the development of the price of conventional jet fuel. To study the potential for adoption of alternative jet fuels in aviation and the extent to which alternative fuels can contribute to the reduction targets, we deploy a System Dynamics approach. The results indicate that the adoption of alternative fuels and therefore their potential towards low-emissions aviation is rather limited in most scenarios considered since current production processes do not allow for competitive prices compared to conventional jet fuel. This calls for the development of new production processes that allow for economic feasibility of converting biomass or hydrogen into drop-in fuels as well as political measures to promote the adoption of alternative fuels.
Salim, Hossan Md; Huque, Khan Shahidul; Kamaruddin, Kazi M; Beg, M D Anwarul Haque
2018-03-01
A growing global concern of antibiotic use in poultry diets due to its potential adverse effects on birds and human health, food safety and the environment has led to a complete ban or restricted use in some countries, and, at the same time, expanding options for the use of alternative feed additives. Multiple, rather than a single additive may replace antibiotic growth promoters (AGPs) in poultry. Blending of feeding additives and hygienic farm management, vaccination and biosecurity may help achieve good intestinal health, stabilise enteric ecosystems and result in sustainable and cost effective production performance of birds. Moreover, controlling unsolicited ingredients at the production level must have the support of different markets responsible for the supply of safe and quality poultry products for consumers. This requires the further increase and diversification of value added poultry products and the expansion of their markets through strategic planning and gradual limitation of live bird markets. More research is warranted in order to explore suitable, reliable and cost effective alternatives to AGPs for commercial use, and strategic poultry value chain development.
DEFF Research Database (Denmark)
Thonar, Cécile; Lekfeldt, Jonas Duus Stevens; Cozzolino, Vincenza
2017-01-01
results were mostly obtained with BEs in combination with organic fertilizers such as composted animal manures, fresh digestate of organic wastes, and sewage sludge. In only one experiment, the nutrient use efficiency of mineral recycling fertilizers was improved by BE inoculation. Conclusions......Background: Agricultural production is challenged by the limitation of non-renewable resources. Alternative fertilizers are promoted but they often have a lower availability of key macronutrients, especially phosphorus (P). Biological inoculants, the so-called bio-effectors (BEs), may be combined...... with these fertilizers to improve the nutrient use efficiency. Methods: The goal of this study was to assess the potential of three BEs in combination with alternative fertilizers (e.g., composted manure, biogas digestate, green compost) to promote plant growth and nutrient uptake in soils typical for various European...
Joo, Ji Bong; Dillon, Robert; Lee, Ilkeun; Yin, Yadong; Bardeen, Christopher J; Zaera, Francisco
2014-06-03
The production of hydrogen from water with semiconductor photocatalysts can be promoted by adding small amounts of metals to their surfaces. The resulting enhancement in photocatalytic activity is commonly attributed to a fast transfer of the excited electrons generated by photon absorption from the semiconductor to the metal, a step that prevents deexcitation back to the ground electronic state. Here we provide experimental evidence that suggests an alternative pathway that does not involve electron transfer to the metal but requires it to act as a catalyst for the recombination of the hydrogen atoms made via the reduction of protons on the surface of the semiconductor instead.
Molina, Cristina E; Llach, Anna; Herraiz-Martínez, Adela; Tarifa, Carmen; Barriga, Montserrat; Wiegerinck, Rob F; Fernandes, Jacqueline; Cabello, Nuria; Vallmitjana, Alex; Benitéz, Raúl; Montiel, José; Cinca, Juan; Hove-Madsen, Leif
2016-01-01
Atrial fibrillation (AF) has been associated with increased spontaneous calcium release from the sarcoplasmic reticulum and linked to increased adenosine A2A receptor (A2AR) expression and activation. Here we tested whether this may favor atrial arrhythmogenesis by promoting beat-to-beat alternation and irregularity. Patch-clamp and confocal calcium imaging was used to measure the beat-to-beat response of the calcium current and transient in human atrial myocytes. Responses were classified as uniform, alternating or irregular and stimulation of Gs-protein coupled receptors decreased the frequency where a uniform response could be maintained from 1.0 ± 0.1 to 0.6 ± 0.1 Hz; p < 0.01 for beta-adrenergic receptors and from 1.4 ± 0.1 to 0.5 ± 0.1 Hz; p < 0.05 for A2ARs. The latter was linked to increased spontaneous calcium release and after-depolarizations. Moreover, A2AR activation increased the fraction of non-uniformly responding cells in HL-1 myocyte cultures from 19 ± 3 to 51 ± 9 %; p < 0.02, and electrical mapping in perfused porcine atria revealed that adenosine induced electrical alternans at longer cycle lengths, doubled the fraction of electrodes showing alternation, and increased the amplitude of alternations. Importantly, protein kinase A inhibition increased the highest frequency where uniform responses could be maintained from 0.84 ± 0.12 to 1.86 ± 0.11 Hz; p < 0.001 and prevention of A2AR-activation with exogenous adenosine deaminase selectively increased the threshold from 0.8 ± 0.1 to 1.2 ± 0.1 Hz; p = 0.001 in myocytes from patients with AF. In conclusion, A2AR-activation promotes beat-to-beat irregularities in the calcium transient in human atrial myocytes, and prevention of A2AR activation may be a novel means to maintain uniform beat-to-beat responses at higher beating frequencies in patients with atrial fibrillation.
FMDP Reactor Alternative Summary Report: Volume 2 - CANDU heavy water reactor alternative
International Nuclear Information System (INIS)
Greene, S.R.; Spellman, D.J.; Bevard, B.B.
1996-09-01
The Department of Energy Office of Fissile Materials Disposition (DOE/MD) initiated a detailed analysis activity to evaluate each of ten plutonium disposition alternatives that survived an initial screening process. This document, Volume 2 of a four volume report, summarizes the results of these analyses for the CANDU reactor based plutonium disposition alternative
FMDP Reactor Alternative Summary Report: Volume 2 - CANDU heavy water reactor alternative
Energy Technology Data Exchange (ETDEWEB)
Greene, S.R.; Spellman, D.J.; Bevard, B.B. [and others
1996-09-01
The Department of Energy Office of Fissile Materials Disposition (DOE/MD) initiated a detailed analysis activity to evaluate each of ten plutonium disposition alternatives that survived an initial screening process. This document, Volume 2 of a four volume report, summarizes the results of these analyses for the CANDU reactor based plutonium disposition alternative.
International Nuclear Information System (INIS)
Huang, Jianmin; Levitsky, Lynne L.; Rhoads, David B.
2009-01-01
Hepatocyte nuclear factor 4α (HNF4α) is a critical transcription factor for pancreas and liver development and functions in islet β cells to maintain glucose homeostasis. Mutations in the human HNF4A gene lead to maturity onset diabetes of the young (MODY1) and polymorphisms are associated with increased risk for type 2 diabetes mellitus (T2DM). Expression of six HNF4α variants, three each from two developmentally regulated promoters, has been firmly established. We have now detected a new set of HNF4α variants designated HNF4α10-12 expressed from distal promoter P2. These variants, generated by inclusion of previously undetected exon 1E (human = 222 nt, rodent = 136 nt) following exon 1D have an altered N-terminus but identical remaining reading frame. HNF4α10-α12 are expressed in pancreatic islets (and liver) and exhibit transactivation potentials similar to the corresponding α7-α9 isoforms. DNA-binding analyses implied much higher protein levels of HNF4α10-α12 in liver than expected from the RT-PCR data. Our results provide evidence for a more complex expression pattern of HNF4α than previously appreciated. We recommend inclusion of exon 1E and nearby DNA sequences in screening for HNF4α mutations and polymorphisms in genetic analyses of MODY1 and T2DM.
Energy Technology Data Exchange (ETDEWEB)
Huang, Jianmin, E-mail: jmhuang@partners.org [Pediatric Endocrine Unit, MassGeneral Hospital for Children and Harvard Medical School, Boston, Massachusetts, 02114-2696 (United States); Levitsky, Lynne L. [Pediatric Endocrine Unit, MassGeneral Hospital for Children and Harvard Medical School, Boston, Massachusetts, 02114-2696 (United States); Rhoads, David B., E-mail: rhoads@helix.mgh.harvard.edu [Pediatric Endocrine Unit, MassGeneral Hospital for Children and Harvard Medical School, Boston, Massachusetts, 02114-2696 (United States)
2009-04-15
Hepatocyte nuclear factor 4{alpha} (HNF4{alpha}) is a critical transcription factor for pancreas and liver development and functions in islet {beta} cells to maintain glucose homeostasis. Mutations in the human HNF4A gene lead to maturity onset diabetes of the young (MODY1) and polymorphisms are associated with increased risk for type 2 diabetes mellitus (T2DM). Expression of six HNF4{alpha} variants, three each from two developmentally regulated promoters, has been firmly established. We have now detected a new set of HNF4{alpha} variants designated HNF4{alpha}10-12 expressed from distal promoter P2. These variants, generated by inclusion of previously undetected exon 1E (human = 222 nt, rodent = 136 nt) following exon 1D have an altered N-terminus but identical remaining reading frame. HNF4{alpha}10-{alpha}12 are expressed in pancreatic islets (and liver) and exhibit transactivation potentials similar to the corresponding {alpha}7-{alpha}9 isoforms. DNA-binding analyses implied much higher protein levels of HNF4{alpha}10-{alpha}12 in liver than expected from the RT-PCR data. Our results provide evidence for a more complex expression pattern of HNF4{alpha} than previously appreciated. We recommend inclusion of exon 1E and nearby DNA sequences in screening for HNF4{alpha} mutations and polymorphisms in genetic analyses of MODY1 and T2DM.
James, Ricky; Naughton, Declan P; Petróczi, Andrea
2010-11-10
Substances with performance enhancing properties appear on a continuum, ranging from prohibited performance enhancing drugs (PED) through dietary supplements to functional foods (FF). Anti-doping messages designed to dissuade athletes from using PEDs have been typically based on moralising sport competition and/or employing scare campaigns with focus on the negative consequences. Campaigns offering comparable and acceptable alternatives are nonexistent, nor are athletes helped in finding these for themselves. It is timely that social marketing strategies for anti-doping prevention and intervention incorporate media messages that complement the existing approaches by promoting comparable and acceptable alternatives to doping. To facilitate this process, the aim of this study was to ascertain whether a single exposure knowledge-based information intervention led to increased knowledge and subsequently result in changes in beliefs and automatic associations regarding performance enhancements. In a repeated measure design, 115 male recreational gym users were recruited and provided with a brief information pamphlet on nitrite/nitrate and erythropoietin as a comparison. Measures of knowledge, beliefs and automatic associations were taken before and after the intervention with at least 24 hours between the two assessments. The psychological tests included explicit measures of beliefs and cognitive attitudes toward FF and PED using a self-reported questionnaire and computerised assessments of automatic associations using the modified and shortened version of the Implicit Association Test. The information based intervention significantly increased knowledge (p social marketing campaigns for drug free sport should follow appropriate market segmentation and use targeted messages via promoting the natural form as opposed to the purified form of the main active ingredient.
Brown, Maile R; Kronengold, Jack; Gazula, Valeswara-Rao; Spilianakis, Charalampos G; Flavell, Richard A; von Hehn, Christian A A; Bhattacharjee, Arin; Kaczmarek, Leonard K
2008-11-01
The rates of activation and unitary properties of Na+-activated K+ (K(Na)) currents have been found to vary substantially in different types of neurones. One class of K(Na) channels is encoded by the Slack gene. We have now determined that alternative RNA splicing gives rise to at least five different transcripts for Slack, which produce Slack channels that differ in their predicted cytoplasmic amino-termini and in their kinetic properties. Two of these, termed Slack-A channels, contain an amino-terminus domain closely resembling that of another class of K(Na) channels encoded by the Slick gene. Neuronal expression of Slack-A channels and of the previously described Slack isoform, now called Slack-B, are driven by independent promoters. Slack-A mRNAs were enriched in the brainstem and olfactory bulb and detected at significant levels in four different brain regions. When expressed in CHO cells, Slack-A channels activate rapidly upon depolarization and, in single channel recordings in Xenopus oocytes, are characterized by multiple subconductance states with only brief transient openings to the fully open state. In contrast, Slack-B channels activate slowly over hundreds of milliseconds, with openings to the fully open state that are approximately 6-fold longer than those for Slack-A channels. In numerical simulations, neurones in which outward currents are dominated by a Slack-A-like conductance adapt very rapidly to repeated or maintained stimulation over a wide range of stimulus strengths. In contrast, Slack-B currents promote rhythmic firing during maintained stimulation, and allow adaptation rate to vary with stimulus strength. Using an antibody that recognizes all amino-termini isoforms of Slack, Slack immunoreactivity is present at locations that have no Slack-B-specific staining, including olfactory bulb glomeruli and the dendrites of hippocampal neurones, suggesting that Slack channels with alternate amino-termini such as Slack-A channels are present at
22 CFR 101.2 - Promotion of American interests.
2010-04-01
... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Promotion of American interests. 101.2 Section... FUNCTIONS § 101.2 Promotion of American interests. Officers of the Foreign Service shall further the.... (g) By taking appropriate steps to facilitate the promotion of such import trade into the United...
Intrasplicing coordinates alternative first exons with alternative splicing in the protein 4.1R gene
Energy Technology Data Exchange (ETDEWEB)
Conboy, John G.; Parra, Marilyn K.; Tan, Jeff S.; Mohandas, Narla; Conboy, John G.
2008-11-07
In the protein 4.1R gene, alternative first exons splice differentially to alternative 3' splice sites far downstream in exon 2'/2 (E2'/2). We describe a novel intrasplicing mechanism by which exon 1A (E1A) splices exclusively to the distal E2'/2 acceptor via two nested splicing reactions regulated by novel properties of exon 1B (E1B). E1B behaves as an exon in the first step, using its consensus 5' donor to splice to the proximal E2'/2 acceptor. A long region of downstream intron is excised, juxtaposing E1B with E2'/2 to generate a new composite acceptor containing the E1B branchpoint/pyrimidine tract and E2 distal 3' AG-dinucleotide. Next, the upstream E1A splices over E1B to this distal acceptor, excising the remaining intron plus E1B and E2' to form mature E1A/E2 product. We mapped branch points for both intrasplicing reactions and demonstrated that mutation of the E1B 5' splice site or branchpoint abrogates intrasplicing. In the 4.1R gene, intrasplicing ultimately determines N-terminal protein structure and function. More generally, intrasplicing represents a new mechanism whereby alternative promoters can be coordinated with downstream alternative splicing.
5 CFR 2423.2 - Alternative Dispute Resolution (ADR) services.
2010-01-01
... 5 Administrative Personnel 3 2010-01-01 2010-01-01 false Alternative Dispute Resolution (ADR) services. 2423.2 Section 2423.2 Administrative Personnel FEDERAL LABOR RELATIONS AUTHORITY, GENERAL COUNSEL... Filing, Investigating, Resolving, and Acting on Charges § 2423.2 Alternative Dispute Resolution (ADR...
Treatment, promotion, commotion: Antibiotic alternatives in food-producing animals
Alternatives to antibiotics in animal agriculture are urgently needed but present a complex problem because of their various uses: disease treatment, disease prevention, and feed efficiency improvement. Numerous antibiotic alternatives, such as feed amended with pre- and probiotics, have been propos...
Thierry, Eric; Guilligay, Delphine; Kosinski, Jan; Bock, Thomas; Gaudon, Stephanie; Round, Adam; Pflug, Alexander; Hengrung, Narin; El Omari, Kamel; Baudin, Florence; Hart, Darren J; Beck, Martin; Cusack, Stephen
2016-01-07
Influenza virus polymerase transcribes or replicates the segmented RNA genome (vRNA) into respectively viral mRNA or full-length copies and initiates RNA synthesis by binding the conserved 3' and 5' vRNA ends (the promoter). In recent structures of promoter-bound polymerase, the cap-binding and endonuclease domains are configured for cap snatching, which generates capped transcription primers. Here, we present a FluB polymerase structure with a bound complementary cRNA 5' end that exhibits a major rearrangement of the subdomains within the C-terminal two-thirds of PB2 (PB2-C). Notably, the PB2 nuclear localization signal (NLS)-containing domain translocates ∼90 Å to bind to the endonuclease domain. FluA PB2-C alone and RNA-free FluC polymerase are similarly arranged. Biophysical and cap-dependent endonuclease assays show that in solution the polymerase explores different conformational distributions depending on which RNA is bound. The inherent flexibility of the polymerase allows it to adopt alternative conformations that are likely important during polymerase maturation into active progeny RNPs. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.
Ernst, E
2012-01-01
The concept that alternative therapies can eliminate toxins and toxicants from the body, i.e. 'alternative detox' (AD) is popular. Selected textbooks and articles on the subject of AD. The principles of AD make no sense from a scientific perspective and there is no clinical evidence to support them. The promotion of AD treatments provides income for some entrepreneurs but has the potential to cause harm to patients and consumers. In alternative medicine, simplistic but incorrect concepts such as AD abound. AREAS TIMELY FOR RESEARCH: All therapeutic claims should be scientifically tested before being advertised-and AD cannot be an exception.
Labonte, Adam C.; Sung, Sun‐Sang J.; Jennelle, Lucas T.; Dandekar, Aditya P.
2016-01-01
The liver maintains an immunologically tolerant environment as a result of continuous exposure to food and bacterial constituents from the digestive tract. Hepatotropic pathogens can take advantage of this niche and establish lifelong chronic infections causing hepatic fibrosis and hepatocellular carcinoma. Macrophages (Mϕ) play a critical role in regulation of immune responses to hepatic infection and regeneration of tissue. However, the factors crucial for Mϕ in limiting hepatic inflammation or resolving liver damage have not been fully understood. In this report, we demonstrate that expression of C‐type lectin receptor scavenger receptor‐AI (SR‐AI) is crucial for promoting M2‐like Mϕ activation and polarization during hepatic inflammation. Liver Mϕ uniquely up‐regulated SR‐AI during hepatotropic viral infection and displayed increased expression of alternative Mϕ activation markers, such as YM‐1, arginase‐1, and interleukin‐10 by activation of mer receptor tyrosine kinase associated with inhibition of mammalian target of rapamycin. Expression of these molecules was reduced on Mϕ obtained from livers of infected mice deficient for the gene encoding SR‐AI (msr1). Furthermore, in vitro studies using an SR‐AI‐deficient Mϕ cell line revealed impeded M2 polarization and decreased phagocytic capacity. Direct stimulation with virus was sufficient to activate M2 gene expression in the wild‐type (WT) cell line, but not in the knockdown cell line. Importantly, tissue damage and fibrosis were exacerbated in SR‐AI–/– mice following hepatic infection and adoptive transfer of WT bone‐marrow–derived Mϕ conferred protection against fibrosis in these mice. Conclusion: SR‐AI expression on liver Mϕ promotes recovery from infection‐induced tissue damage by mediating a switch to a proresolving Mϕ polarization state. (Hepatology 2017;65:32‐43). PMID:27770558
What Next? Promoting Alternatives to Ability Grouping.
Wheelock, Anne; Hawley, Willis D.
1993-01-01
Suggests ways to eliminate ability grouping in the schools, and explores new alternatives to improve schooling for all students. Specific guidelines are given for the development of academically and racially heterogeneous schooling. The elimination of grouping practices that deny equal access to education is a goal worth pursuing. (SLD)
Alternative Growth Promoters Modulate Broiler Gut Microbiome and Enhance Body Weight Gain
Salaheen, Serajus; Kim, Seon-Woo; Haley, Bradd J.; Van Kessel, Jo Ann S.; Biswas, Debabrata
2017-01-01
Antibiotic growth promoters (AGPs) are frequently used to enhance weight-gain in poultry production. However, there has been increasing concern over the impact of AGP on the emergence of antibiotic resistance in zoonotic bacterial pathogens in the microbial community of the poultry gut. In this study, we adopted mass-spectrophotometric, phylogenetic, and shotgun-metagenomic approaches to evaluate bioactive phenolic extracts (BPE) from blueberry (Vaccinium corymbosum) and blackberry (Rubus fruticosus) pomaces as AGP alternatives in broilers. We conducted two trials with 100 Cobb-500 broiler chicks (in each trial) in four equal groups that were provided water with no supplementation, supplemented with AGP (tylosin, neomycin sulfate, bacitracin, erythromycin, and oxytetracycline), or supplemented with 0.1 g Gallic acid equivalent (GAE)/L or 1.0 g GAE/L (during the last 72 h before euthanasia) of BPE for 6 weeks. When compared with the control group (water only), the chickens supplemented with AGP and 0.1 g GAE/L of BPE gained 9.5 and 5.8% more body weight, respectively. The microbiomes of both the AGP- and BPE-treated chickens had higher Firmicutes to Bacteroidetes ratios. AGP supplementation appeared to be associated with higher relative abundance of bacteriophages and unique cecal resistomes compared with BPE supplementation or control. Functional characterization of cecal microbiomes revealed significant animal-to-animal variation in the relative abundance of genes involved in energy and carbohydrate metabolism. These findings established a baseline upon which mechanisms of plant-based performance enhancers in regulation of animal growth can be investigated. In addition, the data will aid in designing alternate strategies to improve animal growth performance and consequently production. PMID:29123512
Alternative Growth Promoters Modulate Broiler Gut Microbiome and Enhance Body Weight Gain
Directory of Open Access Journals (Sweden)
Serajus Salaheen
2017-10-01
Full Text Available Antibiotic growth promoters (AGPs are frequently used to enhance weight-gain in poultry production. However, there has been increasing concern over the impact of AGP on the emergence of antibiotic resistance in zoonotic bacterial pathogens in the microbial community of the poultry gut. In this study, we adopted mass-spectrophotometric, phylogenetic, and shotgun-metagenomic approaches to evaluate bioactive phenolic extracts (BPE from blueberry (Vaccinium corymbosum and blackberry (Rubus fruticosus pomaces as AGP alternatives in broilers. We conducted two trials with 100 Cobb-500 broiler chicks (in each trial in four equal groups that were provided water with no supplementation, supplemented with AGP (tylosin, neomycin sulfate, bacitracin, erythromycin, and oxytetracycline, or supplemented with 0.1 g Gallic acid equivalent (GAE/L or 1.0 g GAE/L (during the last 72 h before euthanasia of BPE for 6 weeks. When compared with the control group (water only, the chickens supplemented with AGP and 0.1 g GAE/L of BPE gained 9.5 and 5.8% more body weight, respectively. The microbiomes of both the AGP- and BPE-treated chickens had higher Firmicutes to Bacteroidetes ratios. AGP supplementation appeared to be associated with higher relative abundance of bacteriophages and unique cecal resistomes compared with BPE supplementation or control. Functional characterization of cecal microbiomes revealed significant animal-to-animal variation in the relative abundance of genes involved in energy and carbohydrate metabolism. These findings established a baseline upon which mechanisms of plant-based performance enhancers in regulation of animal growth can be investigated. In addition, the data will aid in designing alternate strategies to improve animal growth performance and consequently production.
Fish, Caitlin A; Brown, Jonisha R; Quandt, Sara A
2015-04-01
Minority families often reside in neighborhoods with few supermarkets or alternative healthy food options (e.g., farmers markets, community gardens), making fresh produce difficult to obtain. This qualitative study identified factors influencing fruit and vegetable shopping and use of alternative healthy food options. Forty-eight minority women with children completed interviews regarding food shopping habits and use of and attitudes toward alternative healthy food options. Interviews were subjected to thematic analysis. Produce shopping was motivated by costs and family preferences. For African American women, poor cooking skills restricted the variety of fruits and vegetables purchased. Latinas were receptive to alternative healthy food options, but did not use them because these sources were inconvenient. African American women were not receptive to them. Improving cooking skills and perceptions of acceptable foods may be as important as increased access to promote greater consumption of fruits and vegetables.
International Nuclear Information System (INIS)
Dutra, Ricardo Marques; Szklo, Alexandre Salem
2008-01-01
The Alternative Energy Sources Incentive Program (PROINFA) was designed in 2002 to stimulate the electricity generation from three energy sources (wind, biomass and small-scale hydro) in Brazil. The Program was divided into two phases. The first one uses feed-in tariffs for promoting the development of 3300 MW. The second one that was originally based on feed-in tariffs was modified in 2003, in order to be based on biddings for renewables. These biddings are capped to limit their impact on the final electricity tariff. Due to this bound, the highest-cost power option promoted by PROINFA (wind power generation) might have development problems. Simulating different scenarios for the biddings, it was verified that the only way to reach the original goal set by PROINFA (10% of the annual electricity consumption provided by alternative sources up to 2020) and, simultaneously, not overcome the bidding bound is to promote biomass-fired power generation alone, during the Program's second phase. However, this action contradicts one of the targets of the Program, which is to diversify the energy matrix. An alternative option could be biddings for renewables according to specific criteria (complementarities, industrial and technological development and cost), based not only on their cost-effectiveness. (author)
10 CFR 2.338 - Settlement of issues; alternative dispute resolution.
2010-01-01
... 10 Energy 1 2010-01-01 2010-01-01 false Settlement of issues; alternative dispute resolution. 2... alternative dispute resolution under paragraph (b) of this section. (b) Settlement judge; alternative dispute... alternative dispute resolution as the Commission may provide or to which the parties may agree. The order...
International Nuclear Information System (INIS)
Freudenthal, Bret D.; Gakhar, Lokesh; Ramaswamy, S.; Washington, M. Todd
2009-01-01
Eukaryotic proliferating cell nuclear antigen (PCNA), an essential accessory factor in DNA replication and repair, is a ring-shaped homotrimer. A novel nontrimeric structure of E113G-mutant PCNA protein is reported, which shows that this protein forms alternate subunit interactions. It is concluded that the charged side chain of Glu113 promotes normal trimer formation by destabilizing these alternate subunit interactions. Eukaryotic proliferating cell nuclear antigen (PCNA) is an essential replication accessory factor that interacts with a variety of proteins involved in DNA replication and repair. Each monomer of PCNA has an N-terminal domain A and a C-terminal domain B. In the structure of the wild-type PCNA protein, domain A of one monomer interacts with domain B of a neighboring monomer to form a ring-shaped trimer. Glu113 is a conserved residue at the subunit interface in domain A. Two distinct X-ray crystal structures have been determined of a mutant form of PCNA with a substitution at this position (E113G) that has previously been studied because of its effect on translesion synthesis. The first structure was the expected ring-shaped trimer. The second structure was an unanticipated nontrimeric form of the protein. In this nontrimeric form, domain A of one PCNA monomer interacts with domain A of a neighboring monomer, while domain B of this monomer interacts with domain B of a different neighboring monomer. The B–B interface is stabilized by an antiparallel β-sheet and appears to be structurally similar to the A–B interface observed in the trimeric form of PCNA. The A–A interface, in contrast, is primarily stabilized by hydrophobic interactions. Because the E113G substitution is located on this hydrophobic surface, the A–A interface should be less favorable in the case of the wild-type protein. This suggests that the side chain of Glu113 promotes trimer formation by destabilizing these possible alternate subunit interactions
Luo, Jie; Cai, Limei; Qi, Shihua; Wu, Jian; Sophie Gu, Xiaowen
2018-03-01
Direct and alternating current electric fields with various voltages were used to improve the decontamination efficiency of chelator assisted phytoremediation for multi-metal polluted soil. The alleviation effect of electric field on leaching risk caused by chelator application during phytoremediation process was also evaluated. Biomass yield, pollutant uptake and metal leaching retardation under alternating current (AC) and direct current (DC) electric fields were compared. The biomass yield of Eucalyptus globulus under AC fields with various voltages (2, 4 and 10 V) were 3.91, 4.16 and 3.67kg, respectively, significantly higher than the chelator treatment without electric field (2.71kg). Besides growth stimulation, AC fields increased the metal concentrations of plant tissues especially in aerial parts manifested by the raised translocation factor of different metals. Direct current electric fields with low and moderate voltages increased the biomass production of the species to 3.45 and 3.12kg, respectively, while high voltage on the contrary suppressed the growth of the plants (2.66kg). Under DC fields, metal concentrations elevated obviously with increasing voltages and the metal translocation factors were similar under all voltages. Metal extraction per plant achieved the maximum value under moderate voltage due to the greatest biomass production. DC field with high voltage (10V) decreased the volume of leachate from the chelator treatment without electric field from 1224 to 56mL, while the leachate gathered from AC field treatments raised from 512 to 670mL. DC field can retard the downward movement of metals caused by chelator application more effectively relative to AC field due to the constant water flow and electroosmosis direction. Alternating current field had more promotive effect on chelator assisted phytoremediation efficiency than DC field illustrated by more metal accumulation in the species. However, with the consideration of leaching risk, DC
Inam, Ayesha; Tariq, Pervaiz N; Zaman, Sahira
2015-06-01
Cultural adaptation of evidence-based programmes has gained importance primarily owing to its perceived impact on the established effectiveness of a programme. To date, many researchers have proposed different frameworks for systematic adaptation process. This article presents the cultural adaptation of preschool Promoting Alternative Thinking Strategies (PATHS) curriculum for Pakistani children using the heuristic framework of adaptation (Barrera & Castro, 2006). The study was completed in four steps: information gathering, preliminary adaptation design, preliminary adaptation test and adaptation refinement. Feedbacks on programme content suggested universality of the core programme components. Suggested changes were mostly surface structure: language, presentation of materials, conceptual equivalence of concepts, training needs of implementation staff and frequency of programme delivery. In-depth analysis was done to acquire cultural equivalence. Pilot testing of the outcome measures showed strong internal consistency. The results were further discussed with reference to similar work undertaken in other cultures. © 2014 International Union of Psychological Science.
Lithium modulation of the human inositol monophosphatase 2 (IMPA2) promoter
International Nuclear Information System (INIS)
Seelan, Ratnam S.; Parthasarathy, Latha K.; Parthasarathy, Ranga N.
2004-01-01
The inositol-signaling pathway is a therapeutic target for lithium in the treatment of bipolar disorder. Inositol monophosphatases (IMPases) play a key role in inositol signaling. Lithium's ability to inhibit IMPase 1 is well known, but its effect on IMPase 2 or on the transcriptional regulation of these genes has not been studied. Here, we report the identification and characterization of the minimal promoter of IMPA2 (encoding IMPase 2) in HeLa (epithelial) and SK-N-AS (neuronal) cells. IMPA2 promoter activity appears to be contributed by different elements in the 5' flanking region, suggesting that the gene is differentially regulated in neuronal and non-neuronal cells. Furthermore, IMPA2 promoter activity in both cell lines is downregulated, in a dose-dependent manner, by lithium after treatment for only 24 h. This effect is also observed in vivo. Our results suggest a possible role for IMPA2 in bipolar disorder
A green approach to the production of 2-pyridone derivatives promoted by infrared irradiation
International Nuclear Information System (INIS)
Hernandez, F.; De la Cruz, F.; Lopez, J.; Pena, E.; Vazquez, M. A.; Delgado, F.; Alcaraz, Y.; FRobles, J.; Martinez A, M.
2014-01-01
An alternative is presented by promoting a reaction with infrared irradiation to obtain different 4-aryl-3-cyano-5-ethoxycarbonyl-6-methyl-2-pyridone derivatives 9 a-k. The process was carried out with a green approach from the corresponding 4 H-pyrans, using mild reaction conditions and infrared irradiation as the energy source. In the first stage, the reaction produced 1,2,3,4-tetrahydropyridine-2-one derivatives 8 a-k, followed by an oxidative step to afford the target molecules in good yields. The structure of products 9 a-k was confirmed by Ft-IR, 1 H NMR and 13 C NMR spectroscopic techniques and X-ray diffraction. It was found that the efficiency of the reaction depends on the catalyst and the solvent, as well as on the aldehyde substituents. (Author)
Expression of P. falciparum var Genes Involves Exchange of the Histone Variant H2A.Z at the Promoter
Petter, Michaela; Lee, Chin Chin; Byrne, Timothy J.; Boysen, Katja E.; Volz, Jennifer; Ralph, Stuart A.; Cowman, Alan F.; Brown, Graham V.; Duffy, Michael F.
2011-01-01
Plasmodium falciparum employs antigenic variation to evade the human immune response by switching the expression of different variant surface antigens encoded by the var gene family. Epigenetic mechanisms including histone modifications and sub-nuclear compartmentalization contribute to transcriptional regulation in the malaria parasite, in particular to control antigenic variation. Another mechanism of epigenetic control is the exchange of canonical histones with alternative variants to generate functionally specialized chromatin domains. Here we demonstrate that the alternative histone PfH2A.Z is associated with the epigenetic regulation of var genes. In many eukaryotic organisms the histone variant H2A.Z mediates an open chromatin structure at promoters and facilitates diverse levels of regulation, including transcriptional activation. Throughout the asexual, intraerythrocytic lifecycle of P. falciparum we found that the P. falciparum ortholog of H2A.Z (PfH2A.Z) colocalizes with histone modifications that are characteristic of transcriptionally-permissive euchromatin, but not with markers of heterochromatin. Consistent with this finding, antibodies to PfH2A.Z co-precipitate the permissive modification H3K4me3. By chromatin-immunoprecipitation we show that PfH2A.Z is enriched in nucleosomes around the transcription start site (TSS) in both transcriptionally active and silent stage-specific genes. In var genes, however, PfH2A.Z is enriched at the TSS only during active transcription in ring stage parasites. Thus, in contrast to other genes, temporal var gene regulation involves histone variant exchange at promoter nucleosomes. Sir2 histone deacetylases are important for var gene silencing and their yeast ortholog antagonises H2A.Z function in subtelomeric yeast genes. In immature P. falciparum parasites lacking Sir2A or Sir2B high var transcription levels correlate with enrichment of PfH2A.Z at the TSS. As Sir2A knock out parasites mature the var genes are
AAHD's Health Promotion and Wellness, Part 2: Health Promotion Programs
Exceptional Parent, 2011
2011-01-01
This article is part 2 of a 4-part series on "Health Promotion and Wellness" from the American Association on Health and Disability (AAHD). According to the U.S. Census Bureau, more than 54 million people--one in five Americans--have a disability, and these Americans are more likely to report: (1) Being in poorer overall health; (2) Having less…
Directory of Open Access Journals (Sweden)
Petróczi Andrea
2010-11-01
Full Text Available Abstract Background Substances with performance enhancing properties appear on a continuum, ranging from prohibited performance enhancing drugs (PED through dietary supplements to functional foods (FF. Anti-doping messages designed to dissuade athletes from using PEDs have been typically based on moralising sport competition and/or employing scare campaigns with focus on the negative consequences. Campaigns offering comparable and acceptable alternatives are nonexistent, nor are athletes helped in finding these for themselves. It is timely that social marketing strategies for anti-doping prevention and intervention incorporate media messages that complement the existing approaches by promoting comparable and acceptable alternatives to doping. To facilitate this process, the aim of this study was to ascertain whether a single exposure knowledge-based information intervention led to increased knowledge and subsequently result in changes in beliefs and automatic associations regarding performance enhancements. Methods In a repeated measure design, 115 male recreational gym users were recruited and provided with a brief information pamphlet on nitrite/nitrate and erythropoietin as a comparison. Measures of knowledge, beliefs and automatic associations were taken before and after the intervention with at least 24 hours between the two assessments. The psychological tests included explicit measures of beliefs and cognitive attitudes toward FF and PED using a self-reported questionnaire and computerised assessments of automatic associations using the modified and shortened version of the Implicit Association Test. Results The information based intervention significantly increased knowledge (p p p Conclusion Evidence was found that even a single exposure to a persuasive positive message can lead to belief change and can create new or alter existing associations - but only in the specific domain. Interventions to change outcome expectations in a positive
Li, Guoqiang; Feng, Ligang; Chang, Jinfa; Wickman, Björn; Grönbeck, Henrik; Liu, Changpeng; Xing, Wei
2014-12-01
Ethanol is an alternative fuel for direct alcohol fuel cells, in which the electrode materials are commonly based on Pt or Pd. Owing to the excellent promotion effect of Ni2 P that was found in methanol oxidation, we extended the catalyst system of Pt or Pd modified by Ni2 P in direct ethanol fuel cells. The Ni2 P-promoted catalysts were compared to commercial catalysts as well as to reference catalysts promoted with only Ni or only P. Among the studied catalysts, Pt/C and Pd/C modified by Ni2 P (30 wt %) showed both the highest activity and stability. Upon integration into the anode of a homemade direct ethanol fuel cell, the Pt-Ni2 P/C-30 % catalyst showed a maximum power density of 21 mW cm(-2) , which is approximately two times higher than that of a commercial Pt/C catalyst. The Pd-Ni2 P/C-30 % catalyst exhibited a maximum power density of 90 mW cm(-2) . This is approximately 1.5 times higher than that of a commercial Pd/C catalyst. The discharge stability on both two catalysts was also greatly improved over a 12 h discharge operation. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Rosso, Edoardo; McGrath, Richard
2016-02-29
Issue addressed: Recently arrived migrants and refugees from a culturally and linguistically diverse background (CALD) may be particularly vulnerable to social exclusion. Participation in sport is endorsed as a vehicle to ease the resettlement process; however, in Australia, this is often thought as a simple matter of integration into existing sport structures (e.g. clubs). This approach fails to place actual community needs at the centre of sport engagement efforts. Methods: A consultation framework was established with South Australian CALD community leaders and organisations to scope needs for community-based alternatives to participation in traditional sport (e.g. clubs), co-design a suitable community sport program and pilot it in five communities. Interviews and questionnaire surveys were conducted with participants, community representatives, stakeholders and volunteers. Results: Regular, free soccer activities engaged 263 young people from a great variety of nationalities, including over 50% refugees, in secondary state school and community-based sites. Conclusion: Alternative community sport programs can provide a basic but valuable forum to promote physical activity and associated well being in CALD and refugee communities. So what?: Alternative approaches can extend the health benefits of sport participation to disadvantaged children and youth who are excluded from traditional sport participation opportunities.
DEFF Research Database (Denmark)
Chen, Yun; Pai, Athma A; Herudek, Jan
2016-01-01
Mammalian transcriptomes are complex and formed by extensive promoter activity. In addition, gene promoters are largely divergent and initiate transcription of reverse-oriented promoter upstream transcripts (PROMPTs). Although PROMPTs are commonly terminated early, influenced by polyadenylation s...... suggest that basic building blocks of divergently transcribed core promoter pairs, in combination with the wealth of TSSs in mammalian genomes, provide a framework with which evolution shapes transcriptomes.......Mammalian transcriptomes are complex and formed by extensive promoter activity. In addition, gene promoters are largely divergent and initiate transcription of reverse-oriented promoter upstream transcripts (PROMPTs). Although PROMPTs are commonly terminated early, influenced by polyadenylation...
A green approach to the production of 2-pyridone derivatives promoted by infrared irradiation
Energy Technology Data Exchange (ETDEWEB)
Hernandez, F.; De la Cruz, F.; Lopez, J.; Pena, E.; Vazquez, M. A. [Universidad de Guanajuato, Dapartamento de Quimica, Noria Alta s/n, 36050 Guanajuato, Gto. (Mexico); Delgado, F. [IPN, Escuela Nacional de Ciencias Biologicas, Departamento de Quimica Organica, Prol. Carpio y Plan de Ayala s/n, 11340 Mexico D. F. (Mexico); Alcaraz, Y.; FRobles, J.; Martinez A, M., E-mail: mvazquez@ugto.mx [Universidad de Guanajuato, Departamento de Farmacia, Noria Alta s/n, 36050 Guanajuato, Gto. (Mexico)
2014-10-01
An alternative is presented by promoting a reaction with infrared irradiation to obtain different 4-aryl-3-cyano-5-ethoxycarbonyl-6-methyl-2-pyridone derivatives 9 a-k. The process was carried out with a green approach from the corresponding 4 H-pyrans, using mild reaction conditions and infrared irradiation as the energy source. In the first stage, the reaction produced 1,2,3,4-tetrahydropyridine-2-one derivatives 8 a-k, followed by an oxidative step to afford the target molecules in good yields. The structure of products 9 a-k was confirmed by Ft-IR, {sup 1}H NMR and {sup 13}C NMR spectroscopic techniques and X-ray diffraction. It was found that the efficiency of the reaction depends on the catalyst and the solvent, as well as on the aldehyde substituents. (Author)
Fip1 regulates mRNA alternative polyadenylation to promote stem cell self-renewal
Lackford, Brad; Yao, Chengguo; Charles, Georgette M; Weng, Lingjie; Zheng, Xiaofeng; Choi, Eun-A; Xie, Xiaohui; Wan, Ji; Xing, Yi; Freudenberg, Johannes M; Yang, Pengyi; Jothi, Raja; Hu, Guang; Shi, Yongsheng
2014-01-01
mRNA alternative polyadenylation (APA) plays a critical role in post-transcriptional gene control and is highly regulated during development and disease. However, the regulatory mechanisms and functional consequences of APA remain poorly understood. Here, we show that an mRNA 3′ processing factor, Fip1, is essential for embryonic stem cell (ESC) self-renewal and somatic cell reprogramming. Fip1 promotes stem cell maintenance, in part, by activating the ESC-specific APA profiles to ensure the optimal expression of a specific set of genes, including critical self-renewal factors. Fip1 expression and the Fip1-dependent APA program change during ESC differentiation and are restored to an ESC-like state during somatic reprogramming. Mechanistically, we provide evidence that the specificity of Fip1-mediated APA regulation depends on multiple factors, including Fip1-RNA interactions and the distance between APA sites. Together, our data highlight the role for post-transcriptional control in stem cell self-renewal, provide mechanistic insight on APA regulation in development, and establish an important function for APA in cell fate specification. PMID:24596251
Carnosol promotes endothelial differentiation under H2O2-induced oxidative stress
Directory of Open Access Journals (Sweden)
Ou Shulin
2017-01-01
Full Text Available Oxidative stress causes deregulation of endothelial cell differentiation. Carnosol is a potent antioxidant and antiinflammatory compound. In the present study, we examined whether the antioxidant effect of carnosol might protect bone marrow stem cells against H2O2-induced oxidative stress and promote endothelial differentiation. We examined cell viability by the MTT assay; oxidative stress and apoptosis were analyzed through changes in ROS levels, apoptotic ratio and caspase-3 activity; changes in protein expression of OCT-4, Flk-1, CD31 and Nrf-2 were assessed by Western blot analysis. H2O2 treatment increased oxidative stress and reduced cell viability, while the stem cell marker OCT-4 and endothelial markers Flk-1, CD31 were significantly downregulated as a result of the treatment with H2O2. Treatment with carnosol improved the antioxidant status, increased OCT-4 expression and promoted endothelial differentiation. This study provides evidence that carnosol could increase the antioxidant defense mechanism and promote endothelial differentiation.
mTORC2 Promotes Tumorigenesis via Lipid Synthesis.
Guri, Yakir; Colombi, Marco; Dazert, Eva; Hindupur, Sravanth K; Roszik, Jason; Moes, Suzette; Jenoe, Paul; Heim, Markus H; Riezman, Isabelle; Riezman, Howard; Hall, Michael N
2017-12-11
Dysregulated mammalian target of rapamycin (mTOR) promotes cancer, but underlying mechanisms are poorly understood. We describe an mTOR-driven mouse model that displays hepatosteatosis progressing to hepatocellular carcinoma (HCC). Longitudinal proteomic, lipidomics, and metabolomic analyses revealed that hepatic mTORC2 promotes de novo fatty acid and lipid synthesis, leading to steatosis and tumor development. In particular, mTORC2 stimulated sphingolipid (glucosylceramide) and glycerophospholipid (cardiolipin) synthesis. Inhibition of fatty acid or sphingolipid synthesis prevented tumor development, indicating a causal effect in tumorigenesis. Increased levels of cardiolipin were associated with tubular mitochondria and enhanced oxidative phosphorylation. Furthermore, increased lipogenesis correlated with elevated mTORC2 activity and HCC in human patients. Thus, mTORC2 promotes cancer via formation of lipids essential for growth and energy production. Copyright © 2017 Elsevier Inc. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Ponthier, Julie L.; Schluepen, Christina; Chen, Weiguo; Lersch,Robert A.; Gee, Sherry L.; Hou, Victor C.; Lo, Annie J.; Short, Sarah A.; Chasis, Joel A.; Winkelmann, John C.; Conboy, John G.
2006-03-01
Activation of protein 4.1R exon 16 (E16) inclusion during erythropoiesis represents a physiologically important splicing switch that increases 4.1R affinity for spectrin and actin. Previous studies showed that negative regulation of E16 splicing is mediated by the binding of hnRNP A/B proteins to silencer elements in the exon and that downregulation of hnRNP A/B proteins in erythroblasts leads to activation of E16 inclusion. This paper demonstrates that positive regulation of E16 splicing can be mediated by Fox-2 or Fox-1, two closely related splicing factors that possess identical RNA recognition motifs. SELEX experiments with human Fox-1 revealed highly selective binding to the hexamer UGCAUG. Both Fox-1 and Fox-2 were able to bind the conserved UGCAUG elements in the proximal intron downstream of E16, and both could activate E16 splicing in HeLa cell co-transfection assays in a UGCAUG-dependent manner. Conversely, knockdown of Fox-2 expression, achieved with two different siRNA sequences resulted in decreased E16 splicing. Moreover, immunoblot experiments demonstrate mouse erythroblasts express Fox-2, but not Fox-1. These findings suggest that Fox-2 is a physiological activator of E16 splicing in differentiating erythroid cells in vivo. Recent experiments show that UGCAUG is present in the proximal intron sequence of many tissue-specific alternative exons, and we propose that the Fox family of splicing enhancers plays an important role in alternative splicing switches during differentiation in metazoan organisms.
GSTT2 promoter polymorphisms and colorectal cancer risk
Directory of Open Access Journals (Sweden)
Ahn Sun-A
2007-01-01
Full Text Available Abstract Background Glutathione S-transferases are a group of enzymes that participate in detoxification and defense mechanisms against toxic carcinogens and other compounds. These enzymes play an important role in human carcinogenesis. In the present study, we sought to determine whether GSTT2 promoter single nucleotide polymorphisms (SNPs are associated with colorectal cancer risk. Methods A total of 436 colorectal cancer patients and 568 healthy controls were genotyped for three GSTT2 promoter SNPs (-537G>A, -277T>C and -158G>A, using real-time TaqMan assay and direct sequencing. An electrophoretic mobility shift assay (EMSA was performed to determine the effects of polymorphisms on protein binding to the GSTT2 promoter. Results The -537A allele (-537G/A or A/A was significantly associated with colorectal cancer risk (OR = 1.373, p = 0.025, while the -158A allele (-158G/A or A/A was involved in protection against colorectal cancer (OR = 0.539, p = 0.032. Haplotype 2 (-537A, -277T, -158G was significantly associated with colorectal cancer risk (OR = 1.386, p = 0.021, while haplotype 4 (-537G, -277C, -158A protected against colorectal cancer (OR = 0.539, p = 0.032. EMSA data revealed lower promoter binding activity in the -537A allele than its -537G counterpart. Conclusion Our results collectively suggest that SNPs and haplotypes of the GSTT2 promoter region are associated with colorectal cancer risk in the Korean population.
Regional alternative transportation evaluation report - region 2
2012-03-01
The U.S. Fish and Wildlife Service (FWS) and the U.S. Department of Transportation (DOT) Volpe : Center (Volpe Center) conducted a regional alternative transportation evaluation (RATE) in Region 2, : which is comprised of Arizona, Oklahoma, New Mexic...
Alternatives to Nuclear Power in Romania
International Nuclear Information System (INIS)
Andrei, L.; Manea, Gh.
1996-01-01
The paper proposes alternatives to nuclear power generation in Romania. The priorities are: improvement of efficiency in producing, transmission, and energy use; promoting the renewable resources of energy, especially of hydroelectric power; restructuring industry under criteria of power consumption efficiency; commercial purposes from horizontal nuclear sector activity in Romania. There are described the causes behind the energy crisis in Romania and present energy policy solutions to it. (author). 2 tabs., 10 refs
Ameloginins promote an alternatively activated macrophage phenotype in vitro
DEFF Research Database (Denmark)
Almqvist, S; Werthen, M; Lyngstadas, SP
2011-01-01
aggregates were visualised by transmission electron microscopy. The amelogenin treatment of macrophages increased several pro- and anti-inflammatory cytokines, including alternative macrophage activation marker AMAC-1 (p
Fan, Lingling; Zhang, Fengbo; Xu, Songhui; Cui, Xiaolu; Hussain, Arif; Fazli, Ladan; Gleave, Martin; Dong, Xuesen; Qi, Jianfei
2018-05-15
Formation of the androgen receptor splicing variant 7 (AR-V7) is one of the major mechanisms by which resistance of prostate cancer to androgen deprivation therapy occurs. The histone demethylase JMJD1A (Jumonji domain containing 1A) functions as a key coactivator for AR by epigenetic regulation of H3K9 methylation marks. Here, we describe a role for JMJD1A in AR-V7 expression. While JMJD1A knockdown had no effect on full-length AR (AR-FL), it reduced AR-V7 levels in prostate cancer cells. Reexpression of AR-V7 in the JMJD1A-knockdown cells elevated expression of select AR targets and partially rescued prostate cancer cell growth in vitro and in vivo. The AR-V7 protein level correlated positively with JMJD1A in a subset of human prostate cancer specimens. Mechanistically, we found that JMJD1A promoted alternative splicing of AR-V7 through heterogeneous nuclear ribonucleoprotein F (HNRNPF), a splicing factor known to regulate exon inclusion. Knockdown of JMJD1A or HNRNPF inhibited splicing of AR-V7, but not AR-FL, in a minigene reporter assay. JMJD1A was found to interact with and promote the recruitment of HNRNPF to a cryptic exon 3b on AR pre-mRNA for the generation of AR-V7. Taken together, the role of JMJD1A in AR-FL coactivation and AR-V7 alternative splicing highlights JMJD1A as a potentially promising target for prostate cancer therapy.
Tausendschön, Michaela; Rehli, Michael; Dehne, Nathalie; Schmidl, Christian; Döring, Claudia; Hansmann, Martin-Leo; Brüne, Bernhard
2015-01-01
Macrophages (MΦ) often accumulate in hypoxic areas, where they significantly influence disease progression. Anti-inflammatory cytokines, such as IL-10, generate alternatively activated macrophages that support tumor growth. To understand how alternative activation affects the transcriptional profile of hypoxic macrophages, we globally mapped binding sites of hypoxia-inducible factor (HIF)-1α and HIF-2α in primary human monocyte-derived macrophages prestimulated with IL-10. 713 HIF-1 and 795 HIF-2 binding sites were identified under hypoxia. Pretreatment with IL-10 altered the binding pattern, with 120 new HIF-1 and 188 new HIF-2 binding sites emerging. HIF-1 binding was most prominent in promoters, while HIF-2 binding was more abundant in enhancer regions. Comparison of ChIP-seq data obtained in other cells revealed a highly cell type specific binding of HIF. In MΦ HIF binding occurred preferentially in already active enhancers or promoters. To assess the roles of HIF on gene expression, primary human macrophages were treated with siRNA against HIF-1α or HIF-2α, followed by genome-wide gene expression analysis. Comparing mRNA expression to the HIF binding profile revealed a significant enrichment of hypoxia-inducible genes previously identified by ChIP-seq. Analysis of gene expression under hypoxia alone and hypoxia/IL-10 showed the enhanced induction of a set of genes including PLOD2 and SLC2A3, while another group including KDM3A and ADM remained unaffected or was reduced by IL-10. Taken together IL-10 influences the DNA binding pattern of HIF and the level of gene induction. Copyright © 2014 Elsevier B.V. All rights reserved.
Agersborg, Sally; Mixon, Christopher; Nguyen, Thanh; Aithal, Sramila; Sudarsanam, Sucha; Blocker, Forrest; Weiss, Lawrence; Gasparini, Robert; Jiang, Shiping; Chen, Wayne; Hess, Gregory; Albitar, Maher
2018-03-22
While HER2 testing is well established in directing appropriate treatment for breast cancer, a small percentage of cases show equivocal results by immunohistochemistry (IHC) and fluorescence in situ hybridization (FISH). Alternative probes may be used in equivocal cases. We present a single community-based institution's experience in further evaluating these cases. Between 2014 and 2016, 4255 samples were submitted for HER2 amplification testing by alternative probes, TP53, RAI1, and RARA. Of the patients tested by FISH, 505/3908 (12.9%) also had IHC data. Most (73.9%) FISH equivocal cases remained equivocal after IHC testing. However, 50.5% of equivocal cases were classified as HER2 amplified by alternative probes. Most cases were positive by more than one probe: 78% of positive cases by RAI1 and 73.9% by TP53. There was a significant difference between IHC and FISH alternative testing (p alternative FISH testing. Available data showed that 41% of patients were treated with palbociclib and were positive by alternative FISH. The prevalence of double HER2 equivocal cases and the discrepancy between IHC and alternative FISH testing suggest that FISH alternative testing using both RAI1 and TP53 probes is necessary for conclusive classification. Because almost half of FISH equivocal cases converted to HER2 amplified upon alternative testing, clinical studies to determine the benefit of anti-HER2 therapy in these patients are urgently needed.
DEFF Research Database (Denmark)
Møller, A M; Jensen, N M; Pildal, J
2001-01-01
This study was performed to test the hypothesis that genetic variation in the promoter of the glucose transporter 2 (GLUT2) might predispose to prediabetic phenotypes or type 2 diabetes. A total of 1611 bp comprising the minimal promoter region of the GLUT2 gene were examined by combined single-s......-tolerant subjects. In conclusion, we found no evidence supporting the hypothesis that genetic variability in the minimal promoter of the GLUT2 is associated with type 2 diabetes or prediabetic phenotypes in the Danish population.......This study was performed to test the hypothesis that genetic variation in the promoter of the glucose transporter 2 (GLUT2) might predispose to prediabetic phenotypes or type 2 diabetes. A total of 1611 bp comprising the minimal promoter region of the GLUT2 gene were examined by combined single...
Lombardi, D.; Sinatra, G. M.
2013-12-01
Critical evaluation and plausibility reappraisal of scientific explanations have been underemphasized in many science classrooms (NRC, 2012). Deep science learning demands that students increase their ability to critically evaluate the quality of scientific knowledge, weigh alternative explanations, and explicitly reappraise their plausibility judgments. Therefore, this lack of instruction about critical evaluation and plausibility reappraisal has, in part, contributed to diminished understanding about complex and controversial topics, such as global climate change. The Model-Evidence Link (MEL) diagram (originally developed by researchers at Rutgers University under an NSF-supported project; Chinn & Buckland, 2012) is an instructional scaffold that promotes students to critically evaluate alternative explanations. We recently developed a climate change MEL and found that the students who used the MEL experienced a significant shift in their plausibility judgments toward the scientifically accepted model of human-induced climate change. Using the MEL for instruction also resulted in conceptual change about the causes of global warming that reflected greater understanding of fundamental scientific principles. Furthermore, students sustained this conceptual change six months after MEL instruction (Lombardi, Sinatra, & Nussbaum, 2013). This presentation will discuss recent educational research that supports use of the MEL to promote critical evaluation, plausibility reappraisal, and conceptual change, and also, how the MEL may be particularly effective for learning about global climate change and other socio-scientific topics. Such instruction to develop these fundamental thinking skills (e.g., critical evaluation and plausibility reappraisal) is demanded by both the Next Generation Science Standards (Achieve, 2013) and the Common Core State Standards for English Language Arts and Mathematics (CCSS Initiative-ELA, 2010; CCSS Initiative-Math, 2010), as well as a
Jamming Attack in Wireless Sensor Network: From Time to Space
Sun, Yanqiang; Wang, Xiaodong; Zhou, Xingming
Classical jamming attack models in the time domain have been proposed, such as constant jammer, random jammer, and reactive jammer. In this letter, we consider a new problem: given k jammers, how does the attacker minimize the pair-wise connectivity among the nodes in a Wireless Sensor Network (WSN)? We call this problem k-Jammer Deployment Problem (k-JDP). To the best of our knowledge, this is the first attempt at considering the position-critical jamming attack against wireless sensor network. We mainly make three contributions. First, we prove that the decision version of k-JDP is NP-complete even in the ideal situation where the attacker has full knowledge of the topology information of sensor network. Second, we propose a mathematical formulation based on Integer Programming (IP) model which yields an optimal solution. Third, we present a heuristic algorithm HAJDP, and compare it with the IP model. Numerical results show that our heuristic algorithm is computationally efficient.
Cyclooxygenase 2 Promotes Parathyroid Hyperplasia in ESRD
Zhang, Qian; Qiu, Junsi; Li, Haiming; Lu, Yanwen; Wang, Xiaoyun; Yang, Junwei; Wang, Shaoqing; Zhang, Liyin; Gu, Yong; Hao, Chuan-Ming
2011-01-01
Hyperplasia of the PTG underlies the secondary hyperparathyroidism (SHPT) observed in CKD, but the mechanism underlying this hyperplasia is incompletely understood. Because aberrant cyclooxygenase 2 (COX2) expression promotes epithelial cell proliferation, we examined the effects of COX2 on the parathyroid gland in uremia. In patients with ESRD who underwent parathyroidectomy, clusters of cells within the parathyroid glands had increased COX2 expression. Some COX2-positive cells exhibited two nuclei, consistent with proliferation. Furthermore, nearly 78% of COX2-positive cells expressed proliferating cell nuclear antigen (PCNA). In the 5/6-nephrectomy rat model, rats fed a high-phosphate diet had significantly higher serum PTH levels and larger parathyroid glands than sham-operated rats. Compared with controls, the parathyroid glands of uremic rats exhibited more PCNA-positive cells and greater COX2 expression in the chief cells. Treatment with COX2 inhibitor celecoxib significantly reduced PCNA expression, attenuated serum PTH levels, and reduced the size of the glands. In conclusion, COX2 promotes the pathogenesis of hyperparathyroidism in ESRD, suggesting that inhibiting the COX2 pathway could be a potential therapeutic target. PMID:21335517
DEFF Research Database (Denmark)
Mishra, Shiva Raj; Neupane, Dinesh; Kallestrup, Per
2015-01-01
Complementary and alternative medicine has been a part of human life and practices since the beginning of time. The role of complementary and alternative medicine for the health of humans is undisputed particularly in light of its role in health promotion and well-being. This article discusses wa...... through which complementary and alternative medicine can be promoted and sustained as an integrated element of health care in developing countries. We specifically present the exemplary of Amchi traditional doctors of Northern Himalayas......Complementary and alternative medicine has been a part of human life and practices since the beginning of time. The role of complementary and alternative medicine for the health of humans is undisputed particularly in light of its role in health promotion and well-being. This article discusses ways...
Energy Technology Data Exchange (ETDEWEB)
Yanagawa, H.; Nishio, H.; Takeshima, Y. [Kobe Univ. School of Medicine (Japan)] [and others
1994-09-01
The dystrophin gene, which is muted in patients with Duchenne and Becker muscular dystrophies, is the largest known human gene. Five alternative promoters have been characterized until now. Here we show that a novel dystrophin isoform with a different first exon can be produced through transcription initiation at a previously-unidentified alternative promoter. The case study presented is that of patient with Duchenne muscular dystrophy who had a deletion extending from 5{prime} end of the dystrophin gene to exon 2, including all promoters previously mapped in the 5{prime} part of the gene. Transcripts from lymphoblastoid cells were found to contain sequences corresponding to exon 3, indicating the presence of new promoter upstream of this exon. The nucleotide sequence of amplified cDNA corresponding to the 5{prime} end of the new transcript indicated that the 5{prime} end of exon 3 was extended by 9 codons, only the last (most 3{prime}) of which codes for methionine. The genomic nucleotide sequence upstream from the new exon, as determined using inverse polymerase chain reaction, revealed the presence of sequences similar to a TATA box, an octamer motif and an MEF-2 element. The identified promoter/exon did not map to intron 2, as might have been expected, but to a position more than 500 kb upstream of the most 5{prime} of the previously-identified promoters, thereby adding 500 kb to the dystrophin gene. The sequence of part of the new promoter region is very similar to that of certain medium reiteration frequency repetitive sequences. These findings may help us understand the molecular evolution of the dystrophin gene.
Identification of functional DNA variants in the constitutive promoter region of MDM2
Directory of Open Access Journals (Sweden)
Lalonde Marie-Eve
2012-09-01
Full Text Available Abstract Although mutations in the oncoprotein murine double minute 2 (MDM2 are rare, MDM2 gene overexpression has been observed in several human tumors. Given that even modest changes in MDM2 levels might influence the p53 tumor suppressor signaling pathway, we postulated that sequence variation in the promoter region of MDM2 could lead to disregulated expression and variation in gene dosage. Two promoters have been reported for MDM2; an internal promoter (P2, which is located near the end of intron 1 and is p53-responsive, and an upstream constitutive promoter (P1, which is p53-independent. Both promoter regions contain DNA variants that could influence the expression levels of MDM2, including the well-studied single nucleotide polymorphism (SNP SNP309, which is located in the promoter P2; i.e., upstream of exon 2. In this report, we screened the promoter P1 for DNA variants and assessed the functional impact of the corresponding SNPs. Using the dbSNP database and genotyping validation in individuals of European descent, we identified three common SNPs (−1494 G > A; indel 40 bp; and −182 C > G. Three major promoter haplotypes were inferred by using these three promoter SNPs together with rs2279744 (SNP309. Following subcloning into a gene reporter system, we found that two of the haplotypes significantly influenced MDM2 promoter activity in a haplotype-specific manner. Site-directed mutagenesis experiments indicated that the 40 bp insertion/deletion variation is causing the observed allelic promoter activity. This study suggests that part of the variability in the MDM2 expression levels could be explained by allelic p53-independent P1 promoter activity.
Long-term-consequence analysis of no action alternative 2
International Nuclear Information System (INIS)
Buck, J.W.; Bagaasen, L.M.; Staven, L.H.; Serne, R.J.
1996-07-01
This report is a supplement to the Waste Isolation Pilot Plant (WIPP) Disposal-Phase Supplemental Environmental Impact Statement. Data and information is described which pertains to estimated impacts from postulated long-term release of radionuclides and hazardous constituents from alpha-bearing wastes stored at major generator/storage sites after loss of institutional control (no action alternative 2). Under this alternative, wastes would remain at the generator sites and not be emplaced at WIPP
Directory of Open Access Journals (Sweden)
David Rodrigues
Full Text Available When individuals are highly committed to their romantic relationship, they are more likely to engage in pro-relationship maintenance mechanisms. The present research expanded on the notion that commitment redirects self-oriented goals to consider broader relational goals and examined whether commitment interacts with a promotion and prevention focus to activate derogation of attractive alternatives. Three studies used cross-sectional and experimental approaches. Study 1 showed that romantically involved individuals predominantly focused on promotion, but not prevention, reported less initial attraction to an attractive target than single individuals, especially when highly committed to their relationship. Study 2 showed that romantically involved individuals induced in a promotion focus, compared to those in prevention focus, reported less initial attraction, but only when more committed to their relationship. Regardless of regulatory focus manipulation, more committed individuals were also less likely to perceive quality among alternative scenarios and to be attentive to alternative others in general. Finally, Study 3 showed that romantically involved individuals induced in promotion focus and primed with high commitment reported less initial attraction, than those primed with low commitment, or than those induced in prevention focus. Once again, for these latter no differences occurred according to commitment prime. Together, the findings suggest that highly committed promotion focused individuals consider broader relationship goals and activate relationship maintenance behaviors such as derogation of attractive alternatives to promote their relationship.
Rodrigues, David; Lopes, Diniz; Kumashiro, Madoka
2017-01-01
When individuals are highly committed to their romantic relationship, they are more likely to engage in pro-relationship maintenance mechanisms. The present research expanded on the notion that commitment redirects self-oriented goals to consider broader relational goals and examined whether commitment interacts with a promotion and prevention focus to activate derogation of attractive alternatives. Three studies used cross-sectional and experimental approaches. Study 1 showed that romantically involved individuals predominantly focused on promotion, but not prevention, reported less initial attraction to an attractive target than single individuals, especially when highly committed to their relationship. Study 2 showed that romantically involved individuals induced in a promotion focus, compared to those in prevention focus, reported less initial attraction, but only when more committed to their relationship. Regardless of regulatory focus manipulation, more committed individuals were also less likely to perceive quality among alternative scenarios and to be attentive to alternative others in general. Finally, Study 3 showed that romantically involved individuals induced in promotion focus and primed with high commitment reported less initial attraction, than those primed with low commitment, or than those induced in prevention focus. Once again, for these latter no differences occurred according to commitment prime. Together, the findings suggest that highly committed promotion focused individuals consider broader relationship goals and activate relationship maintenance behaviors such as derogation of attractive alternatives to promote their relationship.
Characterization of the promoter of human CRTh2, a prostaglandin D{sub 2} receptor
Energy Technology Data Exchange (ETDEWEB)
Quapp, Russell; Madsen, Norman [Department of Medicine, Division of Pulmonary Medicine, Pulmonary Research Group, 574B Heritage Medical Research Centre, University of Alberta, Edmonton, AB, T6G 2S2 (Canada); Cameron, Lisa [Department of Medicine, Division of Pulmonary Medicine, Pulmonary Research Group, 574B Heritage Medical Research Centre, University of Alberta, Edmonton, AB, T6G 2S2 (Canada)
2007-11-30
Chemoattractant-receptor homologous molecule expressed on Th2 cells (CRTh2) is a receptor for prostaglandin (PG)D{sub 2}, a lipid mediator involved in allergic inflammation. CRTh2 is expressed by Th2 cells, eosinophils and basophils and PDG{sub 2}-CRTh2 signaling induces calcium mobilization, cell migration and expression of the Th2 cytokines IL-4, IL-5, and IL-13. Despite the role of CRTh2 in allergic inflammation, transcriptional regulation of this gene has not been studied. Here, we demonstrated that a reporter construct of the CRTh2 promoter was induced following T cell stimulation. This activity could be further enhanced by over-expression of GATA-3, but not NFAT2 or STAT6. Electromobility shift assay demonstrated GATA-3 binding to a probe from the CRTh2 promoter. This study provides the first detailed analysis of transcriptional regulation of the human CRTh2 promoter. These findings may help identify strategies to attenuate expression of this gene and influence the maintenance and proliferation of Th2 cells in allergic inflammation.
H2A/K pseudogene mutation may promote cell proliferation
Energy Technology Data Exchange (ETDEWEB)
Guo, Jisheng; Jing, Ruirui; Lv, Xin; Wang, Xiaoyue; Li, Junqiang; Li, Lin; Li, Cuiling; Wang, Daoguang; Bi, Baibing; Chen, Xinjun [Cancer Research Center, Shandong University School of Medicine, Jinan 250012 (China); Yang, Jing-Hua, E-mail: sdu_crc_group1@126.com [Cancer Research Center, Shandong University School of Medicine, Jinan 250012 (China); Department of Surgery, VA Boston Healthcare System, Boston University School of Medicine, Boston 510660, MA (United States)
2016-05-15
Highlights: • The mutant H2A/K pseudogene is active. • The mutant H2A/K pseudogene can promote cell proliferation. - Abstract: Little attention has been paid to the histone H2A/K pseudogene. Results from our laboratory showed that 7 of 10 kidney cancer patients carried a mutant H2A/K pseudogene; therefore, we were interested in determining the relationship between mutant H2A/K and cell proliferation. We used shotgun and label-free proteomics methods to study whether mutant H2A/K lncRNAs affected cell proliferation. Quantitative proteomic analysis indicated that the expression of mutant H2A/K lncRNAs resulted in the upregulation of many oncogenes, which promoted cell proliferation. Further interaction analyses revealed that a proliferating cell nuclear antigen (PCNA)-protein interaction network, with PCNA in the center, contributes to cell proliferation in cells expressing the mutant H2A/K lncRNAs. Western blotting confirmed the critical upregulation of PCNA by mutant H2A/K lncRNA expression. Finally, the promotion of cell proliferation by mutant H2A/K lncRNAs (C290T, C228A and A45G) was confirmed using cell proliferation assays. Although we did not determine the exact mechanism by which the oncogenes were upregulated by the mutant H2A/K lncRNAs, we confirmed that the mutant H2A/K lncRNAs promoted cell proliferation by upregulating PCNA and other oncogenes. The hypothesis that cell proliferation is promoted by the mutant H2A/K lncRNAs was supported by the protein expression and cell proliferation assay results. Therefore, mutant H2A/K lncRNAs may be a new factor in renal carcinogenesis.
Multiple promoters and alternative splicing: Hoxa5 transcriptional complexity in the mouse embryo.
Directory of Open Access Journals (Sweden)
Yan Coulombe
2010-05-01
Full Text Available The genomic organization of Hox clusters is fundamental for the precise spatio-temporal regulation and the function of each Hox gene, and hence for correct embryo patterning. Multiple overlapping transcriptional units exist at the Hoxa5 locus reflecting the complexity of Hox clustering: a major form of 1.8 kb corresponding to the two characterized exons of the gene and polyadenylated RNA species of 5.0, 9.5 and 11.0 kb. This transcriptional intricacy raises the question of the involvement of the larger transcripts in Hox function and regulation.We have undertaken the molecular characterization of the Hoxa5 larger transcripts. They initiate from two highly conserved distal promoters, one corresponding to the putative Hoxa6 promoter, and a second located nearby Hoxa7. Alternative splicing is also involved in the generation of the different transcripts. No functional polyadenylation sequence was found at the Hoxa6 locus and all larger transcripts use the polyadenylation site of the Hoxa5 gene. Some larger transcripts are potential Hoxa6/Hoxa5 bicistronic units. However, even though all transcripts could produce the genuine 270 a.a. HOXA5 protein, only the 1.8 kb form is translated into the protein, indicative of its essential role in Hoxa5 gene function. The Hoxa6 mutation disrupts the larger transcripts without major phenotypic impact on axial specification in their expression domain. However, Hoxa5-like skeletal anomalies are observed in Hoxa6 mutants and these defects can be explained by the loss of expression of the 1.8 kb transcript. Our data raise the possibility that the larger transcripts may be involved in Hoxa5 gene regulation.Our observation that the Hoxa5 larger transcripts possess a developmentally-regulated expression combined to the increasing sum of data on the role of long noncoding RNAs in transcriptional regulation suggest that the Hoxa5 larger transcripts may participate in the control of Hox gene expression.
Characterization and sequence analysis of the F2 promoter from corynephage BFK20
International Nuclear Information System (INIS)
Koptides, M.; Ugorcakova, J.; Baloghova, E.; Bukovska, G.; Timko, J.
1994-01-01
F2 promoter from corynephage BFK20 was isolated and characterized. It was functional in Escherichia coli and Corynebacterium glutamicum. Cloning of the F2 promoter into the pJUP05 promoter probe vector caused an increase of the neomycin phosphotransferase II specific activity. According to the Northern blot hybridization the nptII gene was expressed from the cloned F2 promoter. The apparent transcription start point in E. coli and C. glutamicum was determined. The-35 region of F2 promoter showed high similarity to that of E. coli promoter consensus sequence, but its - 10 region was G+C rich and had no significant homology to that. (author)
Interplay between estrogen receptor and AKT in estradiol-induced alternative splicing.
Bhat-Nakshatri, Poornima; Song, Eun-Kyung; Collins, Nikail R; Uversky, Vladimir N; Dunker, A Keith; O'Malley, Bert W; Geistlinger, Tim R; Carroll, Jason S; Brown, Myles; Nakshatri, Harikrishna
2013-06-11
Alternative splicing is critical for generating complex proteomes in response to extracellular signals. Nuclear receptors including estrogen receptor alpha (ERα) and their ligands promote alternative splicing. The endogenous targets of ERα:estradiol (E2)-mediated alternative splicing and the influence of extracellular kinases that phosphorylate ERα on E2-induced splicing are unknown. MCF-7 and its anti-estrogen derivatives were used for the majority of the assays. CD44 mini gene was used to measure the effect of E2 and AKT on alternative splicing. ExonHit array analysis was performed to identify E2 and AKT-regulated endogenous alternatively spliced apoptosis-related genes. Quantitative reverse transcription polymerase chain reaction was performed to verify alternative splicing. ERα binding to alternatively spliced genes was verified by chromatin immunoprecipitation assay. Bromodeoxyuridine incorporation-ELISA and Annexin V labeling assays were done to measure cell proliferation and apoptosis, respectively. We identified the targets of E2-induced alternative splicing and deconstructed some of the mechanisms surrounding E2-induced splicing by combining splice array with ERα cistrome and gene expression array. E2-induced alternatively spliced genes fall into at least two subgroups: coupled to E2-regulated transcription and ERα binding to the gene without an effect on rate of transcription. Further, AKT, which phosphorylates both ERα and splicing factors, influenced ERα:E2 dependent splicing in a gene-specific manner. Genes that are alternatively spliced include FAS/CD95, FGFR2, and AXIN-1. E2 increased the expression of FGFR2 C1 isoform but reduced C3 isoform at mRNA level. E2-induced alternative splicing of FAS and FGFR2 in MCF-7 cells correlated with resistance to FAS activation-induced apoptosis and response to keratinocyte growth factor (KGF), respectively. Resistance of MCF-7 breast cancer cells to the anti-estrogen tamoxifen was associated with ER
Naturally occurring BRCA2 alternative mRNA splicing events in clinically relevant samples
DEFF Research Database (Denmark)
Fackenthal, James D; Yoshimatsu, Toshio; Zhang, Bifeng
2016-01-01
patterns and thereby disrupt gene function. mRNA analyses are therefore among the tests used to interpret the clinical significance of some genetic variants. However, these could be confounded by the appearance of naturally occurring alternative transcripts unrelated to germline sequence variation...... to characterise the spectrum of naturally occurring BRCA2 mRNA alternate-splicing events. METHODS: mRNA was prepared from several blood and breast tissue-derived cells and cell lines by contributing ENIGMA laboratories. cDNA representing BRCA2 alternate splice sites was amplified and visualised using capillary...... or agarose gel electrophoresis, followed by sequencing. RESULTS: We demonstrate the existence of 24 different BRCA2 mRNA alternate-splicing events in lymphoblastoid cell lines and both breast cancer and non-cancerous breast cell lines. CONCLUSIONS: These naturally occurring alternate-splicing events...
2017-01-01
When individuals are highly committed to their romantic relationship, they are more likely to engage in pro-relationship maintenance mechanisms. The present research expanded on the notion that commitment redirects self-oriented goals to consider broader relational goals and examined whether commitment interacts with a promotion and prevention focus to activate derogation of attractive alternatives. Three studies used cross-sectional and experimental approaches. Study 1 showed that romantically involved individuals predominantly focused on promotion, but not prevention, reported less initial attraction to an attractive target than single individuals, especially when highly committed to their relationship. Study 2 showed that romantically involved individuals induced in a promotion focus, compared to those in prevention focus, reported less initial attraction, but only when more committed to their relationship. Regardless of regulatory focus manipulation, more committed individuals were also less likely to perceive quality among alternative scenarios and to be attentive to alternative others in general. Finally, Study 3 showed that romantically involved individuals induced in promotion focus and primed with high commitment reported less initial attraction, than those primed with low commitment, or than those induced in prevention focus. Once again, for these latter no differences occurred according to commitment prime. Together, the findings suggest that highly committed promotion focused individuals consider broader relationship goals and activate relationship maintenance behaviors such as derogation of attractive alternatives to promote their relationship. PMID:28319147
SAGE 2.0 SOLVENT ALTERNATIVES GUIDE - USER'S GUIDE
The guide provides instruction for using the SAGE (Solvent Alternatives Guide) software system, version 2.O. It assumes that the user is familiar with the fundamentals of operating a personal computer under the Microsoft disk operating system (MS-DOS). AGE recommends solvent repl...
SAGE 2.1: SOLVENT ALTERNATIVES GUIDE: USER'S GUIDE
The guide provides instruction for using the SAGE (Solvent Alternatives GuidE) software system, version 2.1. SAGE recommends solvent replacements in cleaning and degreasing operations. It leads the user through a question-and-answer session. The user's responses allow the system ...
Directory of Open Access Journals (Sweden)
Leandro M Redondo
2014-03-01
Full Text Available Antibiotics have been included in the formulation of feed for livestock production for more than 40 years as a strategy to improve feed conversion rates and to reduce costs. The use of antimicrobials as growth-promoting factors (AGP in sub-therapeutic doses for long periods is particularly favorable to select antimicrobial-resistant microorganisms. In the last years, global concern about development of antimicrobial resistance and transference of resistance genes from animal to human strains has been arising. Removal of AGP from animal diets involves a tremendous pressure on the livestock and poultry farmers, one of the main consequences being a substantial increase in the incidence of infectious diseases with the related increase in the use of antibiotics for therapy and, concomitantly, economic cost. Therefore, alternatives to AGP are urgently needed. The challenge is to implement new alternatives without affecting the production performances of livestock and also avoiding the increase of antimicrobial resistant microorganisms. Plant extracts and purified derived substances are showing promising results for food animal production, either from their efficacy as well as from an economical point of view. Tannins are plant derived compounds that are being successfully used as additives in feed poultry to control diseases and to improve animal performance. Successful use of any of these extracts as feed additive must ensure a product of consistent quality in enough quantities to fulfill the actual requirements of the poultry industry. Chestnut (hydrolizable and Quebracho (condennsed tannins are probably the most readily available commercial products that are covering those needs. The present report intends to analyze the available data supporting their use.
Alternative motor fuels today and tomorrow
International Nuclear Information System (INIS)
Bensaid, B.
2004-01-01
Today, petroleum products account for 97% of the energy consumed in road transport. The purpose of replacing these products with alternative energies is to reduce oil dependence as well as greenhouse gas emissions. The high price of oil has promoted the use of 'conventional' alternative motor fuels (biofuels, LPG, NGV) and also renewed interest in syn-fuels (GTL, CTL, BTL) that have already given rise to industrial and pilot projects. (author)
Promoter2.0: for the recognition of PolII promoter sequences
DEFF Research Database (Denmark)
Knudsen, Steen; Knudsen, Steen
1999-01-01
Motivation : A new approach to the prediction of eukaryotic PolII promoters from DNA sequence takesadvantage of a combination of elements similar to neural networks and genetic algorithms to recognize a set ofdiscrete subpatterns with variable separation as one pattern: a promoter. The neural...... of optimization, the algorithm was able todiscriminate between vertebrate promoter and non-promoter sequences in a test set with a correlationcoefficient of 0.63. In addition, all five known transcription start sites on the plus strand of the completeadenovirus genome were within 161 bp of 35 predicted...
Alternative Fuel News, Vol. 2, No. 7
Energy Technology Data Exchange (ETDEWEB)
NREL
1999-05-20
What's in store for alternative Fuels and advanced technology vehicles in the new millennium? The Clean Cities Coalitions now operate more than 240,000 alternative fuel vehicles in both public and private sectors and have access to more than 4,000 alternative refueling stations. DOE recently announced the selection of 15 proposals that will receive just under $1.7 million in financial assistance to help expand DOE's information dissemination and public outreach efforts for alternative fuels and advanced transportation technologies.
Energy Technology Data Exchange (ETDEWEB)
El-Gemmizi, M A [Nuclear Materials Authority, Cairo, (Egypt)
1996-03-01
In most of the Egyptian altered radioactive granites, highly magnetic heavy particles were found to be radioactive. They are a mixture of several iron oxide minerals which are products of super gene alternation of the preexisting hypo gene iron-bearing minerals especially magnetite and pyrite. The end products of this super gene alternation are mainly hydrated iron oxide minerals limonite and/or goethite. During the alternation, deformation and defects in the mineral structure took place, thereby promoting diffusion of the substitutional and interstitial ions (uranium) towards these sites. The mechanism of the alternation of the hypo gene iron-bearing minerals, magnetite and pyrite to form the secondary mineral hematite, limonite and goethite; and the role of these secondary minerals in fixing uranium from the circulating media, and as indicators to the radioactivity of the host rocks are discussed. 2 figs.
International Nuclear Information System (INIS)
El-Gemmizi, M.A.
1996-01-01
In most of the Egyptian altered radioactive granites, highly magnetic heavy particles were found to be radioactive. They are a mixture of several iron oxide minerals which are products of super gene alternation of the preexisting hypo gene iron-bearing minerals especially magnetite and pyrite. The end products of this super gene alternation are mainly hydrated iron oxide minerals limonite and/or goethite. During the alternation, deformation and defects in the mineral structure took place, thereby promoting diffusion of the substitutional and interstitial ions (uranium) towards these sites. The mechanism of the alternation of the hypo gene iron-bearing minerals, magnetite and pyrite to form the secondary mineral hematite, limonite and goethite; and the role of these secondary minerals in fixing uranium from the circulating media, and as indicators to the radioactivity of the host rocks are discussed. 2 figs
TiO2 promoted by two different non-noble metal cocatalysts for enhanced photocatalytic H2 evolution
International Nuclear Information System (INIS)
Lin, Jing-Dong; Yan, Shi; Huang, Qin-Dong; Fan, Mei-Ting; Yuan, You-Zhu; Tan, Timothy Thatt-Yang; Liao, Dai-Wei
2014-01-01
TiO 2 photocatalysts modified by cobalt and nickel cocatalysts were prepared via polymerized complex method (PCM) and evaluated by photocatalytic hydrogen evolution. Hydrogen generation in 6 h for the TiO 2 promoted by cobalt and nickel (0.1%Co + 0.2%Ni/TiO 2 ) is about two times (2456 μmol H 2 ) compared to that of TiO 2 promoted only by cobalt (1180 μmol H 2 for 0.1%Co/TiO 2 ) or nickel (1127 μmol H 2 for 0.2%Ni/TiO 2 ), and mechanically mixed TiO 2 promoted by cobalt and TiO 2 promoted by nickel (0.1%Co/TiO 2 :0.2%Ni/TiO 2 = 1:1 (m/m), 1282 μmol H 2 ). The high photocatalytic H 2 evolution activity over TiO 2 promoted by cobalt and nickel is ascribed to enhanced photo response due to the presence of cobalt and nickel impurity level, and effective separation of photogenerated electrons and holes due to the synergistic effect of cobalt and nickel, which serve as active sites for H 2 evolution reaction (HER) and oxidation reaction (OR) respectively. This study demonstrates a viable strategy to design more active photocatalysts for photocatalytic H 2 evolution by substituting noble metals with more abundant elements using as HER and OR cocatalysts, respectively.
Induction of NFATc2 expression by interleukin 6 promotes T helper type 2 differentiation.
Diehl, Sean; Chow, Chi-Wing; Weiss, Linda; Palmetshofer, Alois; Twardzik, Thomas; Rounds, Laura; Serfling, Edgar; Davis, Roger J; Anguita, Juan; Rincón, Mercedes
2002-07-01
Interleukin (IL)-6 is produced by professional antigen-presenting cells (APCs) such as B cells, macrophages, and dendritic cells. It has been previously shown that APC-derived IL-6 promotes the differentiation of naive CD4+ T cells into effector T helper type 2 (Th2) cells. Here, we have studied the molecular mechanism for IL-6-mediated Th2 differentiation. During the activation of CD4+ T cells, IL-6 induces the production of IL-4, which promotes the differentiation of these cells into effector Th2 cells. Regulation of IL-4 gene expression by IL-6 is mediated by nuclear factor of activated T cells (NFAT), as inhibition of NFAT prevents IL-6-driven IL-4 production and Th2 differentiation. IL-6 upregulates NFAT transcriptional activity by increasing the levels of NFATc2. The ability of IL-6 to promote Th2 differentiation is impaired in CD4+ T cells that lack NFATc2, demonstrating that NFATc2 is required for regulation of IL-4 gene expression by IL-6. Regulation of NFATc2 expression and NFAT transcriptional activity represents a novel pathway by which IL-6 can modulate gene expression.
Aquaporin 2 promotes cell migration and epithelial morphogenesis.
Chen, Ying; Rice, William; Gu, Zhizhan; Li, Jian; Huang, Jianmin; Brenner, Michael B; Van Hoek, Alfred; Xiong, Jianping; Gundersen, Gregg G; Norman, Jim C; Hsu, Victor W; Fenton, Robert A; Brown, Dennis; Lu, Hua A Jenny
2012-09-01
The aquaporin 2 (AQP2) water channel, expressed in kidney collecting ducts, contributes critically to water homeostasis in mammals. Animals lacking or having significantly reduced levels of AQP2, however, have not only urinary concentrating abnormalities but also renal tubular defects that lead to neonatal mortality from renal failure. Here, we show that AQP2 is not only a water channel but also an integrin-binding membrane protein that promotes cell migration and epithelial morphogenesis. AQP2 expression modulates the trafficking and internalization of integrin β1, facilitating its turnover at focal adhesions. In vitro, disturbing the interaction between AQP2 and integrin β1 by mutating the RGD motif led to reduced endocytosis, retention of integrin β1 at the cell surface, and defective cell migration and tubulogenesis. Similarly, in vivo, AQP2-null mice exhibited significant retention of integrin β1 at the basolateral membrane and had tubular abnormalities. In summary, these data suggest that the water channel AQP2 interacts with integrins to promote renal epithelial cell migration, contributing to the structural and functional integrity of the mammalian kidney.
HMGA2 promotes adipogenesis by activating C/EBPβ-mediated expression of PPARγ
Energy Technology Data Exchange (ETDEWEB)
Xi, Yang; Shen, Wanjing; Ma, Lili; Zhao, Ming; Zheng, Jiachen [Diabetes Center, and Zhejiang Provincial Key Laboratory of Pathophysiology, Institute of Biochemistry and Molecular Biology, School of Medicine, Ningbo University, Ningbo 315211 (China); Bu, Shizhong, E-mail: bushizhong@nbu.edu.cn [Diabetes Center, and Zhejiang Provincial Key Laboratory of Pathophysiology, Institute of Biochemistry and Molecular Biology, School of Medicine, Ningbo University, Ningbo 315211 (China); Hino, Shinjiro [Department of Medical Cell Biology, Institute of Molecular Embryology and Genetics, Kumamoto University, Kumamoto, 860-0811 (Japan); Nakao, Mitsuyoshi, E-mail: mnakao@gpo.kumamoto-u.ac.jp [Department of Medical Cell Biology, Institute of Molecular Embryology and Genetics, Kumamoto University, Kumamoto, 860-0811 (Japan); Core Research for Evolutional Science and Technology (CREST), Japan Agency for Medical Research and Development, Tokyo (Japan)
2016-04-15
Adipogenesis is orchestrated by a highly ordered network of transcription factors including peroxisome-proliferator activated receptor-gamma (PPARγ) and CCAAT-enhancer binding protein (C/EBP) family proteins. High mobility group protein AT-hook 2 (HMGA2), an architectural transcription factor, has been reported to play an essential role in preadipocyte proliferation, and its overexpression has been implicated in obesity in mice and humans. However, the direct role of HMGA2 in regulating the gene expression program during adipogenesis is not known. Here, we demonstrate that HMGA2 is required for C/EBPβ-mediated expression of PPARγ, and thus promotes adipogenic differentiation. We observed a transient but marked increase of Hmga2 transcript at an early phase of differentiation of mouse 3T3-L1 preadipocytes. Importantly, Hmga2 knockdown greatly impaired adipocyte formation, while its overexpression promoted the formation of mature adipocytes. We found that HMGA2 colocalized with C/EBPβ in the nucleus and was required for the recruitment of C/EBPβ to its binding element at the Pparγ2 promoter. Accordingly, HMGA2 and C/EBPβ cooperatively enhanced the Pparγ2 promoter activity. Our results indicate that HMGA2 is an essential constituent of the adipogenic transcription factor network, and thus its function may be affected during the course of obesity. - Highlights: • Overexpression of HMGA2 has been implicated in obesity in mice and humans. • HMGA2 is required for adipocyte formation. • HMGA2 colocalizes with C/EBPβ and is required for C/EBPβ recruitment to Pparγ2 promoter. • HMGA2 and C/EBPβ cooperatively enhance the Pparγ2 promoter activity.
HMGA2 promotes adipogenesis by activating C/EBPβ-mediated expression of PPARγ
International Nuclear Information System (INIS)
Xi, Yang; Shen, Wanjing; Ma, Lili; Zhao, Ming; Zheng, Jiachen; Bu, Shizhong; Hino, Shinjiro; Nakao, Mitsuyoshi
2016-01-01
Adipogenesis is orchestrated by a highly ordered network of transcription factors including peroxisome-proliferator activated receptor-gamma (PPARγ) and CCAAT-enhancer binding protein (C/EBP) family proteins. High mobility group protein AT-hook 2 (HMGA2), an architectural transcription factor, has been reported to play an essential role in preadipocyte proliferation, and its overexpression has been implicated in obesity in mice and humans. However, the direct role of HMGA2 in regulating the gene expression program during adipogenesis is not known. Here, we demonstrate that HMGA2 is required for C/EBPβ-mediated expression of PPARγ, and thus promotes adipogenic differentiation. We observed a transient but marked increase of Hmga2 transcript at an early phase of differentiation of mouse 3T3-L1 preadipocytes. Importantly, Hmga2 knockdown greatly impaired adipocyte formation, while its overexpression promoted the formation of mature adipocytes. We found that HMGA2 colocalized with C/EBPβ in the nucleus and was required for the recruitment of C/EBPβ to its binding element at the Pparγ2 promoter. Accordingly, HMGA2 and C/EBPβ cooperatively enhanced the Pparγ2 promoter activity. Our results indicate that HMGA2 is an essential constituent of the adipogenic transcription factor network, and thus its function may be affected during the course of obesity. - Highlights: • Overexpression of HMGA2 has been implicated in obesity in mice and humans. • HMGA2 is required for adipocyte formation. • HMGA2 colocalizes with C/EBPβ and is required for C/EBPβ recruitment to Pparγ2 promoter. • HMGA2 and C/EBPβ cooperatively enhance the Pparγ2 promoter activity.
Lokapirnasari, W P; Dewi, A R; Fathinah, A; Hidanah, S; Harijani, N; Soeharsono; Karimah, B; Andriani, A D
2017-12-01
The purpose of this study was to know the production performance and economic analysis in quail which use probiotic supplementation to alternate antibiotic growth promoter (AGP) to feed consumption, water consumption, egg production, egg mass, feed conversion, and feed efficiency. About 240 quails ( Coturnix coturnix japonica) at 14 weeks of age were completely randomized into four treatments, each treatment consisted of six replications and each replication consisted by 10 heads. The treatment was T0 (organic feed without AGP and without probiotic), T1 (organic feed + 0.001% AGP), T2 (organic feed + 0.005% probiotic in feed), and T3 (organic feed + 0.005% probiotic in drinking water). The probiotic consist of 1.2×10 5 CFU/g of Lactobacillus casei and Lactobacillus rhamnosus . The results showed that the probiotic supplementation both in feed and water give a significant impact to feed consumption, water intake, feed conversion, feed efficiency, and quail day production, but no statistical difference of egg mass. The T3 also show the most profitable business analysis, which has the best result in income, profit, break-even point, return cost ratio, benefit-cost ratio, and return on investment. It can be concluded that giving 0.005% probiotic in drinking water to get the best egg production and profit.
Utilization of Alternative Medical Services In An Urban Centre Of ...
African Journals Online (AJOL)
Alasia Datonye
pattern, behaviour and determinants of Alternative. Therapy (AT) use. ... promoted the use of alternative and traditional therapies and has .... The media jingle/advert. The public .... consumers, may give a false confidence to the users of AT that.
Bone marrow concentrate promotes bone regeneration with a suboptimal-dose of rhBMP-2.
Egashira, Kazuhiro; Sumita, Yoshinori; Zhong, Weijian; I, Takashi; Ohba, Seigo; Nagai, Kazuhiro; Asahina, Izumi
2018-01-01
Bone marrow concentrate (BMC), which is enriched in mononuclear cells (MNCs) and platelets, has recently attracted the attention of clinicians as a new optional means for bone engineering. We previously reported that the osteoinductive effect of bone morphogenetic protein-2 (BMP-2) could be enhanced synergistically by co-transplantation of peripheral blood (PB)-derived platelet-rich plasma (PRP). This study aims to investigate whether BMC can effectively promote bone formation induced by low-dose BMP-2, thereby reducing the undesirable side-effects of BMP-2, compared to PRP. Human BMC was obtained from bone marrow aspirates using an automated blood separator. The BMC was then seeded onto β-TCP granules pre-adsorbed with a suboptimal-dose (minimum concentration to induce bone formation at 2 weeks in mice) of recombinant human (rh) BMP-2. These specimens were transplanted subcutaneously to the dorsal skin of immunodeficient-mice and the induction of ectopic bone formation was assessed 2 and 4 weeks post-transplantation. Transplantations of five other groups [PB, PRP, platelet-poor plasma (PPP), bone marrow aspirate (BM), and BM-PPP] were employed as experimental controls. Then, to clarify the effects on vertical bone augmentation, specimens from the six groups were transplanted for on-lay placement on the craniums of mice. The results indicated that BMC, which contained an approximately 2.5-fold increase in the number of MNCs compared to PRP, could accelerate ectopic bone formation until 2 weeks post-transplantation. On the cranium, the BMC group promoted bone augmentation with a suboptimal-dose of rhBMP-2 compared to other groups. Particularly in the BMC specimens harvested at 4 weeks, we observed newly formed bone surrounding the TCP granules at sites far from the calvarial bone. In conclusion, the addition of BMC could reduce the amount of rhBMP-2 by one-half via its synergistic effect on early-phase osteoinduction. We propose here that BMC transplantation
Identification and characterization of an alternative promoter of the human PGC-1{alpha} gene
Energy Technology Data Exchange (ETDEWEB)
Yoshioka, Toyo; Inagaki, Kenjiro [Division of Diabetes, Metabolism, and Endocrinology, Department of Internal Medicine, Kobe University Graduate School of Medicine, 7-5-1 Kusunoki-cho, Chuo-ku, Kobe 650-0017 (Japan); Noguchi, Tetsuya, E-mail: noguchi@med.kobe-u.ac.jp [Division of Diabetes, Metabolism, and Endocrinology, Department of Internal Medicine, Kobe University Graduate School of Medicine, 7-5-1 Kusunoki-cho, Chuo-ku, Kobe 650-0017 (Japan); Sakai, Mashito; Ogawa, Wataru; Hosooka, Tetsuya [Division of Diabetes, Metabolism, and Endocrinology, Department of Internal Medicine, Kobe University Graduate School of Medicine, 7-5-1 Kusunoki-cho, Chuo-ku, Kobe 650-0017 (Japan); Iguchi, Haruhisa; Watanabe, Eijiro; Matsuki, Yasushi; Hiramatsu, Ryuji [Genomic Science Laboratories, DainipponSumitomo Pharma Co. Ltd., 4-2-1 Takatsukasa, Takarazuka 665-8555 (Japan); Kasuga, Masato [Division of Diabetes, Metabolism, and Endocrinology, Department of Internal Medicine, Kobe University Graduate School of Medicine, 7-5-1 Kusunoki-cho, Chuo-ku, Kobe 650-0017 (Japan); Research Institute, International Medical Center of Japan, 1-21-1 Toyama, Shinjuku-ku, Tokyo 162-8655 (Japan)
2009-04-17
The transcriptional regulator peroxisome proliferator-activated receptor-{gamma} coactivator-1{alpha} (PGC-1{alpha}) controls mitochondrial biogenesis and energy homeostasis. Although physical exercise induces PGC-1{alpha} expression in muscle, the underlying mechanism of this effect has remained incompletely understood. We recently identified a novel muscle-enriched isoform of PGC-1{alpha} transcript (designated PGC-1{alpha}-b) that is derived from a previously unidentified first exon. We have now cloned and characterized the human PGC-1{alpha}-b promoter. The muscle-specific transcription factors MyoD and MRF4 transactivated this promoter through interaction with a proximal E-box motif. Furthermore, either forced expression of Ca{sup 2+}- and calmodulin-dependent protein kinase IV (CaMKIV), calcineurin A, or the p38 mitogen-activated protein kinase (p38 MAPK) kinase MKK6 or the intracellular accumulation of cAMP activated the PGC-1{alpha}-b promoter in cultured myoblasts through recruitment of cAMP response element (CRE)-binding protein (CREB) to a putative CRE located downstream of the E-box. Our results thus reveal a potential molecular basis for isoform-specific regulation of PGC-1{alpha} expression in contracting muscle.
Identification and characterization of an alternative promoter of the human PGC-1α gene
International Nuclear Information System (INIS)
Yoshioka, Toyo; Inagaki, Kenjiro; Noguchi, Tetsuya; Sakai, Mashito; Ogawa, Wataru; Hosooka, Tetsuya; Iguchi, Haruhisa; Watanabe, Eijiro; Matsuki, Yasushi; Hiramatsu, Ryuji; Kasuga, Masato
2009-01-01
The transcriptional regulator peroxisome proliferator-activated receptor-γ coactivator-1α (PGC-1α) controls mitochondrial biogenesis and energy homeostasis. Although physical exercise induces PGC-1α expression in muscle, the underlying mechanism of this effect has remained incompletely understood. We recently identified a novel muscle-enriched isoform of PGC-1α transcript (designated PGC-1α-b) that is derived from a previously unidentified first exon. We have now cloned and characterized the human PGC-1α-b promoter. The muscle-specific transcription factors MyoD and MRF4 transactivated this promoter through interaction with a proximal E-box motif. Furthermore, either forced expression of Ca 2+ - and calmodulin-dependent protein kinase IV (CaMKIV), calcineurin A, or the p38 mitogen-activated protein kinase (p38 MAPK) kinase MKK6 or the intracellular accumulation of cAMP activated the PGC-1α-b promoter in cultured myoblasts through recruitment of cAMP response element (CRE)-binding protein (CREB) to a putative CRE located downstream of the E-box. Our results thus reveal a potential molecular basis for isoform-specific regulation of PGC-1α expression in contracting muscle.
Long, Andrew F
2009-06-18
The potential contribution of complementary and alternative medicine (CAM) modalities to promote and support critical health literacy has not received substantial attention within either the health promotion or the CAM literature. This paper explores the potential of one CAM modality, shiatsu, in promoting well-being and critical health literacy. Data are drawn from a longitudinal, 6 months observational, pragmatic study of the effects and experience of shiatsu within three European countries (Austria, Spain and the UK). Client postal questionnaires included: advice received, changes made 6 months later, clients 'hopes' from having shiatsu and features of the client-practitioner relationship. At baseline, three-quarters of clients (n = 633) received advice, on exercise, diet, posture, points to work on at home or other ways of self-care. At 6 months follow-up, about four-fifths reported making changes to their lifestyle 'as a result of having shiatsu treatment', including taking more rest and relaxation or exercise, changing their diet, reducing time at work and other changes such as increased body/mind awareness and levels of confidence and resolve. Building on the findings, an explanatory model of possible ways that a CAM therapy could contribute to health promotion is presented to guide future research, both within and beyond CAM. Supporting individuals to take control of their self-care requires advice-giving within a supportive treatment context and practitioner relationship, with clients who are open to change and committed to maintaining their health. CAM modalities may have an important role to play in this endeavour.
Directory of Open Access Journals (Sweden)
Long Andrew F
2009-06-01
Full Text Available Abstract Background The potential contribution of complementary and alternative medicine (CAM modalities to promote and support critical health literacy has not received substantial attention within either the health promotion or the CAM literature. This paper explores the potential of one CAM modality, shiatsu, in promoting well-being and critical health literacy. Methods Data are drawn from a longitudinal, 6 months observational, pragmatic study of the effects and experience of shiatsu within three European countries (Austria, Spain and the UK. Client postal questionnaires included: advice received, changes made 6 months later, clients 'hopes' from having shiatsu and features of the client-practitioner relationship. Result At baseline, three-quarters of clients (n = 633 received advice, on exercise, diet, posture, points to work on at home or other ways of self-care. At 6 months follow-up, about four-fifths reported making changes to their lifestyle 'as a result of having shiatsu treatment', including taking more rest and relaxation or exercise, changing their diet, reducing time at work and other changes such as increased body/mind awareness and levels of confidence and resolve. Building on the findings, an explanatory model of possible ways that a CAM therapy could contribute to health promotion is presented to guide future research, both within and beyond CAM. Conclusion Supporting individuals to take control of their self-care requires advice-giving within a supportive treatment context and practitioner relationship, with clients who are open to change and committed to maintaining their health. CAM modalities may have an important role to play in this endeavour.
The Usage of Web 2.0 as a Media Promotion in Indonesia University Libraries
Directory of Open Access Journals (Sweden)
Nove E. Variant Anna
2015-04-01
Full Text Available The usage of web 2.0 has become popular among young people in Indonesia. One of the purpose of using web 2.0 is for promotion in some university libraries. The emerging of the web 2.0 as promotional media is corelating with the development of digital library. The paper aims are (1 to describe the usage of web 2.0 for academic libraries promotion. (2 to describe the information / content of those web 2.0. (3 to describe the promotion activity through web 2.0. This research population is all university libraries in Indonesia, but only 40 university libraries that conduct promotion through web 2.0. The website observation is done between May-July 2013. The research results are (1 the university libraries in Indonesia are use facebook, twitter, and flicker to promote library programs and interaction with users. The web 2.0 consist of information about new book release, user education, general information about library services, and information literacy. (3 some of univerity libraries taking seriously and actively promote their library services, but some of them are don’t use the web 2.0.
The Usage of Web 2.0 as a Media Promotion in Indonesia University Libraries
Directory of Open Access Journals (Sweden)
Nove E. Variant Anna
2018-01-01
Full Text Available The usage of web 2.0 has become popular among young people in Indonesia. One of the purpose of using web 2.0 is for promotion in some university libraries. The emerging of the web 2.0 as promotional media is corelating with the development of digital library. The paper aims are (1 to describe the usage of web 2.0 for academic libraries promotion. (2 to describe the information / content of those web 2.0. (3 to describe the promotion activity through web 2.0. This research population is all university libraries in Indonesia, but only 40 university librraries that conduct promotion through web 2.0. The website observation is done between May-July 2013. The research results are (1 the university libraries in Indonesia are use facebook, twitter, and flikr to promote library programs and interaction with users. The web 2.0 consist of information about new book release, user education, general information about library services, and information literacy. (3 some of univerity libraries taking seriously and actively promote their library services, but some of them are don’t use the web 2.0.
Alternative energy and environmental concerns
International Nuclear Information System (INIS)
2002-01-01
The New Brunswick Market Design Committee will address environmental concerns within the context of the new energy policy and market rules for the newly restructured electric power industry. The new rules that come with power restructuring will in some ways facilitate environmental protection but they can also complicate it. With open access markets, it will be possible to coordinate evolving energy frameworks with current environmental objectives. Restructuring provides an opportunity to create incentives and guidelines to operate in an environmentally sustainable manner, as suggested in the New Brunswick Energy Policy, White Paper which outlines green pricing, the development of a provincial Climate Change Action Plan, and promotion of alternative energy. The Market Design Committee examined the environmental concerns listed within the White Paper that pertain to the generation and transmission of electricity. These include the integration of energy and environmental policy. Other issues addressed in this report were trans-boundary and global air emissions, the development of a provincial climate change action plan, and a federal-provincial climate change framework agreement. New Brunswick will encourage the development of pilot studies that demonstrate the benefits of renewable and alternative technologies and that help promote the market to manufacture, sell and maintain renewable and alternative technologies in small-scale on-site power generation. This report also discussed the 4 key air pollutants for which specific treatment has been defined, including sulphur dioxide, nitrogen oxides, mercury and carbon dioxide. Recommendations for reducing these emissions include the use of renewable energy sources, the use of lower carbon fuels, increased efficiency of power transmission/generation/distribution systems, reducing power demand by the industrial sector, and promoting energy efficient building codes. 34 refs., 1 tab
Alternative fuels for vehicles fleet demonstration program. Final report, volume 2: Appendices
Energy Technology Data Exchange (ETDEWEB)
NONE
1997-06-01
The Alternative Fuels for Vehicles Fleet Demonstration Program (AFV-FDP) was a multiyear effort to collect technical data for use in determining the costs and benefits of alternative-fuel vehicles (AFVs) in typical applications in New York State. This report, Volume 2, includes 13 appendices to Volume 1 that expand upon issues raised therein. Volume 1 provides: (1) Information about the purpose and scope of the AFV-FDP; (2) A summary of AFV-FDP findings organized on the basis of vehicle type and fuel type; (3) A short review of the status of AFV technology development, including examples of companies in the State that are active in developing AFVs and AFV components; and (4) A brief overview of the status of AFV deployment in the State. Volume 3 provides expanded reporting of AFV-FDP technical details, including the complete texts of the brochure Garage Guidelines for Alternative Fuels and the technical report Fleet Experience Survey Report, plus an extensive glossary of AFV terminology. The appendices cover a wide range of issues including: emissions regulations in New York State; production and health effects of ozone; vehicle emissions and control systems; emissions from heavy-duty engines; reformulated gasoline; greenhouse gases; production and characteristics of alternative fuels; the Energy Policy Act of 1992; the Clean Fuel Fleet Program; garage design guidelines for alternative fuels; surveys of fleet managers using alternative fuels; taxes on conventional and alternative fuels; and zero-emission vehicle technology.
Anaesthetic gases: environmental impact and alternatives ...
African Journals Online (AJOL)
Anaesthetic gases: environmental impact and alternatives. ... PROMOTING ACCESS TO AFRICAN RESEARCH ... to be small when compared to gaseous emissions from industrial and agricultural sources, the actual percentage contribution to climate change is small. ... EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT
Bolus, W Reid; Gutierrez, Dario A; Kennedy, Arion J; Anderson-Baucum, Emily K; Hasty, Alyssa H
2015-10-01
Adipose tissue (AT) inflammation during obesity is mediated by immune cells and closely correlates with systemic insulin resistance. In lean AT, eosinophils are present in low but significant numbers and capable of promoting alternative macrophage activation in an IL-4/IL-13-dependent manner. In WT mice, obesity causes the proportion of AT eosinophils to decline, concomitant with inflammation and classical activation of AT macrophages. In this study, we show that CCR2 deficiency leads to increased eosinophil accumulation in AT. Furthermore, in contrast to WT mice, the increase in eosinophils in CCR2(-/-) AT is sustained and even amplified during obesity. Interestingly, a significant portion of eosinophils is found in CLSs in AT of obese CCR2(-/-) mice, which is the first time eosinophils have been shown to localize to these inflammatory hot spots. CCR2(-/-) bone marrow precursors displayed increased expression of various key eosinophil genes during in vitro differentiation to eosinophils, suggesting a potentially altered eosinophil phenotype in the absence of CCR2. In addition, the proportion of eosinophils in AT positively correlated with local expression of Il5, a potent eosinophil stimulator. The increase in eosinophils in CCR2(-/-) mice was detected in all white fat pads analyzed and in the peritoneal cavity but not in bone marrow, blood, spleen, or liver. In AT of CCR2(-/-) mice, an increased eosinophil number positively correlated with M2-like macrophages, expression of the Treg marker Foxp3, and type 2 cytokines, Il4, Il5, and Il13. This is the first study to link CCR2 function with regulation of AT eosinophil accumulation. © Society for Leukocyte Biology.
Alternative Splicing of G9a Regulates Neuronal Differentiation
Directory of Open Access Journals (Sweden)
Ana Fiszbein
2016-03-01
Full Text Available Chromatin modifications are critical for the establishment and maintenance of differentiation programs. G9a, the enzyme responsible for histone H3 lysine 9 dimethylation in mammalian euchromatin, exists as two isoforms with differential inclusion of exon 10 (E10 through alternative splicing. We find that the G9a methyltransferase is required for differentiation of the mouse neuronal cell line N2a and that E10 inclusion increases during neuronal differentiation of cultured cells, as well as in the developing mouse brain. Although E10 inclusion greatly stimulates overall H3K9me2 levels, it does not affect G9a catalytic activity. Instead, E10 increases G9a nuclear localization. We show that the G9a E10+ isoform is necessary for neuron differentiation and regulates the alternative splicing pattern of its own pre-mRNA, enhancing E10 inclusion. Overall, our findings indicate that by regulating its own alternative splicing, G9a promotes neuron differentiation and creates a positive feedback loop that reinforces cellular commitment to differentiation.
Test person operated 2-Alternative Forced Choice Audiometry compared to traditional audiometry
DEFF Research Database (Denmark)
Schmidt, Jesper Hvass; Brandt, Christian; Christensen-Dalsgaard, Jakob
Background: With a newly developed technique, hearing thresholds can be estimated with a system operated by the test persons themselves. This technique is based on the 2 Alternative Forced Choice paradigm known from the psychoacoustic research theory. Test persons can operate the system very......-likelihood and up-down methods has proven effective and reliable even under suboptimal test settings. In non-optimal testing conditions i.e. as a part of a hearing conservation programme the headphone Sennheiser HDA-200 has been used as it contains hearing protection. This test-method has been validated......-retest studies of 2AFC audiometry are comparable to test-retest results known from traditional audiometry under standard clinical settings. Conclusions 2 Alternative Forced Choice audiometry can be a reliable alternative to traditional audiometry especially under certain circumstances, where it can...
Alternative food promotes broad mite control on chilli pepper plants
Duarte, M.V.A.; Venzon, M.; de S. Bittencourt, M.C.; Rodríguez-Cruz, F.A.; Pallini, A.; Janssen, A.
2015-01-01
Many omnivorous arthropods are important natural enemies because they can feed on plant-provided pollen and several prey species, and thus persist in crops even in the absence of the target pest. Hence, populations of these predators can be established in a crop by providing alternative food, thus
MECP2 promoter methylation and X chromosome inactivation in autism.
Nagarajan, Raman P; Patzel, Katherine A; Martin, Michelle; Yasui, Dag H; Swanberg, Susan E; Hertz-Picciotto, Irva; Hansen, Robin L; Van de Water, Judy; Pessah, Isaac N; Jiang, Ruby; Robinson, Wendy P; LaSalle, Janine M
2008-06-01
Epigenetic mechanisms have been proposed to play a role in the etiology of autism. This hypothesis is supported by the discovery of increased MECP2 promoter methylation associated with decreased MeCP2 protein expression in autism male brain. To further understand the influence of female X chromosome inactivation (XCI) and neighboring methylation patterns on aberrant MECP2 promoter methylation in autism, multiple methylation analyses were peformed on brain and blood samples from individuals with autism. Bisulfite sequencing analyses of a region 0.6 kb upstream of MECP2 in brain DNA samples revealed an abrupt transition from a highly methylated region in both sexes to a region unmethylated in males and subject to XCI in females. Chromatin immunoprecipitation analysis demonstrated that the CCTC-binding factor (CTCF) bound to this transition region in neuronal cells, consistent with a chromatin boundary at the methylation transition. Male autism brain DNA samples displayed a slight increase in methylation in this transition region, suggesting a possible aberrant spreading of methylation into the MECP2 promoter in autism males across this boundary element. In addition, autistic female brain DNA samples showed evidence for aberrant MECP2 promoter methylation as an increase in the number of bisulfite sequenced clones with undefined XCI status for MECP2 but not androgen receptor (AR). To further investigate the specificity of MECP2 methylation alterations in autism, blood DNA samples from females and mothers of males with autism were also examined for XCI skewing at AR, but no significant increase in XCI skewing was observed compared to controls. These results suggest that the aberrant MECP2 methylation in autism brain DNA samples is due to locus-specific rather than global X chromosome methylation changes.
Alternative Fuel News, Vol. 3 No. 2
Energy Technology Data Exchange (ETDEWEB)
NONE
1999-09-23
This special issue of Alternative Fuel News highlights the Fifth National Clean Cities Conference held in Louisville, Kentucky. The momentum for the program is stronger than ever and the coalitions are working to propel the alternative fuel industry forward.
International Nuclear Information System (INIS)
Hurst, Helen C
2001-01-01
Overexpression of the ERBB2 proto-oncogene is associated with amplification of the gene in breast cancer but increased activity of the promoter also plays a significant role. Members of two transcription factor families (AP-2 and Ets) show increased binding to the promoter in over-expressing cells. Consequently, strategies have been devised to target promoter activity, either through the DNA binding sites for these factors, or through another promoter sequence, a polypurine-polypyrimidine repeat structure. The promoter has also been exploited for its tumour-specific activity to direct the accumulation of cytotoxic compounds selectively within cancer cells. Our current understanding of the ERBB2 promoter is reviewed and the status of these therapeutic avenues is discussed
76 FR 68067 - United States-Peru Trade Promotion Agreement
2011-11-03
... between the Parties and promoting regional economic integration; promoting broad-based economic development in order to reduce poverty and generate opportunities for sustainable economic alternatives to... rule. CBP also invites comments that relate to the economic, environmental, or federalism effects that...
Ultrasound promoted and SiO2/CCl3COOH mediated synthesis of 2 ...
Indian Academy of Sciences (India)
First one-pot synthesis of 2-aryl-1-arylmethyl-1H- benzimidazole derivatives from ... to promote chemical reactions is called sonochemistry .... −1): 1615, 2845, 2980, 3036, 3067; 1H NMR (500MHz,. CDCl3):δ 5.38 (s, 2H, CH2), 6.65 (d, J = 8.0 ...
Directory of Open Access Journals (Sweden)
Sameer D Salem
Full Text Available BACKGROUND: The association of Insulin-like growth factor 2 mRNA-binding protein 2 (IGF2BP2 common variants (rs4402960 and rs1470579 with type 2 diabetes (T2D has been performed in different populations. The aim of this study was to evaluate the association of alternative variants of IGF2BP2; rs6777038, rs16860234 and rs7651090 with glutamic acid decarboxylase antibodies (GADA negative diabetes in Malaysian Subjects. METHODS/PRINCIPAL FINDINGS: IGF2BP2; rs6777038, rs16860234 and rs7651090 single nucleotide polymorphisms (SNPs were genotyped in 1107 GADA negative diabetic patients and 620 control subjects of Asian from Malaysia. The additive genetic model adjusted for age, race, gender and BMI showed that alternative variants; rs6777038, rs16860234 and rs7651090 of IGF2BP2 associated with GADA negative diabetes (OR = 1.21; 1.36; 1.35, P = 0.03; 0.0004; 0.0002, respectively. In addition, the CCG haplotype and diplotype CCG-TCG increased the risk of diabetes (OR = 1.51, P = 0.01; OR = 2.36, P = 0.009, respectively. CONCLUSIONS/SIGNIFICANCE: IGF2BP2 alternative variants were associated with GADA negative diabetes. The IGF2BP2 haplotypes and diplotypes increased the risk of diabetes in Malaysian subject.
Faucitano, L; Chouinard, P Y; Fortin, J; Mandell, I B; Lafrenière, C; Girard, C L; Berthiaume, R
2008-07-01
Five beef cattle management regimens were evaluated for their effect on meat quality, fatty acid composition, and overall palatability of the longis-simus dorsi (LD) muscle in Angus cross steers. A 98-d growing phase was conducted using grass silage with or without supplementation of growth promotants (Revalor G and Rumensin) or soybean meal. Dietary treatments in the finishing phase were developed with or without supplementation of growth promotants based on exclusive feeding of forages with no grain supplementation, or the feeding of grain:forage (70:30) diets. Growth promotants increased (P forages increased the proportion of cis-9, cis-12, cis-15 C18:3 as well as several other isomers of the n-3 family and decreased in the ratio of n-6 to n-3 fatty acids in the LD muscle as compared with supplementing grain (P forage-based diet increased (P Forage feeding also increased the proportion of cis-9, trans-11 C18:2 (P forage-finishing and growth promotants-free beef production system.
Structure of 2,4-Diaminopyrimidine-Theobromine Alternate Base Pairs
Gengeliczki, Z.; Callahan, M. P.; Kabelac, M.; Rijs, A. M.; de Vries, M. S.
2011-01-01
We report the structure of dusters of 2,4-diaminopyrimidine with 3,7-dimethylxanthine (theobromine) in the gas phase determined by IR-UV double resonance spectroscopy in both the near-IR and mid-IR regions in combination with ab initio computations. These clusters represent potential alternate
Energy Technology Data Exchange (ETDEWEB)
Jha, Jyoti K.; Li, Mi; Ghirlando, Rodolfo; Miller Jenkins, Lisa M.; Wlodawer, Alexander; Chattoraj, Dhruba; Dunny, Gary M.
2017-04-18
Replication of Vibrio cholerae chromosome 2 (Chr2) depends on molecular chaperone DnaK to facilitate binding of the initiator (RctB) to the replication origin. The binding occurs at two kinds of site, 12-mers and 39-mers, which promote and inhibit replication, respectively. Here we show that DnaK employs different mechanisms to enhance the two kinds of binding. We found that mutations in
["Habitual" left branch block alternating with 2 "disguised" bracnch block].
Lévy, S; Jullien, G; Mathieu, P; Mostefa, S; Gérard, R
1976-10-01
Two cases of alternating left bundle branch block and "masquerading block" (with left bundle branch morphology in the stnadard leads and right bundle branch block morphology in the precordial leads) were studied by serial tracings and his bundle electrocardiography. In case 1 "the masquerading" block was associated with a first degree AV block related to a prolongation of HV interval. This case is to our knowledge the first cas of alternating bundle branch block in which his bundle activity was recorded in man. In case 2, the patient had atrial fibrilation and His bundle recordings were performed while differents degrees of left bundle branch block were present: The mechanism of the alternation and the concept of "masquerading" block are discussed. It is suggested that this type of block represents a right bundle branch block associated with severe lesions of the "left system".
Plant growth promoting bacteria as an alternative strategy for salt tolerance in plants: A review.
Numan, Muhammad; Bashir, Samina; Khan, Yasmin; Mumtaz, Roqayya; Shinwari, Zabta Khan; Khan, Abdul Latif; Khan, Ajmal; Al-Harrasi, Ahmed
2018-04-01
Approximately 5.2 billion hectare agriculture land are affected by erosion, salinity and soil degradation. Salinity stress has significantly affecting the fertile lands, and therefore possesses a huge impact on the agriculture and economy of a country. Salt stress has severe effects on the growth and development of plants as well as reducing its yield. Plants are inherently equipped with stress tolerance ability to responds the specific type of stress. Plants retained specific mechanisms for salt stress mitigation, such as hormonal stimulation, ion exchange, antioxidant enzymes and activation of signaling cascades on their metabolic and genetic frontiers that sooth the stressed condition. Additional to the plant inherent mechanisms, certain plant growth promoting bacteria (PGPB) also have specialized mechanism that play key role for salt stress tolerance and plant growth promotion. These bacteria triggers plants to produce different plant growth hormones like auxin, cytokinine and gibberellin as well as volatile organic compounds. These bacteria also produces growth regulators like siderophore, which fix nitrogen, solubilize organic and inorganic phosphate. Considering the importance of PGPB in compensation of salt tolerance in plants, the present study has reviewed the different aspect and mechanism of bacteria that play key role in promoting plants growth and yield. It can be concluded that PGPB can be used as a cost effective and economical tool for salinity tolerance and growth promotion in plants. Copyright © 2018 Elsevier GmbH. All rights reserved.
DEFF Research Database (Denmark)
Møller, A M; Jensen, N M; Pildal, J
2001-01-01
This study was performed to test the hypothesis that genetic variation in the promoter of the glucose transporter 2 (GLUT2) might predispose to prediabetic phenotypes or type 2 diabetes. A total of 1611 bp comprising the minimal promoter region of the GLUT2 gene were examined by combined single......-tolerant subjects. In conclusion, we found no evidence supporting the hypothesis that genetic variability in the minimal promoter of the GLUT2 is associated with type 2 diabetes or prediabetic phenotypes in the Danish population.......-strand conformational polymorphism and heteroduplex analysis followed by direct sequencing of identified variants on genomic DNA from 96 randomly recruited Danish type 2 diabetic patients. We identified 4 nucleotide variants, -447g-->a, -149c-->a, -122t-->c, and -44g-->a. None of the variants were positioned in known...
Alternative Fuel News, Vol. 2, No. 4
Energy Technology Data Exchange (ETDEWEB)
O' Connor, K.; Riley, C.; Raye, M.
1998-11-30
This issue of Alternative Fuel News highlights the accomplishments of the Clean Cities coalitions during the past 5 years. Now Clean Cities advocates in city after city across the US are building stations and driving alternative fuel vehicles, in addition to enhancing public awareness.
Simulation and modeling CO2 absorption in biogas with DEA promoted K2CO3 solution in packed column
Nurkhamidah, Siti; Altway, Ali; Airlangga, Bramantyo; Emilia, Dwi Putri
2017-05-01
Absorption of carbon dioxide (CO2) using potassium carbonate (K2CO3) is one of biogas purification method. However, K2CO3 have slow mass transfer in liquid phase. So it is necessary to eliminate the disadvantage of CO2 absorption using K2CO3 by adding promotor (activator). Diethanol amine (DEA) is one of promotor which can increase its reaction rate. Simulation and modeling research of the CO2 absorption from biogas with DEA promoted K2CO3 solution has not been conducted. Thus, the main goal of this research is create model and simulation for the CO2 absorption from biogas with DEA promoted K2CO3 solution, then observe the influence of promoter concentration. DEA concentration varies between 1-5 %wt. From the simulation, we concluded that the CO2 removal rise with the increasing of promoter concentration. The highest CO2 removal is 54.5318 % at 5 % wt DEA concentration.
Energy Technology Data Exchange (ETDEWEB)
Jabar, A. [Laboratoire de Magnétisme et Physique des Hautes Energies L.M.P.H.E.URAC 12, Université Mohammed V, Faculté des Sciences, B.P. 1014 Rabat (Morocco); Masrour, R., E-mail: rachidmasrour@hotmail.com [Laboratoire de Magnétisme et Physique des Hautes Energies L.M.P.H.E.URAC 12, Université Mohammed V, Faculté des Sciences, B.P. 1014 Rabat (Morocco); Laboratory of Materials, Processes, Environment and Quality, Cady Ayyed University, National School of Applied Sciences, PB 63 46000 Safi (Morocco); Benyoussef, A. [Laboratoire de Magnétisme et Physique des Hautes Energies L.M.P.H.E.URAC 12, Université Mohammed V, Faculté des Sciences, B.P. 1014 Rabat (Morocco); Institute of Nanomaterials and Nanotechnologies, MAScIR, Rabat (Morocco); Hassan II Academy of Science and Technology, Rabat (Morocco); Hamedoun, M. [Institute of Nanomaterials and Nanotechnologies, MAScIR, Rabat (Morocco)
2016-01-01
The magnetic properties of alternate mixed spin-5/2 and spin-2 Ising model on the Bethe lattice have been studied by using the Monte Carlo simulations. The ground state phase diagrams of alternate mixed spin-5/2 and spin-2 Ising model on the Bethe lattice has been obtained. The thermal total magnetization and magnetization of spins-5/2 and spin-2 with the different exchange interactions, external magnetic field and temperatures have been studied. The critical temperature have been deduced. The magnetic hysteresis cycle on the Bethe lattice has been deduced for different values of exchange interactions, for different values of crystal field and for different sizes. The magnetic coercive field has been deduced. - Highlights: • The alternate mixed spin-5/2 and -2 on the Bethe lattice is studied. • The critical temperature has been deduced. • The magnetic coercive filed has been deduced.
Alternatives to antibiotics as growth promoters for use in swine production: a review
2013-01-01
In the past two decades, an intensive amount of research has been focused on the development of alternatives to antibiotics to maintain swine health and performance. The most widely researched alternatives include probiotics, prebiotics, acidifiers, plant extracts and neutraceuticals such as copper and zinc. Since these additives have been more than adequately covered in previous reviews, the focus of this review will be on less traditional alternatives. The potential of antimicrobial peptides, clay minerals, egg yolk antibodies, essential oils, eucalyptus oil-medium chain fatty acids, rare earth elements and recombinant enzymes are discussed. Based on a thorough review of the literature, it is evident that a long and growing list of compounds exist which have been tested for their ability to replace antibiotics as feed additives in diets fed to swine. Unfortunately, the vast majority of these compounds produce inconsistent results and rarely equal antibiotics in their effectiveness. Therefore, it would appear that research is still needed in this area and that the perfect alternative to antibiotics does not yet exist. PMID:24034214
Academic Departments: Problems, Variations, and Alternatives.
McHenry, Dean E.; And Others
Do academic departments promote scholarship, protect higher learning from stagnation and interference, and provide a sound basis for hiring and advancing faculty? Or do they stifle teaching and research, foster parochialism, and limit the development of professors and students? There exist operating alternatives to conventional departments. Those…
Alternative splicing and extensive RNA editing of human TPH2 transcripts.
Directory of Open Access Journals (Sweden)
Maik Grohmann
Full Text Available Brain serotonin (5-HT neurotransmission plays a key role in the regulation of mood and has been implicated in a variety of neuropsychiatric conditions. Tryptophan hydroxylase (TPH is the rate-limiting enzyme in the biosynthesis of 5-HT. Recently, we discovered a second TPH isoform (TPH2 in vertebrates, including man, which is predominantly expressed in brain, while the previously known TPH isoform (TPH1 is primarly a non-neuronal enzyme. Overwhelming evidence now points to TPH2 as a candidate gene for 5-HT-related psychiatric disorders. To assess the role of TPH2 gene variability in the etiology of psychiatric diseases we performed cDNA sequence analysis of TPH2 transcripts from human post mortem amygdala samples obtained from individuals with psychiatric disorders (drug abuse, schizophrenia, suicide and controls. Here we show that TPH2 exists in two alternatively spliced variants in the coding region, denoted TPH2a and TPH2b. Moreover, we found evidence that the pre-mRNAs of both splice variants are dynamically RNA-edited in a mutually exclusive manner. Kinetic studies with cell lines expressing recombinant TPH2 variants revealed a higher activity of the novel TPH2B protein compared with the previously known TPH2A, whereas RNA editing was shown to inhibit the enzymatic activity of both TPH2 splice variants. Therefore, our results strongly suggest a complex fine-tuning of central nervous system 5-HT biosynthesis by TPH2 alternative splicing and RNA editing. Finally, we present molecular and large-scale linkage data evidencing that deregulated alternative splicing and RNA editing is involved in the etiology of psychiatric diseases, such as suicidal behaviour.
Common variants in the TPH2 promoter confer susceptibility to paranoid schizophrenia.
Yi, Zhenghui; Zhang, Chen; Lu, Weihong; Song, Lisheng; Liu, Dentang; Xu, Yifeng; Fang, Yiru
2012-07-01
Serotonergic system-related genes may be good candidates in investigating the genetic basis of schizophrenia. Our previous study suggested that promoter region of tryptophan hydroxylase 2 gene (TPH2) may confer the susceptibility to paranoid schizophrenia. In this study, we investigated whether common variants within TPH2 promoter may predispose to paranoid schizophrenia in Han Chinese. A total of 509 patients who met DSM-IV criteria for paranoid schizophrenia and 510 matched healthy controls were recruited for this study. Five polymorphisms within TPH2 promoter region were tested. No statistically significant differences were found in allele or genotype frequencies between schizophrenic patients and healthy controls. The frequency of the rs4448731T-rs6582071A-rs7963803A-rs4570625T-rs11178997A haplotype was significantly higher in cases compared to the controls (P = 0.003; OR = 1.49; 95% CI, 1.15-1.95). Our results suggest that the common variants within TPH2 promoter are associated with paranoid schizophrenia in Han Chinese. Further studies in larger samples are warranted to elucidate the role of TPH2 in the etiology of paranoid schizophrenia.
29 CFR 2703.2 - Designated agency ethics official and alternate designated agency ethics official.
2010-07-01
... 29 Labor 9 2010-07-01 2010-07-01 false Designated agency ethics official and alternate designated agency ethics official. 2703.2 Section 2703.2 Labor Regulations Relating to Labor (Continued) FEDERAL... agency ethics official and alternate designated agency ethics official. The Chairman shall appoint an...
International Nuclear Information System (INIS)
Szklo, Alexandre; Schaeffer, Roberto
2006-01-01
In this viewpoint, we discuss the importance of consorting alternative energy sources with oil, and not of opposing them. That is why we introduce the concept of alternative energy systems, which we feel is broader-ranging and more effective than alternative energy sources, as this deals with the actual transformation process of the global energy system. Alternative energy systems integrate oil with other energy sources and pave the way for new systems, which will benefit from what we call the 'virtues of oil'. They produce energy carriers for multi-fuel and multi-product strategies, where flexibility is a key target, allied to other co-benefits, especially those related to the increased use of renewable energy sources. The concept of alternative energy systems can bring a new light to the oil transition era discussion and might also influence energy policies for promoting renewables
Emission Control Cost-Effectiveness of Alternative-Fuel Vehicles
Wang, Quanlu; Sperling, Daniel; Olmstead, Janis
1993-01-01
Although various legislation and regulations have been adopted to promote the use of alternative-fuel vehicles for curbing urban air pollution problems, there is a lack of systematic comparisons of emission control cost-effectiveness among various alternative-fuel vehicle types. In this paper, life-cycle emission reductions and life-cycle costs were estimated for passenger cars fueled with methanol, ethanol, liquified petroleum gas, compressed natural gas, and electricity. Vehicle emission es...
MRG15 activates the cdc2 promoter via histone acetylation in human cells
International Nuclear Information System (INIS)
Pena, AndreAna N.; Tominaga, Kaoru; Pereira-Smith, Olivia M.
2011-01-01
Chromatin remodeling is required for transcriptional activation and repression. MRG15 (MORF4L1), a chromatin modulator, is a highly conserved protein and is present in complexes containing histone acetyltransferases (HATs) as well as histone deacetylases (HDACs). Loss of expression of MRG15 in mice and Drosophila results in embryonic lethality and fibroblast and neural stem/progenitor cells cultured from Mrg15 null mouse embryos exhibit marked proliferative defects when compared with wild type cells. To determine the role of MRG15 in cell cycle progression we performed chromatin immunoprecipitation with an antibody to MRG15 on normal human fibroblasts as they entered the cell cycle from a quiescent state, and analyzed various cell cycle gene promoters. The results demonstrated a 3-fold increase in MRG15 occupancy at the cdc2 promoter during S phase of the cell cycle and a concomitant increase in acetylated histone H4. H4 lysine 12 was acetylated at 24 h post-serum stimulation while there was no change in acetylation of lysine 16. HDAC1 and 2 were decreased at this promoter during cell cycle progression. Over-expression of MRG15 in HeLa cells activated a cdc2 promoter-reporter construct in a dose-dependent manner, whereas knockdown of MRG15 resulted in decreased promoter activity. In order to implicate HAT activity, we treated cells with the HAT inhibitor anacardic acid and determined that HAT inhibition results in loss of expression of cdc2 mRNA. Further, chromatin immunoprecipitation with Tip60 localizes the protein to the same 110 bp stretch of the cdc2 promoter pulled down by MRG15. Additionally, we determined that cotransfection of MRG15 with the known associated HAT Tip60 had a cooperative effect in activating the cdc2 promoter. These results suggest that MRG15 is acting in a HAT complex involving Tip60 to modify chromatin via acetylation of histone H4 at the cdc2 promoter to activate transcription.
MRG15 activates the cdc2 promoter via histone acetylation in human cells
Energy Technology Data Exchange (ETDEWEB)
Pena, AndreAna N., E-mail: andreana.pena@gmail.com [Sam and Ann Barshop Institute for Longevity and Aging Studies, The University of Texas Health Science Center at San Antonio, San Antonio, TX (United States); Department of Cellular and Structural Biology, The University of Texas Health Science Center at San Antonio, San Antonio, TX (United States); Tominaga, Kaoru; Pereira-Smith, Olivia M. [Sam and Ann Barshop Institute for Longevity and Aging Studies, The University of Texas Health Science Center at San Antonio, San Antonio, TX (United States); Department of Cellular and Structural Biology, The University of Texas Health Science Center at San Antonio, San Antonio, TX (United States)
2011-07-01
Chromatin remodeling is required for transcriptional activation and repression. MRG15 (MORF4L1), a chromatin modulator, is a highly conserved protein and is present in complexes containing histone acetyltransferases (HATs) as well as histone deacetylases (HDACs). Loss of expression of MRG15 in mice and Drosophila results in embryonic lethality and fibroblast and neural stem/progenitor cells cultured from Mrg15 null mouse embryos exhibit marked proliferative defects when compared with wild type cells. To determine the role of MRG15 in cell cycle progression we performed chromatin immunoprecipitation with an antibody to MRG15 on normal human fibroblasts as they entered the cell cycle from a quiescent state, and analyzed various cell cycle gene promoters. The results demonstrated a 3-fold increase in MRG15 occupancy at the cdc2 promoter during S phase of the cell cycle and a concomitant increase in acetylated histone H4. H4 lysine 12 was acetylated at 24 h post-serum stimulation while there was no change in acetylation of lysine 16. HDAC1 and 2 were decreased at this promoter during cell cycle progression. Over-expression of MRG15 in HeLa cells activated a cdc2 promoter-reporter construct in a dose-dependent manner, whereas knockdown of MRG15 resulted in decreased promoter activity. In order to implicate HAT activity, we treated cells with the HAT inhibitor anacardic acid and determined that HAT inhibition results in loss of expression of cdc2 mRNA. Further, chromatin immunoprecipitation with Tip60 localizes the protein to the same 110 bp stretch of the cdc2 promoter pulled down by MRG15. Additionally, we determined that cotransfection of MRG15 with the known associated HAT Tip60 had a cooperative effect in activating the cdc2 promoter. These results suggest that MRG15 is acting in a HAT complex involving Tip60 to modify chromatin via acetylation of histone H4 at the cdc2 promoter to activate transcription.
Directory of Open Access Journals (Sweden)
Jyoti K. Jha
2017-04-01
Full Text Available Replication of Vibrio cholerae chromosome 2 (Chr2 depends on molecular chaperone DnaK to facilitate binding of the initiator (RctB to the replication origin. The binding occurs at two kinds of site, 12-mers and 39-mers, which promote and inhibit replication, respectively. Here we show that DnaK employs different mechanisms to enhance the two kinds of binding. We found that mutations in rctB that reduce DnaK binding also reduce 12-mer binding and initiation. The initiation defect is suppressed by second-site mutations that increase 12-mer binding only marginally. Instead, they reduce replication inhibitory mechanisms: RctB dimerization and 39-mer binding. One suppressing change was in a dimerization domain which is folded similarly to the initiator of an iteron plasmid—the presumed progenitor of Chr2. In plasmids, DnaK promotes initiation by reducing dimerization. A different mutation was in the 39-mer binding domain of RctB and inactivated it, indicating an alternative suppression mechanism. Paradoxically, although DnaK increases 39-mer binding, the increase was also achieved by inactivating the DnaK binding site of RctB. This result suggests that the site inhibits the 39-mer binding domain (via autoinhibition when prevented from binding DnaK. Taken together, our results reveal an important feature of the transition from plasmid to chromosome: the Chr2 initiator retains the plasmid-like dimerization domain and its control by chaperones but uses the chaperones in an unprecedented way to control the inhibitory 39-mer binding.
Tao, Yan-Bin; He, Liang-Liang; Niu, Long-Jian; Xu, Zeng-Fu
2015-04-01
The JcUEP promoter is active constitutively in the bio-fuel plant Jatropha curcas , and is an alternative to the widely used CaMV35S promoter for driving constitutive overexpression of transgenes in Jatropha. Well-characterized promoters are required for transgenic breeding of Jatropha curcas, a biofuel feedstock with great potential for production of bio-diesel and bio-jet fuel. In this study, an ubiquitin extension protein gene from Jatropha, designated JcUEP, was identified to be ubiquitously expressed. Thus, we isolated a 1.2 kb fragment of the 5' flanking region of JcUEP and evaluated its activity as a constitutive promoter in Arabidopsis and Jatropha using the β-glucuronidase (GUS) reporter gene. As expected, histochemical GUS assay showed that the JcUEP promoter was active in all Arabidopsis and Jatropha tissues tested. We also compared the activity of the JcUEP promoter with that of the cauliflower mosaic virus 35S (CaMV35S) promoter, a well-characterized constitutive promoter conferring strong transgene expression in dicot species, in various tissues of Jatropha. In a fluorometric GUS assay, the two promoters showed similar activities in stems, mature leaves and female flowers; while the CaMV35S promoter was more effective than the JcUEP promoter in other tissues, especially young leaves and inflorescences. In addition, the JcUEP promoter retained its activity under stress conditions in low temperature, high salt, dehydration and exogenous ABA treatments. These results suggest that the plant-derived JcUEP promoter could be an alternative to the CaMV35S promoter for driving constitutive overexpression of transgenes in Jatropha and other plants.
Pokemon and MEF2D co-operationally promote invasion of hepatocellular carcinoma.
Hong, Xin; Hong, Xing-Yu; Li, Tao; He, Cheng-Yan
2015-12-01
Hepatocellular carcinoma (HCC) is one of the most deadly human malignancy, and frequent invasion and metastasis is closely associated with its poor prognosis. However, the molecular mechanism underlying HCC invasion is still not completely elucidated. Pokemon is a well-established oncogene for HCC growth, but its contribution to HCC invasion has not been studied yet. In this paper, Pokemon was found to be overexpressed in MHCC-97H HCC cell line, which possesses higher invasiveness. Downregulation of Pokemon abolished the invasion of MHCC-97H HCC cell lines. Pokemon overexpression was able to enhance the invasion of MHCC-97L cells with lower invasiveness. MEF2D, an oncogene promoting the invasion of HCC cells, was further detected to be upregulated and downregulated when Pokemon was overexpressed and silenced, respectively. Online database analysis indicated that one Pokemon recognition site was located within the promoter of MEF2D. Chromatin co-precipitation, luciferase, and qPCR assays all proved that Pokemon can promote the expression of MEF2D in HCC cells. Restoration of MEF2D expression can prevent the impaired invasion of HCC cells with Pokemon silencing, while suppression of MEF2D abolished the effect of Pokemon overexpression on HCC invasion. More interestingly, MEF2D was also found to increase the transcription of Pokemon by binding myocyte enhancer factor 2 (MEF2) sites within its promoter region, implying an auto-regulatory circuit consisting of these two oncogenes that can promote HCC invasion. Our findings can contribute to the understanding of molecular mechanism underlying HCC invasion, and provided evidence that targeting this molecular loop may be a promising strategy for anti-invasion therapy.
Li, Guangshi; Cheng, Hongwei; Chen, Sha; Lu, Xionggang; Xu, Qian; Lu, Changyuan
2018-06-01
As a more environmentally friendly and energy-efficient route, the sulfation roasting-water leaching technique has been developed for highly effective extraction of non-ferrous metals from nickel sulfide concentrate in the presence of a Na2SO4 additive. The effects of several important roasting parameters—the roasting temperature, the addition of Na2SO4, the holding time, and the heating rate in particular—have been investigated. The results suggest that about 90 pct Ni, 92 pct Co, 95 pct Cu, and leached from the calcine roasted under the optimum conditions. Furthermore, the behavior and mechanism of the Na2SO4 additive in the roasting process have been well addressed by detailed characterization of the roasted product and leaching residue using quantitative phase analysis (QPA) and energy dispersive spectroscopy (EDS) mapping. The Na2SO4 additive was observed to play a noticeable role in promoting the sulfation degree of valuable metals by forming liquid phases [Na2Me(SO4)2] at the outermost layer, which can create a suitable dynamic environment for sulfation. Thus, addition of Na2SO4 might be conducive to an alternative metallurgical process involving complex sulfide ores.
Bachelli, Mara Lígia Biazotto; Amaral, Rívia Darla Álvares; Benedetti, Benedito Carlos
2013-01-01
Lettuce is a leafy vegetable widely used in industry for minimally processed products, in which the step of sanitization is the crucial moment for ensuring a safe food for consumption. Chlorinated compounds, mainly sodium hypochlorite, are the most used in Brazil, but the formation of trihalomethanes from this sanitizer is a drawback. Then, the search for alternative methods to sodium hypochlorite has been emerging as a matter of great interest. The suitability of chlorine dioxide (60 mg L(-1)/10 min), peracetic acid (100 mg L(-1)/15 min) and ozonated water (1.2 mg L(-1)/1 min) as alternative sanitizers to sodium hypochlorite (150 mg L(-1) free chlorine/15 min) were evaluated. Minimally processed lettuce washed with tap water for 1 min was used as a control. Microbiological analyses were performed in triplicate, before and after sanitization, and at 3, 6, 9 and 12 days of storage at 2 ± 1 °C with the product packaged on LDPE bags of 60 μm. It was evaluated total coliforms, Escherichia coli, Salmonella spp., psicrotrophic and mesophilic bacteria, yeasts and molds. All samples of minimally processed lettuce showed absence of E. coli and Salmonella spp. The treatments of chlorine dioxide, peracetic acid and ozonated water promoted reduction of 2.5, 1.1 and 0.7 log cycle, respectively, on count of microbial load of minimally processed product and can be used as substitutes for sodium hypochlorite. These alternative compounds promoted a shelf-life of six days to minimally processed lettuce, while the shelf-life with sodium hypochlorite was 12 days.
RLIM interacts with Smurf2 and promotes TGF-β induced U2OS cell migration
International Nuclear Information System (INIS)
Huang, Yongsheng; Yang, Yang; Gao, Rui; Yang, Xianmei; Yan, Xiaohua; Wang, Chenji; Jiang, Sirui; Yu, Long
2011-01-01
Highlights: → RLIM directly binds to Smurf2. → RLIM enhances TGF-β responsiveness in U2OS cells. → RLIM promotes TGF-β driven migration of osteosarcoma U2OS cells. -- Abstract: TGF-β (transforming growth factor-β), a pleiotropic cytokine that regulates diverse cellular processes, has been suggested to play critical roles in cell proliferation, migration, and carcinogenesis. Here we found a novel E3 ubiquitin ligase RLIM which can directly bind to Smurf2, enhancing TGF-β responsiveness in osteosarcoma U2OS cells. We constructed a U2OS cell line stably over-expressing RLIM and demonstrated that RLIM promoted TGF-β-driven migration of U2OS cells as tested by wound healing assay. Our results indicated that RLIM is an important positive regulator in TGF-β signaling pathway and cell migration.
[Inactivation of PMS2 gene by promoter methylation in nasopharyngeal carcinoma].
Ni, H F; Jiang, B; Zhou, Z; Li, Y; Yuan, X Y; Cao, X L; Huang, G W
2016-11-23
Objective: To investigate the inactivation of PMS2 gene mediated by promoter methylation and its regulatory mechanism in nasopharyngeal carcinoma (NPC). Methods: Fifty-four NPC tissues, 16 normal nasopharyngeal epithelia (NNE), 5 NPC cell lines (CNE1, CNE2, TWO3, HNE1 and HONE1) and 1 normal nasopharyngeal epithelial cell line (NP69) were collected.Methylation-specific PCR (MSP) was used to detect the PMS2 promoter methylation, semi-quantitative reverse transcription PCR (qRT-PCR) was applied to determine its mRNA expression, and immunohistochemistry (IHC) was used to detect the protein expression of PMS2. The expressions of PMS2 mRNA in CNE1 and CNE2 cells before and after treated with methyltransferase inhibitor 5-aza-2-deoxycytidine were analyzed by qRT-PCR. The impact of methylation and demethylation on the mRNA expression of PMS2, and the association of mRNA and protein expression of PMS2 with clinicopathological features of nasopharyngeal cancer were analyzed. Results: Methylation of PMS2 gene was detected in all of the five NPC cell lines, but not in normal nasopharyngeal epithelial NP69 cells. The methylation rate of PMS2 gene in NPC tissues was 63% (34/54), significantly higher than that of the normal nasopharyngeal epithelia (0/16, P PMS2 mRNA and protein were significantly down-regulated in the 54 NPC tissues when compared with those in the 16 NNE tissues ( P PMS2 mRNA was restored in the CNE1 and CNE2 cells.However, the expressions of PMS2 mRNA and protein were not significantly correlated with patients' age, gender, TNM stage, histopathologic type or lymph node metastasis ( P >0.05 for all). Conclusions: Promoter methylation-mediated inactivation of PMS2 gene participates in carcinogenesis and development of NPC. PMS2 may be a candidate tumor suppressor in the treatment for patients with inactivation of PMS2 promoter methylation.
Seth, Puneet; Yeowell, Heather N
2010-04-01
Scleroderma (systemic sclerosis [SSc]) is a complex connective tissue disorder characterized by hardening and thickening of the skin. One hallmark of scleroderma is excessive accumulation of collagen accompanied by increased levels of pyridinoline collagen crosslinks derived from hydroxylysine residues in the collagen telopeptide domains. Lysyl hydroxylase 2 (LH2), an important alternatively spliced enzyme in collagen biosynthesis, acts as a collagen telopeptide hydroxylase. Changes in the pattern of LH2 alternative splicing, favoring increased inclusion of the alternatively spliced LH2 exon 13A, thereby increasing the levels of the long transcript of LH2 (LH2[long]), are linked to scleroderma disease. This study was undertaken to examine the role played by RNA binding protein Fox-2 in regulating exon 13A inclusion, which leads to the generation of scleroderma-associated LH2(long) messenger RNA (mRNA). Phylogenetic sequence analysis of introns flanking exon 13A was performed. A tetracycline-inducible system in T-Rex 293 cells was used to induce Fox-2 protein, and endogenous LH2(long) mRNA was determined by reverse transcriptase-polymerase chain reaction. An LH2 minigene was designed, validated, and used in Fox-2 overexpression and mutagenesis experiments. Knockdown of Fox-2 was performed in mouse embryonic fibroblasts and in fibroblasts from SSc patients. Overexpression of Fox-2 enhanced the inclusion of exon 13A and increased the generation of LH2(long) mRNA, whereas knockdown of Fox-2 decreased LH2(long) transcripts. Mutational analysis of an LH2 minigene demonstrated that 2 of the 4 Fox binding motifs flanking LH2 exon 13A are required for inclusion of exon 13A. In early passage fibroblasts derived from patients with scleroderma, the knockdown of Fox-2 protein significantly decreased the endogenous levels of LH2(long) mRNA. Our findings indicate that Fox-2 plays an integral role in the regulation of LH2 splicing. Knockdown of Fox-2 and other methods to decrease
Promoter de-methylation of cyclin D2 by sulforaphane in prostate cancer cells
Directory of Open Access Journals (Sweden)
Hsu Anna
2011-10-01
Full Text Available Abstract Sulforaphane (SFN, an isothiocyanate derived from cruciferous vegetables, induces potent anti-proliferative effects in prostate cancer cells. One mechanism that may contribute to the anti-proliferative effects of SFN is the modulation of epigenetic marks, such as inhibition of histone deacetylase (HDAC enzymes. However, the effects of SFN on other common epigenetic marks such as DNA methylation are understudied. Promoter hyper-methylation of cyclin D2, a major regulator of cell cycle, is correlated with prostate cancer progression, and restoration of cyclin D2 expression exerts anti-proliferative effects on LnCap prostate cancer cells. Our study aimed to investigate the effects of SFN on DNA methylation status of cyclin D2 promoter, and how alteration in promoter methylation impacts cyclin D2 gene expression in LnCap cells. We found that SFN significantly decreased the expression of DNA methyltransferases (DNMTs, especially DNMT1 and DNMT3b. Furthermore, SFN significantly decreased methylation in cyclin D2 promoter regions containing c-Myc and multiple Sp1 binding sites. Reduced methlyation of cyclin D2 promoter corresponded to an increase in cyclin D2 transcript levels, suggesting that SFN may de-repress methylation-silenced cyclin D2 by impacting epigenetic pathways. Our results demonstrated the ability of SFN to epigenetically modulate cyclin D2 expression, and provide novel insights into the mechanisms by which SFN may regulate gene expression as a prostate cancer chemopreventive agent.
Kam, Chi-Ming; Greenberg, Mark T; Walls, Carla T
2003-03-01
In order for empirically validated school-based prevention programs to "go to scale," it is important to understand the processes underlying program dissemination. Data collected in effectiveness trials, especially those measuring the quality of program implementation and administrative support, are valuable in explicating important factors influencing implementation. This study describes findings regarding quality of implementation in a recent effectiveness trial conducted in a high-risk, American urban community. This delinquency prevention trial is a locally owned intervention, which used the Promoting Alternative THinking Skills Curriculum as its major program component. The intervention involved 350 first graders in 6 inner-city public schools. Three schools implemented the intervention and the other 3 were comparison schools from the same school district. Although intervention effects were not found for all the intervention schools, the intervention was effective in improving children's emotional competence and reducing their aggression in schools which effectively supported the intervention. This study, utilizing data from the 3 intervention schools (13 classrooms and 164 students), suggested that 2 factors contributed to the success of the intervention: (a) adequate support from school principals and (b) high degree of classroom implementation by teachers. These findings are discussed in light of the theory-driven models in program evaluation that emphasized the importance of the multiple factors influencing the implementation of school-based interventions.
Overexpression of HMGA2-LPP fusion transcripts promotes expression of the α 2 type XI collagen gene
International Nuclear Information System (INIS)
Kubo, Takahiro; Matsui, Yoshito; Goto, Tomohiro; Yukata, Kiminori; Yasui, Natsuo
2006-01-01
In a subset of human lipomas, a specific t (3; 12) chromosome translocation gives rise to HMGA2-LPP fusion protein, containing the amino (N)-terminal DNA binding domains of HMGA2 fused to the carboxyl (C)-terminal LIM domains of LPP. In addition to its role in adipogenesis, several observations suggest that HMGA2-LPP is linked to chondrogenesis. Here, we analyzed whether HMGA2-LPP promotes chondrogenic differentiation, a marker of which is transactivation of the α 2 type XI collagen gene (Col11a2). Real-time PCR analysis showed that HMGA2-LPP and COL11A2 were co-expressed. Luciferase assay demonstrated that either of HMGA2-LPP, wild-type HMGA2 or the N-terminal HMGA2 transactivated the Col11a2 promoter in HeLa cells, while the C-terminal LPP did not. RT-PCR analysis revealed that HMGA2-LPP transcripts in lipomas with the fusion were 591-fold of full-length HMGA2 transcripts in lipomas without the fusion. These results indicate that in vivo overexpression of HMGA2-LPP promotes chondrogenesis by upregulating cartilage-specific collagen gene expression through the N-terminal DNA binding domains
Collaborative interplay between FGF-2 and VEGF-C promotes lymphangiogenesis and metastasis
DEFF Research Database (Denmark)
Cao, Renhai; Ji, Hong; Feng, Ninghan
2012-01-01
Interplay between various lymphangiogenic factors in promoting lymphangiogenesis and lymphatic metastasis remains poorly understood. Here we show that FGF-2 and VEGF-C, two lymphangiogenic factors, collaboratively promote angiogenesis and lymphangiogenesis in the tumor microenvironment, leading...... endothelial cell tip cell formation is a prerequisite for FGF-2-stimulated lymphangiogenesis. In the tumor microenvironment, the reciprocal interplay between FGF-2 and VEGF-C collaboratively stimulated tumor growth, angiogenesis, intratumoral lymphangiogenesis, and metastasis. Thus, intervention and targeting...
Directory of Open Access Journals (Sweden)
Valeria Ventorino
2014-01-01
Full Text Available The use of microorganisms to accelerate the natural detoxification processes of toxic substances in the soil represents an alternative ecofriendly and low-cost method of environmental remediation compared to harmful incineration and chemical treatments. Fourteen strains able to grow on minimal selective medium with a complex mixture of different classes of xenobiotic compounds as the sole carbon source were isolated from the soil of the ex-industrial site ACNA (Aziende Chimiche Nazionali Associate in Cengio (Savona, Italy. The best putative degrading isolate, Methylobacterium populi VP2, was identified using a polyphasic approach on the basis of its phenotypic, biochemical, and molecular characterisation. Moreover, this strain also showed multiple plant growth promotion activities: it was able to produce indole-3-acetic acid (IAA and siderophores, solubilise phosphate, and produce a biofilm in the presence of phenanthrene and alleviate phenanthrene stress in tomato seeds. This is the first report on the simultaneous occurrence of the PAH-degrading ability by Methylobacterium populi and its multiple plant growth-promoting activities. Therefore, the selected indigenous strain, which is naturally present in highly contaminated soils, is good candidate for plant growth promotion and is capable of biodegrading xenobiotic organic compounds to remediate contaminated soil alone and/or soil associated with plants.
Alternative Fuel News, Vol. 2, No. 5
Energy Technology Data Exchange (ETDEWEB)
NREL
1999-01-06
In this issue of the Alternative Fuel News, the authors remember what happened just 25 years ago (the energy crisis of 1973) and reiterate that foreign oil dependence is still a national issue. Highlighted are some the successes in the Clean Cities Program and the alternative fuels industry. Also featured is the Natural Gas Vehicle Coalition (NGVC) and the United States Postal Service (USPS) delivers with AFVs.
Providing training enhances the biomechanical improvements of an alternative computer mouse design
Houwink, A.; Oude Hengel, K.M.; Odell, D.; Dennerlein, J.T.
2009-01-01
To determine if an alternative mouse promotes more neutral postures and decreases forearm muscle activity and if training enhances these biomechanical benefits is the purpose of the study. Computer mouse use is a risk factor for developing musculoskeletal disorders; alternative mouse designs can
A New Challenge for Alternative Energy
Institute of Scientific and Technical Information of China (English)
Editorial Department of China Power Enterprise Management
2009-01-01
@@ The year 2008 sees a turning point in China's strategy of promoting energy saving and emissions reduction,as well as development of renewable energy.Oil price breaking US$140 and large area in China suffering from ice and snow disaster,a result of global warming,have both stressed the importance of developing alternative energy.Today,alterative energy accounts for a very small portion in China's power industry.Therefore,it is imminently required to speed up energy restructuring,to vigorously develop power generation with alternative energy such as nuclear energy,hydroenergy,wind energy,solar energy,biomass energy,geothermic energy,thus to realize sustainable development.
DEFF Research Database (Denmark)
Nielsen, C H; Marquart, H V; Prodinger, W M
2001-01-01
of the CR1 binding site with the monoclonal antibody 3D9 also resulted in a minor reduction in MAC deposition, while FE8 and 3D9, in combination, markedly reduced deposition of both C3 fragments (91 +/- 5%) and C9 (95 +/- 3%). The kinetics of C3-fragment and MAC deposition, as well as the dependence of both......Normal human B lymphocytes activate the alternative pathway of complement via complement receptor type 2 (CR2, CD21), that binds hydrolysed C3 (iC3) and thereby promotes the formation of a membrane-bound C3 convertase. We have investigated whether this might lead to the generation of a C5...... convertase and consequent formation of membrane attack complexes (MAC). Deposition of C3 fragments and MAC was assessed on human peripheral B lymphocytes in the presence of 30% autologous serum containing 4.4 mM MgCl2/20 mM EGTA, which abrogates the classical pathway of complement without affecting...
Catalysts Promoted with Niobium Oxide for Air Pollution Abatement
Directory of Open Access Journals (Sweden)
Wendi Xiang
2017-05-01
Full Text Available Pt-containing catalysts are currently used commercially to catalyze the conversion of carbon monoxide (CO and hydrocarbon (HC pollutants from stationary chemical and petroleum plants. It is well known that Pt-containing catalysts are expensive and have limited availability. The goal of this research is to find alternative and less expensive catalysts to replace Pt for these applications. This study found that niobium oxide (Nb2O5, as a carrier or support for certain transition metal oxides, promotes oxidation activity while maintaining stability, making them candidates as alternatives to Pt. The present work reports that the orthorhombic structure of niobium oxide (formed at 800 °C in air promotes Co3O4 toward the oxidation of both CO and propane, which are common pollutants in volatile organic compound (VOC applications. This was a surprising result since this structure of Nb2O5 has a very low surface area (about 2 m2/g relative to the more traditional Al2O3 support, with a surface area of 150 m2/g. The results reported demonstrate that 1% Co3O4/Nb2O5 has comparable fresh and aged catalytic activity to 1% Pt/γ-Al2O3 and 1% Pt/Nb2O5. Furthermore, 6% Co3O4/Nb2O5 outperforms 1% Pt/Al2O3 in both catalytic activity and thermal stability. These results suggest a strong interaction between niobium oxide and the active component—cobalt oxide—likely by inducing an oxygen defect structure with oxygen vacancies leading to enhanced activity toward the oxidation of CO and propane.
Promoter characterization and genomic organization of the human X11β gene APBA2.
LENUS (Irish Health Repository)
Hao, Yan
2012-02-15
Overexpression of neuronal adaptor protein X11β has been shown to decrease the production of amyloid-β, a toxic peptide deposited in Alzheimer\\'s disease brains. Therefore, manipulation of the X11β level may represent a potential therapeutic strategy for Alzheimer\\'s disease. As X11β expression can be regulated at the transcription level, we determined the genomic organization and the promoter of the human X11β gene, amyloid β A4 precursor protein-binding family A member 2 (APBA2). By RNA ligase-mediated rapid amplification of cDNA ends, a single APBA2 transcription start site and the complete sequence of exon 1 were identified. The APBA2 promoter was located upstream of exon 1 and was more active in neurons. The core promoter contains several CpG dinucleotides, and was strongly suppressed by DNA methylation. In addition, mutagenesis analysis revealed a putative Pax5-binding site within the promoter. Together, APBA2 contains a potent neuronal promoter whose activity may be regulated by DNA methylation and Pax5.
Mutational analysis of the UCP2 core promoter and relationships of variants with obesity
DEFF Research Database (Denmark)
Dalgaard, Louise T; Andersen, Gitte; Larsen, Lesli H
2003-01-01
To identify polymorphisms in the human uncoupling protein 2 gene (UCP2) promoter and to investigate whether these were associated with obesity or weight gain.......To identify polymorphisms in the human uncoupling protein 2 gene (UCP2) promoter and to investigate whether these were associated with obesity or weight gain....
Gene Expression in Class 2 Integrons Is SOS-Independent and Involves Two Pc Promoters.
Jové, Thomas; Da Re, Sandra; Tabesse, Aurore; Gassama-Sow, Amy; Ploy, Marie-Cécile
2017-01-01
Integrons are powerful bacterial genetic elements that permit the expression and dissemination of antibiotic-resistance gene cassettes. They contain a promoter Pc that allows the expression of gene cassettes captured through site-specific recombination catalyzed by IntI, the integron-encoded integrase. Class 1 and 2 integrons are found in both clinical and environmental settings. The regulation of intI and of Pc promoters has been extensively studied in class 1 integrons and the regulatory role of the SOS response on intI expression has been shown. Here we investigated class 2 integrons. We characterized the P intI2 promoter and showed that intI2 expression is not regulated via the SOS response. We also showed that, unlike class 1 integrons, class 2 integrons possess not one but two active Pc promoters that are located within the attI2 region that seem to contribute equally to gene cassette expression. Class 2 integrons mostly encode an inactive truncated integrase, but the rare class 2 integrons that encode an active integrase are associated with less efficient Pc2 promoter variants. We propose an evolutionary model for class 2 integrons in which the absence of repression of the integrase gene expression led to mutations resulting in either inactive integrase or Pc variants of weaker activity, thereby reducing the potential fitness cost of these integrons.
Characterization of the promoter region of the human c-erbB-2 protooncogene
International Nuclear Information System (INIS)
Ishii, S.; Imamoto, F.; Yamanashi, Y.; Toyoshima, K.; Yamamoto, T.
1987-01-01
Three overlapping genomic clones that contain the 5'-terminal portion of the human c-erbB-2 gene (ERBB2) were isolated. The promoter region was identified by nuclease S1 mapping with c-erbB-2 mRNA. Seven transcriptional start sites were identified. DNA sequence analysis showed that the promoter region contains a TATA box and a CAAT box about 30 and 80 base pairs (bp), respectively, upstream of the most downstream RNA initiation site. Two putative binding sites for transcription factor Sp1 were identified about 50 and 110 bp upstream of the CAAT box, and six GGA repeats were found between the CAAT box and the TATA box. This region had strong promoter activity when placed upstream of the bacterial chloramphenicol acetyltransferase gene and transfected into monkey CV-1 cells. These data indicate that the promoter of the human c-erbB-2 protooncogene is different from that of the protooncogene c-erbB-1 (epidermal growth factor receptor gene), which does not contain either a TATA box or a CAAT box. Comparison of the promoter sequences and activities of the two protooncogenes should be helpful in analysis of the regulatory mechanism of expression of their gene products, which are growth-factor receptors
The Socio-economics and Alternative Livelihood Options of Fishers ...
African Journals Online (AJOL)
The Socio-economics and Alternative Livelihood Options of Fishers of Lake Victoria, ... PROMOTING ACCESS TO AFRICAN RESEARCH ... Most fishers were males aged 29-38yrs while women were involved in processing and marketing.
International Nuclear Information System (INIS)
Kuemin, Daniel; Hofmann, Christian; Uckert, Wolfgang; Both, Gerald W.; Loeser, Peter
2004-01-01
Activation of the adenoviral E2 promoter is an early step in adenovirus gene expression. For members of the mast- and aviadenoviruses, this requires induction of the cellular transcription factor E2F by virally encoded gene products such as E1A, E4orf6/7 and orf22/GAM-1. The newly recognized genus atadenovirus, of which the ovine isolate OAdV is the prototype, lacks any sequence homology to those genes. To find a possible link between E2 promoter activation and OAdV gene expression, we utilized a screening method to search for genes within the OAdV genome that were capable of stimulating the viral E2 promoter. One such gene, E43, was identified within the proposed E4 region toward the right-hand end of the OAdV genome. The E43 gene product was also found to be capable of stimulating E2F-1-dependent gene expression. A closer inspection of the E2 promoter revealed the presence of a non-palindromic E2F binding site within the OAdV E2 promoter. Mutation of this site markedly reduced both E2F-1- and E43-dependent promoter activation. Moreover, a direct protein-protein interaction of the E43 gene product with E2F, but not with the retinoblastoma protein pRb, suggested a possible cooperation between these two proteins in activating the E2 promoter. The importance of the E43 gene product for virus replication is also underlined by the finding that an OAdV recombinant with a functionally inactivated E43 gene showed severely inhibited virus growth
Wang, Zhong; Zeng, Ximin; Mo, Yiming; Smith, Katie; Guo, Yuming; Lin, Jun
2012-12-01
Antibiotic growth promoters (AGPs) have been used as feed additives to improve average body weight gain and feed efficiency in food animals for more than 5 decades. However, there is a worldwide trend to limit AGP use to protect food safety and public health, which raises an urgent need to discover effective alternatives to AGPs. The growth-promoting effect of AGPs has been shown to be highly correlated with the decreased activity of intestinal bile salt hydrolase (BSH), an enzyme that is produced by various gut microflora and involved in host lipid metabolism. Thus, BSH inhibitors are likely promising feed additives to AGPs to improve animal growth performance. In this study, the genome of Lactobacillus salivarius NRRL B-30514, a BSH-producing strain isolated from chicken, was sequenced by a 454 GS FLX sequencer. A BSH gene identified by genome analysis was cloned and expressed in an Escherichia coli expression system for enzymatic analyses. The BSH displayed efficient hydrolysis activity for both glycoconjugated and tauroconjugated bile salts, with slightly higher catalytic efficiencies (k(cat)/K(m)) on glycoconjugated bile salts. The optimal pH and temperature for the BSH activity were 5.5 and 41°C, respectively. Examination of a panel of dietary compounds using the purified BSH identified some potent BSH inhibitors, in which copper and zinc have been recently demonstrated to promote feed digestion and body weight gain in different food animals. In sum, this study identified and characterized a BSH with broad substrate specificity from a chicken L. salivarius strain and established a solid platform for us to discover novel BSH inhibitors, the promising feed additives to replace AGPs for enhancing the productivity and sustainability of food animals.
Directory of Open Access Journals (Sweden)
Rachel M. Woodfint
2017-01-01
Full Text Available Identification of tissue- and stage-specific gene promoters is valuable for delineating the functional roles of specific genes in genetically engineered animals. Here, through the comparison of gene expression in different tissues by analysis of a microarray database, the intestinal specificity of mucin 2 (MUC2 expression was identified in mice and humans, and further confirmed in chickens by RT-PCR (reverse transcription-PCR analysis. An analysis of cis-acting elements in avian MUC2 gene promoters revealed conservation of binding sites, within a 2.9 kb proximal promoter region, for transcription factors such as caudal type homeobox 2 (CDX2, GATA binding protein 4 (GATA4, hepatocyte nuclear factor 4 α (HNF4A, and transcription factor 4 (TCF4 that are important for maintaining intestinal homeostasis and functional integrity. By generating transgenic quail, we demonstrated that the 2.9 kb chicken MUC2 promoter could drive green fluorescent protein (GFP reporter expression exclusively in the small intestine, large intestine, and ceca. Fluorescence image analysis further revealed GFP expression in intestine epithelial cells. The GFP expression was barely detectable in the embryonic intestine, but increased during post-hatch development. The spatiotemporal expression pattern of the reporter gene confirmed that the 2.9 kb MUC2 promoter could retain the regulatory element to drive expression of target genes in intestinal tissues after hatching. This new transgene expression system, using the MUC2 promoter, will provide a new method of overexpressing target genes to study gene function in the avian intestine.
Nagarajan, Raman P; Hogart, Amber R; Gwye, Ynnez; Martin, Michelle R; LaSalle, Janine M
2006-01-01
Mutations in MECP2, encoding methyl CpG binding protein 2 (MeCP2), cause most cases of Rett syndrome (RTT), an X-linked neurodevelopmental disorder. Both RTT and autism are "pervasive developmental disorders" and share a loss of social, cognitive and language skills and a gain in repetitive stereotyped behavior, following apparently normal perinatal development. Although MECP2 coding mutations are a rare cause of autism, MeCP2 expression defects were previously found in autism brain. To further study the role of MeCP2 in autism spectrum disorders (ASDs), we determined the frequency of MeCP2 expression defects in brain samples from autism and other ASDs. We also tested the hypotheses that MECP2 promoter mutations or aberrant promoter methylation correlate with reduced expression in cases of idiopathic autism. MeCP2 immunofluorescence in autism and other neurodevelopmental disorders was quantified by laser scanning cytometry and compared with control postmortem cerebral cortex samples on a large tissue microarray. A significant reduction in MeCP2 expression compared to age-matched controls was found in 11/14 autism (79%), 9/9 RTT (100%), 4/4 Angelman syndrome (100%), 3/4 Prader-Willi syndrome (75%), 3/5 Down syndrome (60%), and 2/2 attention deficit hyperactivity disorder (100%) frontal cortex samples. One autism female was heterozygous for a rare MECP2 promoter variant that correlated with reduced MeCP2 expression. A more frequent occurrence was significantly increased MECP2 promoter methylation in autism male frontal cortex compared to controls. Furthermore, percent promoter methylation of MECP2 significantly correlated with reduced MeCP2 protein expression. These results suggest that both genetic and epigenetic defects lead to reduced MeCP2 expression and may be important in the complex etiology of autism.
Directory of Open Access Journals (Sweden)
Byunghun Choi
2016-04-01
Full Text Available Chinese responsibility for reducing Greenhouse Gas or carbon dioxide emission increases continuously. Chinese government suggested two targets; Alternative Fuel Vehicle output volume 500 thousand and AFV market share 5% by the end of 2011. However any of two targets did not come true. Therefore this study accessed the question, ‘why Chinese government initiative model for AFV promotion has been so poor?’ This study reviewed the transition process for AFV policies in China and made a structural analysis for three key policies since 2009. As a result the number of articles for related industries or factor endowments was relatively more than firm strategy or demand conditions. Also this study accessed the AFV strategy of Six SOEs from the perspective of social responsibility. Six SOEs have more concentrated on electric vehicle rather than hybrid vehicle with following the government leadership. However major EV or HEV models of them mostly were made by Joint Ventures being under control of foreign makers and the JVs have actually controlled over AFV business. So the limitation of Chinese government initiative model resulted from supplier-centric approach with targeting for public transportation and institution consumer, and it caused a failure to create the demand conditions of general customers.
Literacy, Numeracy and Alternative Dispute Resolution
Cumming, J. Joy; Wilson, Janice M.
2005-01-01
The formal court system in Australia has long been criticised for its adversarial nature. As a result, there has been an increase in the use of alternative dispute resolution processes such as mediation. These are promoted as a means of increasing access to justice by disadvantaged groups and as an inexpensive way of solving legal or quasi-legal…
CO_2 capture from flue gas using clathrate formation in the presence of thermodynamic promoters
International Nuclear Information System (INIS)
Kim, Soyoung; Choi, Sung-Deuk; Seo, Yongwon
2017-01-01
Tetrahydrofuran (THF) as a water-soluble sII clathrate former, cyclopentane (CP) as a water-insoluble sII clathrate former, and tetra n-butyl ammonium chloride (TBAC) as a water-soluble semiclathrate former were used to investigate their thermodynamic promotion effects on clathrate-based CO_2 capture from simulated flue gas. The phase equilibria of CO_2 (20%) + N_2 (80%) + promoter clathrates at different promoter concentrations revealed that the presence of THF, CP, and TBAC could significantly reduce the clathrate formation pressure. THF solutions provided the highest gas uptake and steepest CO_2 concentration changes in the vapor phase, whereas TBAC solutions showed the highest CO_2 selectivity (∼61%) in the clathrate phase. CP solutions exhibited a slower formation rate, but their final gas uptake and CO_2 selectivity in the clathrate phase were comparable to the THF solutions. Raman spectroscopy confirmed the enclathration of both CO_2 and N_2 in the clathrate cages and a structural transition due to the inclusion of promoters in the clathrate phase. The overall experimental results indicate that TBAC is a viable thermodynamic promoter for clathrate-based CO_2 capture from simulated flue gas, considering the lower pressure requirement for clathrate formation, higher CO_2 enrichment in the clathrate phase, non-toxicity, and non-volatility. - Highlights: • Clathrate-based CO_2 capture was investigated in the presence of thermodynamic promoters. • THF, CP, and TBAC demonstrated a significant thermodynamic promotion for CO_2 (20%) + N_2 (80%) clathrates. • The highest gas uptake was observed for the THF (5.6 mol%) solution. • TBAC solutions showed the highest CO_2 selectivity in the clathrate phase (∼61%). • Raman spectroscopy confirmed the guest gas enclathration and clathrate structure.
28 CFR 600.2 - Alternatives available to the Attorney General.
2010-07-01
... GENERAL POWERS OF SPECIAL COUNSEL § 600.2 Alternatives available to the Attorney General. When matters are brought to the attention of the Attorney General that might warrant consideration of appointment of a Special Counsel, the Attorney General may: (a) Appoint a Special Counsel; (b) Direct that an initial...
Directory of Open Access Journals (Sweden)
Mara Lígia Biazotto Bachelli
2013-09-01
Full Text Available Lettuce is a leafy vegetable widely used in industry for minimally processed products, in which the step of sanitization is the crucial moment for ensuring a safe food for consumption. Chlorinated compounds, mainly sodium hypochlorite, are the most used in Brazil, but the formation of trihalomethanes from this sanitizer is a drawback. Then, the search for alternative methods to sodium hypochlorite has been emerging as a matter of great interest. The suitability of chlorine dioxide (60 mg L-1/10 min, peracetic acid (100 mg L-1/15 min and ozonated water (1.2 mg L-1 /1 min as alternative sanitizers to sodium hypochlorite (150 mg L-1 free chlorine/15 min were evaluated. Minimally processed lettuce washed with tap water for 1 min was used as a control. Microbiological analyses were performed in triplicate, before and after sanitization, and at 3, 6, 9 and 12 days of storage at 2 ± 1 ºC with the product packaged on LDPE bags of 60 µm. It was evaluated total coliforms, Escherichia coli, Salmonella spp., psicrotrophic and mesophilic bacteria, yeasts and molds. All samples of minimally processed lettuce showed absence of E. coli and Salmonella spp. The treatments of chlorine dioxide, peracetic acid and ozonated water promoted reduction of 2.5, 1.1 and 0.7 log cycle, respectively, on count of microbial load of minimally processed product and can be used as substitutes for sodium hypochlorite. These alternative compounds promoted a shelf-life of six days to minimally processed lettuce, while the shelf-life with sodium hypochlorite was 12 days.
Structure of 2,4-Diaminopyrimidine - Theobromine Alternate Base Pairs
Gengeliczki, Zsolt; Callahan, Michael P.; Kabelac, Martin; Rijs, Anouk M.; deVries, Mattanjah S.
2011-01-01
We report the structure of clusters of 2,4-diaminopyrimidine with 3,7-dimethylxanthine (theobromine) in the gas phase determined by IR-UV double resonance spectroscopy in both the near-IR and mid-IR regions in combination with ab initio computations. These clusters represent potential alternate nucleobase pairs, geometrically equivalent to guanine-cytosine. We have found the four lowest energy structures, which include the Watson-Crick base pairing motif. This Watson-Crick structure has not been observed by resonant two-photon ionization (R2PI) in the gas phase for the canonical DNA base pairs.
Genome-wide function of H2B ubiquitylation in promoter and genic regions.
Batta, Kiran; Zhang, Zhenhai; Yen, Kuangyu; Goffman, David B; Pugh, B Franklin
2011-11-01
Nucleosomal organization in and around genes may contribute substantially to transcriptional regulation. The contribution of histone modifications to genome-wide nucleosomal organization has not been systematically evaluated. In the present study, we examine the role of H2BK123 ubiquitylation, a key regulator of several histone modifications, on nucleosomal organization at promoter, genic, and transcription termination regions in Saccharomyces cerevisiae. Using high-resolution MNase chromatin immunoprecipitation and sequencing (ChIP-seq), we map nucleosome positioning and occupancy in mutants of the H2BK123 ubiquitylation pathway. We found that H2B ubiquitylation-mediated nucleosome formation and/or stability inhibits the assembly of the transcription machinery at normally quiescent promoters, whereas ubiquitylation within highly active gene bodies promotes transcription elongation. This regulation does not proceed through ubiquitylation-regulated histone marks at H3K4, K36, and K79. Our findings suggest that mechanistically similar functions of H2B ubiquitylation (nucleosome assembly) elicit different functional outcomes on genes depending on its positional context in promoters (repressive) versus transcribed regions (activating).
on some properties of the alternating sylvester series and alternating
African Journals Online (AJOL)
DJFLEX
. (iii) above is known in literature as the alternating Sylvester series while (iv) is known as the alternating Engel expansion (Kalpazidou and Ganatsiou (1991)). We are interested in studying the properties of these alternating series. Theorem 2: ...
77 FR 17457 - Work Group on Alternative Test Methods for Commercial Measuring Devices
2012-03-26
... DEPARTMENT OF COMMERCE National Institute of Standards and Technology Work Group on Alternative... Work Group (WG) to examine alternative methods for testing the accuracy of commercial measuring devices... participates to promote uniformity among the states in laws, regulations, methods, and testing equipment that...
Promoting environmental sustainability via an expert elicitation process
International Nuclear Information System (INIS)
Swor, Tom; Canter, Larry
2011-01-01
Environmental sustainability (ES) planning was applied to the 981-mile, commercially navigable Ohio River. Navigation improvement needs were identified within the broad study along with actions to restore aquatic and riparian ecological resources to a higher state of sustainability. The actions were identified via an Expert Elicitation Process (EEP) involving aquatic and riparian/terrestrial experts knowledgeable of Ohio River resources. The received information was synthesized into goals for the selected resources (Valued Ecosystem Components - or VECs), actions or measures to attain the goals, and monitoring to evaluate conditions. Finally, 26 types of ES actions were identified and classified into three ES alternatives. These alternatives were then evaluated relative to key decision criteria, and such evaluations, based on pertinent decision criteria, were also conducted for four navigation improvement alternatives. Finally, the best combination of ES and navigation alternatives was identified. The key lessons derived from this use of EEP were that: (1) EEP can support the preliminary identification of ES measures; however, more detailed study of specific designs and cost evaluations will be necessary; (2) the method promotes collaboration between key scientists and policymakers from governmental agencies and private sectors, and such collaboration will ultimately provide the foundation for implementation of sustainability actions; and (3) an effective EEP does not occur by accident, it requires careful planning, implementation, and documentation. - Research Highlights: → Use of an Expert Elicitation Process (EEP) is demonstrated in this study. → EEP was used to identify Environmental Sustainability (ES) needs for the Ohio River. → EEP helped develop consensus among resource experts on ES needs. → EEP promotes collaboration to identify and contribute to common resource goals. → EEP may be used in assessing cumulative effects and formulating restoration
Dehghan, Mahlagha; Mokhtarabadi, Sima; Heidari, Fatemeh Ghaedi
2018-04-04
Background The aim of this study was to determine the status of utilizing some complementary and alternative medicine techniques in infertile couples. Methods This was a cross-sectional study conducted on 250 infertile couples referred to a hospital in Kerman using convenience sampling. A researcher-made questionnaire was used to study the prevalence and user satisfaction of complementary and alternative medicines. Results Results indicated that 49.6% of the infertile couples used at least one of the complementary and alternative medicines during the past year. Most individuals used spiritual techniques (71.8% used praying and 70.2% used Nazr) and medicinal plants (54.8%). Safety is the most important factor affecting the satisfaction of infertile couples with complementary treatments (couples think that such treatments are safe (54.8%)). Discussion Concerning high prevalence of complementary and alternative treatments in infertile couples, incorporating such treatments into the healthcare education and promoting the awareness of infertile individuals seem crucial.
Alternative Educational Futures for a Knowledge Society
Young, Michael
2010-01-01
This article offers a critical analysis of recent trends in educational policy with particular reference to their assumptions about the knowledge society. It examines the implications of the analysis for the issue of elitism and the promotion of greater educational equality. The article concludes by offering an alternative approach to educational…
Simulation of remediation alternatives for a 137Cs contaminated soil
International Nuclear Information System (INIS)
Bea, S.A.; Carrera, J.; Saaltink, M.; Soler, J.M.; Ayora, C.
2004-01-01
We analyze remediation alternatives for a soil contaminated with 137 Cs, which sorbs strongly to clay aggregates where water flux is negligible. The mobile portion of the soil (macropores) retains little water and cesium. Some of the remediation alternatives involve infiltration of seawater enriched with KCl, to promote mobilization of Cs through exchange with K. Therefore, a fully coupled reactive transport model is used to test these alternatives. We conclude that flushing is a viable alternative, provided that some recommendations, derived from the modelling exercise are followed. These include high rate periodic infiltration and draining, as well as performing infiltration from independent cells to limit the effect of preferential flowpaths. (orig.)
RBP2 Promotes Adult Acute Lymphoblastic Leukemia by Upregulating BCL2.
Directory of Open Access Journals (Sweden)
Xiaoming Wang
Full Text Available Despite recent increases in the cure rate of acute lymphoblastic leukemia (ALL, adult ALL remains a high-risk disease that exhibits a high relapse rate. In this study, we found that the histone demethylase retinoblastoma binding protein-2 (RBP2 was overexpressed in both on-going and relapse cases of adult ALL, which revealed that RBP2 overexpression was not only involved in the pathogenesis of ALL but that its overexpression might also be related to relapse of the disease. RBP2 knockdown induced apoptosis and attenuated leukemic cell viability. Our results demonstrated that BCL2 is a novel target of RBP2 and supported the notion of RBP2 being a regulator of BCL2 expression via directly binding to its promoter. As the role of RBP2 in regulating apoptosis was confirmed, RBP2 overexpression and activation of BCL2 might play important roles in ALL development and progression.
The promotive effect of N 2 fixers, Bacillus circulans and ...
African Journals Online (AJOL)
The promotive effect of N 2 fixers, Bacillus circulans and Saccharomyces cerevisiae on the viability of native arbuscular mycorrhizal fungi and the impact on the productivity of alfalfa ( Medicago sativa l.)
Directory of Open Access Journals (Sweden)
Jia Bi
2016-01-01
Full Text Available Macrophages can acquire a variety of polarization status and functions: classically activated macrophages (M1 macrophages; alternatively activated macrophages (M2 macrophages. However, the molecular basis of the process is still unclear. Here, this study addresses that microRNA-181a (miR-181a is a key molecule controlling macrophage polarization. We found that miR-181a is overexpressed in M2 macrophages than in M1 macrophages. miR-181a expression was decreased when M2 phenotype converted to M1, whereas it increased when M1 phenotype converted to M2. Overexpression of miR-181a in M1 macrophages diminished M1 phenotype expression while promoting polarization to the M2 phenotype. In contrast, knockdown of miR-181a in M2 macrophages promoted M1 polarization and diminished M2 phenotype expression. Mechanistically, Bioinformatic analysis revealed that Kruppel-like factor 6 (KLF6 and CCAAT/enhancer binding protein-α (C/EBPα is a potential target of miR-181a and luciferase assay confirmed that KLF6 and C/EBPα translation is suppressed by miR-181a through interaction with the 3′UTR of KLF6 and C/EBPα mRNA. Further analysis showed that induction of miR-181a suppressed KLF6 and C/EBPα protein expression. Importantly, miR-181a also diminishes M2 macrophages-mediated migration and invasion capacity of tumor cells. Collectively, our results suggest that miR-181a plays a significant role in regulating macrophage polarization through directly target KLF6 and C/EBPα.
There is No Alternative: The Critical Potential of Alternative Media in the Face of Neoliberalism.
Linus Andersson
2012-01-01
The article discusses the concept of “the alternative” and the media through four sections. The first section discusses neoliberalism and the connection between neoliberal doctrine and mainstream media. This connection is described as promoting “public amnesia”, financialization and economization of news journalism, and social divide. The second section discusses alternative media from the perspective of new social movements and symbolic resistance, claiming that the symbolic resistance frame...
2012-07-09
..., revised, and alternative safety testing methods with regulatory applicability and promotes the scientific... DEPARTMENT OF HEALTH AND HUMAN SERVICES Meeting of the Scientific Advisory Committee on Alternative Toxicological Methods (SACATM) AGENCY: Division of the National Toxicology Program (DNTP...
Energy Technology Data Exchange (ETDEWEB)
Leiby, P.N.
1993-09-01
This report describes a modeling methodology for examining the prospective economic benefits of displacing motor gasoline use by alternative fuels. The approach is based on the Alternative Fuels Trade Model (AFTM). AFTM development was undertaken by the US Department of Energy (DOE) as part of a longer term study of alternative fuels issues. The AFTM is intended to assist with evaluating how alternative fuels may be promoted effectively, and what the consequences of substantial alternative fuels use might be. Such an evaluation of policies and consequences of an alternative fuels program is being undertaken by DOE as required by Section 502(b) of the Energy Policy Act of 1992. Interest in alternative fuels is based on the prospective economic, environmental and energy security benefits from the substitution of these fuels for conventional transportation fuels. The transportation sector is heavily dependent on oil. Increased oil use implies increased petroleum imports, with much of the increase coming from OPEC countries. Conversely, displacement of gasoline has the potential to reduce US petroleum imports, thereby reducing reliance on OPEC oil and possibly weakening OPEC`s ability to extract monopoly profits. The magnitude of US petroleum import reduction, the attendant fuel price changes, and the resulting US benefits, depend upon the nature of oil-gas substitution and the supply and demand behavior of other world regions. The methodology applies an integrated model of fuel market interactions to characterize these effects.
Understanding promotion of photocatalytic activity of TiO2 by Au nanoparticles
Amrollahi Buky, Rezvaneh; Hamdy, Mohamed S.; Mul, Guido
2014-01-01
Au nanoparticles prepared by deposition–precipitation were evaluated in promoting photocatalytic activity of TiO2 (P25) in the oxidation of methylcyclohexane. At 375 nm and in particular at 425 nm, Au was found to significantly enhance the rate induced by P25. Illumination of Au-promoted P25 at 525
Economic impact of ethanol promotion in Mexico: A general equilibrium analysis
International Nuclear Information System (INIS)
Elizondo, Alejandra; Boyd, Roy
2017-01-01
In this paper we analyze the economic impact of a decision to produce ethanol in Mexico, comparing the effect of a subsidy to initiate ethanol production with that of alternative public policies. Public support of biofuels has been a public policy goal since 2008, and the promotion of ethanol remains an active part of the government agenda. The evidence used to encourage or alter the policy is (by necessity) chiefly based on international experience. In this study we use a computable general equilibrium model (CGE) to estimate the impact of ethanol production on the Mexican economy. Using cost data from Brazil we introduce ethanol into a Mexican social accounting matrix, and insert a latent sector into the model to analyze ethanol promotion. Our results show that subsidies to ethanol would increase agriculture production but at the expense of aggregate welfare. By contrast, alternative 'clean energy' policies appear to advance economic growth to a greater extent. - Highlights: • A CGE model is used to estimate the impact of ethanol promotion in Mexico. • The benefits of a policy designed to promote the use of ethanol are rather small. • The rural sector benefits modestly, but production in other sectors decrease. • Alternative policies advance economic growth and welfare to a greater extent.
Promoter methylation of MLH1, PMS2, MSH2 and p16 is a phenomenon of advanced-stage HCCs.
Hinrichsen, Inga; Kemp, Matthias; Peveling-Oberhag, Jan; Passmann, Sandra; Plotz, Guido; Zeuzem, Stefan; Brieger, Angela
2014-01-01
Epigenetic silencing of tumour suppressor genes has been observed in various cancers. Looking at hepatocellular carcinoma (HCC) specific protein silencing was previously demonstrated to be associated with the Hepatitis C virus (HCV). However, the proposed HCV dependent promoter methylation of DNA mismatch repair (MMR) genes and thereby enhanced progression of hepatocarcinogenesis has been the subject of controversial discussion. We investigated promoter methylation pattern of the MMR genes MLH1, MSH2 and PMS2 as well as the cyclin-dependent kinase inhibitor 2A gene (p16) in 61 well characterized patients with HCCs associated with HCV, Hepatitis B virus infection or alcoholic liver disease. DNA was isolated from formalin-fixed, paraffin-embedded tumour and non-tumour adjacent tissue and analysed by methylation-specific PCR. Moreover, microsatellite analysis was performed in tissues showing methylation in MMR gene promoters. Our data demonstrated that promoter methylation of MLH1, MSH2, PMS2 and p16 is present among all considered HCCs. Hereby, promoter silencing was detectable more frequently in advanced-stage HCCs than in low-stage ones. However, there was no significant correlation between aberrant DNA methylation of MMR genes or p16 and HCV infection in related HCC specimens. In summary, we show that promoter methylation of essential MMR genes and p16 is detectable in HCCs most dominantly in pT3 stage tumour cases. Since loss of MMR proteins was previously described to be not only responsible for tumour development but also for chemotherapy resistance, the knowledge of mechanisms jointly responsible for HCC progression might enable significant improvement of individual HCC therapy in the future.
Promoter methylation of MLH1, PMS2, MSH2 and p16 is a phenomenon of advanced-stage HCCs.
Directory of Open Access Journals (Sweden)
Inga Hinrichsen
Full Text Available Epigenetic silencing of tumour suppressor genes has been observed in various cancers. Looking at hepatocellular carcinoma (HCC specific protein silencing was previously demonstrated to be associated with the Hepatitis C virus (HCV. However, the proposed HCV dependent promoter methylation of DNA mismatch repair (MMR genes and thereby enhanced progression of hepatocarcinogenesis has been the subject of controversial discussion. We investigated promoter methylation pattern of the MMR genes MLH1, MSH2 and PMS2 as well as the cyclin-dependent kinase inhibitor 2A gene (p16 in 61 well characterized patients with HCCs associated with HCV, Hepatitis B virus infection or alcoholic liver disease. DNA was isolated from formalin-fixed, paraffin-embedded tumour and non-tumour adjacent tissue and analysed by methylation-specific PCR. Moreover, microsatellite analysis was performed in tissues showing methylation in MMR gene promoters. Our data demonstrated that promoter methylation of MLH1, MSH2, PMS2 and p16 is present among all considered HCCs. Hereby, promoter silencing was detectable more frequently in advanced-stage HCCs than in low-stage ones. However, there was no significant correlation between aberrant DNA methylation of MMR genes or p16 and HCV infection in related HCC specimens. In summary, we show that promoter methylation of essential MMR genes and p16 is detectable in HCCs most dominantly in pT3 stage tumour cases. Since loss of MMR proteins was previously described to be not only responsible for tumour development but also for chemotherapy resistance, the knowledge of mechanisms jointly responsible for HCC progression might enable significant improvement of individual HCC therapy in the future.
The flavonoid fisetin promotes osteoblasts differentiation through Runx2 transcriptional activity.
Léotoing, Laurent; Davicco, Marie-Jeanne; Lebecque, Patrice; Wittrant, Yohann; Coxam, Véronique
2014-06-01
Flavonoids represent a group of polyphenolic compounds commonly found in daily nutrition with proven health benefits. Among this group, the flavonol fisetin has been previously shown to protect bone by repressing osteoclast differentiation. In the present study, we investigated the role of fisetin in regulating osteoblasts physiology. In vivo mice treated with LPSs exhibited osteoporosis features associated with a dramatic repression of osteoblast marker expression. In this model, inhibition of osteocalcin and type I collagen alpha 1 transcription was partially countered by a daily consumption of fisetin. Interestingly, in vitro, fisetin promoted both osteoblast alkaline phosphatase activity and mineralization process. To decipher how fisetin may exert its positive effect on osteoblastogenesis, we analyzed its ability to control the runt-related transcription factor 2 (Runx2), a key organizer in developing and maturing osteoblasts. While fisetin did not impact Runx2 mRNA and protein levels, it upregulated its transcriptional activity. Actually, fisetin stimulated the luciferase activity of a reporter plasmid driven by the osteocalcin gene promoter that contains Runx2 binding sites and promoted the mRNA expression of osteocalcin and type I collagen alpha 1 targets. Bone sparing properties of fisetin also rely on its positive influence on osteoblast differentiation and activity. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Zhou, Jie; Zhang, Haifeng; Meng, Hengkai; Zhu, Yan; Bao, Guanhui; Zhang, Yanping; Li, Yin; Ma, Yanhe
2014-03-28
Cyanobacteria are oxygenic photosynthetic prokaryotes that play important roles in the global carbon cycle. Recently, engineered cyanobacteria capable of producing various small molecules from CO2 have been developed. However, cyanobacteria are seldom considered as factories for producing proteins, mainly because of the lack of efficient strong promoters. Here, we report the discovery and verification of a super-strong promoter P(cpc560), which contains two predicted promoters and 14 predicted transcription factor binding sites (TFBSs). Using P(cpc560), functional proteins were produced at a level of up to 15% of total soluble protein in the cyanobacterium Synechocystis sp. 6803, a level comparable to that produced in Escherichia coli. We demonstrated that the presence of multiple TFBSs in P(cpc560) is crucial for its promoter strength. Genetically transformable cyanobacteria neither have endotoxins nor form inclusion bodies; therefore, P(cpc560) opens the possibility to use cyanobacteria as alternative hosts for producing heterogeneous proteins from CO2 and inorganic nutrients.
Second interim report of the Interagency Commission on Alternative Motor Fuels
International Nuclear Information System (INIS)
1991-09-01
This report describes progress the commission and government agencies have made in implementing the provisions of the Alternative Motor Fuels Act of 1988, assessing the role of alternative motor fuels in the US transportation sector, and developing policies to promote the use of alternative fuels. The alternative motor-fuels policies proposed in the National Energy Strategy (NES) are described and shows how they compose an effective long-term plan to encourage the widespread use of alternative motor fuels. The progress to date of the Department of Energy (DOE) and other agencies in implementing the programs required by the AMFA is reported. A detailed scenario of future alternative-fuel use that displaces 2.5 million barrels per day (MMBD) of petroleum and a feasible path of vehicle production and fuel supply leading to that goal is described. An analytical tool for exploring and quantifying the energy market impacts of alternative fuels, the Alternative Fuels Trade Model (AFTM), is described. The AFTM provides a means of investigating the impacts of alternative fuels in interrelated world energy markets for petroleum and natural gas. Several major initiatives have recently been enacted that have important ramifications for alternative-fuels policy. The Clean Air Act Amendments of 1990 contain provisions mandating the use of nonpetroleum oxygenates in reformulated gasoline. Other provisions for much more stringent emissions standards may affect the ability of manufacturers to make and sell conventional-fuel vehicles or, at the very least, affect their cost-effectiveness in comparison to cleaner alternative-fuel vehicles (AFV's). Finally, the key areas in which technological advances could substantially improve the competitiveness of AFV technologies in the marketplace are reviewed
Antibiotics in Canadian poultry productions and anticipated alternatives
Directory of Open Access Journals (Sweden)
Moussa Sory Diarra
2014-06-01
Full Text Available The use of antibiotics in food-producing animals has significantly increased animal health by lowering mortality and the incidence of diseases. Antibiotics also have largely contributed to increase productivity of farms. However, antibiotic usage in general and relevance of non-therapeutic antibiotics in feed (growth promoters need to be reevaluated especially because bacterial pathogens of humans and animals have developed and shared a variety of antibiotic resistance mechanisms that can easily spread within microbial communities. In Canada, poultry production involves more than 2,600 regulated chicken producers. There are several antibiotics approved as feed additives available for poultry farmers. Feed recipes and mixtures greatly vary geographically and from one farm to another, making links between use of a specific antibiotic feed additive and production yields or selection of specific antibiotic-resistant bacteria difficult to establish. Many on-farm studies have revealed the widespread presence of antibiotic-resistant bacteria in broiler chickens. While sporadic reports linked the presence of antibiotic-resistant organisms to the use of feed supplemented with antibiotics, no recent studies could clearly demonstrate the benefit of antimicrobial growth promoters on performance and production yields. With modern biosecurity and hygienic practices, there is a genuine concern that intensive utilization of antibiotics or use of antimicrobial growth promoters in feed might no longer be useful. Public pressure and concerns about food and environmental safety (antibiotic residues, antibiotic-resistant pathogens have driven researchers to actively look for alternatives to antibiotics. Some of the alternatives include pre- and probiotics, organic acids and essential oils. We will describe here the properties of some bioactive molecules, like those found in cranberry, which have shown interesting polyvalent antibacterial and immuno
Promoted V2O5/TiO2 catalysts for selective catalytic reduction of NO with NH3 at low temperatures
DEFF Research Database (Denmark)
Putluru, Siva Sankar Reddy; Schill, Leonhard; Godiksen, Anita
2016-01-01
characterized by N2 physisorption, XRPD, NH3-TPD, H2-TPR, Raman, FTIR and EPR spectroscopy to investigate the properties of the catalysts. XRPD, Raman and FTIR showed that promotion with 15 wt.% HPA does not cause V2O5 to be present in crystalline form, also at a loading of 5 wt.% V2O5. Hence, use of HPAs does......The influence of varying the V2O5 content (3–6 wt.%) was studied for the selective catalytic reduction (SCR) of nitrogen oxides by ammonia on heteropoly acid (HPA)- and tungsten oxide (WO3)-promoted V2O5/TiO2 catalysts. The SCR activity and alkali deactivation resistance of HPA-promoted V2O5/TiO2...... catalysts was found to be much higher than for WO3-promoted catalysts. By increasing the vanadium content from 3 to 5 wt.% the catalysts displayed a two fold increase in activity at 225 °C and retained their initial activity after alkali doping at a molar K/V ratio of 0.181. Furthermore, the catalysts were...
Wang, Qi; Li, Juanjuan; Wu, Wei; Shen, Ruizhe; Jiang, He; Qian, Yuting; Tang, Yanping; Bai, Tingting; Wu, Sheng; Wei, Lumin; Zang, Yi; Zhang, Ji; Wang, Lifu
2016-03-08
The importance of Pituitary homeobox 2 (Pitx2) in malignancy remains enigmatic, and Pitx2 has not been previously implicated in pancreatic ductal adenocarcinoma (PDAC). In this study, we performed gene expression profiling of human PDAC tissues and identified Pitx2 as a promising candidate. Pitx2 expression was decreased from 2.6- to 19-fold in human PDAC tissues from microarray units. Immunochemistry staining showed that Pitx2 expression was moderate to intense in normal pancreatic and pancreatic intraepithelial neoplastic lesions, whereas low in human PDAC tissues. The Pitx2 levels correlated with overall patient survival post-operatively in PDAC. Induction of Pitx2 expression partly inhibited the malignant phenotype of PDAC cells. Interestingly, low Pitx2 expression was correlated with Smad4 mutant inactivation, but not with Pitx2 DNA-methylation. Furthermore, Smad4 protein bound to Pitx2 promoter and stimulated Pitx2 expression in PDAC. In addition, Pitx2 protein bound to the promoter of the protein phosphatase 2A regulatory subunit B55α (PPP2R2A) and upregulated PPP2R2A expression, which may activate dephosphorylation of Akt in PDAC. These findings provide new mechanistic insights into Pitx2 as a tumor suppressor in the downstream of Smad4. And Pitx2 protein promotes PPP2R2A expression which may inhibit Akt pathway. Therefore, we propose that the Smad4-Pitx2-PPP2R2A axis, a new signaling pathway, suppresses the pancreatic carcinogenesis.
Tang, Juan; Guo, Yun-Shan; Yu, Xiao-Ling; Huang, Wan; Zheng, Ming; Zhou, Ying-Hui; Nan, Gang; Wang, Jian-Chao; Yang, Hai-Jiao; Yu, Jing-Min; Jiang, Jian-Li; Chen, Zhi-Nan
2015-10-27
Oscillations in intracellular Ca2+ concentrations ([Ca2+]i) mediate various cellular function. Although it is known that [Ca2+]i oscillations are susceptible to dysregulation in tumors, the tumor-specific regulators of [Ca2+]i oscillations are poorly characterized. We discovered that CD147 promotes hepatocellular carcinoma (HCC) metastasis and proliferation by enhancing the amplitude and frequency of [Ca2+]i oscillations in HCC cells. CD147 activates two distinct signaling pathways to regulate [Ca2+]i oscillations. By activating FAK-Src-IP3R1 signaling pathway, CD147 promotes Ca2+ release from endoplasmic reticulum (ER) and enhances the amplitude of [Ca2+]i oscillations. Furthermore, CD147 accelerates ER Ca2+refilling and enhances the frequency of [Ca2+]i oscillations through activating CaMKP-PAK1-PP2A-PLB-SERCA signaling pathway. Besides, CD147-promoted ER Ca2+ release and refilling are tightly regulated by changing [Ca2+]i. CD147 may activate IP3R1 channel under low [Ca2+]i conditions and CD147 may activate SERCA pump under high [Ca2+]i conditions. CD147 deletion suppresses HCC tumorigenesis and increases the survival rate of liver-specific CD147 knockout mice by regulating [Ca2+]i oscillations in vivo. Together, these results reveal that CD147 functions as a critical regulator of ER-dependent [Ca2+]i oscillations to promote oncogenic progression in HCC.
Energy Technology Data Exchange (ETDEWEB)
Kunz, S.; Schmitz, H.J.; Schrenk, D. [Kaiserslautern Univ. (Germany). Dept. of Food Chemistry and Environmental Toxicology; Buchmann, A.; Schwarz, M. [Tuebingen Univ. (Germany). Inst. of Toxicology; Schilling, B.; Paepke, O. [ERGO Research, Hamburg (Germany); Robertson, L.W.; Lehmler, H.J. [Iowa Univ, Iowa City, IA (United States). Dept. of Occupational and Environmental Health
2004-09-15
Polychlorinated biphenyls (PCBs) are potent persistent environmental pollutants exhibiting neurotoxic, teratogenic and tumor-promoting effects in experimental animal models. PCB congeners can be divided into 'dioxin-like' and 'non-dioxin-like' congeners on the basis of their ability to act as aryl hydrocarbon receptor (AhR) agonists. Like the most toxic dioxin congener 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) 'dioxin-like' PCBs bind to the AhR and show characteristic effects on the expression of AhR-regulated genes including the induction of cytochrome P450 (CYP) 1A1. On the other hand, 'non-dioxin-like' PCB congeners have a lower or no binding affinity to the AhR, but exhibit a 'phenobarbital-type' induction of CYP 2B1/2 activity. The tumor-promoting potency of several PCBs has been demonstrated in two-stage initiation-promotion experiments in rat liver. Preneoplastic cell clones, targets for tumor promotion, can be identified as phenotypically altered foci showing characteristic enzyme patterns including the decreased activity of adenosine triphosphatase (ATPase) or the increased expression of the placental form of gluthatione S-transferase (GSTP). In the present study, the effect of the 'non-dioxin-like' 2,4,4'-trichlorobiphenyl (PCB 28) and 2,2',4,5,5'-pentachlorobiphenyl (PCB 101) on the promotion of enzyme-altered hepatic foci was investigated in female Wistar rats after initiation with diethylnitrosamine (DEN).
CNPY2 promoted the proliferation of renal cell carcinoma cells and increased the expression of TP53
International Nuclear Information System (INIS)
Taniguchi, Hidefumi; Ito, Saya; Ueda, Takashi; Morioka, Yukako; Kayukawa, Naruhiro; Ueno, Akihisa; Nakagawa, Hideo; Fujihara, Atsuko; Ushijima, So; Kanazawa, Motohiro; Hongo, Fumiya; Ukimura, Osamu
2017-01-01
Renal cell carcinoma (RCC) is the most common type of kidney cancer. However, the mechanisms underlying the progression of the disease are not well understood. The data in this report suggest that canopy FGF signaling regulator 2 (CNPY2) is a promoter of RCC progression. We found that CNPY2 significantly promoted growth of RCC cells and upregulated TP53 gene expression. Although TP53 is widely known as a tumor suppressor, in RCC TP53 promoted tumor cell growth. A typical p53 target gene, CDKN1A, was upregulated by both p53 and CNPY2 in RCC cells, suggesting that CNPY2 increased the expression level of TP53. Consistent with these results, CNPY2 and TP53 expression levels were positively correlated in RCC patients. These findings suggested that CNPY2 promoted cancer cell growth in RCC through regulating TP53 gene expression. - Highlights: • CNPY2 promoted growth of renal cell carcinoma (RCC) cells. • TP53 expression levels were increased by CNPY2 in RCC cells. • Growth of RCC cells was promoted by TP53. • CNPY2 expression positively correlated with TP53 expression in RCC patients.
Tumor Restrictive Suicide Gene Therapy for Glioma Controlled by the FOS Promoter.
Directory of Open Access Journals (Sweden)
Jianqing Pan
Full Text Available Effective suicide gene delivery and expression are crucial to achieving successful effects in gene therapy. An ideal tumor-specific promoter expresses therapeutic genes in tumor cells with minimal normal tissue expression. We compared the activity of the FOS (FBJ murine osteosarcoma viral oncogene homolog promoter with five alternative tumor-specific promoters in glioma cells and non-malignant astrocytes. The FOS promoter caused significantly higher transcriptional activity in glioma cell lines than all alternative promoters with the exception of CMV. The FOS promoter showed 13.9%, 32.4%, and 70.8% of the transcriptional activity of CMV in three glioma cell lines (U87, U251, and U373. Importantly, however, the FOS promoter showed only 1.6% of the transcriptional activity of CMV in normal astrocytes. We also tested the biologic activity of recombinant adenovirus containing the suicide gene herpes simplex virus thymidine kinase (HSV-tk driven by the FOS promoter, including selective killing efficacy in vitro and tumor inhibition rate in vivo. Adenoviral-mediated delivery of the HSV-tk gene controlled by the FOS promoter conferred a cytotoxic effect on human glioma cells in vitro and in vivo. This study suggests that use of the FOS-tk adenovirus system is a promising strategy for glioma-specific gene therapy but still much left for improvement.
Dvorak, Kaitlyn M; Pettee, Krista M; Rubinic-Minotti, Kaitlin; Su, Robin; Nestor-Kalinoski, Andrea; Eisenmann, Kathryn M
2018-01-01
The tumor microenvironment (TME) promotes tumor cell invasion and metastasis. An important step in the shift to a pro-cancerous microenvironment is the transformation of normal stromal fibroblasts to carcinoma-associated fibroblasts (CAFs). CAFs are present in a majority of solid tumors and can directly promote tumor cell motility via cytokine, chemokine and growth factor secretion into the TME. The exact effects that the TME has upon cytoskeletal regulation in motile tumor cells remain enigmatic. The conserved formin family of cytoskeleton regulating proteins plays an essential role in the assembly and/or bundling of unbranched actin filaments. Mammalian Diaphanous-related formin 2 (mDia2/DIAPH3/Drf3/Dia) assembles a dynamic F-actin cytoskeleton that underlies tumor cell migration and invasion. We therefore sought to understand whether CAF-derived chemokines impact breast tumor cell motility through modification of the formin-assembled F-actin cytoskeleton. In MDA-MB-231 cells, conditioned media (CM) from WS19T CAFs, a human breast tumor-adjacent CAF line, significantly and robustly increased wound closure and invasion relative to normal human mammary fibroblast (HMF)-CM. WS19T-CM also promoted proteasome-mediated mDia2 degradation in MDA-MB-231 cells relative to control HMF-CM and WS21T CAF-CM, a breast CAF cell line that failed to promote robust MDA-MB-231 migration. Cytokine array analysis of CM identified up-regulated secreted factors in WS19T relative to control WS21T CM. We identified CXCL12 as a CM factor influencing loss of mDia2 protein while increasing MDA-MB-231 cell migration. Our data suggest a mechanism whereby CAFs promote tumor cell migration and invasion through CXCL12 secretion to regulate the mDia2-directed cytoskeleton in breast tumor cells.
The miR-599 promotes non-small cell lung cancer cell invasion via SATB2
International Nuclear Information System (INIS)
Tian, Wenjun; Wang, Guanghai; Liu, Yiqing; Huang, Zhenglan; Zhang, Caiqing; Ning, Kang; Yu, Cuixiang; Shen, Yajuan; Wang, Minghui; Li, Yuantang; Wang, Yong; Zhang, Bingchang; Zhao, Yaoran
2017-01-01
MicroRNAs (miRNAs) play important roles in the pathogenesis of many types of cancers by negatively regulating gene expression at posttranscriptional level. Here, we identified that miR-599 is up-regulated in non-small cell lung cancer (NSCLC) patients. It promoted NSCLC cell proliferation by negatively regulating SATB2. In NSCLC cell lines, CCK-8 proliferation assay indicated that the cell proliferation is promoted by miR-599 mimics. Transwell assay showed that miR-599 mimics promoted the invasion and migration of NSCLC cells. Luciferase assays confirmed that miR-599 directly binds to the 3'untranslated region of SATB2, and western blotting showed that miR-599 suppresses the expression of SATB2 at the protein level. This study indicates that miR-599 promotes proliferation and invasion of NSCLC cell lines via SATB2. The miR-599 may represent a potential therapeutic target for NSCLC treatment. - Highlights: • miR-599 is up-regulated in NSCLC. • miR-599 promotes the proliferation and invasion of NSCLC cells. • miR-599 inhibitors inhibits the proliferation and invasion of NSCLC cells. • miR-599 targets 3′ UTR of SATB2 in NSCLC cells. • miR-599 inhibits SATB2 in NSCLC cells.
Mdm2 is a novel activator of ApoCIII promoter which is antagonized by p53 and SHP inhibition
Energy Technology Data Exchange (ETDEWEB)
Yang, Zhihong; Zhang, Yuxia [Departments of Medicine and Oncological Sciences, Huntsman Cancer Institute, University of Utah School of Medicine, Salt Lake City, UT 84132 (United States); Wang, Li, E-mail: l.wang@hsc.utah.edu [Departments of Medicine and Oncological Sciences, Huntsman Cancer Institute, University of Utah School of Medicine, Salt Lake City, UT 84132 (United States)
2012-01-13
Highlights: Black-Right-Pointing-Pointer Mdm2 enhances HNF4{alpha} activation of the ApoCIII promoter via interaction with HNF4{alpha}. Black-Right-Pointing-Pointer p53 antagonizes the effect of Mdm2 activation of the ApoCIII promoter. Black-Right-Pointing-Pointer SHP strengthens p53 inhibition but abolishes Mdm2 activation of the ApoCIII promoter. Black-Right-Pointing-Pointer Mdm2 alters the enrichment of HNF4{alpha}, p53 and SHP to the ApoCIII promoter. -- Abstract: We examined the effect of Mdm2 on regulation of the ApoCIII promoter and its cross-talk with p53 and nuclear receptor SHP. Overexpression of Mdm2 markedly enhanced ApoCIII promoter activity by HNF4{alpha}. A direct association of Mdm2 protein with the HNF4{alpha} protein was observed by co-immunoprecipitation. Ectopic expression of p53 decreased HNF4{alpha} activation of the ApoCIII promoter and antagonized the effect of Mdm2. Co-expression of SHP further strengthened p53 inhibition and abolished Mdm2 activation of the ApoCIII promoter. Mdm2 inhibited p53-mediated enrichment of HNF4{alpha} to the ApoCIII promoter while simultaneously reducing p53 binding and increasing recruitment of SHP to the ApoCIII promoter. The results from this study implicate a potentially important function of Mdm2 in regulation of lipoprotein metabolism.
Mdm2 is a novel activator of ApoCIII promoter which is antagonized by p53 and SHP inhibition
International Nuclear Information System (INIS)
Yang, Zhihong; Zhang, Yuxia; Wang, Li
2012-01-01
Highlights: ► Mdm2 enhances HNF4α activation of the ApoCIII promoter via interaction with HNF4α. ► p53 antagonizes the effect of Mdm2 activation of the ApoCIII promoter. ► SHP strengthens p53 inhibition but abolishes Mdm2 activation of the ApoCIII promoter. ► Mdm2 alters the enrichment of HNF4α, p53 and SHP to the ApoCIII promoter. -- Abstract: We examined the effect of Mdm2 on regulation of the ApoCIII promoter and its cross-talk with p53 and nuclear receptor SHP. Overexpression of Mdm2 markedly enhanced ApoCIII promoter activity by HNF4α. A direct association of Mdm2 protein with the HNF4α protein was observed by co-immunoprecipitation. Ectopic expression of p53 decreased HNF4α activation of the ApoCIII promoter and antagonized the effect of Mdm2. Co-expression of SHP further strengthened p53 inhibition and abolished Mdm2 activation of the ApoCIII promoter. Mdm2 inhibited p53-mediated enrichment of HNF4α to the ApoCIII promoter while simultaneously reducing p53 binding and increasing recruitment of SHP to the ApoCIII promoter. The results from this study implicate a potentially important function of Mdm2 in regulation of lipoprotein metabolism.
MODEL2TALK : An Intervention to Promote Productive Classroom Talk
van der Veen, Chiel; van der Wilt, Femke; van Kruistum, Claudia; van Oers, Bert; Michaels, Sarah
2017-01-01
This article describes the MODEL2TALK intervention, which aims to promote young children's oral communicative competence through productive classroom talk. Productive classroom talk provides children in early childhood education with many opportunities to talk and think together. Results from a
Exploiting nucleotide composition to engineer promoters.
Directory of Open Access Journals (Sweden)
Manfred G Grabherr
Full Text Available The choice of promoter is a critical step in optimizing the efficiency and stability of recombinant protein production in mammalian cell lines. Artificial promoters that provide stable expression across cell lines and can be designed to the desired strength constitute an alternative to the use of viral promoters. Here, we show how the nucleotide characteristics of highly active human promoters can be modelled via the genome-wide frequency distribution of short motifs: by overlapping motifs that occur infrequently in the genome, we constructed contiguous sequence that is rich in GC and CpGs, both features of known promoters, but lacking homology to real promoters. We show that snippets from this sequence, at 100 base pairs or longer, drive gene expression in vitro in a number of mammalian cells, and are thus candidates for use in protein production. We further show that expression is driven by the general transcription factors TFIIB and TFIID, both being ubiquitously present across cell types, which results in less tissue- and species-specific regulation compared to the viral promoter SV40. We lastly found that the strength of a promoter can be tuned up and down by modulating the counts of GC and CpGs in localized regions. These results constitute a "proof-of-concept" for custom-designing promoters that are suitable for biotechnological and medical applications.
Energy Technology Data Exchange (ETDEWEB)
Fang, Zejun [Sanmen People' s Hospital of Zhejiang, Sanmen, Zhejiang, 317100 (China); Gong, Chaoju [Department of Pathology and Pathophysiology, Zhejiang University School of Medicine, Hangzhou, Zhejiang, 310058 (China); Liu, Hong [Zhejiang Normal University – Jinhua People' s Hospital Joint Center for Biomedical Research, Jinhua, Zhejiang, 321004 (China); Zhang, Xiaomin; Mei, Lingming [Sanmen People' s Hospital of Zhejiang, Sanmen, Zhejiang, 317100 (China); Song, Mintao [Department of Pathophysiology, Institute of Basic Medical Sciences, Chinese Academy of Medical Sciences (CAMS), School of Basic Medicine, Peking Union Medical College (PUMC), Beijing, 100005 (China); Qiu, Lanlan; Luo, Shuchai; Zhu, Zhihua; Zhang, Ronghui; Gu, Hongqian [Sanmen People' s Hospital of Zhejiang, Sanmen, Zhejiang, 317100 (China); Chen, Xiang, E-mail: sychenxiang@126.com [Sanmen People' s Hospital of Zhejiang, Sanmen, Zhejiang, 317100 (China)
2015-08-21
As the ribonucleotide reductase small subunit, the high expression of ribonucleotide reductase small subunit M2 (RRM2) induces cancer and contributes to tumor growth and invasion. In several colorectal cancer (CRC) cell lines, we found that the expression levels of RRM2 were closely related to the transcription factor E2F1. Mechanistic studies were conducted to determine the molecular basis. Ectopic overexpression of E2F1 promoted RRM2 transactivation while knockdown of E2F1 reduced the levels of RRM2 mRNA and protein. To further investigate the roles of RRM2 which was activated by E2F1 in CRC, CCK-8 assay and EdU incorporation assay were performed. Overexpression of E2F1 promoted cell proliferation in CRC cells, which was blocked by RRM2 knockdown attenuation. In the migration and invasion tests, overexpression of E2F1 enhanced the migration and invasion of CRC cells which was abrogated by silencing RRM2. Besides, overexpression of RRM2 reversed the effects of E2F1 knockdown partially in CRC cells. Examination of clinical CRC specimens demonstrated that both RRM2 and E2F1 were elevated in most cancer tissues compared to the paired normal tissues. Further analysis showed that the protein expression levels of E2F1 and RRM2 were parallel with each other and positively correlated with lymph node metastasis (LNM), TNM stage and distant metastasis. Consistently, the patients with low E2F1 and RRM2 levels have a better prognosis than those with high levels. Therefore, we suggest that E2F1 can promote CRC proliferation, migration, invasion and metastasis by regulating RRM2 transactivation. Understanding the role of E2F1 in activating RRM2 transcription will help to explain the relationship between E2F1 and RRM2 in CRC and provide a novel predictive marker for diagnosis and prognosis of the disease. - Highlights: • E2F1 promotes RRM2 transactivation in CRC cells. • E2F1 promotes the proliferation of CRC cells by activating RRM2. • E2F1 promotes the migration and
EFFECT OF ALTERNATIVE MULTINUTRIENT SOURCES ON SOIL CHEMICAL PROPERTIES
Directory of Open Access Journals (Sweden)
Vanessa Martins
2015-02-01
Full Text Available The current high price of potassium chloride and the dependence of Brazil on imported materials to supply the domestic demand call for studies evaluating the efficiency of alternative sources of nutrients. The aim of this work was to evaluate the effect of silicate rock powder and a manganese mining by-product, and secondary materials originated from these two materials, on soil chemical properties and on brachiaria production. This greenhouse experiment was conducted in pots with 5 kg of soil (Latossolo Vermelho-Amarelo distrófico - Oxisol. The alternative nutrient sources were: verdete, verdete treated with NH4OH, phonolite, ultramafic rock, mining waste and the proportion of 75 % of these K fertilizers and 25 % lime. Mixtures containing 25 % of lime were heated at 800 ºC for 1 h. These sources were applied at rates of 0, 150, 300, 450 and 600 kg ha-1 K2O, and incubated for 45 days. The mixtures of heated silicate rocks with lime promoted higher increases in soil pH in decreasing order: ultramafic rock>verdete>phonolite>mining waste. Applying the mining waste-lime mixture increased soil exchangeable K, and available P when ultramafic rock was incorporated. When ultramafic rock was applied, the release of Ca2+ increased significantly. Mining subproduct released the highest amount of Zn2+ and Mn2+ to the soil. The application of alternative sources of K, with variable chemical composition, altered the nutrient availability and soil chemical properties, improving mainly plant development and K plant uptake, and are important nutrient sources.
HNF1 alpha activates the aminopeptidase N promoter in intestinal (Caco-2) cells
DEFF Research Database (Denmark)
Olsen, Jørgen; Laustsen, Lotte; Troelsen, J
1994-01-01
The importance of HNF1 binding proteins for intestinal aminopeptidase N expression was investigated using the Caco-2 cell-line. Aminopeptidase N promoter activity in Caco-2 cells depends on the HNF1 element (positions -85 to -58) and co-transfection with an HNF1 alpha expression vector demonstrates...... a direct activation of the promoter by HNF1 alpha through this element. Electrophoretic mobility shift assays using nuclear extracts from Caco-2 cells show the presence of high amounts of HNF1 binding proteins irrespective of their state of differentiation....
Energy Technology Data Exchange (ETDEWEB)
Stan, Cornel [Berkeley Univ., CA (United States)]|[Paris Univ. (France)]|[Pisa Univ. (Italy)]|[Perugia Univ. (Italy)]|[Westsaechsischen Hochschule Zwickau (Germany)
2008-07-01
The implementation possibilities of future drive concepts - from hybrid systems comprising an electric motor and an internal combustion engine to fuel cells to alternative fuels like hydrogen or alcohol - will depend largely on quality criteria, e.g. power density, rotary momentum, acceleration characteristics, specific energy consumption, emissions of chemical substances, and noise. The boundary criteria for the introduction of realizeable concepts of alternative drives for motor cars will be defined by the availability and storability of the envisaged fuels, technical complexity, cost, safety, infrastructure and service. The book presents and analyzes the processes, drives and energy sources that can be combined in complex energy management systems for motor cars in accordance with the aforementioned criteria. Knowledge about these facts is indispensable for the development of new concepts. The 2nd edition describes many new developments in car propulsion systems as well as their combinations, new energy sources, energy converters and energy stores. All contents and literature reflect the latest state of science and technology. (orig.) [German] Ueber die Realisierungsmoeglichkeiten zukuenftiger Antriebskonzepte - von Hybridsystemen Elektro-/Verbrennungsmotor ueber Brennstoffzellen bis zu alternativen Energietraegern wie Wasserstoff oder Alkohol - werden fundierte Kriterien der Qualitaet eines Antriebs entscheiden. Leistungsdichte, Drehmomentverlauf, Beschleunigungscharakteristik, spezifischer Energieverbrauch sowie Emission chemischer Stoffe und Geraeusche sind dafuer wichtige Merkmale zur Qualitaetsbeurteilung. Die Verfuegbarkeit und die Speicherfaehigkeit vorgesehener Energietraeger, die technische Komplexitaet, Kosten, Sicherheit, Infrastruktur und Service werden die Randbedingungen fuer die Einfuehrung realisierbarer Konzepte alternativer Antriebe fuer Automobile stellen. Die Uebersicht und die Analyse der Prozesse, Antriebsmaschinen und Energietraeger, die
Zhu, Qi; Mangukiya, Hitesh Bhagavanbhai; Mashausi, Dhahiri Saidi; Guo, Hao; Negi, Hema; Merugu, Siva Bharath; Wu, Zhenghua; Li, Dawei
2017-09-01
Anterior gradient 2 (AGR2), a member of protein disulfide isomerase (PDI) family, is both located in cytoplasm and secreted into extracellular matrix. The orthologs of AGR2 have been linked to limb regeneration in newt and wound healing in zebrafish. In mammals, AGR2 influences multiple cell signaling pathways in tumor formation and in normal cell functions related to new tissue formation like angiogenesis. However, the function of AGR2 in mammalian wound healing remains unknown. This study aimed to investigate AGR2 expression and its function during skin wound healing and the possible application of external AGR2 in cutaneous wound to accelerate the healing process. Our results showed that AGR2 expression was induced in the migrating epidermal tongue and hyperplastic epidermis after skin excision. Topical application of recombinant AGR2 significantly accelerated wound-healing process by increasing the migration of keratinocytes (Kera.) and the recruitment of fibroblasts (Fibro.) near the wounded area. External AGR2 also promoted the migration of Kera. and Fibro. in vitro in a dose-dependent manner. The adhesion domain of AGR2 was required for the formation of focal adhesions in migrating Fibro., leading to the directional migration along AGR2 gradient. These results indicate that recombinant AGR2 accelerates skin wound healing through regulation of Kera. and Fibro. migration, thus demonstrating its potential utility as an alternative strategy of the therapeutics to accelerate the healing of acute or chronic skin wounds. © 2017 Federation of European Biochemical Societies.
Alternatives to the use of antibiotics as growth promoters for monogastric animals
Verstegen, M.W.A.; Williams, B.A.
2002-01-01
Recently, more and more is becoming known about the mode of action of antibiotics as growth promoters (AMGP), particularly in relation to the development of microbial resistance. Consequently, the use of these AMGP is already restricted or forbidden in many countries. Therefore, to compensate for
Alternative growth promoters alter broiler gut microbiome and enhance body weight gain
Antibiotic growth promoters (AGPs) have commonly been used to enhance growth in poultry production. However, there has been increasing concern over the impact of AGPs use in food production on acquisition of antibiotic resistance in zoonotic bacterial pathogens through inter-bacterial transfer of an...
SAV1 promotes Hippo kinase activation through antagonizing the PP2A phosphatase STRIPAK
Energy Technology Data Exchange (ETDEWEB)
Bae, Sung Jun [Department of Pharmacology, University of Texas Southwestern Medical Center, Dallas, United States; Ni, Lisheng [Department of Pharmacology, University of Texas Southwestern Medical Center, Dallas, United States; Osinski, Adam [Department of Pharmacology, University of Texas Southwestern Medical Center, Dallas, United States; Tomchick, Diana R. [Department of Biophysics, University of Texas Southwestern Medical Center, Dallas, United States; Brautigam, Chad A. [Department of Biophysics, University of Texas Southwestern Medical Center, Dallas, United States; Department of Microbiology, University of Texas Southwestern Medical Center, Dallas, United States; Luo, Xuelian [Department of Pharmacology, University of Texas Southwestern Medical Center, Dallas, United States; Department of Biophysics, University of Texas Southwestern Medical Center, Dallas, United States
2017-10-24
The Hippo pathway controls tissue growth and homeostasis through a central MST-LATS kinase cascade. The scaffold protein SAV1 promotes the activation of this kinase cascade, but the molecular mechanisms remain unknown. Here, we discover SAV1-mediated inhibition of the PP2A complex STRIPAKSLMAP as a key mechanism of MST1/2 activation. SLMAP binding to autophosphorylated MST2 linker recruits STRIPAK and promotes PP2A-mediated dephosphorylation of MST2 at the activation loop. Our structural and biochemical studies reveal that SAV1 and MST2 heterodimerize through their SARAH domains. Two SAV1–MST2 heterodimers further dimerize through SAV1 WW domains to form a heterotetramer, in which MST2 undergoes trans-autophosphorylation. SAV1 directly binds to STRIPAK and inhibits its phosphatase activity, protecting MST2 activation-loop phosphorylation. Genetic ablation of SLMAP in human cells leads to spontaneous activation of the Hippo pathway and alleviates the need for SAV1 in Hippo signaling. Thus, SAV1 promotes Hippo activation through counteracting the STRIPAKSLMAP PP2A phosphatase complex.
Promoting de-escalation of commitment: a regulatory-focus perspective on sunk costs.
Molden, Daniel C; Hui, Chin Ming
2011-01-01
People frequently escalate their commitment to failing endeavors. Explanations for such behavior typically involve loss aversion, failure to recognize other alternatives, and concerns with justifying prior actions; all of these factors produce recommitment to previous decisions with the goal of erasing losses and vindicating these decisions. Solutions to escalation of commitment have therefore focused on external oversight and divided responsibility during decision making to attenuate loss aversion, blindness to alternatives, and justification biases. However, these solutions require substantial resources and have additional adverse effects. The present studies tested an alternative method for de-escalating commitment: activating broad motivations for growth and advancement (promotion). This approach should reduce concerns with loss and increase perceptions of alternatives, thereby attenuating justification motives. In two studies featuring hypothetical financial decisions, activating promotion motivations reduced recommitment to poorly performing investments as compared with both not activating any additional motivations and activating motivations for safety and security (prevention).
Alternative Tobacco Product Use and Smoking Cessation: A National Study
Popova, Lucy
2013-01-01
Objectives. We investigated the frequency of alternative tobacco product use (loose leaf, moist snuff, snus, dissolvables, electronic cigarettes [e-cigarettes]) among smokers and the association with quit attempts and intentions. Methods. A nationally representative probability-based cross-sectional survey of 1836 current or recently former adult smokers was completed in November 2011. Multivariate logistic regressions evaluated associations between alternative tobacco product use and smoking cessation behaviors. Results. Of the smokers, 38% had tried an alternative tobacco product, most frequently e-cigarettes. Alternative tobacco product use was associated with having made a quit attempt, and those intending to quit were significantly more likely to have tried and to currently use the products than were smokers with no intentions to quit. Use was not associated with successful quit attempts. Interest in future use of alternative tobacco products was low, except for e-cigarettes. Conclusions. Alternative tobacco products are attractive to smokers who want to quit smoking, but these data did not indicate that alternative tobacco products promote cessation. Unsubstantiated overt and implied claims that alternative tobacco products aid smoking cessation should be prohibited. PMID:23488521
Alkali promotion of N-2 dissociation over Ru(0001)
DEFF Research Database (Denmark)
Mortensen, Jens Jørgen; Hammer, Bjørk; Nørskov, Jens Kehlet
1998-01-01
Using self-consistent density functional calculations, we show that adsorbed Na and Cs lower the barrier for dissociation of N2 on Ru(0001). Since N2 dissociation is a crucial step in the ammonia synthesis reaction, we explain in this way the experimental observation that alkali metals promote th...... the ammonia synthesis reaction over Ru catalysts. We also show that the origin of this effect is predominantly a direct electrostatic attraction between the adsorbed alkali atoms and the dissociating molecule....
Shifting Cultivation : Promoting Innovative Policy and Development ...
International Development Research Centre (IDRC) Digital Library (Canada)
Shifting Cultivation : Promoting Innovative Policy and Development Options in the Eastern Himalayas. Shifting ... pressure and market forces. The idea is to share good policies and practices related to shifting cultivation and alternative options through regional exchange. ... Les chaînes de valeur comme leviers stratégiques.
A growth hormone receptor SNP promotes lung cancer by impairment of SOCS2-mediated degradation
DEFF Research Database (Denmark)
Chhabra, Y.; Wong, H. Y.; Nikolajsen, Louise Fletcher
2018-01-01
Both humans and mice lacking functional growth hormone (GH) receptors are known to be resistant to cancer. Further, autocrine GH has been reported to act as a cancer promoter. Here we present the first example of a variant of the GH receptor (GHR) associated with cancer promotion, in this case lu......-mesenchymal transition and metastases (TWIST1, SNAI2, EGFR, MYC and CCND1) at 2 h after a GH pulse. This is consistent with prolonged GH signalling acting to promote cancer progression in lung cancer.Oncogene advance online publication, 2 October 2017; doi:10.1038/onc.2017.352....
Host-race formation: promoted by phenology, constrained by heritability.
Whipple, A V; Abrahamson, W G; Khamiss, M A; Heinrich, P L; Urian, A G; Northridge, E M
2009-04-01
Host-race formation is promoted by genetic trade-offs in the ability of herbivores to use alternate hosts, including trade-offs due to differential timing of host-plant availability. We examined the role of phenology in limiting host-plant use in the goldenrod gall fly (Eurosta solidaginis) by determining: (1) whether phenology limits alternate host use, leading to a trade-off that could cause divergent selection on Eurosta emergence time and (2) whether Eurosta has the genetic capacity to respond to such selection in the face of existing environmental variation. Experiments demonstrated that oviposition and gall induction on the alternate host, Solidago canadensis, were the highest on young plants, whereas the highest levels of gall induction on the normal host, Solidago gigantea, occurred on intermediate-age plants. These findings indicate a phenological trade-off for host-plant use that sets up the possibility of divergent selection on emergence time. Heritability, estimated by parent-offspring regression, indicated that host-race formation is impeded by the amount of genetic variation, relative to environmental, for emergence time.
Enhancing promotional strategies within social marketing programs: use of Web 2.0 social media.
Thackeray, Rosemary; Neiger, Brad L; Hanson, Carl L; McKenzie, James F
2008-10-01
The second generation of Internet-based applications (i.e., Web 2.0), in which users control communication, holds promise to significantly enhance promotional efforts within social marketing campaigns. Web 2.0 applications can directly engage consumers in the creative process by both producing and distributing information through collaborative writing, content sharing, social networking, social bookmarking, and syndication. Web 2.0 can also enhance the power of viral marketing by increasing the speed at which consumers share experiences and opinions with progressively larger audiences. Because of the novelty and potential effectiveness of Web 2.0, social marketers may be enticed to prematurely incorporate related applications into promotional plans. However, as strategic issues such as priority audience preferences, selection of appropriate applications, tracking and evaluation, and related costs are carefully considered, Web 2.0 will expand to allow health promotion practitioners more direct access to consumers with less dependency on traditional communication channels.
The role of ghrelin and ghrelin-receptor gene variants and promoter activity in type 2 diabetes.
Garcia, Edwin A; King, Peter; Sidhu, Kally; Ohgusu, Hideko; Walley, Andrew; Lecoeur, Cecile; Gueorguiev, Maria; Khalaf, Sahira; Davies, Derek; Grossman, Ashley B; Kojima, Masayasu; Petersenn, Stephan; Froguel, Phillipe; Korbonits, Márta
2009-08-01
Ghrelin and its receptor play an important role in glucose metabolism and energy homeostasis, and therefore they are functional candidates for genes carrying susceptibility alleles for type 2 diabetes. We assessed common genetic variation of the ghrelin (GHRL; five single nucleotide polymorphisms (SNP)) and the ghrelin-receptor (GHSR) genes (four SNPs) in 610 Caucasian patients with type 2 diabetes and 820 controls. In addition, promoter reporter assays were conducted to model the regulatory regions of both genes. Neither GHRL nor GHSR gene SNPs were associated with type 2 diabetes. One of the ghrelin haplotypes showed a marginal protective role in type 2 diabetes. We observed profound differences in the regulation of the GHRL gene according to promoter sequence variants. There are three different GHRL promoter haplotypes represented in the studied cohort causing up to 45% difference in the level of gene expression, while the promoter region of GHSR gene is primarily represented by a single haplotype. The GHRL and GHSR gene variants are not associated with type 2 diabetes, although GHRL promoter variants have significantly different activities.
CRE promoter sites modulate alternative splicing via p300-mediated histone acetylation
Czech Academy of Sciences Publication Activity Database
Dušková, E.; Hnilicová, Jarmila; Staněk, D.
2014-01-01
Roč. 11, č. 7 (2014), s. 1-10 ISSN 1547-6286 R&D Projects: GA ČR(CZ) GBP305/12/G034 Grant - others:Charles University Prague(CZ) 274111 Institutional support: RVO:61388971 Keywords : alternative splicing * fibronectin * p300 Subject RIV: EE - Microbiology, Virology Impact factor: 4.974, year: 2014
Bender, Melinda S; Martinez, Suzanna; Kennedy, Christine
2016-07-01
Rapid proliferation of smartphone ownership and use among Latinos offers a unique opportunity to employ innovative visually enhanced low-text (VELT) mobile health applications (mHealth app) to promote health behavior change for Latinos at risk for lifestyle-related diseases. Using focus groups and in-depth interviews with 16 promotores and 5 health care providers recruited from California clinics, this qualitative study explored perceptions of visuals for a VELT mHealth app promoting physical activity (PA) and limiting sedentary behavior (SB) for Latinos. In this Phase 1 study, participants endorsed visuals portraying PA guidelines and recommended visuals depicting family and socially oriented PA. Overall, participants supported a VELT mHealth app as an alternative to text-based education. Findings will inform the future Phase 2 study development of a culturally appropriate VELT mHealth app to promote PA for Latinos, improve health literacy, and provide an alternative to traditional clinic text-based health education materials. © The Author(s) 2015.
Intrinsically bent DNA in replication origins and gene promoters.
Gimenes, F; Takeda, K I; Fiorini, A; Gouveia, F S; Fernandez, M A
2008-06-24
Intrinsically bent DNA is an alternative conformation of the DNA molecule caused by the presence of dA/dT tracts, 2 to 6 bp long, in a helical turn phase DNA or with multiple intervals of 10 to 11 bp. Other than flexibility, intrinsic bending sites induce DNA curvature in particular chromosome regions such as replication origins and promoters. Intrinsically bent DNA sites are important in initiating DNA replication, and are sometimes found near to regions associated with the nuclear matrix. Many methods have been developed to localize bent sites, for example, circular permutation, computational analysis, and atomic force microscopy. This review discusses intrinsically bent DNA sites associated with replication origins and gene promoter regions in prokaryote and eukaryote cells. We also describe methods for identifying bent DNA sites for circular permutation and computational analysis.
Dynamic usage of transcription start sites within core promoters
DEFF Research Database (Denmark)
Kawaji, Hideya; Frith, Martin C; Katayama, Shintaro
2006-01-01
BACKGROUND: Mammalian promoters do not initiate transcription at single, well defined base pairs, but rather at multiple, alternative start sites spread across a region. We previously characterized the static structures of transcription start site usage within promoters at the base pair level......, based on large-scale sequencing of transcript 5' ends. RESULTS: In the present study we begin to explore the internal dynamics of mammalian promoters, and demonstrate that start site selection within many mouse core promoters varies among tissues. We also show that this dynamic usage of start sites...... is associated with CpG islands, broad and multimodal promoter structures, and imprinting. CONCLUSION: Our results reveal a new level of biologic complexity within promoters--fine-scale regulation of transcription starting events at the base pair level. These events are likely to be related to epigenetic...
Directory of Open Access Journals (Sweden)
Rafael Estrada-Avilés
Full Text Available Calsequestrin-2 (CASQ2 is the main Ca2+-binding protein inside the sarcoplasmic reticulum of cardiomyocytes. Previously, we demonstrated that MEF-2 and SRF binding sites within the human CASQ2 gene (hCASQ2 promoter region are functional in neonatal cardiomyocytes. In this work, we investigated if the calcineurin/NFAT pathway regulates hCASQ2 expression in neonatal cardiomyocytes. The inhibition of NFAT dephosphorylation with CsA or INCA-6, reduced both the luciferase activity of hCASQ2 promoter constructs (-3102/+176 bp and -288/+176 bp and the CASQ2 mRNA levels in neonatal rat cardiomyocytes. Additionally, NFATc1 and NFATc3 over-expressing neonatal cardiomyocytes showed a 2-3-fold increase in luciferase activity of both hCASQ2 promoter constructs, which was prevented by CsA treatment. Site-directed mutagenesis of the -133 bp MEF-2 binding site prevented trans-activation of hCASQ2 promoter constructs induced by NFAT overexpression. Chromatin Immunoprecipitation (ChIP assays revealed NFAT and MEF-2 enrichment within the -288 bp to +76 bp of the hCASQ2 gene promoter. Besides, a direct interaction between NFAT and MEF-2 proteins was demonstrated by protein co-immunoprecipitation experiments. Taken together, these data demonstrate that NFAT interacts with MEF-2 bound to the -133 bp binding site at the hCASQ2 gene promoter. In conclusion, in this work, we demonstrate that the Ca2+-calcineurin/NFAT pathway modulates the transcription of the hCASQ2 gene in neonatal cardiomyocytes.
Alternative Fuels Data Center: Workplace Charging Success: MetLife
future." Several others noted that their decision to purchase or lease a PEV was based on MetLife's : MetLife " By making PEV charging stations more readily available to employees, we can encourage more promote alternative transportation. By making PEV charging stations more readily available to employees
Role of CeO2 promoter in NiO/α-Al2O3 catalyst for dry reforming of methane
Loc, Luu Cam; Phuong, Phan Hong; Tri, Nguyen
2017-09-01
A series of Ni/α-Al2O3 (NiAl) catalysts promoted by CeO2 was prepared by co-impregnation methods with content of (NiO+CeO2) being in the range of 10-30 wt%. The NiO:CeO2 weight ratio was fluctuated at 1:1, 1:2 and 1:3. Several techniques, including X-ray powder diffraction (XRD), Hydrogen temperature-programmed reduction (H2-TPR), and transmission electron microscopy (TEM) were used to investigate catalysts' physico-chemical properties. The activity of these catalysts in dry reforming of CH4 was investigated at temperature range of 550-800 °C. The results revealed that the most suitable CeO2 promoted Ni catalyst contained 20 wt% of (NiO+CeO2) and NiO:CeO2 weight ratio of 1:2. The best catalytic performance of catalyst [20(1Ni2Ce)Al] due to a better reducibility resulted in a higher amount of free small particle NiO. At 700 °C and CH4:CO2 molar ratio of 1:1, the conversion of CH4 and CO2 on the most suitable CeO2 promoted Ni catalyst reached 86% and 67%, respectively; H2 and CO selectivity of 90% and H2:CO molar ratio of 1.15 were obtained. Being similar to MgO [1], promoter CeO2 could improve catalytic activity of Ni/α-Al2O3 catalyst at a lower range of temperature. Besides, both MgO and CeO2 had a great impact on improving coke resistance of Ni catalysts. At higher temperature, the role of CeO2 as well as MgO in preventing coke formation on catalyst was clarified by temperature-programmed oxidation (TPO) technique. Coke amount formed after 30-h TOS on 20(1Ni2Ce) catalyst was found to be 22.18 mgC/gcat, being less than on non-promoted catalyst (36.75 mgC/gcat), but more than on 20(1Ni2Mg)Al one (5.25 mgC/gcat).
Predictability of Joint Promotion Examinations in SS2 on Academic ...
African Journals Online (AJOL)
This research studied the predictability of joint SS2 promotion examinations of all the command secondary schools in Nigeria on academic performance of students in Senior School Certificate Examinations. The sample consists of 120 students selected at the Command Secondary School, Abakaliki and Command Day ...
DEFF Research Database (Denmark)
Sohoni, Sujata Vijay; Fazio, Alessandro; Workman, Christopher
2014-01-01
The objective of this study was the application of the synthetic promoter library (SPL) technology for modulation of actinorhodin production in Streptomyces coelicolor A3(2). The SPL technology was used to optimize the expression of a pathway specific positive transcriptional regulator Actll orf4...... constitutive promoter. ScoSPL20 demonstrated exceptional productivity despite having a comparatively weak expression from the promoter. Interestingly, the ScoSPL20 promoter was activated at a much earlier stage of growth compared to the wild type, demonstrating the advantage of fine-tuning and temporal tuning......, which activates the transcription of the S. coelicolor actinorhodin biosynthetic gene cluster. The native actll orf4 promoter was replaced with synthetic promoters, generating a S. coelicolor library with a broad range of expression levels of actll orf4. The resulting library was screened based...
Ground state properties of the bond alternating spin-1/2 anisotropic Heisenberg chain
Directory of Open Access Journals (Sweden)
S. Paul
2017-06-01
Full Text Available Ground state properties, dispersion relations and scaling behaviour of spin gap of a bond alternating spin-1/2 anisotropic Heisenberg chain have been studied where the exchange interactions on alternate bonds are ferromagnetic (FM and antiferromagnetic (AFM in two separate cases. The resulting models separately represent nearest neighbour (NN AFM-AFM and AFM-FM bond alternating chains. Ground state energy has been estimated analytically by using both bond operator and Jordan-Wigner representations and numerically by using exact diagonalization. Dispersion relations, spin gap and several ground state orders have been obtained. Dimer order and string orders are found to coexist in the ground state. Spin gap is found to develop as soon as the non-uniformity in alternating bond strength is introduced in the AFM-AFM chain which further remains non-zero for the AFM-FM chain. This spin gap along with the string orders attribute to the Haldane phase. The Haldane phase is found to exist in most of the anisotropic region similar to the isotropic point.
An alternative for antibiotic se in poultry: probiotics
Directory of Open Access Journals (Sweden)
FW Edens
2003-05-01
Full Text Available Over the past 50 years, there has been increasing amounts of antibiotics used prophylactically and as growth promoters. Today, there is a consumer and governmental outcry to eliminate that practice from poultry and livestock production. Evidence has been accumulated to show that there is a link between risk of zoonotic disease and growth promoting antibiotic usage in livestock and poultry. Therefore, alternatives to the use of growth promoting antibiotics must be found to promote growth or production at or near the genetic potential of the modern day broiler, turkey, and egg producer. The use of probiotics has many potential benefits and include modified host metabolism, immuno-stimulation, anti-inflammatory reactions, exclusion and killing of pathogens in the intestinal tract, reduced bacterial contamination on processed broiler carcasses, enhanced nutrient absorption and performance, and ultimately decreased human health risk. The development of these factors generally can be ascribed to the ability of most probiotic products to balance and maintain the intestinal microflora in poultry species.
Promotion of Nb2O5 on the wustite-based iron catalyst for ammonia synthesis
International Nuclear Information System (INIS)
Han, Wenfeng; Huang, Shiliang; Cheng, Tianhong; Tang, Haodong; Li, Ying; Liu, Huazhang
2015-01-01
Highlights: • Niobium enhances the reduction of wustite-based ammonia synthesis catalyst significantly. • Nb 2 O 5 inhibits the segregation or formation of solid solutions on the catalyst surface. • Nb 2 O 5 doping enhances the growth rates of [2 1 1] and [2 0 0] planes rather than their amounts. - Abstract: Niobium was selected and investigated as a potential promoter for wustite-based catalyst (WBC) for ammonia synthesis. Experiments on reduction performance, activity test and H 2 -TGA, in situ XRD as well as XPS were carried out to obtain the promotion effect and mechanism involved. Niobium as a promoter was confirmed to enhance the reduction of WBC significantly. This behavior is highly desired for industry in terms of catalyst regeneration and lesser pretreatment time for fabrication regardless the unimproved catalytic performance for Nb 2 O 5 -doped wustite-based catalyst (Nb-WBC). Possible reasons for these phenomena are discussed. It is suggested that Nb 2 O 5 is not favorable for the segregation or formation of solid solutions on the catalyst surface, which are difficult to be reduced. However, it seems that niobium does not promote the growth of [2 1 1] plane, which is active for ammonia synthesis.
Liu, Yuan; Chen, Zhijun; Cheng, Haixia; Chen, Juan; Qian, Jing
2017-01-03
Retinopathy of prematurity (ROP) is characterized by late-phase pathologic retinal vasoproliferation. Gremlin is a novel vascular endothelial growth factors (VEGF) receptor 2 (VEGFR2) agonist and promotes angiogenic response. We demonstrated that gremlin expression was significantly increased in retinas of ROP model mice, which was correlated with VEGF upregulation. In retinal pigmentation epithelial (RPE) cells, gremlin activated VEGFR2-Akt-mTORC2 (mammalian target of rapamycin complex 2) signaling, and promoted cell proliferation, migration and VEGF production. VEGFR inhibition (by SU5416) or shRNA knockdown almost abolished gremlin-mediated pleiotropic functions in RPE cells. Further, pharmacological inhibition of Akt-mTOR, or shRNA knockdown of key mTORC2 component (Rictor or Sin1) also attenuated gremlin-exerted activities in RPE cells. We conclude that gremlin promotes RPE cell proliferation, migration and VEGF production possibly via activating VEGFR2-Akt-mTORC2 signaling. Gremlin could be a novel therapeutic target of ROP or other retinal vasoproliferation diseases.
Finding theory- and evidence-based alternatives to fear appeals: Intervention Mapping
Kok, Gerjo; Bartholomew, L Kay; Parcel, Guy S; Gottlieb, Nell H; Fernández, María E
2013-01-01
Fear arousal—vividly showing people the negative health consequences of life-endangering behaviors—is popular as a method to raise awareness of risk behaviors and to change them into health-promoting behaviors. However, most data suggest that, under conditions of low efficacy, the resulting reaction will be defensive. Instead of applying fear appeals, health promoters should identify effective alternatives to fear arousal by carefully developing theory- and evidence-based programs. The Interv...
Energy Technology Data Exchange (ETDEWEB)
Waller, Zoë A.E., E-mail: z.waller@uea.ac.uk; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail: m.searcey@uea.ac.uk
2014-04-25
Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.
Acid-Sensing Ion Channel 2a (ASIC2a) Promotes Surface Trafficking of ASIC2b via Heteromeric Assembly
Kweon, Hae-Jin; Kim, Dong-Il; Bae, Yeonju; Park, Jae-Yong; Suh, Byung-Chang
2016-01-01
Acid-sensing ion channels (ASICs) are proton-activated cation channels that play important roles as typical proton sensors during pathophysiological conditions and normal synaptic activities. Among the ASIC subunits, ASIC2a and ASIC2b are alternative splicing products from the same gene, ACCN1. It has been shown that ASIC2 isoforms have differential subcellular distribution: ASIC2a targets the cell surface by itself, while ASIC2b resides in the ER. However, the underlying mechanism for this d...
Multi-protein delivery by nanodiamonds promotes bone formation.
Moore, L; Gatica, M; Kim, H; Osawa, E; Ho, D
2013-11-01
Bone morphogenetic proteins (BMPs) are well-studied regulators of cartilage and bone development that have been Food and Drug Administration (FDA)-approved for the promotion of bone formation in certain procedures. BMPs are seeing more use in oral and maxillofacial surgeries because of recent FDA approval of InFUSE(®) for sinus augmentation and localized alveolar ridge augmentation. However, the utility of BMPs in medical and dental applications is limited by the delivery method. Currently, BMPs are delivered to the surgical site by the implantation of bulky collagen sponges. Here we evaluate the potential of detonation nanodiamonds (NDs) as a delivery vehicle for BMP-2 and basic fibroblast growth factor (bFGF). Nanodiamonds are biocompatible, 4- to 5-nm carbon nanoparticles that have previously been used to deliver a wide variety of molecules, including proteins and peptides. We find that both BMP-2 and bFGF are readily loaded onto NDs by physisorption, forming a stable colloidal solution, and are triggered to release in slightly acidic conditions. Simultaneous delivery of BMP-2 and bFGF by ND induces differentiation and proliferation in osteoblast progenitor cells. Overall, we find that NDs provide an effective injectable alternative for the delivery of BMP-2 and bFGF to promote bone formation.
Promoting Social and Emotional Competencies among Young Children in Croatia with Preschool PATHS
Mihic, Josipa; Novak, Miranda; Basic, Josipa; Nix, Robert L.
2016-01-01
Preschool PATHS (Promoting Alternative Thinking Strategies) is an evidence-based universal prevention program focused on promoting children's social and emotional competencies and reducing the likelihood of behaviour problems and negative relationships with peers and teachers. This paper examines changes in the social and emotional competencies of…
Promoting Reflective Thinking Skills by Using Web 2.0 Application
Abdullah, Mohamed
2015-01-01
The study aims to investigate are using Web 2.0 applications promoting reflective thinking skills for higher education student in faculty for education. Although the literature reveals that technology integration is a trend in higher education and researchers and educators have increasingly shared their ideas and examples of implementations of Web…
Tamarkin-Ben-Harush, Ana; Vasseur, Jean-Jacques; Debart, Françoise; Ulitsky, Igor; Dikstein, Rivka
2017-02-08
Transcription start-site (TSS) selection and alternative promoter (AP) usage contribute to gene expression complexity but little is known about their impact on translation. Here we performed TSS mapping of the translatome following energy stress. Assessing the contribution of cap-proximal TSS nucleotides, we found dramatic effect on translation only upon stress. As eIF4E levels were reduced, we determined its binding to capped-RNAs with different initiating nucleotides and found the lowest affinity to 5'cytidine in correlation with the translational stress-response. In addition, the number of differentially translated APs was elevated following stress. These include novel glucose starvation-induced downstream transcripts for the translation regulators eIF4A and Pabp, which are also translationally-induced despite general translational inhibition. The resultant eIF4A protein is N-terminally truncated and acts as eIF4A inhibitor. The induced Pabp isoform has shorter 5'UTR removing an auto-inhibitory element. Our findings uncovered several levels of coordination of transcription and translation responses to energy stress.
Energy Technology Data Exchange (ETDEWEB)
1992-01-01
The major goal of this project is to determine how microorganisms regulate the assimilation of CO[sup 2] via pathways alternative to the usual Calvin reductive pentose phosphate scheme. In particular, we are interest in the molecular basis for switches in CO[sub 2] metabolic paths. Several earlier studies had indicated that purple nonsulfur photosynthetic bacteria assimilate significant amounts of CO[sub 2] via alternative non-Calvin routes. We have deleted the gene that encodes. RubisCo (ribulose bisphosphate carboxylase/oxygenase) in both the Rhodobacter sphaeroids and Rhodospirillum rubrum. The R. sphaeroides RubisCO deletion strain (strain 16) could not grow under photoheterotrophic conditions with malate as electron donor and CO[sub 2] as the electron acceptor; however the R. rub RubisCO deletion strain (strain I-19) could. Over the past year we have sought to physiologically characterize strain 16PHC. We found that, 16PHC exhibited rates of whole-cell CO[sub 2] fixation which were significantly higher than strain 16. Strain 16PHC could not grow photolithoautotrophically in a CO[sub 2] atmosphere; however, CO[sub 2] fixation catalyzed by photoheterotrophically grown 16PHC was repressed by the addition of DMSO. Likewise, we found that cells initially grown in the presence of DMSO could induce the CO[sub 2] fixation system when DMSO was removed. Thus, these results suggested that both PHC and I-19 could be used to study alternative CO[sub 2] fixation reactions and their significance in R. sphaexoides and R. rubrum.
Multicomponent Biginelli's synthesis of 3,4-dihydropyrimidin-2(1H-ones promoted by SnCl2.2H2O
Directory of Open Access Journals (Sweden)
Russowsky Dennis
2004-01-01
Full Text Available The ability of SnCl2.2H2O as catalyst to promote the Biginelli three-component condensation reaction from a diversity of aromatic aldehydes, ethyl acetoacetate and urea or thiourea is described. The reaction was carried out in acetonitrile or ethanol as solvents in neutral media and represents an improvement of the classical Biginelli protocol and an advantage in comparison with FeCl3.6H2O, NiCl2.6H2O and CoCl2.6H2O which were used with HCl as co-catalyst. The synthesis of 3,4-dihydropyrimidinones was achieved in good to excelent yields.
Alternative Conceptions: Turning Adversity into Advantage
Ferreira, Annalize; Lemmer, Miriam; Gunstone, Richard
2017-08-01
While a vast body of research has identified difficulties in students' understanding about forces and acceleration and their related alternative conceptions, far less research suggests ways to use students' alternative conceptions to enhance conceptual understanding of a specific fundamental concept. This study focused on distinguishing between students' conceptual understanding of the Newtonian concept of gravitational acceleration being the same for all objects and students' alternative conception that heavy objects fall faster. A multiple choice questionnaire was distributed to first year physics students for three consecutive years at a university in South Africa. The results indicate that changing the direction of motion and the physics quantity asked in paired questions revealed practically significant inconsistencies in students' reasoning and conceptions. This research contributes to the body of knowledge in proposing how the alternative conception of mass-related gravitational acceleration can be used in instruction to enhance conceptual understanding of the force-mass-acceleration relationship. Understanding of this relationship not only promotes conceptual understanding of the basic Newtonian concepts of the laws of motion which forms the critical foundation on which more advanced physics courses are built, but also contributes towards students' perception of physics as a set of coherent ideas applicable in all contexts.
2010-04-01
...) to alternative minimum tax foreign tax credit. 1.904(b)-2 Section 1.904(b)-2 Internal Revenue... alternative minimum tax foreign tax credit. (a) Application of section 904(b)(2)(B) adjustments. Section 904(b)(2)(B) shall apply for purposes of determining the alternative minimum tax foreign tax credit under...
Critical illness induces alternative activation of M2 macrophages in adipose tissue.
Langouche, Lies; Marques, Mirna B; Ingels, Catherine; Gunst, Jan; Derde, Sarah; Vander Perre, Sarah; D'Hoore, André; Van den Berghe, Greet
2011-01-01
We recently reported macrophage accumulation in adipose tissue of critically ill patients. Classically activated macrophage accumulation in adipose tissue is a known feature of obesity, where it is linked with increasing insulin resistance. However, the characteristics of adipose tissue macrophage accumulation in critical illness remain unknown. We studied macrophage markers with immunostaining and gene expression in visceral and subcutaneous adipose tissue from healthy control subjects (n = 20) and non-surviving prolonged critically ill patients (n = 61). For comparison, also subcutaneous in vivo adipose tissue biopsies were studied from 15 prolonged critically ill patients. Subcutaneous and visceral adipose tissue biopsies from non-surviving prolonged critically ill patients displayed a large increase in macrophage staining. This staining corresponded with elevated gene expression of "alternatively activated" M2 macrophage markers arginase-1, IL-10 and CD163 and low levels of the "classically activated" M1 macrophage markers tumor necrosis factor (TNF)-α and inducible nitric-oxide synthase (iNOS). Immunostaining for CD163 confirmed positive M2 macrophage staining in both visceral and subcutaneous adipose tissue biopsies from critically ill patients. Surprisingly, circulating levels and tissue gene expression of the alternative M2 activators IL-4 and IL-13 were low and not different from controls. In contrast, adipose tissue protein levels of peroxisome proliferator-activated receptor-γ (PPARγ), a nuclear receptor required for M2 differentiation and acting downstream of IL-4, was markedly elevated in illness. In subcutaneous abdominal adipose tissue biopsies from surviving critically ill patients, we could confirm positive macrophage staining with CD68 and CD163. We also could confirm elevated arginase-1 gene expression and elevated PPARγ protein levels. Unlike obesity, critical illness evokes adipose tissue accumulation of alternatively activated M2
FGF‐2 promotes osteocyte differentiation through increased E11/podoplanin expression
Ikpegbu, Ekele; Basta, Lena; Clements, Dylan N.; Fleming, Robert; Vincent, Tonia L.; Buttle, David J.; Pitsillides, Andrew A.; Farquharson, Colin
2018-01-01
E11/podoplanin is critical in the early stages of osteoblast‐to‐osteocyte transitions (osteocytogenesis), however, the upstream events which regulate E11 expression are unknown. The aim of this study was to examine the effects of FGF‐2 on E11‐mediated osteocytogenesis and to reveal the nature of the underlying signaling pathways regulating this process. Exposure of MC3T3 osteoblast‐like cells and murine primary osteoblasts to FGF‐2 (10 ng/ml) increased E11 mRNA and protein expression (p 70% reduction of basal E11 mRNA expression (p < 0.05) and effectively abrogated FGF‐2‐related changes in E11 expression and dendrite formation. FGF‐2 strongly activated the ERK signaling pathway in osteoblast‐like cells but inhibition of this pathway did not block the ability of FGF‐2 to enhance E11 expression or to promote acquisition of the osteocyte phenotype. The results of this study highlight a novel mechanism by which FGF‐2 can regulate osteoblast differentiation and osteocyte formation. Specifically, the data suggests that FGF‐2 promotes osteocytogenesis through increased E11 expression and further studies will identify if this regulatory pathway is essential for bone development and maintenance in health and disease. PMID:29215722
Direct inhibition of TNF-α promoter activity by Fanconi anemia protein FANCD2.
Directory of Open Access Journals (Sweden)
Nobuko Matsushita
Full Text Available Fanconi anemia (FA, an inherited disease, is associated with progressive bone marrow failure, predisposition to cancer, and genomic instability. Genes corresponding to 15 identified FA complementation groups have been cloned, and each gene product functions in the response to DNA damage induced by cross-linking agents and/or in protection against genome instability. Interestingly, overproduction of inflammatory cytokines such as tumor necrosis factor alpha (TNF-α and aberrant activation of NF-κB-dependent transcriptional activity have been observed in FA cells. Here we demonstrated that FANCD2 protein inhibits NF-κB activity in its monoubiquitination-dependent manner. Furthermore, we detected a specific association between FANCD2 and an NF-κB consensus element in the TNF-α promoter by electrophoretic mobility shift assays (EMSA and chromatin immunoprecipitation (ChIP assay. Therefore, we propose FANCD2 deficiency promotes transcriptional activity of the TNF-α promoter and induces overproduction of TNF-which then sustains prolonged inflammatory responses. These results also suggest that artificial modulation of TNFα production could be a promising therapeutic approach to FA.
saRNA-guided Ago2 targets the RITA complex to promoters to stimulate transcription.
Portnoy, Victoria; Lin, Szu Hua Sharon; Li, Kathy H; Burlingame, Alma; Hu, Zheng-Hui; Li, Hao; Li, Long-Cheng
2016-03-01
Small activating RNAs (saRNAs) targeting specific promoter regions are able to stimulate gene expression at the transcriptional level, a phenomenon known as RNA activation (RNAa). It is known that RNAa depends on Ago2 and is associated with epigenetic changes at the target promoters. However, the precise molecular mechanism of RNAa remains elusive. Using human CDKN1A (p21) as a model gene, we characterized the molecular nature of RNAa. We show that saRNAs guide Ago2 to and associate with target promoters. saRNA-loaded Ago2 facilitates the assembly of an RNA-induced transcriptional activation (RITA) complex, which, in addition to saRNA-Ago2 complex, includes RHA and CTR9, the latter being a component of the PAF1 complex. RITA interacts with RNA polymerase II to stimulate transcription initiation and productive elongation, accompanied by monoubiquitination of histone 2B. Our results establish the existence of a cellular RNA-guided genome-targeting and transcriptional activation mechanism and provide important new mechanistic insights into the RNAa process.
Directory of Open Access Journals (Sweden)
Deepti Jain
Full Text Available Plants respond to different forms of stresses by inducing transcription of a common and distinct set of genes by concerted actions of a cascade of transcription regulators. We previously reported that a gene, CaZF encoding a C2H2-zinc finger family protein from chickpea (Cicer arietinum imparted high salinity tolerance when expressed in tobacco plants. We report here that in addition to promoting tolerance against dehydration, salinity and high temperature, the CaZF overexpressing plants exhibited similar phenotype of growth and development like the plants overexpressing CAP2, encoding an AP2-family transcription factor from chickpea. To investigate any relationship between these two genes, we performed gene expression analysis in the overexpressing plants, promoter-reporter analysis and chromatin immunoprecipitation. A number of transcripts that exhibited enhanced accumulation upon expression of CAP2 or CaZF in tobacco plants were found common. Transient expression of CAP2 in chickpea leaves resulted in increased accumulation of CaZF transcript. Gel mobility shift and transient promoter-reporter assays suggested that CAP2 activates CaZF promoter by interacting with C-repeat elements (CRTs in CaZF promoter. Chromatin immunoprecipitation (ChIP assay demonstrated an in vivo interaction of CAP2 protein with CaZF promoter.
Species-Specific Expression of Full-Length and Alternatively Spliced Variant Forms of CDK5RAP2.
Directory of Open Access Journals (Sweden)
John S Y Park
Full Text Available CDK5RAP2 is one of the primary microcephaly genes that are associated with reduced brain size and mental retardation. We have previously shown that human CDK5RAP2 exists as a full-length form (hCDK5RAP2 or an alternatively spliced variant form (hCDK5RAP2-V1 that is lacking exon 32. The equivalent of hCDK5RAP2-V1 has been reported in rat and mouse but the presence of full-length equivalent hCDK5RAP2 in rat and mouse has not been examined. Here, we demonstrate that rat expresses both a full length and an alternatively spliced variant form of CDK5RAP2 that are equivalent to our previously reported hCDK5RAP2 and hCDK5RAP2-V1, repectively. However, mouse expresses only one form of CDK5RAP2 that is equivalent to the human and rat alternatively spliced variant forms. Knowledge of this expression of different forms of CDK5RAP2 in human, rat and mouse is essential in selecting the appropriate model for studies of CDK5RAP2 and primary microcephaly but our findings further indicate the evolutionary divergence of mouse from the human and rat species.
Epithelial-derived IL-33 promotes intestinal tumorigenesis in Apc Min/+ mice.
He, Zhengxiang; Chen, Lili; Souto, Fabricio O; Canasto-Chibuque, Claudia; Bongers, Gerold; Deshpande, Madhura; Harpaz, Noam; Ko, Huaibin M; Kelley, Kevin; Furtado, Glaucia C; Lira, Sergio A
2017-07-14
Increased expression of Interleukin (IL)-33 has been detected in intestinal samples of patients with ulcerative colitis, a condition associated with increased risk for colon cancer, but its role in the development of colorectal cancer has yet to be fully examined. Here, we investigated the role of epithelial expressed IL-33 during development of intestinal tumors. IL-33 expression was detected in epithelial cells in colorectal cancer specimens and in the Apc Min/+ mice. To better understand the role of epithelial-derived IL-33 in the intestinal tumorigenesis, we generated transgenic mice expressing IL-33 in intestinal epithelial cells (V33 mice). V33 Apc Min/+ mice, resulting from the cross of V33 with Apc Min/+ mice, had increased intestinal tumor burden compared with littermate Apc Min/+ mice. Consistently, Apc Min/+ mice deficient for IL-33 receptor (ST2), had reduced polyp burden. Mechanistically, overexpression of IL-33 promoted expansion of ST2 + regulatory T cells, increased Th2 cytokine milieu, and induced alternatively activated macrophages in the gut. IL-33 promoted marked changes in the expression of antimicrobial peptides, and antibiotic treatment of V33 Apc Min/+ mice abrogated the tumor promoting-effects of IL-33 in the colon. In conclusion, elevated IL-33 signaling increases tumor development in the Apc Min/+ mice.
The European Resource Centre for Alternatives in Higher Education.
de Boo, Jasmijn; Dewhurst, David; van der Valk, Jan
2004-06-01
The European Resource Centre for Alternatives in Higher Education (EURCA: http://www.eurca.org) is an exciting new project, which aims to enable teachers using animals in teaching to be more creative and innovative in their approach to teaching and learning, to foster high-quality training for science students, and to significantly reduce the number of animals used, often unnecessarily, in teaching. This will be achieved by: a) establishing a resource centre--a collection of mainly electronic alternatives, and taking this to relevant scientific meetings in Europe, where it would function as a drop-in advice centre for teachers; b) creating a network of academic teachers who actively use alternatives, to take responsibility for disseminating information about alternatives to other teachers in the European Union, to participate in the activity outlined above, and to share experiences and good practice; c) setting up an Internet website with an expansive, information-rich database (peer-reviews, demos, peer-evaluations, peer-recommendations, links to users, etc.) on selected "tried and tested" alternatives; and d) encouraging and promoting the findings of evaluative studies on the effectiveness of alternatives in higher education teaching and learning.
Impact of Ni promotion on the hydrogenation pathways of phenanthrene on MoS 2 /γ-Al 2 O 3
Energy Technology Data Exchange (ETDEWEB)
Schachtl, Eva; Yoo, Jong Suk; Gutiérrez, Oliver Y.; Studt, Felix; Lercher, Johannes A.
2017-08-01
The reaction network and elementary steps of the hydrogenation of phenanthrene are explored on parent and Ni-promoted MoS2/c-Al2O3. Two pathways were identified, i.e., Path 1: Phenanthrene _ 9,10-dihydrophenanthrene (DiHPhe)?1,2,3,4,4a,9,10,10a-octahydro-phenanthrene (asymOHPhe), and Path 2: Phenanthrene ?1,2,3,4-tetrahydrophenanthrene (TetHPhe)?1,2,3,4,5,6,7,8-octahydrophenan threne. The steps TetHPhe?asymOHPhe (hydrogenation), and DiHPhe?TetHPhe (hydrogenationisomerization) become notable at phenanthrene conversions above 20%. The reaction preferentially proceeds via Path 1 (90% selectivity) on MoS2/Al2O3. Ni promotion (Ni/(Ni + Mo) molar ratio of 0.3 at the edges on MoS2) increases the hydrogenation activity per active edge twofold and leads to 50% selectivity to both pathways. The reaction orders in H2 vary from _0.8 on MoS2/Al2O3 to _1.2 on Ni-MoS2/Al2O3, whereas the reaction orders in phenanthrene (_0.6) hardly depend on Ni promotion. The reaction orders in H2S are zero on MoS2/Al2O3 and slightly negative on Ni-MoS2/Al2O3. DFT calculations indicate that phenanthrene is preferentially adsorbed parallel to the basal planes, while H is located at the edges perpendicular to the basal planes. Theory also suggests that Ni atoms, incorporated preferentially on the S-edges, increase the stability of hydrogenated intermediates. Hydrogenation of phenanthrene proceeds through quasi-equilibrated adsorption of the reactants followed by consecutive addition of hydrogen pairs to the adsorbed hydrocarbon. The rate determining steps for the formation of DiHPhe and TetHPhe are the addition of the first and second hydrogen pair, respectively. The concentration of SH groups (activated H at the edges) increases with Ni promotion linearly correlating the rates of Path 1 and Path 2, albeit with different functions. The enhancing effect of Ni on Path 2 is attributed to accelerated hydrogen addition to adsorbed hydrocarbons without important changes in their coverages.
International Nuclear Information System (INIS)
Jiang Jianjun; Liu Yongjun; Tang Fei; Yang Cuihong
2011-01-01
We investigated the properties of the spin-1/2 ferromagnetic-antiferromagnetic-antiferromagnetic alternating Heisenberg chain using the spin-wave theory. The spin-wave excitation spectra, the sublattice magnetizations and the local bond energies of the model are calculated to be compared with the corresponding properties of the mixed spin (1, 1/2) chain for a range of α. The results demonstrate that all the properties show similar behaviours in the small α limit, so the properties of the mixed spin (1, 1/2) chain can be described using the spin-1/2 ferromagnetic-antiferromagnetic-antiferromagnetic alternating Heisenberg chain. -- Research Highlights: →The spin-wave excitation spectra, the sublattice magnetizations and the local bond energies of the spin-1/2 ferromagnetic-antiferromagnetic-antiferromagnetic alternating Heisenberg chain are calculated. →In the small α limit, the properties of the mixed spin (1,1/2) chain can be described using the spin-1/2 ferromagnetic-antiferromagnetic-antiferromagnetic alternating Heisenberg chain. →The spin-1/2 ferromagnetic-antiferromagnetic-antiferromagnetic alternating Heisenberg chain may be of interest for some real quasi-one-dimensional molecular magnetic materials.
Synthetic promoter libraries for Corynebacterium glutamicum
DEFF Research Database (Denmark)
Rytter, Jakob Vang; Helmark, Søren; Chen, Jun
2014-01-01
The ability to modulate gene expression is an important genetic tool in systems biology and biotechnology. Here, we demonstrate that a previously published easy and fast PCR-based method for modulating gene expression in lactic acid bacteria is also applicable to Corynebacterium glutamicum. We co...... promoter library (SPL) technology is convenient for modulating gene expression in C. glutamicum and should have many future applications, within basic research as well as for optimizing industrial production organisms....... constructed constitutive promoter libraries based on various combinations of a previously reported C. glutamicum -10 consensus sequence (gngnTA(c/t)aaTgg) and the Escherichia coli -35 consensus, either with or without an AT-rich region upstream. A promoter library based on consensus sequences frequently found...... in low-GC Gram-positive microorganisms was also included. The strongest promoters were found in the library with a -35 region and a C. glutamicum -10 consensus, and this library also represents the largest activity span. Using the alternative -10 consensus TATAAT, which can be found in many other...
P2Y2 Receptor and EGFR Cooperate to Promote Prostate Cancer Cell Invasion via ERK1/2 Pathway.
Li, Wei-Hua; Qiu, Ying; Zhang, Hong-Quan; Tian, Xin-Xia; Fang, Wei-Gang
2015-01-01
As one member of G protein-coupled P2Y receptors, P2Y2 receptor can be equally activated by extracellular ATP and UTP. Our previous studies have proved that activation of P2Y2 receptor by extracellular ATP could promote prostate cancer cell invasion and metastasis in vitro and in vivo via regulating the expressions of some epithelial-mesenchymal transition/invasion-related genes (including IL-8, E-cadherin, Snail and Claudin-1), and the most significant change in expression of IL-8 was observed after P2Y2 receptor activation. However, the signaling pathway downstream of P2Y2 receptor and the role of IL-8 in P2Y2-mediated prostate cancer cell invasion remain unclear. Here, we found that extracellular ATP/UTP induced activation of EGFR and ERK1/2. After knockdown of P2Y2 receptor, the ATP -stimulated phosphorylation of EGFR and ERK1/2 was significantly suppressed. Further experiments showed that inactivation of EGFR and ERK1/2 attenuated ATP-induced invasion and migration, and suppressed ATP-mediated IL-8 production. In addition, knockdown of IL-8 inhibited ATP-mediated invasion and migration of prostate cancer cells. These findings suggest that P2Y2 receptor and EGFR cooperate to upregulate IL-8 production via ERK1/2 pathway, thereby promoting prostate cancer cell invasion and migration. Thus blocking of the P2Y2-EGFR-ERK1/2 pathway may provide effective therapeutic interventions for prostate cancer.
Schang, Laura K; Czabanowska, Katarzyna M; Lin, Vivian
2012-06-01
Worldwide, countries face the challenge of securing funds for health promotion. To address this issue, some governments have established health promotion foundations, which are statutory bodies with long-term and recurrent public resources. This article draws on experiences from Austria, Australia, Germany, Hungary and Switzerland to illustrate four lessons learned from the foundation model to secure funding for health promotion. These lessons are concerned with: (i) the broad spectrum of potential revenue sources for health promotion foundations within national contexts; (ii) legislative anchoring of foundation revenues as a base for financial sustainability; (iii) co-financing as a means to increase funds and shared commitment for health promotion; (iv) complementarity of foundations to existing funding. Synthesizing the lessons, we discuss health promotion foundations in relation to wider concerns for investment in health based on the values of sustainability, solidarity and stewardship. We recommend policy-makers and researchers take notice of health promotion foundations as an alternative model for securing funds for health promotion, and appreciate their potential for integrating inter-sectoral revenue collection and inter-sectoral funding strategies. However, health promotion foundations are not a magic bullet. They also pose challenges to coordination and public sector stewardship. Therefore, health promotion foundations will need to act in concert with other governance instruments as part of a wider societal agenda for investment in health.
Finding theory- and evidence-based alternatives to fear appeals: Intervention Mapping
Kok, Gerjo; Bartholomew, L Kay; Parcel, Guy S; Gottlieb, Nell H; Fernández, María E
2014-01-01
Fear arousal—vividly showing people the negative health consequences of life-endangering behaviors—is popular as a method to raise awareness of risk behaviors and to change them into health-promoting behaviors. However, most data suggest that, under conditions of low efficacy, the resulting reaction will be defensive. Instead of applying fear appeals, health promoters should identify effective alternatives to fear arousal by carefully developing theory- and evidence-based programs. The Intervention Mapping (IM) protocol helps program planners to optimize chances for effectiveness. IM describes the intervention development process in six steps: (1) assessing the problem and community capacities, (2) specifying program objectives, (3) selecting theory-based intervention methods and practical applications, (4) designing and organizing the program, (5) planning, adoption, and implementation, and (6) developing an evaluation plan. Authors who used IM indicated that it helped in bringing the development of interventions to a higher level. PMID:24811880
Solubility and viscosity for CO_2 capture process using MEA promoted DEAE aqueous solution
International Nuclear Information System (INIS)
Fu, Dong; Wang, LeMeng; Zhang, Pan; Mi, ChenLu
2016-01-01
Highlights: • Solubility of CO_2 in MEA promoted DEAE aqueous solution was measured. • Mass fraction and temperature dependences of solubility were illustrated. • Viscosities of carbonated MEA–DEAE solutions were measured and calculated. • Temperature, mass fraction and CO_2 loading dependences of viscosity were illustrated. - Abstract: The saturated solubility of CO_2 in monoethanolamine (MEA) promoted 2-diethylaminoethanol (DEAE) aqueous solution was investigated at temperatures ranging from (303.2 to 323.2) K. The mass fraction and temperature dependences of the saturated solubility and CO_2 loading are illustrated. The viscosities of both CO_2-unloaded and CO_2-loaded DEAE–MEA aqueous solutions were measured and then calculated by using the Weiland equation. The effects of temperature, mass fraction and CO_2 loading on viscosities are demonstrated.
Antitumorigenic potential of STAT3 alternative splicing modulation.
Zammarchi, Francesca; de Stanchina, Elisa; Bournazou, Eirini; Supakorndej, Teerawit; Martires, Kathryn; Riedel, Elyn; Corben, Adriana D; Bromberg, Jacqueline F; Cartegni, Luca
2011-10-25
Signal transducer and activator of transcription 3 (STAT3) plays a central role in the activation of multiple oncogenic pathways. Splicing variant STAT3β uses an alternative acceptor site within exon 23 that leads to a truncated isoform lacking the C-terminal transactivation domain. Depending on the context, STAT3β can act as a dominant-negative regulator of transcription and promote apoptosis. We show that modified antisense oligonucleotides targeted to a splicing enhancer that regulates STAT3 exon 23 alternative splicing specifically promote a shift of expression from STAT3α to STAT3β. Induction of endogenous STAT3β leads to apoptosis and cell-cycle arrest in cell lines with persistent STAT3 tyrosine phosphorylation compared with total STAT3 knockdown obtained by forced splicing-dependent nonsense-mediated decay (FSD-NMD). Comparison of the molecular effects of splicing redirection to STAT3 knockdown reveals a unique STAT3β signature, with a down-regulation of specific targets (including lens epithelium-derived growth factor, p300/CBP-associated factor, CyclinC, peroxisomal biogenesis factor 1, and STAT1β) distinct from canonical STAT3 targets typically associated with total STAT3 knockdown. Furthermore, similar in vivo redirection of STAT3 alternative splicing leads to tumor regression in a xenograft cancer model, demonstrating how pharmacological manipulation of a single key splicing event can manifest powerful antitumorigenic properties and validating endogenous splicing reprogramming as an effective cancer therapeutic approach.
Insulin Promoter Factor 1 variation is associated with type 2 diabetes in African Americans
Directory of Open Access Journals (Sweden)
Wang Xiaoqin
2005-10-01
Full Text Available Abstract Background Defective insulin secretion is a key defect in the pathogenesis of type 2 diabetes (T2DM. The β-cell specific transcription factor, insulin promoter factor 1 gene (IPF1, is essential to pancreatic development and the maintenance of β-cell mass. We hypothesized that regulatory or coding variants in IPF1 contribute to defective insulin secretion and thus T2DM. Methods We screened 71 Caucasian and 69 African American individuals for genetic variants in the promoter region, three highly conserved upstream regulatory sequences (PH1, PH2 and PH3, the human β-cell specific enhancer, and the two exons with adjacent introns. We tested for an association of each variant with T2DM Caucasians (192 cases and 192 controls and African Americans (341 cases and 186 controls. Results We identified 8 variants in the two populations, including a 3 bp insertion in exon 2 (InsCCG243 in African Americans that resulted in an in-frame proline insertion in the transactivation domain. No variant was associated with T2DM in Caucasians, but polymorphisms at -3766 in the human β-cell enhancer, at -2877 bp in the PH1 domain, and at -108 bp in the promoter region were associated with T2DM in African American subjects (p Conculsion The common alleles of regulatory variants in the 5' enhancer and promoter regions of the IPF1 gene increase susceptibility to type 2 diabetes among African American individuals, likely as a result of gene-gene or gene-environment interactions. In contrast, IPF1 is not a cause of type 2 diabetes in Caucasians. A previously described InsCCG243 variant may contribute to diabetes susceptibility in African American individuals, but is of low penetrance.
Ets2 in tumor fibroblasts promotes angiogenesis in breast cancer.
Directory of Open Access Journals (Sweden)
Julie A Wallace
Full Text Available Tumor fibroblasts are active partners in tumor progression, but the genes and pathways that mediate this collaboration are ill-defined. Previous work demonstrates that Ets2 function in stromal cells significantly contributes to breast tumor progression. Conditional mouse models were used to study the function of Ets2 in both mammary stromal fibroblasts and epithelial cells. Conditional inactivation of Ets2 in stromal fibroblasts in PyMT and ErbB2 driven tumors significantly reduced tumor growth, however deletion of Ets2 in epithelial cells in the PyMT model had no significant effect. Analysis of gene expression in fibroblasts revealed a tumor- and Ets2-dependent gene signature that was enriched in genes important for ECM remodeling, cell migration, and angiogenesis in both PyMT and ErbB2 driven-tumors. Consistent with these results, PyMT and ErbB2 tumors lacking Ets2 in fibroblasts had fewer functional blood vessels, and Ets2 in fibroblasts elicited changes in gene expression in tumor endothelial cells consistent with this phenotype. An in vivo angiogenesis assay revealed the ability of Ets2 in fibroblasts to promote blood vessel formation in the absence of tumor cells. Importantly, the Ets2-dependent gene expression signatures from both mouse models were able to distinguish human breast tumor stroma from normal stroma, and correlated with patient outcomes in two whole tumor breast cancer data sets. The data reveals a key function for Ets2 in tumor fibroblasts in signaling to endothelial cells to promote tumor angiogenesis. The results highlight the collaborative networks that orchestrate communication between stromal cells and tumor cells, and suggest that targeting tumor fibroblasts may be an effective strategy for developing novel anti-angiogenic therapies.
Hawaii alternative fuels utilization program. Phase 3, final report
Energy Technology Data Exchange (ETDEWEB)
Kinoshita, C.M.; Staackmann, M.
1996-08-01
The Hawaii Alternative Fuels Utilization Program originated as a five-year grant awarded by the US Department of Energy (USDOE) to the Hawaii Natural Energy Institute (HNEI) of the University of Hawaii at Manoa. The overall program included research and demonstration efforts aimed at encouraging and sustaining the use of alternative (i.e., substitutes for gasoline and diesel) ground transportation fuels in Hawaii. Originally, research aimed at overcoming technical impediments to the widespread adoption of alternative fuels was an important facet of this program. Demonstration activities centered on the use of methanol-based fuels in alternative fuel vehicles (AFVs). In the present phase, operations were expanded to include flexible fuel vehicles (FFVs) which can operate on M85 or regular unleaded gasoline or any combination of these two fuels. Additional demonstration work was accomplished in attempting to involve other elements of Hawaii in the promotion and use of alcohol fuels for ground transportation in Hawaii.
Electrochemical study on the cationic promotion of the catalytic SO2 oxidation in pyrosulfate melts
DEFF Research Database (Denmark)
Petrushina, Irina; Bjerrum, Niels; Cappeln, Frederik Vilhelm
1998-01-01
The electrochemical behavior of the molten V2O5-M2S2O7 (M = K, Cs, or Na) system was studied using a gold working electrode at 440 degrees C in argon and air atmosphere. The aim of the present investigation was to find a possible correlation between the promoting effect of Cs+ and Na+ ions...... on the catalytic oxidation of SO2 in the V2O5-M2S2O7 system and the effect of these alkali cations on the electrochemical behavior of V2O5 in the alkali pyrosulfate melts It has been shown that Na+ ions had a promoting effect on the V(V) reversible arrow V(IV) electrochemical reaction. Sodium ions accelerate both...... in the catalytic SO, oxidation most likely is the oxidation of V(IV) to V(V) and the Na+ and Cs+ promoting effect is based on the acceleration of this stage. It has also been proposed that voltammetric measurements can be used for fast optimization of the composition of the vanadium catalyst (which...
Botanical alternatives to antibiotics for use in organic poultry production.
Diaz-Sanchez, Sandra; D'Souza, Doris; Biswas, Debrabrata; Hanning, Irene
2015-06-01
The development of antibiotic resistant pathogens has resulted from the use of sub-therapeutic concentrations of antibiotics delivered in poultry feed. Furthermore, there are a number of consumer concerns regarding the use of antibiotics in food animals including residue contamination of poultry products and antibiotic resistant bacterial pathogens. These issues have resulted in recommendations to reduce the use of antibiotics as growth promoters in livestock in the United States. Unlike conventional production, organic systems are not permitted to use antibiotics. Thus, both conventional and organic poultry production need alternative methods to improve growth and performance of poultry. Herbs, spices, and various other plant extracts are being evaluated as alternatives to antibiotics and some do have growth promoting effects, antimicrobial properties, and other health-related benefits. This review aims to provide an overview of herbs, spices, and plant extracts, currently defined as phytobiotics as potential feed additives. © 2015 Poultry Science Association Inc.
Alternative Energy Development and China's Energy Future
Energy Technology Data Exchange (ETDEWEB)
Zheng, Nina; Fridley, David
2011-06-15
In addition to promoting energy efficiency, China has actively pursued alternative energy development as a strategy to reduce its energy demand and carbon emissions. One area of particular focus has been to raise the share of alternative energy in China’s rapidly growing electricity generation with a 2020 target of 15% share of total primary energy. Over the last ten years, China has established several major renewable energy regulations along with programs and subsidies to encourage the growth of non-fossil alternative energy including solar, wind, nuclear, hydro, geothermal and biomass power as well as biofuels and coal alternatives. This study thus seeks to examine China’s alternative energy in terms of what has and will continue to drive alternative energy development in China as well as analyze in depth the growth potential and challenges facing each specific technology. This study found that despite recent policies enabling extraordinary capacity and investment growth, alternative energy technologies face constraints and barriers to growth. For relatively new technologies that have not achieved commercialization such as concentrated solar thermal, geothermal and biomass power, China faces technological limitations to expanding the scale of installed capacity. While some alternative technologies such as hydropower and coal alternatives have been slowed by uneven and often changing market and policy support, others such as wind and solar PV have encountered physical and institutional barriers to grid integration. Lastly, all alternative energy technologies face constraints in human resources and raw material resources including land and water, with some facing supply limitations in critical elements such as uranium for nuclear, neodymium for wind and rare earth metals for advanced solar PV. In light of China’s potential for and barriers to growth, the resource and energy requirement for alternative energy technologies were modeled and scenario analysis
Haam, Keeok; Kim, Hee-Jin; Lee, Kyung-Tae; Kim, Jeong-Hwan; Kim, Mirang; Kim, Seon-Young; Noh, Seung-Moo; Song, Kyu-Sang; Kim, Yong Sung
2014-09-01
BTB and CNC homology 2 (BACH2) is a lymphoid-specific transcription factor with a prominent role in B-cell development. Genetic polymorphisms within a single locus encoding BACH2 are associated with various autoimmune diseases and allergies. In this study, restriction landmark genomic scanning revealed methylation at a NotI site in a CpG island covering the BACH2 promoter in gastric cancer cell lines and primary gastric tumors. Increased methylation of the BACH2 promoter was observed in 52% (43/83) of primary gastric tumors, and BACH2 hypermethylation was significantly associated with decreased gene expression. Treatment with 5-aza-2'-deoxycytidine and/or trichostatin. A restored BACH2 expression in BACH2-silenced gastric cancer cell lines, and knockdown of BACH2 using short hairpin RNA (i.e. RNA interference) increased cell proliferation in gastric cancer cells. Clinicopathologic data showed that decreased BACH2 expression occurred significantly more frequently in intestinal-type (27/44, 61%) compared with diffuse-type (13/50, 26%) gastric cancers (P<0.001). Furthermore, BACH2 promoter methylation paralleled that of previously identified targets, such as LRRC3B, LIMS2, PRKD1 and POPDC3, in a given set of gastric tumors. We propose that concerted methylation in many promoters plays a role in accelerating gastric tumor formation and that methylated promoter loci may be targets for therapeutic treatment, such as the recently introduced technique of epigenetic editing. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.
Turkey in Search of Relevant Foreign Policy Strategy (2002-2016
Directory of Open Access Journals (Sweden)
Urmanov Dayan R.
2016-06-01
Full Text Available The main idea of this article is to describe the process of Turkish foreign policy evolvement during the rule of Justice and Development party (JDP. From weak economy and unstable political situation in 2001, JDP quickly formulated a new strategy of foreign policy and stabilized economy. In the article the Turkish foreign policy in the 21st century is divided into several stages which respond to different international threats and circumstances. The first stage was a peacekeeping stage when Turkey tried to stabilize the situation near its borders and implement peace initiatives for the purpose to find new markets and allies. As a result, Turkey formulated a new strategy of foreign policy, called “Zero Problems Policy” which aimed to create a ring of friendly countries on the borders. On the second stage, Turkish foreign policy was more active – Turkey tried to balance among regional power centers and confront with one of the most powerful actors – Israel. Confrontation with Tel Aviv was a preface to the third stage, and today under the influence of “Arab Spring” and desire to change its role in international relations, Turkey refused “Zero Problems Policy” strategy and turned to a new aggressive and revanchist idea – neo- Ottomanism. Ankara tries to build a new regional set of rules where Turkey will play a leading role.
Diverse alternative back-splicing and alternative splicing landscape of circular RNAs
Zhang, Xiao-Ou; Dong, Rui; Zhang, Yang; Zhang, Jia-Lin; Luo, Zheng; Zhang, Jun; Chen, Ling-Ling; Yang, Li
2016-01-01
Circular RNAs (circRNAs) derived from back-spliced exons have been widely identified as being co-expressed with their linear counterparts. A single gene locus can produce multiple circRNAs through alternative back-splice site selection and/or alternative splice site selection; however, a detailed map of alternative back-splicing/splicing in circRNAs is lacking. Here, with the upgraded CIRCexplorer2 pipeline, we systematically annotated different types of alternative back-splicing and alternative splicing events in circRNAs from various cell lines. Compared with their linear cognate RNAs, circRNAs exhibited distinct patterns of alternative back-splicing and alternative splicing. Alternative back-splice site selection was correlated with the competition of putative RNA pairs across introns that bracket alternative back-splice sites. In addition, all four basic types of alternative splicing that have been identified in the (linear) mRNA process were found within circRNAs, and many exons were predominantly spliced in circRNAs. Unexpectedly, thousands of previously unannotated exons were detected in circRNAs from the examined cell lines. Although these novel exons had similar splice site strength, they were much less conserved than known exons in sequences. Finally, both alternative back-splicing and circRNA-predominant alternative splicing were highly diverse among the examined cell lines. All of the identified alternative back-splicing and alternative splicing in circRNAs are available in the CIRCpedia database (http://www.picb.ac.cn/rnomics/circpedia). Collectively, the annotation of alternative back-splicing and alternative splicing in circRNAs provides a valuable resource for depicting the complexity of circRNA biogenesis and for studying the potential functions of circRNAs in different cells. PMID:27365365
Excitations and possible bound states in the S = 1/2 alternating chain compound (VO)2P2O7
International Nuclear Information System (INIS)
Tennant, D.A.; Nagler, S.E.; Sales, B.C.
1997-01-01
Magnetic excitations in an array of (VO) 2 P 2 O 7 single crystals have been measured using inelastic neutron scattering. Until now, (VO) 2 P 2 O 7 has been thought of as a two-leg antiferromagnetic Heisenberg spin ladder with chains running in the a-direction. The present results show unequivocally that (VO) 2 P 2 O 7 is best described as an alternating spin-chain directed along the crystallographic b-direction. In addition to the expected magnon with magnetic zone-center energy gap Δ = 3.1 meV, a second excitation is observed at an energy just below 2Δ. The higher mode may be a triplet two-magnon bound state. Numerical results in support of bound modes are presented
Sox2 promotes survival of satellite glial cells in vitro
International Nuclear Information System (INIS)
Koike, Taro; Wakabayashi, Taketoshi; Mori, Tetsuji; Hirahara, Yukie; Yamada, Hisao
2015-01-01
Sox2 is a transcriptional factor expressed in neural stem cells. It is known that Sox2 regulates cell differentiation, proliferation and survival of the neural stem cells. Our previous study showed that Sox2 is expressed in all satellite glial cells of the adult rat dorsal root ganglion. In this study, to examine the role of Sox2 in satellite glial cells, we establish a satellite glial cell-enriched culture system. Our culture method succeeded in harvesting satellite glial cells with the somata of neurons in the dorsal root ganglion. Using this culture system, Sox2 was downregulated by siRNA against Sox2. The knockdown of Sox2 downregulated ErbB2 and ErbB3 mRNA at 2 and 4 days after siRNA treatment. MAPK phosphorylation, downstream of ErbB, was also inhibited by Sox2 knockdown. Because ErbB2 and ErbB3 are receptors that support the survival of glial cells in the peripheral nervous system, apoptotic cells were also counted. TUNEL-positive cells increased at 5 days after siRNA treatment. These results suggest that Sox2 promotes satellite glial cell survival through the MAPK pathway via ErbB receptors. - Highlights: • We established satellite glial cell culture system. • Function of Sox2 in satellite glial cell was examined using siRNA. • Sox2 knockdown downregulated expression level of ErbB2 and ErbB3 mRNA. • Sox2 knockdown increased apoptotic satellite glial cell. • Sox2 promotes satellite glial cell survival through ErbB signaling
Sox2 promotes survival of satellite glial cells in vitro
Energy Technology Data Exchange (ETDEWEB)
Koike, Taro, E-mail: koiket@hirakata.kmu.ac.jp; Wakabayashi, Taketoshi; Mori, Tetsuji; Hirahara, Yukie; Yamada, Hisao
2015-08-14
Sox2 is a transcriptional factor expressed in neural stem cells. It is known that Sox2 regulates cell differentiation, proliferation and survival of the neural stem cells. Our previous study showed that Sox2 is expressed in all satellite glial cells of the adult rat dorsal root ganglion. In this study, to examine the role of Sox2 in satellite glial cells, we establish a satellite glial cell-enriched culture system. Our culture method succeeded in harvesting satellite glial cells with the somata of neurons in the dorsal root ganglion. Using this culture system, Sox2 was downregulated by siRNA against Sox2. The knockdown of Sox2 downregulated ErbB2 and ErbB3 mRNA at 2 and 4 days after siRNA treatment. MAPK phosphorylation, downstream of ErbB, was also inhibited by Sox2 knockdown. Because ErbB2 and ErbB3 are receptors that support the survival of glial cells in the peripheral nervous system, apoptotic cells were also counted. TUNEL-positive cells increased at 5 days after siRNA treatment. These results suggest that Sox2 promotes satellite glial cell survival through the MAPK pathway via ErbB receptors. - Highlights: • We established satellite glial cell culture system. • Function of Sox2 in satellite glial cell was examined using siRNA. • Sox2 knockdown downregulated expression level of ErbB2 and ErbB3 mRNA. • Sox2 knockdown increased apoptotic satellite glial cell. • Sox2 promotes satellite glial cell survival through ErbB signaling.
FGF-2 promotes osteocyte differentiation through increased E11/podoplanin expression.
Ikpegbu, Ekele; Basta, Lena; Clements, Dylan N; Fleming, Robert; Vincent, Tonia L; Buttle, David J; Pitsillides, Andrew A; Staines, Katherine A; Farquharson, Colin
2018-07-01
E11/podoplanin is critical in the early stages of osteoblast-to-osteocyte transitions (osteocytogenesis), however, the upstream events which regulate E11 expression are unknown. The aim of this study was to examine the effects of FGF-2 on E11-mediated osteocytogenesis and to reveal the nature of the underlying signaling pathways regulating this process. Exposure of MC3T3 osteoblast-like cells and murine primary osteoblasts to FGF-2 (10 ng/ml) increased E11 mRNA and protein expression (p 70% reduction of basal E11 mRNA expression (p < 0.05) and effectively abrogated FGF-2-related changes in E11 expression and dendrite formation. FGF-2 strongly activated the ERK signaling pathway in osteoblast-like cells but inhibition of this pathway did not block the ability of FGF-2 to enhance E11 expression or to promote acquisition of the osteocyte phenotype. The results of this study highlight a novel mechanism by which FGF-2 can regulate osteoblast differentiation and osteocyte formation. Specifically, the data suggests that FGF-2 promotes osteocytogenesis through increased E11 expression and further studies will identify if this regulatory pathway is essential for bone development and maintenance in health and disease. © 2017 The Authors. Journal of Cellular Physiology Published by Wiley Periodicals, Inc.
Copper nanoparticles as an alternative feed additives in poultry diet
DEFF Research Database (Denmark)
Scott, A.; Vadalasetty, K. P.; Chwalibog, A.
2018-01-01
of the crucial health and environmental concerns. In recent years, many studies have reported copper nanoparticles (Cu-NP) as a promising alternative to antibacterial reagents and a growth promoter. Depending on the size, shape, dose and animal species, Cu-NP exhibit a variety of effects on animal performance...
Xie, Fei; Zhang, Ge; Pan, Jianwei
2018-02-01
Thin cases and long treating time are shortcomings of conventional duplex treatment of aluminizing followed by nitriding (DTAN). Alternating current field (ACF) enhanced DTAN was carried out on AISI 1045 steel by applying an ACF to treated samples and treating agents with a pair of electrodes for overcoming those shortcomings. By investigating cases' structures, phases, composition and hardness distributions of differently treated samples, preliminary studies were made on characterizations of the ACF enhanced duplex treatment to AISI 1045 steel. The results show that, with the help of the ACF, the surface Al-rich phase Al5Fe2 formed in conventional pack aluminizing can be easily avoided and the aluminizing process is dramatically promoted. The aluminizing case can be nitrided either with conventional pack nitriding or ACF enhanced pack nitriding. By applying ACF to pack nitriding, the diffusion of nitrogen into the aluminizing case is promoted. AlN, Fe2∼3N and solid solution of N in iron are efficiently formed as a result of reactions of N with the aluminizing case. A duplex treated case with an effective thickness of more than 170 μm can be obtained by the alternating current field enhanced 4 h pack aluminizing plus 4 h pack nitriding.
Energy Technology Data Exchange (ETDEWEB)
Ficker, C.
2000-09-08
This issue of Alternative Fuel News discusses Executive Order 13149 which is designed to not only increase the use of alternative fuel by federal agencies but also to increase the use of fuel efficient vehicles in the federal fleet. Also highlighted is the 6th National Clean Cities Conference and Expo held in San Diego, May 7-10, 2000, which attracted nearly 1,000 people for three action-packed days of alternative fuel activities. The work to develop a market for alternative fuels is more important than ever.
International Nuclear Information System (INIS)
Iliopoulos, Constantine; Rozakis, Stelios
2010-01-01
Following European Directive 2003/30/EC, the Greek Government adapted legislation that introduces and regulates the bio diesel market. The implemented quota scheme allocates the country's annual, predetermined, tax exempt production of bio diesel to industries based on their ability to meet several criteria. A number of bio diesel supply chain stakeholders have criticized this policy for being efficiency-robbing and vague. This paper uses 2007 data from energy crop farms and three bio diesel-producing companies in order to assess these criticisms. We study the economic and environmental aspects of the currently adopted policy and compare them to three alternative scenarios. We conclude that such criticisms have a merit and that policy makers need to reconsider their alternative options regarding the promotion of bio diesel in transport. Permission of sales directly to local consumers and promotion of forward integration by farmers are efficiency enhancing and environment-friendly means of promoting the use of bio diesel in transport.
Mesoporous TiO2 : an alternative material for PEM fuel cells catalyst support
Energy Technology Data Exchange (ETDEWEB)
Do, T.B. [Michigan Univ., Ann Arbor, MI (United States). Dept. of Materials Science; Ruthkosky, M.; Cai, M. [General Motors, Warren, MI (United States). Research and Development Center
2008-07-01
This paper discussed the feasibility of using an alternative catalyst support material to replace carbon in proton exchange membrane (PEM) fuel cells. The alternative catalyst support material requires a high surface area with a large porosity but must have comparable conductivity with carbon. A mesoporous titanium oxide (TiO2) material produced by coprecipitation was introduced. The conductivity of the material is about one order of that of carbon. The 8 mole per cent Nb-doped TiO2 was formed and deposited on the surface of a nano polystyrene (PS) template via the hydrolysis of a co-solution of Ti(OC4H9)4 and Nb(OC2H5)5. The removal of PS by heat treatment produced porous structure of TiO2 with the appearance of 3 different pore types, notably open pore, ink-pot pores and closed pores. TiO2 formed from the rutile phase, allowing a lower activation temperature at 850 degrees C in a hydrogen atmosphere. The pore structures were retained after this heat treatment. The BET surface area was 116 m{sup 2}/g, porosity was 22 per cent and the average pore size was 159 angstrom. The conductivity improved considerably from almost non-conductive to one order of that of carbon.
Alternative Pathways to Legitimacy: Promotional Practices in the Ontario For-Profit College Sector
Pizarro Milian, Roger; Quirke, Linda
2017-01-01
This study empirically examines how for-profit career colleges in Ontario, Canada market themselves to prospective students. It uses a mixed-methods approach to review the content of 489 online promotional profiles representing 375 unique for-profit colleges. It finds that for-profit colleges adopt several distinct marketing strategies, including…
Directory of Open Access Journals (Sweden)
Ho-Chang Kuo
2015-01-01
Full Text Available Kawasaki disease (KD is characterized by pediatric systemic vasculitis of an unknown cause. The low affinity immunoglobulin gamma Fc region receptor II-a (FCGR2A gene was reported to be involved in the susceptibility of KD. DNA methylation is one of the epigenetic mechanisms that control gene expression; thus, we hypothesized that methylation status of CpG islands in FCGR2A promoter associates with the susceptibility and therapeutic outcomes of Kawasaki disease. In this study, 36 KD patients and 24 healthy subjects from out-patient clinic were recruited. Eleven potential methylation sites within the targeted promoter region of FCGR2A were selected for investigation. We marked the eleven methylation sites from A to K. Our results indicated that methylation at the CpG sites G, H, and J associated with the risk of KD. CpG sites B, C, E, F, H, J, and K were found to associate with the outcomes of IVIG treatment. In addition, CpG sites G, J, and K were predicted as transcription factors binding sites for NF-kB, Myc-Max, and SP2, respectively. Our study reported a significant association among the promoter methylation of FCGR2A, susceptibility of KD, and the therapeutic outcomes of IVIG treatment. The methylation levels of CpG sites of FCGR2A gene promoter should be an important marker for optimizing IVIG therapy.
E1A-dependent trans-activation of the human MYC promoter is mediated by the E2F factor
International Nuclear Information System (INIS)
Hiebert, S.W.; Lipp, M.; Nevins, J.R.
1989-01-01
E2F is a cellular transcription factor that binds to two sites in the adenovirus E2 promoter. Previous experiments have implicated E2F in the E1A-dependent transactivation of the E2 gene since levels of active E2F increase markedly during adenovirus infection in parallel with the increase in E2 transcription, and an E2F binding site can confer E1A inducibility to a heterologous promoter. Here the authors show that E2F binds to two sequence elements within the P2 promoter of the human MYC gene which are within a region that is critical for promoter activity. The MYC promoter can be trans-activated in an E1A-dependent manner and site-directed mutagenesis demonstrates that these E2F elements are essential for trans-activation. Finally, they also find that adenovirus infection of quiescent cells results in a stimulation of the endogenous MYC gene. They conclude that the activation of the E2F factor, which is likely responsible for the activation of viral E2 transcription, is also responsible for the E1A-dependent induction of MYC transcription
Phase-alternated composite π/2 pulses for solid state quadrupole echo NMR spectroscopy
International Nuclear Information System (INIS)
Ramamoorthy, A.; Narasimhan, P.T.
1991-01-01
Phase-alternated composite π/2 pulses have been constructed for spin I=1 to overcome quadrupole interaction effects in solid state nuclear magnetic resonance(NMR) spectroscopy. Magnus expansion approach is used to design these sequences in a manner similar to the NMR coherent averaging theory. It is inferred that the symmetric phase-alternated composite π/2 pulses reported here are quite successful in producing quadrupole echo free phase distortions. This effectiveness of the present composite pulses is due to the fact that most of them are of shorter durations as compared to the ones reported in literature. In this theoretical procedure, irreducible spherical tensor operator formalism is employed to simplify the complexity involved in the evaluation of Magnus expansion terms. It has been argued in this paper that composite π/2 pulse sequences for this purpose can also be derived from the broadband inversion π pulses which are designed to compensate electric field gradient(efg) inhomogeniety in spin I=1 nuclear quadrupole resonance(NQR) spectroscopy. (author). 28 refs
Promoting lifestyle changes for Chinese Australians with Type 2 diabetes
SUET TING CHOI
2017-01-01
Providing translated diabetes education from English to Chinese is not enough to promote healthy lifestyle changes among Chinese Australians with type 2 diabetes. This thesis explored the behaviour patterns of Chinese patients during diabetes education and identified the most successful education approaches. The research involved a review of literature and an exploratory qualitative study across three countries. The findings suggest health professionals working with Chinese Australian patient...
Global warming impacts of CFC alternative technologies: Combining fluorocarbon and CO2 effects
International Nuclear Information System (INIS)
Fairchild, P.D.; Fischer, S.K.; Hughes, P.J.
1992-01-01
Chlorofluorocarbons (CFCs) are on their way out, due to their role in stratospheric ozone depletion and the related international Montreal Protocol agreement and various national phaseout timetables. As the research, engineering development, and manufacturing investment decisions have ensued to prepare for this transition away from CFCs, the climate change issue has emerged and there has recently been increased attention on the direct global warming potential (GWP) of the fluorocarbon alternatives as greenhouse gases. However, there has been less focus on the indirect global warming effect arising from end-use energy changes and associated CO 2 emissions. A study was undertaken to address these combined global warming effects. A concept of Total Equivalent Warming Impact (TEWI) was developed for combining the direct and indirect effects and was used for evaluating CFC-replacement options available in the required CFC transition time frame. Analyses of industry technology surveys indicate that CFC-user industries have made substantial progress toward near-equal energy efficiency with many HCFC/HFC alternatives. The findings also bring into question the relative importance of the direct effect in many applications and stress energy efficiency when searching for suitable CFC alternatives. For chillers, household refrigerators, and unitary air-conditioning or heat pump equipment, changes in efficiency of only 2--5% would have a greater effect on future TEWI than completely eliminating the direct effect
Pai, Chen-Chun; Kishkevich, Anastasiya; Deegan, Rachel S; Keszthelyi, Andrea; Folkes, Lisa; Kearsey, Stephen E; De León, Nagore; Soriano, Ignacio; de Bruin, Robertus Antonius Maria; Carr, Antony M; Humphrey, Timothy C
2017-09-12
Chromatin modification through histone H3 lysine 36 methylation by the SETD2 tumor suppressor plays a key role in maintaining genome stability. Here, we describe a role for Set2-dependent H3K36 methylation in facilitating DNA replication and the transcriptional responses to both replication stress and DNA damage through promoting MluI cell-cycle box (MCB) binding factor (MBF)-complex-dependent transcription in fission yeast. Set2 loss leads to reduced MBF-dependent ribonucleotide reductase (RNR) expression, reduced deoxyribonucleoside triphosphate (dNTP) synthesis, altered replication origin firing, and a checkpoint-dependent S-phase delay. Accordingly, prolonged S phase in the absence of Set2 is suppressed by increasing dNTP synthesis. Furthermore, H3K36 is di- and tri-methylated at these MBF gene promoters, and Set2 loss leads to reduced MBF binding and transcription in response to genotoxic stress. Together, these findings provide new insights into how H3K36 methylation facilitates DNA replication and promotes genotoxic stress responses in fission yeast. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Chen-Chun Pai
2017-09-01
Full Text Available Chromatin modification through histone H3 lysine 36 methylation by the SETD2 tumor suppressor plays a key role in maintaining genome stability. Here, we describe a role for Set2-dependent H3K36 methylation in facilitating DNA replication and the transcriptional responses to both replication stress and DNA damage through promoting MluI cell-cycle box (MCB binding factor (MBF-complex-dependent transcription in fission yeast. Set2 loss leads to reduced MBF-dependent ribonucleotide reductase (RNR expression, reduced deoxyribonucleoside triphosphate (dNTP synthesis, altered replication origin firing, and a checkpoint-dependent S-phase delay. Accordingly, prolonged S phase in the absence of Set2 is suppressed by increasing dNTP synthesis. Furthermore, H3K36 is di- and tri-methylated at these MBF gene promoters, and Set2 loss leads to reduced MBF binding and transcription in response to genotoxic stress. Together, these findings provide new insights into how H3K36 methylation facilitates DNA replication and promotes genotoxic stress responses in fission yeast.
Wolff, Dennis W; Xie, Yan; Deng, Caishu; Gatalica, Zoran; Yang, Mingjie; Wang, Bo; Wang, Jincheng; Lin, Ming-Fong; Abel, Peter W; Tu, Yaping
2012-04-01
G-protein-coupled receptor (GPCR)-stimulated androgen-independent activation of androgen receptor (AR) contributes to acquisition of a hormone-refractory phenotype by prostate cancer. We previously reported that regulator of G-protein signaling (RGS) 2, an inhibitor of GPCRs, inhibits androgen-independent AR activation (Cao et al., Oncogene 2006;25:3719-34). Here, we show reduced RGS2 protein expression in human prostate cancer specimens compared to adjacent normal or hyperplastic tissue. Methylation-specific PCR analysis and bisulfite sequencing indicated that methylation of the CpG island in the RGS2 gene promoter correlated with RGS2 downregulation in prostate cancer. In vitro methylation of this promoter suppressed reporter gene expression in transient transfection studies, whereas reversal of this promoter methylation with 5-aza-2'-deoxycytidine (5-Aza-dC) induced RGS2 reexpression in androgen-independent prostate cancer cells and inhibited their growth under androgen-deficient conditions. Interestingly, the inhibitory effect of 5-Aza-dC was significantly reduced by an RGS2-targeted short hairpin RNA, indicating that reexpressed RGS2 contributed to this growth inhibition. Restoration of RGS2 levels by ectopic expression in androgen-independent prostate cancer cells suppressed growth of xenografts in castrated mice. Thus, RGS2 promoter hypermethylation represses its expression and unmasks a latent pathway for AR transactivation in prostate cancer cells. Targeting this reversible process may provide a new strategy for suppressing prostate cancer progression by reestablishing its androgen sensitivity. Copyright © 2011 UICC.
41 CFR 102-79.110 - What Integrated Workplace policy must Federal agencies strive to promote?
2010-07-01
... capital costs over a substantial time period; and (i) Support alternative workplace arrangements... Workplace policy must Federal agencies strive to promote? 102-79.110 Section 102-79.110 Public Contracts and... Integrated Workplace § 102-79.110 What Integrated Workplace policy must Federal agencies strive to promote...
PTP1B inhibitor promotes endothelial cell motility by activating the DOCK180/Rac1 pathway.
Wang, Yuan; Yan, Feng; Ye, Qing; Wu, Xiao; Jiang, Fan
2016-04-07
Promoting endothelial cell (EC) migration is important not only for therapeutic angiogenesis, but also for accelerating re-endothelialization after vessel injury. Several recent studies have shown that inhibition of protein tyrosine phosphatase 1B (PTP1B) may promote EC migration and angiogenesis by enhancing the vascular endothelial growth factor receptor-2 (VEGFR2) signalling. In the present study, we demonstrated that PTP1B inhibitor could promote EC adhesion, spreading and migration, which were abolished by the inhibitor of Rac1 but not RhoA GTPase. PTP1B inhibitor significantly increased phosphorylation of p130Cas, and the interactions among p130Cas, Crk and DOCK180; whereas the phosphorylation levels of focal adhesion kinase, Src, paxillin, or Vav2 were unchanged. Gene silencing of DOCK180, but not Vav2, abrogated the effects of PTP1B inhibitor on EC motility. The effects of PTP1B inhibitor on EC motility and p130Cas/DOCK180 activation persisted in the presence of the VEGFR2 antagonist. In conclusion, we suggest that stimulation of the DOCK180 pathway represents an alternative mechanism of PTP1B inhibitor-stimulated EC motility, which does not require concomitant VEGFR2 activation as a prerequisite. Therefore, PTP1B inhibitor may be a useful therapeutic strategy for promoting EC migration in cardiovascular patients in which the VEGF/VEGFR functions are compromised.
Providing Training Enhances the Biomechanical Improvements of an Alternative Computer Mouse Design
Houwink, A.; Oude Hengel, K.M.; Odell, D.; Dennerlein, J.T.
2009-01-01
Objective: The purpose of this study is to determine if an alternative mouse promotes more neutral postures and decreases forearm muscle activity and if training enhances these biomechanical benefits. Background: Computer mouse use is a risk factor for developing musculoskeletal disorders;
Promoting Exit from Violent Extremism
DEFF Research Database (Denmark)
Dalgaard-Nielsen, Anja
2013-01-01
A number of Western countries are currently adding exit programs targeting militant Islamists to their counterterrorism efforts. Drawing on research into voluntary exit from violent extremism, this article identifies themes and issues that seem to cause doubt, leading to exit. It then provides a ...... the influence attempt as subtle as possible, use narratives and self-affirmatory strategies to reduce resistance to persuasion, and consider the possibility to promote attitudinal change via behavioral change as an alternative to seek to influence beliefs directly....
How Bureaucracy Promotes Inclusive Organizing
DEFF Research Database (Denmark)
Holck, Lotte
Diversity literature in general and Feminist in particular have long promoted alternatives to bureaucracy on the premise that this form of governance is far from gender- and race-neutral, and that inclusive organizing necessitate a flatter, decentralized and more ‘organic’ set-up (Ferguson 1984...... and opportunities conducive to their inclusion. Guided by Ashcraft (2001) concept of organized dissonance, this paper explores how the combination of apparent incongruent elements of stability/flexibility and formality/informality might offer a passage for inclusive organizing....
Park, Hae Jeong; Lee, Soojung; Ju, Eunji; Jones, Jayre A; Choi, Inyeong
2017-03-01
Genome-wide association studies have identified the single nucleotide polymorphism (SNP) rs3278 in the human SLC4A7 gene as one of the marker loci for addiction vulnerability. This marker is located in an intron of the gene, and its genomic role has been unknown. In this study, we examined rs3278 and three adjacent SNPs prevalent in alcoholics for their effects on an alternative promoter that would lead to the production of the NH 2 -terminally truncated protein NBCn1ΔN450, missing the first 450 amino acids. Analysis of the transcription start site database and a promoter prediction algorithm identified a cluster of three promoters in intron 7 and two short CpG-rich sites in intron 6. The promoter closest to rs3278 showed strong transcription activity in luciferase reporter gene assays. Major-to-minor allele substitution at rs3278 resulted in increased transcription activity. Equivalent substitutions at adjacent rs3772723 (intron 7) and rs13077400 (exon 8) had negligible effect; however, the substitution at nonsynonymous rs3755652 (exon 8) increased the activity by more than twofold. The concomitant substitution at rs3278/rs3755652 produced an additive effect. The rs3755652 had more profound effects on the promoter than the upstream regulatory CpG sites. The amino acid change E326K caused by rs3755652 had negligible effect on transporter function. In HEK 293 cells, NBCn1ΔN450 was expressed in plasma membranes, but at significantly lower levels than the nontruncated NBCn1-E. The pH change mediated by NBCn1ΔN450 was also low. We conclude that rs3278 and rs3755652 stimulate an alternative transcription of the SLC4A7 gene, increasing the production of a defective transporter. Copyright © 2017 the American Physiological Society.
SEASTAR: systematic evaluation of alternative transcription start sites in RNA.
Qin, Zhiyi; Stoilov, Peter; Zhang, Xuegong; Xing, Yi
2018-05-04
Alternative first exons diversify the transcriptomes of eukaryotes by producing variants of the 5' Untranslated Regions (5'UTRs) and N-terminal coding sequences. Accurate transcriptome-wide detection of alternative first exons typically requires specialized experimental approaches that are designed to identify the 5' ends of transcripts. We developed a computational pipeline SEASTAR that identifies first exons from RNA-seq data alone then quantifies and compares alternative first exon usage across multiple biological conditions. The exons inferred by SEASTAR coincide with transcription start sites identified directly by CAGE experiments and bear epigenetic hallmarks of active promoters. To determine if differential usage of alternative first exons can yield insights into the mechanism controlling gene expression, we applied SEASTAR to an RNA-seq dataset that tracked the reprogramming of mouse fibroblasts into induced pluripotent stem cells. We observed dynamic temporal changes in the usage of alternative first exons, along with correlated changes in transcription factor expression. Using a combined sequence motif and gene set enrichment analysis we identified N-Myc as a regulator of alternative first exon usage in the pluripotent state. Our results demonstrate that SEASTAR can leverage the available RNA-seq data to gain insights into the control of gene expression and alternative transcript variation in eukaryotic transcriptomes.
DEFF Research Database (Denmark)
Boyd, Mette; Coskun, Mehmet; Lilje, Berit
2014-01-01
The Caco-2 cell line is one of the most important in vitro models for enterocytes, and is used to study drug absorption and disease, including inflammatory bowel disease and cancer. In order to use the model optimally, it is necessary to map its functional entities. In this study, we have generated...... genome-wide maps of active transcription start sites (TSSs), and active enhancers in Caco-2 cells with or without tumour necrosis factor (TNF)-α stimulation to mimic an inflammatory state. We found 520 promoters that significantly changed their usage level upon TNF-α stimulation; of these, 52...... promoters. As a case example, we characterize an enhancer regulating the laminin-5 γ2-chain (LAMC2) gene by nuclear factor (NF)-κB binding. This report is the first to present comprehensive TSS and enhancer maps over Caco-2 cells, and highlights many novel inflammation-specific promoters and enhancers....
Directory of Open Access Journals (Sweden)
Ryan F Overcash
Full Text Available The type I transmembrane protein with epidermal growth factor and two follistatin motifs 2 (TMEFF2, is expressed mainly in brain and prostate. Expression of TMEFF2 is deregulated in prostate cancer, suggesting a role in this disease, but the molecular mechanism(s involved in this effect are not clear. Although androgens promote tmeff2 transcription, androgen delivery to castrated animals carrying CWR22 xenografts increases TMEFF2 protein levels in the absence of mRNA changes, suggesting that TMEFF2 may also be post-transcriptionally regulated. Here we show that translation of TMEFF2 is regulated by androgens. Addition of physiological concentrations of dihydrotestosterone (DHT to prostate cancer cell lines increases translation of endogenous TMEFF2 or transfected TMEFF2-Luciferase fusions, and this effect requires the presence of upstream open reading frames (uORFs in the 5'-untranslated region (5'-UTR of TMEFF2. Using chemical and siRNA inhibition of the androgen receptor (AR, we show that the androgen effect on TMEFF2 translation is mediated by the AR. Importantly, DHT also promotes phosphorylation of the α subunit of the translation initiation factor 2 (eIF2α in an AR-dependent manner, paralleling the effect on TMEFF2 translation. Moreover, endoplasmic reticulum (ER stress conditions, which promote eIF2α phosphorylation, also stimulate TMEFF2 translation. These results indicate that androgen signaling promotes eIF2α phosphorylation and subsequent translation of TMEFF2 via a mechanism that requires uORFs in the 5'-UTR of TMEFF2.
TGF-β promotes glioma cell growth via activating Nodal expression through Smad and ERK1/2 pathways
International Nuclear Information System (INIS)
Sun, Jing; Liu, Su-zhi; Lin, Yan; Cao, Xiao-pan; Liu, Jia-ming
2014-01-01
Highlights: •TGF-β promoted Nodal expression in glioma cells. •TGF-β promoted Nodal expression via activating Smad and ERK1/2 pathways. •TGF-β promotes glioma cell growth via activating Nodal expression. -- Abstract: While there were certain studies focusing on the mechanism of TGF-β promoting the growth of glioma cells, the present work revealed another novel mechanism that TGF-β may promote glioma cell growth via enhancing Nodal expression. Our results showed that Nodal expression was significantly upregulated in glioma cells when TGF-β was added, whereas the TGF-β-induced Nodal expression was evidently inhibited by transfection Smad2 or Smad3 siRNAs, and the suppression was especially significant when the Smad3 was downregulated. Another, the attenuation of TGF-β-induced Nodal expression was observed with blockade of the ERK1/2 pathway also. Further detection of the proliferation, apoptosis, and invasion of glioma cells indicated that Nodal overexpression promoted the proliferation and invasion of tumor cells and inhibited their apoptosis, resembling the effect of TGF-β addition. Downregulation of Nodal expression via transfection Nodal-specific siRNA in the presence of TGF-β weakened the promoting effect of the latter on glioma cells growth, and transfecting Nodal siRNA alone in the absence of exogenous TGF-β more profoundly inhibited the growth of glioma cells. These results demonstrated that while both TGF-β and Nodal promoted glioma cells growth, the former might exert such effect by enhancing Nodal expression, which may form a new target for glioma therapy
Chemotherapy induces alternative transcription and splicing: Facts and hopes for cancer treatment.
Lambert, Charles A; Garbacki, Nancy; Colige, Alain C
2017-10-01
Alternative promoter usage, alternative splicing and alternative cleavage/polyadenylation (referred here as to alternative transcription and splicing) are main instruments to diversify the transcriptome from a limited set of genes. There is a good deal of evidence that chemotherapeutic drugs affect these processes, but the therapeutic incidence of these effects is poorly documented. The scope of this study is to review the impact of chemotherapy on alternative transcription and splicing and to discuss potential implications in cancer therapy. A literature survey identified >2200 events induced by chemotherapeutic drugs. The molecular pathways involved in these regulations are briefly discussed. The GO terms associated with the alternative transcripts are mainly related to cell cycle/division, mRNA processing, DNA repair, macromolecules catabolism and chromatin. A large fraction (43%) of transcripts are also related to the new hallmarks of cancer, mostly genetic instability and replicative immortality. Finally, we ask the question of the impact of alternative transcription and splicing on drug efficacy and of the possible curative benefit of combining chemotherapy and pharmaceutical regulation of this process. Copyright © 2017 Elsevier Ltd. All rights reserved.
Alternative splicing, a new target to block cellular gene expression by poliovirus 2A protease
International Nuclear Information System (INIS)
Alvarez, Enrique; Castello, Alfredo; Carrasco, Luis; Izquierdo, Jose M.
2011-01-01
Highlights: → Novel role for poliovirus 2A protease as splicing modulator. → Poliovirus 2A protease inhibits the alternative splicing of pre-mRNAs. → Poliovirus 2A protease blocks the second catalytic step of splicing. -- Abstract: Viruses have developed multiple strategies to interfere with the gene expression of host cells at different stages to ensure their own survival. Here we report a new role for poliovirus 2A pro modulating the alternative splicing of pre-mRNAs. Expression of 2A pro potently inhibits splicing of reporter genes in HeLa cells. Low amounts of 2A pro abrogate Fas exon 6 skipping, whereas higher levels of protease fully abolish Fas and FGFR2 splicing. In vitro splicing of MINX mRNA using nuclear extracts is also strongly inhibited by 2A pro , leading to accumulation of the first exon and the lariat product containing the unspliced second exon. These findings reveal that the mechanism of action of 2A pro on splicing is to selectively block the second catalytic step.
Alternative splicing, a new target to block cellular gene expression by poliovirus 2A protease
Energy Technology Data Exchange (ETDEWEB)
Alvarez, Enrique, E-mail: ealvarez@cbm.uam.es [Centro de Biologia Molecular Severo Ochoa (CSIC-UAM), Nicolas Cabrera, 1 Universidad Autonoma de Madrid, Cantoblanco, 28049 Madrid (Spain); Castello, Alfredo; Carrasco, Luis; Izquierdo, Jose M. [Centro de Biologia Molecular Severo Ochoa (CSIC-UAM), Nicolas Cabrera, 1 Universidad Autonoma de Madrid, Cantoblanco, 28049 Madrid (Spain)
2011-10-14
Highlights: {yields} Novel role for poliovirus 2A protease as splicing modulator. {yields} Poliovirus 2A protease inhibits the alternative splicing of pre-mRNAs. {yields} Poliovirus 2A protease blocks the second catalytic step of splicing. -- Abstract: Viruses have developed multiple strategies to interfere with the gene expression of host cells at different stages to ensure their own survival. Here we report a new role for poliovirus 2A{sup pro} modulating the alternative splicing of pre-mRNAs. Expression of 2A{sup pro} potently inhibits splicing of reporter genes in HeLa cells. Low amounts of 2A{sup pro} abrogate Fas exon 6 skipping, whereas higher levels of protease fully abolish Fas and FGFR2 splicing. In vitro splicing of MINX mRNA using nuclear extracts is also strongly inhibited by 2A{sup pro}, leading to accumulation of the first exon and the lariat product containing the unspliced second exon. These findings reveal that the mechanism of action of 2A{sup pro} on splicing is to selectively block the second catalytic step.
Directory of Open Access Journals (Sweden)
Kosuke Fujita
2017-06-01
Full Text Available Retinal ganglion cell degeneration triggered by axonal injury is believed to underlie many ocular diseases, including glaucoma and optic neuritis. In these diseases, retinal ganglion cells are affected unevenly, both spatially and temporally, such that healthy and unhealthy cells coexist in different patterns at different time points. Herein, we describe a temporally and spatially regulated adeno-associated virus gene therapy aiming to reduce undesired off-target effects on healthy retinal neurons. The Mcp-1 promoter previously shown to be activated in stressed retinal ganglion cells following murine optic nerve injury was combined with the neuroprotective intracellular transcription factor Nrf2. In this model, Mcp-1 promoter-driven NRF2 expression targeting only stressed retinal ganglion cells showed efficacy equivalent to non-selective cytomegalovirus promoter-driven therapy for preventing cell death. However, cytomegalovirus promoter-mediated NRF2 transcription induced cellular stress responses and death of Brn3A-positive uninjured retinal ganglion cells. Such undesired effects were reduced substantially by adopting the Mcp-1 promoter. Combining a stress-responsive promoter and intracellular therapeutic gene is a versatile approach for specifically targeting cells at risk of degeneration. This strategy may be applicable to numerous chronic ocular and non-ocular conditions.
International Nuclear Information System (INIS)
Li, Wei; Tao, Min; Li, Dao-Ming; Chen, Kai; Chen, Zheng; Zong, Yang; Yin, Hong; Xu, Ze-Kuan; Zhu, Yi; Gong, Fei-Ran
2012-01-01
Hepatocellular carcinoma (HCC) is one of the leading causes of cancer-related deaths worldwide. Current therapies are insufficient, making HCC an intractable disease. Our previous studies confirmed that inhibition of protein phosphatase 2A (PP2A) may provide a promising therapeutic strategy for cancer. Unfortunately, constitutive expression of PP2A in normal tissues limits the application of PP2A inhibition. Thus, a HCC-specific gene delivery system should be developed. The α-fetoprotein (AFP) promoter is commonly used in HCC-specific gene therapy strategies; however, the utility of this approach is limited due to the weak activity of the AFP promoter. It has been shown that linking the AFP enhancer with the promoter of the non-tissue-specific, human housekeeping phosphoglycerate kinase (pgk) gene can generate a strong and HCC-selective promoter. We constructed a HCC-specific gene therapy system to target PP2A using the AFP enhancer/pgk promoter, and evaluated the efficiency and specificity of this system both in vitro and in vivo. AFP enhancer/pgk promoter-driven expression of the dominant negative form of the PP2A catalytic subunit α (DN-PP2Acα) exerted cytotoxic effects against an AFP-positive human hepatoma cell lines (HepG2 and Hep3B), but did not affect AFP-negative human hepatoma cells (SK-HEP-1) or normal human liver cells (L-02). Moreover, AFP enhancer/pgk promoter driven expression of DN-PP2Acα inhibited the growth of AFP-positive HepG2 tumors in nude mice bearing solid tumor xenografts, but did not affect AFP-negative SK-HEP-1 tumors. The novel approach of AFP enhancer/pgk promoter-driven expression of DN-PP2Acα may provide a useful cancer gene therapy strategy to selectively target HCC
Directory of Open Access Journals (Sweden)
Muhamad Nizar
2014-12-01
Full Text Available Indonesia Quality Standard (QS for ambient SO2 for 1 hour time average i.e. 900 μg/m3(equivalent to 360μg/m3in24 hour time average regulated in the Government Regulation No. 41 of 1999 is the most loose compared to the ambient SO2 standards of other countries in the world including WHO QS guideline. This QS is not expected to guarantee the protection of public health in Indonesia. Therefore more stringent QS alternative for ambient SO2 is required. This research examines benefit values in public health aspect if Indonesia tightens its ambient SO2 QS. Two alternative QS for SO2 are used i.e196 μg/m3(equivalent to 78μg/m3in24 hour time average referring to U.S. EPA and 750μg/m3(equivalent to 360μg/m3in24 hour time average referring to PUSARPEDAL. First step is to map distribution of SO2 ambient concentrations in Indonesia. The result indicates that Provinces of Jakarta and Banten have exceeded both alternative QS while Provinces of Yogyakarta, West Java, Central Java, East Java, Bali, and North Sumatra only exceed the alternative QS of 196μg/m3. From the public health aspect, by attaining to the alternative QS of 750μg/m3, Jakarta and Banten will reduce incidence of ARI by 95% and 98%. By attaining to the alternative QS of 196μg/m3, East Java, Bali and North Sumatra will reduce the incidence of ARI by 59%, 51%, and 5%.
Observation of the spin gap in a S=1/2 alternating chain compound, high pressure phase of (VO)2P2O7
International Nuclear Information System (INIS)
Saito, Takashi; Azuma, Masaki; Fujita, Masaki; Takano, Mikio
2001-01-01
Inelastic neutron scattering data were collected on the high pressure phase of (VO) 2 P 2 O 7 , a S=1/2 Heisenberg antiferromagnetic alternating chain compound. The existence of a spin gap was confirmed, and the size was determined to be Δ=2.15(6) meV (=25.0(7) K). The theoretically predicted second gap (Δ'=2Δ) owing to a 2-magnon bound state was not observed. This is consistent with the high field magnetization measurement reported previously. (author)
Han, Hongyan; Zhu, Weiyao; Long, Yunqian; Song, Hongqing; Huang, Kun
2018-02-01
This paper provides an experimental method to deal with the problems of low oil recovery ratio faced with water flooding utilizing the CO2/water alternate displacement technology. A series of CO2/water alternate flooding experiments were carried out under 60°C and 18.4MPa using high temperature / pressure microscopic visualization simulation system. Then, we used the image processing technique and software to analyze the proportion of remaining oil in the displacement process. The results show that CO2 can extract the lighter chemical components in the crude oil and make it easier to form miscible phase, which can reduce the viscosity and favorable mobility ratio of oil. What’s more, the displacement reduces the impact of gas channeling, which can achieve an enlarged sweeping efficiency to improve filtration ability. In addition, the CO2 dissolved in oil and water can greatly reduce the interfacial tension, which can increase the oil displacement efficiency in a large extent. Generally speaking, the recovery rate of residual oil in the micro - model can be elevated up to 15.89% ∼ 16.48% under formation condition by alternate displacement.
Directory of Open Access Journals (Sweden)
Esha Mathew
2016-03-01
Significance: Targeting the stroma is emerging as a new paradigm in pancreatic cancer; however, efforts to that effect are hampered by our limited understanding of the nature and function of stromal components. Here, we uncover previously unappreciated heterogeneity within the stroma and identify interactions among stromal components that promote tumor growth and could be targeted therapeutically.
Using Checklists to Assess Your Transition to Alternative Fuels: A Technical Reference
Energy Technology Data Exchange (ETDEWEB)
Risch, C. E. [Argonne National Lab. (ANL), Argonne, IL (United States); Santini, D. J. [Argonne National Lab. (ANL), Argonne, IL (United States); Johnson, L. R. [Argonne National Lab. (ANL), Argonne, IL (United States)
2016-12-01
The Checklist for Transition to New Alternative Fuel(s) was published in September 2011 by Chuck Risch and Dan Santini. Many improvements, described below, have been incorporated into this current document, Checklists for Assessing the Transitions to New Highway Fuels.2 Further, the original authors and Larry Johnson, co-author of the current report, identified a need for a succinct version of the full report and prepared a brochure based on it to aid busy decisionmakers: Check It Out: Using Checklists to Assess Your Transition to Alternative Fuels.2 These checklists are tools for those stakeholders charged with determining a feasible alternative fuel or fuels for highway transportation systems of the future. The original had four major players whose needs had to be satisfied for a successful transition. The term “activist,” intended to encompass environmental and other special interests, was included in the “customers” category. Activists are customers of the government in the sense that they organize citizens to exert political pressure to regulate the design of vehicles, fuel infrastructure, and roadway networks. Many who evaluate alternative fuels view activists, particularly environmental activists, as a separate category. Further, “activist” has become a pejorative term to many people. Therefore, we have used the word “advocate” or “activist/advocate” instead. Thus, in this update we recognize that environmental and other activists/advocates have been--and will continue to be--a powerful force promoting change in the nature of the fuels that are used in transportation.
IL6 gene promoter polymorphisms and type 2 diabetes
DEFF Research Database (Denmark)
Huth, Cornelia; Heid, Iris M; Vollmert, Caren
2006-01-01
Several lines of evidence indicate a causal role of the cytokine interleukin (IL)-6 in the development of type 2 diabetes in humans. Two common polymorphisms in the promoter of the IL-6 encoding gene IL6, -174G>C (rs1800795) and -573G>C (rs1800796), have been investigated for association with type...... 2 diabetes in numerous studies but with results that have been largely equivocal. To clarify the relationship between the two IL6 variants and type 2 diabetes, we analyzed individual data on >20,000 participants from 21 published and unpublished studies. Collected data represent eight different...... countries, making this the largest association analysis for type 2 diabetes reported to date. The GC and CC genotypes of IL6 -174G>C were associated with a decreased risk of type 2 diabetes (odds ratio 0.91, P = 0.037), corresponding to a risk modification of nearly 9%. No evidence for association was found...
Choudhary, Pooja; Loewen, Michele C
2016-01-01
Although well documented for mammalian G-protein-coupled receptors, alternate functionalities and associated alternate signalling remain to be unequivocally established for the Saccharomyces cerevisiae pheromone Ste2p receptor. Here, evidence supporting alternate functionalities for Ste2p is re-evaluated, extended and quantified. In particular, strong mating and constitutive signalling mutations, focusing on residues S254, P258 and S259 in TM6 of Ste2p, are stacked and investigated in terms of their effects on classical G-protein-mediated signal transduction associated with cell cycle arrest, and alternatively, their impact on downstream mating projection and zygote formation events. In relative dose response experiments, accounting for systemic and observational bias, mutational-derived functional differences were observed, validating the S254L-derived bias for downstream mating responses and highlighting complex relationships between TM6-mutation derived constitutive signalling and ligand-induced functionalities. Mechanistically, localization studies suggest that alterations to receptor trafficking may contribute to mutational bias, in addition to expected receptor conformational stabilization effects. Overall, these results extend previous observations and quantify the contributions of Ste2p variants to mediating cell cycle arrest versus downstream mating functionalities. © Crown copyright 2015.
Alternative Fuels Data Center: Vermont Transportation Data for Alternative
alternative fuels Fuel Public Private Biodiesel (B20 and above) 3 0 Compressed Natural Gas (CNG) 1 2 Electric Recycled Cooking Oil Powers Biodiesel Vehicles in Vermont Recycled Cooking Oil Powers Biodiesel Vehicles in sold per GGE Biodiesel (B20) $2.79/gallon $2.54/GGE $2.84/gallon $2.58/GGE Biodiesel (B99-B100) $2.47
Comparison of the Kinetic Promoters Piperazine and Carbonic Anhydrase for CO2 Absorption
DEFF Research Database (Denmark)
Gladis, Arne; Gundersen, Maria T.; Thomsen, Kaj
2017-01-01
Kinetic promoter that enhance the reaction kinetics with CO2 are enabling the use of the low heat of reaction of slow absorbing solvents like MDEA. Mass transfer experiments with 30 wt% MDEA promoted by either by 1.7 and 8.5g/L enzyme carbonic anhydrase (CA) or 5 wt% piperazine (PZ) where conduct...
Genome wide identification of aberrant alternative splicing events in myotonic dystrophy type 2.
Perfetti, Alessandra; Greco, Simona; Fasanaro, Pasquale; Bugiardini, Enrico; Cardani, Rosanna; Garcia-Manteiga, Jose M; Manteiga, Jose M Garcia; Riba, Michela; Cittaro, Davide; Stupka, Elia; Meola, Giovanni; Martelli, Fabio
2014-01-01
Myotonic dystrophy type 2 (DM2) is a genetic, autosomal dominant disease due to expansion of tetraplet (CCTG) repetitions in the first intron of the ZNF9/CNBP gene. DM2 is a multisystemic disorder affecting the skeletal muscle, the heart, the eye and the endocrine system. According to the proposed pathological mechanism, the expanded tetraplets have an RNA toxic effect, disrupting the splicing of many mRNAs. Thus, the identification of aberrantly spliced transcripts is instrumental for our understanding of the molecular mechanisms underpinning the disease. The aim of this study was the identification of new aberrant alternative splicing events in DM2 patients. By genome wide analysis of 10 DM2 patients and 10 controls (CTR), we identified 273 alternative spliced exons in 218 genes. While many aberrant splicing events were already identified in the past, most were new. A subset of these events was validated by qPCR assays in 19 DM2 and 15 CTR subjects. To gain insight into the molecular pathways involving the identified aberrantly spliced genes, we performed a bioinformatics analysis with Ingenuity system. This analysis indicated a deregulation of development, cell survival, metabolism, calcium signaling and contractility. In conclusion, our genome wide analysis provided a database of aberrant splicing events in the skeletal muscle of DM2 patients. The affected genes are involved in numerous pathways and networks important for muscle physio-pathology, suggesting that the identified variants may contribute to DM2 pathogenesis.
Directory of Open Access Journals (Sweden)
Ling Yang
2013-01-01
Full Text Available Abstract Background To evaluate the promoter methylation status of MUC2 gene and mRNA expression in patients with hepatocellular carcinoma. Methods We analyzed MUC2 methylation by MSP, and MUC2 mRNA by real-time PCR in 74 HCC. Results MUC2 mRNA were lower in HCC tissues (Mean -ΔCt = −4.70 than that in Non-HCC tissues (Mean -ΔCt = −2.98. Expression of MUC2 was elevated in only 23 (31.08% of the 74 HCC patients. MUC2 promoter was hypermethylated in 62.2% (46/74 of HCCs, and in only 18.9% (14/74 of non-tumor samples. MUC2 mRNA were lower in HCC patients with hypermethylation (Mean -ΔΔCt = −2.25 than those with demethylation (Mean -ΔΔCt = −0.22, and there is a decreased tendency for MUC2 mRNA in HCC patients with promoter hypermethylation (p = 0.011. There was a significantly correlation found between MUC2 mRNA and HBV and AFP in HCC. The loss of MUC2 mRNA and hypermethylation could be poor prognostic factors. After treated by 5-Aza-CdR and TSA, we found that MUC2 mRNA induced significantly in 7721, Huh7 and HepG2 cells. Conclusion The results suggested that MUC2 mRNA silenced by promoter hypermethylation is associated with high levels HBV in HCC.
International Nuclear Information System (INIS)
Tong, Joanna H; Lo, Kwok W; To, Ka F; Ng, David C; Chau, Shuk L; So, Ken K; Leung, Patrick P; Lee, Tin L; Lung, Raymond W; Chan, Michael W; Chan, Anthony W
2010-01-01
Human Disabled-2 (DAB2), is a multi-function signalling molecule that it is frequently down-regulated in human cancers. We aimed to investigate the possible tumour suppressor effect of DAB2 in nasopharyngeal carcinoma (NPC). We studied the expression of DAB2 in NPC cell lines, xenografts and primary tumour samples. The status of promoter methylation was assessed by methylation specific PCR and bisulfite sequencing. The functional role of DAB2 in NPC was investigated by re-introducing DAB2 expression into NPC cell line C666-1. Decrease or absent of DAB2 transcript was observed in NPC cell lines and xenografts. Loss of DAB2 protein expression was seen in 72% (33/46) of primary NPC as demonstrated by immunohistochemistry. Aberrant DAB2 promoter methylation was detected in 65.2% (30/46) of primary NPC samples by methylation specific PCR. Treatment of the DAB2 negative NPC cell line C666-1 with 5-aza-2'-deoxycytidine resulted in restoration of DAB2 expression in a dose-dependent manner. Overexpression of DAB2 in NPC cell line C666-1 resulted in reduced growth rate and 35% reduction in anchorage-dependent colony formation, and inhibition of serum-induced c-Fos expression compared to vector-transfected controls. Over expression of DAB2 resulted in alterations of multiple pathways as demonstrated by expression profiling and functional network analysis, which confirmed the role of DAB2 as an adaptor molecule involved in multiple receptor-mediated signalling pathways. We report the frequent down regulation of DAB2 in NPC and the promoter hypermethylation contributes to the loss of expression of DAB2. This is the first study demonstrating frequent DAB2 promoter hypermethylation in human cancer. Our functional studies support the putative tumour suppressor effect of DAB2 in NPC cells
Transient HIF2A inhibition promotes satellite cell proliferation and muscle regeneration.
Xie, Liwei; Yin, Amelia; Nichenko, Anna S; Beedle, Aaron M; Call, Jarrod A; Yin, Hang
2018-03-13
The remarkable regeneration capability of skeletal muscle depends on coordinated proliferation and differentiation of satellite cells. The self-renewal of satellite cells is critical for long-term maintenance of muscle regeneration potential. Hypoxia profoundly affects the proliferation, differentiation, and self-renewal of cultured myoblasts. However, the physiological relevance of hypoxia and hypoxia signaling in satellite cells in vivo remains largely unknown. Here, we report that satellite cells are in an intrinsic hypoxic state in vivo and express hypoxia-inducible factor 2A (HIF2A). HIF2A promotes the stemness and long-term homeostatic maintenance of satellite cells by maintaining the quiescence, increasing the self-renewal and blocking the myogenic differentiation of satellite cells. HIF2A stabilization in satellite cells cultured under normoxia augmented their engraftment potential in regenerative muscle. Reversely, HIF2A ablation led to the depletion of satellite cells and the consequent regenerative failure in the long-term. In contrast, transient pharmacological inhibition of HIF2A accelerated muscle regeneration by increasing satellite cell proliferation and differentiation. Mechanistically, HIF2A induces the quiescence/self-renewal of satellite cells by binding the promoter of Spry1 gene and activating Spry1 expression. These findings suggest that HIF2A is a pivotal mediator of hypoxia signaling in satellite cells and may be therapeutically targeted to improve muscle regeneration.
2d-LCA - an alternative to x-wires
Puczylowski, Jaroslaw; Hölling, Michael; Peinke, Joachim
2014-11-01
The 2d-Laser Cantilever Anemometer (2d-LCA) is an innovative sensor for two-dimensional velocity measurements in fluids. It uses a micostructured cantilever made of silicon and SU-8 as a sensing element and is capable of performing mesurements with extremly high temporal resolutions up to 150 kHz. The size of the cantilever defines its spatial resolution, which is in the order of 150 μm only. Another big feature is a large angular range of 180° in total. The 2d-LCA has been developed as an alternative measurement method to x-wires with the motivation to create a sensor that can operate in areas where the use of hot-wire anemometry is difficult. These areas include measurements in liquids and in near-wall or particle-laden flows. Unlike hot-wires, the resolution power of the 2d-LCA does not decrease with increasing flow velocity, making it particularly suitable for measurements in high speed flows. Comparative measurements with the 2d-LCA and hot-wires have been carried out in order to assess the performance of the new anemometer. The data of both measurement techniques were analyzed using the same stochastic methods including a spectral analysis as well as an inspection of increment statistics and structure functions. Furthermore, key parameters, such as mean values of both velocity components, angles of attack and the characteristic length scales were determined from both data sets. The analysis reveals a great agreement between both anemometers and thus confirms the new approach.
Steer, Andrew M; Bia, Nicolas; Smith, David K; Clarke, Paul A
2017-09-25
Understanding the prebiotic genesis of 2-deoxy-d-ribose, which forms the backbone of DNA, is of crucial importance to unravelling the origins of life, yet remains open to debate. Here we demonstrate that 20 mol% of proteinogenic amino esters promote the selective formation of 2-deoxy-d-ribose over 2-deoxy-d-threopentose in combined yields of ≥4%. We also demonstrate the first aldol reaction promoted by prebiotically-relevant proteinogenic amino nitriles (20 mol%) for the enantioselective synthesis of d-glyceraldehyde with 6% ee, and its subsequent conversion into 2-deoxy-d-ribose in yields of ≥ 5%. Finally, we explore the combination of these two steps in a one-pot process using 20 mol% of an amino ester or amino nitrile promoter. It is hence demonstrated that three interstellar starting materials, when mixed together with an appropriate promoter, can directly lead to the formation of a mixture of higher carbohydrates, including 2-deoxy-d-ribose.
Tu, Min; Lu, Cheng; Lv, Nan; Wei, Jishu; Lu, Zipeng; Xi, Chunhua; Chen, Jianmin; Guo, Feng; Jiang, Kuirong; Li, Qiang; Wu, Junli; Song, Guoxin; Wang, Shui; Gao, Wentao; Miao, Yi
2016-12-28
Vasohibin 2 (VASH2) is an angiogenic factor and cancer-related protein that acts via paracrine mechanisms. Here, we investigated the angiogenic function and mechanism of action of VASH2 in 200 human breast cancer tissues by performing immunohistochemical staining, western blot, indirect sandwich enzyme-linked immunosorbent assay (ELISA), and a semi-quantitative sandwich-based antibody array. Breast cancer cells stably overexpressing VASH2 or with knocked-down VASH2 were established and used for in vivo and in vitro models. In human luminal tissue, but not in HER2-positive or basal-like breast cancer tissues, VASH2 was positively correlated with CD31-positive microvascular density, induced angiogenesis in xenograft tumors, and promoted human umbilical vein endothelial cell tube formation in vitro. VASH2 expression was absent in the concentrated conditioned medium collected from knocked-down VASH2 and VASH2-overexpressing luminal breast cancer cells. Further, VASH2 regulated the expression of fibroblast growth factor 2 (FGF2) in human luminal breast cancer cells, and the pro-angiogenic effect induced by VASH2 overexpression was blocked by FGF2 neutralization in vitro. Additionally, dual luciferase reporter assay and Chromatin immunoprecipitation analysis results showed that FGF2 promoter was transcriptionally activated by VASH2 via histone modifications. In conclusion, VASH2 expression is positively correlated with FGF2 expression and promotes angiogenesis in human luminal breast cancer by transcriptional activation of fibroblast growth factor 2 through non-paracrine mechanisms. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.
Yadav et al., Afr J Tradit Complement Altern Med. (2014) 11(2):249 ...
African Journals Online (AJOL)
cadewumi
Yadav et al., Afr J Tradit Complement Altern Med. (2014) 11(2):249-256 ..... In recent years the popularity of complementary medicine has increased. Much interest has been focused on exploring ... delayed the induction of glucose intolerance and euglycemia in high fructose diet fed rats. Diabegon treatment inhibits the ...
DEFF Research Database (Denmark)
Zhang, Yifeng; Angelidaki, Irini
2016-01-01
Sustainable H2O2 supply and elimination of residual H2O2 are two key challenges to the Fenton processes treating recalcitrant contaminants. In this study, an innovative Bioelectro-Fenton system capable of alternate switching between microbial electrolysis cell (MEC) and microbial fuel cell (MFC......) mode of operation was developed to meet the challenges. In the MEC mode, H2O2 was electrochemically produced which reacts with Fenton’s reagent (Fe II) to form hydroxyradical. The residual H2O2 (unused H2O2) is removed as electron acceptor by switching the system to MFC mode. Complete decolorization...
Alternative developmental toxicity models for assessing the in vivo embryotoxicity of azoles
Dimopoulou, Myrto
2018-01-01
The implementation of regulations for protecting both humans and the environment from potential chemical health hazards, as well as the increase of global pressure for reducing, refining and replacing animal experiments promote the development and application of alternatives to in vivo
Syndecans promote integrin-mediated adhesion of mesenchymal cells in two distinct pathways
DEFF Research Database (Denmark)
Whiteford, James; Behrends, Volker; Kirby, Hishani
2007-01-01
and signaling through the cytoplasmic domain of syndecan-4. Here an alternate pathway mediated by the extracellular domains of syndecans-2 and -4 is characterized that is independent of both heparan sulphate and syndecan signaling. This pathway is restricted to mesenchymal cells and was not seen in any...... epithelial cell line tested, apart from vascular endothelia. The syndecan ectodomains coated as substrates promoted integrin-dependent attachment, spreading and focal adhesion formation. Syndecan-4 null cells were competent, as were fibroblasts compromised in heparan sulphate synthesis that were unable...
Conserved alternative and antisense transcripts at the programmed cell death 2 locus
Czech Academy of Sciences Publication Activity Database
Mihola, Ondřej; Forejt, Jiří; Trachtulec, Zdeněk
2007-01-01
Roč. 8, - (2007), s. 20 ISSN 1471-2164 R&D Projects: GA ČR(CZ) GA204/01/0997; GA ČR GA301/05/0738; GA AV ČR IAA5052406; GA MŠk(CZ) 1M0520 Institutional research plan: CEZ:AV0Z50520514 Keywords : Pdcd2 * antisense * alternative transcript * imprinting Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 4.180, year: 2007
Nsakala, Gabriel Vodiena; Coppieters, Yves
2014-01-01
This paper describes a review of the possibilities of improving HIV/AIDS prevention and reproductive health of teenagers and adolescents in the Democratic Republic of Congo (DRC). This approach was based on compilation of institutional, political, legislative and national strategy data. The document review was completed by information collected from 15 key informants and by direct observation of the work of peer educators and community workers, allowing evaluation of the possibilities of development of the priority domains of the Ottawa Charter for Health Promotion in young adolescents. Health promotion interventions for adolescents are globally ensured institutionally by three specialized programmes of the Ministry of Health, in collaboration with numerous national and international partners. Organized operationally outside of the primary health care circuit, strategic actions are more specifically directed towards acquisition of knowledge than individual skills by means of IEC (information, education and communication) and (BCC) (behaviour change communication) approaches, but with disappointing results. Although traces of these five priority domains of the Ottawa Charter are perceptible in the national response to the health problems of adolescents, the work of the various actors is not coordinated and organized in compliance with health promotion guidelines. The training of health workers appears to be a major determinant to structure this response around a dynamic federating the actions of all stakeholders to orient them towards the options of the health promotion approach.
Goodaire, EG; Polcino Milies, C
1996-01-01
For the past ten years, alternative loop rings have intrigued mathematicians from a wide cross-section of modern algebra. As a consequence, the theory of alternative loop rings has grown tremendously. One of the main developments is the complete characterization of loops which have an alternative but not associative, loop ring. Furthermore, there is a very close relationship between the algebraic structures of loop rings and of group rings over 2-groups. Another major topic of research is the study of the unit loop of the integral loop ring. Here the interaction between loop rings and group ri
Standardization of Alternative Fuels. Phase 1
Energy Technology Data Exchange (ETDEWEB)
NONE
2003-08-15
There are different interpretations of the term 'alternative fuels', depending on the part of the world in which the definition is used. In this report, alternative fuels mainly stand for fuels that can replace gasoline and diesel oil and at the same time contribute to lowered emissions with impact on health, environment and climate. The use of alternative vehicle fuels has increased during the last 30 years. However, the increase has developed slowly and today the use is very limited, compared to the use of conventional fuels. Although, the use in some special applications, often in rather small geographical areas, can be somewhat larger. The main interest for alternative fuels has for a long time been driven by supply security issues and the possibility to reduce emissions with a negative impact on health and environment. However, the development of reformulated gasoline and low sulphur diesel oil has contributed to substantially decreased emissions from these fuels without using any alternative fuel. This has reduced the environmental impact driving force for the introduction of alternative fuels. In line with the increased interest for climate effects and the connections between these effects and the emission of greenhouse gases, and then primarily carbon dioxide, the interest for biomass based alternative fuels has increased during the 1990s. Even though one of the driving forces for alternative fuels is small today, alternative fuels are more commonly accepted than ever before. The European Commission has for example in May 2003 agreed on a directive for the promotion of the use of bio fuels. In the directive there are goals for the coming 7 years that will increase the use of alternative fuels in Europe rather dramatically, from below 1 percent now up to almost 6 percent of the total vehicle fuel consumption in 2010. The increased use of alternative fuels in Europe and the rest of the world will create a need for a common interpretation of what we
Directory of Open Access Journals (Sweden)
Asghar Gandomkar
2016-10-01
Full Text Available Core flooding experiments were conducted with the objective of evaluating near miscible surfactant alternating CO2 injection and the effect of surfactant concentrations on gas-oil and water displacements in porous media. The core samples were provided from a low permeability mixed wet oil reservoir at 156 °F and 1900 psia. In addition, very few studies of surfactant adsorption on carbonate minerals have been conducted. Hence, the surfactant adsorption on carbonate rock was determined by core flooding and crushed tests. It was found that for the crushed rock, the required equilibrium time is approximately five hours, while it is more than four days for the flow-through tests. Hysteresis effects demonstrated that the irreducible water saturations were 5 to 10% higher than the initial connate water saturation after drainage cycles during 5000 ppm surfactant solution. Furthermore, near-miscible surfactant alternating CO2 injection process led to a 4-17% increase in the recovery factor in comparison to water alternating gas process.
Directory of Open Access Journals (Sweden)
Kasey N Davis
Full Text Available Genetic variation and early adverse environmental events work together to increase risk for schizophrenia. γ-aminobutyric acid (GABA, the major inhibitory neurotransmitter in adult mammalian brain, plays a major role in normal brain development, and has been strongly implicated in the pathobiology of schizophrenia. GABA synthesis is controlled by two glutamic acid decarboxylase (GAD genes, GAD1 and GAD2, both of which produce a number of alternative transcripts. Genetic variants in the GAD1 gene are associated with increased risk for schizophrenia, and reduced expression of its major transcript in the human dorsolateral prefrontal cortex (DLPFC. No consistent changes in GAD2 expression have been found in brains from patients with schizophrenia. In this work, with the use of RNA sequencing and PCR technologies, we confirmed and tracked the expression of an alternative truncated transcript of GAD2 (ENST00000428517 in human control DLPFC homogenates across lifespan besides the well-known full length transcript of GAD2. In addition, using quantitative RT-PCR, expression of GAD2 full length and truncated transcripts were measured in the DLPFC of patients with schizophrenia, bipolar disorder and major depression. The expression of GAD2 full length transcript is decreased in the DLPFC of schizophrenia and bipolar disorder patients, while GAD2 truncated transcript is increased in bipolar disorder patients but decreased in schizophrenia patients. Moreover, the patients with schizophrenia with completed suicide or positive nicotine exposure showed significantly higher expression of GAD2 full length transcript. Alternative transcripts of GAD2 may be important in the growth and development of GABA-synthesizing neurons as well as abnormal GABA signaling in the DLPFC of patients with schizophrenia and affective disorders.
Regional differences in gene expression and promoter usage in aged human brains
Pardo, Luba M.
2013-02-19
To characterize the promoterome of caudate and putamen regions (striatum), frontal and temporal cortices, and hippocampi from aged human brains, we used high-throughput cap analysis of gene expression to profile the transcription start sites and to quantify the differences in gene expression across the 5 brain regions. We also analyzed the extent to which methylation influenced the observed expression profiles. We sequenced more than 71 million cap analysis of gene expression tags corresponding to 70,202 promoter regions and 16,888 genes. More than 7000 transcripts were differentially expressed, mainly because of differential alternative promoter usage. Unexpectedly, 7% of differentially expressed genes were neurodevelopmental transcription factors. Functional pathway analysis on the differentially expressed genes revealed an overrepresentation of several signaling pathways (e.g., fibroblast growth factor and wnt signaling) in hippocampus and striatum. We also found that although 73% of methylation signals mapped within genes, the influence of methylation on the expression profile was small. Our study underscores alternative promoter usage as an important mechanism for determining the regional differences in gene expression at old age.
KRUYT, FAE; FOLKERS, GE; WALHOUT, AJM; VANDERLEEDE, BM; VANDERSAAG, PT; Kruyt, Frank
The retinoic acid (RA) receptor (RAR) beta2 promoter is strongly activated by RA in embryonal carcinoma (EC) cells. We examined this activation in the P19 EC-derived END-2 cell line and in E1A-expressing counterparts and found strong RA-dependent RARbeta2 promoter activation in the E1A-expressing
LHCSR Expression under HSP70/RBCS2 Promoter as a Strategy to Increase Productivity in Microalgae
Directory of Open Access Journals (Sweden)
Federico Perozeni
2018-01-01
Full Text Available Microalgae are unicellular photosynthetic organisms considered as potential alternative sources for biomass, biofuels or high value products. However, limited biomass productivity is commonly experienced in their cultivating system despite their high potential. One of the reasons for this limitation is the high thermal dissipation of the light absorbed by the outer layers of the cultures exposed to high light caused by the activation of a photoprotective mechanism called non-photochemical quenching (NPQ. In the model organism for green algae Chlamydomonas reinhardtii, NPQ is triggered by pigment binding proteins called light-harvesting-complexes-stress-related (LHCSRs, which are over-accumulated in high light. It was recently reported that biomass productivity can be increased both in microalgae and higher plants by properly tuning NPQ induction. In this work increased light use efficiency is reported by introducing in C. reinhardtii a LHCSR3 gene under the control of Heat Shock Protein 70/RUBISCO small chain 2 promoter in a npq4 lhcsr1 background, a mutant strain knockout for all LHCSR genes. This complementation strategy leads to a low expression of LHCSR3, causing a strong reduction of NPQ induction but is still capable of protecting from photodamage at high irradiance, resulting in an improved photosynthetic efficiency and higher biomass accumulation.
LHCSR Expression under HSP70/RBCS2 Promoter as a Strategy to Increase Productivity in Microalgae.
Perozeni, Federico; Stella, Giulio Rocco; Ballottari, Matteo
2018-01-05
Microalgae are unicellular photosynthetic organisms considered as potential alternative sources for biomass, biofuels or high value products. However, limited biomass productivity is commonly experienced in their cultivating system despite their high potential. One of the reasons for this limitation is the high thermal dissipation of the light absorbed by the outer layers of the cultures exposed to high light caused by the activation of a photoprotective mechanism called non-photochemical quenching (NPQ). In the model organism for green algae Chlamydomonas reinhardtii , NPQ is triggered by pigment binding proteins called light-harvesting-complexes-stress-related (LHCSRs), which are over-accumulated in high light. It was recently reported that biomass productivity can be increased both in microalgae and higher plants by properly tuning NPQ induction. In this work increased light use efficiency is reported by introducing in C. reinhardtii a LHCSR3 gene under the control of Heat Shock Protein 70 / RUBISCO small chain 2 promoter in a npq4 lhcsr1 background, a mutant strain knockout for all LHCSR genes. This complementation strategy leads to a low expression of LHCSR3 , causing a strong reduction of NPQ induction but is still capable of protecting from photodamage at high irradiance, resulting in an improved photosynthetic efficiency and higher biomass accumulation.
Jovanovic, Ivan P; Pejnovic, Nada N; Radosavljevic, Gordana D; Pantic, Jelena M; Milovanovic, Marija Z; Arsenijevic, Nebojsa N; Lukic, Miodrag L
2014-04-01
The role of IL-33/ST2 pathway in antitumor immunity is unclear. Using 4T1 breast cancer model we demonstrate time-dependent increase of endogenous IL-33 at both the mRNA and protein levels in primary tumors and metastatic lungs during cancer progression. Administration of IL-33 accelerated tumor growth and development of lung and liver metastases, which was associated with increased intratumoral accumulation of CD11b(+) Gr-1(+) TGF-β1(+) myeloid-derived suppressor cells (MDSCs) that expressed IL-13α1R, IL-13-producing Lin(-) Sca-1(+) ST2(+) innate lymphoid cells (ILCs) and CD4(+) Foxp3(+) ST2(+) IL-10(+) Tregs compared to untreated mice. Higher incidence of monocytic vs. granulocytic MDSCs and plasmocytoid vs. conventional dendritic cells (DCs) was present in mammary tumors of IL-33-treated mice. Intratumoral NKp46(+) NKG2D(+) and NKp46(+) FasL(+) cells were markedly reduced after IL-33 treatment, while phosphate-buffered saline-treated ST2-deficient mice had increased frequencies of these tumoricidal natural killer (NK) cells compared to untreated wild-type mice. IL-33 promoted intratumoral cell proliferation and neovascularization, which was attenuated in the absence of ST2. Tumor-bearing mice given IL-33 had increased percentages of splenic MDSCs, Lin(-) Sca-1(+) ILCs, IL-10-expressing CD11c(+) DCs and alternatively activated M2 macrophages and higher circulating levels of IL-10 and IL-13. A significantly reduced NK cell, but not CD8(+) T-cell cytotoxicity in IL-33-treated mice was observed and the mammary tumor progression was not affected when CD8(+) T cells were in vivo depleted. We show a previously unrecognized role for IL-33 in promoting breast cancer progression through increased intratumoral accumulation of immunosuppressive cells and by diminishing innate antitumor immunity. Therefore, IL-33 may be considered as an important mediator in the regulation of breast cancer progression. © 2013 UICC.
International Nuclear Information System (INIS)
Ruiz, E.; Cillero, D.; Martinez, P. J.; Morales, A.; San Vicente, G.; Diego, G. de; Sanchez, J. M.
2014-01-01
The ultimate goal of the project PROMOCAP was the development and study of electrochemical promotion systems for the capture and valorization of CO 2 in combustion flue gases. To achieve this objective, electrocatalysts consisting of tubes or monoliths of solid electrolyte (K-βAl 2 O 3 or YSZ), coated by the corresponding active metal (Pt, Pd, Ni, Cu, Fe-TiO 2 , Pt-Ru - C, Pt-C, etc.), were prepared using both conventional (painting) and improved (dip-coating, electroless or spray-coating) procedures. Both physico-chemical and volt amperometric characterization of the electrocatalysts was carried out both as prepared and after use in electro promoted CO 2 capture and valorization processes (study of chemisorption, reaction, inhibition, deactivation phenomena, etc.). Pilot plant studies were carried out under realistic conditions for identifying the best electro catalyst and the operating conditions more suitable for CO 2 electro promoted capture and valorization. Finally, the electrocatalysts identified as the most promising for electro promoted CO 2 capture (Pt/K-βAl 2 O 3 ) and valorization (Cu/K-βAl 2 O 3 ) were prepared using the developed optimized procedures and their behavior over multiple cycles of electro promoted CO 2 capture and in long term operation against electro promoted CO 2 hydrogenation, respectively, was studied under real or realistic conditions. (Author)
Alternative Fuels Data Center: Virginia Transportation Data for Alternative
/2018 Biodiesel and Green Diesel Definitions updated 4/9/2018 Data Download Fueling Stations 706 stations in Virginia with alternative fuels Fuel Public Private Biodiesel (B20 and above) 1 9 Compressed unit sold per GGE per unit sold per GGE Biodiesel (B20) $2.47/gallon $2.25/GGE $2.84/gallon $2.58/GGE
Li, Minghua; Li, Zhiqin; Morris, David L.; Rui, Liangyou
2007-01-01
The SH2B family has three members (SH2B1, SH2B2, and SH2B3) that contain conserved dimerization (DD), pleckstrin homology, and SH2 domains. The DD domain mediates the formation of homo- and heterodimers between members of the SH2B family. The SH2 domain of SH2B1 (previously named SH2-B) or SH2B2 (previously named APS) binds to phosphorylated tyrosines in a variety of tyrosine kinases, including Janus kinase-2 (JAK2) and the insulin receptor, thereby promoting the activation of JAK2 or the ins...
Felsberg, Jörg; Thon, Niklas; Eigenbrod, Sabina; Hentschel, Bettina; Sabel, Michael C; Westphal, Manfred; Schackert, Gabriele; Kreth, Friedrich Wilhelm; Pietsch, Torsten; Löffler, Markus; Weller, Michael; Reifenberger, Guido; Tonn, Jörg C
2011-08-01
Epigenetic silencing of the O(6) -methylguanine-DNA methyltransferase (MGMT) gene promoter is associated with prolonged survival in glioblastoma patients treated with temozolomide (TMZ). We investigated whether glioblastoma recurrence is associated with changes in the promoter methylation status and the expression of MGMT and the DNA mismatch repair (MMR) genes MLH1, MSH2, MSH6 and PMS2 in pairs of primary and recurrent glioblastomas of 80 patients, including 64 patients treated with radiotherapy and TMZ after the first operation. Among the primary tumors, the MGMT promoter was methylated in 31 patients and unmethylated in 49 patients. In 71 patients (89%), the MGMT promoter methylation status of the primary tumor was retained at recurrence. MGMT promoter methylation, but not MGMT protein expression, was associated with longer progression-free survival, overall survival and postrecurrence survival (PRS). Moreover, PRS was increased under salvage chemotherapy. Investigation of primary and recurrent glioblastomas of 43 patients did not identify promoter methylation in any of the four MMR genes. However, recurrent glioblastomas demonstrated significantly lower MSH2, MSH6 and PMS2 protein expression as detected by immunohistochemistry. In conclusion, reduced expression of MMR proteins, but not changes in MGMT promoter methylation, is characteristic of glioblastomas recurring after the current standards of care. Copyright © 2011 UICC.
Energy Technology Data Exchange (ETDEWEB)
1992-12-31
The major goal of this project is to determine how microorganisms regulate the assimilation of CO{sup 2} via pathways alternative to the usual Calvin reductive pentose phosphate scheme. In particular, we are interest in the molecular basis for switches in CO{sub 2} metabolic paths. Several earlier studies had indicated that purple nonsulfur photosynthetic bacteria assimilate significant amounts of CO{sub 2} via alternative non-Calvin routes. We have deleted the gene that encodes. RubisCo (ribulose bisphosphate carboxylase/oxygenase) in both the Rhodobacter sphaeroids and Rhodospirillum rubrum. The R. sphaeroides RubisCO deletion strain (strain 16) could not grow under photoheterotrophic conditions with malate as electron donor and CO{sub 2} as the electron acceptor; however the R. rub RubisCO deletion strain (strain I-19) could. Over the past year we have sought to physiologically characterize strain 16PHC. We found that, 16PHC exhibited rates of whole-cell CO{sub 2} fixation which were significantly higher than strain 16. Strain 16PHC could not grow photolithoautotrophically in a CO{sub 2} atmosphere; however, CO{sub 2} fixation catalyzed by photoheterotrophically grown 16PHC was repressed by the addition of DMSO. Likewise, we found that cells initially grown in the presence of DMSO could induce the CO{sub 2} fixation system when DMSO was removed. Thus, these results suggested that both PHC and I-19 could be used to study alternative CO{sub 2} fixation reactions and their significance in R. sphaexoides and R. rubrum.
ATM-Dependent Phosphorylation of MEF2D Promotes Neuronal Survival after DNA Damage
Chan, Shing Fai; Sances, Sam; Brill, Laurence M.; Okamoto, Shu-ichi; Zaidi, Rameez; McKercher, Scott R.; Akhtar, Mohd W.; Nakanishi, Nobuki
2014-01-01
Mutations in the ataxia telangiectasia mutated (ATM) gene, which encodes a kinase critical for the normal DNA damage response, cause the neurodegenerative disorder ataxia-telangiectasia (AT). The substrates of ATM in the brain are poorly understood. Here we demonstrate that ATM phosphorylates and activates the transcription factor myocyte enhancer factor 2D (MEF2D), which plays a critical role in promoting survival of cerebellar granule cells. ATM associates with MEF2D after DNA damage and phosphorylates the transcription factor at four ATM consensus sites. Knockdown of endogenous MEF2D with a short-hairpin RNA (shRNA) increases sensitivity to etoposide-induced DNA damage and neuronal cell death. Interestingly, substitution of endogenous MEF2D with an shRNA-resistant phosphomimetic MEF2D mutant protects cerebellar granule cells from cell death after DNA damage, whereas an shRNA-resistant nonphosphorylatable MEF2D mutant does not. In vivo, cerebella in Mef2d knock-out mice manifest increased susceptibility to DNA damage. Together, our results show that MEF2D is a substrate for phosphorylation by ATM, thus promoting survival in response to DNA damage. Moreover, dysregulation of the ATM–MEF2D pathway may contribute to neurodegeneration in AT. PMID:24672010
LRRK2 mediated Rab8a phosphorylation promotes lipid storage.
Yu, Miao; Arshad, Muhammad; Wang, Wenmin; Zhao, Dongyu; Xu, Li; Zhou, Linkang
2018-02-27
Several mutations in leucine rich repeat kinase 2 (LRRK2) gene have been associated with pathogenesis of Parkinson's disease (PD), a neurodegenerative disorder marked by resting tremors, and rigidity, leading to Postural instability. It has been revealed that mutations that lead to an increase of kinase activity of LRRK2 protein are significantly associated with PD pathogenesis. Recent studies have shown that some Rab GTPases, especially Rab8, serve as substrates of LRRK2 and undergo phosphorylation in its switch II domain upon interaction. Current study was performed in order to find out the effects of the phosphorylation of Rab8 and its mutants on lipid metabolism and lipid droplets growth. The phosphorylation status of Rab8a was checked by phos-tag gel. Point mutant construct were generated to investigate the function of Rab8a. 3T3L1 cells were transfected with indicated plasmids and the lipid droplets were stained with Bodipy. Fluorescent microscopy experiments were performed to examine the sizes of lipid droplets. The interactions between Rab8a and Optineurin were determined by immunoprecipitation and western blot. Our assays demonstrated that Rab8a was phosphorylated by mutated LRRK2 that exhibits high kinase activity. Phosphorylation of Rab8a on amino acid residue T72 promoted the formation of large lipid droplets. T72D mutant of Rab8a had higher activity to promote the formation of large lipid droplets compared with wild type Rab8a, with increase in average diameter of lipid droplets from 2.10 μm to 2.46 μm. Moreover, phosphorylation of Rab8a weakened the interaction with its effector Optineurin. Y1699C mutated LRRK2 was able to phosphorylate Rab8a and phosphorylation of Rab8a on site 72 plays important role in the fusion and enlargement of lipid droplets. Taken together, our study suggests an indirect relationship between enhanced lipid storage capacity and PD pathogenesis.
TiO2-V2O5 nanocomposites as alternative energy storage substances for photocatalysts.
Ngaotrakanwiwat, Pailin; Meeyoo, Vissanu
2012-01-01
TiO2-V2O5 was prepared and evaluated as an energy storage material for photocatalysts with high capacity and initial charging rate. The compound was successfully obtained by sol-gel technique and effects of compound composition and calcination temperature on the energy storage ability were investigated. The synthesized compounds were characterized by means of X-ray powder diffraction (XRD), scanning electron microscopy equipped with energy-dispersive X-ray analysis (SEM-EDX) and transmission electron microscopy (TEM). The results reveals that the compound of Ti:V molar ratio equal to 1:0.11 calcined at 550 degrees C exhibited superior energy storage ability than parent substances and 1.7-times higher capacity and 2.3-times higher initial charging rate compared to WO3, indicating that the compound is a remarkable alternative to conventional energy storage substances.
Promotional programmes for energy conservation and CO2 avoidance. Efficiency and costs
International Nuclear Information System (INIS)
Lechtenboehmer, S.; Bach, W.
1994-01-01
Least-cost planning and demand-side management are attempts to bring into accord company policies of the energy utility with the targets of environmental and climate protection and resource savings. Since 1982 also the Stadtwerke Muenster have promotional programmes for heating system modernization. With the example of three current promotional programmes the article analysis the costs of such programmes, their impact with regard to energy conservation and CO 2 avoidance and their status within the scope of local climate protection. Moreover the volume of investment is assessed which is necessary in Muenster to reduce the heating energy consumption of existing residential buildings till 2005 by more than one third. (orig./UA) [de
Huda, Kazi Md Kamrul; Banu, Mst Sufara Akhter; Pathi, Krishna Mohan; Tuteja, Narendra
2013-01-01
Plasma membrane Ca(2+)ATPase is a transport protein in the plasma membrane of cells and helps in removal of calcium (Ca(2+)) from the cell, hence regulating Ca(2+) level within cells. Though plant Ca(2+)ATPases have been shown to be involved in plant stress responses but their promoter regions have not been well studied. The 1478 bp promoter sequence of rice plasma membrane Ca(2+)ATPase contains cis-acting elements responsive to stresses and plant hormones. To identify the functional region, serial deletions of the promoter were fused with the GUS sequence and four constructs were obtained. These were differentially activated under NaCl, PEG cold, methyl viologen, abscisic acid and methyl jasmonate treatments. We demonstrated that the rice plasma membrane Ca(2+)ATPase promoter is responsible for vascular-specific and multiple stress-inducible gene expression. Only full-length promoter showed specific GUS expression under stress conditions in floral parts. High GUS activity was observed in roots with all the promoter constructs. The -1478 to -886 bp flanking region responded well upon treatment with salt and drought. Only the full-length promoter presented cold-induced GUS expression in leaves, while in shoots slight expression was observed for -1210 and -886 bp flanking region. The -1210 bp deletion significantly responded to exogenous methyl viologen and abscisic acid induction. The -1210 and -886 bp flanking region resulted in increased GUS activity in leaves under methyl jasmonate treatments, whereas in shoots the -886 bp and -519 bp deletion gave higher expression. Salicylic acid failed to induce GUS activities in leaves for all the constructs. The rice plasma membrane Ca(2+)ATPase promoter is a reproductive organ-specific as well as vascular-specific. This promoter contains drought, salt, cold, methyl viologen, abscisic acid and methyl jasmonate related cis-elements, which regulated gene expression. Overall, the tissue-specificity and inducible nature of this
Directory of Open Access Journals (Sweden)
Kazi Md Kamrul Huda
Full Text Available Plasma membrane Ca(2+ATPase is a transport protein in the plasma membrane of cells and helps in removal of calcium (Ca(2+ from the cell, hence regulating Ca(2+ level within cells. Though plant Ca(2+ATPases have been shown to be involved in plant stress responses but their promoter regions have not been well studied.The 1478 bp promoter sequence of rice plasma membrane Ca(2+ATPase contains cis-acting elements responsive to stresses and plant hormones. To identify the functional region, serial deletions of the promoter were fused with the GUS sequence and four constructs were obtained. These were differentially activated under NaCl, PEG cold, methyl viologen, abscisic acid and methyl jasmonate treatments. We demonstrated that the rice plasma membrane Ca(2+ATPase promoter is responsible for vascular-specific and multiple stress-inducible gene expression. Only full-length promoter showed specific GUS expression under stress conditions in floral parts. High GUS activity was observed in roots with all the promoter constructs. The -1478 to -886 bp flanking region responded well upon treatment with salt and drought. Only the full-length promoter presented cold-induced GUS expression in leaves, while in shoots slight expression was observed for -1210 and -886 bp flanking region. The -1210 bp deletion significantly responded to exogenous methyl viologen and abscisic acid induction. The -1210 and -886 bp flanking region resulted in increased GUS activity in leaves under methyl jasmonate treatments, whereas in shoots the -886 bp and -519 bp deletion gave higher expression. Salicylic acid failed to induce GUS activities in leaves for all the constructs.The rice plasma membrane Ca(2+ATPase promoter is a reproductive organ-specific as well as vascular-specific. This promoter contains drought, salt, cold, methyl viologen, abscisic acid and methyl jasmonate related cis-elements, which regulated gene expression. Overall, the tissue-specificity and inducible
Pagoto, Sherry L; Schneider, Kristin L; Oleski, Jessica; Bodenlos, Jamie S; Ma, Yunsheng
2010-09-01
To examine the impact of a skin cancer prevention intervention that promoted sunless tanning as a substitute for sunbathing. Randomized controlled trial. Public beaches in Massachusetts. Women (N = 250) were recruited to participate in the study during their visit to a public beach. Intervention The intervention included motivational messages to use sunless tanning as an alternative to UV tanning, instructions for proper use of sunless tanning products, attractive images of women with sunless tans, a free trial of a sunless tanning product, skin cancer education, and UV imaging. The control participants completed surveys. The primary outcome was sunbathing 2 months and 1 year after the intervention. Secondary outcomes included sunburns, sun protection use, and sunless tanning. At 2 months, intervention participants reduced their sunbathing significantly more than did controls and reported significantly fewer sunburns and greater use of protective clothing. At 1 year, intervention participants reported significant decreases in sunbathing and increases in sunless tanning relative to control participants but no differences in the other outcomes. This intervention, which promoted sunless tanning as an alternative to UV tanning, had a short-term effect on sunbathing, sunburns, and use of protective clothing and a longer-term effect on sunbathing and sunless tanning. clinicaltrials.gov Identifier: NCT00403377.
Radioactive Decontamination by Strippable Paint
International Nuclear Information System (INIS)
Chantaraparprachoom, N.; Mishima, K.
1998-01-01
The strippable paint, one of the adhesion method, is to decontaminate solid surface of materials or/and a large area. Two kinds of specimen planchet, SUS 304 stainless steel and polycarbonate plastic, contaminated with radioactive 137 Cs were studied under various conditions. It included surface bottom types, the flat and convex concentric circle type, normal condition at room temperature and overheat condition (∼80 degree celsius). This method used coating paints which contains some elements to have a reaction with radioactive materials selectively. ALARA-Decon clear, Rempack-X200 clear, JD-P5-Mrs.Coat and Pro-Blue-color guard were selected to use as the coating paints. The contaminated surface was coated by the strippable paint under the optimum time, followed by peeling the paint seal. The Rempack-X200 showed the best result, the highest decontamination efficiency which are about 99-100% for all conditions of specimens. The JD-P5 and ALARA-Decon showed good results, which are 98-99% decontamination efficiency for the normal condition set of specimens and about 94-97% for the overheat set of specimens. They can decontaminate polycarbonate specimens better than stainless steel specimens. The Pro-Blue-color guard showed the lowest decontamination efficiency of which 60% for polycarbonate specimens at normal condition and 40%, 30% for stainless steel specimens at normal and overheat conditions respectively. There was no effects of surface bottom types significantly
International Nuclear Information System (INIS)
Ou Xunmin; Zhang Xiliang; Chang Shiyan
2010-01-01
The Chinese government has enacted policies to promote alternative vehicle fuels (AVFs) and alternative fuel vehicles (AFVs), including city bus fleets. The life cycle (LC), energy savings (ES) and GHG reduction (GR) profiles of AVFs/AFVs are critical to those policy decisions. The well-to-wheels module of the Tsinghua-CA3EM model is employed to investigate actual performance data. Compared with conventional buses, AFVs offer differences in performance in terms of both ES and GR. Only half of the AFVs analyzed demonstrate dual benefits. However, all non-oil/gas pathways can substitute oil/gas with coal. Current policies seek to promote technology improvements and market creation initiatives within the guiding framework of national-level diversification and district-level uniformity. Combined with their actual LC behavior and in keeping with near- and long-term strategies, integrated policies should seek to (1) apply hybrid electric technology to diesel buses; (2) encourage NG/LPG buses in gas-abundant cities; (3) promote commercialize electric buses or plug-in capable vehicles through battery technology innovation; (4) support fuel cell buses and hydrogen technology R and D for future potential applications; and (5) conduct further research on boosting vehicle fuel efficiency, applying low-carbon transportation technologies, and addressing all resultant implications of coal-based transportation solutions to human health and natural resources.
Energy Technology Data Exchange (ETDEWEB)
Ou Xunmin, E-mail: oxm07@mails.tsinghua.edu.c [School of Public Policy and Management (SPPM), Tsinghua University, Beijing 100084 (China); China Automotive Energy Research Center (CAERC), Tsinghua University, Beijing 100084 (China); Institute of Energy, Environment and Economy (3E), Tsinghua University, Beijing 100084 (China); Zhang Xiliang, E-mail: zhang_xl@tsinghua.edu.c [China Automotive Energy Research Center (CAERC), Tsinghua University, Beijing 100084 (China); Institute of Energy, Environment and Economy (3E), Tsinghua University, Beijing 100084 (China); Chang Shiyan [China Automotive Energy Research Center (CAERC), Tsinghua University, Beijing 100084 (China); Institute of Energy, Environment and Economy (3E), Tsinghua University, Beijing 100084 (China)
2010-01-15
The Chinese government has enacted policies to promote alternative vehicle fuels (AVFs) and alternative fuel vehicles (AFVs), including city bus fleets. The life cycle (LC), energy savings (ES) and GHG reduction (GR) profiles of AVFs/AFVs are critical to those policy decisions. The well-to-wheels module of the Tsinghua-CA3EM model is employed to investigate actual performance data. Compared with conventional buses, AFVs offer differences in performance in terms of both ES and GR. Only half of the AFVs analyzed demonstrate dual benefits. However, all non-oil/gas pathways can substitute oil/gas with coal. Current policies seek to promote technology improvements and market creation initiatives within the guiding framework of national-level diversification and district-level uniformity. Combined with their actual LC behavior and in keeping with near- and long-term strategies, integrated policies should seek to (1) apply hybrid electric technology to diesel buses; (2) encourage NG/LPG buses in gas-abundant cities; (3) promote commercialize electric buses or plug-in capable vehicles through battery technology innovation; (4) support fuel cell buses and hydrogen technology R and D for future potential applications; and (5) conduct further research on boosting vehicle fuel efficiency, applying low-carbon transportation technologies, and addressing all resultant implications of coal-based transportation solutions to human health and natural resources.
Energy Technology Data Exchange (ETDEWEB)
Ou, Xunmin [School of Public Policy and Management (SPPM), Tsinghua University, Beijing 100084 (China); China Automotive Energy Research Center (CAERC), Tsinghua University, Beijing 100084 (China); Institute of Energy, Environment and Economy (3E), Tsinghua University, Beijing 100084 (China); Zhang, Xiliang; Chang, Shiyan [China Automotive Energy Research Center (CAERC), Tsinghua University, Beijing 100084 (China); Institute of Energy, Environment and Economy (3E), Tsinghua University, Beijing 100084 (China)
2010-01-15
The Chinese government has enacted policies to promote alternative vehicle fuels (AVFs) and alternative fuel vehicles (AFVs), including city bus fleets. The life cycle (LC), energy savings (ES) and GHG reduction (GR) profiles of AVFs/AFVs are critical to those policy decisions. The well-to-wheels module of the Tsinghua-CA3EM model is employed to investigate actual performance data. Compared with conventional buses, AFVs offer differences in performance in terms of both ES and GR. Only half of the AFVs analyzed demonstrate dual benefits. However, all non-oil/gas pathways can substitute oil/gas with coal. Current policies seek to promote technology improvements and market creation initiatives within the guiding framework of national-level diversification and district-level uniformity. Combined with their actual LC behavior and in keeping with near- and long-term strategies, integrated policies should seek to (1) apply hybrid electric technology to diesel buses; (2) encourage NG/LPG buses in gas-abundant cities; (3) promote commercialize electric buses or plug-in capable vehicles through battery technology innovation; (4) support fuel cell buses and hydrogen technology R and D for future potential applications; and (5) conduct further research on boosting vehicle fuel efficiency, applying low-carbon transportation technologies, and addressing all resultant implications of coal-based transportation solutions to human health and natural resources. (author)
DNA of HeLa cells during caffeine-promoted recovery from X-ray induced G2 arrest
International Nuclear Information System (INIS)
Bases, R.; Mendez, F.; Liebeskind, D.; Elequin, F.; Neubort, S.
1980-01-01
Progression of X-irradiated HeLa cells from G2 arrest through mitosis was promoted by 1mM caffeine. Caffeine promoted the return from abnormally high levels of radiation-induced immunoreactivity to antinucleoside antibodies, which indicates persistent DNA strand separation, to the low levels normally found in G2. With caffeine, the irradiated cells progressed through mitosis, producing daughter cells with the normal G1 content of DNA. Without caffeine, the DNA content of individual radiation-arrested cells retained G2 values and the abnormally high levels of immunoreactivity to antinucleoside antibodies. (author)
Directory of Open Access Journals (Sweden)
Surleen Kaur
2016-03-01
Full Text Available Insulin receptor substrate-2 (IRS-2 plays critical role in the regulation of various metabolic processes by insulin and IGF-1. The defects in its expression and/or function are linked to diseases like polycystic ovary syndrome (PCOS, insulin resistance and cancer. To predict the transcription factors (TFs responsible for the regulation of human IRS-2 gene expression, the transcription factor binding sites (TFBS and the corresponding TFs were investigated by analysis of IRS-2 promoter sequence using MatInspector Genomatix software (Cartharius et al., 2005 [1]. The ibid data is part of author׳s publication (Anjali et al., 2015 [2] that explains Follicle stimulating hormone (FSH mediated IRS-2 promoter activation in human granulosa cells and its importance in the pathophysiology of PCOS. Further analysis was carried out for binary interactions of TF regulatory genes in IRS-2 network using Cytoscape software tool and R-code. In this manuscript, we describe the methodology used for the identification of TFBSs in human IRS-2 promoter region and provide details on experimental procedures, analysis method, validation of data and also the raw files. The purpose of this article is to provide the data on all TFBSs in the promoter region of human IRS-2 gene as it has the potential for prediction of the regulation of IRS-2 gene in normal or diseased cells from patients with metabolic disorders and cancer. Keywords: IRS-2, TFBS, FSH, SP1, ChIP
[HER2 gene amplification assay: is CISH an alternative to FISH?].
Denoux, Yves; Arnould, Laurent; Fiche, Maryse; Lannes, B; Couturier, Jérôme; Vincent-Salomon, Anne; Penault-Llorca, Frédérique; Antoine, M; Balaton, A; Baranzelli, M C; Becette, V; Bellocq, J P; Bibeau, F; Ettore, F; Fridman, V; Gnassia, J P; Jacquemier, J; MacGrogan, G; Mathieu, M C; Migeon, C; Rigaud, C; Roger, P; Sigal-Zafrani, B; Simony-Lafontaine, J; Trassard, M; Treilleux, I; Verriele, V; Voigt, J J
2003-12-01
The HER2 proto-oncogene encodes a transmembrane protein, which is considered to function as a growth factor receptor. Overexpression of this protein found by immunohistochemistry in about 20% of infiltrating breast carcinomas, has a predictive value of response to treatment by trastuzumab, an anti-HER2 humanized monoclonal antibody. Search for HER2 gene amplification is necessary to adapt the immunohistochemical technique quality and also in the cases of delicate analysis or weak overexpression. It is usually carried out by Fluorescence In Situ Hybridization (FISH). A more recent hybridization technique, named CISH because of its chromogenic revelation is an alternative method, which gives highly correlated results with FISH. We present details of this technique, which may be more familiar for the pathologists than FISH, because reading analysis is similar to that of immunohistochemical staining.
Differential SLC1A2 Promoter Methylation in Bipolar Disorder With or Without Addiction
Directory of Open Access Journals (Sweden)
Yun-Fang Jia
2017-07-01
Full Text Available While downregulation of excitatory amino acid transporter 2 (EAAT2, the main transporter removing glutamate from the synapse, has been recognized in bipolar disorder (BD, the underlying mechanisms of downregulation have not been elucidated. BD is influenced by environmental factors, which may, via epigenetic modulation of gene expression, differentially affect illness presentation. This study thus focused on epigenetic DNA methylation regulation of SLC1A2, encoding for EAAT2, in BD with variable environmental influences of addiction. High resolution melting PCR (HRM-PCR and thymine–adenine (TA cloning with sequence analysis were conducted to examine methylation of the promoter region of the SLC1A2. DNA was isolated from blood samples drawn from BD patients (N = 150 with or without addiction to alcohol, nicotine, or food, defined as binge eating, and matched controls (N = 32. In comparison to controls, the SLC1A2 promoter region was hypermethylated in BD without addiction but was hypomethylated in BD with addiction. After adjusting for age and sex, the association of methylation levels with nicotine addiction (p = 0.0009 and binge eating (p = 0.0002 remained significant. Consistent with HRM-PCR, direct sequencing revealed increased methylation in CpG site 6 in BD, but decreased methylation in three CpG sites (6, 48, 156 in BD with alcohol and nicotine addictions. These results suggest that individual point methylation within the SLC1A2 promoter region may be modified by exogenous addiction and may have a potential for developing clinically valuable epigenetic biomarkers for BD diagnosis and monitoring.
DEFF Research Database (Denmark)
Knudsen, Jan Dines; Johanson, Ted; Eliasson Lantz, Anna
2015-01-01
A control point for keeping redox homeostasis in Saccharomyces cerevisiae during fermentative growth is the dynamic regulation of transcription for the glycerol-3-phosphate dehydrogenase 2 (GPD2) gene. In this study, the possibility to steer the activity of the GPD2 promoter was investigated by p...
An, Ming-Xin; Li, Si; Yao, Han-Bing; Li, Chao; Wang, Jia-Mei; Sun, Jia; Li, Xin-Yu; Meng, Xiao-Na; Wang, Hua-Qin
2017-12-04
Aerobic glycolysis, a phenomenon known historically as the Warburg effect, is one of the hallmarks of cancer cells. In this study, we characterized the role of BAG3 in aerobic glycolysis of pancreatic ductal adenocarcinoma (PDAC) and its molecular mechanisms. Our data show that aberrant expression of BAG3 significantly contributes to the reprogramming of glucose metabolism in PDAC cells. Mechanistically, BAG3 increased Hexokinase 2 (HK2) expression, the first key enzyme involved in glycolysis, at the posttranscriptional level. BAG3 interacted with HK2 mRNA, and the degree of BAG3 expression altered recruitment of the RNA-binding proteins Roquin and IMP3 to the HK2 mRNA. BAG3 knockdown destabilized HK2 mRNA via promotion of Roquin recruitment, whereas BAG3 overexpression stabilized HK2 mRNA via promotion of IMP3 recruitment. Collectively, our results show that BAG3 promotes reprogramming of glucose metabolism via interaction with HK2 mRNA in PDAC cells, suggesting that BAG3 may be a potential target in the aerobic glycolysis pathway for developing novel anticancer agents. © 2017 An et al.
Higashi-Kuwata, Nobuyo; Makino, Takamitsu; Inoue, Yuji; Takeya, Motohiro; Ihn, Hironobu
2009-08-01
Localized scleroderma is a connective tissue disorder that is limited to the skin and subcutaneous tissue. Macrophages have been reported to be particularly activated in patients with skin disease including systemic sclerosis and are potentially important sources for fibrosis-inducing cytokines, such as transforming growth factor beta. To clarify the features of immunohistochemical characterization of the immune cell infiltrates in localized scleroderma focusing on macrophages, skin biopsy specimens were analysed by immunohistochemistry. The number of cells stained with monoclonal antibodies, CD68, CD163 and CD204, was calculated. An evident macrophage infiltrate and increased number of alternatively activated macrophages (M2 macrophages) in their fibrotic areas were observed along with their severity of inflammation. This study revealed that alternatively activated macrophages (M2 macrophages) may be a potential source of fibrosis-inducing cytokines in localized scleroderma, and may play a crucial role in the pathogenesis of localized scleroderma.
Glycine Receptor α2 Subunit Activation Promotes Cortical Interneuron Migration
Directory of Open Access Journals (Sweden)
Ariel Avila
2013-08-01
Full Text Available Glycine receptors (GlyRs are detected in the developing CNS before synaptogenesis, but their function remains elusive. This study demonstrates that functional GlyRs are expressed by embryonic cortical interneurons in vivo. Furthermore, genetic disruption of these receptors leads to interneuron migration defects. We discovered that extrasynaptic activation of GlyRs containing the α2 subunit in cortical interneurons by endogenous glycine activates voltage-gated calcium channels and promotes calcium influx, which further modulates actomyosin contractility to fine-tune nuclear translocation during migration. Taken together, our data highlight the molecular events triggered by GlyR α2 activation that control cortical tangential migration during embryogenesis.
β-elemene inhibits tumor-promoting effect of M2 macrophages in lung cancer.
Yu, Xiaomu; Xu, Maoyi; Li, Na; Li, Zongjuan; Li, Hongye; Shao, Shujuan; Zou, Kun; Zou, Lijuan
2017-08-19
Macrophages in tumor are mostly M2-polarized and have been reported to promote tumorigenesis, which are also defined as tumor-associated macrophages (TAMs). β-elemene has therapeutic effects against several cancers, however, it remains unknown whether β-elemene could inhibit cancer by targeting TAMs. Herein, we examined the effect of β-elemene on macrophages to elucidate a novel mechanism of β-elemene in tumor therapy. We showed that the conditioned medium of M2 macrophages promoted lung cancer cells to migration, invasion and epithelial mesenchymal transition, which could be inhibited by β-elemene. Moreover, β-elemene regulated the polarization of macrophages from M2 to M1. β-elemene also inhibited the proliferation, migration, invasion of lung cancer cells and enhanced its radiosensitivity. These results indicate β-elemene suppresses lung cancer by regulating both macrophages and lung cancer cells, it is a promising drug for combination with chemotherapy or radiotherapy. Copyright © 2017 Elsevier Inc. All rights reserved.
Excitation of bond-alternating spin-1/2 Heisenberg chains by tunnelling electrons
International Nuclear Information System (INIS)
Gauyacq, J-P; Lorente, N
2014-01-01
Inelastic electron tunneling spectra (IETS) are evaluated for spin-1/2 Heisenberg chains showing different phases of their spin ordering. The spin ordering is controlled by the value of the two different Heisenberg couplings on the two sides of each of the chain's atoms (bond-alternating chains). The perfect anti-ferromagnetic phase, i.e. a unique exchange coupling, marks a topological quantum phase transition (TQPT) of the bond-alternating chain. Our calculations show that the TQPT is recognizable in the excited states of the chain and hence that IETS is in principle capable of discriminating the phases. We show that perfectly symmetric chains, such as closed rings mimicking infinite chains, yield the same spectra on both sides of the TQPT and IETS cannot reveal the nature of the spin phase. However, for finite size open chains, both sides of the TQPT are associated with different IETS spectra, especially on the edge atoms, thus outlining the transition. (paper)
Directory of Open Access Journals (Sweden)
Kristi M Porter
Full Text Available Pulmonary Hypertension (PH is a progressive disorder characterized by endothelial dysfunction and proliferation. Hypoxia induces PH by increasing vascular remodeling. A potential mediator in hypoxia-induced PH development is arachidonate 5-Lipoxygenase (ALOX5. While ALOX5 metabolites have been shown to promote pulmonary vasoconstriction and endothelial cell proliferation, the contribution of ALOX5 to hypoxia-induced proliferation remains unknown. We hypothesize that hypoxia exposure stimulates HPAEC proliferation by increasing ALOX5 expression and activity. To test this, human pulmonary artery endothelial cells (HPAEC were cultured under normoxic (21% O2 or hypoxic (1% O2 conditions for 24-, 48-, or 72 hours. In a subset of cells, the ALOX5 inhibitor, zileuton, or the 5-lipoxygenase activating protein inhibitor, MK-886, was administered during hypoxia exposure. ALOX5 expression was measured by qRT-PCR and western blot and HPAEC proliferation was assessed. Our results demonstrate that 24 and 48 hours of hypoxia exposure have no effect on HPAEC proliferation or ALOX5 expression. Seventy two hours of hypoxia significantly increases HPAEC ALOX5 expression, hydrogen peroxide (H2O2 release, and HPAEC proliferation. We also demonstrate that targeted ALOX5 gene silencing or inhibition of the ALOX5 pathway by pharmacological blockade attenuates hypoxia-induced HPAEC proliferation. Furthermore, our findings indicate that hypoxia-induced increases in cell proliferation and ALOX5 expression are dependent on H2O2 production, as administration of the antioxidant PEG-catalase blocks these effects and addition of H2O2 to HPAEC promotes proliferation. Overall, these studies indicate that hypoxia exposure induces HPAEC proliferation by activating the ALOX5 pathway via the generation of H2O2.
Finding theory- and evidence-based alternatives to fear appeals: Intervention Mapping.
Kok, Gerjo; Bartholomew, L Kay; Parcel, Guy S; Gottlieb, Nell H; Fernández, María E
2014-04-01
Fear arousal-vividly showing people the negative health consequences of life-endangering behaviors-is popular as a method to raise awareness of risk behaviors and to change them into health-promoting behaviors. However, most data suggest that, under conditions of low efficacy, the resulting reaction will be defensive. Instead of applying fear appeals, health promoters should identify effective alternatives to fear arousal by carefully developing theory- and evidence-based programs. The Intervention Mapping (IM) protocol helps program planners to optimize chances for effectiveness. IM describes the intervention development process in six steps: (1) assessing the problem and community capacities, (2) specifying program objectives, (3) selecting theory-based intervention methods and practical applications, (4) designing and organizing the program, (5) planning, adoption, and implementation, and (6) developing an evaluation plan. Authors who used IM indicated that it helped in bringing the development of interventions to a higher level. © 2013 The Authors. International Journal of Psychology published by John Wiley © Sons Ltd on behalf of International Union of Psychological Science.
Alternative Fuel News, Vol. 2, No. 6
Energy Technology Data Exchange (ETDEWEB)
NREL
1999-03-17
The cover story in this issue of the Alternative Fuel News highlights the niche market principle; the places in which AFVs would best fit. This year's SEP funding is expected to be the springboard needed for the development of niche projects. The Clean Cities Program, by matching those needs and attributes in niches, can dramatically increase the attractiveness of AFVs and make an impact on those high-mileage, high-use fleets.
DEFF Research Database (Denmark)
Garcia-Suarez, Eduardo J.; Khokarale, Santosh Govind; Nguyen van Buu, Olivier
2014-01-01
Brønsted acid ionic liquids (BAILs) were prepared and applied as combined acid promoters and reaction media in Pd–phosphine catalyzed methoxycarbonylation of ethylene to produce methyl propionate. The BAILs served as alternatives to common mineral acids required for the reaction, e.g. methanesulf......Brønsted acid ionic liquids (BAILs) were prepared and applied as combined acid promoters and reaction media in Pd–phosphine catalyzed methoxycarbonylation of ethylene to produce methyl propionate. The BAILs served as alternatives to common mineral acids required for the reaction, e...
International Nuclear Information System (INIS)
Cranston, G.V.
1986-01-01
This paper proposes an information dissemination program to adequately familiarize the public with the actual health and safety risks of nuclear energy development. It plans for a discussion panel for alternatives available to promote revitalization of nuclear power in the US. It also provides for technology transfer between contractors, designers, and training staff. It recognizes problem areas in licensing and certification by the Nuclear Regulatory Commission and ways to standardize the administrative procedures
Muñoz Gómez, M; Bisbe Vives, E; Basora Macaya, M; García Erce, J A; Gómez Luque, A; Leal-Noval, S R; Colomina, M J; Comin Colet, J; Contreras Barbeta, E; Cuenca Espiérrez, J; Garcia de Lorenzo Y Mateos, A; Gomollón García, F; Izuel Ramí, M; Moral García, M V; Montoro Ronsano, J B; Páramo Fernández, J A; Pereira Saavedra, A; Quintana Diaz, M; Remacha Sevilla, Á; Salinas Argente, R; Sánchez Pérez, C; Tirado Anglés, G; Torrabadella de Reinoso, P
2015-12-01
In recent years, several safety alerts have questioned or restricted the use of some pharmacological alternatives to allogeneic blood transfusion in established indications. In contrast, there seems to be a promotion of other alternatives, based on blood products and/or antifibrinolytic drugs, which lack a solid scientific basis. The Multidisciplinary Autotransfusion Study Group and the Anemia Working Group España convened a multidisciplinary panel of 23 experts belonging to different healthcare areas in a forum for debate to: 1) analyze the different safety alerts referred to certain transfusion alternatives; 2) study the background leading to such alternatives, the evidence supporting them, and their consequences for everyday clinical practice, and 3) issue a weighted statement on the safety of each questioned transfusion alternative, according to its clinical use. The members of the forum maintained telematics contact for the exchange of information and the distribution of tasks, and a joint meeting was held where the conclusions on each of the items examined were presented and discussed. A first version of the document was drafted, and subjected to 4 rounds of review and updating until consensus was reached (unanimously in most cases). We present the final version of the document, approved by all panel members, and hope it will be useful for our colleagues. Copyright © 2015 Elsevier España, S.L.U. and SEMICYUC. All rights reserved.
International Nuclear Information System (INIS)
Zaid, A.; Salem, Gh.
2012-01-01
The GC-box is an important transcriptional regulatory element present in the promoters of many mammalian genes, and is found in most, if not all, oxidative phosphorylation (OXPHOS) promoters. In the present study we examine the effects of three Spl family members (Sp2, Sp3, and Sp4) on the adenine nucleotide translocase 2, cytochrome cl, Fl-ATPase β-subunit, and the mitochondria transcription factor (mtTFA) promoters in Drosophila SL2 cell line. Sp3, like Spl, strongly activates transcription all four promoters. SP4 stimulates, moderately, but Sp2 had no effect. In addition, Sp3 can, like Spl, inhibit transcription from the proximal promoter of the ANT2 gene through binding to the Cbox GC element. By contrast, Sp4 and Sp2 do not repress promoter activity. Furthermore, since Sp4 and Sp2 bind to the Cbox repression element on the ANT2 promoter, but do not repress transcription, inhibition of transcription cannot be explained by steric hindrance of pre-initiation complex assembly. These data suggest that different Spl family members differentially affect transcription from the OXPHOS promoters.
Directory of Open Access Journals (Sweden)
So Masaki
Full Text Available Transforming growth factor beta (TGF-β has critical roles in regulating cell growth, differentiation, apoptosis, invasion and epithelial-mesenchymal transition (EMT of various cancer cells. TGF-β-induced EMT is an important step during carcinoma progression to invasion state. Thioredoxin binding protein-2 (TBP-2, also called Txnip or VDUP1 is downregulated in various types of human cancer, and its deficiency results in the earlier onset of cancer. However, it remains unclear how TBP-2 suppresses the invasion and metastasis of cancer.In this study, we demonstrated that TBP-2 deficiency increases the transcriptional activity in response to TGF-β and also enhances TGF-β-induced Smad2 phosphorylation levels. Knockdown of TBP-2 augmented the TGF-β-responsive expression of Snail and Slug, transcriptional factors related to TGF-β-mediated induction of EMT, and promoted TGF-β-induced spindle-like morphology consistent with the depletion of E-Cadherin in A549 cells.Our results indicate that TBP-2 deficiency enhances TGF-β signaling and promotes TGF-β-induced EMT. The control of TGF-β-induced EMT is critical for the inhibition of the invasion and metastasis. Thus TBP-2, as a novel regulatory molecule of TGF-β signaling, is likely to be a prognostic indicator or a potential therapeutic target for preventing tumor progression.
Renewable energy sources (promotion)
International Nuclear Information System (INIS)
Cook, F.
1986-01-01
Permission to present a Bill to establish an independent commission directly responsible for the research, development and demonstration of clean, renewable, alternative sources of energy (to nuclear energy) is requested. The paragraphs of the preamble to the Bill are summarized by the Member seeking permission. The main reason for promoting renewable energy sources is opposition to the nuclear industry. One objection was raised. However, permission was granted to present the Bill and it was read for the first time with a second reading ordered for 7 March 1986. The Bill itself is not reprinted but the permission and question are reported verbatim. (U.K.)
Sohoni, Sujata Vijay; Fazio, Alessandro; Workman, Christopher T.; Mijakovic, Ivan; Lantz, Anna Eliasson
2014-01-01
The objective of this study was the application of the synthetic promoter library (SPL) technology for modulation of actinorhodin production in Streptomyces coelicolor A3(2). The SPL technology was used to optimize the expression of a pathway specific positive transcriptional regulator ActII orf4, which activates the transcription of the S. coelicolor actinorhodin biosynthetic gene cluster. The native actII orf4 promoter was replaced with synthetic promoters, generating a S. coelicolor library with a broad range of expression levels of actII orf4. The resulting library was screened based on the yield of actinorhodin. Selected strains were further physiologically characterized. One of the strains from the library, ScoSPL20, showed considerably higher yield of actinorhodin and final actinorhodin titer, compared to S. coelicolor wild type and S. coelicolor with actII orf4 expressed from a strong constitutive promoter. ScoSPL20 demonstrated exceptional productivity despite having a comparatively weak expression from the promoter. Interestingly, the ScoSPL20 promoter was activated at a much earlier stage of growth compared to the wild type, demonstrating the advantage of fine-tuning and temporal tuning of gene expression in metabolic engineering. Transcriptome studies were performed in exponential and actinorhodin-producing phase of growth to compare gene expression between ScoSPL20 and the wild type. To our knowledge, this is the first successful application of the SPL technology for secondary metabolite production in filamentous bacteria. PMID:24963940
International Nuclear Information System (INIS)
1980-08-01
The SPS Concept Development and Evaluation Program includes a comparative assessment. An early first step in the assessment process is the selection and characterization of alternative technologies. This document describes the cost and performance (i.e., technical and environmental) characteristics of six central station energy alternatives: (1) conventional coal-fired powerplant; (2) conventional light water reactor (LWR); (3) combined cycle powerplant with low-Btu gasifiers; (4) liquid metal fast breeder reactor (LMFBR); (5) photovoltaic system without storage; and (6) fusion reactor
Deletion of P2 promoter of GJB1 gene a cause of Charcot-Marie-Tooth disease.
Kulshrestha, R; Burton-Jones, S; Antoniadi, T; Rogers, M; Jaunmuktane, Z; Brandner, S; Kiely, N; Manuel, R; Willis, T
2017-08-01
X-linked Charcot-Marie-Tooth disease (CMT) is the second most common cause of CMT, and is usually caused by mutations in the gap junction protein beta 1 (GJB1) gene. This gene has nerve specific P2 promoter that work synergistically with SOX10 and EGR2 genes to initiate transcription. Mutation in this region is known to cause Schwann cell dysfunction. A single large family of X linked peripheral neuropathy was identified in our practice. Next generation sequencing for targeted panel assay identified an upstream exon-splicing deletion identified extending from nucleotide c.-5413 to approximately - c.-49. This matches the sequence of 32 nucleotides at positions c.*218-*249 in the 3'UTR downstream of the GJB1 gene. The deleted fragment included the entire P2 promoter region. The deletion segregated with the disease. To our knowledge a deletion of the P2 promoter alone as a cause of CMT has not been reported previously. Copyright © 2017 Elsevier B.V. All rights reserved.
Characteristics of NaNO3-Promoted CdO as a Midtemperature CO2 Absorbent.
Kim, Kang-Yeong; Kwak, Jin-Su; An, Young-In; Oh, Kyung-Ryul; Kwon, Young-Uk
2017-06-28
In this study, we explored the reaction system CdO(s) + CO 2 (g) ⇄ CdCO 3 (s) as a model system for CO 2 capture agent in the intermediate temperature range of 300-400 °C. While pure CdO does not react with CO 2 at all up to 500 °C, CdO mixed with an appropriate amount of NaNO 3 (optimal molar ratio NaNO 3 /CdO = 0.14) greatly enhances the conversion of CdO into CdCO 3 up to ∼80% (5.68 mmol/g). These NaNO 3 -promoted CdO absorbents can undergo many cycles of absorption and desorption by temperature swing between 300 and 370 °C under a 100% CO 2 condition. Details of how NaNO 3 promotes the CO 2 absorption of CdO have been delineated through various techniques using thermogravimetry, coupled with X-ray diffraction and electron microscopy. On the basis of the observed data, we propose a mechanism of CO 2 absorption and desorption of NaNO 3 -promoted CdO. The absorption proceeds through a sequence of events of CO 2 adsorption on the CdO surface covered by NaNO 3 , dissolution of so-formed CdCO 3 , and precipitation of CdCO 3 particles in the NaNO 3 medium. The desorption occurs through the decomposition of CdCO 3 in the dissolved state in the NaNO 3 medium where CdO nanoparticles are formed dispersed in the NaNO 3 medium. The CdO nanoparticles are aggregated into micrometer-large particles with smooth surfaces and regular shapes.
Loo, Tze Mun; Kamachi, Fumitaka; Watanabe, Yoshihiro; Yoshimoto, Shin; Kanda, Hiroaki; Arai, Yuriko; Nakajima-Takagi, Yaeko; Iwama, Atsushi; Koga, Tomoaki; Sugimoto, Yukihiko; Ozawa, Takayuki; Nakamura, Masaru; Kumagai, Miho; Watashi, Koichi; Taketo, Makoto M; Aoki, Tomohiro; Narumiya, Shuh; Oshima, Masanobu; Arita, Makoto; Hara, Eiji; Ohtani, Naoko
2017-05-01
Obesity increases the risk of cancers, including hepatocellular carcinomas (HCC). However, the precise molecular mechanisms through which obesity promotes HCC development are still unclear. Recent studies have shown that gut microbiota may influence liver diseases by transferring its metabolites and components. Here, we show that the hepatic translocation of obesity-induced lipoteichoic acid (LTA), a Gram-positive gut microbial component, promotes HCC development by creating a tumor-promoting microenvironment. LTA enhances the senescence-associated secretory phenotype (SASP) of hepatic stellate cells (HSC) collaboratively with an obesity-induced gut microbial metabolite, deoxycholic acid, to upregulate the expression of SASP factors and COX2 through Toll-like receptor 2. Interestingly, COX2-mediated prostaglandin E 2 (PGE 2 ) production suppresses the antitumor immunity through a PTGER4 receptor, thereby contributing to HCC progression. Moreover, COX2 overexpression and excess PGE 2 production were detected in HSCs in human HCCs with noncirrhotic, nonalcoholic steatohepatitis (NASH), indicating that a similar mechanism could function in humans. Significance: We showed the importance of the gut-liver axis in obesity-associated HCC. The gut microbiota-driven COX2 pathway produced the lipid mediator PGE 2 in senescent HSCs in the tumor microenvironment, which plays a pivotal role in suppressing antitumor immunity, suggesting that PGE 2 and its receptor may be novel therapeutic targets for noncirrhotic NASH-associated HCC. Cancer Discov; 7(5); 522-38. ©2017 AACR. This article is highlighted in the In This Issue feature, p. 443 . ©2017 American Association for Cancer Research.
An Alternate Reality Game for Language Learning: ARGuing for Multilingual Motivation
Connolly, Thomas M.; Stansfield, Mark; Hainey, Thomas
2011-01-01
Over the last decade, Alternate Reality Games (ARGs), a form of narrative often involving multiple media and gaming elements to tell a story that might be affected by participants' actions, have been used in the marketing and promotion of a number of entertainment related products such as films, computer games and music. This paper discusses the…
Directory of Open Access Journals (Sweden)
Hongying Zhang
2017-07-01
Full Text Available Drought, salinity, and cold are the major factors limiting wheat quality and productivity; it is thus highly desirable to characterize the abiotic-stress-inducible promoters suitable for the genetic improvement of plant resistance. The sucrose non-fermenting 1-related protein kinase 2 (SnRK2 family genes show distinct regulatory properties in response to abiotic stresses. The present study characterized the approximately 3000-bp upstream sequence (the 313 bp upstream of the ATG was the transcription start site of the Triticum aestivum TaSnRK2.8 promoter under abscisic acid (ABA and abiotic stresses. Four different-length 5′ deletion fragments of TaSnRK2.8 promoter were fused with the GUS reporter gene and transformed into Arabidopsis. Tissue expression analysis showed that the TaSnRK2.8 promoter region from position -1481 to -821 contained the stalk-specific elements, and the region from position -2631 to -1481 contained the leaf- and root-specific elements. In the ABA-treated seedlings, the deletion analysis showed that the TaSnRK2.8 promoter region from position -821 to -2631 contained ABA response elements. The abiotic stress responses of the TaSnRK2.8 promoter derivatives demonstrated that they harbored abiotic-stress response elements: the region from position -821 to -408 harbored the osmotic-stress response elements, whereas the region from position -2631 to -1481 contained the positive regulatory motifs and the region from position -1481 to -821 contained the leaf- and stalk-specific enhancers. Further deletion analysis of the promoter region from position -821 to -408 indicated that a 125-bp region from position -693 to -568 was required to induce an osmotic-stress response. These results contribute to a better understanding of the molecular mechanisms of TaSnRK2.8 in response to abiotic stresses, and the TaSnRK2.8 promoter seems to be a candidate for regulating the expression of abiotic stress response genes in transgenic plants.
Growth hormone-promoted tyrosyl phosphorylation of SHC proteins and SHC association with Grb2
DEFF Research Database (Denmark)
VanderKuur, J; Allevato, G; Billestrup, Nils
1995-01-01
. To gain insight into pathways coupling GH receptor (GHR) to MAP kinase activation and signaling molecules that might interact with GHR and its associated tyrosine kinase JAK2, we examined whether SHC and Grb2 proteins serve as signaling molecules for GH. Human GH was shown to promote the rapid tyrosyl...... phosphorylation of 66-, 52-, and 46-kDa SHC proteins in 3T3-F442A fibroblasts. GH also promoted binding of GHR and JAK2 to the SH2 domain of 46/52-kDa SHC protein fused to glutathione S-transferase (GST). Constitutively phosphorylated JAK2, from COS-7 cells transiently transfected with murine JAK2 cDNA, bound......-638 and GHR1-638(Y333,338F), GH stimulated phosphorylation of all 3 SHC proteins whereas GH stimulated phosphorylation of only the 66- and 52-kDa SHC proteins in cells expressing GHR1-454. GH had no effect on SHC phosphorylation in cells expressing GHR1-294 or GHR delta P, the latter lacking amino acids 297...
Statins Activate Human PPAR Promoter and Increase PPAR mRNA Expression and Activation in HepG2 Cells
Directory of Open Access Journals (Sweden)
Makoto Seo
2008-01-01
Full Text Available Statins increase peroxisome proliferator-activated receptor (PPAR mRNA expression, but the mechanism of this increased PPAR production remains elusive. To examine the regulation of PPAR production, we examined the effect of 7 statins (atorvastatin, cerivastatin, fluvastatin, pitavastatin, pravastatin, rosuvastatin, and simvastatin on human PPAR promoter activity, mRNA expression, nuclear protein levels, and transcriptional activity. The main results are as follows. (1 Majority of statins enhanced PPAR promoter activity in a dose-dependent manner in HepG2 cells transfected with the human PPAR promoter. This enhancement may be mediated by statin-induced HNF-4. (2 PPAR mRNA expression was increased by statin treatment. (3 The PPAR levels in nuclear fractions were increased by statin treatment. (4 Simvastatin, pravastatin, and cerivastatin markedly enhanced transcriptional activity in 293T cells cotransfected with acyl-coenzyme A oxidase promoter and PPAR/RXR expression vectors. In summary, these data demonstrate that PPAR production and activation are upregulated through the PPAR promoter activity by statin treatment.
Directory of Open Access Journals (Sweden)
Jianjing eYang
2016-03-01
Full Text Available Neuro-inflammation plays an important role in the recovery of brain injury after stroke. Microglia/macrophage is the major executor in the neuro-inflammation, which can be polarized into two distinct phenotypes: injurious/toxic classical activation (M1 phenotype and protective alternative activation (M2 phenotype. Here, we investigated whether intracerebral administration of interleukin-4 (IL-4 at an early stage could affect the activation of microglia/macrophage and the corresponding outcome after intracerebral hemorrhage (ICH. The neuro-behavior was recorded between different groups in the rat ICH model. The M1 and M2 markers were then determined by qRT-PCR, western blotting, ELISA and immunofluorescence, respectively. We observed aberrant activation of microglia/macrophage after ICH. After intracerebral injection of IL-4, M1 activation was greatly inhibited while M2 activation was enhanced, along with improving neurobehavioral recovery from deficits after ICH. Our study showed that early intracerebral injection of IL-4 potentially promotes neuro-functional recovery, probably through enhancing the alternative activation of microglia/macrophage.
Kim, Kyoung-Han; Kim, Yun Hye; Son, Joe Eun; Lee, Ju Hee; Kim, Sarah; Choe, Min Seon; Moon, Joon Ho; Zhong, Jian; Fu, Kiya; Lenglin, Florine; Yoo, Jeong-Ah; Bilan, Philip J; Klip, Amira; Nagy, Andras; Kim, Jae-Ryong; Park, Jin Gyoon; Hussein, Samer Mi; Doh, Kyung-Oh; Hui, Chi-Chung; Sung, Hoon-Ki
2017-11-01
Intermittent fasting (IF), a periodic energy restriction, has been shown to provide health benefits equivalent to prolonged fasting or caloric restriction. However, our understanding of the underlying mechanisms of IF-mediated metabolic benefits is limited. Here we show that isocaloric IF improves metabolic homeostasis against diet-induced obesity and metabolic dysfunction primarily through adipose thermogenesis in mice. IF-induced metabolic benefits require fasting-mediated increases of vascular endothelial growth factor (VEGF) expression in white adipose tissue (WAT). Furthermore, periodic adipose-VEGF overexpression could recapitulate the metabolic improvement of IF in non-fasted animals. Importantly, fasting and adipose-VEGF induce alternative activation of adipose macrophage, which is critical for thermogenesis. Human adipose gene analysis further revealed a positive correlation of adipose VEGF-M2 macrophage-WAT browning axis. The present study uncovers the molecular mechanism of IF-mediated metabolic benefit and suggests that isocaloric IF can be a preventive and therapeutic approach against obesity and metabolic disorders.
Kim, Kyoung-Han; Kim, Yun Hye; Son, Joe Eun; Lee, Ju Hee; Kim, Sarah; Choe, Min Seon; Moon, Joon Ho; Zhong, Jian; Fu, Kiya; Lenglin, Florine; Yoo, Jeong-Ah; Bilan, Philip J; Klip, Amira; Nagy, Andras; Kim, Jae-Ryong; Park, Jin Gyoon; Hussein, Samer MI; Doh, Kyung-Oh; Hui, Chi-chung; Sung, Hoon-Ki
2017-01-01
Intermittent fasting (IF), a periodic energy restriction, has been shown to provide health benefits equivalent to prolonged fasting or caloric restriction. However, our understanding of the underlying mechanisms of IF-mediated metabolic benefits is limited. Here we show that isocaloric IF improves metabolic homeostasis against diet-induced obesity and metabolic dysfunction primarily through adipose thermogenesis in mice. IF-induced metabolic benefits require fasting-mediated increases of vascular endothelial growth factor (VEGF) expression in white adipose tissue (WAT). Furthermore, periodic adipose-VEGF overexpression could recapitulate the metabolic improvement of IF in non-fasted animals. Importantly, fasting and adipose-VEGF induce alternative activation of adipose macrophage, which is critical for thermogenesis. Human adipose gene analysis further revealed a positive correlation of adipose VEGF-M2 macrophage-WAT browning axis. The present study uncovers the molecular mechanism of IF-mediated metabolic benefit and suggests that isocaloric IF can be a preventive and therapeutic approach against obesity and metabolic disorders. PMID:29039412
Yildiz, Esra; Kavuran, Esin
2018-03-01
A healthy promotion is important for maintaining health and preventing complications in patients with type 2 diabetes. The aim of the present study was to examine the psychometrics of a recently developed tool that can be used to screen for a health-promoting lifestyle in patients with type 2 diabetes. Data were collected from outpatients attending diabetes clinics. The Type 2 Diabetes and Health Promotion Scale (T2DHPS) and a demographic questionnaire were administered to 295 participants. Forward-backward translation of the original English version was used to develop a Turkish version. Internal consistency of the scale was assessed by Cronbach's alpha. An explanatory factor analysis and confirmatory factor analysis used validity of the Type 2 Diabetes and Health Promotion Scale - Turkish version. Kaiser-Meyer-Olkin (KMO) and Bartlett's sphericity tests showed that the sample met the criteria required for factor analysis. The reliability coefficient for the total scale was 0.84, and alpha coefficients for the subscales ranged from 0.57 to 0.92. A six-factor solution was obtained that explained 59.3% of the total variance. The ratio of chi-square statistics to degrees of freedom (χ 2 /df) 3.30 (χ 2 = 1157.48/SD = 350); error of root mean square approximation (RMSEA) 0.061; GFI value of 0.91 and comparative fit index (CFI) value was obtained as 0.91. Turkish version of The T2DHPS is a valid and reliable tool that can be used to assess patients' health-promoting lifestyle behaviours. Validity and reliability studies in different cultures and regions are recommended. © 2017 Nordic College of Caring Science.
Chen, Hai-Wen
2008-04-01
Based on his early graduated studies in psychophysics, the author has, in recent years, applied psychophysics for studying organic and motor senses (the two sensory systems deeply embedded inside of human body), and tried to understand the scientific foundation of the oriental health promoting practices. The preliminary results are promising and are discussed in detail in this paper. Psychophysics studies of organic and motor senses may be the tool to provide the connection between Western and Eastern medicines to form a balanced holistic medicine approach, and may help us to understand the scientific foundation of mysterious oriental health Promoting practices that serve as alternative medicines for promoting human wellness against illness.
International Nuclear Information System (INIS)
Villamizar Moreno, J.
1999-01-01
The article shows the results of a proposal of alternative handling of the agriculture ecosystem tobacco-bean-maize, main agricultural activity of the Northeastern Andes of Colombia. This system is the base of the economic and alimentary security and the main factor of degradation of the natural resources of the region. The work looks for to develop the diversified rotations, as essential component of biological diversity, the reduced works as strategy of protection of the soil and the promotion of the agriculture ecology like new model of agricultural development. The results of the work show that the high volume of organic residuals coming from the rotation tobacco bean maize, become compost in the field and the reduction of the farm, they promote the stability of the productive components of the soils and their agricultural yields. The biggest levels of organic matter and of total porosity, generated by the biggest biological activity, they indicate that the technological alternatives of the proposal slow the effects of the degradation originated by the conventional agriculture. These alternatives can be included in the regional programs of agricultural production, like solution principle and as strategy for the sustainable development of the region
Group Motivational Interviewing in Schools: Development of a Health Promotion Intervention
Hawkins, Jemma L.; Bravo, Paulina; Gobat, Nina; Rollnick, Stephen; Jerzembek, Gabrielle; Whitehead, Sarah; Chanon, Sue; Kelson, Mark; Adams, Orla; Murphy, Simon
2016-01-01
Objective: In the light of the shortcomings of curriculum-based health promotion in secondary schools, group motivational interviewing provides a potential alternative approach. This two-phase study set out to establish the key components, feasibility and acceptability of a group motivational interviewing intervention, focused on alcohol…
Alternative Fuels Data Center: Maine Transportation Data for Alternative
Biodiesel-Blended Diesel Documentation Requirement Data Download Fueling Stations 149 stations in Maine with alternative fuels Fuel Public Private Biodiesel (B20 and above) 2 1 Compressed Natural Gas (CNG) 0 2 Electric ://www.youtube.com/embed/jHftlruFR40 Video thumbnail for Maine's Only Biodiesel Manufacturer Powers Fleets in the
Directory of Open Access Journals (Sweden)
Hua Geng
Full Text Available BACKGROUND: The apolipoprotein E gene (APOE coding polymorphism modifies the risks of Alzheimer's disease, type 2 diabetes, and coronary heart disease. Aside from the coding variants, single nucleotide polymorphism (SNP of the APOE promoter has also been shown to modify the risk of Alzheimer's disease. METHODOLOGY/PRINCIPAL FINDINGS: In this study we investigate the genotype-function relationship of APOE promoter polymorphism at molecular level and at physiological level: i.e., in transcription control of the gene and in the risk of type 2 diabetes. In molecular studies, the effect of the APOE -491A/T (rs449647 polymorphism on gene transcription was accessed by dual-luciferase reporter gene assays. The -491 A to T substitution decreased the activity (p<0.05 of the cloned APOE promoter (-1017 to +406. Using the -501 to -481 nucleotide sequence of the APOE promoter as a 'bait' to screen the human brain cDNA library by yeast one-hybrid system yielded ATF4, an endoplasmic reticulum stress response gene, as one of the interacting factors. Electrophoretic-mobility-shift assays (EMSA and chromatin immuno-precipitation (ChIP analyses further substantiated the physical interaction between ATF4 and the APOE promoter. Over-expression of ATF4 stimulated APOE expression whereas siRNA against ATF4 suppressed the expression of the gene. However, interaction between APOE promoter and ATF4 was not -491A/T-specific. At physiological level, the genotype-function relationship of APOE promoter polymorphism was studied in type 2 diabetes. In 630 cases and 595 controls, three APOE promoter SNPs -491A/T, -219G/T (rs405509, and +113G/C (rs440446 were genotyped and tested for association with type 2 diabetes in Hong Kong Chinese. No SNP or haplotype association with type 2 diabetes was detected. CONCLUSIONS/SIGNIFICANCE: At molecular level, polymorphism -491A/T and ATF4 elicit independent control of APOE gene expression. At physiological level, no genotype
Complementary and alternative medicine - representations in popular magazines.
Dunne, Alexandra; Phillips, Christine
2010-09-01
More than half the patients who use complementary and alternative medicine (CAM) in Australia do not discuss it with their doctors. Many consumers use popular media, especially women's magazines, to learn about CAM. To explore representations of CAM in popular Australian women's magazines. Content analysis of three Australian magazines: Australian Women's Weekly, Dolly and New Idea published from January to June 2008. Of 220 references to CAM (4-17 references per issue), most were to biologically based practices, particularly 'functional foods', which enhance health. Most representations of CAM were positive (81.3% positive, 16.4% neutral, 2.3% negative). Explanations of modes of action of CAM tended to be biological but relatively superficial. Australian magazines cast CAM as safe therapy which enhances patient engagement in healthcare, and works in ways analogous to orthodox medical treatments. General practitioners can use discussions with their patients about CAM to encourage health promoting practices.
de Boer, Johannes W.; Alsters, Paul L.; Meetsma, Auke; Hage, Ronald; Browne, Wesley R.; Feringa, Ben L.
2008-01-01
The role played by the additives salicylic acid, L-ascorbic acid and oxalic acid in promoting the catalytic activity of [Mn(IV) (2)(O)(3)(tmtacn)(2)](PF(6))(2) {1(PF(6))(2), where tmtacn = N, N ', N ''-trimethyl-1,4,7-triazacyclononane} in the epoxidation and cis-dihydroxylation of alkenes with
MDM2 promoter SNP344T>A (rs1196333 status does not affect cancer risk.
Directory of Open Access Journals (Sweden)
Stian Knappskog
Full Text Available The MDM2 proto-oncogene plays a key role in central cellular processes like growth control and apoptosis, and the gene locus is frequently amplified in sarcomas. Two polymorphisms located in the MDM2 promoter P2 have been shown to affect cancer risk. One of these polymorphisms (SNP309T>G; rs2279744 facilitates Sp1 transcription factor binding to the promoter and is associated with increased cancer risk. In contrast, SNP285G>C (rs117039649, located 24 bp upstream of rs2279744, and in complete linkage disequilibrium with the SNP309G allele, reduces Sp1 recruitment and lowers cancer risk. Thus, fine tuning of MDM2 expression has proven to be of significant importance with respect to tumorigenesis. We assessed the potential functional effects of a third MDM2 promoter P2 polymorphism (SNP344T>A; rs1196333 located on the SNP309T allele. While in silico analyses indicated SNP344A to modulate TFAP2A, SPIB and AP1 transcription factor binding, we found no effect of SNP344 status on MDM2 expression levels. Assessing the frequency of SNP344A in healthy Caucasians (n = 2,954 and patients suffering from ovarian (n = 1,927, breast (n = 1,271, endometrial (n = 895 or prostatic cancer (n = 641, we detected no significant difference in the distribution of this polymorphism between any of these cancer forms and healthy controls (6.1% in healthy controls, and 4.9%, 5.0%, 5.4% and 7.2% in the cancer groups, respectively. In conclusion, our findings provide no evidence indicating that SNP344A may affect MDM2 transcription or cancer risk.
Cost-effectiveness and incidence of renewable energy promotion in Germany
Energy Technology Data Exchange (ETDEWEB)
Boehringer, Christoph [Oldenburg Univ. (Germany). Dept. of Economics; Landis, Florian [Eidgenoessische Technische Hochschule, Zurich (Switzerland); Tovar Reanos, Miguel Angel [Zentrum fuer Europaeische Wirtschaftsforschung GmbH (ZEW), Mannheim (Germany)
2017-08-01
Over the last decade Germany has boosted renewable energy in power production by means of massive subsidies. The flip side are very high electricity prices which raises concerns that the transition cost towards a renewable energy system will be mainly borne by poor households. In this paper, we combine computable general equilibrium and microsimulation analysis to investigate the cost-effectiveness and incidence of Germany's renewable energy promotion. We find that the regressive effects of renewable energy promotion could be ameliorated by alternative subsidy financing mechanisms which achieve the same level of electricity generation from renewable energy sources.
Quantifying the effects of promoting smokeless tobacco as a harm reduction strategy in the USA.
Mejia, Adrienne B; Ling, Pamela M; Glantz, Stanton A
2010-08-01
Snus (a form of smokeless tobacco) is less dangerous than cigarettes. Some health professionals argue that snus should be promoted as a component of a harm reduction strategy, while others oppose this approach. Major US tobacco companies (RJ Reynolds and Philip Morris) are marketing snus products as cigarette brand line extensions. The population effects of smokeless tobacco promotion will depend on the combined effects of changes in individual risk with population changes in tobacco use patterns. To quantitatively evaluate the health impact of smokeless tobacco promotion as part of a harm reduction strategy in the US. A Monte Carlo simulation of a decision tree model of tobacco initiation and use was used to estimate the health effects associated with five different patterns of increased smokeless tobacco use. With cigarette smoking having a health effect of 100, the base case scenario (based on current US prevalence rates) yields a total health effect of 24.2 (5% to 95% interval 21.7 to 26.5) and the aggressive smokeless promotion (less cigarette use and increased smokeless, health-concerned smokers switching to snus, smokers in smokefree environments switching to snus) was associated with a health effect of 30.4 (5% to 95% interval 25.9 to 35.2). The anticipated health effects for additional scenarios with lower rates of smokeless uptake also overlapped with the base case. Promoting smokeless tobacco as a safer alternative to cigarettes is unlikely to result in substantial health benefits at a population level.
β-Hydroxy-β-Methylbutyrate (HMB) Promotes Neurite Outgrowth in Neuro2a Cells.
Salto, Rafael; Vílchez, Jose D; Girón, María D; Cabrera, Elena; Campos, Nefertiti; Manzano, Manuel; Rueda, Ricardo; López-Pedrosa, Jose M
2015-01-01
β-Hydroxy-β-methylbutyrate (HMB) has been shown to enhance cell survival, differentiation and protein turnover in muscle, mainly activating phosphoinositide-3-kinase/protein kinase B (PI3K/Akt) and mitogen-activated protein kinases/ extracellular-signal-regulated kinases (MAPK/ERK) signaling pathways. Since these two pathways are related to neuronal survival and differentiation, in this study, we have investigated the neurotrophic effects of HMB in mouse neuroblastoma Neuro2a cells. In Neuro2a cells, HMB promotes differentiation to neurites independent from any effects on proliferation. These effects are mediated by activation of both the PI3K/Akt and the extracellular-signal-regulated kinases (ERK1/2) signaling as demonstrated by the use of specific inhibitors of these two pathways. As myocyte-enhancer factor 2 (MEF2) family of transcription factors are involved in neuronal survival and plasticity, the transcriptional activity and protein levels of MEF2 were also evaluated. HMB promoted MEF2-dependent transcriptional activity mediated by the activation of Akt and ERK1/2 pathways. Furthermore, HMB increases the expression of brain glucose transporters 1 (GLUT1) and 3 (GLUT3), and mTOR phosphorylation, which translates in a higher protein synthesis in Neuro2a cells. Furthermore, Torin1 and rapamycin effects on MEF2 transcriptional activity and HMB-dependent neurite outgrowth support that HMB acts through mTORC2. Together, these findings provide clear evidence to support an important role of HMB in neurite outgrowth.
De Grandis, Elisa; Stagnaro, Michela; Biancheri, Roberta; Giannotta, Melania; Gobbi, Giuseppe; Traverso, Monica; Veneselli, Edvige; Zara, Federico
2013-07-01
Alternating hemiplegia of childhood is a rare, predominantly sporadic disorder. Diagnosis is clinical, and little is known about genetics. Glucose transporter 1 deficiency syndrome shares with alternating hemiplegia of childhood paroxysmal and nonparoxysmal symptoms. The aim of the study was to investigate glucose transporter 1 mutations in 30 Italian patients. Genetic material was analyzed by DNA amplification and glucose transporter 1 region sequencing. Mutational analysis findings of the SLC2A1 gene were negative in all patients. The pattern of movement disorders was reviewed. Interictal dystonia and multiple paroxysmal events were typical of alternating hemiplegia of childhood. In conclusion, alternating hemiplegia of childhood is a heterogeneous clinical condition, and although glucose transporter 1 deficiency can represent an undiagnosed cause of this disorder, mutational analysis is not routinely recommended. Alternatively, a careful clinical analysis and the 3-O-methyl-D-glucose uptake test can allow prompt identification of a subgroup of patients with alternating hemiplegia of childhood treatable with a ketogenic diet.
2-HG Inhibits Necroptosis by Stimulating DNMT1-Dependent Hypermethylation of the RIP3 Promoter
Directory of Open Access Journals (Sweden)
Zhentao Yang
2017-05-01
Full Text Available 2-hydroxyglutarate-(2-HG-mediated inhibition of TET2 activity influences DNA hypermethylation in cells harboring mutations of isocitrate dehydrogenases 1 and 2 (IDH1/2. Here, we show that 2-HG also regulates DNA methylation mediated by DNA methyltransferase 1 (DNMT1. DNMT1-dependent hypermethylation of the RIP3 promoter occurred in both IDH1 R132Q knockin mutant mouse embryonic fibroblast (MEFs and 2-HG-treated wild-type (WT MEFs. We found that 2-HG bound to DNMT1 and stimulated its association with the RIP3 promoter, inducing hypermethylation that reduces RIP3 protein and consequently impaired RIP3-dependent necroptosis. In human glioma samples, RIP3 protein levels correlated negatively with IDH1 R132H levels. Furthermore, ectopic expression of RIP3 in transformed IDH1-mutated MEFs inhibited the growth of tumors derived from these cells following transplantation into nude mice. Thus, our research sheds light on a mechanism of 2-HG-induced DNA hypermethylation and suggests that impaired necroptosis contributes to the tumorigenesis driven by IDH1/2 mutations.
[Alternatives to animal experimentation v.s. animal rights terrorism].
Kurosawa, Tsutomu Miki
2008-05-01
Systematic modern animal experimentation was established by Bernard Claude who wrote "An Introduction to the Study of Experimental Medicine" in 1865. At this point, the public was already asking that the pain and distress of experimental animals be reduced. For this, scientists, William Russell and Rex Burch in 1959 proposed the principles of alternatives to animal experimentation, the "3Rs". Since that time, animal welfare advocates have promoted the 3Rs concept in biomedical research communities. However, cruel animal experiments have continued and there are reports of radical extremists showing their opposition by invasion, arson, theft and even bombing of institutions involved, resulting in killing of the animals. SHAC, one extremist group believed to be animal welfare activitists was recognized as a terrorist group after the 9.11 tragedy in USA and the government viewed their activities very seriously. In 2001, British animal extremists invaded Japanese universities and stole laboratory resources; one individual was arrested and sentenced to prison for three years; Japanese who assisted in the incident were arrested and one was sentenced for one year. In 2006, SHAC USA members were prosecuted and sentenced for up to 6 years for their terrorism activities including arson. We need to consider the background of these activities which are financially supported by animal welfare advocates. The way we, as scientists who conduct such experiments can respond is by promoting alternatives to this experimentation. In Japan, the animal welfare law was revised in 2005 stressing the importance of 3Rs in scientific activities with animals. The promotion of 3Rs should be strengthened in the pharmaceutical community.
Directory of Open Access Journals (Sweden)
Laura Terragni
2009-09-01
Full Text Available Can consumers contribute to a more sustainable world? In this article we describe alternative consumption in Norway, exemplified by organic food, and discuss the role of consumers in promoting change. The paper is based on studies undertaken at the Norwegian National Institute for Consumer Research (SIFO during the last 15 years. The analysis starts by considering the origin of the organic movement in Norway and follows its development, showing that over the years consumption of organic products has reached a noteworthy position in the conventional market. While organic products seem to face conventionalisation, other alternative initiatives are emerging, such as fair trade, farmers’ market, farm food outlets, box schemes and community supported agriculture (CSA. Agreeing with the critique of a ‘generic active consumer model’, the article makes the case that the consumer’s role must be understood contextually and within its limitations. At the same time, the data presented in this article show that within shifting contextual frameworks, consumers utilise consumption with the goal of producing change. The paper suggests that forms of consumption defined as alternative are socially contested and the products that consumers identify as alternative are those that, in a given time and space, best reflect alternative values.Les consommateurs peuvent-ils contribuer à un monde plus durable? Dans cet article nous décrivons la consommation alternative en Norvège à travers l’exemple des aliments bio, et nous discutons le rôle des consommateurs dans la promotion du changement. Cet article se fonde sur des recherches entreprises par l’Institut national de la recherche sur les consommateurs (SIFO en Norvège, au cours des 15 dernières années. L’analyse commence par décrire l’origine du mouvement bio en Norvège et suit son développement, montrant qu’au fil des années la consommation de produits bio a atteint une position importante
Conversion of CO2 via Visible Light Promoted Homogeneous Redox Catalysis
Directory of Open Access Journals (Sweden)
Bernhard Rieger
2012-11-01
Full Text Available This review gives an overview on the principles of light-promoted homogeneous redox catalysis in terms of applications in CO2 conversion. Various chromophores and the advantages of different structures and metal centers as well as optimization strategies are discussed. All aspects of the reduction catalyst site are restricted to CO2 conversion. An important focus of this review is the question of a replacement of the sacrificial donor which is found in most of the current publications. Furthermore, electronic parameters of supramolecular systems are reviewed with reference to the requisite of chromophores, oxidation and reduction sites.
20 CFR 404.230 - Guaranteed alternative.
2010-04-01
... 20 Employees' Benefits 2 2010-04-01 2010-04-01 false Guaranteed alternative. 404.230 Section 404... INSURANCE (1950- ) Computing Primary Insurance Amounts Guaranteed Alternative for People Reaching Age 62 After 1978 But Before 1984 § 404.230 Guaranteed alternative. (a) General. If you reach age 62 after 1978...
Assessment of Alternative Scenarios for CO2 Reduction Potential in the Residential Building Sector
Directory of Open Access Journals (Sweden)
Young-Sun Jeong
2017-03-01
Full Text Available The South Korean government announced its goals of reducing the country’s CO2 emissions by up to 30% below the business as usual (BAU projections by 2020 in 2009 and 37% below BAU projections by 2030 in 2015. This paper explores the potential energy savings and reduction in CO2 emissions offered by residential building energy efficiency policies and plans in South Korea. The current and future energy consumption and CO2 emissions in the residential building were estimated using an energy–environment model from 2010 to 2030. The business as usual scenario is based on the energy consumption characteristic of residential buildings using the trends related to socio-economic prospects and the number of dwellings. The alternative scenarios took into account energy efficiency for new residential buildings (scenario I, refurbishment of existing residential buildings (scenario II, use of highly efficient boilers (scenario III, and use of a solar thermal energy system (scenario IV. The results show that energy consumption in the residential building sector will increase by 33% between 2007 and 2030 in the BAU scenario. Maximum reduction in CO2 emissions in the residential building sector of South Korea was observed by 2030 in scenario I. In each alternative scenario analysis, CO2 emissions were 12.9% lower than in the business as usual scenario by the year 2030.
ΔNp63α induces the expression of FAT2 and Slug to promote tumor invasion
Dang, Tuyen T.; Westcott, Jill M.; Maine, Erin A.; Kanchwala, Mohammed; Xing, Chao; Pearson, Gray W.
2016-01-01
Tumor invasion can be induced by changes in gene expression that alter cell phenotype. The transcription factor ΔNp63α promotes basal-like breast cancer (BLBC) migration by inducing the expression of the mesenchymal genes Slug and Axl, which confers cells with a hybrid epithelial/mesenchymal state. However, the extent of the ΔNp63α regulated genes that support invasive behavior is not known. Here, using gene expression analysis, ChIP-seq, and functional testing, we find that ΔNp63α promotes BLBC motility by inducing the expression of the atypical cadherin FAT2, the vesicular binding protein SNCA, the carbonic anhydrase CA12, the lipid binding protein CPNE8 and the kinase NEK1, along with Slug and Axl. Notably, lung squamous cell carcinoma migration also required ΔNp63α dependent FAT2 and Slug expression, demonstrating that ΔNp63α promotes migration in multiple tumor types by inducing mesenchymal and non-mesenchymal genes. ΔNp63α activation of FAT2 and Slug influenced E-cadherin localization to cell-cell contacts, which can restrict spontaneous cell movement. Moreover, live-imaging of spheroids in organotypic culture demonstrated that ΔNp63α, FAT2 and Slug were essential for the extension of cellular protrusions that initiate collective invasion. Importantly, ΔNp63α is co-expressed with FAT2 and Slug in patient tumors and the elevated expression of ΔNp63α, FAT2 and Slug correlated with poor patient outcome. Together, these results reveal how ΔNp63α promotes cell migration by directly inducing the expression of a cohort of genes with distinct cellular functions and suggest that FAT2 is a new regulator of collective invasion that may influence patient outcome. PMID:27081041
Song, Xian-Rong; Qiu, Yi-Feng; Song, Bo; Hao, Xin-Hua; Han, Ya-Ping; Gao, Pin; Liu, Xue-Yuan; Liang, Yong-Min
2015-02-20
A novel BF3·Et2O-promoted tandem reaction of easily prepared 2-propynolphenols/anilines and trimethylsilyl azide is developed to give C2-alkenylated benzoxazoles and benzimidazoles in moderate to good yields. Most reactions could be accomplished in 30 min at room temperature. This tandem process involves a Csp-Csp2 bond cleavage and a C-N bond formation. Moreover, both tertiary and secondary propargylic alcohols with diverse functional groups were tolerated under the mild conditions.
The effect of alternative work arrangements on women's well-being: a demand-control model.
Kelloway, E K; Gottlieb, B H
1998-01-01
The growth of women's participation in the labor force and evidence of the conflict they experience between job and family demands have spurred many employers to introduce alternative work arrangements such as flextime, job sharing, and telecommuting. Drawing on data gained from a sample of women (N = 998) in two large Canadian organizations, this study evaluates two mediational models of the impact of alternative work arrangements on women's stress and family role competence. Specifically, it tests and finds support for the hypotheses that (a) work arrangements involving scheduling flexibility (telecommuting and flextime) promote these aspects of women's well-being by increasing their perceived control over their time, and (b) arrangements involving reduced hours of employment (part-time employment and job sharing) promote well-being by reducing perceived job overload. Discussion of these findings centers on their implications for employed women, their employers, and future research.
Directory of Open Access Journals (Sweden)
M. Alex Syaekhoni
2017-11-01
Full Text Available Due to increasing concerns about environmental protection, the environmental sustainability of businesses has been widely considered in the manufacturing and supply chain context. Further, its adoption has been implemented in the retail industry for marketing field, including green product promotion. This study aimed to propose a customer purchasing behavior analysis as an alternative for supporting decision-making in order to promote green products in retail stores. Hence, right-on-target marketing strategies can be implemented appropriately. The study was carried out using shopping path data collected by radio frequency identification (RFID from a large retail store in Seoul, South Korea. In addition, the store layout and its traffic were also analyzed. This method is expected to help experts providing appropriate decision alternatives. In addition, it can help retailers in order to increase product sales and achieve high levels of customer satisfaction.
Organizing for teamwork in healthcare: an alternative to team training?
Rydenfält, Christofer; Odenrick, Per; Larsson, Per Anders
2017-05-15
Purpose The purpose of this paper is to explore how organizational design could support teamwork and to identify organizational design principles that promote successful teamwork. Design/methodology/approach Since traditional team training sessions take resources away from production, the alternative approach pursued here explores the promotion of teamwork by means of organizational design. A wide and pragmatic definition of teamwork is applied: a team is considered to be a group of people that are set to work together on a task, and teamwork is then what they do in relation to their task. The input - process - output model of teamwork provides structure to the investigation. Findings Six teamwork enablers from the healthcare team literature - cohesion, collaboration, communication, conflict resolution, coordination, and leadership - are discussed, and the organizational design measures required to implement them are identified. Three organizational principles are argued to facilitate the teamwork enablers: team stability, occasions for communication, and a participative and adaptive approach to leadership. Research limitations/implications The findings could be used as a foundation for intervention studies to improve team performance or as a framework for evaluation of existing organizations. Practical implications By implementing these organizational principles, it is possible to achieve many of the organizational traits associated with good teamwork. Thus, thoughtful organization for teamwork can be used as an alternative or complement to the traditional team training approach. Originality/value With regards to the vast literature on team training, this paper offers an alternative perspective on how to improve team performance in healthcare.
Characterization of P1 promoter activity of the β-galactoside α2,6 ...
Indian Academy of Sciences (India)
2012-04-05
Apr 5, 2012 ... The level of β-galactoside α2,6-sialyltransferase I (ST6Gal I) mRNA, encoded by the gene siat1, is increased in malignant tissues. Expression is regulated by different promoters – P1, P2 and P3 – generating three mRNA isoforms. H, X and YZ. In cervical cancer tissue the mRNA isoform H, which results ...
CSIR Research Space (South Africa)
Du
1997-08-01
Full Text Available Final Project Report ALTERNATIVE INERTING AGENTS Author/s: J J L DU PLESSIS Research Agency: OSIR MINING TECHNOLOGY Project No: Date: 3 2 7 2 COL 443 APRIL 1999 N’ ) ( G~6~ I Title: 9 / The results show...
Promoting effect of bile acids on neoplastic transformation of x-irradiated 10T1/2 cells
International Nuclear Information System (INIS)
Han, A.; Hill, C.K.
1984-01-01
Experimental studies have raised a concern about a role of bile acids in colo-rectal carcinogenesis. Studies in vivo suggest that bile acids may act as tumor promoters. Using 10T1/2 mouse cells as a model system, the authors explored the effects of cholic and cheno-deoxycholic acid on x-ray-induced neoplastic transformation in these cells. Addition of either cheno-deoxycholic acid or cholic acid to 10T1/2 cells, 24 hours after exposure to x-rays (50kv) increases significantly the frequencies of transformation. The compounds were present in the medium throughout the entire postirradiation refeeding period. At the concentrations used (0.5μg/ml), neither acid was cytotoxic and did not have any effect on cell survival. The enhancement of radiation-induced transformation seems to be greater in the presence of cholic acid, as compared to the effect of cheno-deoxycholic acid. Increase in transformation was relatively greater after low compared to high doses of radiation. The effect of bile acids on transformation of 10T1/2 cells is similar to that of a known tumor promoter TPA. The authors' observations support the conclusion that promotional effect of bile acids is not because of their specific effect on colonic epithelium, but rather due to their general properties as tumor promoters
Energy Technology Data Exchange (ETDEWEB)
Zheng, Xuqin [Department of Endocrinology, First Affiliated Hospital, Nanjing Medical University, Nanjing, Jiangsu Province 210029 (China); Sun, Tao [Department of Neurology, Jinling Hospital, Nanjing University School of Medicine, Nanjing, Jiangsu Province 210002 (China); Wang, Xiaodong, E-mail: xdwang666@hotmail.com [Department of Endocrinology, First Affiliated Hospital, Nanjing Medical University, Nanjing, Jiangsu Province 210029 (China)
2013-07-05
Highlights: •TC, a CB2R specific agonist, stimulates SIRT1 activity by PKA/CREB pathway. •TC promotes PGC-1α transcriptional activity by increasing its deacetylation. •TC increases the expression of genes linked to FAO and promotes the rate of FAO. •The effects of TC in FAO are dependent on CB2R. •Suggesting CB2R as a target to treat diseases with lipid dysregulation. -- Abstract: Abnormal fatty acid oxidation has been associated with obesity and type 2 diabetes. At the transcriptional level, peroxisome proliferator-activated receptor-gamma coactivator 1α (PGC-1α) has been reported to strongly increase the ability of hormone nuclear receptors PPARα and ERRα to drive transcription of fatty acid oxidation enzymes. In this study, we report that a specific agonist of the type 2 cannabinoid receptor (CB2R) can lead to fatty acid oxidation through the PGC-1α pathway. We have found that CB2R is expressed in differentiated C2C12 myotubes, and that use of the specific agonist trans-caryophyllene (TC) stimulates sirtuin 1 (SIRT1) deacetylase activity by increasing the phosphorylation of cAMP response element-binding protein (CREB), thus leading to increased levels of PGC-1α deacetylation. This use of TC treatment increases the expression of genes linked to the fatty acid oxidation pathway in a SIRT1/PGC-1α-dependent mechanism and also drastically accelerates the rate of complete fatty acid oxidation in C2C12 myotubes, neither of which occur when CB2R mRNA is knocked down using siRNA. These results reveal that activation of CB2R by a selective agonist promotes lipid oxidation through a signaling/transcriptional pathway. Our findings imply that pharmacological manipulation of CB2R may provide therapeutic possibilities to treat metabolic diseases associated with lipid dysregulation.
International Nuclear Information System (INIS)
Kangvansura, Praewpilin; Schulz, Hans; Suramitr, Anwaraporn; Poo-arporn, Yingyot; Viravathana, Pinsuda; Worayingyong, Attera
2014-01-01
Highlights: • Ru/ZrO 2 , ZrO 2 promoted Co/SiO 2 for FTS were reduced by time resolved XANES. • Reduced catalysts resulted from XANES reduction showed the mixed phases of Co, CoO. • The highest percentages of CoO resulted from the high ZrO 2 promoted Co/SiO 2 . • Product distributions of 1-alkenes, iso-alkanes indicated sites for FTS and the 2° reaction. • Alkene readsorption were high corresponding to the high CoO forming branched alkanes. - Abstract: Co/SiO 2 catalysts were promoted with 4% and 8% ZrO 2 . Small amounts (0.07%) of Ru were impregnated onto 4%ZrO 2 /Co/SiO 2 . Catalysts resulting from time-resolved XANES reduction showed mixed phases of Co and CoO, with the highest percentages of Co resulting from Ru/4%ZrO 2 /Co/SiO 2 and the highest percentages of CoO resulting from 8%ZrO 2 /Co/SiO 2 . Product distributions of n-alkanes, iso-alkanes and alkenes during Fischer–Tropsch Synthesis (FTS) were used to investigate the catalyst performance of 4%ZrO 2 /Co/SiO 2 8%ZrO 2 /Co/SiO 2 and Ru/4%ZrO 2 /Co/SiO 2 . FTS steady state was studied by growth probabilities of n-alkane products. No 1-alkene was produced from Ru/4%ZrO 2 /Co/SiO 2 , indicating high availability of Fischer–Tropsch sites for long chain hydrocarbon growth, despite high methanation. Branched alkanes produced from the secondary reaction were related to the high CoO percentages on 8%ZrO 2 /Co/SiO 2 . Alkene readsorption sites were high, corresponding to the high CoO percentages, causing a high probability of forming branched alkane products
MDM2 promoter SNP344T>A (rs1196333) status does not affect cancer risk
S. Knappskog (Stian); L.B. Gansmo (Liv); P. Romundstad (Pål); M. Bjørnslett (Merete); J. Trovik (Jone); J. Sommerfelt-Pettersen (Jan); E. Løkkevik (Erik); R.A.E.M. Tollenaar (Rob); C.M. Seynaeve (Caroline); P. Devilee (Peter); H.B. Salvesen (Helga); A. Dørum (Anne); K. Hveem (Kristian); L.J. Vatten (Lars); P.E. Lønning (Per )
2012-01-01
textabstractThe MDM2 proto-oncogene plays a key role in central cellular processes like growth control and apoptosis, and the gene locus is frequently amplified in sarcomas. Two polymorphisms located in the MDM2 promoter P2 have been shown to affect cancer risk. One of these polymorphisms
International Nuclear Information System (INIS)
Weston, B.H.
1990-01-01
This book contains the following chapters: The Military and Alternative Security: New Missions for Stable Conventional Security; Technology and Alternative Security: A Cherished Myth Expires; Law and Alternative Security: Toward a Just World Peace; Politics and Alternative Security: Toward a More Democratic, Therefore More Peaceful, World; Economics and Alternative Security: Toward a Peacekeeping International Economy; Psychology and Alternative Security: Needs, Perceptions, and Misperceptions; Religion and Alternative Security: A Prophetic Vision; and Toward Post-Nuclear Global Security: An Overview
Duan, Chaojun; Li, Minghua; Rui, Liangyou
2004-10-15
Leptin regulates energy homeostasis primarily by binding and activating its long form receptor (LRb). Deficiency of either leptin or LRb causes morbid obesity. Leptin stimulates LRb-associated JAK2, thus initiating multiple pathways including the Stat3 and phosphatidylinositol (PI) 3-kinase pathways that mediate leptin biological actions. Here we report that SH2-B, a JAK2-interacting protein, promotes activation of the PI 3-kinase pathway by recruiting insulin receptor substrate 1 (IRS1) and IRS2 in response to leptin. SH2-B directly bound, via its PH and SH2 domain, to both IRS1 and IRS2 both in vitro and in intact cells and mediated formation of a JAK2/SH2-B/IRS1 or IRS2 tertiary complex. Consequently, SH2-B dramatically enhanced leptin-stimulated tyrosine phosphorylation of IRS1 and IRS2 in HEK293 cells stably expressing LRb, thus promoting association of IRS1 and IRS2 with the p85 regulatory subunit of PI 3-kinase and phosphorylation and activation of Akt. SH2-B mutants with lower affinity for IRS1 and IRS2 exhibited reduced ability to promote association of JAK2 with IRS1, tyrosine phosphorylation of IRS1, and association of IRS1 with p85 in response to leptin. Moreover, deletion of the SH2-B gene impaired leptin-stimulated tyrosine phosphorylation of endogenous IRS1 in mouse embryonic fibroblasts (MEF), which was reversed by reintroduction of SH2-B. Similarly, SH2-B promoted growth hormone-stimulated tyrosine phosphorylation of IRS1 in both HEK293 and MEF cells. Our data suggest that SH2-B is a novel mediator of the PI 3-kinase pathway in response to leptin or other hormones and cytokines that activate JAK2.
International Nuclear Information System (INIS)
Palev, T.D.
1997-08-01
The paper contains essentially two new results. Physically, a deformation of the parastatistics in a sense of quantum groups is carried out. Mathematically, an alternative to the Chevalley description of the quantum orthosymplectic superalgebra U q [osp(2n + 1/2m)] in terms of m pairs of deformed parabosons and n pairs of deformed parafermions is outlined. (author). 35 refs
Structure of the gene for human β2-adrenergic receptor: expression and promoter characterization
International Nuclear Information System (INIS)
Emorine, L.J.; Marullo, S.; Delavier-Klutchko, C.; Kaveri, S.V.; Durieu-Trautmann, O.; Strosberg, A.D.
1987-01-01
The genomic gene coding for the human β 2 -adrenergic receptor (β 2 AR) from A431 epidermoid cells has been isolated. Transfection of the gene into eukaryotic cells restores a fully active receptor/GTP-binding protein/adenylate cyclase complex with β 2 AR properties. Southern blot analyses with β 2 AR-specific probes show that a single β 2 AR gene is common to various human tissues and that its flanking sequences are highly conserved among humans and between man and rabbit, mouse, and hamster. Functional significance of these regions is supported by the presence of a promoter region (including mRNA cap sites, two TATA boxes, a CAAT box, and three G + C-rich regions that resemble binding sites for transcription factor Sp1) 200-300 base pairs 5' to the translation initiation codon. In the 3' flanking region, sequences homologous to glucocorticoid-response elements might be responsible for the increased expression of the β 2 AR gene observed after treatment of the transfected cells with hydrocortisone. In addition, 5' to the promoter region, an open reading frame encodes a 251-residue polypeptide that displays striking homologies with protein kinases and other nucleotide-binding proteins
Hu, Yuhui; Willett, Kristine L.; Khan, Ikhlas A.; Scheffler, Brian E.; Dasmahapatra, Asok K.
2009-01-01
Medaka (Oryzias latipes) embryos at different developmental stages were exposed to ethanol for 48 h, then allowed to hatch. Teratogenic effects were evaluated in hatchlings after examining chondrocranial cartilage deformities. Ethanol disrupted cartilage development in medaka in a dose and developmental stage-specific manner. Compared to controls, the linear length of the neurocranium and other cartilages were reduced in ethanol-treated groups. Moreover, the chondrification in cartilages, specifically trabeculae and polar cartilages, were inhibited by ethanol. To understand the mechanism of ethanol teratogenesis, NAD+: NADH status during embryogenesis and the methylation pattern of Aldh1A2 promoter in whole embryos and adult tissues (brain, eye, heart and liver) were analyzed. Embryos 6 dpf had higher NAD+ than embryos 0 or 2 dpf. Ethanol (200 or 400 mM) was able to reduce NAD+ content in 2 and 6 dpf embryos. However, in both cases reductions were not significantly different from the controls. Moreover, no significant difference in either NADH content or in NAD+: NADH status of the ethanol-treated embryos, with regard to controls, was observed. The promoter of Aldh1A2 contains 31 CpG dinucleotides (-705 to +154, ATG = +1); none of which were methylated. Compared to controls, embryonic ethanol exposure (100 and 400 mM) was unable to alter Aldh1A2 promoter methylation in embryos or in the tissues of adults (breeding) developmentally exposed to ethanol (300 mM, 48 hpf). From these data we conclude that ethanol teratogenesis in medaka does not induce alteration in the methylation pattern of Aldh1A2 promoter, but does change cartilage development. PMID:19651241
Lithium niobate bulk crystallization promoted by CO2 laser radiation
Ferreira, N. M.; Costa, F. M.; Nogueira, R. N.; Graça, M. P. F.
2012-09-01
The crystallization induced by laser radiation is a very promising technique to promote glass/ceramic transformation, being already used to produce crystalline patterns on glass surfaces. In this work, a SiO2-Li2O-Nb2O5 glass, prepared by the sol-gel route, was submitted to CO2 laser radiation and conventional heat-treatments in order to induce the LiNbO3 crystallization. The structure and morphology of the samples prepared by both routes was analyzed as a function of exposure time, radiation power and heat-treatment temperatures by XRD, Raman spectroscopy and SEM. The results reveal a correlation between the crystallization degree of LiNbO3 particles and glass matrix with the heat treatment type and experimental parameters. An heat-treatment at 650 °C/4 h was necessary to induce crystallization in heat treatments samples while 4 W/500 s was enough for laser radiation ones, corresponding a reduction time processing of ˜14 000 s.
Directory of Open Access Journals (Sweden)
Andrew D Beggs
2013-05-01
Full Text Available Serrated adenomas form a distinct subtype of colorectal pre-malignant lesions that may progress to malignancy along a different molecular pathway than the conventional adenoma-carcinoma pathway. Previous studies have hypothesised that BRAF mutation and promoter hypermethylation plays a role, but the evidence for this is not robust. We aimed to carry out a whole-genome loss of heterozygosity analysis, followed by targeted promoter methylation and expression analysis to identify potential pathways in serrated adenomas. An initial panel of 9 sessile serrated adenomas (SSA and one TSA were analysed using Illumina Goldengate HumanLinkage panel arrays to ascertain regions of loss of heterozygosity. This was verified via molecular inversion probe analysis and microsatellite analysis of a further 32 samples. Methylation analysis of genes of interest was carried out using methylation specific PCR (verified by pyrosequencing and immunohistochemistry used to correlate loss of expression of genes of interest. All experiments used adenoma samples and normal tissue samples as control. SSA samples were found on whole-genome analysis to have consistent loss of heterozygosity at 4p15.1-4p15.31, which was not found in the sole TSA, adenomas, or normal tissues. Genes of interest in this region were PDCH7 and SLIT2, and combined MSP/IHC analysis of these genes revealed significant loss of SLIT2 expression associated with promoter methylation of SLIT2. Loss of expression of SLIT2 by promoter hypermethylation and loss of heterozygosity events is significantly associated with serrated adenoma development, and SLIT2 may represent a epimutated tumour suppressor gene according to the Knudson "two hit" hypothesis.
Eissa, Sanaa; Zohny, Samir F; Shehata, Hanan Hussien; Hegazy, Marwa G A; Salem, Ahmed M; Esmat, Mohamed
2012-04-01
We evaluated the significance of urinary retinoic acid receptor-β2 (RAR-β2) gene promoter methylation and hyaluronidase activity in comparison with voided urine cytology (VUC) in diagnosis of bladder cancer. This study included 100 patients diagnosed with bladder cancer, 65 patients with benign urological disorders and 51 healthy volunteers. Urine supernatant was used for determining hyaluronidase activity by zymography while urine sediment was used for cytology and detection of methylated RAR-β2 gene promoter by methylation specific nested PCR. The sensitivity and specificity were 53% and 90.5% for VUC, 65% and 89.7% for percent methylation fraction of RAR-β2 gene promoter, and 89% and 90.5% for hyaluronidase activity; combination of the three parameters increased sensitivity to 95%. A significant association was observed between investigated markers and advanced grade tumor. Combined use of RAR-β2 gene promoter methylation, hyaluronidase activity and VUC is promising non-invasive tool for bladder cancer detection. Copyright © 2012. Published by Elsevier Inc.
Fructose-fed streptozotocin-injected rat: an alternative model for type 2 diabetes.
Wilson, Rachel D; Islam, Md Shahidul
2012-01-01
The main objective of the study was to develop an alternative non-genetic rat model for type 2 diabetes (T2D). Six-week-old male Sprague-Dawley rats (190.56 ± 23.60 g) were randomly divided into six groups, namely: Normal Control (NC), Diabetic Control (DBC), Fructose-10 (FR10), Fructose-20 (FR20), Fructose-30 (FR30) and Fructose-40 (FR40) and were fed a normal rat pellet diet ad libitum for 2 weeks. During this period, the two control groups received normal drinking water whilst the fructose groups received 10, 20, 30 and 40% fructose in drinking water ad libitum, respectively. After two weeks of dietary manipulation, all groups except the NC group received a single injection (i.p.) of streptozotocin (STZ) (40 mg/kg b.w.) dissolved in citrate buffer (pH 4.4). The NC group received only a vehicle buffer injection (i.p.). One week after the STZ injection, animals with non-fasting blood glucose levels > 300 mg/dl were considered as diabetic. Three weeks after the STZ injection, the animals in FR20, FR30 and FR40 groups were eliminated from the study due to the severity of diabetes and the FR10 group was selected for the remainder of the 11 weeks experimental period. The significantly (p < 0.05) higher fluid intake, blood glucose, serum lipids, liver glycogen, liver function enzymes and insulin resistance (HOMA-IR) and significantly (p < 0.05) lower body weight, oral glucose tolerance, number of pancreatic β-cells and pancreatic β-cell functions (HOMA-β) of FR10 group demonstrate that the 10% fructose-fed followed by 40 mg/kg of BWSTZ injected rat can be a new and alternative model for T2D.
EZH2 regulates neuroblastoma cell differentiation via NTRK1 promoter epigenetic modifications.
Li, Zhenghao; Takenobu, Hisanori; Setyawati, Amallia Nuggetsiana; Akita, Nobuhiro; Haruta, Masayuki; Satoh, Shunpei; Shinno, Yoshitaka; Chikaraishi, Koji; Mukae, Kyosuke; Akter, Jesmin; Sugino, Ryuichi P; Nakazawa, Atsuko; Nakagawara, Akira; Aburatani, Hiroyuki; Ohira, Miki; Kamijo, Takehiko
2018-05-01
The polycomb repressor complex 2 molecule EZH2 is now known to play a role in essential cellular processes, namely, cell fate decisions, cell cycle regulation, senescence, cell differentiation, and cancer development/progression. EZH2 inhibitors have recently been developed; however, their effectiveness and underlying molecular mechanisms in many malignancies have not yet been elucidated in detail. Although the functional role of EZH2 in tumorigenesis in neuroblastoma (NB) has been investigated, mutations of EZH2 have not been reported. A Kaplan-Meier analysis on the event free survival and overall survival of NB patients indicated that the high expression of EZH2 correlated with an unfavorable prognosis. In order to elucidate the functional roles of EZH2 in NB tumorigenesis and its aggressiveness, we knocked down EZH2 in NB cell lines using lentivirus systems. The knockdown of EZH2 significantly induced NB cell differentiation, e.g., neurite extension, and the neuronal differentiation markers, NF68 and GAP43. EZH2 inhibitors also induced NB cell differentiation. We performed a comprehensive transcriptome analysis using Human Gene Expression Microarrays and found that NTRK1 (TrkA) is one of the EZH2-related suppression targets. The depletion of NTRK1 canceled EZH2 knockdown-induced NB cell differentiation. Our integrative methylome, transcriptome, and chromatin immunoprecipitation assays using NB cell lines and clinical samples clarified that the NTRK1 P1 and P2 promoter regions were regulated differently by DNA methylation and EZH2-related histone modifications. The NTRK1 transcript variants 1/2, which were regulated by EZH2-related H3K27me3 modifications at the P1 promoter region, were strongly expressed in favorable, but not unfavorable NB. The depletion and inhibition of EZH2 successfully induced NTRK1 transcripts and functional proteins. Collectively, these results indicate that EZH2 plays important roles in preventing the differentiation of NB cells and also
TRF2 Recruits RTEL1 to Telomeres in S Phase to Promote T-Loop Unwinding
Sarek, Grzegorz; Vannier, Jean-Baptiste; Panier, Stephanie; Petrini, John?H.J.; Boulton, Simon?J.
2015-01-01
Summary The helicase RTEL1 promotes t-loop unwinding and suppresses telomere fragility to maintain the integrity of vertebrate telomeres. An interaction between RTEL1 and PCNA is important to prevent telomere fragility, but how RTEL1 engages with the telomere to promote t-loop unwinding is unclear. Here, we establish that the shelterin protein TRF2 recruits RTEL1 to telomeres in S phase, which is required to?prevent catastrophic t-loop processing by structure-specific nucleases. We show that ...
Retailer branding of consumer sales promotions. A major development in food marketing?
Hamlin, Robert P; Lindsay, Sophie; Insch, Andrea
2012-02-01
This article examines retailer branding of consumer price promotions. It discusses the mechanics of price promotions, consumers' reactions to them and the benefits that accrue to those that use them. It describes how large food retailers can now deploy branded price promotion systems that are fundamentally different to 'traditional' price promotions in both their mechanics and their effects on consumer decision processes. The article describes a field experiment that compared the performance of a food retailer's branded price promotion system with that of a generic (manufacturer) price promotion. The research involved three experiments that covered two food categories (sliced bread and margarine) and two levels of discount (10% and 20%). The results indicate that food retailers are able to attach powerful brands to their price promotion systems, and these brand heuristics can significantly increase consumer purchase intent relative to an equivalent generic/manufacturer promotion. This incremental heuristic effect was stable in both categories and for both levels of price discount studied. These results are consistent with the predictions of alternative, non-cognitive and heuristic based models of food consumer choice that have been published recently in 'Appetite'. Copyright © 2011 Elsevier Ltd. All rights reserved.
Ammonium-tungstate-promoted growth of boron nitride nanotubes
E, Songfeng; Li, Chaowei; Li, Taotao; Geng, Renjie; Li, Qiulong; Lu, Weibang; Yao, Yagang
2018-05-01
Ammonium tungstate ((NH4)10W12O41 · xH2O) is a kind of oxygen-containing ammonium salt. The following study proves that it can be successfully used as a metal oxide alternative to produce boron oxide (B2O2) by oxidizing boron (B) in a traditional boron oxide chemical vapor deposition (BOCVD) process. This special oxidant promotes the simplistic fabrication of boron nitride nanotubes (BNNTs) in a conventional horizontal tube furnace, an outcome which may have resulted from its strong oxidizability. The experimental results demonstrate that the mole ratio of B and (NH4)10W12O41 · xH2O is a key parameter in determining the formation, quality and quantity of BNNTs when stainless steel is employed as a catalyst. We also found that Mg(NO3)2 and MgO nanoparticles (NPs) can be used as catalysts to grow BNNTs with the same precursor. The BNNTs obtained from the Mg(NO3)2 catalyst were straighter than those obtained from the MgO NP catalyst. This could have been due to the different physical forms of the catalysts that were used.
Directory of Open Access Journals (Sweden)
In Sung Son
2013-03-01
Full Text Available The effects of the SnO2 pore size and metal oxide promoters on the sensing properties of SnO2-based thick film gas sensors were investigated to improve the detection of very low H2S concentrations (<1 ppm. SnO2 sensors and SnO2-based thick-film gas sensors promoted with NiO, ZnO, MoO3, CuO or Fe2O3 were prepared, and their sensing properties were examined in a flow system. The SnO2 materials were prepared by calcining SnO2 at 600, 800, 1,000 and 1,200 °C to give materials identified as SnO2(600, SnO2(800, SnO2(1000, and SnO2(1200, respectively. The Sn(12Mo5Ni3 sensor, which was prepared by physically mixing 5 wt% MoO3 (Mo5, 3 wt% NiO (Ni3 and SnO2(1200 with a large pore size of 312 nm, exhibited a high sensor response of approximately 75% for the detection of 1 ppm H2S at 350 °C with excellent recovery properties. Unlike the SnO2 sensors, its response was maintained during multiple cycles without deactivation. This was attributed to the promoter effect of MoO3. In particular, the Sn(12Mo5Ni3 sensor developed in this study showed twice the response of the Sn(6Mo5Ni3 sensor, which was prepared by SnO2(600 with the smaller pore size than SnO2(1200. The excellent sensor response and recovery properties of Sn(12Mo5Ni3 are believed to be due to the combined promoter effects of MoO3 and NiO and the diffusion effect of H2S as a result of the large pore size of SnO2.
Zhang, Runxuan
2016-05-06
Background Alternative splicing is the major post-transcriptional mechanism by which gene expression is regulated and affects a wide range of processes and responses in most eukaryotic organisms. RNA-sequencing (RNA-seq) can generate genome-wide quantification of individual transcript isoforms to identify changes in expression and alternative splicing. RNA-seq is an essential modern tool but its ability to accurately quantify transcript isoforms depends on the diversity, completeness and quality of the transcript information. Results We have developed a new Reference Transcript Dataset for Arabidopsis (AtRTD2) for RNA-seq analysis containing over 82k non-redundant transcripts, whereby 74,194 transcripts originate from 27,667 protein-coding genes. A total of 13,524 protein-coding genes have at least one alternatively spliced transcript in AtRTD2 such that about 60% of the 22,453 protein-coding, intron-containing genes in Arabidopsis undergo alternative splicing. More than 600 putative U12 introns were identified in more than 2,000 transcripts. AtRTD2 was generated from transcript assemblies of ca. 8.5 billion pairs of reads from 285 RNA-seq data sets obtained from 129 RNA-seq libraries and merged along with the previous version, AtRTD, and Araport11 transcript assemblies. AtRTD2 increases the diversity of transcripts and through application of stringent filters represents the most extensive and accurate transcript collection for Arabidopsis to date. We have demonstrated a generally good correlation of alternative splicing ratios from RNA-seq data analysed by Salmon and experimental data from high resolution RT-PCR. However, we have observed inaccurate quantification of transcript isoforms for genes with multiple transcripts which have variation in the lengths of their UTRs. This variation is not effectively corrected in RNA-seq analysis programmes and will therefore impact RNA-seq analyses generally. To address this, we have tested different genome
How alternative are alternative fuels?
Soffritti, Tiziana; Danielis, Romeo
1998-01-01
Could alternative fuel vehicles contribute to a substantial reduction of air pollution? Is there a market for alternative fuel vehicles? Could a market be created via a pollution tax? The article answers these questions on the basis of the available estimates.
Modular Energy Storage System for Alternative Energy Vehicles
Energy Technology Data Exchange (ETDEWEB)
Thomas, Janice [Magna Electronics Inc., Auburn Hills, MI (United States); Ervin, Frank [Magna Electronics Inc., Auburn Hills, MI (United States)
2012-05-15
An electrical vehicle environment was established to promote research and technology development in the area of high power energy management. The project incorporates a topology that permits parallel development of an alternative energy delivery system and an energy storage system. The objective of the project is to develop technologies, specifically power electronics, energy storage electronics and controls that provide efficient and effective energy management between electrically powered devices in alternative energy vehicles plugin electric vehicles, hybrid vehicles, range extended vehicles, and hydrogen-based fuel cell vehicles. In order to meet the project objectives, the Vehicle Energy Management System (VEMS) was defined and subsystem requirements were obtained. Afterwards, power electronics, energy storage electronics and controls were designed. Finally, these subsystems were built, tested individually, and integrated into an electric vehicle system to evaluate and optimize the subsystems performance. Phase 1 of the program established the fundamental test bed to support development of an electrical environment ideal for fuel cell application and the mitigation of many shortcomings of current fuel cell technology. Phase 2, continued development from Phase 1, focusing on implementing subsystem requirements, design and construction of the energy management subsystem, and the integration of this subsystem into the surrogate electric vehicle. Phase 2 also required the development of an Alternative Energy System (AES) capable of emulating electrical characteristics of fuel cells, battery, gen set, etc. Under the scope of the project, a boost converter that couples the alternate energy delivery system to the energy storage system was developed, constructed and tested. Modeling tools were utilized during the design process to optimize both component and system design. This model driven design process enabled an iterative process to track and evaluate the impact
Scaling behavior of spin gap of the bond alternating anisotropic spin-1/2 Heisenberg chain
Energy Technology Data Exchange (ETDEWEB)
Paul, Susobhan, E-mail: suso.phy.paul@gmail.com [Department of Physics, Scottish Church College, 1 & 3 Urquhart Square, Kolkata-700006 (India); Ghosh, Asim Kumar, E-mail: asimkumar96@yahoo.com [Department of Physics, Jadavpur University, 188 Raja S C Mallik Road, Kolkata-700032 (India)
2016-05-06
Scaling behavior of spin gap of a bond alternating spin-1/2 anisotropic Heisenberg chain has been studied both in ferromagnetic (FM) and antiferromagnetic (AFM) cases. Spin gap has been estimated by using exact diagonalization technique. All those quantities have been obtained for a region of anisotropic parameter Δ defined by 0≤Δ≤1. Spin gap is found to develop as soon as the non-uniformity in the alternating bond strength is introduced in the AFM regime which furthermore sustains in the FM regime as well. Scaling behavior of the spin gap has been studied by introducing scaling exponent. The variation of scaling exponents with Δ is fitted with a regular function.
SNAI2/Slug promotes growth and invasion in human gliomas
International Nuclear Information System (INIS)
Yang, Hong Wei; Menon, Lata G; Black, Peter M; Carroll, Rona S; Johnson, Mark D
2010-01-01
Numerous factors that contribute to malignant glioma invasion have been identified, but the upstream genes coordinating this process are poorly known. To identify genes controlling glioma invasion, we used genome-wide mRNA expression profiles of primary human glioblastomas to develop an expression-based rank ordering of 30 transcription factors that have previously been implicated in the regulation of invasion and metastasis in cancer. Using this approach, we identified the oncogenic transcriptional repressor, SNAI2/Slug, among the upper tenth percentile of invasion-related transcription factors overexpressed in glioblastomas. SNAI2 mRNA expression correlated with histologic grade and invasive phenotype in primary human glioma specimens, and was induced by EGF receptor activation in human glioblastoma cells. Overexpression of SNAI2/Slug increased glioblastoma cell proliferation and invasion in vitro and promoted angiogenesis and glioblastoma growth in vivo. Importantly, knockdown of endogenous SNAI2/Slug in glioblastoma cells decreased invasion and increased survival in a mouse intracranial human glioblastoma transplantation model. This genome-scale approach has thus identified SNAI2/Slug as a regulator of growth and invasion in human gliomas
Pokemon promotes the invasiveness of hepatocellular carcinoma by enhancing MEF2D transcription.
Kong, Jing; Liu, Xiaoping; Li, Xiangqian; Wu, Jinsheng; Wu, Ning; Chen, Jun; Fang, Fang
2016-05-01
Pokemon, a master oncogene crucial for the tumorigenicity and progression of a variety of cancers, has been demonstrated to enhance the proliferation and survival of hepatocellular carcinoma (HCC). However, the contribution of Pokemon to the invasiveness of HCC has not yet been studied. In this study, we employed HCC cells to investigate the role of Pokemon in the invasion of HCC with multidisciplinary approaches. Pokemon overexpression was found to be closely associated with invasion and intrahepatic metastasis of HCC in clinical specimens. Suppression of Pokemon attenuated the invasion of HCC cells by in vitro transwell and wound-healing assays. Myocyte enhancer factor 2D (MEF2D), an oncogene that can promote the invasiveness of HCC, was found to be underexpressed during Pokemon silencing in HCC cells. Restoration of MEF2D abolished the effect of Pokemon downregulation on the migration of HCC cells. Further experiments verified that Pokemon binds two putative recognition sites located within the upstream region of the MEF2D promoter and enhances its transcription. The association between Pokemon and MEF2D was further confirmed in HCC specimens. Animal experiments further confirmed that Pokemon downregulation attenuated the metastasis of HCC cells in mice. Collectively, Pokemon was found to enhance the migration and invasion of HCC by increasing MEF2D expression. Thus, targeting Pokemon and MEF2D may be an effective strategy to suppress the metastasis of HCC.
Alternative Fuels in Cement Production
DEFF Research Database (Denmark)
Larsen, Morten Boberg
The substitution of alternative for fossil fuels in cement production has increased significantly in the last decade. Of these new alternative fuels, solid state fuels presently account for the largest part, and in particular, meat and bone meal, plastics and tyre derived fuels (TDF) accounted...... for the most significant alternative fuel energy contributors in the German cement industry. Solid alternative fuels are typically high in volatile content and they may differ significantly in physical and chemical properties compared to traditional solid fossil fuels. From the process point of view......, considering a modern kiln system for cement production, the use of alternative fuels mainly influences 1) kiln process stability (may accelerate build up of blockages preventing gas and/or solids flow), 2) cement clinker quality, 3) emissions, and 4) decreased production capacity. Kiln process stability...
Cytosine deletion at AP2-box region of HSP70 promoter and its ...
Indian Academy of Sciences (India)
Cytosine deletion at AP2-box region of HSP70 promoter and its influence on semen quality traits in crossbred bulls ... Laboratory, ICAR-Central Institute for Research on Cattle, Meerut 250 001, India; School of Atmospheric Stress Management, ICAR-National Institute of Abiotic Stress Management, Baramati 413 115, India ...
Proceedings: Second Annual Pacific Northwest Alternative and Renewable Energy Resources Conference.
Energy Technology Data Exchange (ETDEWEB)
None
1980-01-01
Papers presented at the conference are published in this volume. The purpose of the conference was to solicit regional cooperation in the promoting of near-term development of such alternative and renewable energy resources in the Pacific Northwest as: cogeneration; biomass; wind; small hydro; solar end-use applications; and geothermal direct heat utilization. Separate abstracts of selected papers were prepared for inclusion in the Energy Data Base.
How Theaters Remember: Cultures of Memory in Institutionalized Systems
Directory of Open Access Journals (Sweden)
Milena Dragićević Šešić
2014-11-01
Full Text Available The aim of this study is to explore organizational policies and strategies regarding the institutional memory of Belgrade’s repertoire theaters. The concept of institutional (organizational memory has not been developed within the culture of memory theory. The role of theater in the culture of memory has been researched mostly through studies of its repertoire, corresponding to how theaters deal with issues of glory, guilt, or shame. This study explores how theaters rethink their own past and organizational culture, how they use their capacity for re-imagining themselves, for clarifying their role and function in different historical moments. The objective of this research is to identify the main institutional policies and types of strategies used for preserving institutional memory through key narratives of remembering, and key methods of inter-generational transfer. The sample comprises of four Belgrade-based public repertoire theaters: the Yugoslav Dramatic Theater (JDP, the Belgrade Dramatic Theater (BDP, Atelje 212, and Bitef Theater. Specific attention is given to the means of transmission, of individual (episodic memories into the collective consciousness, influencing organizational cultures and shaping a theater’s identity (semantic memory. Research has shown that there are important differences in active policies of preserving institutional memory among Belgrade’s theaters. Different organizational and programming strategies were implemented in order to safeguard institutional identity and memory, particularly in theaters with a permanent ensemble. The major difference is between theaters whose culture of memory might be called “non-existent” (Bitef, or “in storage” (BDP, and those succeeding in creating a functional memory (JDP, Atelje 212.
The environment and the use of alternative fuels
International Nuclear Information System (INIS)
Okken, P.A.
1992-05-01
The contribution of the Netherlands Energy Research Foundation (ECN) to the ANWB symposium on alternative fuels and techniques concerns the necessity to use alternatives to reduce CO 2 emissions, the importance of system integration, and a discussion of the strong and weak points with regard to the introduction of the fuel alternatives in the Netherlands. First attention is paid to the greenhouse effect (CO 2 emissions) of the use of fuels. Options to reduce CO 2 emission from automobiles are mentioned. Than several alternative fuels and accompanying techniques, and their impact on the CO 2 emission, are discussed: diesel, liquid petroleum gas (LPG), compressed natural gas (CNG), methanol, ethanol, rapeseed, electricity, and hydrogen. The possibilities to reduce CO 2 emission in the Netherlands can be calculated by means of the Energy and Materials Scenarios (EMS). For several aspects assessments are given for the above-mentioned alternatives: availability of technology, ease of fuel storage, risk of use, impact on the city climate, full fuel cycle CO 2 emission, costs, and reserves. These aspects can be considered as valid for most of the industrialized countries. For the Netherlands two other aspects have been assessed: the interest of the oil industry in the introduction of alternative fuels, the availability of the alternatives in the Netherlands. 5 figs., 6 tabs., 10 refs
Web 2.0 for health promotion: reviewing the current evidence.
Chou, Wen-ying Sylvia; Prestin, Abby; Lyons, Claire; Wen, Kuang-yi
2013-01-01
As Web 2.0 and social media make the communication landscape increasingly participatory, empirical evidence is needed regarding their impact on and utility for health promotion. Following Preferred Reporting Items for Systematic Reviews and Meta-Analyses guidelines, we searched 4 medical and social science databases for literature (2004-present) on the intersection of Web 2.0 and health. A total of 514 unique publications matched our criteria. We classified references as commentaries and reviews (n = 267), descriptive studies (n = 213), and pilot intervention studies (n = 34). The scarcity of empirical evidence points to the need for more interventions with participatory and user-generated features. Innovative study designs and measurement methods are needed to understand the communication landscape and to critically assess intervention effectiveness. To address health disparities, interventions must consider accessibility for vulnerable populations.
NF45/ILF2 tissue expression, promoter analysis, and interleukin-2 transactivating function
International Nuclear Information System (INIS)
Zhao Guohua; Shi Lingfang; Qiu Daoming; Hu Hong; Kao, Peter N.
2005-01-01
NF45/ILF2 associates with NF90/ILF3 in the nucleus and regulates IL-2 gene transcription at the antigen receptor response element (ARRE)/NF-AT DNA target sequence (P.N. Kao, L. Chen, G. Brock, J. Ng, A.J. Smith, B. Corthesy, J. Biol. Chem. 269 (1994) 20691-20699). NF45 is widely expressed in normal tissues, especially testis, brain, and kidney, with a predominantly nuclear distribution. NF45 mRNA expression is increased in lymphoma and leukemia cell lines. The human and murine NF45 proteins differ only by substitution of valine by isoleucine at amino acid 142. Fluorescence in situ hybridization localized the human NF45 gene to chromosome 1q21.3, and mouse NF45 gene to chromosome 3F1. Promoter analysis of 2.5 kB of the murine NF45 gene reveals that significant activation is conferred by factors, possible including NF-Y, that bind to the CCAAT-box sequence. The function of human NF45 in regulating IL-2 gene expression was characterized in Jurkat T-cells stably transfected with plasmids directing expression of NF45 cDNA in sense or antisense orientations. NF45 sense expression increased IL-2 luciferase reporter gene activity 120-fold, and IL-2 protein expression 2-fold compared to control cells. NF45 is a highly conserved, regulated transcriptional activator, and one target gene is IL-2
PIF4 Promotes Expression of LNG1 and LNG2 to Induce Thermomorphogenic Growth in Arabidopsis
Directory of Open Access Journals (Sweden)
Geonhee Hwang
2017-07-01
Full Text Available Arabidopsis plants adapt to high ambient temperature by a suite of morphological changes including elongation of hypocotyls and petioles and leaf hyponastic growth. These morphological changes are collectively called thermomorphogenesis and are believed to increase leaf cooling capacity by enhancing transpiration efficiency, thereby increasing tolerance to heat stress. The bHLH transcription factor PHYTOCHROME INTERACTING FACTOR4 (PIF4 has been identified as a major regulator of thermomorphogenic growth. Here, we show that PIF4 promotes the expression of two homologous genes LONGIFOLIA1 (LNG1 and LONGIFOLIA2 (LNG2 that have been reported to regulate leaf morphology. ChIP-Seq analyses and ChIP assays showed that PIF4 directly binds to the promoters of both LNG1 and LNG2. The expression of LNG1 and LNG2 is induced by high temperature in wild type plants. However, the high temperature activation of LNG1 and LNG2 is compromised in the pif4 mutant, indicating that PIF4 directly regulates LNG1 and LNG2 expression in response to high ambient temperatures. We further show that the activities of LNGs support thermomorphogenic growth. The expression of auxin biosynthetic and responsive genes is decreased in the lng quadruple mutant, implying that LNGs promote thermomorphogenic growth by activating the auxin pathway. Together, our results demonstrate that LNG1 and LNG2 are directly regulated by PIF4 and are new components for the regulation of thermomorphogenesis.
International Nuclear Information System (INIS)
Woelneberg, Pia W.; Ertesvaag, Ivar S.
2008-01-01
The supply of process steam in combination with power for natural-gas export compressors was investigated using exergy analysis. The existing system with three 12.32 MW direct drive gas turbines each with a HRSG delivering 19.2 kg/s high-pressure steam was compared with an alternative where the gas turbines were replaced with new turbines. The exergy efficiencies were 46.7% and 48.6%, respectively, for the two cases. A second alternative with electric motors and a new CHP was investigated in three variants, all with some surplus electricity production. All variants gave higher exergy efficiencies than the other alternatives, from 51.5% to 53.6%. A third alternative with electric motors, stand-alone boilers and purchase of electricity was also analyzed, considering different origins of the electricity. This alternative gave the lowest exergy efficiencies, from 37.1% to 41.4% for different variants. In accordance with the exergy utilization, the CO 2 emissions per unit of exergy delivered were the lowest for the second alternative, while the total emissions were the highest for the third alternative. However, the domestic emissions, important in relation to international CO 2 agreements, were shown to be the lowest for the stand-alone boiler in combination with imported electricity. (author)
Oxidative conversion of propane over lithium-promoted magnesia catalyst. I. Kinetics and mechanism
Leveles, L.; Seshan, Kulathuiyer; Lercher, J.A.; Lefferts, Leonardus
2003-01-01
Oxidative conversion of lower alkanes over lithium-promoted magnesia catalysts offers a viable alternative for propene and ethene production. The catalytic performance of propane oxidative dehydrogenation and cracking shows yields up to 50% of olefin (propene and ethene). The reaction kinetics were
Suwantika, Auliya A.; Postma, Maarten J.
2013-01-01
BACKGROUND: Rotavirus infection has been reported to be responsible for the majority of severe diarrhea in children under-5-years-old in Indonesia. Breast milk is considered to give protection against rotavirus infection. Increasing breastfeeding promotion programs could be an alternative target to
Difficulties of Alternatively Certified Teachers
Schonfeld, Irvin Sam; Feinman, Samantha J.
2012-01-01
This daily diary study followed, over a 2-week period, 252 beginning New York City public school teachers. Seventy percent were alternatively certified (New York City Teaching Fellows) and the rest, traditionally certified teachers. Alternatively certified teachers were more likely to experience stressors such as violent incidents and classroom…
DEFF Research Database (Denmark)
Skov, J.; Gaudin, M.; Podbevsek, P.
2012-01-01
In brome mosaic virus, both the replication of the genomic (+)-RNA strands and the transcription of the subgenomic RNA are carried out by the viral replicase. The production of (-)-RNA strands is dependent on the formation of an AUA triloop in the stem-loop C (SLC) hairpin in the 3'-untranslated...... region of the (+)-RNA strands. Two alternate hypotheses have been put forward for the mechanism of subgenomic RNA transcription. One posits that transcription commences by recognition of at least four key nucleotides in the subgenomic promoter by the replicase. The other posits that subgenomic...... transcription starts by binding of the replicase to a hairpin formed by the subgenomic promoter that resembles the minus strand promoter hairpin SLC. In this study, we have determined the three-dimensional structure of the subgenomic promoter hairpin using NMR spectroscopy. The data show that the hairpin...
Sun, Jinghui; Luo, Qing; Liu, Lingling; Song, Guanbin
2018-07-28
Cancer stem cells (CSCs) are a small subpopulation of tumour cells that have been proposed to be responsible for cancer initiation, chemotherapy resistance and cancer recurrence. Shear stress activated cellular signalling is involved in cellular migration, proliferation and differentiation. However, little is known about the effects of shear stress on the migration of liver cancer stem cells (LCSCs). Here, we studied the effects of shear stress that are generated from a parallel plated flow chamber system, on LCSC migration and the activation of focal adhesion kinase (FAK) and extracellular signal regulated kinase1/2 (ERK1/2), using transwell assay and western blot, respectively. We found that 2 dyne/cm 2 shear stress loading for 6 h promotes LCSC migration and activation of the FAK and ERK1/2 signalling pathways, whereas treatment with the FAK phosphorylation inhibitor PF573228 or the ERK1/2 phosphorylation inhibitor PD98059 suppressed the shear stress-promoted migration, indicating the involvement of FAK and ERK1/2 activation in shear stress-induced LCSC migration. Additionally, atomic force microscopy (AFM) analysis showed that shear stress lowers LCSC stiffness via the FAK and ERK1/2 pathways, suggesting that the mechanism by which shear stress promotes LCSC migration might partially be responsible for the decrease in cell stiffness. Further experiments focused on the role of the actin cytoskeleton, demonstrating that the F-actin filaments in LCSCs are less well-defined after shear stress treatment, providing an explanation for the reduction in cell stiffness and the promotion of cell migration. Overall, our study demonstrates that shear stress promotes LCSC migration through the activation of the FAK-ERK1/2 signalling pathways, which further results in a reduction of organized actin and softer cell bodies. Copyright © 2018 Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
1978-01-01
Of the alternatives considered for disposal of the high-level waste in tanks 8D2 and 8D4, the following process is recommended: homogenization of the contents of tank 8D2, centrifugation of the sludge and supernate, mixing of the 8D4 acid waste with the centrifuged sludge, and converting the mixture to a borosilicate glass using the Hanford spray calciner/in-can melter
'Troubling' moments in health promotion: unpacking the ethics of empowerment.
Spencer, Grace
2015-12-01
Concepts of empowerment feature strongly in global health discourses. Empowerment is frequently advocated as a positive approach to addressing individual and community-level health needs. Despite its popularity, relatively little has been said about the unintended consequences of empowerment, which may give rise to some troubling ethical issues or, indeed, result in outcomes that may not be considered health promoting. Drawing on current uses of empowerment within health promotion, along with insights from an ethnographic study on young people's health, this paper raises some critical questions about the ethics of empowerment. By doing so, the paper troubles the idea that empowerment is a 'good thing' without some careful attention to the varying ways in which the ethics of empowerment may unfold in practice. Findings revealed young people's different perspectives on health and priorities for health promotion. The present analysis highlights how these alternative framings prompt a number of ethical tensions for understanding and operationalising empowerment. In conclusion, the findings underscore the importance of promoting ethical reflexivity in health promotion and, crucially, attending to the unintended and potentially ethically problematic consequences of empowerment. So what? This paper raises some critical questions about the ethics of empowerment and calls for a more thorough engagement with the unintended consequences of empowerment within health promotion.
The XXX spin s quantum chain and the alternating s1, s2 chain with boundaries
International Nuclear Information System (INIS)
Doikou, Anastasia
2002-01-01
The integrable XXX spin s quantum chain and the alternating s 1 , s 2 (s 1 -s 2 =1/2) chain with boundaries are considered. The scattering of their excitations with the boundaries via the Bethe ansatz method is studied, and the exact boundary S matrices are computed in the limit s,s 1,2 →∞. Moreover, the connection of these models with the SU(2) Principal Chiral, WZW and the RSOS models is discussed
Liu, Yanli; Yang, Xin; Xin, Hongliang; Chen, Si; Yang, Chengbo; Duan, Yulan; Yang, Xiaojun
2017-09-01
This experiment was conducted to investigate the effects of protected essential oils and organic acids mixture on poultry feeding. A total of 450 1-day-old Cobb 500 chicks were randomly allotted into three treatments with six replicates. Birds were offered a basal diet (C), basal diet with 0.15 g/kg enramycin premix (A) and basal diet with 0.30 g/kg protected essential oils and organic acids mixture product (P). The results showed that protected essential oils and organic acids mixture supplementation reduced average daily feed intake and ratio of feed to gain (F/G) at 22-42 days of age, and F/G during 1-42 days of age also declined (P essential oils and organic acids mixture supplementation changed gut microflora mainly in Lactobacillus. These data suggested that dietary mixture of organic acids and essential oils addition could be used in the poultry industry as an antibiotic growth promoter alternative. © 2017 Japanese Society of Animal Science.
Directory of Open Access Journals (Sweden)
Furkan Orhan
Full Text Available ABSTRACT In the current study, 18 halotolerant and halophilic bacteria have been investigated for their plant growth promoting abilities in vitro and in a hydroponic culture. The bacterial strains have been investigated for ammonia, indole-3-acetic acid and 1-aminocyclopropane-1-carboxylate-deaminase production, phosphate solubilisation and nitrogen fixation activities. Of the tested bacteria, eight were inoculated with Triticum aestivum in a hydroponic culture. The investigated bacterial strains were found to have different plant-growth promoting activities in vitro. Under salt stress (200 mM NaCl, the investigated bacterial strains significantly increased the root and shoot length and total fresh weight of the plants. The growth rates of the plants inoculated with bacterial strains ranged from 62.2% to 78.1%.Identifying of novel halophilic and halotolerant bacteria that promote plant growth can be used as alternatives for salt sensitive plants. Extensive research has been conducted on several halophilic and halotolerant bacterial strains to investigate their plant growth promoting activities. However, to the best of my knowledge, this is the first study to inoculate these bacterial strains with wheat.
Orhan, Furkan
2016-01-01
In the current study, 18 halotolerant and halophilic bacteria have been investigated for their plant growth promoting abilities in vitro and in a hydroponic culture. The bacterial strains have been investigated for ammonia, indole-3-acetic acid and 1-aminocyclopropane-1-carboxylate-deaminase production, phosphate solubilisation and nitrogen fixation activities. Of the tested bacteria, eight were inoculated with Triticum aestivum in a hydroponic culture. The investigated bacterial strains were found to have different plant-growth promoting activities in vitro. Under salt stress (200mM NaCl), the investigated bacterial strains significantly increased the root and shoot length and total fresh weight of the plants. The growth rates of the plants inoculated with bacterial strains ranged from 62.2% to 78.1%. Identifying of novel halophilic and halotolerant bacteria that promote plant growth can be used as alternatives for salt sensitive plants. Extensive research has been conducted on several halophilic and halotolerant bacterial strains to investigate their plant growth promoting activities. However, to the best of my knowledge, this is the first study to inoculate these bacterial strains with wheat. Copyright © 2016 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.
Kolandaivelu, Kumaran; Bailey, Lynn; Buzzi, Stefano; Zucker, Arik; Milleret, Vincent; Ziogas, Algirdas; Ehrbar, Martin; Khattab, Ahmed A; Stanley, James R L; Wong, Gee K; Zani, Brett; Markham, Peter M; Tzafriri, Abraham R; Bhatt, Deepak L; Edelman, Elazer R
2017-04-20
Simple surface modifications can enhance coronary stent performance. Ultra-hydrophilic surface (UHS) treatment of contemporary bare metal stents (BMS) was assessed in vivo to verify whether such stents can provide long-term efficacy comparable to second-generation drug-eluting stents (DES) while promoting healing comparably to BMS. UHS-treated BMS, untreated BMS and corresponding DES were tested for three commercial platforms. A thirty-day and a 90-day porcine coronary model were used to characterise late tissue response. Three-day porcine coronary and seven-day rabbit iliac models were used for early healing assessment. In porcine coronary arteries, hydrophilic treatment reduced intimal hyperplasia relative to the BMS and corresponding DES platforms (1.5-fold to threefold reduction in 30-day angiographic and histological stenosis; p<0.04). Endothelialisation was similar on UHS-treated BMS and untreated BMS, both in swine and rabbit models, and lower on DES. Elevation in thrombotic indices was infrequent (never observed with UHS, rare with BMS, most often with DES), but, when present, correlated with reduced endothelialisation (p<0.01). Ultra-hydrophilic surface treatment of contemporary stents conferred good healing while moderating neointimal and thrombotic responses. Such surfaces may offer safe alternatives to DES, particularly when rapid healing and short dual antiplatelet therapy (DAPT) are crucial.
Global Energy Issues and Alternate Fueling
Hendricks, Robert C.
2007-01-01
This viewgraph presentation describes world energy issues and alternate fueling effects on aircraft design. The contents include: 1) US Uses about 100 Quad/year (1 Q = 10(exp 15) Btu) World Energy Use: about 433 Q/yr; 2) US Renewable Energy about 6%; 3) Nuclear Could Grow: Has Legacy Problems; 4) Energy Sources Primarily NonRenewable Hydrocarbon; 5) Notes; 6) Alternate Fuels Effect Aircraft Design; 7) Conventional-Biomass Issue - Food or Fuel; 8) Alternate fuels must be environmentally benign; 9) World Carbon (CO2) Emissions Problem; 10) Jim Hansen s Global Warming Warnings; 11) Gas Hydrates (Clathrates), Solar & Biomass Locations; 12) Global Energy Sector Response; 13) Alternative Renewables; 14) Stratospheric Sulfur Injection Global Cooling Switch; 15) Potential Global Energy Sector Response; and 16) New Sealing and Fluid Flow Challenges.
Distributively generated matrix near rings
International Nuclear Information System (INIS)
Abbasi, S.J.
1993-04-01
It is known that if R is a near ring with identity then (I,+) is abelian if (I + ,+) is abelian and (I,+) is abelian if (I*,+) is abelian [S.J. Abbasi, J.D.P. Meldrum, 1991]. This paper extends these results. We show that if R is a distributively generated near ring with identity then (I,+) is included in Z(R), the center of R, if (I + ,+) is included in Z(M n (R)), the center of matrix near ring M n (R). Furthermore (I,+) is included in Z(R) if (I*,+) is included in Z(M n (R)). (author). 5 refs
Wang, Hao; Nie, Lei; Wu, Lei; Liu, Qiufang; Guo, Xueyan
2017-03-25
Metastasis is one of the most decisive factors influencing CRC patient prognosis and current studies suggest that a molecular mechanism known as EMT broadly regulates cancer metastasis. NR2F2 is a key molecule in the development of CRC, but the roles and underlying mechanisms of NR2F2 in TGF-β induced EMT in CRC remain largely unknown. In the current study, we were interested to examine the role of NR2F2 in the TGF-β-induced EMT in CRC. Here, we found NR2F2 was upregulated in CRC cells and promotes TGF-β-induced EMT in CRC. Using comparative miRNA profiling TGF-β pre-treated CRC cells in which NR2F2 had been knocked down with that of control cells, we identified miR-21 as a commonly downregulated miRNA in HT29 cells treated with TGF-β and NR2F2 siRNA, and its downregulation inhibiting migration and invasion of CRC cells. Moreover, we found NR2F2 could transcriptional activated miR-21 expression by binding to miR-21 promoter in HT29 by ChIP and luciferase assay. In the last, our data demonstrated that Smad7 was the direct target of miR-21 in CRC cells. Thus, NR2F2 could promote TGF-β-induced EMT and inhibit Smad7 expression via transactivation of miR-21, and NR2F2 may be a new common therapeutic target for CRC. Copyright © 2017 Elsevier Inc. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Okamoto, Michio [Department of Orthopaedic Surgery, Osaka University Graduate School of Medicine, 2-2 Yamadaoka, Suita, Osaka 565-0871 (Japan); Tanaka, Hiroyuki, E-mail: tanahiro-osk@umin.ac.jp [Department of Orthopaedic Surgery, Osaka University Graduate School of Medicine, 2-2 Yamadaoka, Suita, Osaka 565-0871 (Japan); Okada, Kiyoshi [Department of Orthopaedic Surgery, Osaka University Graduate School of Medicine, 2-2 Yamadaoka, Suita, Osaka 565-0871 (Japan); Kuroda, Yusuke [Department of Orthopaedic Surgery, Kansai Rosai Hospital, 3-1-69 Inabaso, Amagasaki, Hyogo 660-8511 (Japan); Nishimoto, Shunsuke; Murase, Tsuyoshi; Yoshikawa, Hideki [Department of Orthopaedic Surgery, Osaka University Graduate School of Medicine, 2-2 Yamadaoka, Suita, Osaka 565-0871 (Japan)
2014-01-17
Highlights: •Methylcobalamin activated the Erk1/2 signaling pathway in C2C12 cells. •Methylcobalamin promoted the proliferation and migration in C2C12 cells. •C2C12 cell apoptosis during differentiation was inhibited by methylcobalamin. -- Abstract: Methylcobalamin (MeCbl) is a vitamin B12 analog that has some positive effects on peripheral nervous disorders. Although some previous studies revealed the effects of MeCbl on neurons, its effect on the muscle, which is the final target of motoneuron axons, remains to be elucidated. This study aimed to determine the effect of MeCbl on the muscle. We found that MeCbl promoted the proliferation and migration of C2C12 myoblasts in vitro and that these effects are mediated by the Erk1/2 signaling pathway without affecting the activity of the Akt signaling pathway. We also demonstrated that MeCbl inhibits C2C12 cell apoptosis during differentiation. Our results suggest that MeCbl has beneficial effects on the muscle in vitro. MeCbl administration may provide a novel therapeutic approach for muscle injury or degenerating muscle after denervation.
Yan, Meiping; Zhang, Xinhua; Chen, Ao; Gu, Wei; Liu, Jie; Ren, Xiaojiao; Zhang, Jianping; Wu, Xiaoxiong; Place, Aaron T; Minshall, Richard D; Liu, Guoquan
2017-11-01
Intercellular adhesion molecule-1 (ICAM-1) mediates the firm adhesion of leukocytes to endothelial cells and initiates subsequent signaling that promotes their transendothelial migration (TEM). Vascular endothelial (VE)-cadherin plays a critical role in endothelial cell-cell adhesion, thereby controlling endothelial permeability and leukocyte transmigration. This study aimed to determine the molecular signaling events that originate from the ICAM-1-mediated firm adhesion of neutrophils that regulate VE-cadherin's role as a negative regulator of leukocyte transmigration. We observed that ICAM-1 interacts with Src homology domain 2-containing phosphatase-2 (SHP-2), and SHP-2 down-regulation via silencing of small interfering RNA in endothelial cells enhanced neutrophil adhesion to endothelial cells but inhibited neutrophil transmigration. We also found that VE-cadherin associated with the ICAM-1-SHP-2 complex. Moreover, whereas the activation of ICAM-1 leads to VE-cadherin dissociation from ICAM-1 and VE-cadherin association with actin, SHP-2 down-regulation prevented ICAM-1-VE-cadherin association and promoted VE-cadherin-actin association. Furthermore, SHP-2 down-regulation in vivo promoted LPS-induced neutrophil recruitment in mouse lung but delayed neutrophil extravasation. These results suggest that SHP-2- via association with ICAM-1-mediates ICAM-1-induced Src activation and modulates VE-cadherin switching association with ICAM-1 or actin, thereby negatively regulating neutrophil adhesion to endothelial cells and enhancing their TEM.-Yan, M., Zhang, X., Chen, A., Gu, W., Liu, J., Ren, X., Zhang, J., Wu, X., Place, A. T., Minshall, R. D., Liu, G. Endothelial cell SHP-2 negatively regulates neutrophil adhesion and promotes transmigration by enhancing ICAM-1-VE-cadherin interaction. © FASEB.
Roy, S.
2015-06-27
Classically or alternatively activated macrophages (M1 and M2, respectively) play distinct and important roles for microbiocidal activity, regulation of inflammation and tissue homeostasis. Despite this, their transcriptional regulatory dynamics are poorly understood. Using promoter-level expression profiling by non-biased deepCAGE we have studied the transcriptional dynamics of classically and alternatively activated macrophages. Transcription factor (TF) binding motif activity analysis revealed four motifs, NFKB1_REL_RELA, IRF1,2, IRF7 and TBP that are commonly activated but have distinct activity dynamics in M1 and M2 activation. We observe matching changes in the expression profiles of the corresponding TFs and show that only a restricted set of TFs change expression. There is an overall drastic and transient up-regulation in M1 and a weaker and more sustainable up-regulation in M2. Novel TFs, such as Thap6, Maff, (M1) and Hivep1, Nfil3, Prdm1, (M2) among others, were suggested to be involved in the activation processes. Additionally, 52 (M1) and 67 (M2) novel differentially expressed genes and, for the first time, several differentially expressed long non-coding RNA (lncRNA) transcriptome markers were identified. In conclusion, the finding of novel motifs, TFs and protein-coding and lncRNA genes is an important step forward to fully understand the transcriptional machinery of macrophage activation.
Calvo, María; Malinowski, Tadeusz; García, Juan Antonio
2014-02-01
Plum pox virus (PPV) C is one of the less common PPV strains and specifically infects cherry trees in nature. Making use of two PPV-C isolates that display different pathogenicity features, i.e., SwCMp, which had been adapted to Nicotiana species, and BY101, which had been isolated from cherry rootstock L2 (Prunus lannesiana) and propagated only in cherry species, we have generated two infective full-length cDNA clones in order to determine which viral factors are involved in the adaptation to each host. According to our results, the C-P3(PIPO)/6K1/N-CI (cylindrical inclusion) region contains overlapping but not coincident viral determinants involved in symptoms development, local viral amplification, and systemic movement capacity. Amino acid changes in this region promoting the adaptation to N. benthamiana or P. avium have trade-off effects in the alternative host. In both cases, adaptation can be achieved through single amino acid changes in the NIapro protease recognition motif between 6K1 and CI or in nearby sequences. Thus, we hypothesize that the potyvirus polyprotein processing could depend on specific host factors and the adaptation of PPV-C isolates to particular hosts relies on a fine regulation of the proteolytic cleavage of the 6K1-CI junction.
Cardiomyocyte H9c2 cells present a valuable alternative to fish lethal testing for azoxystrobin
International Nuclear Information System (INIS)
Rodrigues, Elsa T.; Pardal, Miguel Â.; Laizé, Vincent; Cancela, M. Leonor; Oliveira, Paulo J.; Serafim, Teresa L.
2015-01-01
The present study aims at identifying, among six mammalian and fish cell lines, a sensitive cell line whose in vitro median inhibitory concentration (IC_5_0) better matches the in vivo short-term Sparus aurata median lethal concentration (LC_5_0). IC_5_0_s and LC_5_0 were assessed after exposure to the widely used fungicide azoxystrobin (AZX). Statistical results were relevant for most cell lines after 48 h of AZX exposure, being H9c2 the most sensitive cells, as well as the ones which provided the best prediction of fish toxicity, with a LC_5_0_,_9_6_h/IC_5_0_,_4_8_h = 0.581. H9c2 cell proliferation upon 72 h of AZX exposure revealed a LC_5_0_,_9_6_h/IC_5_0_,_7_2_h = 0.998. Therefore, identical absolute sensitivities were attained for both in vitro and in vivo assays. To conclude, the H9c2 cell-based assay is reliable and represents a suitable ethical alternative to conventional fish assays for AZX, and could be used to get valuable insights into the toxic effects of other pesticides. - Highlights: • Fish toxicity data are still considered standard information in ecotoxicology. • Alternatives to animal testing have become an important topic of research. • Cell-based assays are currently a promising in vitro alternative. • Comparative studies to accelerate the validation of cell-based methods are required. • H9c2 cell line proved to produce in vitro reliable toxicity results for azoxystrobin. - The application of cell-based assays for environmental toxicity studies would greatly reduce the number of fish needed for toxicity testing without any loss of reliability.
Kalrn promoter usage and isoform expression respond to chronic cocaine exposure
Directory of Open Access Journals (Sweden)
Ma Xin-Ming
2011-02-01
Full Text Available Abstract Background The long-term effects of cocaine on behavior are accompanied by structural changes in excitatory glutamatergic synapses onto the medium spiny neurons of the striatum. The Kalrn gene encodes several functionally distinct isoforms; these multidomain guanine nucleotide exchange factors (GEFs contain additional domains known to interact with phosphatidylinositides as well as with a number of different proteins. Through their activation of Rho proteins and their interactions with other proteins, the different Kalirin isoforms affect cytoskeletal organization. Chronic exposure of adult male rodents to cocaine increases levels of Kalirin 7 in the striatum. When exposed chronically to cocaine, mice lacking Kalirin 7, the major adult isoform, fail to show an increase in dendritic spine density in the nucleus accumbens, show diminished place preference for cocaine, and exhibit increased locomotor activity in response to cocaine. Results The use of alternate promoters and 3'-terminal exons of the mouse Kalrn gene were investigated using real-time quantitative polymerase chain reaction. While the two most distal full-length Kalrn promoters are used equally in the prefrontal cortex, the more proximal of these promoters accounts for most of the transcripts expressed in the nucleus accumbens. The 3'-terminal exon unique to the Kalirin 7 isoform accounts for a greater percentage of the Kalrn transcripts in prefrontal cortex than in nucleus accumbens. Western blot analyses confirmed these differences. Chronic cocaine treatment increases usage of the promoter encoding the Δ-Kalirin isoforms but does not alter full-length Kalirin promoter usage. Usage of the 3'-terminal exon unique to Kalirin 7 increases following chronic cocaine exposure. Conclusions Kalrn promoter and 3'-terminal exon utilization are region-specific. In the nucleus accumbens, cocaine-mediated alterations in promoter usage and 3'-terminal exon usage favor expression of
Lei, Jiehua; Yuan, Yuqi; Lyu, Zhonglin; Wang, Mengmeng; Liu, Qi; Wang, Hongwei; Yuan, Lin; Chen, Hong
2017-08-30
Glycosaminoglycans (GAGs), especially heparin and heparan sulfate (HS), hold great potential for inducing the neural differentiation of embryonic stem cells (ESCs) and have brought new hope for the treatment of neurological diseases. However, the disadvantages of natural heparin/HS, such as difficulty in isolating them with a sufficient amount, highly heterogeneous structure, and the risk of immune responses, have limited their further therapeutic applications. Thus, there is a great demand for stable, controllable, and well-defined synthetic alternatives of heparin/HS with more effective biological functions. In this study, based upon a previously proposed unit-recombination strategy, several heparin-mimicking polymers were synthesized by integrating glucosamine-like 2-methacrylamido glucopyranose monomers (MAG) with three sulfonated units in different structural forms, and their effects on cell proliferation, the pluripotency, and the differentiation of ESCs were carefully studied. The results showed that all the copolymers had good cytocompatibility and displayed much better bioactivity in promoting the neural differentiation of ESCs as compared to natural heparin; copolymers with different sulfonated units exhibited different levels of promoting ability; among them, copolymer with 3-sulfopropyl acrylate (SPA) as a sulfonated unit was the most potent in promoting the neural differentiation of ESCs; the promoting effect is dependent on the molecular weight and concentration of P(MAG-co-SPA), with the highest levels occurring at the intermediate molecular weight and concentration. These results clearly demonstrated that the sulfonated unit in the copolymers played an important role in determining the promoting effect on ESCs' neural differentiation; SPA was identified as the most potent sulfonated unit for copolymer with the strongest promoting ability. The possible reason for sulfonated unit structure as a vital factor influencing the ability of the copolymers
Essential oils: an alternative approach to management of powdery mildew diseases
Directory of Open Access Journals (Sweden)
Elena STURCHIO
2015-01-01
Full Text Available In recent years there has been growing interest in the application of plant-derived substances in agriculture as alternatives to the use of pesticides, in order to obtain healthy crops and more environmentally sustainable crop production systems. The properties of some essential oils as natural fungicides were evaluated, to promote their use in alternative agriculture. Potentially detrimental effects caused by essential oil residues in soil were also assessed by mutagenicity assays to avoid possible adverse effects related to the use of these materials. Trials in a controlled environment were set up, using ‘Romanesco’ zucchini treated with essential oils, either exclusively or alternated with a synthetic fungicide. The treatments were applied when natural infection by Podosphaera xanthii appeared on test plants, and powdery mildew incidence and severity were assessed after six weeks. Preliminary results indicated that the alternation of natural materials with effective synthetic fungicide maintained effective disease control, and may also assist with management of pesticide resistance in P. xanthii. No relevant mutagenic effects of essential oil residues in soil were revealed, although an appropriate formulation useful under field conditions is required for effective application.
International Nuclear Information System (INIS)
Roychoudhury, Paromita; Ghosh, Utpal; Bhattacharyya, Nitai P.; Chaudhuri, Keya
2006-01-01
The cellular response to ionizing radiation is mediated by a complex interaction of number of proteins involving different pathways. Previously, we have shown that up regulation of mitochondrial genes ND1, ND4, and COX1 transcribed from the heavy strand promoter (P H ) has been increased in a radio-resistant cell strain designated as M5 in comparison with the parental Chinese hamster V79 cells. These genes are also up regulated in Chinese hamster V79 cells VB13 that express exogenous human Bcl2. In the present study, the expression of the gene ND6 that is expressed from the light strand promoter (P L ) was found to be similar in both the cell lines, as determined by RT-PCR. To test the possibility that this differential expression of mitochondrial genes under these two promoters was mediated by differences in proteins' affinity to interact with these promoters, we have carried out electrophoretic mobility shift assay (EMSA) using mitochondrial cell extracts from these two cell lines. Our result of these experiments revealed that two different proteins formed complex with the synthetic promoters and higher amount of protein from M5 cell extracts interacted with the P H promoter in comparison to that observed with cell extracts from Chinese hamster V79 cells. The promoter-specific differential binding of proteins was also observed in VB13. These results showed that differential mitochondrial gene expression observed earlier in the radio-resistant M5 cells was due to enhanced interaction proteins with the promoters P H and mediated by the expression of Bcl2
Li, Xue-Dong; Song, Qing-Wen; Lang, Xian-Dong; Chang, Yao; He, Liang-Nian
2017-11-17
Chemical valorization of CO 2 to access various value-added compounds has been a long-term and challenging objective from the viewpoint of sustainable chemistry. Herein, a one-pot three-component reaction of terminal propargyl alcohols, CO 2 , and 2-aminoethanols was developed for the synthesis of 2-oxazolidinones and an equal amount of α-hydroxyl ketones promoted by Ag 2 O/TMG (1,1,3,3-tetramethylguanidine) with a TON (turnover number) of up to 1260. By addition of terminal propargyl alcohol, the thermodynamic disadvantage of the conventional 2-aminoethanol/CO 2 coupling was ameliorated. Mechanistic investigations including control experiments, DFT calculation, kinetic and NMR studies suggest that the reaction proceeds through a cascade pathway and TMG could activate propargyl alcohol and 2-aminoethanol through the formation of hydrogen bonds and also activate CO 2 . © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Surfactant-promoted reactions of Cl2 and Br2 with Br- in glycerol.
Faust, Jennifer A; Dempsey, Logan P; Nathanson, Gilbert M
2013-10-17
Gas-liquid scattering experiments are used to explore reactions of gaseous Cl2 and Br2 with a 0.03 M solution of the surfactant tetrahexylammonium bromide (THABr) dissolved in glycerol. At thermal collision energies, 79 ± 2% of incident Cl2 molecules react with Br(-) to form Cl2Br(-) in the interfacial region. This reaction probability is three times greater than the reactivity of Cl2 with 3 M NaBr-glycerol, even though the interfacial Br(-) concentrations are similar in each solution. We attribute the high 79% uptake to the presence of surface THA(+) ions that stabilize the Cl2Br(-) intermediate as it is formed in the charged, hydrophobic pocket created by the hexyl chains. Cl2Br(-) generates the single exchange product BrCl in a 1% yield close to the surface, while the remaining 99% desorbs as the double exchange product Br2 over >0.1 s after diffusing deeply into the bulk. When NaCl is added to the surfactant solution in a 20:1 Cl(-)/Br(-) ratio, the Cl2 reaction probability drops from 79% to 46 ± 1%, indicating that Cl(-) in the interfacial region only partially blocks reaction with Br(-). In parallel, we observe that gaseous Br2 molecules dissolve in 0.03 M THABr for 10(4) times longer than in 3 M NaBr. We attribute this change to formation of stabilizing interfacial and bulk-phase THA(+)Br3(-) ion pairs, in analogy with the capture of Cl2 and formation of THA(+)Cl2Br(-) pairs. The THA(+) ion appears to be a powerful interfacial catalyst for promoting reaction of Cl2 and Br2 with Br(-) and for ferrying the resultant ions into solution.
Alternative fuels for vehicles; Alternative drivmidler
Energy Technology Data Exchange (ETDEWEB)
2012-02-15
Up until 2020 and onwards the analysis indicates that especially electricity, biogas and natural gas as propellants is economically attractive compared to conventional gasoline and diesel while other fuels have the same or higher costs for petrol and diesel. Especially biogas and electricity will also offer significant reductions in CO{sub 2} emissions, but also hydrogen, methanol, DME and to a lesser extent the second generation bioethanol and most of the other alternative fuels reduce CO{sub 2} emissions. Use of the traditional food-based first generation biofuels involves, at best, only modest climate benefits if land use changes are counted, and at worst, significant negative climate effects. Natural gas as a propellant involves a moderate climate gain, but may play a role for building infrastructure and market for gaseous fuels in large fleets, thereby contributing to the phasing in of biogas for transport. The electric-based automotive fuels are the most effective due to a high efficiency of the engine and an increasing proportion of wind energy in the electricity supply. The methanol track also has a relatively high efficiency. Among the others, the track based on diesel engines (biodiesel) is more effective than the track based on gasoline/Otto engines (gas and ethanol) as a result of the diesel engine's better efficiency. For the heavy vehicles all the selected alternative fuels to varying degrees reduce emissions of CO{sub 2}, particularly DME based on wood. The only exception to this is - as for passenger cars - the propellant synthetic diesel based on coal. (LN).
An Alternative Transcript of the FOG-2 Gene Encodes a FOG-2 Isoform lacking the FOG Repression Motif
Dale, Rodney M.; Remo, Benjamin F.; Svensson, Eric C.
2007-01-01
The FOG family of transcriptional co-factors is composed of two members in mammals: FOG-1 and FOG-2. Both have been shown to bind to GATA factors and function as transcriptional co-repressors in specific cell and promoter contexts. We have previously defined a novel repression domain localized to the N-terminus of each FOG family member, the FOG Repression Motif, which is necessary for FOG-mediated transcriptional repression. In this report, we describe the identification and characterization...
Alternatives to traditional transportation fuels: An overview
Energy Technology Data Exchange (ETDEWEB)
1994-06-01
This report presents the first compilation by the Energy Information Administration (EIA) of information on alternatives to gasoline and diesel fuel. The purpose of the report is: (1) to provide background information on alternative transportation fuels and replacement fuels compared with gasoline and diesel fuel, and (2) to furnish preliminary estimates of alternative transportation fuels and alternative fueled vehicles as required by the Energy Policy Act of 1992 (EPACT), Title V, Section 503, ``Replacement Fuel Demand Estimates and Supply Information.`` Specifically, Section 503 requires the EIA to report annually on: (1) the number and type of alternative fueled vehicles in existence the previous year and expected to be in use the following year, (2) the geographic distribution of these vehicles, (3) the amounts and types of replacement fuels consumed, and (4) the greenhouse gas emissions likely to result from replacement fuel use. Alternative fueled vehicles are defined in this report as motorized vehicles licensed for on-road use, which may consume alternative transportation fuels. (Alternative fueled vehicles may use either an alternative transportation fuel or a replacement fuel.) The intended audience for the first section of this report includes the Secretary of Energy, the Congress, Federal and State agencies, the automobile manufacturing industry, the transportation fuel manufacturing and distribution industries, and the general public. The second section is designed primarily for persons desiring a more technical explanation of and background for the issues surrounding alternative transportation fuels.
Petróczi Andrea; Naughton Declan P; James Ricky
2010-01-01
Abstract Background Substances with performance enhancing properties appear on a continuum, ranging from prohibited performance enhancing drugs (PED) through dietary supplements to functional foods (FF). Anti-doping messages designed to dissuade athletes from using PEDs have been typically based on moralising sport competition and/or employing scare campaigns with focus on the negative consequences. Campaigns offering comparable and acceptable alternatives are nonexistent, nor are athletes he...
Blum, Walter; Pecze, László; Rodriguez, Janine Wörthmüller; Steinauer, Martine; Schwaller, Beat
2018-04-27
The calcium-binding protein calretinin (gene name: CALB2) is currently considered as the most sensitive and specific marker for the diagnosis of malignant mesothelioma (MM). MM is a very aggressive tumor strongly linked to asbestos exposure and with no existing cure so far. The mechanisms of calretinin regulation, as well as its distinct function in MM are still poorly understood. We searched for transcription factors binding to the CALB2 promoter and modulating calretinin expression. For this, DNA-binding assays followed by peptide shotgun-mass spectroscopy analyses were used. CALB2 promoter activity was assessed by dual-luciferase reporter assays. Furthermore, we analyzed the effects of CALB2 promoter-binding proteins by lentiviral-mediated overexpression or down-regulation of identified proteins in MM cells. The modulation of expression of such proteins by butyrate was determined by subsequent Western blot analysis. Immunohistochemical analysis of embryonic mouse lung tissue served to verify the simultaneous co-expression of calretinin and proteins interacting with the CALB2 promoter during early development. Finally, direct interactions of calretinin with target proteins were evidenced by co-immunoprecipitation experiments. Septin 7 was identified as a butyrate-dependent transcription factor binding to a CALB2 promoter region containing butyrate-responsive elements (BRE) resulting in decreased calretinin expression. Accordingly, septin 7 overexpression decreased calretinin expression levels in MM cells. The regulation was found to operate bi-directionally, i.e. calretinin overexpression also decreased septin 7 levels. During murine embryonic development calretinin and septin 7 were found to be co-expressed in embryonic mesenchyme and undifferentiated mesothelial cells. In MM cells, calretinin and septin 7 colocalized during cytokinesis in distinct regions of the cleavage furrow and in the midbody region of mitotic cells. Co-immunoprecipitation experiments
Directory of Open Access Journals (Sweden)
RODRIGO GONZÁLEZ
2007-01-01
Full Text Available Diabetic nephropathy (DN is one of the major complications of type 2 diabetes and is associated with coronary disease. Nephrin, a protein mainly expressed in glomeruli, is decreased in DN and other kidney diseases. Since insulin levels are misregulated in type 2 diabetes, a possible connection between DN and its decreased nephrin expression could be the presence of regulatory elements responsive to insulin in the nephrin gene (NPHS1 promoter region. In this work, using bioinformatic tools, we identified a purine-rich GAGA element in the nephrin gene promoter and conducted a genomic study in search of the presence of polymorphisms in this element and its possible association with DN in type 2 diabetic patients. We amplified and sequenced a 514 bp promoter region of 100 individuals and found no genetic variants in the purine-rich GAGA-box of the nephrin gene promoter between groups of patients with diabetes type 2 with and without renal and coronary complications, control patients without diabetes and healthy controls
Alternative splicing, gene localization, and binding of SH2-B to the insulin receptor kinase domain
Nelms, Keats; O'Neill, Thomas J.; Li, Shiqing; Hubbard, Stevan R.; Gustafson, Thomas A.; Paul, William E.
1999-01-01
. The SH2-B protein is an SH2-domain-containing molecule that interacts with a number of phosphorylated kinase and receptor molecules including the insulin receptor. Two isoforms of the SH2-B have been identified and have been proposed to arise through alternate splicing. Here we have identified a third isoform of the SH2-B protein, SH2-Bγ, that interacts specifically with the insulin receptor. This interaction required phosphorylation of residue Y1146 in the triple tyrosine motif within the ...
Alternative energy companies : a financier's view
International Nuclear Information System (INIS)
Aitken, J.
2002-01-01
The Canadian energy technology sector can be divided into 2 categories: (1) alternative energy generators which include small hydro, wind, biomass, solar energy and fuel cells, and (2) energy technology services. This presentation focused on publicly traded entities and how financing alternatives are limited to project finance, and venture capital. This situation may change as the long term winners emerge and various segments are recognized as not requiring special regulatory and price incentives. Case studies were presented of financing renewable energy projects and the commitment of the Royal Bank of Canada's (RBC) Financial Group to provide financing for alternative energy projects that impact the transportation sector. 15 figs
Goethite promoted biodegradation of 2,4-dinitrophenol under nitrate reduction condition.
Tang, Ting; Yue, Zhengbo; Wang, Jin; Chen, Tianhu; Qing, Chengsong
2018-02-05
Iron oxide may interact with other pollutants in the aquatic environments and further influence their toxicity, transport and fate. The current study was conducted to investigate the biodegradation of 2,4-dinitrophenol (2,4-DNP) in the presence of iron oxide of goethite under anoxic condition using nitrate as the electron acceptor. Experiment results showed that the degradation rate of 2,4-DNP was improved by goethite. High performance liquid chromatography-mass spectra analysis results showed that goethite promoted degradation and transformation of 2,4-diaminophenol and 2-amino-4-nitrophenol (2-nitro-4-aminophenol). Microbial community analysis results showed that the abundance of Actinobacteria, which have the potential ability to degrade PAHs, was increased when goethite was available. This might partially explain the higher degradation of 2,4-DNP. Furthermore, another bacterium of Desulfotomaculum reducens which could reduce soluble Fe(III) and nitrate was also increased. Results further confirmed that nanomaterials in the aquatic environment will influence the microbial community and further change the transformation process of toxic pollutants. Copyright © 2017 Elsevier B.V. All rights reserved.
Decommissioning alternatives, process and work activities
International Nuclear Information System (INIS)
Anon.
1986-01-01
The following outlines the topics discussed under Decommissioning Alternatives, Process and Work Activities: (1) decommissioning alternatives, (2) work activities for prompt removal/dismantling, (3) work activities for entombment with delayed dismantling, and (4) work activities for mothballing with delayed dismantling
Plant-based milk alternatives an emerging segment of functional beverages: a review.
Sethi, Swati; Tyagi, S K; Anurag, Rahul K
2016-09-01
Plant-based or non-dairy milk alternative is the fast growing segment in newer food product development category of functional and specialty beverage across the globe. Nowadays, cow milk allergy, lactose intolerance, calorie concern and prevalence of hypercholesterolemia, more preference to vegan diets has influenced consumers towards choosing cow milk alternatives. Plant-based milk alternatives are a rising trend, which can serve as an inexpensive alternate to poor economic group of developing countries and in places, where cow's milk supply is insufficient. Though numerous types of innovative food beverages from plant sources are being exploited for cow milk alternative, many of these faces some/any type of technological issues; either related to processing or preservation. Majority of these milk alternatives lack nutritional balance when compared to bovine milk, however they contain functionally active components with health promoting properties which attracts health conscious consumers. In case of legume based milk alternatives, sensory acceptability is a major limiting factor for its wide popularity. New and advanced non-thermal processing technologies such as ultra high temperature treatment, ultra high pressure homogenization, pulsed electric field processing are being researched for tackling the problems related to increase of shelf life, emulsion stability, nutritional completeness and sensory acceptability of the final product. Concerted research efforts are required in coming years in functional beverages segment to prepare tailor-made newer products which are palatable as well as nutritionally adequate.
PKCα promotes generation of reactive oxygen species via DUOX2 in hepatocellular carcinoma
International Nuclear Information System (INIS)
Wang, Jiajun; Shao, Miaomiao; Liu, Min; Peng, Peike; Li, Lili; Wu, Weicheng; Wang, Lan; Duan, Fangfang; Zhang, Mingming; Song, Shushu; Jia, Dongwei; Ruan, Yuanyuan; Gu, Jianxin
2015-01-01
Hepatocellular carcinoma (HCC) remains the second leading cause of cancer-related death worldwide, and elevated rates of reactive oxygen species (ROS) have long been considered as a hallmark of almost all types of cancer including HCC. Protein kinase C alpha (PKCα), a serine/threonine kinase among conventional PKC family, is recognized as a major player in signal transduction and tumor progression. Overexpression of PKCα is commonly observed in human HCC and associated with its poor prognosis. However, how PKCα is involved in hepatocellular carcinogenesis remains not fully understood. In this study, we found that among the members of conventional PKC family, PKCα, but not PKCβI or βII, promoted ROS production in HCC cells. PKCα stimulated generation of ROS by up-regulating DUOX2 at post-transcriptional level. Depletion of DUOX2 abrogated PKCα-induced activation of AKT/MAPK pathways as well as cell proliferation, migration and invasion in HCC cells. Moreover, the expression of DUOX2 and PKCα was well positively correlated in both HCC cell lines and patient samples. Collectively, our findings demonstrate that PKCα plays a critical role in HCC development by inducing DUOX2 expression and ROS generation, and propose a strategy to target PKCα/DUOX2 as a potential adjuvant therapy for HCC treatment. - Highlights: • PKCα promotes the generation of ROS in hepatocellular carcinoma. • PKCα induces ROS production by up-regulating DUOX2 at post-transcriptional level. • DUOX2 is required for PKCα-induced AKT/MAPK activation and tumor progression in HCC. • The expression of PKCα is positively correlated with DUOX2 in HCC
PKCα promotes generation of reactive oxygen species via DUOX2 in hepatocellular carcinoma
Energy Technology Data Exchange (ETDEWEB)
Wang, Jiajun; Shao, Miaomiao; Liu, Min; Peng, Peike; Li, Lili; Wu, Weicheng; Wang, Lan [Department of Biochemistry and Molecular Biology, School of Basic Medical Sciences, Fudan University, 200032 Shanghai (China); Duan, Fangfang [Institute of Biomedical Science, Fudan University, Shanghai (China); Zhang, Mingming; Song, Shushu [Department of Biochemistry and Molecular Biology, School of Basic Medical Sciences, Fudan University, 200032 Shanghai (China); Jia, Dongwei, E-mail: jiadongwei@fudan.edu.cn [Department of Biochemistry and Molecular Biology, School of Basic Medical Sciences, Fudan University, 200032 Shanghai (China); Ruan, Yuanyuan, E-mail: yuanyuanruan@fudan.edu.cn [Department of Biochemistry and Molecular Biology, School of Basic Medical Sciences, Fudan University, 200032 Shanghai (China); Gu, Jianxin [Department of Biochemistry and Molecular Biology, School of Basic Medical Sciences, Fudan University, 200032 Shanghai (China); Institute of Biomedical Science, Fudan University, Shanghai (China)
2015-08-07
Hepatocellular carcinoma (HCC) remains the second leading cause of cancer-related death worldwide, and elevated rates of reactive oxygen species (ROS) have long been considered as a hallmark of almost all types of cancer including HCC. Protein kinase C alpha (PKCα), a serine/threonine kinase among conventional PKC family, is recognized as a major player in signal transduction and tumor progression. Overexpression of PKCα is commonly observed in human HCC and associated with its poor prognosis. However, how PKCα is involved in hepatocellular carcinogenesis remains not fully understood. In this study, we found that among the members of conventional PKC family, PKCα, but not PKCβI or βII, promoted ROS production in HCC cells. PKCα stimulated generation of ROS by up-regulating DUOX2 at post-transcriptional level. Depletion of DUOX2 abrogated PKCα-induced activation of AKT/MAPK pathways as well as cell proliferation, migration and invasion in HCC cells. Moreover, the expression of DUOX2 and PKCα was well positively correlated in both HCC cell lines and patient samples. Collectively, our findings demonstrate that PKCα plays a critical role in HCC development by inducing DUOX2 expression and ROS generation, and propose a strategy to target PKCα/DUOX2 as a potential adjuvant therapy for HCC treatment. - Highlights: • PKCα promotes the generation of ROS in hepatocellular carcinoma. • PKCα induces ROS production by up-regulating DUOX2 at post-transcriptional level. • DUOX2 is required for PKCα-induced AKT/MAPK activation and tumor progression in HCC. • The expression of PKCα is positively correlated with DUOX2 in HCC.
A Menagerie of Promotional Characters: Promoting Food to Children through Food Packaging
Hebden, Lana; King, Lesley; Kelly, Bridget; Chapman, Kathy; Innes-Hughes, Christine
2011-01-01
Objective: To determine the extent to which (1) promotional characters are used on food packaging for healthful and less-healthful food and (2) different companies use this persuasive marketing strategy. Design: Cross-sectional supermarket audit of all food and beverages featuring promotional characters on the packaging. Setting: Three Australian…
Yin, Fengqiong; Xu, Zhenhua; Wang, Zifeng; Yao, Hong; Shen, Zan; Yu, Fang; Tang, Yiping; Fu, Dengli; Lin, Sheng; Lu, Gang; Kung, Hsiang-Fu; Poon, Wai Sang; Huang, Yunchao; Lin, Marie Chia-Mi
2012-12-14
Chemokine CC-motif receptor-like 2 (CCRL2) is a 7-transmembrane G protein-coupled receptor which plays a key role in lung dendritic cell trafficking to peripheral lymph nodes. The function and expression of CCRL2 in cancer is not understood at present. Here we report that CCRL2 expression level is elevated in human glioma patient samples and cell lines. The magnitude of increase is positively associated with increasing tumor grade, with the highest level observed in grade IV glioblastoma. By gain-of-function and loss-of-function studies, we further showed that CCRL2 did not regulate the growth of human glioblatoma U87 and U373 cells. Importantly, we demonstrated that over-expression of CCRL2 significantly enhanced the migration rate and invasiveness of the glioblastoma cells. Taken together, these results suggest for the first time that elevated CCRL2 in glioma promotes cell migration and invasion. The potential roles of CCRL2 as a novel therapeutic target and biomarker warrant further investigations. Copyright © 2012 Elsevier Inc. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Walspurger, S.; Boels, L.; Cobden, P.D.; Elzinga, G.D.; Haije, W.G.; Van den Brink, R.W. [Energy Research Centre of the Netherlands ECN, Westerduinweg 3, 1755LE, Petten (Netherlands)
2008-09-15
CO2-free hydrogen can be produced from coal gasification power plants by pre-combustion decarbonisation and carbon dioxide capture. Potassium carbonate promoted hydrotalcite-based and alumina-based materials are cheap and excellent materials for high-temperature (300-500C) adsorption of CO2, and particularly promising in the sorption-enhanced water gas shift (SEWGS) reaction. Alkaline promotion significantly improves CO2 reversible sorption capacity at 300-500C for both materials. Hydrotalcites and promoted hydrotalcites, promoted magnesium oxide and promoted -alumina were investigated by in situ analytical methods (IR spectroscopy, sorption experiments, X-ray diffraction) to identify structural and surface rearrangements. All experimental results show that potassium ions actually strongly interact with aluminium oxide centres in the aluminium-containing materials. This study unambiguously shows that potassium promotion of aluminium oxide centres in hydrotalcite generates basic sites which reversibly adsorb CO2 at 400C.
Vitamin K2 promotes mesenchymal stem cell differentiation by inhibiting miR‑133a expression.
Zhang, Yuelei; Weng, Shiyang; Yin, Junhui; Ding, Hao; Zhang, Changqing; Gao, Youshui
2017-05-01
Vitamin K2 has been demonstrated to promote the osteogenic differentiation of mesenchymal stem cells; however, the mechanisms underlying this effect remain unclear. As microRNA (miR)‑133a has been identified as a negative regulator of osteogenic differentiation, the present study hypothesized that vitamin K2 promoted osteogenesis by inhibiting miR‑133a. Using human bone marrow stromal cells (hBMSCs) overexpressing miR‑133a, or a control, the expression levels of osteogenesis‑associated proteins, including runt‑related transcription factor 2, alkaline phosphatase and osteocalcin, were analyzed. miR‑133a significantly suppressed the osteogenic differentiation of hBMSCs. To determine the effect of vitamin K2 on miR‑133a expression and osteogenesis, hBMSCs were treated with vitamin K2. Vitamin K2 inhibited miR‑133a expression, which was accompanied by enhanced osteogenic differentiation. Furthermore, the expression levels of vitamin K epoxide reductase complex subunit 1, the key protein in γ‑carboxylation, were downregulated by miR‑133a overexpression and upregulated by vitamin K2 treatment, indicating a positive feedback on γ‑carboxylation. The results of the present study suggested that vitamin K2 targets miR‑133a to regulate osteogenesis.
2010-07-01
... VHAP service-skip period leak detection and repair. 61.243-2 Section 61.243-2 Protection of Environment... AIR POLLUTANTS National Emission Standard for Equipment Leaks (Fugitive Emission Sources) § 61.243-2 Alternative standards for valves in VHAP service—skip period leak detection and repair. (a)(1) An owner or...
Promoting sustainable public finances in the European Union
DEFF Research Database (Denmark)
Bergman, Ulf Michael; Hutchison, Michael M.; Jensen, Svend E. Hougaard
2016-01-01
New indices of fiscal rule strength are constructed and, using a dynamic panel econometric model for 27 EU countries over the period 1990–2012, we assess whether national fiscal rules alone help to promote sustainable public finances in the EU or whether they must be supported by good governance...... to implementation of fiscal programs. Supranational rules, however, do not affect the effectiveness of national fiscal rules in reducing the deficit bias. Our results are robust to alternative estimation methods and endogeneity assumptions....
Directory of Open Access Journals (Sweden)
Bisi Roberta
2016-12-01
Full Text Available I percorsi che portano ad usufruire di misure alternative alla detenzione sollecitano riflessioni circa l’importanza delle relazioni, dei processi ed anche delle modalità di costruzione degli interventi. Pertanto, è oltremodo necessario che, grazie a comparazioni verificate in altri Paesi e il progetto europeo di ricerca al quale è dedicato questo numero della Rivista ne è un esempio, vengano formulate e trasferite sul piano operativo contenuti e proposte che dovranno scaturire ed essere rilevate con iniziative di studio, di ricerche, di verifiche e di sperimentazioni poiché l’esigenza di libertà, che è alla base della detenzione, pone problemi di fondo e ne sollecita soluzioni, trattandosi di beni raramente e adeguatamente recuperabili o ricostruibili in pieno. Les parcours qui conduisent à bénéficier de mesures alternatives à l’incarcération sollicitent des réflexions sur l’importance des relations, des processus, mais aussi sur les modalités d’élaboration des interventions. Par conséquent, grâce aux comparaisons avec d’autres pays, et au projet de recherche européen auquel ce numéro de la « Revue de Criminologie, Victimologie et Sécurité » est consacré, il est plus que nécessaire que les propositions et les suggestions formulées soient mises en ɶuvre. Ces dernières devront être élaborées à partir d’études, de recherches, de vérifications et d’essais puisque l’exigence de la liberté, qui est à la base de l’incarcération, pose des problèmes majeurs et demande des solutions, s’agissant de biens rarement et adéquatement récupérables ou pouvant être pleinement reconquis. The routes leading to benefit from alternative measures to detention encourage to reflect on the importance of those relationships and procedures involved in the development of the relevant required interventions. Thanks to the comparisons made in other countries (and the European research project examined in this
Pinaire, J; Hasanadka, R; Fang, M; Chou, WY; Stewart, MJ; Kruijer, W; Crabb, D
2000-01-01
Two tandem sites in the aldehyde dehydrogenase 2 promoter (designated FP330-5' and FP330-3') that bind members of the nuclear receptor superfamily mere recently identified. Antibodies against apolipoprotein regulatory protein (ARP-1) altered DNA-protein interactions in electrophoretic mobility shift
Challenges to promoting health for amateur athletes through anti-doping policy.
Henning, April
2017-01-01
Anti-doping regulations are intended, at least in part, to promote the health of athletes. While most anti-doping efforts target elite and professional competitors, there have been recent moves by sport governing bodies to expand anti-doping testing to include amateur athletes. Drawing on previous critiques of anti-doping policies and illustrating cases, this article outlines five of the challenges to health promotion of applying the current detect and ban model to the amateur level of sport. I argue that the current approach is not effective and, in some ways, may undermine the goal of health promotion at the amateur level. In order to address these challenges, I propose alternative, health-centred strategies that focus on athlete empowerment and choice through critical awareness of a variety of substances, associated risks and rewards, and the role of expertise in decision-making.