WorldWideScience

Sample records for alloy-ehp-496

  1. Ductility and resistance to deformation of EhP975 alloy during hot plastic working

    International Nuclear Information System (INIS)

    Baturin, A.I.; Martynov, A.I.

    1982-01-01

    Results of investigations into ductility and resistance to deformation of the EhP975 most heat-resistant difficult-to-form alloy of commercial melting in 1000-1200 deg C temperature range and at deformation rates epsilon = 0.1 - 25 s - 1 are presented. It is shown that ductility of EhP975 alloy grows rather slowly with increase of temperature approximately up to 1075 deg C, then sharp growth of ductility up to the maximum at 1120-1125 deg C is observed; ductility decreases above this temperature zone. It was also established that ductility of EhP975 alloy grows with increase of preliminary deformation degree. It is marked that high temperature annealing increases ductility of EhP975 alloy in comparison with (cast state), especially noticeably at high deformation rates

  2. Investigating thermomechanical parameters of the EhP693VD heat resisting alloys deformation

    International Nuclear Information System (INIS)

    Garibov, G.S.; Galkin, A.M.; Ermanok, M.Z.; Trepilets, A.E.

    1975-01-01

    The purpose of the present publication consists in complex research of the deformation resistance and plastic characteristics of heat-resistant hard-to-form alloy EhP693VD at the temperatures and deformation rates peculiar for the pressing process. The test conditions are: temperature 1000 to 1200 deg C; rate of deformation 0.5, 5.0 and 25 s -1 . The curves of deformation hardening of alloy EhP693VD show that the alloy is characterized by very high values of forming resistance index Ssub(f). With the increase of the rates of deformation, the maximum of curves Ssub(f) /antiepsilon/ is shifted towards greater degrees of deformation. The increase of the temperature results in the lower deformation hardening of the alloy. The intensity of the growth of the deformation resistance with the decrease of temperature becomes higher at lower degrees of deformation. Variation of plasticity at temperatures of up to 1150 deg C correlates with the curves showing variation of the deformation resistance. At a temperature of 1200 deg C, the drop of the deformation resistance is accompanied by the intensive drop of the plastic characteristics. The planning matrices, test results and complete disperse analysis tables are given. The analysis of the obtained equations makes it possible to draw a conclusion that the rise of the test temperature and drop of the rates of deformation entail the increase of the plastic characteristics

  3. Ageing temperature effect on inclination of martensite high strength steels EhP699, EhP678, EhP679 to corrosion cracking

    International Nuclear Information System (INIS)

    Rozenfel'd, I.L.; Spiridonov, V.B.; Konradi, M.V.; Krasnorutskaya, I.B.; Fridman, V.S.

    1979-01-01

    Stated are the data permitting to judge of the role of ageing temperature in the total number of factors, determining the inclination to corrosion cracking of high strength maraging steels, which contain chromium as a main alloying element. The inclination of the EhP699, EhP678, EhP679 steels to corrosion cracking was estimated on smooth stressed specimens in 3 % NaCl solution with the use of electrochemical polarization. The tensile stress resulted from deflection; anode and cathode current density was 10 mA/cm 2 . It is shown, that resistance to corrosion cracking depends on the ageing temperature: maximum sensitivity to corrosion cracking the steels manifest at the ageing temperatures, providing for maximum strength (470-500 deg). At the ageing temperatures by 20-30 deg over the temperature of this maximum the sensitivity to corrosion cracking disappears, which may result from the loss of coherence of strengthening phase in a matrix, from particle coagulation and stress relaxation in the crack peak

  4. Column extraction chromatography with HEH (EHP) for separating rare earth elements from coexistent elements and its application

    International Nuclear Information System (INIS)

    Peng Chunlin; Sun Baocheng; Zhao Junwu; Liu Xuan

    1985-01-01

    For separating rare earths from large amount of coexistent elements a new method of column extraction chromatography with HEH (EHP) as a stationary phase and sulphosalicylic acid, gluconic acid, ascorbic acid respectively as a mobile phase has been developed. It has been applied to the determination of trace rare earth elements in nickel-base alloys and iron-nickel-base alloys with satisfactory results

  5. Investigation of the hydrolytic and radiolytic degradation of HEH[EHP

    International Nuclear Information System (INIS)

    Peterman, Dean Richard; McDowell, Rocklan George; Zarzana, Christopher Andrew; Johnson, Kristyn Marie; Rowe, Salene Marie; Groenewold, Gary Steven

    2016-01-01

    The extractant 2-ethylhexylphosphonic acid mono-2-ethylhexyl ester (HEH[EHP]) is a component used in both the Advanced TALSPEAK and ALSEP solvent extraction processes. The most likely compound formed via hydrolytic or radiolytic degradation of HEH[EHP] would be the phosphonic acid 2-ethylhexylphosphonic acid (H2EHP) that is formed by cleavage of the P-O-R bond. Thus far, attempts to detect H2EHP by gas chromatography or mass spectrometry have not been successful. The inability to detect this proposed degradation product in analytical samples is likely due to inadequate analysis techniques, lack of H2EHP production, further decomposition of H2EHP forming products not detectable by the employed analytical techniques, or a combination of all of the above scenarios. In order to address this problem, commercially available alkylphosphonic acids were acquired and used as surrogates for H2EHP in the gas chromatography and mass spectrometry analysis of samples. Once the ability to detect alkylphosphonic acid compounds was confirmed, these analytical techniques were used to confirm the production of H2EHP in samples of HEH[EHP] exposed to nitric acid and nitric acid plus gamma radiation. This report provides a brief summary of results and serves as documentation of the completion the level four milestone M4FT-16IN030102025 “Investigate the hydrolytic and radiolytic degradation of HEH[EHP]”.

  6. Data_files_Reyes_EHP_phthalates

    Data.gov (United States)

    U.S. Environmental Protection Agency — The file contains three files in comma separated values (.csv) format. “Reyes_EHP_Phthalates_US_metabolites.csv” contains information about the National Health and...

  7. Visual loop-mediated isothermal amplification (LAMP) for the rapid diagnosis of Enterocytozoon hepatopenaei (EHP) infection.

    Science.gov (United States)

    T, Sathish Kumar; A, Navaneeth Krishnan; J, Joseph Sahaya Rajan; M, Makesh; K P, Jithendran; S V, Alavandi; K K, Vijayan

    2018-05-01

    The emerging microsporidian parasite Enterocytozoon hepatopenaei (EHP), the causative agent of hepatopancreatic microsporidiosis, has been widely reported in shrimp-farming countries. EHP infection can be detected by light microscopy observation of spores (1.7 × 1 μm) in stained hepatopancreas (HP) tissue smears, HP tissue sections, and fecal samples. EHP can also be detected by polymerase chain reaction (PCR) targeting the small subunit (SSU) ribosomal RNA (rRNA) gene or the spore wall protein gene (SWP). In this study, a rapid, sensitive, specific, and closed tube visual loop-mediated isothermal amplification (LAMP) protocol combined with FTA cards was developed for the diagnosis of EHP. LAMP primers were designed based on the SSU rRNA gene of EHP. The target sequence of EHP was amplified at constant temperature of 65 °C for 45 min and amplified LAMP products were visually detected in a closed tube system by using SYBR™ green I dye. Detection limit of this LAMP protocol was ten copies. Field and clinical applicability of this assay was evaluated using 162 field samples including 106 HP tissue samples and 56 fecal samples collected from shrimp farms. Out of 162 samples, EHP could be detected in 62 samples (47 HP samples and 15 fecal samples). When compared with SWP-PCR as the gold standard, this EHP LAMP assay had 95.31% sensitivity, 98.98% specificity, and a kappa value of 0.948. This simple, closed tube, clinically evaluated visual LAMP assay has great potential for diagnosing EHP at the farm level, particularly under low-resource circumstances.

  8. Dicty_cDB: SLC496 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC496 (Link to dictyBase) - - - - SLC496E (Link to Original site) - - - - - - SLC4...96E 443 Show SLC496 Library SL (Link to library) Clone ID SLC496 (Link to dictyBase) At...las ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC4...96Q.Seq.d/ Representative seq. ID SLC496E (Link to Original site) R...epresentative DNA sequence >SLC496 (SLC496Q) /CSM/SL/SLC4-D/SLC496Q.Seq.d/ AAGAAATTTGAATCACTCCAAATCATTATCCCA

  9. Effect of HEH[EHP] impurities on the ALSEP solvent extraction process

    Energy Technology Data Exchange (ETDEWEB)

    Holfeltz, Vanessa E. [Nuclear Chemistry and Engineering Group, Pacific Northwest National Laboratory, Richland, WA, USA; School of Nuclear Science and Engineering, Oregon State University, Corvallis, OR, USA; Campbell, Emily L. [Nuclear Chemistry and Engineering Group, Pacific Northwest National Laboratory, Richland, WA, USA; Peterman, Dean R. [Aqueous Separations and Radiochemistry Department, Idaho National Laboratory, Idaho Falls, ID, USA; Standaert, Robert F. [Biosciences Division, Oak Ridge National Laboratory, Oak Ridge, TN, USA; Department of Biochemistry & amp, Cellular and Molecular Biology, University of Tennessee, Knoxville, TN, USA; Biology & amp, Soft Matter Division, Oak Ridge National Laboratory, Oak Ridge, TN, USA; Shull Wollan Center — a Joint Institute for Neutron Sciences, Oak Ridge National Laboratory, Oak Ridge, TN, USA; Paulenova, Alena [School of Nuclear Science and Engineering, Oregon State University, Corvallis, OR, USA; Lumetta, Gregg J. [Nuclear Chemistry and Engineering Group, Pacific Northwest National Laboratory, Richland, WA, USA; Levitskaia, Tatiana G. [Nuclear Chemistry and Engineering Group, Pacific Northwest National Laboratory, Richland, WA, USA

    2017-12-20

    In solvent extraction processes, organic phase impurities can negatively impact separation factors, hydrolytic performance, and overall system robustness. This affects the process-level viability of a separation concept and necessitates knowledge of the behavior and mechanisms to control impurities in the solvent. The most widespread way through which impurities are introduced into a system is through impure extractants and/or diluents used to prepare the solvent, and often development of new purification schemes to achieve the desired level of purity is needed. In this work, the acidic extractant, 2-ethylhexylphosphonic acid mono-2-ethylhexyl ester (HEH[EHP])—proposed for application in extractive processes aimed at separating trivalent minor actinides from lanthanides and other fission products—is characterized with respect to its common impurities and their impact on Am(III) stripping in the Actinide Lanthanide SEParation (ALSEP) system. To control impurities in HEH[EHP], existing purification technologies commonly applied for the acidic organophosphorus reagents are reviewed, and a new method specific to HEH[EHP] purification is presented.

  10. Structure of the d-alanylgriseoluteic acid biosynthetic protein EhpF, an atypical member of the ANL superfamily of adenylating enzymes

    International Nuclear Information System (INIS)

    Bera, Asim K.; Atanasova, Vesna; Gamage, Swarna; Robinson, Howard; Parsons, James F.

    2010-01-01

    The structure of EhpF from P. agglomerans has been solved alone and in complex with phenazine-1,6-dicarboxylate. Apo EhpF was solved and refined in two different space groups at 1.95 and 2.3 Å resolution and the EhpF–phenazine-1,6-dicarboxylate complex structure was determined at 2.8 Å resolution. The structure of EhpF, a 41 kDa protein that functions in the biosynthetic pathway leading to the broad-spectrum antimicrobial compound d-alanylgriseoluteic acid (AGA), is reported. A cluster of approximately 16 genes, including ehpF, located on a 200 kbp plasmid native to certain strains of Pantoea agglomerans encodes the proteins that are required for the conversion of chorismic acid to AGA. Phenazine-1,6-dicarboxylate has been identified as an intermediate in AGA biosynthesis and deletion of ehpF results in accumulation of this compound in vivo. The crystallographic data presented here reveal that EhpF is an atypical member of the acyl-CoA synthase or ANL superfamily of adenylating enzymes. These enzymes typically catalyze two-step reactions involving adenylation of a carboxylate substrate followed by transfer of the substrate from AMP to coenzyme A or another phosphopantetheine. EhpF is distinguished by the absence of the C-terminal domain that is characteristic of enzymes from this family and is involved in phosphopantetheine binding and in the second half of the canonical two-step reaction that is typically observed. Based on the structure of EhpF and a bioinformatic analysis, it is proposed that EhpF and EhpG convert phenazine-1,6-dicarboxylate to 6-formylphenazine-1-carboxylate via an adenylyl intermediate

  11. The Assessment of reliability and validity of Persian Version of the Endometriosis Health Profile (EHP-30

    Directory of Open Access Journals (Sweden)

    Marzieh Nojomi

    2011-06-01

    Full Text Available Background: The Endometriosis Health Profile-30 (EHP-30 is a disease-specific questionnaire to measure the health-related quality of life in patients with endometriosis. The aim of this study was to evaluate the validity and reliability of the Persian version of Endometriosis Health Profile (EHP-30 in women with endometriosis referring to three Gynecology Clinics in Tehran, Iran. Methods: One hundred women (20 to 50 years old with surgically confirmed endometriosis recruited from three outpatient Gynecology Clinics affiliated to the Iran University of Medical Sciences. All 100 patients were asked to complete EHP-30 questionnaire while referring to the Clinics. The findings were analyzed using descriptive statistics, internal reliability consistency, construct validity (using short form-36, which had already been validated in Iran, factor analysis (with principle component analysis method, and item total correlation to assess the validity and reliability of the questionnaire. Results: The internal consistency reliability of the questionnaire was high (Cronbach’s α ranged between 0.80 and 0.93 for core, and 0.78 and 0.90 for modular parts. All items were loaded on their own factors except item 17 (feeling aggressive or violent and item 18 (feeling unwell, which were loaded on pain and social support domains, respectively. Construct validity of EHP-30, established by using SF-36, indicates good correlations in several similar scales of these two questionnaires. Conclusion: The findings of the study demonstrate that Persian version of EHP-30 is a valid and reliable measure to assess the quality of life in women with endometriosis

  12. A Nested PCR Assay to Avoid False Positive Detection of the Microsporidian Enterocytozoon hepatopenaei (EHP) in Environmental Samples in Shrimp Farms

    Science.gov (United States)

    Jaroenlak, Pattana; Sanguanrut, Piyachat; Williams, Bryony A. P.; Stentiford, Grant D.; Flegel, Timothy W.; Sritunyalucksana, Kallaya

    2016-01-01

    Hepatopancreatic microsporidiosis (HPM) caused by Enterocytozoon hepatopenaei (EHP) is an important disease of cultivated shrimp. Heavy infections may lead to retarded growth and unprofitable harvests. Existing PCR detection methods target the EHP small subunit ribosomal RNA (SSU rRNA) gene (SSU-PCR). However, we discovered that they can give false positive test results due to cross reactivity of the SSU-PCR primers with DNA from closely related microsporidia that infect other aquatic organisms. This is problematic for investigating and monitoring EHP infection pathways. To overcome this problem, a sensitive and specific nested PCR method was developed for detection of the spore wall protein (SWP) gene of EHP (SWP-PCR). The new SWP-PCR method did not produce false positive results from closely related microsporidia. The first PCR step of the SWP-PCR method was 100 times (104 plasmid copies per reaction vial) more sensitive than that of the existing SSU-PCR method (106 copies) but sensitivity was equal for both in the nested step (10 copies). Since the hepatopancreas of cultivated shrimp is not currently known to be infected with microsporidia other than EHP, the SSU-PCR methods are still valid for analyzing hepatopancreatic samples despite the lower sensitivity than the SWP-PCR method. However, due to its greater specificity and sensitivity, we recommend that the SWP-PCR method be used to screen for EHP in feces, feed and environmental samples for potential EHP carriers. PMID:27832178

  13. A Nested PCR Assay to Avoid False Positive Detection of the Microsporidian Enterocytozoon hepatopenaei (EHP) in Environmental Samples in Shrimp Farms.

    Science.gov (United States)

    Jaroenlak, Pattana; Sanguanrut, Piyachat; Williams, Bryony A P; Stentiford, Grant D; Flegel, Timothy W; Sritunyalucksana, Kallaya; Itsathitphaisarn, Ornchuma

    2016-01-01

    Hepatopancreatic microsporidiosis (HPM) caused by Enterocytozoon hepatopenaei (EHP) is an important disease of cultivated shrimp. Heavy infections may lead to retarded growth and unprofitable harvests. Existing PCR detection methods target the EHP small subunit ribosomal RNA (SSU rRNA) gene (SSU-PCR). However, we discovered that they can give false positive test results due to cross reactivity of the SSU-PCR primers with DNA from closely related microsporidia that infect other aquatic organisms. This is problematic for investigating and monitoring EHP infection pathways. To overcome this problem, a sensitive and specific nested PCR method was developed for detection of the spore wall protein (SWP) gene of EHP (SWP-PCR). The new SWP-PCR method did not produce false positive results from closely related microsporidia. The first PCR step of the SWP-PCR method was 100 times (104 plasmid copies per reaction vial) more sensitive than that of the existing SSU-PCR method (106 copies) but sensitivity was equal for both in the nested step (10 copies). Since the hepatopancreas of cultivated shrimp is not currently known to be infected with microsporidia other than EHP, the SSU-PCR methods are still valid for analyzing hepatopancreatic samples despite the lower sensitivity than the SWP-PCR method. However, due to its greater specificity and sensitivity, we recommend that the SWP-PCR method be used to screen for EHP in feces, feed and environmental samples for potential EHP carriers.

  14. 30 CFR 49.6 - Equipment and maintenance requirements.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Equipment and maintenance requirements. 49.6... TRAINING MINE RESCUE TEAMS § 49.6 Equipment and maintenance requirements. (a) Each mine rescue station... indicates that a corrective action is necessary, the corrective action shall be made and the person shall...

  15. Re-Computation of Numerical Results Contained in NACA Report No. 496

    Science.gov (United States)

    Perry, Boyd, III

    2015-01-01

    An extensive examination of NACA Report No. 496 (NACA 496), "General Theory of Aerodynamic Instability and the Mechanism of Flutter," by Theodore Theodorsen, is described. The examination included checking equations and solution methods and re-computing interim quantities and all numerical examples in NACA 496. The checks revealed that NACA 496 contains computational shortcuts (time- and effort-saving devices for engineers of the time) and clever artifices (employed in its solution methods), but, unfortunately, also contains numerous tripping points (aspects of NACA 496 that have the potential to cause confusion) and some errors. The re-computations were performed employing the methods and procedures described in NACA 496, but using modern computational tools. With some exceptions, the magnitudes and trends of the original results were in fair-to-very-good agreement with the re-computed results. The exceptions included what are speculated to be computational errors in the original in some instances and transcription errors in the original in others. Independent flutter calculations were performed and, in all cases, including those where the original and re-computed results differed significantly, were in excellent agreement with the re-computed results. Appendix A contains NACA 496; Appendix B contains a Matlab(Reistered) program that performs the re-computation of results; Appendix C presents three alternate solution methods, with examples, for the two-degree-of-freedom solution method of NACA 496; Appendix D contains the three-degree-of-freedom solution method (outlined in NACA 496 but never implemented), with examples.

  16. The short form endometriosis health profile (EHP-5: translation and validation study of the Iranian version

    Directory of Open Access Journals (Sweden)

    Goshtasebi Azita

    2011-07-01

    Full Text Available Abstract Background Endometriosis Health Profile (EHP-5 is a valid instrument to measure health-related quality of life in endometriosis. This study was conducted to culturally adapt and validate the EHP-5 in Iran. Methods Using a standard "forward-backward' translation procedure, the English language version of the questionnaire was translated into Persian (Iranian language. Then a sample of 199 women aged 18-50 years completed the questionnaire. To test reliability the internal consistency was assessed by Cronbach's alpha coefficient. Validity was evaluated using known groups comparison. Results The mean age of respondents was 31.4 (SD = 5.4 years. Reliability analysis showed satisfactory result (Cronbach's alpha coefficient = 0.71. The questionnaire discriminated well between sub-groups of women differing in infertility and premenstrual syndrome (PMS in the expected direction. Conclusion This preliminary validation study of the Iranian version of the EHP-5 proved that it is an acceptable, reliable and valid measure of quality of life in endometriosis patients.

  17. Dense populations of the microsporidian Enterocytozoon hepatopenaei (EHP) in feces of Penaeus vannamei exhibiting white feces syndrome and pathways of their transmission to healthy shrimp.

    Science.gov (United States)

    Tang, Kathy F J; Han, Jee Eun; Aranguren, Luis Fernando; White-Noble, Brenda; Schmidt, Margeaux M; Piamsomboon, Patharapol; Risdiana, Eris; Hanggono, Bambang

    2016-10-01

    White feces syndrome (WFS) is an emerging problem for penaeid shrimp farming industries in SE Asia countries, Thailand, Malaysia, Vietnam, Indonesia, China, and in India. This occurrence of this syndrome is usually first evidenced by the appearance of white fecal strings floating on surface of the shrimp ponds. The gross signs of affected shrimp include the appearance of a whitish hindgut and loose carapace, and it is associated with reduced feeding and growth retardation. To investigate the nature of the white feces syndrome, samples of white feces and shrimp hepatopancreas tissue were collected from Penaeus vannamei in affected farms in Indonesia, and these were examined histologically. Within the white feces, we found densely packed spores of the microsporidian Enterocytozoon hepatopenaei (abbreviated as EHP) and relatively fewer numbers of rod-shaped bacteria. From WFS ponds, hepatopancreas samples form 30 individual shrimp were analyzed by histology and in situ hybridization. The results showed that all of the shrimp examined were infected with EHP accompanied by septic hepatopancreatic necrosis (SHPN). Midgut epithelial cells were also infected and this increased the number of tissue types being affected by EHP. By PCR, EHP was detected in all the samples analyzed from WFS-affected ponds, but not in those sampled from healthy shrimp ponds. To determine the modes of transmission for this parasite, we performed feeding and cohabitation bioassays, the results showed that EHP can be transmitted through per os feeding of EHP-infected hepatopancreas tissue to healthy shrimp and through cohabitation ofinfected and healthy shrimp. In addition, we found the use of Fumagillin-B, an antimicrobial agent, was ineffective in either reducing or eliminating EHP in infected shrimp. Copyright © 2016 Elsevier Inc. All rights reserved.

  18. Whirlwind Drama During Spirit's 496th Sol

    Science.gov (United States)

    2005-01-01

    This movie clip shows a dust devil growing in size and blowing across the plain inside Mars' Gusev Crater. The clip consists of frames taken by the navigation camera on NASA's Mars Exploration Rover Spirit during the morning of the rover's 496th martian day, or sol (May 26, 2005). Contrast has been enhanced for anything in the images that changes from frame to frame, that is, for the dust moved by wind.

  19. Measuring health-related quality of life in women with endometriosis: comparing the clinimetric properties of the Endometriosis Health Profile-5 (EHP-5) and the EuroQol-5D (EQ-5D).

    Science.gov (United States)

    Aubry, G; Panel, P; Thiollier, G; Huchon, C; Fauconnier, A

    2017-06-01

    Which of the Endometriosis Health Profile-5 (EHP-5) and the EuroQol-5D (EQ-5D) is the most efficient to assess quality of life in women suffering from endometriosis? Although EHP-5 and EQ-5D instruments had an excellent responsiveness, EHP-5 has a better discriminative ability than EQ-5 to measure health-related quality of life (HrQoL). Proper measurement of HrQoL is important in endometriosis. While many quality of life instruments are available, few have been completely validated in endometriosis. The EHP-5 and the EQ-5D are short and practical scales, which may be useful. Literature is lacking to determine which one is the most suitable in clinical practice or in clinical research. This prospective and observational study conducted between 1 January 2012 and 31 December 2013 included a total of 253 consecutive women with proven endometriosis, undergoing medical or surgical treatment, in 2 French tertiary care centers. Women over 18 years consulting for painful symptoms of at least 3 months' duration or for infertility, with endometriosis proven histologically or radiologically, were requested to fill in the 2 scales before (T0) and 12 months after treatment (T1). Construct validity consisted in testing presupposed relationships between the scales and the characteristics of the patients or the endometriosis. Responsiveness to change was calculated for all patients and in each treatment group. Effect sizes were used according to Cohen's d method. A total of 216 women filled in completely all the questionnaires at T0 and 133 (61.6%) at T1. EHP-5 and EQ-5D had good discriminative abilities regarding the patients' symptoms, with significant superiority of EHP-5 concerning three of the nine hypotheses. The largest difference was that calculated for the 'intensity of dysmenorrhea' using the Visual Analogic Scale, with respectively effect size from Cohen's d (ES) = 0.86 95% CI (0.54-1.17) for EHP-5 versus 0.48 95% CI (0.16-0.79) for EQ-5D. There were no differences in

  20. Heat treatment effect on the properties of the EhP767 maraging steel welded joints

    International Nuclear Information System (INIS)

    Taver, E.I.; Piskarev, M.N.; Yushchenko, K.A.; Pustovit, A.I.; Anisimova, M.S.

    1977-01-01

    Heat treatment effect on properties of welded joints of maraging 03Kh13N4K13M3T (EhP767) steel with yield strength over 150 kgs/mm 2 has been investigated. It is shown, that change in impact strength of aged joints at - 196 deg C depends on the amount of residual austenite and grain size. To stabilize 20-40 % residual austenite heat treatment regimes have been developed. Recommended are quenching at 1030-1050 deg C, sub-zero treatment and aging at 520 deg C for 16 hrs

  1. Topological model of austenite-martensite interfaces in Cu-Al-Ni alloy

    Czech Academy of Sciences Publication Activity Database

    Ostapovets, Andriy; Zárubová, Niva; Paidar, Václav

    2012-01-01

    Roč. 122, č. 3 (2012), s. 493-496 ISSN 0587-4246. [International Symposium on Physics of Materials, ISPMA /12./. Praha, 04.09.2011-08.09.2011] R&D Projects: GA AV ČR IAA100100920 Institutional research plan: CEZ:AV0Z10100520 Keywords : CuAlNi * alloy * experimental data * in-situ * topological models * transmission electron microscopy Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 0.531, year: 2012

  2. The stellar content of the A496 cD galaxy

    NARCIS (Netherlands)

    Valentijn, E. A.; Moorwood, A. F. M.

    1985-01-01

    J, H, and K radial color distributions obtained for the galaxy A496 cD indicate that while the halo becomes bluer at increasing radii in the B-V, it becomes redder in the visual-IR colors. The combined visual-IR data lead to a unique model for both the main sequence and giant stars in which the main

  3. 78 FR 78838 - Grant of Interim Extension of the Term of U.S. Patent No. 5,496,801; Recombinant Human...

    Science.gov (United States)

    2013-12-27

    ...] Grant of Interim Extension of the Term of U.S. Patent No. 5,496,801; Recombinant Human Parathyroid...,801. FOR FURTHER INFORMATION CONTACT: Mary C. Till by telephone at (571) 272-7755; by mail marked to... No. 5,496,801. The patent claims the human biological product recombinant human parathyroid hormone...

  4. Closure Letter Report for Corrective Action Unit 496: Buried Rocket Site - Antelope Lake (TTR)

    International Nuclear Information System (INIS)

    NSTec Environmental Restoration

    2007-01-01

    A Streamlined Approach for Environmental Restoration (SAFER) Plan for investigation and closure of CAU 496, Corrective Action Site (CAS) TA-55-008-TAAL (Buried Rocket), at the Tonopah Test Range (TTR), was approved by the Nevada Department of Environmental Protection (NDEP) on July 21,2004. Approval to transfer CAS TA-55-008-TAAL from CAU 496 to CAU 4000 (No Further Action Sites) was approved by NDEP on December 21, 2005, based on the assumption that the rocket did not present any environmental concern. The approval letter included the following condition: ''NDEP understands, from the NNSA/NSO letter dated November 30,2005, that a search will be conducted for the rocket during the planned characterization of other sites at the Tonopah Test Range and, if found, the rocket will be removed as a housekeeping measure''. NDEP and U.S. Department of Energy, National Nuclear Security Administration Nevada Site Office personnel located the rocket on Mid Lake during a site visit to TTR, and a request to transfer CAS TA-55-008-TAAL from CAU 4000 back to CAU 496 was approved by NDEP on September 11,2006. CAS TA-55-008-TAAL was added to the ''Federal Facility Agreement and Consent Order'' of 1996, based on an interview with a retired TTR worker in 1993. The original interview documented that a rocket was launched from Area 9 to Antelope Lake and was never recovered due to the high frequency of rocket tests being conducted during this timeframe. The interviewee recalled the rocket being an M-55 or N-55 (the M-50 ''Honest John'' rocket was used extensively at TTR from the 1960s to early 1980s). A review of previously conducted interviews with former TTR personnel indicated that the interviewees confused information from several sites. The location of the CAU 496 rocket on Mid Lake is directly south of the TTR rocket launch facility in Area 9 and is consistent with information gathered on the lost rocket during recent interviews. Most pertinently, an interview in 2005 with a

  5. Effect of technological procedures on the crack resistance of nickel alloy welded joints under heat treatment

    International Nuclear Information System (INIS)

    Bagdasarov, Yu.S.; Sorokin, L.I.; Yakushin, B.F.; Moryashchev, S.F.

    1983-01-01

    Comparison of the efficiency of some technological procedures directed to the increase of crack resistance of KhN50MBKTYUR (EhP99) alloy welded joints under heat treatment was conducted. Welded joints were manufactured by the methods of electron beam welding, laser welding, automatic argon-arc welding. The latter was conducted by conventional technology as well as with electromagnetic mixing of liquid metal of welding bath, with compulsory cooling of weld matal, with pulse arc. It is shown that the high fracture resistance of welded joints, manufactured by electron beam and laser welding is achieved by combination of high mechanical properties of heat affected zone metal and reduced elastic potential energy margin of residual welding stresses (as compared to argon-arc welding)

  6. Assessment and outcome of 496 penetrating gastrointestinal warfare injuries.

    Science.gov (United States)

    Saghafinia, M; Nafissi, N; Motamedi, M R K; Motamedi, M H K; Hashemzade, M; Hayati, Z; Panahi, F

    2010-03-01

    The abdominal viscera are among the most vulnerable organs of the body to penetrating trauma. Proper management of such trauma in war victims at the first-line hospital where these victims are first seen is of paramount importance. We reviewed medical records of war victims suffering small bowel and colorectal injuries treated at first, second and third-line hospitals during the Iraq-Iran War (1980-88) to assess surgical outcomes. The medical records of 496 Iranian war victims suffering penetrating gastrointestinal (GI) injuries treated at first, second and third-line (tertiary) hospitals, a total of 19 centres, were reviewed. Laparotomy had been performed at the 1st line hospitals for all patients who had an acute abdomen, whose wounds violated the peritoneum or whose abdominal radiographs showed air or shrapnel in the abdominal cavity. Stable patients were transferred from first-line to second-line or from second line to tertiary hospitals postoperatively. The treatments, complications and patient outcomes were documented and analyzed. There were 496 patients; 145, 220 and 131 victims underwent laparotomy for GI injuries at first, second and third-line hospitals respectively. The small intestine and colon respectively were the most prevalent abdominal organs damaged. Those first treated for GI injuries at front-line hospitals (145 victims) had more serious conditions and could not be transferred prior to surgery and presented a higher prevalence of complications and mortality. Overall mortality from GI surgery was 3.6% (18 patients). Eleven patients (7.5%) whose first GI operation was performed at frontline hospitals and 7 patients (3.2%) who underwent their first surgical operation at second-line hospitals died. The most common reason for these deaths was complications relating to the gastrointestinal operation such as anastomotic leak. Six missed injuries were seen at the frontline and one at second line hospitals. There were no deaths at the 3rd line hospitals

  7. Clinical manifestations and laboratory findings of 496 children with brucellosis in Van, Turkey.

    Science.gov (United States)

    Parlak, Mehmet; Akbayram, Sinan; Doğan, Murat; Tuncer, Oğuz; Bayram, Yasemin; Ceylan, Nesrin; Özlük, Suat; Akbayram, Hatice Tuba; Öner, Abdurrahman

    2015-08-01

    Brucellosis is the most common zoonotic disease worldwide and remains an important human disease especially in developing countries. The aim of the present study was to evaluate clinical manifestations and laboratory findings of childhood brucellosis in Van province of Eastern Turkey. To our knowledge, this is the largest series of childhood brucellosis reported in the literature. In this retrospective study, 496 children with brucellosis were assessed for the clinical manifestations and laboratory findings from July 2009 through December 2013. The diagnosis of brucellosis was based on clinical findings and a standard tube agglutination test (titer ≥ 1:160). Data were analyzed using Minitab version 16. The study included 496 children (boys, 60.5%) with a mean age of 10.0 ± 3.95 years (range, 1-16 years). The most frequent clinical symptoms were arthralgia (46.2%), fever (32.1%), and abdominal pain (17.1%) and the most common clinical signs were peripheral arthritis (10.1%), splenomegaly (2.2%) and hepatomegaly (1.8%). The most contagious seasons were summer and autumn (63.3%). Elevated lactate dehydrogenase and C-reactive protein and erythrocyte sedimentation rate were reported in 63.1%, 58.7%, and 55.2% of the patients, respectively. Anemia (20.4%), thrombocytopenia (15.5%), and leukopenia (12.1%) were the most common hematologic findings. Brucellosis remains a serious public health problem in Turkey. The clinical and laboratory characteristics of childhood brucellosis have been described in order to assist clinicians in diagnosing and monitoring the disease. © 2015 Japan Pediatric Society.

  8. An experimental study of the enhanced heating capacity of an electric heat pump (EHP) using the heat recovered from a gas engine generator

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Cheol Min; Chang, Se Dong [HAC R and D Laboratory, LG Electronics, 327-23 Gasan-Dong, Geumcheon-gu, Seoul 153-802 (Korea); Lee, Jaekeun; Hwang, Yujin [School of Mechanical Engineering, Pusan National University, San 30, Changjeon-Dong, Keumjeong-Ku, Busan 609-735 (Korea)

    2009-11-15

    This paper is concerned with the effect of recovered heat on the heating capacity of an Electric Heat Pump (EHP), which is supplied with electric power and recovered heat from a gas engine generator system. Two methods of supplying recovery heat are examined: (i) to the refrigerant with the discharge line heat exchanger (HEX), and (ii) to the refrigerant of the evaporator with the sub-evaporator. Heating capacity, input power and coefficient of performance (COP) were investigated and compared for each heat recovery method. Conclusively, we found that the second method was most reasonable to recover wasted heat and increased system COP by 215%. (author)

  9. Investigation of various synthetic conditions for large-scale synthesis and electrochemical properties of Li{sub 3.98}Al{sub 0.06}Ti{sub 4.96}O{sub 12}/C as anode material

    Energy Technology Data Exchange (ETDEWEB)

    Dong, Guo-Hui, E-mail: dgh1516@gmail.com [Shanghai Shanshan Tech Co., Ltd., 3158 Jinhai Road, Shanghai 201209 (China); Shanghai Jiao Tong University, 800 Dongchuan Road, Shanghai 200240 (China); Liu, Hua-Jing; Zhou, Liang [Shanghai Shanshan Tech Co., Ltd., 3158 Jinhai Road, Shanghai 201209 (China); Shanghai Second Polytechnic University, 2360 Jinhai Road, Shanghai 201209 (China); Chong, Lina; Yang, Jun [Shanghai Jiao Tong University, 800 Dongchuan Road, Shanghai 200240 (China); Qiao, Yong-Min; Zhang, Dian-Hao [Shanghai Shanshan Tech Co., Ltd., 3158 Jinhai Road, Shanghai 201209 (China)

    2014-12-05

    Graphical abstract: A gel and spray-drying method is demonstrated for large-scale preparation of Li{sub 3.98}Al{sub 0.06}Ti{sub 4.96}O{sub 12}/C secondary microspheres via optimizing various synthetic conditions. The electrochemical performances of the Li{sub 3.98}Al{sub 0.06}Ti{sub 4.96}O{sub 12}/C microspheres are investigated. - Highlights: • Various synthetic conditions are investigated. • Materials can be produced at ∼1 kg scale by using our demonstrated synthesis method. • Li{sub 3.98}Al{sub 0.06}Ti{sub 4.96}O{sub 12}/C sample possesses high electronic conductivity and rate property, and excellent cycling performance. • Secondary micro-spherical Li{sub 3.98}Al{sub 0.06}Ti{sub 4.96}O{sub 12}/C sample has high tap density et al. - Abstract: Poor electronic conductivity is one of the biggest obstacles for practical application of lithium titanate as lithium-ion battery anode material. Utilizing the advantages of coating and doping techniques to optimize the conductive and rate performances of lithium titanate was reported in this work. Herein, the effects of various synthetic conditions including calcination temperatures and holding times, lithium overdoses, carbon contents, doping contents and doping elements on phase, primary particles’ size and electrochemical performance were comprehensively investigated. The optimal Li{sub 3.98}Al{sub 0.06}Ti{sub 4.96}O{sub 12}/C secondary microspheres were synthesized, which possessed high electronic conductivity, tap density, reversible capacity and first columbic efficiency, and excellent rate performances. Furthermore, the synthesized samples were characterized by various techniques.

  10. Electrical Resistance Alloys and Low-Expansion Alloys

    DEFF Research Database (Denmark)

    Kjer, Torben

    1996-01-01

    The article gives an overview of electrical resistance alloys and alloys with low thermal expansion. The electrical resistance alloys comprise resistance alloys, heating alloys and thermostat alloys. The low expansion alloys comprise alloys with very low expansion coefficients, alloys with very low...... thermoelastic coefficients and age hardenable low expansion alloys....

  11. Silicon Alloying On Aluminium Based Alloy Surface

    International Nuclear Information System (INIS)

    Suryanto

    2002-01-01

    Silicon alloying on surface of aluminium based alloy was carried out using electron beam. This is performed in order to enhance tribological properties of the alloy. Silicon is considered most important alloying element in aluminium alloy, particularly for tribological components. Prior to silicon alloying. aluminium substrate were painted with binder and silicon powder and dried in a furnace. Silicon alloying were carried out in a vacuum chamber. The Silicon alloyed materials were assessed using some techniques. The results show that silicon alloying formed a composite metal-non metal system in which silicon particles are dispersed in the alloyed layer. Silicon content in the alloyed layer is about 40% while in other place is only 10.5 %. The hardness of layer changes significantly. The wear properties of the alloying alloys increase. Silicon surface alloying also reduced the coefficient of friction for sliding against a hardened steel counter face, which could otherwise be higher because of the strong adhesion of aluminium to steel. The hardness of the silicon surface alloyed material dropped when it underwent a heating cycle similar to the ion coating process. Hence, silicon alloying is not a suitable choice for use as an intermediate layer for duplex treatment

  12. Photohadronic scenario in interpreting the February-March 2014 flare of 1ES 1011+496

    Energy Technology Data Exchange (ETDEWEB)

    Sahu, Sarira [Universidad Nacional Autonoma de Mexico, Instituto de Ciencias Nucleares, Circuito Exterior, Mexico (Mexico); RIKEN, Astrophysical Big Bang Laboratory, Wako, Saitama (Japan); Rosales de Leon, Alberto [Universidad Nacional Autonoma de Mexico, Instituto de Ciencias Nucleares, Circuito Exterior, Mexico (Mexico); Salvador Miranda, Luis [University of Johannesburg, Department of Physics, Auckland Park (South Africa)

    2017-11-15

    The extraordinary multi-TeV flare from 1ES 1011+496 during February-March 2014 was observed by the MAGIC telescopes for 17 nights and the average spectrum of the whole period has a non-trivial shape. We have used the photohadronic model and a template extragalactic background light model to explain the average spectrum which fits the flare data well. The spectral index α is the only free parameter in our model. We have also shown that the non-trivial nature of the spectrum is due to the change in the behavior of the optical depth above ∝ 600 GeV γ-ray energy accompanied with the high SSC flux. This corresponds to an almost flat intrinsic flux for the multi-TeV γ-rays. Our model prediction can constrain the SSC flux of the leptonic models in the quiescent state. (orig.)

  13. Photohadronic scenario in interpreting the February-March 2014 flare of 1ES 1011+496

    Science.gov (United States)

    Sahu, Sarira; de León, Alberto Rosales; Miranda, Luis Salvador

    2017-11-01

    The extraordinary multi-TeV flare from 1ES 1011+496 during February-March 2014 was observed by the MAGIC telescopes for 17 nights and the average spectrum of the whole period has a non-trivial shape. We have used the photohadronic model and a template extragalactic background light model to explain the average spectrum which fits the flare data well. The spectral index α is the only free parameter in our model. We have also shown that the non-trivial nature of the spectrum is due to the change in the behavior of the optical depth above ˜ 600 GeV γ -ray energy accompanied with the high SSC flux. This corresponds to an almost flat intrinsic flux for the multi-TeV γ -rays. Our model prediction can constrain the SSC flux of the leptonic models in the quiescent state.

  14. Laser surface alloying of aluminium-transition metal alloys

    International Nuclear Information System (INIS)

    Almeida, A.; Vilar, R.

    1998-01-01

    Laser surface alloying has been used as a tool to produce hard and corrosion resistant Al-transition metal (TM) alloys. Cr and Mo are particularly interesting alloying elements to produce stable high-strength alloys because they present low diffusion coefficients and solid solubility in Al. To produce Al-TM surface alloys a two-step laser process was developed: firstly, the material is alloyed using low scanning speed and secondly, the microstructure is modified by a refinement step. This process was used in the production of Al-Cr, Al-Mo and Al-Mo and Al-Nb surface alloys by alloying Cr, Mo or Nb powder into an Al and 7175 Al alloy substrate using a CO 2 laser . This paper presents a review of the work that has been developed at Instituto Superior Tecnico on laser alloying of Al-TM alloy, over the last years. (Author) 16 refs

  15. Magnesium secondary alloys: Alloy design for magnesium alloys with improved tolerance limits against impurities

    Energy Technology Data Exchange (ETDEWEB)

    Blawert, C., E-mail: carsten.blawert@gkss.d [GKSS Forschungszentrum Geesthacht GmbH, Max-Planck-Str. 1, 21502 Geesthacht (Germany); Fechner, D.; Hoeche, D.; Heitmann, V.; Dietzel, W.; Kainer, K.U. [GKSS Forschungszentrum Geesthacht GmbH, Max-Planck-Str. 1, 21502 Geesthacht (Germany); Zivanovic, P.; Scharf, C.; Ditze, A.; Groebner, J.; Schmid-Fetzer, R. [TU Clausthal, Institut fuer Metallurgie, Robert-Koch-Str. 42, 38678 Clausthal-Zellerfeld (Germany)

    2010-07-15

    The development of secondary magnesium alloys requires a completely different concept compared with standard alloys which obtain their corrosion resistance by reducing the levels of impurities below certain alloy and process depending limits. The present approach suitable for Mg-Al based cast and wrought alloys uses a new concept replacing the {beta}-phase by {tau}-phase, which is able to incorporate more impurities while being electro-chemically less detrimental to the matrix. The overall experimental effort correlating composition, microstructure and corrosion resistance was reduced by using thermodynamic calculations to optimise the alloy composition. The outcome is a new, more impurity tolerant alloy class with a composition between the standard AZ and ZC systems having sufficient ductility and corrosion properties comparable to the high purity standard alloys.

  16. Alloying principles for magnesium base heat resisting alloys

    International Nuclear Information System (INIS)

    Drits, M.E.; Rokhlin, L.L.; Oreshkina, A.A.; Nikitina, N.I.

    1982-01-01

    Some binary systems of magnesium-base alloys in which solid solutions are formed, are considered for prospecting heat resistant alloys. It is shown that elements having essential solubility in solid magnesium strongly decreasing with temperature should be used for alloying maqnesium base alloys with high strength properties at increased temperatures. The strengthening phases in these alloys should comprise essential quantity of magnesium and be rather refractory

  17. Use of high energy ball milling to study the role of graphene nanoplatelets and carbon nanotubes reinforced magnesium alloy

    Energy Technology Data Exchange (ETDEWEB)

    Rashad, Muhammad, E-mail: rashadphy87@gmail.com [College of Materials Science and Engineering, Chongqing University, Chongqing 400044 (China); National Engineering Research Center for Magnesium Alloys, Chongqing University, Chongqing 400044 (China); Pan, Fusheng, E-mail: fspan@cqu.edu.cn [College of Materials Science and Engineering, Chongqing University, Chongqing 400044 (China); National Engineering Research Center for Magnesium Alloys, Chongqing University, Chongqing 400044 (China); Chongqing Academy of Science and Technology, Chongqing, Chongqing 401123 (China); Zhang, Jianyue [College of Materials Science and Engineering, Chongqing University, Chongqing 400044 (China); National Engineering Research Center for Magnesium Alloys, Chongqing University, Chongqing 400044 (China); Asif, Muhammad [School of Materials Science and Engineering, Dalian University of Technology, Dalian 116024 (China)

    2015-10-15

    Graphene nanoplatelets (few layer graphene) and carbon nanotubes were used as reinforcement fillers to enhance the mechanical properties of AZ31 magnesium alloy through high energy ball milling, sintering, and hot extrusion techniques. Experimental results revealed that tensile fracture strain of AZ31 magnesium alloy was enhanced by +49.6% with 0.3 wt.% graphene nanoplatelets compared to −8.3% regression for 0.3 wt.% carbon nanotubes. The tensile strength of AZ31 magnesium alloy was decreased (−11.2%) with graphene nanoplatelets addition, while increased (+7.7%) with carbon nanotubes addition. Unlike tensile test, compression tests showed different trend. The compression strength of carbon nanotubes-AZ31 composite was +51.2% greater than AZ31 magnesium alloy as compared to +0.6% increase for graphene nanoplatelets. The compressive fracture strain of carbon nanotubes-AZ31 composite was decreased (−14.1%) while no significant change in fracture strain of graphene nanoplatelets-AZ31 composite was observed. The X-ray diffraction results revealed that addition of reinforcement particles weaken the basal textures which affect the composite's yield asymmetry. Microstructure evaluation revealed the absence of intermetallic phase formation between reinforcements and matrix. The carbon reinforcements in AZ31 magnesium alloy dissolve and isolate β phases throughout the matrix. The increased fracture strain and mechanical strength of graphene nanoplatelets and carbon nanotubes-AZ31 composites are attributed to large specific surface area of graphene nanoplatelets and stiffer nature of carbon nanotubes respectively. - Highlights: • Powder metallurgy method was used to fabricate magnesium composites. • The AZ31-carbon materials composite were blended using ball milling. • The reinforcement particles weaken the basal texture which affects yield asymmetry of composites. • AZ31-graphene nanoplatelets composite exhibited impressive increase in tensile elongation

  18. Use of high energy ball milling to study the role of graphene nanoplatelets and carbon nanotubes reinforced magnesium alloy

    International Nuclear Information System (INIS)

    Rashad, Muhammad; Pan, Fusheng; Zhang, Jianyue; Asif, Muhammad

    2015-01-01

    Graphene nanoplatelets (few layer graphene) and carbon nanotubes were used as reinforcement fillers to enhance the mechanical properties of AZ31 magnesium alloy through high energy ball milling, sintering, and hot extrusion techniques. Experimental results revealed that tensile fracture strain of AZ31 magnesium alloy was enhanced by +49.6% with 0.3 wt.% graphene nanoplatelets compared to −8.3% regression for 0.3 wt.% carbon nanotubes. The tensile strength of AZ31 magnesium alloy was decreased (−11.2%) with graphene nanoplatelets addition, while increased (+7.7%) with carbon nanotubes addition. Unlike tensile test, compression tests showed different trend. The compression strength of carbon nanotubes-AZ31 composite was +51.2% greater than AZ31 magnesium alloy as compared to +0.6% increase for graphene nanoplatelets. The compressive fracture strain of carbon nanotubes-AZ31 composite was decreased (−14.1%) while no significant change in fracture strain of graphene nanoplatelets-AZ31 composite was observed. The X-ray diffraction results revealed that addition of reinforcement particles weaken the basal textures which affect the composite's yield asymmetry. Microstructure evaluation revealed the absence of intermetallic phase formation between reinforcements and matrix. The carbon reinforcements in AZ31 magnesium alloy dissolve and isolate β phases throughout the matrix. The increased fracture strain and mechanical strength of graphene nanoplatelets and carbon nanotubes-AZ31 composites are attributed to large specific surface area of graphene nanoplatelets and stiffer nature of carbon nanotubes respectively. - Highlights: • Powder metallurgy method was used to fabricate magnesium composites. • The AZ31-carbon materials composite were blended using ball milling. • The reinforcement particles weaken the basal texture which affects yield asymmetry of composites. • AZ31-graphene nanoplatelets composite exhibited impressive increase in tensile elongation

  19. Alloy materials

    Energy Technology Data Exchange (ETDEWEB)

    Hans Thieme, Cornelis Leo (Westborough, MA); Thompson, Elliott D. (Coventry, RI); Fritzemeier, Leslie G. (Acton, MA); Cameron, Robert D. (Franklin, MA); Siegal, Edward J. (Malden, MA)

    2002-01-01

    An alloy that contains at least two metals and can be used as a substrate for a superconductor is disclosed. The alloy can contain an oxide former. The alloy can have a biaxial or cube texture. The substrate can be used in a multilayer superconductor, which can further include one or more buffer layers disposed between the substrate and the superconductor material. The alloys can be made a by process that involves first rolling the alloy then annealing the alloy. A relatively large volume percentage of the alloy can be formed of grains having a biaxial or cube texture.

  20. Investigation on mechanical alloying process for v-cr-ti alloys

    International Nuclear Information System (INIS)

    Stanciulescu, M.; Carlan, P.; Mihalache, M.; Bucsa, G.; Abrudeanu, M.; Galateanu, A.

    2015-01-01

    Mechanical alloying (MA) is an efficient approach for fabricating oxide-dispersion alloys and structural materials including vanadium alloys for fusion and fission application. Dissolution behaviour of the alloying elements is a key issue for optimizing the mechanical alloying process in fabricating vanadium alloys. This paper studies the MA process of V-4wt.%Cr-4wt.%Ti alloy. The outcomes of the MA powders in a planetary ball mill are reported in terms of powder particle size and morphology evolution and elemental composition. The impact of spark-plasma sintering process on the mechanically alloyed powder is analysed. An optimal set of sintering parameters, including the maximum temperature, the dwell time and the heating rate are determined. (authors)

  1. Laser surface alloying of aluminium-transition metal alloys

    Directory of Open Access Journals (Sweden)

    Almeida, A.

    1998-04-01

    Full Text Available Laser surface alloying has been used as a tool to produce hard and corrosion resistant Al-transition metal (TM alloys. Cr and Mo are particularly interesting alloying elements to produce stable highstrength alloys because they present low diffusion coefficients and solid solubility in Al. To produce Al-TM surface alloys a two-step laser process was developed: firstly, the material is alloyed using low scanning speed and secondly, the microstructure is modified by a refinement step. This process was used in the production of Al-Cr, Al-Mo and Al-Nb surface alloys by alloying Cr, Mo or Nb powder into an Al and 7175 Al alloy substrate using a CO2 laser. This paper presents a review of the work that has been developed at Instituto Superior Tecnico on laser alloying of Al-TM alloys, over the last years.

    En el presente trabajo se estudia la aleación superficial mediante láser de aluminio con metales de transición. El cromo y el molibdeno son particularmente interesantes porque producen aleaciones de alta resistencia y por el bajo coeficiente de difusión y solución sólida en aluminio. Para producir estas aleaciones se ha seguido un procedimiento desarrollado en dos partes. En primer lugar, el material se alea usando una baja velocidad de procesado y en segundo lugar la estructura se modifica mediante un refinamiento posterior. Este procedimiento se ha empleado en la producción de aleaciones Al-Cr, Al-Mo y Al-Nb mediante aleación con láser de CO2 de polvos de Cr, Mo o Nb en aluminio y la aleación 7175. Este trabajo es una revisión del desarrollado en el Instituto Superior Técnico de Lisboa en los últimos años.

  2. Characteristics of mechanical alloying of Zn-Al-based alloys

    International Nuclear Information System (INIS)

    Zhu, Y.H.; Hong Kong Polytechnic; Perez Hernandez, A.; Lee, W.B.

    2001-01-01

    Three pure elemental powder mixtures of Zn-22%Al-18%Cu, Zn-5%Al-11%Cu, and Zn-27%Al-3%Cu (in wt.%) were mechanically alloyed by steel-ball milling processing. The mechanical alloying characteristics were investigated using X-ray diffraction, scanning electron microscopy, and transmission electron microscopy techniques. It was explored that mechanical alloying started with the formation of phases from pure elemental powders, and this was followed by mechanical milling-induced phase transformation. During mechanical alloying, phases stable at the higher temperatures formed at the near room temperature of milling. Nano-structure Zn-Al-based alloys were produced by mechanical alloying. (orig.)

  3. Application of mechanical alloying to synthesis of intermetallic phases based alloys

    International Nuclear Information System (INIS)

    Dymek, S.

    2001-01-01

    Mechanical alloying is the process of synthesis of powder materials during milling in high energetic mills, usually ball mills. The central event in mechanical alloying is the ball-powder-ball collision. Powder particles are trapped between the colliding balls during milling and undergo deformation and/or fracture. Fractured parts are cold welded. The continued fracture and cold welding results in a uniform size and chemical composition of powder particles. The main applications of mechanical alloying are: processing of ODS alloys, syntheses of intermetallic phases, synthesis of nonequilibrium structures (amorphous alloys, extended solid solutions, nanocrystalline, quasi crystals) and magnetic materials. The present paper deals with application of mechanical alloying to synthesis Ni A l base intermetallic phases as well as phases from the Nb-Al binary system. The alloy were processed from elemental powders. The course of milling was monitored by scanning electron microscopy and X-ray diffraction. After milling, the collected powders were sieved by 45 μm grid and hot pressed (Nb alloys and NiAl) or hot extruded (NiAl). The resulting material was fully dense and exhibited fine grain (< 1 μm) and uniform distribution of oxide dispersoid. The consolidated material was compression and creep tested. The mechanical properties of mechanically alloys were superior to properties of their cast counterparts both in the room and elevated temperatures. Higher strength of mechanically alloyed materials results from their fine grains and from the presence of dispersoid. At elevated temperatures, the Nb-Al alloys have higher compression strength than NiAl-based alloys processed at the same conditions. The minimum creep rates of mechanically alloyed Nb alloys are an order of magnitude lower than analogously processed NiAl-base alloys. (author)

  4. Adinkras from ordered quartets of BC4 Coxeter group elements and regarding another Gadget’s 1,358,954,496 matrix elements

    Science.gov (United States)

    Gates, S. James; Kang, Lucas; Kessler, David S.; Korotkikh, Vadim

    2018-04-01

    A Gadget, more precisely a scalar Gadget, is defined as a mathematical calculation acting over a domain of one or more adinkra graphs and whose range is a real number. A 2010 work on the subject of automorphisms of adinkra graphs, implied the existence of multiple numbers of Gadgets depending on the number of colors under consideration. For four colors, this number is two. In this work, we verify the existence of a second such Gadget and calculate (both analytically and via explicit computer-enabled algorithms) its 1,358,954,496 matrix elements over 36,864 minimal valise adinkras related to the Coxeter Group BC4.

  5. Surface modification of 5083 Al alloy by electrical discharge alloying processing with a 75 mass% Si-Fe alloy electrode

    Energy Technology Data Exchange (ETDEWEB)

    Stambekova, Kuralay [Department of Materials Science and Engineering, National Chung Hsing University, 250 Kuo-Kuang Rd., Taichung 40227, Taiwan (China); Lin, Hung-Mao [Department of Mechanical Engineering, Far East University, No. 49, Zhonghua Rd., Xinshi Dist., Tainan City 74448, Taiwan (China); Uan, Jun-Yen, E-mail: jyuan@dragon.nchu.edu.tw [Department of Materials Science and Engineering, National Chung Hsing University, 250 Kuo-Kuang Rd., Taichung 40227, Taiwan (China)

    2012-03-01

    This study experimentally investigates the surface modification of 5083 Al alloy by the electrical discharge alloying (EDA) process with a Si-Fe alloy as an electrode. Samples were analyzed by transmission electron microscopy (TEM), scanning electron microscopy (SEM), micro-hardness and corrosion resistance tests. The micro-hardness of EDA alloyed layer was evidently higher than that of the base metal (5083 Al alloy). The TEM results show that the matrix of the alloyed layer has an amorphous-like structure; the matrix contains fine needle-like Si particles, block-like Si particles and nano-size Al{sub 4.5}FeSi and Al{sub 13}Fe{sub 4} particles. The TEM results support experimental results for the high hardness of the alloyed layer. Moreover, the EDA alloyed layer with composite microstructures has good corrosion resistance in NaCl aqueous solution.

  6. Synthesis Of NiCrAlC alloys by mechanical alloying

    International Nuclear Information System (INIS)

    Silva, A.K.; Pereira, J.I.; Vurobi Junior, S.; Cintho, O.M.

    2010-01-01

    The purpose of the present paper is the synthesis of nickel alloys (NiCrAlC), which has been proposed like a economic alternative to the Stellite family Co alloys using mechanical alloying, followed by sintering heat treatment of milled material. The NiCrAlC alloys consist of a chromium carbides dispersion in a Ni 3 Al intermetallic matrix, that is easily synthesized by mechanical alloying. The use of mechanical alloying enables higher carbides sizes and distribution control in the matrix during sintering. We are also investigated the compaction of the processed materials by compressibility curves. The milling products were characterized by X-ray diffraction, and the end product was featured by conventional metallography and scanning electronic microscopy (SEM), that enabled the identification of desired phases, beyond microhardness test, which has been shown comparable to alloys manufactured by fusion after heat treating. (author)

  7. Correlation between diffusion barriers and alloying energy in binary alloys

    DEFF Research Database (Denmark)

    Vej-Hansen, Ulrik Grønbjerg; Rossmeisl, Jan; Stephens, Ifan

    2016-01-01

    In this paper, we explore the notion that a negative alloying energy may act as a descriptor for long term stability of Pt-alloys as cathode catalysts in low temperature fuel cells.......In this paper, we explore the notion that a negative alloying energy may act as a descriptor for long term stability of Pt-alloys as cathode catalysts in low temperature fuel cells....

  8. Titanium alloys. Advances in alloys, processes, products and applications

    International Nuclear Information System (INIS)

    Blenkinsop, P.A.

    1993-01-01

    The last few years have been a period of consolidation of existing alloys and processes. While the aerospace industry remains the principal driving force for alloy development, the paper illustrates examples of new markets being established in 'older' alloys, by a combination of product/process development and a re-examination of engineering design parameters. Considerable attention is still being directed towards the titanium aluminide systems, but other more conventional alloy developments are underway aimed at specific engineering and process requirements, both in the aerospace and non-aerospace sectors. Both the advanced high temperature and conventional alloy developments are considered, before the paper goes on to assess the potential of new processes and products, like spray-forming, metal matrix composites and shaped-plate rolling. (orig.)

  9. High-temperature deformation of a mechanically alloyed niobium-yttria alloy

    International Nuclear Information System (INIS)

    Chou, I.; Koss, D.A.; Howell, P.R.; Ramani, A.S.

    1997-01-01

    Mechanical alloying (MA) and hot isostatic pressing have been used to process two Nb alloys containing yttria particles, Nb-2 vol.%Y 2 O 3 and Nb-10 vol.%Y 2 O 3 . Similar to some thermomechanically processed nickel-based alloys, both alloys exhibit partially recrystallized microstructures, consisting of a 'necklace' of small recrystallized grains surrounding much larger but isolated, unrecrystallized, cold-worked grains. Hot compression tests from 1049 to 1347 C (0.5-0.6T MP ) of the 10% Y 2 O 3 alloy show that MA material possesses a much higher yield and creep strength than its powder-blended, fully recrystallized counterpart. In fact, the density-compensated specific yield strength of the MA Nb-10Y 2 O 3 exceeds that of currently available commercial Nb alloys. (orig.)

  10. Iron-based amorphous alloys and methods of synthesizing iron-based amorphous alloys

    Science.gov (United States)

    Saw, Cheng Kiong; Bauer, William A.; Choi, Jor-Shan; Day, Dan; Farmer, Joseph C.

    2016-05-03

    A method according to one embodiment includes combining an amorphous iron-based alloy and at least one metal selected from a group consisting of molybdenum, chromium, tungsten, boron, gadolinium, nickel phosphorous, yttrium, and alloys thereof to form a mixture, wherein the at least one metal is present in the mixture from about 5 atomic percent (at %) to about 55 at %; and ball milling the mixture at least until an amorphous alloy of the iron-based alloy and the at least one metal is formed. Several amorphous iron-based metal alloys are also presented, including corrosion-resistant amorphous iron-based metal alloys and radiation-shielding amorphous iron-based metal alloys.

  11. High strength alloys

    Science.gov (United States)

    Maziasz, Phillip James [Oak Ridge, TN; Shingledecker, John Paul [Knoxville, TN; Santella, Michael Leonard [Knoxville, TN; Schneibel, Joachim Hugo [Knoxville, TN; Sikka, Vinod Kumar [Oak Ridge, TN; Vinegar, Harold J [Bellaire, TX; John, Randy Carl [Houston, TX; Kim, Dong Sub [Sugar Land, TX

    2010-08-31

    High strength metal alloys are described herein. At least one composition of a metal alloy includes chromium, nickel, copper, manganese, silicon, niobium, tungsten and iron. System, methods, and heaters that include the high strength metal alloys are described herein. At least one heater system may include a canister at least partially made from material containing at least one of the metal alloys. At least one system for heating a subterranean formation may include a tubular that is at least partially made from a material containing at least one of the metal alloys.

  12. Aluminum fin-stock alloys

    International Nuclear Information System (INIS)

    Gul, R.M.; Mutasher, F.

    2007-01-01

    Aluminum alloys have long been used in the production of heat exchanger fins. The comparative properties of the different alloys used for this purpose has not been an issue in the past, because of the significant thickness of the finstock material. However, in order to make fins lighter in weight, there is a growing demand for thinner finstock materials, which has emphasized the need for improved mechanical properties, thermal conductivity and corrosion resistance. The objective of this project is to determine the effect of iron, silicon and manganese percentage increment on the required mechanical properties for this application by analyzing four different aluminum alloys. The four selected aluminum alloys are 1100, 8011, 8079 and 8150, which are wrought non-heat treatable alloys with different amount of the above elements. Aluminum alloy 1100 serve as a control specimen, as it is commercially pure aluminum. The study also reports the effect of different annealing cycles on the mechanical properties of the selected alloys. Metallographic examination was also preformed to study the effect of annealing on the precipitate phases and the distribution of these phases for each alloy. The microstructure analysis of the aluminum alloys studied indicates that the precipitated phase in the case of aluminum alloys 1100 and 8079 is beta-FeAI3, while in 8011 it is a-alfa AIFeSi, and the aluminum alloy 8150 contains AI6(Mn,Fe) phase. The comparison of aluminum alloys 8011 and 8079 with aluminum alloy 1100 show that the addition of iron and silicon improves the percent elongation and reduces strength. The manganese addition increases the stability of mechanical properties along the annealing range as shown by the comparison of aluminum alloy 8150 with aluminum alloy 1100. Alloy 8150 show superior properties over the other alloys due to the reaction of iron and manganese, resulting in a preferable response to thermal treatment and improved mechanical properties. (author)

  13. Nickel alloys and high-alloyed special stainless steels. Properties, manufacturing, applications. 4. compl. rev. ed.

    International Nuclear Information System (INIS)

    Heubner, Ulrich; Kloewer, Jutta; Alves, Helena; Behrens, Rainer; Schindler, Claudius; Wahl, Volker; Wolf, Martin

    2012-01-01

    This book contains the following eight topics: 1. Nickel alloys and high-alloy special stainless steels - Material overview and metallurgical principles (U. Heubner); 2. Corrosion resistance of nickel alloys and high-alloy special stainless steels (U. Heubner); 3. Welding of nickel alloys and high-alloy special stainless steels (T. Hoffmann, M. Wolf); 4. High-temperature materials for industrial plant construction (J. Kloewer); 5. Nickel alloys and high-alloy special stainless steels as hot roll clad composites-a cost-effective alternative (C. Schindler); 6. Selected examples of the use of nickel alloys and high-alloy special stainless steels in chemical plants (H. Alves); 7. The use of nickel alloys and stainless steels in environmental engineering (V. Wahl); 8: Nickel alloys and high-alloy special stainless steels for the oil and gas industry (R. Behrens).

  14. Biocompatibility of dental alloys

    Energy Technology Data Exchange (ETDEWEB)

    Braemer, W. [Heraeus Kulzer GmbH and Co. KG, Hanau (Germany)

    2001-10-01

    Modern dental alloys have been used for 50 years to produce prosthetic dental restorations. Generally, the crowns and frames of a prosthesis are prepared in dental alloys, and then veneered by feldspar ceramics or composites. In use, the alloys are exposed to the corrosive influence of saliva and bacteria. Metallic dental materials can be classified as precious and non-precious alloys. Precious alloys consist of gold, platinum, and small amounts of non-precious components such as copper, tin, or zinc. The non-precious alloys are based on either nickel or cobalt, alloyed with chrome, molybdenum, manganese, etc. Titanium is used as Grade 2 quality for dental purposes. As well as the dental casting alloys, high purity electroplated gold (99.8 wt.-%) is used in dental technology. This review discusses the corrosion behavior of metallic dental materials with saliva in ''in vitro'' tests and the influence of alloy components on bacteria (Lactobacillus casei and Streptococcus mutans). The test results show that alloys with high gold content, cobalt-based alloys, titanium, and electroplated gold are suitable for use as dental materials. (orig.)

  15. Interphase thermodynamic bond in heterogeneous alloys: effects on alloy properties

    International Nuclear Information System (INIS)

    Savchenko, A.M.; Konovalov, Yu.V.; Yuferov, O.I.

    2005-01-01

    Inconsistency between a conventional thermodynamic description of alloys as a mechanical mixture of phases and a real alloys state as a common thermodynamic system in which there is a complicated physical-chemical phases interaction has been considered. It is supposed that in heterogeneous alloys (eutectic ones, for instance), so called interphase thermodynamic bond can become apparent due to a partial electron levels splitting under phase interaction. Thermodynamic description of phase equilibrium in alloys is proposed taking into account a thermodynamic bond for the system with phase diagram of eutectic type, and methods of the value of this bond estimation are presented. Experimental evidence (Al-Cu-Si, Al-Si-Mg-Cu, U-Mo + Al) of the effect of interphase thermodynamic bond on temperature and enthalpy of melting of alloys are produced as well as possibility of its effects on alloys electrical conduction, strength, heat and corrosion resistance is substantiated theoretically [ru

  16. Irradiation-assisted stress corrosion cracking in HTH Alloy X-750 and Alloy 625

    International Nuclear Information System (INIS)

    Bajaj, R.; Mills, W.J.; Lebo, M.R.; Hyatt, B.Z.; Burke, M.G.

    1995-01-01

    In-reactor testing of bolt-loaded compact tension specimens was performed in 360 C water to determine the irradiation-assisted stress corrosion cracking (IASCC) behavior of HTH Alloy X-750 and direct-aged Alloy 625. New data confirm previous results showing that high irradiation levels reduce SCC resistance in Alloy X-750. Heat-to-heat variability correlates with boron content, with low boron heats showing improved IASCC properties. Alloy 625 is resistant to IASCC, as no cracking was observed in any Alloy 625 specimens. Microstructural, microchemical and deformation studies were performed to characterize the mechanisms responsible for IASCC in Alloy X-750 and the lack of an effect in Alloy 625. The mechanisms under investigation are: boron transmutation effects, radiation-induced changes in microstructure and deformation characteristics, and radiation-induced segregation. Irradiation of Alloy X-750 caused significant strengthening and ductility loss that was associated with the formation of cavities and dislocation loops. High irradiation levels did not cause significant segregation of alloying or trace elements in Alloy X-750. Irradiation of Alloy 625 resulted in the formation of small dislocation loops and a fine body-centered-orthorhombic phase. The strengthening due to the loops and precipitates was apparently offset by a partial dissolution of γ double-prime precipitates, as Alloy 625 showed no irradiation-induced strengthening or ductility loss. In the nonirradiated condition, an IASCC susceptible HTH heat containing 28 ppm B showed grain boundary segregation of boron, whereas a nonsusceptible HTH heat containing 2 ppm B and Alloy 625 with 20 ppm B did not show significant boron segregation. Transmutation of boron to helium at grain boundaries, coupled with matrix strengthening, is believed to be responsible for IASCC in Alloy X-750, and the absence of these two effects results in the superior IASCC resistance displayed by Alloy 625

  17. Filler metal alloy for welding cast nickel aluminide alloys

    Science.gov (United States)

    Santella, M.L.; Sikka, V.K.

    1998-03-10

    A filler metal alloy used as a filler for welding cast nickel aluminide alloys contains from about 15 to about 17 wt. % chromium, from about 4 to about 5 wt. % aluminum, equal to or less than about 1.5 wt. % molybdenum, from about 1 to about 4.5 wt. % zirconium, equal to or less than about 0.01 wt. % yttrium, equal to or less than about 0.01 wt. % boron and the balance nickel. The filler metal alloy is made by melting and casting techniques such as are melting the components of the filler metal alloy and cast in copper chill molds. 3 figs.

  18. The Evaluation of the Corrosion Resistance of the Al-Si Alloys Antimony Alloyed

    Directory of Open Access Journals (Sweden)

    Svobodova J.

    2014-06-01

    Full Text Available This paper deals with the evaluation of the corrosion resistance of the Al-Si alloys alloyed with the different amount of antimony. Specifically it goes about the alloy AlSi7Mg0,3 which is antimony alloyed in the concentrations 0; 0,001; 0,005; 0,01 a 0,05 wt. % of antimony. The introduction of the paper is dedicated to the theory of the aluminium alloys corrosion resistance, testing and evaluation of the corrosion resistance. The influence of the antimony to the Al-Si alloys properties is described further in the introduction. The experimental part describes the experimental samples which were prepared for the experiment and further they were exposed to the loading in the atmospheric conditions for a period of the 3 months. The experimental samples were evaluated macroscopically and microscopically. The results of the experiment were documented and the conclusions in terms of the antimony impact to the corrosion resistance of the Al-Si alloy were concluded. There was compared the corrosion resistance of the Al-Si alloy antimony alloyed (with the different antimony content with the results of the Al-Si alloy without the alloying after the corrosion load in the atmospheric conditions in the experiment.

  19. VANADIUM ALLOYS

    Science.gov (United States)

    Smith, K.F.; Van Thyne, R.J.

    1959-05-12

    This patent deals with vanadium based ternary alloys useful as fuel element jackets. According to the invention the ternary vanadium alloys, prepared in an arc furnace, contain from 2.5 to 15% by weight titanium and from 0.5 to 10% by weight niobium. Characteristics of these alloys are good thermal conductivity, low neutron capture cross section, good corrosion resistance, good welding and fabricating properties, low expansion coefficient, and high strength.

  20. Results of the independent verification of radiological remedial action at 496 South Main Street, Monticello, Utah (MS00050)

    International Nuclear Information System (INIS)

    Crutcher, J.W.; Smuin, M.W.

    1989-12-01

    In 1980 the site of a vanadium and uranium mill at Monticello, Utah, was accepted into the US Department of Energy's (DOE's) Surplus Facilities Management Program, with the objectives of restoring the government-owned mill site to safe levels of radioactivity, disposing of or containing the tailings in an environmentally safe manner, and performing remedial actions on off-site (vicinity) properties that had been contaminated by radioactive material resulting from mill operations. During 1984, UNC Geotech, the remedial action contractor designated by DOE, performed remedial action on the vicinity property at 496 South Main Street, Monticello, Utah. The Pollutant Assessments Group (PAG) of Oak Ridge National Laboratory was assigned the responsibility of verifying the data supporting the adequacy of remedial action and confirming the site's compliance with DOE guidelines. The PAG found that the site successfully meets the DOE remedial action objectives. Procedures used by PAG are described. 3 refs., 2 tabs

  1. Crevice corrosion propagation on alloy 625 and alloy C276 in natural seawater

    International Nuclear Information System (INIS)

    McCafferty, E.; Bogar, F.D.; Thomas, E.D. II; Creegan, C.A.; Lucas, K.E.; Kaznoff, A.I.

    1997-01-01

    Chemical composition of the aqueous solution within crevices on two different Ni-Cr-Mo-Fe alloys immersed in natural seawater was determined using a semiquantitative thin-layer chromatographic method. Active crevices were found to contain concentrated amounts of dissolved Ni 2+ , Cr 3+ , Mo 3+ , and Fe 2+ ions. Propagation of crevice corrosion for the two alloys was determined from anodic polarization curves in model crevice solutions based upon stoichiometric dissolution or selective dissolution of alloy components. Both alloys 625 (UNS N06625) and C276 (UNS N10276) underwent crevice corrosion in the model crevice electrolytes. For the model crevice solution based upon selective dissolution of alloy constituents, the anodic dissolution rate for alloy 625 was higher than that for alloy C276. This trend was reversed for the model crevice solution based upon uniform dissolution of alloy constituents

  2. Corrosion of aluminum alloys as a function of alloy composition

    International Nuclear Information System (INIS)

    Johnson, A.B. Jr.

    1969-10-01

    A study was initiated which included nineteen aluminum alloys. Tests were conducted in high purity water at 360 0 C and flow tests (approx. 20 ft/sec) in reactor process water at 130 0 C (TF-18 loop tests). High-silicon alloys and AlSi failed completely in the 360 0 C tests. However, coupling of AlSi to 8001 aluminum suppressed the failure. The alloy compositions containing iron and nickel survived tht 360 0 C autoclave exposures. Corrosion rates varied widely as a function of alloy composition, but in directions which were predictable from previous high-temperature autoclave experience. In the TF-18 loop flow tests, corrosion penetrations were similar on all of the alloys and on high-purity aluminum after 105 days. However, certain alloys established relatively low linear corrosion rates: Al-0.9 Ni-0.5 Fe-0.1 Zr, Al-1.0 Ni-0.15 Fe-11.5 Si-0.8 Mg, Al-1.2 Ni-1.8 Fe, and Al-7.0 Ni-4.8 Fe. Electrical polarity measurements between AlSi and 8001 alloys in reactor process water at temperatures up to 150 0 C indicated that AlSi was anodic to 8001 in the static autoclave system above approx. 50 0 C

  3. Surface treatment of new type aluminum lithium alloy and fatigue crack behaviors of this alloy plate bonded with Ti–6Al–4V alloy strap

    International Nuclear Information System (INIS)

    Sun, Zhen-Qi; Huang, Ming-Hui; Hu, Guo-Huai

    2012-01-01

    Highlights: ► A new generation aluminum lithium alloy which special made for Chinese commercial plane was investigated. ► Pattern of aluminum lithium alloy and Ti alloy were shown after anodization. ► Crack propagation of samples bonded with different wide Ti straps were studied in this paper. -- Abstract: Samples consisting of new aluminum lithium alloy (Al–Li alloy) plate developed by the Aluminum Company of America and Ti–6Al–4V alloy (Ti alloy) plate were investigated. Plate of 400 mm × 140 mm × 2 mm with single edge notch was anodized in phosphoric solution and Ti alloy plate of 200 mm × 20 (40) mm × 2 mm was anodized in alkali solution. Patterns of two alloys were studied at original/anodized condition. And then, aluminum alloy and Ti alloy plates were assembled into a sample with FM 94 film adhesive. Fatigue crack behaviors of the sample were investigated under condition of nominal stress σ = 36 MPa and 54 MPa, stress ratio of 0.1. Testing results show that anodization treatment modifies alloys surface topography. Ti alloy bonding to Al–Li alloy plate effectively retards crack growth than that of Al–Li alloy plate. Fatigue life of sample bonded with Ti alloy strap improves about 62.5% than that of non-strap plate.

  4. The Properties of 7xxx Series Alloys Formed by Alloying Additions

    Directory of Open Access Journals (Sweden)

    Kwak Z.

    2015-06-01

    Full Text Available Currently there is a constant development in the field of aluminium alloys engineering. This results from, i.a., better understanding of the mechanisms that direct strengthening of these alloys and the role of microalloying. Now it is microalloying in aluminum alloys that is receiving a lot of attention. It affects substantially the macro- and microstructure and kinetics of phase transformation influencing the properties during production and its exploitation. 7xxx series aluminum alloys, based on the Al-Zn-Mg-Cu system, are high-strength alloys, moreover, the presence of Zr and Sr further increases their strength and improves resistance to cracking.

  5. Reducing thermal conductivity of binary alloys below the alloy limit via chemical ordering

    International Nuclear Information System (INIS)

    Duda, John C; English, Timothy S; Jordan, Donald A; Norris, Pamela M; Soffa, William A

    2011-01-01

    Substitutional solid solutions that exist in both ordered and disordered states will exhibit markedly different physical properties depending on their exact crystallographic configuration. Many random substitutional solid solutions (alloys) will display a tendency to order given the appropriate kinetic and thermodynamic conditions. Such order-disorder transitions will result in major crystallographic reconfigurations, where the atomic basis, symmetry, and periodicity of the alloy change dramatically. Consequently, the dominant scattering mechanism in ordered alloys will be different than that in disordered alloys. In this study, we present a hypothesis that ordered alloys can exhibit lower thermal conductivities than their disordered counterparts at elevated temperatures. To validate this hypothesis, we investigate the phononic transport properties of disordered and ordered AB Lennard-Jones alloys via non-equilibrium molecular dynamics and harmonic lattice dynamics calculations. It is shown that the thermal conductivity of an ordered alloy is the same as the thermal conductivity of the disordered alloy at ∼0.6T melt and lower than that of the disordered alloy above 0.8T melt .

  6. Dissipative properties of materials with microplastic mechanism of damping under conditions of separate and joint action of static stresses and temperature

    International Nuclear Information System (INIS)

    Shpak, D.E.

    1985-01-01

    Static stress and temperature are studied experimentally for their separate and joint effect on dissipative properties of VT3-1 and Ehp 718 alloys whose dissipation energy is conditioned by microplastic strains. The results of the study are presented. It is shown that for the materials studied in contrast to the materials with other basic damping mechanisms joint effect of static stresses and temperature is close to a simple summation of the separate effect of these factors without any changes in the character of energy dissipation dependence

  7. Dissipative properties of materials with microplastic mechanism of damping under conditions of separate and joint action of static stresses and temperature

    Energy Technology Data Exchange (ETDEWEB)

    Shpak, D.E.

    1985-01-01

    Static stress and temperature are studied experimentally for their separate and joint effect on dissipative properties of VT3-1 and Ehp 718 alloys whose dissipation energy is conditioned by microplastic strains. The results of the study are presented. It is shown that for the materials studied in contrast to the materials with other basic damping mechanisms joint effect of static stresses and temperature is close to a simple summation of the separate effect of these factors without any changes in the character of energy dissipation dependence.

  8. Translating VDM to Alloy

    DEFF Research Database (Denmark)

    Lausdahl, Kenneth

    2013-01-01

    specifications. However, to take advantage of the automated analysis of Alloy, the model-oriented VDM specifications must be translated into a constraint-based Alloy specifications. We describe how a sub- set of VDM can be translated into Alloy and how assertions can be expressed in VDM and checked by the Alloy...

  9. Electron beam and laser surface alloying of Al-Si base alloys

    International Nuclear Information System (INIS)

    Vanhille, P.; Tosto, S.; Pelletier, J.M.; Issa, A.; Vannes, A.B.; Criqui, B.

    1992-01-01

    Surface alloying on aluminium-base alloys is achieved either by using an electron beam or a laser beam, in order to improve the mechanical properties of the near-surface region. A predeposit of nickel is first realized by plasma spraying. Melting of both the coating and part of the substrate produces a surface alloy with a fine, dendritic microstructure with a high hardness. Enhancement of this property requires an increase in the nickel content. Various problems occur during the formation of nickel-rich surface layers: incomplete homogenization owing to a progressive increase of the liquidus temperature, cracks owing to the brittleness of this hard suface alloy, formation of a plasma when experiments are carried out in a gaseous environment (laser surface alloying). Nevertheless, various kinds of surface layers may be achieved; for example very hard surface alloys (HV 0.2 =900), with a thickness of about 500-600 μm, or very thick surface alloys (e>2 mm), with a fairly good hardness (greater than 350 HV 0.2 ). Thus, it is possible to obtain a large variety of new materials by using high energy beams on aluminium substrates. (orig.)

  10. Combinatorial thin film materials science: From alloy discovery and optimization to alloy design

    Energy Technology Data Exchange (ETDEWEB)

    Gebhardt, Thomas, E-mail: gebhardt@mch.rwth-aachen.de; Music, Denis; Takahashi, Tetsuya; Schneider, Jochen M.

    2012-06-30

    This paper provides an overview of modern alloy development, from discovery and optimization towards alloy design, based on combinatorial thin film materials science. The combinatorial approach, combining combinatorial materials synthesis of thin film composition-spreads with high-throughput property characterization has proven to be a powerful tool to delineate composition-structure-property relationships, and hence to efficiently identify composition windows with enhanced properties. Furthermore, and most importantly for alloy design, theoretical models and hypotheses can be critically appraised. Examples for alloy discovery, optimization, and alloy design of functional as well as structural materials are presented. Using Fe-Mn based alloys as an example, we show that the combination of modern electronic-structure calculations with the highly efficient combinatorial thin film composition-spread method constitutes an effective tool for knowledge-based alloy design.

  11. Combinatorial thin film materials science: From alloy discovery and optimization to alloy design

    International Nuclear Information System (INIS)

    Gebhardt, Thomas; Music, Denis; Takahashi, Tetsuya; Schneider, Jochen M.

    2012-01-01

    This paper provides an overview of modern alloy development, from discovery and optimization towards alloy design, based on combinatorial thin film materials science. The combinatorial approach, combining combinatorial materials synthesis of thin film composition-spreads with high-throughput property characterization has proven to be a powerful tool to delineate composition–structure–property relationships, and hence to efficiently identify composition windows with enhanced properties. Furthermore, and most importantly for alloy design, theoretical models and hypotheses can be critically appraised. Examples for alloy discovery, optimization, and alloy design of functional as well as structural materials are presented. Using Fe-Mn based alloys as an example, we show that the combination of modern electronic-structure calculations with the highly efficient combinatorial thin film composition-spread method constitutes an effective tool for knowledge-based alloy design.

  12. Shape memory alloys

    International Nuclear Information System (INIS)

    Kaszuwara, W.

    2004-01-01

    Shape memory alloys (SMA), when deformed, have the ability of returning, in certain circumstances, to their initial shape. Deformations related to this phenomenon are for polycrystals 1-8% and up to 15% for monocrystals. The deformation energy is in the range of 10 6 - 10 7 J/m 3 . The deformation is caused by martensitic transformation in the material. Shape memory alloys exhibit one directional or two directional shape memory effect as well as pseudoelastic effect. Shape change is activated by temperature change, which limits working frequency of SMA to 10 2 Hz. Other group of alloys exhibit magnetic shape memory effect. In these alloys martensitic transformation is triggered by magnetic field, thus their working frequency can be higher. Composites containing shape memory alloys can also be used as shape memory materials (applied in vibration damping devices). Another group of composite materials is called heterostructures, in which SMA alloys are incorporated in a form of thin layers The heterostructures can be used as microactuators in microelectromechanical systems (MEMS). Basic SMA comprise: Ni-Ti, Cu (Cu-Zn,Cu-Al, Cu-Sn) and Fe (Fe-Mn, Fe-Cr-Ni) alloys. Shape memory alloys find applications in such areas: automatics, safety and medical devices and many domestic appliances. Currently the most important appears to be research on magnetic shape memory materials and high temperature SMA. Vital from application point of view are composite materials especially those containing several intelligent materials. (author)

  13. Grindability of dental magnetic alloys.

    Science.gov (United States)

    Hayashi, Eisei; Kikuchi, Masafumi; Okuno, Osamu; Kimura, Kohei

    2005-06-01

    In this study, the grindability of cast magnetic alloys (Fe-Pt-Nb magnetic alloy and magnetic stainless steel) was evaluated and compared with that of conventional dental casting alloys (Ag-Pd-Au alloy, Type 4 gold alloy, and cobalt-chromium alloy). Grindability was evaluated in terms of grinding rate (i.e., volume of metal removed per minute) and grinding ratio (i.e., volume ratio of metal removed compared to wheel material lost). Solution treated Fe-Pt-Nb magnetic alloy had a significantly higher grinding rate than the aged one at a grinding speed of 750-1500 m x min(-1). At 500 m x min(-1), there were no significant differences in grinding rate between solution treated and aged Fe-Pt-Nb magnetic alloys. At a lower speed of 500 m x min(-1) or 750 m x min(-1), it was found that the grinding rates of aged Fe-Pt-Nb magnetic alloy and stainless steel were higher than those of conventional casting alloys.

  14. Alloying Solid Solution Strengthening of Fe-Ga Alloys: A First-Principle Study

    National Research Council Canada - National Science Library

    Chen, Kuiying; Cheng, Leon M

    2006-01-01

    ... and Co in cubic solid solution of Fe-Ga alloys. Mayer bond order "BO" values were used to evaluate the atomic bond strengths in the alloys, and were then used to assess the alloying strengthening characteristics...

  15. Studies on neutron irradiation effects of iron alloys and nickel-base heat resistant alloys

    International Nuclear Information System (INIS)

    Watanabe, Katsutoshi

    1987-09-01

    The present paper describes the results of neutron irradiation effects on iron alloys and nickel-base heat resistant alloys. As for the iron alloys, irradiation hardening and embrittlement were investigated using internal friction measurement, electron microscopy and tensile testings. The role of alloying elements was also investigated to understand the irradiation behavior of iron alloys. The essential factors affecting irradiation hardening and embrittlement were thus clarified. On the other hand, postirradiation tensile and creep properties were measured of Hastelloy X alloy. Irradiation behavior at elevated temperatures is discussed. (author)

  16. Neutron-absorbing alloys

    International Nuclear Information System (INIS)

    Portnoi, K.I.; Arabei, L.B.; Gryaznov, G.M.; Levi, L.I.; Lunin, G.L.; Kozhukhov, V.M.; Markov, J.M.; Fedotov, M.E.

    1975-01-01

    A process is described for the production of an alloy consiting of 1 to 20% In, 0.5 to 15% Sm, and from 3 to 18% Hf, the balance being Ni. Such alloys show a good absorption capacity for thermal and intermediate neutrons, good neutron capture efficiency, and good corrosion resistance, and find application in nuclear reactor automatic control and safety systems. The Hf provides for the maintenance of a reasonably high order of neutron capture efficiency throughout the lifetime of a reactor. The alloys are formed in a vacuum furnace operating with an inert gas atmosphere at 280 to 300 mm.Hg. They have a corrosion resistance from 3 to 3.5 times that of the Ag-based alloys commonly employed, and a neutron capture efficiency about twice that of the Ag alloys. Castability and structural strength are good. (U.K.)

  17. Effect of mechanical alloying on FeCrC reinforced Ni alloys

    Energy Technology Data Exchange (ETDEWEB)

    Yilmaz, S. Osman [Univ. of Namik Kemal, Tekirdag (Turkey); Teker, Tanju [Adiyaman Univ. (Turkey). Dept. of Metallurgical and Materials Engineering; Demir, Fatih [Batman Univ. (Turkey)

    2016-05-01

    Mechanical alloying (MA) is a powder metallurgy processing technique involving cold welding, fracturing and rewelding of powder particles in a high-energy ball mill. In the present study, the intermetallic matrix composites (IMCs) of Ni-Al reinforced by M{sub 7}C{sub 3} were produced by powder metallurgical routes via solid state reaction of Ni, Al and M{sub 7}C{sub 3} particulates by mechanical alloying processes. Ni, Al and M{sub 7}C{sub 3} powders having 100 μm were mixed, mechanical alloyed and the compacts were combusted in a furnace. The mechanically alloyed (MAed) powders were investigated by X-ray diffraction (XRD), microhardness measurement, optic microscopy (OM), scanning electron microscopy (SEM) and energy dispersive spectrometry (EDS). The presence of the carbides depressed the formation of unwanted NiAl intermetallic phases. The mechanical alloyed M{sub 7}C{sub 3} particles were unstable and decomposed partially within the matrix during alloying and sintering, and the morphology of the composites changed with the dissolution ratio of M{sub 7}C{sub 3} and sintering temperature.

  18. Advances in titanium alloys

    International Nuclear Information System (INIS)

    Seagle, S.R.; Wood, J.R.

    1993-01-01

    As described above, new developments in the aerospace market are focusing on higher temperature alloys for jet engine components and higher strength/toughness alloys for airframe applications. Conventional alloys for engines have reached their maximum useful temperature of about 1000 F (540 C) because of oxidation resistance requirements. IMI 834 and Ti-1100 advanced alloys show some improvement, however, the major improvement appears to be in gamma titanium aluminides which could extend the maximum usage temperature to about 1500 F (815 C). This puts titanium alloys in a competitive position to replace nickel-base superalloys. Advanced airframe alloys such as Ti-6-22-22S, Beta C TM , Ti-15-333 and Ti-10-2-3 with higher strength than conventional Ti-6-4 are being utilized in significantly greater quantities, both in military and commercial applications. These alloys offer improved strength with little or no sacrifice in toughness and improved formability, in some cases. Advanced industrial alloys are being developed for improved corrosion resistance in more reducing and higher temperature environments such as those encountered in sour gas wells. Efforts are focused on small precious metal additions to optimize corrosion performance for specific applications at a modest increase in cost. As these applications develop, the usage of titanium alloys for industrial markets should steadily increase to approach that for aerospace applications. (orig.)

  19. Progressive degradation of alloy 690 and the development of a significant improvement in alloy 800CR

    International Nuclear Information System (INIS)

    Staehle, Roger W.; Arioka, Koji; Tapping, Robert

    2015-01-01

    The present most widely used alloys for tubing in steam generators and structural materials in water cooled reactors are Alloy 690 and Alloy 800. However, both alloys, while improved over Alloy 600 may not meet the needs of longer range applications in the range of 80-100 years. Alloy 690 sustains damage resulting from the formation of cavities at grain boundaries which eventually cover about 50% of the area of the grain boundaries with the remainder covering being covered with carbides. The cavities seem to nucleate on the carbides leaving the grain boundaries a structure of cavities and carbides. Such a structure will lead the Alloy 690 to fail completely. Normal Alloy 800 does not produce such cavities and probably retains a large amount of its corrosion resistance but does sustain progressive SCC at low rate. A new alloy, 800CR, has been developed in a collaboration among Arioka, Tapping, and Staehle. This alloy is based on a Cr composition of 23.5-27% with the remainder retaining the previous Alloy 800 composition. 800CR sustains a crack velocity about 100 times less than Alloy 690 and a negligible rate of initiation. The 800CR, alloy is now seeking a patent. (authors)

  20. Nonswelling alloy

    Science.gov (United States)

    Harkness, S.D.

    1975-12-23

    An aluminum alloy containing one weight percent copper has been found to be resistant to void formation and thus is useful in all nuclear applications which currently use aluminum or other aluminum alloys in reactor positions which are subjected to high neutron doses.

  1. Nonswelling alloy

    International Nuclear Information System (INIS)

    Harkness, S.D.

    1975-01-01

    An aluminum alloy containing one weight percent copper has been found to be resistant to void formation and thus is useful in all nuclear applications which currently use aluminum or other aluminum alloys in reactor positions which are subjected to high neutron doses

  2. PLUTONIUM-ZIRCONIUM ALLOYS

    Science.gov (United States)

    Schonfeld, F.W.; Waber, J.T.

    1960-08-30

    A series of nuclear reactor fuel alloys consisting of from about 5 to about 50 at.% zirconium (or higher zirconium alloys such as Zircaloy), balance plutonium, and having the structural composition of a plutonium are described. Zirconium is a satisfactory diluent because it alloys readily with plutonium and has desirable nuclear properties. Additional advantages are corrosion resistance, excellent fabrication propenties, an isotropie structure, and initial softness.

  3. Ultrahigh temperature intermetallic alloys

    Energy Technology Data Exchange (ETDEWEB)

    Brady, M.P.; Zhu, J.H.; Liu, C.T.; Tortorelli, P.F.; Wright, J.L.; Carmichael, C.A.; Walker, L.R. [Oak Ridge National Lab., TN (United States). Metals and Ceramics Div.

    1997-12-01

    A new family of Cr-Cr{sub 2}X based alloys with fabricability, mechanical properties, and oxidation resistance superior to previously developed Cr-Cr{sub 2}Nb and Cr-Cr{sub 2}Zr based alloys has been identified. The new alloys can be arc-melted/cast without cracking, and exhibit excellent room temperature and high-temperature tensile strengths. Preliminary evaluation of oxidation behavior at 1100 C in air indicates that the new Cr-Cr{sub 2}X based alloys form an adherent chromia-based scale. Under similar conditions, Cr-Cr{sub 2}Nb and Cr-Cr{sub 2}Zr based alloys suffer from extensive scale spallation.

  4. Electronic structure of alloys

    International Nuclear Information System (INIS)

    Ehrenreich, H.; Schwartz, L.M.

    1976-01-01

    The description of electronic properties of binary substitutional alloys within the single particle approximation is reviewed. Emphasis is placed on a didactic exposition of the equilibrium properties of the transport and magnetic properties of such alloys. Topics covered include: multiple scattering theory; the single band alloy; formal extensions of the theory; the alloy potential; realistic model state densities; the s-d model; and the muffin tin model. 43 figures, 3 tables, 151 references

  5. Monitoring alloy formation during mechanical alloying process by x-ray diffraction techniques

    International Nuclear Information System (INIS)

    Abdul Kadir Masrom; Noraizam Md Diah; Mazli Mustapha

    2002-01-01

    Monitoring alloying (MA) is a novel processing technique that use high energy impact ball mill to produce alloys with enhanced properties and microscopically homogeneous materials starting from various powder mixtures. Mechanical alloying process was originally developed to produce oxide dispersion strengthened nickel superalloys. In principal, in high-energy ball milling process, alloy is formed by the result of repeated welding, fracturing and rewelding of powder particles in a high energy ball mill. In this process a powder mixture in a ball mill is subjected to high-energy collisions among balls. MA has been shown to be capable of synthesizing a variety of materials. It is known to be capable to prepare equilibrium and non-equilibrium phases starting from blended elemental or prealloyed powders. The process ability to produce highly metastable materials such as amorphous alloys and nanostructured materials has made this process attractive and it has been considered as a promising material processing technique that could be used to produce many advanced materials at low cost. The present study explores the conditions under which aluminum alloys formation occurs by ball milling of blended aluminum and its alloying elements powders. In this work, attempt was made in producing aluminum 2024 alloys by milling of blended elemental aluminum powder of 2024 composition in a stainless steel container under argon atmosphere for up to 210 minutes. X-ray diffraction together with thermal analysis techniques has been used to monitor phase changes in the milled powder. Results indicate that, using our predetermined milling parameters, alloys were formed after 120 minutes milling. The thermal analysis data was also presented in this report. (Author)

  6. Effect of ternary alloying elements on the shape memory behavior of Ti-Ta alloys

    International Nuclear Information System (INIS)

    Buenconsejo, Pio John S.; Kim, Hee Young; Miyazaki, Shuichi

    2009-01-01

    The effect of ternary alloying elements (X = V, Cr, Fe, Zr, Hf, Mo, Sn, Al) on the shape memory behavior of Ti-30Ta-X alloys was investigated. All the alloying elements decreased the martensitic transformation temperatures. The decrease in the martensitic transformation start (M s ) temperature due to alloying was affected by the atomic size and number of valence electrons of the alloying element. A larger number of valence electrons and a smaller atomic radius of an alloying element decreased the M s more strongly. The effect of the alloying elements on suppressing the aging effect on the shape memory behavior was also investigated. It was found that the additions of Sn and Al to Ti-Ta were effective in suppressing the effect of aging on the shape memory behavior, since they strongly suppress the formation of ω phase during aging treatment. For this reason the Ti-30Ta-1Al and Ti-30Ta-1Sn alloys exhibited a stable high-temperature shape memory effect during thermal cycling.

  7. Anodic behavior of alloy 22 in bicarbonate containing media: Effect of alloying

    International Nuclear Information System (INIS)

    Zadorozne, N S; Giordano, C M; Rebak, R B; Ares, A E; Carranza, R M

    2012-01-01

    Alloy 22 is one of the candidates for the manufacture of high level nuclear waste containers. These containers provide services in natural environments characterized by multi-ionic solutions.It is estimated they could suffer three types of deterioration: general corrosion, localized corrosion (specifically crevice corrosion) and stress corrosion cracking (SCC). It has been confirmed that the presence of bicarbonate and chloride ions is necessary to produce cracking, . It has also been determined that the susceptibility to SCC could be related to the occurrence of an anodic peak in the polarization curves in these media at potentials below transpassivity. The aim of this work is to study the effect of alloying elements on the anodic behavior of Alloy 22 in media containing bicarbonate and chloride ions at different concentrations and temperatures. Polarization curves were made on alloy 22 (Ni-22% Cr-13% Mo), Ni-Mo (Ni-28, 5% Mo) and Ni-Cr (Ni-20% Cr) in the following solutions: 1 mol/L NaCl at 90 o C, and 1.148 mol/L NaHCO 3 ; 1.148 mol/L NaHCO 3 + 1 mol/L NaCl; 1.148 mol/L NaHCO 3 + 0.1 mol/L NaCl, at 90 o C, 75 o C, 60 o C and 25 o C. It was found that alloy 22 has a anodic current density peak at potentials below transpassivity, only in the presence of bicarbonate ions. Curves performed in 1 mol/L NaCl did not show any anodic peak, in any of the tested alloys. The curves made on alloys Ni-Mo and Ni-Cr in the presence of bicarbonate ions, allowed to determine that Cr, is responsible for the appearance of the anodic peak in alloy 22. The curves of alloy Ni-Mo showed no anodic peak in the studied conditions. The potential at which the anodic peak appears in alloy 22 and Ni-Cr alloy, increases with decreasing temperature. The anodic peak was also affected by solution composition. When chloride ion is added to bicarbonate solutions, the anodic peak is shifted to higher potential and current densities, depending on the concentration of added chloride ions (author)

  8. INVESTIGATION OF MAGNESIUM ALLOYS MACHINABILITY

    Directory of Open Access Journals (Sweden)

    Berat Barıs BULDUM

    2013-01-01

    Full Text Available Magnesium is the lightest structural metal. Magnesium alloys have a hexagonal lattice structure, which affects the fundamental properties of these alloys. Plastic deformation of the hexagonal lattice is more complicated than in cubic latticed metals like aluminum, copper and steel. Magnesium alloy developments have traditionally been driven by industry requirements for lightweight materials to operate under increasingly demanding conditions. Magnesium alloys have always been attractive to designers due to their low density, only two thirds that of aluminium and its alloys [1]. The element and its alloys take a big part of modern industry needs. Especially nowadays magnesium alloys are used in automotive and mechanical (trains and wagons manufacture, because of its lightness and other features. Magnesium and magnesium alloys are the easiest of all metals to machine, allowing machining operations at extremely high speed. All standard machining operations such as turning, drilling, milling, are commonly performed on magnesium parts.

  9. Characteristics of Film Formed on Alloy 600 and Alloy 690 in Water Containing lead

    International Nuclear Information System (INIS)

    Hwang Seong Sik; Lee, Deok Hyun; Kim, Hong Pyo; Kim, Joung Soo; Kim, Ju Yup

    1999-01-01

    Anodic polarization behaviors of Alloy 600 and Alloy 690 have been studied as a function of lead content in the solution of pH 4 and 10 at 90 .deg. C. As the amount of lead in the solution increased, critical current densities and passive current densities of Alloy 600 and Alloy 690 increased, while the breakdown potential of the alloys decreased. The high critical current density in the high lead solution was thought to come from the combination of an enhanced dissolution of constituents on the surface of the alloys by the lead and an anodic dissolution of metallic lead deposited on the surface of the specimens. The morphology of lead precipitated on the specimen after the anodic scan changed with the pH of solution: small irregular particles were precipitated on the surface of the specimen in the solution of pH 4, while the high density of regular sized particles was formed on it in the solution of pH 10.Pb was observed to enhance Cr depletion from the outer surface of Alloy 600 and Alloy 690 and also to increase the ratio of O 2- /OH - in the surface film formed in the high lead solution. The SCC resistance of Alloy 600 and Alloy 690 may have decreased due to the poor quality of the passive film formed and the enhanced oxygen evolution in the solution containing lead

  10. Grain refining mechanism of Al-containing Mg alloys with the addition of Mn-Al alloys

    International Nuclear Information System (INIS)

    Qin, Gaowu W.; Ren Yuping; Huang Wei; Li Song; Pei Wenli

    2010-01-01

    Graphical abstract: Display Omitted Research highlights: The ε-AlMn phase acts as the heterogeneous nucleus of α-Mg phase during the solidification of the AZ31 Mg alloy, not the γ-Al 8 Mn 5 phase. The grain refinement effect is very clear with the addition of only 0.5 wt% Mn-28Al alloy (pure ε-AlMn). The grain refinement does not deteriorate up to the holding time of 60 min at 740 o C. - Abstract: The effect of manganese on grain refinement of Al-containing AZ31 Mg alloy has been investigated by designing a series of Mn-Al alloys composed of either pure ε-AlMn, γ 2 -Al 8 Mn 5 or both of them using optical microscopy and X-ray diffraction. It is experimentally clarified that the grain refinement of the AZ31 Mg alloy is due to the existence of the ε-AlMn phase in the Mn-Al alloys, not the γ 2 -Al 8 Mn 5 phase. The grain size of AZ31 Mg alloy is about 91 μm without any addition of Mn-Al alloys, but remarkably decreases to ∼55 μm with the addition of either Mn-34 wt% Al or Mn-28 wt% Al. With a minor addition of 0.5 wt% Mn-28Al alloy, the grain size of AZ31 alloy decreases to ∼53 μm, and the Mn-28Al alloy can be active as grain refiner for holding time up to 60 min for the melt AZ31 alloy at 750 o C.

  11. Synthesis of Amorphous Powders of Ni-Si and Co-Si Alloys by Mechanical Alloying

    Science.gov (United States)

    Omuro, Keisuke; Miura, Harumatsu

    1991-05-01

    Amorphous powders of the Ni-Si and Co-Si alloys are synthesized by mechanical alloying (MA) from crystalline elemental powders using a high energy ball mill. The alloying and amorphization process is examined by X-ray diffraction, differential scanning calorimetry (DSC), and scanning electron microscopy. For the Ni-Si alloy, it is confirmed that the crystallization temperature of the MA powder, measured by DSC, is in good agreement with that of the powder sample prepared by mechanical grinding from the cast alloy ingot products of the same composition.

  12. Formation and characterization of Al–Ti–Nb alloys by electron-beam surface alloying

    Energy Technology Data Exchange (ETDEWEB)

    Valkov, S., E-mail: stsvalkov@gmail.com [Institute of Electronics, Bulgarian Academy of Science, 72 Tzarigradsko Chaussee blvd., 1784 Sofia (Bulgaria); Petrov, P. [Institute of Electronics, Bulgarian Academy of Science, 72 Tzarigradsko Chaussee blvd., 1784 Sofia (Bulgaria); Lazarova, R. [Institute of Metal Science, Equipment and Technologies with Hydro and Aerodynamics Center, Bulgarian Academy of Science, 67 Shipchenski Prohod blvd., 1574 Sofia (Bulgaria); Bezdushnyi, R. [Department of Solid State Physics and Microelectronics, Faculty of Physics, Sofia University “St. Kliment Ohridsky”, 1164 Sofia (Bulgaria); Dechev, D. [Institute of Electronics, Bulgarian Academy of Science, 72 Tzarigradsko Chaussee blvd., 1784 Sofia (Bulgaria)

    2016-12-15

    Highlights: • Al–Ti–Nb surface alloys have been successfully obtained by electron-beam surface alloying technology. • The alloys consist of (Ti,Nb)Al{sub 3} fractions, distributed in the biphasic structure of (Ti,Nb)Al{sub 3} particles dispersed in α-Al. • The alloying speed does not affect the lattice parameters of (Ti,Nb)Al{sub 3} and, does not form additional stresses, strains etc. • It was found that lower velocity of the specimen motion during the alloying process develops more homogeneous structures. • The measured hardness of (Ti,Nb)Al{sub 3} compound reaches 775 HV[kg/cm{sup 2}] which is much greater than the values of NbAl{sub 3}. - Abstract: The combination of attractive mechanical properties, light weight and resistance to corrosion makes Ti-Al based alloys applicable in many industrial branches, like aircraft and automotive industries etc. It is known that the incorporation of Nb improves the high temperature performance and mechanical properties. In the present study on Al substrate Ti and Nb layers were deposited by DC (Direct Current) magnetron sputtering, followed by electron-beam alloying with scanning electron beam. It was chosen two speeds of the specimen motion during the alloying process: V{sub 1} = 0.5 cm/s and V{sub 2} = 1 cm/s. The alloying process was realized in circular sweep mode in order to maintain the melt pool further. The obtained results demonstrate a formation of (Ti,Nb)Al{sub 3} fractions randomly distributed in biphasic structure of intermetallic (Ti,Nb)Al{sub 3} particles, dispersed in α-Al solid solution. The evaluated (Ti,Nb)Al{sub 3} lattice parameters are independent of the speed of the specimen motion and therefore the alloying speed does not affect the lattice parameters and thus, does not form additional residual stresses, strains etc. It was found that lower velocity of the specimen motion during the alloying process develops more homogeneous structures. The metallographic analyses demonstrate a

  13. Effects of alloying elements on thermal desorption of helium in Ni alloys

    International Nuclear Information System (INIS)

    Xu, Q.; Cao, X.Z.; Sato, K.; Yoshiie, T.

    2012-01-01

    It is well known that the minor elements Si and Sn can suppress the formation of voids in Ni alloys. In the present study, to investigate the effects of Si and Sn on the retention of helium in Ni alloys, Ni, Ni–Si, and Ni–Sn alloys were irradiated by 5 keV He ions at 723 K. Thermal desorption spectroscopy (TDS) was performed at up to 1520 K, and microstructural observations were carried out to identify the helium trapping sites during the TDS analysis. Two peaks, at 1350 and 1457 K, appeared in the TDS spectrum of Ni. On the basis of the microstructural observations, the former peak was attributed to the release of trapped helium from small cavities and the latter to its release from large cavities. Small-cavity helium trapping sites were also found in the Ni–Si and Ni–Sn alloys, but no large cavities were observed in these alloys. In addition, it was found that the oversized element Sn could trap He atoms in the Ni–Sn alloy.

  14. Effects of alloying elements on thermal desorption of helium in Ni alloys

    Energy Technology Data Exchange (ETDEWEB)

    Xu, Q., E-mail: xu@rri.kyoto-u.ac.jp [Research Reactor Institute, Kyoto University, Osaka 590-0494 (Japan); Cao, X.Z.; Sato, K.; Yoshiie, T. [Research Reactor Institute, Kyoto University, Osaka 590-0494 (Japan)

    2012-12-15

    It is well known that the minor elements Si and Sn can suppress the formation of voids in Ni alloys. In the present study, to investigate the effects of Si and Sn on the retention of helium in Ni alloys, Ni, Ni-Si, and Ni-Sn alloys were irradiated by 5 keV He ions at 723 K. Thermal desorption spectroscopy (TDS) was performed at up to 1520 K, and microstructural observations were carried out to identify the helium trapping sites during the TDS analysis. Two peaks, at 1350 and 1457 K, appeared in the TDS spectrum of Ni. On the basis of the microstructural observations, the former peak was attributed to the release of trapped helium from small cavities and the latter to its release from large cavities. Small-cavity helium trapping sites were also found in the Ni-Si and Ni-Sn alloys, but no large cavities were observed in these alloys. In addition, it was found that the oversized element Sn could trap He atoms in the Ni-Sn alloy.

  15. Effects of alloying elements on thermal desorption of helium in Ni alloys

    Science.gov (United States)

    Xu, Q.; Cao, X. Z.; Sato, K.; Yoshiie, T.

    2012-12-01

    It is well known that the minor elements Si and Sn can suppress the formation of voids in Ni alloys. In the present study, to investigate the effects of Si and Sn on the retention of helium in Ni alloys, Ni, Ni-Si, and Ni-Sn alloys were irradiated by 5 keV He ions at 723 K. Thermal desorption spectroscopy (TDS) was performed at up to 1520 K, and microstructural observations were carried out to identify the helium trapping sites during the TDS analysis. Two peaks, at 1350 and 1457 K, appeared in the TDS spectrum of Ni. On the basis of the microstructural observations, the former peak was attributed to the release of trapped helium from small cavities and the latter to its release from large cavities. Small-cavity helium trapping sites were also found in the Ni-Si and Ni-Sn alloys, but no large cavities were observed in these alloys. In addition, it was found that the oversized element Sn could trap He atoms in the Ni-Sn alloy.

  16. High-Strength Low-Alloy (HSLA) Mg-Zn-Ca Alloys with Excellent Biodegradation Performance

    Science.gov (United States)

    Hofstetter, J.; Becker, M.; Martinelli, E.; Weinberg, A. M.; Mingler, B.; Kilian, H.; Pogatscher, S.; Uggowitzer, P. J.; Löffler, J. F.

    2014-04-01

    This article deals with the development of fine-grained high-strength low-alloy (HSLA) magnesium alloys intended for use as biodegradable implant material. The alloys contain solely low amounts of Zn and Ca as alloying elements. We illustrate the development path starting from the high-Zn-containing ZX50 (MgZn5Ca0.25) alloy with conventional purity, to an ultrahigh-purity ZX50 modification, and further to the ultrahigh-purity Zn-lean alloy ZX10 (MgZn1Ca0.3). It is shown that alloys with high Zn-content are prone to biocorrosion in various environments, most probably because of the presence of the intermetallic phase Mg6Zn3Ca2. A reduction of the Zn content results in (Mg,Zn)2Ca phase formation. This phase is less noble than the Mg-matrix and therefore, in contrast to Mg6Zn3Ca2, does not act as cathodic site. A fine-grained microstructure is achieved by the controlled formation of fine and homogeneously distributed (Mg,Zn)2Ca precipitates, which influence dynamic recrystallization and grain growth during hot forming. Such design scheme is comparable to that of HSLA steels, where low amounts of alloying elements are intended to produce a very fine dispersion of particles to increase the material's strength by refining the grain size. Consequently our new, ultrapure ZX10 alloy exhibits high strength (yield strength R p = 240 MPa, ultimate tensile strength R m = 255 MPa) and simultaneously high ductility (elongation to fracture A = 27%), as well as low mechanical anisotropy. Because of the anodic nature of the (Mg,Zn)2Ca particles used in the HSLA concept, the in vivo degradation in a rat femur implantation study is very slow and homogeneous without clinically observable hydrogen evolution, making the ZX10 alloy a promising material for biodegradable implants.

  17. The influence of alloy composition on residual stresses in heat treated aluminium alloys

    Energy Technology Data Exchange (ETDEWEB)

    Robinson, J.S., E-mail: jeremy.robinson@ul.ie [Department of Mechanical, Aeronautical and Biomedical Engineering, University of Limerick (Ireland); Redington, W. [Materials and Surface Science Institute, University of Limerick (Ireland)

    2015-07-15

    The as quenched properties of eight different heat treatable aluminium alloys are related to residual stress magnitudes with the objective being to establish if there is a relationship between the residual stress and the as quenched alloy hardness and strength. Near surface residual stresses were assessed with X-ray diffraction using both the established sin{sup 2}ψ method and the more recent cos α technique. Through thickness residual stresses were also characterised using neutron diffraction. The alloys were chosen to encompass a wide range of strengths. The low to medium strength alloys were 6060 and 6082, medium to high strength 2618A, 2014A, 7075, 7010 and two variants of 7449, while the very high strength alloy was the powder metallurgy alloy N707. To assess the as quenched strength, dynamic hardness and tensile properties were determined from samples tested immediately after quenching to minimise the influence of precipitation hardening by natural aging. In addition, hot hardness measurements were made in situ on samples cooled to simulate quench paths. Within the experimental constraints of the investigation, the distribution of residual stress through the thickness was found to follow the same pattern for all the alloys investigated, varying from tensile in the interior to surface compression. The influence of alloy strength was manifested as a change in the observed residual stress magnitudes, and surface residual stresses were found to vary linearly with as quenched hardness and strength. - Highlights: • As quenched aluminium alloys contain high magnitude residual stresses. • Surface is compressive balance by a tensile core. • As quenched surface residual stress is linear function of alloy strength. • In situ hot hardness demonstrates rapid change in intrinsic hardness during rapid cooling.

  18. WC-3015 alloy (high-temperature alloy)

    International Nuclear Information System (INIS)

    Anon.

    1974-01-01

    WC-3015 Nb alloy containing 28 to 30 Hf, 1 to 2 Zr, 13 to 16 W, 0 to 4 Ta, 0 to 5 Ti, 0.07 to 0.33 C, less than or equal to 0.02 N, less than or equal to 0.03 O, less than or equal to 0.001 H was developed for use at high temperature in oxidizing environments. Its composition can be tailored to meet specific requirements. When WC-3015 is exposed to O at elevated temperature, Hf and Nb oxidized preferentially and HfO 2 dissolves in Nb 2 O 5 to form 6HfO-Nb 2 O 5 . This complex oxide has a tight cubic lattice which resists the diffusion of O into the substrate. During 24-h exposure to air at 2400 0 F, the alloy oxidizes to a depth of approximately 0.035 in. with a surface recession of 0 to 0.004 in. Oxidation resistance of WC-3015 welds and base material can be further enhanced greatly by applying silicide coatings. WC-3015 alloy can be machined by conventional and electrical-discharge methods. It can be hot worked readily by extrusion, forging or rolling. Cold working can be used at room or elevated temperature. It can be welded by the electron-beam or Tig processes. Physical constants, typical mechanical properties at 75 to 2400 0 F, and effects of composition and heat treatment on tensile and stress-rupture properties of the alloy are tabulated

  19. Advanced ordered intermetallic alloy deployment

    Energy Technology Data Exchange (ETDEWEB)

    Liu, C.T.; Maziasz, P.J.; Easton, D.S. [Oak Ridge National Lab., TN (United States)

    1997-04-01

    The need for high-strength, high-temperature, and light-weight materials for structural applications has generated a great deal of interest in ordered intermetallic alloys, particularly in {gamma}-based titanium aluminides {gamma}-based TiAl alloys offer an attractive mix of low density ({approximately}4g/cm{sup 3}), good creep resistance, and high-temperature strength and oxidation resistance. For rotating or high-speed components. TiAl also has a high damping coefficient which minimizes vibrations and noise. These alloys generally contain two phases. {alpha}{sub 2} (DO{sub 19} structure) and {gamma} (L 1{sub 0}), at temperatures below 1120{degrees}C, the euticoid temperature. The mechanical properties of TiAl-based alloys are sensitive to both alloy compositions and microstructure. Depending on heat-treatment and thermomechanical processing, microstructures with near equiaxed {gamma}, a duplex structure (a mix of the {gamma} and {alpha}{sub 2} phases) can be developed in TiAl alloys containing 45 to 50 at. % Al. The major concern for structural use of TiAl alloys is their low ductility and poor fracture resistance at ambient temperatures. The purpose of this project is to improve the fracture toughness of TiAl-based alloys by controlling alloy composition, microstructure and thermomechanical treatment. This work is expected to lead to the development of TiAl alloys with significantly improved fracture toughness and tensile ductility for structural use.

  20. Impact toughness of laser alloyed aluminium AA1200 alloys

    CSIR Research Space (South Africa)

    Mabhali, Luyolo AB

    2013-08-01

    Full Text Available ),. 559-563. [2] T. Tomida, K. Nakata, S. Saji, T. Kubo, T, Formation of metal matrix composite layer on aluminium alloy with TiC-Cu powder by laser surface alloying process; Surface and Coatings Technology; vol. 142-144, 2001, 585-589. [3] L. A. B...

  1. A sulfidation-resistant nickel-base alloy

    International Nuclear Information System (INIS)

    Lai, G.Y.

    1989-01-01

    For applications in mildly to moderately sulfidizing environments, stainless steels, Fe-Ni-Cr alloys (e.g., alloys 800 and 330), and more recently Fe-Ni-Cr-Co alloys (e.g., alloy 556) are frequently used for construction of process equipment. However, for many highly sulfidizing environments, few existing commercial alloys have adequate performance. Thus, a new nickel-based alloy containing 27 wt.% Co, 28 wt.% Cr, 4 wt.% Fe, 2.75 wt.% Si, 0.5 wt.% Mn and 0.05 wt.% C (Haynes alloy HR-160) was developed

  2. Irradiation assisted stress corrosion cracking of HTH Alloy X-750 and Alloy 625

    International Nuclear Information System (INIS)

    Mills, W.J.; Lebo, M.R.; Bajaj, R.; Kearns, J.J.; Hoffman, R.C.; Korinko, J.J.

    1994-01-01

    In-reactor testing of bolt-loaded precracked compact tension specimens was performed in 360 degree C water to determine effect of irradiation on the SCC behavior of HTH Alloy X-750 and direct aged Alloy 625. Out-of-flux and autoclave control specimens provided baseline data. Primary test variables were stress intensity factor, fluence, chemistry, processing history, prestrain. Results for the first series of experiments were presented at a previous conference. Data from two more recent experiments are compared with previous results; they confirm that high irradiation levels significantly reduce SCC resistance in HTH Alloy X-750. Heat-to-heat differences in IASCC were related to differences in boron content, with low boron heats showing improved SCC resistance. The in-reactor SCC performance of Alloy 625 was superior to that for Alloy X-750, as no cracking was observed in any Alloy 625 specimens even though they were tested at very high K 1 and fluence levels. A preliminary SCC usage model developed for Alloy X-750 indicates that in-reactor creep processes, which relax stresses but also increase crack tip strain rates, and radiolysis effects accelerate SCC. Hence, in-reactor SCC damage under high flux conditions may be more severe than that associated with postirradiation tests. In addition, preliminary mechanism studies were performed to determine the cause of IASCC In Alloy X-750

  3. Improvement of magnetocaloric properties of Gd-Ge-Si alloys by alloying with iron

    Directory of Open Access Journals (Sweden)

    Erenc-Sędziak T.

    2013-01-01

    Full Text Available The influence of annealing of Gd5Ge2Si2Fex alloys at 1200°C and of alloying with various amount of iron on structure as well as thermal and magnetocaloric properties is investigated. It was found that annealing for 1 to 10 hours improves the entropy change, but reduces the temperature of maximum magnetocaloric effect by up to 50 K. Prolonged annealing of the Gd5Ge2Si2 alloy results in the decrease of entropy change due to the reduction of Gd5Ge2Si2 phase content. Addition of iron to the ternary alloy enhances the magnetocaloric effect, if x = 0.4 – 0.6, especially if alloying is combined with annealing at 1200°C: the peak value of the isothermal entropy change from 0 to 2 T increases from 3.5 to 11 J/kgK. Simultaneously, the temperature of maximum magnetocaloric effect drops to 250 K. The changes in magnetocaloric properties are related to the change in phase transformation from the second order for arc molten ternary alloy to first order in the case of annealed and/or alloyed with iron. The results of this study indicate that the minor addition of iron and heat treatment to Gd-Ge-Si alloys may be useful in improving the materials’ magnetocaloric properties..

  4. Non-equiatomic high entropy alloys: Approach towards rapid alloy screening and property-oriented design

    Energy Technology Data Exchange (ETDEWEB)

    Pradeep, K.G. [Max-Planck-Institut für Eisenforschung GmbH, Max-Planck-str.1, 40237 Düsseldorf (Germany); Materials Chemistry, RWTH Aachen University, Kopernikusstr.10, 52074 Aachen (Germany); Tasan, C.C., E-mail: c.tasan@mpie.de [Max-Planck-Institut für Eisenforschung GmbH, Max-Planck-str.1, 40237 Düsseldorf (Germany); Yao, M.J. [Max-Planck-Institut für Eisenforschung GmbH, Max-Planck-str.1, 40237 Düsseldorf (Germany); Deng, Y. [Max-Planck-Institut für Eisenforschung GmbH, Max-Planck-str.1, 40237 Düsseldorf (Germany); Department of Engineering Design and Materials, Norwegian University of Science and Technology, No-7491 Trondheim (Norway); Springer, H. [Max-Planck-Institut für Eisenforschung GmbH, Max-Planck-str.1, 40237 Düsseldorf (Germany); Raabe, D., E-mail: d.raabe@mpie.de [Max-Planck-Institut für Eisenforschung GmbH, Max-Planck-str.1, 40237 Düsseldorf (Germany)

    2015-11-11

    The high entropy alloy (HEA) concept has triggered a renewed interest in alloy design, even though some aspects of the underlying thermodynamic concepts are still under debate. This study addresses the short-comings of this alloy design strategy with the aim to open up new directions of HEA research targeting specifically non-equiatomic yet massively alloyed compositions. We propose that a wide range of massive single phase solid solutions could be designed by including non-equiatomic variants. It is demonstrated by introducing a set of novel non-equiatomic multi-component CoCrFeMnNi alloys produced by metallurgical rapid alloy prototyping. Despite the reduced configurational entropy, detailed characterization of these materials reveals a strong resemblance to the well-studied equiatomic single phase HEA: The microstructure of these novel alloys exhibits a random distribution of alloying elements (confirmed by Energy-Dispersive Spectroscopy and Atom Probe Tomography) in a single face-centered-cubic phase (confirmed by X-ray Diffraction and Electron Backscatter Diffraction), which deforms through planar slip (confirmed by Electron-Channeling Contrast Imaging) and leads to excellent ductility (confirmed by uniaxial tensile tests). This approach widens the field of HEAs to non-equiatomic multi-component alloys since the concept enables to tailor the stacking fault energy and associated transformation phenomena which act as main mechanisms to design useful strain hardening behavior.

  5. Non-equiatomic high entropy alloys: Approach towards rapid alloy screening and property-oriented design

    International Nuclear Information System (INIS)

    Pradeep, K.G.; Tasan, C.C.; Yao, M.J.; Deng, Y.; Springer, H.; Raabe, D.

    2015-01-01

    The high entropy alloy (HEA) concept has triggered a renewed interest in alloy design, even though some aspects of the underlying thermodynamic concepts are still under debate. This study addresses the short-comings of this alloy design strategy with the aim to open up new directions of HEA research targeting specifically non-equiatomic yet massively alloyed compositions. We propose that a wide range of massive single phase solid solutions could be designed by including non-equiatomic variants. It is demonstrated by introducing a set of novel non-equiatomic multi-component CoCrFeMnNi alloys produced by metallurgical rapid alloy prototyping. Despite the reduced configurational entropy, detailed characterization of these materials reveals a strong resemblance to the well-studied equiatomic single phase HEA: The microstructure of these novel alloys exhibits a random distribution of alloying elements (confirmed by Energy-Dispersive Spectroscopy and Atom Probe Tomography) in a single face-centered-cubic phase (confirmed by X-ray Diffraction and Electron Backscatter Diffraction), which deforms through planar slip (confirmed by Electron-Channeling Contrast Imaging) and leads to excellent ductility (confirmed by uniaxial tensile tests). This approach widens the field of HEAs to non-equiatomic multi-component alloys since the concept enables to tailor the stacking fault energy and associated transformation phenomena which act as main mechanisms to design useful strain hardening behavior.

  6. Alloy Fabrication Laboratory

    Data.gov (United States)

    Federal Laboratory Consortium — At NETL’s Alloy Fabrication Facility in Albany, OR, researchers conduct DOE research projects to produce new alloys suited to a variety of applications, from gas...

  7. Grain refining mechanism of Al-containing Mg alloys with the addition of Mn-Al alloys

    Energy Technology Data Exchange (ETDEWEB)

    Qin, Gaowu W., E-mail: qingw@smm.neu.edu.c [Key Laboratory for Anisotropy and Texture of Materials (Ministry of Education), Northeastern University, Wenhu Road 3-11, Heping District, Shenyang 110004, Liaoning Province (China); Ren Yuping; Huang Wei; Li Song; Pei Wenli [Key Laboratory for Anisotropy and Texture of Materials (Ministry of Education), Northeastern University, Wenhu Road 3-11, Heping District, Shenyang 110004, Liaoning Province (China)

    2010-10-08

    Graphical abstract: Display Omitted Research highlights: The {epsilon}-AlMn phase acts as the heterogeneous nucleus of {alpha}-Mg phase during the solidification of the AZ31 Mg alloy, not the {gamma}-Al{sub 8}Mn{sub 5} phase. The grain refinement effect is very clear with the addition of only 0.5 wt% Mn-28Al alloy (pure {epsilon}-AlMn). The grain refinement does not deteriorate up to the holding time of 60 min at 740 {sup o}C. - Abstract: The effect of manganese on grain refinement of Al-containing AZ31 Mg alloy has been investigated by designing a series of Mn-Al alloys composed of either pure {epsilon}-AlMn, {gamma}{sub 2}-Al{sub 8}Mn{sub 5} or both of them using optical microscopy and X-ray diffraction. It is experimentally clarified that the grain refinement of the AZ31 Mg alloy is due to the existence of the {epsilon}-AlMn phase in the Mn-Al alloys, not the {gamma}{sub 2}-Al{sub 8}Mn{sub 5} phase. The grain size of AZ31 Mg alloy is about 91 {mu}m without any addition of Mn-Al alloys, but remarkably decreases to {approx}55 {mu}m with the addition of either Mn-34 wt% Al or Mn-28 wt% Al. With a minor addition of 0.5 wt% Mn-28Al alloy, the grain size of AZ31 alloy decreases to {approx}53 {mu}m, and the Mn-28Al alloy can be active as grain refiner for holding time up to 60 min for the melt AZ31 alloy at 750 {sup o}C.

  8. Corrosion-electrochemical and mechanical properties of aluminium-berylium alloys alloyed by rare-earth metals

    International Nuclear Information System (INIS)

    Safarov, A.M.; Odinaev, Kh.E.; Shukroev, M.Sh.; Saidov, R.Kh.

    1997-01-01

    In order to study influence of rare earth metals on corrosion-electrochemical and mechanical properties of aluminium-berylium alloys the alloys contain 1 mass % beryllium and different amount of rare earth metals were obtained.-electrochemical and mechanical properties of aluminium-berylium alloys. The electrochemical characteristics of obtained alloys, including stationary potential, potentials of passivation beginning and full passivation, potentials of pitting formation and re passivation were defined.

  9. Role of alloying additions on the properties of Cu–Al–Mn shape memory alloys

    Energy Technology Data Exchange (ETDEWEB)

    Dasgupta, Rupa, E-mail: rupadasgupta@ampri.res.in; Jain, Ashish Kumar; Kumar, Pravir; Hussain, Shahadat; Pandey, Abhishek

    2015-01-25

    Highlights: • Cu based SMAs with high transition temperature could be made using LM route. • The properties depend on alloying composition. • Property characterisation establishes feasibility of making SMAs. - Abstract: The effect of alloying seven different elements [Zn, Si, Fe, Ni, Mg, Cr and Ti] on the microstructure, hardness, phase precipitation and transformation temperature in a Cu–12.5Al–5Mn alloy with a view to possible improvements as a result of these additions is the focus of the reported study. The base alloy has been chosen keeping in mind its ability to exhibit shape memory properties and improved ductility over other Cu-based SMAs. The objective was to ascertain changes or improvements attained due to the individual tertiary additions. The samples were prepared through liquid metallurgy route using pure copper, aluminum, manganese and the respective quaternary alloying elements in right quantities to weigh 1000 g of the alloy in total and were melted together. Samples from the cast alloys were subject to homogenisation treatment at 200 °C for 2 h in a muffle furnace and furnace cooled. Samples from the homogenised alloys were heated and held for 2 h at 920 °C followed by ice quenching to obtain the desired martensitic structure for shape memory behaviour. The alloys in the cast, homogenised and quenched conditions were metallographically polished to observe the martensitic phase formation mainly in quenched samples which is a pre requisite for exhibiting shape memory properties in these alloys. X-ray Diffraction studies were carried out on the cast and quenched samples using Cu Kα target; and the phases identified indicate martensitic phase precipitation; however in some cases the precipitation is incomplete. Differential Scanning Calorimetric [DSC] studies were carried out on quenched samples from room temperature to 600 °C maintaining a constant rate of 10 °C/min. Results indicate clear transformation peaks in all the samples which

  10. Role of alloying additions on the properties of Cu–Al–Mn shape memory alloys

    International Nuclear Information System (INIS)

    Dasgupta, Rupa; Jain, Ashish Kumar; Kumar, Pravir; Hussain, Shahadat; Pandey, Abhishek

    2015-01-01

    Highlights: • Cu based SMAs with high transition temperature could be made using LM route. • The properties depend on alloying composition. • Property characterisation establishes feasibility of making SMAs. - Abstract: The effect of alloying seven different elements [Zn, Si, Fe, Ni, Mg, Cr and Ti] on the microstructure, hardness, phase precipitation and transformation temperature in a Cu–12.5Al–5Mn alloy with a view to possible improvements as a result of these additions is the focus of the reported study. The base alloy has been chosen keeping in mind its ability to exhibit shape memory properties and improved ductility over other Cu-based SMAs. The objective was to ascertain changes or improvements attained due to the individual tertiary additions. The samples were prepared through liquid metallurgy route using pure copper, aluminum, manganese and the respective quaternary alloying elements in right quantities to weigh 1000 g of the alloy in total and were melted together. Samples from the cast alloys were subject to homogenisation treatment at 200 °C for 2 h in a muffle furnace and furnace cooled. Samples from the homogenised alloys were heated and held for 2 h at 920 °C followed by ice quenching to obtain the desired martensitic structure for shape memory behaviour. The alloys in the cast, homogenised and quenched conditions were metallographically polished to observe the martensitic phase formation mainly in quenched samples which is a pre requisite for exhibiting shape memory properties in these alloys. X-ray Diffraction studies were carried out on the cast and quenched samples using Cu Kα target; and the phases identified indicate martensitic phase precipitation; however in some cases the precipitation is incomplete. Differential Scanning Calorimetric [DSC] studies were carried out on quenched samples from room temperature to 600 °C maintaining a constant rate of 10 °C/min. Results indicate clear transformation peaks in all the samples which

  11. Fracture of Shape Memory Alloys

    OpenAIRE

    Miyazaki, Shuichi; Otsuka, Kazuhiro

    1981-01-01

    The initiation and the propagation of cracks during both quenching and deformation in polycrystalline Cu-Al-Ni alloys have been investigated under various conditions. The fracture surfaces of Ti-Ni and Cu-Al-Ni alloys were also observed by a scanning electron microscope. From these results, it was concluded that the brittleness of Cu-Al-Ni alloy and other β phase alloys are due to large elastic anisotropy and large grain sizes, while that the large ductility in Ti-Ni alloy being due to the sm...

  12. Alloy development for cladding and duct applications

    International Nuclear Information System (INIS)

    Straalsund, J.L.; Johnson, G.D.

    1981-01-01

    Three general classes of materials under development for cladding and ducts are listed. Solid solution strengthened, or austenitic, alloys are Type 316 stainless steel and D9. Precipitation hardened (also austenitic) alloys consist of D21, D66 and D68. These alloys are similar to such commercial alloys as M-813, Inconel 706, Inconel 718 and Nimonic PE-16. The third general class of alloys is composed of ferritic alloys, with current emphasis being placed on HT-9, a tempered martensitic alloy, and D67, a delta-ferritic steel. The program is comprised of three parallel paths. The current reference, or first generation alloy, is 20% cold worked Type 316 stainless steel. Second generation alloys for near-term applications include D9 and HT-9. Third generation materials consist of the precipitation strengthened steels and ferritic alloys, and are being considered for implementation at a later time than the first and second generation alloys. The development of second and third generation materials was initiated in 1974 with the selection of 35 alloys. This program has proceeded to today where there are six advanced alloys being evaluated. These alloys are the developmental alloys D9, D21, D57, D66 and D68, together with the commerical alloy, HT-9. The status of development of these alloys is summarized

  13. ZIRCONIUM-TITANIUM-BERYLLIUM BRAZING ALLOY

    Science.gov (United States)

    Gilliland, R.G.; Patriarca, P.; Slaughter, G.M.; Williams, L.C.

    1962-06-12

    A new and improved ternary alloy is described which is of particular utility in braze-bonding parts made of a refractory metal selected from Group IV, V, and VI of the periodic table and alloys containing said metal as a predominating alloying ingredient. The brazing alloy contains, by weight, 40 to 50 per cent zirconium, 40 to 50 per cent titanium, and the balance beryllium in amounts ranging from 1 to 20 per cent, said alloy having a melting point in the range 950 to 1400 deg C. (AEC)

  14. Borated aluminum alloy manufacturing technology

    International Nuclear Information System (INIS)

    Shimojo, Jun; Taniuchi, Hiroaki; Kajihara, Katsura; Aruga, Yasuhiro

    2003-01-01

    Borated aluminum alloy is used as the basket material of cask because of its light weight, thermal conductivity and superior neutron absorbing abilities. Kobe Steel has developed a unique manufacturing process for borated aluminum alloy using a vacuum induction melting method. In this process, aluminum alloy is melted and agitated at higher temperatures than common aluminum alloy fabrication methods. It is then cast into a mold in a vacuum atmosphere. The result is a high quality aluminum alloy which has a uniform boron distribution and no impurities. (author)

  15. CES_EHP_Figure_2

    Data.gov (United States)

    U.S. Environmental Protection Agency — The increasing number of chemicals for which SHEDS probabilistic exposure assessment has been performed over the years. This dataset is associated with the following...

  16. Grain refinement of an AZ63B magnesium alloy by an Al-1C master alloy

    Energy Technology Data Exchange (ETDEWEB)

    Yichuan Pan; Xiangfa Liu; Hua Yang [The Key Lab. of Liquid Structure and Heredity of Materials, Shandong Univ., Jinan (China)

    2005-12-01

    In order to develop a refiner of Mg-Al alloys, an Al-1C (in wt.%) master alloy was synthesized using a casting method. The microstructure and grain-refining performance of the Al-1C master alloy were investigated using X-ray diffraction (XRD), electron probe microanalysis (EPMA) and a grain-refining test. The microstructure of the Al-1C master alloy is composed of {alpha}-Al solid solution, Al{sub 4}C{sub 3} particles, and graphite phases. After grain refinement of AZ63B alloy by the Al-1C master alloy, the mean grain size reached a limit when 2 wt.% Al-C master alloy was added at 800 C and held for 20 min in the melt before casting. The minimum mean grain size is approximately 48 {mu}m at the one-half radius of the ingot and is about 17% of that of the unrefined alloy. The Al-1C master alloy results in better grain refinement than C{sub 2}Cl{sub 6} and MgCO{sub 3} carbon-containing refiners. (orig.)

  17. The physical metallurgy of mechanically-alloyed, dispersion-strengthened Al-Li-Mg and Al-Li-Cu alloys

    Science.gov (United States)

    Gilman, P. S.

    1984-01-01

    Powder processing of Al-Li-Mg and Al-Li-Cu alloys by mechanical alloying (MA) is described, with a discussion of physical and mechanical properties of early experimental alloys of these compositions. The experimental samples were mechanically alloyed in a Szegvari attritor, extruded at 343 and 427 C, and some were solution-treated at 520 and 566 C and naturally, as well as artificially, aged at 170, 190, and 210 C for times of up to 1000 hours. All alloys exhibited maximum hardness after being aged at 170 C; lower hardness corresponds to the solution treatment at 566 C than to that at 520 C. A comparison with ingot metallurgy alloys of the same composition shows the MA material to be stronger and more ductile. It is also noted that properly aged MA alloys can develop a better combination of yield strength and notched toughness at lower alloying levels.

  18. De-alloyed platinum nanoparticles

    Science.gov (United States)

    Strasser, Peter [Houston, TX; Koh, Shirlaine [Houston, TX; Mani, Prasanna [Houston, TX; Ratndeep, Srivastava [Houston, TX

    2011-08-09

    A method of producing de-alloyed nanoparticles. In an embodiment, the method comprises admixing metal precursors, freeze-drying, annealing, and de-alloying the nanoparticles in situ. Further, in an embodiment de-alloyed nanoparticle formed by the method, wherein the nanoparticle further comprises a core-shell arrangement. The nanoparticle is suitable for electrocatalytic processes and devices.

  19. Variations of color with alloying elements in Pd-free Au-Pt-based high noble dental alloys

    International Nuclear Information System (INIS)

    Shiraishi, Takanobu; Takuma, Yasuko; Miura, Eri; Fujita, Takeshi; Hisatsune, Kunihiro

    2007-01-01

    The effects of alloying addition of a small amount of base metals (In, Sn, Fe, Zn) on color variations in Pd-free Au-Pt-based high noble dental alloys were investigated in terms of rectilinear and polar color coordinates. The ternary Au-Pt-X (X = In, Sn, Fe, Zn) and quaternary Au-Pt-In-Y (Y = Sn, Fe, Zn) alloys were prepared from high purity component metals. The amount of alloying base metals, X and Y, were restricted up to 2 at.%. The alloying addition of a small amount of Fe, In, Sn, to a binary Au-10 at.% Pt alloy (referred to as AP10) effectively increased chroma, C *. On the other hand, the addition of Zn to the parent alloy AP10 did not change color coordinates greatly. The increase in chroma in the present Au-Pt-based high noble alloys was attributed to the increase in the slope of spectral reflectance curve at its absorption edge near 515 nm. It was found that the addition of a small amount of Fe to the parent alloy AP10 markedly increased lightness, L *, and the addition of Sn gave a very light tint of red to the parent alloy. Although red-green chromaticity index a * contributed to chroma to some extent, contribution of yellow-blue chromaticity index b * was much greater in determining chroma in this Pd-free Au-Pt-based multi-component alloys. The present results are expected to be valuable in case color is to be taken into account in designing Pd-free Au-Pt-based high noble dental alloys

  20. Variations of color with alloying elements in Pd-free Au-Pt-based high noble dental alloys

    Energy Technology Data Exchange (ETDEWEB)

    Shiraishi, Takanobu [Department of Dental and Biomedical Materials Science, Unit of Basic Medical Sciences, Graduate School of Biomedical Sciences, Nagasaki University, 1-7-1 Sakamoto, Nagasaki 852-8588 (Japan)]. E-mail: siraisi@nagasaki-u.ac.jp; Takuma, Yasuko [Department of Dental and Biomedical Materials Science, Unit of Basic Medical Sciences, Graduate School of Biomedical Sciences, Nagasaki University, 1-7-1 Sakamoto, Nagasaki 852-8588 (Japan); Miura, Eri [Department of Dental and Biomedical Materials Science, Unit of Basic Medical Sciences, Graduate School of Biomedical Sciences, Nagasaki University, 1-7-1 Sakamoto, Nagasaki 852-8588 (Japan); Fujita, Takeshi [Department of Dental and Biomedical Materials Science, Unit of Basic Medical Sciences, Graduate School of Biomedical Sciences, Nagasaki University, 1-7-1 Sakamoto, Nagasaki 852-8588 (Japan); Hisatsune, Kunihiro [Department of Dental and Biomedical Materials Science, Unit of Basic Medical Sciences, Graduate School of Biomedical Sciences, Nagasaki University, 1-7-1 Sakamoto, Nagasaki 852-8588 (Japan)

    2007-06-15

    The effects of alloying addition of a small amount of base metals (In, Sn, Fe, Zn) on color variations in Pd-free Au-Pt-based high noble dental alloys were investigated in terms of rectilinear and polar color coordinates. The ternary Au-Pt-X (X = In, Sn, Fe, Zn) and quaternary Au-Pt-In-Y (Y = Sn, Fe, Zn) alloys were prepared from high purity component metals. The amount of alloying base metals, X and Y, were restricted up to 2 at.%. The alloying addition of a small amount of Fe, In, Sn, to a binary Au-10 at.% Pt alloy (referred to as AP10) effectively increased chroma, C *. On the other hand, the addition of Zn to the parent alloy AP10 did not change color coordinates greatly. The increase in chroma in the present Au-Pt-based high noble alloys was attributed to the increase in the slope of spectral reflectance curve at its absorption edge near 515 nm. It was found that the addition of a small amount of Fe to the parent alloy AP10 markedly increased lightness, L *, and the addition of Sn gave a very light tint of red to the parent alloy. Although red-green chromaticity index a * contributed to chroma to some extent, contribution of yellow-blue chromaticity index b * was much greater in determining chroma in this Pd-free Au-Pt-based multi-component alloys. The present results are expected to be valuable in case color is to be taken into account in designing Pd-free Au-Pt-based high noble dental alloys.

  1. Effects of segregation of primary alloying elements on the creep response in magnesium alloys

    DEFF Research Database (Denmark)

    Huang, Y.D.; Dieringa, H.; Hort, N.

    2008-01-01

    The segregation of primary alloying elements deteriorates the high temperature creep resistance of magnesium alloys. Annealing at high temperatures alleviating their segregations can improve the creep resistance. Present investigation on the effect of segregation of primary alloying elements...... on the creep response may provide some useful information about how to improve the creep resistance of magnesium alloys in the future. (c) 2008 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved....

  2. Effectiveness of Ti-micro alloying in relation to cooling rate on corrosion of AZ91 Mg alloy

    International Nuclear Information System (INIS)

    Candan, S.; Celik, M.; Candan, E.

    2016-01-01

    In this study, micro Ti-alloyed AZ91 Mg alloys (AZ91 + 0.5wt.%Ti) have been investigated in order to clarify effectiveness of micro alloying and/or cooling rate on their corrosion properties. Molten alloys were solidified under various cooling rates by using four stage step mold. The microstructural investigations were carried out by using scanning electron microscopy (SEM). Corrosion behaviors of the alloys were evaluated by means of immersion and electrochemical polarization tests in 3.5% NaCl solution. Results showed that the Mg 17 Al 12 (β) intermetallic phase in the microstructure of AZ91 Mg alloy formed as a net-like structure. The Ti addition has reduced the distribution and continuity of β intermetallic phase and its morphology has emerged as fully divorced eutectic. Compared to AZ91 alloy, the effect of the cooling rate in Ti-added alloy on the grain size was less pronounced. When AZ91 and its Ti-added alloys were compared under the same cooling conditions, the Ti addition showed notably high corrosion resistance. Electrochemical test results showed that while I corr values of AZ91 decrease with the increase in the cooling rate, the effect of the cooling rate on I corr values was much lower in the Ti-added alloy. The corrosion resistance of AZ91 Mg alloy was sensitive towards the cooling rates while Ti-added alloy was not affected much from the cooling conditions. - Highlights: • Effect the cooling rate on grain size was less pronounced in the Ti-added alloy. • The morphology of the β phase transformed into fully divorced eutectics. • Ti addition exhibited significantly higher corrosion resistance. • Ti micro alloying is more effective than faster cooling of the alloy on corrosion.

  3. Mechanical and bio-corrosion properties of quaternary Mg–Ca–Mn–Zn alloys compared with binary Mg–Ca alloys

    International Nuclear Information System (INIS)

    Bakhsheshi-Rad, H.R.; Idris, M.H.; Abdul-Kadir, M.R.; Ourdjini, A.; Medraj, M.; Daroonparvar, M.; Hamzah, E.

    2014-01-01

    Highlights: • Quaternary alloy show better mechanical and corrosion properties than binary alloy. • Mg–2Ca–0.5Mn–2Zn alloy showed suitable mechanical properties for bone application. • The improved corrosion resistance with addition of Mn and Zn into the Mg–Ca alloy. • Formation of protective surface film Mn-containing magnesium on quaternary alloy. • Secondary phases have strong effect on micro-galvanic corrosion of Mg alloys. - Abstract: Binary Mg–xCa alloys and the quaternary Mg–Ca–Mn–xZn were studied to investigate their bio-corrosion and mechanical properties. The surface morphology of specimens was characterized by X-ray diffraction (XRD), Fourier-transformed infrared spectroscopy (FTIR), scanning electron microscopy (SEM) and energy dispersive X-ray spectroscopy (EDS). The results of mechanical properties show that the yield strength (YS), ultimate tensile strength (UTS) and elongation of quaternary alloy increased significantly with the addition of zinc (Zn) up to 4 wt.%. However, further addition of Zn content beyond 4 wt.% did not improve yield strength and ultimate tensile strength. In contrast, increasing calcium (Ca) content has a deleterious effect on binary Mg–Ca alloys. Compression tests of the magnesium (Mg) alloys revealed that the compression strength of quaternary alloy was higher than that of binary alloy. However, binary Mg–Ca alloy showed higher reduction in compression strength after immersion in simulated body fluid. The bio-corrosion behaviour of the binary and quaternary Mg alloys were investigated using immersion tests and electrochemical tests. Electrochemical tests shows that the corrosion potential (E corr ) of binary Mg–2Ca significantly shifted toward nobeler direction from −1996.8 to −1616.6 mV SCE with the addition of 0.5 wt.% manganese (Mn) and 2 wt.% Zn content. However, further addition of Zn to 7 wt.% into quaternary alloy has the reverse effect. Immersion tests show that the quaternary

  4. Effect of reversible hydrogen alloying and plastic deformation on microstructure development in titanium alloys

    International Nuclear Information System (INIS)

    Murzinova, M.A.

    2011-01-01

    Hydrogen leads to degradation in fracture-related mechanical properties of titanium alloys and is usually considered as a very dangerous element. Numerous studies of hydrogen interaction with titanium alloys showed that hydrogen may be considered not only as an impurity but also as temporary alloying element. This statement is based on the following. Hydrogen stabilizes high-temperature β-phase, leads to decrease in temperature of β→α transformation and extends (α + β )-phase field. The BCC β-phase exhibits lower strength and higher ductility in comparison with HCP α -phase. As a result, hydrogen improves hot workability of hard-to-deform titanium alloys. Hydrogen changes chemical composition of the phases, kinetics of phase transformations, and at low temperatures additional phase transformation (β→α + TiH 2 ) takes place, which is accompanied with noticeable change in volumes of phases. As a result, fine lamellar microstructure may be formed in hydrogenated titanium alloys after heat treatment. It was shown that controlled hydrogen alloying improves weldability and machinability of titanium alloys. After processing hydrogenated titanium preforms are subjected to vacuum annealing, and the hydrogen content decreases up to safe level. Hydrogen removal is accompanied with hydrides dissolution and β→α transformation that makes possible to control structure formation at this final step of treatment. Thus, reversible hydrogen alloying of titanium alloys allows to obtain novel microstructure with enhanced properties. The aim of the work was to study the effect of hydrogen on structure formation, namely: i) influence of hydrogen content on transformation of lamellar microstructure to globular one during deformation in (α+β)-phase field; ii) effect of dissolved hydrogen on dynamic recrystallization in single α- and β- phase regions; iii) influence of vacuum annealing temperature on microstructure development. The work was focused on the optimization of

  5. Physical metallurgy of titanium alloys

    International Nuclear Information System (INIS)

    Collings, E.W.

    1988-01-01

    Researches in electric, magnetic, thermophysical properties of titanium alloys in the wide range of temperatures (from helium upto elevated one), as well as stability of phases in alloys of different types are generalized. Fundamental description of physical properties of binary model alloys is given. Acoustic emission, shape memory and Bauschinger effects, pseudoelasticity, aging and other aspects of physical metallurgy of titanium alloys are considered

  6. Fe-Cr-Ni system alloys

    International Nuclear Information System (INIS)

    Levin, F.L.

    1986-01-01

    Phase diagram of Fe-Cr-Ni system, which is the basic one for production of corrosion resistant alloys, is considered. Data on corrosion resistance of such alloys are correlated depending on a number of factors: quality and composition of modifying elements, corrosion medium, temperature, alloy structure, mechanical and thermal treatment. Grades of Fe-Ni-Cr alloys are presented, and fields of their application are pointed out

  7. Galvanic corrosion in odontological alloys

    International Nuclear Information System (INIS)

    Riesgo, O.; Bianchi, G.L.; Duffo, G.S.

    1993-01-01

    Galvanic corrosion can occur when different alloys are placed in direct contact within the oral cavity or within tissues. Concern has been expressed associated with the coupling of selected restorative materials as well as implant material with various alloys used for restorative procedures. This could be critical if the crown or bridge had subgingival finish line with a metallic zone in contact with the tissue, and the implant was made in titanium alloy. The present work shows the results of galvanic coupling studies done on implants of titanium alloy connected to nickel-chromium and cobalt-chromium alloys. (Author)

  8. Grain refinement of 7075Al alloy microstructures by inoculation with Al-Ti-B master alloy

    Science.gov (United States)

    Hotea, V.; Juhasz, J.; Cadar, F.

    2017-05-01

    This paper aims to bring some clarification on grain refinement and modification of high strength alloys used in aerospace technique. In this work it was taken into account 7075 Al alloy, and the melt treatment was carried out by placing in the form of master alloy wire ternary AlTiB the casting trough at 730°C. The morphology of the resulting microstructures was characterized by optical microscopy. Micrographs unfinished and finished with pre-alloy containing ternary Al5Ti1B evidence fine crystals, crystal containing no columnar structure and highlights the size of the dendrites, and intermetallic phases occurring at grain boundaries in Al-Zn-Mg-Cu alloy. It has been found that these intermetallic compounds are MgZn2 type. AlTiB master alloys finishing ensures a fine eutectic structure, which determines the properties of hardware and improving the mechanical properties of aluminum alloys used in aeronautical engineering.

  9. Two phase titanium aluminide alloy

    Science.gov (United States)

    Deevi, Seetharama C.; Liu, C. T.

    2001-01-01

    A two-phase titanic aluminide alloy having a lamellar microstructure with little intercolony structures. The alloy can include fine particles such as boride particles at colony boundaries and/or grain boundary equiaxed structures. The alloy can include alloying additions such as .ltoreq.10 at % W, Nb and/or Mo. The alloy can be free of Cr, V, Mn, Cu and/or Ni and can include, in atomic %, 45 to 55% Ti, 40 to 50% Al, 1 to 5% Nb, 0.3 to 2% W, up to 1% Mo and 0.1 to 0.3% B. In weight %, the alloy can include 57 to 60% Ti, 30 to 32% Al, 4 to 9% Nb, up to 2% Mo, 2 to 8% W and 0.02 to 0.08% B.

  10. Studies of the AA2519 Alloy Hot Rolling Process and Cladding with EN AW-1050A Alloy

    Directory of Open Access Journals (Sweden)

    Płonka B.

    2016-03-01

    Full Text Available The objective of the study was to determine the feasibility of plastic forming by hot rolling of the AA2519 aluminium alloy sheets and cladding these sheets with a layer of the EN AW-1050A alloy. Numerous hot-rolling tests were carried out on the slab ingots to define the parameters of the AA2519 alloy rolling process. It has been established that rolling of the AA2519 alloy should be carried out in the temperature range of 400-440°C. Depending on the required final thickness of the sheet metal, appropriate thickness of the EN AW-1050A alloy sheet, used as a cladding layer, was selected. As a next step, structure and mechanical properties of the resulting AA2519 alloy sheets clad with EN AW-1050A alloy was examined. The thickness of the coating layer was established at 0,3÷0,5mm. Studies covered alloy grain size and the core alloy-cladding material bond strength.

  11. Investigation of a hot-pressed Nb–Ti–Al alloy: Mechanical alloying, microstructure and mechanical property

    Energy Technology Data Exchange (ETDEWEB)

    Shi, Zhiwu; Wei, Hua; Zhang, Hongyu; Jin, Tao; Sun, Xiaofeng; Zheng, Qi, E-mail: qzheng@imr.ac.cn

    2016-01-10

    The Nb–23Ti–15Al (at%) alloy was prepared by mechanical alloying (MA) and hot-pressing (HPing). The microstructure evolution of powder particles during MA and its influence on the microstructure and mechanical properties of the hot-pressed (HPed) alloy have been investigated. The powder and HPed alloy were characterized via X-ray diffraction (XRD), scanning electron microscopy (SEM) and transmission electron microscopy (TEM). The results indicate that particle size increases in the first stage and then decreases in the second stage during MA; as milling speed increases, mechanically alloyed (MAed) powder with convoluted elemental lamellae, homogeneous Nb solid-solution and an amorphous phase could be obtained respectively in 24 h. Higher homogeneity in microstructure and composition of the MAed powder particles promotes the precipitation of the δ phase and refines the β and Ti(O,C) phases in the HPed alloy. Moreover, due to the phase equilibrium changes caused by Fe and Cr in the amorphous powder, σ phase appears in the alloy as a stable phase instead of the δ phase. Properly MAed powder contributes to higher hardness of the HPed alloy, for reasons of microstructure refinement and sufficient precipitating of strengthening phases.

  12. Investigation of a hot-pressed Nb–Ti–Al alloy: Mechanical alloying, microstructure and mechanical property

    International Nuclear Information System (INIS)

    Shi, Zhiwu; Wei, Hua; Zhang, Hongyu; Jin, Tao; Sun, Xiaofeng; Zheng, Qi

    2016-01-01

    The Nb–23Ti–15Al (at%) alloy was prepared by mechanical alloying (MA) and hot-pressing (HPing). The microstructure evolution of powder particles during MA and its influence on the microstructure and mechanical properties of the hot-pressed (HPed) alloy have been investigated. The powder and HPed alloy were characterized via X-ray diffraction (XRD), scanning electron microscopy (SEM) and transmission electron microscopy (TEM). The results indicate that particle size increases in the first stage and then decreases in the second stage during MA; as milling speed increases, mechanically alloyed (MAed) powder with convoluted elemental lamellae, homogeneous Nb solid-solution and an amorphous phase could be obtained respectively in 24 h. Higher homogeneity in microstructure and composition of the MAed powder particles promotes the precipitation of the δ phase and refines the β and Ti(O,C) phases in the HPed alloy. Moreover, due to the phase equilibrium changes caused by Fe and Cr in the amorphous powder, σ phase appears in the alloy as a stable phase instead of the δ phase. Properly MAed powder contributes to higher hardness of the HPed alloy, for reasons of microstructure refinement and sufficient precipitating of strengthening phases.

  13. A new technique to modify hypereutectic Al-24%Si alloys by a Si-P master alloy

    Energy Technology Data Exchange (ETDEWEB)

    Wu Yaping; Wang Shujun; Li Hui [Key Laboratory of Liquid Structure and Heredity of Materials, Ministry of Education, Shandong University, 73 Jingshi Road, Jinan 250061 (China); Liu Xiangfa [Key Laboratory of Liquid Structure and Heredity of Materials, Ministry of Education, Shandong University, 73 Jingshi Road, Jinan 250061 (China)], E-mail: xfliu@sdu.edu.cn

    2009-05-27

    The modification effect of a Si-P master alloy on Al-24%Si alloy was investigated by using electron probe micro-analyzer (EPMA) and optical microscopy (OM). The dissolution problem of the Si-P master alloys was solved by changing the sequence of addition. When the Si-P master alloy was added into Al melt before the addition of silicon, the best modification effect could be achieved. The modification parameters of the master alloy on Al-24%Si alloy were optimized through designing and analyzing the orthogonal experiment, and their influences on the modification effect were discussed. The results show that the influence of temperature on the modification effect is the greatest, followed by the addition level, and the holding time is the least. The optimized modification parameters are the modification temperature of 810 deg. C, the addition level of 0.35 wt.%, the holding time of 30 min + 50 min whose meaning is that the Si-P master alloy is added firstly to the molten Al, and silicon is added 30 min later, then holding another 50 min. In addition, the modification mechanism of the Si-P master alloy on Al-24%Si alloy was also discussed.

  14. Study on microstructure and properties of Mg-alloy surface alloying layer fabricated by EPC

    Directory of Open Access Journals (Sweden)

    Chen Dongfeng

    2010-02-01

    Full Text Available AZ91D surface alloying was investigated through evaporative pattern casting (EPC technology. Aluminum powder (0.074 to 0.104 mm was used as the alloying element in the experiment. An alloying coating with excellent properties was fabricated, which mainly consisted of adhesive, co-solvent, suspending agent and other ingredients according to desired proportion. Mg-alloy melt was poured under certain temperature and the degree of negative pressure. The microstructure of the surface layer was examined by means of scanning electron microscopy. It has been found that a large volume fraction of network new phases were formed on the Mg-alloy surface, the thickness of the alloying surface layer increased with the alloying coating increasing from 0.3 mm to 0.5 mm, and the microstructure became compact. Energy dispersive X-ray (EDX analysis was used to determine the chemical composition of the new phases. It showed that the new phases mainly consist of β-Mg17Al12, in addition to a small quantity of inter-metallic compounds and oxides. A micro-hardness test and a corrosion experiment to simulate the effect of sea water were performed. The result indicated that the highest micro-hardness of the surface reaches three times that of the matrix. The corrosion rate of alloying samples declines to about a fifth of that of the as-cast AZ91D specimen.

  15. Dispersion strengthening of precipitation hardened Al-Cu-Mg alloys prepared by rapid solidification and mechanical alloying

    Science.gov (United States)

    Gilman, P. S.; Sankaran, K. K.

    1988-01-01

    Several Al-4Cu-1Mg-1.5Fe-0.75Ce alloys have been processed from either rapidly solidified or mechanically alloyed powder using various vacuum degassing parameters and consolidation techniques. Strengthening by the fine subgrains, grains, and the dispersoids individually or in combination is more effective when the alloys contain shearable precipitates; consequently, the strength of the alloys is higher in the naturally aged rather than the artificially aged condition. The strengths of the mechanically alloyed variants are greater than those produced from prealloyed powder. Properties and microstructural features of these dispersion strengthened alloys are discussed in regards to their processing histories.

  16. The Development of the Low-Cost Titanium Alloy Containing Cr and Mn Alloying Elements

    Science.gov (United States)

    Zhu, Kailiang; Gui, Na; Jiang, Tao; Zhu, Ming; Lu, Xionggang; Zhang, Jieyu; Li, Chonghe

    2014-04-01

    The α + β-type Ti-4.5Al-6.9Cr-2.3Mn alloy has been theoretically designed on the basis of assessment of the Ti-Al-Cr-Mn thermodynamic system and the relationship between the molybdenum equivalent and mechanical properties of titanium alloys. The alloy is successfully prepared by the split water-cooled copper crucible, and its microstructures and mechanical properties at room temperature are investigated using the OM, SEM, and the universal testing machine. The results show that the Ti-4.5Al-6.9Cr-2.3Mn alloy is an α + β-type alloy which is consistent with the expectation, and its fracture strength, yield strength, and elongation reach 1191.3, 928.4 MPa, and 10.7 pct, respectively. Although there is no strong segregation of alloying elements under the condition of as-cast, the segregation of Cr and Mn is obvious at the grain boundary after thermomechanical treatment.

  17. Effect of Al alloying on the martensitic temperature in Ti-Ta shape memory alloys

    Energy Technology Data Exchange (ETDEWEB)

    Ferrari, Alberto; Rogal, Jutta; Drautz, Ralf [Interdisciplinary Centre for Advanced Materials Simulation, Ruhr-Universitaet Bochum (Germany)

    2017-07-01

    Ti-Ta-based alloys are promising candidates as high temperature shape memory alloys (HTSMAs) for actuators and superelastic applications. The shape memory mechanism involves a martensitic transformation between the low-temperature α'' phase (orthorhombic) and the high-temperature β phase (body-centered cubic). In order to prevent the degradation of the shape memory effect, Ti-Ta needs to be alloyed with further elements. However, this often reduces the martensitic temperature M{sub s}, which is usually strongly composition dependent. The aim of this work is to analyze how the addition of a third element to Ti-Ta alloys affects M{sub s} by means of electronic structure calculations. In particular, it will be investigated how alloying Al to Ti-Ta alters the relative stability of the α'' and β phases. This understanding will help to identify new alloy compositions featuring both a stable shape memory effect and elevated transformation temperatures.

  18. Density of Liquid Ni-Cr Alloy

    Institute of Scientific and Technical Information of China (English)

    2003-01-01

    The density of liquid Ni-Cr alloy was measured by a modified sessile drop method. The density of liquid Ni-Cr alloywas found to decrease with increasing temperature and Cr concentration in the alloy. The molar volume of liquidNi-Cr alloy increases with increasing the Cr concentration in the alloy. The molar volume of Ni-Cr alloy determinedin the present work shows a positive deviation from the linear molar volume.

  19. Corrosion Behavior and Microhardness of Ni-P-SiO2-Al2O3 Nano-composite Coatings on Magnesium Alloy

    Science.gov (United States)

    Sadreddini, S.; Rahemi Ardakani, S.; Rassaee, H.

    2017-05-01

    In the present work, nano-composites of Ni-P-SiO2-Al2O3 were coated on AZ91HP magnesium alloy. The surface morphology of the nano-composite coating was studied by field emission scanning electron microscopy (FESEM). The amount of SiO2 in the coating was determined by energy-dispersive analysis of x-ray (EDX), and the crystalline structure of the coating was examined by x-ray diffractometer (XRD). All the experiments concerning the corrosion behavior of the coating carried out in 3.5 wt.% NaCl solution and evaluated by electrochemical impedance spectroscopy (EIS) and polarization technique. The results showed that an incorporation of SiO2 and Al2O3 in Ni-P coating at the SiO2 concentration of 10 g/Land 14 g/LAl2O3 led to the lowest corrosion rate ( i corr = 1.3 µA/cm2), the most positive E corr and maximum microhardness (496 VH). Furthermore, Ni-P-SiO2-Al2O3 nano-composite coating possesses less porosity than that in Ni-P coating, resulting in improving corrosion resistance.

  20. Low activation ferritic alloys

    Science.gov (United States)

    Gelles, David S.; Ghoniem, Nasr M.; Powell, Roger W.

    1986-01-01

    Low activation ferritic alloys, specifically bainitic and martensitic stainless steels, are described for use in the production of structural components for nuclear fusion reactors. They are designed specifically to achieve low activation characteristics suitable for efficient waste disposal. The alloys essentially exclude molybdenum, nickel, nitrogen and niobium. Strength is achieved by substituting vanadium, tungsten, and/or tantalum in place of the usual molybdenum content in such alloys.

  1. Impact of the De-Alloying Kinetics and Alloy Microstructure on the Final Morphology of De-Alloyed Meso-Porous Metal Films

    Directory of Open Access Journals (Sweden)

    Bao Lin

    2014-10-01

    Full Text Available Nano-textured porous metal materials present unique surface properties due to their enhanced surface energy with potential applications in sensing, molecular separation and catalysis. In this paper, commercial alloy foils, including brass (Cu85Zn15 and Cu70Zn30 and white gold (Au50Ag50 foils have been chemically de-alloyed to form nano-porous thin films. The impact of the initial alloy micro-structure and number of phases, as well as chemical de-alloying (DA parameters, including etchant concentration, time and solution temperature on the final nano-porous thin film morphology and properties were investigated by electron microscopy (EM. Furthermore, the penetration depth of the pores across the alloys were evaluated through the preparation of cross sections by focus ion beam (FIB milling. It is demonstrated that ordered pores ranging between 100 nm and 600 nm in diameter and 2–5 μm in depth can be successfully formed for the range of materials tested. The microstructure of the foils were obtained by electron back-scattered diffraction (EBSD and linked to development of pits across the material thickness and surface during DA. The role of selective etching of both noble and sacrificial metal phases of the alloy were discussed in light of the competitive surface etching across the range of microstructures and materials tested.

  2. Preparation of Copper and Chromium Alloyed Layers on Pure Titanium by Plasma Surface Alloying Technology

    Science.gov (United States)

    He, Xiaojing; Li, Meng; Wang, Huizhen; Zhang, Xiangyu; Tang, Bin

    2015-05-01

    Cu-Cr alloyed layers with different Cu and Cr contents on pure titanium were obtained by means of plasma surface alloying technology. The microstructure, chemical composition and phase composition of Cu-Cr alloyed layers were analyzed by scanning electron microscopy (SEM), energy dispersive spectrometer (EDS) and X-ray diffraction (XRD), respectively. The experimental results demonstrate that the alloyed layers are bonded strongly to pure titanium substrate and consist of unbound Ti, CuTi, Cu3Ti, CuTi3 and Cr2Ti. The thickness of Cu5Cr5 and Cu7Cr3 alloyed layer are about 18 μm and 28 μm, respectively. The antibacterial properties against gram-negative Escherichia coli (E.coli, ATCC10536) and gram-positive Staphylococcus aureus (S. aureus, ATCC6538) of untreated pure titanium and Cu-Cr alloyed specimen were investigated by live/dead fluorescence staining method. The study shows that Cu-Cr alloyed layers exhibit excellent antibacterial activities against both E.coli and S.aureus within 24 h, which may be attributed to the formation of Cu-containing phases.

  3. Preparation of a high strength Al–Cu–Mg alloy by mechanical alloying and press-forming

    International Nuclear Information System (INIS)

    Tang Huaguo; Cheng Zhiqiang; Liu Jianwei; Ma Xianfeng

    2012-01-01

    Highlights: ► A high strength aluminum alloy of Al–2 wt.%Mg–2 wt.%Cu has been prepared by mechanical alloying and press-forming. ► The alloy only consists of solid solution α-Al. ► The grains size of α-Al was about 300 nm–5 μm. ► The solid solution strengthening and the grain refinement strengthening are the main reasons for such a high strength. - Abstract: A high strength aluminum alloy, with the ratio of 96 wt.%Al–2 wt.%Mg–2 wt.%Cu, has been prepared by mechanical alloying and press-forming. The alloy exhibited a high tensile strength of 780 MPa and a high microhardness of 180 HV. X-ray diffraction characterizations confirmed that the alloy only consists of a solid solution α-Al. Microstructure characterizations revealed that the grain size of α-Al was about 300 nm–5 μm. The solid solution strengthening and the grain refinement strengthening were considered to be the reason for such a high strength.

  4. Preparation of a high strength Al-Cu-Mg alloy by mechanical alloying and press-forming

    Energy Technology Data Exchange (ETDEWEB)

    Tang Huaguo [State Key Laboratory of Rare Earth Utilization, Changchun Institute of Applied Chemistry, Chinese Academy of Sciences, Changchun 130022 (China); Cheng Zhiqiang [College of Resources and Environment, Jilin Agricultural University, Changchun 130118 (China); Liu Jianwei [State Key Laboratory of Rare Earth Utilization, Changchun Institute of Applied Chemistry, Chinese Academy of Sciences, Changchun 130022 (China); Ma Xianfeng, E-mail: xfma@ciac.jl.cn [State Key Laboratory of Rare Earth Utilization, Changchun Institute of Applied Chemistry, Chinese Academy of Sciences, Changchun 130022 (China)

    2012-07-30

    Highlights: Black-Right-Pointing-Pointer A high strength aluminum alloy of Al-2 wt.%Mg-2 wt.%Cu has been prepared by mechanical alloying and press-forming. Black-Right-Pointing-Pointer The alloy only consists of solid solution {alpha}-Al. Black-Right-Pointing-Pointer The grains size of {alpha}-Al was about 300 nm-5 {mu}m. Black-Right-Pointing-Pointer The solid solution strengthening and the grain refinement strengthening are the main reasons for such a high strength. - Abstract: A high strength aluminum alloy, with the ratio of 96 wt.%Al-2 wt.%Mg-2 wt.%Cu, has been prepared by mechanical alloying and press-forming. The alloy exhibited a high tensile strength of 780 MPa and a high microhardness of 180 HV. X-ray diffraction characterizations confirmed that the alloy only consists of a solid solution {alpha}-Al. Microstructure characterizations revealed that the grain size of {alpha}-Al was about 300 nm-5 {mu}m. The solid solution strengthening and the grain refinement strengthening were considered to be the reason for such a high strength.

  5. Nano-structureal and nano-chemical analysis of Ni-based alloy/low alloy steel dissimilar metal weld interfaces

    International Nuclear Information System (INIS)

    Choi, Kyoung Joon; Shin, Sang Hun; Kim, Jong Jin; Jung, Ju Ang; Kim, Ji Hyun

    2012-01-01

    The dissimilar metal joints welded between Ni-based alloy, Alloy 690 and low alloy steel, A533 Gr. B with Alloy 152 filler metal were characterized by using optical microscope, scanning electron microscope, transmission electron microscope, secondary ion mass spectrometry and 3-dimensional atom probe tomography. It was found that in the weld root region, the weld was divided into several regions including unmixed zone in Ni-base alloy, fusion boundary, and heat-affected zone in the low alloy steel. The result of nanostructural and nanochemical analyses in this study showed the non-homogeneous distribution of elements with higher Fe but lower Mn, Ni and Cr in A533 Gr. B compared with Alloy 152, and the precipitation of carbides near the fusion boundary.

  6. Nano-structureal and nano-chemical analysis of Ni-based alloy/low alloy steel dissimilar metal weld interfaces

    Energy Technology Data Exchange (ETDEWEB)

    Choi, Kyoung Joon; Shin, Sang Hun; Kim, Jong Jin; Jung, Ju Ang; Kim, Ji Hyun [Interdisciplinary School of Green Energy, Ulsan National Institute of Science and Technology (UNIST), Ulsan (Korea, Republic of)

    2012-06-15

    The dissimilar metal joints welded between Ni-based alloy, Alloy 690 and low alloy steel, A533 Gr. B with Alloy 152 filler metal were characterized by using optical microscope, scanning electron microscope, transmission electron microscope, secondary ion mass spectrometry and 3-dimensional atom probe tomography. It was found that in the weld root region, the weld was divided into several regions including unmixed zone in Ni-base alloy, fusion boundary, and heat-affected zone in the low alloy steel. The result of nanostructural and nanochemical analyses in this study showed the non-homogeneous distribution of elements with higher Fe but lower Mn, Ni and Cr in A533 Gr. B compared with Alloy 152, and the precipitation of carbides near the fusion boundary.

  7. Superconducting alloys

    International Nuclear Information System (INIS)

    Bowers, J.E.

    1976-01-01

    Reference is made to superconductors having high critical currents. The superconductor described comprises an alloy consisting of a matrix of a Type II superconductor which is a homogeneous mixture of 50 to 95 at.% Pb and 5 to 40 at.%Bi and/or 10 to 50 at.%In. Dispersed in the matrix is a material to provide pinning centres comprising from 0.01% to 20% by volume of the alloy; this material is a stable discontinuous phase of discrete crystalline particles of Cu, Mn, Te, Se, Ni, Ca, Cr, Ce, Ge or La, either in the form of the element or a compound with a component of the matrix. These particles should have an average diameter of not more than 2μ. A method for making this alloy is described. (U.K.)

  8. Imparting passivity to vapor deposited magnesium alloys

    Science.gov (United States)

    Wolfe, Ryan C.

    Magnesium has the lowest density of all structural metals. Utilization of low density materials is advantageous from a design standpoint, because lower weight translates into improved performance of engineered products (i.e., notebook computers are more portable, vehicles achieve better gas mileage, and aircraft can carry more payload). Despite their low density and high strength to weight ratio, however, the widespread implementation of magnesium alloys is currently hindered by their relatively poor corrosion resistance. The objective of this research dissertation is to develop a scientific basis for the creation of a corrosion resistant magnesium alloy. The corrosion resistance of magnesium alloys is affected by several interrelated factors. Among these are alloying, microstructure, impurities, galvanic corrosion effects, and service conditions, among others. Alloying and modification of the microstructure are primary approaches to controlling corrosion. Furthermore, nonequilibrium alloying of magnesium via physical vapor deposition allows for the formation of single-phase magnesium alloys with supersaturated concentrations of passivity-enhancing elements. The microstructure and surface morphology is also modifiable during physical vapor deposition through the variation of evaporation power, pressure, temperature, ion bombardment, and the source-to-substrate distance. Aluminum, titanium, yttrium, and zirconium were initially chosen as candidates likely to impart passivity on vapor deposited magnesium alloys. Prior to this research, alloys of this type have never before been produced, much less studied. All of these metals were observed to afford some degree of corrosion resistance to magnesium. Due to the especially promising results from nonequilibrium alloying of magnesium with yttrium and titanium, the ternary magnesium-yttrium-titanium system was investigated in depth. While all of the alloys are lustrous, surface morphology is observed under the scanning

  9. Strength and fracture of two-phase alloys: a comparison of two alloy systems

    International Nuclear Information System (INIS)

    Gurland, J.

    1978-01-01

    The functional roles of the hard and soft constituents in the deformation and fracture of two-phase alloys are discussed on the basis of two commercially important alloy systems, namely spheroidized carbon steels and cemented carbides, WC-Co. A modified rule of mixtures provides a structural approach to the yield and flow strength. Consideration of the fracture toughness is attempted by means of a phenomenological modelling of the fracture process on the microscale. While there are large differences in properties between the two alloys, the deformation and fracture processes show broad smilarities which are associated with the features of the interaction between constituents common to both alloys

  10. Passive Corrosion Behavior of Alloy 22

    International Nuclear Information System (INIS)

    R.B. Rebak; J.H. Payer

    2006-01-01

    Alloy 22 (NO6022) was designed to stand the most aggressive industrial applications, including both reducing and oxidizing acids. Even in the most aggressive environments, if the temperature is lower than 150 F (66 C) Alloy 22 would remain in the passive state having particularly low corrosion rates. In multi-ionic solutions that may simulate the behavior of concentrated ground water, even at near boiling temperatures, the corrosion rate of Alloy 22 is only a few nano-meters per year because the alloy is in the complete passive state. The corrosion rate of passive Alloy 22 decreases as the time increases. Immersion corrosion testing also show that the newer generation of Ni-Cr-Mo alloys may offer a better corrosion resistance than Alloy 22 only in some highly aggressive conditions such as in hot acids

  11. Corrosion-electrochemical behaviour and mechanical properties ofaluminium alloy-321, alloyed by barium

    International Nuclear Information System (INIS)

    Ganiev, I.; Mukhiddinov, G.N.; Kargapolova, T.V.; Mirsaidov, U.

    1995-01-01

    The purpose of present work is studying of influence of barium additionson electrochemical corrosion of casting aluminium-copper alloy Al-321,containing as base alloying components copper, chromium, manganese, titanium,zirconium, cadmium

  12. Coupling between bulk ordering and surface segregation: from alloy surfaces to surface alloys

    International Nuclear Information System (INIS)

    Gallis, Coralie

    1997-01-01

    -The knowledge of the alloy surfaces is of prime interest to understand their catalytic properties. On the one hand, the determination of the stability of the surface alloys depends very strongly on the behaviours of the A c B 1-c alloy surfaces. On the other hand, the knowledge of the kinetics of the formation-dissolution of surface alloys can allow to understand the equilibrium segregation isotherm. We have then studied the relation between the equilibrium surface segregation in an alloy A c B 1-c and the kinetics of dissolution of a few metallic layers of A/B and the inverse deposit. We have used an energetic model derived from the electronic structure (T.I.B.M.) allowing us to study the surface segregation both in the disordered state and in the ordered one. The kinetics of dissolution were studied using the kinetic version of this model (K.T.I.B.M.) consistent with the equilibrium model. To illustrate our study, we have chosen the Cu-Pd system, a model for the formation of surface alloys and for which a great number of studies, both experimental and theoretical, are in progress. We then have shown for the (111) surface of this system that the surface alloys obtained during the dissolution are related to the alloy surfaces observed for the equilibrium segregation. The Cu-Pd system is characteristic of systems which have a weak segregation energy. Then, we have performed an equivalent study for a system with a strong segregation energy. Our choice was directly put on the Pt-Sn system. The surface behaviour, both in equilibrium and during the kinetics of dissolution, is very different from the Cu-Pd case. In particular, we have found pure 2-D surface alloys. Finally, a quenched molecular dynamics study has allowed us to determine the relative stability of various possible surface superstructures. (author) [fr

  13. ODS Alloys for Nuclear Applications

    International Nuclear Information System (INIS)

    Jang, Jin Sung

    2006-01-01

    ODS (oxide dispersion strengthening) alloy is one of the potential candidate alloys for the cladding or in reactor components of Generation IV reactors and for the structural material even for fusion reactors. It is widely accepted as very resistant material to neutron irradiation as well as strong material at high temperature due to its finely distributed and stable oxide particles. Among Generation IV reactors SFR and SCWR are anticipated in general to run in the temperature range between 300 and 550 .deg. C, and the peak cladding temperature is supposed to reach at about 620 .deg. C during the normal operation. Therefore Zr.base alloys, which have been widely known and adopted for the cladding material due to their excellent neutron economics, are no more adequate at these operating conditions. Fe-base ODS alloys in general has a good high temperature strength at the above high temperature as well as the neutron resistance. In this study a range of commercial grade ODS alloys and their applications are reviewed, including an investigation of the stability of a commercial grade 20% Cr Fe-base ODS alloy(MA956). The alloy was evaluated in terms of the fracture toughness change along with the aging treatment. Also an attempt of the development of 9% Cr Fe-base ODS alloys is introduced

  14. Positrons in amorphous alloys

    International Nuclear Information System (INIS)

    Moser, Pierre.

    1981-07-01

    Positron annihilation techniques give interesting informations about ''empty spaces'' in amorphous alloys. The results of an extensive research work on the properties of either pre-existing or irradiation induced ''empty spaces'' in four amorphous alloys are presented. The pre-existing empty spaces appear to be small vacancy-like defects. The irradiation induced defects are ''close pairs'' with widely distributed configurations. There is a strong interaction between vacancy like and interstitial like components. A model is proposed, which explains the radiation resistance mechanism of the amorphous alloys. An extensive joint research work to study four amorphous alloys, Fe 80 B 20 ,Fe 40 Ni 40 P 14 B 6 , Cu 50 Ti 50 , Pd 80 Si 20 , is summarized

  15. Local atomic order in nanocrystalline Fe-based alloys obtained by mechanical alloying

    International Nuclear Information System (INIS)

    Jartych, E.

    2003-01-01

    Using the 57 Fe Moessbauer spectroscopy, a local atomic order in nanocrystalline alloys of iron with Al, Ni, W and Mo has been determined. Alloys were prepared by mechanical alloying method. Analysis of Moessbauer spectra was performed on the basis of the local environment model in terms of Warren-Cowley parameters. It was shown that impurity atoms are not randomly distributed in the volume of the first and the second co-ordination spheres of 57 Fe nuclei and they form clusters

  16. Environmental fatigue in aluminum-lithium alloys

    Science.gov (United States)

    Piascik, Robert S.

    1992-01-01

    Aluminum-lithium alloys exhibit similar environmental fatigue crack growth characteristics compared to conventional 2000 series alloys and are more resistant to environmental fatigue compared to 7000 series alloys. The superior fatigue crack growth behavior of Al-Li alloys 2090, 2091, 8090, and 8091 is due to crack closure caused by tortuous crack path morphology and crack surface corrosion products. At high R and reduced closure, chemical environment effects are pronounced resulting in accelerated near threshold da/dN. The beneficial effects of crack closure are minimized for small cracks resulting in rapid growth rates. Limited data suggest that the 'chemically small crack' effect, observed in other alloy system, is not pronounced in Al-Li alloys. Modeling of environmental fatigue in Al-Li-Cu alloys related accelerated fatigue crack growth in moist air and salt water to hydrogen embrittlement.

  17. Determination of local constitutive properties of titanium alloy matrix in boron-modified titanium alloys using spherical indentation

    International Nuclear Information System (INIS)

    Sreeranganathan, A.; Gokhale, A.; Tamirisakandala, S.

    2008-01-01

    The constitutive properties of the titanium alloy matrix in boron-modified titanium alloys are different from those of the corresponding unreinforced alloy due to the microstructural changes resulting from the addition of boron. Experimental and finite-element analyses of spherical indentation with a large penetration depth to indenter radius ratio are used to compute the local constitutive properties of the matrix alloy. The results are compared with that of the corresponding alloy without boron, processed in the same manner

  18. The quasicrystalline phase formation in Al-Cu-Cr alloys produced by mechanical alloying

    Energy Technology Data Exchange (ETDEWEB)

    Sviridova, T.A.; Shevchukov, A.P.; Shelekhov, E.V. [National University of Science and Technology ' MISIS' , Moscow 119049 (Russian Federation); Diakonov, D.L. [Bardin Central Research Institute for the Iron and Steel Industry, Moscow 105005 (Russian Federation); Tcherdyntsev, V.V.; Kaloshkin, S.D. [National University of Science and Technology ' MISIS' , Moscow 119049 (Russian Federation)

    2011-06-15

    Research highlights: > Formation of decagonal quasicrystalline phase in Al-Cu-Cr alloys. > Obtained decagonal phase belongs to D{sub 3} family of decagonal quasicrystals. > Decagonal phase has 1.26 nm periodicity along 10-fold axis. > Alloys were produced by combination of mechanical alloying and subsequent annealing. > Phase composition of as-milled powders depending on annealing temperature. - Abstract: Almost single-phase decagonal quasicrystal with periodicity of 1.26 nm along 10-fold axis was produced in Al{sub 69}Cu{sub 21}Cr{sub 10} and Al{sub 72.5}Cu{sub 16.5}Cr{sub 11} alloys using combination of mechanical alloying (MA) and subsequent annealing. Phase transformations of as-milled powders depending on annealing temperature in the range of 200-800 deg. C are examined. Since the transformations can be explained based on kinetic and thermodynamic reasons it seems that applied technique (short preliminary MA followed by the annealing) permits to produce the equilibrium phases rather than metastable ones.

  19. Grain refinement of zinc-aluminium alloys

    International Nuclear Information System (INIS)

    Zaid, A.I.O.

    2006-01-01

    It is now well-established that the structure of the zinc-aluminum die casting alloys can be modified by the binary Al-Ti or the ternary Al-Ti-B master alloys. in this paper, grain refinement of zinc-aluminum alloys by rare earth materials is reviewed and discussed. The importance of grain refining of these alloys and parameters affecting it are presented and discussed. These include parameters related to the Zn-Al alloys cast, parameters related to the grain refining elements or alloys and parameters related to the process. The effect of addition of other alloying elements e.g. Zr either alone or in the presence of the main grain refiners Ti or Ti + B on the grain refining efficiency is also reviewed and discussed. Furthermore, based on the grain refinement and the parameters affecting it, a criterion for selection of the optimum grain refiner is suggested. Finally, the recent research work on the effect of grain refiners on the mechanical behaviour, impact strength, wear resistance, and fatigue life of these alloys are presented and discussed. (author)

  20. Applications of thermodynamic calculations to Mg alloy design: Mg-Sn based alloy development

    International Nuclear Information System (INIS)

    Jung, In-Ho; Park, Woo-Jin; Ahn, Sang Ho; Kang, Dae Hoon; Kim, Nack J.

    2007-01-01

    Recently an Mg-Sn based alloy system has been investigated actively in order to develop new magnesium alloys which have a stable structure and good mechanical properties at high temperatures. Thermodynamic modeling of the Mg-Al-Mn-Sb-Si-Sn-Zn system was performed based on available thermodynamic, phase equilibria and phase diagram data. Using the optimized database, the phase relationships of the Mg-Sn-Al-Zn alloys with additions of Si and Sb were calculated and compared with their experimental microstructures. It is shown that the calculated results are in good agreement with experimental microstructures, which proves the applicability of thermodynamic calculations for new Mg alloy design. All calculations were performed using FactSage thermochemical software. (orig.)

  1. A highly ductile magnesium alloy system

    International Nuclear Information System (INIS)

    Gao, W; Liu, H

    2009-01-01

    Magnesium (Mg) alloys are finding increasing applications in industry mainly due to their high strength-to-weight ratio. However, they have intrinsically poor plastic deformation ability at room temperature. Therefore, the vast majority of Mg alloys are used only in cast state, severely limiting the development of their applications. We have recently discovered a new Mg alloy system that possesses exceptionally high ductility as well as good mechanical strength. The superior plasticity allows this alloy system to be mechanically deformed at room temperature, directly from an as-cast alloy plate, sheet or ingot into working parts. This type of cold mechanical forming properties has never been reported with any other Mg alloy systems.

  2. HAYNES 244 alloy – a new 760 ∘C capable low thermal expansion alloy

    Directory of Open Access Journals (Sweden)

    Fahrmann Michael G.

    2014-01-01

    Full Text Available HAYNES® 244TM alloy is a new 760∘C capable, high strength low thermal expansion (CTE alloy. Its nominal chemical composition in weight percent is Ni – 8 Cr – 22.5 Mo – 6 W. Recently, a first mill-scale heat of 244 alloy was melted by Haynes International, and processed to various product forms such as re-forge billet, plate, and sheet. This paper presents key attributes of this new alloy (CTE, strength, low-cycle fatigue performance, oxidation resistance, thermal stability as they pertain to the intended use in rings and seals of advanced gas turbines.

  3. Aeronautical Industry Requirements for Titanium Alloys

    Science.gov (United States)

    Bran, D. T.; Elefterie, C. F.; Ghiban, B.

    2017-06-01

    The project presents the requirements imposed for aviation components made from Titanium based alloys. A significant portion of the aircraft pylons are manufactured from Titanium alloys. Strength, weight, and reliability are the primary factors to consider in aircraft structures. These factors determine the requirements to be met by any material used to construct or repair the aircraft. Many forces and structural stresses act on an aircraft when it is flying and when it is static and this thesis describes environmental factors, conditions of external aggression, mechanical characteristics and loadings that must be satisfied simultaneously by a Ti-based alloy, compared to other classes of aviation alloys (as egg. Inconel super alloys, Aluminum alloys).For this alloy class, the requirements are regarding strength to weight ratio, reliability, corrosion resistance, thermal expansion and so on. These characteristics additionally continue to provide new opportunities for advanced manufacturing methods.

  4. Controlled Thermal Expansion Alloys

    Data.gov (United States)

    National Aeronautics and Space Administration — There has always been a need for controlled thermal expansion alloys suitable for mounting optics and detectors in spacecraft applications.  These alloys help...

  5. Electrodeposition of Al-Mn alloy on AZ31B magnesium alloy in molten salts

    International Nuclear Information System (INIS)

    Zhang Jifu; Yan Chuanwei; Wang Fuhui

    2009-01-01

    The Al-Mn alloy coatings were electrodeposited on AZ31B Mg alloy in AlCl 3 -NaCl-KCl-MnCl 2 molten salts at 170 deg. C aiming to improve the corrosion resistance. However, in order to prevent AZ31B Mg alloy from corrosion during electrodeposition in molten salts and to ensure excellent adhesion of coatings to the substrate, AZ31B Mg alloy should be pre-plated with a thin zinc layer as intermediate layer. Then the microstructure, composition and phase constituents of the coatings were investigated by scanning electron microscopy (SEM), energy-dispersive X-ray spectrometry (EDX), and X-ray diffraction (XRD). It was indicated that, by adjusting the MnCl 2 content in the molten salts from 0.5 wt% to 2 wt%, the Mn content in the alloy coating was increased and the phase constituents were changed from f.c.c Al-Mn solid solution to amorphous phase. The corrosion resistance of the coatings was evaluated by potentiodynamic polarization measurements in 3.5% NaCl solution. It was confirmed that the Al-Mn alloy coatings exhibited good corrosion resistance with a chear passive region and significantly reduced corrosion current density at anodic potentiodynamic polarization. The corrosion resistance of the alloy coatings was also related with the microstructure and Mn content of the coatings.

  6. Hardening of niobium alloys at precrystallization annealing

    International Nuclear Information System (INIS)

    Vasil'eva, E.V.; Pustovalov, V.A.

    1989-01-01

    Niobium base alloys were investigated. It is shown that precrystallization annealing of niobium-molybdenum, niobium-vanadium and niobium-zirconium alloys elevates much more sufficiently their resistance to microplastic strains, than to macroplastic strains. Hardening effect differs sufficiently for different alloys. The maximal hardening is observed for niobium-vanadium alloys, the minimal one - for niobium-zirconium alloys

  7. Structural thermodynamics of alloys

    CERN Document Server

    Manenc, Jack

    1973-01-01

    Technical progress has for a very long time been directly dependent on progress in metallurgy, which is itself connected with improvements in the technology of alloys. Metals are most frequently used in the form of alloys for several reasons: the quantity of pure metal in its native state in the earth's crust is very limited; pure metals must be extracted from ores which are themselves impure. Finally, the methods of treatment used lead more easily to alloys than to pure metals. The most typical case is that of iron, where a pure ore may be found, but which is the starting point for cast iron or steel, alloys of iron and carbon. In addition, the properties of alloys are in general superior to those of pure metals and modem metallurgy consists of controlling these properties so as to make them conform to the requirements of the design office. Whilst the engineer was formerly compelled to adapt his designs and constructions to the materials available, such as wood, stone, bronze, iron, cast iron and ordinary st...

  8. Alloying element's substitution in titanium alloy with improved oxidation resistance and enhanced magnetic properties

    Energy Technology Data Exchange (ETDEWEB)

    Yu, Ang-Yang, E-mail: ayyu@imr.ac.cn; Wei, Hua; Hu, Qing-Miao; Yang, Rui

    2017-01-15

    First-principles method is used to characterize segregation and magnetic properties of alloyed Ti/TiO{sub 2}interface. We calculate the segregation energy of the doped Ti/TiO{sub 2} interface to investigate alloying atom's distribution. The oxidation resistance of Ti/TiO{sub 2} interface is enhanced by elements Fe and Ni but reduced by element Co. Magnetism could be produced by alloying elements such as Co, Fe and Ni in the bulk of titanium and the surface of Ti at Ti/TiO{sub 2} interface. The presence of these alloying elements could transform the non-magnetic titanium alloys into magnetic systems. We have also calculated the temperature dependence of magnetic permeability for the doped and pure Ti/TiO{sub 2} interfaces. Alloying effects on the Curie temperature of the Ti/TiO{sub 2} interface have been elaborated. - Highlights: • We consider the segregation of alloying atoms on the Ti(101¯0)/TiO{sub 2}(100) interface. • Alloying the Ti//TiO{sub 2} interface with Fe and Ni has a great advantage of improving the oxidation resistance. • Fe, Co and Nican enhance the magnetic properties of the investigated system. • The variation of permeability with temperature has been presented.

  9. Swelling in neutron-irradiated titanium alloys

    International Nuclear Information System (INIS)

    Peterson, D.T.

    1982-04-01

    Immersion density measurements have been performed on a series of titanium alloys irradiated in EBR-II to a fluence of 5 x 10 22 n/cm 2 (E > 0.1 MeV) at 450 and 550 0 C. The materials irradiated were the near-alpha alloys Ti-6242S and Ti-5621S, the alpha-beta alloy Ti-64, and the beta alloy Ti-38644. Swelling was observed in all alloys with the greater swelling being observed at 550 0 C. Microstructural examination revealed the presence of voids in all alloys. Ti-38644 was found to be the most radiation resistant. Ti-6242S and Ti-5621S also displayed good radiation resistance, whereas considerable swelling and precipitation were observed in Ti-64 at 550 0 C

  10. Oxidation Behavior of TiAl-Based Alloy Modified by Double-Glow Plasma Surface Alloying with Cr-Mo

    Science.gov (United States)

    Wei, Xiangfei; Zhang, Pingze; Wang, Qiong; Wei, Dongbo; Chen, Xiaohu

    2017-07-01

    A Cr-Mo alloyed layer was prepared on a TiAl-based alloy using plasma surface alloying technique. The isothermal oxidation kinetics of the untreated and treated samples was examined at 850 °C. The microstructure and phase composition of the alloyed layer were analyzed by scanning electron microscope (SEM), energy dispersive spectrometer (EDS) and X-ray powder diffraction (XRD). The morphology and constituent of the oxide scales were also analyzed. The results indicated that the oxidation resistance of TiAl was improved significantly after the alloying treatment. The oxide scale eventually became a mixture of Al2O3, Cr2O3 and TiO2. The oxide scale was dense and integrated throughout the oxidation process. The improvement was mainly owing to the enhancing of scale adhesion and the preferential oxidation of aluminum brought by the alloying effect for TiAl-based alloy.

  11. Noble metal alloys for metal-ceramic restorations.

    Science.gov (United States)

    Anusavice, K J

    1985-10-01

    A review of the comparative characteristics and properties of noble metal alloys used for metal-ceramic restorations has been presented. Selection of an alloy for one's practice should be based on long-term clinical data, physical properties, esthetic potential, and laboratory data on metal-ceramic bond strength and thermal compatibility with commercial dental porcelains. Although gold-based alloys, such as the Au-Pt-Pd, Au-Pd-Ag, and Au-Pd classes, may appear to be costly compared with the palladium-based alloys, they have clearly established their clinical integrity and acceptability over an extended period of time. Other than the relatively low sag resistance of the high gold-low silver content alloys and the potential thermal incompatibility with some commercial porcelain products, few clinical failures have been observed. The palladium-based alloys are less costly than the gold-based alloys. Palladium-silver alloys require extra precautions to minimize porcelain discoloration. Palladium-copper and palladium-cobalt alloys may also cause porcelain discoloration, as copper and cobalt are used as colorants in glasses. The palladium-cobalt alloys are least susceptible to high-temperature creep compared with all classes of noble metals. Nevertheless, insufficient clinical data exist to advocate the general use of the palladium-copper and palladium-cobalt alloys at the present time. One should base the selection and use of these alloys in part on their ability to meet the requirements of the ADA Acceptance Program. A list of acceptable or provisionally acceptable alloys is available from the American Dental Association and is published annually in the Journal of the American Dental Association. Dentists have the legal and ethical responsibility for selection of alloys used for cast restorations. This responsibility should not be delegated to the dental laboratory technician. It is advisable to discuss the criteria for selection of an alloy with the technician and the

  12. Electroplating technologies of alloys

    International Nuclear Information System (INIS)

    Kim, Joung Soo; Kim, Seung Ho; Jeong, Hyun Kyu; Hwnag, Sung Sik; Seo, Yong Chil; Kim, Dong Jin; Seo, Moo Hong

    2001-12-01

    In localization of electrosleeving technique, there are some problems like the following articles. Firstly, Patents published by OHT have claimed Ni-P, Ni-B alloy plating and Mo, Mn Cr, W, Co as a pinning agent. Secondly, alloy platings have many restrictions. There are some method to get alloy plating in spite of the various restrictions. If current density increase above limiting current density in one of the metals, both of the metals discharge at the same time. The addition of surface active agent(sufactant) in the plating solution is one of the methods to get alloy plating. Alloy plating using pulse current easily controls chemical composition and structure of deposit. Ni-Fe alloy plating is known to exhibit anomalous type of plating behavior in which deposition of the less noble metal is favoured. Presence of hypophohphite ion can control the iron codeposition by changing the deposition mechanism. Hypophohphite suppresses the deposition of Fe and also promotes Ni. Composite plating will be considered to improve the strength at the high temperature. Addition of particle size of 10δ400μm makes residual stress compressive in plate layer and suppress the grain growth rate at the high temperature. Addition of particle makes suface roughness high and fracture stress low at high temperature. But, selection of the kinds of particle and control of additives amount overcome the problems above

  13. Processing and properties of Nb-Ti-based alloys

    International Nuclear Information System (INIS)

    Sikka, V.K.; Viswanathan, S.

    1992-01-01

    The processing characteristics, tensile properties, and oxidation response of two Nb-Ti-Al-Cr alloys were investigated. One creep test at 650 C and 172 MPa was conducted on the base alloy which contained 40Nb-40Ti-10Al-10Cr. A second alloy was modified with 0.11 at. % carbon and 0.07 at. % yttrium. Alloys were arc melted in a chamber backfilled with argon, drop cast into a water-cooled copper mold, and cold rolled to obtain a 0.8-mm sheet. The sheet was annealed at 1,100 C for 0.5 h. Longitudinal tensile specimens and oxidation specimens were obtained for both the base alloy and the modified alloy. Tensile properties were obtained for the base alloy at room temperature, 400, 600, 700, 800, 900, and 1,000 C, and for the modified alloy at room temperature, 400, 600, 700, and 800 C. Oxidation tests on the base alloy and modified alloy, as measured by weight change, were carried out at 600, 700, 800, and 900 C. Both the base alloy and the modified alloy were extremely ductile and were cold rolled to the final sheet thickness of 0.8 mm without an intermediate anneal. The modified alloy exhibited some edge cracking during cold during cold rolling. Both alloys recrystallized at the end of a 0.5-h annealing treatment. The alloys exhibited moderate strength and oxidation resistance below 600 C, similar to the results of alloys reported in the literature

  14. Aeronautical requirements for Inconel 718 alloy

    Science.gov (United States)

    Elefterie, C. F.; Guragata, C.; Bran, D.; Ghiban, B.

    2017-06-01

    The project goal is to present the requirements imposed by aviation components made from super alloys based on Nickel. A significant portion of fasteners, locking lugs, blade retainers and inserts are manufactured from Alloy 718. The thesis describes environmental factors (corrosion), conditions of external aggression (salt air, intense heat, heavy industrial pollution, high condensation, high pressure), mechanical characteristics (tensile strength, yield strength and fatigue resistance) and loadings (tensions, compression loads) that must be satisfied simultaneously by Ni-based super alloy, compared to other classes of aviation alloys (as egg. Titanium alloys, Aluminum alloys). For this alloy the requirements are strength durability, damage tolerance, fail safety and so on. The corrosion can be an issue, but the fatigue under high-magnitude cyclic tensile loading it’s what limits the lifetime of the airframe. Also, the excellent malleability and weldability characteristics of the 718 system make the material physical properties tolerant of manufacturing processes. These characteristics additionally continue to provide new opportunities for advanced manufacturing methods.

  15. Recent advances in alloy design of Ni{sub 3}Al alloys for structural use

    Energy Technology Data Exchange (ETDEWEB)

    Liu, C.T.; George, E.P.

    1996-12-31

    This is a comprehensive review of recent advances in R&D of Ni{sub 3}Al-based alloys for structural use at elevated temperatures in hostile environments. Recent studies indicate that polycrystalline Ni{sub 3}Al is intrinsically quite ductile at ambient temperatures, and its poor tensile ductility and brittle grain-boundary fracture are caused mainly by moisture-induced hydrogen embrittlement when the aluminide is tested in moisture- or hydrogen-containing environments. Tensile ductility is improved by alloying with substitutional and interstitial elements. Among these additives, B is most effective in suppressing environmental embrittlement and enhancing grain-boundary cohesion, resulting in a dramatic increase of tensile ductility at room temperature. Both B-doped and B-free Ni{sub 3}Al alloys exhibit brittle intergranular fracture and low ductility at intermediate temperatures (300-850 C) because of oxygen-induced embrittlement in oxidizing environments. Cr is found to be most effective in alleviating elevated-temperature embrittlement. Parallel efforts on alloy development using physical metallurgy principles have led to development of several Ni{sub 3}Al alloys for industrial use. The unique properties of these alloys are briefly discussed. 56 refs, 15 figs, 3 tabs.

  16. Thermal Plasma Spheroidization of High-Nitrogen Stainless Steel Powder Alloys Synthesized by Mechanical Alloying

    Science.gov (United States)

    Razumov, Nikolay G.; Popovich, Anatoly A.; Wang, QingSheng

    2018-03-01

    This paper presents the results of experimental studies on the treatment of Fe-23Cr-11Mn-1N high-nitrogen stainless steel powder alloys, synthesized by the mechanical alloying (MA) of elemental powders in the flow of a thermal plasma. Fe-23Cr-11Mn-1N high-nitrogen stainless steel powder alloys were prepared by MA in the attritor under an argon atmosphere. For spheroidization of Fe-23Cr-11Mn-1N high-nitrogen stainless steel powder alloys, the TekSphero 15 plant manufactured by Tekna Plasma Systems Inc was used. The studies have shown the possibility of obtaining Fe-23Cr-11Mn-1N high-nitrogen spherical powders steel alloys from the powder obtained by MA. According to the results of a series of experiments, it was found that the results of plasma spheroidization of powders essentially depend on the size of the fraction due to some difference in the particle shape and flowability, and on the gas regime of the plasma torch. It is established that during the plasma spheroidization process, some of the nitrogen leaves the alloy. The loss rate of nitrogen depends on the size of the initial particles.

  17. Microstructural characterization of mechanically alloyed Al–Cu–Mn alloy with zirconium

    Energy Technology Data Exchange (ETDEWEB)

    Prosviryakov, A.S., E-mail: pro.alex@mail.ru; Shcherbachev, K.D.; Tabachkova, N.Yu.

    2015-01-19

    An evolution of Al–Cu–Mn alloy microstructure during its mechanical alloying with zirconium 20 wt% and after subsequent annealing was studied by X-ray diffraction, light microscopy and transmission electron microscopy. The effect of milling time on powder microhardness, Al lattice parameter, lattice microstrain and crystallite size was determined.

  18. Antibacterial biodegradable Mg-Ag alloys

    Directory of Open Access Journals (Sweden)

    D Tie

    2013-06-01

    Full Text Available The use of magnesium alloys as degradable metals for biomedical applications is a topic of ongoing research and the demand for multifunctional materials is increasing. Hence, binary Mg-Ag alloys were designed as implant materials to combine the favourable properties of magnesium with the well-known antibacterial property of silver. In this study, three Mg-Ag alloys, Mg2Ag, Mg4Ag and Mg6Ag that contain 1.87 %, 3.82 % and 6.00 % silver by weight, respectively, were cast and processed with solution (T4 and aging (T6 heat treatment.The metallurgical analysis and phase identification showed that all alloys contained Mg4Ag as the dominant β phase. After heat treatment, the mechanical properties of all Mg-Ag alloys were significantly improved and the corrosion rate was also significantly reduced, due to presence of silver. Mg(OH2 and MgO present the main magnesium corrosion products, while AgCl was found as the corresponding primary silver corrosion product. Immersion tests, under cell culture conditions, demonstrated that the silver content did not significantly shift the pH and magnesium ion release. In vitro tests, with both primary osteoblasts and cell lines (MG63, RAW 264.7, revealed that Mg-Ag alloys show negligible cytotoxicity and sound cytocompatibility. Antibacterial assays, performed in a dynamic bioreactor system, proved that the alloys reduce the viability of two common pathogenic bacteria, Staphylococcus aureus (DSMZ 20231 and Staphylococcus epidermidis (DSMZ 3269, and the results showed that the killing rate of the alloys against tested bacteria exceeded 90%. In summary, biodegradable Mg-Ag alloys are cytocompatible materials with adjustable mechanical and corrosion properties and show promising antibacterial activity, which indicates their potential as antibacterial biodegradable implant materials.

  19. Reaction kinetics of oxygen on single-phase alloys, oxidation of nickel and niobium alloys

    International Nuclear Information System (INIS)

    Lalauze, Rene

    1973-01-01

    This research thesis first addresses the reaction kinetics of oxygen on alloys. It presents some generalities on heterogeneous reactions (conventional theory, theory of jumps), discusses the core reaction (with the influence of pressure), discusses the influence of metal self-diffusion on metal oxidation kinetics (equilibrium conditions at the interface, hybrid diffusion regime), reports the application of the hybrid diffusion model to the study of selective oxidation of alloys (Wagner model, hybrid diffusion model) and the study of the oxidation kinetics of an alloy forming a solid solution of two oxides. The second part reports the investigation of the oxidation of single phase nickel and niobium alloys (phase α, β and γ)

  20. A study of the formation of Cr-surface alloyed layer on structural alloy steel by Co2 laser

    International Nuclear Information System (INIS)

    Kim, T.H.; Han, W.S.

    1986-01-01

    In order to improve wear and erosion-resistances of a structural alloy steel (SNCM 8) during heat-cycling, chromium-alloyed layers were produced on the surface by irradiating Co 2 laser. Specimens were prepared either by electroplating of hard-chromium or coating of chromium powders on the steel followed by the laser treatment. Index values, which related the depth and the width of the alloyed layers to the scanning speed of laser, for both samples are experimentally measured. At a fixed scanning speed, while both samples resulted in a similar depth of the alloyed layers, the chromium powder coated specimen showed larger width of the alloyed layer than the chromium electroplated one. The hardness values of the alloyed layers in both samples were slightly lower than that of the martensitic region beneath the alloyed layers. But they are considerably higher than those of steel matrices. Regardless of the prior treatments before laser irradiation, distributions of chromium were fairly uniform throughout the alloyed layers. (Author)

  1. Precipitation and Hardening in Magnesium Alloys

    Science.gov (United States)

    Nie, Jian-Feng

    2012-11-01

    Magnesium alloys have received an increasing interest in the past 12 years for potential applications in the automotive, aircraft, aerospace, and electronic industries. Many of these alloys are strong because of solid-state precipitates that are produced by an age-hardening process. Although some strength improvements of existing magnesium alloys have been made and some novel alloys with improved strength have been developed, the strength level that has been achieved so far is still substantially lower than that obtained in counterpart aluminum alloys. Further improvements in the alloy strength require a better understanding of the structure, morphology, orientation of precipitates, effects of precipitate morphology, and orientation on the strengthening and microstructural factors that are important in controlling the nucleation and growth of these precipitates. In this review, precipitation in most precipitation-hardenable magnesium alloys is reviewed, and its relationship with strengthening is examined. It is demonstrated that the precipitation phenomena in these alloys, especially in the very early stage of the precipitation process, are still far from being well understood, and many fundamental issues remain unsolved even after some extensive and concerted efforts made in the past 12 years. The challenges associated with precipitation hardening and age hardening are identified and discussed, and guidelines are outlined for the rational design and development of higher strength, and ultimately ultrahigh strength, magnesium alloys via precipitation hardening.

  2. Effect of Microstructure and Alloy Chemistry on Hydrogen Embrittlement of Precipitation-Hardened Ni-Based Alloys

    Science.gov (United States)

    Obasi, G. C.; Zhang, Z.; Sampath, D.; Morana, Roberto; Akid, R.; Preuss, M.

    2018-04-01

    The sensitivity to hydrogen embrittlement (HE) has been studied in respect of precipitation size distributions in two nickel-based superalloys: Alloy 718 (UNS N07718) and Alloy 945X (UNS N09946). Quantitative microstructure analysis was carried out by the combination of scanning and transmission electron microscopy and energy dispersive x-ray spectroscopy (EDS). While Alloy 718 is mainly strengthened by γ″, and therefore readily forms intergranular δ phase, Alloy 945X has been designed to avoid δ formation by reducing Nb levels providing high strength through a combination of γ' and γ″. Slow strain rate tensile tests were carried out for different microstructural conditions in air and after cathodic hydrogen (H) charging. HE sensitivity was determined based on loss of elongation due to the H uptake in comparison to elongation to failure in air. Results showed that both alloys exhibited an elevated sensitivity to HE. Fracture surfaces of the H precharged material showed quasi-cleavage and transgranular cracks in the H-affected region, while ductile failure was observed toward the center of the sample. The crack origins observed on the H precharged samples exhibited quasi-cleavage with slip traces at high magnification. The sensitivity is slightly reduced for Alloy 718, by coarsening γ″ and reducing the overall strength of the alloy. However, on further coarsening of γ″, which promotes continuous decoration of grain boundaries with δ phase, the embrittlement index rose again indicating a change of hydrogen embrittlement mechanism from hydrogen-enhanced local plasticity (HELP) to hydrogen-enhanced decohesion embrittlement (HEDE). In contrast, Alloy 945X displayed a strong correlation between strength, based on precipitation size and embrittlement index, due to the absence of any significant formation of δ phase for the investigated microstructures. For the given test parameters, Alloy 945X did not display any reduced sensitivity to HE compared with

  3. Stress Corrosion Cracking of Certain Aluminum Alloys

    Science.gov (United States)

    Hasse, K. R.; Dorward, R. C.

    1983-01-01

    SC resistance of new high-strength alloys tested. Research report describes progress in continuing investigation of stress corrosion (SC) cracking of some aluminum alloys. Objective of program is comparing SC behavior of newer high-strength alloys with established SC-resistant alloy.

  4. Nickel base alloys

    International Nuclear Information System (INIS)

    Gibson, R.C.; Korenko, M.K.

    1980-01-01

    Nickel based alloy, the characteristic of which is that it mainly includes in percentages by weight: 57-63 Ni, 7-18 Cr, 10-20 Fe, 4-6 Mo, 1-2 Nb, 0.2-0.8 Si, 0.01-0.05 Zr, 1.0-2.5 Ti, 1.0-2.5 Al, 0.02-0.06 C and 0.002-0.015 B. The aim is to create new nickel-chromium alloys, hardened in a solid solution and by precipitation, that are stable, exhibit reduced swelling and resistant to plastic deformation inside the reactor. These alloys of the gamma prime type have improved mechanical strengthm swelling resistance, structural stability and welding properties compared with Inconel 625 [fr

  5. Alloys under irradiation

    International Nuclear Information System (INIS)

    Martin, G.; Bellon, P.; Soisson, F.

    1997-01-01

    During the last two decades, some effort has been devoted to establishing a phenomenology for alloys under irradiation. Theoretically, the effects of the defect supersaturation, sustained defect fluxes and ballistic mixing on solid solubility under irradiation can now be formulated in a unified manner, at least for the most simple cases: coherent phase transformations and nearest-neighbor ballistic jumps. Even under such restrictive conditions, several intriguing features documented experimentally can be rationalized, sometimes in a quantitative manner and simple qualitative rules for alloy stability as a function of irradiation conditions can be formulated. A quasi-thermodynamic formalism can be proposed for alloys under irradiation. However, this point of view has limits illustrated by recent computer simulations. (orig.)

  6. Influence of alloying elements and density on aqueous corrosion behaviour of some sintered low alloy steels

    International Nuclear Information System (INIS)

    Kandavel, T.K.; Chandramouli, R.; Karthikeyan, P.

    2012-01-01

    Highlights: ► Corrosion of low alloy P/M steels under HCl acid pickling environment has been studied. ► Influence of density, strain and alloying elements on the rate of corrosion of the steels has been investigated. ► Residual porosity has significant effect on acid corrosion. ► Addition of the alloying elements Cu, Mo and Ti reduces the corrosion rate significantly. ► Carbide forming elements Mo and Ti improve further the resistance of the steels to aqueous corrosion. -- Abstract: Low alloy steels produced through powder metallurgy route of sintering followed by forging are promising candidate materials for high strength small components. Porosity in such steels poses a real challenge during acid pickling treatment, which is one of the processing steps during manufacturing. The present research work attempts to investigate the mechanism underlying the acid corrosion behaviour of some sintered low alloy steels under induced acid pickling conditions. Sintered-forged low alloy steel samples containing molybdenum (Mo), copper (Cu) and titanium (Ti) were subjected to aqueous corrosion attack by immersing the samples in 18% HCl (Hydrochloric acid) solution for 25 h. Sample weight loss and Fe (Iron) loss were estimated for the corroded samples. The morphology of the corroded surfaces was studied through metallography and scanning electron microscopy. Higher porosity alloys underwent enhanced corrosion rates. Both corrosion rate and iron loss are found to decrease linearly with reduction in porosity in all cases of the alloys. The alloying elements Mo, Ti and Cu, when added in combination, have played a complementary role in the reduction of corrosion rate by almost one order of magnitude compared to unalloyed steel. Presence of carbides of the carbide forming elements Mo and Ti played a positive role on the corrosion behaviour of the low alloy steels.

  7. Investigating aluminum alloy reinforced by graphene nanoflakes

    Energy Technology Data Exchange (ETDEWEB)

    Yan, S.J., E-mail: shaojiuyan@126.com [Beijing Institute of Aeronautical Materials, Beijing 100095 (China); Dai, S.L.; Zhang, X.Y.; Yang, C.; Hong, Q.H.; Chen, J.Z. [Beijing Institute of Aeronautical Materials, Beijing 100095 (China); Lin, Z.M. [Aviation Industry Corporation of China, Beijing 100022 (China)

    2014-08-26

    As one of the most important engineering materials, aluminum alloys have been widely applied in many fields. However, the requirement of enhancing their mechanical properties without sacrificing the ductility is always a challenge in the development of aluminum alloys. Thanks to the excellent physical and mechanical properties, graphene nanoflakes (GNFs) have been applied as promising reinforcing elements in various engineering materials, including polymers and ceramics. However, the investigation of GNFs as reinforcement phase in metals or alloys, especially in aluminum alloys, is still very limited. In this study, the aluminum alloy reinforced by GNFs was successfully prepared via powder metallurgy approach. The GNFs were mixed with aluminum alloy powders through ball milling and followed by hot isostatic pressing. The green body was then hot extruded to obtain the final GNFs reinforced aluminum alloy nanocomposite. The scanning electron microscopy and transmission electron microscope analysis show that GNFs were well dispersed in the aluminum alloy matrix and no chemical reactions were observed at the interfaces between the GNFs and aluminum alloy matrix. The mechanical properties' testing results show that with increasing filling content of GNFs, both tensile and yield strengths were remarkably increased without losing the ductility performance. These results not only provided a pathway to achieve the goal of preparing high strength aluminum alloys with excellent ductilitybut they also shed light on the development of other metal alloys reinforced by GNFs.

  8. Synthesis of Nb-18%Al alloy by mechanical alloying method

    International Nuclear Information System (INIS)

    Dymek, S.; Wrobel, M.; Dollar, M.

    1999-01-01

    The main goal of this study was attempt to employ by mechanical alloying to produce Nb-Al alloy. The Nb-rich alloy composition was selected in order to receive the ductile niobium solid solution (Nb ss ) phase in the final, equilibrium state. This ductile phase was believed to prevent crack propagation in the consolidated alloy and thus to improve its ductility and toughness. Elemental powders of niobium (99.8% pure and -325 mesh) and aluminium (99.9% pure and -325 mesh) were used as starting materials. These powders were mixed to give the nominal compositions od 82% Nb and 18% Al (atomic percent). Mechanical alloying was carried out in a Szegvari laboratory attritor mill in an argon atmosphere with the controlled oxygen level reduced to less than 10 ppm. The total milling time was 86 hours. During the course of milling powder samples were taken out after 5, 10 and 20 hours, which allowed characterization of the powder morphology and progress of the mechanical alloying process. The changes in particle morphology during milling were examined using a scanning electron microscope and the phase analysis was performed in a X-ray diffractometer with CoK α radiation. Initially, particles' size increased and their appearance changed from the regular to one of the flaky shape. X-ray diffraction patterns of examined powders as a function of milling time are presented. Peaks from Al, through much weaker than in the starting material, were still present after 5 hours of milling but disappeared completely after 10 hours of milling. With increasing milling time, the peaks became broader and their intensities decreased. Formation of amorphous phase was observed after 86 hours of milling. This was deducted from a diffuse halo observed at the 2Θ angle of about 27 o . Intermetallic phases Nb 3 Al and Nb 2 Al were found in the consolidated material only. (author)

  9. Electron microscopy study of hardened layers structure at electrospark alloying the VT-18 titanium alloy with aluminium

    International Nuclear Information System (INIS)

    Pilyankevich, A.N.; Martynenko, A.N.; Verkhoturov, A.D.; Paderno, V.N.

    1979-01-01

    Presented are the results of metallographic, electron-microscopic, and X-ray structure analysis, of microhardness measurements and of the study of the electrode weight changes at electrospark alloying the VT-18 titanium alloy with aluminium. It is shown, that pulsating thermal and mechanical loadings in the process of electrospark alloying result in the electrode surface electroerosion, a discrete relief is being formed, which changes constantly in the process depending on the alloying time. Though with the process time the cathode weight gain increases, microareas of fracture in the hardened layer appear already at the initial stages of electrospark alloying

  10. Development and evaluation of a magnesium–zinc–strontium alloy for biomedical applications — Alloy processing, microstructure, mechanical properties, and biodegradation

    International Nuclear Information System (INIS)

    Guan, Ren-guo; Cipriano, Aaron F.; Zhao, Zhan-yong; Lock, Jaclyn; Tie, Di; Zhao, Tong; Cui, Tong; Liu, Huinan

    2013-01-01

    A new biodegradable magnesium–zinc–strontium (Mg–Zn–Sr) alloy was developed and studied for medical implant applications. This first study investigated the alloy processing (casting, rolling, and heat treatment), microstructures, mechanical properties, and degradation properties in simulated body fluid (SBF). Aging treatment of the ZSr41 alloy at 175 °C for 8 h improved the mechanical properties when compared to those of the as-cast alloy. Specifically, the aged ZSr41 alloy had an ultimate tensile strength of 270 MPa, Vickers hardness of 71.5 HV, and elongation at failure of 12.8%. The mechanical properties of the ZSr41 alloy were superior as compared with those of pure magnesium and met the requirements for load-bearing medical implants. Furthermore, the immersion of the ZSr41 alloy in SBF showed a degradation mode that progressed cyclically, alternating between pitting and localized corrosion. The steady-state average degradation rate of the aged ZSr41 alloy in SBF was 0.96 g/(m 2 ·hr), while the pH of SBF immersion solution increased. The corrosion current density of the ZSr41 alloy in SBF solution was 0.41 mA/mm 2 , which was much lower than 1.67 mA/mm 2 for pure Mg under the same conditions. In summary, compared to pure Mg, the mechanical properties of the new ZSr41 alloy improved while the degradation rate decreased due to the addition of Zn and Sr alloying elements and specific processing conditions. The superior mechanical properties and corrosion resistance of the new ZSr41 alloy make it a promising alloy for next-generation implant applications. - Highlights: • Developed a new biodegradable magnesium–zinc–strontium (Mg–Zn–Sr) alloy for medical implant applications • Reported Mg–Zn–Sr alloy processing and microstructure characterization • Improved mechanical properties of Mg alloy after aging treatment • Improved degradation properties of Mg alloy in simulated body fluid

  11. Influence of impurities and ion surface alloying on the corrosion resistance of E110 alloy

    International Nuclear Information System (INIS)

    Kalin, B. A.; Volkov, N. V.; Valikov, R. A.; Novikov, V. V.; Markelov, V. A.; Pimenov, Yu. V.

    2013-01-01

    The corrosion resistance of zirconium alloys depends on their structural-phase state, the type of core coolant and operating factors. The formation of a protective oxide film on the zirconium alloys is sensitive to the content of impurity atoms present in the charge base of alloys and accumulating in them in the manufacture of products. The impurity composition of the initial zirconium is determined by the method of its manufacture and generally remains unchanged in the products, deter-mining their properties, including their corrosion resistance. An increased content of impurities (C, N, Al, Mo, Fe) both individually and in their combination negatively affects the corrosion resistance of zirconium and its alloys. One of the potentially effective methods to increase the protective properties of oxide films on zirconium alloys is a surface alloying using the regime of mixing the atoms of a film, preliminarily coated on the surface, and the atoms of a target. This method makes it possible to form a given structural-phase state in the thin surface layer with unique physicochemical properties and thus to in-crease the corrosion resistance and wear resistance of fuel claddings. In this context, the object of investigation was samples of cladding tubes from alloy E110 with various content of impurity elements (nitrogen, aluminum, and carbon) with the aim to reduce the negative influence of impurities on the corrosion resistance by changing the structural-phase state of the surface layer of fuel claddings and fuel assembly components with alloying in the regime of ion mixing of atoms

  12. Development and evaluation of a magnesium-zinc-strontium alloy for biomedical applications--alloy processing, microstructure, mechanical properties, and biodegradation.

    Science.gov (United States)

    Guan, Ren-guo; Cipriano, Aaron F; Zhao, Zhan-yong; Lock, Jaclyn; Tie, Di; Zhao, Tong; Cui, Tong; Liu, Huinan

    2013-10-01

    A new biodegradable magnesium-zinc-strontium (Mg-Zn-Sr) alloy was developed and studied for medical implant applications. This first study investigated the alloy processing (casting, rolling, and heat treatment), microstructures, mechanical properties, and degradation properties in simulated body fluid (SBF). Aging treatment of the ZSr41 alloy at 175 °C for 8h improved the mechanical properties when compared to those of the as-cast alloy. Specifically, the aged ZSr41 alloy had an ultimate tensile strength of 270 MPa, Vickers hardness of 71.5 HV, and elongation at failure of 12.8%. The mechanical properties of the ZSr41 alloy were superior as compared with those of pure magnesium and met the requirements for load-bearing medical implants. Furthermore, the immersion of the ZSr41 alloy in SBF showed a degradation mode that progressed cyclically, alternating between pitting and localized corrosion. The steady-state average degradation rate of the aged ZSr41 alloy in SBF was 0.96 g/(m(2)·hr), while the pH of SBF immersion solution increased. The corrosion current density of the ZSr41 alloy in SBF solution was 0.41 mA/mm(2), which was much lower than 1.67 mA/mm(2) for pure Mg under the same conditions. In summary, compared to pure Mg, the mechanical properties of the new ZSr41 alloy improved while the degradation rate decreased due to the addition of Zn and Sr alloying elements and specific processing conditions. The superior mechanical properties and corrosion resistance of the new ZSr41 alloy make it a promising alloy for next-generation implant applications. Copyright © 2013 Elsevier B.V. All rights reserved.

  13. Effects of Alloying Elements on Room and High Temperature Tensile Properties of Al-Si Cu-Mg Base Alloys =

    Science.gov (United States)

    Alyaldin, Loay

    In recent years, aluminum and aluminum alloys have been widely used in automotive and aerospace industries. Among the most commonly used cast aluminum alloys are those belonging to the Al-Si system. Due to their mechanical properties, light weight, excellent castability and corrosion resistance, these alloys are primarily used in engineering and in automotive applications. The more aluminum is used in the production of a vehicle, the less the weight of the vehicle, and the less fuel it consumes, thereby reducing the amount of harmful emissions into the atmosphere. The principal alloying elements in Al-Si alloys, in addition to silicon, are magnesium and copper which, through the formation of Al2Cu and Mg2Si precipitates, improve the alloy strength via precipitation hardening following heat treatment. However, most Al-Si alloys are not suitable for high temperature applications because their tensile and fatigue strengths are not as high as desired in the temperature range 230-350°C, which are the temperatures that are often attained in automotive engine components under actual service conditions. The main challenge lies in the fact that the strength of heat-treatable cast aluminum alloys decreases at temperatures above 200°C. The strength of alloys under high temperature conditions is improved by obtaining a microstructure containing thermally stable and coarsening-resistant intermetallics, which may be achieved with the addition of Ni. Zr and Sc. Nickel leads to the formation of nickel aluminide Al3Ni and Al 9FeNi in the presence of iron, while zirconium forms Al3Zr. These intermetallics improve the high temperature strength of Al-Si alloys. Some interesting improvements have been achieved by modifying the composition of the base alloy with additions of Mn, resulting in an increase in strength and ductility at both room and high temperatures. Al-Si-Cu-Mg alloys such as the 354 (Al-9wt%Si-1.8wt%Cu-0.5wt%Mg) alloys show a greater response to heat treatment as a

  14. Corrosion and protection of magnesium alloys

    Energy Technology Data Exchange (ETDEWEB)

    Ghali, E. [Laval Univ., Quebec City, PQ (Canada). Dept. of Mining and Metallurgy

    2000-07-01

    The oxide film on magnesium offers considerable surface protection in rural and some industrial environments and the corrosion rate lies between that of aluminum and low carbon steels. Galvanic coupling of magnesium alloys, high impurity content such as Ni, Fe, Cu and surface contamination are detrimental for corrosion resistance of magnesium alloys. Alloying elements can form secondary particles which are noble to the Mg matrix, thereby facilitating corrosion, or enrich the corrosion product thereby possibly inhibiting the corrosion rate. Bimetallic corrosion resistance can be increased by fluxless melt protection, choice of compatible alloys, insulating materials, and new high-purity alloys. Magnesium is relatively insensible to oxygen concentration. Pitting, corrosion in the crevices, filiform corrosion are observed. Granular corrosion of magnesium alloys is possible due to the cathodic grain-boundary constituent. More homogeneous microstructures tend to improve corrosion resistance. Under fatigue loading conditions, microcrack initiation in Mg alloys is related to slip in preferentially oriented grains. Coating that exclude the corrosive environments can provide the primary defense against corrosion fatigue. Magnesium alloys that contain neither aluminum nor zinc are the most SCC resistant. Compressive surface residual stresses as that created by short peening increase SCC resistance. Cathodic polarization or cladding with a SCC resistant sheet alloy are good alternatives. Effective corrosion prevention for magnesium alloy components and assemblies should start at the design stage. Selective surface preparation, chemical treatment and coatings are recommended. Oil application, wax coating, anodizing, electroplating, and painting are possible alternatives. Recently, it is found that a magnesium hydride layer, created on the magnesium surface by cathodic charging in aqueous solution is a good base for painting. (orig.)

  15. Phase transformations on Zr-Nb alloys

    International Nuclear Information System (INIS)

    Doi, Sergio Norifumi

    1980-01-01

    This research intended the laboratory scale experimental development of Zr-Nb alloys with adequate characteristics for use as fuel element cladding or for the making of irradiation capsules. Zr-Nb alloys with different Nb contents were melted and the resulting material was characterised. The following metallurgical aspects were considered: preparation of Zr-Nb alloys with various Nb contents; heat and thermomechanical treatments; microstructural characterization; mechanical properties; oxidation properties. The influence of the heat treatment and thermomechanical treatment, on the out-of-pile mechanical and oxidation properties of the Zr-Nb alloys were studied. It was found that the alloy microhardness increases with the Nb content and/or with the thermomechanical treatment. Mechanical properties such as yield and ultimate tensile strength as well as elongation were determined by means of compression tests. The results showed that the alloy yield stress increases with the Nb content and with the thermomechanical treatment, while its elongation decreases. Thermogravimetric analysis determined the alloy oxidation kinetics, in the 400 - 800 deg C interval, at 1 atm. oxygen pressure. The results showed that the alloy oxidation rate increases with the temperature and Nb content. It was also observed that the oxidation rate increases considerably for temperatures higher than 600 deg C.(author)

  16. Phase formation in multicomponent monotectic aluminium alloys

    Energy Technology Data Exchange (ETDEWEB)

    Mirkovic, Djordje; Groebner, Joachim; Schmid-Fetzer, Rainer [Institute of Metallurgy, Clausthal University of Technology (Germany)

    2008-07-01

    Alloys with a miscibility gap in the liquid state are potential materials for advanced bearings in automotive and other applications. While binary alloys, such as Al-Pb or Al-Bi, are well known, the information available for ternary monotectic Al-alloys is scarce. However, the phase formation in multicomponent alloys is not only more challenging from a scientific aspect, it is also a prerequisite for a focused development of advanced alloys. This motivated our detailed study of monotectic Al-Bi-Cu-Sn alloys including both experimental and computational thermodynamic methods. Based on the initially established systematic classification of monotectic ternary Al-alloys, the first promising monotectic reaction was observed in the ternary Al-Bi-Zn system. Further ternary systems Al-Cu-Sn, Al-Bi-Sn, Al-Bi-Cu and Bi-Cu-Sn were investigated as basis for quaternary Al-Bi-Cu-Sn alloys. Experimental investigations of phase equilibria, enthalpies and solidification microstructures were combined with thermodynamic modeling. The results demonstrate that the developed precise thermodynamic description is vital to reveal the distinct multicomponent monotectic features of pertinent phase diagrams. The solidification paths of ternary monotectic alloy systems, Al-Bi-Zn, Al-Sn-Cu and Al-Bi-Cu, were also studied using thermodynamic calculations, revealing specific details of phase formation during solidification of selected alloys.

  17. Quasicrystal-reinforced Mg alloys.

    Science.gov (United States)

    Kyun Kim, Young; Tae Kim, Won; Hyang Kim, Do

    2014-04-01

    The formation of the icosahedral phase (I-phase) as a secondary solidification phase in Mg-Zn-Y and Mg-Zn-Al base systems provides useful advantages in designing high performance wrought magnesium alloys. The strengthening in two-phase composites (I-phase + α -Mg) can be explained by dispersion hardening due to the presence of I-phase particles and by the strong bonding property at the I-phase/matrix interface. The presence of an additional secondary solidification phase can further enhance formability and mechanical properties. In Mg-Zn-Y alloys, the co-presence of I and Ca 2 Mg 6 Zn 3 phases by addition of Ca can significantly enhance formability, while in Mg-Zn-Al alloys, the co-presence of the I-phase and Mg 2 Sn phase leads to the enhancement of mechanical properties. Dynamic and static recrystallization are significantly accelerated by addition of Ca in Mg-Zn-Y alloy, resulting in much smaller grain size and more random texture. The high strength of Mg-Zn-Al-Sn alloys is attributed to the presence of finely distributed Mg 2 Sn and I-phase particles embedded in the α -Mg matrix.

  18. Analysis of heavy alloying elements segregation in gravity cast experimental Mg-Al-Zn-RE alloy

    Directory of Open Access Journals (Sweden)

    A. Żydek

    2010-01-01

    Full Text Available Microstructure of experimental AZ91 alloy with an addition of rare earth elements (RE at a level of 4 wt.% was examined by means of light microscopy. The investigated AZ91 + 4 wt.% RE alloy was fabricated by adding cerium rich mish metal to molten commercial AZ91 alloy. In the microstructure of the resulting alloy, besides α solid solution, α + γ eutectic and discontinuous precipitates of γ phase, also the Al11RE3 phase with needle-like morphology and the polygonal Al10RE2Mn7 phase were revealed. No segregation of rare earth elements was found in the investigated gravity cast alloy, which was confirmed by statistical analysis of cerium concentrations in selected parts of the cast. Similar results were obtained for manganese. Ce and Mn concentrations were determined by a spectrophotometric method.

  19. General characteristics of eutectic alloy solidification mechanisms

    International Nuclear Information System (INIS)

    Lemaignan, Clement.

    1977-01-01

    The eutectic alloy sodification was studied in binary systems: solidification of non facetted - non facetted eutectic alloy (theoretical aspects, variation of the lamellar spacing, crystallographic relation between the various phases); solidification of facetted - non facetted eutectic alloy; coupled growth out of eutectic alloy; eutectic nucleation [fr

  20. Mechanical Properties of Low Density Alloys at Cryogenic Temperatures

    International Nuclear Information System (INIS)

    Jiao, X. D.; Liu, H. J.; Li, L. F.; Yang, K.

    2006-01-01

    Low-density alloys include aluminum alloys, titanium alloys and magnesium alloys. Aluminum alloys and titanium alloys have been widely investigated and used as structural materials for cryogenic applications because of their light weight and good low-temperature mechanical properties.For aerospace applications, persistent efforts are being devoted to reducing weight and improving performance. Magnesium alloys are the lightest structural alloys among those mentioned above. Therefore, it is necessary to pay attention to magnesium alloys and to investigate their behaviors at cryogenic temperatures. In this paper, we have investigated the mechanical properties and microstructures of some magnesium alloys at cryogenic temperatures. Experimental results on both titanium and magnesium alloys are taken into account in considering these materials for space application

  1. Modification of Sr on 4004 Aluminum Alloy

    Science.gov (United States)

    Guo, Erjun; Cao, Guojian; Feng, Yicheng; Wang, Liping; Wang, Guojun; Lv, Xinyu

    2013-05-01

    As a brazing foil, 4004 Al alloy has good welding performance. However, the high Si content decreases the plasticity of the alloy. To improve the plasticity of 4004 Al alloy and subsequently improve the productivity of 4004 Al foil or 434 composite foil, 4004 Al alloy was modified by Al-10%Sr master alloy. Modification effects of an additional amount of Sr, modification temperature, and holding time on 4004 aluminum alloy were studied by orthogonal design. The results showed that the greatest impact parameter of 4004 aluminum alloy modification was the additional amount of Sr, followed by holding time and modification temperature. The optimum modification parameters obtained by orthogonal design were as follows: Sr addition of 0.04%, holding time of 60 min, and modification temperature of 760°C. The effect of Sr addition on modification was analyzed in detail based on orthogonal results. With increasing of Sr addition, elongation of 4004 alloy increased at first, and decreased after reaching the maximum value.

  2. Magnetic susceptibility of Dirac fermions, Bi-Sb alloys, interacting Bloch fermions, dilute nonmagnetic alloys, and Kondo alloys

    Energy Technology Data Exchange (ETDEWEB)

    Buot, Felix A., E-mail: fbuot@gmu.edu [Computational Materials Science Center, George Mason University, Fairfax, VA 22030 (United States); TCSE Center, Spintronics Group, Physics Department, University of San Carlos, Talamban, Cebu 6000 (Philippines); C& LB Research Institute, Carmen, Cebu 6005 (Philippines); Otadoy, Roland E.S.; Rivero, Karla B. [TCSE Center, Spintronics Group, Physics Department, University of San Carlos, Talamban, Cebu 6000 (Philippines)

    2017-03-01

    Wide ranging interest in Dirac Hamiltonian is due to the emergence of novel materials, namely, graphene, topological insulators and superconductors, the newly-discovered Weyl semimetals, and still actively-sought after Majorana fermions in real materials. We give a brief review of the relativistic Dirac quantum mechanics and its impact in the developments of modern physics. The quantum band dynamics of Dirac Hamiltonian is crucial in resolving the giant diamagnetism of bismuth and Bi-Sb alloys. Quantitative agreement of the theory with the experiments on Bi-Sb alloys has been achieved, and physically meaningful contributions to the diamagnetism has been identified. We also treat relativistic Dirac fermion as an interband dynamics in uniform magnetic fields. For the interacting Bloch electrons, the role of translation symmetry for calculating the magnetic susceptibility avoids any approximation to second order in the field. The expressions for magnetic susceptibility of dilute nonmagnetic alloys give a firm theoretical foundation of the empirical formulas used in fitting experimental results. The unified treatment of all the above calculations is based on the lattice Weyl-Wigner formulation of discrete phase-space quantum mechanics. For completeness, the magnetic susceptibility of Kondo alloys is also given since Dirac fermions in conduction band and magnetic impurities exhibit Kondo effect.

  3. Comparison of three Ni-Hard I alloys

    Energy Technology Data Exchange (ETDEWEB)

    Dogan, Omer N.; Hawk, Jeffrey A.; Rice, J. (Texaloy Foundry Co., Inc., Floresville, Texas)

    2004-09-01

    This report documents the results of an investigation which was undertaken to reveal the similarities and differences in the mechanical properties and microstructural characteristics of three Ni-Hard I alloys. One alloy (B1) is ASTM A532 class IA Ni-Hard containing 4.2 wt. pct. Ni. The second alloy (B2) is similar to B1 but higher in Cr, Si, and Mo. The third alloy (T1) also falls in the same ASTM specification, but it contains 3.3 wt. pct. Ni. The alloys were evaluated in both as-cast and stress-relieved conditions except for B2, which was evaluated in the stress-relieved condition only. While the matrix of the high Ni alloys is composed of austenite and martensite in both conditions, the matrix of the low Ni alloy consists of a considerable amount of bainite, in addition to the martensite and the retained austenite in as cast condition, and primarily bainite, with some retained austenite, in the stress relieved condition. It was found that the stress relieving treatment does not change the tensile strength of the high Ni alloy. Both the as cast and stress relieved high Ni alloys had a tensile strength of about 350 MPa. On the other hand, the tensile strength of the low Ni alloy increased from 340 MPa to 452 MPa with the stress relieving treatment. There was no significant difference in the wear resistance of these alloys in both as-cast and stressrelieved conditions.

  4. An X-Ray Luminous, Dwarf Seyfert Companion of Markarian 273 (ApJ, 496, L9 [1998])

    Science.gov (United States)

    Xia, X.-Y.; Boller, Th.; Wu, H.; Deng, Z.-G.; Gao, Y.; Zou, Z.-L.; Mao, S.; Börner, G.

    1998-11-01

    In the Letter ``An X-Ray Luminous, Dwarf Seyfert Companion of Markarian 273'' by X.-Y. Xia, Th. Boller, H. Wu, Z.-G. Deng, Y. Gao, Z.-L. Zou, S. Mao, and G. Börner (ApJ, 496, L9 [1998]), an observational error occurred that invalidates some of our conclusions. Since Mrk 273x was essentially invisible (B~21) in our acqusition image, in order to position the slit on the faint Mrk 273x, a slit rotation had to be applied. Unfortunately, the amount of rotation was applied incorrectly. As a result, the spectrum obtained (shown in Fig. 2) was not for the intended target, Mrk 273x, but for an object very close to, but northeast of, Mrk 273. A new spectrum of Mrk 273x indicates that Mrk 273x is at redshift 0.458, not at 0.0378 as quoted in the Letter. The larger redshift implies that both the optical and X-ray luminosity have to be revised upward by a factor of ~170. Mrk 273x is therefore not a dwarf galaxy optically. The X-ray properties of Mrk 273x remain the same except that its soft X-ray luminosity now reaches ~1044 ergs s-1 for H0=50 km s-1 Mpc-1. The new observations will be presented in a subsequent paper (X.-Y. Xia et al., in preparation [1998]) in order to make corrections and shed further insights on the objects in the Mrk 273 field.

  5. Powder-metallurgy preparation of NiTi shape-memory alloy using mechanical alloying and spark-plasma sintering.

    Czech Academy of Sciences Publication Activity Database

    Novák, P.; Moravec, H.; Vojtěch, V.; Knaislová, A.; Školáková, A.; Kubatík, Tomáš František; Kopeček, Jaromír

    2017-01-01

    Roč. 51, č. 1 (2017), s. 141-144 ISSN 1580-2949 R&D Projects: GA ČR(CZ) GA14-03044S Institutional support: RVO:61389021 ; RVO:68378271 Keywords : mechanical alloying * spark plasma sintering * NiTi * shape memory alloy Subject RIV: JG - Metallurgy; JG - Metallurgy (FZU-D) OBOR OECD: Materials engineering ; Materials engineering (FZU-D) Impact factor: 0.436, year: 2016 https://www.researchgate.net/publication/313900224_Powder-metallurgy_preparation_of_NiTi_shape-memory_alloy_using_mechanical_alloying_and_spark-plasma_sintering

  6. Fabrication of spherical high-nitrogen stainless steel powder alloys by mechanical alloying and thermal plasma spheroidization

    Science.gov (United States)

    Razumov, Nikolay G.; Wang, Qing Sheng; Popovich, Anatoly A.; Shamshurin, Aleksey I.

    2018-04-01

    This paper describes the results of experimental studies on the treatment of Fe-23Cr-11Mn-1N high-nitrogen stainless steel powder alloys, synthesized by the mechanical alloying (MA) of elemental powders in the flow of a radio frequency thermal plasma. The as-milled powder with irregular particles were successfully converted into spherical high-nitrogen stainless steel powder alloy. Measurement of the residual nitrogen content in the obtained powder, shown that during the plasma spheroidization process, part of the nitrogen escapes from the alloy.

  7. Alloying behavior of iron, gold and silver in AlCoCrCuNi-based equimolar high-entropy alloys

    International Nuclear Information System (INIS)

    Hsu, U.S.; Hung, U.D.; Yeh, J.W.; Chen, S.K.; Huang, Y.S.; Yang, C.C.

    2007-01-01

    High-entropy alloys are newly developed alloys that are composed, by definition, of at least five principal elements with concentrations in the range of 5-35 at.%. Therefore, the alloying behavior of any given principal element is significantly affected by all the other principal elements present. In order to elucidate this further, the influence of iron, silver and gold addition on the microstructure and hardness of AlCoCrCuNi-based equimolar alloys has been examined. The as-cast AlCoCrCuNi base alloy is found to have a dendritic structure, of which only solid solution FCC and BCC phases can be observed. The BCC dendrite has a chemical composition close to that of the nominal alloy, with a deficiency in copper however, which is found to segregate and form a FCC Cu-rich interdendrite. The microstructure of the iron containing alloys is similar to that of the base alloy. It is found that both of these aforementioned alloys have hardnesses of about 420 HV, which is equated to their similar microstructures. The as-cast ingot forms two layers of distinct composition with the addition of silver. These layers, which are gold and silver in color, are determined to have a hypoeutectic Ag-Cu composition and a multielement mixture of the other principal elements, respectively. This indicates the chemical incompatibility of silver with the other principal elements. The hardnesses of the gold (104 HV) and silver layers (451 HV) are the lowest and highest of the alloy systems studied. This is attributed to the hypoeutectic Ag-Cu composition of the former and the reduced copper content of the latter. Only multielement mixtures, i.e. without copper segregation, form in the gold containing alloy. Thus, it may be said that gold acts as a 'mixing agent' between copper and the other elements. Although several of the atom pairs in the gold containing alloy have positive enthalpies, thermodynamic considerations show that the high entropy contribution is sufficient to counterbalance

  8. Irradiation effects in magnesium and aluminium alloys

    International Nuclear Information System (INIS)

    Sturcken, E.F.

    1979-01-01

    Effects of neutron irradiation on microstructure, mechanical properties and swelling of several magnesium and aluminium alloys were studied. The neutron fluences of 2-3 X 10 22 n/cm 2 , >0.2 MeV produced displacement doses of 20 to 45 displacements per atom (dpa). Ductility of the magnesium alloys was severely reduced by irradiation induced recrystallization and precipitation of various forms. Precipitation of transmuted silicon occurred in the aluminium alloys. However, the effect on ductility was much less than for the magnesium alloys. The magnesium and aluminium alloys had excellent resistance to swelling: The best magnesium alloy was Mg/3.0 wt% Al/0.19 wt% Ca; its density decreased by only 0.13%. The best aluminium alloy was 6063, with a density decrease of 0.22%. (Auth.)

  9. Developing precipitation hardenable high entropy alloys

    Science.gov (United States)

    Gwalani, Bharat

    High entropy alloys (HEAs) is a concept wherein alloys are constructed with five or more elements mixed in equal proportions; these are also known as multi-principle elements (MPEs) or complex concentrated alloys (CCAs). This PhD thesis dissertation presents research conducted to develop precipitation-hardenable high entropy alloys using a much-studied fcc-based equi-atomic quaternary alloy (CoCrFeNi). Minor additions of aluminium make the alloy amenable for precipitating ordered intermetallic phases in an fcc matrix. Aluminum also affects grain growth kinetics and Hall-Petch hardenability. The use of a combinatorial approach for assessing composition-microstructure-property relationships in high entropy alloys, or more broadly in complex concentrated alloys; using laser deposited compositionally graded AlxCrCuFeNi 2 (0 mechanically processed via conventional techniques. The phase stability and mechanical properties of these alloys have been investigated and will be presented. Additionally, the activation energy for grain growth as a function of Al content in these complex alloys has also been investigated. Change in fcc grain growth kinetic was studied as a function of aluminum; the apparent activation energy for grain growth increases by about three times going from Al0.1CoCrFeNi (3% Al (at%)) to Al0.3CoCrFeNi. (7% Al (at%)). Furthermore, Al addition leads to the precipitation of highly refined ordered L12 (gamma') and B2 precipitates in Al0.3CoCrFeNi. A detailed investigation of precipitation of the ordered phases in Al0.3CoCrFeNi and their thermal stability is done using atom probe tomography (APT), transmission electron microscopy (TEM) and Synchrotron X-ray in situ and ex situ analyses. The alloy strengthened via grain boundary strengthening following the Hall-Petch relationship offers a large increment of strength with small variation in grain size. Tensile strength of the Al0.3CoFeNi is increased by 50% on precipitation fine-scale gamma' precipitates

  10. A review on magnesium alloys as biodegradable materials

    Science.gov (United States)

    Gu, Xue-Nan; Zheng, Yu-Feng

    2010-06-01

    Magnesium alloys attracted great attention as a new kind of degradable biomaterials. One research direction of biomedical magnesium alloys is based on the industrial magnesium alloys system, and another is the self-designed biomedical magnesium alloys from the viewpoint of biomaterials. The mechanical, biocorrosion properties and biocompatibilities of currently reported Mg alloys were summarized in the present paper, with the mechanical properties of bone tissue, the healing period postsurgery, the pathophysiology and toxicology of the alloying elements being discussed. The strategy in the future development of biomedical Mg alloys was proposed.

  11. INFLUENCE OF MECHANICAL ALLOYING AND LEAD CONTENT ON MICROSTRUCTURE, HARDNESS AND TRIBOLOGICAL BEHAVIOR OF 6061 ALUMINIUM ALLOYS

    Directory of Open Access Journals (Sweden)

    M. Paidpilli

    2017-03-01

    Full Text Available In the present work, one batch of prealloyed 6061Al powder was processed by mixing and another one was ball milled with varying amount of lead content (0-15 vol. %. These powders were compacted at 300MPa and sintered at 590˚C under N2. The instrumented hardness and the young’s modulus of as-sintered 6061Al-Pb alloys were examined as a function of lead content and processing route. The wear test under dry sliding condition has been performed at varying loads (10-40 N using pin-on-disc tribometer. The microstructure and worn surfaces have been investigated using SEM to evaluate the change in topographical features due to mechanical alloying and lead content. The mechanically alloyed materials showed improved wear characteristics as compared to as-mixed counterpart alloys. Delamination of 6061Al-Pb alloys decreases up to an optimum lead composition in both as-mixed and ball-milled 6061Al-Pb alloys. The results indicated minimum wear rate for as-mixed and ball-milled 6061Al alloy at 5 and 10 vol. % Pb, respectively.

  12. Fabrication and Magnetic Properties of Co₂MnAl Heusler Alloys by Mechanical Alloying.

    Science.gov (United States)

    Lee, Chung-Hyo

    2018-02-01

    We have applied mechanical alloying (MA) to produce nanocrystalline Co2MnAl Heusler alloys using a mixture of elemental Co50Mn25Al25 powders. An optimal milling and heat treatment conditions to obtain a Co2MnAl Heusler phase with fine microstructure were investigated by X-ray diffraction, differential scanning calorimeter and vibrating sample magnetometer measurements. α-(Co, Mn, Al) FCC phases coupled with amorphous phase are obtained after 3 hours of MA without any evidence for the formation of Co2MnAl alloys. On the other hand, a Co2MnAl Heusler alloys can be obtained by the heat treatment of all MA samples up to 650 °C. X-ray diffraction result shows that the average grain size of Co2MnAl Heusler alloys prepared by MA for 5 h and heat treatment is in the range of 95 nm. The saturation magnetization of MA powders decreases with MA time due to the magnetic dilution by alloying with nonmagnetic Mn and Al elements. The magnetic hardening due to the reduction of the grain size with ball milling is also observed. However, the saturation magnetization of MA powders after heat treatment increases with MA time and reaches to a maximum value of 105 emu/g after 5 h of MA. It can be also seen that the coercivity of 5 h MA sample annealed at 650 °C is fairly low value of 25 Oe.

  13. Rare earth metal alloy magnets

    International Nuclear Information System (INIS)

    Harris, I.R.; Evans, J.M.; Nyholm, P.S.

    1979-01-01

    This invention relates to rare earth metal alloy magnets and to methods for their production. The technique is based on the fact that rare earth metal alloys (for e.g. cerium or yttrium) which have been crumbled to form a powder by hydride formation and decomposition can be used for the fabrication of magnets without the disadvantages inherent in alloy particle size reduction by mechanical milling. (UK)

  14. PREPARATION OF ACTINIDE-ALUMINUM ALLOYS

    Science.gov (United States)

    Moore, R.H.

    1962-09-01

    BS>A process is given for preparing alloys of aluminum with plutonium, uranium, and/or thorium by chlorinating actinide oxide dissolved in molten alkali metal chloride with hydrochloric acid, chlorine, and/or phosgene, adding aluminum metal, and passing air and/or water vapor through the mass. Actinide metal is formed and alloyed with the aluminum. After cooling to solidification, the alloy is separated from the salt. (AEC)

  15. Stress corrosion in high-strength aluminum alloys

    Science.gov (United States)

    Dorward, R. C.; Hasse, K. R.

    1980-01-01

    Report describes results of stress-corrosion tests on aluminum alloys 7075, 7475, 7050, and 7049. Tests compare performance of original stress-corrosion-resistant (SCR) aluminum, 7075, with newer, higher-strength SCR alloys. Alloys 7050 and 7049 are found superior in short-transverse cross-corrosion resistance to older 7075 alloy; all alloys are subject to self-loading effect caused by wedging of corrosion products in cracks. Effect causes cracks to continue to grow, even at very-low externally applied loads.

  16. Ti-Pt Alloys form mechanical milling

    CSIR Research Space (South Africa)

    Nxumalo, S

    2009-12-01

    Full Text Available C maximum in these alloys. A few researchers have studied the martensitic transformation in TiPt alloys using arc melted cast samples. In this work high temperature shape memory alloys are targeted using powder metallurgy as a processing route....

  17. Anodic oxidation of Ta/Fe alloys

    International Nuclear Information System (INIS)

    Mato, S.; Alcala, G.; Thompson, G.E.; Skeldon, P.; Shimizu, K.; Habazaki, H.; Quance, T.; Graham, M.J.; Masheder, D.

    2003-01-01

    The behaviour of iron during anodizing of sputter-deposited Ta/Fe alloys in ammonium pentaborate electrolyte has been examined by transmission electron microscopy, Rutherford backscattering spectroscopy, glow discharge optical emission spectroscopy and X-ray photoelectron spectroscopy. Anodic films on Ta/1.5 at.% Fe, Ta/3 at.% Fe and Ta/7 at.% Fe alloys are amorphous and featureless and develop at high current efficiency with respective formation ratios of 1.67, 1.60 and 1.55 nm V -1 . Anodic oxidation of the alloys proceeds without significant enrichment of iron in the alloy in the vicinity of the alloy/film interface and without oxygen generation during film growth, unlike the behaviour of Al/Fe alloys containing similar concentrations of iron. The higher migration rate of iron species relative to that of tantalum ions leads to the formation of an outer iron-rich layer at the film surface

  18. The modification of some properties of Al-2%Mg alloy by Ti &Li alloying elements

    Directory of Open Access Journals (Sweden)

    Talib Abdulameer Jasim

    2017-11-01

    Full Text Available Aluminium-Magnisium alloys are light, high strength with resistance to corrosion and good weldability. When the content of magnesium  exceeds 3% there is a tendency to stress corrosion . This work is an attempt is to prepare low density alloy with up to approximately 2.54 g / cm3 by adding different contents of Ti, and lithium to aluminum-2%Magnisium alloy. The lithium is added in two aspects, lithium chloride and pure metal. The casting performed using conventional casting method. Moreover, solution heat treatment (SHT at 520 ºC for 4 hrs, quenching in cold water, and aging at 50ºC for 4 days were done to get better mechanical properties of all samples. Microstructure was inspected by light optical microscope before and after SHT. Alloy3 which contains 1.5%Ti was tested by SEM and EDS spectrometer to exhibit the shape and micro chemical analysis of Al3Ti phase. Hardness, ultimate tensile strength, and modulus of elasticity were tested for all alloys. The results indicated that Al3Ti phase precipitates in alloys contain 0.5%T, 1%Ti, And 1.5%Ti.  The phases Al3Li as well as Al3Ti were precipitated in alloy4 which contains 2%Ti, and 2.24%Li. Mechanical properties test results also showed that the alloy4 has achieved good results, the modulus of elasticity chanced from 310.65GPa before SHT to 521.672GPa, after SHT and aging, the ultimate tensile strength was changed from 365MPa before SHT to 469MPa, after SHT and aging,  and hardness was increased from 128 to 220HV.

  19. Rotary Friction Welding of Weight Heavy Alloy with Wrought AlMg3 Alloy for Subcaliber Ammunition

    OpenAIRE

    Olgierd Janusz Goroch; Zbigniew Gulbinowicz

    2017-01-01

    The results of studies concerning friction welding of Weight Heavy Alloy (WHA) with AlMg3 alloy are presented. The friction welding of density 17,5 Mg/m3 with aluminum alloy showed that it is possible to reach the joints with the strength exceeding the yield strength of wrought AlMg3 alloy. This strength looks to be promising from point of view of condition which have to be fulfilled in case of armor subcaliber ammunition, where WHA rods play the role Kinetic Energy Penetrators and aluminum i...

  20. Development of high performance ODS alloys

    Energy Technology Data Exchange (ETDEWEB)

    Shao, Lin [Texas A & M Univ., College Station, TX (United States); Gao, Fei [Univ. of Michigan, Ann Arbor, MI (United States); Garner, Frank [Texas A & M Univ., College Station, TX (United States)

    2018-01-29

    This project aims to capitalize on insights developed from recent high-dose self-ion irradiation experiments in order to develop and test the next generation of optimized ODS alloys needed to meet the nuclear community's need for high strength, radiation-tolerant cladding and core components, especially with enhanced resistance to void swelling. Two of these insights are that ferrite grains swell earlier than tempered martensite grains, and oxide dispersions currently produced only in ferrite grains require a high level of uniformity and stability to be successful. An additional insight is that ODS particle stability is dependent on as-yet unidentified compositional combinations of dispersoid and alloy matrix, such as dispersoids are stable in MA957 to doses greater than 200 dpa but dissolve in MA956 at doses less than 200 dpa. These findings focus attention on candidate next-generation alloys which address these concerns. Collaboration with two Japanese groups provides this project with two sets of first-round candidate alloys that have already undergone extensive development and testing for unirradiated properties, but have not yet been evaluated for their irradiation performance. The first set of candidate alloys are dual phase (ferrite + martensite) ODS alloys with oxide particles uniformly distributed in both ferrite and martensite phases. The second set of candidate alloys are ODS alloys containing non-standard dispersoid compositions with controllable oxide particle sizes, phases and interfaces.

  1. Site preference and elastic properties of ternary alloying additions in B2 YAg alloys by first-principles calculations

    Energy Technology Data Exchange (ETDEWEB)

    Wu Yurong, E-mail: winwyr@126.com [College of Electromechanical Engineering, Hunan University of Science and Technology, Xiantang 411201 (China); Hu Wangyu [Department of Applied Physics, Hunan University, Changsha 410082 (China); Xu Longshan [Department of Materials Science and Engineering, Xiamen University of Technology, Xiamen 361024 (China)

    2012-09-15

    First-principles calculations were preformed to study the site preference behavior and elastic properties of 3d (Ti-Cu) transition-metal elements in B2 ductility YAg alloy. In YAg, Ti is found to occupy the Y sublattice whereas V, Cr, Co, Fe, Ni and Cu tend to substitute for Ag sublattice. Due to the addition of 3d transition metals, the lattice parameters of YAg is decreased in the order: Valloy, and Fe is the most effective element to improve the ductility of YAg, while Ti, Ni and V alloying elements can reduce the ductility of YAg alloy, especially, V transforms ductile into brittle for YAg alloy. In addition, both V and Ni alloying elements can increase the hardness of YAg alloy, and Y{sub 8}Ag{sub 7}V is harder than Y{sub 8}Ag{sub 7}Ni.

  2. Dispersoid reinforced alloy powder and method of making

    Energy Technology Data Exchange (ETDEWEB)

    Anderson, Iver E.; Terpstra, Robert L.

    2017-12-05

    A method of making dispersion-strengthened alloy particles involves melting an alloy having a corrosion and/or oxidation resistance-imparting alloying element, a dispersoid-forming element, and a matrix metal wherein the dispersoid-forming element exhibits a greater tendency to react with a reactive species acquired from an atomizing gas than does the alloying element. The melted alloy is atomized with the atomizing gas including the reactive species to form atomized particles so that the reactive species is (a) dissolved in solid solution to a depth below the surface of atomized particles and/or (b) reacted with the dispersoid-forming element to form dispersoids in the atomized particles to a depth below the surface of said atomized particles. The atomized alloy particles are solidified as solidified alloy particles or as a solidified deposit of alloy particles. Bodies made from the dispersion strengthened alloy particles, deposit thereof, exhibit enhanced fatigue and creep resistance and reduced wear as well as enhanced corrosion and/or oxidation resistance at high temperatures by virtue of the presence of the corrosion and/or oxidation resistance imparting alloying element in solid solution in the particle alloy matrix.

  3. Dispersoid reinforced alloy powder and method of making

    Energy Technology Data Exchange (ETDEWEB)

    Anderson, Iver E.; Terpstra, Robert L.

    2017-10-10

    A method of making dispersion-strengthened alloy particles involves melting an alloy having a corrosion and/or oxidation resistance-imparting alloying element, a dispersoid-forming element, and a matrix metal wherein the dispersoid-forming element exhibits a greater tendency to react with a reactive species acquired from an atomizing gas than does the alloying element. The melted alloy is atomized with the atomizing gas including the reactive species to form atomized particles so that the reactive species is (a) dissolved in solid solution to a depth below the surface of atomized particles and/or (b) reacted with the dispersoid-forming element to form dispersoids in the atomized particles to a depth below the surface of said atomized particles. The atomized alloy particles are solidified as solidified alloy particles or as a solidified deposit of alloy particles. Bodies made from the dispersion strengthened alloy particles, deposit thereof, exhibit enhanced fatigue and creep resistance and reduced wear as well as enhanced corrosion and/or oxidation resistance at high temperatures by virtue of the presence of the corrosion and/or oxidation resistance imparting alloying element in solid solution in the particle alloy matrix.

  4. Characterization of Dispersion Strengthened Copper Alloy Prepared by Internal Oxidation Combined with Mechanical Alloying

    Science.gov (United States)

    Zhao, Ziqian; Xiao, Zhu; Li, Zhou; Zhu, Mengnan; Yang, Ziqi

    2017-11-01

    Cu-3.6 vol.% Al2O3 dispersion strengthened alloy was prepared by mechanical alloying (MA) of internal oxidation Cu-Al powders. The lattice parameter of Cu matrix decreased with milling time for powders milled in argon, while the abnormal increase of lattice parameter occurred in the air resulting from mechanochemical reactions. With a quantitative analysis, the combined method makes residual aluminum oxidized completely within 10-20 h while mechanical alloying method alone needs longer than 40 h. Lamellar structure formed and the thickness of lamellar structure decreased with milling time. The size of Al2O3 particles decreased from 46 to 22 nm after 40 h milling. After reduction, core-shell structure was found in MAed powders milled in the air. The compacted alloy produced by MAed powders milled in the argon had an average hardness and electrical conductivity of 172.2 HV and 82.1% IACS while the unmilled alloy's were 119.8 HV and 74.1% IACS due to the Al2O3 particles refinement and residual aluminum in situ oxidization.

  5. Recent developments in advanced aircraft aluminium alloys

    International Nuclear Information System (INIS)

    Dursun, Tolga; Soutis, Costas

    2014-01-01

    Highlights: • To compete with composites, performance of aluminium alloys should be increased. • Al–Li alloys have higher strength, fracture and fatigue/corrosion resistance. • Improvements of aerospace Al alloys are due to optimised solute content and ratios. • In selecting new materials, there should be no reduction in the level of safety. • The use of hybrid materials could provide additional opportunities for Al alloys. - Abstract: Aluminium alloys have been the primary material for the structural parts of aircraft for more than 80 years because of their well known performance, well established design methods, manufacturing and reliable inspection techniques. Nearly for a decade composites have started to be used more widely in large commercial jet airliners for the fuselage, wing as well as other structural components in place of aluminium alloys due their high specific properties, reduced weight, fatigue performance and corrosion resistance. Although the increased use of composite materials reduced the role of aluminium up to some extent, high strength aluminium alloys remain important in airframe construction. Aluminium is a relatively low cost, light weight metal that can be heat treated and loaded to relatively high level of stresses, and it is one of the most easily produced of the high performance materials, which results in lower manufacturing and maintenance costs. There have been important recent advances in aluminium aircraft alloys that can effectively compete with modern composite materials. This study covers latest developments in enhanced mechanical properties of aluminium alloys, and high performance joining techniques. The mechanical properties on newly developed 2000, 7000 series aluminium alloys and new generation Al–Li alloys are compared with the traditional aluminium alloys. The advantages and disadvantages of the joining methods, laser beam welding and friction stir welding, are also discussed

  6. Aluminum alloy and associated anode and battery

    International Nuclear Information System (INIS)

    Tarcy, G.P.

    1990-01-01

    This patent describes an aluminum alloy. It comprises: eutectic amounts of at least two alloying elements selected from the group consisting of bismuth, cadmium, scandium, gallium, indium, lead, mercury, thallium, tin, and zinc with the balance being aluminum and the alloying elements being about 0.01 to 3.0 percent by weight of the alloy

  7. Viscosity of Industrially Important Zn-Al Alloys Part II: Alloys with Higher Contents of Al and Si

    Science.gov (United States)

    Nunes, V. M. B.; Queirós, C. S. G. P.; Lourenço, M. J. V.; Santos, F. J. V.; Nieto de Castro, C. A.

    2018-05-01

    The viscosity of Zn-Al alloys melts, with industrial interest, was measured for temperatures between 693 K and 915 K, with an oscillating cup viscometer, and estimated expanded uncertainties between 3 and 5 %, depending on the alloy. The influence of minor components, such as Si, Mg and Ce + La, on the viscosity of the alloys is discussed. An increase in the amount of Mg triggers complex melt/solidification processes while the addition of Ce and La renders alloys viscosity almost temperature independent. Furthermore, increases in Al and Si contents decrease melts viscosity and lead to an Arrhenius type behavior. This paper complements a previous study describing the viscosity of Zn-Al alloys with quasi-eutectic compositions.

  8. Calculations of hydrogen diffusivity in Zr-based alloys: Influence of alloying elements and effect of stress

    International Nuclear Information System (INIS)

    Yu, J.; Jiang, C.; Zhang, Y.

    2017-01-01

    This report summarizes the progress on modeling hydrogen diffusivity in Zr-based alloys. The presence of hydrogen (H) can detrimentally affect the mechanical properties of many metals and alloys. To mitigate these detrimental effects requires fundamental understanding of the thermodynamics and kinetics governing H pickup and hydride formation. In this work, we focus on H diffusion in Zr-based alloys by studying the effects of alloying elements and stress, factors that have been shown to strongly affect H pickup and hydride formation in nuclear fuel claddings. A recently developed accelerated kinetic Monte Carlo method is used for the study. It is found that for the alloys considered here, H diffusivity depends weakly on composition, with negligible effect at high temperatures in the range of 600-1200 K. Therefore, the small variation in compositions of these alloys is likely not a major cause of the very different H pickup rates. In contrast, stress strongly affects H diffusivity. This effect needs to be considered for studying hydride formation and delayed hydride cracking.

  9. Calculations of hydrogen diffusivity in Zr-based alloys: Influence of alloying elements and effect of stress

    Energy Technology Data Exchange (ETDEWEB)

    Yu, J. [Idaho National Lab. (INL), Idaho Falls, ID (United States); Jiang, C. [Idaho National Lab. (INL), Idaho Falls, ID (United States); Zhang, Y. [Idaho National Lab. (INL), Idaho Falls, ID (United States)

    2017-06-01

    This report summarizes the progress on modeling hydrogen diffusivity in Zr-based alloys. The presence of hydrogen (H) can detrimentally affect the mechanical properties of many metals and alloys. To mitigate these detrimental effects requires fundamental understanding of the thermodynamics and kinetics governing H pickup and hydride formation. In this work, we focus on H diffusion in Zr-based alloys by studying the effects of alloying elements and stress, factors that have been shown to strongly affect H pickup and hydride formation in nuclear fuel claddings. A recently developed accelerated kinetic Monte Carlo method is used for the study. It is found that for the alloys considered here, H diffusivity depends weakly on composition, with negligible effect at high temperatures in the range of 600-1200 K. Therefore, the small variation in compositions of these alloys is likely not a major cause of the very different H pickup rates. In contrast, stress strongly affects H diffusivity. This effect needs to be considered for studying hydride formation and delayed hydride cracking.

  10. Alloy Effects on the Gas Nitriding Process

    Science.gov (United States)

    Yang, M.; Sisson, R. D.

    2014-12-01

    Alloy elements, such as Al, Cr, V, and Mo, have been used to improve the nitriding performance of steels. In the present work, plain carbon steel AISI 1045 and alloy steel AISI 4140 were selected to compare the nitriding effects of the alloying elements in AISI 4140. Fundamental analysis is carried out by using the "Lehrer-like" diagrams (alloy specific Lehrer diagram and nitriding potential versus nitrogen concentration diagram) and the compound layer growth model to simulate the gas nitriding process. With this method, the fundamental understanding for the alloy effect based on the thermodynamics and kinetics becomes possible. This new method paves the way for the development of new alloy for nitriding.

  11. Mechanical alloying in the Fe-Cu system

    DEFF Research Database (Denmark)

    Jiang, Jianzhong; Gente, C.; Bormann, R.

    1998-01-01

    The studies of mechanical alloying on the Fe-Cu system, as a model system for those with positive heats of mixing, are reviewed. Several problems involved in the mechanical alloying process are discussed. For example, (1) whether alloying occurs on an atomic level; (2) what the solid solubility...... in the Fe-Cu system is; (3) where the positive energy is stored in the alloys; (4) what the decomposition process of the supersaturated alloys is; and (5) what type of magnetic properties the new materials have. The elucidation of these problems will shed light on the understanding of the mechanisms...... for the preparation of materials under highly non-equilibrium conditions in systems with positive heats of mixing by mechanical alloying....

  12. Corrosion resistance of titanium alloys for dentistry

    International Nuclear Information System (INIS)

    Laskawiec, J.; Michalik, R.

    2001-01-01

    Titanium and its alloys belong to biomaterials which the application scope in medicine increases. Some properties of the alloys, such as high mechanical strength, low density, low Young's modulus, high corrosion resistance and good biotolerance decide about it. The main areas of the application of titanium and its alloys are: orthopedics and traumatology, cardiosurgery, faciomaxillary surgery and dentistry. The results of investigations concerning the corrosion resistance of the technical titanium and Ti6Al14V alloy and comparatively a cobalt alloy of the Vitallium type in the artificial saliva is presented in the work. Significantly better corrosion resistance of titanium and the Ti6Al14V than the Co-Cr-Mo alloy was found. (author)

  13. Magnetoimpedance effect in Nanoperm alloys

    International Nuclear Information System (INIS)

    Hernando, B.; Alvarez, P.; Santos, J.D.; Gorria, P.; Sanchez, M.L.; Olivera, J.; Perez, M.J.; Prida, V.M.

    2006-01-01

    The influence of isothermal annealing (1 h at 600 deg. C in Ar atmosphere) on the soft magnetic properties and magnetoimpedance (MI) effect has been studied in ribbons of the following Nanoperm alloys: Fe 91 Zr 7 B 2 , Fe 88 Zr 8 B 4 , Fe 87 Zr 6 B 6 Cu 1 and Fe 8 Zr 1 B 1 . A maximum MI ratio of about 27% was measured for the nanocrystalline alloy Fe 87 Zr 6 B 6 Cu 1 at a driving frequency of 0.2 MHz. The thermal annealing led to magnetic softening for this alloy, while a hardening is observed for the Fe 8 Zr 1 B 1 alloy

  14. Technetium and technetium alloys

    International Nuclear Information System (INIS)

    Ijdo, W.L.

    1993-10-01

    This report presents the results of a literature survey on technetium and technetium alloys. The literature has been searched through 1993. The survey was focused on technetium and (binary cubic) technetium alloys, but other important information on technetium has not been omitted from this survey. This report has been written with the aim to collect more information about phase systems which could be of importance in the transmutation process by neutrons of technetium. With the information presented in this report, it should be possible to select a suitable technetium alloy for further investigation regarding to the transmutation process. (orig.)

  15. Carbon Alloys-Multi-functionalization

    Energy Technology Data Exchange (ETDEWEB)

    Yasuda, Eiichi [MSL, Tokyo Institute of Technology, Yokohama 226-8503 (Japan)], E-mail: yasuda.e.aa.@m.titech.ac.jp; Enami, Takashi; Hoteida, Nobuyuki [MSL, Tokyo Institute of Technology, Yokohama 226-8503 (Japan); Lanticse-Diaz, L.J. [University of the Philippines (Philippines); Tanabe, Yasuhiro [Nagoya University (Japan); Akatsu, Takashi [MSL, Tokyo Institute of Technology, Yokohama 226-8503 (Japan)

    2008-02-25

    Last decade after our proposal of the 'Carbon Alloys' concept, many different kinds of Carbon Alloys, such as carbon nanotubes, carbon nanofibers, graphene sheet with magnetism, semi-conducting BCN compounds, graphite intercalation compounds, exfoliated carbon fiber, etc. have been found and developed. To extend the concept further, it is important to make it into intelligent materials by incorporating multiple functions. One example of the multi-functionalization is the development of homo-atomic Carbon Alloys from glassy carbon (GC) that exhibits high electrical conductivity and low gas permeability after treatment at critical conditions. Glassy carbon underwent metamorphosis to graphite spheres at HIP condition, and improved resistance to oxidation after alloying with Ta. The other one is shape utilization of the nano-sized carbon by understanding the effect of its large surfaces or interfaces in nanotechnology treatment. Recently carbon nanofiber was produced by polymer blend technology (PB) which was proposed by Prof. A. Oya during the Carbon Alloy project and progressed into intelligent carbon nanofiber (CNF) materials. CNF is combined into the polymer composites which is a candidate material for the bipolar separator in fuel cell. The superior properties, i.e., high electrical conductivity, high modulus, high strength, etc., of the CNF is being utilized in the preparation of this polymer composite.

  16. Synthesis of shape memory alloys using electrodeposition

    Science.gov (United States)

    Hymer, Timothy Roy

    Shape memory alloys are used in a variety of applications. The area of micro-electro-mechanical systems (MEMS) is a developing field for thin film shape memory alloys for making actuators, valves and pumps. Until recently thin film shape memory alloys could only be made by rapid solidification or sputtering techniques which have the disadvantage of being "line of sight". At the University of Missouri-Rolla, electrolytic techniques have been developed that allow the production of shape memory alloys in thin film form. The advantages of this techniques are in-situ, non "line of sight" and the ability to make differing properties of the shape memory alloys from one bath. This research focused on the electrodeposition of In-Cd shape memory alloys. The primary objective was to characterize the electrodeposited shape memory effect for an electrodeposited shape memory alloy. The effect of various operating parameters such as peak current density, temperature, pulsing, substrate and agitation were investigated and discussed. The electrodeposited alloys were characterized by relative shape memory effect, phase transformation, morphology and phases present. Further tests were performed to optimize the shape memory by the use of a statistically designed experiment. An optimized shape memory effect for an In-Cd alloy is reported for the conditions of the experiments.

  17. First-principles study on the effect of alloying elements on the elastic deformation response in β-titanium alloys

    International Nuclear Information System (INIS)

    Gouda, Mohammed K.; Gepreel, Mohamed A. H.; Nakamura, Koichi

    2015-01-01

    Theoretical deformation response of hypothetical β-titanium alloys was investigated using first-principles calculation technique under periodic boundary conditions. Simulation was carried out on hypothetical 54-atom supercell of Ti–X (X = Cr, Mn, Fe, Zr, Nb, Mo, Al, and Sn) binary alloys. The results showed that the strength of Ti increases by alloying, except for Cr. The most effective alloying elements are Nb, Zr, and Mo in the current simulation. The mechanism of bond breaking was revealed by studying the local structure around the alloying element atom with respect to volume change. Moreover, the effect of alloying elements on bulk modulus and admissible strain was investigated. It was found that Zr, Nb, and Mo have a significant effect to enhance the admissible strain of Ti without change in bulk modulus

  18. Synergistic alloying effect on microstructural evolution and mechanical properties of Cu precipitation-strengthened ferritic alloys

    International Nuclear Information System (INIS)

    Wen, Y.R.; Li, Y.P.; Hirata, A.; Zhang, Y.; Fujita, T.; Furuhara, T.; Liu, C.T.; Chiba, A.; Chen, M.W.

    2013-01-01

    We report the influence of alloying elements (Ni, Al and Mn) on the microstructural evolution of Cu-rich nanoprecipitates and the mechanical properties of Fe–Cu-based ferritic alloys. It was found that individual additions of Ni and Al do not give rise to an obvious strengthening effect, compared with the binary Fe–Cu parent alloy, although Ni segregates at the precipitate/matrix interface and Al partitions into Cu-rich precipitates. In contrast, the co-addition of Ni and Al results in the formation of core–shell nanoprecipitates with a Cu-rich core and a B2 Ni–Al shell, leading to a dramatic improvement in strength. The coarsening rate of the core–shell precipitates is about two orders of magnitude lower than that of monolithic Cu-rich precipitates in the binary and ternary Fe–Cu alloys. Reinforcement of the B2 Ni–Al shells by Mn partitioning further improves the strength of the precipitation-strengthened alloys by forming ultrastable and high number density core–shell nanoprecipitates

  19. Requirements of titanium alloys for aeronautical industry

    Science.gov (United States)

    Ghiban, Brânduşa; Bran, Dragoş-Teodor; Elefterie, Cornelia Florina

    2018-02-01

    The project presents the requirements imposed for aeronatical components made from Titanium based alloys. Asignificant portion of the aircraft pylons are manufactured from Titanium alloys. Strength, weight, and reliability are the primary factors to consider in aircraft structures. These factors determine the requirements to be met by any material used to construct or repair the aircraft. Many forces and structural stresses act on an aircraft when it is flying and when it is static and this thesis describes environmental factors, conditions of external aggression, mechanical characteristics and loadings that must be satisfied simultaneously by a Ti-based alloy, compared to other classes of aviation alloys (as egg. Inconel super alloys, Aluminum alloys). For this alloy class, the requirements are regarding strength to weight ratio, reliability, corrosion resistance, thermal expansion and so on. These characteristics additionally continue to provide new opportunities for advanced manufacturing methods.

  20. Mechanical behaviour of aluminium-lithium alloys

    Indian Academy of Sciences (India)

    Aluminium-lithium alloys hold promise of providing a breakthrough response to the crying need for lightweight alloys for use as structurals in aerospace applications. Considerable worldwide research has gone into developing a range of these alloys over the last three decades. As a result, substantial understanding has ...

  1. Corrosion Behaviour of New Zr Alloys

    DEFF Research Database (Denmark)

    Tolksdorf, E.

    1974-01-01

    Corrosion studies have indicated that the most promising replacements for Zicaloy-2 are ZrCrFe, ZrVFe and probably ZrNbTa, provided they are in their optimized condition. These alloys are conventionally manufactured alloys. An internally oxidized ZrMgO alloy is even superior, from the corrosion...

  2. Argon-arc welding of heat resisting aluminium alloys

    International Nuclear Information System (INIS)

    Ryazantsev, V.I.; Fedoseev, V.A.

    1997-01-01

    Welding of aluminium heat resisting alloys of the Al-Cu-Mg system is studied. The hot-shortness of heat-resistant alloys M40, 1150 and 1151 are at the level of aluminium alloys 1201 and by 2-3 times lower as compared to the aluminium alloy AMg6. The M40, 1150 and 1151 alloys have unquestionable advantages against other know aluminium alloys only at temperatures of welded structures operation, beginning with 150-2000 deg C and especially at 250 deg C

  3. Recent research and developments on wrought magnesium alloys

    Directory of Open Access Journals (Sweden)

    Sihang You

    2017-09-01

    Full Text Available Wrought magnesium alloys attract special interests as lightweight structural material due to their homogeneous microstructure and enhanced mechanical properties compared to as-cast alloys. In this contribution, recent research and developments on wrought magnesium alloys are reviewed from the viewpoint of the alloy design, focusing on Mg-Al, Mg-Zn and Mg-rare earth (RE systems. The effects of different alloying elements on the microstructure and mechanical properties are described considering their strengthening mechanisms, e.g. grain refinement, precipitation and texture hardening effect. Finally, the new alloy design and also the future research of wrought magnesium alloys to improve their mechanical properties are discussed.

  4. Effect of alloying elements on σ phase formation in Fe-Cr-Mn alloys

    International Nuclear Information System (INIS)

    Okazaki, Yoshimitsu; Miyahara, Kazuya; Hosoi, Yuzo; Tanino, Mitsuru; Komatsu, Hazime.

    1989-01-01

    Alloys of Fe-(8∼12%) Cr-(5∼30%) Mn were solution-treated at 1373 K for 3.6 ks, followed by cold-working of 50% reduction. Both solution-treated and 50% cold-worked materials were aged in the temperature range from 773 to 973 K for 3.6 x 10 3 ks. The identification of σ phase formation was made by using X-ray diffraction from the electrolytically extracted residues of the aged specimens. The region of σ phase formation determined by the present work is wider than that on the phase diagram already reported. It is to be noted that Mn promotes markedly the σ phase formation, and that three different types of σ phase formation are observed depending on Mn content: α→γ + α→γ + α + σ in 10% Mn, α→γ + σ in 15 to 20% Mn alloys, α→χ(Chi) →χ + σ + γ in 25 to 30% Mn alloys. An average electron concentration (e/a) in the σ phase was estimated by quantitative analysis of alloying elements using EPMA. The e/a value in the σ phase formed in Fe-(12∼16%) Cr-Mn alloys aged at 873 K for 3.6 x 10 3 ks is about 7.3, which is independent of Mn content. In order to prevent σ phase formation in Fe-12% Cr-15% Mn alloy, the value of Ni * eq of 11 (Ni * eq = Ni + 30(C) + 25(N)) is required. (author)

  5. Grindability of cast Ti-Cu alloys.

    Science.gov (United States)

    Kikuchi, Masafumi; Takada, Yukyo; Kiyosue, Seigo; Yoda, Masanobu; Woldu, Margaret; Cai, Zhuo; Okuno, Osamu; Okabe, Toru

    2003-07-01

    The purpose of the present study was to evaluate the grindability of a series of cast Ti-Cu alloys in order to develop a titanium alloy with better grindability than commercially pure titanium (CP Ti), which is considered to be one of the most difficult metals to machine. Experimental Ti-Cu alloys (0.5, 1.0, 2.0, 5.0, and 10.0 mass% Cu) were made in an argon-arc melting furnace. Each alloy was cast into a magnesia mold using a centrifugal casting machine. Cast alloy slabs (3.5 mm x 8.5 mm x 30.5 mm), from which the hardened surface layer (250 microm) was removed, were ground using a SiC abrasive wheel on an electric handpiece at four circumferential speeds (500, 750, 1000, or 1250 m/min) at 0.98 N (100 gf). Grindability was evaluated by measuring the amount of metal volume removed after grinding for 1min. Data were compared to those for CP Ti and Ti-6Al-4V. For all speeds, Ti-10% Cu alloy exhibited the highest grindability. For the Ti-Cu alloys with a Cu content of 2% or less, the highest grindability corresponded to an intermediate speed. It was observed that the grindability increased with an increase in the Cu concentration compared to CP Ti, particularly for the 5 or 10% Cu alloys at a circumferential speed of 1000 m/min or above. By alloying with copper, the cast titanium exhibited better grindability at high speed. The continuous precipitation of Ti(2)Cu among the alpha-matrix grains made this material less ductile and facilitated more effective grinding because small broken segments more readily formed.

  6. Corrosion of cast and non equilibrium magnesium alloys

    International Nuclear Information System (INIS)

    Mathieu, S.; Rapin, C.; Steinmetz, P.; Hazan, J.

    1999-01-01

    Due to their low density, magnesium alloys arc very promising as regards applications in the automotive or aeronautical industry. Their corrosion resistance has however to be increased, particularly for cast alloys which are very often two-phased and thus suffer from internal galvanic corrosion. With use of sputtering methods of elaboration, homogeneous magnesium alloys containing far from equilibrium Al, Zr or valve metals contents can be prepared. Corrosion data for Mg-Al-Zn-Sn alloys and MgZr alloys obtained by sputtering, have been determined and compared to those of cast and thixocast AZ91 alloy. Electrochemical tests have evidenced a significantly better behaviour of non equilibrium alloys which, thanks to XPS measurements, could be correlated to the composition of the superficial oxide scale formed on these alloys. (author)

  7. Effects of alloying elements on nodular and uniform corrosion resistance of zirconium-based alloys

    International Nuclear Information System (INIS)

    Abe, Katsuhiro

    1992-01-01

    The effects of alloying and impurity elements (tin, iron, chromium, nickel, niobium, tantalum, oxygen, aluminum, carbon, nitrogen, silicon, and phosphorus) on the nodular and uniform corrosion resistance of zirconium-based alloys were studied. The improving effect of iron, nickel and niobium in nodular corrosion resistance were observed. The uniform corrosion resistance was also improved by nickel, niobium and tantalum. The effects of impurity elements, nitrogen, aluminum and phosphorus were negligibly small but increasing the silicon content seemed to improve slightly the uniform corrosion resistance. Hydrogen pick-up fraction were not changed by alloying and impurity elements except nickel. Nickel addition increased remarkably hydrogen pick-up fraction. Although the composition of secondary precipitates changed with contents of alloying elements, the correlation of composition of secondary precipitates to corrosion resistance was not observed. (author)

  8. Rotary Friction Welding of Weight Heavy Alloy with Wrought AlMg3 Alloy for Subcaliber Ammunition

    Directory of Open Access Journals (Sweden)

    Olgierd Janusz Goroch

    2017-12-01

    Full Text Available The results of studies concerning friction welding of Weight Heavy Alloy (WHA with AlMg3 alloy are presented. The friction welding of density 17,5 Mg/m3 with aluminum alloy showed that it is possible to reach the joints with the strength exceeding the yield strength of wrought AlMg3 alloy. This strength looks to be promising from point of view of condition which have to be fulfilled in case of armor subcaliber ammunition, where WHA rods play the role Kinetic Energy Penetrators and aluminum is used for projectile ballistic cup.

  9. Effect of ternary alloying elements on microstructure and mechanical property of Nb-Si based refractory intermetallic alloy

    International Nuclear Information System (INIS)

    Kim, W.Y.; Kim, H.S.; Kim, S.K.; Ra, T.Y.; Kim, M.S.

    2005-01-01

    Microstructure and mechanical property at room temperature and at 1773 K of Nb-Si based refractory intermetallic alloys were investigated in terms of compression and fracture toughness test. Mo and V were chosen as ternary alloying elements because of their high melting points, atomic sizes smaller than Nb. Both ternary alloying elements were found to have a significant role in modifying the microstructure from dispersed structure to eutectic-like structure in Nb solid solution/Nb 5 Si 3 intermetallic composites. The 0.2% offset yield strength at room temperature increased with increasing content of ternary elements in Nb solid solution and volume fraction of Nb 5 Si 3 . At 1773 K, Mo addition has a positive role in increasing the yield strength. On the other hand, V addition has a role in decreasing the yield strength. The fracture toughness of ternary alloys was superior to binary alloys. Details will be discussed in correlation with ternary alloying, volume fraction of constituent phase, and the microstructure. (orig.)

  10. Effect of low-temperature thermomechanical treatment on mechanical properties of low-alloying molybdenum alloys with carbide hardening

    International Nuclear Information System (INIS)

    Bernshtejn, L.M.; Zakharov, A.M.; Veller, M.V.

    1978-01-01

    Presented are results of testing low-temperature thermomechanical treatment of low-alloying molybdenum alloys, including quenching from 2100 deg C, 40% deformation by hydroextrusion and aging at the temperature of 1200-1400 deg C. Tensile tests at room temperature with the following processing of results have shown that low-temperature thermomechanical treatment of low-alloying molybdenum alloys of Mo-Zr-C and Mo-Zr-Nb-C systems leads to a significant increase in low-temperature mechanical properties (strength properties - by 30-35%, ductility - by 30-40%) as compared with conventional heat treatment (aging after quenching). The treatment proposed increases resistance to small, as well as large plastic deformations, and leads to a simultaneous rise of strength and plastic properties at all stages of tensile test. Alloying of the Mo-Zr-C system with niobium increases both strength and plastic characteristics as compared with alloys without niobium when testing samples, subjected to low temperature thermomechanical treatment and conventional heat treatment at room temperature

  11. Annex 5 - Fabrication of U-Al alloy

    International Nuclear Information System (INIS)

    Drobnjak, Dj.; Lazarevic, Dj.; Mihajlovic, A.

    1961-01-01

    Alloy U-Al with low content of aluminium is often used for fabrication of fuel elements because it is stable under moderate neutron flux density. Additionally this type of alloys show much better characteristics than pure uranium under reactor operating conditions (temperature, mechanical load, corrosion effect of water). This report contains the analysis of the phase diagram of U-Al alloy with low content of aluminium, applied procedure for alloying and casting with detailed description of equipment. Characteristics of the obtained alloy are described and conclusions about the experiment and procedure are presented [sr

  12. An introduction to surface alloying of metals

    CERN Document Server

    Hosmani, Santosh S; Goyal, Rajendra Kumar

    2014-01-01

    An Introduction to Surface Alloying of Metals aims to serve as a primer to the basic aspects of surface alloying of metals. The book serves to elucidate fundamentals of surface modification and their engineering applications. The book starts with basics of surface alloying and goes on to cover key surface alloying methods, such as carburizing, nitriding, chromizing, duplex treatment, and the characterization of surface layers. The book will prove useful to students at both the undergraduate and graduate levels, as also to researchers and practitioners looking for a quick introduction to surface alloying.

  13. Influence of graphite-alloy interactions on corrosion of Ni-Mo-Cr alloy in molten fluorides

    Science.gov (United States)

    Ai, Hua; Hou, Juan; Ye, Xiang-Xi; Zeng, Chao Liu; Sun, Hua; Li, Xiaoyun; Yu, Guojun; Zhou, Xingtai; Wang, Jian-Qiang

    2018-05-01

    In this study, the effects of graphite-alloy interaction on corrosion of Ni-Mo-Cr alloy in molten FLiNaK salt were investigated. The corrosion tests of Ni-Mo-Cr alloys were conducted in graphite crucibles, to examine the differences of test specimens in conditions of electric contact and isolated with graphite, respectively. The corrosion attack is severer with more weight loss and deeper Cr depletion layer in samples electric contact with graphite than those isolated with graphite. The occurrence of galvanic corrosion between alloy specimens and graphite container was confirmed by electrochemical measurement. The corrosion is controlled by nonelectric transfer in isolated test while electrochemical reaction accelerated corrosion in electric contact test.

  14. Systematic corrosion investigation of various Cu-Sn alloys electrodeposited on mild steel in acidic solution: Dependence of alloy composition

    Energy Technology Data Exchange (ETDEWEB)

    Suerme, Yavuz, E-mail: ysurme@nigde.edu.t [Department of Chemistry, Faculty of Science and Art, Nigde University, 51200 Nigde (Turkey); Guerten, A. Ali [Department of Chemistry, Faculty of Science and Art, Osmaniye Korkut Ata University, 80000 Osmaniye (Turkey); Bayol, Emel; Ersoy, Ersay [Department of Chemistry, Faculty of Science and Art, Nigde University, 51200 Nigde (Turkey)

    2009-10-19

    Copper-tin alloy films were galvanostatically electrodeposited on the mild steel (MS) by combining the different amount of Cu and Sn electrolytes at a constant temperature (55 deg. C) and pH (3.5). Alloy films were characterized by using the energy dispersive X-ray analysis (EDX), scanning electron microscopy (SEM), X-ray diffraction (XRD) and micrographing techniques. Corrosion behaviours were evaluated with electrochemical impedance spectrometry (EIS) and electrochemical polarization measurements. Time gradient of electrolysis process was adjusted to obtain same thickness of investigated alloys on MS. The systematic corrosion investigation of various Cu{sub x}-Sn{sub 100-x} (x = 0-100) alloy depositions on MS substrate were carried out in 0.1 M sulphuric acid medium. Results indicate that the corrosion resistance of the alloy coatings depended on the alloy composition, and the corrosion resistance increased at Cu-Sn alloy deposits in proportion to Sn ratio.

  15. Nickel aluminide alloy suitable for structural applications

    Science.gov (United States)

    Liu, C.T.

    1998-03-10

    Alloys are disclosed for use in structural applications based upon NiAl to which are added selected elements to enhance room temperature ductility and high temperature strength. Specifically, small additions of molybdenum produce a beneficial alloy, while further additions of boron, carbon, iron, niobium, tantalum, zirconium and hafnium further improve performance of alloys at both room temperature and high temperatures. A preferred alloy system composition is Ni--(49.1{+-}0.8%)Al--(1.0{+-}0.8%)Mo--(0.7 + 0.5%)Nb/Ta/Zr/Hf--(nearly zero to 0.03%)B/C, where the % is at. % in each of the concentrations. All alloys demonstrated good oxidation resistance at the elevated temperatures. The alloys can be fabricated into components using conventional techniques. 4 figs.

  16. Effect of alloying elements on the stability of Ni2M in Alloy690 based upon thermodynamic calculation

    International Nuclear Information System (INIS)

    Horiuchi, Toshiaki; Kuwano, Kazuhiro; Satoh, Naohiro

    2012-01-01

    Some researchers recently point out that Ni based alloys used in nuclear power plants have the ordering tendency, which is a potential to decrease mechanical properties within the expected lifetime of the plants. In the present study, authors evaluated the effect of 8 alloying elements on the ordering tendency in Alloy690 based upon thermodynamic calculation by Thermo-Calc. It is clarified that the additive amount of Fe, Cr, Ti and Si, particularly Fe and Cr, was influential for the stability of Ni 2 M, while that of Mn, Cu, B and C had almost no effect for that. Authors therefore designed the Ni 2 M stabilized alloy by no addition of Fe in Alloy690. Ni 2 M is estimated to be stable even at 773 K in the Ni 2 M stabilized alloy. The influence by long range ordering or precipitating of Ni 2 M in Alloy690 for mechanical properties or SCC susceptibility is expected to be clarified by the sample obtained in the present study. (author)

  17. Applications of shape memory alloys in Japan

    International Nuclear Information System (INIS)

    Asai, M.; Suzuki, Y.

    2000-01-01

    In Japan, a first application of shape memory TiNi alloy was a moving flap in an air-conditioner which was developed as sensing function of shape memory alloy at Matsushista Electric Industrial Co. Then, shape memory utilized in a coffee maker, an electric rice-cooker, a thermal mixing valve and etc. were commercialized in Japan. And brassiere wires, a guide wire for medical treatment, an antenna for portable telephone and others were commercialized utilizing superelasticity. At the same time with these commercial products, there was not only progress in fabrication technology to effect accurate transformation temperature, but also the discovery of small hysteresis alloy such as R-phase or TiNiCu alloy and low transformation temperature alloy such as TiNiFe, TiNiV and TiNiCo alloys. Therefore the shape memory alloy market has expanded widely to electric appliances, automobile, residence, medical care and other field today. (orig.)

  18. Activation analyses for different fusion structural alloys

    International Nuclear Information System (INIS)

    Attaya, H.; Smith, D.

    1991-01-01

    The leading candidate structural materials, viz., the vanadium alloys, the nickel or the manganese stabilized austenitic steels, and the ferritic steels, are analysed in terms of their induced activation in the TPSS fusion power reactor. The TPSS reactor has 1950 MW fusion power and inboard and outboard average neutron wall loading of 3.75 and 5.35 MW/m 2 respectively. The results shows that, after one year of continuous operation, the vanadium alloys have the least radioactivity at reactor shutdown. The maximum difference between the induced radioactivity in the vanadium alloys and in the other iron-based alloys occurs at about 10 years after reactor shutdown. At this time, the total reactor radioactivity, using the vanadium alloys, is about two orders of magnitude less than the total reactor radioactivity utilizing any other alloy. The difference is even larger in the first wall, the FW-vanadium activation is 3 orders of magnitude less than other alloys' FW activation. 2 refs., 7 figs

  19. Corrosion of high-density sintered tungsten alloys

    International Nuclear Information System (INIS)

    Batten, J.J.; Moore, B.T.

    1989-01-01

    In comparative corrosion tests, the corrosion resistance of an Australian tungsten alloy (95% W, 3.5% Ni, 1.5% Fe) was found to be superior to three other tungsten alloys and, under certain conditions, even more corrosion-resistant than pure tungsten. Corrosion resistance was evaluated after immersion in both distilled water and 5% sodium chloride solutions, and in cyclic humidity and salt mist environments. For all but the Australian alloy, the rate of corrosion in sodium chloride solution was markedly less than that in distilated water. In all cases, alloys containing copper had the greatest corrosion rates. Corrosion mechanisms were investigated using a scanning electron microscope, analysis of corrosion products and galvanic corrosion studies. For the alloys, corrosion was attributed primarily to a galvanic reaction. Whether the tungsten or binder phase of the alloy became anodic, and thus was attacked preferentially, depended upon alloy composition and corrosion environment. 16 refs., 4 tabs., 4 figs

  20. Grain Refinement of an Al-2 wt%Cu Alloy by Al3Ti1B Master Alloy and Ultrasonic Treatment

    International Nuclear Information System (INIS)

    Wang, E Q; Wang, G; Dargusch, M S; StJohn, D H; Qian, M; Eskin, D G

    2016-01-01

    Both inoculation by AlTiB master alloys and Ultrasonic Treatment (UT) are effective methods of refining the grain size of aluminium alloys. The present study investigates the influence of UT on the grain refinement of an Al-2 wt% Cu alloy with a range of Al3TilB master alloy additions. When the alloy contains the smallest amount of added master alloy, UT caused significant additional grain refinement compared with that provided by the master alloy only. However, the influence of UT on grain size reduces with increasing addition of the master alloy. Plotting the grain size data versus the inverse of the growth restriction factor (Q) reveals that the application of UT causes both an increase in the number of potentially active nuclei and a decrease in the size of the nucleation free zone due to a reduction in the temperature gradient throughout the melt. Both these factors promote the formation of a fine equiaxed grain structure. (paper)

  1. Influence of the selected alloy additions on limiting the phase formation in Cu-Zn alloys

    OpenAIRE

    J. Kozana; St. Rzadkosz; M. Piękoś

    2010-01-01

    Influence of the selected alloy additions into copper and zinc alloys was investigated in order to find out the possibility of limiting the precipitation of unfavourable phase . The observation of microstructures and strength tests were performed. The results of metallographic and strength investigations indicate positive influence of small amounts of nickel, cobalt or tellurium. The precise determination of the influence of the selected alloy additions on limiting the gamma phase formation ...

  2. Refining U-Zr-Nb alloys by remelting

    International Nuclear Information System (INIS)

    Aguiar, B.M.; Kniess, C.T.; Riella, H.G.; Ferraz, W.B.

    2011-01-01

    The high density U-Zr-Nb and U-Nb uranium-based alloys can be employed as nuclear fuel in a PWR reactor due to their high density and nuclear properties. These alloys can stabilize the gamma phase, however, according to TTT diagrams, at the working temperature of a PWR reactor, all gamma phase transforms to α'' phase in a few hours. To avoid this kind of transformation during the nuclear reactor operation, the U-Zr-Nb alloy and U-Nn are used in α'' phase. The stability of α'' phase depends on the alloy composition and cooling rate. The alloy homogenization has to be very effective to eliminate precipitates rich in Zr and Nb to avoid changes in the alloying elements contents in the matrix. The homogenization was obtained by remelting the alloy and keeping it in the liquid state for enough time to promote floating of the precipitates (usually carbides, less dense) and leaving the matrix free of precipitates. However, this floating by density difference may result in segregation between the alloying elements (Nb and Zr, at the top) and uranium (at the bottom). The homogenized alloys were characterized in terms of metallographic techniques, optical microscopy, scanning electronic microscopy, EDS and X-ray diffraction. In this paper, it is shown that the contents of Zr and Nb at the bottom and at the top of the matrix are constant. (author)

  3. Metal-ceramic alloys in dentistry: a review.

    Science.gov (United States)

    Roberts, Howard W; Berzins, David W; Moore, B Keith; Charlton, David G

    2009-02-01

    The purpose of this article is to review basic information about the alloys used for fabricating metal-ceramic restorations in dentistry. Their compositions, properties, advantages, and disadvantages are presented and compared. In addition to reviewing traditional noble-metal and base-metal metal-ceramic alloys, titanium and gold composite alloys are also discussed. A broad search of the published literature was performed using Medline to identify pertinent current articles on metal-ceramic alloys as well as articles providing a historical background about the development of these alloys. Textbooks, the internet, and manufacturers' literature were also used to supplement this information. The review discusses traditional as well as more recently-developed alloys and technologies used in dentistry for fabricating metal-ceramic restorations. Clear advantages and disadvantages for these alloy types are provided and discussed as well as the role that compositional variations have on the alloys' performance. This information should enable clinicians and technicians to easily identify the important physical properties of each type and their primary clinical indications. A number of alloys and metals are available for metal-ceramic use in dentistry. Each has its advantages and disadvantages, primarily based on its specific composition. Continuing research and development are resulting in the production of new technologies and products, giving clinicians even more choices in designing and fabricating metal-ceramic restorations.

  4. Internal chlorination of Ni-Cr alloys

    Energy Technology Data Exchange (ETDEWEB)

    Berztiss, D.; Hennesen, K.; Grabke, H.J. [Max-Planck-Institut fuer Eisenforschung GmbH, Duesseldorf (Germany)

    1998-12-31

    In contrast to internal oxidation, sulfidation and carburization, very little information is available regarding internal chlorination, especially diffusion of chlorine in metallic alloys. This paper describes results of experiments on Ni-Cr alloys (<10 wt% Cr) exposed in an atmosphere containing radioactive HCl. The diffusion of chlorine in the alloy can be determined by measurement of residual {beta}-activity from the sample surface. Successively thin layers (0.5-10 {mu}m) of the alloy were removed by lapping and the surface activity was measured to obtain a depth profile. Both single and polycrystalline materials were tested. Through this work it should be determined if there is in fact solubility and diffusion of chlorine in Ni-based alloys as some authors have proposed or if the ingress of chlorine is mainly a grain boundary phenomenon. (orig.)

  5. SINTERED REFRACTORY TUNGSTEN ALLOYS. Gesinterte hochschmelzende wolframlegierungen

    Energy Technology Data Exchange (ETDEWEB)

    Kieffer, R.; Sedlatschek, K.; Braun, H.

    1971-12-15

    Dependence of the melting point of the refractory metals on their positions in the periodic system - alloys of tungsten with other refractory metals - sintering of the alloys - processing of the alloys - technological properties.

  6. Fabrication and mechanical behavior of bulk nanoporous Cu via chemical de-alloying of Cu–Al alloys

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Fei, E-mail: chenfei027@gmail.com [State Key Lab of Advanced Technology for Materials Synthesis and Processing, Wuhan University of Technology, Wuhan 430070 (China); Chen, Xi; Zou, Lijie; Yao, Yao; Lin, Yaojun; Shen, Qiang [State Key Lab of Advanced Technology for Materials Synthesis and Processing, Wuhan University of Technology, Wuhan 430070 (China); Lavernia, Enrique J. [Department of Chemical Engineering and Materials Science, University of California at Irvine, Irvine, CA 92697 (United States); Zhang, Lianmeng, E-mail: lmzhang@whut.edu.cn [State Key Lab of Advanced Technology for Materials Synthesis and Processing, Wuhan University of Technology, Wuhan 430070 (China)

    2016-04-13

    We report on a study of the influence of microstructure on the mechanical behavior of bulk nanoporous Cu fabricated by chemical de-alloying of Cu{sub 50}Al{sub 50}, Cu{sub 40}Al{sub 60}, Cu{sub 33}Al{sub 67} and Cu{sub 30}Al{sub 70} (at%) alloys. The precursor Cu–Al alloys were fabricated using arc melting and bulk nanoporous Cu was obtained by subsequent de-alloying of Cu–Al alloys in 20 wt% NaOH aqueous solution at a temperature of 65 °C. We studied the microstructure of the precursor Cu–Al alloys, as well as that of the as de-alloyed bulk nanoporous Cu, using X-ray diffraction, scanning electron microscopy and energy dispersive spectrometry. Moreover, the compressive strength of bulk nanoporous Cu was measured and the relationship between microstructure and mechanical properties was studied. Our results show that the microstructure of bulk nanoporous Cu is characterized by bi-continuous interpenetrating ligament-channels with a ligament size of 130±20 nm (for Cu{sub 50}Al{sub 50}), 170±20 nm (for Cu{sub 40}Al{sub 60}) and 160±10 nm (for Cu{sub 33}Al{sub 67}). Interestingly the microstructure of de-alloyed Cu{sub 30}Al{sub 70} is bimodal with nanopores (100's nm) and interspersed featureless regions a few microns in size. The compressive strength increased with decreasing volume fraction of porosity; as porosity increased 56.3±2% to 73.9±2%, the compressive strength decreased from 17.18±1 MPa to 2.71±0.5 MPa.

  7. Nucleation of dislocation loops during irradiation in binary FCC alloys with different alloy compositions

    International Nuclear Information System (INIS)

    Hashimoto, T.; Shigenaka, N.; Fuse, M.

    1992-01-01

    Dislocation loop nucleation is analyzed using a rate theory based model for face-centered cubic (fcc) binary alloys containing A- and B-atoms. In order to calculate the nucleation process in concentrated alloys, the model considers three types of interstitial dumbbells composed of A- and B-atoms, AA-, BB-, and AB-type dumbbells. Conversions between these interstitial dumbbells are newly introduced in the formulation in consideration of dumbbell configurations and movements. The model also includes reactions, such as point defect production by irradiation, mutual recombination of an interstitial and a vacancy, and dislocation loop nucleation and growth. Parameter values are chosen based on the atom size of the alloy component elements, and dislocation loop nucleation kinetics are investigated while varying alloy compositions. Two different types of kinetics are obtained in accordance with the dominant loop nucleus type. The migration energy difference of AA- and BB-type interstitial dumbbells is important in the determination of the dominant loop nucleus type. The present model predicts that the dislocation loop concentration decrease with increasing under sized atoms content, but defect production rate and temperature dependences of loop concentration are insensitive to alloy compositions. (author)

  8. Phase decomposition in a mechanically alloyed Cu-44.5 at%Ni-22.5 at%Fe alloy during isothermal aging

    International Nuclear Information System (INIS)

    Lopez-Hirata, Victor M.; Saucedo-Munoz, Maribel L.; Diaz-Barriga-Arceo, Lucia G.

    2006-01-01

    A supersaturated solid solution of Cu-44.5 at%Ni-22.5 at%Fe alloy was produced by ball milling of a pure chemical elemental mixture for 1080 ks. An fcc supersaturated solid solution with a grain size of about 20 nm was obtained after milling. This alloy was subsequently aged at 803, 898 and 1003 K for different times. The growth kinetics of the modulation wavelength was determined from the X-ray diffraction results and followed the Lifshitz-Slyozov-Wagner theory for a diffusion-controlled coarsening in the MA alloy after aging. The growth kinetics of composition modulation wavelength for the MA alloy was faster at 803 and 898 K than that for the same alloy composition obtained by a conventional processing and then aged at the same temperatures. The activation energy for the decomposed phase coarsening process in the MA alloy was lower than that corresponding to the conventionally-processed alloy. (author)

  9. Ductile transplutonium metal alloys

    Science.gov (United States)

    Conner, William V.

    1983-01-01

    Alloys of Ce with transplutonium metals such as Am, Cm, Bk and Cf have properties making them highly suitable as sources of the transplutonium element, e.g., for use in radiation detector technology or as radiation sources. The alloys are ductile, homogeneous, easy to prepare and have a fairly high density.

  10. Protective claddings for high strength chromium alloys

    Science.gov (United States)

    Collins, J. F.

    1971-01-01

    The application of a Cr-Y-Hf-Th alloy as a protective cladding for a high strength chromium alloy was investigated for its effectiveness in inhibiting nitrogen embrittlement of a core alloy. Cladding was accomplished by a combination of hot gas pressure bonding and roll cladding techniques. Based on bend DBTT, the cladding alloy was effective in inhibiting nitrogen embrittlement of the chromium core alloy for up to 720 ks (200hours) in air at 1422 K (2100 F). A significant increase in the bend DBTT occurred with longer time exposures at 1422 K or short time exposures at 1589 K (2400 F).

  11. United modification of Al-24Si alloy by Al-P and Al-Ti-C master alloys

    Institute of Scientific and Technical Information of China (English)

    韩延峰; 刘相法; 王海梅; 王振卿; 边秀房; 张均艳

    2003-01-01

    The modification effect of a new type of Al-P master alloy on Al-24Si alloys was investigated. It is foundthat excellent modification effect can be obtained by the addition of this new type of A1-P master alloy into Al-24Simelt and the average primary Si grain size is decreased below 47 μm from original 225 μm. It is also found that theTiC particles in the melt coming from Al8Ti2C can improve the modification effect of the Al-P master alloy. Whenthe content of TiC particles in the Al-24Si melt is 0.03 %, the improvement reaches the maximum and keeps steadywith increasing content of TiC particles. Modification effect occurs at 50 min after the addition of the Al-P master al-loy and TiC particles, and keeps stable with prolonging holding time.

  12. Mössbauer and XRD study of the Fe65Si35 alloy obtained by mechanical alloying

    International Nuclear Information System (INIS)

    Vélez, G. Y.; Rodríguez, R. R.; Melo, C. A.; Pérez Alcázar, G. A.; Zamora, Ligia E.; Tabares, J. A.

    2011-01-01

    A study was made on the alloy Fe 65 Si 35 using x-ray diffraction and Mössbauer spectrometry. The alloy was obtained by mechanical alloying in a high energy planetary mill, with milling times of 15, 30, 50, 75 and 100 h. The results show that in the alloys two structural phases are present, a Fe-Si BCC disordered phase and ferromagnetic, and a Fe-Si SC phase, whose nature is paramagnetic and which decreases with milling time. In the temporal evolution of the milling two stages are differentiated: one between 15 and 75 h of milling, in which silicon atoms diffuse into the bcc matrix of iron and its effect is to reduce the hyperfine magnetic field; the other, after 75 h of milling, where the alloy is consolidated, the effect of the milling is only to increase the disorder of the system, increasing the magnetic order.

  13. Three dimensional atom probe study of Ni-base alloy/low alloy steel dissimilar metal weld interfaces

    International Nuclear Information System (INIS)

    Choi, Kyoung Joon; Shin, Sang Hun; Kim, Jong Jin; Jung, Ju Ang; Kim, Ji Hyun

    2012-01-01

    Three dimensional atom probe tomography (3D APT) is applied to characterize the dissimilar metal joint which was welded between the Ni-based alloy, Alloy 690 and the low alloy steel, A533 Gr. B, with Alloy 152 filler metal. While there is some difficulty in preparing the specimen for the analysis, the 3D APT has a truly quantitative analytical capability to characterize nanometer scale particles in metallic materials, thus its application to the microstructural analysis in multicomponent metallic materials provides critical information on the mechanism of nanoscale microstructural evolution. In this study, the procedure for 3D APT specimen preparation was established, and those for dissimilar metal weld interface were prepared near the fusion boundary by a focused ion beam. The result of the analysis in this study showed the precipitation of chromium carbides near the fusion boundary between A533 Gr. B and Alloy 152.

  14. Three dimensional atom probe study of Ni-base alloy/low alloy steel dissimilar metal weld interfaces

    Energy Technology Data Exchange (ETDEWEB)

    Choi, Kyoung Joon; Shin, Sang Hun; Kim, Jong Jin; Jung, Ju Ang; Kim, Ji Hyun [Interdisciplinary School of Green Energy, Ulsan National Institute of Science and Technology, Ulsan (Korea, Republic of)

    2012-08-15

    Three dimensional atom probe tomography (3D APT) is applied to characterize the dissimilar metal joint which was welded between the Ni-based alloy, Alloy 690 and the low alloy steel, A533 Gr. B, with Alloy 152 filler metal. While there is some difficulty in preparing the specimen for the analysis, the 3D APT has a truly quantitative analytical capability to characterize nanometer scale particles in metallic materials, thus its application to the microstructural analysis in multicomponent metallic materials provides critical information on the mechanism of nanoscale microstructural evolution. In this study, the procedure for 3D APT specimen preparation was established, and those for dissimilar metal weld interface were prepared near the fusion boundary by a focused ion beam. The result of the analysis in this study showed the precipitation of chromium carbides near the fusion boundary between A533 Gr. B and Alloy 152.

  15. Shape-memory effect in Ti-Nb alloys

    International Nuclear Information System (INIS)

    Peradze, T.; Berikashvili, T.; Chelidze, T.; Gorgadze, K.; Bochorishvili, M.; Taktakishvili, M.

    2009-01-01

    The work deals with the investigation of the binary alloy of titanium with niobium and is aimed at demonstrating the functional-mechanical possibilities of Ti-Nb alloys from the viewpoint of their potential application in practice. The shape-memory effect, super elasticity and reactive stress in alloys of Ti-Nb system were studied. It turned out that the work carried out expanded the interval of Nb content in the investigated alloys from 25.9 to 33.1 wt%. The shape recovery made up not less than 90% at the deformation of 6-8%. The reactive stress reached 350-450 MPa. In the alloys under study another (high-temperature) shape-memory effect was found, and the influence of hydrogen and oxygen on the inelastic properties of alloys was studied. (author)

  16. Improving tribological properties of Ti-5Zr-3Sn-5Mo-15Nb alloy by double glow plasma surface alloying

    Energy Technology Data Exchange (ETDEWEB)

    Guo, Lili; Qin, Lin, E-mail: qinlin@tyut.edu.cn; Kong, Fanyou; Yi, Hong; Tang, Bin

    2016-12-01

    Highlights: • The Mo alloyed layers were successfully prepared on TLM surface by DG-PSA. • The surface microhardness of TLM is remarkably enhanced by Mo alloying. • The TLM samples after Mo alloying exhibit good wettability. • The Mo alloyed TLM samples show excellent tribological properties. - Abstract: Molybdenum, an alloying element, was deposited and diffused on Ti-5Zr-3Sn-5Mo-15Nb (TLM) substrate by double glow plasma surface alloying technology at 900, 950 and 1000 °C. The microstructure, composition distribution and micro-hardness of the Mo modified layers were analyzed. Contact angles on deionized water and wear behaviors of the samples against corundum balls in simulated human body fluids were investigated. Results show that the surface microhardness is significantly enhanced after alloying and increases with treated temperature rising, and the contact angles are lowered to some extent. More importantly, compared to as-received TLM alloy, the Mo modified samples, especially the one treated at 1000 °C, exhibit the significant improvement of tribological properties in reciprocating wear tests, with lower specific wear rate and friction coefficient. To conclude, Mo alloying treatment is an effective approach to obtain excellent comprehensive properties including optimal wear resistance and improved wettability, which ensure the lasting and safety application for titanium alloys as the biomedical implants.

  17. Corrosion resistant alloy uses in the power industry

    International Nuclear Information System (INIS)

    Nickerson, J.L.; Hall, F.A.; Asphahani, A.I.

    1989-01-01

    Nickel-base alloys have been used as cost-effective measures in a variety of severely corrosive situations in pollution control units for coal-fired power plants. Cost effectiveness and practical answers to corrosion problems are illustrated (specifically the wallpaper concept/metallic lining technique). Numerous cases of successful use of HASTELLOY alloys in Flue Gas Desulfurization (FGD) systems and hazardous waste treatment incineration scrubber systems are listed. In this paper developments in nickel-base alloys and their use in FGD and other segments of the power industry are discussed. In the Ni-Cr-Mo-W alloy family, the C-22 alloy has the best resistance to localized corrosion in halide environments (chloride/fluoride-containing solutions). This alloy is also used effectively as a universal filler metal to weld less-resistant alloys were weld corrosion may be a problem. Field performance of this alloy in the power industry is described

  18. Multi-functional magnesium alloys containing interstitial oxygen atoms.

    Science.gov (United States)

    Kang, H; Choi, H J; Kang, S W; Shin, S E; Choi, G S; Bae, D H

    2016-03-15

    A new class of magnesium alloys has been developed by dissolving large amounts of oxygen atoms into a magnesium lattice (Mg-O alloys). The oxygen atoms are supplied by decomposing titanium dioxide nanoparticles in a magnesium melt at 720 °C; the titanium is then completely separated out from the magnesium melt after solidification. The dissolved oxygen atoms are located at the octahedral sites of magnesium, which expand the magnesium lattice. These alloys possess ionic and metallic bonding characteristics, providing outstanding mechanical and functional properties. A Mg-O-Al casting alloy made in this fashion shows superior mechanical performance, chemical resistance to corrosion, and thermal conductivity. Furthermore, a similar Mg-O-Zn wrought alloy shows high elongation to failure (>50%) at room temperature, because the alloy plastically deforms with only multiple slips in the sub-micrometer grains (alloys are expected to open a new paradigm in commercial alloy design.

  19. Physical and welding metallurgy of Gd-enriched austenitic alloys for spent nuclear fuel applications. Part II, nickel base alloys

    International Nuclear Information System (INIS)

    Mizia, Ronald E.; Michael, Joseph Richard; Williams, David Brian; Dupont, John Neuman; Robino, Charles Victor

    2004-01-01

    The physical and welding a metallurgy of gadolinium- (Gd-) enriched Ni-based alloys has been examined using a combination of differential thermal analysis, hot ductility testing. Varestraint testing, and various microstructural characterization techniques. Three different matrix compositions were chosen that were similar to commercial Ni-Cr-Mo base alloys (UNS N06455, N06022, and N06059). A ternary Ni-Cr-Gd alloy was also examined. The Gd level of each alloy was ∼2 wt-%. All the alloys initiated solidification by formation of primary austenite and terminated solidification by a Liquid γ + Ni 5 Gd eutectic-type reaction at ∼1270 C. The solidification temperature ranges of the alloys varied from ∼100 to 130 C (depending on alloy composition). This is a substantial reduction compared to the solidification temperature range to Gd-enriched stainless steels (360 to 400 C) that terminate solidification by a peritectic reaction at ∼1060 C. The higher-temperature eutectic reaction that occurs in the Ni-based alloys is accompanied by significant improvements in hot ductility and solidification cracking resistance. The results of this research demonstrate that Gd-enriched Ni-based alloys are excellent candidate materials for nuclear criticality control in spent nuclear fuel storage applications that require production and fabrication of large amounts of material through conventional ingot metallurgy and fusion welding techniques

  20. Microstructure and magnetic behavior of Cu–Co–Si ternary alloy synthesized by mechanical alloying and isothermal annealing

    Energy Technology Data Exchange (ETDEWEB)

    Chabri, Sumit, E-mail: sumitchabri2006@gmail.com [Department of Metallurgy & Materials Engineering, Indian Institute of Engineering Science and Technology, Shibpur, Howrah 711103 (India); Bera, S. [Department of Metallurgical & Materials Engineering, National Institute of Technology, Durgapur 713209 (India); Mondal, B.N. [Department of Central Scientific Services, Indian Association for the Cultivation of Science, Jadavpur, Kolkata 700032 (India); Basumallick, A.; Chattopadhyay, P.P. [Department of Metallurgy & Materials Engineering, Indian Institute of Engineering Science and Technology, Shibpur, Howrah 711103 (India)

    2017-03-15

    Microstructure and magnetic behavior of nanocrystalline 50Cu–40Co–10Si (at%) alloy prepared by mechanical alloying and subsequent isothermal annealing in the temperature range of 450–650 °C have been studied. Phase evolution during mechanical alloying and isothermal annealing is characterized by X-ray diffraction (XRD), differential thermal analyzer (DTA), high resolution transmission electron microscopy (HRTEM) and magnetic measurement. Addition of Si has been found to facilitate the metastable alloying of Co in Cu resulting into the formation of single phase solid solution having average grain size of 9 nm after ball milling for 50 h duration. Annealing of the ball milled alloy improves the magnetic properties significantly and best combination of magnetic properties has been obtained after annealing at 550 °C for 1 h duration.

  1. Effect of stress on the superconducting transition temperature in indium, indium-alloy, tin, and tin-alloy whisker samples

    International Nuclear Information System (INIS)

    Cook, J.W. Jr.; Davis, W.T.; Chandler, J.H.; Skove, M.J.

    1977-01-01

    The dependence of the superconducting transition temperature (T/sub c/) on stress (sigma) for pure In and Sn samples was found to be in qualitative agreement with earlier work. For convenience T/sub c/ is expressed as a function of the experimentally measured strain (epsilon), which is proportional to sigma. The effect of alloying on the initial dependence of the T/sub c/-vs-epsilon curves, (per. delta T/sub c//per. delta epsilon)/sub epsilon = 0/ = eta, was quite different for the In and Sn alloys. The In samples were alloyed with a maximum of 4.8 at.% Tl, 7.9 at.% Sn, and 6.7 at.% Pd; the Sn samples were alloyed with a maximum of 0.3 at.% Cd, 6.0 at.% In, 0.3 at.% Sb, and 2.2 at.% Bi. The addition of impurities had a large effect on eta for the In alloys, with eta reversing sign for some Sn and Pb alloy contents (chi). The T/sub c/-vs-epsilon curves also became nonlinear for some chi. The possible relationship of the In alloy results to changes in the Fermi surface due to the addition of impurities is discussed. For the Sn alloy samples, there was no change in eta with any impurity. The change in room-temperature resistivity with strain was also measured. There was only a slight decrease in the dependence of resistivity on strain for the In--Sn and In--Pb data and no effect on the In--Tl or Sn alloy data

  2. Thermomechanical treatment of titanium alloys

    International Nuclear Information System (INIS)

    Khorev, A.K.

    1979-01-01

    The problems of the theory and practical application of thermomechanical treatment of titanium alloys are presented. On the basis of the systematic investigations developed are the methods of thermomechanical treatment of titanium alloys, established are the optimum procedures and produced are the bases of their industrial application with an account of alloy technological peculiarities and the procedure efficiency. It is found that those strengthening methods are more efficient at which the contribution of dispersion hardening prevails over the strengthening by phase hardening

  3. Fracture characteristics of uranium alloys by scanning electron microscopy

    International Nuclear Information System (INIS)

    Koger, J.W.; Bennett, R.K. Jr.

    1976-10-01

    The fracture characteristics of uranium alloys were determined by scanning electron microscopy. The fracture mode of stress-corrosion cracking (SCC) of uranium-7.5 weight percent niobium-2.5 weight percent zirconium (Mulberry) alloy, uranium--niobium alloys, and uranium--molybdenum alloys in aqueous chloride solutions is intergranular. The SCC fracture surface of the Mulberry alloy is characterized by very clean and smooth grain facets. The tensile-overload fracture surfaces of these alloys are characteristically ductile dimple. Hydrogen-embrittlement failures of the uranium alloys are brittle and the fracture mode is transgranular. Fracture surfaces of the uranium-0.75 weight percent titanium alloys are quasi cleavage

  4. Iron-titanium-mischmetal alloys for hydrogen storage

    Science.gov (United States)

    Sandrock, Gary Dale

    1978-01-01

    A method for the preparation of an iron-titanium-mischmetal alloy which is used for the storage of hydrogen. The alloy is prepared by air-melting an iron charge in a clay-graphite crucible, adding titanium and deoxidizing with mischmetal. The resultant alloy contains less than about 0.1% oxygen and exhibits a capability for hydrogen sorption in less than half the time required by vacuum-melted, iron-titanium alloys.

  5. Shape-Memory-Alloy Actuator For Flight Controls

    Science.gov (United States)

    Barret, Chris

    1995-01-01

    Report proposes use of shape-memory-alloy actuators, instead of hydraulic actuators, for aerodynamic flight-control surfaces. Actuator made of shape-memory alloy converts thermal energy into mechanical work by changing shape as it makes transitions between martensitic and austenitic crystalline phase states of alloy. Because both hot exhaust gases and cryogenic propellant liquids available aboard launch rockets, shape-memory-alloy actuators exceptionally suited for use aboard such rockets.

  6. Influence of liquid copper-silver brazing alloy on properties of high-strength and heat resistant alloys and steels

    International Nuclear Information System (INIS)

    Semenov, V.N.

    1999-01-01

    The influence of temperature, heating rate, microstructure, the duration of Cu-Ag melt attack during brazing, the thickness and the material of barrier coating on properties of materials (Ni-Cr alloys, Cr-Ni steals, a Fe-Ni base EhJ-702 alloy) being brazed is studied. The tests of specimens with a brazing alloy are carried out in the temperature range of 780-1000 deg C. It is revealed that heat resistant alloys under brazing conditions experience brittle fracture. Multiphase structure coarse grain, increased hydrogen content mechanical stress concentrators are found to intensity embrittlement of the materials. The use of barrier coating displaying a chemical affinity to the brazing alloy results in a decrease of the tendency to embrittlement

  7. The corrosion and passivity of sputtered Mg–Ti alloys

    International Nuclear Information System (INIS)

    Song, Guang-Ling; Unocic, Kinga A.; Meyer, Harry; Cakmak, Ercan; Brady, Michael P.; Gannon, Paul E.; Himmer, Phil; Andrews, Quinn

    2016-01-01

    Highlights: • A supersaturated single phase Mg–Ti alloy can be obtained by magnetron sputtering. • The anodic dissolution of Mg–Ti alloy is inhibited by Ti addition. • The alloy becomes passive when Ti content is high and the alloy has become Ti based. • The formation of a continuous thin passive film is responsible for the passivation of the alloy. - Abstract: This study explored the possibility of forming a “stainless” Mg–Ti alloy. The electrochemical behavior of magnetron-sputtered Mg–Ti alloys was measured in a NaCl solution, and the surface films on the alloys were examined by XPS, SEM and TEM. Increased corrosion resistance was observed with increased Ti content in the sputtered Mg–Ti alloys, but passive-like behavior was not reached until the Ti level (atomic %) was higher than the Mg level. The surface film that formed on sputtered Mg–Ti based alloys in NaCl solution was thick, discontinuous and non-protective, whereas a thin, continuous and protective Mg and Ti oxide film was formed on a sputtered Ti–Mg based alloy.

  8. Auger electron spectroscopy of alloys

    International Nuclear Information System (INIS)

    Kuijers, F.J.

    1978-01-01

    This thesis describes how the surface compositions of some alloys can be determined by Auger Electron Spectroscopy (AES). The motivation for this research and the reasons for the choice of alloy systems studied are formulated. The theoretical background of AES is briefly discussed and the apparatus used and the experimental procedures applied are described. Four alloy systems have been investigated in this thesis - Ni-Cu and Pd - Ag (consisting of a component active in most cataytic reactions - Ni and Pd; and a component which is almost inactive for a number of reactions - Cu and Ag) and Pt - Pd and Pt-Ir (consisting of two active components). Knowledge of the surface composition of the various alloy systems is shown to be essential for the interpretation of catalytic results. (Auth./C.F.)

  9. Machinability of experimental Ti-Ag alloys.

    Science.gov (United States)

    Kikuchi, Masafumi; Takahashi, Masatoshi; Okuno, Osamu

    2008-03-01

    This study investigated the machinability of experimental Ti-Ag alloys (5, 10, 20, and 30 mass% Ag) as a new dental titanium alloy candidate for CAD/CAM use. The alloys were slotted with a vertical milling machine and carbide square end mills under two cutting conditions. Machinability was evaluated through cutting force using a three-component force transducer fixed on the table of the milling machine. The horizontal cutting force of the Ti-Ag alloys tended to decrease as the concentration of silver increased. Values of the component of the horizontal cutting force perpendicular to the feed direction for Ti-20% Ag and Ti-30% Ag were more than 20% lower than those for titanium under both cutting conditions. Alloying with silver significantly improved the machinability of titanium in terms of cutting force under the present cutting conditions.

  10. Refining processes of selected copper alloys

    Directory of Open Access Journals (Sweden)

    S. Rzadkosz

    2009-04-01

    Full Text Available The analysis of the refining effectiveness of the liquid copper and selected copper alloys by various micro additions and special refiningsubstances – was performed. Examinations of an influence of purifying, modifying and deoxidation operations performed in a metal bath on the properties of certain selected alloys based on copper matrix - were made. Refining substances, protecting-purifying slag, deoxidation and modifying substances containing micro additions of such elements as: zirconium, boron, phosphor, sodium, lithium, or their compounds introduced in order to change micro structures and properties of alloys, were applied in examinations. A special attention was directed to macro and micro structures of alloys, their tensile and elongation strength and hot-cracks sensitivity. Refining effects were estimated by comparing the effectiveness of micro structure changes with property changes of copper and its selected alloys from the group of tin bronzes.

  11. Refining U-Zr-Nb alloys by remelting

    Energy Technology Data Exchange (ETDEWEB)

    Aguiar, B.M.; Kniess, C.T.; Riella, H.G., E-mail: bmaguiar@ipen.b [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), Sao Paulo, SP (Brazil); Ferraz, W.B. [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil)

    2011-07-01

    The high density U-Zr-Nb and U-Nb uranium-based alloys can be employed as nuclear fuel in a PWR reactor due to their high density and nuclear properties. These alloys can stabilize the gamma phase, however, according to TTT diagrams, at the working temperature of a PWR reactor, all gamma phase transforms to {alpha}'' phase in a few hours. To avoid this kind of transformation during the nuclear reactor operation, the U-Zr-Nb alloy and U-Nn are used in {alpha}'' phase. The stability of {alpha}'' phase depends on the alloy composition and cooling rate. The alloy homogenization has to be very effective to eliminate precipitates rich in Zr and Nb to avoid changes in the alloying elements contents in the matrix. The homogenization was obtained by remelting the alloy and keeping it in the liquid state for enough time to promote floating of the precipitates (usually carbides, less dense) and leaving the matrix free of precipitates. However, this floating by density difference may result in segregation between the alloying elements (Nb and Zr, at the top) and uranium (at the bottom). The homogenized alloys were characterized in terms of metallographic techniques, optical microscopy, scanning electronic microscopy, EDS and X-ray diffraction. In this paper, it is shown that the contents of Zr and Nb at the bottom and at the top of the matrix are constant. (author)

  12. Order/disorder in electrodeposited aluminum-titanium alloys

    Directory of Open Access Journals (Sweden)

    Stafford G.R.

    2003-01-01

    Full Text Available The composition, morphology, and crystallographic microstructure of Al-Ti alloys electrodeposited from two different chloroaluminate molten salt electrolytes were examined. Alloys containing up to 28 % atomic fraction Ti were electrodeposited at 150 °C from 2:1 AlCl3-NaCl with controlled additions of Ti2+. The apparent limit on alloy composition is proposed to be due to a mechanism by which Al3Ti forms through the reductive decomposition of [Ti(AlCl43]-. The composition of Al-Ti alloys electrodeposited from the AlCl3-EtMeImCl melt at 80 °C is limited by the diffusion of Ti2+ to the electrode surface. Alloys containing up to 18.4 % atomic fraction Ti are only obtainable at high Ti2+ concentrations in the melt and low current densities. Alloys electrodeposited from the higher temperature melt have an ordered L12 crystal structure while alloys of similar composition but deposited at lower temperature are disordered fcc. The appearance of antiphase boundaries in the ordered alloys suggests that the deposit may be disordered initially and then orders in the solid state, subsequent to the charge transfer step and adatom incorporation into the lattice. This is very similar to the disorder-trapping observed in rapidly solidified alloys. The measured domain size is consistent with a mechanism of diffusion-controlled doman growth at the examined deposition temperatures and times.

  13. Magnesium alloy AZ63A reinforcement by alloying with gallium and using high-disperse ZrO2 particles

    Directory of Open Access Journals (Sweden)

    J. Khokhlova

    2016-12-01

    Full Text Available The aim of this work was to obtain an experimental magnesium alloy by remelting standard AZ63A alloy with addition of gallium ligatures and ZrO2 particles. This allowed reinforcement of alloy and increase its hardness and Young's modulus. The chemical analysis of this alloy shows two types of structures which are evenly distributed in volume. Thus we can conclude that reinforcing effect is the result of formation of intermetallic phase Mg5-Ga2.

  14. Engineering data bases for refractory alloys

    International Nuclear Information System (INIS)

    Cooper, R.H. Jr.; Harms, W.O.

    1985-01-01

    Refractory alloys based on niobium, molybdenum, tantalum, and tungsten are required for the multi-100kW(e) space nuclear reactor power concepts that have been assessed in the SP-100 Program because of the extremely high temperatures involved. A review is presented of the technology efforts on the candidate refractory alloys in the areas of availability/fabricability, mechanical properties, irradiation effects, and compatibility. Of the niobium-base alloys, only Nb-1Zr has a data base that is sufficiently comprehensive for the high level of confidence required in the reference-alloy selection process for the reactor concept to be tested in the Ground Engineering System (GES) Phase of the SP-100 Program. Based on relatively short-term tests, the alloy PWC-11 (Nb-1Zr-0.1C) appears to have significantly greater creep strength than Nb-1Zr; however, concerns as to whether this precipitation-hardened alloy will remain thermally stable during seven years of full-power reactor operation need to be resolved. Additional information on the reference GES alloy will be needed for the detailed engineering design of a space power system and the fabrication of prototypical GES test components. Expedient development and demonstration of an adequate total manufacturing capability will be required if a high risk of significant schedule slippages and cost overruns is to be avoided. 4 refs., 1 fig., 3 tabs

  15. Crystallographic orientation-spray formed hypereutectic aluminium-silicon alloys

    Directory of Open Access Journals (Sweden)

    Hamilta de Oliveira Santos

    2005-06-01

    Full Text Available Aluminium-silicon alloys have been wide accepted in the automotive, electric and aerospace industries. Preferred orientation is a very common condition for metals and alloys. Particularly, aluminium induces texture during the forming process. The preparation of an aggregate with completely random crystal orientation is a difficult task. The present work was undertaken to analyse the texture by X-ray diffraction techniques, of three spray formed hypereutectic Al-Si alloys. Samples were taken from a billet of an experimental alloy (alloy 1 and were subsequently hot-rolled and cold-rolled (height reduction, 72% and 70%, respectively. The other used samples, alloys 2 and 3, were taken from cylinders liners. The results from the Laue camera showed texture just in the axial direction of alloy 3. The pole figures also indicated the presence of a typical low intensity deformation texture, especially for alloy 3. The spray formed microstructure, which is very fine, hinders the Al-Si texture formation during mechanical work.

  16. Study of fatigue crack propagation in magnesium alloys

    International Nuclear Information System (INIS)

    Yarema, S.Ya.; Zinyuk, O.D.; Ostash, O.P.; Kudryashov, V.G.; Elkin, F.M.

    1981-01-01

    Fatigue crack propagation in standard (MA2-1, MA8) and super light (MA21, MA18) alloys has been investigated in the whole range of load amplitude changes-from threshold to critical; the materials have been compared by cyclic crack resistance, fractographic analysis has been made. It is shown that MA2-1 alloy crack resistance is slightly lower than the resistance of the other three alloys. MA8 and MA21 alloys having similar mechanical properties almost do not differ in cyclic crack resistance as well. MA18 alloy has the highest resistance to fatigue crack propagation in the whole range of Ksub(max) changes. The presented results on cyclic crack resistance of MA21 and MA18 alloys agree with the data on statistic fracture toughness. The fractures have been also investigated using a scanning electron microscope. Fracture microrelieves of MA8 and MA21 alloys are very similar. At low crack propagation rates (v - 7 m/cycle) it develops through grains, in MA2-1 alloy fracture intergrain fracture areas can be observed. In MA8 and MA21 alloy fractures groove covered areas can be seen alonside with areas of slipping plane laminatron; their specific weight increases with #betta# decrease. Lower crack propagation rates and higher values of threshold stress intensity factors for MA8 and MA21 alloys than for MA2-1 alloy are caused by the absence of intergrain fracture

  17. Stress corrosion crack tip microstructure in nickel-based alloys

    International Nuclear Information System (INIS)

    Shei, S.A.; Yang, W.J.

    1994-04-01

    Stress corrosion cracking behavior of several nickel-base alloys in high temperature caustic environments has been evaluated. The crack tip and fracture surfaces were examined using Auger/ESCA and Analytical Electron Microscopy (AEM) to determine the near crack tip microstructure and microchemistry. Results showed formation of chromium-rich oxides at or near the crack tip and nickel-rich de-alloying layers away from the crack tip. The stress corrosion resistance of different nickel-base alloys in caustic may be explained by the preferential oxidation and dissolution of different alloying elements at the crack tip. Alloy 600 (UNS N06600) shows good general corrosion and intergranular attack resistance in caustic because of its high nickel content. Thermally treated Alloy 690 (UNS N06690) and Alloy 600 provide good stress corrosion cracking resistance because of high chromium contents along grain boundaries. Alloy 625 (UNS N06625) does not show as good stress corrosion cracking resistance as Alloy 690 or Alloy 600 because of its high molybdenum content

  18. Fatigue crack propagation in aluminum-lithium alloys

    Science.gov (United States)

    Rao, K. T. V.; Ritchie, R. O.; Piascik, R. S.; Gangloff, R. P.

    1989-01-01

    The principal mechanisms which govern the fatigue crack propagation resistance of aluminum-lithium alloys are investigated, with emphasis on their behavior in controlled gaseous and aqueous environments. Extensive data describe the growth kinetics of fatigue cracks in ingot metallurgy Al-Li alloys 2090, 2091, 8090, and 8091 and in powder metallurgy alloys exposed to moist air. Results are compared with data for traditional aluminum alloys 2024, 2124, 2618, 7075, and 7150. Crack growth is found to be dominated by shielding from tortuous crack paths and resultant asperity wedging. Beneficial shielding is minimized for small cracks, for high stress ratios, and for certain loading spectra. While water vapor and aqueous chloride environments enhance crack propagation, Al-Li-Cu alloys behave similarly to 2000-series aluminum alloys. Cracking in water vapor is controlled by hydrogen embrittlement, with surface films having little influence on cyclic plasticity.

  19. The effect of remelting various combinations of new and used cobalt-chromium alloy on the mechanical properties and microstructure of the alloy

    Directory of Open Access Journals (Sweden)

    Sharad Gupta

    2012-01-01

    Conclusion: Repeated remelting of base metal alloy for dental casting without addition of new alloy can affect the mechanical properties of the alloy. Microstructure analysis shows deterioration upon remelting. However, the addition of 25% and 50% (by weight of new alloy to the remelted alloy can bring about improvement both in mechanical properties and in microstructure.

  20. First principles analysis of hydrogen chemisorption on Pd-Re alloyed overlayers and alloyed surfaces

    DEFF Research Database (Denmark)

    Pallassana, Venkataraman; Neurock, Matthew; Hansen, Lars Bruno

    2000-01-01

    Gradient corrected periodic density functional theory (DFT-GGA) slab calculations were used to examine the chemisorption of atomic hydrogen on various Pd-Re alloyed overlayers and uniformly alloyed surfaces. Adsorption was examined at 33% surface coverage, where atomic hydrogen preferred the thre...

  1. Vanadium-base alloys for fusion reactor applications

    International Nuclear Information System (INIS)

    Smith, D.L.; Loomis, B.A.; Diercks, D.R.

    1984-10-01

    Vanadium-base alloys offer potentially significant advantages over other candidate alloys as a structural material for fusion reactor first wall/blanket applications. Although the data base is more limited than that for the other leading candidate structural materials, viz., austenitic and ferritic steels, vanadium-base alloys exhibit several properties that make them particularly attractive for the fusion reactor environment. This paper presents a review of the structural material requirements, a summary of the materials data base for selected vanadium-base alloys, and a comparison of projected performance characteristics compared to other candidate alloys. Also, critical research and development (R and D) needs are defined

  2. Vanadium-base alloys for fusion reactor applications

    Energy Technology Data Exchange (ETDEWEB)

    Smith, D.L.; Loomis, B.A.; Diercks, D.R.

    1984-10-01

    Vanadium-base alloys offer potentially significant advantages over other candidate alloys as a structural material for fusion reactor first wall/blanket applications. Although the data base is more limited than that for the other leading candidate structural materials, viz., austenitic and ferritic steels, vanadium-base alloys exhibit several properties that make them particularly attractive for the fusion reactor environment. This paper presents a review of the structural material requirements, a summary of the materials data base for selected vanadium-base alloys, and a comparison of projected performance characteristics compared to other candidate alloys. Also, critical research and development (R and D) needs are defined.

  3. Enthalpies of a binary alloy during solidification

    Science.gov (United States)

    Poirier, D. R.; Nandapurkar, P.

    1988-01-01

    The purpose of the paper is to present a method of calculating the enthalpy of a dendritic alloy during solidification. The enthalpies of the dendritic solid and interdendritic liquid of alloys of the Pb-Sn system are evaluated, but the method could be applied to other binaries, as well. The enthalpies are consistent with a recent evaluation of the thermodynamics of Pb-Sn alloys and with the redistribution of solute in the same during dendritic solidification. Because of the heat of mixing in Pb-Sn alloys, the interdendritic liquid of hypoeutectic alloys (Pb-rich) of less than 50 wt pct Sn has enthalpies that increase as temperature decreases during solidification.

  4. Influence of the selected alloy additions on limiting the phase formation in Cu-Zn alloys

    Directory of Open Access Journals (Sweden)

    J. Kozana

    2010-01-01

    Full Text Available Influence of the selected alloy additions into copper and zinc alloys was investigated in order to find out the possibility of limiting the precipitation of unfavourable phase . The observation of microstructures and strength tests were performed. The results of metallographic and strength investigations indicate positive influence of small amounts of nickel, cobalt or tellurium. The precise determination of the influence of the selected alloy additions on limiting the gamma phase formation will be the subject of further examinations.

  5. The Influence of Alloy Composition on the Hot Tear Susceptibility of the Al-Zn-Mg-Cu Alloy System

    International Nuclear Information System (INIS)

    Kim, Jee-Hun; Jo, Jae-Sub; Sim, Woo-Jeong; Im, Hang-Joon

    2012-01-01

    Hot tearing was the most significant casting defect when the castability evaluation of the Al- Zn-Mg-Cu alloy system was conducted. It was related to the solidification range of the alloy. Therefore, the hot tear susceptibility of the AA7075 alloy, whose solidification range is the widest, was evaluated. The hot tear susceptibility was evaluated by using a mold for a hot tearing test designed to create the condition for the occurrence of hot tear in 8 steps. According to the tearing location and shape, a hot tear susceptibility index (HTS) score was measured. The solidification range of each alloy and hot tear susceptibility was compared and thereafter the microstructure of a near tear defect was observed. As a result, the HTS of the AA7075 alloy was found to be 67. Also, the HTS in relation to a change in Zn, Mg, Cu composition showed a difference of about 6-11% compared to the AA7075 alloy.

  6. Progress in development of iron base alloys

    International Nuclear Information System (INIS)

    Zackay, V.V.; Parker, E.R.

    1980-01-01

    The ways of development of new iron base high-strength alloys are considered. Perspectiveness of ferritic steel strengthening with intermetallides (TaFe 2 , for instance) is shown. Favourable combination of plasticity, strength and fracture toughness in nickel-free iron-manganese alloys (16-20%) is also pointed out. A strength level of alloyed maraging steels can be achieved by changes in chemical composition and by proper heat treatments of low- and medium-alloyed steels

  7. Properties of boride-added powder metallurgy magnesium alloys

    Science.gov (United States)

    Tanaka, Atsushi; Yoshimura, Syota; Fujima, Takuya; Takagi, Ken-ichi

    2009-06-01

    Magnesium alloys with metallic borides, magnesium diboride (MgB2) or aluminum diboride (AlB2), were investigated regarding their mechanical properties, transverse rupture strength (TRS) and micro Vickers hardness (HV). The alloys were made from pure Mg, Al and B powders by mechanical alloying and hot pressing to have boride content of between 2.0 and 20 vol%. The alloy with AlB2 exhibited an obvious improvement of HV around a boride content of 6 vol% though the other alloy, with MgB2, did not. TRS showed moderate maxima around the same boride content region for the both alloys. X-ray diffraction measurements indicated an intermetallic compound, Mg17Al12, formed in the alloy with AlB2, which was consistent with its higher hardness.

  8. Properties of boride-added powder metallurgy magnesium alloys

    International Nuclear Information System (INIS)

    Tanaka, Atsushi; Yoshimura, Syota; Fujima, Takuya; Takagi, Ken-ichi

    2009-01-01

    Magnesium alloys with metallic borides, magnesium diboride (MgB 2 ) or aluminum diboride (AlB 2 ), were investigated regarding their mechanical properties, transverse rupture strength (TRS) and micro Vickers hardness (HV). The alloys were made from pure Mg, Al and B powders by mechanical alloying and hot pressing to have boride content of between 2.0 and 20 vol%. The alloy with AlB 2 exhibited an obvious improvement of HV around a boride content of 6 vol% though the other alloy, with MgB 2 , did not. TRS showed moderate maxima around the same boride content region for the both alloys. X-ray diffraction measurements indicated an intermetallic compound, Mg 17 Al 12 , formed in the alloy with AlB 2 , which was consistent with its higher hardness.

  9. Casting Characteristics of High Cerium Content Aluminum Alloys

    Energy Technology Data Exchange (ETDEWEB)

    Weiss, D; Rios, O R; Sims, Z C; McCall, S K; Ott, R T

    2017-09-05

    This paper compares the castability of the near eutectic aluminum-cerium alloy system to the aluminum-silicon and aluminum-copper systems. The alloys are compared based on die filling capability, feeding characteristics and tendency to hot tear in both sand cast and permanent mold applications. The castability ranking of the binary Al–Ce systems is as good as the aluminum-silicon system with some deterioration as additional alloying elements are added. In alloy systems that use cerium in combination with common aluminum alloying elements such as silicon, magnesium and/or copper, the casting characteristics are generally better than the aluminum-copper system. In general, production systems for melting, de-gassing and other processing of aluminum-silicon or aluminum-copper alloys can be used without modification for conventional casting of aluminum-cerium alloys.

  10. Density of Ni-Cr Alloy in the Mushy State

    Institute of Scientific and Technical Information of China (English)

    2003-01-01

    The density of Ni-Cr alloy in the mushy state has been measured using the modified sessile drop method. The density of Ni-Cr alloy in the mushy state was found to decrease with increasing temperature and Cr concentration in alloy.The molar volume of Ni-Cr alloy in the mushy state therefore increases with increasing the Cr concentration in alloy.The ratio of the difference of density divided by the temperature difference between liquidus and solidus temperatures decreases with increasing Cr concentration. The density of the alloy increased with the precipitation of a solid phase in alloy during the solidification process. The temperature dependence of the density of alloy in the mushy state was not linear but biquadratic.

  11. Study of fatigue behaviour of 7475 aluminium alloy

    Indian Academy of Sciences (India)

    Unknown

    controlled toughness alloy developed for applications that require a combination of high strength, superior fracture toughness and resistance to fatigue crack propagation both in air and aggressive environment. The 7475 alu- minium alloy is basically a modified version of 7075 alloy. Properties in 7075 alloy are improved by ...

  12. Mechanical properties and microstructure of copper alloys and copper alloy-stainless steel laminates for fusion reactor high heat flux applications

    Science.gov (United States)

    Leedy, Kevin Daniel

    A select group of copper alloys and bonded copper alloy-stainless steel panels are under consideration for heat sink applications in first wall and divertor structures of a planned thermonuclear fusion reactor. Because these materials must retain high strengths and withstand high heat fluxes, their material properties and microstructures must be well understood. Candidate copper alloys include precipitate strengthened CuNiBe and CuCrZr and dispersion strengthened Cu-Alsb2Osb3 (CuAl25). In this study, uniaxial mechanical fatigue tests were conducted on bulk copper alloy materials at temperatures up to 500sp°C in air and vacuum environments. Based on standardized mechanical properties measurement techniques, a series of tests were also implemented to characterize copper alloy-316L stainless steel joints produced by hot isostatic pressing or by explosive bonding. The correlation between mechanical properties and the microstructure of fatigued copper alloys and the interface of copper alloy-stainless steel laminates was examined. Commercial grades of these alloys were used to maintain a degree of standardization in the materials testing. The commercial alloys used were OMG Americas Glidcop CuAl25 and CuAl15; Brush Wellman Hycon 3HP and Trefimetaux CuNiBe; and Kabelmetal Elbrodur and Trefimetaux CuCrZr. CuAl25 and CuNiBe alloys possessed the best combination of fatigue resistance and microstructural stability. The CuAl25 alloy showed only minimal microstructural changes following fatigue while the CuNiBe alloy consistently exhibited the highest fatigue strength. Transmission electron microscopy observations revealed that small matrix grain sizes and high densities of submicron strengthening phases promoted homogeneous slip deformation in the copper alloys. Thus, highly organized fatigue dislocation structure formation, as commonly found in oxygen-free high conductivity Cu, was inhibited. A solid plate of CuAl25 alloy hot isostatically pressed to a 316L stainless steel

  13. Fabrication of nanocrystalline alloys Cu–Cr–Mo super satured solid solution by mechanical alloying

    Energy Technology Data Exchange (ETDEWEB)

    Aguilar, C., E-mail: claudio.aguilar@usm.cl [Departamento de Ingeniería Metalúrgica y Materiales, Universidad Técnica Federico Santa María, Av. España 1680, Valparaíso (Chile); Guzmán, D. [Departamento de Ingeniería en Metalurgia, Facultad de Ingeniería, Universidad de Atacama y Centro Regional de Investigación y Desarrollo Sustentable de Atacama (CRIDESAT), Av. Copayapu 485, Copiapó (Chile); Castro, F.; Martínez, V.; Cuevas, F. de las [Centro de Estudios e Investigaciones Técnicas de Gipuzkoa, Paseo de Manuel Lardizábal, N° 15, 20018 San Sebastián (Spain); Lascano, S. [Departamento de Ingeniería Mecánica, Universidad Técnica Federico Santa María, Av. España 1680, Valparaíso (Chile); Muthiah, T. [Departamento de Ingeniería Metalúrgica y Materiales, Universidad Técnica Federico Santa María, Av. España 1680, Valparaíso (Chile)

    2014-08-01

    This work discusses the extension of solid solubility of Cr and Mo in Cu processed by mechanical alloying. Three alloys processed, Cu–5Cr–5Mo, Cu–10Cr–10Mo and Cu–15Cr–15Mo (weight%) using a SPEX mill. Gibbs free energy of mixing values 10, 15 and 20 kJ mol{sup −1} were calculated for these three alloys respectively by using the Miedema's model. The crystallite size decreases and dislocation density increases when the milling time increases, so Gibbs free energy storage in powders increases by the presence of crystalline defects. The energy produced by crystallite boundaries and strain dislocations were estimated and compared with Gibbs free energy of mixing values. The energy storage values by the presence of crystalline defects were higher than Gibbs free energy of mixing at 120 h for Cu–5Cr–5Mo, 130 h for Cu–10Cr–10Mo and 150 h for Cu–15Cr–15Mo. During milling, crystalline defects are produced that increases the Gibbs free energy storage and thus the Gibbs free energy curves are moved upwards and hence the solubility limit changes. Therefore, the three alloys form solid solutions after these milling time, which are supported with the XRD results. - Highlights: • Extension of solid solution Cr and Mo in Cu achieved by mechanical alloying. • X-ray characterization of Cu–Cr–Mo system processed by mechanical alloying. • Thermodynamics analysis of formation of solid solution of the Cu–Cr–Mo system.

  14. Gamma rays shielding parameters for white metal alloys

    Science.gov (United States)

    Kaur, Taranjot; Sharma, Jeewan; Singh, Tejbir

    2018-05-01

    In the present study, an attempt has been made to check the feasibility of white metal alloys as gamma rays shielding materials. Different combinations of cadmium, lead, tin and zinc were used to prepare quaternary alloys Pb60Sn20ZnxCd20-x (where x = 5, 10, 15) using melt quench technique. These alloys were also known as white metal alloys because of its shining appearance. The density of prepared alloys has been measured using Archimedes Principle. Gamma rays shielding parameters viz. mass attenuation coefficient (µm), effective atomic number (Zeff), electron density (Nel), Mean free path (mfp), Half value layer (HVL) and Tenth value layer (TVL) has been evaluated for these alloys in the wide energy range from 1 keV to 100 GeV. The WinXCom software has been used for obtaining mass attenuation coefficient values for the prepared alloys in the given energy range. The effective atomic number (Zeff) has been assigned to prepared alloys using atomic to electronic cross section ratio method. Further, the variation of various shielding parameters with photon energy has been investigated for the prepared white metal alloys.

  15. Aeronautical Cast Ti Alloy and Forming Technology Development

    OpenAIRE

    ZHANG Meijuan; NAN Hai; JU Zhongqiang; GAO Fuhui; QIE Xiwang; ZHU Langping

    2016-01-01

    The application and feature of Ti alloy and TiAl alloy for aviation at home and abroad were briefly introduced. According to the patent application status in Ti alloy field, the development of Ti alloy casting technology was analyzed in the recent thirty years, especially the transformation in aviation. Along with the development of aeronautional manufacturing technology and demand of high performance aircraft, Ti alloy casting is changing towards to be large, integral and complicated, and th...

  16. Characterization of low alloy ferritic steel–Ni base alloy dissimilar metal weld interface by SPM techniques, SEM/EDS, TEM/EDS and SVET

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Siyan; Ding, Jie; Ming, Hongliang; Zhang, Zhiming; Wang, Jianqiu, E-mail: wangjianqiu@imr.ac.cn

    2015-02-15

    The interface region of welded A508–Alloy 52 M is characterized by scanning probe microscope (SPM) techniques, scanning electron microscopy (SEM)/energy dispersive spectroscopy (EDS), transmission electron microscopy (TEM)/Energy Dispersive Spectroscopy (EDS) and scanning vibrate electrode technique (SVET). The regions along the welded A508–Alloy 52 M interface can be categorized into two types according to their different microstructures. In the type-I interface region, A508 and Alloy 52 M are separated by the fusion boundary, while in the type-II interface region, A508 and Alloy 52 M are separated by a martensite zone. A508, martensite zone and grain boundaries in Alloy 52 M are ferromagnetic while the Alloy 52 M matrix is paramagnetic. The Volta potentials measured by scanning Kelvin probe force microscopy (SKPFM) of A508, martensite zone and Alloy 52 M follow the order: V{sub 52} {sub M} > V{sub A508} > V{sub martensite}. The corrosion behavior of A508–Alloy 52 M interface region is galvanic corrosion, in which Alloy 52 M is cathode while A508 is anode. The martensite dissolves faster than Alloy 52 M, but slower than A508 in the test solution. - Highlights: • The A508–Alloy 52 M interface regions can be categorized into two types. • The chromium depleted region is observed along the Alloy 52 M grain boundary. • The Alloy 52 M grain boundaries which are close to the interface are ferromagnetic. • Martensite zone has lower Volta potential but higher corrosion resistance than A508.

  17. Research activities of biomedical magnesium alloys in China

    Science.gov (United States)

    Zheng, Yufeng; Gu, Xuenan

    2011-04-01

    The potential application of Mg alloys as bioabsorable/biodegradable implants have attracted much recent attention in China. Advances in the design and biocompatibility evaluation of bio-Mg alloys in China are reviewed in this paper. Bio-Mg alloys have been developed by alloying with the trace elements existing in human body, such as Mg-Ca, Mg-Zn and Mg-Si based systems. Additionally, novel structured Mg alloys such as porous, composited, nanocrystalline and bulk metallic glass alloys were tried. To control the biocorrosion rate of bio-Mg implant to match the self-healing/regeneration rate of the surrounding tissue in vivo, surface modification layers were coated with physical and chemical methods.

  18. High strength cast aluminum alloy development

    Science.gov (United States)

    Druschitz, Edward A.

    The goal of this research was to understand how chemistry and processing affect the resulting microstructure and mechanical properties of high strength cast aluminum alloys. Two alloy systems were investigated including the Al-Cu-Ag and the Al-Zn-Mg-Cu systems. Processing variables included solidification under pressure (SUP) and heat treatment. This research determined the range in properties that can be achieved in BAC 100(TM) (Al-Cu micro-alloyed with Ag, Mn, Zr, and V) and generated sufficient property data for design purposes. Tensile, stress corrosion cracking, and fatigue testing were performed. CuAl2 and Al-Cu-Fe-Mn intermetallics were identified as the ductility limiting flaws. A solution treatment of 75 hours or longer was needed to dissolve most of the intermetallic CuAl 2. The Al-Cu-Fe-Mn intermetallic was unaffected by heat treatment. These results indicate that faster cooling rates, a reduction in copper concentration and a reduction in iron concentration might increase the ductility of the alloy by decreasing the size and amount of the intermetallics that form during solidification. Six experimental Al-Zn-Mg-Cu series alloys were produced. Zinc concentrations of 8 and 12wt% and Zn/Mg ratios of 1.5 to 5.5 were tested. Copper was held constant at 0.9%. Heat treating of the alloys was optimized for maximum hardness. Al-Zn-Mg-Cu samples were solution treated at 441°C (826°F) for 4 hours before ramping to 460°C (860°F) for 75 hours and then aged at 120°C (248°F) for 75 hours. X-ray diffraction showed that the age hardening precipitates in most of these alloys was the T phase (Mg32Zn 31.9Al17.1). Tensile testing of the alloys showed that the best mechanical properties were obtained in the lowest alloy condition. Chilled Al-8.2Zn-1.4Mg-0.9Cu solidified under pressure resulted in an alloy with a yield strength of 468MPa (68ksi), tensile strength of 525MPa (76ksi) and an elongation of 9%.

  19. AN ELECTROPLATING METHOD OF FORMING PLATINGS OF NICKEL, COBALT, NICKEL ALLOYS OR COBALT ALLOYS

    DEFF Research Database (Denmark)

    1997-01-01

    An electroplating method of forming platings of nickel, cobalt, nickel alloys or cobalt alloys with reduced stresses in an electrodepositing bath of the type: Watt's bath, chloride bath or a combination thereof, by employing pulse plating with periodic reverse pulse and a sulfonated naphthalene...

  20. High temperature niobium alloys

    International Nuclear Information System (INIS)

    Wojcik, C.C.

    1991-01-01

    Niobium alloys are currently being used in various high temperature applications such as rocket propulsion, turbine engines and lighting systems. This paper presents an overview of the various commercial niobium alloys, including basic manufacturing processes, properties and applications. Current activities for new applications include powder metallurgy, coating development and fabrication of advanced porous structures for lithium cooled heat pipes

  1. Thermofluency in zirconium alloys

    International Nuclear Information System (INIS)

    Orozco M, E.A.

    1976-01-01

    A summary is presented about the theoretical and experimental results obtained at present in thermofluency under radiation in zirconium alloys. The phenomenon of thermofluency is presented in a general form, underlining the thermofluency at high temperature because this phenomenon is similar to the thermofluency under radiation, which ocurrs in zirconium alloys into the operating reactor. (author)

  2. Phonon broadening in high entropy alloys

    Science.gov (United States)

    Körmann, Fritz; Ikeda, Yuji; Grabowski, Blazej; Sluiter, Marcel H. F.

    2017-09-01

    Refractory high entropy alloys feature outstanding properties making them a promising materials class for next-generation high-temperature applications. At high temperatures, materials properties are strongly affected by lattice vibrations (phonons). Phonons critically influence thermal stability, thermodynamic and elastic properties, as well as thermal conductivity. In contrast to perfect crystals and ordered alloys, the inherently present mass and force constant fluctuations in multi-component random alloys (high entropy alloys) can induce significant phonon scattering and broadening. Despite their importance, phonon scattering and broadening have so far only scarcely been investigated for high entropy alloys. We tackle this challenge from a theoretical perspective and employ ab initio calculations to systematically study the impact of force constant and mass fluctuations on the phonon spectral functions of 12 body-centered cubic random alloys, from binaries up to 5-component high entropy alloys, addressing the key question of how chemical complexity impacts phonons. We find that it is crucial to include both mass and force constant fluctuations. If one or the other is neglected, qualitatively wrong results can be obtained such as artificial phonon band gaps. We analyze how the results obtained for the phonons translate into thermodynamically integrated quantities, specifically the vibrational entropy. Changes in the vibrational entropy with increasing the number of elements can be as large as changes in the configurational entropy and are thus important for phase stability considerations. The set of studied alloys includes MoTa, MoTaNb, MoTaNbW, MoTaNbWV, VW, VWNb, VWTa, VWNbTa, VTaNbTi, VWNbTaTi, HfZrNb, HfMoTaTiZr.

  3. Characterization and corrosion behaviour of CoNi alloys obtained by mechanical alloying

    International Nuclear Information System (INIS)

    Olvera, S.; Sánchez-Marcos, J.; Palomares, F.J.; Salas, E.; Arce, E.M.; Herrasti, P.

    2014-01-01

    CoNi alloys including Co 30 Ni 70 , Co 50 Ni 50 and Co 70 Ni 30 were prepared via mechanical alloying using Co and Ni powders. The crystallinity and short-range order were studied using X-ray diffraction and X-ray absorption spectroscopy. The results show that the milling process increases the number of vacancies, especially around the Co atoms, while the milling time decreases the crystalline size and enhances the crystallinity. X-ray photoelectron spectroscopy was used to characterise the chemical composition of the samples surface. The magnetic properties were analysed using zero-field cooling, field cooling and a magnetic hysteresis loops. The magnetic saturation moment is approximately 1.05 μ B /atom; this value decreases with the mechanical alloying time, and it is proportional to the cobalt concentration. The polarization and impedance curves in different media (NaCl, H 2 SO 4 and NaOH) showed similar corrosion resistance values. The corrosion resistance increased in the order NaCl, H 2 SO 4 and NaOH. A good passivation layer was formed in NaOH due to the cobalt and nickel oxides on the particle surfaces. - Highlights: • Ni x Co 100-x alloys were synthesized by mechanical alloying • Milling time decrease size and enhances crystallinity. • Oxygen is not present in a significant percentage in bulk but is detected on the surface. • Magnetic saturation moment is 1.05 mB/atom and decrease with mechanical allowing time • Corrosion resistance is higher in NaOH than in NaCl or HCl solutions

  4. Surface energy of metal alloy nanoparticles

    Science.gov (United States)

    Takrori, Fahed M.; Ayyad, Ahmed

    2017-04-01

    The measurement of surface energy of alloy nanoparticles experimentally is still a challenge therefore theoretical work is necessary to estimate its value. In continuation of our previous work on the calculation of the surface energy of pure metallic nanoparticles we have extended our work to calculate the surface energy of different alloy systems, namely, Co-Ni, Au-Cu, Cu-Al, Cu-Mg and Mo-Cs binary alloys. It is shown that the surface energy of metallic binary alloy decreases with decreasing particle size approaching relatively small values at small sizes. When both metals in the alloy obey the Hume-Rothery rules, the difference in the surface energy is small at the macroscopic as well as in the nano-scale. However when the alloy deviated from these rules the difference in surface energy is large in the macroscopic and in the nano scales. Interestingly when solid solution formation is not possible at the macroscopic scale according to the Hume-Rothery rules, it is shown it may form at the nano-scale. To our knowledge these findings here are presented for the first time and is challenging from fundamental as well as technological point of views.

  5. Moessbauer effect study on mechanically alloyed amorphous Fe1-xTix alloys

    International Nuclear Information System (INIS)

    Chen Hong; Xu Zuxiong; Ma Ruzhang; Zhao Zhongtao; Ping Jueyun

    1994-01-01

    Amorphous Fe 1-x Ti x (x = 0.50, 0.60) powders were produced by mechanical alloying from pure elemental powders in a vibratory ball-mill. X-ray diffraction (XRD) and Moessbauer effect (ME) were used to study the progress of amorphization and the property of hydrogen absorption in Fe-Ti alloys. The amorphization process and the properties of the amorphous phase are discussed. (orig.)

  6. Beryllium-aluminum alloys for investment castings

    International Nuclear Information System (INIS)

    Nachtrab, W.T.; Levoy, N.

    1997-01-01

    Beryllium-aluminum alloys containing greater than 60 wt % beryllium are very favorable materials for applications requiring light weight and high stiffness. However, when produced by traditional powder metallurgical methods, these alloys are expensive and have limited applications. To reduce the cost of making beryllium-aluminum components, Nuclear Metals Inc. (NMI) and Lockheed Martin Electronics and Missiles have recently developed a family of patented beryllium-aluminum alloys that can be investment cast. Designated Beralcast, the alloys can achieve substantial weight savings because of their high specific strength and stiffness. In some cases, weight has been reduced by up to 50% over aluminum investment casting. Beralcast is now being used to make thin wall precision investment castings for several advanced aerospace applications, such as the RAH-66 Comanche helicopter and F-22 jet fighter. This article discusses alloy compositions, properties, casting method, and the effects of cobalt additions on strength

  7. Oxide characterization and hydrogen behaviors of Zr-based alloys

    International Nuclear Information System (INIS)

    Kim, Y. S.; Kim, D. J.; Kwon, S. H.; Lee, H. S.; Oh, S. J.; Yim, B. J.; Son, S. B.; Yun, S. P.

    2006-03-01

    The work scope and contents of the research are as follows : basic properties of zirconium alloys, hydrogen pick-up mechanism of zirconium alloy, effects of hydride on the corrosion behaviors of zirconium alloys, estimation on stress of oxide layer in the zirconium alloy, microstructure and characteristic of oxide in pre-hydrided zirconium alloys

  8. Manufacturing of High Entropy Alloys

    Science.gov (United States)

    Jablonski, Paul D.; Licavoli, Joseph J.; Gao, Michael C.; Hawk, Jeffrey A.

    2015-07-01

    High entropy alloys (HEAs) have generated interest in recent years due to their unique positioning within the alloy world. By incorporating a number of elements in high proportion they have high configurational entropy, and thus they hold the promise of interesting and useful properties such as enhanced strength and phase stability. The present study investigates the microstructure of two single-phase face-centered cubic (FCC) HEAs, CoCrFeNi and CoCrFeNiMn, with special attention given to melting, homogenization and thermo-mechanical processing. Large-scale ingots were made by vacuum induction melting to avoid the extrinsic factors inherent in small-scale laboratory button samples. A computationally based homogenization heat treatment was applied to both alloys in order to eliminate segregation due to normal ingot solidification. The alloys fabricated well, with typical thermo-mechanical processing parameters being employed.

  9. Squeeze Casting Method Of AI-Si Alloy For Piston Material

    International Nuclear Information System (INIS)

    Wagiyo, H.; Dani, Muhammad; Sulistioso, G.S.; Pardede, Elman; Handayani, Ari; Teguh, Yulius S.P.P.

    2001-01-01

    The AI-Si alloy is an alloy used as piston material. This alloys could be as AI-Si hypereutectic alloy (Si content more than 12.5 % wt.), as AI-Si eutectic alloy (Si cuntent 12.5 % wt, and as AI-Si hypoeutectic alloy (Si content less than 12.5 % wt.). The synthesize of AI-Si alloy piston generally using the technique of gravity casting in a dies. This method is causing high porousity. By using the squeeze technique, amount ofporousity in AI-Si alloy is possibly reduced and the density of this alloy should be higher. The other factors such as alloying elements of AI-Si alloy (Mg. Cu, Zn) would increase the mechanical properties especially the hardness. The focuses of this research are the microstructure and the maximum hardness during the heat treatment of AI-Si alloy which was added by alloying elments. The result of hardness at test shows the maximum hardness at 94.7 kg/mm 2 obtained at aging temperature of 210 o C for hours with homogenous dendritic microstructure

  10. Decagonal quasicrystalline phase in as-cast and mechanically alloyed Al–Cu–Cr alloys

    International Nuclear Information System (INIS)

    Shevchukov, A.P.; Sviridova, T.A.; Kaloshkin, S.D.; Tcherdyntsev, V.V.; Gorshenkov, M.V.; Churyukanova, M.N.; Zhang, D.; Li, Z.

    2014-01-01

    Highlights: ► Microstructure of as-cast Al–Cu–Cr alloys was investigated. ► Composition of decagonal quasicrystalline phase was determined. ► Single-phase decagonal quasicrystalline powder was obtained. ► Phase composition changes during heating were controlled using DSC and X-ray diffraction. -- Abstract: Microstructure and phase composition of three Al-rich as-cast alloys of Al–Cu–Cr system were investigated by X-ray diffraction analysis (XRD) and scanning electron microscopy (SEM). The decagonal quasicrystalline phase is contained in all alloys under study and has grains with faceted shape, its composition lies in the range of 71–73 at.% Al, 11–12 at.% Cu and 15–18 at.% Cr. The heating in calorimeter of the mechanically alloyed Al 73 Cu 11 Cr 16 powder up to 600 °C leads to the formation of the pure decagonal phase. Total thermal effect in the temperature range 250–600 °C corresponding to the quasicrystalline phase formation is about 15 kJ/mol

  11. Annealing behavior of high permeability amorphous alloys

    International Nuclear Information System (INIS)

    Rabenberg, L.

    1980-06-01

    Effects of low temperature annealing on the magnetic properties of the amorphous alloy Co 71 4 Fe 4 6 Si 9 6 B 14 4 were investigated. Annealing this alloy below 400 0 C results in magnetic hardening; annealing above 400 0 C but below the crystallization temperature results in magnetic softening. Above the crystallization temperature the alloy hardens drastically and irreversibly. Conventional and high resolution transmission electron microscopy were used to show that the magnetic property changes at low temperatures occur while the alloy is truly amorphous. By imaging the magnetic microstructures, Lorentz electron microscopy has been able to detect the presence of microscopic inhomogeneities in this alloy. The low temperature annealing behavior of this alloy has been explained in terms of atomic pair ordering in the presence of the internal molecular field. Lorentz electron microscopy has been used to confirm this explanation

  12. Investigation of americium-241 metal alloys for target applications

    International Nuclear Information System (INIS)

    Conner, W.V.; Rockwell International Corp., Golden, CO

    1982-01-01

    Several 241 Am metal alloys have been investigated for possible use in the Lawrence Livermore National Laboratory Radiochemical Diagnostic Tracer Program. Several properties were desired for an alloy to be useful for tracer program applications. A suitable alloy would have a fairly high density, be ductile, homogeneous and easy to prepare. Alloys investigated have included uranium-americium, aluminium-americium, and cerium-americium. Uranium-americium alloys with the desired properties proved to be difficult to prepare, and work with this alloy was discontinued. Aluminium-americium alloys were much easier to prepare, but the alloy consisted of an aluminium-americium intermetallic compound (AmAl 4 ) in an aluminum matrix. This alloy could be cast and formed into shapes, but the low density of aluminum, and other problems, made the alloy unsuitable for the intended application. Americium metal was found to have a high solid solubility in cerium and alloys prepared from these two elements exhibited all of the properties desired for the tracer program application. Cerium-americium alloys containing up to 34 wt% americium have been prepared using both co-melting and co-reduction techniques. The latter technique involves co-reduction of cerium tetrafluoride and americium tetrafluoride with calcium metal in a sealed reduction vessel. Casting techniques have been developed for preparing up to eight 2.2 cm (0.87 in) diameter disks in a single casting, and cerium-americium metal alloy disks containing from 10 to 25 wt% 241 Am have been prepared using these techniques. (orig.)

  13. In vitro mechanical integrity of hydroxyapatite coated magnesium alloy

    International Nuclear Information System (INIS)

    Kannan, M Bobby; Orr, Lynnley

    2011-01-01

    The mechanical integrity of resorbable implants during service, especially in load bearing orthopaedic applications, is critical. The high degradation rate of resorbable magnesium and magnesium-based implants in body fluid may potentially cause premature in-service failure. In this study, a magnesium alloy (AZ91) was potentiostatically coated with hydroxyapatite at different cathodic voltages in an attempt to enhance the mechanical integrity. The mechanical integrity of the uncoated and hydroxyapatite coated alloys was evaluated after in vitro testing of the coated samples in simulated body fluid (SBF). The uncoated alloy showed 40% loss in the mechanical strength after five days exposure to SBF. However, the hydroxyapatite coated alloy exposed to SBF showed 20% improvement in the mechanical strength as compared to that of the uncoated alloy. The alloy coated potentiostatically at -2 V performed better than the -3 V coated alloy. The cross-sectional analysis of the coatings revealed relatively uniform coating thickness for the -2 V coated alloy, whereas the -3 V coated alloy exhibited areas of uneven coating. This can be attributed to the increase in hydrogen evolution on the alloy during -3 V coating as compared to -2 V coating. The scanning electron micrographs of the in vitro tested alloy revealed that hydroxyapatite coating significantly reduced the localized corrosion of the alloy, which is critical for better in-service mechanical integrity. Thus, the study suggests that the in vitro mechanical integrity of resorbable magnesium-based alloy can be improved by potentiostatic hydroxyapatite coating.

  14. In vitro mechanical integrity of hydroxyapatite coated magnesium alloy

    Energy Technology Data Exchange (ETDEWEB)

    Kannan, M Bobby; Orr, Lynnley, E-mail: bobby.mathan@jcu.edu.au [Discipline of Chemical Engineering, School of Engineering and Physical Sciences, James Cook University, Townsville, Queensland 4811 (Australia)

    2011-08-15

    The mechanical integrity of resorbable implants during service, especially in load bearing orthopaedic applications, is critical. The high degradation rate of resorbable magnesium and magnesium-based implants in body fluid may potentially cause premature in-service failure. In this study, a magnesium alloy (AZ91) was potentiostatically coated with hydroxyapatite at different cathodic voltages in an attempt to enhance the mechanical integrity. The mechanical integrity of the uncoated and hydroxyapatite coated alloys was evaluated after in vitro testing of the coated samples in simulated body fluid (SBF). The uncoated alloy showed 40% loss in the mechanical strength after five days exposure to SBF. However, the hydroxyapatite coated alloy exposed to SBF showed 20% improvement in the mechanical strength as compared to that of the uncoated alloy. The alloy coated potentiostatically at -2 V performed better than the -3 V coated alloy. The cross-sectional analysis of the coatings revealed relatively uniform coating thickness for the -2 V coated alloy, whereas the -3 V coated alloy exhibited areas of uneven coating. This can be attributed to the increase in hydrogen evolution on the alloy during -3 V coating as compared to -2 V coating. The scanning electron micrographs of the in vitro tested alloy revealed that hydroxyapatite coating significantly reduced the localized corrosion of the alloy, which is critical for better in-service mechanical integrity. Thus, the study suggests that the in vitro mechanical integrity of resorbable magnesium-based alloy can be improved by potentiostatic hydroxyapatite coating.

  15. Properties of boride-added powder metallurgy magnesium alloys

    Energy Technology Data Exchange (ETDEWEB)

    Tanaka, Atsushi; Yoshimura, Syota; Fujima, Takuya; Takagi, Ken-ichi [Department of Mechanical Engineering, Tokyo City University 1-28-1 Tamazutsumi, Setagaya, Tokyo 158-8557 (Japan)], E-mail: ktakagi@tcu.ac.jp

    2009-06-01

    Magnesium alloys with metallic borides, magnesium diboride (MgB{sub 2}) or aluminum diboride (AlB{sub 2}), were investigated regarding their mechanical properties, transverse rupture strength (TRS) and micro Vickers hardness (HV). The alloys were made from pure Mg, Al and B powders by mechanical alloying and hot pressing to have boride content of between 2.0 and 20 vol%. The alloy with AlB{sub 2} exhibited an obvious improvement of HV around a boride content of 6 vol% though the other alloy, with MgB{sub 2}, did not. TRS showed moderate maxima around the same boride content region for the both alloys. X-ray diffraction measurements indicated an intermetallic compound, Mg{sub 17}Al{sub 12}, formed in the alloy with AlB{sub 2}, which was consistent with its higher hardness.

  16. Corrosion behaviour of Al-Fe-Ti-V medium entropy alloy

    Science.gov (United States)

    Bodunrin, M. O.; Obadele, B. A.; Chown, L. H.; Olubambi, P. A.

    2017-12-01

    Alloys containing up to four multi-principal elements in equiatomic ratios are referred to as medium entropy alloys (MEA). These alloys have attracted the interest of many researchers due to the superior mechanical properties it offers over the traditional alloys. The design approach of MEA often results to simple solid solution with either body centered cubic; face centered cubic structures or both. As the consideration for introducing the alloys into several engineering application increases, there have been efforts to study the corrosion behaviour of these alloys. Previous reports have shown that some of these alloys are more susceptible to corrosion when compared with traditional alloys due to lack of protective passive film. In this research, we have developed AlFeTiV medium entropy alloys containing two elements (Ti and Al) that readily passivate when exposed to corrosive solutions. The alloys were produced in vacuum arc furnace purged with high purity argon. Open circuit potential and potentiodynamic polarisation tests were used to evaluate the corrosion behaviour of the as-cast AlFeTiV alloy in 3.5 wt% NaCl and 1 M H2SO4. The corrosion performance of the alloy was compared with Ti-6Al-4V alloy tested under similar conditions. The results show that unlike in Ti-6Al-4V alloy, the open circuit potential of the AlFeTiV alloy move towards the negative values in both 3.5 wt% NaCl and 1 M H2SO4 solutions indicating that self-activation occurred rapidly on immersion. Anodic polarisation of the alloys showed that AlFeTiV alloy exhibited a narrow range of passivity in both solutions. In addition, the alloys exhibited lower Ecorr and higher Icorr when compared with traditional Ti-6Al-4V alloy. The traditional Ti-6Al-4V alloy showed superior corrosion resistant to the AlFeTiV alloy in both 3.5 wt.% NaCl and 1 M H2SO4 solutions.

  17. Powder Metallurgy Processing of a WxTaTiVCr High-Entropy Alloy and Its Derivative Alloys for Fusion Material Applications.

    Science.gov (United States)

    Waseem, Owais Ahmed; Ryu, Ho Jin

    2017-05-16

    The W x TaTiVCr high-entropy alloy with 32at.% of tungsten (W) and its derivative alloys with 42 to 90at.% of W with in-situ TiC were prepared via the mixing of elemental W, Ta, Ti, V and Cr powders followed by spark plasma sintering for the development of reduced-activation alloys for fusion plasma-facing materials. Characterization of the sintered samples revealed a BCC lattice and a multi-phase structure. The selected-area diffraction patterns confirmed the formation of TiC in the high-entropy alloy and its derivative alloys. It revealed the development of C15 (cubic) Laves phases as well in alloys with 71 to 90at.% W. A mechanical examination of the samples revealed a more than twofold improvement in the hardness and strength due to solid-solution strengthening and dispersion strengthening. This study explored the potential of powder metallurgy processing for the fabrication of a high-entropy alloy and other derived compositions with enhanced hardness and strength.

  18. Additive Manufacturing of Metastable Beta Titanium Alloys

    Science.gov (United States)

    Yannetta, Christopher J.

    Additive manufacturing processes of many alloys are known to develop texture during the deposition process due to the rapid reheating and the directionality of the dissipation of heat. Titanium alloys and with respect to this study beta titanium alloys are especially susceptible to these effects. This work examines Ti-20wt%V and Ti-12wt%Mo deposited under normal additive manufacturing process parameters to examine the texture of these beta-stabilized alloys. Both microstructures contained columnar prior beta grains 1-2 mm in length beginning at the substrate with no visible equiaxed grains. This microstructure remained constant in the vanadium system throughout the build. The microstructure of the alloy containing molybdenum changed from a columnar to an equiaxed structure as the build height increased. Eighteen additional samples of the Ti-Mo system were created under different processing parameters to identify what role laser power and travel speed have on the microstructure. There appears to be a correlation in alpha lath size and power density. The two binary alloys were again deposited under the same conditions with the addition of 0.5wt% boron to investigate the effects an insoluble interstitial alloying element would have on the microstructure. The size of the prior beta grains in these two alloys were reduced with the addition of boron by approximately 50 (V) and 100 (Mo) times.

  19. Characterization of zinc–nickel alloy electrodeposits obtained from ...

    Indian Academy of Sciences (India)

    Zinc alloy offers superior sacrificial protection to steel as the alloy dissolves more slowly than pure zinc. The degree of protection and the rate of dissolution depend on the alloying metal and its composition. Zinc-nickel alloy may also serve as at less toxic substitute for cadmium. In this paper the physico-chemical ...

  20. Effect of Alloy Elements on Microstructures and Mechanical Properties in Al-Mg-Si Alloys

    Science.gov (United States)

    Kato, Yoshikazu; Hisayuki, Koji; Sakaguchi, Masashi; Higashi, Kenji

    Microstructures and mechanical properties in the modified Al-Mg-Si alloys with variation in the alloy elements and their contents were investigated to enhance higher strength and ductility. Optimizing both the alloy element design and the industrial processes including heat-treatments and extrusion technology was carried out along the recent suggestion from the first principles calculation. The investigation concluded that the addition of Fe and/or Cu could recovery their lost ductility, furthermore increase their tensile strength up to 420 MPa at high elongation of 24 % after T6 condition for Al-0.8mass%Mg-1.0mass%Si-0.8mass%Cu-0.5mass%Fe alloy with excess Si content. The excellent combination between strength and ductility could be obtained by improvement to the grain boundary embitterment caused by grain boundary segregation of Si as a result from the interaction of Si with Cu or Fe with optimizing the amount of Cu and Fe contents.

  1. Effects of thermal aging on microstructures of low alloy steel–Ni base alloy dissimilar metal weld interfaces

    International Nuclear Information System (INIS)

    Choi, Kyoung Joon; Kim, Jong Jin; Lee, Bong Ho; Bahn, Chi Bum; Kim, Ji Hyun

    2013-01-01

    In this study, the advanced instrumental analysis has been performed to investigate the effect of long-term thermal aging on the microstructural evolution in the fusion boundary region between weld metal and low alloy steel in dissimilar metal welds. A representative dissimilar weld mock-up made of Alloy 690-Alloy 152-A533 Gr. B was fabricated and aged at 450 °C for 2750 h. The micro- and nano-scale characterization were conducted mainly near in a weld root region by using optical microscopy, scanning electron microscopy, transmission electron microscopy, and three dimensional atom probe tomography. It was observed that the weld root was generally divided into several regions including dilution zone in the Ni-base alloy weld metal, fusion boundary, and heat-affected zone in the low alloy steel. A steep gradient was shown in the chemical composition profile across the interface between A533 Gr. B and Alloy 152. The precipitation of carbides was also observed along and near the fusion boundary of as-welded and aged dissimilar metal joints. It was also found that the precipitation of Cr carbides was enhanced by the thermal aging near the fusion boundary

  2. Effects of thermal aging on microstructures of low alloy steel–Ni base alloy dissimilar metal weld interfaces

    Energy Technology Data Exchange (ETDEWEB)

    Choi, Kyoung Joon; Kim, Jong Jin [Interdisciplinary School of Green Energy, Ulsan National Institute of Science and Technology (UNIST), 100 Banyeon-ri, Eonyang-eup, Ulju-gun, Ulsan 689-798 (Korea, Republic of); Lee, Bong Ho [National Center for Nanomaterials Technology (NCNT), Pohang University of Science and Technology (POSTECH), 77 Cheongam-ro, Nam-gu, Pohang, Gyeongbuk 790-784 (Korea, Republic of); Bahn, Chi Bum [Argonne National Laboratory, 9700 S. Cass Ave, Lemont, IL 60439 (United States); Kim, Ji Hyun, E-mail: kimjh@unist.ac.kr [Interdisciplinary School of Green Energy, Ulsan National Institute of Science and Technology (UNIST), 100 Banyeon-ri, Eonyang-eup, Ulju-gun, Ulsan 689-798 (Korea, Republic of)

    2013-10-15

    In this study, the advanced instrumental analysis has been performed to investigate the effect of long-term thermal aging on the microstructural evolution in the fusion boundary region between weld metal and low alloy steel in dissimilar metal welds. A representative dissimilar weld mock-up made of Alloy 690-Alloy 152-A533 Gr. B was fabricated and aged at 450 °C for 2750 h. The micro- and nano-scale characterization were conducted mainly near in a weld root region by using optical microscopy, scanning electron microscopy, transmission electron microscopy, and three dimensional atom probe tomography. It was observed that the weld root was generally divided into several regions including dilution zone in the Ni-base alloy weld metal, fusion boundary, and heat-affected zone in the low alloy steel. A steep gradient was shown in the chemical composition profile across the interface between A533 Gr. B and Alloy 152. The precipitation of carbides was also observed along and near the fusion boundary of as-welded and aged dissimilar metal joints. It was also found that the precipitation of Cr carbides was enhanced by the thermal aging near the fusion boundary.

  3. Studies on the growth of oxide films on alloy 800 and alloy 600 in lithiated water at high temperature

    International Nuclear Information System (INIS)

    Olmedo, A.M.; Bordon, R.

    2007-01-01

    In this work, the oxide films grown on Alloy 800 and Alloy 600 in lithiated (pH 25 C d egrees = 10.2-10.4) water at high temperature, with and without hydrogen overpressure (HO) and an initial oxygen dissolved in the water have been studied. The oxide films were grown at different temperatures (220-350 C degrees) and exposure times with HO, and at 315 C degrees without HO in static autoclaves. Some results are also reported for oxide layers grown on Alloy 800 coupons exposed in a high temperature loop during extended exposure times. The average oxide thickness was determined using descaling procedures. The morphology and composition of the oxide films were analyzed with scanning electron microscopy (SEM), EDS and X-ray diffraction (XRD). For both Alloys, at 350 C degrees with HO, the oxide layers were clearly composed of a double layer: an inner one of very small crystallites and an outer layer formed by bigger crystals scattered over the inner one. The analysis by X-ray diffraction indicated the presence of spinel structures like magnetite (Fe 3 O 4 ) and ferrites and/or nickel chromites. In this case the average oxide thickness was around 0.12 to 0.15 μm for both Alloys. Similar values were found at lower temperatures. The morphology of the oxide layer was similar at lower temperatures for Alloy 800, but a different morphology consisting of platelets or needles was found for Alloy 600. The oxide morphology found at 315 C degrees, without HO and with initial dissolved oxygen in the water, was also very different between both Alloys. The oxide film grown on Alloy 600 with an initial dissolved oxygen in the water, showed clusters of platelets forming structures like flowers that were dispersed on an rather homogeneous layer consisting of smaller platelets or needles. The average oxide film grown in this case was around 0.25 μm for Alloy 600 and 0.18 μm for Alloy 800. (author) [es

  4. Study on improved tribological properties by alloying copper to CP-Ti and Ti–6Al–4V alloy

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Song [Biomechanics and Biotechnology Lab, Research Institute of Tsinghua University in Shenzhen, Shenzhen 518057 (China); Department of Mechanical Engineering, Tsinghua University, Beijing 100084 (China); Ma, Zheng [Institute of Metal Research, Chinese Academy of Science, Shenyang 110016 (China); Liao, Zhenhua [Department of Mechanical Engineering, Tsinghua University, Beijing 100084 (China); Biomechanics and Biotechnology Lab, Research Institute of Tsinghua University in Shenzhen, Shenzhen 518057 (China); Song, Jian [State Key Laboratory of Tribology, Tsinghua University, Beijing 100084 (China); Department of Mechanical Engineering, Tsinghua University, Beijing 100084 (China); Yang, Ke [Institute of Metal Research, Chinese Academy of Science, Shenyang 110016 (China); Liu, Weiqiang, E-mail: weiqliu@hotmail.com [Biomechanics and Biotechnology Lab, Research Institute of Tsinghua University in Shenzhen, Shenzhen 518057 (China); State Key Laboratory of Tribology, Tsinghua University, Beijing 100084 (China)

    2015-12-01

    Copper alloying to titanium and its alloys is believed to show an antibacterial performance. However, the tribological properties of Cu alloyed titanium alloys were seldom studied. Ti–5Cu and Ti–6Al–4V–5Cu alloys were fabricated in the present study in order to further study the friction and wear properties of titanium alloys with Cu additive. The microstructure, composition and hardness were characterized using X-ray diffraction (XRD), scanning electron microscopy (SEM), transmission electron microscope (TEM) and hardness tester. The tribological behaviors were tested with ZrO{sub 2} counterface in 25% bovine serum using a ball-on-disc tribo-tester. The results revealed that precipitations of Ti{sub 2}Cu intermetallic compounds appeared in both Ti–5Cu and Ti–6Al–4V–5Cu alloys. The tribological results showed an improvement in friction and wear resistance for both Ti–5Cu and Ti–6Al–4V–5Cu alloys due to the precipitation of Ti{sub 2}Cu. The results also indicated that both CP-Ti and Ti–5Cu behaved better wear resistance than Ti–6Al–4V and Ti–6Al–4V–5Cu due to different wear mechanisms when articulated with hard zirconia. Both CP-Ti and Ti–5Cu revealed dominant adhesive wear with secondary abrasive wear mechanism while both Ti–6Al–4V and Ti–6Al–4V–5Cu showed severe abrasive wear and cracks with secondary adhesive wear mechanism due to different surface hardness integrated by their microstructures and material types. - Highlights: • Ti–5Cu and Ti–6Al–4V–5Cu alloys were fabricated with Cu additive. • Precipitations of Ti{sub 2}Cu intermetallic compounds appeared after alloying Cu. • The precipitation of Ti{sub 2}Cu improved both friction and wear resistance. • Plowing was the dominant material removal force with severe plowing phenomenon. • Different dominant and secondary wear mechanisms appeared with different hardness.

  5. Texture in low-alloyed uranium alloys

    International Nuclear Information System (INIS)

    Sariel, J.

    1982-08-01

    The dependence of the preferred orientation of cast and heat-treated polycrystalline adjusted uranium and uranium -0.1 w/o chromium alloys on the production process was studied. The importance of obtaining material free of preferred orientation is explained, and a survey of the regular methods to determine preferred orientation is given. Dilatometry, tensile testing and x-ray diffraction were used to determine the extent of the directionality of these alloys. Data processing showed that these methods are insufficient in a case of a material without any plastic forming, because of unreproducibility of results. Two parameters are defined from the results of Schlz's method diffraction test. These parameters are shown theoretically and experimentally (by extreme-case samples) to give the deviation from isotropy. Application of these parameters to the examined samples showes that cast material has preferred orientation, though it is not systematic. This preferred orientation was reduced by adequate heat treatments

  6. Development and Processing Improvement of Aerospace Aluminum Alloys

    Science.gov (United States)

    Lisagor, W. Barry; Bales, Thomas T.

    2007-01-01

    This final report, in multiple presentation format, describes a comprehensive multi-tasked contract study to improve the overall property response of selected aerospace alloys, explore further a newly-developed and registered alloy, and correlate the processing, metallurgical structure, and subsequent properties achieved with particular emphasis on the crystallographic orientation texture developed. Modifications to plate processing, specifically hot rolling practices, were evaluated for Al-Li alloys 2195 and 2297, for the recently registered Al-Cu-Ag alloy, 2139, and for the Al-Zn-Mg-Cu alloy, 7050. For all of the alloys evaluated, the processing modifications resulted in significant improvements in mechanical properties. Analyses also resulted in an enhanced understanding of the correlation of processing, crystallographic texture, and mechanical properties.

  7. NEW METHOD OF PRODUCTION OF ALUNINUM SILICON ALLOYS

    Directory of Open Access Journals (Sweden)

    V. K. Afanasiev

    2015-01-01

    Full Text Available A new approach to the preparation of aluminum-silicon alloys, based on the concept of the leading role of hydrogen in determining the structure and properties of alloys consists in using as charge materials of silicon dioxide (silica and hydrogen instead of crystalline silicon was described. Practical ways to implement the new method were proposed on the example of industrial alloys prepared on charge synthetic alloy. It is shown that the application of the proposed method allows to improve the mechanical properties and reduce the coefficient of thermal expansion alloys, Al-Si. The effect of heat treatment on mechanical properties, density and thermal expansion of synthetic alloys was researched.

  8. Effect of neutron irradiation on vanadium alloys

    International Nuclear Information System (INIS)

    Braski, D.N.

    1986-01-01

    Neutron-irradiated vanadium alloys were evaluated for their susceptibility to irradiation hardening, helium embrittlement, swelling, and residual radioactivity, and the results were compared with those for the austenitic and ferritic stainless steels. The VANSTAR-7 and V-15Cr-5Ti alloys showed the greatest hardening between 400 and 600 0 C while V-3Ti-1Si and V-20Ti had lower values that were comparable to those of ferritic steels. The V-15Cr-5Ti and VANSTAR-7 alloys were susceptible to helium embrittlement caused by the combination of weakened grain boundaries and irradiation-hardened grain matrices. Specimen fractures were entirely intergranular in the most severe instances of embrittlement. The V-3Ti-1Si and V-20Ti alloys were more resistant to helium embrittlement. Except for VANSTAR-7 irradiated to 40 dpa at 520 0 C, all of the vanadium alloys exhibited low swelling that was similar to the ferritic steels. Swelling was greater in specimens that were preimplanted with helium using the tritium trick. The vanadium alloys clearly exhibit lower residual radioactivity after irradiation than the ferrous alloys

  9. Effect of neutron irradiation on vanadium alloys

    Energy Technology Data Exchange (ETDEWEB)

    Braski, D.N.

    1986-01-01

    Neutron-irradiated vanadium alloys were evaluated for their susceptibility to irradiation hardening, helium embrittlement, swelling, and residual radioactivity, and the results were compared with those for the austenitic and ferritic stainless steels. The VANSTAR-7 and V-15Cr-5Ti alloys showed the greatest hardening between 400 and 600/sup 0/C while V-3Ti-1Si and V-20Ti had lower values that were comparable to those of ferritic steels. The V-15Cr-5Ti and VANSTAR-7 alloys were susceptible to helium embrittlement caused by the combination of weakened grain boundaries and irradiation-hardened grain matrices. Specimen fractures were entirely intergranular in the most severe instances of embrittlement. The V-3Ti-1Si and V-20Ti alloys were more resistant to helium embrittlement. Except for VANSTAR-7 irradiated to 40 dpa at 520/sup 0/C, all of the vanadium alloys exhibited low swelling that was similar to the ferritic steels. Swelling was greater in specimens that were preimplanted with helium using the tritium trick. The vanadium alloys clearly exhibit lower residual radioactivity after irradiation than the ferrous alloys.

  10. Vanadium alloys for structural applications in fusion systems: A review of vanadium alloy mechanical and physical properties

    Energy Technology Data Exchange (ETDEWEB)

    Loomis, B.A.; Smith, D.L.

    1991-12-16

    The current knowledge is reviewed on (1) the effects of neutron irradiation on tensile strength and ductility, ductile-brittle transition temperature, creep, fatigue, and swelling of vanadium-base alloys, (2) the compatibility of vanadium-base alloys with liquid lithium, water, and helium environments, and (3) the effects of hydrogen and helium on the physical and mechanical properties of vanadium alloys that are potential candidates for structural materials applications in fusion systems. Also, physical and mechanical properties issues are identified that have not been adequately investigated in order to qualify a vanadium-base alloy for the structural material in experimental fusion devices and/or in fusion reactors.

  11. Vanadium alloys for structural applications in fusion systems: A review of vanadium alloy mechanical and physical properties

    International Nuclear Information System (INIS)

    Loomis, B.A.; Smith, D.L.

    1991-01-01

    The current knowledge is reviewed on (1) the effects of neutron irradiation on tensile strength and ductility, ductile-brittle transition temperature, creep, fatigue, and swelling of vanadium-base alloys, (2) the compatibility of vanadium-base alloys with liquid lithium, water, and helium environments, and (3) the effects of hydrogen and helium on the physical and mechanical properties of vanadium alloys that are potential candidates for structural materials applications in fusion systems. Also, physical and mechanical properties issues are identified that have not been adequately investigated in order to qualify a vanadium-base alloy for the structural material in experimental fusion devices and/or in fusion reactors

  12. Effect of alloying Mo on mechanical strength and corrosion resistance of Zr-1% Sn-1% Nb-1% Fe alloy

    International Nuclear Information System (INIS)

    Sugondo

    2011-01-01

    It had been done research on Zr-1%Sn-1%Nb-1%Fe-(x)%Mo alloy. The ingot was prepared by means of electrical electrode technique. The chemical analysis was identified by XRF, the metallography examination was perform by an optical microscope, the hardness test was done by Vickers microhardness, and the corrosion test was done in autoclave. The objective of this research were making Zr-1%Sn-1%Nb-1%Fe-(x)%Mo alloy with Mo concentration; comparing effect of Mo concentration to metal characteristics of Zr-1%Sn-1%Nb-1%Fe which covered microstructure; composition homogeneity, mechanical strength; and corrosion resistance in steam, and determining the optimal Mo concentration in Zr-1%Sn-1%Nb-1%Fe-(x)% Mo alloy for nuclear fuel cladding which had corrosion resistance and high hardness. The results were as follow: The alloying Mo refined grains at concentration in between 0,1%-0,3% and the concentration more than that could coarsened grains. The hardness of the Zr-1%Sn-1%Nb-1%Fe-(x)%Mo alloy was controlled either by the flaw or the dislocation, the intersection of the harder alloying element, the solid solution of the alloying element and the second phase formation of ZrMo 2 . The corrosion rate of the Zr-1%Sn-1%Nb-1%Fe-(x)%Mo alloy was controlled by the second phase of ZrMo 2 . The 0.3% Mo concentration in Zr-1%Sn-1%Nb-1%Fe-(x)%Mo alloy was the best for second phase formation. The Mo concentration in between 0,3-0,5% in Zr-1%Sn-1%Nb-1%Fe-(x)%Mo alloy was good for the second phase formation and the solid solution. (author)

  13. Development of amorphous and nanocrystalline Al65Cu35-xZrx alloys by mechanical alloying

    International Nuclear Information System (INIS)

    Manna, I.; Chattopadhyay, P.P.; Banhart, F.; Fecht, H.J.

    2004-01-01

    Mechanical alloying of Al 65 Cu 35-x Zr x (x=5, 15 and 25 at.% Zr) elemental powder blends by planetary ball milling up to 50 h yields amorphous and/or nanocrystalline products. Microstructure of the milled product at different stages of milling has been characterized by X-ray diffraction, (XRD) high-resolution transmission electron microscopy (TEM) and energy dispersive X-ray spectroscopy (EDS). Among the different alloys synthesized by mechanical alloying, Al 65 Cu 20 Zr 15 yields a predominantly amorphous product, while the other two alloys develop a composite microstructure comprising nanocrystalline and amorphous solid solutions in Al 65 Cu 10 Zr 25 and nano-intermetallic phase/compound in Al 65 Cu 30 Zr 5 , respectively. The genesis of solid-state amorphization in Al 65 Cu 20 Zr 15 and Al 65 Cu 10 Zr 25 is investigated

  14. Change in mechanical properties of low-alloyed molybdenum alloys at two-stage strengthening during aging

    International Nuclear Information System (INIS)

    Bernshtejn, L.M.; Zakharov, A.M.; Arbuzov, V.K.

    1977-01-01

    Change in mechanical properties of hardened low-alloyed molybdenum alloys (Mo-Zr-C and Mo-Zr-Nb-C) at two-stage strengthening during ageing at 1400 deg C is studied. The initial strengthening maximum following ageing for 5 hr is caused by separation of dispersed ZrC particles and is accompanied by worsened plasticity, a development characteristic of precipitation hardening processes. The second increase in strength after a 10-hr ageing is not accompanied by reduced plasticity, this being characteristic of strengthening as a result of reconstruction of the dislocation structure. Niobium (0.16 wt.%) added to Mo-Zr-C alloys simultaneously increases their plastic and strength properties. The said effect is caused by prevention of premature decomposition of alloys on account of increased low-temperature plasticity, which permits to obtain high resistance to plastic deformation

  15. Corrosion behavior of friction stir welded AZ31B Mg alloy - Al6063 alloy joint

    Directory of Open Access Journals (Sweden)

    B. Ratna Sunil

    2016-12-01

    Full Text Available In the present work, AZ31B Mg alloy and Al6063 alloy-rolled sheets were successfully joined by friction stir welding. Microstructural studies revealed a sound joint with good mechanical mixing of both the alloys at the nugget zone. Corrosion performance of the joint was assessed by immersing in 3.5% NaCl solution for different intervals of time and the corrosion rate was calculated. The joint has undergone severe corrosion attack compared with both the base materials (AZ31B and Al6063 alloys. The predominant corrosion mechanism behind the high corrosion rate of the joint was found to be high galvanic corrosion. From the results, it can be suggested that the severe corrosion of dissimilar Mg–Al joints must be considered as a valid input while designing structures intended to work in corroding environment.

  16. Influence of the alloying effect on nickel K-shell fluorescence yield in Ni Si alloys

    Science.gov (United States)

    Kalayci, Y.; Agus, Y.; Ozgur, S.; Efe, N.; Zararsiz, A.; Arikan, P.; Mutlu, R. H.

    2005-02-01

    Alloying effects on the K-shell fluorescence yield ωK of nickel in Ni-Si binary alloy system have been studied by energy dispersive X-ray fluorescence. It is found that ωK increases from pure Ni to Ni 2Si and then decreases from Ni 2Si to NiSi. These results are discussed in terms of d-occupation number on the Ni site and it is concluded that electronic configuration as a result of p-d hybridization explain qualitatively the observed variation of ωK in Ni-Si alloys.

  17. Electrodeposition of NiPd alloy from aqueous chloride electrolytes

    Energy Technology Data Exchange (ETDEWEB)

    Mech, K., E-mail: kmech@agh.edu.pl [AGH University of Science and Technology, Academic Centre for Materials and Nanotechnology, al. A. Mickiewicza 30, 30-059 Krakow (Poland); Wróbel, M [AGH, University of Science and Technology, Faculty of Metals Engineering and Industrial Computer Science, al. A. Mickiewicza 30, Krakow (Poland); Wojnicki, M [AGH University of Science and Technology, Faculty of Non-Ferrous Metals, Department of Physical Chemistry and Metallurgy of Non-Ferrous Metals, al. A. Mickiewicza 30, 30-059 Krakow (Poland); Mech-Piskorz, J. [Institute of Physical Chemistry, Polish Academy of Sciences, ul. Kasprzaka 44/52, 01-224 Warsaw (Poland); Żabiński, P.; Kowalik, R. [AGH University of Science and Technology, Faculty of Non-Ferrous Metals, Department of Physical Chemistry and Metallurgy of Non-Ferrous Metals, al. A. Mickiewicza 30, 30-059 Krakow (Poland)

    2016-12-01

    Highlights: • Mechanism of electrode reactions resulting in NiPd alloys was described. • Electrolysis conditions enabling alloys synthesis were determined. • Alloys were characterized towards composition, structure and surface properties. - Abstract: Presented results describing properties of alloys deposited at potentiostatic conditions in Ni{sup 2+} – Pd{sup 2+} – Cl{sup −} – H{sub 2}O system. Electrolysis parameters were defined based on results of thermodynamic analysis as well as voltammetry coupled with electrochemical quartz crystal microbalance (EQCM). Influence of electrode potential and electrolyte components concentration on alloy composition, morphology and its structure was investigated. Alloys were deposited at different Ni(II) and Pd(II) complexes concentrations. Results indicated possibilities of electrochemical synthesis of alloys of wide composition range. Deposits structure as well as crystallites size were discussed based on results of XRD measurements. Alloys composition was determined with the use of energy dispersive spectroscopy (EDS). Morphology of alloys was characterized with the use of scanning electron microscopy (SEM).

  18. Progress in Preparation and Research of High Entropy Alloys

    Directory of Open Access Journals (Sweden)

    CHEN Yong-xing

    2017-11-01

    Full Text Available The current high entropy alloys' studies are most in block, powder, coating, film and other areas. There are few studies of high entropy alloys in other areas and they are lack of unified classification. According to the current high entropy alloys' research situation, The paper has focused on the classification on all kinds of high entropy alloys having been researched, introduced the selecting principle of elements, summarized the preparation methods, reviewed the research institutions, research methods and research contents of high entropy alloys, prospected the application prospect of high entropy alloys, put forward a series of scientific problems of high entropy alloys, including less research on mechanism, incomplete performance research, unsystematic thermal stability study, preparation process parameters to be optimized, lightweight high entropy alloys' design, the expansion on the research field, etc, and the solutions have been given. Those have certain guiding significance for the expansion of the application of high entropy alloys subjects in the future research direction.

  19. Effects of Al-Mn-Ti-P-Cu master alloy on microstructure and properties of Al-25Si alloy

    Directory of Open Access Journals (Sweden)

    Xu Chunxiang

    2013-09-01

    Full Text Available To obtain a higher microstructural refining efficiency, and improve the properties and processing ability of hypereutectic Al-25Si alloy, a new environmentally friendly Al-20.6Mn-12Ti-0.9P-6.1Cu (by wt.% master alloy was fabricated; and its modification and strengthening mechanisms on the Al-25Si alloy were studied. The mechanical properties of the unmodified, modified and heat treated alloys were investigated. Results show that the optimal addition amount of the Al-20.6Mn-12Ti-0.9P-6.1Cu master alloy is 4wt.%. In this case, primary Si and eutectic Si as well as メ-Al phase were clearly refined, and this refining effect shows an excellent long residual action as it can be heat-retained for at least 5 h. After being T6 heat treated, the morphology of primary and eutectic Si in the Al-25Si alloys with the addition of 4wt.% Al-20.6Mn-12Ti-0.9P-6.1Cu alloy changes into particles and short rods. The average grain size of the primary and eutectic Si decreases from 250 レm (unmodified to 13.83 レm and 35 レm (unmodified to 7 レm; the メ-Al becomes obviously finer and the distribution of Si phases tends to be uniform and dispersed. Meanwhile, the tensile properties are improved obviously; the tensile strengths at room temperature and 300 ìC reach 241 MPa and 127 MPa, increased by 153.7% and 67.1%, respectively. In addition, the tensile fracture mechanism changes from brittle fracture for the alloy without modification to ductile fracture after modification. Modifying the morphology of Si phase and strengthening the matrix can effectively block the initiation and propagation of cracks, thus improving the strength of the hypereutectic Al-25Si alloy.

  20. Complex precipitation pathways in multicomponent alloys

    Energy Technology Data Exchange (ETDEWEB)

    Clouet, Emmanuel; Nastar, Maylise [Service de Recherches de Metallurgie Physique, CEA/Saclay, 91191 Gif-sur-Yvette (France); Lae, Ludovic; Deschamps, Alexis [LTPCM/ENSEEG, UMR CNRS 5614, Domaine Universitaire, BP 75, 38402 St Martin d' Heres (France); Epicier, Thierry [Groupe d' Etudes de Metallurgie Physique et de Physique des Materiaux, UMR CNRS 5510, INSA, 69621 Villeurbanne (France); Lefebvre, Williams [Groupe de Physique des Materiaux, UMR CNRS 6634, Universite de Rouen, 76801 Saint Etienne du Rouvray (France)

    2006-07-01

    One usual way to strengthen a metal is to add alloying elements and to control the size and the density of the precipitates obtained. However, precipitation in multicomponent alloys can take complex pathways depending on the relative diffusivity of solute atoms and on the relative driving forces involved. In Al - Zr - Sc alloys, atomic simulations based on first-principle calculations combined with various complementary experimental approaches working at different scales reveal a strongly inhomogeneous structure of the precipitates: owing to the much faster diffusivity of Sc compared with Zr in the solid solution, and to the absence of Zr and Sc diffusion inside the precipitates, the precipitate core is mostly Sc-rich, whereas the external shell is Zr-rich. This explains previous observations of an enhanced nucleation rate in Al - Zr - Sc alloys compared with binary Al - Sc alloys, along with much higher resistance to Ostwald ripening, two features of the utmost importance in the field of light high-strength materials. (authors)

  1. Creep behavior of Ti3Al-Nb intermetallic alloys

    International Nuclear Information System (INIS)

    Yu, T.H.; Yue, W.J.; Koo, C.H.

    1997-01-01

    It is well known that Ti 3 Al-Nb alloys are potential materials for aerospace applications. The creep property is an important consideration when materials are used at high temperature. In this article, the effect of microstructure of Ti-25Al-10Nb alloy on the creep property was investigated, and the creep property of Ti-25Al-10Nb alloy modified by small addition of silicon 0.2 at.% or carbon 0.1 at.% was observed. The alloy with the addition of molybdenum to replace part of niobium 2 at.% was also studied. The experimental results show that the furnace-cooled Ti-25Al-10Nb alloy has superior creep resistance to the air-cooled Ti-25Al-10Nb alloy at 200 MPa, but exhibits poor creep resistance at 250 MPa or above. Small addition of silicon to the Ti-25Al-10Nb alloy may increase creep resistance. Small addition of carbon to the Ti-25Al-10Nb alloy may reduce creep resistance but raise rupture strain. Molybdenum is the most effective alloying element to increase creep resistance for the Ti-25Al-10Nb alloy. The creep mechanism of Ti-25Al-10Nb alloy is governed by dislocation climb. (orig.)

  2. In vitro mechanical integrity of hydroxyapatite coated magnesium alloy.

    Science.gov (United States)

    Kannan, M Bobby; Orr, Lynnley

    2011-08-01

    The mechanical integrity of resorbable implants during service, especially in load bearing orthopaedic applications, is critical. The high degradation rate of resorbable magnesium and magnesium-based implants in body fluid may potentially cause premature in-service failure. In this study, a magnesium alloy (AZ91) was potentiostatically coated with hydroxyapatite at different cathodic voltages in an attempt to enhance the mechanical integrity. The mechanical integrity of the uncoated and hydroxyapatite coated alloys was evaluated after in vitro testing of the coated samples in simulated body fluid (SBF). The uncoated alloy showed 40% loss in the mechanical strength after five days exposure to SBF. However, the hydroxyapatite coated alloy exposed to SBF showed 20% improvement in the mechanical strength as compared to that of the uncoated alloy. The alloy coated potentiostatically at -2 V performed better than the -3 V coated alloy. The cross-sectional analysis of the coatings revealed relatively uniform coating thickness for the -2 V coated alloy, whereas the -3 V coated alloy exhibited areas of uneven coating. This can be attributed to the increase in hydrogen evolution on the alloy during -3 V coating as compared to -2 V coating. The scanning electron micrographs of the in vitro tested alloy revealed that hydroxyapatite coating significantly reduced the localized corrosion of the alloy, which is critical for better in-service mechanical integrity. Thus, the study suggests that the in vitro mechanical integrity of resorbable magnesium-based alloy can be improved by potentiostatic hydroxyapatite coating. © 2011 IOP Publishing Ltd

  3. Characterization of aluminium alloys rapidly solidified

    International Nuclear Information System (INIS)

    Monteiro, W.A.

    1988-01-01

    This paper discussed the investigation of the microstructural and mechanical properties of the aluminium alloys (3003; 7050; Al-9% Mg) rapidly solidified by melt spinning process (cooling rate 10 4 - 10 6 K/s). The rapidly solidification process of the studied aluminium alloys brought a microcrystallinity, a minimum presence of coarse precipitation and, also, better mechanical properties of them comparing to the same alloys using ingot process. (author) [pt

  4. Alloy nanoparticle synthesis using ionizing radiation

    Science.gov (United States)

    Nenoff, Tina M [Sandia Park, NM; Powers, Dana A [Albuquerque, NM; Zhang, Zhenyuan [Durham, NC

    2011-08-16

    A method of forming stable nanoparticles comprising substantially uniform alloys of metals. A high dose of ionizing radiation is used to generate high concentrations of solvated electrons and optionally radical reducing species that rapidly reduce a mixture of metal ion source species to form alloy nanoparticles. The method can make uniform alloy nanoparticles from normally immiscible metals by overcoming the thermodynamic limitations that would preferentially produce core-shell nanoparticles.

  5. Development of ODS-Fe{sub 3}Al alloys

    Energy Technology Data Exchange (ETDEWEB)

    Wright, I.G.; Pint, B.A.; Tortorelli, P.F.; McKamey, C.G. [Oak Ridge National Lab., TN (United States)

    1997-12-01

    The overall goal of this program is to develop an oxide dispersion-strengthened (ODS) version of Fe{sub 3}Al that has sufficient creep strength and resistance to oxidation at temperatures in the range 1000 to 1200 C to be suitable for application as heat exchanger tubing in advanced power generation cycles. The main areas being addressed are: (a) alloy processing to achieve the desired alloy grain size and shape, and (b) optimization of the oxidation behavior to provide increased service life compared to semi-commercial ODS-FeCrAl alloys intended for the same applications. The recent studies have focused on mechanically-alloyed powder from a commercial alloy vendor. These starting alloy powders were very clean in terms of oxygen content compared to ORNL-produced powders, but contained similar levels of carbon picked up during the milling process. The specific environment used in milling the powder appears to exert a considerable influence on the post-consolidation recrystallization behavior of the alloy. A milling environment which produced powder particles having a high surface carbon content resulted in a consolidated alloy which readily recrystallized, whereas powder with a low surface carbon level after milling resulted in no recrystallization even at 1380 C. A feature of these alloys was the appearance of voids or porosity after the recrystallization anneal, as had been found with ORNL-produced alloys. Adjustment of the recrystallization parameters did not reveal any range of conditions where recrystallization could be accomplished without the formation of voids. Initial creep tests of specimens of the recrystallized alloys indicated a significant increase in creep strength compared to cast or wrought Fe{sub 3}Al, but the specimens failed prematurely by a mechanism that involved brittle fracture of one of the two grains in the test cross section, followed by ductile fracture of the remaining grain. The reasons for this behavior are not yet understood. The

  6. Effect of V or Zr addition on the mechanical properties of the mechanically alloyed Al-8wt%Ti alloys

    International Nuclear Information System (INIS)

    Moon, I.H.; Lee, J.H.; Lee, K.M.; Kim, Y.D.

    1995-01-01

    Mechanical alloying (MA) of Al-Ti alloy, being a solid state process, offers the unique advantage of producing homogeneous and fine dispersions of thermally stable Al 3 Ti phase, where the formation of the fine Al 3 Ti phase by the other method is restricted from the thermodynamic viewpoint. The MA Al-Ti alloys show substantially higher strength than the conventional Al alloys at the elevated temperature due to the presence of Al 3 Ti as well as Al 4 C 3 and Al 2 O 3 , of which the last two phases were introduced during MA process. The addition of V or Zr to Al-Ti alloy was known to decrease the lattice mismatch between the intermetallic compound and the aluminum matrix, and such decrease in lattice mismatching can influence positively the high temperature mechanical strength of the MA Al-Ti by increasing the resistance to dispersoid coarsening at the elevated temperature. In the present study, therefore, the mechanical behavior of the MA Al-Ti-V and Al-Ti-Zr alloys were investigated in order to evaluate the effect of V or Zr addition on the mechanical properties of the MA Al-8Ti alloy at high temperature

  7. HLA-inferred extended haplotype disparity level is more relevant than the level of HLA mismatch alone for the patients survival and GvHD in T cell-replate hematopoietic stem cell transplantation from unrelated donor.

    Science.gov (United States)

    Nowak, Jacek; Nestorowicz, Klaudia; Graczyk-Pol, Elzbieta; Mika-Witkowska, Renata; Rogatko-Koros, Marta; Jaskula, Emilia; Koscinska, Katarzyna; Madej, Sylwia; Tomaszewska, Agnieszka; Nasilowska-Adamska, Barbara; Szczepinski, Andrzej; Halaburda, Kazimierz; Dybko, Jaroslaw; Kuliczkowski, Kazimierz; Czerw, Tomasz; Giebel, Sebastian; Holowiecki, Jerzy; Baranska, Malgorzata; Pieczonka, Anna; Wachowiak, Jacek; Czyz, Anna; Gil, Lidia; Lojko-Dankowska, Anna; Komarnicki, Mieczyslaw; Bieniaszewska, Maria; Kucharska, Agnieszka; Hellmann, Andrzej; Gronkowska, Anna; Jedrzejczak, Wieslaw W; Markiewicz, Miroslaw; Koclega, Anna; Kyrcz-Krzemien, Slawomira; Mielcarek, Monika; Kalwak, Krzysztof; Styczynski, Jan; Wysocki, Mariusz; Drabko, Katarzyna; Wojcik, Beata; Kowalczyk, Jerzy; Gozdzik, Jolanta; Pawliczak, Daria; Gwozdowicz, Slawomir; Dziopa, Joanna; Szlendak, Urszula; Witkowska, Agnieszka; Zubala, Marta; Gawron, Agnieszka; Warzocha, Krzysztof; Lange, Andrzej

    2018-06-01

    Serious risks in unrelated hematopoietic stem cell transplantation (HSCT) including graft versus host disease (GvHD) and mortality are associated with HLA disparity between donor and recipient. The increased risks might be dependent on disparity in not-routinely-tested multiple polymorphisms in genetically dense MHC region, being organized in combinations of two extended MHC haplotypes (Ehp). We assessed the clinical role of donor-recipient Ehp disparity levels in N = 889 patients by the population-based detection of HLA allele phase mismatch. We found increased GvHD incidences and mortality rates with increasing Ehp mismatch level even with the same HLA mismatch level. In multivariate analysis HLA mismatch levels were excluded from models and Ehp disparity level remained independent prognostic factor for high grade acute GvHD (p = 0.000037, HR = 10.68, 95%CI 5.50-32.5) and extended chronic GvHD (p < 0.000001, HR = 15.51, CI95% 5.36-44.8). In group with single HLA mismatch, patients with double Ehp disparity had worse 5-year overall survival (45% vs. 56%, p = 0.00065, HR = 4.05, CI95% 1.69-9.71) and non-relapse mortality (40% vs. 31%, p = 0.00037, HR = 5.63, CI95% 2.04-15.5) than patients with single Ehp disparity. We conclude that Ehp-linked factors contribute to the high morbidity and mortality in recipients given HLA-mismatched unrelated transplant and Ehp matching should be considered in clinical HSCT. Copyright © 2018. Published by Elsevier Inc.

  8. Nickel and cobalt base alloys

    International Nuclear Information System (INIS)

    Houlle, P.

    1994-01-01

    Nickel base alloys have a good resistance to pitting, cavernous or cracks corrosion. Nevertheless, all the nickel base alloys are not equivalent. Some differences exit between all the families (Ni, Ni-Cu, Ni-Cr-Fe, Ni-Cr-Fe-Mo/W-Cu, Ni-Cr-Mo/W, Ni-Mo). Cobalt base alloys in corrosive conditions are generally used for its wear and cracks resistance, with a compromise to its localised corrosion resistance properties. The choice must be done from the perfect knowledge of the corrosive medium and of the alloys characteristics (chemical, metallurgical). A synthesis of the corrosion resistance in three medium (6% FeCl 3 , 4% NaCl + 1% HCl + 0.1% Fe 2 (SO 4 ) 3 , 11.5% H 2 SO 4 + 1.2% HCl + 1% Fe 2 (SO 4 ) 3 + 1% CuCl 2 ) is presented. (A.B.). 11 refs., 1 fig., 12 tabs

  9. Emissivity measurements on aeronautical alloys

    International Nuclear Information System (INIS)

    Campo, L. del; Perez-Saez, R.B.; Gonzalez-Fernandez, L.; Esquisabel, X.; Fernandez, I.; Gonzalez-Martin, P.; Tello, M.J.

    2010-01-01

    The emissivity of three Ni and Co based aeronautical alloys is analyzed in this paper. These alloys are employed in high temperature environments whenever good corrosion resistance, high temperature resistance and high strength are essential. Thus, apart from the aeronautical industry, these alloys are also used in other technological applications, as for example, aerospace, nuclear reactors, and tooling. The results in this paper extend the emissivity data for these alloys available in the literature. Emissivity dependence on the radiation wavelength (2-22 μm), sample temperature (200-650 o C) and emission angle (0-85 o ) has been investigated. In addition, the effect of surface finish and oxidation has also been taken into consideration. The data in this paper have several applications, as temperature measurement of a target by pyrometry, low observability of airplanes and thermal radiation heat transfer simulation in airplane nozzles or furnaces.

  10. Emissivity measurements on aeronautical alloys

    Energy Technology Data Exchange (ETDEWEB)

    Campo, L. del, E-mail: leire.del-campo@cnrs-orleans.f [Departamento de Fisica de la Materia Condensada, Facultad de Ciencia y Tecnologia, Universidad del Pais Vasco, Barrio Sarriena s/n, 48940 Leioa, Bizkaia (Spain); Perez-Saez, R.B., E-mail: raul.perez@ehu.e [Departamento de Fisica de la Materia Condensada, Facultad de Ciencia y Tecnologia, Universidad del Pais Vasco, Barrio Sarriena s/n, 48940 Leioa, Bizkaia (Spain); Instituto de Sintesis y Estudio de Materiales, Universidad del Pais Vasco, Apdo. 644, 48080 Bilbao (Spain); Gonzalez-Fernandez, L. [Departamento de Fisica de la Materia Condensada, Facultad de Ciencia y Tecnologia, Universidad del Pais Vasco, Barrio Sarriena s/n, 48940 Leioa, Bizkaia (Spain); Esquisabel, X.; Fernandez, I. [Industria de Turbo Propulsores, S.A., Planta de Zamudio, Edificio 300, 48170 Zamudio, Bizkaia (Spain); Gonzalez-Martin, P. [Industria de Turbo Propulsores, S.A., Parque empresarial San Fernando, Avda. Castilla 2, 28830 San Fernando de Henares, Madrid (Spain); Tello, M.J. [Departamento de Fisica de la Materia Condensada, Facultad de Ciencia y Tecnologia, Universidad del Pais Vasco, Barrio Sarriena s/n, 48940 Leioa, Bizkaia (Spain); Instituto de Sintesis y Estudio de Materiales, Universidad del Pais Vasco, Apdo. 644, 48080 Bilbao (Spain)

    2010-01-21

    The emissivity of three Ni and Co based aeronautical alloys is analyzed in this paper. These alloys are employed in high temperature environments whenever good corrosion resistance, high temperature resistance and high strength are essential. Thus, apart from the aeronautical industry, these alloys are also used in other technological applications, as for example, aerospace, nuclear reactors, and tooling. The results in this paper extend the emissivity data for these alloys available in the literature. Emissivity dependence on the radiation wavelength (2-22 {mu}m), sample temperature (200-650 {sup o}C) and emission angle (0-85{sup o}) has been investigated. In addition, the effect of surface finish and oxidation has also been taken into consideration. The data in this paper have several applications, as temperature measurement of a target by pyrometry, low observability of airplanes and thermal radiation heat transfer simulation in airplane nozzles or furnaces.

  11. Modeling wear of cast Ti alloys.

    Science.gov (United States)

    Chan, Kwai S; Koike, Marie; Okabe, Toru

    2007-05-01

    The wear behavior of Ti-based alloys was analyzed by considering the elastic-plastic fracture of individual alloys in response to the relevant contact stress field. Using the contact stresses as the process driving force, wear was computed as the wear rate or volume loss as a function of hardness and tensile ductility for Ti-based cast alloys containing an alpha, alpha+beta or beta microstructure with or without the intermetallic precipitates. Model predictions indicated that wear of Ti alloys increases with increasing hardness but with decreasing fracture toughness or tensile ductility. The theoretical results are compared with experimental data to elucidate the roles of microstructure in wear and contrasted against those in grindability.

  12. NASA-427: A New Aluminum Alloy

    Science.gov (United States)

    Nabors, Sammy A.

    2015-01-01

    NASA's Marshall Space Flight Center researchers have developed a new, stronger aluminum alloy, ideal for cast aluminum products that have powder or paint-baked thermal coatings. With advanced mechanical properties, the NASA-427 alloy shows greater tensile strength and increased ductility, providing substantial improvement in impact toughness. In addition, this alloy improves the thermal coating process by decreasing the time required for heat treatment. With improvements in both strength and processing time, use of the alloy provides reduced materials and production costs, lower product weight, and better product performance. The superior properties of NASA-427 can benefit many industries, including automotive, where it is particularly well-suited for use in aluminum wheels.

  13. Viscosity of Ga-Li liquid alloys

    Science.gov (United States)

    Vidyaev, Dmitriy; Boretsky, Evgeny; Verkhorubov, Dmitriy

    2018-03-01

    The measurement of dynamic viscosity of Ga-Li liquid alloys has been performed using low-frequency vibrational viscometer at five temperatures in the range 313-353 K and four gallium-based dilute alloy compositions containing 0-1.15 at.% Li. It was found that the viscosity of the considered alloys increases with decreasing temperature and increasing lithium concentration in the above ranges. It was shown that dependence of the viscosity of Ga-Li alloys in the investigated temperature range has been described by Arrhenius equation. For this equation the activation energy of viscous flow and pre-exponential factor were calculated. This study helped to determine the conditions of the alkali metals separating process in gallam-exchange systems.

  14. Corrosion resistance improvement of titanium base alloys

    Directory of Open Access Journals (Sweden)

    Mihai V. Popa

    2010-01-01

    Full Text Available The corrosion resistance of the new Ti-6Al-4V-1Zr alloy in comparison with ternary Ti-6Al-4V alloy in Ringer-Brown solution and artificial Carter-Brugirard saliva of different pH values was studied. In Ringer-Brown solution, the new alloy presented an improvement of all electrochemical parameters due to the alloying with Zr; also, impedance spectra revealed better protective properties of its passive layer. In Carter-Brugirard artificial saliva, an increase of the passive film thickness was proved. Fluoride ions had a slight negative influence on the corrosion and ion release rates, without to affect the very good stability of the new Ti-6Al-4V-1Zr alloy.

  15. Mechanical and microstructural characterization of the nickel base alloy (Alloy 600) after heat treatment

    International Nuclear Information System (INIS)

    Fernandes, Stela Maria de Carvalho

    1993-01-01

    The characterization of microstructural and mechanical properties of cold rolled and heat treated alloys 600 made in Brazil were investigated. The recovery and recrystallization behavior as well as solubilization and aging have been studied using optical, scanning electron and transmission electron microscopy. Microhardness and tensile testing have been carried out. The recovery process of the cold rolled alloy 600 occurred until 600 deg C and the recrystallization stage was situated between 600 and 850 deg C. The primary recrystallization temperature was obtained at 850 deg C after 1 hour (isochronal heat treatments). The aged alloy 600 shows carbide precipitation on grains bu with ductility maintenance. (author)

  16. Fatigue Characteristics of Selected Light Metal Alloys

    Directory of Open Access Journals (Sweden)

    Cieśla M.

    2016-03-01

    Full Text Available The paper addresses results of fatigue testing of light metal alloys used in the automotive as well as aerospace and aviation industries, among others. The material subject to testing comprised hot-worked rods made of the AZ31 alloy, the Ti-6Al-4V two-phase titanium alloy and the 2017A (T451 aluminium alloy. Both low- and high-cycle fatigue tests were conducted at room temperature on the cycle asymmetry ratio of R=-1. The low-cycle fatigue tests were performed using the MTS-810 machine on two levels of total strain, i.e.Δεc= 1.0% and 1.2%. The high-cycle fatigue tests, on the other hand, were performed using a machine from VEB Werkstoffprufmaschinen-Leipzig under conditions of rotary bending. Based on the results thus obtained, one could develop fatigue life characteristics of the materials examined (expressed as the number of cycles until failure of sample Nf as well as characteristics of cyclic material strain σa=f(N under the conditions of low-cycle fatigue testing. The Ti-6Al-4V titanium alloy was found to be characterised by the highest value of fatigue life Nf, both in lowand high-cycle tests. The lowest fatigue life, on the other hand, was established for the aluminium alloys examined. Under the high-cycle fatigue tests, the life of the 2017A aluminium and the AZ31 magnesium alloy studied was determined by the value of stress amplitude σa. With the stress exceeding 150 MPa, it was the aluminium alloy which displayed higher fatigue life, whereas the magnesium alloy proved better on lower stress.

  17. Precipitation Behavior of Magnesium Alloys Containing Neodymium and Yttrium

    Science.gov (United States)

    Solomon, Ellen L. S.

    Magnesium is the lightest of the structural metals and has great potential for reducing the weight of transportation systems, which in turn reduces harmful emissions and improves fuel economy. Due to the inherent softness of Mg, other elements are typically added in order to form a fine distribution of precipitates during aging, which improves the strength by acting as barriers to moving dislocations. Mg-RE alloys are unique among other Mg alloys because they form precipitates that lie parallel to the prismatic planes of the Mg matrix, which is an ideal orientation to hinder dislocation slip. However, RE elements are expensive and impractical for many commercial applications, motivating the rapid design of alternative alloy compositions with comparable mechanical properties. Yet in order to design new alloys reproducing some of the beneficial properties of Mg-RE alloys, we must first fully understand precipitation in these systems. Therefore, the main objectives of this thesis are to identify the roles of specific RE elements (Nd and Y) on precipitation and to relate the precipitate microstructure to the alloy strength. The alloys investigated in this thesis are the Mg-Nd, Mg-Y, and Mg-Y-Nd systems, which contain the main alloying elements of commercial WE series alloys (Y and Nd). In all three alloy systems, a sequence of metastable phases forms upon aging. Precipitate composition, atomic structure, morphology, and spatial distribution are strongly controlled by the elastic strain energy originating from the misfitting coherent precipitates. The dominating role that strain energy plays in these alloy systems gives rise to very unique microstructures. The evolution of the hardness and precipitate microstructure with aging revealed that metastable phases are the primary strengthening phases of these alloys, and interact with dislocations by shearing. Our understanding of precipitation mechanisms and commonalities among the Mg-RE alloys provide future avenues to

  18. Characterization and corrosion behaviour of CoNi alloys obtained by mechanical alloying

    Energy Technology Data Exchange (ETDEWEB)

    Olvera, S. [Instituto Politécnico Nacional, ESIQIE, Departamento de Ingeniería en Metalurgia y Materiales, México, D. F. (Mexico); Universidad Autónoma de Madrid, Facultad de Ciencias, Departamento de Química-Física Aplicada, 28049 Madrid (Spain); Sánchez-Marcos, J. [Universidad Autónoma de Madrid, Facultad de Ciencias, Departamento de Química-Física Aplicada, 28049 Madrid (Spain); Palomares, F.J. [Instituto de Ciencia de Materiales de Madrid, ICMM-CSIC, Cantoblanco, 28049 Madrid (Spain); Salas, E. [Spline Spanish CRG Beamline at the European Synchrotron Radiation Facilities, ESRF, BP 220-38043, Grenoble Cedex (France); Arce, E.M. [Instituto Politécnico Nacional, ESIQIE, Departamento de Ingeniería en Metalurgia y Materiales, México, D. F. (Mexico); Herrasti, P., E-mail: pilar.herrasti@uam.es [Universidad Autónoma de Madrid, Facultad de Ciencias, Departamento de Química-Física Aplicada, 28049 Madrid (Spain)

    2014-07-01

    CoNi alloys including Co{sub 30}Ni{sub 70}, Co{sub 50}Ni{sub 50} and Co{sub 70}Ni{sub 30} were prepared via mechanical alloying using Co and Ni powders. The crystallinity and short-range order were studied using X-ray diffraction and X-ray absorption spectroscopy. The results show that the milling process increases the number of vacancies, especially around the Co atoms, while the milling time decreases the crystalline size and enhances the crystallinity. X-ray photoelectron spectroscopy was used to characterise the chemical composition of the samples surface. The magnetic properties were analysed using zero-field cooling, field cooling and a magnetic hysteresis loops. The magnetic saturation moment is approximately 1.05 μ{sub B}/atom; this value decreases with the mechanical alloying time, and it is proportional to the cobalt concentration. The polarization and impedance curves in different media (NaCl, H{sub 2}SO{sub 4} and NaOH) showed similar corrosion resistance values. The corrosion resistance increased in the order NaCl, H{sub 2}SO{sub 4} and NaOH. A good passivation layer was formed in NaOH due to the cobalt and nickel oxides on the particle surfaces. - Highlights: • Ni{sub x}Co{sub 100-x} alloys were synthesized by mechanical alloying • Milling time decrease size and enhances crystallinity. • Oxygen is not present in a significant percentage in bulk but is detected on the surface. • Magnetic saturation moment is 1.05 mB/atom and decrease with mechanical allowing time • Corrosion resistance is higher in NaOH than in NaCl or HCl solutions.

  19. Ferromagnetic bulk glassy alloys

    International Nuclear Information System (INIS)

    Inoue, Akihisa; Makino, Akihiro; Mizushima, Takao

    2000-01-01

    This paper deals with the review on the formation, thermal stability and magnetic properties of the Fe-based bulk glassy alloys in as-cast bulk and melt-spun ribbon forms. A large supercooled liquid region over 50 K before crystallization was obtained in Fe-(Al, Ga)-(P, C, B, Si), Fe-(Cr, Mo, Nb)-(Al, Ga)-(P, C, B) and (Fe, Co, Ni)-Zr-M-B (M=Ti, Hf, V, Nb, Ta, Cr, Mo and W) systems and bulk glassy alloys were produced in a thickness range below 2 mm for the Fe-(Al, Ga)-(P, C, B, Si) system and 6 mm for the Fe-Co-(Zr, Nb, Ta)-(Mo, W)-B system by copper-mold casting. The ring-shaped glassy Fe-(Al, Ga)-(P, C, B, Si) alloys exhibit much better soft magnetic properties as compared with the ring-shaped alloy made from the melt-spun ribbon because of the formation of the unique domain structure. The good combination of high glass-forming ability and good soft magnetic properties indicates the possibility of future development as a new bulk glassy magnetic material

  20. Capacity retention in hydrogen storage alloys

    Science.gov (United States)

    Anani, A.; Visintin, A.; Srinivasan, S.; Appleby, A. J.; Reilly, J. J.; Johnson, J. R.

    1992-01-01

    Results of our examination of the properties of several candidate materials for hydrogen storage electrodes and their relation to the decrease in H-storage capacity upon open-circuit storage over time are reported. In some of the alloy samples examined to date, only about 10 percent of the hydrogen capacity was lost upon storage for 20 days, while in others, this number was as high as 30 percent for the same period of time. This loss in capacity is attributed to two separate mechanisms: (1) hydrogen desorbed from the electrode due to pressure differences between the cell and the electrode sample; and (2) chemical and/or electrochemical degradation of the alloy electrode upon exposure to the cell environment. The former process is a direct consequence of the equilibrium dissociation pressure of the hydride alloy phase and the partial pressure of hydrogen in the hydride phase in equilibrium with that in the electrolyte environment, while the latter is related to the stability of the alloy phase in the cell environment. Comparison of the equilibrium gas-phase dissociation pressures of these alloys indicate that reversible loss of hydrogen capacity is higher in alloys with P(eqm) greater than 1 atm than in those with P(eqm) less than 1 atm.

  1. A Review of Dissimilar Welding Techniques for Magnesium Alloys to Aluminum Alloys

    Directory of Open Access Journals (Sweden)

    Liming Liu

    2014-05-01

    Full Text Available Welding of dissimilar magnesium alloys and aluminum alloys is an important issue because of their increasing applications in industries. In this document, the research and progress of a variety of welding techniques for joining dissimilar Mg alloys and Al alloys are reviewed from different perspectives. Welding of dissimilar Mg and Al is challenging due to the formation of brittle intermetallic compound (IMC such as Mg17Al12 and Mg2Al3. In order to increase the joint strength, three main research approaches were used to eliminate or reduce the Mg-Al intermetallic reaction layer. First, solid state welding techniques which have a low welding temperature were used to reduce the IMCs. Second, IMC variety and distribution were controlled to avoid the degradation of the joining strength in fusion welding. Third, techniques which have relatively controllable reaction time and energy were used to eliminate the IMCs. Some important processing parameters and their effects on weld quality are discussed, and the microstructure and metallurgical reaction are described. Mechanical properties of welds such as hardness, tensile, shear and fatigue strength are discussed. The aim of the report is to review the recent progress in the welding of dissimilar Mg and Al to provide a basis for follow-up research.

  2. A Review of Dissimilar Welding Techniques for Magnesium Alloys to Aluminum Alloys

    Science.gov (United States)

    Liu, Liming; Ren, Daxin; Liu, Fei

    2014-01-01

    Welding of dissimilar magnesium alloys and aluminum alloys is an important issue because of their increasing applications in industries. In this document, the research and progress of a variety of welding techniques for joining dissimilar Mg alloys and Al alloys are reviewed from different perspectives. Welding of dissimilar Mg and Al is challenging due to the formation of brittle intermetallic compound (IMC) such as Mg17Al12 and Mg2Al3. In order to increase the joint strength, three main research approaches were used to eliminate or reduce the Mg-Al intermetallic reaction layer. First, solid state welding techniques which have a low welding temperature were used to reduce the IMCs. Second, IMC variety and distribution were controlled to avoid the degradation of the joining strength in fusion welding. Third, techniques which have relatively controllable reaction time and energy were used to eliminate the IMCs. Some important processing parameters and their effects on weld quality are discussed, and the microstructure and metallurgical reaction are described. Mechanical properties of welds such as hardness, tensile, shear and fatigue strength are discussed. The aim of the report is to review the recent progress in the welding of dissimilar Mg and Al to provide a basis for follow-up research. PMID:28788646

  3. A Review of Dissimilar Welding Techniques for Magnesium Alloys to Aluminum Alloys.

    Science.gov (United States)

    Liu, Liming; Ren, Daxin; Liu, Fei

    2014-05-08

    Welding of dissimilar magnesium alloys and aluminum alloys is an important issue because of their increasing applications in industries. In this document, the research and progress of a variety of welding techniques for joining dissimilar Mg alloys and Al alloys are reviewed from different perspectives. Welding of dissimilar Mg and Al is challenging due to the formation of brittle intermetallic compound (IMC) such as Mg 17 Al 12 and Mg₂Al₃. In order to increase the joint strength, three main research approaches were used to eliminate or reduce the Mg-Al intermetallic reaction layer. First, solid state welding techniques which have a low welding temperature were used to reduce the IMCs. Second, IMC variety and distribution were controlled to avoid the degradation of the joining strength in fusion welding. Third, techniques which have relatively controllable reaction time and energy were used to eliminate the IMCs. Some important processing parameters and their effects on weld quality are discussed, and the microstructure and metallurgical reaction are described. Mechanical properties of welds such as hardness, tensile, shear and fatigue strength are discussed. The aim of the report is to review the recent progress in the welding of dissimilar Mg and Al to provide a basis for follow-up research.

  4. Development the Mechanical Properties of (AL-Li-Cu Alloy

    Directory of Open Access Journals (Sweden)

    Ihsan Kadhom AlNaimi

    2017-11-01

    Full Text Available The aim of this research is to develop mechanical properties of a new aluminium-lithium-copper alloy. This alloy prepared under control atmosphere by casting in a permanent metal mould. The microstructure was examined and mechanical properties were tested before and after heat treatment to study the influence of heat treatment on its mechanical properties including; modulus of elasticity, tensile strength, impact, and fatigue. The results showed that the modulus of elasticity of the prepared alloy is higher than standard alloy about 2%. While the alloy that heat treated for 6 h and cooled in water, then showed a higher ultimate tensile stress comparing with as-cast alloy. The homogenous heat treatment gives best fatigue behaviour comparing with as-cast and other heat treatment alloys. Also, the impact test illustrates that the homogeneous heat treatment alloy gives the highest value.

  5. Effects of scandium and zirconium combination alloying on as-cast microstructure and mechanical properties of Al-4Cu-1.5Mg alloy

    Directory of Open Access Journals (Sweden)

    Xiang Qingchun

    2011-02-01

    Full Text Available The influences of minor scandium and zirconium combination alloying on the as-cast microstructure and mechanical properties of Al-4Cu-1.5Mg alloy have been experimentally investigated. The experimental results show that when the minor elements of scandium and zirconium are simultaneously added into the Al-4Cu-1.5Mg alloy, the as-cast microstructure of the alloy is effectively modified and the grains of the alloy are greatly refined. The coarse dendrites in the microstructure of the alloy without Sc and Zr additions are refined to the uniform and fine equiaxed grains. As the additions of Sc and Zr are 0.4% and 0.2%, respectively, the tensile strength, yield strength and elongation of the alloy are relatively better, which are 275.0 MPa, 176.0 MPa and 8.0% respectively. The tensile strength is increased by 55.3%, and the elongation is nearly raised three times, compared with those of the alloy without Sc and Zr additions.

  6. High-alloy steels and nickel alloys for construction of industrial plants. Pt. 2

    International Nuclear Information System (INIS)

    2007-01-01

    Vol. 2 of the 8. Dresden Corrosion Protection Seminar comprises eight papers, most of which are in the form of PowerPoint presentations: High-temperature materials and their applications in chemical engineering (J. Kloever); Alloy 602 CA in metal dusting conditions; Material requirements in future power plants (H. Schneider); Status report on material qualification for the 700 C technology in coal power plants (R. Mohrmann); Materials for nuclear fusion (M. Paju); The degradation mechanism relaxation cracking as exemplified by the alloys 800 H and 617 (H.C. van Wortel); Specific requirements on the design of a pressurised manifold of Alloy 800 H in refineries, a case study (I. Rommerskirchen et al.); Materials for electro-surfacing for corrosion protection in conditions of high-temperature corrosion (M.Spiegel) [de

  7. ALLOY DESIGN AND PROPERTY EVALUATION OF TI ALLOY ...

    African Journals Online (AJOL)

    eobe

    1,2 DEPARTMENT OF METALLURGICAL AND MATERIALS ENGINEERING, UNIVERSITY OF NIGERIA, NSUKKA, NIGERIA. 2 DEPT ... a result of this structural change, titanium alloys fall ... the phase stability and mechanical behaviours of Ti-.

  8. Refinement and fracture mechanisms of as-cast QT700-6 alloy by alloying method

    Directory of Open Access Journals (Sweden)

    Min-qiang Gao

    2017-01-01

    Full Text Available The as-cast QT700-6 alloy was synthesized with addition of a certain amount of copper, nickel, niobium and stannum elements by alloying method in a medium frequency induction furnace, aiming at improving its strength and toughness. Microstructures of the as-cast QT700-6 alloy were observed using a scanning-electron microscope (SEM and the mechanical properties were investigated using a universal tensile test machine. Results indicate that the ratio of pearlite/ferrite is about 9:1 and the graphite size is less than 40 μm in diameter in the as-cast QT700-6 alloy. The predominant refinement mechanism is attributed to the formation of niobium carbides, which increases the heterogeneous nucleus and hinders the growth of graphite. Meanwhile, niobium carbides also exist around the grain boundaries, which improve the strength of the ductile iron. The tensile strength and elongation of the as-cast QT700-6 alloy reach over 700 MPa and 6%, respectively, when the addition amount of niobium is 0.8%. The addition of copper and nickel elements contributed to the decrease of eutectoid transformation temperature, resulting in the decrease of pearlite lamellar spacing (about 248 nm, which is also beneficial to enhancing the tensile strength. The main fracture mechanism is cleavage fracture with the appearance of a small amount of dimples.

  9. Requirements of Inconel 718 alloy for aeronautical applications

    Science.gov (United States)

    Ghiban, Brandusa; Elefterie, Cornelia Florina; Guragata, Constantin; Bran, Dragos

    2018-02-01

    The main requirements imposed by aviation components made from super alloys based on Nickel are presented in present paper. A significant portion of fasteners, locking lugs, blade retainers and inserts are manufactured from Inconel 718 alloy. The thesis describes environmental factors (corrosion), conditions of external aggression (salt air, intense heat, heavy industrial pollution, high condensation, high pressure), mechanical characteristics (tensile strength, creep, density, yield strength, fracture toughness, fatigue resistance) and loadings (tensions, compression loads) that must be satisfied simultaneously by Ni-based super alloy, compared to other classes of aviation alloys (as egg. Titanium alloys, Aluminum alloys). For this alloy the requirements are strength, durability, damage tolerance, fail safety and so on. The corrosion can be an issue, but the fatigue under high-magnitude cyclic tensile loading it what limits the lifetime of the airframe. The excellent malleability and weldability characteristics of the 718 system make the material physical properties tolerant of manufacturing processes. These characteristics additionally continue to provide new opportunities for advanced manufacturing methods.

  10. Additional materials for welding of the EP99 heat resisting alloy with the EI868 alloy and 12Kh18N9T steel

    International Nuclear Information System (INIS)

    Sorokin, L.I.; Filippova, S.P.; Petrova, L.A.

    1978-01-01

    Presented are the results of the studies aimed at selecting an additive material for argon-arc welding process involving heat-resistant nickel EP99 alloy to be welded to the EI868 alloy and 12Kh18N9T steel. As the additive material use was made of wire made of nickel-chromium alloys and covered electrodes made of the EP367 alloy with additions of tungsten. It has been established that in order to improve the resistance of metal to hot-crack formation during argon arc welding of the EP99 alloy with the EI868 alloy, it is advisable to use an additive material of the EP533 alloy, and while welding the same alloy with the 12Kh18N9T steel, filler wire of the EP367 alloy is recommended

  11. Development of Zr alloys - Fabrication of Zr-Nb alloy used in PHWRs

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Kang In; Kim, Won Baek; Choi, Guk Sun; Lee, Chul Kyung; Jang, Dae Kyu; Seo, Chang Yeol; Sim, Kun Joo; Lee, Jae Cheon [Korea Institute of Geology Mining and Materials, Taejon (Korea, Republic of)

    1996-07-01

    The manufacture of Zr-Nb alloy ingot by EB melting process is carried out to meet the chemical composition and mechanical and property specifications and to ensure that the ingots are free of unacceptable defects through this study. It was established that Zr-Nb alloy was made by EB melting technique including the control of adding elements, melting power and melting and cast device. 28 refs., 13 tabs., 26 figs., 23 ills. (author)

  12. Liquid metal corrosion considerations in alloy development

    International Nuclear Information System (INIS)

    Tortorelli, P.F.; DeVan, J.H.

    1984-01-01

    Liquid metal corrosion can be an important consideration in developing alloys for fusion and fast breeder reactors and other applications. Because of the many different forms of liquid metal corrosion (dissolution, alloying, carbon transfer, etc.), alloy optimization based on corrosion resistance depends on a number of factors such as the application temperatures, the particular liquid metal, and the level and nature of impurities in the liquid and solid metals. The present paper reviews the various forms of corrosion by lithium, lead, and sodium and indicates how such corrosion reactions can influence the alloy development process

  13. Structure and grindability of dental Ti-Cr alloys

    International Nuclear Information System (INIS)

    Hsu, H.-C.; Wu, S.-C.; Chiang, T.-Y.; Ho, W.-F.

    2009-01-01

    The purpose of this study was to investigate the structure and microhardness of a series of binary Ti-Cr alloys with Cr contents up to 30 wt%. In addition, the grindability was also evaluated using an electric dental handpiece with SiC wheels, with the goal of developing a titanium alloy with better mechanical properties and machinability than commercially pure titanium (c.p. Ti), a metal generally considered to be difficult to machine. This study evaluated the phase and structure of Ti-Cr alloys, using an X-ray diffraction (XRD) for phase analysis and optical microscope for microstructure of the etched alloys. Grindability was evaluated by measuring the amount of metal volume removed after grinding for 1 min. Results indicated that the structure of Ti-Cr alloys is sensitive to the Cr content. The cast c.p. Ti has a hexagonal α phase. With 5 wt% Cr, metastable β phase starts to be retained. With Cr contents higher than 10 wt%, the equi-axed β phase is almost entirely retained. In addition, athermal ω phase was found in the Ti-5Cr and Ti-10Cr alloys. The largest quantity of ω phase and highest microhardness were found in Ti-10Cr alloy. The grinding rate of the Ti-Cr alloys showed a similar tendency to the microhardness. The Ti-10Cr alloy exhibited the best grindability, especially at 1000 m/min, which presumably due to the brittle nature of the alloy containing the ω phase in the β matrix.

  14. Effects of chemical composition on the corrosion of dental alloys.

    Science.gov (United States)

    Galo, Rodrigo; Ribeiro, Ricardo Faria; Rodrigues, Renata Cristina Silveira; Rocha, Luís Augusto; de Mattos, Maria da Glória Chiarello

    2012-01-01

    The aim of this study was to determine the effect of the oral environment on the corrosion of dental alloys with different compositions, using electrochemical methods. The corrosion rates were obtained from the current-potential curves and electrochemical impedance spectroscopy (EIS). The effect of artificial saliva on the corrosion of dental alloys was dependent on alloy composition. Dissolution of the ions occurred in all tested dental alloys and the results were strongly dependent on the general alloy composition. Regarding the alloys containing nickel, the Ni-Cr and Ni-Cr-Ti alloys released 0.62 mg/L of Ni on average, while the Co-Cr dental alloy released ions between 0.01 and 0.03 mg/L of Co and Cr, respectively.The open-circuit potential stabilized at a higher level with lower deviation (standard deviation: Ni-Cr-6Ti = 32 mV/SCE and Co-Cr = 54 mV/SCE). The potenciodynamic curves of the dental alloys showed that the Ni-based dental alloy with >70 wt% of Ni had a similar curve and the Co-Cr dental alloy showed a low current density and hence a high resistance to corrosion compared with the Ni-based dental alloys. Some changes in microstructure were observed and this fact influenced the corrosion behavior for the alloys. The lower corrosion resistance also led to greater release of nickel ions to the medium. The quantity of Co ions released from the Co-Cr-Mo alloy was relatively small in the solutions. In addition, the quantity of Cr ions released into the artificial saliva from the Co-Cr alloy was lower than Cr release from the Ni-based dental alloys.

  15. Oxide films on magnesium and magnesium alloys

    International Nuclear Information System (INIS)

    Shih, T.-S.; Liu, J.-B.; Wei, P.-S.

    2007-01-01

    Magnesium alloys are very active and readily ignite during heating and melting. In this study, we discuss the combustion of magnesium and magnesium alloys and propose prospective anti-ignition mechanisms for magnesium alloys during the heating process. When magnesium and magnesium alloys were heated in air, the sample surfaces produced layers of thermally formed oxides. These thermally formed oxides played an important role in affecting the combustion of the magnesium and magnesium alloys. When magnesium was heated in air, brucite that formed in the early stage was then transformed into periclase by dehydroxylation. By extending the heating time, more periclase formed and increased in thickness which was associated with microcracks formation. When magnesium was heated in a protective atmosphere (SF 6 ), a film of MgF 2 formed at the interface between the oxide layer and the Mg substrate. This film generated an anti-ignition behavior which protected the substrate from oxidation. When solution-treated AZ80 alloy was heated, spinel developed at the interface between the thermally formed oxide layer and the Mg substrate, improving the anti-ignition properties of the substrate. In addition, we also explain the effects of beryllium in an AZB91 alloy on the ignition-proofing behavior

  16. Structural alloys for high field superconducting magnets

    International Nuclear Information System (INIS)

    Morris, J.W. Jr.

    1985-08-01

    Research toward structural alloys for use in high field superconducting magnets is international in scope, and has three principal objectives: the selection or development of suitable structural alloys for the magnet support structure, the identification of mechanical phenomena and failure modes that may influence service behavior, and the design of suitable testing procedures to provide engineering design data. This paper reviews recent progress toward the first two of these objectives. The structural alloy needs depend on the magnet design and superconductor type and differ between magnets that use monolithic and those that employ force-cooled or ICCS conductors. In the former case the central requirement is for high strength, high toughness, weldable alloys that are used in thick sections for the magnet case. In the latter case the need is for high strength, high toughness alloys that are used in thin welded sections for the conductor conduit. There is productive current research on both alloy types. The service behavior of these alloys is influenced by mechanical phenomena that are peculiar to the magnet environment, including cryogenic fatigue, magnetic effects, and cryogenic creep. The design of appropriate mechanical tests is complicated by the need for testing at 4 0 K and by rate effects associated with adiabatic heating during the tests. 46 refs

  17. Microstructures and properties of aluminum die casting alloys

    Energy Technology Data Exchange (ETDEWEB)

    M. M. Makhlouf; D. Apelian; L. Wang

    1998-10-01

    This document provides descriptions of the microstructure of different aluminum die casting alloys and to relate the various microstructures to the alloy chemistry. It relates the microstructures of the alloys to their main engineering properties such as ultimate tensile strength, yield strength, elongation, fatigue life, impact resistance, wear resistance, hardness, thermal conductivity and electrical conductivity. Finally, it serves as a reference source for aluminum die casting alloys.

  18. Titanium by design: TRIP titanium alloy

    Science.gov (United States)

    Tran, Jamie

    Motivated by the prospect of lower cost Ti production processes, new directions in Ti alloy design were explored for naval and automotive applications. Building on the experience of the Steel Research Group at Northwestern University, an analogous design process was taken with titanium. As a new project, essential kinetic databases and models were developed for the design process and used to create a prototype design. Diffusion kinetic models were developed to predict the change in phase compositions and microstructure during heat treatment. Combining a mobility database created in this research with a licensed thermodynamic database, ThermoCalc and DICTRA software was used to model kinetic compositional changes in titanium alloys. Experimental diffusion couples were created and compared to DICTRA simulations to refine mobility parameters in the titanium mobility database. The software and database were able to predict homogenization times and the beta→alpha plate thickening kinetics during cooling in the near-alpha Ti5111 alloy. The results of these models were compared to LEAP microanalysis and found to be in reasonable agreement. Powder metallurgy was explored using SPS at GM R&D to reduce the cost of titanium alloys. Fully dense Ti5111 alloys were produced and achieved similar microstructures to wrought Ti5111. High levels of oxygen in these alloys increased the strength while reducing the ductility. Preliminary Ti5111+Y alloys were created, where yttrium additions successfully gettered excess oxygen to create oxides. However, undesirable large oxides formed, indicating more research is needed into the homogeneous distribution of the yttrium powder to create finer oxides. Principles established in steels were used to optimize the beta phase transformation stability for martensite transformation toughening in titanium alloys. The Olson-Cohen kinetic model is calibrated to shear strains in titanium. A frictional work database is established for common alloying

  19. Superplasticity in powder metallurgy aluminum alloys and composites

    International Nuclear Information System (INIS)

    Mishra, R.S.; Bieler, T.R.; Mukherjee, A.K.

    1995-01-01

    Superplasticity in powder metallurgy Al alloys and composites has been reviewed through a detailed analysis. The stress-strain curves can be put into 4 categories: classical well-behaved type, continuous strain hardening type, continuous strain softening type and complex type. The origin of these different types of is discussed. The microstructural features of the processed material and the role of strain have been reviewed. The role of increasing misorientation of low angle boundaries to high angle boundaries by lattice dislocation absorption is examined. Threshold stresses have been determined and analyzed. The parametric dependencies for superplastic flow in modified conventional aluminum alloys, mechanically alloyed alloys and Al alloy matrix composites is determined to elucidate the superplastic mechanism at high strain rates. The role of incipient melting has been analyzed. A stress exponent of 2, an activation energy equal to that for grain boundary diffusion and a grain size dependence of 2 generally describes superplastic flow in modified conventional Al alloys and mechanically alloyed alloys. The present results agree well with the predictions of grain boundary sliding models. This suggests that the mechanism of high strain rate superplasticity in the above-mentioned alloys is similar to conventional superplasticity. The shift of optimum superplastic strain rates to higher values is a consequence of microstructural refinement. The parametric dependencies for superplasticity in aluminum alloy matrix composites, however, is different. A true activation energy of superplasticity in aluminum alloy matrix composites, however, is different. A true activation energy of 313 kJ/mol best describes the composites having SiC reinforcements. The role of shape of the reinforcement (particle or whisker) and processing history is addressed. The analysis suggests that the mechanism for superplasticity in composites is interface diffusion controlled grain boundary sliding

  20. Interfacial Reaction During Dissimilar Joining of Aluminum Alloy to Magnesium and Titanium Alloys

    Science.gov (United States)

    Robson, J. D.; Panteli, A.; Zhang, C. Q.; Baptiste, D.; Cai, E.; Prangnell, P. B.

    Ultrasonic welding (USW), a solid state joining process, has been used to produce welds between AA6111 aluminum alloy and AZ31 magnesium alloys or titanium alloy Ti-6Al-4V. The mechanical properties of the welds have been assessed and it has been shown that it is the nature and thickness of the intermetallic compounds (IMCs) at the joint line that are critical in determining joint strength and particularly fracture energy. Al-Mg welds suffer from a very low fracture energy, even when strength is comparable with that of similar metal Mg-Mg welds, due to a thick IMC layer always being formed. It is demonstrated that in USW of Al-Ti alloy the slow interdiffusion kinetics means that an IMC layer does not form during welding, and fracture energy is greater. A model has been developed to predict IMC formation during welding and provide an understanding of the critical factors that determine the IMC thickness. It is predicted that in Al-Mg welds, most of the lMC thickening occurs whilst the IMC regions grow as separate islands, prior to the formation of a continuous layer.

  1. Bulk amorphous Mg-based alloys

    DEFF Research Database (Denmark)

    Pryds, Nini

    2004-01-01

    are discussed in this paper. On the basis of these measurements phase diagrams of the different systems were constructed. Finally, it is demonstrated that when pressing the bulk amorphous alloy onto a metallic dies at temperatures within the supercooled liquid region, the alloy faithfully replicates the surface...

  2. Measurement and analyses of molten Ni-Co alloy density

    Institute of Scientific and Technical Information of China (English)

    XIAO Feng; K. MUKAI; FANG Liang; FU Ya; YANG Ren-hui

    2006-01-01

    With the advent of powerful mathematical modeling techniques for material phenomena, there is renewed interest in reliable data for the density of the Ni-based superalloys. Up to now, there has been few report on the density of molten Ni-Co alloy.In order to obtain more accurate density data for molten Ni-Co alloy, the density of molten Ni-Co alloy was measured with a modified sessile drop method, and the accommodation of different atoms in molten Ni-Co alloy was analyzed. The density of alloy is found to decrease with increasing temperature and Co concentration in the alloy. The molar volume of molten Ni-Co alloy increases with increasing Co concentration. The molar volume of Ni-Co alloy determined shows a positive deviation from the linear molar volume, and the deviation of molar volume from ideal mixing increases with increasing Co concentration over the experimental concentration range.

  3. Mechanical Properties of Magnesium-Rare Earth Alloy Systems: A Review

    Directory of Open Access Journals (Sweden)

    Sravya Tekumalla

    2014-12-01

    Full Text Available Magnesium-rare earth based alloys are increasingly being investigated due to the formation of highly stable strengthening phases, activation of additional deformation modes and improvement in mechanical properties. Several investigations have been done to study the effect of rare earths when they are alloyed to pure magnesium and other Mg alloys. In this review, the mechanical properties of the previously investigated different magnesium-rare earth based binary alloys, ternary alloys and other higher alloys with more than three alloying elements are presented.

  4. Density and Structure Analysis of Molten Ni-W Alloys

    Institute of Scientific and Technical Information of China (English)

    Feng XIAO; Liang FANG

    2004-01-01

    Density of molten Ni and Ni-W alloys was measured in the temperature range of 1773~1873 K with a sessile drop method.The density of molten Ni and Ni-W alloys trends to decrease with increasing temperature. The density and molar volume of the alloys trend to increase with increasing W concentration in the alloys. The calculation result shows an ideal mixing of Ni-W alloys.

  5. Introduction to hydrogen in alloys

    International Nuclear Information System (INIS)

    Westlake, D.G.

    1980-01-01

    Substitutional alloys, both those that form hydrides and those that do not, are discussed, but with more emphasis on the former than the latter. This overview includes the following closely related subjects: (1) the significant effects of substitutional solutes on the pressure-composition-temperature (PCT) equilibria of metal-hydrogen systems, (2) the changes in thermodynamic properties resulting from differences in atom size and from modifications of electronic structure, (3) attractive and repulsive interactions between H and solute atoms and the effects of such interactions on the pressure dependent solubility for H, (4) H trapping in alloys of Group V metals and its effect on the terminal solubility for H (TSH), (5) some other mechanisms invoked to explain the enhancement (due to alloying) of the (TSH) in Group V metals, and (6) H-impurity complexes in alloys of the metals Ni, Co, and Fe. Some results showing that an enhanced TSH may ameliorate the resistance of a metal to hydrogen embrittlement are presented

  6. Creep of titanium--silicon alloys

    International Nuclear Information System (INIS)

    Paton, N.E.; Mahoney, M.W.

    1976-01-01

    Operative creep mechanisms in laboratory melts of Ti-5Zr-0.5Si and Ti-5Zr-0.5Si have been investigated as a function of microstructure, creep stress, and temperature. From creep rate data and transmission electron microscopy results, it has been shown that an important creep strengthening mechanism at 811 0 K in Si-bearing Ti alloys is clustering of solute atoms on dislocations. All of the alloys investigated showed anomalously high apparent activation energies and areas for creep and a high exponent (n) in the Dorn equation. In addition, the effect of heat treatment was investigated and it is shown that the highest creep strength was obtained by using a heat treatment which retained the maximum amount of silicon in solution. This is consistent with the proposed creep strengthening mechanism. An investigation of the creep behavior of several other Si containing alloys including two commercial alloys, Ti-11 and IMI-685 indicated similar results. 12 fig., 6 tables

  7. Mg-Ca Alloys Produced by Reduction of CaO: Understanding of ECO-Mg Alloy Production

    Science.gov (United States)

    Jung, In-Ho; Lee, Jin Kyu; Kim, Shae K.

    2017-04-01

    There have been long debates about the environment conscious (ECO) Mg technology which utilizes CaO to produce Ca-containing Mg alloys. Two key process technologies of the ECO-Mg process are the chemical reduction of CaO by liquid Mg and the maintenance of melt cleanliness during the alloying of Ca. Thermodynamic calculations using FactSage software were performed to explain these two key issues. In addition, an experimental study was performed to compare the melt cleanliness of the Ca-containing Mg alloys produced by the conventional route with metallic Ca and the ECO-Mg route with CaO.

  8. Effect of structure and alloying elements on void formation in austenitic steels and nickel alloys

    International Nuclear Information System (INIS)

    Levy, V.; Azam, N.; Le Naour, L.; Didout, G.; Delaplace, J.

    1977-01-01

    In the development of the fast breeder reactors the phenomenon of metal swelling due to the formation of radiation induced voids is a large problem. In the complex alloys small fluctuations in composition can have a considerable effect on swelling and a great deal of investigation on the effect of both major and minor alloying elements is needed to be able to predict swelling. To provide more insight a research program involving irradiation of both commercial or specially cast alloys by 500 keV Ni + ions or 1 MeV electrons has been developed. The major results are presented

  9. Nature of negative microplastic deformation in alloys

    International Nuclear Information System (INIS)

    Palatnik, L.S.; Ivantsov, V.I.; Kagan, Ya.I.; Papirov, I.I.; Fat'yanova, N.B.; AN Ukrainskoj SSR, Kharkov. Fiziko-Tekhnicheskij Inst.)

    1985-01-01

    The paper deals with investigation of microplastic deformation of corrosion resistant aging 40KhNYU alloy and the study of physical nature of negative microdeformation in this alloy under tension. Investigation of microplasticity of 40KhNYU alloy was conducted by the method of mechanostatic hysteresis using resistance strain gauge for measuring stresses and deformations. Microplasticity curves for 40KhNYU alloy were obtained. They represent the result of competition between usual (positive) microdeformation and phase (negative) deformation under tensile effect on the alloy. It was established that the negative microdeformation increment occurs during secondary aging of the phase precipitated from initial supersat urated solid solution (primary decomposition product). This phase decomposes under tension with disperse phase precipitation which promotes decreasing its specific volume and specimen volume as a whole

  10. Method of treating Ti--Nb--Zr--Ta superconducting alloys

    International Nuclear Information System (INIS)

    Horiuchi, T.; Monju, Y.; Tatara, I.; Nagai, N.; Hisata, M.; Matsumoto, K.

    1975-01-01

    A superconducting alloy is formulated from 10 to 50 at. percent Ti, 20 to 50 at. percent Nb, 10 to 40 at. percent Zr, and 5 to 12 at. percent Ta. A Ti--Nb--Zr--Ta superconducting alloy with a fine, non-homogeneous structure is obtained by forming a β solid solution of Ti--Nb--Zr--Ta alloy by heating to a temperature within the β solid solution range, cooling, and then cold working the heated alloy. The cold worked alloy is heated to a temperature within the (β' + β'') alloy to maintain the peritectoid structure, cold worked, then heated to a temperature within the eutectoid range to form a multiphase alloy structure and then cooled and finally cold worked. (U.S.)

  11. Thermodynamic properties of uranium in gallium–aluminium based alloys

    International Nuclear Information System (INIS)

    Volkovich, V.A.; Maltsev, D.S.; Yamshchikov, L.F.; Chukin, A.V.; Smolenski, V.V.; Novoselova, A.V.; Osipenko, A.G.

    2015-01-01

    Activity, activity coefficients and solubility of uranium was determined in gallium-aluminium alloys containing 1.6 (eutectic), 5 and 20 wt.% aluminium. Additionally, activity of uranium was determined in aluminium and Ga–Al alloys containing 0.014–20 wt.% Al. Experiments were performed up to 1073 K. Intermetallic compounds formed in the alloys were characterized by X-ray diffraction. Partial and excess thermodynamic functions of U in the studied alloys were calculated. - Highlights: • Thermodynamics of uranium is determined in Ga–Al alloys of various compositions. • Uranium in the mixed alloys interacts with both components, Ga and Al. • Interaction of U with Al increases with decreasing temperature. • Activity and solubility of uranium depend on Al content in Ga–Al alloys.

  12. Thermodynamic properties of uranium in gallium–aluminium based alloys

    Energy Technology Data Exchange (ETDEWEB)

    Volkovich, V.A., E-mail: v.a.volkovich@urfu.ru [Department of Rare Metals and Nanomaterials, Institute of Physics and Technology, Ural Federal University, Ekaterinburg, 620002 (Russian Federation); Maltsev, D.S.; Yamshchikov, L.F. [Department of Rare Metals and Nanomaterials, Institute of Physics and Technology, Ural Federal University, Ekaterinburg, 620002 (Russian Federation); Chukin, A.V. [Department of Theoretical Physics and Applied Mathematics, Institute of Physics and Technology, Ural Federal University, Ekaterinburg, 620002 (Russian Federation); Smolenski, V.V.; Novoselova, A.V. [Institute of High-Temperature Electrochemistry UD RAS, Ekaterinburg, 620137 (Russian Federation); Osipenko, A.G. [JSC “State Scientific Centre - Research Institute of Atomic Reactors”, Dimitrovgrad, 433510 (Russian Federation)

    2015-10-15

    Activity, activity coefficients and solubility of uranium was determined in gallium-aluminium alloys containing 1.6 (eutectic), 5 and 20 wt.% aluminium. Additionally, activity of uranium was determined in aluminium and Ga–Al alloys containing 0.014–20 wt.% Al. Experiments were performed up to 1073 K. Intermetallic compounds formed in the alloys were characterized by X-ray diffraction. Partial and excess thermodynamic functions of U in the studied alloys were calculated. - Highlights: • Thermodynamics of uranium is determined in Ga–Al alloys of various compositions. • Uranium in the mixed alloys interacts with both components, Ga and Al. • Interaction of U with Al increases with decreasing temperature. • Activity and solubility of uranium depend on Al content in Ga–Al alloys.

  13. Annealing texture of rolled nickel alloys

    International Nuclear Information System (INIS)

    Meshchaninov, I.V.; Khayutin, S.G.

    1976-01-01

    A texture of pure nickel and binary alloys after the 95% rolling and annealing has been studied. Insoluble additives (Mg, Zr) slacken the cubic texture in nickel and neral slackening of the texture (Zr). In the case of alloying with silicium (up to 2%) the texture practically coinsides with that of a technical-grade nickel. The remaining soluble additives either do not change the texture of pure nickel (C, Nb) or enhance the sharpness and intensity of the cubic compontnt (Al, Cu, Mn, Cr, Mo, W, Co -at their content 0.5 to 2.0%). A model is proposed by which variation of the annealing texture upon alloying is caused by dissimilar effect of the alloying elements on the mobility of high- and low-angle grain boundaries

  14. Hydrogen storage in Ti-Mn-(FeV) BCC alloys

    International Nuclear Information System (INIS)

    Santos, S.F.; Huot, J.

    2009-01-01

    Recently, the replacement of vanadium by the less expensive (FeV) commercial alloy has been investigated in Ti-Cr-V BCC solid solutions and promising results were reported. In the present work, this approach of using (FeV) alloys is adopted to synthesize alloys of the Ti-Mn-V system. Compared to the V-containing alloys, the alloys containing (FeV) have a smaller hydrogen storage capacity but a larger reversible hydrogen storage capacity, which is caused by the increase of the plateau pressure of desorption. Correlations between the structure and the hydrogen storage properties of the alloys are also discussed.

  15. Study on improved tribological properties by alloying copper to CP-Ti and Ti-6Al-4V alloy.

    Science.gov (United States)

    Wang, Song; Ma, Zheng; Liao, Zhenhua; Song, Jian; Yang, Ke; Liu, Weiqiang

    2015-12-01

    Copper alloying to titanium and its alloys is believed to show an antibacterial performance. However, the tribological properties of Cu alloyed titanium alloys were seldom studied. Ti-5Cu and Ti-6Al-4V-5Cu alloys were fabricated in the present study in order to further study the friction and wear properties of titanium alloys with Cu additive. The microstructure, composition and hardness were characterized using X-ray diffraction (XRD), scanning electron microscopy (SEM), transmission electron microscope (TEM) and hardness tester. The tribological behaviors were tested with ZrO2 counterface in 25% bovine serum using a ball-on-disc tribo-tester. The results revealed that precipitations of Ti2Cu intermetallic compounds appeared in both Ti-5Cu and Ti-6Al-4V-5Cu alloys. The tribological results showed an improvement in friction and wear resistance for both Ti-5Cu and Ti-6Al-4V-5Cu alloys due to the precipitation of Ti2Cu. The results also indicated that both CP-Ti and Ti-5Cu behaved better wear resistance than Ti-6Al-4V and Ti-6Al-4V-5Cu due to different wear mechanisms when articulated with hard zirconia. Both CP-Ti and Ti-5Cu revealed dominant adhesive wear with secondary abrasive wear mechanism while both Ti-6Al-4V and Ti-6Al-4V-5Cu showed severe abrasive wear and cracks with secondary adhesive wear mechanism due to different surface hardness integrated by their microstructures and material types. Copyright © 2015 Elsevier B.V. All rights reserved.

  16. Minor-alloyed Cu-Ni-Si alloys with high hardness and electric conductivity designed by a cluster formula approach

    Directory of Open Access Journals (Sweden)

    Dongmei Li

    2017-08-01

    Full Text Available Cu-Ni-Si alloys are widely used due to their good electrical conductivities in combination with high strength and hardness. In the present work, minor-alloying with M = (Cr, Fe, Mo, Zr was conducted for the objective of further improving their hardness while maintaining their conductivity level. A cluster-plus-glue-atom model was introduced to design the compositions of M-alloyed Cu-Ni-Si alloys, in which an ideal composition formula [(Ni,Si,M-Cu12]Cu3 (molar proportion was proposed. To guarantee the complete precipitation of solute elements in fine δ-Ni2Si precipitates, the atomic ratio of (Ni,M/Si was set as 2/1. Thus the designed alloy series of Cu93.75(Ni/Zr3.75Si2.08(Cr/Fe/Mo0.42 (at% were arc-melted into ingots under argon atmosphere, and solid-solutioned at 950 °C for 1 h plus water quenching and then aged at 450 °C for different hours. The experimental results showed that these designed alloys exhibit high hardness (HV > 1.7 GPa and good electrical conductivities (≥ 35% IACS. Specifically, the quinary Cu93.75Ni3.54Si2.08(Cr/Fe0.42Zr0.21 alloys (Cu-3.32Ni-0.93Si-0.37(Cr/Fe−0.30Zr wt% possess both a high hardness with HV = 2.5–2.7 GPa, comparable to the high-strength KLFA85 alloy (Cu-3.2Ni-0.7Si-1.1Zn wt%, HV = 2.548 GPa, and a good electrical conductivity (35–36% IACS.

  17. New Developments of Ti-Based Alloys for Biomedical Applications

    Science.gov (United States)

    Li, Yuhua; Yang, Chao; Zhao, Haidong; Qu, Shengguan; Li, Xiaoqiang; Li, Yuanyuan

    2014-01-01

    Ti-based alloys are finding ever-increasing applications in biomaterials due to their excellent mechanical, physical and biological performance. Nowdays, low modulus β-type Ti-based alloys are still being developed. Meanwhile, porous Ti-based alloys are being developed as an alternative orthopedic implant material, as they can provide good biological fixation through bone tissue ingrowth into the porous network. This paper focuses on recent developments of biomedical Ti-based alloys. It can be divided into four main sections. The first section focuses on the fundamental requirements titanium biomaterial should fulfill and its market and application prospects. This section is followed by discussing basic phases, alloying elements and mechanical properties of low modulus β-type Ti-based alloys. Thermal treatment, grain size, texture and properties in Ti-based alloys and their limitations are dicussed in the third section. Finally, the fourth section reviews the influence of microstructural configurations on mechanical properties of porous Ti-based alloys and all known methods for fabricating porous Ti-based alloys. This section also reviews prospects and challenges of porous Ti-based alloys, emphasizing their current status, future opportunities and obstacles for expanded applications. Overall, efforts have been made to reveal the latest scenario of bulk and porous Ti-based materials for biomedical applications. PMID:28788539

  18. Single-phase high-entropy alloys. An overview

    Energy Technology Data Exchange (ETDEWEB)

    Kozak, Roksolana; Steurer, Walter [ETH Zurich (Switzerland). Lab. of Crystallography; Sologubenko, Alla [ETH Zurich (Switzerland). Lab. of Nanotechnology

    2015-02-01

    The term 'high-entropy alloys (HEAs)' first appeared about 10 years ago defining alloys composed of n=5-13 principal elements with concentrations of approximately 100/n at.% each. Since then many equiatomic (or near equiatomic) single- and multi-phase multicomponent alloys were developed, which are reported for a combination of tunable properties: high hardness, strength and ductility, oxidation and wear resistance, magnetism, etc. In our paper, we focus on probably single-phase HEAs (solid solutions) out of all HEAs studied so far, discuss ways of their prediction, mechanical properties. In contrast to classical multielement/multiphase alloys, only single-phase multielement alloys (solid solutions) represent the basic concept underlying HEAs as mixing-entropy stabilized homogenous materials. The literature overview is complemented by own studies demonstrating that the alloys CrFeCoNi, CrFeCoNiAl{sub 0.3} and PdFeCoNi homogenized at 1300 and 1100 C, respectively, for 1 week are not single-phase HEAs, but a coherent mixture of two solid solutions.

  19. Manufacture and properties of molybdenum-rhenium alloys

    International Nuclear Information System (INIS)

    Fischer, B.; Freund, D.

    2001-01-01

    It is necessary to measure strength and creep behavior to guarantee the safe and reliable usage of refractory alloys at extremely high temperatures. In the literature there is very little information available about the properties of Mo-Re alloys at temperatures higher than 1000 C. A special test facility has been designed and built for stress-rupture testing at very high temperatures (up to 3000 C) of refractory metals and alloys in inert atmospheres. - The stress-rupture strength as well as the creep behavior of molybdenum-rhenium alloys with rhenium contents between 41 and 51 wt.% have been determined at temperatures ranging from 1200 to 2000 C, and rupture times of up to 10 hours using this facility. Previous measurements of stress-rupture strength and creep behavior of pure rhenium have been compared with the measurement results of Mo-Re alloys. - The discussion of the values measured is based on metallographic test results and scanning electron microscopy (SEM) images of Mo-Re alloy samples after stress-rupture testing. (orig.) [de

  20. Structural and magnetic properties of nanocrystalline Fe–Co–Ni alloy processed by mechanical alloying

    International Nuclear Information System (INIS)

    Raanaei, Hossein; Eskandari, Hossein; Mohammad-Hosseini, Vahid

    2016-01-01

    In this present work, a nanostructured iron–cobalt–nickel alloy with Fe_5_0Co_3_0Ni_2_0 composition has been processed by mechanical alloying. The structural and magnetic properties have been investigated by X-ray diffraction, scanning electron microscopy, energy dispersive X-ray spectroscopy and vibrating sample magnetometer. It is shown that the crystallize size reaches to about 18.7 nm after 32 h milling time. A remarkable decrease in coercivity after 16 h milling time and also a continuous increase in remanent magnetization during the mechanical alloying process are observed. Heat treatment of the samples milled at 32 and 48 h demonstrates the crystalline constituent elements and also Fe_3O_4 crystalline phase. - Highlights: • This article focuses on mechanical alloying of Fe_5_0Co_3_0Ni_2_0 composition. • Structural and magnetic properties were investigated. • Saturation magnetization was increased sharply after 16 h of milling time. • The heat treatment revealed the signature of Fe_3O_4 as well as FeNi_3 and Co crystalline phases.

  1. Structural and magnetic properties of nanocrystalline Fe–Co–Ni alloy processed by mechanical alloying

    Energy Technology Data Exchange (ETDEWEB)

    Raanaei, Hossein, E-mail: hraanaei@yahoo.com [Department of Physics, Persian Gulf University, Bushehr 75169 (Iran, Islamic Republic of); Eskandari, Hossein [Department of Mechanical Engineering, Persian Gulf University, Bushehr 75169 (Iran, Islamic Republic of); Mohammad-Hosseini, Vahid [Department of Physics, Persian Gulf University, Bushehr 75169 (Iran, Islamic Republic of)

    2016-01-15

    In this present work, a nanostructured iron–cobalt–nickel alloy with Fe{sub 50}Co{sub 30}Ni{sub 20} composition has been processed by mechanical alloying. The structural and magnetic properties have been investigated by X-ray diffraction, scanning electron microscopy, energy dispersive X-ray spectroscopy and vibrating sample magnetometer. It is shown that the crystallize size reaches to about 18.7 nm after 32 h milling time. A remarkable decrease in coercivity after 16 h milling time and also a continuous increase in remanent magnetization during the mechanical alloying process are observed. Heat treatment of the samples milled at 32 and 48 h demonstrates the crystalline constituent elements and also Fe{sub 3}O{sub 4} crystalline phase. - Highlights: • This article focuses on mechanical alloying of Fe{sub 50}Co{sub 30}Ni{sub 20} composition. • Structural and magnetic properties were investigated. • Saturation magnetization was increased sharply after 16 h of milling time. • The heat treatment revealed the signature of Fe{sub 3}O{sub 4} as well as FeNi{sub 3} and Co crystalline phases.

  2. Determination of tungsten in high-alloy steels and heat resisting alloys by isotope dilution-spark source mass spectrometry

    International Nuclear Information System (INIS)

    Saito, Morimasa; Yamada, Kei; Okochi, Haruno; Hirose, Fumio

    1983-01-01

    Tungsten in high-alloy steels and heat-resisting alloys was determined by isotope dilution method combined with spark source mass spectrometry by using 183 W enriched tungsten. The spike solution was prepared by fusing tungsten trioxide in sodium carbonate. A high-alloy steel sample was dissolved in the mixture of sulfuric acid and phosphoric acid together with the spike solution; a sample of heat resisting alloy was similarly dissolved in the mixture of hydrochloric acid, nitric acid, sulfuric acid, and phosphoric acid. The solution was evaporated to give dense white fumes. Tungsten was separated from the residue by a conventional cinchonine salt-precipitation method. The salt was ignited, and the residue was mixed with graphite powder and pressed into electrodes. The isotope 183 W and 184 W were measured. The method was applied to the determination of tungsten in JSS and NBS standard high-alloy steels and JAERI standard nickel- and NBS standard cobalt-base heat resisting alloys containing more than 0.05% tungsten. The results were obtained with satisfactory precision and accuracy. However, the results obtained for JSS standard high- speed steels containing molybdenum tended to be significantly lower than the certified values. (author)

  3. Superconductivity in zirconium-rhodium alloys

    Science.gov (United States)

    Zegler, S. T.

    1969-01-01

    Metallographic studies and transition temperature measurements were made with isothermally annealed and water-quenched zirconium-rhodium alloys. The results clarify both the solid-state phase relations at the Zr-rich end of the Zr-Rh alloy system and the influence upon the superconducting transition temperature of structure and composition.

  4. Austenitic alloys Fe-Ni-Cr dominating

    International Nuclear Information System (INIS)

    Gibson, R.C.; Korenko, M.K.

    1980-01-01

    Austenitic alloy essentially comprising 42 to 48% nickel, 11 to 13% chromium, 2.6 to 3.4% niobium, 0.2 to 1.2% silicon, 0.5 to 1.5% vanadium, 2.6 to 3.4% molybdenum, 0.1 to 0.3% aluminium, 0.1 to 0.3% titanium, 0.02 to 0.05% carbon, 0.002 to 0.015% boron, up to 0.06% zirconium, the balance being iron. The characteristic of this alloy is a conventional elasticity limit to within 2% of at least 450 MPa, with a maximum tensile strength of at least 500 MPa at a test temperature of 650 0 C after immersion annealing at 1038 0 C and 30% hardening. To this effect the invention concerns Ni-Cr-Fe high temperature alloys possessing excellent mechanical strength characteristics, that can be obtained with lower levels of nickel and chromium than those used in alloys of this kind in the present state of the technique, a higher amount of niobium than in the previous alloys and with the addition of 0.5 to 1.5% vanadium [fr

  5. Hydrogen interactions in aluminum-lithium alloys

    Science.gov (United States)

    Smith, S. W.; Scully, J. R.

    1991-01-01

    A program is described which seeks to develop an understanding of the effects of dissolved and trapped hydrogen on the mechanical properties of selected Al-Li-Cu-X alloys. A proposal is made to distinguish hydrogen (H2) induced EAC from aqueous dissolution controlled EAC, to correlate H2 induced EAC with mobile and trapped concentrations, and to identify significant trap sites and hydride phases (if any) through use of model alloys and phases. A literature review shows three experimental factors which have impeded progress in the area of H2 EAC for this class of alloys. These are as listed: (1) inter-subgranular fracture in Al-Li alloys when tested in the S-T orientation in air or vacuum make it difficult to readily detect H2 induced fracture based on straight forward changes in fractography; (2) the inherently low H2 diffusivity and solubility in Al alloys is further compounded by a native oxide which acts as a H2 permeation barrier; and (3) H2 effects are masked by dissolution assisted processes when mechanical testing is performed in aqueous solutions.

  6. Amorphization of Fe-based alloy via wet mechanical alloying assisted by PCA decomposition

    Energy Technology Data Exchange (ETDEWEB)

    Neamţu, B.V., E-mail: Bogdan.Neamtu@stm.utcluj.ro [Materials Science and Engineering Department, Technical University of Cluj-Napoca, 103-105, Muncii Avenue, 400641, Cluj-Napoca (Romania); Chicinaş, H.F.; Marinca, T.F. [Materials Science and Engineering Department, Technical University of Cluj-Napoca, 103-105, Muncii Avenue, 400641, Cluj-Napoca (Romania); Isnard, O. [Université Grenoble Alpes, Institut NEEL, F-38042, Grenoble (France); CNRS, Institut NEEL, 25 rue des martyrs, BP166, F-38042, Grenoble (France); Pană, O. [National Institute for Research and Development of Isotopic and Molecular Technologies, 65-103 Donath Street, 400293, Cluj-Napoca (Romania); Chicinaş, I. [Materials Science and Engineering Department, Technical University of Cluj-Napoca, 103-105, Muncii Avenue, 400641, Cluj-Napoca (Romania)

    2016-11-01

    Amorphization of Fe{sub 75}Si{sub 20}B{sub 5} (at.%) alloy has been attempted both by wet and dry mechanical alloying starting from a mixture of elemental powders. Powder amorphization was not achieved even after 140 hours of dry mechanical alloying. Using the same milling parameters, when wet mechanical alloying was used, the powder amorphization was achieved after 40 h of milling. Our assumption regarding the powder amorphization capability enhancement by contamination with carbon was proved by X-ray Photoelectron Spectroscopy (XPS) measurements which revealed the presence of carbon in the chemical composition of the wet mechanically alloyed sample. Using shorter milling times and several process control agents (PCA) (ethanol, oleic acid and benzene) with different carbon content it was proved that the milling duration required for powder amorphization is linked to the carbon content of the PCA. Differential Scanning Calorimetry (DSC), thermomagnetic (TG) and X-ray Diffraction (XRD) measurements performed to the heated samples revealed the fact that, the crystallisation occurs at 488 °C, thus leading to the formation of Fe{sub 3}Si and Fe{sub 2}B. Thermogravimetry measurements performed under H{sub 2} atmosphere, showed the same amount of contamination with C, which is about 2.3 wt%, for the amorphous samples regardless of the type of PCA. Saturation magnetisation of the wet milled samples decreases upon increasing milling time. In the case of the amorphous samples wet milled with benzene up to 20 h and with oleic acid up to 30 h, the saturation magnetisation has roughly the same value, indicating the same degree of contamination. The XRD performed on the samples milled using the same parameters, revealed that powder amorphization can be achieved even via dry milling, just by adding the equivalent amount of elemental C calculated from the TG plots. This proves that in this system by considering the atomic species which can contaminate the powder, they can be

  7. Electron-beam welding of aluminum alloys

    Energy Technology Data Exchange (ETDEWEB)

    Brillant, Marcel; de Bony, Yves

    1980-08-15

    The objective of this article is to describe the status of the application of electron-beam welding to aluminum alloys. These alloys are widely employed in the aeronautics, space and nuclear industries.

  8. Tracer diffusion study in binary alloys

    International Nuclear Information System (INIS)

    Bocquet, Jean-Louis

    1973-01-01

    The diffusional properties of dilute alloys are quite well described with 5 vacancy jump frequencies: the diffusion experiments allow as to determine only 3 jump frequency ratios. The first experiment set, found by Howard and Manning, was used in order to determine the 3 frequency ratios in the dilute Cu-Fe alloy. N.V. Doan has shown that the isotope effect measurements may be replaced by easier electromigration experiments: this new method was used with success for the dilute Ag-Zn and Ag-Cd alloys. Two effects which take place in less dilute alloys cannot be explained with the 5 frequency model, these are: the linear enhancement of solute diffusion and the departure from linear enhancement of solvent diffusion versus solute concentration. To explain these effects, we have had to take account of the influence of solute pairs on diffusion via 53 new vacancy jump frequencies. Diffusion in a concentrated alloy can be described with a quasi-chemical approach: we show that a description with 'surrounded atoms' allows the simultaneous explanation of the thermodynamical properties of the binary solid solution, the dependence of atomic jump frequencies with respect to the local concentration of the alloy. In this model, the two atomic species have a jump frequency spectrum at their disposal, which seems to greatly modify Manning's correlation analysis. (author) [fr

  9. A new paradigm for heat treatment of alloys

    Energy Technology Data Exchange (ETDEWEB)

    Ustinovshikov, Y., E-mail: ust@ftiudm.ru

    2014-11-25

    Highlights: • The sign of the ordering energy in alloys varies with the temperature. • Each temperature of heating leads to formation of its characteristic microstructure. • Quenching of alloys is a totally unnecessary and useless operation. - Abstract: The article considers the consequences in the field of heat treatment of alloys that could follow the introduction of the concept of phase transition ordering-phase separation into common use. By example of the Fe{sub 50}Cr{sub 50} alloy, industrial carbon tool steel and Ni{sub 88}Al{sub 12} alloy, it is shown that this transition occurs at a temperature, which is definite for each system, that the change of the sign of the chemical interaction between component atoms reverses the direction of diffusion fluxes in alloys, which affects changes in the type of microstructures. The discovery of this phase transition dramatically changes our understanding of the solid solution, changes the ideology of alloy heat treatment. It inevitably leads to the conclusion about the necessity of carrying out structural studies with the help of TEM in order to adjust the phase diagrams of the systems where this phase transition has been discovered. Conclusions have been made that quenching of alloys from the so-called region of the solid solution, which is usually performed before tempering (aging) is a completely unnecessary and useless operation, that the final structure of the alloy is formed during tempering (aging) no matter what the structure was before this heat treatment.

  10. Mechanism of serrated flow in binary Al-Li alloys

    Energy Technology Data Exchange (ETDEWEB)

    Kumar, S.; Pink, E. [Austrian Academy of Sciences, Leoben (Austria). Erich-Schmid-Inst. of Solid State Physics; Krol, J. [Polish Academy of Sciences, Krakow (Poland). Alexander-Krupkowski-Inst. of Metallurgy and Materials Science

    1996-09-15

    The work on serrated flow in Al-Li alloys has given rise to a controversy--whether serrations in these alloys are caused by lithium atoms in solid solution or by {delta}{prime}(Al{sub 3}Li)-precipitates. This controversy calls for further work to clarify the mechanism of serrated flow in the Al-Li alloys. Kumar and McShane have shown that in an Al-2.5Li-2Mg-0.14Zr alloy, non-shearable {delta}{prime}-precipitates, which are obtained in the under-aged and peak-aged conditions, might directly initiate serrated flow. However, the latter result was ambiguous because of the presence of other alloying elements, and the need to work on a binary Al-Li alloy was emphasized. The present work discusses the results from the binary Al-Li alloys.

  11. Design of powder metallurgy titanium alloys and composites

    International Nuclear Information System (INIS)

    Liu, Y.; Chen, L.F.; Tang, H.P.; Liu, C.T.; Liu, B.; Huang, B.Y.

    2006-01-01

    Low cost and good performance are two major factors virtually important for Ti alloy development. In this paper, we have studied the effects of alloying elements, thermo-mechanical treatment and particle reinforcement on microstructures and mechanical properties of powder metallurgy (PM) Ti alloys and their composites. Our results indicate that low cost PM Ti alloys and their composites with attractive properties can be fabricated through a single compaction-sintering process, although secondary treatments are required for high performance applications. Three new PM Ti alloys and one TiC/Ti composite of high performance are developed, and new design principles are also proposed. For design of PM Ti alloys, addition of alloying elements has the beneficial effect of enhanced sintering and/or improved mechanical properties. For example, Fe element accelerates the sintering process, Mo and Al are good candidates for solution strengthening, and rare earth elements effectively increase the material ductility by scavenging oxygen from the Ti matrix. For the design of Ti-based composites, in situ formation of strengthening particles and solid solution hardening of the matrix both should be considered simultaneously for alloy development. Cr 3 C 2 is found to be a very suitable additive for processing particle reinforced Ti composites

  12. La doping effect on TZM alloy oxidation behavior

    International Nuclear Information System (INIS)

    Yang, Fan; Wang, Kuai-She; Hu, Ping; He, Huan-Cheng; Kang, Xuan-Qi; Wang, Hua; Liu, Ren-Zhi; Volinsky, Alex A.

    2014-01-01

    Highlights: • The oxidation can be resisted by doping La into TZM alloy. • La doped TZM alloy has more compact organization. • It can rise the starting temperature of severe oxidation reaction by more than 50 °C. • Effectively slow down the oxidation rate. • Provide guidance for experiments of improving high-temperature oxidation resistance. - Abstract: Powder metallurgy methods were utilized to prepare lanthanum-doped (La-TZM) and traditional TZM alloy plates. High temperature oxidation experiments along with the differential thermal analysis were employed to study the oxidation behavior of the two kinds of TZM alloys. An extremely volatile oxide layer was generated on the surface of traditional TZM alloy plates when the oxidation started. Molybdenum oxide volatilization exposed the alloy matrix, which was gradually corroded by oxygen, losing its quality with serious surface degradation. The La-TZM alloy has a more compact structure due to the lanthanum doping. The minute lanthanum oxide particles are pinned at the grain boundaries and refine the grains. Oxide layer generated on the matrix surface can form a compact coating, which effectively blocks the surface from being corroded by oxidation. The oxidation resistance of La-TZM alloys has been enhanced, expanding its application range

  13. MO-HF-C alloy composition

    International Nuclear Information System (INIS)

    Whelan, E.P.; Kalns, E.

    1987-01-01

    This patent describes, as an article of manufacture, a cast ingot of a molybdenum-hafnium-carbon alloy consisting essentially by weight of about 0.6% to about 1% Hf, about 0.045% to about 0.08% C, and the balance essentially molybdenum. The amount of Hf and C present are substantially stoichiometric with respect to HfC and within about +-15% of stoichiometry. The ingot is characterized in that it has a substantially less tendency to crack compared to alloys containing Hf in excess of about 1% by weight and carbon in excess of 0.08% by weight, without substantial diminution in strength properties of the alloy

  14. Use of low fusing alloy in dentistry.

    Science.gov (United States)

    Wee, A G; Schneider, R L; Aquilino, S A

    1998-11-01

    Low fusing alloy has been used in dentistry for remount procedures in both fixed and removable prosthodontics, in implant prosthodontics for the fabrication of solid implant casts, in maxillofacial prosthetics as oral radiation shields, and in dental research for its unique properties. Previously, the use of low fusing alloy was thought to offer a high degree of dimensional accuracy. However, multiple in vitro studies have shown that its presumed dimensional accuracy may be questionable. This article reviews the physical properties, metallurgical considerations of low fusing alloy, its applications in dentistry, and a safe, simple method of using low fusing alloy.

  15. Tribological research of cobalt alloys used as biomaterials

    Directory of Open Access Journals (Sweden)

    Robert Karpiński

    2015-12-01

    Full Text Available This study provides information about the cobalt alloys used in dentistry and medicine. The work includes a review of the literature describing the general properties of cobalt alloys. In addition it describes the impact of the manufacturing conditions and alloy additives used , on the structure and mechanical properties of these alloys. The research methodology and the results obtained has been presented in the study. Two cobalt-based alloys Co-CrMo-W and Co-Cr-Ni-Mo were selected for the tests. The first one was prepared with the use of casting technique whereas the second was obtained due to plastic forming. An analysis of the chemical composition and in vitro tribological tests with the use of tribotester of "ball-on-disc" type was conducted. Comparative tribological characteristics of these alloys has been presented.

  16. A review on hot tearing of magnesium alloys

    Directory of Open Access Journals (Sweden)

    Jiangfeng Song

    2016-09-01

    Full Text Available Hot tearing is often a major casting defect in magnesium alloys and has a significant impact on the quality of their casting products. Hot tearing of magnesium alloys is a complex solidification phenomenon which is still not fully understood, it is of great importance to investigate the hot tearing behaviour of magnesium alloys. This review attempts to summarize the investigations on hot tearing of magnesium alloys over the past decades. The hot tearing criteria including recently developed Kou's criterion are summarized and compared. The numeric simulation and assessing methods of hot tearing, factors influencing hot tearing, and hot tearing susceptibility (HTS of magnesium alloys are discussed.

  17. Zirconium alloy barrier having improved corrosion resistance

    International Nuclear Information System (INIS)

    Adamson, R.B.; Rosenbaum, H.S.

    1983-01-01

    A nuclear fuel element for use in the core of a nuclear reactor has a composite cladding container having a substrate and a dilute zirconium alloy liner bonded to the inside surface of the substrate. The dilute zirconium alloy liner forms about 1 to about 20 percent of the thickness of the cladding and is comprised of zirconium and a metal selected from the group consisting of iron, chromium, iron plus chromium, and copper. The dilute zirconium alloy liner shields the substrate from impurities or fission products from the nuclear fuel material and protects the substrate from stress corrosion and stress cracking. The dilute zirconium alloy liner displays greater corrosion resistance, especially to oxidation by hot water or steam than unalloyed zirconium. The substrate material is selected from conventional cladding materials, and preferably is a zirconium alloy. (author)

  18. Underwater laser beam welding of Alloy 690

    International Nuclear Information System (INIS)

    Hino, Takehisa; Tamura, Masataka; Kono, Wataru; Kawano, Shohei; Yoda, Masaki

    2009-01-01

    Stress Corrosion Clacking (SCC) has been reported at Alloy 600 welds between nozzles and safe-end in Pressurized Water Reactor (PWR) plant. Alloy 690, which has higher chromium content than Alloy 600, has been applied for cladding on Alloy 600 welds for repairing damaged SCC area. Toshiba has developed Underwater Laser Beam Welding technique. This method can be conducted without draining, so that the repairing period and the radiation exposure during the repair can be dramatically decreased. In some old PWRs, high-sulfur stainless steel is used as the materials for this section. It has a high susceptibility of weld cracks. Therefore, the optimum welding condition of Alloy 690 on the high-sulfur stainless steel was investigated with our Underwater Laser Beam Welding unit. Good cladding layer, without any crack, porosity or lack of fusion, could be obtained. (author)

  19. Synthesis Of NiCrAlC alloys by mechanical alloying; Sintese de ligas NiCrAlC por moagem de alta energia

    Energy Technology Data Exchange (ETDEWEB)

    Silva, A.K.; Pereira, J.I.; Vurobi Junior, S.; Cintho, O.M., E-mail: alissonkws@gmail.co [Universidade Estadual de Ponta Grossa (UEPG), PR (Brazil)

    2010-07-01

    The purpose of the present paper is the synthesis of nickel alloys (NiCrAlC), which has been proposed like a economic alternative to the Stellite family Co alloys using mechanical alloying, followed by sintering heat treatment of milled material. The NiCrAlC alloys consist of a chromium carbides dispersion in a Ni{sub 3}Al intermetallic matrix, that is easily synthesized by mechanical alloying. The use of mechanical alloying enables higher carbides sizes and distribution control in the matrix during sintering. We are also investigated the compaction of the processed materials by compressibility curves. The milling products were characterized by X-ray diffraction, and the end product was featured by conventional metallography and scanning electronic microscopy (SEM), that enabled the identification of desired phases, beyond microhardness test, which has been shown comparable to alloys manufactured by fusion after heat treating. (author)

  20. Corrosion evaluation of alloys for nuclear waste processing

    International Nuclear Information System (INIS)

    Corbett, R.A.; Bickford, D.F.; Morrison, W.S.

    1986-01-01

    Corrosion scouting tests were performed on stainless steel and nickel-based alloys in simulated process solutions to be used in a facility to immobilize high-level radioactive waste by incorporating it into borosilicate glass. Alloys with combined chromium plus molybdenum contents >30% and also >9% molybdenum, were the most resistant to general and local attack. Alloy C-276 was selected as the reference process equipment material, with Alloy 690 and ALLCORR selected for specific applications

  1. Corrosion Characteristics of Ti-xTa Alloys with Ta contents

    International Nuclear Information System (INIS)

    Kim, H. J.; Choe, H. C.

    2013-01-01

    The purpose of this study was to investigate corrosion characteristics of Ti-xTa alloys with Ta contents. Ti-xTa alloys used as samples (x=30, 40%) were arc-melted under argon atmosphere of 99.9% purity. Ti-xTa alloys were homogenized for 12hr at 1000 .deg. C and then water quenched. The surface characteristics of Ti-xTa alloys were investigated using optical microscopy (OM) and X-ray diffractometer (XRD). The anodic corrosion behaviors of the specimens were examined through potentiodynamic, potentiostatic and galvanostatic test in 0.9 % NaCl solution at 36.5 ± 1 .deg. C. After corrosion test, the surface characteristics of Ti-xTa alloys were investigated using OM. The microstructure of Ti-Ta alloy showed the beta structure with Ta content. The corrosion resistance of Ti alloy was improved by increasing Ta content and the corrosion morphology of Ti-Ta alloy showed that the site attacked by chloride ion decreased from the active to passive region with Ta content. Potential of Ti-40Ta alloy increased as time increased, whereas, current density of Ti-40Ta alloy decreased as time increased compared to Ti-30 alloy

  2. The effects of alloying elements on microstructures and mechanical properties of tungsten inert gas welded AZ80 magnesium alloys joint

    Science.gov (United States)

    Li, Hui; Zhang, Jiansheng; Ding, Rongrong

    2017-11-01

    The effects of alloying elements on the macrostructures, microstructures and tensile strength of AZ80 Mg alloy weldments were studied in the present study. The results indicate that with the decrease of Al element content of filler wire, the welding defects of seam are gradually eliminated and the β-Mg17Al12 phases at α-Mg boundaries are refined and become discontinuous, which are beneficial to the improvement of tensile strength. With AZ31 Mg alloy filler wire, the maximum tensile strength of AZ80 weldment is 220 MPa and fracture occurs at the welding seam of joint. It is experimentally proved that robust AZ80 Mg alloy joints can be obtained by tungsten inert gas (TIG) welding process with AZ31 Mg alloy filler wire. However, further study is required to improve the microstructures and reduce welding defects of joint in order to further improve the joining strength of AZ80 Mg alloy joint.

  3. Hydrofluoric Acid Corrosion Study of High-Alloy Materials

    International Nuclear Information System (INIS)

    Osborne, P.E.

    2002-01-01

    A corrosion study involving high-alloy materials and concentrated hydrofluoric acid (HF) was conducted in support of the Molten Salt Reactor Experiment Conversion Project (CP). The purpose of the test was to obtain a greater understanding of the corrosion rates of materials of construction currently used in the CP vs those of proposed replacement parts. Results of the study will help formulate a change-out schedule for CP parts. The CP will convert slightly less than 40 kg of 233 U from a gas (UF 6 ) sorbed on sodium fluoride pellets to a more stable oxide (U 3 O 8 ). One by-product of the conversion is the formation of concentrated HF. Six moles of highly corrosive HF are produced for each mole of UF 6 converted. This acid is particularly corrosive to most metals, elastomers, and silica-containing materials. A common impurity found in 233 U is 232 U. This impurity isotope has several daughters that make the handling of the 233 U difficult. Traps of 233 U may have radiation fields of up to 400 R at contact, a situation that makes the process of changing valves or working on the CP more challenging. It is also for this reason that a comprehensive part change-out schedule must be established. Laboratory experiments involving the repeated transfer of HF through 1/2-in. metal tubing and valves have proven difficult due to the corrosivity of the HF upon contact with all wetted parts. Each batch of HF is approximately 1.5 L of 33 wt% HF and is transferred most often as a vapor under vacuum and at temperatures of up to 250 C. Materials used in the HF side of the CP include Hastelloy C-276 and Monel 400 tubing, Haynes 230 and alloy C-276 vessels, and alloy 400 valve bodies with Inconel (alloy 600) bellows. The chemical compositions of the metals discussed in this report are displayed in Table 1. Of particular concern are the almost 30 vendor-supplied UG valves that have the potential for exposure to HF. These valves have been proven to have a finite life due to failure

  4. Recent progress on gas tungsten arc welding of vanadium alloys

    Energy Technology Data Exchange (ETDEWEB)

    King, J.F.; Grossbeck, M.L.; Goodwin, G.M.; Alexander, D.J. [Oak Ridge National Lab., TN (United States)

    1997-04-01

    This is a progress report on a continuing research project to acquire a fundamental understanding of the metallurgical processes in the welding of vanadium alloys. It also has the goal of developing techniques for welding structural vanadium alloys. The alloy V-4Cr-4Ti is used as a representative alloy of the group; it is also the prime candidate vanadium alloy for the U.S. Fusion Program at the present time. However, other alloys of this class were used in the research as necessary. The present work focuses on recent findings of hydrogen embrittlement found in vanadium alloy welds. It was concluded that the atmosphere in the inert gas glove box was insufficient for welding 6mm thick vanadium alloy plates.

  5. The effect of alloying elements on the vacancy defect evolution in electron-irradiated austenitic Fe-Ni alloys studied by positron annihilation

    Energy Technology Data Exchange (ETDEWEB)

    Druzhkov, A.P. [Institute of Metal Physics, Ural Branch RAS, 18 Kovalevskaya St., 620041 Ekaterinburg (Russian Federation)], E-mail: druzhkov@imp.uran.ru; Perminov, D.A.; Davletshin, A.E. [Institute of Metal Physics, Ural Branch RAS, 18 Kovalevskaya St., 620041 Ekaterinburg (Russian Federation)

    2009-01-31

    The vacancy defect evolution under electron irradiation in austenitic Fe-34.2 wt% Ni alloys containing oversized (aluminum) and undersized (silicon) alloying elements was investigated by positron annihilation spectroscopy at temperatures between 300 and 573 K. It is found that the accumulation of vacancy defects is considerably suppressed in the silicon-doped alloy. This effect is observed at all the irradiation temperatures. The obtained results provide evidence that the silicon-doped alloy forms stable low-mobility clusters involving several Si and interstitial atoms, which are centers of the enhanced recombination of migrating vacancies. The clusters of Si-interstitial atoms also modify the annealing of vacancy defects in the Fe-Ni-Si alloy. The interaction between small vacancy agglomerates and solute Al atoms is observed in the Fe-Ni-Al alloy under irradiation at 300-423 K.

  6. An evaluation of a lathe-cut high-copper amalgam alloy.

    Science.gov (United States)

    Knibbs, P J; Plant, C G; Shovelton, D S; Jones, P A

    1987-09-01

    Modification of an amalgam alloy may give rise to improved physical properties. The physical properties of a newly formulated, single-composition lathe-cut amalgam alloy were studied and found to be superior to those of a conventional lathe-cut amalgam alloy. However, such modification in formulation may result in changes in the clinical handling properties of the material. The high-copper amalgam alloy was assessed by a panel of general practitioners who found that the general handling properties of the material were similar to those of conventional lathe-cut amalgam alloys. The longer term performance of the high-copper alloy was assessed by means of a blind, controlled clinical trial carried out by two operators. A 1-year assessment of the resulting restorations and tooth replicas could not distinguish between the high-copper alloy and a conventional alloy. The two alloys had both given good clinical results.

  7. Effect of alloying elements on the shape memory properties of ductile Cu-Al-Mn alloys

    International Nuclear Information System (INIS)

    Sutou, Y.; Kainuma, R.; Ishida, K.

    1999-01-01

    The effect of alloying elements on the M s temperature, ductility and the shape memory properties of Cu-Al-Mn ductile shape memory (SM) alloys was investigated by differential scanning calorimetry, cold-rolling and tensile test techniques. It was found that the addition of Au, Si and Zn to the Cu 73 -Al 17 -Mn 10 alloy stabilized the martensite (6M) phase increasing the M s temperature, while the addition of Ag, Co, Cr, Fe, Ni, Sn and Ti decreased the stability of the martensite phase, decreasing the M s temperature. The SM properties were improved by the addition of Co, Ni, Cr and Ti. (orig.)

  8. Theory of Rare-Earth Alloys

    DEFF Research Database (Denmark)

    Lindgård, Per-Anker

    1977-01-01

    A mean-field random alloy theory combined with a simple calculation of the exchange interaction J(c,Q) is shown to quantitatively account for the phase diagrams for alloys of rare-earth metals with Y, Lu, Sc, and other rare-earth metals. A concentration-dependent J(c,Q) explains the empirical 2...

  9. The linear rule of metal extraction

    International Nuclear Information System (INIS)

    Han Li; Yushuang Wang; Zhichun Chen; Shulan Meng

    1988-01-01

    On the basis of experimental results a linear rule for the solvent extraction of rare earths and yttrium over a definite range of acidity and metal ion concentration is found. Relations between the coefficients of the linear rule and initial acidity are presented for the extraction systems: HEH(EHP)-kerosene-HNO 3 -R(NO 3 ) 3 , HEH(EHP)-kerosene-HCl-RCl 3 , D2EHPA-n-heptane-HCl-RCl 3 , HEH(EHP)-n-heptane-HCl-RCl 3 , where R=La-Nd, Sm-Lu, Y; HEH(EHP)=momo(2-ethyl-hexyl)2-ethyl-hexyl phosphonate; D2EHPA=di(2-ethyl-hexyl) phosphoric acid. 3 refs.; 1 tab

  10. New alloys for structural application. Kikai kozoyo shin kinzoku zairyo

    Energy Technology Data Exchange (ETDEWEB)

    Suzuki, T [Kogakuin Univ., Tokyo (Japan)

    1993-01-15

    As recent advance on the scientific technologies is amazing, the materials having new function or excellent performance have been developed. Speaking on some recent examples, they can be divided roughly to one group belonging to invention of materials themselves such as oxide superconductors and compounds semi-conductors, and the other belonging to the products as invention of epoc-making material manufacturing methods such as noncrystalline alloys and particle dispersion reinforced alloys (ODS). In this report, first, some new metallic materials introduced relatively recently and converting many technical innovations in wide range of machinery field, such as titanium alloys, refractory alloys having nickel group, aluminium-lithium alloys, HSLA steels composed of reduced weight of alloy elements and having higher strengths than those of carbon-steels and various properties, intermetallic materials such as Ni3Al and others are described, and next, mechanical alloying and its particle dispersion reinforced alloys, liquid phase rapid cooling process and its noncrystalline alloy-rapid cooling cohesion powder sintering alloys, and others are summarized under the paths from their birth to present status. 31 refs., 12 figs., 5 tabs.

  11. Copper-Silver Alloy Depositions Using Thermionic Vacuum ARC (TVA)

    International Nuclear Information System (INIS)

    Akan, T.

    2004-01-01

    TVA is a plasma source generating pure metal vapor plasma and consists of a heated cathode emitting thermo electrons and an anode containing material to be evaporated. We used Cu and Ag pieces as anode materials and produced their alloys by electron bombarding. Cu-Ag alloys in various mass ratios were prepared by using the TVA and the TVA discharges were generated in the vapors of these alloys. The volt-ampere characteristics of the TVA discharges generated in the vapors of these alloys were investigated with respect to the ratio of Ag in the Cu-Ag alloy. Cu-Ag alloy thin films with various mass ratios were deposited onto the glass substrates by using their TVA discharges. The ratios of Cu and Ag in the thin Cu-Ag alloy films were found using scanning electron microscope-energy dispersive xray (SEM-EDX) microanalyses

  12. Powder metallurgical low-modulus Ti-Mg alloys for biomedical applications.

    Science.gov (United States)

    Liu, Yong; Li, Kaiyang; Luo, Tao; Song, Min; Wu, Hong; Xiao, Jian; Tan, Yanni; Cheng, Ming; Chen, Bing; Niu, Xinrui; Hu, Rong; Li, Xiaohui; Tang, Huiping

    2015-11-01

    In this work, powder metallurgical (PM) Ti-Mg alloys were prepared using combined techniques of mechanical alloying and spark plasma sintering. The alloys mainly consist of super saturations of Mg in Ti matrix, and some laminar structured Ti- and Mg-rich phases. The PM Ti-Mg alloys contain a homogeneous mixtures of nanocrystalline Mg and Ti phases. The novel microstructures result in unconventional mechanical and biological properties. It has been shown that the PM Ti-Mg alloys have a much lower compression modulus (36-50GPa) compared to other Ti alloys, but still remain a very high compressive strength (1500-1800MPa). In addition, the PM Ti-Mg alloys show good biocompatibility and bioactivity. Mg can dissolve in the simulated body fluids, and induce the formation of the calcium phosphate layer. The compression modulus of PM Ti-Mg alloys decreases with the amount of Mg, while the bioactivity increases. Although the corrosion resistance of Ti-Mg alloys decreases with the content of Mg, the alloys still show good stability in simulated body fluid under electrochemical conditions. The indirect and direct cytotoxicity results show that PM Ti-Mg alloys have a good biocompatibility to NIH-3T3 cells. Therefore, the PM Ti-Mg alloys are promising candidates in biomedical applications. Copyright © 2015 Elsevier B.V. All rights reserved.

  13. Alloying effect on K shell X-ray fluorescence cross-sections and yields in Ti-Ni based shape memory alloys

    Directory of Open Access Journals (Sweden)

    Bünyamin Alım

    2018-04-01

    Full Text Available K shell X-ray fluorescence cross-sections (σKα, σKβ and σK, and K shell fluorescence yields (ωK of Ti, Ni both in pure metals and in different alloy compositions (TixNi1-x; x = 0.3, 0.4, 0.5, 0.6, 0.7 were measured by using energy dispersive X-ray fluorescence (EDXRF technique. The samples were excited by 22.69 keV X-rays from a 10 mCi Cd-109 radioactive point source and K X rays emitted by samples were counted by a high resolution Si(Li solid-state detector coupled to a 4 K multichannel analyzer (MCA. The alloying effects on the X-ray fluorescence (XRF parameters of Ti-Ni shape memory alloys (SMAs were investigated. It is clearly observed that alloying effect causes to change in K shell XRF parameter values in Ti-Ni based SMAs for different compositions of x. Also, the present investigation makes it possible to perform reliable interpretation of experimental σKα, σKβ and ωK values for Ti and Ni in SMAs and can also provide quantitative information about the changes of K shell X-ray fluorescence cross sections and fluorescence yields of these metals with alloy composition. Keywords: Alloying effect, XRF, K X-ray fluorescence cross-section, K shell fluorescence yield, Shape memory alloy

  14. Relaxation resistance of heat resisting alloys with cobalt

    International Nuclear Information System (INIS)

    Borzdyka, A.M.

    1977-01-01

    Relaxation resistance of refractory nickel-chromium alloys containing 5 to 14 % cobalt is under study. The tests involve the use of circular samples at 800 deg to 850 deg C. It is shown that an alloy containing 14% cobalt possesses the best relaxation resistance exceeding that of nickel-chromium alloys without any cobalt by a factor of 1.5 to 2. The relaxation resistance of an alloy with 5% cobalt can be increased by hardening at repeated loading

  15. Microstructure and Aging of Powder-Metallurgy Al Alloys

    Science.gov (United States)

    Blackburn, L. B.

    1987-01-01

    Report describes experimental study of thermal responses and aging behaviors of three new aluminum alloys. Alloys produced from rapidly solidified powders and contain 3.20 to 5.15 percent copper, 0.24 to 1.73 percent magnesium, 0.08 to 0.92 percent iron, and smaller amounts of manganese, nickel, titanium, silicon, and zinc. Peak hardness achieved at lower aging temperatures than with standard ingot-metallurgy alloys. Alloys of interest for automobile, aircraft, and aerospace applications.

  16. Oxidation performance of V-Cr-Ti alloys

    International Nuclear Information System (INIS)

    Natesan, K.; Uz, M.

    2000-01-01

    Vanadium-base alloys are being considered as candidates for the first wall in advanced V-Li blanket concepts in fusion reactor systems. However, a primary deterrent to the use of these alloys at elevated temperatures is their relatively high affinity for interstitial impurities, i.e., O, N, H, and C. The authors conducted a systematic study to determine the effects of time, temperature, and oxygen partial pressure (pO 2 ) in the exposure environment on O uptake, scaling kinetics, and scale microstructure in V-(4--5) wt.% Cr-(4--5) wt.% Ti alloys. Oxidation experiments were conducted on the alloys at pO 2 in the range of 5 x 10 -6 -760 torr (6.6 x 10 -4 -1 x 10 5 Pa) at several temperatures in the range of 350--700 C. Models that describe the oxidation kinetics, oxide type and thickness, alloy grain size, and depth of O diffusion in the substrate of the two alloys were determined and compared. Weight change data were correlated with time by a parabolic relationship. The parabolic rate constant was calculated for various exposure conditions and the temperature dependence of the constant was described by an Arrhenius relationship. The results showed that the activation energy for the oxidation process is fairly constant at pO 2 levels in the range of 5 x 10 -6 -0.1 torr. The activation energy calculated from data obtained in the air tests was significantly lower, whereas that obtained in pure-O tests (at 760 torr) was substantially higher than the energy obtained under low-pO 2 conditions. The oxide VO 2 was the predominant phase that formed in both alloys when exposed to pO 2 levels of 6.6 x 10 -4 to 0.1 torr. V 2 O 5 was the primary phase in specimens exposed to air and to pure O 2 at 760 torr. The implications of the increased O concentration are increased strength and decreased ductility of the alloy. However, the strength of the alloy was not a strong function of the O concentration of the alloy, but an increase in O concentration did cause a substantial decrease

  17. Manufacturing development of low activation vanadium alloys

    International Nuclear Information System (INIS)

    Smith, J.P.; Johnson, W.R.; Baxi, C.B.

    1996-10-01

    General Atomics is developing manufacturing methods for vanadium alloys as part of a program to encourage the development of low activation alloys for fusion use. The culmination of the program is the fabrication and installation of a vanadium alloy structure in the DIII-D tokamak as part of the Radiative Divertor modification. Water-cooled vanadium alloy components will comprise a portion of the new upper divertor structure. The first step, procuring the material for this program has been completed. The largest heat of vanadium alloy made to date, 1200 kg of V-4Cr-4Ti, has been produced and is being converted into various product forms. Results of many tests on the material during the manufacturing process are reported. Research into potential fabrication methods has been and continues to be performed along with the assessment of manufacturing processes particularly in the area of joining. Joining of vanadium alloys has been identified as the most critical fabrication issue for their use in the Radiative Divertor Program. Joining processes under evaluation include resistance seam, electrodischarge (stud), friction and electron beam welding. Results of welding tests are reported. Metallography and mechanical tests are used to evaluate the weld samples. The need for a protective atmosphere during different welding processes is also being determined. General Atomics has also designed, manufactured, and will be testing a helium-cooled, high heat flux component to assess the use of helium cooled vanadium alloy components for advanced tokamak systems. The component is made from vanadium alloy tubing, machined to enhance the heat transfer characteristics, and joined to end flanges to allow connection to the helium supply. Results are reported

  18. Materials Properties Database for Selection of High-Temperature Alloys and Concepts of Alloy Design for SOFC Applications

    Energy Technology Data Exchange (ETDEWEB)

    Yang, Z Gary; Paxton, Dean M.; Weil, K. Scott; Stevenson, Jeffry W.; Singh, Prabhakar

    2002-11-24

    To serve as an interconnect / gas separator in an SOFC stack, an alloy should demonstrate the ability to provide (i) bulk and surface stability against oxidation and corrosion during prolonged exposure to the fuel cell environment, (ii) thermal expansion compatibility with the other stack components, (iii) chemical compatibility with adjacent stack components, (iv) high electrical conductivity of the surface reaction products, (v) mechanical reliability and durability at cell exposure conditions, (vii) good manufacturability, processability and fabricability, and (viii) cost effectiveness. As the first step of this approach, a composition and property database was compiled for high temperature alloys in order to assist in determining which alloys offer the most promise for SOFC interconnect applications in terms of oxidation and corrosion resistance. The high temperature alloys of interest included Ni-, Fe-, Co-base superal

  19. A new high-strength iron base austenitic alloy with good toughness and corrosion resistance (GE-EPRI alloy-TTL)

    International Nuclear Information System (INIS)

    Ganesh, S.

    1989-01-01

    A new high strength, iron based, austenitic alloy has been successfully developed by GE-EPRI to satisfy the strength and corrosion resistance requirements of large retaining rings for high capacity generators (>840Mw). This new alloy is a modified version of the EPRI alloy-T developed by the University of California, Berkeley, in an earlier EPRI program. It is age hardenable and has the nominal composition (weight %): 34.5 Ni, 5Cr, 3Ti, 1Nb, 1Ta, 1Mo, .5Al, .3V, .01B. This composition was selected based on detailed metallurgical and processing studies on modified versions of alloy-T. These studies helped establish the optimum processing conditions for the new alloy and enabled the successful scale-up production of three large (50-52 inch dia) test rings from a 5,000 lb VIM-VAR billet. The rings were metallurgically sound and exhibited yield strength capabilities in the range 145 to 220 ksi depending on the extent of hot/cold work induced. The test rings met or exceeded all the property goals. The above alloy can provide a good combination of strength, toughness and corrosion resistance and, through an suitable modification of chemistry or processing conditions, could be a viable candidate for high strength LWR internal applications. 3 figs

  20. Electrochemical hydrogen storage alloys and batteries fabricated from Mg containing base alloys

    Science.gov (United States)

    Ovshinsky, Stanford R.; Fetcenko, Michael A.

    1996-01-01

    An electrochemical hydrogen storage material comprising: (Base Alloy).sub.a M.sub.b where, Base Alloy is an alloy of Mg and Ni in a ratio of from about 1:2 to about 2:1, preferably 1:1; M represents at least one modifier element chosen from the group consisting of Co, Mn, Al, Fe, Cu, Mo, W, Cr, V, Ti, Zr, Sn, Th, Si, Zn, Li, Cd, Na, Pb, La, Mm, and Ca; b is greater than 0.5, preferably 2.5, atomic percent and less than 30 atomic percent; and a+b=100 atomic percent. Preferably, the at least one modifier is chosen from the group consisting of Co, Mn, Al, Fe, and Cu and the total mass of the at least one modifier element is less than 25 atomic percent of the final composition. Most preferably, the total mass of said at least one modifier element is less than 20 atomic percent of the final composition.

  1. Thermoelectrical power analysis of precipitation in 6013 aluminum alloy

    International Nuclear Information System (INIS)

    Abdala, M.R.W.S.; Garcia de Blas, J.C.; Barbosa, C.; Acselrad, O.

    2008-01-01

    The 6013 aluminum alloy was first developed for application in the aircraft industry and, more recently, as a replacement option for the use of the 6061 alloy in the automotive industry. The present work describes the evolution of the process of formation and dissolution of different kinds of precipitates in 6013 aluminum alloy, subjected to different conditions of heat treatment, using for this purpose measurements of thermoelectrical power, Vickers microhardness and differential scanning calorimeter (DSC). Although in the last years many works have been published on the use of thermoelectrical power (TEP) measurements for the analysis of precipitation process in traditional alloys such as 6061, there is still little information related to 6013 alloy. The results obtained are compared with a previous characterization work on the same alloy using transmission electron microscopy. It was observed that TEP measurements are very sensitive to precipitation phenomena in this alloy, and it has been found that there is an inverse relation between TEP and Vickers microhardness values, which allowed proposing a precipitation sequence for 6013 aluminum alloy

  2. Alloy phase stability and design

    International Nuclear Information System (INIS)

    Stocks, G.M.; Pope, E.P.; Giamei, A.F.

    1991-01-01

    At the level of basic quantum theory the papers in this symposium reflect the great progress that has been made in understanding the physical properties of both ordered and disordered alloys based on Density Functional Theory (DFT). DFT provides a quantitative parameter-free (often referred to as first principles) theory of the ground state properties of these systems. This general approach has also been used in combination with classical elasticity and dislocation theory to provide the first quantitative understanding of some of the mechanical properties of intermetallic alloys. Recent advances have built on DFT theory to provide the first glimpses of a theory of the finite temperature phase stability of alloys. It is the strength of these first principles theories that the understanding of materials properties is in terms of the underlying electronic structure. At the level of atomistic simulation, based on semi-empirical potentials, again much progress has been made in understanding the properties of extended defects such as grain boundaries and dislocations. On the experimental front increasingly sophisticated tools are being brought to bear in order to understand both the underlying electronic structure and detailed atomic arrangements. This information, together with input from theory, is playing an increasing role in guiding alloy design efforts. At the more practical level a number of these sophisticated alloy design efforts have in recent years produced impressive results across a broad front. The properties of existing materials are continually being improved and new ones developed. Often this progress is based on a deeper understanding of the properties at the atomistic and electronic level. The design of new ordered intermetallic alloys that have reached or are reaching commercialization represents one of the major achievements of this investment of intellectual resources

  3. Nickel-Titanium Alloys: Corrosion "Proof" Alloys for Space Bearing, Components and Mechanism Applications

    Science.gov (United States)

    DellaCorte, Christopher

    2010-01-01

    An intermetallic nickel-titanium alloy, 60NiTi (60 wt% Ni, 40 wt% Ti), is shown to be a promising candidate tribological material for space mechanisms. 60NiTi offers a broad combination of physical properties that make it unique among bearing materials. 60NiTi is hard, electrically conductive, highly corrosion resistant, readily machined prior to final heat treatment, and is non-magnetic. Despite its high Ti content, 60NiTi is non-galling even under dry sliding. No other bearing alloy, metallic or ceramic, encompasses all of these attributes. Since 60NiTi contains such a high proportion of Ti and possesses many metallic properties, it was expected to exhibit poor tribological performance typical of Ti alloys, namely galling type behavior and rapid lubricant degradation. In this poster-paper, the oil-lubricated behavior of 60NiTi is presented.

  4. Zinc-nickel alloy electrodeposits for water electrolysis

    Energy Technology Data Exchange (ETDEWEB)

    Sheela, G.; Pushpavanam, Malathy; Pushpavanam, S. [Central Electrochemical Research Inst., Karaikudi (India)

    2002-06-01

    Electrodeposited zinc-nickel alloys of various compositions were prepared. A suitable electrolyte and conditions to produce alloys of various compositions were identified. Alloys produced on electroformed nickel foils were etched in caustic to leach out zinc and to produce the Raney type, porous electro catalytic surface for hydrogen evolution. The electrodes were examined by polarisation measurements, to evaluate their Tafel parameters, cyclic voltammetry, to test the change in surface properties on repeated cycling, scanning electron microscopy to identify their microstructure and X-ray diffraction. The catalytic activity as well as the life of the electrode produced from 50% zinc alloy was found to be better than others. (Author)

  5. [Study on corrosion resistance of three non-noble porcelain alloys].

    Science.gov (United States)

    Wu, Zhikai; Xu, Sheng; Li, Wei; Teng, Jin; Li, Ning

    2011-10-01

    To study the electrochemical corrosion behavior of Co-Cr, Ni-Cr and Ni-Cr-Be based porcelain alloys in NaCl solution. Five samples of each alloy were made respectively, electric polarization curve of each alloy was obtained using potentiodynamic polarization technique. Self-corrosion potential (E(corr)), self-corrosion current density (I(corr), passive region and transpassivation potential were tested. Microstructure and constituent was examined using scanning electron microscopy and energy dispersive spectroscopy. Co-Cr alloy possessed the most desirable corrosion resistance because of its integrated, homogeneous and compact passive film. The poor compactness of Ni-Cr alloy's passive film decreased its corrosion resistance. Ni-Cr-Be alloy exhibited the worst corrosion resistance due to the Cr and Mo depleted Ni-Be eutectic phases in the alloy. Taking biological security into consideration, it is necessary to avoid the application of porcelain alloys with Be element. Co-Cr alloy with better biocompatibility possesses much broader prospect in the field of dental restoration.

  6. The welding of alloy 800

    International Nuclear Information System (INIS)

    Ward, M.; Norman, P.L.

    1975-01-01

    This paper reviews the technical literature published on the welding of alloy 800. Much of this work has been carried out using the Varestraint and Gleeble tests to investigate the susceptibility of the alloy and of high nickel consumables to hot-cracking. Inspite of much reported work, it is pointed out that many years of experience in the use of alloy 800 shows it to be readily weldable without any major problems occurring due to hot-cracking. The elements investigated include titanium, aluminium, sulphur, phosphorus and carbon, and the effects of these elements are discuused in terms of their effects on the hot-ductility curves obtained by Gleeble testing. Conclusions reached by various researchers state that the individual effects of the above five elements may be masked by other unknown factors. It is concluded that with correct welding procedures alloy 800 can be welded without cracking problems even with high heat input welding processes using either high-nickel filler wires or a matching electrode. Matching composition filler wires have been used with success but none are at present available commercially. (author)

  7. Nanostructured Platinum Alloys for Use as Catalyst Materials

    Science.gov (United States)

    Narayan, Sri R. (Inventor); Hays, Charles C. (Inventor)

    2015-01-01

    A series of binary and ternary Pt-alloys, that promote the important reactions for catalysis at an alloy surface; oxygen reduction, hydrogen oxidation, and hydrogen and oxygen evolution. The first two of these reactions are essential when applying the alloy for use in a PEMFC.

  8. Irradiation-induced microstructural changes in alloy X-750

    International Nuclear Information System (INIS)

    Kenik, E.A.

    1997-01-01

    Alloy X-750 is a nickel base alloy that is often used in nuclear power systems for it's excellent corrosion resistance and mechanical properties. The present study examines the microstructure and composition profiles in a heat of Alloy X-750 before and after neutron irradiation

  9. Phase transformations in the titanium-niobium binary alloy system

    International Nuclear Information System (INIS)

    Moffat, D.L.

    1985-01-01

    A fundamental study of the phase transformations in the Ti-Nb binary alloy system was completed. Eight alloys in the range 20 to 70 at% Nb were investigated using transmission electron microscopy, light metallography, and x-ray diffraction. Measurements of electric resistivity and Vicker's microhardness also were performed. Emphasis was placed on the minimization of interstitial contamination in all steps of alloy fabrication and specimen preparation. In order to eliminate the effects of prior cold working, the alloys studied were recrystallized at 1000 0 C. Phase transformations were studied in alloys quenched to room temperature after recrystallization and then isothermally aged, and in those isothermally aged without a prior room temperature quench. It was found that the microstructures of the quenched 20 and 25% Nb alloys were extremely sensitive to quench rate - with a fast quench producing martensite, a slow quench, the omega phase. Microstructures of the higher niobium content alloys were much less sensitive to quench rate. The microstructures of the isothermally aged 20 and 25% Nb alloys were found to be sensitive to prior thermal history. Alloys quenched to room temperature and then aged at 400 0 C contained large omega precipitates, while those aged without an intermediate room temperature quench contained alpha precipitates

  10. Stochastic simulation of nucleation in binary alloys

    Science.gov (United States)

    L’vov, P. E.; Svetukhin, V. V.

    2018-06-01

    In this study, we simulate nucleation in binary alloys with respect to thermal fluctuations of the alloy composition. The simulation is based on the Cahn–Hilliard–Cook equation. We have considered the influence of some fluctuation parameters (wave vector cutoff and noise amplitude) on the kinetics of nucleation and growth of minority phase precipitates. The obtained results are validated by the example of iron–chromium alloys.

  11. Ion-induced surface modification of alloys

    International Nuclear Information System (INIS)

    Wiedersich, H.

    1983-11-01

    In addition to the accumulation of the implanted species, a considerable number of processes can affect the composition of an alloy in the surface region during ion bombardment. Collisions of energetic ions with atoms of the alloy induce local rearrangement of atoms by displacements, replacement sequences and by spontaneous migration and recombination of defects within cascades. Point defects form clusters, voids, dislocation loops and networks. Preferential sputtering of elements changes the composition of the surface. At temperatures sufficient for thermal migration of point defects, radiation-enhanced diffusion promotes alloy component redistribution within and beyond the damage layer. Fluxes of interstitials and vacancies toward the surface and into the interior of the target induce fluxes of alloying elements leading to depth-dependent compositional changes. Moreover, Gibbsian surface segregation may affect the preferential loss of alloy components by sputtering when the kinetics of equilibration of the surface composition becomes competitive with the sputtering rate. Temperature, time, current density and ion energy can be used to influence the individual processes contributing to compositional changes and, thus, produce a rich variety of composition profiles near surfaces. 42 references

  12. Precision forging technology for aluminum alloy

    Science.gov (United States)

    Deng, Lei; Wang, Xinyun; Jin, Junsong; Xia, Juchen

    2018-03-01

    Aluminum alloy is a preferred metal material for lightweight part manufacturing in aerospace, automobile, and weapon industries due to its good physical properties, such as low density, high specific strength, and good corrosion resistance. However, during forging processes, underfilling, folding, broken streamline, crack, coarse grain, and other macro- or microdefects are easily generated because of the deformation characteristics of aluminum alloys, including narrow forgeable temperature region, fast heat dissipation to dies, strong adhesion, high strain rate sensitivity, and large flow resistance. Thus, it is seriously restricted for the forged part to obtain precision shape and enhanced property. In this paper, progresses in precision forging technologies of aluminum alloy parts were reviewed. Several advanced precision forging technologies have been developed, including closed die forging, isothermal die forging, local loading forging, metal flow forging with relief cavity, auxiliary force or vibration loading, casting-forging hybrid forming, and stamping-forging hybrid forming. High-precision aluminum alloy parts can be realized by controlling the forging processes and parameters or combining precision forging technologies with other forming technologies. The development of these technologies is beneficial to promote the application of aluminum alloys in manufacturing of lightweight parts.

  13. The influence of the deoxidization on the aluminum alloys

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Q.; Wu, X.; Wang, W. [Beijing Univ. of Aeronautics and Astronautics (China). Dept. of Mater. Sci. and Eng.

    2000-07-01

    Though the composition of the 7075 and 7050 aluminum alloys are quite similar, the anodic behaviors of the two alloys were quite different. Unlike the 7075 alloy, a chromic acid anodic film could not be formed on the 7050 alloy surface with a conventional anodizing process, unless a so-called deoxidization was employed. Therefore, the effects of the deoxidization were studied. The results showed that the deoxidization affected the 7050 quite obviously, introducing numerous number of the ''pits'' to the sample surface, and hence the film obtained was relatively thick but rather weak. In addition, the anodizing voltage also brought remarkable effect to the anodic behavior of the 7050 alloy. The test results showed that the deoxidization lowered the corrosion resistance of the 7050 alloys. By contrast, neither oxidization nor the voltage affected the anodic behavior and the corrosion resistance of the 7075 alloy very much. (orig.)

  14. Transformation processes during annealing of Al-amorphous alloys

    International Nuclear Information System (INIS)

    Petrescu, N.; Petrescu, M.; Calin, M.; Jianu, A.D.; Fecioru, M.

    1993-01-01

    As the amorphous aluminum alloys represent the newest achievement in rapid solidification of Al-based high strength heat resistent materials, a study was undertaken on the amorphous alloys in the Al-RE-TM system, the rare-earth metal being a lanthanide mixture and the transition metal a Ni-Fe substitution in definite proportions. The decomposition on heating of the most highly alloyed amorphous alloy in the investigated series is characterized by differential thermal analysis, electron microscopy and X-ray diffraction. (orig.)

  15. Transformation processes during annealing of Al-amorphous alloys

    Energy Technology Data Exchange (ETDEWEB)

    Petrescu, N. (Polytechnic Inst. Bucharest, Faculty Materials Science and Engineering, Bucharest (Romania)); Petrescu, M. (Polytechnic Inst. Bucharest, Faculty Materials Science and Engineering, Bucharest (Romania)); Calin, M. (Polytechnic Inst. Bucharest, Faculty Materials Science and Engineering, Bucharest (Romania)); Jianu, A.D. (Polytechnic Inst. Bucharest, Faculty Materials Science and Engineering, Bucharest (Romania) IFTM-Bucharest (Romania)); Fecioru, M. (Polytechnic Inst. Bucharest, Faculty Materials Science and Engineering, Bucharest (Romania) DACIA Enterprise-Bucharest (Romania))

    1993-11-01

    As the amorphous aluminum alloys represent the newest achievement in rapid solidification of Al-based high strength heat resistent materials, a study was undertaken on the amorphous alloys in the Al-RE-TM system, the rare-earth metal being a lanthanide mixture and the transition metal a Ni-Fe substitution in definite proportions. The decomposition on heating of the most highly alloyed amorphous alloy in the investigated series is characterized by differential thermal analysis, electron microscopy and X-ray diffraction. (orig.).

  16. In vitro corrosion and biocompatibility of binary magnesium alloys.

    Science.gov (United States)

    Gu, Xuenan; Zheng, Yufeng; Cheng, Yan; Zhong, Shengping; Xi, Tingfei

    2009-02-01

    As bioabsorbable materials, magnesium alloys are expected to be totally degraded in the body and their biocorrosion products not deleterious to the surrounding tissues. It's critical that the alloying elements are carefully selected in consideration of their cytotoxicity and hemocompatibility. In the present study, nine alloying elements Al, Ag, In, Mn, Si, Sn, Y, Zn and Zr were added into magnesium individually to fabricate binary Mg-1X (wt.%) alloys. Pure magnesium was used as control. Their mechanical properties, corrosion properties and in vitro biocompatibilities (cytotoxicity and hemocompatibility) were evaluated by SEM, XRD, tensile test, immersion test, electrochemical corrosion test, cell culture and platelet adhesion test. The results showed that the addition of alloying elements could influence the strength and corrosion resistance of Mg. The cytotoxicity tests indicated that Mg-1Al, Mg-1Sn and Mg-1Zn alloy extracts showed no significant reduced cell viability to fibroblasts (L-929 and NIH3T3) and osteoblasts (MC3T3-E1); Mg-1Al and Mg-1Zn alloy extracts indicated no negative effect on viabilities of blood vessel related cells, ECV304 and VSMC. It was found that hemolysis and the amount of adhered platelets decreased after alloying for all Mg-1X alloys as compared to the pure magnesium control. The relationship between the corrosion products and the in vitro biocompatibility had been discussed and the suitable alloying elements for the biomedical applications associated with bone and blood vessel had been proposed.

  17. Shape Memory Alloys (Part II: Classification, Production and Application

    Directory of Open Access Journals (Sweden)

    I. Ivanic

    2014-09-01

    Full Text Available Shape memory alloys (SMAs have been extensively investigated because of their unique shape memory behaviour, i.e. their ability to recover their original shape they had before deformation. Shape memory effect is related to the thermoelastic martensitic transformation. Austenite to martensite phase transformation can be obtained by mechanical (loading and thermal methods (heating and cooling. Depending on thermomechanical conditions, SMAs demonstrate several thermomechanical phenomena, such as pseudoelasticity, superelasticity, shape memory effect (one-way and two-way and rubber-like behaviour. Numerous alloys show shape memory effect (NiTi-based alloys, Cu-based alloys, Fe-based alloys etc.. Nitinol (NiTi is the most popular and the most commonly used SMA due to its superior thermomechanical and thermoelectrical properties. NiTi alloys have greater shape memory strain and excellent corrosion resistance compared to Cu – based alloys. However, they are very costly. On the other hand, copper-based alloys (CuZn and CuAl based alloys are much less expensive, easier to manufacture and have a wider range of potential transformation temperatures. The characteristic transformation temperatures of martensitic transformation of CuAlNi alloys can lie between −200 and 200 °C, and these temperatures depend on Al and Ni content. Among the Cu – based SMAs, the most frequently applied are CuZnAl and CuAlNi alloys. Although CuZnAl alloys with better mechanical properties are the most popular among the Cu-based SMAs, they lack sufficient thermal stability, while CuAlNi shape memory alloys, in spite of their better thermal stability, have found only limited applications due to insufficient formability owing to the brittle γ2 precipitates. The most important disadvantage of polycrystalline CuAlNi alloys is a small reversible deformation (one-way shape memory effect: up to 4 %; two-way shape memory effect: only approximately 1.5 % due to intergranular

  18. Production method of hydrogen storage alloy electrode and hydrogen storage alloy for rechageable battery; Suiso kyuzo gokin denkyoku oyobi chikudenchiyo suiso kyuzo gokin no seizo hoho

    Energy Technology Data Exchange (ETDEWEB)

    Mizutaki, F.; Ishimaru, M.

    1995-04-07

    This invention relates to the hydrogen storage alloy electrode in which the misch metal-nickel system hydrogen storage alloy is employed. The grain of the hydrogen storage alloy is controlled so as to reduce the dendrite cell size. Since the hydrogen storage alloy having such small dendrite cell size has no part where the metal structure is too brittle, the alloy has a sufficient mechanical strength. It can stand for the swell and shrink stress associated with the sorption and desorption of hydrogen. The disintegration, therefore, due to the cracking of the alloy is hardly to take place. In addition, the quenching of molten alloy at a cooling rate of 1000{degree}C/sec or faster suppresses the occurrence of segregation of any alloy element at the grain boundary, making it possible to produce the homogeneous and mechanically strong alloy. In other words, it can be achieved to produce a hydrogen storage alloy electrode having an excellent cycle property. 4 figs., 1 tab.

  19. Effect of processing of mechanical alloying and powder metallurgy on microstructure and properties of Cu-Al-Ni-Mn alloy

    International Nuclear Information System (INIS)

    Xiao Zhu; Li Zhou; Fang Mei; Xiong Shiyun; Sheng Xiaofei; Zhou Mengqi

    2008-01-01

    The fabrication conditions of Cu-Al-Ni-Mn alloy powder by mechanical alloying and powder metallurgy have been systematically studied. The mechanically alloyed powder (MAed powder) was fabricated at a speed between 100 rpm and 300 rpm for various milling times with and without process control agent (PCA). With an increasing of milling time, the size of crystallite grain decreases. Only the Cu diffraction pattern appear as the rotation speed is up to 300 rpm for 25 h. The elemental powders with PCA agglomerate slightly, but the degree of alloying is lower than that without PCA. The shape memory recovery of the quenched sample hot-extruded at extrusion rate of 50:1 is measured to be 100% recovered in 250 deg. C oil bath for 40 s after deformed to 4.0%. After aging at 120 deg. C for 10 days, the shape memory recovery of the alloy remains 98%

  20. Radiation stability of chromium low alloys

    International Nuclear Information System (INIS)

    Chakin, V.P.; Kazakov, V.A.

    1990-01-01

    Radiation effect on the behaviour of mechanical properties and structure of chromium low alloys such as VKh-2K, KhP-3, VKhM in the wide range of temperatures and neutron fluences is studied. Radiation stability of the alloys is shown to be limited by low-temperature radiation embrittlement (LTRE), caused by radiation hardening as a result of formation of radiation-induced defects such as dislocation loops and vacancy voids in the structure. The methods for prevention LTRE of chromium alloys are suggested. 8 refs.; 8 figs

  1. Vanadium alloys for fusion reactor applications

    International Nuclear Information System (INIS)

    Mattas, R.F.; Loomis, B.A.; Smith, D.L.

    1992-01-01

    This paper reports that fusion reactors will produce a severe operating environment for structural materials. The material should have good mechanical strength and ductility to high temperature, be corrosion resistant to the local environment, have attractive thermophysical properties to accommodate high heat loads, and be resistant to neutron damage. Vanadium alloys are being developed for such applications, and they exhibit desirable properties in many areas Recent progress in vanadium alloy development indicates good strength and ductility to 700 degrees C, minimal degradation by neutron irradiation, and reduced radioactivity compared with other candidate alloy systems

  2. Evaluation of molybdenum and its alloys

    International Nuclear Information System (INIS)

    Lundberg, L.B.

    1981-01-01

    The choice of pure molybdenum as the prime candidate material for space reactor core heat pipes is critically examined. Pure molybdenum's high ductile-brittle transition temperature appears to be its major disadvantage. The candidate materials examined in detail for this application include low carbon arc-cast molybdenum, TZM-molybdenum alloy, and molybdenum-rhenium alloys. Published engineering properties are collected and compared, and it appears that Mo-Re alloys with 10 to 15% rhenium offer the best combination. Hardware is presently being made from electron beam melted Mo-13Re to test this conclusion

  3. Magnesium Alloys as a Biomaterial for Degradable Craniofacial Screws

    Science.gov (United States)

    Henderson, Sarah E.; Verdelis, Konstantinos; Maiti, Spandan; Pal, Siladitya; Chung, William L.; Chou, Da-Tren; Kumta, Prashant N.; Almarza, Alejandro J.

    2014-01-01

    Recently, magnesium (Mg) alloys have received significant attention as a potential biomaterial for degradable implants, and this study was directed at evaluating the suitability of Mg for craniofacial bone screws. The objective was to implant screws fabricated from commercially available Mg-alloys (pure Mg and AZ31) in-vivo in a rabbit mandible. First, Mg-alloy screws were compared to stainless steel screws in an in-vitro pull-out test and determined to have a similar holding strength (~40N). A finite element model of the screw was created using the pull-out test data, and the model can be used for future Mg-alloy screw design. Then, Mg-alloy screws were implanted for 4, 8, and 12 weeks, with two controls of an osteotomy site (hole) with no implant and a stainless steel screw implanted for 12 weeks. MicroCT (computed tomography) was used to assess bone remodeling and Mg-alloy degradation, both visually and qualitatively through volume fraction measurements for all time points. Histologic analysis was also completed for the Mg-alloys at 12 weeks. The results showed that craniofacial bone remodeling occurred around both Mg-alloy screw types. Pure Mg had a different degradation profile than AZ31, however bone growth occurred around both screw types. The degradation rate of both Mg-alloy screw types in the bone marrow space and the muscle were faster than in the cortical bone space at 12 weeks. Furthermore, it was shown that by alloying Mg, the degradation profile could be changed. These results indicate the promise of using Mg-alloys for craniofacial applications. PMID:24384125

  4. Nanostructured Al–Zn–Mg–Cu–Zr alloy prepared by mechanical alloying followed by hot pressing

    International Nuclear Information System (INIS)

    Azimi, Amin; Shokuhfar, Ali; Zolriasatein, Ashkan

    2014-01-01

    Nanostructured Al–7.8 wt% Zn–2.6 wt% Mg–2 wt% Cu–0.1 wt% Zr alloy was mechanically alloyed (MA) from elemental powders and consolidated by hot press technique. The effect of the milling time and hot pressing process on microstructure was investigated by means of X-ray diffraction measurements (XRD) and analytical and scanning electron microscopy (SEM). Furthermore mechanical properties of samples with different MA time as well as pure aluminum were investigated by microhardness and compression tests. The results show that an Al–Zn–Mg–Cu–Zr homogenous supersaturated solid solution with a crystallite size of 27 nm was obtained after 40 h of milling time. Microstructure refinement and morphological changes of powders from flake to spherical shape were observed by increasing milling time. Phase and microstructural characterization of high density bulk nanostructured samples revealed that increasing milling time up to 40 h leads to formation of MgZn 2 precipitation in the alloy matrix. With increasing milling time, density of the samples and crystalline size decrease. Significant enhancement of hardness and compressive strength is observed in the aluminum alloy by increasing milling time up to 40 h which is much higher than pure aluminum. Crystallite size refinement in pure aluminum samples from micro- to nanoscales resulted in 107% and 100% improvement in compressive strength and hardness, respectively. Furthermore the compressive strength and hardness of Al–Zn–Mg–Cu–Zr alloy nanostructured samples increased to 179% and 172%, respectively, compared to nanostructured pure Al, which was produced as reference specimen. 40 h of MA was the optimum case for preparing such an Al alloy and more milling up to 50 h led to deterioration of mechanical properties

  5. Hydrogen in titanium alloys

    International Nuclear Information System (INIS)

    Wille, G.W.; Davis, J.W.

    1981-04-01

    The titanium alloys that offer properties worthy of consideration for fusion reactors are Ti-6Al-4V, Ti-6Al-2Sn-4Zr-2Mo-Si (Ti-6242S) and Ti-5Al-6Sn-2Zr-1Mo-Si (Ti-5621S). The Ti-6242S and Ti-5621S are being considered because of their high creep resistance at elevated temperatures of 500 0 C. Also, irradiation tests on these alloys have shown irradiation creep properties comparable to 20% cold worked 316 stainless steel. These alloys would be susceptible to slow strain rate embrittlement if sufficient hydrogen concentrations are obtained. Concentrations greater than 250 to 500 wppm hydrogen and temperatures lower than 100 to 150 0 C are approximate threshold conditions for detrimental effects on tensile properties. Indications are that at the elevated temperature - low hydrogen pressure conditions of the reactors, there would be negligible hydrogen embrittlement

  6. Processing of Refractory Metal Alloys for JOYO Irradiations

    International Nuclear Information System (INIS)

    RF Luther; ME Petrichek

    2006-01-01

    This is a summary of the refractory metal processing experienced by candidate Prometheus materiats as they were fabricated into specimens destined for testing within the JOYO test reactor, ex-reactor testing at Oak Ridge National Laboratory (ORNL), or testing within the NRPCT. The processing is described for each alloy from the point of inception to the point where processing was terminated due to the cancellation of Naval Reactor's involvement in the Prometheus Project. The alloys included three tantalum-base alloys (T-111, Ta-10W, and ASTAR-811C), a niobium-base alloy, (FS-85), and two molybdenum-rhenium alloys, one containing 44.5 w/o rhenium, and the other 47.5 w/o rhenium. Each of these alloys was either a primary candidate or back-up candidate for cladding and structural applications within the space reactor. Their production was intended to serve as a forerunner for large scale production ingots that were to be procured from commercial refractory metal vendors such as Wah Chang

  7. Environment assisted degradation mechanisms in aluminum-lithium alloys

    Science.gov (United States)

    Gangloff, Richard P.; Stoner, Glenn E.; Swanson, Robert E.

    1988-01-01

    Section 1 of this report records the progress achieved on NASA-LaRC Grant NAG-1-745 (Environment Assisted Degradation Mechanisms in Al-Li Alloys), and is based on research conducted during the period April 1 to November 30, 1987. A discussion of work proposed for the project's second year is included. Section 2 provides an overview of the need for research on the mechanisms of environmental-mechanical degradation of advanced aerospace alloys based on aluminum and lithium. This research is to provide NASA with the basis necessary to permit metallurgical optimization of alloy performance and engineering design with respect to damage tolerance, long term durability and reliability. Section 3 reports on damage localization mechanisms in aqueous chloride corrosion fatigue of aluminum-lithium alloys. Section 4 reports on progress made on measurements and mechanisms of localized aqueous corrosion in aluminum-lithium alloys. Section 5 provides a detailed technical proposal for research on environmental degradation of Al-Li alloys, and the effect of hydrogen in this.

  8. Observations of a Cast Cu-Cr-Zr Alloy

    Science.gov (United States)

    Ellis, David L.

    2006-01-01

    Prior work has demonstrated that Cu-Cr-Nb alloys have considerable advantages over the copper alloys currently used in regeneratively cooled rocket engine liners. Observations indicated that Zr and Nb have similar chemical properties and form very similar compounds. Glazov and Zakharov et al. reported the presence of Cr2Zr in Cu-Cr-Zr alloys with up to 3.5 wt% Cr and Zr though Zeng et al. calculated that Cr2Zr could not exist in a ternary Cu-Cr-Zr alloy. A cast Cu-6.15 wt% Cr-5.25 wt% Zr alloy was examined to determine if the microstructure developed would be similar to GRCop-84 (Cu-6.65 wt% Cr-5.85 wt% Nb). It was observed that the Cu-Cr-Zr system did not form any Cr2Zr even after a thermal exposure at 875 C for 176.5 h. Instead the alloy consisted of three phases: Cu, Cu5Zr, and Cr.

  9. Hydrogen solubility and permeability of Nb-W-Mo alloy membrane

    International Nuclear Information System (INIS)

    Awakura, Y.; Nambu, T.; Matsumoto, Y.; Yukawa, H.

    2011-01-01

    Research highlights: → The concept for alloy design of Nb-based hydrogen permeable membrane has been applied to Nb-W-Mo ternary alloy in order to improve further the resistance to hydrogen embrittlement and hydrogen permeability. → The alloying effects of Mo on the hydriding properties of Nb-W alloy have been elucidated. → The addition of Mo and/or W into niobium improves the resistance to hydrogen embrittlement by reducing the dissolved hydrogen concentration in the alloy. → Nb-W-Mo alloy possesses excellent hydrogen permeability together with strong resistance to hydrogen embrittlement. - Abstract: The alloying effects of molybdenum on the hydrogen solubility, the resistance to hydrogen embrittlement and the hydrogen permeability are investigated for Nb-W-Mo system. It is found that the hydrogen solubility decreases by the addition of molybdenum into Nb-W alloy. As a result, the resistance to hydrogen embrittlement improves by reducing the hydrogen concentration in the alloy. It is demonstrated that Nb-5 mol%W-5 mol%Mo alloy possesses excellent hydrogen permeability without showing any hydrogen embrittlement when used under appropriate hydrogen permeation conditions, i.e., temperature and hydrogen pressures.

  10. Swelling in several commercial alloys irradiated to very high neutron fluence

    International Nuclear Information System (INIS)

    Gelles, D.S.; Pintler, J.S.

    1984-01-01

    Swelling values have been obtained from a set of commercial alloys irradiated in EBR-II to a peak fluence of 2.5 x 10 23 n/cm 2 (E > 0.1 MeV) or approx. 125 dpa covering the range 400 to 650 0 C. The alloys can be ranked for swelling resistance from highest to lowest as follows: the martensitic and ferritic alloys, the niobium based alloys, the precipitation strengthened iron and nickel based alloys, the molybdenum alloys and the austenitic alloys

  11. A comparing study of alloy 600 and alloy 690 on resistance to intergranular stress corrosion cracking(IGSCC)

    International Nuclear Information System (INIS)

    Lee, Jae Hun

    1993-02-01

    In order to compare the effect of senitization on the intergranular stress corrosion cracking(IGSCC) between Alloy 600 and Alloy 690, these alloys have been sensitized for 1 to 100 hours at 700 .deg. C. The degree of sensitization(DOS) has evaluated by the ratio of Ir(the maximum current density at anodic scan) to Ia(the maximum current density at reverse scan) in the modified double loop EPR(electrochemical potentiokinetic reactivation) test in 0.01M H 2 SO 4 + 0.0001M KSCN at 25 .deg. C and at scan rate of 0.5mV/sec. The susceptibility to IGSCC has been measured in 0.01M Na 2 S 4 O 6 solution using CERT(constant extension rate tester) at strain rate of 1.0 x 10 -6 S -1 . With increasing sensitization time the DOS of Alloy 600 increases to the maximum value at 5 hours and decreases gradually due to the replenishment of Cr to the Cr-depleted grain boundaries. For Alloy 600 samples except those sensitized for less than 1 hour, the DOS measured by the modified EPR test parallel to susceptibility to IGSCC revealed by the ratio of strain to failure (εf, Na 2 S 4 O 6 /εf, Air). It appears that the susceptibility to IGSCC is closely associated with the depth in Cr-depleted concentration profile across grain boundary. For the sensitized Alloy 690 samples exhibited extremely low value of Ir/Ia less than 0.074% and also were immune to IGSCC. The good resistance of Alloy 690 to IGSCC is considered to be attributed to the higher Cr concentration to avoid serious Cr-depletion problems adjacent to grain boundary

  12. Influence of surface roughness on the corrosion behaviour of magnesium alloy

    International Nuclear Information System (INIS)

    Walter, R.; Kannan, M. Bobby

    2011-01-01

    Research highlights: → Surface roughness of AZ91 magnesium alloy plays a critical role in the passivation behaviour of the alloy. → The passivation behaviour of the alloy influences the pitting tendency. → Increase in surface roughness of AZ91 magnesium alloy increases the pitting tendency of the alloy. -- Abstract: In this study, the influence of surface roughness on the passivation and pitting corrosion behaviour of AZ91 magnesium alloy in chloride-containing environment was examined using electrochemical techniques. Potentiodynamic polarisation and electrochemical impedance spectroscopy tests suggested that the passivation behaviour of the alloy was affected by increasing the surface roughness. Consequently, the corrosion current and the pitting tendency of the alloy also increased with increase in the surface roughness. Scanning electron micrographs of 24 h immersion test samples clearly revealed pitting corrosion in the highest surface roughness (Sa 430) alloy, whereas in the lowest surface roughness (Sa 80) alloy no evidence of pitting corrosion was observed. Interestingly, when the passivity of the alloy was disturbed by galvanostatically holding the sample at anodic current for 1 h, the alloy underwent high pitting corrosion irrespective of their surface roughness. Thus the study suggests that the surface roughness plays a critical role in the passivation behaviour of the alloy and hence the pitting tendency.

  13. Reactive wetting of Ti-6Al-4V alloy by molten Al 4043 and 6061 alloys at 600-700 C

    Energy Technology Data Exchange (ETDEWEB)

    Lin, Qiaoli; Li, Fuxiang; Jin, Peng; Yu, Weiyuan [Lanzhou Univ. of Technology (China). State Key Lab. of Advanced Processing and Recycling of Non-ferrous Metal

    2017-06-15

    Wetting of Ti-6Al-4V alloy by two industrial grade Al alloys (i.e., Al 6061 and 4043 alloys) was studied using the sessile drop method at 600-700 C under high vacuum. Al/Ti-6Al-4V is a typical reactive wetting system with good final wettability accompanied by the formation of precursor film which is actually an extended reaction layer. The formation mechanism for the precursor film is ''subcutaneous infiltration''. The small amount of alloying element Si in the alloys can cause significant segregation at the liquid/solid interface which satisfies the thermodynamic condition. The wetting behavior can be described by the classic reaction product control models, and Ti{sub 7}Al{sub 5}Si{sub 12} decomposition and Al{sub 3}Ti formation correspond to the two spreading stages. The small difference in alloying elements in Al 6061 and 4043 resulted in distinctly different interface structures, formation of precursor film and spreading dynamics, especially for the Si segregation at the interface.

  14. Investigation of phase stability of novel equiatomic FeCoNiCuZn based-high entropy alloy prepared by mechanical alloying

    Science.gov (United States)

    Soni, Vinay Kumar; Sanyal, S.; Sinha, S. K.

    2018-05-01

    The present work reports the structural and phase stability analysis of equiatomic FeCoNiCuZn High entropy alloy (HEA) systems prepared by mechanical alloying (MA) method. In this research effort some 1287 alloy combinations were extensively studied to arrive at most favourable combination. FeCoNiCuZn based alloy system was selected on the basis of physiochemical parameters such as enthalpy of mixing (ΔHmix), entropy of mixing (ΔSmix), atomic size difference (ΔX) and valence electron concentration (VEC) such that it fulfils the formation criteria of stable multi component high entropy alloy system. In this context, we have investigated the effect of novel alloying addition in view of microstructure and phase formation aspect. XRD plots of the MA samples shows the formation of stable solid solution with FCC (Face Cantered Cubic) after 20 hr of milling time and no indication of any amorphous or intermetallic phase formation. Our results are in good agreement with calculation and analysis done on the basis of physiochemical parameters during selection of constituent elements of HEA.

  15. Thermodynamic Database for Zirconium Alloys

    International Nuclear Information System (INIS)

    Jerlerud Perez, Rosa

    2003-05-01

    For many decades zirconium alloys have been commonly used in the nuclear power industry as fuel cladding material. Besides their good corrosion resistance and acceptable mechanical properties the main reason of using these alloys is the low neutron absorption. Zirconium alloys are exposed to a very severe environment during the nuclear fission process and there is a demand for better design of this material. To meet this requirement a thermodynamic database is developed to support material designers. In this thesis some aspects about the development of a thermodynamic database for zirconium alloys are presented. A thermodynamic database represents an important facility in applying thermodynamic equilibrium calculations for a given material providing: 1) relevant information about the thermodynamic properties of the alloys e.g. enthalpies, activities, heat capacity, and 2) significant information for the manufacturing process e.g. heat treatment temperature. The basic information in the database is first the unary data, i.e. pure elements; those are taken from the compilation of the Scientific Group Thermodata Europe (SGTE) and then the binary and ternary systems. All phases present in those binary and ternary systems are described by means of the Gibbs energy dependence on composition and temperature. Many of those binary systems have been taken from published or unpublished works and others have been assessed in the present work. All the calculations have been made using Thermo C alc software and the representation of the Gibbs energy obtained by applying Calphad technique

  16. The effect of main alloying elements on the physical properties of Al–Si foundry alloys

    International Nuclear Information System (INIS)

    Stadler, F.; Antrekowitsch, H.; Fragner, W.; Kaufmann, H.; Pinatel, E.R.; Uggowitzer, P.J.

    2013-01-01

    In this study we describe the effect of the main alloying elements Si, Cu and Ni on the thermal properties of hypoeutectic and near-eutectic Al–Si foundry alloys. By means of systematic variations of the chemical composition, the influence of the amount of ‘second phases’ on the thermal conductivity, thermal expansion coefficient, and thermal shock resistance is evaluated. Thermodynamic calculations predicting the phase formation in multi-component Al–Si cast alloys were carried out and verified using SEM, EDX and XRD analysis. The experimentally obtained data are discussed on a systematic basis of thermodynamic calculations and compared to theoretical models for the thermal conductivity and thermal expansion of heterogeneous solids.

  17. Research progress on laser surface modification of titanium alloys

    International Nuclear Information System (INIS)

    Tian, Y.S.; Chen, C.Z.; Li, S.T.; Huo, Q.H.

    2005-01-01

    Recent developments on laser surface modification of titanium and its alloys are reviewed. Due to the intrinsic properties of high coherence and directionality, laser beam can be focus onto metallic surface to perform a broad range of treatments such as remelting, alloying and cladding, which are used to improve the wear and corrosion resistance of titanium alloys. In addition, the fabrication of bioactive films on the surface of titanium alloys to improve their biocompatibility can be performed by the method of laser ablation deposition. The effect of some laser processing parameters on the resulting surface properties of titanium alloys is discussed. The problems to be solved and the prospects in the field of laser modification of titanium and its alloys are elucidated

  18. Laves intermetallics in stainless steel-zirconium alloys

    International Nuclear Information System (INIS)

    Abraham, D.P.; McDeavitt, S.M.; Richardson, J.W. Jr.

    1997-01-01

    Laves intermetallics have a significant effect on properties of metal waste forms being developed at Argonne National Laboratory. These waste forms are stainless steel-zirconium alloys that will contain radioactive metal isotopes isolated from spent nuclear fuel by electrometallurgical treatment. The baseline waste form composition for stainless steel-clad fuels is stainless steel-15 wt.% zirconium (SS-15Zr). This article presents results of neutron diffraction measurements, heat-treatment studies and mechanical testing on SS-15Zr alloys. The Laves intermetallics in these alloys, labeled Zr(Fe,Cr,Ni) 2+x , have both C36 and C15 crystal structures. A fraction of these intermetallics transform into (Fe,Cr,Ni) 23 Zr 6 during high-temperature annealing; the authors have proposed a mechanism for this transformation. The SS-15Zr alloys show virtually no elongation in uniaxial tension, but exhibit good strength and ductility in compression tests. This article also presents neutron diffraction and microstructural data for a stainless steel-42 wt.% zirconium (SS-42Zr) alloy

  19. Interdiffusion between U-Mo alloys and Al or Al alloys at 340 deg. C. Irradiation plan

    International Nuclear Information System (INIS)

    Fortis, A.M.; Mirandou, M.; Ortiz, M.; Balart, S.; Denis, A.; Moglioni, A.; Cabot, P.

    2005-01-01

    Out of reactor interdiffusion experiments between U-Mo alloys and Al alloys made close to fuel operation temperature are needed to validate the results obtained above 500 deg. C. A study of interdiffusion between U-Mo and Al or Al alloys, out and in reactor, has been initiated. The objective is to characterize the interdiffusion layer around 250 deg. C and study the influence of neutron irradiation. Irradiation experiments will be performed in the Argentine RA3 reactor and chemical diffusion couples will be fabricated by Friction Stir Welding (FSW) technique. In this work out-of-pile diffusion experiments performed at 340 deg. C are presented. Friction Stir Welding (FSW) was used to fabricate some of the samples. One of the results is the presence of Si, in the interaction layer, coming from the Al alloy. This is promising in the sense that the absence of Al rich phases may also be expected at low temperature. (author)

  20. Hydrogen storage alloys for nickel/metal hydride battery

    Energy Technology Data Exchange (ETDEWEB)

    Kuriyama, Nobuhiro; Sakai, Tetsuo; Myamura, Hiroshi; Tanaka, Hideaki; Ishikawa, Hiroshi; Uehara, Itsuki [Osaka National Research Inst. (Japan)

    1996-06-01

    Efforts to improve performance of metal hydride electrodes such as substitution of alloy components, heat treatment, and surface treatment intended to change surface and bulk structure of hydrogen storage alloys, mainly LaNi{sub 5} based alloys, are reviewed. The importance of control of morphology is emphasized. (author)