Aplicación de las funciones elípticas de Fourier para la descripción de la forma de los huevos de las aves

Directory of Open Access Journals (Sweden)

Dennis Denis Ávila

2014-12-01

Full Text Available La forma de los huevos es difícil de cuantificar por la ausencia de fórmulas exactas que describan su geometría. Se describe un algoritmo para la caracterización y comparación de estas formas, basado en la aplicación de las funciones de Fourier. Estas permiten delinear cualquier tipo de contorno cerrado y han sido aplicadas efectivamente al análisis de varias formas biológicas. Se describen los pasos para la toma de datos, su procesamiento y el empleo del programa SHAPE para la obtención de los descriptores, a partir de un estudio de caso. En este se comparan las formas de los huevos de tres especies de aves que representan tres estrategias reproductivas bien diferentes: el Catey (Aratinga euops, la Gaviota Real (Thalasseus maximus y el Totí (Dives atroviolaceus. A partir de 73 fotografías digitales a huevos depositados en colecciones, se calcularon los coeficientes de las funciones para 4, 6, 8, 16 y 20 armónicos, y se redujeron por medio de un Análisis de Componentes Principales. Los puntajes de los componentes que describen hasta el 90 % de la variabilidad fueron empleados en un Análisis de Función Discriminante Lineal para analizar la posibilidad de separar los huevos según sus formas. Con solo cuatro armónicos los primeros cinco componentes explicaron 97% de la varianza en formas. Más armónicos disminuyen la varianza explicada, requiriéndose hasta ocho componentes para explicar la misma cantidad. Los polígonos convexos en el espacio discriminante muestran una clara distinción entre especies sugiriendo la posible discriminación (errores de clasificación entre 7-15%. Los errores en las clasificaciones estuvieron relacionados a diferencias específicas en la forma entre especies. En el estudio de caso, los huevos de A. euops fueron perfectamente clasificados pero en las otras especies los errores fueron entre 5 y 29%, con este número de armónicos y componentes empleados. El algoritmo propuesto a pesar de su

CAUSAS DE MORTALIDAD EMBRIONARIA EN LA INCUBACION NATURAL Y ARTIFICIAL DE HUEVOS DE PATA CRIOLLA (Cairina moschata doméstica L.)

OpenAIRE

Ortiz Chavez, Hilario Hildebrando; Universidad Nacional Agraria La Molina (Perú).; Cumpa Gavidia, Marcial Estanislao

2016-01-01

como en incubación artificial de los huevos de pata Criolla. Para ello, se incubaron en total 900 huevos, de los cuales 778 fueron fértiles. Los resultados mostraron que el almacenamiento de los huevos en el nido hasta por tres semanas permitió una mayor viabilidad de los embriones, en comparación con el almacenamiento en sala para incubación artificial. Las causas principales de mortalidad embrionaria, tanto en incubación natural como en la artificial son consecuencia de la contaminación de ...

Cuantificacion de huevo en fideos secos según metodo electroforético (SDS PAGUE) Quantification of egg in dried noodles by electrophoretic methods (SDS PAGE)

OpenAIRE

LB López; K Cellerino; MJ Binaghi; MS Giacomino; ME Valencia

2011-01-01

La cuantificación de huevo en fideos secos elaborados con harina y agregado de huevo. Se analizaron 6 sistemas modelos (SM) de fideos que contenían 0,0; 1,0; 2,5; 4,0; 6,0 y 8,0% de huevo en polvo. Se extrajeron proteínas totales con un buffer que contiene dodecilsulfato de sodio (SDS) y 2-Mercaptoetanol y se realizó electroforesis en gel de poliacrilamida con SDS. Se establecieron las relaciones de las áreas de los picos de los densitogramas (de huevo y de trigo) que permiten una correcta cu...

Desarrollo de un método analítico para la determinación de selenio en huevos fortificados de gallinas (Isa Brown) por espectroscopia de absorción atómica con generación de hidruros

OpenAIRE

Gutiérrez Peña, Luís Vicente; Carrero, Pablo E; Delgado C, Yelitza J; Picón, David; Paz, Luis A; Vielma, José R; Quintero, Arlenis Y; Gutiérrez, Ever O; Gutiérrez, Iserslis A

2014-01-01

El huevo es una fuente proteica de uso masivo, en consideración a su bajo costo, es consumido con mayor frecuencia por toda la población. Por esta razón, es de gran interés introducir al mercado un tipo de huevo "saludable", que disminuya los riesgos ligados a enfermedades cardiovasculares y que actúe como antioxidante. Por ello, se evaluó la incorporación del Selenio Orgánico (Sel-Plex®, Alltech Inc) en el programa de alimentación de gallinas ponedoras comerciales raza isa brown con el objet...

Ingesta de huevo y factores de riesgo cardiovascular en adolescentes; papel de la actividad física: Estudio HELENA

OpenAIRE

A. Soriano-Maldonado; M. Cuenca-García; L. A. Moreno; M. González-Gross; C. Leclercq; O. Androutsos; E. J. Guerra-Hernández; M. J. Castillo; J. R. Ruiz

2013-01-01

Introducci??n: Las enfermedades cardiovasculares (ECVs) suponen la principal causa de morbi-mortalidad en los pa??ses occidentales. El incremento del colesterol plasm??tico se ha relacionado con el desarrollo de ECV. El huevo, por su alto contenido en colesterol, ha sido indirectamente relacionado con el riesgo de desarrollar ECVs. Objetivo: Examinar la asociaci??n entre ingesta de huevo y factores de riesgo cardiovascular en adolescentes, estudiando si dicha relaci??n est?? influenciada por ...

FACTORES AMBIENTALES Y PROPORCIÓN RACIAL QUE INFLUYEN EN EL PESO AL NACIMIENTO, AL DESTETE Y EDAD AL PRIMER PARTO EN BOVINOS SUIZO PARDO EN MÉXICO

Directory of Open Access Journals (Sweden)

Ricardo del Carmen Chin Colli

2012-01-01

Full Text Available Se evaluaron los efectos de algunos factores ambientales y proporción racial en el peso al nacimiento (PN, peso al destete ajustado a 240 (PD240 días de edad y edad al primer parto (EPP en bovinos Suizo Pardo. El modelo estadístico utilizado para analizar las variables dependientes, después de eliminar factores e interacciones de primer orden no significativos (P>0.05, incluyó los efectos de rancho como efecto aleatorio anidado dentro de región y los efectos fijos de año (A y época (E de nacimiento, sexo de la cría (para PN y PD240, grado de pureza, la interacción AxE, así como las covariables edad de la vaca al parto en su función lineal y cuadrática (para PN y PD240. Los análisis se realizaron utilizando modelos de efectos mixtos. Las medias para PN, PD240 y EPP fueron 37.7 ± 5.1, 233.8 ± 46.9 kg y 1209.6 ± 338.0 días, respectivamente. Todos los efectos principales fueron significativos (P

Los huevos falsos (SAGs facilitan el comportamiento social de emergencia en las crías de la tortuga laúd Dermochelys coriacea (Testudines: Dermochelyidae

Directory of Open Access Journals (Sweden)

Juan Patiño-Martinez

2010-09-01

Full Text Available La emergencia de las crías de tortuga laúd eclosionadas en los nidos profundos desde la arena hasta la superficie de la playa ocurre sin ayuda parental y es el primer gran desafío de supervivencia en su ciclo de vida. Este estudio, desarrollado en la costa Caribe colombiana, describe el comportamiento social de emergencia de neonatos y evalúa el efecto de la traslocación de los nidos en los patrones temporales de emergencia. Se propone por primera vez que el espacio liberado por la deshidratación de falsos huevos (SAGs en la nidada, representa una ventaja reproductiva al facilitar el agrupamiento de los neonatos en un espacio muy limitado y favorecer la sincronía de la emergencia. El tiempo medio registrado para la emergencia en grupo fue de 3.3 días, variando entre uno y seis días. La traslocación de los nidos no afectó el patrón temporal de emergencia que fue predominantemente nocturno (77.77% en nidos naturales y 81.65% en trasladados. Los picos máximos de emergencias a la superficie coincidieron con los periodos de menor temperatura ambiental exterior (22:00h-06:00h. La ventaja selectiva de este patrón temporal y de la emergencia sincrónica está probablemente relacionada con las mayores tasas de depredación y mortalidad por hipertermia observadas durante el día.

Identificación de Lutzomyia spp. (Diptera: Psychodidae) grupo verrucarum por medio de microscopia electrónica de sus huevos

OpenAIRE

Sierra A, Diana; Vélez B, Iván Darío; Uribe S, Sandra

2000-01-01

En Colombia la microscopia electrónica de huevos de phlebotomineos para determinación de especies es nueva. Debido a la diversidad de especies e importancia médica del grupo verrucarum se estudiaron cuatro de estas especies: Lutzomyia youngi, Lutzomyia evansi, Lutzomyia columbiana y Lutzomyia longiflocosa. El modelo de superficie del huevo es poligonal. Lutzomyia youngi y Lutzomyia columbiana exhibieron un modelo pentagonal o hexagonal, Lutzomyia evansi polígonos elongados y Lutzomyia longifl...

Toxicidad de Schinus molle L. (Anacardiaceae) a cuatro controladores biológicos de plagas agrícolas en el Perú

OpenAIRE

IANNACONE, José; ALVARIÑO, Lorena

2010-01-01

Schinus molle L. (Anacardiaceae) "molle" es una planta de importancia etnobotánica originaria de la zona altoandina y usada artesanalmente como agente insecticida para el control de plagas agrícolas en el Perú. Se evaluó el efecto ecotoxicológico de extractos acuosos de molle sobre cuatro organismos no blanco: Ceraeochrysa cincta (Schneider) (Neuroptera: Chrysopidae) en huevos y larvas de primer estadio, Chrysoperla asoralis (Bank) (Neuroptera: Chrysopidae) en huevos y larvas de primer estadi...

Metodo para montaje permanente de huevos de helmintos enteroparasitos Definitive preservation of helminthic eggs

Directory of Open Access Journals (Sweden)

Victor Muñoz

1990-04-01

Full Text Available Se comunican resultados obtenidos empleando Medio de Hoyer para el montaje de huevos de helmintos enteroparásitos, destinado a preparaciones para colecciones docentes y/o de investigación. La utilización de esta técnica en muestras fecales conteniendo huevos de A. lumbricoides, T. trichiura, Uncinaria sp., Taenia sp., Diphyllobothrium sp., H. nana, H. diminuta y F. hepática, permitió la correcta observación de ellos en lecturas iniciadas a las 24 horas y mantenidas hasta 180 días después.The results using the Hoyer method for examining eggs of helminths enteroparasites are presented. This method is particularly swited for teaching and on research purposes. Using this technique in fecal sample containing eggs of A.lumbricoides, T. trichiura, Uncinaria sp., Taenia sp., Diphyllobothrium sp., H. nana, H. diminuta and F. hepática allowed the correct identification of then after 24 hours up to 180 days after the samples were obtained.

The ability of T2/B4 primers to detect Leishmania infantum among ...

African Journals Online (AJOL)

SERVER

2008-04-03

Apr 3, 2008 ... Reverse Primer (5`-CCT CTC TTT TTT CNC TGT GC-3`). (Schönian et al., 1996),. B. Forward Primer (RV1) (5`-GTG GGG GAG GGG CGT TCT-3`) and Reverse Primer (RV2) (5`-ATT TTA CAC CAA CCC CCA GTT-. 3`) (Lachaud et al., 2002; Reale et al., 1999),. C. Forward Primer (T2) (5`-CGG CTT CGC ...

Optimización de una metodología para el aislamiento y detección molecular de huevos de Toxocara canis en muestras de suelo

OpenAIRE

Mendoza Meza, Dary Luz; Maldonado Santana, Humberto

2015-01-01

La toxocariasis es una zoonosis común en países en desarrollo, como Colombia. La ingesta accidental de huevos de Toxocara sp representa la principal vía de transmisión al humano, por tanto, la vigilancia de la contaminación ambiental es una de las principales estrategias en la prevención de la toxocariasis. El objetivo fue optimizar una metodología para evaluar la contaminación del suelo porhuevos de Toxocara canis. Las muestras de suelo se colectaron en un parque público en la ciudad de Barr...

Identificación de Lutzomyia spp. (Diptera: Psychodidae grupo verrucarum por medio de microscopia electrónica de sus huevos

Directory of Open Access Journals (Sweden)

Diana Sierra A

2000-06-01

Full Text Available En Colombia la microscopia electrónica de huevos de phlebotomineos para determinación de especies es nueva. Debido a la diversidad de especies e importancia médica del grupo verrucarum se estudiaron cuatro de estas especies: Lutzomyia youngi, Lutzomyia evansi, Lutzomyia columbiana y Lutzomyia longiflocosa. El modelo de superficie del huevo es poligonal. Lutzomyia youngi y Lutzomyia columbiana exhibieron un modelo pentagonal o hexagonal, Lutzomyia evansi polígonos elongados y Lutzomyia longiflocosa un modelo poligonal frecuentemente rectangular. La microscopia electrónica de huevos es confiable para identificar especies del grupo verrucarum.The value of Colombian phlebotomine eggs for species determination was studied with a scanning electron microscope. The species diversity and medical importance of the verrucarum group were the bases to select Lutzomyia youngi, Lutzomyia evansi, Lutzomyia columbiana and Lutzomyia longiflocosa. The egg surface was poligonal. Lutzomyia youngi, and Lutzomyia columbiana had pentagonal or hexagonal patterns; Lutzomyia evansi elongated polygons and Lutzomyia longiflocosa irregular polygonal sculpturing, frequently rectangular. Egg scanning electron microscopy is reliable to identify species of the verrucarum group.

Características técnico-sanitarias de expendios de carnes, pescados, aves y huevos de la ciudad de Tunja 2003

Directory of Open Access Journals (Sweden)

Fred Gustavo Manrique-Abril

2011-02-01

Full Text Available Se presenta una caracterización epidemiológica de los expendios de carnes, pescado y aves de Tunja en el año 2003, resultado del diagnóstico sanitario del municipio y las visitas adelantadas por la unidad de saneamiento. Al partir del compromiso que el sector salud tiene en el componente de ambiente, surge la necesidad de crear un sistema de vigilancia epidemiológica ambiental, cuya metodología y estrategia esté orientada hacia el conocimiento de los factores de riesgo ambientales a que están expuestos los grupos humanos, con el fin de determinar prioridades y orientar los recursos de salud disponibles en el desarrollo de intervenciones; es por eso que se implantó en Tunja la vigilancia de factores de riesgo del consumo en esta estrategia, la cual, incluye la de expendios decarnes y derivados, aves huevos y pescado; entonces, se usaron las actas de inspección sanitaria y se tabuló en EPIINFO 2002 para su análisis con SPSS 11,5. Así se realizó un análisis descriptivo a 173 establecimientos y se encontró que existen condiciones diversas de sanidad respecto de la estructura física, los procesos productivos y el producto para la venta; también hay un incumplimiento de normas técnico-sanitarias, en diferentes sectores de la ciudad, que se priorizan para el control por parte de la autoridad sanitaria. Al 75% de los establecimientos no cumplen con las condiciones higiénico sanitarias en cárnicos; el 66,6% no cuenta con las condiciones en establecimiento de venta de pescados ý el 52,5% delos establecimientos de venta de aves y huevos, no cumplen con las condiciones higiénico sanitarias para tal fin.

Extracción y aplicaciones alimentarias de membranas de cáscaras de huevo

OpenAIRE

García Campos, Tania

2015-01-01

Caracterización físico-química de la membrana de la cáscara de huevo, seguida del estudio y desarollo de posibles aplicaciones de la membrana en diversos campos, entre los que destaca la formación de geles y la retención de cobre y proteínas.

Uso de un aditivo a base de cantaxantina y extracto de achiote en dietas de gallinas de postura y su efecto sobre la coloración de la yema y la vida de anaquel del huevo

Directory of Open Access Journals (Sweden)

Víctor Rojas V.

2015-01-01

Full Text Available El objetivo del presente trabajo fue evaluar el uso de un aditivo a base de cantaxantina y extracto de achiote (Bixa orellana L. en dietas de gallinas de postura y su efecto sobre la coloración de la yema y la vida de anaquel del huevo. Se utilizaron 864 gallinas postura de 34 a 45 semanas de edad, distribuidas en un diseño completamente al azar con 6 repeticiones por tratamiento. Los tratamientos fueron T0 (dieta control, T1 (T0 + 30 g de cantaxantina y extracto de achiote y T2 (T0 + 60 g de cantaxantina y extracto de achiote. Los resultados obtenidos fueron de 88,6; 91,9 y 90,8 % para porcentaje de postura; 60,5; 61,6 y 61,5 g para peso de huevo; 53,6; 56,4 y 55,7 g para masa de huevo. La coloración de yema a temperatura de 7 °C para escala roche fue de 6, 9 y 12 por colorimétrico Minolta para “L” 42,10; 40,24 y 39,65; para “a” de 0,07; 3,68 y 6,44 y para “b” de 19,35; 18,36 y 18,18. La vida de anaquel a temperatura de 7 °C fue de 81, 86 y 90 UH. La peroxidación lipídica fue de 0,10; 0,07 y 0,05 μmol MDA.g-1 de yema; para T0, T1 y T2 respectivamente. En todas las variables indicadas se encontraron diferencias estadísticas significativas entre tratamientos (p < 0,05. El consumo de alimento fue de 103,9; 109,2 y 107,5 g y la conversión alimenticia de 1,94; 1,93 y 1,92. Se concluye que la adición de cantaxantina y extracto de achiote a 30 y 60 g t-1 de alimento respecto al testigo, mejoró los parámetros de rendimiento, coloración de yema y la vida de anaquel del huevo.

Relación entre colesterol dietario, consumo de huevo y perfil lipídico en adultos aparentemente sanos, según grupos de edad

OpenAIRE

Oriondo Gates, Rosa Lorenza; Bernui Leo, Ivonne; Valdivieso Izquierdo, Lázaro Rubén; Estrada Menacho, Enriqueta

2013-01-01

Objetivos: Evaluar la relación entre el colesterol dietario, consumo de huevo y el perfíl lipídico en adultos aparentemente sanos, según grupo etario. Diseño: Estudio descriptivo, de asociación cruzada. Institución: Centro de Investigación de Bioquímica y Nutrición, Facultad de Medicina, Universidad Nacional Mayor de San Marcos, Lima, Perú. Participantes: Adultos aparentemente sanos. Intervenciones: En 50 adultos aparentemente sanos se determinó el consumo de colesterol dietario, huevo y perf...

Respuesta de Gallinas Ponedoras a Raciones con Diferentes Niveles de Harina de Hojas de Guandul (CajanusCajan L.

Directory of Open Access Journals (Sweden)

Ruíz V. Juan Guillermo

1969-09-01

Full Text Available En el presente trabajo se dan los resultados de dos ensayos llevados a cabo en el Centro Nacional de Investigaciones Agropecuarias de Medellín, para estudiar el efecto producido por la harina de hojas de guandul(Cajanuscajan en la coloración de la yema y en la producción de ponedoras. Durante el primer ensayo se trabajó con 120 gallinas Hy-line en postura avanzada, usando 3 raciones con 74%, 70.5% y68.5%de maíz amarillo como material prima básica y niveles de 0%, 6% y 9% de harina de guandul respectivamente. Aunque a medida que se aumentó el nivel de guandul hubo una pequeña baja en la producción de huevos, esta diferencia no fue significativa, como tampoco lo fue el (consumo de alimento y la coloración de la yema. Esta última fue prácticamente igual en los 3 lotes, debido al alto contenido de maíz amarillo en cada una de las raciones. Para el segundo ensayo se trabajó con 160 gallinas de igual raza, pero con 2 -3 meses de postura y 4 tratamientos: 3 en base a sorgo con 0%, 9% Y 12 % de harina de guandul y un cuarto lote con ración comercial, molida para evitar diferencias. La producción de huevos presentó una diferencia significativamente superior, al nivel 0 .05 %, de los lotes 0%y comercial sobre 9% y 12%. En cuanto al consumo de alimento se encontró diferencia altamente significativa del lote comercial sobre los otros 3 lotes. También el comercial fue el de mayor consumo de alimento por docena de huevos producidos. La coloración de la yema del huevo del lote 0% de guandul fue nula obteniendo un producto de difícil mercado. En los lotes 9%, 12% y comercial fue apropiada y muy semejante la pigmentación. El alimento por docena de huevo durante el segundo ensayo fue mayor en el lote con ración comercial, luego 12 %, 9 % y 0% respectivamente. A los siete días se produjo la pigmentación adecuada en la yema del huevo. Huevos almacenados por 25 días no perdieron su grado de coloración, pero sí su

Establecimiento de una línea celular primaria a partir de huevos con embrión de Toxocara canis Establishing a primary cell line from Toxocara canis embryonated eggs

Directory of Open Access Journals (Sweden)

Fernando Iván Marín

2011-09-01

Full Text Available Introducción. Toxocara canis es el segundo nematelminto más prevalente en perros a nivel regional y entre los tres más frecuentes en algunos países de la región. Debido a que la fuente de contaminación es el perro, éste se convierte en un nematodo con gran potencial zoonótico. Por esta razón, consideramos importante disponer de una línea celular de este helminto para el estudio de los aspectos básicos, así como para el desarrollo de técnicas diagnósticas. Objetivo. Obtener una línea celular primaria a partir de huevos con embrión de T. canis. Métodos. Los parásitos se extrajeron del intestino delgado de perros menores de un año. Las células embrionarias se obtuvieron mediante la embriogénesis de los huevos de los nematodos adultos, en cuatro diferentes medios; dos ricos en sustancias nutritivas, el tercero con formol al 1 % y el cuarto con agua destilada. Las células se obtuvieron mediante disociación mecánica de los huevos con embrión mediante la utilización de jeringas 30G. Resultados. El tiempo estimado de obtención de la línea celular fue de 15 días, en los que siete eran utilizados en la embriogénesis de los huevos. Las células respondieron positivamente a los métodos de crioconservación luego de dos días, e inclusive dos meses después, permitiendo fases de replicación de cuatro pases. Conclusiones. Se logró obtener una línea celular de T. canis a partir de huevos con embrión de este helminto. Esta línea celular ayudará al entendimiento de las relaciones patógenas, posibles blancos terapéuticos y para el desarrollo de métodos diagnósticos.Introduction: Toxocara canis is the second most prevalent nemathelminthes in dogs at regional level and among the three most frequent in some countries in the region. Due to the fact that the dog is the contamination source, it becomes a nematode with a high zoonotic potential, so we consider it important to be able to use the cell line of this helminth to study

APLIKASI ANIMASI INTERAKTIF PENCAMPURAN TIGA WARNA PRIMER DAN PENGENALAN BENTUK GEOMETRI PADA PAUD AL-MUSLIMUN

Directory of Open Access Journals (Sweden)

Mayya Nurbayanti Shobary

2016-03-01

Full Text Available Abstract - The development of Interactive animation application mixing three colors and introduction of geometric shapes for early childhood, aims to increase learning tool for parents and teachers to attract the attention of children to learn about colors and shapes using interactive animation application. Application built using the concept of PAUD Al-Muslimun in educating early childhood in knowing the result of mixing three primary colors and geometric shapes. The development of application take an example of how theachers in educating early childhood that began with the introduction of color and shapes, and practice how to mix the primary three colors, by showing interisting picture related to colors and shapes are introduced. Data collection methods used for this study is the direct observation of the teaching and learning activities from the perspective of teachers, children and parents to get an idea of the optimal design of an application built on. The development of Interactive animation application mixing three primary colors and introduction of geometric shapes for early childhood for early childhood through the five steps, analyzing, designing, implemeting, testing, and revision errors or shortfall. In this application there are learning processes knowing the primary color and introduction of geometric shapes with support interactive buttons, interesting picture and audio to enhance the absorption of early childhood to the contents of the material, learning and display concerned and to help parents or teachers role in educating children once more creative . Keywords: Applications, Animation, Interactive, Early Childhood Abstrak - Pembangunan aplikasi animasi interaktif pencampuran tiga warna primer dan pengenalan bentuk geometri untuk anak usia dini, bertujuan untuk menambah sarana pembelajaran untuk orang tua dan guru dalam menarik perhatian anak untuk belajar mengenal warna dan bentuk dengan menggunakan aplikasi animasi interaktif

Variables ambientales y abundancia de los huevos de Anchoa mitchilli (Pisces: Engraulidae en la laguna de Tamiahua, México

Directory of Open Access Journals (Sweden)

Carlos Díaz-Avalos

2003-06-01

Full Text Available Se estudió la abundancia de huevos de Anchoa mitchilli (Cuvier y Valenciennes 1848 en la laguna de Tamiahua, Ver. durante tres ciclos anuales (84-85, 85-86 y 86-87, para determinar zonas y épocas de alta concentración de huevos y su posible asociación con variables como temperatura, salinidad, transparencia y profundidad, así como con factores espacio-temporales como posición geográfica, época climática y el ciclo anual de recolecta. Para probar estadísticamente la asociación de la abundancia de huevos con dichos factores y variables se ajusto un Modelo Lineal Generalizado (MLG con error tipo Gamma. Los resultados del modelo ajustado sugieren que no todas las variables tienen un efecto significativo sobre la abundancia de huevos (t de Student, p >0.05. Las variables que resultaron estadísticamente significativas indican la presencia de un componente estacional y que la salinidad tiene un efecto condicional a la localidad. Las mayores abundancias promedio durante los tres ciclos de recolecta ocurrieron siempre durante el verano. Asimismo, debido a la presencia de interacciones significativas (t de Student, pEgg abundance of Anchoa mitchilli was studied in Laguna de Tamiahua, Veracruz during three annual cycles (84-85, 85-86 and 86-87. Our goal was to detect areas and seasons with high egg abundance and the possible association of such areas and seasons with covariates such as temperature, salinity, transparency, depth, location, season and year. The association was tested statistically using a Generalized Linear Model (GLM with Gamma type error. The results suggest that not all the covariates considered have a significant effect on egg abundance (Student’s T, p>0.005. The significant effects show the presence of a seasonal component and that the effect of salinity on egg abundance is conditional to location. High average egg abundances for the three annual cycles were observed during summer. The presence of significant interactions

Modificación del perfil en ácidos grasos, α-tocoferol y niveles de oxidación en huevos enriquecidos en ácidos grasos poliinsaturados Cû3 tras someterlos a diferentes procesados térmicos.

OpenAIRE

Cortinas Hernández, Lucía

2001-01-01

Premio a la Investigación 200J del Instituto de Estudios del Huevo. El huevo es un alimento equilibrado de alto valor nutritivo. España es el cuarto país productor de huevos en la Unión Europea, y el undécimo a nivel mundial, a pesar de la disminución de consumo que se ha producido en los últimos años. Uno de los motivos que ha contribuido a esta reducción, ha sido su contenido relativamente elevado de colesterol, nutriente relacionado con la aparición de determinadas patologías cardiovasc...

MethPrimer: designing primers for methylation PCRs.

Science.gov (United States)

Li, Long-Cheng; Dahiya, Rajvir

2002-11-01

DNA methylation is an epigenetic mechanism of gene regulation. Bisulfite- conversion-based PCR methods, such as bisulfite sequencing PCR (BSP) and methylation specific PCR (MSP), remain the most commonly used techniques for methylation mapping. Existing primer design programs developed for standard PCR cannot handle primer design for bisulfite-conversion-based PCRs due to changes in DNA sequence context caused by bisulfite treatment and many special constraints both on the primers and the region to be amplified for such experiments. Therefore, the present study was designed to develop a program for such applications. MethPrimer, based on Primer 3, is a program for designing PCR primers for methylation mapping. It first takes a DNA sequence as its input and searches the sequence for potential CpG islands. Primers are then picked around the predicted CpG islands or around regions specified by users. MethPrimer can design primers for BSP and MSP. Results of primer selection are delivered through a web browser in text and in graphic view.

Efecto del aceite esencial de orégano sobre el desempeño productivo de ponedoras y la estabilidad oxidativa de huevos enriquecidos con ácidos grasos poliinsaturados

Directory of Open Access Journals (Sweden)

R. E. Ortiz

2017-01-01

Full Text Available Este estudio evaluó la inclusión de aceite esencial de orégano (AEO, Lippia origanoides Kunth en dietas enriquecidas con ácidos grasos poliinsaturados (AGPI sobre el desempeño productivo de ponedoras, el perfil lipídico y la estabilidad oxidativa de huevos en almacenamiento. Se distribuyeron 144 ponedoras en uno de cuatro tratamientos con seis replicas, con el objetivo de de evaluar el efecto del tipo de aceite usado en la dieta (palma o pescado y la inclusión de AEO sobre las variables de producción, junto con el extracto etéreo, perfil de lípidos y concentración de malonaldehído (MDA, usando un diseño completamente al azar con arreglo factorial y medidas repetidas en el tiempo por los días de almacenamiento (0, 30 y 60 días a 4°C. Los resultados mostraron que el tipo de aceite y el AEO no afectaron el desempeño productivo de las ponedoras (P > 0,05. La concentración de AGPI se incrementó en 16,8% en dietas con aceite de pescado en las que el DHA (ácido docosahexaenoico también aumentó en un 1,4% (P < 0,05, incrementando la concentración de MDA (malonaldehído en el huevo (41,6 ng MDA/g d yema, mientras que la suplementación de AEO con 100 g/ton mejoró la estabilidad oxidativa durante el almacenamiento (31.1 ng MDA/g de yema. Durante el almacenamiento la concentración de MDA en la yema incremento con el tiempo alcanzando los 38 ng MDA/g de yema a los 60 días. El AEO mostró potencial como antioxidante natural en la dieta de las ponedoras mejorando la estabilidad oxidativa de los huevos almacenados a 4°C hasta por 60 días.

ENRIQUECIMIENTO DE HUEVOS CON ÁCIDOS GRASOS OMEGA-3 MEDIANTE LA SUPLEMENTACIÓN CON SEMILLA DE LINO (Linum usitatissimum EN LA DIETA

Directory of Open Access Journals (Sweden)

Gonzalo Díaz

2009-04-01

Full Text Available Objetivo. Enriquecer los huevos de gallina con ácidos grasos omega-3 (n-3 mediante la inclusión de semillas de lino en la dieta. Materiales y métodos. La dieta de las aves fue formulada con niveles de 0 (L0, 10 (L10, 15 (L15 y 20% (L20 de linaza. Se determinó la composición de ácidos grasos por cromatografía de gases y se evaluó la producción y calidad del huevo. Resultados. El porcentaje de producción de huevo fue superior en los grupos L0 y L15 (p<0.05 con 93,0 y 91,5% de producción comparada con 86,0 % en los grupos L10 y L20. La mejor conversión de alimento se presentó también en los grupos L0 y L15. Con la inclusión de semilla de lino, se incrementó el contenido de ácidos grasos n-3 desde 3,0 % en el grupo L0 hasta 12,6 % en el grupo L20, siendo los ácidos grasos n-3 á-linolénico (C18:3, n-3 y docosahexahenóico (DHA, C22:6, n-3 los hallados en mayor concentración. Con la inclusión de linaza en la dieta de las gallinas ponedoras se redujo el contenido de acido linoleico (C18:2n-6, lo cual resultó en una disminución en la relación n-6: n-3. Conclusiones. Con base en la evaluación económica se concluye que es posible enriquecer la yema de huevo de gallina hasta con un 10,1 % de ácidos grasos n-3 mediante la inclusión de un 15 % de linaza en la dieta de las gallinas, sin embargo, esto representó un sobrecosto de producción del 12%.

Aplicación de un sistema de demanda casi ideal (AIDS a cortes de carnes de bovino, porcino, pollo, huevo y tortilla en el periodo de 1995-2008

Directory of Open Access Journals (Sweden)

Jesús Ramírez Tinoco

2011-01-01

Full Text Available En este trabajo se estiman las elasticidades de la demanda Marshallianas y Hicksianas para diferentes productos como: cortes de carne de bovino (bistec y cortes especiales, porcino (bistec, pulpa y molida, pollo entero, huevo y tortilla. Para ello se estimó un Sistema de Demanda Casi Ideal (AIDS, con ecuaciones aparentemente no relacionadas (SUR, por sus siglas en ingles, aplicando el índice de precios Stone. De acuerdo con los resultados de las elasticidades precio propias Marshallianas y Hicksianas, 11 de 12 productos resultaron con elasticidad menores a uno, o sea inelásticos. En el caso de las elasticidades precio cruzadas, las combinaciones que resultan como sustitutos son, bistec de bovino con cortes especiales de bovino, porcino (bistec, pulpa y molida y pollo entero, la otra combinación es cortes especiales con porcino. La tortilla, se visualiza como complementaria con todos los cortes y con el huevo, las elasticidades gasto indican que los cárnicos y el huevo se establecen como bienes normales necesarios. El modelo AIDS es utilizado para pronosticar cambios en la demanda, por lo que, ante un aumento del 10 % en los precios de los productos en estudio, se pronostica una disminución de las cantidades demandadas de bistec (7.4 %, cortes especiales (7.7 % y pollo entero (4.7 %, los productos menos afectados son, porcino (bistec, trozo y molida y el huevo con 2 y 0.2 %, respectivamente.

Embriodiagnosis y ovoscopia. Análisis y control de calidad de los huevos incubables

OpenAIRE

Sandra Lisette Ricaurte Galindo. M.V.Z.

2005-01-01

El examén de los huevos claros o con embriones muertos durante el período de incubación con la ayuda de un Ovoscopio, puede resultar una herramienta útil es para el encargado de sala de incubación. Indudablemente para el Medico Veterinario Zootecnista se deben controlar los numerosos parámetros en la incubadora, asegurando así las necesidades que requiere el proceso de incubación para obtener el éxito. Estos parámetros incluyen por ejemplo, la temperatura apropiada de almacenamiento de los hu...

Programa de acompañamiento para estudiantes de primer ingreso : Marco de referencia y propuesta de trabajo para primer semestre de 2002

OpenAIRE

Chinchilla-Brenes, Sonia; Sánchez-Oller, Sylvia

2001-01-01

Proyecto de Investigación El problema de la deserción estudiantil es un fenómeno mundial que involucra principalmente a alumnos de primer ingreso a los centros educativos y de manera particular a las instituciones de educación superior las cuales reportan índices de deserción de alrededor del 30% en el primer año. Ante esta situación se hace necesaria la atención de la población de primer ingreso con programas específicos que acompañen a los y las estudiantes en este proceso de ajuste al m...

Efecto de la harina de cefalotórax de camarón sobre la pigmentación y contenido de colesterol en la yema del huevo

OpenAIRE

Chavarría Barrantes, Arlette; Herrera Ramírez, Carlos Hernán; Zumbado Alpízar, Mario Ernesto

1996-01-01

Se estudió la variación en la tasa de pigmentación y contenido de colesterol de la yema de los huevos de las gallinas ponedoras (ISA-Babcok B-300), de 42 semanas de edad; alimentadas por 5 semanas con raciones conteniendo 0 (control) y 10% de harina de cefalotórax de camarón (HCC). Se determinó el grado de pigmentación y el contenido de colesterol de la yema de los huevos, cada 3-4 días durante el período de estudio. Los resultados se analizaron estadísticamente (95% de confianza) para detect...

OBTENCIÓN DE ANTICUERPOS POLICLONALES IgY ANTIPARVOVIRUS CANINO A PARTIR DE YEMA DE HUEVO DE GALLINA

Directory of Open Access Journals (Sweden)

Pinto, J.

2005-06-01

Full Text Available Inmunizando un grupo de diez gallinas de postura raza Lohmann de 16 semanas de edad con parvovirus canino (CPV cepa vacunal, se obtuvieron anticuerpos IgY policlonales contra CPV en yema de huevo.En la extracción de los anticuerpos de la yema se requirieron dos pasos, el primero para la remoción de lípidos y el segundo para la precipitación de proteínas. Para la remoción de lípidos se usó el método PBS:Cloroformo y para la precipitación de los anticuerpos solubles (Inmunoglobulinas-IgY se usó el método de salting-out con sulfato de amonio ((NH42SO4. La evaluación del proceso se efectuó empleando el método comercial estándar “EGGstract IgY Purification System®” de PROMEGA.La metodología empleada permitió la obtención de anticuerpos IgY policlonales contra CPV a partir de yema de huevo de gallina en concentraciones altas por mililitro de yema, con una pureza aceptable y títulos altos; los resultados fueron comparables con el método comercial.

Viabilidad de huevos y modelo de jaula para la cría artificial masiva de Anastrepha fraterculus (Diptera: Tephritidae Viability of eggs and screen cage model for mass artificial rearing of Anastrepha fraterculus (Diptera: Tephritidae

Directory of Open Access Journals (Sweden)

Juliana García

2011-12-01

Full Text Available El objetivo del presente trabajo fue determinar la viabilidad de huevos y el modelo de jaula apropiada para la cría artificial masiva de Anastrepha fraterculus (Wiedemann. Los resultados muestran que el periodo de máxima oviposición ocurre durante los primeros 10 días en jaulas modelo Mediana, lo cual permite obtener el volumen de huevos necesario para alimentar el pie de cría de A. fraterculus en una cría masiva. Considerando que se encontró relación positiva entre el volumen de huevos ovipositados y el porcentaje de eclosión de huevos, en un periodo de 21 días de colecta, este periodo coincide además con los valores de eclosión más altos. Entre los modelos de jaulas evaluadas: Mediana, Grande y Mission; el modelo Mediana mostró los mejores resultados al evaluar el número de ía con un valor promedio de 11,4. La jaula que mostró menores resultados fue el modelo Mission, con un valor promedio de 4,6 huevos/hembra/día. Las jaulas grandes mostraron valores menores a las jaulas Medianas, pero las diferencias fueron no significativas. Los buenos valores registrados en las jaulas Medianas posiblemente se deban a la estructura de la jaula, que presentó la cara interna dividida en muchos compartimientos, lo cual mejora la distribución de las moscas adultas y previene la mortalidad temprana por hacinamiento en la base o en el techo de la jaula.The aim of this study was to determine the viability of eggs and cage model suitable for artificial mass rearing of Anastrepha fraterculus (Wiedemann. The results show that the period of maximum oviposition occurs during the first 10 days in Medium cages which allows to obtain the necessary volume of eggs to feed the foot of rearing of A. fraterculus in a mass rearing. Considering that a positive relationship was found between the volume of eggs oviposited and the hatchability percentage in a period of 21 days of collection, this period coincides with the highest values of hatching. Among the

Development of specific primers for the detection of HVA1 from ...

African Journals Online (AJOL)

aghomotsegin

2014-01-22

Jan 22, 2014 ... can potentially improve the stress tolerance in plants. (Bajaj et al. ... protein) from barley was engineered in rice (Chandra et al., 2004; Rohila et al., .... US), 400 nM forward and reverse primers, 100 ng of DNA template in 25 µl ...

Comparación reproductiva de vacas holstein, bon y f1 bon x holstein en el centro paysandú, 2. Edad al primer parto, intervalo entre partos, días abiertos y servicios por concepción.

Directory of Open Access Journals (Sweden)

Quijano B Jorge H

2003-06-01

Full Text Available Se estimaron los porcentajes de heterosis para edad al primer parto, intervalo entre partos, días abiertos y servicios por concepción, en vacas F1 (BON x HOLSTEIN del Centro Paysandú, propiedad de la Universidad Nacional de Colombia, ubicado en la zona ecológica de bosque muy húmedo montano bajo (bmh-MB y situado a 2600 m.s.n.m. con una temperatura promedio de 12,5C, en el corregimiento de Santa Elena, Municipio de Medellín. El modelo usado incluyó los efectos de: Grupo Genético, año de parto, edad al parto sobre las variables edad al primer parto, intervalo entre partos, días abiertos y servicios por concepción. El efecto del grupo genético fue altamente significativo (P0,05, -7,9 (P0,05 para edad al primer parto, intervalo entre partos, días abiertos y servicios por concepción respectivamente.

Ultraestructura de los huevos de dos mariposas nocturnas de Chile: Ormiscodes socialis y Polythysana cinerascens (Lepidoptera: Saturniidae

Directory of Open Access Journals (Sweden)

Alfonso Benítez-Mora

2006-12-01

Full Text Available Se describe la estructura y ultraestructura de los huevos de las especies Ormiscodes socialis (Feisthamel y Polythysana cinerascens (Philippi, considerando la forma, tamaño, color, tipo de ovipostura, y aeropilas (cantidad, distribución y proporción en el área micropilar, entre otros. La ultraestructura es mostrada a través de las celdas primarias, celdas secundarias, aeropilas y micropilas; además se incluye a la especie ya descrita Adetomeris microphthalma (Philippi y se confecciona un cuadro comparativo para los huevos de estas especies. Se registra como nuevo hospedero de P. Cinerascens a Myoschilos oblonga Ruiz y Pavón (Santalaceae.Egg ultrastructure in two Chilean moths: Ormiscodes socialis y Polythysana cinerascens (Lepidoptera: Saturniidae. The structure and ultra-structure of the eggs from Ormiscodes socialis (Feisthamel and Polythysana cinerascens (Philippi are described, considering shape, size, coloring when recently laid, oviposition type nd aeropiles (quantity, distribution and proportion in the micropilar area, among others. The ultra-structure is shown for primary cells, secondary cells, aeropiles and icropiles. A comparative table of the eggs of these species is presented and includes the previously described eggs of Adetomeris microphthalma (Philippi. Myoschilos oblonga Ruiz y Pavón (Santalaceae is recorded as a new host for P. cinerascens. Rev. Biol. Trop. 54 (4: 1085-1091. Epub 2006 Dec. 15.

Titulación académica y posibilidades de acceso al primer empleo

Directory of Open Access Journals (Sweden)

ET. OTROS

2009-11-01

Full Text Available RESUMEN: El presente artículo realiza una revisión sobre el estado de la cuestión de la temática focalizada y recoge una investigación de carácter cualitativo. La técnica de recogida de información utilizada ha sido la entrevista. La investigación abordada versa sobre un estudio de caso, acerca de la titulación académica de los empleados de una empresa del sector del comercio en España y sus posibilidades de acceso al primer empleo.De la investigación se desprende que existe una estrecha relación entre la formación y el empleo llegando a convertirse en uno de los mayores condicionantes para la consecución y mantenimiento de éste. Los titulados medios y universitarios no encuentran dificultades para optar al primer empleo en el sector del comercio en España, debido a que todos presentan un nivel de estudios superior al solicitado para el trabajo que realizan en los primeros años de su vida laboral. A pesar de que el nivel de estudios no asegura la obtención del primer empleo coloca a las personas en una situación privilegiada para lograrlo, así la formación ofrece una predisposición para conseguirlo. Con todo, es recomendable desarrollar procedimientos para ofrecer una educación inicial más adaptada al contexto laboral de cada titulación académica que propicien un grado de exigencia coherente con la capacitación profesional.ABSTRACT: The present article is a review on the state of art of the topic starting from a qualitative approach. The technique Lised to collect data was the interview. This is a case study about the academic degrees of the employees of a company in the business sector in Spain and their possibilities of obtaining their first job.One conclusión is the cióse relationship between training and employment and how the former is one of the greatest conditioners in attaining and maintaining the latter. Persons with secondary diplomas and university degrees have no difficulties in gaining their first job

Primer3_masker: integrating masking of template sequence with primer design software.

Science.gov (United States)

Kõressaar, Triinu; Lepamets, Maarja; Kaplinski, Lauris; Raime, Kairi; Andreson, Reidar; Remm, Maido

2018-06-01

Designing PCR primers for amplifying regions of eukaryotic genomes is a complicated task because the genomes contain a large number of repeat sequences and other regions unsuitable for amplification by PCR. We have developed a novel k-mer based masking method that uses a statistical model to detect and mask failure-prone regions on the DNA template prior to primer design. We implemented the software as a standalone software primer3_masker and integrated it into the primer design program Primer3. The standalone version of primer3_masker is implemented in C. The source code is freely available at https://github.com/bioinfo-ut/primer3_masker/ (standalone version for Linux and macOS) and at https://github.com/primer3-org/primer3/ (integrated version). Primer3 web application that allows masking sequences of 196 animal and plant genomes is available at http://primer3.ut.ee/. maido.remm@ut.ee. Supplementary data are available at Bioinformatics online.

Desarrollo embrionario-larval del pez tropical Hemirhamphus brasiliensis (Beloniformes: Hemirhamphidae a partir de huevos recolectados del medio natural

Directory of Open Access Journals (Sweden)

Jesús Rosas

2008-09-01

Full Text Available Se describe la formación del embrión y el desarrollo larval del pez Hemirhamphus brasiliensis Linnaeus, 1758, a partir de huevos en estado de mórula, recolectados en el alga parda Sargassum sp. Los huevos eran esféricos con un diámetro de 1923.54 ±72.35 µm, con numerosos filamentos coriónicos y estrías en su superficie. Durante las primeras 48 h, el embrión desarrolló la vesícula cefálica, los miomeros y el corazón, el cual se ubicó en el exterior de cuerpo impulsando sangre incolora, la cual se pigmentó de rojo posteriormente. Antes de la eclosión se desarrollaron el riñón, estómago, hígado y la vesícula biliar, las aletas pectorales, cuatro pares de arcos branquiales y la boca. Las larvas eclosionaron a la 114 h, presentando el cuerpo robusto en forma de torpedo, verde-amarillo con melanoforos dendriformes. Al nacer ingirieron metanauplios de Artemia. A las 72 h después de la eclosión se observó el esbozo de la aleta pélvica y a las 240 h se completó la metamorfosis.Embrionary-larval development of the tropical fish Hemirhamphus brasiliensis (Beloniformes: Hemirhamphidae from eggs collected in the wild. The embryo formation and larval development of Hemirhamphus brasiliensis Linnaeus, 1758 (Pisces: Hemirhamphidae is described from morula stage eggs collected on Sargassum sp. Thalii in the field (10°50’55.2" N y 64°09’467" W. The eggs were spherical, 1 923.54 ±72.35 µm diameter with several corionic filaments, and are striated. During the first 48 h the embryo developed cephalic vesicle, miomers, and a heart located on the external body surface, beating strongly and circulating colorless blood which became pigmented red later. Before hatching, the larva developed kidney, gut tract, liver and biliar vesicle, pectoral fins, four pairs of gill arches and the mouth. The larva hatched at 114 h, the body was torpedo-shaped, yellow-green, with several dendriform melanophores; the pelvic fin was observed 72 h post

Geology of the epithermal Ag-Au Huevos Verdes vein system and San José district, Deseado massif, Patagonia, Argentina

Science.gov (United States)

Dietrich, Andreas; Gutierrez, Ronald; Nelson, Eric P.; Layer, Paul W.

2012-03-01

The San José district is located in the northwest part of the Deseado massif and hosts a number of epithermal Ag-Au quartz veins of intermediate sulfidation style, including the Huevos Verdes vein system. Veins are hosted by andesitic rocks of the Bajo Pobre Formation and locally by rhyodacitic pyroclastic rocks of the Chon Aike Formation. New 40Ar/39Ar constraints on the age of host rocks and mineralization define Late Jurassic ages of 151.3 ± 0.7 Ma to 144.7 ± 0.1 Ma for volcanic rocks of the Bajo Pobre Formation and of 147.6 ± 1.1 Ma for the Chon Aike Formation. Illite ages of the Huevos Verdes vein system of 140.8 ± 0.2 and 140.5 ± 0.3 Ma are 4 m.y. younger than the volcanic host rock unit. These age dates are among the youngest reported for Jurassic volcanism in the Deseado massif and correlate well with the regional context of magmatic and hydrothermal activity. The Huevos Verdes vein system has a strike length of 2,000 m, with several ore shoots along strike. The vein consists of a pre-ore stage and three main ore stages. Early barren quartz and chalcedony are followed by a mottled quartz stage of coarse saccharoidal quartz with irregular streaks and discontinuous bands of sulfide-rich material. The banded quartz-sulfide stage consists of sulfide-rich bands alternating with bands of quartz and bands of chlorite ± illite. Late-stage sulfide-rich veinlets are associated with kaolinite gangue. Ore minerals are argentite and electrum, together with pyrite, sphalerite, galena, chalcopyrite, minor bornite, covellite, and ruby silver. Wall rock alteration is characterized by narrow (propylitic alteration. Gangue minerals are dominantly massive quartz intergrown with minor to accessory adularia. Epidote, illite, illite/smectite, and, preferentially at deeper levels, Fe-chlorite gangue indicate near-neutral pH hydrothermal fluids at temperatures of >220°C. Kaolinite occurring with the late sulfide-rich veinlet stage indicates pH 315°, whereas strike

Composición química del huevo de tortuga lora (Lepidochelys olivacea) y evaluación de su calidad física y microbiológica durante su almacenamiento

OpenAIRE

Mora Castro, Randall; Chaves Quirós, Ana Cecilia

1997-01-01

Se determinó la composición química de los huevos de tortuga lora (Lepidochelys olivacea) y se evaluó su calidad física y microbiológica durante el almacenamiento a 5 °C y 25 °C y a una humedad relativa de 92 %. Se encontró que los huevos de tortuga lora tienen una masa promedio de 27,9 g y están constituidos por un 58,0 % de yema, un 38,0 % de clara y un 4,0 % de cáscara. La cáscara contiene un 37,0 % de humedad, un 28,2 % de proteína y un 36,0 % de materia mineral. En la clara el compone...

Estudios Taxonómicos, Ontogenéticos, Ecológicos y Etológicos sobre los Ostrácodos de agua dulce en Colombia -II. Contribución al conocimiento del desarrollo embrionario tardío y de los procesos de la eclosión del huevo de Heterocypris Bogotensis Roessler Estudios Taxonómicos, Ontogenéticos, Ecológicos y Etológicos sobre los Ostrácodos de agua dulce en Colombia - I. Contribución al conocimiento del desarrollo embrionario tardío y de los procesos de la eclosión del huevo de Heterocypris Bogotensis Roessler Estudios Taxonómicos, Ontogenéticos, Ecológicos y Etológicos sobre los Ostrácodos de agua dulce en Colombia - I. Contribución al conocimiento del desarrollo embrionario tardío y de los procesos de la eclosión del huevo de Heterocypris Bogotensis Roessler

Directory of Open Access Journals (Sweden)

Roessler Ewald W.

1982-04-01

Full Text Available El presente estudio da una breve descripción del huevo de Heterocypris bogotensis Roessler con énfasis en la estructura de las capas del huevo y su papel ecológico. Se presenta una etapa ontogenética hasta la fecha desconocida, la cual se destaca por la formación de un tronco relativamente grande que se reduce despues de la secreción de una cutícula iniciandose una mudaembrionaria compleja. Se muestra el papel del exoesqueleto embrionario en los sucesos durante la salida de las capas del huevo. Se discuten brevemente cuestiones filogenéticas.The present study gives a short description of the egg off Heterocypris bogotensis Roessler with special consideration of the structure of the eggshell and its ecological importance. An up to date unknown embriological stage is presented that sticks out by the formation of a trunk that will be reduced after the secretion of a cuticula within the iniciation of an embriological molting process. The role of the embriological exoskeleton during hatching is described and phylogenetic questions are shortly discussed.In der vorliegenden Studie wird eine kurze Beschreibung des Eies von Heterocypris bogotensis Roessler gegeben unter Beruecksichtigung der Struktur der Eihuellen und ihrer oekologischen Bedeutung. Es wird auf die Entwick lung eines bisher  unbekannten embryonalen Stadiums eingegangen, dassich durch die Ausbildung eines Rumpfes auszeichnet, der nach Abscheidung einer Kutikula und Einleitung einer embryonalen Haeutung wieder rueckgebildet wird. Die Bedeutung des abgeschiedenen Exoskeletts waehrend des Schlupfprozesses wird aufgezeigt, der Schlupfvorgang beschrieben. Auf phylogenetischeFragestellungen wird kurz eingegangen.

Reología de derivados de la yema de huevo deshidratada

Directory of Open Access Journals (Sweden)

Partal, Pedro

2000-08-01

Full Text Available The emulsification process, as weIl as and the emulsion rheology and stability, greatly depends on the rheological properties of the continuous phase, the most important ingredient of which is yolk. However, since native yolk is not microbiologically stable, processing of yolk, such as spray-drying, is necessary for food applications. The influence of processing by spray-drying on the microstructure and rheological properties of yolk was investigated using oscillatory, creep and steady state flow measurements. The spray-drying process produces denaturation of proteins giving rise to a dramatic change from a fluid-like behaviour, as corresponds to the native yolk, to a gel-like behaviour corresponding to the reconstituted dried yolk (45% solids. Temperature exerts a slight influence on the linear viscoelastic properties of processed yolk.Tanto el proceso de emulsificación como las propiedades reológicas y la estabilidad de una emulsión alimentaria, tipo mayonesa, dependen en gran medida de la microestructura y la reología de la fase continua acuosa, cuyo ingrediente principal es la yema de huevo. Debido a la inestabilidad microbiológica de ésta se hacen necesarios procesos de deshidratación por atomización para conservarla con fines alimentarios. En este trabajo se trata de determinar la influencia que ejerce la deshidratación sobre la microestructura analizando las propiedades reológicas de la yema mediante ensayos reológicos de cizalla oscilatoria, de flujo en estado estacionario y de fluencia viscosa. Se llegó a la conclusión de que la deshidratación produce la desnaturalización de las proteínas provocando un cambio desde un comportamiento tipo fluido (yema nativa a un comportamiento tipo gel (yema deshidratada reconstituida al 45% en sólidos. Por otro lado, se ha observado una escasa variación de las propiedades viscoelásticas lineales de la yema deshidratada con la temperatura.

Efecto de la proporción de genes Bos indicus x Bos taurus sobre peso al destete y edad a primer parto en una población multirracial

Directory of Open Access Journals (Sweden)

Hugo O. Toledo Alvarado

2015-01-01

Full Text Available Se analizaron 1,289 registros de hembras de primer parto con diversas proporciones de genes Bos indicus y Bos taurus (Charolais, Suizo, Simmental, Holstein Friesian y Salers. Tanto animales puros y cruzados de un hato comercial, ubicado en el municipio de Hueytamalco, Puebla, nacidas entre 1966 a 2006, con el objetivo de estimar la combinación óptima de genes Cebú y la retención de heterosis (RVH sobre las características de peso al destete ajustado a 270 días (PD y edad a primer parto (EPP. A partir de modelos de regresión múltiple se identificó la proporción de Cebú con el mejor comportamiento para las dos características de acuerdo al coeficiente de determinación (R 2 y al estadístico de Mallow (CP. La mejor respuesta para PD se encontró en el rango de 42 a 70 % de genes Bos indicus ; mientras que las menores EPP se establecieron entre 27 al 40 % de proporción Cebú. La retención de heterosis que mostró mayor potencial para PD fue de 76 a 78 % y para EPP de 79 a 92 %. Estos resultados manifiestan la importancia de los efectos no aditivos en ambas características, así como la necesidad de realizar cruzamientos dirigidos.

UniPrimer: A Web-Based Primer Design Tool for Comparative Analyses of Primate Genomes

Directory of Open Access Journals (Sweden)

Nomin Batnyam

2012-01-01

Full Text Available Whole genome sequences of various primates have been released due to advanced DNA-sequencing technology. A combination of computational data mining and the polymerase chain reaction (PCR assay to validate the data is an excellent method for conducting comparative genomics. Thus, designing primers for PCR is an essential procedure for a comparative analysis of primate genomes. Here, we developed and introduced UniPrimer for use in those studies. UniPrimer is a web-based tool that designs PCR- and DNA-sequencing primers. It compares the sequences from six different primates (human, chimpanzee, gorilla, orangutan, gibbon, and rhesus macaque and designs primers on the conserved region across species. UniPrimer is linked to RepeatMasker, Primer3Plus, and OligoCalc softwares to produce primers with high accuracy and UCSC In-Silico PCR to confirm whether the designed primers work. To test the performance of UniPrimer, we designed primers on sample sequences using UniPrimer and manually designed primers for the same sequences. The comparison of the two processes showed that UniPrimer was more effective than manual work in terms of saving time and reducing errors.

EDAD AL PRIMER PARTO EN VACAS HOLSTEIN DE LECHERÍA ESPECIALIZADA EN COSTA RICA

Directory of Open Access Journals (Sweden)

Mauren Salazar-Carranza

2013-01-01

Full Text Available El objetivo de este trabajo fue determinar la edad al primer parto (EPP en vacas Holstein pu- ras en lecherías especializadas de Costa Rica. Se realizó un es- tudio longitudinal prospectivo histórico con 46 029 animales de raza Holstein pura de lechería especializada de Costa Rica, durante el periodo comprendido entre los años 2000 y 2010. Se incluyeron los datos de vacas que contaban con registros completos para todas las variables del estudio, registrados en el programa VAMPP Bovino 3.0. Se calculó la EPP por las variables de zona ecológica, la época de nacimiento, el año de parto, el índice de endogamia, el número de lactancias de la madre y el tipo de parto que dio origen al animal en estudio. Los datos fueron analizados por medio de estadística descrip- tiva (porcentajes, promedios, desviación estándar [DE] y el cálculo de intervalos de confianza (IC95%. La EPP prome- dio fue 30,7 meses (D.E: 6,8; IC 95%: 30,6 – 30,8. Durante el periodo, el promedio de la EPP varió entre los 30 y 31 meses; sin embargo, en los años 2006 y 2007 mostró una tendencia a disminuir. La EPP presentó diferencias significativas entre estratos según la época de nacimiento, el número de lactancia de la madre, la zona ecológica, el año de nacimiento, el tipo de parto de la madre y el coeficiente de endogamia de la vaca. Al igual que las tendencias mundiales, mostró tendencia a decrecer en Costa Rica; y las variables de animal, tiempo y ambiente mostraron un efecto sobre la EPP. Excepto el coefi- ciente de endogamia (a mediano y largo plazo, esos factores no son modificables en condiciones de pastoreo, que son los imperantes en la gran mayoría de fincas estudiadas.

Una nueva técnica para el estudio microscópico de los huevos de Anopheles Una nueva técnica para el estudio microscópico de los huevos de Anopheles

Directory of Open Access Journals (Sweden)

Osorno-Mesa Ernesto

1947-12-01

Full Text Available A new method is described for dissection and mounting of the exochorion of Anopheles eggs, for microscopic study, which has advantages over previous methods. The possible taxocomic importance of the morphology of the micropyle, clearly seen by this method, is noted. Se describe una técnica original para el estudio microscópico de los huevos de Anopheles, fundamentada en la disección del exocorion, indicando las grandes ventajas que tiene. Se anota la importancia taxonómica que pueda tener la morfología del micrópilo. / Abstract. A new method is described for dissection and mounting of the exochorion of Anopheles eggs, for microscopic study, which has advantages over previous methods. The possible taxocomic importance of the morphology of the micropyle, clearly seen by this method, is noted.

Primers-4-Yeast: a comprehensive web tool for planning primers for Saccharomyces cerevisiae.

Science.gov (United States)

Yofe, Ido; Schuldiner, Maya

2014-02-01

The budding yeast Saccharomyces cerevisiae is a key model organism of functional genomics, due to its ease and speed of genetic manipulations. In fact, in this yeast, the requirement for homologous sequences for recombination purposes is so small that 40 base pairs (bp) are sufficient. Hence, an enormous variety of genetic manipulations can be performed by simply planning primers with the correct homology, using a defined set of transformation plasmids. Although designing primers for yeast transformations and for the verification of their correct insertion is a common task in all yeast laboratories, primer planning is usually done manually and a tool that would enable easy, automated primer planning for the yeast research community is still lacking. Here we introduce Primers-4-Yeast, a web tool that allows primers to be designed in batches for S. cerevisiae gene-targeting transformations, and for the validation of correct insertions. This novel tool enables fast, automated, accurate primer planning for large sets of genes, introduces consistency in primer planning and is therefore suggested to serve as a standard in yeast research. Primers-4-Yeast is available at: http://www.weizmann.ac.il/Primers-4-Yeast Copyright © 2013 John Wiley & Sons, Ltd.

Preferencia alimenticia del ácaro depredador Balaustium sp. en condiciones controladas

Directory of Open Access Journals (Sweden)

Muñoz Karen

2009-04-01

Full Text Available

Se evaluó la preferencia de presas de Balaustium sp., enemigo natural de diferentes artrópodos plaga, y el cual es nativo de la Sabana de Bogotá. En unidades experimentales construidas con foliolos de plantas de rosa se colocaron independientemente individuos de Balaustium sp. y se registró el número de presas consumidas. De esta manera se determinó la preferencia de los tres estados móviles del ácaro depredador Balaustium sp. por diferentes edades de tres presas. Las especies y edades de las presas estudiadas fueron: huevos, ninfas y adultos de Trialeurodes vaporariorum, huevos, ninfas y adultos de Tetranychus urticae, y larvas de primer y segundo instar y adultos de Frankliniella occidentalis. Los estados menos desarrollados fueron preferidos, aunque se observó que los adultos del depredador tienen gran habilidad para consumir adultos de T. vaporariorum. La presa preferida por las larvas de Balaustium sp. fue los huevos de T. urticae con una proporción de consumo de 0,54 de los huevos que se ofrecieron de esta presa; las deutoninfas del depredador eligieron huevos de T. vaporariorum (0,537 o de T. urticae (0,497 y los adultos de Balaustium sp. prefrieron los huevos de T. vaporariorum (0,588.

Composición química del huevo de Tortuga Golfina Lepidochelys olivacea (Testudines: Cheloniidae y su potencial como recurso alimenticio

Directory of Open Access Journals (Sweden)

María Isabel Castro-González

2011-12-01

Full Text Available Por su potencial como fuente alimenticia, se analizó la composición química de huevo de Lepidochelys olivácea en La Escobilla, Oaxaca, México. El Instituto de Ciencias del Mar y Limnología de la Universidad Nacional Autónoma de México proporcionó 250 muestras de huevo liofilizado de 25 tortugas, que se analizaron siguiendo métodos oficiales para humedad, cenizas, proteína, grasa, lípidos totales(LT y análisis microbiológicos; además de ácidos grasos(AG por cromatografía de gases, aminoácidos(AA, vitaminas y colesterol(col por HPLC. Los resultados fueron los siguientes: (g/100g humedad(4.7, cenizas(3.8, proteína(53.7 y grasa(47.4. AA esenciales (g aa/100g Proteína: Ile (4.4, Lys(6.6, Leu(7.4, Met+Cys (8.8, Phe+Tyr (10.8; retinol (340μg/100g, colecalciferol (5.9 μg/100g, tocoferol (8.6, tiamina (0.3 y riboflavina (1.1 (mg/100g. Y los de (LT, (AG y (Col se concentraron en tres grupos por peso de tortuga: (LT (44.3-48.7-49.1g/100g, (Col (518.4-522.5-728.7 mg/100g. Entonces se identificaron 17 AGSaturados, 8 AGMonoinsaturados y 11 AGPoliinsaturados. Los AGS más abundantes (mg/100g: C16:0 (485-1263, AGM: C16:1 (456-716, C18:1n-9c (904- 1754 y AGP: C20:4n-6 (105-217, EPA (48-103 y HA (97-189. También, existió diferencia significativa (Fisher, p<0.05 para (Col, AG totales, AGS, AGM, AGP y AG n-3 (EPA+DHA. No se detectó presencia de agentes microbiológicos. El huevo liofilizado de L. olivacea es una opción para el desarrollo de productos alimenticios por su proteína de alto valor biológico y ácidos grasos n-3.

Residual Effect of Pesticides used in Integrated Apple Production on Chrysoperlaexterna (Hagen (Neuroptera: Chrysopidae Larvae Efecto Residual de los Pesticidas utilizados en la Producción integrada de Manzanas en las Larvas de Chrysoperla externa (Hagen (Neuroptera: Chrysopidae

Directory of Open Access Journals (Sweden)

Alexandre P Moura

2012-06-01

Brasil. Los plaguicidas son muy utilizados para su control, y una manera de cambiar esto es la combinación de plaguicidas selectivos e insectos depredadores. Este trabajo tuvo como objetivo evaluar los efectos de abamectina, carbaril, azufre, fenitrotion, metidation, y triclorfon en la supervivencia de larvas y pupas, en la ovipostura de adultos, y en la viabilidad de huevos de dos poblaciones de Chrysoperla externa (Hagen, 1861 (Neuroptera: Chrysopidae. Los tratamientos fueron aplicados en placas de vidrio, y las larvas fueron sometidas a contacto con los productos. Carbaril, fenitrotion, y metidation causaron mortalidad del 100% de larvas. No se observaron cambios en el número de huevos puestos por hembras procedentes de larvas de primero segundo estadio expuestas a residuos de abamectina y azufre, o abamectina, azufre y triclorfon, respectivamente. Abamectina redujo la viabilidad de huevos puestos por hembras a partir de larvas de primer estadio, procedentes de Bento Gonçalves. Azufre redujo la viabilidad de huevos a partir de larvas de segundo estadio, mientras que abamectina y triclorfon redujeron la viabilidad de huevos puestos por hembras desde Vacaria. Carbaril, fenitrotion y metidation fueron perjudiciales. Triclorfon fue perjudicial para larvas de primer estadio y ligeramente perjudicial para las de segundo. Abamectina y azufre son ligeramente perjudiciales para larvas de primer estadio, sin embargo no ejercen efecto en las de segundo.

Note: Primer Amysat 001; Fragment size is 211bp

Indian Academy of Sciences (India)

Renuka

Bhandara : Lanes 1–14 represent different strains of Bhandara Ecorace. Note: Primer Amysat 001; Fragment size is 211bp. Fig. 1. SSR profiles generated from genomic DNA of 16 strains from different individuals of (A.L, D. TV, D. BV, Modal, Sukinda, Raily, Bhandara) ecoraces of tasar silk worm, Antheraea mylitta using the.

Polyacid macromolecule primers

Science.gov (United States)

Sugama, Toshifumi.

1989-12-26

Hydrophilic polyacids are described, such as macromolecules of polyitaconic acid and polyacrylic acid, where such macromolecules have molecular weights >50,000 as primers between a polymeric top coating, such as polyurethane, and an oxidized aluminum or aluminum alloy. A near monolayer of primer is used in polymeric adhesive/oxidized aluminum adhered joint systems in 0.05% primer concentration to give superior results in standard peel tests. 2 figs.

Effects of continuous drought and immersion on hatchability of Ochlerotatus albifasciatus (Diptera: Culicidae eggs stored at low temperature Efecto de la sequía continua y la inmersión sobre la respuesta de eclosión de los huevos de Ochlerotatus albifasciatus (Diptera: Culicidae almacenados a baja temperatura

Directory of Open Access Journals (Sweden)

Raúl E Campos

2007-07-01

Full Text Available The role of environmental factors on the hatching response of O. albifasciatus (Macquart eggs is studied by simulating winter conditions in the laboratory. The hypothesis tested was that hatching response is affected by: (1 time that eggs remain at low temperature, (2 storage conditions, and (3 acclimatization time. Eggs were stored at 5ºC in drought and immersion conditions during 7, 21, 35, 90 and 146 days, immediately after, they were acclimatized at 22ºC during 24, 72, and 168 hours, and then eggs were flooded to induce hatching. Percent of hatched eggs was analyzed with a Generalized Lineal Model with a binomial distribution. Results show that: (1 a long storage period at cold temperature and long acclimatization periods improve the hatching response; (2 storage conditions have a moderate effect on hatching, being more evident in eggs stored dry; (3 a long time of acclimatization favors the hatching response in submerged eggs more than in eggs stored dry; (4 long time at cold favors the hatching response in eggs stored dry more than in submerged eggs; (5 the hatching response of eggs that remain for a long time at low temperature is higher when the time of acclimatization is long.Se estudió el rol de los factores ambientales sobre la eclosión de los huevos de O. albifasciatus (Macquart, simulando condiciones de invierno. La hipótesis planteada fue que la respuesta de eclosión de los huevos depende de: (1 tiempo de permanencia a baja temperatura, (2 condiciones de almacenamiento, y (3 tiempo de aclimatación. Los huevos fueron almacenados a 5º C en condiciones de sequía y sumergidos durante 7, 21, 35, 90 y 146 días; luego fueron aclimatados a 22º C durante 24, 72, y 168 horas y posteriormente inundados para inducir la eclosión. El porcentaje de huevos eclosionados se analizó con un Modelo Lineal Generalizado con distribución binomial. Los resultados mostraron que: (1 largos períodos de almacenamiento en frío y largos tiempos

PHUSER (Primer Help for USER): a novel tool for USER fusion primer design

DEFF Research Database (Denmark)

Olsen, Lars Rønn; Hansen, Niels Bjørn; Bonde, Mads

2011-01-01

containing a customizable USER cassette. Designing primers using PHUSER ensures that the primers have similar annealing temperature (Tm), which is essential for efficient PCR. PHUSER also avoids identical overhangs, thereby ensuring correct order of assembly of DNA fragments. All possible primers...

VizPrimer: a web server for visualized PCR primer design based on known gene structure.

Science.gov (United States)

Zhou, Yang; Qu, Wubin; Lu, Yiming; Zhang, Yanchun; Wang, Xiaolei; Zhao, Dongsheng; Yang, Yi; Zhang, Chenggang

2011-12-15

The visualization of gene structure plays an important role in polymerase chain reaction (PCR) primer design, especially for eukaryotic genes with a number of splice variants that users need to distinguish between via PCR. Here, we describe a visualized web server for primer design named VizPrimer. It utilizes the new information technology (IT) tools, HTML5 to display gene structure and JavaScript to interact with the users. In VizPrimer, the users can focus their attention on the gene structure and primer design strategy, without wasting time calculating the exon positions of splice variants or manually configuring complicated parameters. In addition, VizPrimer is also suitable for the design of PCR primers for amplifying open reading frames and detecting single nucleotide polymorphisms (SNPs). VizPrimer is freely available at http://biocompute.bmi.ac.cn/CZlab/VizPrimer/. The web server supported browsers: Chrome (≥5.0), Firefox (≥3.0), Safari (≥4.0) and Opera (≥10.0). zhangcg@bmi.ac.cn; yangyi528@vip.sina.com.

Low-copy nuclear primers and ycf1 primers in Cactaceae.

Science.gov (United States)

Franck, Alan R; Cochrane, Bruce J; Garey, James R

2012-10-01

To increase the number of variable regions available for phylogenetic study in the Cactaceae, primers were developed for a portion of the plastid ycf1 gene and intron-spanning regions of two low-copy nuclear genes (isi1, nhx1). • Primers were tested on several families within Caryophyllales, focusing on the Cactaceae. Gel electrophoresis indicated positive amplification in most samples. Sequences of these three regions (isi1, nhx1, ycf1) from Harrisia exhibited variation similar to or greater than two plastid regions (atpB-rbcL intergenic spacer and rpl16 intron). • The isi, nhx, and ycf1 primers amplify phylogenetically useful information applicable to the Cactaceae and other families in the Caryophyllales.

Estrategia para mejorar el acceso al tratamiento etiológico para la enfermedad de Chagas en el primer nivel de atención en Argentina

Directory of Open Access Journals (Sweden)

Karen Klein

2017-05-01

Full Text Available RESUMEN Objetivo Mejorar la distribución del tratamiento etiológico para la enfermedad de Chagas mediante la identificación de barreras para su descentralización al primer nivel de atención en Argentina. Métodos Se llevó a cabo un estudio cualitativo, de carácter exploratorio y descriptivo, en base a entrevistas semiestructuradas a actores clave pertenecientes al Programa Nacional de Chagas y miembros de los equipos de salud del primer nivel de atención con el objetivo de identificar barreras para el diagnóstico y tratamiento de la enfermedad de Chagas en diferentes niveles (administrativo, efectores de salud y comunidad que podrían afectar una estrategia descentralizada de distribución. Además, se implementó un piloto de descentralización en diez centros de atención primaria en una provincia argentina. Resultados Se realizaron 22 entrevistas semiestructuradas con responsables de programas y profesionales de la salud. Los principales obstáculos hallados fueron la falta de búsqueda sistemática de casos, la poca articulación entre los niveles de atención y los actores del sistema de salud, la falta de capacitación del equipo de salud respecto al tratamiento, el seguimiento de los pacientes y las barreras asociadas a los pacientes. Se llevó a cabo un programa piloto de descentralización y se evaluaron estrategias para optimizar la intervención a gran escala. Conclusiones Los resultados permitieron mejorar la implementación del plan de descentralización del tratamiento a través de una mejor articulación interprogramática, la capitalización de herramientas de monitoreo y de comunicación ya existentes, y la sensibilización de los equipos de salud. Además, se formularon recomendaciones tendientes a mejorar el diagnóstico y el tratamiento de la enfermedad de Chagas.

CRISPR Primer Designer: Design primers for knockout and chromosome imaging CRISPR-Cas system.

Science.gov (United States)

Yan, Meng; Zhou, Shi-Rong; Xue, Hong-Wei

2015-07-01

The clustered regularly interspaced short palindromic repeats (CRISPR)-associated system enables biologists to edit genomes precisely and provides a powerful tool for perturbing endogenous gene regulation, modulation of epigenetic markers, and genome architecture. However, there are concerns about the specificity of the system, especially the usages of knocking out a gene. Previous designing tools either were mostly built-in websites or ran as command-line programs, and none of them ran locally and acquired a user-friendly interface. In addition, with the development of CRISPR-derived systems, such as chromosome imaging, there were still no tools helping users to generate specific end-user spacers. We herein present CRISPR Primer Designer for researchers to design primers for CRISPR applications. The program has a user-friendly interface, can analyze the BLAST results by using multiple parameters, score for each candidate spacer, and generate the primers when using a certain plasmid. In addition, CRISPR Primer Designer runs locally and can be used to search spacer clusters, and exports primers for the CRISPR-Cas system-based chromosome imaging system. © 2014 Institute of Botany, Chinese Academy of Sciences.

Effectiveness of different adhesive primers on the bond strength between an indirect composite resin and a base metal alloy.

Science.gov (United States)

Sarafianou, Aspasia; Seimenis, Ioannis; Papadopoulos, Triantafillos

2008-05-01

There is a need for achieving reliable chemical bond strength between veneering composites resins and casting alloys through the use of simplified procedures. The purpose of this study was to examine the shear bond strength of an indirect composite resin to a Ni-Cr alloy, using 4 primers and 2 airborne-particle-abrasion procedures. Fifty-six Ni-Cr (Heraenium NA) discs, 10 mm in diameter and 1.5 mm in height, were fabricated. Twenty-four discs were airborne-particle abraded with 50-microm Al2O3 particles, while another 24 were airborne-particle abraded with 250-microm Al2O3 particles. The following primers were applied on 6 discs of each airborne-particle-abrasion treatment group: Solidex Metal Photo Primer (MPP50, MPP250), Metal Primer II (MPII50, MPII250), SR Link (SRL50, SRL250), and Tender Bond (TB50, TB250). The Rocatec system was used on another 6 discs, airborne-particle abraded according to the manufacturer's recommendations, which served as the control group (R). Two more discs were airborne-particle abraded with 50-microm and 250-microm Al2O3 particles, respectively, to determine the Al content on their surfaces, without any bonding procedure. The indirect composite resin used was Sinfony. Specimens were thermally cycled (5 degrees C and 55 degrees C, 30-second dwell time, 5000 cycles) and tested in shear mode in a universal testing machine. The failure mode was determined with an optical microscope, and selected specimens were subjected to energy dispersive spectroscopy (EDS). Mean bond strength values were analyzed using 2-way ANOVA followed by Tukey's multiple comparison tests (alpha=.05) and compared to the control group using 1-way ANOVA followed by Tukey's multiple comparison tests (alpha=.05). The groups abraded with 50-microm particles exhibited significantly higher bond strength compared to the groups abraded with 250-microm particles. Group MPII50 exhibited the highest mean value (17.4 +/-2 MPa). Groups MPP50, MPP250, and TB50, TB250 showed

Spawning areas and larval distributions of anchovy Engraulis encrasicolus in relation to environmental conditions in the Gulf of Tunis (Central Mediterranean Sea)

OpenAIRE

Rafik Zarrad; Hechmi Missaoui; Francisco Alemany; Romdhane Mohamed Salah; Alberto Garcia; M'rabet Ridha; Jarboui Othman; El Abed Amor

2006-01-01

Se estudiaron los huevos y larvas de anchoa en el Golfo de Túnez por medio de cuatro campañas estacionales llevadas a cabo entre verano del 2002 y primavera del 2003. Los huevos y larvas de anchoa se encontraron a lo largo de todo el año; pero fueron mucho más abundantes en primavera y verano. En primavera, la principal área de puesta se localizó en el norte del Golfo, al oeste y suroeste de la isla de Zembra. En verano, las mayores concentraciones de huevos y larvas también se encontra...

Comportamiento reproductivo del pez Opistognathus rosenblatti (Perciformes: Opistognathidae en cautiverio

Directory of Open Access Journals (Sweden)

Mauricio Contreras

2012-09-01

Full Text Available El bocón manchas azules O. rosenblatti, es una especie endémica del Golfo de California con un elevado valor comercial, del cual existe poca información referente a su biología. Los peces alcanzaron la edad adulta después de ocho meses de cautiverio. Manifestaron ascensos en la columna de agua, típicos de los desplantes de cortejo en su hábitat natural. Asimismo se registro en 50 ocasiones la presencia de masas ovígeras o alguna evidencia de desgove. El macho cuidó los huevos dentro de su refugio, pero nunca en su cavidad bucal. En promedio, depositaron 3 592 huevos, con una viabilidad de eclosión superior al 99%. La eclosión se da de noche y se liberan larvas de 4.51mm de longitud promedio del notocordio. Este estudio presenta el primer registro de su cortejo, su desove e información sobre características elementales de las masas ovígeras y sus larvas, las cuales fueron obtenidas en cautiverio. De tal manera que, la flexibilidad y adaptabilidad de su comportamiento individual a condiciones particulares del ambiente, significan que vale la pena su cultivo comercial, como ya se realiza con otras especies de la misma familia.

Bioinformatic tools for PCR Primer design

African Journals Online (AJOL)

ES

reaction (PCR), oligo hybridization and DNA sequencing. Proper primer design is actually one of the most important factors/steps in successful DNA sequencing. Various bioinformatics programs are available for selection of primer pairs from a template sequence. The plethora programs for PCR primer design reflects the.

Los huevos en La Colmena

Directory of Open Access Journals (Sweden)

José Molina

2014-10-01

Full Text Available Las lenguas proponen interesantes juegos de recepción. En el español de nuestro país, por ejemplo, con la palabra ‘huevos’ nos referimos a los genitales masculinos, mientras que en italiano se trata del título del libro de poemas de Elisa Biagini (Florencia, Italia, 1970. Lo interesante surge cuando nos enteramos de que ‘huevo’ en italiano es masculino al singular y femenino al plural. El poemario de Biagini juega con esa transición de géneros. En el tantas veces atacado ‘horizonte masculino’ de la poesía italiana nace esta voz que llena de intenciones las imágenes. No hay referencias directas, sino el gesto hábil que sólo la poesía puede producir en el juego de la palabra. Biagini propone combatir la discursividad masculina de su tradición desde la dispersión de su voz: elabora figuras femeninas que aman hombres y mujeres, que son niñas, amantes y madres, sin necesidad de renunciar a la perversidad y al humor. El ejemplo más claro de esto es el poema “Feminist icon”, donde la misma mano que acaba de masturbarse hace la señal de la cruz entre el cuerpo y un burro de planchar. Biagini ha publicado tres libros de poemas: Questi nodi (Florencia, Gazebo, 1993, Uova (Génova, Zona, 1999 y l’ospite (Torino, Einaudi, 2004. Los poemas aquí traducidos fueron tomados de una antología personal.

30 CFR 56.6304 - Primer protection.

Science.gov (United States)

2010-07-01

... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 56.6304 Section 56.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of explosives...

Christiaan Barnard: 40 años del primer transplante de corazón humano.

OpenAIRE

Jorge Reynolds; Juan Fernando Cediel; César Payán

2009-01-01

Fueron éstas las palabras pronunciadas por Christiaan Neethling Barnard para referirse al domingo 3 de diciembre de 1967 cuando, en el Hospital Groote Schuur de Cape Town, Sudáfrica, dirigió al equipo que realizó el primer transplante cardíaco efectuado en un ser humano1. Después de 40 años, se recuerda al doctor Barnard, no sólo como cirujano excepcional, sino como un luchador incansable que revolucionó conceptos tan trascendentales en la ciencia médica como el de la muerte cerebral1,2.Chris...

KENO-VI Primer: A Primer for Criticality Calculations with SCALE/KENO-VI Using GeeWiz

International Nuclear Information System (INIS)

Bowman, Stephen M.

2008-01-01

The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory is widely used and accepted around the world for criticality safety analyses. The well-known KENO-VI three-dimensional Monte Carlo criticality computer code is one of the primary criticality safety analysis tools in SCALE. The KENO-VI primer is designed to help a new user understand and use the SCALE/KENO-VI Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO-VI in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO-VI that are useful in criticality analyses. The primer is based on SCALE 6, which includes the Graphically Enhanced Editing Wizard (GeeWiz) Windows user interface. Each example uses GeeWiz to provide the framework for preparing input data and viewing output results. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO-VI input and allows the user to quickly run a simple criticality problem with SCALE/KENO-VI. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO-VI features that are covered in detail in the sample problems in that section. Upon completion of the primer, a new user should be comfortable using GeeWiz to set up criticality problems in SCALE/KENO-VI. The primer provides a starting point for the criticality safety analyst who uses SCALE/KENO-VI. Complete descriptions are provided in the SCALE/KENO-VI manual. Although the primer is self-contained, it is intended as a companion volume to the SCALE/KENO-VI documentation. (The SCALE manual is provided on the SCALE installation DVD.) The primer provides specific examples of

Transmisión de Salmonella enterica a través de huevos de gallina y su importancia en salud pública Transmission of Salmonella enterica through chicken eggs and their importance in public health.

Directory of Open Access Journals (Sweden)

Diana Paola Rincón Acero

2011-08-01

Full Text Available La salmonelosis producida por especies de Salmonella sp. no tíficas, se manifiesta en humanos como una gastroenteritis o enterocolitis aguda de inicio repentino, cuyos síntomas aparecen de 6 a 48 horas después de la ingestión de alimentos o agua contaminada. Salmonella se transmite principalmente por el consumo de productos avícolas contaminados o por contaminación cruzada a través de manipuladores de alimentos o utensilios de cocina. La presente revisión se fundamenta en la interacción de Salmonella con el sistema reproductivo de la gallina y trata importantes aspectos como las formas de trasmisión al huevo, la epidemiología y prevención de este evento. Lo anterior con el fin de destacar la importancia de este patógeno en la generación de enfermedades trasmitidas por alimentos y el impacto que tiene el control de puntos críticos en la cadena de producción de los huevos y la vigilancia epidemiológica como mecanismos de control. Salud UIS 2011; 43 (2: 167-177Salmonellosis caused by non-typhoidal Salmonella species manifests in human like an acute gastroenteritis or enterocolitis that suddenly happens, whose symptoms occur between 6 to 48 hours after ingestion of contaminated food or water. Salmonella is mainly transmitted through consumption of contaminated poultry products, or crossed contamination by food handlers or kitchen utensils. This review is based on the interaction of Salmonella with the hen's reproductive system and presents important aspects such as the routes of transmission to the egg, epidemiology and prevention of this event. This in order to highlight the importance of this pathogen like source of foodborne diseases and the impact of the critical control points in the eggs production and epidemiological surveillance like control mechanisms. Salud UIS 2011; 43 (2: 167-177

Effect of Surface Treatment on Shear Bond Strength between Resin Cement and Ce-TZP/Al2O3

Directory of Open Access Journals (Sweden)

Jong-Eun Kim

2016-01-01

Full Text Available Purpose. Although several studies evaluating the mechanical properties of Ce-TZP/Al2O3 have been published, to date, no study has been published investigating the bonding protocol between Ce-TZP/Al2O3 and resin cement. The aim of this study was to evaluate the shear bond strength to air-abraded Ce-TZP/Al2O3 when primers and two different cement types were used. Materials and Methods. Two types of zirconia (Y-TZP and Ce-TZP/Al2O3 specimens were further divided into four subgroups according to primer application and the cement used. Shear bond strength was measured after water storage for 3 days or 5,000 times thermocycling for artificial aging. Results. The Y-TZP block showed significantly higher shear bond strength than the Ce-TZP/Al2O3 block generally. Primer application promoted high bond strength and less effect on bond strength reduction after thermocycling, regardless of the type of cement, zirconia block, or aging time. Conclusions. Depending on the type of the primer or resin cement used after air-abrasion, different wettability of the zirconia surface can be observed. Application of primer affected the values of shear bond strength after the thermocycling procedure. In the case of using the same bonding protocol, Y-TZP could obtain significantly higher bond strength compared with Ce-TZP/Al2O3.

Evaluación del impacto de la intervención educativa-motivacional "Como Jugando" para prevenir la obesidad en escolares del Cercado de Lima: resultados al primer año

Directory of Open Access Journals (Sweden)

Juan Pablo Aparco

Full Text Available RESUMEN Objetivo. Determinar el impacto, al primer año, de la intervención educativa-motivacional "Como Jugando" sobre el índice de masa corporal (IMC, conocimientos en alimentación, niveles de actividad física y patrones de consumo alimentario en escolares del 1.° al 4.° grado de primaria, de cuatro instituciones educativas (IE del Cercado de Lima. Materiales y métodos. Estudio cuasiexperimental, controlado. Se evaluó el IMC, conocimientos en nutrición, frecuencia de consumo de alimentos y nivel de actividad física. "Como Jugando" incluyó actividades lúdicas y vivenciales para escolares e involucró a docentes y padres. El impacto se estimó aplicando la prueba de McNemar para muestras relacionadas y modelos de regresión de diferencias en diferencias ajustados por variables relativas al escolar y la madre. Resultados. El estudio incluyó a 696 escolares de 2 IE de intervención y 2 IE de control, el puntaje Z de IMC y las prevalencias de obesidad no variaron durante el periodo de estudio. La intervención mostró impacto en mejorar los conocimientos en nutrición (OR: 1,46; IC95%: 1,17-1,81 redujo el riesgo de tener un nivel malo de actividad física (OR: 0,63; IC95%: 0,46-0,87 y mejoró los patrones de consumo de todos los alimentos, salvo verduras (grupo intervención. Conclusiones. La intervención "Como Jugando", al primer año de implementación, no redujo el Puntaje Z del IMC, sin embargo, tuvo impacto sobre los conocimientos en nutrición, redujo la probabilidad de tener un nivel malo de actividad física y mantuvo o aumentó la frecuencia adecuada del consumo de frutas, agua sin azúcar, jugos envasados y galletas dulces y saladas. Es necesario continuar evaluando la intervención "Como Jugando" para estimar el impacto sobre indicadores biológicos.

Control de cloequez y comportamiento productivo de guajolotas criollas

Directory of Open Access Journals (Sweden)

A. Juárez

2009-01-01

Full Text Available Con el objetivo de evaluar el efecto de enjaulamiento como alternativa contra la cloequez en las guajolotas criollas y su posterior comportamiento productivo, se utilizaron 30 guajolotas criollas: 25 (experimentales ubicadas en jaulas individuales y 5 (testigos que permanecieron en el nido, en piso de tierra; el alimento ofrecido a discreción fue de tipo comercial, especial para gallinas en postura. En ambos grupos se midió el peso vivo al iniciar el experimento -que duró 120 días- y posteriormente cada semana. Nuevamente se midió el peso vivo al iniciar postura, así como el intervalo del enjaulamiento e inicio de puesta, peso del huevo, diámetro ecuatorial y polar, índice de forma del huevo, peso, porcentaje y espesor del cascarón. Los resultados indican que: a las cinco semanas de enjauladas el 100% de las guajolotas retornaron al siguiente ciclo de postura, en comparación con 0% de postura de las guajolotas en nido en piso. La diferencia en peso corporal entre pavas cluecas al enjaular e inicio de postura fue superior a 800 g; la producción mensual fue de 16.6 huevos; el índice de forma del huevo fue de 73%; el peso, porcentaje y e productisor del cascarón fue de: 8.1g, 10% y 0.47mm, respectivamente. Las unidades Haugh observadas fueron de 80.9. En síntesis, el enjaulamiento representa una alternativa de solución al problema de la cloequez en las guajolotas criollas y facilita el registro de indicadores productivos en este germoplasma avícola nativo.

Laboratory validation of two real-time RT-PCR methods with 5'-tailed primers for an enhanced detection of foot-and-mouth disease virus.

Science.gov (United States)

Vandenbussche, Frank; Lefebvre, David J; De Leeuw, Ilse; Van Borm, Steven; De Clercq, Kris

2017-08-01

The 3D and 5UTR real-time RT-PCR assays (RT-qPCR) from Callahan et al. (2002) and Reid et al. (2002) are commonly used reference methods for the detection of foot-and-mouth disease virus (FMDV). For an optimal detection of FMDV in clinical samples, it is advised to use both assays simultaneously (King et al., 2006). Recently, Vandenbussche et al. (2016) showed that the addition of 5'-tails to the FMDV-specific primers enhances the detection of FMDV in both the 3D and the 5UTR RT-qPCR assay. To validate the 3D and 5UTR RT-qPCR assays with 5'-tailed primers for diagnostic purposes, both assays were run in parallel in a triplex one-step RT-qPCR protocol with beta-actin as an internal control and synthetic RNA as an external control. We obtained low limits of detection and high linearity's, high repeatability and reproducibility, near 100% analytical specificity and >99% diagnostic accuracy for both assays. It was concluded that the 3D and 5UTR RT-qPCR assays with 5'-tailed primers are particularly suited for the detection of FMDV as well as to exclude the presence of FMDV. Copyright © 2017 Elsevier B.V. All rights reserved.

Los huevos falsos (SAGs facilitan el comportamiento social de emergencia en las crías de la tortuga laúd Dermochelys coriacea (Testudines: Dermochelyidae

Directory of Open Access Journals (Sweden)

Juan Patiño-Martinez

2010-09-01

Full Text Available La emergencia de las crías de tortuga laúd eclosionadas en los nidos profundos desde la arena hasta la superficie de la playa ocurre sin ayuda parental y es el primer gran desafío de supervivencia en su ciclo de vida. Este estudio, desarrollado en la costa Caribe colombiana, describe el comportamiento social de emergencia de neonatos y evalúa el efecto de la traslocación de los nidos en los patrones temporales de emergencia. Se propone por primera vez que el espacio liberado por la deshidratación de falsos huevos (SAGs en la nidada, representa una ventaja reproductiva al facilitar el agrupamiento de los neonatos en un espacio muy limitado y favorecer la sincronía de la emergencia. El tiempo medio registrado para la emergencia en grupo fue de 3.3 días, variando entre uno y seis días. La traslocación de los nidos no afectó el patrón temporal de emergencia que fue predominantemente nocturno (77.77% en nidos naturales y 81.65% en trasladados. Los picos máximos de emergencias a la superficie coincidieron con los periodos de menor temperatura ambiental exterior (22:00h-06:00h. La ventaja selectiva de este patrón temporal y de la emergencia sincrónica está probablemente relacionada con las mayores tasas de depredación y mortalidad por hipertermia observadas durante el día.False eggs (SAGs facilitate social post-hatching emergence behaviour in Leatherback turtles Dermochelys coriacea (Testudines: Dermochelyidae nests. Hatchling emergence to the beach surface from deep sand nests occurs without parental care. Social behaviour among siblings is crucial to overcome this first challenge in sea turtles life. This study, carried out at the Caribbean coast of Colombia, describes the emergence social behaviour of hatchlings from eight nests, and assess the nests translocation effects on temporal patterns of emergence. For the first time, we propose that space released by dehydration of shelled albumen globes (SAGs at the top of the clutch

EFECTOS TOXICOLÓGICOS DE EXTRACTOS DE MOLLE (Schinus molle) Y LANTANA (Lantana camara) SOBRE Chrysoperla externa (NEUROPTERA: CHRYSOPIDAE), Trichogramma pintoi (HYMENOPTERA: TRICHOGRAMMATIDAE) Y Copidosoma koehleri (HYMENOPTERA: ENCYRTIDAE) EN EL PERÚ

OpenAIRE

Iannacone O., José; Lamas M., Gerardo

2003-01-01

Extractos de dos plantas; el molle (Schinus molle L., Anacardiaceae) y la lantana (Lantana camara L., Verbenaceae), se evaluaron sobre huevos, larvas de primer estadio y pupas de Chrysoperla externa Hagen (Neuroptera: Chrysopidae), y sobre estados inmaduros y adultos de los microhimenopteros Trichogramma pintoi Voegelé (Trichogrammatidae) y Copidosoma koehleri Blanchard (Encyrtidae), en bioensayos toxicológicos bajo condiciones de laboratorio. Los extractos acuosos (F1) del molle y la lantana...

Platigástridos (Hymenoptera: Platygastridae parasitoides de Pentatomidae en Córdoba. Caracterización de las masas de huevos parasitoidizadas y aspectos biológicos

Directory of Open Access Journals (Sweden)

Norma LA PORTA

2013-01-01

Full Text Available Se caracterizan las masas de huevos parasitoidizadas de pentatómidos per - tenecientes a cinco especies, cuatro fitófagas y una depredadora. Además, se analizan aspectos biológicos de esas oviposturas (abundancia y parasitoidismo y de sus para - sitoides (proporción sexual y emergencia: cinco especies de microhimenópteros plati - gástridos pertenecientes a los géneros Trissolcus Ashmead, Telenomus Haliday y Gryon Haliday . El análisis de las masas de huevos de pentatómidos en el campo apor ta indi - cadores exomorfológicos para determinar si están o no parasitoidizadas y, en algunos casos, conocer la especie de parasitoide emergente. Los altos niveles de parasitoidismo registrados en ambos sitios muestreados –Marcos Juárez y zona periurbana de Córdoba, sugieren que los parasitoides oófagos inciden de manera importante en las poblaciones de hemípteros presentes en el cultivo de soja. Las especies parasitoides mostraron una proporción de sexos marcadamente sesgada hacia las hembras, con un comportamiento similar respecto a cada huésped con el que interactuaron. Los porcentajes de emergencia resultaron más variables dependiendo de la especie parasitoide, del huésped y del sitio. El multiparasitoidismo fue registrado en todas las especies con excepción de Nezara viridula L. Telenomus podisi Ashmead fue el parasitoide común en las combinaciones observadas, resultando T. podisi-Trissolcus urichi Crawford la más frecuente.

The Los Alamos primer

CERN Document Server

Serber, Robert

2018-01-01

Unabridged declassified value reproduction of The Los Alamos Primer by Robert Serber, in full color with all censor markings. This is the booklet given to new workers at Los Alamos during World War II, to catch them up on how to build a practical fission bomb. The Primer was driven by Robert Oppenheimer asking his protégé Robert Serber to summarize all knowledge and possible solutions known as of April 1943 in a series of lectures. Serber did such an excellent job that the notes from the series was turned into The Los Alamos Primer. Serber was known as an expert that bridged theory and reality, and so was also chosen to be one of the first Americans to enter Hiroshima and Nagasaki to assess the atomic damage in 1945.

El secreto del huevo azul, de Catalina González Vilar. Estudio narratológico. The secret of the blue egg, by Catalina González Vilar. Narratological study

Directory of Open Access Journals (Sweden)

Miguel Sánchez-García

2013-11-01

Full Text Available This article discusses a narratological study of the literary work The secret of the blue egg, by the writer Catalina Gonzalez Vilar, that won El Barco de Vapor prize in 2012. It examines the different constitutive elements of the text (topic approach, prominent figures, syntactic structure, narrative technique… and his contribution to the development of the story with the purpose of discovering the aesthetic and literary values that contribute to the fable. It aims at demonstrating the proper use of them all as they shape a text rich in nuances, striking, suggestive. All these qualities of great importance both in creations aimed at adults as well as at children and young people because they enrich the final value of the work, and by extension, the cultural background of their readers.Este trabajo aborda el estudio narratológico de la obra El secreto del huevo azul, de la escritora Catalina González Vilar, que obtuvo el Premio El Barco de Vapor en el año 2012. Examina los diferentes elementos constitutivos del texto (el enfoque del tema, la caracterización de los personajes, la estructura sintáctica, el tratamiento del lenguaje, la técnica narrativa utilizada… y su aporte al desarrollo de la historia con la finalidad de descubrir los valores estéticos y literarios que aporta a la fábula. Pretende demostrar el adecuado uso de todos ellos dado que favorecen un texto rico en matices, llamativo, sugerente. Cualidades, todas ellas, de gran importancia tanto en creaciones destinadas al público adulto como al infantil y juvenil pues enriquece el valor final de la obra, y por extensión, el bagaje cultural de sus lectores.

Complementation of a primer binding site-impaired murine leukemia virus-derived retroviral vector by a genetically engineered tRNA-like primer

DEFF Research Database (Denmark)

Lund, Anders Henrik; Duch, M; Lovmand, J

1997-01-01

, but not with a noncomplementary tRNA-like molecule. The engineered primer was shown to be involved in both the initiation of first-strand synthesis and second-strand transfer. These results provide an in vivo demonstration that the retroviral replication machinery may recognize sequence complementarity rather than actual primer...... binding site and 3' primer sequences. Use of mutated primer binding site vectors replicating via engineered primers may add additional control features to retroviral gene transfer technology....

Nanotechnology: A Policy Primer

Science.gov (United States)

2013-06-24

savings in the United States of 24 million barrels of oil.4 • Universal access to clean water. Nanotechnology water desalination and filtration...CRS Report for Congress Prepared for Members and Committees of Congress Nanotechnology : A Policy Primer John F. Sargent Jr. Specialist...COVERED 00-00-2013 to 00-00-2013 4. TITLE AND SUBTITLE Nanotechnology : A Policy Primer 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT

Cuidado popular de familias con un adulto mayor sobreviviente del primer accidente cerebrovascular

Directory of Open Access Journals (Sweden)

Lucero López-Díaz

2016-01-01

Full Text Available Introducción: el accidente cerebrovascular afecta a numerosas personas en el mundo y se constituye en la principal causa de muer- te. Los sobrevivientes pueden padecer discapacidad y sufrir modificaciones en las actividades cotidianas. La familia es el principal apoyo del sobreviviente y al ser parte de una misma cultura, construye acciones de cuidado en búsqueda del bienestar. Objetivo: describir las acciones del cuidado popular de las familias con un adulto mayor sobreviviente del primer accidente cerebrovascular. Método: estudio etnográfico, con observación participante y entrevistas en profundidad. Participaron siete familias bogotanas (siete adultos mayores entre los dos y diez meses posteriores al primer accidente cerebrovascular y los siete cuidadores principales respectivos. Resultados: cuidadores y adulto mayor comparten acciones de cuidado para la recuperación, relacionadas con la alimentación, el cuidado personal y la ingesta de medicamentos permeadas por la creencia religiosa, fuente de soporte y vínculo afectivo. Conclusión: conocer el cuidado popular de esta población posibilita proponer acciones culturalmente congruentes con sus valores y creencias para potencializar las ca- pacidades familiares e intermediar en los procesos de tratamiento.

MPprimer: a program for reliable multiplex PCR primer design

Directory of Open Access Journals (Sweden)

Wang Xiaolei

2010-03-01

Full Text Available Abstract Background Multiplex PCR, defined as the simultaneous amplification of multiple regions of a DNA template or multiple DNA templates using more than one primer set (comprising a forward primer and a reverse primer in one tube, has been widely used in diagnostic applications of clinical and environmental microbiology studies. However, primer design for multiplex PCR is still a challenging problem and several factors need to be considered. These problems include mis-priming due to nonspecific binding to non-target DNA templates, primer dimerization, and the inability to separate and purify DNA amplicons with similar electrophoretic mobility. Results A program named MPprimer was developed to help users for reliable multiplex PCR primer design. It employs the widely used primer design program Primer3 and the primer specificity evaluation program MFEprimer to design and evaluate the candidate primers based on genomic or transcript DNA database, followed by careful examination to avoid primer dimerization. The graph-expanding algorithm derived from the greedy algorithm was used to determine the optimal primer set combinations (PSCs for multiplex PCR assay. In addition, MPprimer provides a virtual electrophotogram to help users choose the best PSC. The experimental validation from 2× to 5× plex PCR demonstrates the reliability of MPprimer. As another example, MPprimer is able to design the multiplex PCR primers for DMD (dystrophin gene which caused Duchenne Muscular Dystrophy, which has 79 exons, for 20×, 20×, 20×, 14×, and 5× plex PCR reactions in five tubes to detect underlying exon deletions. Conclusions MPprimer is a valuable tool for designing specific, non-dimerizing primer set combinations with constrained amplicons size for multiplex PCR assays.

Predictive maintenance primer

International Nuclear Information System (INIS)

Flude, J.W.; Nicholas, J.R.

1991-04-01

This Predictive Maintenance Primer provides utility plant personnel with a single-source reference to predictive maintenance analysis methods and technologies used successfully by utilities and other industries. It is intended to be a ready reference to personnel considering starting, expanding or improving a predictive maintenance program. This Primer includes a discussion of various analysis methods and how they overlap and interrelate. Additionally, eighteen predictive maintenance technologies are discussed in sufficient detail for the user to evaluate the potential of each technology for specific applications. This document is designed to allow inclusion of additional technologies in the future. To gather the information necessary to create this initial Primer the Nuclear Maintenance Applications Center (NMAC) collected experience data from eighteen utilities plus other industry and government sources. NMAC also contacted equipment manufacturers for information pertaining to equipment utilization, maintenance, and technical specifications. The Primer includes a discussion of six methods used by analysts to study predictive maintenance data. These are: trend analysis; pattern recognition; correlation; test against limits or ranges; relative comparison data; and statistical process analysis. Following the analysis methods discussions are detailed descriptions for eighteen technologies analysts have found useful for predictive maintenance programs at power plants and other industrial facilities. Each technology subchapter has a description of the operating principles involved in the technology, a listing of plant equipment where the technology can be applied, and a general description of the monitoring equipment. Additionally, these descriptions include a discussion of results obtained from actual equipment users and preferred analysis techniques to be used on data obtained from the technology. 5 refs., 30 figs

China Energy Primer

Energy Technology Data Exchange (ETDEWEB)

Ni, Chun Chun

2009-11-16

Based on extensive analysis of the 'China Energy Databook Version 7' (October 2008) this Primer for China's Energy Industry draws a broad picture of China's energy industry with the two goals of helping users read and interpret the data presented in the 'China Energy Databook' and understand the historical evolution of China's energy inustry. Primer provides comprehensive historical reviews of China's energy industry including its supply and demand, exports and imports, investments, environment, and most importantly, its complicated pricing system, a key element in the analysis of China's energy sector.

Brassolis isthmia (LEPIDOPTERA: NYMPHALIDAE, EN PEJIBAYE Y EN COCOTERO EN COSTA RICA

Directory of Open Access Journals (Sweden)

Ram\\u00F3n G. Mexz\\u00F3n

2011-01-01

Full Text Available El objetivo de este trabajo fue describir el ciclo de vida de Brassolis isthmia asociado al pejibaye bajo condiciones de campo y de laboratorio, y su actividad en cocotero. El ciclo de vida de B. isthmia fue estudiado en condiciones de campo y de laboratorio en Guápiles, Limón, Costa Rica, entre setiembre y noviembre de 1994, durante un incremento poblacional del insecto en una plantación de pejibaye. En los años siguientes se realizaron observaciones de las actividades alimentarias de la mariposa en cocotero en varias localidades de la Vertiente Caribeña. Varios centenares de huevos y de larvas de primer estadio fueron recolectadas y colocadas en grupos de diez individuos, y alimentadas con pedazos de hojas de pejibaye, de 30 x 80 mm. El número de larvas necesario para causar defoliaciones de 5% y 20% fue calculado para cada estado de desarrollo larval. El ciclo de vida promedio duró 159 días, distribuidos en las etapas de: huevo: 20, larva: 114, pupa: 20 y adulto: 5 días. Las larvas son gregarias, se alimentan durante la noche y permanecen durante el día en nidos construidos con restos de hojas secas y seda. El consumo promedio durante la etapa larva es de 820,62 cm² de follaje; el séptimo estado larval requiere un 72,8% de éste.

Impedance evaluation of permeability and corrosion of Al-2024 aluminum alloy coated with a chromate free primer

NARCIS (Netherlands)

Foyet, A; Wu, T.H.; Kodentsov, A.; Ven, van der L.G.J.; With, de G.; Benthem, van R.A.T.M.

2009-01-01

The corrosion of AA-2024 aluminum alloy protected with a chromate free primer is investigated afterimmersion in a 0.5MNaCl aqueous solution. Thewater uptake by the coating increases continuouslywhenthe film, applied on an aluminum AA-2024 substrate, is placed in the 0.5MNaCl solution. This increase

De neurocirujano a primer ministro de Salud de la Argentina

Directory of Open Access Journals (Sweden)

Karina Inés Ramacciotti

2008-01-01

Full Text Available La trayectoria y los vínculos que entabló Ramón Carrillo con anterioridad a ejercer el cargo de primer secretario de Salud Pública en la Argentina (1946 no han sido objeto de estudio pormenorizado. Así pues en este artículo se analizarán en primer lugar, una serie de cartas de lectores publicadas en La Semana Médica en los primeros años de la década del '40 del siglo XX. Estas notas permiten comprender las disputas internas que se produjeron en la Facultad de Ciencias Médicas al producirse el concurso de Titular de Neurocirugía de la Universidad de Buenos Aires. En segundo lugar, se revisará cómo Carrillo pasa de ocupar este prestigioso cargo académico a convertirse en decano interi- no de la Facultad de Ciencias Médicas. Son las relaciones que anuda durante estos años las que lo posicionan en un escenario político privilegiado para alcanzar un relevante puesto en la administración pública.

Contribución al conocimiento del barniz o "Mopa-mopa', Elaeagia pastoensis mora

Directory of Open Access Journals (Sweden)

Mejía G. Mario

1987-03-01

Full Text Available En la dieta de 252 gallinas semipesadas en postura (42 a 62 semanas se incluyeron 3 niveles (0,25 Y 50 o/o de harina de yuca (HY combinados con torta de soya (TS y soya integral cocida (SIC. No hubo diferencias (P < o igual 0.05 debidas a los niveles de HY; sin embargo, aumentaron el porcentaje de postura y el consumo y disminuyeron el peso del huevo y la coloración de la yema conforme se incrementaron los niveles de HY. Las dietas con 50 % y O% de HY presentaron respectivamente la mejor conversión por docena de huevo y por kilogramo de huevo producido. Hubo diferencia (P < o igual 0.05 con la mejor respuesta en consumo de alimento, producción y peso del huevo, conversión alimenticia por kg de huevo producido y coloración de la yema por el uso de SIC en reemplazo de TS en dietas a base de sorgo y HY. Sin embargo no hubo diferencias (P < o igual O.05 debidas a la interacción de los niveles de yuca por la fuente de proteína. El mejor beneficio neto se obtuvo con la dieta que contenía O% de harina de yuca (100 % sorgo + SIC.An experiment was conducted with 252 laying hens (42 to 62 weeks age to evaluate the use of three levels (0,25 Y 50 % of cassava flour (CF in combination with soy bean meal (SBM and whole cooked soy bean (WCSB in the diet. There were no differences (P < 0.05 due to the CF levels; however, production o lo and feed consumption increased, egg weight and yoIk color decreased when increased the levels of CF; the diets with 0% and 50 % CF had respectly the best conversion/dozen egg and conversion/kg egg. There were differences (P < 0.05 with a best response in feed consumption, egg production, egg weight, feed consumption/kg egg production, egg weight, feed consumption/kg egg produced and yolk color due to the use of WCSB replacing SBM in diets containing milo and C F for laying hens. The interaction level of cassava x protein source was not significant (P < 0.05. Economically the best net benefic was obtained with the diet

MCMC-ODPR: Primer design optimization using Markov Chain Monte Carlo sampling

Directory of Open Access Journals (Sweden)

Kitchen James L

2012-11-01

Full Text Available Abstract Background Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR algorithm. Results After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. Conclusions MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.

MCMC-ODPR: primer design optimization using Markov Chain Monte Carlo sampling.

Science.gov (United States)

Kitchen, James L; Moore, Jonathan D; Palmer, Sarah A; Allaby, Robin G

2012-11-05

Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR) algorithm. After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.

Parámetros reproductores de la gaviota patiamarilla Larus michahellis lusitanius Naumann, 1840 en Gipuzkoa

Directory of Open Access Journals (Sweden)

ARAIZAGA, J., ALDALUR, A., CUADRADO, J.F., DIEZ, E., GOIKOETXEA, J., HERRERO, A., JAUREGI, J.I., LASO, M., SANCHEZ, J.M.

2012-01-01

Full Text Available El objetivo del presente artículo es estudiar la reproducción de la gaviota patiamarilla Larus michahellis lusitanius Naumann, 1840 en Gipuzkoa. En particular, analizamos (1 el tamaño de puesta (número de huevos/nido, (2 la fecha de eclosión, (3 el número de huevos eclosionados/nido y (4 la proporción de huevos eclosionados en relación al número de huevos en el nido, considerando dos zonas que, a priori, presentan diferente tipo de sustrato de nidificación. Para ello, durante un periodo de 40 días (16.05.201124.06-2011 la colonia de Ulia se visitó a diario. En promedio, se registró un tamaño de puesta de 3 huevos/nido, un número de huevos eclosionados de 3/nido y un porcentaje de eclosión de 88,4%. La fecha media de eclosión sucedió en la segunda quincena de Mayo. Asimismo, se registraron algunas diferencias entre las dos zonas en que se dividió la colonia (tamaño de puesta inferior y porcentaje de huevos eclosionados superior en una zona que presentó más roca y vegetación de mayor porte en relación a otra zona con menos rocas así como más hierba. Discutimos esto en un contexto de zonificación de la colonia de estudio en el marco de áreas de carácter óptimo o subóptimo en términos reproductivos.

High-speed measurement of firearm primer blast waves

OpenAIRE

Courtney, Michael; Daviscourt, Joshua; Eng, Jonathan; Courtney, Amy

2012-01-01

This article describes a method and results for direct high-speed measurements of firearm primer blast waves employing a high-speed pressure transducer located at the muzzle to record the blast pressure wave produced by primer ignition. Key findings are: 1) Most of the lead styphnate based primer models tested show 5.2-11.3% standard deviation in the magnitudes of their peak pressure. 2) In contrast, lead-free diazodinitrophenol (DDNP) based primers had standard deviations of the peak blast p...

INFORMACIÓN EN EL PRIMER NIVEL DE ATENCIÓN

Directory of Open Access Journals (Sweden)

Orzuza, Gloria Beatriz

2013-01-01

Full Text Available En América Latina y el Caribe existen algunos limitantes al acceso de la atención médica como la escasez de recursos, la distancia física y cultural entre la oferta pública y la población demandante. En este sentido, en la definición de políticas de salud formuladas por los Estados no podrá estar ausente la incorporación de tecnologías de información y comunicación, ya que el concepto de salud electrónica engloba las aplicaciones de registros médicos electrónicos, servicios de telemedicina, portales de salud y sistemas de gestión hospitalaria.En Argentina existía un gran interés de los profesionales médicos por la telemedicina e informática en salud, así en 1992 se realiza el Primer Congreso Mundial. Comienzan entonces muchas iniciativas en telemedicina, educación a distancia, portales de salud y en registros médicos electrónico.Las investigaciones en salud a nivel nacional, concluyen que Misiones pertenece al grupo de provincias argentinas que se encuentra en una situación más desfavorable respecto a las otras provincias. En este marco, se contribuirá con lineamientos estratégicos generales para un sistema de información a ser desarrollado en el primer nivel de atención, con el propósito de obtener la información necesaria para la toma de decisión y favorecer en la optimización de la gestión.

Hexavalent Chromium IV-Free Primer Development

Science.gov (United States)

Alldredge, Michael J.; Buck, Amy L.

2015-01-01

Primer materials provide corrosion protection for metal parts as well as an increased adhesion between metallic substrates and thermal protection systems (TPSs). Current primers for use in cryogenic applications contain hexavalent chromium. This hexavalent chromium provides excellent corrosion protection even in a cryogenic environment, but it is a carcinogen that requires special equipment and waste control procedures to use. The hazardous nature of hexavalent chromium makes it an obsolescence risk in the future. This study included two phases of evaluation. Thirteen primers were initially identified as candidates and twelve of those primers were tested in phase 1. Four of the best performing candidates from phase 1 continued into phase 2 testing. Phase 1 testing consisted mostly of liquid constituent and physical property testing. Cryoflex and salt fog testing were included in phase 1 because of their importance to the overall success of a candidate material. Phase 2 consisted of physical, thermal, and mechanical properties for nominally processed and fabricated specimens.

Estudio de cultivos celulares primarios de Psorophora confinnis (Díptera: Culicidae)

OpenAIRE

Felio J. Bello; Jaime A. Rodríguez; Alberto Morales; Víctor A. Olano

1999-01-01

Con el propósito de obtener una línea celular de Psorophora confinnis (Arribalzaga, 1891) para estudios de susceptibilidad a infecciones con arbovirus, se iniciaron los cultivos primarios de esta especie, vectora del virus de la encefalitis equina venezolana, tipo epidemo-epizoótico. A partir de huevos embrionados, larvas de primer estadio recién eclosionadas y ovarios de hembras adultas, se realizaron explantes por separado de tejidos embrionarios en diversos medios de cultivos, suplementado...

Presencia de Triatoma sordida Stäl, 1859 en ecotopos urbanos de la ciudad de Corrientes, Argentina

Directory of Open Access Journals (Sweden)

María E. Bar

1993-04-01

Full Text Available Con el objeto de verificar la presencia de T. sordida Stäl 1859, en ecotopos urbanos de la ciudad de Corrientes, Argentina se tomaron como base un habitat extradomiciliario y la vivienda humana. En el palomar situado en el Parque Mitre fue realizado un censo completo de población de T. sordida para lo cual fueron disecados 400 nidos de paloma (Columbia livia. Los ejemplares de triatominos detectados en las viviendas fueron enviados por los pobladores al Laboratorio de Artrópodos. Los triatominos fueron determinados sistemáticamente y por clase de edad. La materia fecal de los mismos fue examinada al microscopio para la identificación del Trypanosoma cruzi. En el palomar se colectaron: 6 huevos, 45 ninfas de primer estadío, 110 ninfas de segundo estadío, 226 ninfas de tercer estadío, 303 ninfas de cuarto estadío, 1.103 ninfas de quinto estadío, 12 hembras y 11 machos. Se constató la presencia de esta especie en 27 viviendas localizadas en 8 barrios de la Ciudad. Se capturaron 13 huevos, 33 ninfas de diferentes estadíos, 27 hembras y 9 machos, totalizando 82 individuos. Ningún triatomino resultó infectado por T. cruzi. Los adultos de T. sordida se desplazaron hacia el domicilio en primavera y verano. Es de destacar que el 33% del material hallado en las viviendas correspondió a hembras. Se ha comprobado la adaptación de T. sordida a un habitat extradomiciliario y su tendencia a invadir la vivienda humana, hecho que se debería ser tenido en cuenta en los programas de control de vectores.

Presencia de Triatoma sordida Stäl, 1859 en ecotopos urbanos de la ciudad de Corrientes, Argentina

Directory of Open Access Journals (Sweden)

Bar María E.

1993-01-01

Full Text Available Con el objeto de verificar la presencia de T. sordida Stäl 1859, en ecotopos urbanos de la ciudad de Corrientes, Argentina se tomaron como base un habitat extradomiciliario y la vivienda humana. En el palomar situado en el Parque Mitre fue realizado un censo completo de población de T. sordida para lo cual fueron disecados 400 nidos de paloma (Columbia livia. Los ejemplares de triatominos detectados en las viviendas fueron enviados por los pobladores al Laboratorio de Artrópodos. Los triatominos fueron determinados sistemáticamente y por clase de edad. La materia fecal de los mismos fue examinada al microscopio para la identificación del Trypanosoma cruzi. En el palomar se colectaron: 6 huevos, 45 ninfas de primer estadío, 110 ninfas de segundo estadío, 226 ninfas de tercer estadío, 303 ninfas de cuarto estadío, 1.103 ninfas de quinto estadío, 12 hembras y 11 machos. Se constató la presencia de esta especie en 27 viviendas localizadas en 8 barrios de la Ciudad. Se capturaron 13 huevos, 33 ninfas de diferentes estadíos, 27 hembras y 9 machos, totalizando 82 individuos. Ningún triatomino resultó infectado por T. cruzi. Los adultos de T. sordida se desplazaron hacia el domicilio en primavera y verano. Es de destacar que el 33% del material hallado en las viviendas correspondió a hembras. Se ha comprobado la adaptación de T. sordida a un habitat extradomiciliario y su tendencia a invadir la vivienda humana, hecho que se debería ser tenido en cuenta en los programas de control de vectores.

Multiplexing Short Primers for Viral Family PCR

Energy Technology Data Exchange (ETDEWEB)

Gardner, S N; Hiddessen, A L; Hara, C A; Williams, P L; Wagner, M; Colston, B W

2008-06-26

We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets for large, diverse, and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers ({approx}3700 18-mers or {approx}2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and for several diverse species such as foot-and-mouth disease virus, hemagglutinin and neuraminidase segments of influenza A virus, Norwalk virus, and HIV-1.

Cytotoxic and genotoxic evaluation of orthodontic adhesives with primer and without primer exposed to electron beam irradiation - an in-vitro study

International Nuclear Information System (INIS)

Ravi, M.S.; Panchasara, Chirag; Vijay, R.; Suchetha Kumari, N.; Sanjeev, Ganesh

2013-01-01

To evaluate the in vitro genotoxicity and cytotoxicity of two visible light-cured adhesives. The materials tested were 1. orthodontic adhesive with primer (Transbond XT3M) and 2. Orthodontic adhesive without primer (Heliosit, Ivoclar Vivadent AG), Cured sterile individual masses were exposed to 2 kGy electron beam radiation, both irradiated and non irradiated materials were immersed in Phosphate buffer saline and left at 370℃ for 24 hr. Then a volume of 200 μL of the extract medium was mixed with human peripheral blood lymphocyte tested for comet assay by single cell DNA Damage assay and Apoptosis by DNA diffusion agar assay. Evaluation of cytotoxicity was carried out by Hemolysis assay method. Haemolytic activity of orthodontic adhesive without primer (53.34±3.12) was slightly more than that of orthodontic adhesive with primer (52.9±.88). In case of Apoptosis, adhesive with primer (188.92±55.05) and adhesives without primer (186.75±101.83) showed increased diffusion of DNA compared to normal lymphocyte (111.22±8.78). However the level of DNA diffusion was not significantly different between the two adhesives. Both adhesives were cytotoxic and induced apoptosis. Adhesives without primer were found to be slightly toxic than that of adhesive with primer. Both the adhesives had no significant effect on the percentage of DNA tail and olive tail moment of DNA exposed to electron beam radiation. (author)

KENO V.a Primer: A Primer for Criticality Calculations with SCALE/KENO V.a Using CSPAN for Input

International Nuclear Information System (INIS)

Busch, R.D.

2003-01-01

The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory (ORNL) is widely used and accepted around the world for criticality safety analyses. The well-known KENO V.a three-dimensional Monte Carlo criticality computer code is the primary criticality safety analysis tool in SCALE. The KENO V.a primer is designed to help a new user understand and use the SCALE/KENO V.a Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO V.a in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO V.a that are useful in criticality analyses. The primer is based on SCALE 4.4a, which includes the Criticality Safety Processor for Analysis (CSPAN) input processor for Windows personal computers (PCs). A second edition of the primer, which uses the new KENO Visual Editor, is currently under development at ORNL and is planned for publication in late 2003. Each example in this first edition of the primer uses CSPAN to provide the framework for data input. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO V.a input and allows the user to quickly run a simple criticality problem with SCALE/KENO V.a. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO V.a features which are covered in detail in the example problems in that section. Upon completion of the primer, a new user should be comfortable using CSPAN to set up criticality problems in SCALE/KENO V.a

Primer on spontaneous heating and pyrophoricity

Energy Technology Data Exchange (ETDEWEB)

1994-12-01

This primer was prepared as an information resource for personnel responsible for operation of DOE nuclear facilities. It has sections on combustion principles, spontaneous heating/ignition of hydrocarbons and organics, pyrophoric gases and liquids, pyrophoric nonmetallic solids, pyrophoric metals (including Pu and U), and accident case studies. Although the information in this primer is not all-encompassing, it should provide the reader with a fundamental knowledge level sufficient to recognize most spontaneous combustion hazards and how to prevent ignition and widespread fires. This primer is provided as an information resource only, and is not intended to replace any fire protection or hazardous material training.

30 CFR 57.6304 - Primer protection.

Science.gov (United States)

2010-07-01

... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 57.6304 Section 57.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Transportation-Surface and Underground § 57.6304 Primer protection. (a) Tamping shall not be done directly on a...

ADICIÓN DE CARBONATO CÁLCICO Y SU REPERCUSIÓN ECONÓMICA SOBRE EL GROSOR DEL CASCARÓN EN PONEDORAS

Directory of Open Access Journals (Sweden)

José Humberto Vera Rodríguez

2012-06-01

Full Text Available El objetivo de esta investigación fue evaluar el efecto de la adición de dosis de carbonato de calcio en las últimas horas de la tarde con una granulometría de 2 a 4 mm sobre el peso del huevo, grosor del cascarón y análisis económico de los tratamientos. Se utilizaron 200 ponedoras Isa Brown en fase I de producción (19 a 30 semanas de edad, en un diseño de bloques completamente al azar con 4 tratamientos, 10 repeticiones por tratamiento y 5 gallinas por repetición, durante 12 semanas. Los tratamientos fueron: 0.50; 1.00; 1.50 gramos/gallina/ día de carbonato de calcio más un tratamiento testigo al cual no se le adicionó. Los niveles de carbonato de calcio no influenciaron (p>0.05 en el peso del huevo. Los resultados registraron diferencias significativas (p<0.05 en el grosor del cascarón y al realizar el análisis de regresión con el peso del huevo para establecer el grosor del cascarón se alcanzó un coeficiente de correlación de 0.69 garantizando dicha diferencia. En conclusión se estima que la adición de 1.50 gramos/gallina/día de carbonato de calcio mejora significativamente el grosor del cascarón y en cuanto al análisis económico se demostró que la mejor tasa de retorno marginal la mostró dicho tratamiento con el 10.76 %. Los niveles de carbonato de calcio no afectan en el peso del huevo.

El juego y la matemática. Juegos de matemáticas para el alumnado del primer ciclo de E. Primaria.

OpenAIRE

Sánchez Esteban, Nerea

2013-01-01

Este trabajo tiene como finalidad desarrollar una metodología que ayude a mejorar la adquisición de los conceptos que se estudian en el primer ciclo de Educación Primaria en el área de matemáticas, añadiendo una motivación al alumnado para que cuando se tenga que enfrentar a esta materia tenga una actitud positiva. Para conseguir esto he seleccionado una serie de juegos matemáticos enfocados a aprender de una manera diferente los contenidos que se tiene que trabajar en el citado primer ciclo....

Rust transformation/rust compatible primers

Science.gov (United States)

Emeric, Dario A.; Miller, Christopher E.

1993-01-01

Proper surface preparation has been the key to obtain good performance by a surface coating. The major obstacle in preparing a corroded or rusted surface is the complete removal of the contaminants and the corrosion products. Sandblasting has been traditionally used to remove the corrosion products before painting. However, sandblasting can be expensive, may be prohibited by local health regulations and is not applicable in every situation. To get around these obstacles, Industry developed rust converters/rust transformers and rust compatible primers (high solids epoxies). The potential use of these products for military equipment led personnel of the Belvoir Research, Development and Engineering Center (BRDEC) to evaluate the commercially available rust transformers and rust compatible primers. Prior laboratory experience with commercially available rust converters, as well as field studies in Hawaii and Puerto Rico, revealed poor performance, several inherent limitations, and lack of reliability. It was obvious from our studies that the performance of rust converting products was more dependent on the amount and type of rust present, as well as the degree of permeability of the coating, than on the product's ability to form an organometallic complex with the rust. Based on these results, it was decided that the Military should develop their own rust converter formulation and specification. The compound described in the specification is for use on a rusted surface before the application of an organic coating (bituminous compounds, primer or topcoat). These coatings should end the need for sandblasting or the removing of the adherent corrosion products. They also will prepare the surface for the application of the organic coating. Several commercially available rust compatible primers (RCP) were also tested using corroded surfaces. All of the evaluated RCP failed our laboratory tests for primers.

El Tratado de Versalles y el huevo de la serpiente

OpenAIRE

Cruset, María Eugenia

2009-01-01

Si algo enseña la historia es que no hay verdadero y pacífico desarrollo sin verdad, justicia y reparación. O, dicho en sentido negativo, nada hay más explosivo y destructivo para cualquier país que las arbitrariedades e inequidades. Este año se cumplen 90 años de uno de los episodios más gráficos de lo que estamos diciendo: el Tratado de Versalles, que firmado el 28 de junio de 1919 significó el fin de la Primer Guerra Mundial con la humillante derrota de Alemania. Flagrante situación de arb...

An iterative method for selecting degenerate multiplex PCR primers.

Science.gov (United States)

Souvenir, Richard; Buhler, Jeremy; Stormo, Gary; Zhang, Weixiong

2007-01-01

Single-nucleotide polymorphism (SNP) genotyping is an important molecular genetics process, which can produce results that will be useful in the medical field. Because of inherent complexities in DNA manipulation and analysis, many different methods have been proposed for a standard assay. One of the proposed techniques for performing SNP genotyping requires amplifying regions of DNA surrounding a large number of SNP loci. To automate a portion of this particular method, it is necessary to select a set of primers for the experiment. Selecting these primers can be formulated as the Multiple Degenerate Primer Design (MDPD) problem. The Multiple, Iterative Primer Selector (MIPS) is an iterative beam-search algorithm for MDPD. Theoretical and experimental analyses show that this algorithm performs well compared with the limits of degenerate primer design. Furthermore, MIPS outperforms an existing algorithm that was designed for a related degenerate primer selection problem.

Un acercamiento al deporte y al fútbol como negocio y al funcionamiento, problemática y mejora del fútbol peruano

OpenAIRE

García Vega, Emilio Humberto

2015-01-01

El presente artículo trata de aproximarse al deporte, más específicamente al fútbol, como negocio y acercarse a su realidad, funcionamiento y problemática en el Perú. En esta línea, en primer lugar, se desarrolla un marco teórico general que permite conocer cómo se presenta la transformación del deporte y del fútbol hacia un modelo de negocio rentable, conocer brevemente cómo se da la generación de valor de una institución deportiva; y además, se presentan los factores críticos del éxito de l...

A plastome primer set for comprehensive quantitative real time RT-PCR analysis of Zea mays: a starter primer set for other Poaceae species

Directory of Open Access Journals (Sweden)

Dunn Sade N

2008-06-01

Full Text Available Abstract Background Quantitative Real Time RT-PCR (q2(RTPCR is a maturing technique which gives researchers the ability to quantify and compare very small amounts of nucleic acids. Primer design and optimization is an essential yet time consuming aspect of using q2(RTPCR. In this paper we describe the design and empirical optimization of primers to amplify and quantify plastid RNAs from Zea mays that are robust enough to use with other closely related species. Results Primers were designed and successfully optimized for 57 of the 104 reported genes in the maize plastome plus two nuclear genes. All 59 primer pairs produced single amplicons after end-point reverse transcriptase polymerase chain reactions (RT-PCR as visualized on agarose gels and subsequently verified by q2(RTPCR. Primer pairs were divided into several categories based on the optimization requirements or the uniqueness of the target gene. An in silico test suggested the majority of the primer sets should work with other members of the Poaceae family. An in vitro test of the primer set on two unsequenced species (Panicum virgatum and Miscanthus sinensis supported this assumption by successfully producing single amplicons for each primer pair. Conclusion Due to the highly conserved chloroplast genome in plant families it is possible to utilize primer pairs designed against one genomic sequence to detect the presence and abundance of plastid genes or transcripts from genomes that have yet to be sequenced. Analysis of steady state transcription of vital system genes is a necessary requirement to comprehensively elucidate gene expression in any organism. The primer pairs reported in this paper were designed for q2(RTPCR of maize chloroplast genes but should be useful for other members of the Poaceae family. Both in silico and in vitro data are presented to support this assumption.

Bajo peso al nacer, crecimiento y desarrollo en el primer año de vida

Directory of Open Access Journals (Sweden)

Elia Rosa Lemus Lago

1997-04-01

Full Text Available Se efectuó un estudio descriptivo, longitudinal y retrospectivo en el área de salud del Policlínico Docente "19 de Abril" con los niños nacidos con peso inferior a los 2 500 g, en el año 1994, y se siguió su evolución clínica durante el primer año de vida, que correspondió a una muestra de 23 infantes. Los datos fueron recogidos de las historias clínicas individuales de los niños y de la embarazada. Se analizaron los parámetros peso, talla, circunsferencia cefálica, valoración nutricional y desarrollo psicomotor. Predominó el bajo peso para la edad gestacional con un 65,2 y el 34,7 % correspondió a los nacidos antes del término de la gestación. El 100 % de los pretérmino al año de vida tuvieron una valoración nutricional normal. No se comportaron de igual forma los de bajo peso para la edad gestacional en los que el 20 % quedaron por debajo del 3er. percentil.A descriptive, longitudinal and retrospective study was conducted at the health area of the "19 de Abril" Teaching Polyclinic. 23 infants who were born in 1994 with a birth weight < 2 500 g were included in the sample. Their clinical evolution was followed during the first year of life. The data were obtained from the individual medical histories of the children and of the pregnant women. The following parameters were analyzed: weight, size, cephalic perimeter, nutritional assessment and psychomotor development. Low weight prevailed for the gestational age with 65.2 %, whereas 34.7 % corresponded to preterm deliveries. 100 % of the preterm infants had a normal nutritional assessment after the first year of life. However, 20 % of those with low weight at the gestational age remained under the third percentile.

Caracterización de la composición en proteína, lípidos, energía y perfiles de ácidos grasos en huevos de tilapia roja (Oreochromis spp.

Directory of Open Access Journals (Sweden)

Rubén Darío Valbuena-Villarreal

2013-06-01

Full Text Available Luego de considerar el significado de las tilapias en el escenario piscícola nacional, la posibilidad de mejorar los índices de producción es un imperativo técnico y, dentro de estos, focalizar esfuerzos experimentales en la semilla resulta ser una opción estratégica. Con el fin de establecer un referente de base se utilizaron las puestas individuales de 50 hembras de tilapia roja (Oreochromis spp. para determinar los contenidos en los huevos de proteína (% MS, extracto etéreo (% MS, energía (cal g-1 y los perfiles de ácidos grasos (%, con algunas relaciones de interés analítico. Salvo ciertas variaciones menores, los valores encontrados se ajustan a los registros disponibles para la especie en diferentes estudios, lo que sugiere que las dietas ofrecidas a los reproductores experimentales contienen los mínimos necesarios para asegurar una provisión de nutrientes y energía suficientes para los embriones y las larvas en formación. Se analiza que, como punto de partida, esta serie de datos tiene utilidad para el desarrollo de trabajos destinados a mejorar los estándares de producción de alevinos, considerando que las variaciones en la composición, que pueden ser determinadas sobre los huevos, se pueden utilizar y tienen validez como un indicativo directo de su calidad.

Bioinformatic tools and guideline for PCR primer design | Abd ...

African Journals Online (AJOL)

Bioinformatics has become an essential tool not only for basic research but also for applied research in biotechnology and biomedical sciences. Optimal primer sequence and appropriate primer concentration are essential for maximal specificity and efficiency of PCR. A poorly designed primer can result in little or no ...

Estrategia de motivación para estudiantes de primer año de Medicina, Universidad San Sebastián, Concepción, Chile

Directory of Open Access Journals (Sweden)

P. Jorquera-Aguayo

Full Text Available Introducción. En el marco de un nuevo modelo educativo formativo, la Universidad San Sebastián apunta al desarrollo de estrategias pedagógicas que sitúan al estudiante en el centro de las acciones. Es así como surge la necesidad de incrementar la motivación en los jóvenes que ingresan a la carrera de medicina, profesión desde siempre ligada a los valores sociales y el altruismo. Este trabajo explora la relevancia del contacto temprano con el paciente y el hospital como fuentes de motivación en primer año. Sujetos y métodos. Todos los estudiantes de primer año de medicina (n = 115 fueron invitados a visitar voluntariamente un hospital. Allí, los estudiantes recorrieron el establecimiento y sostuvieron una conversación libre con un paciente. Las opiniones se recogieron a través de un escrito libre. Resultados. Se inscribieron 95 estudiantes, de los cuales 68 concurrieron a la visita. Al consultar sobre la vivencia con el paciente, los estudiantes se refirieron positivamente a ésta. La ansiedad al inicio de la conversación fue uno de los aspectos más mencionados, al igual que la importancia de conocer el futuro lugar de trabajo. Conclusiones. La experiencia evidenció un alto interés en participar. Asimismo reveló elementos de la vida afectiva de los estudiantes, pilar fundamental de la educación médica. Finalmente, se aconseja la temprana relación con el paciente y con el hospital como agentes motivacionales en primer año. Se sugiere incorporar tareas y complementar la evaluación con herramientas que permitan obtener información objetiva sobre los aprendizajes adquiridos.

Comparison of bond strengths of ceramic brackets bonded to zirconia surfaces using different zirconia primers and a universal adhesive.

Science.gov (United States)

Lee, Ji-Yeon; Ahn, Jaechan; An, Sang In; Park, Jeong-Won

2018-02-01

The aim of this study is to compare the shear bond strengths of ceramic brackets bonded to zirconia surfaces using different zirconia primers and universal adhesive. Fifty zirconia blocks (15 × 15 × 10 mm, Zpex, Tosoh Corporation) were polished with 1,000 grit sand paper and air-abraded with 50 µm Al 2 O 3 for 10 seconds (40 psi). They were divided into 5 groups: control (CO), Metal/Zirconia primer (MZ, Ivoclar Vivadent), Z-PRIME Plus (ZP, Bisco), Zirconia Liner (ZL, Sun Medical), and Scotchbond Universal adhesive (SU, 3M ESPE). Transbond XT Primer (used for CO, MZ, ZP, and ZL) and Transbond XT Paste was used for bracket bonding (Gemini clear ceramic brackets, 3M Unitek). After 24 hours at 37°C storage, specimens underwent 2,000 thermocycles, and then, shear bond strengths were measured (1 mm/min). An adhesive remnant index (ARI) score was calculated. The data were analyzed using one-way analysis of variance and the Bonferroni test ( p = 0.05). Surface treatment with primers resulted in increased shear bond strength. The SU group showed the highest shear bond strength followed by the ZP, ZL, MZ, and CO groups, in that order. The median ARI scores were as follows: CO = 0, MZ = 0, ZP = 0, ZL = 0, and SU = 3 ( p < 0.05). Within this experiment, zirconia primer can increase the shear bond strength of bracket bonding. The highest shear bond strength is observed in SU group, even when no primer is used.

Efecto del tipo de lactancia durante el primer año de vida sobre el estado de hierro y el desarrollo físico y psicológico del niño

OpenAIRE

Bedmar Carretero, Cristina

2012-01-01

L’objectiu d’aquest estudi va ser valorar el desenvolupament del nen durant el primer any de vida en funció del tipus de lactància realitzada durant el primer semestre y de la dosis de ferro administrada durant el segon semestre. Hem observat que el 75,5% dels nens realitzen lactància materna exclusiva al néixer y el 16,5% la mantenen fins als 6 mesos. El 39,5% tenen alguna mutació en el gen HFE. La prevalença de dèficit de ferro y anèmia ferropènica es del 4,5% y 2,5% als 6 mesos y del 9,2% ...

Medium Caliber Lead-Free Electric Primer. Version 2

Science.gov (United States)

2012-09-01

2008). Safe Drinking Water Act of 1986 lists lead compounds as carcinogens (27 CCR 27001 – Dec. 2008). EPA began a Phase I assessment to determine...primer cups was our standard method, wet loading using solvents (hexane and iso -propanol) was investigated to reduce risk of accidental ignition...LOADING OPERATION (Single Die) Wet primer mix charge with solvent (Hexane/ Iso -Propanol) and stir to mix to a uniform slurry Insert primer cup in

Evaluación in vitro de hongos nematófagos en zonas arroceras de Costa Rica contra el nematodo agallador Meloidogyne javanica

Directory of Open Access Journals (Sweden)

Walter Peraza Padilla

2014-12-01

Full Text Available Se evaluó el parasitismo in vitro de 14 aislamientos de hongos nematófagos (6 Trichoderma sp., 4 Paecilomyces sp., 2 Fusarium oxysporum, y 2 Monacrosporium sp. contra juveniles y huevos del nematodo agallador Meloidogyne javanica. Los hongos, de 3 regiones productoras de arroz en Costa Rica, (Pacífico Central, Huetar Atlántica y Chorotega, se aislaron mediante el método de espolvoreado en placas, durante abril del 2008 a agosto de 2009. Se utilizó un diseño completamente al azar con 10 repeticiones por hongo, en agar-agua (AA. Se inoculó una suspensión de 1 a 1,5x10 6 conidios (ufc.ml -1 por plato Petri, y al cuarto día se depositó en 0,5 ml una suspensión de 150 juveniles y 100 huevos de M. javanica previamente desinfectados, a temperatura ambiente (23-26°C y con luz natural. Transcurridas 96 h se contó en cada plato el número de nematodos vivos, muertos ó parasi- tados y de huevos parasitados o no parasitados. Se realizó un análisis de regresión logística (RL para las variables evaluadas, el cual mostró diferencias significativas (p<0,0001 en el desempeño de los hongos evaluados, presentando rangos de entre 10% a 56% en nematodos muertos, de 13% a 79% en nematodos parasitados y de 1% a 96% en huevos parasitados. En general, los hongos del género Trichoderma (Tri1, Tri2, Tri3 y Tri4 fueron los más eficientes en el parasitismo sobre juveniles y huevos de M. javanica.

EFECTO DE UN COMPLEJO DE VITAMINAS Y AMINOÁCIDOS EN EL COMPORTAMIENTO PRODUCTIVO DE GALLINAS PONEDORAS

Directory of Open Access Journals (Sweden)

MÓNICA MARÍA ESTRADA P.

Full Text Available Los sistemas intensivos de producción de huevo comercial pueden conllevar a las aves a un estado de inmunodepresión, esto puede ser mitigado con el suministro de nutrientes que activen los mecanismos fisiológicos del animal. Este trabajo evaluó el efecto de un complejo de vitaminas y aminoácidos en el desempeño productivo de gallinas ponedoras. Un lote de 20395 gallinas de la línea Lohmann LSL, se dividió en dos grupos, el primer grupo recibió el tratamiento de vitaminas y aminoácidos (T2, el segundo grupo se estableció como el control (T1. Se empleó la estadística de T2 de Hotelling, se utilizó el método de Spearman para la determinación de la relación entre variables donde el análisis se suplementó por medio de la técnica descriptiva unidireccional. Para las variables productivas consumo de alimento, porcentaje de producción de huevos, huevo ave alojada, viabilidad y conversión alimenticia se encontró diferencias estadísticas altamente significativas (p<0,0001 en el efecto promedio de los grupos tomando en forma simultánea todas las variables respuesta. El grupo (T2 presentó mejor desempeño productivo.

Simple sequence repeat marker loci discovery using SSR primer.

Science.gov (United States)

Robinson, Andrew J; Love, Christopher G; Batley, Jacqueline; Barker, Gary; Edwards, David

2004-06-12

Simple sequence repeats (SSRs) have become important molecular markers for a broad range of applications, such as genome mapping and characterization, phenotype mapping, marker assisted selection of crop plants and a range of molecular ecology and diversity studies. With the increase in the availability of DNA sequence information, an automated process to identify and design PCR primers for amplification of SSR loci would be a useful tool in plant breeding programs. We report an application that integrates SPUTNIK, an SSR repeat finder, with Primer3, a PCR primer design program, into one pipeline tool, SSR Primer. On submission of multiple FASTA formatted sequences, the script screens each sequence for SSRs using SPUTNIK. The results are parsed to Primer3 for locus-specific primer design. The script makes use of a Web-based interface, enabling remote use. This program has been written in PERL and is freely available for non-commercial users by request from the authors. The Web-based version may be accessed at http://hornbill.cspp.latrobe.edu.au/

Value for money assessment for public-private partnerships : a primer.

Science.gov (United States)

2015-01-01

This primer addresses Value for Money Assessment for public-private partnerships (P3s). Companion : primers on Financial Assessment and Risk Assessment for P3s are also available as part of this series of : primers.

Las preguntas de los alumnos, análisis de su aportación al aprendizaje de las ciencias

OpenAIRE

Roca Tort, M.

2009-01-01

La importancia de las preguntas, en la construcción de las ideas científicas y en el proceso comunicativo que favorece su construcción, ha planteado la necesidad de buscar las características que permiten distinguir las preguntas que favorecen este proceso. Se parte de los resultados encontrados al analizar las preguntas planteadas por los alumnos de primer ciclo de ESO al realizar la unidad didáctica sobre el ciclo del agua. En primer lugar se analizó el contenido y la demanda de cada una de...

Economics : pricing, demand, and economic efficiency : a primer.

Science.gov (United States)

2008-11-01

The Congestion Pricing Primer Series is part of : FHWAs outreach efforts to introduce the various : aspects of congestion pricing to decision-makers and : transportation professionals in the United States. The : primers are intended to lay out the...

Semantic Web Primer

NARCIS (Netherlands)

Antoniou, Grigoris; Harmelen, Frank van

2004-01-01

The development of the Semantic Web, with machine-readable content, has the potential to revolutionize the World Wide Web and its use. A Semantic Web Primer provides an introduction and guide to this still emerging field, describing its key ideas, languages, and technologies. Suitable for use as a

Crecimiento longitudinal posnatal del primer metatarsiano. [Longitudinal postnatal growth of the first metatarsal bone

Directory of Open Access Journals (Sweden)

Julio J. Masquijo

2014-10-01

Full Text Available Introducción: si bien el crecimiento prenatal y posnatal del pie ha sido documentado hace varios años, el crecimiento longitudinal del primer metatarsiano en particular no ha sido estudiado previamente. El objetivo del estudio es determinar el patrón de crecimiento longitudinal posnatal de este hueso y compararlo con el del pie y los huesos largos del miembro inferior. Materiales y Métodos: mediante una búsqueda informatizada, se identificaron pacientes <18 años de edad con radiografías informadas como “normal” por el radiólogo. Se analizó una muestra de 886 pacientes divididos en 18 grupos según la edad (0-11 meses, 1 año, 2 años, etc. y el sexo. El análisis de las imágenes se realizó con un software de imágenes Kodak Carestream PACS. Resultados: el largo promedio en el primer grupo fue de 19,91 mm (3,20; 15,22-25,62. El largo promedio en el último grupo fue de 66,13 mm (5,33; 52,50-77,18. La tasa de crecimiento anual fue de 2,71 mm. La edad promedio al momento del cierre de la fisis fue de 14.85 años (± 1.64 para los varones y 14.77 años (± 3.63 para las niñas. Conclusión: el crecimiento del primer metatarsiano acompaña el crecimiento longitudinal del pie, pero no el de los huesos largos del miembro inferior. Las curvas de crecimiento del primer metatarsiano descritas en este artículo pueden ser aplicadas en patologías que afectan el desarrollo del pie o que requieren cirugía de corrección sobre el primer metatarsiano, o se las puede emplear como estándar de referencia en futuros estudios.

Testing of Flame Sprayed Al2O3 Matrix Coatings Containing TiO2

Directory of Open Access Journals (Sweden)

Czupryński A.

2016-09-01

Full Text Available The paper presents the results of the properties of flame sprayed ceramic coatings using oxide ceramic materials coating of a powdered aluminium oxide (Al2O3 matrix with 3% titanium oxide (TiO2 applied to unalloyed S235JR grade structural steel. A primer consisting of a metallic Ni-Al-Mo based powder has been applied to plates with dimensions of 5×200×300 mm and front surfaces of Ø40×50 mm cylinders. Flame spraying of primer coating was made using a RotoTec 80 torch, and an external coating was made with a CastoDyn DS 8000 torch. Evaluation of the coating properties was conducted using metallographic testing, phase composition research, measurement of microhardness, substrate coating adhesion (acc. to EN 582:1996 standard, erosion wear resistance (acc. to ASTM G76-95 standard, and abrasive wear resistance (acc. to ASTM G65 standard and thermal impact. The testing performed has demonstrated that flame spraying with 97% Al2O3 powder containing 3% TiO2 performed in a range of parameters allows for obtaining high-quality ceramic coatings with thickness up to ca. 500 µm on a steel base. Spray coating possesses a structure consisting mainly of aluminium oxide and a small amount of NiAl10O16 and NiAl32O49 phases. The bonding primer coat sprayed with the Ni-Al-Mo powder to the steel substrate and external coating sprayed with the 97% Al2O3 powder with 3% TiO2 addition demonstrates mechanical bonding characteristics. The coating is characterized by a high adhesion to the base amounting to 6.5 MPa. Average hardness of the external coating is ca. 780 HV. The obtained coatings are characterized by high erosion and abrasive wear resistance and the resistance to effects of cyclic thermal shock.

Coal Bed Methane Primer

Energy Technology Data Exchange (ETDEWEB)

Dan Arthur; Bruce Langhus; Jon Seekins

2005-05-25

During the second half of the 1990's Coal Bed Methane (CBM) production increased dramatically nationwide to represent a significant new source of income and natural gas for many independent and established producers. Matching these soaring production rates during this period was a heightened public awareness of environmental concerns. These concerns left unexplained and under-addressed have created a significant growth in public involvement generating literally thousands of unfocused project comments for various regional NEPA efforts resulting in the delayed development of public and fee lands. The accelerating interest in CBM development coupled to the growth in public involvement has prompted the conceptualization of this project for the development of a CBM Primer. The Primer is designed to serve as a summary document, which introduces and encapsulates information pertinent to the development of Coal Bed Methane (CBM), including focused discussions of coal deposits, methane as a natural formed gas, split mineral estates, development techniques, operational issues, producing methods, applicable regulatory frameworks, land and resource management, mitigation measures, preparation of project plans, data availability, Indian Trust issues and relevant environmental technologies. An important aspect of gaining access to federal, state, tribal, or fee lands involves education of a broad array of stakeholders, including land and mineral owners, regulators, conservationists, tribal governments, special interest groups, and numerous others that could be impacted by the development of coal bed methane. Perhaps the most crucial aspect of successfully developing CBM resources is stakeholder education. Currently, an inconsistent picture of CBM exists. There is a significant lack of understanding on the parts of nearly all stakeholders, including industry, government, special interest groups, and land owners. It is envisioned the Primer would being used by a variety of

Quick spacecraft charging primer

International Nuclear Information System (INIS)

Larsen, Brian Arthur

2014-01-01

This is a presentation in PDF format which is a quick spacecraft charging primer, meant to be used for program training. It goes into detail about charging physics, RBSP examples, and how to identify charging.

Primer design for a prokaryotic differential display RT-PCR.

Science.gov (United States)

Fislage, R; Berceanu, M; Humboldt, Y; Wendt, M; Oberender, H

1997-05-01

We have developed a primer set for a prokaryotic differential display of mRNA in the Enterobacteriaceae group. Each combination of ten 10mer and ten 11mer primers generates up to 85 bands from total Escherichia coli RNA, thus covering expressed sequences of a complete bacterial genome. Due to the lack of polyadenylation in prokaryotic RNA the type T11VN anchored oligonucleotides for the reverse transcriptase reaction had to be replaced with respect to the original method described by Liang and Pardee [ Science , 257, 967-971 (1992)]. Therefore, the sequences of both the 10mer and the new 11mer oligonucleotides were determined by a statistical evaluation of species-specific coding regions extracted from the EMBL database. The 11mer primers used for reverse transcription were selected for localization in the 3'-region of the bacterial RNA. The 10mer primers preferentially bind to the 5'-end of the RNA. None of the primers show homology to rRNA or other abundant small RNA species. Randomly sampled cDNA bands were checked for their bacterial origin either by re-amplification, cloning and sequencing or by re-amplification and direct sequencing with 10mer and 11mer primers after asymmetric PCR.

Climate Change, Health, and Communication: A Primer.

Science.gov (United States)

Chadwick, Amy E

2016-01-01

Climate change is one of the most serious and pervasive challenges facing us today. Our changing climate has implications not only for the ecosystems upon which we depend, but also for human health. Health communication scholars are well-positioned to aid in the mitigation of and response to climate change and its health effects. To help theorists, researchers, and practitioners engage in these efforts, this primer explains relevant issues and vocabulary associated with climate change and its impacts on health. First, this primer provides an overview of climate change, its causes and consequences, and its impacts on health. Then, the primer describes ways to decrease impacts and identifies roles for health communication scholars in efforts to address climate change and its health effects.

Marketing Information Products and Services : A Primer for ...

International Development Research Centre (IDRC) Digital Library (Canada)

Marketing Information Products and Services : A Primer for Librarians and Information Professionals. Couverture du livre Marketing Information Products and Services : A Primer for Librarians and Information Professionals. Directeur(s) : Abhinandan K. Jain, Ashok Jambhekar, T.P.Rama Rao et S. Sreenivas Rao. Maison(s) ...

Desarrollo embrionario y larva del sapo Incilius aucoinae (Bufonidae en Golfito, Costa Rica

Directory of Open Access Journals (Sweden)

Susy Segura-Solís

2009-11-01

Full Text Available Se describe la larva y los estadios del desarrollo del huevo y larva de Incilius aucoinae utilizando especímenes del río Cañaza, Golfito, Costa Rica, recolectados en enero de 1997 y enero-febrero de 1998. La muestra fue de 696 individuos, 317 huevos en estadios 1-12, 176 huevos con embriones en estadios 15-16, y 204 renacuajos en estadios 21-43. El promedio del número de huevos por nidada fue de 8 940 (n = 4, los cuales fueron colocados en una hilera, sujetos al sustrato del río. Los huevos en estadios 1-12 tienen un promedio de diámetro de 1.75 (s = 0.38 mm y los huevos con embriones en estadios 15-16 miden 1.33 (0.34 de ancho y 3.06 (1.46 mm de largo. La descripción del renacuajo basada en el espécimen UCR 19982, es como sigue: el dorso, el vientre y la cola son de color café y punteado de café oscuro; la cola mide 9.43 mm y el cuerpo 6.18, para un tamaño total de 15.62; las aletas son pequeñas café claro translúcidas, la dorsal con puntos dispersos y la ventral sin ningún tipo de pigmento oscuro. También es el único renacuajo ovoide con una tendencia a ser aplastado dorso-ventralmente, y con la boca antero-ventral. Dentro de la variación observada, algunos individuos son de color negro (3.4 % y pocos son uniformes (0.5- 1.5 %.

Antonio Roalas. Un pintor del primer tercio del siglo XVII en Madrid

Directory of Open Access Journals (Sweden)

Rodríguez Rebollo, Ángel

2004-03-01

Full Text Available El conocimiento que actualmente se tiene sobre los pintores del barroco madrileño ha avanzado mucho desde que Ángulo y Pérez Sánchez publicaran los dos volúmenes dedicados al primer y segundo tercio del siglo XVII. Posteriormente han ido viendo la luz estudios más pormenorizados, a veces en forma de exposiciones, que han clarificado aún más la importancia de los artistas que trabajaron en torno a la Corte de los llamados «los Austrias menores»; sin embargo, existen aún hoy un buen número de pintores sólo conocidos a través de contratos o inventarios de la época. La absoluta desinformación que tenemos de ellos, acrecentada por la inexistencia de obras firmadas, no permite a los historiadores dedicarles al menos un estudio parcial de su arte…

An environmentally acceptable primer for galvanized steel: Formulation and evaluation by SVET

Energy Technology Data Exchange (ETDEWEB)

Simoes, A.M.P., E-mail: alda.simoes@ist.utl.p [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal); Carbonari, R.O.; Di Sarli, A.R.; Amo, B. del [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal); Romagnoli, R., E-mail: estelectro@cidepint.gov.a [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal)

2011-01-15

Research highlights: {yields} Chromates can be replaced successfully by aluminium phosphosilicate in paint systems. {yields} The solvents of the primer are eco-friendly ones. {yields} The primer adheres on galvanized steel and allows top-coating. {yields} The binder of the primer is compatible with other binders for top-coating. - Abstract: The object of this paper was to formulate a two-pack wash primer employing aluminium phosphosilicate as active anticorrosive pigment instead of basic zinc chromate. The anticorrosive action of the primer was evaluated by the polarization technique and the scanning vibrating electrode technique (SVET). The exposed surface was then examined by scanning electron microscopy (SEM) and the surface composition determined by energy dispersive X-ray (EDX) analysis. The primer was finally integrated in a complete paint scheme whose anticorrosive performance was evaluated by the salt spray chamber and electrochemical impedance spectroscopy. The adhesion of the primer plus a painting system was also evaluated by standard ASTM D 3359-90 test method. The wash primer pigmented with zinc chromate was used as reference. Results indicated that basic zinc chromate could be replaced by the more eco-friendly wash-primer containing aluminium phosphosilicate.

Microsatellite primers for fungus-growing ants

DEFF Research Database (Denmark)

Villesen, Palle; Gertsch, P J; Boomsma, JJ

2002-01-01

We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...... developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants....

Microsatellite Primers for Fungus-Growing Ants

DEFF Research Database (Denmark)

Villesen Fredsted, Palle; Gertsch, Pia J.; Boomsma, Jacobus Jan (Koos)

2002-01-01

We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...... developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants....

A physicists guide to The Los Alamos Primer

International Nuclear Information System (INIS)

Reed, B Cameron

2016-01-01

In April 1943, a group of scientists at the newly established Los Alamos Laboratory were given a series of lectures by Robert Serber on what was then known of the physics and engineering issues involved in developing fission bombs. Serber’s lectures were recorded in a 24 page report titled The Los Alamos Primer , which was subsequently declassified and published in book form. This paper describes the background to the Primer and analyzes the physics contained in its 22 sections. The motivation for this paper is to provide a firm foundation of the background and contents of the Primer for physicists interested in the Manhattan Project and nuclear weapons. (invited comment)

Aportes para una vida saludable. Proceso socioeducativo con estudiantes de primer ingreso, Universidad Nacional

OpenAIRE

Gonzalez-Soto, L.; Orozco-Morales, A.R.

2017-01-01

Propósito: Exponer la experiencia de medir en algún grado el impacto social de un proceso socioeducativo anual, desarrollado con 800 estudiantes de primer ingreso provenientes de diversos lugares del país, con limitadas condiciones socioeconómica y quienes son beneficiarios de beca para sus estudios. El proceso consistió en establecer 4 o 5 eventos anuales y trabajar con metodologías lúdicas temas alusivos a estilos de vida saludables. Material y método: Se aplicó la técnica de grupo focal al...

Bolívar, primer diplomático de la libertad americana

Directory of Open Access Journals (Sweden)

Rafael Gómez Hoyos

1969-03-01

Full Text Available Don Miguel Luis Amunátegui, primer biógrafo de don Andrés Bello, recopilador y comentarista meritorio de sus obras, nos dejó una falsa visión de Bolívar como diplomático de la libertad. Basado en los recuerdos del anciano humanista, cuando ya le flaqueaba la memoria, o gracias a un error suyo de apreciación, al comentar los incidentes de la misión encomendada ante el gobierno británico por la Junta Suprema de Caracas, nos relata increíble falta de tacto y descuido imperdonable en Simón Bolívar, Jefe de la Misión.

Percepción de los estudiantes de enfermería en cuanto al comportamiento de fumar en México

OpenAIRE

Francisco Cruz Vazquez; Sandra Cristina Pillon; Maria Teresa Cuamatzi

2004-01-01

El estudio tiene como objetivo evaluar el comportamiento de fumar y la percepción de los factores que influeyen en ese comportamiento, entre estudiantes del primer año de Licenciatura en enfermería. Fueron entrevistado 36 alumnos del primer año de graduación en enfermería. Siendo 18 (50%) fumadores, con edad media de 23,5 años; 75% del sexo femenino en cuanto al patron de consumo estos fuman de 2 a 6 cigarrillos al dia, empezaron a fumar en media con 15 años. En cuanto a la per...

RUCS: Rapid identification of PCR primers for unique core sequences

DEFF Research Database (Denmark)

Thomsen, Martin Christen Frølund; Hasman, Henrik; Westh, Henrik

2017-01-01

Designing PCR primers to target a specific selection of whole genome sequenced strains can be a long, arduous, and sometimes impractical task. Such tasks would benefit greatly from an automated tool to both identify unique targets, and to validate the vast number of potential primer pairs...... for the targets in silico . Here we present RUCS, a program that will find PCR primer pairs and probes for the unique core sequences of a positive genome dataset complement to a negative genome dataset. The resulting primer pairs and probes are in addition to simple selection also validated through a complex...... in silico PCR simulation. We compared our method, which identifies the unique core sequences, against an existing tool called ssGeneFinder, and found that our method was 6.5-20 times more sensitive. We used RUCS to design primer pairs that would target a set of genomes known to contain the mcr-1 colistin...

Do we need primer for orthodontic bonding? A randomized controlled trial.

Science.gov (United States)

Nandhra, Sarabjit Singh; Littlewood, Simon J; Houghton, Nadine; Luther, Friedy; Prabhu, Jagadish; Munyombwe, Theresa; Wood, Simon R

2015-04-01

To evaluate the clinical performance of APC™II Victory Series™ (3M Unitek) brackets in direct orthodontic bonding with and without the use of primer. A single-operator, two-centre prospective, non-inferiority randomized controlled clinical trial. The Orthodontic departments at the Leeds Dental Institute and St Luke's Hospital, Bradford, UK. Ethical approval was granted by Leeds (East) Research Ethics Committee on 18th of December 2009 (Reference 09/H1306/102). The protocol was not published prior to trial commencement. Ninety-two patients requiring orthodontic treatment with fixed appliances were randomly allocated to the control (bonded with primer) or test groups (bonded without primer). Patients were randomly allocated to either the control or experimental group. This was performed by preparing opaque numbered sealed envelopes in advance using a random numbers table generated by a computer by an independent third party . Once the envelopes were opened, blinding of the operator and the patient was no longer possible due to the nature of the intervention. Patients were approached for inclusion in the trial if they qualified for NHS orthodontic treatment requiring fixed appliances and had no previous orthodontic treatment. Number of bracket failures, time to bond-up appliances, and the adhesive remnant index (ARI) when bracket failure occurred, over a 12-month period Failure rate with primer was 11.1 per cent and without primer was 15.8 per cent. Bonding without primer was shown statistically to be non-inferior to bonding with primer odds ratio 0.95-2.25 (P = 0.08). Mean difference in bond-up time per bracket was 0.068 minutes (4 seconds), which was not statistically significant (P = 0.402). There was a statistically significant difference in the Adhesive Remnant Index - ARI 0 with primer 49.4 per cent, no primer 76.5 per cent, (P failure rate of 2% to be clinically significant. When bonding with APC™II Victory Series™ brackets without primer was shown

Primer on consumer marketing research : procedures, methods, and tools

Science.gov (United States)

1994-03-01

The Volpe Center developed a marketing research primer which provides a guide to the approach, procedures, and research tools used by private industry in predicting consumer response. The final two chapters of the primer focus on the challenges of do...

Optimization of ISSR-PCR reaction system and selection of primers in Bryum argenteum

Directory of Open Access Journals (Sweden)

Ma Xiaoying

2017-02-01

Full Text Available In order to determine optimum ISSR-PCR reaction system for moss Bryum argenteum,the concentrations of template DNA primers,dNTPs,Mg2+ and Taq DNA polymerase were optimized in four levels by PCR orthogonal experimental method. The appropriate primers were screened from 100 primers by temperature gradient PCR,and the optimal anneal temperature of the screened primers were determined. The results showed that the optimized 20 μL ISSR-PCR reaction system was as follows:template DNA 20 ng/20 μL,primers 0.45 μmol/L,Mg2+2.65 mmol/L,Taq DNA polymerase 0.4 U/20 μL,dNTPs 0.45 mmol/L. Using this system,50 primers with clear bands,repeatability well and polymorphism highly were selected from 100 primers. The establishment of this system,the screened primers and the annealing temperature could provide a theoretical basis for further research on the genetic diversity of bryophytes using ISSR molecular markers.

Disclosing bias in bisulfite assay: MethPrimers underestimate high DNA methylation.

Directory of Open Access Journals (Sweden)

Andrea Fuso

Full Text Available Discordant results obtained in bisulfite assays using MethPrimers (PCR primers designed using MethPrimer software or assuming that non-CpGs cytosines are non methylated versus primers insensitive to cytosine methylation lead us to hypothesize a technical bias. We therefore used the two kinds of primers to study different experimental models and methylation statuses. We demonstrated that MethPrimers negatively select hypermethylated DNA sequences in the PCR step of the bisulfite assay, resulting in CpG methylation underestimation and non-CpG methylation masking, failing to evidence differential methylation statuses. We also describe the characteristics of "Methylation-Insensitive Primers" (MIPs, having degenerated bases (G/A to cope with the uncertain C/U conversion. As CpG and non-CpG DNA methylation patterns are largely variable depending on the species, developmental stage, tissue and cell type, a variable extent of the bias is expected. The more the methylome is methylated, the greater is the extent of the bias, with a prevalent effect of non-CpG methylation. These findings suggest a revision of several DNA methylation patterns so far documented and also point out the necessity of applying unbiased analyses to the increasing number of epigenomic studies.

Criticality calculations with MCNP trademark: A primer

International Nuclear Information System (INIS)

Harmon, C.D. II; Busch, R.D.; Briesmeister, J.F.; Forster, R.A.

1994-01-01

With the closure of many experimental facilities, the nuclear criticality safety analyst increasingly is required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his/her facility. This primer will help you, the analyst, understand and use the MCNP Monte Carlo code for nuclear criticality safety analyses. It assumes that you have a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with MCNP in particular. Appendix A gives an introduction to Monte Carlo techniques. The primer is designed to teach by example, with each example illustrating two or three features of MCNP that are useful in criticality analyses. Beginning with a Quickstart chapter, the primer gives an overview of the basic requirements for MCNP input and allows you to run a simple criticality problem with MCNP. This chapter is not designed to explain either the input or the MCNP options in detail; but rather it introduces basic concepts that are further explained in following chapters. Each chapter begins with a list of basic objectives that identify the goal of the chapter, and a list of the individual MCNP features that are covered in detail in the unique chapter example problems. It is expected that on completion of the primer you will be comfortable using MCNP in criticality calculations and will be capable of handling 80 to 90 percent of the situations that normally arise in a facility. The primer provides a set of basic input files that you can selectively modify to fit the particular problem at hand

Quantitative Experimental Determination of Primer-Dimer Formation Risk by Free-Solution Conjugate Electrophoresis

Science.gov (United States)

Desmarais, Samantha M.; Leitner, Thomas; Barron, Annelise E.

2012-01-01

DNA barcodes are short, unique ssDNA primers that “mark” individual biomolecules. To gain better understanding of biophysical parameters constraining primer-dimer formation between primers that incorporate barcode sequences, we have developed a capillary electrophoresis method that utilizes drag-tag-DNA conjugates to quantify dimerization risk between primer-barcode pairs. Results obtained with this unique free-solution conjugate electrophoresis (FSCE) approach are useful as quantitatively precise input data to parameterize computation models of dimerization risk. A set of fluorescently labeled, model primer-barcode conjugates were designed with complementary regions of differing lengths to quantify heterodimerization as a function of temperature. Primer-dimer cases comprised two 30-mer primers, one of which was covalently conjugated to a lab-made, chemically synthesized poly-N-methoxyethylglycine drag-tag, which reduced electrophoretic mobility of ssDNA to distinguish it from ds primer-dimers. The drag-tags also provided a shift in mobility for the dsDNA species, which allowed us to quantitate primer-dimer formation. In the experimental studies, pairs of oligonucleotide primer-barcodes with fully or partially complementary sequences were annealed, and then separated by free-solution conjugate CE at different temperatures, to assess effects on primer-dimer formation. When less than 30 out of 30 basepairs were bonded, dimerization was inversely correlated to temperature. Dimerization occurred when more than 15 consecutive basepairs formed, yet non-consecutive basepairs did not create stable dimers even when 20 out of 30 possible basepairs bonded. The use of free-solution electrophoresis in combination with a peptoid drag-tag and different fluorophores enabled precise separation of short DNA fragments to establish a new mobility shift assay for detection of primer-dimer formation. PMID:22331820

Ciclo de vida y aspectos poblacionales de Edessa aff. aulacosterna Stal, 1872 (Heteroptera: Pentatomidae chinche del fruto del camu camu (Myrtaceae en zona de restinga, Ucayali, Perú Life cycle and population aspects of camu camu fruit stink bug Edessa aff. aulacosterna Stal, 1872 (Heteroptera: Pentatomidae in restinga zone, Ucayali, Peru

Directory of Open Access Journals (Sweden)

José Iannacone

2007-01-01

Full Text Available El camu camu es uno de los frutales nativos con gran potencial económico para la agroindustria y agro exportación. Edessa es una de las plagas del camu camu que provoca sequedad en los brotes, y en los frutos una mancha decolorada con círculos concéntricos bien marcados y un punto central al alimentarse. El objetivo del presente trabajo fue determinar el ciclo biológico bajo condiciones de laboratorio y la fluctuación poblacional de Edessa aff. aulacosterna "Chinche del fruto del camu camu" durante enero a noviembre del 2004 en el cultivo de camu camu, en parcelas en desarrollo y producción ubicadas en áreas de restinga inundables en Pucallpa, Ucayali, Perú. Se colectaron huevos, ninfas y adultos procedentes del distrito de Yarinacocha, Pucallpa, Ucayali, Perú para iniciar la crianza artificial. El tiempo de duración del huevo al I estadio ninfal fue 5,1 días. Se encontró un 94,6% de eclosión de los huevos, variando entre 12 hasta 14 huevos por postura. El tiempo transcurrido desde el huevo hasta II estadío fue de 37,3 días y del III al V estadío ninfal fue de 81,9 días. El porcentaje de mortalidad del primer estadio ninfal a adulto fue de 98,1%. Los adultos colectados se localizaron preferentemente sobre las ramas y el tallo de la planta, mientras que las ninfas se encontraron en los brotes tiernos. Con relación a su fluctuación poblacional, solo se registró posturas a lo largo del año en parcelas en producción. No se encontraron diferencias entre ninfas I a V, y adultos de Edessa aff. aulacosterna, entre plantaciones en producción y desarrollo de camu camu. Solo se encontró diferencias entre la época seca y lluviosa en las ninfas de III a V estadio en las plantas de camu camu en desarrollo. Edessa aff. aulacosterna presentó mayormente una distribución contagiosa. El adecuado conocimiento de la bioecología nos permite mejorar la estrategia de control de esta plaga.Camu camu is one of the native fruits with a great

UniPrime2: a web service providing easier Universal Primer design.

Science.gov (United States)

Boutros, Robin; Stokes, Nicola; Bekaert, Michaël; Teeling, Emma C

2009-07-01

The UniPrime2 web server is a publicly available online resource which automatically designs large sets of universal primers when given a gene reference ID or Fasta sequence input by a user. UniPrime2 works by automatically retrieving and aligning homologous sequences from GenBank, identifying regions of conservation within the alignment, and generating suitable primers that can be used to amplify variable genomic regions. In essence, UniPrime2 is a suite of publicly available software packages (Blastn, T-Coffee, GramAlign, Primer3), which reduces the laborious process of primer design, by integrating these programs into a single software pipeline. Hence, UniPrime2 differs from previous primer design web services in that all steps are automated, linked, saved and phylogenetically delimited, only requiring a single user-defined gene reference ID or input sequence. We provide an overview of the web service and wet-laboratory validation of the primers generated. The system is freely accessible at: http://uniprime.batlab.eu. UniPrime2 is licenced under a Creative Commons Attribution Noncommercial-Share Alike 3.0 Licence.

Optimal pcr primers for rapid and accurate detection of Aspergillus flavus isolates.

Science.gov (United States)

Al-Shuhaib, Mohammed Baqur S; Albakri, Ali H; Alwan, Sabah H; Almandil, Noor B; AbdulAzeez, Sayed; Borgio, J Francis

2018-03-01

Aspergillus flavus is among the most devastating opportunistic pathogens of several food crops including rice, due to its high production of carcinogenic aflatoxins. The presence of these organisms in economically important rice strip farming is a serious food safety concern. Several polymerase chain reaction (PCR) primers have been designed to detect this species; however, a comparative assessment of their accuracy has not been conducted. This study aims to identify the optimal diagnostic PCR primers for the identification of A. flavus, among widely available primers. We isolated 122 A. flavus native isolates from randomly collected rice strips (N = 300). We identified 109 isolates to the genus level using universal fungal PCR primer pairs. Nine pairs of primers were examined for their PCR diagnostic specificity on the 109 isolates. FLA PCR was found to be the optimal PCR primer pair for specific identification of the native isolates, over aflP(1), aflM, aflA, aflD, aflP(3), aflP(2), and aflR. The PEP primer pair was found to be the most unsuitable for A. flavus identification. In conclusion, the present study indicates the powerful specificity of the FLA PCR primer over other commonly available diagnostic primers for accurate, rapid, and large-scale identification of A. flavus native isolates. This study provides the first simple, practical comparative guide to PCR-based screening of A. flavus infection in rice strips. Copyright © 2018 Elsevier Ltd. All rights reserved.

Intervención de los EOE especializados en atención temprana. Elaboración de una guía para profesionales que atienden al alumnado TEA en el primer ciclo de educación infantil

OpenAIRE

Rodríguez Somodevilla, Sonia

2013-01-01

Desde el curso escolar 2009-10 la Consejería de Educación de la Junta de Andalucía asumió las competencias educativas en el primer ciclo de Educación Infantil lo que llevó al EOEE en Atención Temprana de Málaga a plantearse la necesidad de elaborar una guía para proporcionar a todos los profesionales que atienden a los niños y niñas con Trastorno del Espectro Autista dentro de las Escuelas Infantiles, una información básica sobre qué es el Trastorno, la detección con las señales ...

Contribución al Estudio de las Moscas Anastrephas en Colombia.

Directory of Open Access Journals (Sweden)

González Mendoza Rafael

1952-11-01

como oriunda del Brasil, es decir una especie enteramente tropical. 8. Dentro de los dípteros, las moscas del género Anastrepha se pueden clasificar como suborden Cyclorrapha, serie Schyzophora, sección Myodaria, subsección Acalyptratae, familia Trypetidae. 9. Las moscas Anastrephas cumplen su ciclo biológico al través de 4 estados metamorfósicos que ocurren así: imago en el ambiente aéreo, huevo y larva en la fruta y pupa en el suelo. En cada uno de los estados metamorfósicos, el insecto exhibe las características comunes de los dípteros. 10. Los huevos miden l , mm.; son de forma ovalada y ápices un tanto agudos, de color blancuzco ligeramente cremoso. La incubación demora de 4 a 7 días; el número de huevos por postura es de 3 y hasta l. La incubación de los huevos y la vida de la larva recién nacida son afectados por temperatura, humedad y determinados factores resultantes de la condición de madurez de la fruta. 11. Las larvas son vermiformes, puntiagudas en la cabeza, de color amarillo crema claro en tonalidades diversas hasta blanquecino o cremoso. No poseen patas; no tienen ojos ni antenas. Su tamaño y la duración del período larvario varían con la temperatura, la humedad, y diversas condiciones de la fruta en cuanto a cantidad de material parásito, acidez, estado de madurez, etc. El número de larvas puede ser de 1 a 3 por fruta y hasta cifras muy elevadas como 72, según la población de moscas y la clase de fruta. Las larvas adquieren su desarrollo completo entre tres estadios y dos "écdicis". 12. Las pupas son ovaladas como una barrilito; miden de 3 a 7 mm, de largo x 1 1⁄2 a 21⁄2 de ancho. Son de color castaño claro en tonalidades hasta el tabaco oscuro. La duración del período de pupa, así como diferentes hechos relacionados con el estado, sufren variaciones debidas a temperatura, humedad, acidez, soltura y textura del suelo, que es el medio donde normalmente ocurre el empupamiento. 13. El estado

Genus-specific PCR Primers Targeting Intracellular Parasite Euduboscquella (Dinoflagellata: Syndinea)

Science.gov (United States)

Jung, Jae-Ho; Choi, Jung Min; Kim, Young-Ok

2018-03-01

We designed a genus-specific primer pair targeting the intracellular parasite Euduboscquella. To increase target specificity and inhibit untargeted PCR, two nucleotides were added at the 3' end of the reverse primer, one being a complementary nucleotide to the Euduboscquella-specific SNP (single-nucleotide polymorphism) and the other a deliberately mismatched nucleotide. Target specificity of the primer set was verified experimentally using PCR of two Euduboscquella species (positive controls) and 15 related species (negative controls composed of ciliates, diatoms and dinoflagellates), and analytical comparison with SILVA SSU rRNA gene database (release 119) in silico. In addition, we applied the Euduboscquella-specific primer set to four environmental samples previously determined by cytological staining to be either positive or negative for Euduboscquella. As expected, only positive controls and environmental samples known to contain Euduboscquella were successfully amplified by the primer set. An inferred SSU rRNA gene phylogeny placed environmental samples containing aloricate ciliates infected by Euduboscquella in a cluster discrete from Euduboscquella groups a-d previously reported from loricate, tintinnid ciliates.

Reporte del primer caso de enfermedad de Chagas transplacentaria analizado por AP-PCR en Moniquirá, Boyacá

Directory of Open Access Journals (Sweden)

Concepción Judith Puerta

2009-12-01

Conclusiones. Éste es el primer caso de enfermedad de Chagas transplacentaria reportado en el municipio de Moniquirá, que demuestra que esta forma de transmisión ocurre en el país. La presencia de infección mixta por ambos grupos de T. cruzi en las muestras del recién nacido, sugiere infección mixta en la madre, con mayor prevalencia de T. cruzi I, al menos en el hemocultivo.

Al clamor de les vuvuzeles

Directory of Open Access Journals (Sweden)

Javier Olivera Betrán

2010-09-01

Full Text Available El Mundial de Futbol de Sud-àfrica ha situat l’Àfrica al mapa mundial i ha mostrat al món el triomf de l’estil de futbol d’Espanya basat en la col·lectivitat, l’esperit d’equip, la humilitat, la cohesió interna i el joc bonic. L’organització africana, seriosa i eficaç, ha sabut mobilitzar i il·lusionar la població del país que ha participat en el mundial des de l’orgull de ser africà, amb l’esperit alegre, festiu i també reivindicatiu de la gent de l’Àfrica. Aquest esdeveniment suposa el llançament de la marca “Sud-àfrica” al món amb un avís clar d’optar a l’organització d’uns primers Jocs Olímpics a Àfrica (potser els de 2020. S’obre una finestra d’esperança al segle xxi per al continent perdut de la mà de l’esport espectacle tan universal, massiu, emocional i mercantil que també es juga a la canxa de la política i de l’economia.

Laboratory and gas-fired furnace performance tests of epoxy primers for intumescent coatings

DEFF Research Database (Denmark)

Nørgaard, Kristian Petersen; Dam-Johansen, Kim; Catala, Pere

2014-01-01

, either to ensure adhesion of the intumescent coating to the steel or to provide corrosion resistance. It is essential to document the performance of the intumescent coating together with the primer to ensure the overall quality of coating system. In the present work, two epoxy primers were used...... to a gas-fired furnace following the ISO834 fire curve (a so-called cellulosic fire), one of the primers selected performed well and the other poorly. From tests in the electrically heated oven, it was found that both primers were sensitive to the film thickness employed and the presence of oxygen....... At oxygen-rich conditions, higher primer thicknesses gave weaker performance. In addition, a color change from red to black was observed in nitrogen, while the color remained red in the oxygen-nitrogen mixture. In summary, the results suggest that an adequate choice of primer, primer thickness...

Nutrición y desarrollo psicomotor durante el primer semestre de vida

Directory of Open Access Journals (Sweden)

CHÁVEZ ADOLFO

1998-01-01

Full Text Available Objetivo. Estudiar el desarrollo psicomotor de niños pequeños de una comunidad rural pobre y mal alimentada y relacionarlo con la alimentación y nutrición tanto de su madre como de ellos mismos. Material y métodos. Se estudiaron 82 unidades madre-niño, desde antes del quinto mes de embarazo hasta los seis meses de edad del niño, en antropometría y dieta; en el niño se aplicaron pruebas de Brazelton al nacer, de Bayley a los tres y seis meses de edad y de interacción con su madre. Resultados. Varias de las pruebas psicomotoras del niño se correlacionaron positivamente con el peso de la madre y sus pliegues cutáneos, lo mismo que con su propio peso y talla previos. También con el consumo materno de productos animales y frutas durante el embarazo y negativamente con el consumo de tortillas y frijoles. Las correlaciones de varias de las pruebas del niño a los seis meses fueron positivas con su consumo complementario, de energía total y de varios alimentos, sobre todo de huevo, leche y frutas alrededor de los tres meses de edad. Conclusiones. Es importante que dentro del estrato social rural pobre estudiado, pequeñas variaciones de consumo de alimentos y nutrición de la unidad materno-infantil den lugar a cambios en las diversas pruebas de desarrollo psicomotor del niño pequeño, lo que sugiere la necesidad de impulsar más los programas de nutrición aplicados.

A database of PCR primers for the chloroplast genomes of higher plants

Science.gov (United States)

Heinze, Berthold

2007-01-01

Background Chloroplast genomes evolve slowly and many primers for PCR amplification and analysis of chloroplast sequences can be used across a wide array of genera. In some cases 'universal' primers have been designed for the purpose of working across species boundaries. However, the essential information on these primer sequences is scattered throughout the literature. Results A database is presented here which assembles published primer information for chloroplast DNA. Additional primers were designed to fill gaps where little or no primer information could be found. Amplicons are either the genes themselves (typically useful in studies of sequence variation in higher-order phylogeny) or they are spacers, introns, and intergenic regions (for studies of phylogeographic patterns within and among species). The current list of 'generic' primers consists of more than 700 sequences. Wherever possible, we give the locations of the primers in the thirteen fully sequenced chloroplast genomes (Nicotiana tabacum, Atropa belladonna, Spinacia oleracea, Arabidopsis thaliana, Populus trichocarpa, Oryza sativa, Pinus thunbergii, Marchantia polymorpha, Zea mays, Oenothera elata, Acorus calamus, Eucalyptus globulus, Medicago trunculata). Conclusion The database described here is designed to serve as a resource for researchers who are venturing into the study of poorly described chloroplast genomes, whether for large- or small-scale DNA sequencing projects, to study molecular variation or to investigate chloroplast evolution. PMID:17326828

A database of PCR primers for the chloroplast genomes of higher plants

Directory of Open Access Journals (Sweden)

Heinze Berthold

2007-02-01

Full Text Available Abstract Background Chloroplast genomes evolve slowly and many primers for PCR amplification and analysis of chloroplast sequences can be used across a wide array of genera. In some cases 'universal' primers have been designed for the purpose of working across species boundaries. However, the essential information on these primer sequences is scattered throughout the literature. Results A database is presented here which assembles published primer information for chloroplast DNA. Additional primers were designed to fill gaps where little or no primer information could be found. Amplicons are either the genes themselves (typically useful in studies of sequence variation in higher-order phylogeny or they are spacers, introns, and intergenic regions (for studies of phylogeographic patterns within and among species. The current list of 'generic' primers consists of more than 700 sequences. Wherever possible, we give the locations of the primers in the thirteen fully sequenced chloroplast genomes (Nicotiana tabacum, Atropa belladonna, Spinacia oleracea, Arabidopsis thaliana, Populus trichocarpa, Oryza sativa, Pinus thunbergii, Marchantia polymorpha, Zea mays, Oenothera elata, Acorus calamus, Eucalyptus globulus, Medicago trunculata. Conclusion The database described here is designed to serve as a resource for researchers who are venturing into the study of poorly described chloroplast genomes, whether for large- or small-scale DNA sequencing projects, to study molecular variation or to investigate chloroplast evolution.

Evaluating primers for profiling anaerobic ammonia oxidizing bacteria within freshwater environments.

Directory of Open Access Journals (Sweden)

Puntipar Sonthiphand

Full Text Available Anaerobic ammonia oxidizing (anammox bacteria play an important role in transforming ammonium to nitrogen gas and contribute to fixed nitrogen losses in freshwater environments. Understanding the diversity and abundance of anammox bacteria requires reliable molecular tools, and these are not yet well established for these important Planctomycetes. To help validate PCR primers for the detection of anammox bacteria within freshwater ecosystems, we analyzed representative positive controls and selected samples from Grand River and groundwater sites, both from Ontario, Canada. The objectives of this study were to identify a suitable anammox denaturing gradient gel electrophoresis (DGGE fingerprint method by using GC-clamp modifications to existing primers, and to verify the specificity of anammox-specific primers used for DGGE, cloning and qPCR methods. Six primer combinations were tested from four published primer sets (i.e. A438f/A684r, Amx368f/Amx820r, An7f/An1388r, and Pla46/1392r for both direct and nested PCR amplifications. All PCR products were run subsequently on DGGE gels to compare the resulting patterns. Two anammox-specific primer combinations were also used to generate clone libraries and quantify anammox bacterial 16S rRNA genes with qPCR. The primer set A438f/A684r was highly specific to anammox bacteria, provided reliable DGGE fingerprints and generated a high proportion of anammox-related clones. A second primer set (Amx368f/Amx820r was anammox specific, based on clone library analysis, but PCR products from different candidate species of anammox bacteria resolved poorly using DGGE analysis. Both DGGE and cloning results revealed that Ca. Brocadia and an uncharacterized anammox bacterial cluster represented the majority of anammox bacteria found in Grand River sediment and groundwater samples, respectively. Together, our results demonstrate that although Amx368f/Amx820r was useful for anammox-specific qPCR and clone library

PCR with Paracoccidioides brasiliensis specific primers: potential use in ecological studies PCR com «primers» específicos de Paracoccidioides brasiliensis: uso potencial em estudos ecológicos

Directory of Open Access Journals (Sweden)

S. DÍEZ

1999-11-01

Full Text Available The precise microenvironment of Paracoccidioides brasiliensis has not yet been discovered perhaps because the methods used are not sensitive enough. We applied to this purpose the polymerase chain reaction (PCR using three sets of specific primers corresponding to two P. brasiliensis genes. This fungus as well as several other fungi, were grown and their DNA obtained by mechanical disruption and a phenol chloroform isoamylalcohol-based purification method. The DNA served for a PCR reaction that employed specific primers from two P. brasiliensis genes that codify for antigenic proteins, namely, the 27 kDa and the 43 kDa. The lowest detection range for the 27 kDa gene was 3 pg. The amplification for both genes was positive only with DNA from P. brasiliensis; additionally, the mRNA for the 27 kDa gene was present only in P. brasiliensis, as indicated by the Northern analysis. The standardization of PCR technology permitted the amplification of P. brasiliensis DNA in artificially contaminated soils and in tissues of armadillos naturally infected with the fungus. These results indicate that PCR technology could play an important role in the search for P. brasiliensis’ habitat and could also be used in other ecological studies.O microambiente adequado do Paracoccidioides brasiliensis não foi ainda bem esclarecido, talvez porque os métodos utilizados não sejam suficientemente sensíveis. Aplicamos com este propósito, a reação em cadeia da polimerase (PCR usando três jogos de primers específicos do P. brasiliensis, correspondendo a dois dos genes do P. brasiliensis. Este fungo, assim como outros fungos, foram cultivados e seus DNAs obtidos por ruptura mecânica e purificados com mistura de fenol-clorofórmio com álcool isoamílico. Os DNAs serviram para a reação de PCR utilizando-se primers específicos para dois dos genes do P. brasiliensis que codificam para as proteínas antigênicas, denominadas, 27 kDa e 43 kDa. O limite mínimo de

Universal primers that amplify RNA from all three flavivirus subgroups

Directory of Open Access Journals (Sweden)

Barnard Ross T

2008-01-01

Full Text Available Abstract Background Species within the Flavivirus genus pose public health problems around the world. Increasing cases of Dengue and Japanese encephalitis virus in Asia, frequent outbreaks of Yellow fever virus in Africa and South America, and the ongoing spread of West Nile virus throughout the Americas, show the geographical burden of flavivirus diseases. Flavivirus infections are often indistinct from and confused with other febrile illnesses. Here we review the specificity of published primers, and describe a new universal primer pair that can detect a wide range of flaviviruses, including viruses from each of the recognised subgroups. Results Bioinformatic analysis of 257 published full-length Flavivirus genomes revealed conserved regions not previously targeted by primers. Two degenerate primers, Flav100F and Flav200R were designed from these regions and used to generate an 800 base pair cDNA product. The region amplified encoded part of the methyltransferase and most of the RNA-dependent-RNA-polymerase (NS5 coding sequence. One-step RT-PCR testing was successful using standard conditions with RNA from over 60 different flavivirus strains representing about 50 species. The cDNA from each virus isolate was sequenced then used in phylogenetic analyses and database searches to confirm the identity of the template RNA. Conclusion Comprehensive testing has revealed the broad specificity of these primers. We briefly discuss the advantages and uses of these universal primers.

Perfil cognitivo y prevalencia de depresión, desesperanza y riesgo suicida en jóvenes vinculados al primer nivel de formación en una escuela militar colombiana

Directory of Open Access Journals (Sweden)

Daniella Abello Luque

2016-01-01

Full Text Available Este estudio evaluó el perfil cognitivo y los niveles de desesperanza, depresión y riesgo suicida en un grupo de jóvenes vinculados al proceso de formación de una escuela militar colombiana. En total participaron 114 sujetos, militares regulares de primer año (MR-1A, que representan la totalidad de un contingente particular; todos ellos hombres, con edades entre los diecisiete y los veintidós años, provenientes de hogares ubicados en la región Caribe (41% y el centro del país (12%, sin ningún tipo de diagnóstico médico o mental relevante. Los resultados indican relaciones lineales y directamente promocionales entre todas las variables, con magnitudes significativas en lo referente a las relaciones depresión-desesperanza (rs= 0,295; ρ= 0,01 y depresión-riesgo suicida (rs= 0,478; ρ= 0,01, siendo esta ultima el reporte más elevado.

The development of the Oocytes and Seasonal Changes in the ovary of the Ide Idus Idus (L. in the river kävlingean, south Sweden

Directory of Open Access Journals (Sweden)

Cala Plutarco

1970-09-01

. Afuera de la zonaradiata aparece un aparato especial "aparato de adhesión de los huevos" --Apporatus for fastening the eggs (Raven 1961--, consistente en filamentos largos (Fig. 12.ESTADIO 8. Huevos maduros o listos para ser expelidos. Estos huevos en condiciones frescas son fuertemente adhesivos. Son esféricos, ca. 1,7 mm diam., y están cubiertos por una membrana gruesa. Luego de la ovulación, los estratos foliculares y el tejido conectivo estromático circundante entraen colapso para formar el lumen que contiene residues celulares (Figs. 14 y 15.  Así, el primer signo de una gónada indiferenciada aparece, en Idus idus (L. del río Kävlingean, después del primer período de crecimiento o en peces aproximadamente de seis meses. Los primeros oocitos aparecen durante el segundo verano. Oocitos en el estadio 5 aparecen usualmente en ovarios de peces de edad (age group IV, pero algunas veces se hallan en la edad III. El paso del estadio 5 al estadio 6 requiere un año y entonces el pez se considera maduro y los oocitos inician la maduración. Es decir,la hembra de I. idus puede alcanzar madurez sexual a una edad de cuatro años, sin embargo usualmente la adquiere a los cinco años de edad, de manera que las hembras pueden desovar por primera vez en el quinto año de vida, pero la mayoría en el sexto.  No todos los huevos maduros son puestos durante el desove (Fig. 16.  Los que aún quedan en el ovario despues del desove sufren atresia. Las plaquetas periféricas de vitelo comienzan a aglutinarse apareciendo vacuolos.  La membrana vitelina a menudo persiste hasta que tanto el vitelo como el citoplasma han desaparecido, siendo difícil determinar si su desaparición es efectuada por fagocitosis o disolución.  La relación entre el desarrollo de los oocitos y la edad del I. idus (ver Tabla 1, puede ser resumida como sigue:AÑO 1. Al finalizar el primer año de vida del alevino las gónadas están compuestas por grupos aislados de oogonios o espermatogonios, i

Primers for phylogeny reconstruction in Bignonieae (Bignoniaceae) using herbarium samples.

Science.gov (United States)

Zuntini, Alexandre R; Fonseca, Luiz Henrique M; Lohmann, Lúcia G

2013-09-01

New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. • Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. • The standardized methodology allows the inclusion of herbarium materials as alternative sources of DNA for phylogenetic studies in Bignonieae.

Efecto de la edad al primer parto y los días abiertos en un bovino doble propósito sobre la huella hídrica y de carbono

Directory of Open Access Journals (Sweden)

Raúl Andrés Molina Benavides

2016-12-01

Full Text Available La actividad ganadera contribuye con la emisión de gases de efecto invernadero (EGEI y el consumo de agua fresca (CA. Por ende, el objetivo de esta investigación fue estimar el efecto de la edad al primer parto (EPP y los días abiertos (DA en un bovino doble propósito en pastoreo, trópico bajo colombiano, sobre las EGEI y el CA. Esta estimación se logró integrando 4 metodologías existentes: Dinámica de Sistemas, Large Ruminal Nutrition System, Huella de carbono y Huella hídrica. Durante toda su vida, 91 meses, desde el nacimiento hasta el sacrificio, la vaca produjo 5.879 kg de leche -4 lactancias-, emitió 16.066 kg CO2eq y consumió 12.804.569 L de agua. Al disminuir la EPP en un mes, el CA y  las EGEI se redujeron en 123.156 l y 155 kg CO2eq, respectivamente. Cuando se  mermaron los DA en 21, las EGEI bajaron 647 kg CO2eq y el CA se redujo en 455.455 L. Parámetros reproductivos como la EPP y los DA tienen una fuerte influencia sobre la dinámica del animal en el hato,  afectando su productividad, emisiones de gases de efecto invernadero y consumo de agua. 

Review of The Atheist’s Primer and Atheism for Beginners

Directory of Open Access Journals (Sweden)

Andrew J Bissette

2014-05-01

Full Text Available The New Atheists are occasionally accused of lacking nuance and sophistication, or of existing in an intellectual vacuum. To some it may seem that Dawkins 'et al'. are naïve logical positivists; this perspective may be reinforced by recent authors’ explicit rejection of the value of philosophy and other non-scientific approaches to knowledge (cf. Lawrence Krauss, Stephen Hawking. Into the fray steps Michael Palmer, offering his attempt to popularise a version of atheism that is underpinned by a long tradition of philosophical inquiry. 'The Atheist’s Primer', a condensed version of Palmer’s previous work, is aptly named: it is a crash course on the history and major arguments of atheism from a firmly philosophical angle. Its companion text, 'Atheism For Beginners', is a coursebook aimed at tutors seeking to teach this material.

Pengembangan Sejumlah Primer untuk Reverse Transcriptase Polymerase Chain Reaction Guna Melacak Virus Flu Burung di Indonesia (DEVELOPMENt OF PRIMERS FOR REVERSE TRANSCRIPTASE POLYMERASE CHAIN REACTION TO DETECT AVIAN INFLUENZA VIRUS IN INDONESIA

Directory of Open Access Journals (Sweden)

Ni Luh Putu Indi Dharmayanti

2016-07-01

Full Text Available Until recently, two clades of of avian influenza viruses (AIVs designated as 2.3.2 and 2.2.3 havebeen circulating in Indonesia. Mutations of AIV genes have cretaed many more variants of the virus. It istherefore important to evaluate the appropriate methods used for the detection and diagnosis of AI virusin the field. Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR have been used as a standardmethod for detection of AIV in many laboratories in Indonesia. The success of RT-PCR for detection ofAIV virus is dependent on the nucleotide sequences of primer that match with the circulating of AIVs. Theaims of this study was to develop RT-PCR by designing primers for H5 subtype specific to the circulatingAIVs in the field. The primers were designed using Primer Design software, and optimization andvalidation of the primer were conducted using AIVs that have been characterized in the previous study.The primers were then used RT-PCR using AIV isolates from field samples and their sensitivity andspecificity were then determined. The results showed that the H5 primers designed in this study, H5-IDand H5-NLP, was able to detect the AIVs in field samples better than the H5-specific primers have beenused previously. In conclusion, H5 primers designed based on recent viruses in the field showed betterresults in the detection of AI virus as compared to the previous primers. As AIV-H5N1 subtype in the fieldwill continue to change and evolve, the use of primers designed in this study is recommended for diagnosisof H5 AIV.

Design of a Percussion and Electric Primer Gun Firing Power Supply

Science.gov (United States)

2014-07-01

solenoid failure. As new instrumentation techniques such as high-speed video and laser interferometry have been introduced into our gun testing...to drive a solenoid into a percussion primer or ignite the M52A3B1 electric primer. To reduce power requirements, it uses charged capacitor banks to...drive the solenoid or ignite the primer. This report details the design and construction of the power supplies. 15. SUBJECT TERMS power supply

Transferability of retrotransposon primers derived from Persimmon (Diospyros kaki Thunb.) across other plant species.

Science.gov (United States)

Du, X Y; Hu, Q N; Zhang, Q L; Wang, Y B; Luo, Z R

2013-06-06

Retrotransposon-based molecular markers are powerful molecular tools. However, these markers are not readily available due to the difficulty in obtaining species-specific retrotransposon primers. Although recent techniques enabling the rapid isolation of retrotransposon sequences have facilitated primer development, this process nonetheless remains time-consuming and costly. Therefore, research into the transferability of retrotransposon primers developed from one plant species onto others would be of great value. The present study investigated the transferability of retrotransposon primers derived from 'Luotian-tianshi' persimmon (Diospyros kaki Thunb.) across other fruit crops, as well as within the genus using inter-retrotransposon amplified polymorphism molecular marker. Fourteen of the 26 retrotransposon primers tested (53.85%) produced robust and reproducible amplification products across all fruit crops tested, indicating their applicability across plant species. Four of the 13 fruit crops showed the best transferability performances: persimmon, grape, citrus, and peach. Furthermore, similarity coefficients and UPGMA clustering indicated that these primers could further offer a potential tool for germplasm differentiation, parentage identification, genetic diversity assessment, classification, and phylogenetic studies across a variety of plant species. Transferability was further confirmed by examining published primers derived from Rosaceae, Gramineae, and Solanaceae. This study is one of the few currently available studies concerning the transferability of retrotransposon primers across plant species in general, and is the first successful study of the transferability of retrotransposon primers derived from persimmon. The primers presented here will help reduce costs for future retrotransposon primer development and therefore contribute to the popularization of retrotransposon molecular markers.

Eficacia del primer tratamiento sistémico con glucocorticoides en la enfermedad inflamatoria intestinal. Revisión sistemática y serie de casos

OpenAIRE

López San Román, Antonio

2009-01-01

Los glucocorticoides son un fármaco de eficacia alta en pacientes con enfermedad inflamatoria intestinal, consiguiendo inducir respuesta en aproximadamente un 70% de los pacientes, respuesta que perdura a largo plazo en casi la mitad de los casos. La mayor edad al diagnóstico y al inicio del primer tratamiento son los principales factores predoctores de mala respuesta a los glucocorticoides. Una política de inmunosupresión precoz de los pacientes que no se hubieran beneficiado a largo plazo d...

Comparison of shear bond strength of orthodontic brackets using various zirconia primers.

Science.gov (United States)

Lee, Ji-Yeon; Kim, Jin-Seok; Hwang, Chung-Ju

2015-07-01

The aim of this study was to compare the shear bond strength (SBS) of orthodontic brackets bonded to zirconia surfaces using three different zirconia primers and one silane primer, and subjected to thermocycling. We designed 10 experimental groups following the surface treatment and thermocycling. The surface was treated with one of the following method: no-primer (NP), Porcelain Conditioner (PC), Z-PRIME Plus (ZP), Monobond Plus (MP) and Zirconia Liner Premium (ZL) (n=20). Then each group was subdivided to non-thermocycled and thermocycled groups (NPT, PC, ZPT, MPT, ZLT) (n=10). Orthodontic brackets were bonded to the specimens using Transbond™ XT Paste and light cured for 15 s at 1,100 mW/cm(2). The SBS was measured at a 1 mm/min crosshead speed. The failure mode was assessed by examination with a stereomicroscope and the amount of bonding resin remaining on the zirconia surface was scored using the modified adhesive remnant index (ARI). The SBS of all experimental groups decreased after thermocycling. Before thermocycling, the SBS was ZL, ZP ≥ MP ≥ PC > NP but after thermocycling, the SBS was ZLT ≥ MPT ≥ ZPT > PCT = NPT (p > 0.05). For the ARI score, both of the groups lacking primer (NP and NPT) displayed adhesive failure modes, but the groups with zirconia primers (ZP, ZPT, MP, MPT, ZL, and ZLT) were associated with mixed failure modes. Surface treatment with a zirconia primer increases the SBS relative to no-primer or silane primer application between orthodontic brackets and zirconia prostheses.

Bioinformatic tools for PCR Primer design

African Journals Online (AJOL)

ES

Bioinformatics is an emerging scientific discipline that uses information ... complex biological questions. ... and computer programs for various purposes of primer ..... polymerase chain reaction: Human Immunodeficiency Virus 1 model studies.

Pràctica 9. El desenvolupament psicomotor del xiquet (primer cicle d'Educació Infantil)

OpenAIRE

Gomis Selva, Nieves; Sánchez Colodrero, Vicente; Delgado Domenech, Beatriz

2013-01-01

El començament del desenvolupament del xiquet està dominat essencialment per la motricitat. En els primers mesos d’edat del nadó, els moviments són veritables manifestacions del seu desenvolupament psicològic. Aquesta motricitat es desenvoluparà amb més precisió i seguretat si creem un ambient segur i de llibertat per als xiquets, on el rol de l’adult és d’acompanyament no invasiu i testimoni dels seus èxits. Els treballs d’investigació de l’Institut Lóczy i de la doctora Emmi Pikler ens indi...

Recolectores, verificadores y reflexivos: perfiles de la competencia informacional en estudiantes universitarios de primer semestre

Directory of Open Access Journals (Sweden)

Harold Castañeda-Peña

2010-01-01

Full Text Available Artículo de investigación que explora perfiles de la competencia informacional en estudiantes universitarios de primer semestre, a partir de un concepto renovado de competencia informacional desde la perspectiva sociocultural, donde se entiende perfil como una práctica habitual que es situada y variada. Se analiza el caso de 285 estudiantes provenientes de dos universidades colombianas, por medio de un instrumento observacional (cuestionario de perfil, protocolos en voz alta y entrevistas. Se encuentra que el 55% de los estudiantes de primer año de una universidad con carreras profesionales tiende a recolectar información y que el 78% de los estudiantes de primer año de una universidad con carreras tecnológicas tiende a contrastar y verificar información, en tanto que sólo entre 3% y 4% tiende a manejar la información críticamente. Se discute que, al asumir una tarea académica, estos estudiantes vinculan sus prácticas de competencia informacional a sus propias historias de vida y escolares, y que la edad y los antecedentes académicos parecen influir en tales prácticas. Los casos analizados se ubican dentro de perfiles de competencia informacional: recolectores, verificadores y reflexivos. Estos perfiles no son fijos, sino más bien fluidos, y se concretan de manera diferente según la tarea académica. Se recomienda realizar estudios de perfiles informacionales en estudiantes tanto de secundaria como universitarios, para diseñar políticas educativas sobre competencia informacional.

Evaluación de los métodos de Graham y pin tape en el diagnóstico de Enterobius vermicularis

Directory of Open Access Journals (Sweden)

María Beltrán F

2005-03-01

Full Text Available El objetivo del estudio fue evaluar el método de pin tape (PT respecto al método de Graham (MG para el diagnóstico e intensidad de infección por E. vermicularis en niños. Se obtuvieron 250 muestras de 125 niños de ambos sexos, comprendidos entre 3 y 13 años de edad. Con el método de Graham se tuvo una prevalencia de 47% y con el pin tape 33,6%, asimismo, se detectó mayor intensidad de infección (número de huevos por lámina con el MG que con el PT. La sensibilidad del PT respecto al MG fue de 71%, especificidad de 100% y concordancia (Kappa 0,72. Se recomienda el uso del método de Graham respecto al pin tape, debido a que el método de Graham resulta más práctico, tiene mayor sensibilidad y detecta mayor número de huevos por lámina.

Primers for Phylogeny Reconstruction in Bignonieae (Bignoniaceae Using Herbarium Samples

Directory of Open Access Journals (Sweden)

Alexandre R. Zuntini

2013-08-01

Full Text Available Premise of the study: New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. Methods and Results: Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. Conclusions: The standardized methodology allows the inclusion of herbarium materials as alternative sources of DNA for phylogenetic studies in Bignonieae.

Real-time PCR (qPCR) primer design using free online software.

Science.gov (United States)

Thornton, Brenda; Basu, Chhandak

2011-01-01

Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most commonly used fluorescent chemistries are SYBR® Green dyes and TaqMan®, Molecular Beacon or Scorpion probes. SYBR® Green is very simple to use and cost efficient. As SYBR® Green dye binds to any double-stranded DNA product, its success depends greatly on proper primer design. Many types of online primer design software are available, which can be used free of charge to design desirable SYBR® Green-based qPCR primers. This laboratory exercise is intended for those who have a fundamental background in PCR. It addresses the basic fluorescent chemistries of real-time PCR, the basic rules and pitfalls of primer design, and provides a step-by-step protocol for designing SYBR® Green-based primers with free, online software. Copyright © 2010 Wiley Periodicals, Inc.

A Hearing Aid Primer 1

Science.gov (United States)

Yetter, Carol J.

2009-01-01

This hearing aid primer is designed to define the differences among the three levels of hearing instrument technology: conventional analog circuit technology (most basic), digitally programmable/analog circuit technology (moderately advanced), and fully digital technology (most advanced). Both moderate and advanced technologies mean that hearing…

DNA Extraction and Primer Selection

DEFF Research Database (Denmark)

Karst, Søren Michael; Nielsen, Per Halkjær; Albertsen, Mads

Talk regarding pitfalls in DNA extraction and 16S amplicon primer choice when performing community analysis of complex microbial communities. The talk was a part of Workshop 2 "Principles, Potential, and Limitations of Novel Molecular Methods in Water Engineering; from Amplicon Sequencing to -omics...

A classical primer for QCD

International Nuclear Information System (INIS)

Moriyasu, K.

1981-01-01

A basic primer for QCD is presented using a semiclassical approach to the colour Maxwell equations. The non-Abelian nature of colour symmetry and the violation of superposition by colour fields is compared with QED. A simple discussion of asymptotic freedom is also presented. (author)

GETPrime: a gene- or transcript-specific primer database for quantitative real-time PCR.

Science.gov (United States)

Gubelmann, Carine; Gattiker, Alexandre; Massouras, Andreas; Hens, Korneel; David, Fabrice; Decouttere, Frederik; Rougemont, Jacques; Deplancke, Bart

2011-01-01

The vast majority of genes in humans and other organisms undergo alternative splicing, yet the biological function of splice variants is still very poorly understood in large part because of the lack of simple tools that can map the expression profiles and patterns of these variants with high sensitivity. High-throughput quantitative real-time polymerase chain reaction (qPCR) is an ideal technique to accurately quantify nucleic acid sequences including splice variants. However, currently available primer design programs do not distinguish between splice variants and also differ substantially in overall quality, functionality or throughput mode. Here, we present GETPrime, a primer database supported by a novel platform that uniquely combines and automates several features critical for optimal qPCR primer design. These include the consideration of all gene splice variants to enable either gene-specific (covering the majority of splice variants) or transcript-specific (covering one splice variant) expression profiling, primer specificity validation, automated best primer pair selection according to strict criteria and graphical visualization of the latter primer pairs within their genomic context. GETPrime primers have been extensively validated experimentally, demonstrating high transcript specificity in complex samples. Thus, the free-access, user-friendly GETPrime database allows fast primer retrieval and visualization for genes or groups of genes of most common model organisms, and is available at http://updepla1srv1.epfl.ch/getprime/. Database URL: http://deplanckelab.epfl.ch.

Hacia una definición de la medida

OpenAIRE

Parot, Jean Jacques

2012-01-01

Hacia una definición de la medida A. Primera situación Un granjero va al mercado para vender a) Una gallina (20 pesos) b) Un bulto de naranjas (45 pesos) c) Un pate (38 pesos) d) Una docena de huevos (12 pesos)

Tools for Ultraspecific Probe/Primer Design

National Research Council Canada - National Science Library

Fofanov, Yurly

2006-01-01

.... Our approach will deliver DNA probes and PCR primers that have an unprecedentedly low probability of false positives or confusion by environmental background, and which resist evasion by threat agent engineering...

Diversity of internal structures in inhibited epoxy primers

Directory of Open Access Journals (Sweden)

Anthony E. Hughes

2015-10-01

Full Text Available Computed tomography is making a significant impact in the field of materials science in recent years. In this paper the authors report on advances made in three areas of characterization and also identified where further research needs to be focused. First we report on a new approach to data analysis called “Data Constrained Modelling (DCM” in which compositional tomography can be undertaken rather than adsorption or phase contrast tomography. This is achieved by collecting X-ray CT data at different energies and then combining the datasets to reconstruct 3D compositional tomography. Second, on the application of this approach to inhibited primers typical of those used in the aerospace industry. Aerospace primers are effectively composite materials containing inorganic phases which are bound together with a polymer. Understanding the materials science of these systems requires information over several orders of magnitude in length-scale. In this paper we report on how DCM can be used to extend our understanding at the smaller length scales at the limits of resolution of the technique. The third and final advance is in extending the approach to include 4-dimensional studies. In this case we examine the primer before and after leaching. This process causes changes in the primer which can be both detected and quantified using the above approach.

Preparation and Characterization of Acrylic Primer for Concrete Substrate Application

Directory of Open Access Journals (Sweden)

El-Sayed Negim

2016-01-01

Full Text Available This study dealt with the properties of acrylic primer for concrete substrate using acrylic syrup, made from a methyl methacrylate monomer solution of terpolymers. Terpolymer systems consisting of methyl methacrylate (MMA, 2-ethylhexyl acrylate (2-EHA, and methacrylic acid (MAA with different chemical composition ratios of MMA and 2-EHA were synthesized through bulk polymerization using azobisisobutyronitrile (AIBN as initiator. The terpolymer composition is characterized by FTIR, 1H NMR, DSC, TGA, and SEM. The glass transition temperature and the thermal stability increased with increasing amounts of MMA in the terpolymer backbone. The effect of chemical composition of terpolymers on physicomechanical properties of primer films was investigated. However, increasing the amount of MMA in terpolymer backbone increased tensile and contact angle of primer films while elongation at break, water absorption, and bond strength are decreased. In particular, the primer syrup containing 65% 2-EHA has good bonding strength with concrete substrate around 1.1 MPa.

Bond strength of compomers to dentin using acidic primers.

Science.gov (United States)

Tate, W H; You, C; Powers, J M

1999-10-01

To determine the in vitro bond strengths of seven compomer/bonding agent restorative systems to human dentin. Seven compomer/bonding agents were bonded to human dentin, stored in water at 37 degrees C for 24 hours, and debonded in tension. Bonding conditions were with and without phosphoric acid etching, with and without the use of combined primer/bonding agents, and under moist and wet bond interfaces. Without phosphoric acid etching, F2000/F2000 Compomer Primer/Adhesive and F2000/Single Bond Dental Adhesive System were less sensitive to dentin wetness. With moist dentin, bond strengths of Dyract/Prime & Bond 2.1, Dyract AP/Prime & Bond 2.1, Hytac/OSB light-curing, one-component bonding agent, F2000/Single Bond, and Freedom/STAE single component light-cured dentin/enamel adhesive system, were improved with phosphoric acid etching. Also, with moist dentin, the bond strength of F2000/F2000 Compomer Primer/Adhesive in the 3M Clicker dispensing system was higher without phosphoric acid etching, whereas bonds of Compoglass/Syntac Single-component were not affected by phosphoric acid etching. Bonding did not occur without primer/bonding agent, regardless of surface condition or use of phosphoric acid etching.

Performance testing of lead free primers: blast waves, velocity variations, and environmental testing

OpenAIRE

Courtney, Elya; Courtney, Amy; Summer, Peter David; Courtney, Michael

2014-01-01

Results are presented for lead free primers based on diazodinitrophenol (DDNP)compared with tests on lead styphnate based primers. First, barrel friction measurements in 5.56 mm NATO are presented. Second, shot to shot variations in blast waves are presented as determined by detonating primers in a 7.62x51mm rifle chamber with a firing pin, but without any powder or bullet loaded and measuring the blast wave at the muzzle with a high speed pressure transducer. Third, variations in primer blas...

Microsatellite Primers in the Lichen Symbiotic Alga Trebouxia decolorans (Trebouxiophyceae

Directory of Open Access Journals (Sweden)

Francesco Dal Grande

2013-03-01

Full Text Available Premise of the study: Polymorphic microsatellite markers were developed for the symbiotic green alga Trebouxia decolorans to study fine-scale population structure and clonal diversity. Methods and Results: Using Illumina pyrosequencing, 20 microsatellite primer sets were developed for T. decolorans. The primer sets were tested on 43 individuals sampled from four subpopulations in Germany. The primers amplified di-, tri-, and tetranucleotide repeats with three to 15 alleles per locus, and the unbiased haploid diversity per locus ranged from 0.636 to 0.821. Conclusions: The identified microsatellite markers will be useful to study the genetic diversity, dispersal, and reproductive mode of this common lichen photobiont.

40 CFR 63.745 - Standards: Primer and topcoat application operations.

Science.gov (United States)

2010-07-01

... CATEGORIES (CONTINUED) National Emission Standards for Aerospace Manufacturing and Rework Facilities § 63.745.../L (4.5 lb/gal) of primer (less water), as applied, for general aviation rework facilities; or 650 g... (4.5 lb/gal) of primer (less water and exempt solvents), as applied, for general aviation rework...

Employment of Near Full-Length Ribosome Gene TA-Cloning and Primer-Blast to Detect Multiple Species in a Natural Complex Microbial Community Using Species-Specific Primers Designed with Their Genome Sequences.

Science.gov (United States)

Zhang, Huimin; He, Hongkui; Yu, Xiujuan; Xu, Zhaohui; Zhang, Zhizhou

2016-11-01

It remains an unsolved problem to quantify a natural microbial community by rapidly and conveniently measuring multiple species with functional significance. Most widely used high throughput next-generation sequencing methods can only generate information mainly for genus-level taxonomic identification and quantification, and detection of multiple species in a complex microbial community is still heavily dependent on approaches based on near full-length ribosome RNA gene or genome sequence information. In this study, we used near full-length rRNA gene library sequencing plus Primer-Blast to design species-specific primers based on whole microbial genome sequences. The primers were intended to be specific at the species level within relevant microbial communities, i.e., a defined genomics background. The primers were tested with samples collected from the Daqu (also called fermentation starters) and pit mud of a traditional Chinese liquor production plant. Sixteen pairs of primers were found to be suitable for identification of individual species. Among them, seven pairs were chosen to measure the abundance of microbial species through quantitative PCR. The combination of near full-length ribosome RNA gene library sequencing and Primer-Blast may represent a broadly useful protocol to quantify multiple species in complex microbial population samples with species-specific primers.

El desarrollo temprano del calamar patagónico Loligo gahi D’Orbigny,1835 en aguas peruanas (Cephalopoda: Loliginidae

Directory of Open Access Journals (Sweden)

Franz Cardoso

2013-05-01

Full Text Available El desarrollo temprano del calamar patagónico, Loligo gahi D’Orbigny, 1835 fue estudiado en el campo y en el laboratorio. Las puestas colectadas en la Isla San Lorenzo, Perú, fueron transferidas al laboratorio, e incubadas en un sistema cerrado de agua marina. Las cápsulas midieron de 88 a 169 mm de longitud y cada cápsula contenía entre 56 y 114 huevos fertilizados. Los huevos midieron de 1,7 a 2,1 mm de longitud y la longitud del manto de los individuos eclosionados varió de 1,9 a 2,8 mm. El desarrollo de las paralarvas se logró a los 20 días, a una temperatura promedio de 19 ºC. El patrón de desarrollo embrionario es similar al observado en otras especies de Loligo. Las paralarvas sobrevivieron 45 días con una dieta de zooplancton (copepódos, micidáceos y larvas de poliquetos.

Computational intelligence-based polymerase chain reaction primer selection based on a novel teaching-learning-based optimisation.

Science.gov (United States)

Cheng, Yu-Huei

2014-12-01

Specific primers play an important role in polymerase chain reaction (PCR) experiments, and therefore it is essential to find specific primers of outstanding quality. Unfortunately, many PCR constraints must be simultaneously inspected which makes specific primer selection difficult and time-consuming. This paper introduces a novel computational intelligence-based method, Teaching-Learning-Based Optimisation, to select the specific and feasible primers. The specified PCR product lengths of 150-300 bp and 500-800 bp with three melting temperature formulae of Wallace's formula, Bolton and McCarthy's formula and SantaLucia's formula were performed. The authors calculate optimal frequency to estimate the quality of primer selection based on a total of 500 runs for 50 random nucleotide sequences of 'Homo species' retrieved from the National Center for Biotechnology Information. The method was then fairly compared with the genetic algorithm (GA) and memetic algorithm (MA) for primer selection in the literature. The results show that the method easily found suitable primers corresponding with the setting primer constraints and had preferable performance than the GA and the MA. Furthermore, the method was also compared with the common method Primer3 according to their method type, primers presentation, parameters setting, speed and memory usage. In conclusion, it is an interesting primer selection method and a valuable tool for automatic high-throughput analysis. In the future, the usage of the primers in the wet lab needs to be validated carefully to increase the reliability of the method.

The Fluid Reading Primer: Animated Decoding Support for Emergent Readers.

Science.gov (United States)

Zellweger, Polle T.; Mackinlay, Jock D.

A prototype application called the Fluid Reading Primer was developed to help emergent readers with the process of decoding written words into their spoken forms. The Fluid Reading Primer is part of a larger research project called Fluid Documents, which is exploring the use of interactive animation of typography to show additional information in…

Targeted reduction of highly abundant transcripts using pseudo-random primers.

Science.gov (United States)

Arnaud, Ophélie; Kato, Sachi; Poulain, Stéphane; Plessy, Charles

2016-04-01

Transcriptome studies based on quantitative sequencing can estimate levels of gene expression by measuring target RNA abundance in sequencing libraries. Sequencing costs are proportional to the total number of sequenced reads, and in order to cover rare RNAs, considerable quantities of abundant and identical reads are needed. This major limitation can be addressed by depleting a proportion of the most abundant sequences from the library. However, such depletion strategies involve either extra handling of the input RNA sample or use of a large number of reverse transcription primers, termed not-so-random (NSR) primers, which are costly to synthesize. Taking advantage of the high tolerance of reverse transcriptase to mis-prime, we found that it is possible to use as few as 40 pseudo-random (PS) reverse transcription primers to decrease the rate of undesirable abundant sequences within a library without affecting the overall transcriptome diversity. PS primers are simple to design and can be used to deplete several undesirable RNAs simultaneously, thus creating a flexible tool for enriching transcriptome libraries for rare transcript sequences.

Defense Primer: DOD Contractors

Science.gov (United States)

2017-02-10

functions, from intelligence analysis or software development to landscaping or food service. Why does DOD use individual contractors? Going back to...that provide professional services, from research to management support. The bulk of contractors—more than 70%—provide products, and these include...10 U.S.C. Part IV: Service, Supply, and Procurement. CRS Products CRS In Focus IF10548, Defense Primer: U.S. Defense Industrial Base, by Daniel

Automated degenerate PCR primer design for high-throughput sequencing improves efficiency of viral sequencing

Directory of Open Access Journals (Sweden)

Li Kelvin

2012-11-01

Full Text Available Abstract Background In a high-throughput environment, to PCR amplify and sequence a large set of viral isolates from populations that are potentially heterogeneous and continuously evolving, the use of degenerate PCR primers is an important strategy. Degenerate primers allow for the PCR amplification of a wider range of viral isolates with only one set of pre-mixed primers, thus increasing amplification success rates and minimizing the necessity for genome finishing activities. To successfully select a large set of degenerate PCR primers necessary to tile across an entire viral genome and maximize their success, this process is best performed computationally. Results We have developed a fully automated degenerate PCR primer design system that plays a key role in the J. Craig Venter Institute’s (JCVI high-throughput viral sequencing pipeline. A consensus viral genome, or a set of consensus segment sequences in the case of a segmented virus, is specified using IUPAC ambiguity codes in the consensus template sequence to represent the allelic diversity of the target population. PCR primer pairs are then selected computationally to produce a minimal amplicon set capable of tiling across the full length of the specified target region. As part of the tiling process, primer pairs are computationally screened to meet the criteria for successful PCR with one of two described amplification protocols. The actual sequencing success rates for designed primers for measles virus, mumps virus, human parainfluenza virus 1 and 3, human respiratory syncytial virus A and B and human metapneumovirus are described, where >90% of designed primer pairs were able to consistently successfully amplify >75% of the isolates. Conclusions Augmenting our previously developed and published JCVI Primer Design Pipeline, we achieved similarly high sequencing success rates with only minor software modifications. The recommended methodology for the construction of the consensus

Primer reporte de miasis hospitalaria por Lucilia cuprina (Diptera: Calliphoridae en Costa Rica

Directory of Open Access Journals (Sweden)

Lucía Quesada-Lobo

2012-12-01

Full Text Available Introducción. Las miasis hospitalarias son entidades con una importancia manifiesta en salud pública. La documentación de este tipo de casos es escasa en la literatura biomédica regional y mundial. Objetivo. Informar un caso de miasis hospitalaria en Costa Rica, donde el agente etiológico implicado fue Lucilia cuprina (Diptera: Calliphoridae. Este caso de miasis hospitalaria figura como el primer informe para Latinoamérica asociado con este agente etiológico. Presentación del caso. Una paciente de 91 años de edad, con signos de inmunosupresión, afectación grave de la función pulmonar y asistencia respiratoria mecánica, presentó larvas en ambas fosas nasales al séptimo día después del ingreso hospitalario. Varios ejemplares fueron recolectados y procesados para su identificación. La identificación taxonómica de los ejemplares recolectados estableció que la especie de los muscomorfos correspondía a L. cuprina. Conclusión. El presente constituye el primer caso de miasis hospitalaria por L. cuprina en la literatura biomédica de Costa Rica y el primero registrado en Latinoamérica.   doi: http://dx.doi.org/10.7705/biomedica.v32i4.690

Freshwater Wetlands: A Citizen's Primer.

Science.gov (United States)

Catskill Center for Conservation and Development, Inc., Hobart, NY.

The purpose of this "primer" for the general public is to describe the general characteristics of wetlands and how wetland alteration adversely affects the well-being of humans. Particular emphasis is placed on wetlands in New York State and the northeast. Topics discussed include wetland values, destruction of wetlands, the costs of…

Quantitative Microbial Risk Assessment Tutorial - Primer

Science.gov (United States)

This document provides a Quantitative Microbial Risk Assessment (QMRA) primer that organizes QMRA tutorials. The tutorials describe functionality of a QMRA infrastructure, guide the user through software use and assessment options, provide step-by-step instructions for implementi...

A tool for design of primers for microRNA-specific quantitative RT-qPCR. BMC Bioinformatics

DEFF Research Database (Denmark)

Busk, Peter Kamp

2014-01-01

of formation of secondary structures and primer dimers. Testing of the primers showed that 76 out of 79 primers (96%) worked for quantification of microRNAs by miR-specific RT-qPCR of mammalian RNA samples. This success rate corresponds to the success rate of manual primer design. Furthermore, primers designed......Background MicroRNAs are small but biologically important RNA molecules. Although different methods can be used for quantification of microRNAs, quantitative PCR is regarded as the reference that is used to validate other methods. Several commercial qPCR assays are available but they often come...... at a high price and the sequences of the primers are not disclosed. An alternative to commercial assays is to manually design primers but this work is tedious and, hence, not practical for the design of primers for a larger number of targets. Results I have developed the software miRprimer for automatic...

Modelos de aplicación de ecuaciones diferenciales de primer orden con geogebra: actividades para resolver problemas de mezclas

Directory of Open Access Journals (Sweden)

Cesar Augusto Hernández-Suarez

2016-09-01

Full Text Available El objetivo del estudio es diseñar una actividad para abordar los problemas de mezclas en un curso de ecuaciones diferenciales que permita realizar cambios de representación en los registros gráfico, algebraico y lengua natural mediante la ayuda de software libre Geogebra, esperando así reducir la dificultad que presentan los estudiantes al momento de plantear la ecuación diferencial que modela un problema de mezclas. La actividad se fundamenta en dos marcos, el didáctico y el matemático, los cuales fueron elaborados con los aportes de distintas fuentes consultadas acerca del objeto de investigación. La selección de los participantes fue realizada mediante muestreo intencional y durante el desarrollo de este proceso se eligieron dieciocho (18 estudiantes de un programa académico de Ingeniería Civil de un curso de ecuaciones diferenciales. Se aplicó una encuesta a los estudiantes sobre los modelos de aplicación de ecuaciones diferenciales de primer orden para determinar el modelo a utilizar; los modelos con mayor porcentaje de elección fueron: Mezclas y ley de enfriamiento de Newton, razón por la cual se eligió el modelo de mezclas para el diseño de una actividad tipo test con 3 problemas que para ser resueltos con el Geogebra. Se analizan las respuestas dadas por los estudiantes al resolver una serie de problemas de aplicación de primer orden con el software libre Geogebra. Estos problemas permiten realizar traspasos del registro lenguaje natural al algebraico mediante representaciones ejecutables y preguntas que pretenden orientar al estudiante durante el desarrollo de la misma, con el fin de proporcionar herramientas para plantear la ecuación diferencial que se ajusta a los problemas planteados. Como resultados se obtiene una propuesta del uso del Geogebra como un recurso didáctico para favorecer la resolución de problemas de aplicación de ecuaciones diferenciales de primer orden (problemas de mezclas. Se puede concluir

Improved group-specific primers based on the full SILVA 16S rRNA gene reference database.

Science.gov (United States)

Pfeiffer, Stefan; Pastar, Milica; Mitter, Birgit; Lippert, Kathrin; Hackl, Evelyn; Lojan, Paul; Oswald, Andreas; Sessitsch, Angela

2014-08-01

Quantitative PCR (qPCR) and community fingerprinting methods, such as the Terminal Restriction Fragment Length Polymorphism (T-RFLP) analysis,are well-suited techniques for the examination of microbial community structures. The use of phylum and class-specific primers can provide enhanced sensitivity and phylogenetic resolution as compared with domain-specific primers. To date, several phylum- and class-specific primers targeting the 16S ribosomal RNA gene have been published. However, many of these primers exhibit low discriminatory power against non-target bacteria in PCR. In this study, we evaluated the precision of certain published primers in silico and via specific PCR. We designed new qPCR and T-RFLP primer pairs (for the classes Alphaproteobacteria and Betaproteobacteria, and the phyla Bacteroidetes, Firmicutes and Actinobacteria) by combining the sequence information from a public dataset (SILVA SSU Ref 102 NR) with manual primer design. We evaluated the primer pairs via PCR using isolates of the above-mentioned groups and via screening of clone libraries from environmental soil samples and human faecal samples. As observed through theoretical and practical evaluation, the primers developed in this study showed a higher level of precision than previously published primers, thus allowing a deeper insight into microbial community dynamics.

Sensory reception of the primer pheromone ethyl oleate

Science.gov (United States)

Muenz, Thomas S.; Maisonnasse, Alban; Plettner, Erika; Le Conte, Yves; Rössler, Wolfgang

2012-05-01

Social work force distribution in honeybee colonies critically depends on subtle adjustments of an age-related polyethism. Pheromones play a crucial role in adjusting physiological and behavioral maturation of nurse bees to foragers. In addition to primer effects of brood pheromone and queen mandibular pheromone—both were shown to influence onset of foraging—direct worker-worker interactions influence adult behavioral maturation. These interactions were narrowed down to the primer pheromone ethyl oleate, which is present at high concentrations in foragers, almost absent in young bees and was shown to delay the onset of foraging. Based on chemical analyses, physiological recordings from the antenna (electroantennograms) and the antennal lobe (calcium imaging), and behavioral assays (associative conditioning of the proboscis extension response), we present evidence that ethyl oleate is most abundant on the cuticle, received by olfactory receptors on the antenna, processed in glomeruli of the antennal lobe, and learned in olfactory centers of the brain. The results are highly suggestive that the primer pheromone ethyl oleate is transmitted and perceived between individuals via olfaction at close range.

The Corrosion Protection of 2219-T87 Aluminum by Organic and Inorganic Zinc-Rich Primers

Science.gov (United States)

Danford, M. D.; Mendrek, M. J.; Walsh, D. W.

1995-01-01

The behavior of zinc-rich primer-coated 2219-T87 aluminum in a 3.5-percent Na-Cl was investigated using electrochemical techniques. The alternating current (ac) method of electrochemical impedance spectroscopy (EIS), in the frequency range of 0.001 to 40,000 Hz, and the direct current (dc) method of polarization resistance (PR) were used to evaluate the characteristics of an organic, epoxy zinc-rich primer and an inorganic, ethyl silicate zinc-rich primer. A dc electrochemical galvanic corrosion test was also used to determine the corrosion current of each zinc-rich primer anode coupled to a 2219-T87 aluminum cathode. Duration of the EIS/PR and galvanic testing was 21 days and 24 h, respectively. The galvanic test results demonstrated a very high galvanic current between the aluminum cathode and both zinc-rich primer anodes (37.9 pA/CM2 and 23.7 pA/CM2 for the organic and inorganic primers, respectively). The PR results demonstrated a much higher corrosion rate of the zinc in the inorganic primer than in the organic primer, due primarily to the higher porosity in the former. Based on this investigation, the inorganic zinc-rich primer appears to provide superior galvanic protection and is recommended for additional study for application in the solid rocket booster aft skirt.

Evaluación de la transmisión vertical de Bartonella bacilliformis en Lutzomyia verrucarum (Diptera: Psychodidae

Directory of Open Access Journals (Sweden)

Carlos Ponce G

2002-04-01

Full Text Available Objetivos: Identificar la existencia de transmisión vertical de Bartonella bacilliformis en Lutzomyia verrucarum. Materiales y métodos: en este estudio experimental, se realizó la crianza individual y masiva (Tº 22°C±2ºC, humedad relativa: 80%±5% de Lutzomyia verrucarum en el Laboratorio de Entomología del Centro de Investigaciones del Hospital de Caraz (Ancash- Perú. Con la finalidad de lograr la infección de las hembras se procedió a alimentarlas con sangre infectada obtenida por éstas directamente al picar la piel de pacientes con bartonelosis aguda frotis positivo. Las hembras, luego de poner sus huevos, fueron evaluadas a través de la prueba de PCR para Bartonella baciliformis. Resultados: 13 de 18 (72,2% hembras alimentadas con sangre infectada con bacteremia al 3% lograron poner huevos y de éstas ninguna resultó ser positiva al PCR. 12 de 54 (22,2% hembras alimentadas con sangre infectada con bacteremia al 80% ovipusieron y de éstas sólo una (8,3% resultó ser positiva al PCR. Ninguno de los descendientes adultos de esta hembra resultó positivo al PCR. Conclusiones: el bajo porcentaje de infección por Bartonella baciliformis encontrado en hembras oviponedoras no permitió determinar la existencia de transmisión vertical de Bartonella bacilliformis en Lutzomyia verrucarum.

El Marketing Sensorial : Un estudio empírico aplicado al marketing olfativo

OpenAIRE

Hernández Callejón, Mario

2016-01-01

En cuanto a la estructura del trabajo, será la siguiente: En primer lugar,bloque de introducción a la importancia de la experiencia en el proceso de compra. En segundo lugar, bloque dedicado al marketing sensorial. El tercer bloque irá destinado al diseño de la investigación en la que se analizará el efecto del olfato sobre el recuerdo. Finalmente, estableceremos las oportunas conclusiones, así como futuras líneas de investigación. Facultad de Ciencias de la Empresa Universidad Politécn...

Presentación del primer caso humano de parasitismo por Macracanthorhynchus hirudinaceus en el Perú y breve revisión

Directory of Open Access Journals (Sweden)

María Beltrán F. de Estrada

1997-07-01

Full Text Available Se reporta un caso humano portador de Macracanthorhynchus hirudinaceus. Se trata de un varón de 45 años de edad, natural de la provincia de Chota, departamento de Cajamarca, Perú; con molestias digestivas. El diagnóstico se hizo por el hallazgo de huevos de Macracanthorhynchus hirudinaceus en las heces. Además se encontró Trichuris trichiura, Ancylostoma duodenale, Trichostrongylus sp, Blastocystis hominis y Entamoeba coli. Esta es la primera comunicación de un caso humano de M. hirudinaceus para el Perú.

PRIMEGENSw3: a web-based tool for high-throughput primer and probe design.

Science.gov (United States)

Kushwaha, Garima; Srivastava, Gyan Prakash; Xu, Dong

2015-01-01

Highly specific and efficient primer and probe design has been a major hurdle in many high-throughput techniques. Successful implementation of any PCR or probe hybridization technique depends on the quality of primers and probes used in terms of their specificity and cross-hybridization. Here we describe PRIMEGENSw3, a set of web-based utilities for high-throughput primer and probe design. These utilities allow users to select genomic regions and to design primer/probe for selected regions in an interactive, user-friendly, and automatic fashion. The system runs the PRIMEGENS algorithm in the back-end on the high-performance server with the stored genomic database or user-provided custom database for cross-hybridization check. Cross-hybridization is checked not only using BLAST but also by checking mismatch positions and energy calculation of potential hybridization hits. The results can be visualized online and also can be downloaded. The average success rate of primer design using PRIMEGENSw3 is ~90 %. The web server also supports primer design for methylated sequences, which is used in epigenetic studies. Stand-alone version of the software is also available for download at the website.

GST-PRIME: an algorithm for genome-wide primer design.

Science.gov (United States)

Leister, Dario; Varotto, Claudio

2007-01-01

The profiling of mRNA expression based on DNA arrays has become a powerful tool to study genome-wide transcription of genes in a number of organisms. GST-PRIME is a software package created to facilitate large-scale primer design for the amplification of probes to be immobilized on arrays for transcriptome analyses, even though it can be also applied in low-throughput approaches. GST-PRIME allows highly efficient, direct amplification of gene-sequence tags (GSTs) from genomic DNA (gDNA), starting from annotated genome or transcript sequences. GST-PRIME provides a customer-friendly platform for automatic primer design, and despite the relative simplicity of the algorithm, experimental tests in the model plant species Arabidopsis thaliana confirmed the reliability of the software. This chapter describes the algorithm used for primer design, its input and output files, and the installation of the standalone package and its use.

Determinación del umbral de detección de Pseudococcus viburni (Hemiptera: Pseudococcidae por PCR Determination of the detection threshold of Pseudococcus viburni (Hemiptera: Pseudococcidae by PCR

Directory of Open Access Journals (Sweden)

Diana Vera

2012-06-01

Full Text Available La cochinilla harinosa de los frutales Pseudococcus viburni (Signoret es una plaga cuarentenaria, presente en el Alto Valle de Río Negro y Neuquén, Argentina. Su detección durante la fiscalización aduanera, aun en los estados inmaduros, provoca rechazos de la fruta fresca argentina con destino a los mercados internacionales. Las técnicas actuales de identificación de pseudocóccidos y otros cocoideos implican la realización de preparados microscópicos que requieren varios días. Por esto, la disminución de los tiempos de identificación es importante sobre todo en las tareas de fiscalización. En este trabajo, se determinó el umbral de detección específica de P. viburni mediante PCR, como así también, la implementación de un método rápido de extracción de ADN mediante DNAzolT. Insectos de diferentes estados de desarrollo (huevo, ninfas (tres estados ninfales y adulto, conservados en etanol pro análisis a -20 ºC, provenientes de montes frutales del Alto Valle, Argentina, fueron procesados según el protocolo del fabricante y se logró obtener ADN de buena calidad y concentración. Una alícuota del mismo fue utilizado como templado para una reacción de PCR usando primers específicos para P. viburni, registrados en bibliografía y como control positivo ADN de P. viburni de colección entomológica. Los primers utilizados y sus secuencias son A4 (5'-cccgcggccgttctctcttt-3' y A5 (5'-atatgttgtgcatagttgtgtgtgcgc-3', diseñados por Beuning et al. (1999. La amplificación generó una banda de peso molecular esperado de 650 pb. en gel de agarosa al 1.5% en todos los estadios, se determinó como límite de detección el estado de huevo. Esta técnica constituye una detección específica de P. viburni en un lapso máximo de 48 h.The obscure mealybug Pseudococcus viburni (Signoret is a quarantine pest present in the Upper Valley of Río Negro and Neuquén, Argentina. The detection of any growth stage of the mealybug in quarantine

Estabilidad oxidativa de huevos enriquecidos con ácidos grasos poliinsaturados omega 3, frente a antioxidantes naturales Estabilidade oxidativa de ovos enriquecidos com ácidos graxos poliinsaturados ômega 3, frente a antioxidantes naturais

Directory of Open Access Journals (Sweden)

María Elena Bernal Gómez

2003-12-01

Full Text Available Fueron alimentadas 192 gallinas ponedoras de 22 semanas de edad, de linaje comercial Babcock, durante 30 días con dietas de 0 (cero y 12,7% de semilla de linaza molida que corresponde a 0 y 5% de aceite de linaza, respectivamente. Fueron definidos 8 tratamientos: 4 grupos con 12,7% de semilla de linaza (control/sin antioxidante; BHA+BHT, 100+100 ppm; orégano, 200 ppm; romero, 200 ppm y 4 grupos sin semilla de linaza, pero utilizando los mismos antioxidantes. Este estudio fue realizado con el objetivo de verificar la eficacia del uso de antioxidantes naturales provenientes del orégano y del romero en la protección contra el deterioro oxidativo de la fracción lipídica de las yemas de los huevos enriquecidos con ácidos grasos poliinsaturados omega 3 (PUFA É-3. El grado de oxidación lipídica fue determinado a través de la prueba TBARS (substancias reactivas con ácido tiobarbitúrico. Según los resultados obtenidos, fue verificada diferencia significativa en la reducción del grado de oxidación lipídica de las yemas de huevo en todos los tratamientos con antioxidantes, cuando se compara con el control. Por lo tanto, los extratos de los condimentos, romero y orégano, pueden ser utilizados satisfactoriamente para obtener huevos enriquecidos con PUFA É-3, mejorando la estabilidad lipídica.Foram alimentadas 192 galinhas poedeiras de 22 semanas de idade da linhagem comercial Babcock, durante 30 dias com dietas constituídas de 0 (zero e 12,7% de semente de linhaça moída correspondente a 0 e 5% de óleo de linhaça, respectivamente. Foram definidos 8 tratamentos: 4 grupos com 5% de óleo de linhaça (controle/sem antioxidante; BHA+BHT, 100+100 ppm; orégano, 200 ppm; alecrim, 200 ppm e 4 grupos sem óleo de linhaça, mas utilizando os mesmos antioxidantes. Este estudo foi realizado com o objetivo de verificar a eficácia do uso de antioxidantes naturais provenientes do orégano e do alecrim, na proteção contra a deteriora

Trasplante simultáneo de páncreas y riñón: reporte del primer caso realizado en el Perú

Directory of Open Access Journals (Sweden)

José De Vinatea

2010-04-01

Full Text Available El trasplante simultáneo de páncreas y riñón es la opción terapéutica ideal para pacientes con diabetes mellitus tipo 1 con insuficiencia renal crónica. Permite recuperar la insulino-independencia y evita la necesidad de diálisis, mejorando notablemente la calidad de vida. Así mismo, la restitución de la euglicemia logra que las complicaciones tardías de la diabetes no progresen e incluso regresionen, prolongando la supervivencia global de estos pacientes. Estos beneficios superan a los riesgos de la cirugía y de la inmunosupresión inherentes al trasplante. A nivel mundial, desde 1966, en que se llevó a cabo el primer trasplante de páncreas en Minnesota (Estados Unidos, se han registrado más de 20 000 trasplantes de páncreas, con resultados cada vez mejores gracias al refinamiento en las técnicas quirúrgicas y a los nuevos esquemas de inmunosupresión. En el presente caso clínico, se reporta y describe la realización del primer trasplante simultáneo de páncreas y riñón en el Perú.

Accidentes laborales asociados al desánimo de médicos SERUMS para laborar en el primer nivel de atención de Lima, Perú

Science.gov (United States)

Mejia, Christian R.; Valladares-Garrido, Mario J.; Romero, Brian M.; Valladares-Garrido, Danai; Linares-Reyes, Edgardo

2018-01-01

Introducción la retención laboral es un tema de suma importancia, porque se requiere de profesionales en el primer nivel de atención (PNA). El objetivo fue determinar si los accidentes laborales se asociaron al desánimo de los médicos para trabajar en el PNA de Lima, Perú. Métodos estudio transversal analítico de datos secundarios de una base de datos generada de una encuesta a médicos que realizaron su Servicio Rural y Urbano-Marginal en Salud (SERUMS). Se incluyó solo a los médicos que manifestaron al inicio del SERUMS que podían trabajar en el PNA de Lima. Se definió como cambio de intención de trabajo en el PNA a los que finalizando el SERUMS refirieron que ya no deseaban laborar en Lima. Esto se asoció según si tuvieron un accidente laboral y se ajustó por otras variables. Resultados de los 124 médicos el 63% fueron hombres (78). La mediana de edad fue de 26 años (rango intercuartílico: 25-27 años). Después de su SERUMS, el 12% (15) manifestó que cambió su interés y que deseaba trabajar en la capital. En el análisis multivariado, haber tenido un accidente laboral disminuyó la frecuencia del cambio de intención de trabajo en el PNA (RPa: 0.28, IC 95%: 0.14-0.54, p de trabajar en provincias, pero nuestro estudio dice lo contrario, posiblemente por la percepción de que un trabajo en la capital del país permite estar más cerca de los servicios para ser atendido en caso de cualquier emergencia. PMID:29190859

Biología del Trips Frankliniella Occidentalis (Pegande (Thysanoptera: thripidae sobre Crisantemo Chrysanthemum morifolium l. bajo condiciones de laboratorio Developmentaland reproductive biology of Frankliniella Occidentslis (Pegande (Thysanoptera: thripidae on Chrysanthemum

Directory of Open Access Journals (Sweden)

Cardenas Estrella

1989-12-01

Full Text Available La especie Frankliniella occidentalis (Pegande se encontró causando daño a flores de crisantemo en una empresa de la
Sabana de Bogotá. Se estudió su biología bajo condiciones de laboratorio (24,31 ± 2,50C y 66,36 ± 12% H.R.. El rango de
duración en días de su ciclo de vida fue: huevo 4-5, ninfa de primer instar 3-4, ninfa de segundo instar 5-8, prepupa 4-6, pupa 3-5 y los adultos alcanzaron una longevidad entre 60 y 121 días. Esta especie presentó partenogénesis de tipo arrenotoquia; de las hembras fecundadas se obtuvo una generación
de 87,5% hembras y 12% machos. La fecundidad por partenogénesis fue de 325,7 huevos por hembra y la sexual de
303,1 huevos por hembra.F. occidentelis (Pegande was found to be an important pest in chrysanthemum green houses at the Bogotá Plateau.
We studied its biology under lab conditions (24 ± 2.50C and 66 ± 12% R.H.. Its life cycle was egg 4-5 days, first instar nymph 3-4 days, second instar nymph 5-3 day prepupa 4-6 days, pupa 3-5 days and the adults had a longevity between 60 and 121
days. Females reproduce by parthenogenesis (Arrhenotoky in the absence of males. Fertilized females produced 87.5% females and 12% males. Fecundity of parthenogenetic females was 325.7 eggs per female. Fecundity of sexually reproduced females was 303.1 eggs per female.

Evolución del peso en pacientes durante el primer año del trasplante renal

Directory of Open Access Journals (Sweden)

Pilar López Garrigós

Full Text Available Durante el primer año de trasplante renal es frecuente una ganancia de peso, debido, entre otros a la dieta, sedentarismo, e inmunosupresores, pudiendo aumentar los factores de riesgo del síndrome metabólico. Objetivos: Conocer la evolución del peso de nuestros pacientes durante el primer año del trasplante, y analizar la influencia con las distintas variables asociadas al paciente, sexo, edad, IMC, tratamiento inmunosupresor entre otras. Determinar la asociación entre la ganancia de peso y la aparición de factores de riesgo, como hipertensión arterial, diabetes y dislipidemia. Material y Método: Estudio retrospectivo y analítico. Se estudiaron 100 pacientes con un año de evolución en el trasplante, del Hospital Virgen de la Salud de Toledo. Sé analizaron datos antropométricos, demográficos y clínicos. La ganancia de peso se distribuyo según a las variables del estudio. Resultados: La ganancia de peso al año del trasplante afecto a 93 pacientes, con una media de 7,21 kg ±5,87. El 44,1% aumento su peso por encima de la media, y el 23,7% gano > 10 kg. La prevalencia de sobrepeso y obesidad antes del trasplante fue 57% y 76% después del trasplante. Los hombres ganaron ligeramente más peso que las mujeres. Los más jóvenes < 49 años ganaron más peso, media 9,3 kg. Mayor incidencia de diabetes, hipertensión y dislipemias en los pacientes con sobrepeso y obesidad. Conclusiones: La mayoría de los pacientes aumentaron significativamente de peso al año del trasplante, asociándose con varios de los factores del síndrome metabólico. - Importante la educación, por parte de la enfermería, del paciente para fomentar hábitos de vida saludable.

Primer-dependent and primer-independent initiation of double stranded RNA synthesis by purified arabidopsis RNA-dependent RNA polymerases RDR2 and RDR6

DEFF Research Database (Denmark)

Devert, Anthony; Fabre, Nicolas; Floris, Maina Huguette Joséphine

2015-01-01

) targeted by RNA silencing. The dsRNA is subsequently cleaved by the ribonuclease DICER-like into secondary small interfering RNAs (siRNAs) that reinforce and/or maintain the silenced state of the target RNA. Models of RNA silencing propose that RDRs could use primer-independent and primer......Cellular RNA-dependent RNA polymerases (RDRs) are fundamental components of RNA silencing in plants and many other eukaryotes. In Arabidopsis thaliana genetic studies have demonstrated that RDR2 and RDR6 are involved in the synthesis of double stranded RNA (dsRNA) from single stranded RNA (ssRNA......-dependent initiation to generate dsRNA from a transcript targeted by primary siRNA or microRNA (miRNA). However, the biochemical activities of RDR proteins are still partly understood. Here, we obtained active recombinant RDR2 and RDR6 in a purified form. We demonstrate that RDR2 and RDR6 have primer...

Bioinspired Catecholic Primers for Rigid and Ductile Dental Resin Composites.

Science.gov (United States)

Shin, Eeseul; Ju, Sung Won; An, Larry; Ahn, Eungjin; Ahn, Jin-Soo; Kim, Byeong-Su; Ahn, B Kollbe

2018-01-17

In the construction of dental restorative polymer composite materials, surface priming on mineral fillers is essential to improve the mechanical performance of the composites. Here we present bioinspired catechol-functionalized primers for a tougher dental resin composite containing glass fillers. The catecholic primers with different polymerizable end groups were designed and then coated on glass surfaces using a simple drop-casting or dip-coating process. The surface binding ability and possible cross-linking (coupling or chemical bridging between the glass substrate and the dental resin) of the catecholic bifunctional primers were evaluated using atomic force microscopy, contact angle measurements, and the knife shear bonding test and compared to a state-of-the-art silane-based coupling agent. Various mechanical tests including shrinkage and compression tests of the dental resin composites were also conducted. Compression tests of the composites containing the catecholic primed fillers exhibited enhanced mechanical properties, owing to the bidentate hydrogen bonding of catechol moieties to the oxide mineral surface. Furthermore, the superior biocompatibility of the primed surface was confirmed via cell attachment assay, thus providing applicability of catecholic primers for practical dental and biomedical applications.

Nonspecific amplification of human DNA by Streptococcus pneumoniae LytA primer

Directory of Open Access Journals (Sweden)

Helen Hencida Thangamony

2018-01-01

Full Text Available Background: Determination of various analytical parameters is essential for the validation of primers used for in-house nucleic acid amplification tests. While standardising a high-resolution melt analysis (HRMA for detection of Streptococcus pneumoniae in acute pyogenic meningitis, we encountered non-specific amplification of certain base pair sequences of human DNA by Centers for Disease Control & Prevention, USA recommended S. pneumoniae LytA primer. Materials and Methods: HRMA was standardised using DNA extracted from an ATCC strain of S. pneumoniae using SP LytA F373 primer and Type-it HRMTM polymerase chain reaction kit in Rotor-Gene Q Thermal Cycler according to the manufacturer's instructions. Specificity of the primers was determined in dry and wet laboratory experiments against diverse related and unrelated microbial pathogens by HRMA and on DNA extracted from unspiked clinical samples negative for SP DNA. Sensitivity was determined by calculating lower limit of detection threshold in experiments with spiked samples. The amplicon from spiked experiments was sequenced and analysed through Gene Bank. Results: Our dry/wet laboratory experiments showed two separate curves and different Tm values indicating certain non-specific amplification by the primer. Basic Local Alignment Search Tool (BLAST analysis of the amplicon obtained in the spiked experiment showed sequences of human chromosome 20 associated with Homo sapiens protein tyrosine phosphatase, receptor type T gene. The problem was resolved by stopping the reaction at 30th Ct cycle and observing the Tm values. Conclusion: Since HRMA is done without a specific probe, one should be aware of non-specific amplifications while using primers for HRMA of human clinical samples.

The R primer

CERN Document Server

Ekstrom, Claus Thorn

2011-01-01

Newcomers to R are often intimidated by the command-line interface, the vast number of functions and packages, or the processes of importing data and performing a simple statistical analysis. The R Primer provides a collection of concise examples and solutions to R problems frequently encountered by new users of this statistical software.Rather than explore the many options available for every command as well as the ever-increasing number of packages, the book focuses on the basics of data preparation and analysis and gives examples that can be used as a starting point. The numerous examples i

Primer sets for cloning the human repertoire of T cell Receptor Variable regions.

Science.gov (United States)

Boria, Ilenia; Cotella, Diego; Dianzani, Irma; Santoro, Claudio; Sblattero, Daniele

2008-08-29

Amplification and cloning of naïve T cell Receptor (TR) repertoires or antigen-specific TR is crucial to shape immune response and to develop immuno-based therapies. TR variable (V) regions are encoded by several genes that recombine during T cell development. The cloning of expressed genes as large diverse libraries from natural sources relies upon the availability of primers able to amplify as many V genes as possible. Here, we present a list of primers computationally designed on all functional TR V and J genes listed in the IMGT, the ImMunoGeneTics information system. The list consists of unambiguous or degenerate primers suitable to theoretically amplify and clone the entire TR repertoire. We show that it is possible to selectively amplify and clone expressed TR V genes in one single RT-PCR step and from as little as 1000 cells. This new primer set will facilitate the creation of more diverse TR libraries than has been possible using currently available primer sets.

THE QUALITY IMPROVEMENT OF PRIMER PACKAGING PROCESS USING SIX SIGMA METHODOLOGY

Directory of Open Access Journals (Sweden)

Prima Ditahardiyani

2008-01-01

Full Text Available The implementation of Six Sigma has become a common theme in many organizations. This paper presents the Six Sigma methodology and its implementation in a primer packaging process of Cranberry drink. DMAIC (Define, Measure, Analyze, Improve and Control approach is used to analyze and to improve the primer packaging process, which have high variability and defects output. After the improvement, the results showed that there was an increasing sigma level. However, it is not significantly and has not achieved the world standard quality, yet. Therefore, the implementation of Six Sigma in primer packaging process of Cranberry drink still has a room for doing a further research.

Neurociencia y bilingüismo: efecto del primer idioma

Directory of Open Access Journals (Sweden)

Germary Díaz-Sánchez

2013-08-01

Full Text Available Desde la perspectiva neurobiológica, en este trabajo abordamos los efectos del idioma materno sobre el aprendizaje de una segunda lengua. Aunque existen investigaciones en diferentes países sobre este problema, pocas tratan el enfoque de la neurobiología y, menos aún, cuando se trata del español como idioma materno. Para la investigación se recopiló literatura descriptiva y experimental, con el fin de obtener los datos necesarios para alcanzar los objetivos; se realizó un metaanálisis cualitativo de los datos obtenidos, utilizando tablas de correlación. Los datos reflejaron que la adquisición de un segundo idioma siempre va a estar mediatizada por los esquemas ya establecidos del primer idioma y que existen aspectos neurobiológicos que subyacen a algunos mecanismos de interferencia y a la adquisición de un segundo lenguaje. Además, encontramos que, mientras más similares sean los idiomas, los mecanismos neurales subyacentes facilitan la transferencia del uno al otro.

Cross-kingdom amplification using bacteria-specific primers: complications for studies of coral microbial ecology.

Science.gov (United States)

Galkiewicz, Julia P; Kellogg, Christina A

2008-12-01

PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem.

Cross-Kingdom Amplification Using Bacteria-Specific Primers: Complications for Studies of Coral Microbial Ecology▿

OpenAIRE

Galkiewicz, Julia P.; Kellogg, Christina A.

2008-01-01

PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem.

Molecular passportization of clones of karelian birch using PCRwith semi-specific primers

Directory of Open Access Journals (Sweden)

Tatyana V Matveeva

2008-09-01

Full Text Available Using 4 clones of Karelian birch (Betula pendula Roth var caretica Merckl. from the collection of the karelian birch of the laboratory of genetics of Research Institute of Forest Genetics and Breeding, Voronezh, one normal tree of Betula pendula Roth, and one tree of B. pubescens Ehrh., collected from the nature, we have analyzed the possibility of application of PCR with semi-specific primers for molecular typing. We found primers with high percentage of polymorphic markers. These primers could be recommended for molecular typing of birch.

Cross-Kingdom Amplification Using Bacteria-Specific Primers: Complications for Studies of Coral Microbial Ecology▿

Science.gov (United States)

Galkiewicz, Julia P.; Kellogg, Christina A.

2008-01-01

PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. PMID:18931299

¿Qué textos leen en primer año los estudiantes de Psicología?

Directory of Open Access Journals (Sweden)

María Micaela Villalonga Penna

2016-11-01

Full Text Available Resumen Qué se lee en las universidades es una de las temáticas que han abordado los estudios realizados desde los enfoques de las Alfabetizaciones Académicas y de la Literacidad crítica. En este sentido, nos preguntamos ¿qué textos leen en primer año los estudiantes de psicología? Teniendo en cuenta este interrogante, en este trabajo presentamos el análisis del material bibliográfico del primer año de la carrera de psicología de una universidad estatal. Esta investigación se realizó desde los enfoques cualitativo y cuantitativo de investigación. Analizamos un corpus de 320 textos que corresponden al material bibliográfico de las nueve materias del primer año de la mencionada carrera. Empleamos las categorías de análisis propuestas por Carlino (2005, Padilla (2013 y Padilla, Douglas y López (2007; 2011, entre otras, y tuvimos en cuenta categorías emergentes también. Los hallazgos dieron a conocer el uso de ´cuadernillos´, que incluyen fotocopias del material bibliográfico que pueden o no contar con elementos que ayuden a contextuarlo como copias de la tapa y contratapa, página con datos de edición, índice y referencias completas. El material bibliográfico está constituido por textos académicos derivados de textos científicos, entre los que priman los capítulos de libros y las fichas de cátedra. Además, estos textos son predominantemente expositivos o argumentativos.

¿Qué textos leen en primer año los estudiantes de Psicología?

Directory of Open Access Journals (Sweden)

María Micaela Villalonga Penna

Full Text Available Resumen Qué se lee en las universidades es una de las temáticas que han abordado los estudios realizados desde los enfoques de las Alfabetizaciones Académicas y de la Literacidad crítica. En este sentido, nos preguntamos ¿qué textos leen en primer año los estudiantes de psicología? Teniendo en cuenta este interrogante, en este trabajo presentamos el análisis del material bibliográfico del primer año de la carrera de psicología de una universidad estatal. Esta investigación se realizó desde los enfoques cualitativo y cuantitativo de investigación. Analizamos un corpus de 320 textos que corresponden al material bibliográfico de las nueve materias del primer año de la mencionada carrera. Empleamos las categorías de análisis propuestas por Carlino (2005, Padilla (2013 y Padilla, Douglas y López (2007; 2011, entre otras, y tuvimos en cuenta categorías emergentes también. Los hallazgos dieron a conocer el uso de ´cuadernillos´, que incluyen fotocopias del material bibliográfico que pueden o no contar con elementos que ayuden a contextuarlo como copias de la tapa y contratapa, página con datos de edición, índice y referencias completas. El material bibliográfico está constituido por textos académicos derivados de textos científicos, entre los que priman los capítulos de libros y las fichas de cátedra. Además, estos textos son predominantemente expositivos o argumentativos.

Specific primer design of mitochondrial 12S rRNA for species identification in raw meats

Science.gov (United States)

Cahyadi, M.; Puruhita; Barido, F. H.; Hertanto, B. S.

2018-01-01

Polymerase chain reaction (PCR) is a molecular technique that widely used in agriculture area including species identification in animal-based products for halalness and food safety reasons. Amplification of DNA using PCR needs a primer pair (forward and reverse primers) to isolate specific DNA fragment in the genome. This objective of this study was to design specific primer from mitochondrial 12S rRNA region for species identification in raw beef, pork and chicken meat. Three published sequences, HQ184045, JN601075, and KT626857, were downloaded from National Center for Biotechnology Information (NCBI) website. Furthermore, those reference sequences were used to design specific primer for bovine, pig, and chicken species using primer3 v.0.4.0. A total of 15 primer pairs were picked up from primer3 software. Of these, an universal forward primer and three reverse primers which are specific for bovine, pig, and chicken species were selected to be optimized using multiplex-PCR technique. The selected primers were namely UNIF (5’-ACC GCG GTC ATA CGA TTA AC-3’), SPR (5’-AGT GCG TCG GCT ATT GTA GG-3’), BBR (5’-GAA TTG GCA AGG GTT GGT AA-3’), and AR (5’-CGG TAT GTA CGT GCC TCA GA-3’). In addition, the PCR products were visualized using 2% agarose gels under the UV light and sequenced to be aligned with reference sequences using Clustal Omega. The result showed that those primers were specifically amplified mitochondrial 12S rRNA regions from bovine, pig, and chicken using PCR. It was indicated by the existence of 155, 357, and 611 bp of DNA bands for bovine, pig, and chicken species, respectively. Moreover, sequence analysis revealed that our sequences were identically similar with reference sequences. It can be concluded that mitochondrial 12S rRNA may be used as a genetic marker for species identification in meat products.

El primer virreinato americano

Directory of Open Access Journals (Sweden)

Cassá, Roberto

2006-12-01

Full Text Available This article explores the government of viceroy Christopher Columbus in the American territories. We return to the first Spanish settlement in Santo Domingo and the contradictions inherent to this expansionist proyect. The contradictions were part of the logic of the absolutist state and Columbus’ reaction against the controls imposed by the monarchs. Secondly, we look into the dificulties that the Admiral encountered to develop a mercantilist model. In this context, we examine the rationale behind the first government of the Indies and the features that defined the new West Indian society.

El artículo trata sobre el gobierno de Cristóbal Colón en tierras americanas. Retomamos el tema del primer emplazamiento español en Santo Domingo y las contradicciones que tuvo aquel proyecto debido a la lógica del estado absolutista, a la ambición desmedida del descubridor y a su reacción ante los controles que desde un principio impusieron los monarcas. En un segundo momento analizamos las dificultades que encontró el Almirante para desarrollar un modelo mercantilista acorde a sus ideas y a los acuerdos a que llegó con la Corona. En ese contexto analizamos la lógica del primer gobierno colombinista en las Indias y los rasgos que definieron la nueva sociedad antillana.

Establecimiento de una metodología para la producción de semilla prebasica de papa criolla variedad "Yema de huevo" (Solanum phureja Juz et Buk a partir de minituberculos

Directory of Open Access Journals (Sweden)

Cotes Jose M.

1999-12-01

Full Text Available

En la actualidad, para la producción de semilla de papa, se utiliza, como herramienta, la técnica de micropropagacion, la cual garantiza, mediante un adecuado proceso. alta sanidad de los tubérculos semilla y una rápida multiplicación. En la papa diploide Solanum phureja cultivar "yema de huevo", la multiplicación "in vitro" fue desarrollada exitosamente y, par lo tanto, el paso siguiente, la producción de minituberculos en casa de malla (Semilla prebasica requiere de los estudios necesarios para optimizar esta fase. El presente trabajo tuvo como objetivo conocer la densidad y el tamaño del minituberculo semilla óptimos para desarrollar la producción de semilla prebasica en condiciones de casa malla. La investigación se realizo bajo un diseño completamente a1 azar, con arreglo factorial (4x3, siendo el primer factor la distancia entre plantas y, el segundo, cl diámetro del minituberculo semilla. El experimento se realizo en casa de malla en la Estación San Jorge del ICA a 2800 msnm y repetido durante dos semestres consecutivos. Se encontró que la distancia de 6 cm entre sitios de siembra optimiza la producción de semilla prebasica y la distancia de 12 cm entre sitios de siembra, la tasa de multiplicaci6n. Los mejores diámetros de minituberculo son los comprendidos entre 0,5 y 2 cm

Palabras claves:

Sediment transport primer: estimating bed-material transport in gravel-bed rivers

Science.gov (United States)

Peter Wilcock; John Pitlick; Yantao Cui

2009-01-01

This primer accompanies the release of BAGS, software developed to calculate sediment transport rate in gravel-bed rivers. BAGS and other programs facilitate calculation and can reduce some errors, but cannot ensure that calculations are accurate or relevant. This primer was written to help the software user define relevant and tractable problems, select appropriate...

Generation of sequence signatures from DNA amplification fingerprints with mini-hairpin and microsatellite primers.

Science.gov (United States)

Caetano-Anollés, G; Gresshoff, P M

1996-06-01

DNA amplification fingerprinting (DAF) with mini-hairpins harboring arbitrary "core" sequences at their 3' termini were used to fingerprint a variety of templates, including PCR products and whole genomes, to establish genetic relationships between plant tax at the interspecific and intraspecific level, and to identify closely related fungal isolates and plant accessions. No correlation was observed between the sequence of the arbitrary core, the stability of the mini-hairpin structure and DAF efficiency. Mini-hairpin primers with short arbitrary cores and primers complementary to simple sequence repeats present in microsatellites were also used to generate arbitrary signatures from amplification profiles (ASAP). The ASAP strategy is a dual-step amplification procedure that uses at least one primer in each fingerprinting stage. ASAP was able to reproducibly amplify DAF products (representing about 10-15 kb of sequence) following careful optimization of amplification parameters such as primer and template concentration. Avoidance of primer sequences partially complementary to DAF product termini was necessary in order to produce distinct fingerprints. This allowed the combinatorial use of oligomers in nucleic acid screening, with numerous ASAP fingerprinting reactions based on a limited number of primer sequences. Mini-hairpin primers and ASAP analysis significantly increased detection of polymorphic DNA, separating closely related bermudagrass (Cynodon) cultivars and detecting putatively linked markers in bulked segregant analysis of the soybean (Glycine max) supernodulation (nitrate-tolerant symbiosis) locus.

El aprendizaje de distintos dominios notacionales según niños de preescolar y primer grado

Directory of Open Access Journals (Sweden)

Nora Scheuer

2010-10-01

Full Text Available Se investiga si las concepciones de los niños acerca del aprendizaje adoptan matices diferentes según tres dominios notacionales: dibujo, escritura y notación numérica. Se entrevistó individualmente a 120 alumnos de preescolar (60 y primer grado (60 de escuelas públicas en Argentina. Se aplicó la lexicometría a las transcripciones de sus respuestas completas a tres preguntas referidas a la actividad, dificultades y metas en relación al propio aprendizaje del dibujo, escritura o notación numérica. Los resultados revelan diferencias significativas en cómo los niños refieren el contenido de aprendizaje y a sí mismos como aprendices según el dominio, indicando una teoría interpretativa del aprendizaje en relación al dibujo y la notación numérica, y una teoría directa en relación a la escritura.

El aprendizaje de distintos dominios notacionales según niños de preescolar y primer grado

Directory of Open Access Journals (Sweden)

Nora Scheuer

2010-01-01

Full Text Available Se investiga si las concepciones de los niños acerca del aprendizaje adoptan matices diferentes según tres dominios notacionales: dibujo, escritura y notación numérica. Se entrevistó individualmente a 120 alumnos de preescolar (60 y primer grado (60 de escuelas públicas en Argentina. Se aplicó la lexicometría a las transcripciones de sus respuestas completas a tres preguntas referidas a la actividad, dificultades y metas en relación al propio aprendizaje del dibujo, escritura o notación numérica. Los resultados revelan diferencias significativas en cómo los niños refieren el contenido de aprendizaje y a sí mismos como aprendices según el dominio, indicando una teoría interpretativa del aprendizaje en relación al dibujo y la notación numérica, y una teoría directa en relación a la escritura.

Microsatellite Primers in the Foundation Tree Species Pinus edulis and P. monophylla (Pinaceae

Directory of Open Access Journals (Sweden)

Andrew L. Krohn

2013-07-01

Full Text Available Premise of the study: Microsatellite primers were developed in the foundational tree species Pinus edulis to investigate population differentiation of P. edulis and hybridization among closely related species. Methods and Results: Using a hybridization protocol, primer sets for 11 microsatellite loci were developed using megagametophyte tissue from P. edulis and scored for polymorphism in three populations of P. edulis and a single P. monophylla population. The primers amplified simple and compound di-, tri-, and pentanucleotide repeats with two to 18 alleles per locus. Conclusions: These results demonstrate the utility of the described primers for studies of population differentiation within and among P. edulis populations as well as across putative hybrid zones where P. edulis may coexist with sister species.

In vivo effect of a self-etching primer on dentin.

Science.gov (United States)

Milia, E; Lallai, M R; García-Godoy, F

1999-08-01

To determine the ultrastructural aspects of the dentin collagen area in the cavity preparation floor produced in vivo after phosphoric acid acid-etching or after using Clearfil Liner Bond 2 self-etching primer (LB2 Primer). Twenty-four non-carious third molars scheduled for extraction from young adult patients (16-30 years old) were used. Conventional Class I cavities (+/- 2 mm deep) were prepared on the occlusal surfaces of all teeth using a cylindrical diamond bur on a high-speed handpiece with copious water spray. To avoid dehydration of the dentin, the smear layer-covered dentin was briefly air-dried for 2 seconds. Cavities were assigned at random to the following groups: Group A: Dentin etched for 15 seconds with 34% phosphoric acid, rinsed for 20 seconds and then briefly air-dried for 2 seconds with oil-free compressed air leaving the surfaces slightly moist. Group B: LB2 Primer was applied to the cavity surfaces for 30 seconds and then briefly air-dried to remove the solvent. Group C: The untreated dentin smear layer was used as a control. In all three groups, the cavities were filled incrementally with a resin-based composite (APX), light curing every increment for 40 seconds. After 30 minutes, the teeth were extracted atraumatically and the samples immediately prepared for evaluation with the transmission electron microscope. The use of a self-etching primer did not produce significant morphological changes in the moist dentin substrate. Adverse morphological conditions where observed when there was an excess water on the dentin surface. Phosphoric acid altered the collagen more severely than the self-etching primer.

Characteristics of the population employed in primer sector in Turkey

Directory of Open Access Journals (Sweden)

Bayar Rüya

2006-01-01

Full Text Available Activities related to the production of raw material like agriculture husbandry, forestry, fishery are called as primer activities. Especially people living in rural areas earn their livings on primer activities, mainly agriculture. Rural planning is inevitable for providing rural development which has an important place in all development of a country. And achievement of this planning depends on putting forth the characteristics of the population living in rural areas with its different aspects. Therefore, the requirements will be introduced more clearly and the increase in the welfare levels of the people living in rural areas will have been achieved. To achieve the rural development and progress, in addition to the features like the size of agricultural products, products that are cultivated, activities like husbandry, forestry, hunting, etc. and the qualities of the enterprises in which these activities are carried out, policies applied, capital, market and technology, the characteristics of the population employed in this sector is also of importance. Considering these points, what is aimed in this study is to put forth the characteristics of the population employed in primer sector in Turkey. According to the census results of the year 2000 in Turkey 38% of the population is employed, and 48% of this work is in primer sector.

Comparison among amoA Primers Suited for Quantification and Diversity Analyses of Ammonia-Oxidizing Bacteria in Soil

Science.gov (United States)

Shimomura, Yumi; Morimoto, Sho; Hoshino, Yuko Takada; Uchida, Yoshitaka; Akiyama, Hiroko; Hayatsu, Masahito

2012-01-01

Ammonia monooxygenase subunit A gene (amoA) is frequently used as a functional gene marker for diversity analysis of ammonia-oxidizing bacteria (AOB). To select a suitable amoA primer for real-time PCR and PCR-denaturing gradient gel electrophoresis (DGGE), three reverse primers (degenerate primer amoA-2R; non-degenerate primers amoA-2R-GG and amoA-2IR) were examined. No significant differences were observed among the three primers in terms of quantitative values of amoA from environmental samples using real-time PCR. We found that PCR-DGGE analysis with the amoA-2IR primer gave the best results in this studied soil. These results indicate that amoA-2IR is a suitable primer for community analysis of AOB in the environment. PMID:22075625

Menopause 101: A Primer for the Perimenopausal

Science.gov (United States)

... Abstracts Media Award Recipients Media Policy Media Requests Menopause 101: A primer for the perimenopausal The information ... about 2 years earlier. Common Body Changes at Menopause Each woman’s experience of menopause is different. Many ...

Clonorchis sinensis

Directory of Open Access Journals (Sweden)

Alfredo Guillén O

2004-07-01

Full Text Available Se presenta el caso de una paciente de origen asiático con un año de permanencia en el Perú, que acude a una clínica limeña por presentar diarrea acuosa, al realizar los análisis respectivos se encuentran huevos de Clonorchis sinensis.

Polyadenylated Sequencing Primers Enable Complete Readability of PCR Amplicons Analyzed by Dideoxynucleotide Sequencing

Directory of Open Access Journals (Sweden)

Martin Beránek

2012-01-01

Full Text Available Dideoxynucleotide DNA sequencing is one of the principal procedures in molecular biology. Loss of an initial part of nucleotides behind the 3' end of the sequencing primer limits the readability of sequenced amplicons. We present a method which extends the readability by using sequencing primers modified by polyadenylated tails attached to their 5' ends. Performing a polymerase chain reaction, we amplified eight amplicons of six human genes (AMELX, APOE, HFE, MBL2, SERPINA1 and TGFB1 ranging from 106 bp to 680 bp. Polyadenylation of the sequencing primers minimized the loss of bases in all amplicons. Complete sequences of shorter products (AMELX 106 bp, SERPINA1 121 bp, HFE 208 bp, APOE 244 bp, MBL2 317 bp were obtained. In addition, in the case of TGFB1 products (366 bp, 432 bp, and 680 bp, respectively, the lengths of sequencing readings were significantly longer if adenylated primers were used. Thus, single strand dideoxynucleotide sequencing with adenylated primers enables complete or near complete readability of short PCR amplicons.

Primer sets for cloning the human repertoire of T cell Receptor Variable regions

Directory of Open Access Journals (Sweden)

Santoro Claudio

2008-08-01

Full Text Available Abstract Background Amplification and cloning of naïve T cell Receptor (TR repertoires or antigen-specific TR is crucial to shape immune response and to develop immuno-based therapies. TR variable (V regions are encoded by several genes that recombine during T cell development. The cloning of expressed genes as large diverse libraries from natural sources relies upon the availability of primers able to amplify as many V genes as possible. Results Here, we present a list of primers computationally designed on all functional TR V and J genes listed in the IMGT®, the ImMunoGeneTics information system®. The list consists of unambiguous or degenerate primers suitable to theoretically amplify and clone the entire TR repertoire. We show that it is possible to selectively amplify and clone expressed TR V genes in one single RT-PCR step and from as little as 1000 cells. Conclusion This new primer set will facilitate the creation of more diverse TR libraries than has been possible using currently available primer sets.

Genus-Specific Primers for Study of Fusarium Communities in Field Samples

Science.gov (United States)

Edel-Hermann, Véronique; Gautheron, Nadine; Durling, Mikael Brandström; Kolseth, Anna-Karin; Steinberg, Christian; Persson, Paula; Friberg, Hanna

2015-01-01

Fusarium is a large and diverse genus of fungi of great agricultural and economic importance, containing many plant pathogens and mycotoxin producers. To date, high-throughput sequencing of Fusarium communities has been limited by the lack of genus-specific primers targeting regions with high discriminatory power at the species level. In the present study, we evaluated two Fusarium-specific primer pairs targeting translation elongation factor 1 (TEF1). We also present the new primer pair Fa+7/Ra+6. Mock Fusarium communities reflecting phylogenetic diversity were used to evaluate the accuracy of the primers in reflecting the relative abundance of the species. TEF1 amplicons were subjected to 454 high-throughput sequencing to characterize Fusarium communities. Field samples from soil and wheat kernels were included to test the method on more-complex material. For kernel samples, a single PCR was sufficient, while for soil samples, nested PCR was necessary. The newly developed primer pairs Fa+7/Ra+6 and Fa/Ra accurately reflected Fusarium species composition in mock DNA communities. In field samples, 47 Fusarium operational taxonomic units were identified, with the highest Fusarium diversity in soil. The Fusarium community in soil was dominated by members of the Fusarium incarnatum-Fusarium equiseti species complex, contradicting findings in previous studies. The method was successfully applied to analyze Fusarium communities in soil and plant material and can facilitate further studies of Fusarium ecology. PMID:26519387

La teoría APOE y su aplicación en la traducción de enunciados del lenguaje natural al lenguaje de la lógica de primer orden

OpenAIRE

Azcárate, Carmen; Manya, Felipe; Ramírez, José Luis

2004-01-01

Este trabajo es de carácter empírico-teórico y en él se describirán algunas de las dificultades observadas en estudiantes de Informática y Sistemas Computacionales, cuando intentan usar el lenguaje de la Lógica de primer orden (LPO) para representar enunciados del lenguaje natural (común), en un primer curso de Lógica. Las dificultades que se observaron, en la población de estudiantes a los que se les aplicó un cuestionario piloto, se relacionan con: enunciados cuantificados, sobre todo aquel...

Cross-kingdom amplification using Bacteria-specific primers: Complications for studies of coral microbial ecology

Science.gov (United States)

Galkiewicz, J.P.; Kellogg, C.A.

2008-01-01

PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. Copyright ?? 2008, American Society for Microbiology. All Rights Reserved.

Expectativas de laborar en el primer nivel de atención de salud de los estudiantes de una facultad de medicina de Lima, Perú

Directory of Open Access Journals (Sweden)

Carolina B Tarqui-Mamani

2015-01-01

Full Text Available Introducción: La situación sanitaria del Perú requiere que más profesionales de la salud brinden atención en los establecimientos de salud del primer nivel de atención, ubicados principalmente en las zonas periféricas, rurales o más pobres del país. Objetivo: Identificar expectativas laborales y personales de los futuros profesionales de la salud que son formados en una facultad de medicina de Lima, particularmente trabajar en el primer nivel de atención de salud. Diseño: Estudio observacional, descriptivo y exploratorio. Lugar: Facultad de Medicina, Universidad Nacional Mayor de San Marcos, Lima, Perú. Participantes: Estudiantes pre internado de las Escuelas Académico Profesionales. Intervenciones: El muestreo fue por conveniencia y se incluyó a 278 estudiantes de las 5 escuelas que conforman la facultad de medicina. Se aplicó un cuestionario ad hoc donde se preguntó aspectos relativos a las expectativas laborales, económicas y visión de los estudiantes como futuros profesionales. Se calculó promedios, desviación estándar, distribución de frecuencias, los intervalos de confianza al 95% con la prueba de Poissón y chi cuadrado. Principales medidas de resultados: Expectativa de laborar en el primer nivel de atención de salud. Resultados: El 50% de los estudiantes manifestó que les gustaría desarrollarse en el área asistencial; solo 14,5% expresó su intención de trabajar en el primer nivel de atención de salud (puestos y centros de salud, 87,1% consideró que estudiar en una universidad emblemática es una fortaleza que favorece su vida profesional y 57,6% que seguirá estudios de posgrado; 58,6% de los estudiantes señaló la intención de trabajar en Lima, 21,9% en provincias y 16,2% en el extranjero. El promedio de expectativa económica mensual fue el equivalente a 1 577 nuevos soles o poco más de 2 sueldos mínimos vitales previstos para el 2012. Conclusiones: La expectativa de los futuros profesionales de la

Primer registro de infestación en un reptil por larvas de Amblyomma parvitarsum (Acari: Ixodidae en Argentina

Directory of Open Access Journals (Sweden)

Gabriel Natalio Castillo

2015-05-01

Full Text Available Amblyomma parvitarsum es una garrapata endémica del Altiplano Andino de Argentina, Bolivia, Chile y Perú. En la provincia de San Juan adultos de esta garrapata fueron encontrados en el Parque Nacional San Guillermo sobre Vicugna vicugna. En Argentina también existen citas de adultos de A. parvitarsum sobre bovinos, ovinos y el ñandú . El primer caso de parasitismo de larvas de A. parvitarsum en Liolaemus fue realizado en Chile. El presente trabajo menciona por primera vez para Argentina la presencia de larvas de A. parvitarsum parasitando al lagarto Liolaemus eleodori.

Math primer for engineers

CERN Document Server

Cryer, CW

2014-01-01

Mathematics and engineering are inevitably interrelated, and this interaction will steadily increase as the use of mathematical modelling grows. Although mathematicians and engineers often misunderstand one another, their basic approach is quite similar, as is the historical development of their respective disciplines. The purpose of this Math Primer is to provide a brief introduction to those parts of mathematics which are, or could be, useful in engineering, especially bioengineering. The aim is to summarize the ideas covered in each subject area without going into exhaustive detail. Formula

A Quantum Groups Primer

Science.gov (United States)

Majid, Shahn

2002-05-01

Here is a self-contained introduction to quantum groups as algebraic objects. Based on the author's lecture notes for the Part III pure mathematics course at Cambridge University, the book is suitable as a primary text for graduate courses in quantum groups or supplementary reading for modern courses in advanced algebra. The material assumes knowledge of basic and linear algebra. Some familiarity with semisimple Lie algebras would also be helpful. The volume is a primer for mathematicians but it will also be useful for mathematical physicists.

Reacciones y respuestas de la Democracia Cristiana frente al Golpe Militar de 1973: ¿Colaboración u oposición?

Directory of Open Access Journals (Sweden)

Pablo Rubio Apiolaza

2015-06-01

Full Text Available Este artículo realiza un análisis de la estrategia política del Partido Demócrata Cristiano (PDC durante el primer año de la dictadura militar chilena. Se enfatiza en su política de alianzas y sus relaciones internas, seleccionando algunas coyunturas clave en su relación con la Unidad Popular así como su reacción al golpe militar y al primer año de la dictadura. A través de un examen de su documentación interna, el artículo pretende demostrar el predominio de la  DC de posiciones conservadoras, a pesar de que las posiciones partidarias no son únicas, lo que explica un intenso debate interno en los inicios de la dictadura.

A comprehensive collection of experimentally validated primers for Polymerase Chain Reaction quantitation of murine transcript abundance

Directory of Open Access Journals (Sweden)

Wang Xiaowei

2008-12-01

Full Text Available Abstract Background Quantitative polymerase chain reaction (QPCR is a widely applied analytical method for the accurate determination of transcript abundance. Primers for QPCR have been designed on a genomic scale but non-specific amplification of non-target genes has frequently been a problem. Although several online databases have been created for the storage and retrieval of experimentally validated primers, only a few thousand primer pairs are currently present in existing databases and the primers are not designed for use under a common PCR thermal profile. Results We previously reported the implementation of an algorithm to predict PCR primers for most known human and mouse genes. We now report the use of that resource to identify 17483 pairs of primers that have been experimentally verified to amplify unique sequences corresponding to distinct murine transcripts. The primer pairs have been validated by gel electrophoresis, DNA sequence analysis and thermal denaturation profile. In addition to the validation studies, we have determined the uniformity of amplification using the primers and the technical reproducibility of the QPCR reaction using the popular and inexpensive SYBR Green I detection method. Conclusion We have identified an experimentally validated collection of murine primer pairs for PCR and QPCR which can be used under a common PCR thermal profile, allowing the evaluation of transcript abundance of a large number of genes in parallel. This feature is increasingly attractive for confirming and/or making more precise data trends observed from experiments performed with DNA microarrays.

Estudio de cultivos celulares primarios de Psorophora confinnis (Díptera: Culicidae

Directory of Open Access Journals (Sweden)

Felio J. Bello

1999-06-01

Full Text Available Con el propósito de obtener una línea celular de Psorophora confinnis (Arribalzaga, 1891 para estudios de susceptibilidad a infecciones con arbovirus, se iniciaron los cultivos primarios de esta especie, vectora del virus de la encefalitis equina venezolana, tipo epidemo-epizoótico. A partir de huevos embrionados, larvas de primer estadio recién eclosionadas y ovarios de hembras adultas, se realizaron explantes por separado de tejidos embrionarios en diversos medios de cultivos, suplementados con 20% de suero fetal bovino y una mezcla de antibióticos y antimicóticos al 1%. La esterilización del material biológico se efectuó mediante la inmersión de éste en diversas sustancias, tales como: hipoclorito de sodio al 1,6%, etanol al 70% y una solución de 0,25% de cloruro de mercurio disuelto en 70% de etanol. El crecimiento celular se inició sólo en el medio MMNPl2 en un tiempo promedio de 62 días después de efectuadas las siembras, mediante la proliferación de colonias aisladas procedentes de tejidos embrionarios, y también a partir de las terminaciones de los fragmentos larvales. La evolución del crecimiento celular hasta la formación de la monocapa confluente fue supremamente lenta y sólo se alcanzó a los 8 meses post-explante, presentando ésta una morfología celular predominantemente epitelioide. No fue exitoso el crecimiento celular a partir de los tejidos ováricos de hembras adultas. La iniciación del crecimiento celular en esta especie presentó tiempos diferentes comparados con los empleados en los cultivos celulares de otros mosquitos, lo cual indica que a pesar de utilizarse una metodología similar en el proceso para obtener cultivos primarios, las adaptaciones celulares a las condiciones físicas, ambientales y nutricionales son diferentes en cada una de las especies. Este es el primer informe de cultivos celulares de una especie de mosquito perteneciente al género Psorophora.

Scrimer: designing primers from transcriptome data

Czech Academy of Sciences Publication Activity Database

Mořkovský, Libor; Pačes, Jan; Rídl, Jakub; Reifová, R.

2015-01-01

Roč. 15, č. 6 (2015), s. 1415-1420 ISSN 1755-098X R&D Projects: GA MŠk EE2.3.20.0303 Institutional support: RVO:68081766 ; RVO:68378050 Keywords : next-generation sequencing * primer design * SNaPshot * SNP genotyping * transcriptome Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 5.298, year: 2015

Efecto del tipo de lactancia durante el primer año de vida sobre el estado de hierro y el desarrollo físico y psicológico del niño

OpenAIRE

Bedmar Carretero, Cristina

2012-01-01

El objetivo de este estudio fue valorar el desarrollo del niño durante el primer año de vida en función del tipo de lactancia realizada durante el primer semestre y de la dosis de hierro administrada durante el segundo semestre. El 75,5% realizan lactancia materna exclusiva al nacer y el 16,5% la mantienen hasta los 6 meses. El 39,5%tienen alguna mutación en el gen HFE. La prevalencia de déficit de hierroy anemia ferropénicaes del 4,5% y 2,5% a los 6 meses y del 9,2% y 1,2% a los 12 meses.La ...

Microsatellite primers in the white proteas (Protea section Exsertae, Proteaceae), a rapidly radiating lineage.

Science.gov (United States)

Prunier, Rachel; Latimer, Andrew

2010-01-01

Microsatellite primers were developed in the South African sclerophyllous shrub Protea punctata to investigate the degree of population differentiation within and between P. punctata and closely related species. • 10 primer pairs were identified from three individuals of Protea punctata. The primers amplified di- and tri-nucleotide repeats. Across all P. punctata samples, the loci have 8-49 alleles. All primers also amplified in Protea section Exsertae (P. aurea, P. aurea subsp. potbergensis, P. mundii, P. venusta, P. lacticolor, and P. subvestita). The loci had 14-69 alleles across the subgenus. • These results show the broad utility of microsatellite loci for future studies of population genetics in the white proteas and their potential utility across the entire genus.

Profitability primer: a guide to profitability analysis in the electric power industry

International Nuclear Information System (INIS)

Woo, C.K.; Lloyd-Zannetti, D.; Martin, J.; Price, S.

1996-06-01

As the electric power industry is opened to forces of competition, increased attention must be focused to develop products and services that deliver good value to customers and to identify customer segments that are profitable to serve. This primer introduces the concept of profitability analysis and its application to the electric power industry. The primer recognizes that some segments of the business will remain monopolistic and subject to regulations, while other segments will become competitive. The primer also recognizes that customer profitability is critically dependent on a host of related issues such as how internal costs are allocated to various functions and how revenues are collected and allocated

Evaluation of highly conserved hsp65-specific nested PCR primers for diagnosing Mycobacterium tuberculosis.

Science.gov (United States)

Priyadarshini, P; Tiwari, K; Das, A; Kumar, D; Mishra, M N; Desikan, P; Nath, G

2017-02-01

To evaluate the sensitivity and specificity of a new nested set of primers designed for the detection of Mycobacterium tuberculosis complex targeting a highly conserved heat shock protein gene (hsp65). The nested primers were designed using multiple sequence alignment assuming the nucleotide sequence of the M. tuberculosis H37Rv hsp65 genome as base. Multidrug-resistant Mycobacterium species along with other non-mycobacterial and fungal species were included to evaluate the specificity of M. tuberculosis hsp65 gene-specific primers. The sensitivity of the primers was determined using serial 10-fold dilutions, and was 100% as shown by the bands in the case of M. tuberculosis complex. None of the other non M. tuberculosis complex bacterial and fungal species yielded any band on nested polymerase chain reaction (PCR). The first round of amplification could amplify 0.3 ng of the template DNA, while nested PCR could detect 0.3 pg. The present hsp65-specific primers have been observed to be sensitive, specific and cost-effective, without requiring interpretation of biochemical tests, real-time PCR, sequencing or high-performance liquid chromatography. These primer sets do not have the drawbacks associated with those protocols that target insertion sequence 6110, 16S rDNA, rpoB, recA and MPT 64.

Temas de Física para Ingeniería: Primer principio de la termodinámica

OpenAIRE

Beléndez Vázquez, Augusto

1992-01-01

Acústica, fluidos y termodinámica: "Primer principio de la termodinámica". Objetivos y caracteres generales de la termodinámica. Conceptos fundamentales de la termodinámica. Capacidad calorífica, calor específico y calor latente. Trabajo. Primer principio de la termodinámica: energía interna. Algunas aplicaciones del primer principio.

A primer on motor vehicle air pollution.

Science.gov (United States)

1973-01-01

This primer presents a brief state-of-the art review of motor vehicle air pollution. Its purpose is to aid highway personnel in understanding the nature of this environmental problem on our highways and to present possible solutions for its abatement...

Factores asociados al abandono del tratamiento antituberculoso en pacientes con TB

Directory of Open Access Journals (Sweden)

Cecilia Navarro-Quintero

2013-06-01

Full Text Available Objetivo. Determinar los factores asociados al abandono del tratamiento antituberculoso, en pacientes de tuberculosis en los municipios de Cúcuta, Villa del Rosario y el Zulia. Materiales y Métodos: estudio cuantitativo de tipo descriptivo retrospectivo transversal de corte con dos muestras, donde se analizó una muestra de abandono al tratamiento (n=34 y otra que terminó el tratamiento antituberculoso (n=34. Se adoptó el instrumento “factores asociados al abandono del tratamiento antituberculoso. Resultados: Los factores perceptivos cognitivos se establecieron como los principales determinantes directos de abandono al tratamiento antituberculoso, entre estos en primer lugar el desconocimiento de la importancia de adherencia al tratamiento (95.8%, seguido de mejoría del estado de salud (82.7%, desconocimiento de la duración del tratamiento (75%. En segundo lugar los factores fisiológicos y por último los factores de seguridad. Conclusiones: el estudio permitió identificar las variables asociadas al abandono del tratamiento antituberculoso, clasificar los factores de riesgo y construir un instrumento al implementarse en los servicios de salud de la región, permitiría al personal de salud detectar oportunamente a los pacientes con un posible riesgo.

Primer on CDM programme of activities

Energy Technology Data Exchange (ETDEWEB)

Hinostroza, M. (UNEP Risoe Centre, Roskilde (Denmark)); Lescano, A.D. (A2G Carbon Partners (Peru)); Alvarez, J.M. (Ministerio del Ambiente del Peru (Peru)); Avendano, F.M. (EEA Fund Management Ltd. (United Kingdom)

2009-07-01

As an advanced modality introduced in 2005, the Programmatic CDM (POA) is expected to address asymmetries of participation, especially of very small-scale project activities in certain areas, key sectors and many countries with considerable potential for greenhouse gas emission reductions, not reached by the traditional single-project-based CDM. Latest experiences with POAs and the recently finalized official guidance governing the Programmatic CDM are the grassroots of this Primer, which has the purpose of supporting the fully understanding of rules and procedures of POAs by interpreting them and analyzing real POA cases. Professional and experts from the public and private entities have contributed to the development of this Primer, produced by the UNEP Risoe Centre, as part of knowledge support activities for the Capacity Development for the CDM (CD4CDM) project. The overall objective of the CD4CDM is to develop the capacities of host countries to identify, design, approve, finance, implement CDM projects and commercialize CERs in participating countries. The CDM4CDM is funded by the Netherlands Ministry of Foreign Affairs. (author)

Aspectos reproductivos del acocil Cambarellus (Cambarellus montezumae (Crustacea: Decápoda: Cambaridae en condiciones controladas Breeding aspects of the crayfish Cambarellus (Cambarellus montezumae (Crustacea: Decapoda: Cambaridae under controlled conditions

Directory of Open Access Journals (Sweden)

José Luis Arredondo-Figueroa

2011-03-01

Full Text Available El acocil Cambarellus (C. montezumae es una especie endémica cuya distribución está restringida a algunos cuerpos de agua lacustre. Se presentan los resultados sobre aspectos reproductivos de esta especie en condiciones controladas, con el objetivo de determinar la factibilidad de la producción de huevos y juveniles y su potencial aplicación a programas de rescate, repoblación y cultivo. Se realizaron 2 ensayos experimentales, el primero en 4 estanques exteriores de 800 litros conectados a sistemas cerrados de recirculación (SCR y el segundo en recipientes de plástico en laboratorio (RPL, de 2 litros. Para el primer ensayo, se manejaron 219 reproductores durante 335 días, obteniendo 136 hembras ovígeras. Cada hembra produjo en promedio 45 ± 23 huevos por puesta. El 83.7% de los huevos eclosionaron, obteniéndose un total de 3 162 juveniles. En los RPL se manejó una población F1 obtenida a partir de los reproductores del SCR en una relación 1 hembra: 2 machos, con 10 repeticiones. La producción de huevo fue variable con un promedio de 34 por hembra. Los indicadores de desempeño mostraron diferencias significativas (P ≤ 0.05 entre sexos con respecto a 6 de ellos. Los resultados indican la factibilidad para su cultivo y producción de huevos y juveniles.Cambarellus (C. montezumae is an endemic crayfish from Mexico, which actual distribution is restricted to few lacustrine bodies of water. Here we present results on the reproduction of this species under controlled conditions with the aim to determine the feasibility of the production of eggs and juveniles, as an strategy for their rescue, re-population and culture. Two experimental assays were conducted, the first one, in 4 outdoor 800-L tanks recirculation aquaculture systems (RAS and the second, in 2-L plastic containers under laboratory conditions (PCL. For the first assay, 219 brooders were used during 335 days , obtaining 136 ovigerous females. Each female produced an average

Forest Interpreter's Primer on Fire Management.

Science.gov (United States)

Zelker, Thomas M.

Specifically prepared for the use of Forest Service field-based interpreters of the management, protection, and use of forest and range resources and the associated human, cultural, and natural history found on these lands, this book is the second in a series of six primers on the multiple use of forest and range resources. Following an…

Designing for transportation management and operations : a primer.

Science.gov (United States)

2013-02-01

This primer is focused on the collaborative and systematic consideration of management and operations during transportation : project design and development. This is termed designing for operations. Effectively designing for operations involves...

Evaluation of genetic diversity in open pollinated guava by iPBS primers

International Nuclear Information System (INIS)

Mehmood, A.; Jaskani, M.J.; Ahmad, S.; Ahmad, R.

2013-01-01

DNA markers are important tools for assessing genetic diversity and relationships among species, cultivars and breeding materials. Many horticultural species are lacking genomic information. DNA markers that do not require prior knowledge of DNA sequences are therefore appealing for horticultural research. A retrotransposon-based DNA marker system, iPBS (inter primer binding sites) developed from conserved primer binding sites within retrotransposons, was used to study the genetic variation and relationships in ornamental guava. PCR from 6 iPBS primers (dominant markers) produced a total of 113 bands (52.38-100% polymorphic) ranging from 150 bp to 3000 bp, and the mean PIC value for each primer ranging from 0.1245 to 0.3698. Molecular information generated from both iPBS was separately scored in a matrix for phylogenetic dendrogram construction. The phylogenetic dendrogram based on iPBS markers reflected morphologic classifications of the accessions that were studied. The iPBS PCR-based genome fingerprinting technology in this study is low-cost and provides another effective alternative in differentiation of accessions in guava (Psidium guajava Linn.) and related species or genera. (author)

The UVM primer a step-by-step introduction to the universal verification methodology

CERN Document Server

Salemi, Ray

2013-01-01

The UVM Primer uses simple, runnable code examples, accessible analogies, and an easy-to-read style to introduce you to the foundation of the Universal Verification Methodology. You will learn the basics of object-oriented programming with SystemVerilog and build upon that foundation to learn how to design testbenches using the UVM. Use the UVM Primer to brush up on your UVM knowledge before a job interview to be able to confidently answer questions such as "What is a uvm_agent?" , "How do you use uvm_sequences?", and "When do you use the UVM's factory." The UVM Primer's downloadable code examples give you hands-on experience with real UVM code. Ray Salemi uses online videos (on www.uvmprimer.com) to walk through the code from each chapter and build your confidence. Read The UVM Primer today and start down the path to the UVM.

Personalidad y tolerancia al dolor

Directory of Open Access Journals (Sweden)

JESÚS M.ª CARRILLO

2005-01-01

Full Text Available Se examina la relación de algunas variables de personalidad -EPQ-A (Eysenck y Eysenck, 1975, NEO-PI (McCrae y Costa, 1988 y STA -personalidad esquizotípica- y STB -personalidad límite-, de Claridge y Broks (1984, con la tolerancia al dolor experimental inducido mediante agua fría (cold pressor test, según el procedimiento de Staats, Heckmat y Staats (1998 en una muestra filtrada mediante un cuestionario sobre dolor crónico, dolores de cabeza, de espalda, artritis, síndrome de Raynaud, y personas bajo medicación. La tolerancia al dolor experimental se evaluó mediante el Umbral del dolor (tiempo en segundos desde la introducción de la mano en el agua hasta el primer informe de dolor, Mantenimiento del dolor (duración en segundos de la inmersión de la mano desde la aparición del umbral hasta su retirada y Tolerancia al dolor (duración total en segundos de la inmersión de la mano desde su introducción hasta su retirada. Un análisis correlacional, factorial y de regresión por pasos mostraron un efecto cruzado entre medidas de ansiedad (tolerancia negativa al dolor y psicoticismo, siendo psicoticismo junto con control emocional predictores de tolerancia positiva al dolor. En cuanto a psicoticismo, parece que son sus elementos de naturaleza paranoide y de "dureza" los que afectan a una percepción atenuada del dolor.

Autonomía y ajuste académico: un estudio con estudiantes portugueses de primer año

Directory of Open Access Journals (Sweden)

Ana Paula Soares

2007-01-01

Full Text Available Los niveles de autonomía psicológica de los alumnos desempeñan un papel importante en su ajuste a las presiones y desafíos de la vida universitaria. En este sentido, el presente estudio descriptivo analiza las relaciones entre los niveles de autonomía de los estudiantes en su entrada en la Enseñanza Superior y la calidad de su ajuste académico al final del primer año. Se aplicó el Iowa Developing Autonomy Inventory (IDAI en el inicio del año lectivo y el Questionário de Vivências Académicas (QVA al final de ese año a una muestra de 420 alumnos de primer año de la Universidade do Minho. Los resultados revelan que los alumnos poseen percepciones bastante positivas en cuanto a sus niveles de autonomía en las áreas de Gestión del tiempo, Movilidad e Interdependencia, y niveles más bajos en la Gestión del dinero, observándose algunas oscilaciones en función del género. Por otro lado, los alumnos cuya entrada en la Enseñanza Superior no implicó su abandono del hogar familiar, especialmente los de sexo masculino, presentan niveles más elevados de ajuste académico. Finalmente, los resultados sugieren que el ajuste académico se encuentra asociado a los niveles de autonomía de los alumnos, en particular en lo que concierne a la Gestión del tiempo, Independencia emocional de sus compañeros e Interdependencia.

A Primer on Electric Utilities, Deregulation, and Restructuring of U.S. Electricity Markets

Energy Technology Data Exchange (ETDEWEB)

Warwick, William M.

2002-06-03

This primer is offered as an introduction to utility restructuring to better prepare readers for ongoing changes in public utilities and associated energy markets. It is written for use by individuals with responsibility for the management of facilities that use energy, including energy managers, procurement staff, and managers with responsibility for facility operations and budgets. The primer was prepared by the Pacific Northwest National Laboratory under sponsorship from the U.S. Department of Energy?s Federal Energy Management Program. The impetus for this primer originally came from the Government Services Administration who supported its initial development.

Aplicaciones de los modelos multinivel al análisis de medidas repetidas en estudios longitudinales

OpenAIRE

María Victoria Zunzunegui; María Jesús García de Yébenes; Mathieu Forster; María Dolores Aguilar Conesa; Angel Rodríguez Laso; Ángel Otero

2004-01-01

Este trabajo es una introducción al análisis de medidas repetidas en estudios longitudinales. Se utiliza un marco analítico con dos etapas, ajustando modelos jerárquicos lineales con dos niveles. El primer nivel corresponde a la ocasión (tiempo) de medida y el segundo al individuo. Estos modelos estadísticos proceden de las ciencias sociales, en las que se han utilizado durante más de 25 años para analizar datos en organizaciones con múltiples niveles. Su aplicación permi...

Cytochrome c oxidase I primers for corbiculate bees: DNA barcode and mini-barcode.

Science.gov (United States)

Françoso, E; Arias, M C

2013-09-01

Bees (Apidae), of which there are more than 19 900 species, are extremely important for ecosystem services and economic purposes, so taxon identity is a major concern. The goal of this study was to optimize the DNA barcode technique based on the Cytochrome c oxidase (COI) mitochondrial gene region. This approach has previously been shown to be useful in resolving taxonomic inconsistencies and for species identification when morphological data are poor. Specifically, we designed and tested new primers and standardized PCR conditions to amplify the barcode region for bees, focusing on the corbiculate Apids. In addition, primers were designed to amplify small COI amplicons and tested with pinned specimens. Short barcode sequences were easily obtained for some Bombus century-old museum specimens and shown to be useful as mini-barcodes. The new primers and PCR conditions established in this study proved to be successful for the amplification of the barcode region for all species tested, regardless of the conditions of tissue preservation. We saw no evidence of Wolbachia or numts amplification by these primers, and so we suggest that these new primers are of broad value for corbiculate bee identification through DNA barcode. © 2013 John Wiley & Sons Ltd.

La estimulación del lenguaje oral a partir de los cuentos en el primer ciclo de educación primaria

OpenAIRE

Torres Jaramillo, Ana María

2014-01-01

El trabajo que se expone a continuación es una propuesta de intervención para trabajar el lenguaje oral en los alumnos del primer ciclo de Educación Primaria. En él, me he marcado unos objetivos, partiendo de la base legal del currículo de Educación Primaria, de modo que, esta propuesta de trabajo pueda desarrollarse en el aula formando parte del currículo. Contiene aspectos teóricos referidos al lenguaje, destacando la importancia del lenguaje oral y un breve desarrollo del lenguaj...

Inteligencia emocional y autoconcepto en los estudiantes de primer ciclo

OpenAIRE

Castillo Canales, Braulio

2017-01-01

En nuestra investigación se tuvo como problema: ¿Qué relación existe entre inteligencia emocional y autoconcepto en los estudiantes de primer ciclo de Administración en Turismo y Hotelería de la Universidad César Vallejo, Lima 2015-II? Además el objetivo fue: Determinar la relación entre inteligencia emocional y autoconcepto en los estudiantes de primer ciclo de Administración en Turismo y Hotelería de la Universidad César Vallejo, Lima 2015-II. El tipo de estudio fue básica...

Teaching Thermal Hydraulics & Numerical Methods: An Introductory Control Volume Primer

Energy Technology Data Exchange (ETDEWEB)

Lucas, D.S.

2004-10-03

This paper covers the basics of the implementation of the control volume method in the context of the Homogeneous Equilibrium Model (HEM)(T/H) code using the conservation equations of mass, momentum, and energy. This primer uses the advection equation as a template. The discussion will cover the basic equations of the control volume portion of the course in the primer, which includes the advection equation, numerical methods, along with the implementation of the various equations via FORTRAN into computer programs and the final result for a three equation HEM code and its validation.

Móvil remisión de V. cinta del primer móvil.

OpenAIRE

2011-01-01

[ES] Definición del término Móvil remisión de V. cinta del primer móvil. en el diccionario Dicter. [EN] Definition of the word Móvil remisión de V. cinta del primer móvil. in the dictionary Dicter.

A primer on water

Science.gov (United States)

Leopold, Luna Bergere; Langbein, Walter Basil

1960-01-01

When you open the faucet you expect water to flow. And you expect it to flow night or day, summer or winter, whether you want to fill a glass or water the lawn. It should be clean and pure, without any odor.You have seen or read about places where the water doesn't have these qualities. You may have lived in a city where you were allowed to water the lawn only during a few hours of certain days. We know a large town where the water turns brown after every big rainstorm.Beginning shortly after World War II, large areas in the Southwestern United States had a 10-year drought, and newspapers published a lot of information about its effects. Some people say that the growing demand for water will cause serious shortages over much of the country in the next 10 to 40 years. But it has always been true that while water wells and springs dry up in some places, floods may be occurring in other places at the same time.Nearly every month news stories are published describing floods somewhere in the country. In fact, every year, on the average, 75,000 persons are forced from their homes by floods. In some years, as in 1951 when the lower Kansas River experienced a great flood, half a million people are affected. To understand the reasons for such recurring distress, it is necessary to know something about rivers and about the flat land or flood plain that borders the river.Interest in water and related problems is growing as our population increases and as the use of water becomes steadily greater. To help meet this heightened interest in general information about water and its use and control is the reason this primer was written. The primer is in two parts. The first part tells about hydrology, or the science that concerns the relation of water to our earth, and the second part describes the development of water supplies and the use of water. The Geological Survey is publishing this primer in nontechnical language in the hope that it will enable the general reader to

Adhesion and thermal stability enhancement of IZO films by adding a primer layer on polycarbonate substrate

Energy Technology Data Exchange (ETDEWEB)

Zhang, Xuan; Zhang, Xiaofeng; Yan, Yue; Zhong, Yanli; Li, Lei; Zhang, Guanli [Beijing Institute of Aeronautical Materials (BIAM), Haidian District, Beijing, 100095 (China)

2015-04-01

A silicone-based primer layer was developed to improve the adhesion and thermal stability of amorphous transparent indium zinc oxide (IZO) films on polycarbonate (PC). The IZO films deposited by direct current magnetron sputtering at room temperature on primer-treated and untreated PCs were evaluated ex situ in terms of surface morphology, adhesion, optical, and electrical properties during annealing at 120 C in air. Nano-scratch tests indicated the adhesion of IZO films on primer-treated substrates was superior to that on untreated PCs. This superior adhesion can be attributed to the strong Si-O-Si inorganic bonds abundant in the primer layer and better matches of the primer layer in the terms of thermal expansion to the IZO. Moreover, the electrical resistivity of IZO films prepared on primer-treated PCs remained stable during the annealing treatment, whereas those of IZO films on untreated PCs presented a continuously increasing trend, which was attributed to the decrease in carrier concentration that resulted from oxygen adsorption. (copyright 2015 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

Functional genes to assess nitrogen cycling and aromatic hydrocarbon degradation: primers and processing matter

Directory of Open Access Journals (Sweden)

Christopher Ryan Penton

2013-09-01

Full Text Available Targeting sequencing to genes involved in key environmental processes, i.e. ecofunctional genes, provides an opportunity to sample nature’s gene guilds to greater depth and help link community structure to process-level outcomes. Vastly different approaches have been implemented for sequence processing and, ultimately, for taxonomic placement of these gene reads. The overall quality of next generation sequence analysis of functional genes is dependent on multiple steps and assumptions of unknown diversity. To illustrate current issues surrounding amplicon read processing we provide examples for three ecofunctional gene groups. A combination of in-silico, environmental and cultured strain sequences was used to test new primers targeting the dioxin and dibenzofuran degrading genes dxnA1, dbfA1, and carAa. The majority of obtained environmental sequences were classified into novel sequence clusters, illustrating the discovery value of the approach. For the nitrite reductase step in denitrification, the well-known nirK primers exhibited deficiencies in reference database coverage, illustrating the need to refine primer-binding sites and/or to design multiple primers, while nirS primers exhibited bias against five phyla. Amino acid-based OTU clustering of these two N-cycle genes from soil samples yielded only 114 unique nirK and 45 unique nirS genus-level groupings, likely a reflection of constricted primer coverage. Finally, supervised and non-supervised OTU analysis methods were compared using the nifH gene of nitrogen fixation, with generally similar outcomes, but the clustering (non-supervised method yielded higher diversity estimates and stronger site-based differences. High throughput amplicon sequencing can provide inexpensive and rapid access to nature’s related sequences by circumventing the culturing barrier, but each unique gene requires individual considerations in terms of primer design and sequence processing and classification.

Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

Science.gov (United States)

Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

2015-09-01

Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

Family-specific vs. universal PCR primers for the study of mitochondrial DNA in plants

Directory of Open Access Journals (Sweden)

Aleksić Jelena M.

2016-01-01

Full Text Available Mitochondrial genomes (mtDNAs or mitogenomes of seed plants are characterized by a notoriously unstable organization on account of which available so-called universal or consensus primers may fail to fulfil their foreseen function - amplification of various mtDNA regions in a broad range of plant taxa. Thus, the primers developed for groups assumed to have similar organization of their mitogenomes, such as families, may facilitate a broader usage of more variable non-coding portions of these genomes in group members. Using in silico PCR method and six available complete mitogenomes of Fabaceae, it has been demonstrated that only three out of 36 published universal primer and three Medicago sativa-specific primer pairs that amplify various mtDNA regions are suitable for six representatives of the Fabaceae family upon minor modifications, and develop 21 Fabaceae-specific primer pairs for amplification of all 14 cis-splicing introns in genes of NADH subunits (nad genes which represent the most commonly used non-coding mtDNA regions in various studies in plants. Using the same method and six available complete mitogenomes of representatives of related families Cucurbitaceae, Euphorbiaceae and Rosaceae and a model plant, Arabidopsis thaliana, it has further been demonstrated that applicability of newly developed primer pairs for amplification of nad introns in more or less related taxa was dependent not only on species evolutionary distances but also on their genome sizes. A reported set of 24 primer pairs is a valuable resource which may facilitate a broader usage of mtDNA variability in future studies at both intra- and inter-specific levels in Fabaceae, which is the third largest family of flowering plants rarely studied at the mtDNA level, and in other more or less related taxa. [Projekat Ministarstva nauke Republike Srbije, br. 173005

Primer registro de anidación de Carao (Aramus guarauna en el estado de Nayarit, México

Directory of Open Access Journals (Sweden)

David Molina

2017-04-01

Full Text Available De 2012 a 2016 registramos la anidación de carao (Aramus guarauna en un humedal suburbano en el Parque Ecológico de Tepic en Nayarit, México, y puede considerarse que permanece en el sitio. Éste es el primer registro de anidación de esta especie en el estado de Nayarit; además, identificamos la ampliación de su intervalo reproductivo hacia el norte del país. Es muy probable que la residencia del carao en este humedal obedezca a la presencia de una población local de caracol manzana (Pomacea y, al parecer, a la ausencia de depredadores y competidores naturales en el sitio.

Formulation and Assessment of a Wash-Primer Containing Lanthanum "Tannate" for Steel Temporary Protection

Science.gov (United States)

D'Alessandro, Oriana; Selmi, Gonzalo J.; Deyá, Cecilia; Di Sarli, Alejandro; Romagnoli, Roberto

2018-02-01

Tannins are polyphenols synthesized by plants and useful for the coating industry as corrosion inhibitors. In addition, lanthanum salts have a great inhibitory effect on steel corrosion. The aim of this study was to obtain lanthanum "tannate" with adequate solubility to be incorporated as the corrosion inhibitor in a wash-primer. The "tannate" was obtained from commercial "Quebracho" tannin and 0.1 M La(NO3)3. The soluble tannin was determined by the Folin-Denis reagent, while the concentration of Lanthanum was obtained by a gravimetric procedure. The protective action of "tannate" on SAE 1010 steel was evaluated by linear polarization curves and corrosion potential measurements. Lanthanum "tannate" was incorporated in a wash-primer formulation and tested by corrosion potential and ionic resistance measurements. The corrosion rate was also determined by the polarization resistance technique. Besides, the primer was incorporated in an alkyd paint system and its anticorrosion performance assessed in the salt spray cabinet and by electrochemical impedance spectroscopy. Results showed that lanthanum "tannate" primer inhibits the development of deleterious iron oxyhydroxides on the steel substrate and incorporated into a paint system had a similar behavior to the primer formulated with zinc tetroxychromate.

The use of a fluoropolymer containing primer to enhance adhesion of rotolined fluoropolymer coatings

Energy Technology Data Exchange (ETDEWEB)

Lech, L.M. [DuPont, Parkersburg, WV (United States)

1999-11-01

Fluoropolymers such as PFA and ETFE are often used in rotolining applications. A common source of failure for rotolined coatings is delamination from the metal substrate. Extensive thermal cycling of the coated part, permeation of the contained liquid to the substrate, or a combination of both thermal cycling and permeation causes this. Rotolined coatings are typically applied directly to the metal part. It has been found that applying an aqueous fluoropolymer based primer to the metal substrate prior to applying the rotolined resin increases the time before delamination is observed. The primer is applied by conventional spray techniques and can either be force dried at low temperature or air-dried under ambient conditions. The primer consists primarily of a fluoropolymer such as ETFE or PFA and a bonding agent such as polyamide-imide, polyphenylene sulfide, or polyether sulfone. After the primer is applied to the metal part, the fluoropolymer in the primer melt blends with the fluoropolymer rotolining resin during the rotolining process. The bonding agent enhances the adhesion of the entire coating system to the metal part. This extends the lifetime of the rotolined coatings.

NIDIFICACIÓN Y EFICIENCIA REPRODUCTIVA DEL COCODRILO AMERICANO EN UNA RESERVA ECOLÓGICA DE MANATÍ

Directory of Open Access Journals (Sweden)

Leticia Torres Martínez

2013-08-01

Full Text Available En el presente trabajo se caracteriza la variación espacial y temporal de los patrones reproductivos del cocodrilo americano (Crocodylus acutus Cuvier, entre 2008 y 2010, para las localidades de La Isleta y Los Coquitos, en la Reserva Ecológica Bahía de Nuevas Grandes-La Isleta en Manatí, Las Tunas. Se describen las conductas de nidificación, desove y atención al nido. Además, se analiza la dinámica de las puestas, eclosiones y la morfometría de los huevos. Se detectó que las hembras no despliegan la misma conducta para la construcción del nido, pero en todos los casos la nidificación implica la transformación del paisaje. En ambas localidades las curvas de acumulación de puestas y eclosiones se dividen en tres etapas: inicial, aceleración y meseta. En general, existe consistencia de la correlación entre el largo y ancho de los huevos con tendencia a que los huevos largos y pesados incrementen su natalidad y viabilidad. En La Isleta la altura y tipo de suelo aseguran una elevada eficiencia de reproducción, lo que sugiere mayor estabilidad temporal de factores bióticos y abióticos.

A Primer to Slow Light

OpenAIRE

Leonhardt, U.

2001-01-01

Laboratory-based optical analogs of astronomical objects such as black holes rely on the creation of light with an extremely low or even vanishing group velocity (slow light). These brief notes represent a pedagogical attempt towards elucidating this extraordinary form of light. This paper is a contribution to the book Artificial Black Holes edited by Mario Novello, Matt Visser and Grigori Volovik. The paper is intended as a primer, an introduction to the subject for non-experts, not as a det...

Eduardo Krapf (1901-1963: Primer Presidente de la Sociedad Interamericana de Psicología

Directory of Open Access Journals (Sweden)

Hugo Klappenbach

2004-01-01

Full Text Available El trabajo, de carácter historiográfico, examina la trayectoria de Eduardo Krapf, quien se recibió de médico en Alemania y posteriormente revalidó su titulo en la Argentina. Se analiza su inserción en la Asociación Psicoanalítica Argentina y sus trabajos sobre psiquiatría y psicología al promediar el siglo XX. En particular, se analizan los intereses que condujeron a Eduardo Krapf a vincularse con la psicología y en particular con la Sociedad Interamericana de Psicología, de la que fue Primer Presidente en 1951. Metodológicamente, se han obtenido los datos principalmente de fuentes primarias, particularmente textos y documentos de archivo existentes en la Facultad de Ciencias Médicas de la Universidad de Buenos Aires

Disponibilidad de medicamentos esenciales en unidades de primer nivel de la Secretaría de Salud de Tamaulipas, México

Directory of Open Access Journals (Sweden)

Reséndez Cristela

2000-01-01

Full Text Available OBJETIVO: Generar un diagnóstico sobre la disponibilidad de algunos medicamentos esenciales del Cuadro Básico de Insumos (CBI en las unidades de primer nivel de atención de la Secretaría de Salud en el estado de Tamaulipas, México. MATERIAL Y MÉTODOS: Entre septiembre y octubre de 1998 se llevó a cabo una encuesta en todas las unidades de primer nivel de tres jurisdicciones sanitarias de Tamaulipas. La disponibilidad de medicamentos se estudió en todas las unidades de dichas jurisdicciones sanitarias. Como instrumento de medición se utilizó una guía de verificación con una lista de 56 medicamentos y 10 insumos diversos. Para cada medicamento e insumo se calculó el número absoluto y la proporción de unidades que al momento de la verificación no contaban con dicho recurso. En las unidades con disponibilidad de medicamentos se estimó la mediana de la distribución. Como medida de resumen se estimó la mediana del total de medicamentos esenciales disponibles en todas las unidades. Posteriormente, se realizó este mismo ejercicio diferenciado por tipo de unidad. Se hicieron comparaciones directas entre la ausencia de uno o más medicamentos en las unidades y la disponibilidad de los mismos en los almacenes. Todo el proceso de análisis se realizó con el paquete estadístico Stata versión 5.0. RESULTADOS: Ninguna de las unidades visitadas contaba con ejemplares de todos los medicamentos incluidos en la lista. La unidad que más se acercó al total tenía 84% de los medicamentos y la que más se alejó contó apenas con 32%. Los problemas de disponibilidad de antibióticos, antihipertensivos, hipoglucemiantes y medicamentos para el tratamiento de deficiencias de hierro fueron particularmente significativos. En contraste, la disponibilidad de sales de rehidratación oral y métodos anticonceptivos y biológicos fue aceptable. CONCLUSIONES: Las instituciones de salud deberán generar alternativas para mejorar el acceso a los

Specific and sensitive quantitative RT-PCR of miRNAs with DNA primers

DEFF Research Database (Denmark)

Balcells, Ingrid; Cirera Salicio, Susanna; Busk, Peter K.

2011-01-01

BACKGROUND: MicroRNAs are important regulators of gene expression at the post-transcriptional level and play an important role in many biological processes. Due to the important biological role it is of great interest to quantitatively determine their expression level in different biological...... be designed with a success rate of 94%. The method was able to quantify synthetic templates over eight orders of magnitude and readily discriminated between microRNAs with single nucleotide differences. Importantly, PCR with DNA primers yielded significantly higher amplification efficiencies of biological...... samples than a similar method based on locked nucleic acids-spiked primers, which is in agreement with the observation that locked nucleic acid interferes with efficient amplification of short templates. The higher amplification efficiency of DNA primers translates into higher sensitivity and precision...

The study of a Mg-rich epoxy primer for protection of AZ91D magnesium alloy

Energy Technology Data Exchange (ETDEWEB)

Lu Xiangyu [School of Materials Science and Engineering, Beijing University of Chemical Technology, Beijing 100029 (China); Zuo Yu, E-mail: zuoy@mail.buct.edu.c [School of Materials Science and Engineering, Beijing University of Chemical Technology, Beijing 100029 (China); Zhao Xuhui; Tang Yuming; Feng Xingguo [School of Materials Science and Engineering, Beijing University of Chemical Technology, Beijing 100029 (China)

2011-01-15

Research highlights: {yields} A Mg-rich epoxy primer was prepared by adding pure magnesium particles in epoxy coating. Cross scratch testing results showed that in 3% NaCl solution the Mg-rich primer showed better protection for AZ91D magnesium alloy than the same epoxy primer without Mg addition. {yields} The open circuit potential of AZ91D alloy in NaCl solution decreased after coated with Mg-rich coating, suggesting that cathodic protection effect of the Mg-rich coating on AZ91D alloy was present. {yields} EIS studies showed that during the immersion tests of AZ91D alloy with Mg-rich coating the magnesium particles in coating dissolved with the charge-transfer resistance R{sub ct} at the magnesium particle/coating interface decreased and the double-layer capacitance Q{sub dl} increased. While the coating resistance remained stable for a long time and corrosion of the AZ91D alloy substrate was obviously delayed. - Abstract: A Mg-rich epoxy primer was prepared by adding pure magnesium particles to an epoxy coating. The coating properties were studied with electrochemical impedance spectroscopy (EIS), scanning electronic microscopy (SEM) and X-ray diffraction (XRD). The Mg-rich primer showed better protection for AZ91D magnesium alloy than the same epoxy primer without Mg addition. The open circuit potential measurements showed cathodic protection effect of the Mg-rich primer on AZ91D alloy. Cross scratch testing showed that the Mg-rich primer provided better protection for the substrate than original epoxy coating. The precipitation of Mg(OH){sub 2} in the coating also provided some degree of barrier protection.

The study of a Mg-rich epoxy primer for protection of AZ91D magnesium alloy

International Nuclear Information System (INIS)

Lu Xiangyu; Zuo Yu; Zhao Xuhui; Tang Yuming; Feng Xingguo

2011-01-01

Research highlights: → A Mg-rich epoxy primer was prepared by adding pure magnesium particles in epoxy coating. Cross scratch testing results showed that in 3% NaCl solution the Mg-rich primer showed better protection for AZ91D magnesium alloy than the same epoxy primer without Mg addition. → The open circuit potential of AZ91D alloy in NaCl solution decreased after coated with Mg-rich coating, suggesting that cathodic protection effect of the Mg-rich coating on AZ91D alloy was present. → EIS studies showed that during the immersion tests of AZ91D alloy with Mg-rich coating the magnesium particles in coating dissolved with the charge-transfer resistance R ct at the magnesium particle/coating interface decreased and the double-layer capacitance Q dl increased. While the coating resistance remained stable for a long time and corrosion of the AZ91D alloy substrate was obviously delayed. - Abstract: A Mg-rich epoxy primer was prepared by adding pure magnesium particles to an epoxy coating. The coating properties were studied with electrochemical impedance spectroscopy (EIS), scanning electronic microscopy (SEM) and X-ray diffraction (XRD). The Mg-rich primer showed better protection for AZ91D magnesium alloy than the same epoxy primer without Mg addition. The open circuit potential measurements showed cathodic protection effect of the Mg-rich primer on AZ91D alloy. Cross scratch testing showed that the Mg-rich primer provided better protection for the substrate than original epoxy coating. The precipitation of Mg(OH) 2 in the coating also provided some degree of barrier protection.

Metabolomics: A Primer.

Science.gov (United States)

Liu, Xiaojing; Locasale, Jason W

2017-04-01

Metabolomics generates a profile of small molecules that are derived from cellular metabolism and can directly reflect the outcome of complex networks of biochemical reactions, thus providing insights into multiple aspects of cellular physiology. Technological advances have enabled rapid and increasingly expansive data acquisition with samples as small as single cells; however, substantial challenges in the field remain. In this primer we provide an overview of metabolomics, especially mass spectrometry (MS)-based metabolomics, which uses liquid chromatography (LC) for separation, and discuss its utilities and limitations. We identify and discuss several areas at the frontier of metabolomics. Our goal is to give the reader a sense of what might be accomplished when conducting a metabolomics experiment, now and in the near future. Copyright © 2017 Elsevier Ltd. All rights reserved.

Mating and memory: an educational primer for use with "epigenetic control of learning and memory in Drosophila by Tip60 HAT action".

Science.gov (United States)

Schmidt, Rebecca L; Sheeley, Sara L

2015-05-01

An article by Xu et al. in the December 2014 issue of GENETICS can be used to illustrate epigenetic modification of gene expression, reverse genetic manipulation, genetic/epigenetic influence on behavioral studies, and studies using the Drosophila model organism applied to human disease. This Primer provides background information; technical explanations of genetic, biochemical, and behavioral approaches from the study; and an example of an approach for classroom use with discussion questions to aid in student comprehension of the research article. Copyright © 2015 by the Genetics Society of America.

Necesidades en salud del diabético usuario del primer nivel de atención

Directory of Open Access Journals (Sweden)

Salinas-Martínez Ana M.

2001-01-01

Full Text Available Objetivo. Determinar la magnitud y jerarquizar la necesidad de salud satisfecha del diabético tipo 2, usuario del primer nivel de atención. Material y métodos. Se realizó un estudio transversal comparativo con representatividad rural y urbana, en el Instituto Mexicano del Seguro Social, en Nuevo León, en 1999. Fueron entrevistados, al azar, 256 diabéticos tipo 2 con dos o más años de diagnóstico. La información fue complementada con el expediente clínico y encuesta al proveedor. Se evaluaron cinco áreas y cuatro determinantes de salud, con base en estándares de la Norma Oficial Mexicana y la Asociación Americana de Diabetes. El plan de análisis consistió en estadística descriptiva y estimación de puntajes z. Resultados. Se registró una media de satisfacción global de necesidades de salud de 48.8%. En la zona rural la media de satisfacción fue menor que en la urbana (36.8% vs 53.3%, phttp://www.insp.mx/salud/index.html

Primer on Health Surveys

Directory of Open Access Journals (Sweden)

David L Nordstrom

2012-06-01

Full Text Available The aim of this paper is to introduce novice researchers to surveys as a method of data collection. It starts with the definition of a survey, its major purposes and types as well as changes in the goals surveys have helped to achieve over time. Advantages and disadvantages of surveys over population censuses and medical examinations are discussed. Approaches to questionnaire construction are introduced along with properties that questionnaires are evaluated for. Modes of administration, sample size issues, and data analysis approaches are also introduced. The primer is illustrated with examples of surveys conducted in different countries with various public health purposes.

Hubungan Stres dengan Kejadian Dismenore Primer pada Mahasiswi Pendidikan Dokter Fakultas Kedokteran Universitas Andalas

Directory of Open Access Journals (Sweden)

Diana Sari

2015-05-01

Full Text Available AbstrakDismenore primer merupakan nyeri menstruasi yang dijumpai tanpa kelainan yang nyata pada alat-alat genital. Lebih dari 50% wanita mengalami dismenore primer dan 15% diantaranya mengalami nyeri yang hebat.Tujuan penelitian ini adalah untuk menentukan hubungan tingkat stres dengan derajat dismenore primer. Penelitian dilakukan pada mahasiswi pendidikan dokter Fakultas Kedokteran Universitas Andalas angkatan 2009 dan 2010. Desain penelitian ini menggunakan cross sectional study dengan jumlah subjek 165 orang. Pengumpulan data dari responden dilakukan dengan wawancara terpimpin (pengisian kuesioner. Analisa statistik yang digunakan adalah uji chi-square dan uji koefisien korelasi sederhana. Uji chi-square menunjukan ada hubungan yang bermakna antara stres dengan kejadian dismenore primer dan uji statistik koefisien korelasi sederhana menunjukkan ada hubungan yang bermakna dengan korelasi agak lemah antara tingkat stres dengan derajat dismenore primer.Kata kunci: stres, dismenore primer, mahasiswi fakultas kedokteran AbstractPrimary dysmenorrhoea is menstrual pain founded without real abnormalities in genital organs. More than 50% woman experiance it and 15% had severe pain. The objective of this study was to determine relationship between stress and primary dysmenorrhoea. Research was executed to education medical female students medical faculty of Andalas University class of 2009 and 2010. This research use cross sectional study design with 165 subjects. Data was collected by guided interview. Statistic analysis use chi-square test and simple correlation test. Chi-square test show there is significant relationship between stress and primary dysmenorrhoea and simple coefficient test show there is weak correlation between stress levels and degree of primary dysmenorrhoea.Keywords: stress, primary dysmenorrhoea, female student of medical faculty

Qualification and Flight Test of Non-Chrome Primers for C-130 Aircraft

Science.gov (United States)

2011-08-17

system  Significant hexavalent chrome reduction in finish system  Potential exposure level of spray applied chromated conversion coating not as...Lockheed Martin Aeronautics Company Qualification and Flight Test of Non- Chrome Primers for C-130 Aircraft Scott Jones Lockheed Martin...00-2011 to 00-00-2011 4. TITLE AND SUBTITLE Qualification and Flight Test of Non- Chrome Primers for C-130 Aircraft 5a. CONTRACT NUMBER 5b. GRANT

A two primers random amplified polymorphic DNA procedure to obtain polymerase chain reaction fingerprints of bacterial species.

Science.gov (United States)

Rivas, R; Velázquez, E; Valverde, A; Mateos, P F; Martínez-Molina, E

2001-04-01

Polymerase chain reation (PCR) fingerprints are used to characterize and recognize bacteria and are generally obtained using universal primers that generate an array of DNA amplicons, which can be separated by electrophoresis. Universal primers 8F and 1491 R have been used to amplify specifically 16S rDNA. We have used these primers at an annealing temperature of 50 degrees C. Agarose gel electrophoresis of PCR products revealed several bands. The band pattern of each bacterial species was different and the strains belonging to the same species shared an identical pattern. The patterns obtained did not show variations with plasmid DNA content or the growth stage of the bacteria. The peculiarity of the randomly amplified polymorphic DNA (RAPD) described in this work lies in the use of two large primers (proximately 20 nt) to obtain the pattern, since normally a only smaller primer is used, and in the new application for the primers used to amplify 16S rDNA. This new procedure, called two primers (TP)-RAPD fingerprinting, is thus rapid, sensitive, reliable, highly reproducible and suitable for experiments with a large number of microorganisms, and can be applied to bacterial taxonomy, ecological studies and for the detection of new bacterial species.

A novel photoinduced electron transfer (PET) primer technique for rapid real-time PCR detection of Cryptosporidium spp

Energy Technology Data Exchange (ETDEWEB)

Jothikumar, N., E-mail: jin2@cdc.gov; Hill, Vincent R.

2013-06-28

Highlights: •Uses a single-labeled fluorescent primer for real-time PCR. •The detection sensitivity of PET PCR was comparable to TaqMan PCR. •Melt curve analysis can be performed to confirm target amplicon production. •Conventional PCR primers can be converted to PET PCR primers. -- Abstract: We report the development of a fluorescently labeled oligonucleotide primer that can be used to monitor real-time PCR. The primer has two parts, the 3′-end of the primer is complimentary to the target and a universal 17-mer stem loop at the 5′-end forms a hairpin structure. A fluorescent dye is attached to 5′-end of either the forward or reverse primer. The presence of guanosine residues at the first and second position of the 3′ dangling end effectively quenches the fluorescence due to the photo electron transfer (PET) mechanism. During the synthesis of nucleic acid, the hairpin structure is linearized and the fluorescence of the incorporated primer increases several-fold due to release of the fluorescently labeled tail and the absence of guanosine quenching. As amplicons are synthesized during nucleic acid amplification, the fluorescence increase in the reaction mixture can be measured with commercially available real-time PCR instruments. In addition, a melting procedure can be performed to denature the double-stranded amplicons, thereby generating fluorescence peaks that can differentiate primer dimers and other non-specific amplicons if formed during the reaction. We demonstrated the application of PET-PCR for the rapid detection and quantification of Cryptosporidium parvum DNA. Comparison with a previously published TaqMan® assay demonstrated that the two real-time PCR assays exhibited similar sensitivity for a dynamic range of detection of 6000–0.6 oocysts per reaction. PET PCR primers are simple to design and less-expensive than dual-labeled probe PCR methods, and should be of interest for use by laboratories operating in resource

A novel photoinduced electron transfer (PET) primer technique for rapid real-time PCR detection of Cryptosporidium spp

International Nuclear Information System (INIS)

Jothikumar, N.; Hill, Vincent R.

2013-01-01

Highlights: •Uses a single-labeled fluorescent primer for real-time PCR. •The detection sensitivity of PET PCR was comparable to TaqMan PCR. •Melt curve analysis can be performed to confirm target amplicon production. •Conventional PCR primers can be converted to PET PCR primers. -- Abstract: We report the development of a fluorescently labeled oligonucleotide primer that can be used to monitor real-time PCR. The primer has two parts, the 3′-end of the primer is complimentary to the target and a universal 17-mer stem loop at the 5′-end forms a hairpin structure. A fluorescent dye is attached to 5′-end of either the forward or reverse primer. The presence of guanosine residues at the first and second position of the 3′ dangling end effectively quenches the fluorescence due to the photo electron transfer (PET) mechanism. During the synthesis of nucleic acid, the hairpin structure is linearized and the fluorescence of the incorporated primer increases several-fold due to release of the fluorescently labeled tail and the absence of guanosine quenching. As amplicons are synthesized during nucleic acid amplification, the fluorescence increase in the reaction mixture can be measured with commercially available real-time PCR instruments. In addition, a melting procedure can be performed to denature the double-stranded amplicons, thereby generating fluorescence peaks that can differentiate primer dimers and other non-specific amplicons if formed during the reaction. We demonstrated the application of PET-PCR for the rapid detection and quantification of Cryptosporidium parvum DNA. Comparison with a previously published TaqMan® assay demonstrated that the two real-time PCR assays exhibited similar sensitivity for a dynamic range of detection of 6000–0.6 oocysts per reaction. PET PCR primers are simple to design and less-expensive than dual-labeled probe PCR methods, and should be of interest for use by laboratories operating in resource

Single primer amplification reaction methods reveal exotic and ...

Indian Academy of Sciences (India)

Unknown

mulberry varieties using three different PCR based single primer amplification ..... the results of a multi- variate analysis using Mahalanobis D2 statistic in case of .... Rajan M V, Chaturvedi H K and Sarkar A 1997 Multivariate analysis as an aid ...

MSP-HTPrimer: a high-throughput primer design tool to improve assay design for DNA methylation analysis in epigenetics.

Science.gov (United States)

Pandey, Ram Vinay; Pulverer, Walter; Kallmeyer, Rainer; Beikircher, Gabriel; Pabinger, Stephan; Kriegner, Albert; Weinhäusel, Andreas

2016-01-01

Bisulfite (BS) conversion-based and methylation-sensitive restriction enzyme (MSRE)-based PCR methods have been the most commonly used techniques for locus-specific DNA methylation analysis. However, both methods have advantages and limitations. Thus, an integrated approach would be extremely useful to quantify the DNA methylation status successfully with great sensitivity and specificity. Designing specific and optimized primers for target regions is the most critical and challenging step in obtaining the adequate DNA methylation results using PCR-based methods. Currently, no integrated, optimized, and high-throughput methylation-specific primer design software methods are available for both BS- and MSRE-based methods. Therefore an integrated, powerful, and easy-to-use methylation-specific primer design pipeline with great accuracy and success rate will be very useful. We have developed a new web-based pipeline, called MSP-HTPrimer, to design primers pairs for MSP, BSP, pyrosequencing, COBRA, and MSRE assays on both genomic strands. First, our pipeline converts all target sequences into bisulfite-treated templates for both forward and reverse strand and designs all possible primer pairs, followed by filtering for single nucleotide polymorphisms (SNPs) and known repeat regions. Next, each primer pairs are annotated with the upstream and downstream RefSeq genes, CpG island, and cut sites (for COBRA and MSRE). Finally, MSP-HTPrimer selects specific primers from both strands based on custom and user-defined hierarchical selection criteria. MSP-HTPrimer produces a primer pair summary output table in TXT and HTML format for display and UCSC custom tracks for resulting primer pairs in GTF format. MSP-HTPrimer is an integrated, web-based, and high-throughput pipeline and has no limitation on the number and size of target sequences and designs MSP, BSP, pyrosequencing, COBRA, and MSRE assays. It is the only pipeline, which automatically designs primers on both genomic

Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

Energy Technology Data Exchange (ETDEWEB)

Bilyard, G.R.; Word, C.J.; Weber, J.R.; Harding, A.K.

2000-09-27

This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of groups interacting about topics in bioremediation or the NABIR program. The primer also provides brief, useful models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums.

Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

Energy Technology Data Exchange (ETDEWEB)

A Harding; B Metting; C Word; G Bilyard; G Hund; J Amaya; J Weber; S Gajewski; S Underriner; T Peterson

1998-12-10

This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of @oups interacting about topics in bioremediation or the NABIR program. The primer also provides briez usefid models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums.

Summary of the primer on tumor immunology and the biological therapy of cancer

Directory of Open Access Journals (Sweden)

Margolin Kim

2009-01-01

Full Text Available Abstract The International Society for Biological Therapy of Cancer (iSBTc is one of the "premier destinations for interaction and innovation in the cancer biologics community". It provides a primer course each year during the annual meeting to address the most important areas of tumor immunology and immunotherapy. The course has been given by prominent investigators in the area of interest, covering the core principles of cancer immunology and immunotherapy. The target audience for this program includes investigators from academic, regulatory, and biopharmaceutical venues. The program goal is to enable the attendees to learn the current status and the most recent advances in biologic therapies, and to leverage this knowledge towards the improvement of cancer therapy. The 2008 immunologic primer course was held on October 30 at the 23rd Annual meeting of iSBTc in San Diego, CA. Nine internationally renowned investigators gave excellent presentations on different topics. The topics covered in this primer included: (1 cytokines in cancer immunology; (2 anti-angiogenic therapy; (3 end stage: immune killing of tumors; (4 blocking T cell checkpoints; (5 approach to identification and therapeutic exploitation of tumor antigens; (6 T regulatory cells; (7 adoptive T cell therapy; (8 immune monitoring of cancer immunotherapy; and (9 immune adjuvants. We summarized the topics in this primer for public education. The related topic slides and schedule can be accessed online http://www.isbtc.org/meetings/am08/primer08.

Screening for Residual Disease in Pediatric Burkitt Lymphoma Using Consensus Primer Pools

Directory of Open Access Journals (Sweden)

Melissa Agsalda

2009-01-01

Full Text Available Assessing molecular persistent or minimal residual disease (PD/MRD in childhood Burkitt lymphoma (BL is challenging because access to original tumor is usually needed to design patient-specific primers (PSPs. Because BL is characterized by rearranged immunoglobulin heavy chain (IgVH genes, IgVH primer pools from IgVH1–IgVH7 regions were tested to detect PD/MRD, thus eliminating the need for original tumor. The focus of the current study was to assess the feasibility of using IgVH primer pools to detect disease in clinical specimens. Fourteen children diagnosed with B-NHL had follow-up repository specimens available to assess PD/MRD. Of the 14 patients, 12 were PD/MRD negative after 2 months of therapy and remained in remission at the end of therapy; 2/14 patients were PD/MRD positive at 2-3 months and later relapsed. PSP-based assays from these 14 patients showed 100% concordance with the current assay. This feasibility study warrants further investigation to assess PD/MRD using IgVH primer pools, which could have clinical significance as a real-time assessment tool to monitor pediatric BL and possibly other B-cell non-Hodgkin lymphoma therapy.

Screening for residual disease in pediatric burkitt lymphoma using consensus primer pools.

Science.gov (United States)

Agsalda, Melissa; Kusao, Ian; Troelstrup, David; Shiramizu, Bruce

2009-01-01

Assessing molecular persistent or minimal residual disease (PD/MRD) in childhood Burkitt lymphoma (BL) is challenging because access to original tumor is usually needed to design patient-specific primers (PSPs). Because BL is characterized by rearranged immunoglobulin heavy chain (IgV(H)) genes, IgV(H) primer pools from IgV(H1)-IgV(H7) regions were tested to detect PD/MRD, thus eliminating the need for original tumor. The focus of the current study was to assess the feasibility of using IgV(H) primer pools to detect disease in clinical specimens. Fourteen children diagnosed with B-NHL had follow-up repository specimens available to assess PD/MRD. Of the 14 patients, 12 were PD/MRD negative after 2 months of therapy and remained in remission at the end of therapy; 2/14 patients were PD/MRD positive at 2-3 months and later relapsed. PSP-based assays from these 14 patients showed 100% concordance with the current assay. This feasibility study warrants further investigation to assess PD/MRD using IgV(H) primer pools, which could have clinical significance as a real-time assessment tool to monitor pediatric BL and possibly other B-cell non-Hodgkin lymphoma therapy.

MRI Primer

International Nuclear Information System (INIS)

Oldendorf, W.; Oldendorf, W. Jr.

1991-01-01

Designed for studies, radiologists, and clinicians at all levels of training, this book provides a basic introduction to the principles, physics, and instrumentation of magnetic resonance imaging. The fundamental concepts that are essential for the optimal clinical use of MRI are thoroughly explained in easily accessible terms. To facilitate the reader's comprehension, the material is presented nonmathematically, using no equations and a minimum of symbols and abbreviations. MRI Primer presents a clear account of the phenomenon of nuclear magnetic resonance and the use of gradient magnetic fields to create clinically useful images of cross-sectional slices. Close attention is given to the magnetization vector as a means of expressing nuclear behavior, the role of T 1 and T 2 weighing in imaging, the use of contrast agents, and the pulse sequences most often used in clinical practice, as well as to the relative capabilities and limitations of MRI and CT. The basic hardware components of an MRI scanner are described in detail. Sample MRI scans illustrate how MRI characterizes tissue. An appendix provides a brief introduction to quantum processes in MRI

A primer of multivariate statistics

CERN Document Server

Harris, Richard J

2014-01-01

Drawing upon more than 30 years of experience in working with statistics, Dr. Richard J. Harris has updated A Primer of Multivariate Statistics to provide a model of balance between how-to and why. This classic text covers multivariate techniques with a taste of latent variable approaches. Throughout the book there is a focus on the importance of describing and testing one's interpretations of the emergent variables that are produced by multivariate analysis. This edition retains its conversational writing style while focusing on classical techniques. The book gives the reader a feel for why

Rapid and sensitive electrochemiluminescence detection of rotavirus by magnetic primer based reverse transcription-polymerase chain reaction

International Nuclear Information System (INIS)

Zhan Fangfang; Zhou Xiaoming; Xing Da

2013-01-01

Graphical abstract: In this work, we have developed and demonstrated a magnetic primer based RT-PCR assay for ECL detection of rotavirus. In the presence of two functional primers (magnetic primer and TBR-primer) and PCR reagents, cDNA from RT was amplified directly onto MPs during PCR cycles of denaturation, annealing and extension. The resulting MPs–TBR complexes were easily loaded on the electrode surface and produced a concentrated ECL signal. The figure shows the schematic illustration of magnetic primer RT-PCR based ECL assay for rotavirus detection. Highlights: ► A novel method for detection of rotavirus has been developed. ► In the presence of magnetic primer, TBR-primer and PCR reagents, cDNA form RT was amplified directly onto MPs. ► To obtain the best sensing and efficient performance, important parameters associated with the efficiency were investigated carefully. ► The proposed method will find numerous applications in food safety field and clinical diagnosis. - Abstract: A novel method for detection of rotavirus has been developed by integrating magnetic primer based reverse transcription-polymerase chain reaction (RT-PCR) with electrochemiluminescence (ECL) detection. This is realized by accomplishing RT of rotavirus RNA in traditional way and performing PCR of the resulting cDNA fragment on the surface of magnetic particles (MPs). In order to implement PCR on MPs and achieve rapid ECL detection, forward and reverse primers are bounded to MPs and tris-(2,2′-bipyridyl) ruthenium (TBR), respectively. After RT-PCR amplification, the TBR labels are directly enriched onto the surface of MPs. Then the MPs–TBR complexes can be loaded on the electrode surface and analyzed by magnetic ECL platform without any post-modification or post-incubation process. So some laborious manual operations can be avoided to achieve rapid yet sensitive detection. In this study, rotavirus in fecal specimens was successfully detected within 1.5 h. Experimental

A Primer on Basic Effect Size Concepts.

Science.gov (United States)

Elmore, Patricia B.; Rotou, Ourania

The increased interest in reporting effect sizes means that it is necessary to consider what should be included in a primer on effect sizes. A review of papers on effect sizes and commonly repeated statistical analyses suggests that it is important to discuss effect sizes relative to bivariate correlation, t-tests, analysis of variance/covariance,…

La Construcción de Políticas Turísticas Orientadas a los Sectores Medios Durante el Primer Peronismo: Argentina 1946-1955

OpenAIRE

Piglia, Melina; Pastoriza, Elisa

2017-01-01

En el marco general de los estudios de las políticas públicas durante el primer peronismo (Argentina 1946-1955), el presente trabajo pretende abordar aspectos descuidados de las políticas turísticas, desde una perspectiva de historia social. El artículo sostiene que, junto a las más conocidas transformaciones producidas en el campo del turismo obrero y el turismo social, se puede advertir durante el período peronista la puesta en marcha de políticas turísticas orientadas al turismo de los sec...

Susceptibilidad de genotipos de Solanum spp. al nematodo causante del nudo radical Meloidogyne spp. (chitwood

Directory of Open Access Journals (Sweden)

Gelpud Chaves Cristian

2011-03-01

Full Text Available

El cultivo del lulo (Solanum quitoense L. presenta una disminución en su productividad, debido al ataque de patógenos como el nematodo del nudo radical Meloidogyne  spp., en el Departamento  de Nariño (Colombia, se han reportado incidencias cercanas al 79%, y pérdidas del 50%.   En la presente investigación, se colectaron 45 genotipos de (Solanum quitoense  L. en los Departamentos  de Nariño  y Putumayo  y 4 genotipos  silvestres  (S. mammosum, S. hirtum,       S. marginatum  y S. umbellatum buscando fuentes de resistencia al nematodo. Se inocularon 9 plantas de cada genotipo de dos meses de edad con 10000 huevos de Meloidogyne spp., dejando tres testigos por cada material. Las variables evaluadas fueron: altura de planta, severidad, incidencia, peso fresco (tallo y raíz y especies prevalentes de Meloidogyne spp. Se hizo una clasificación de genotipos mediante escala de resistencia y regresión entre la severidad y las demás variables para establecer el efecto de Meloidogyne spp. sobre los genotipos de planta. Los resultados mostraron 100% de incidencia del nematodo en  todos  los  genotipos,  2.04%  genotipos  resistentes,  34.7%  moderadamente  resistentes, 42.8% moderadamente susceptibles, 18.3% susceptibles, y 2.04% altamente susceptibles. El genotipo SQbr05 resistente, no se vio afectado por la severidad, al contrario SQbc04 genotipo susceptible, mostró reducciones significativas en peso fresco de tallo y raIz, (R2 = 0.71 y 0.98,el genotipo silvestre (S. mammosum es altamente susceptible, Meloidogyne incognita presentó 55.31% de presencia. El genotipo SQbr05 es promisorio para ser evaluado en campo.

UNA APROXIMACIÓN AL CONOCIMIENTO DE UNA PROFESORA UNIVERSITARIA, AGENTE DE BUENAS PRÁCTICAS DOCENTES, UTILIZANDO MAPAS CONCEPTUALES

Directory of Open Access Journals (Sweden)

Fermín González García

2010-01-01

Full Text Available Se muestra en este trabajo un modelo de conocimiento construido sobre buenas prácticas docentes de una profesora universitaria, responsable de la asignatura "Circuitos y Sistemas I", correspondiente al primer curso (y primer cuatrimestre de la titulación de Ingeniería Técnica de Telecomunicación: Sonido e Imagen. El modelo fue realizado en el marco de una investigación que se ha llevado a cabo por 6 universidades españolas. El trabajo identifica, analiza, explicita y representa con la ayuda del programa informático CMap Tools el pensamiento pedagógico y la práctica docente de un profesor universitario caracterizado por su buena práctica, a partir de entrevistas en profundidad. El modelo de conocimiento construido de las buenas prácticas de este profesor, fácilmente accesible a través de Internet, constituye un excelente ejemplo que puede orientar tanto al profesor novel como a profesores experimentados que quieran mejorar la calidad de la docencia que imparten.

The Universal Primer - An open source solution for archiving, organizing and streaming live lectures

DEFF Research Database (Denmark)

Christoffersen, Marc Juul; Panton, Hans Christian Hansen; Krajowski-Kukiel, Maciej

2011-01-01

. The goal of the Universal Primer is to address these problems, and allow anyone, anywhere, to teach or learn anything that can be reasonably taught or learned through a computer. The Universal Primer is 1: A fully open source solution for streaming live lectures. And 2: A Wikipedia-like website...

A Brief Taxometrics Primer

Science.gov (United States)

Beauchaine, Theodore P.

2009-01-01

Taxometric procedures provide an empirical means of determining which psychiatric disorders are typologically distinct from normal behavioral functioning. Although most disorders reflect extremes along continuously distributed behavioral traits, identifying those that are discrete has important implications for accurate diagnosis, effective treatment, early identification of risk, and improved understanding of etiology. This article provides (a) brief descriptions of the conceptual bases of several taxometric procedures, (b) example analyses using simulated data, and (c) strategies for avoiding common pitfalls that are often observed in taxometrics research. To date, most taxometrics studies have appeared in the adult psychopathology literature. It is hoped that this primer will encourage interested readers to extend taxometrics research to child and adolescent populations. PMID:18088222

Magnesium-Based Sacrificial Anode Cathodic Protection Coatings (Mg-Rich Primers for Aluminum Alloys

Directory of Open Access Journals (Sweden)

Michael D. Blanton

2012-09-01

Full Text Available Magnesium is electrochemically the most active metal employed in common structural alloys of iron and aluminum. Mg is widely used as a sacrificial anode to provide cathodic protection of underground and undersea metallic structures, ships, submarines, bridges, decks, aircraft and ground transportation systems. Following the same principle of utilizing Mg characteristics in engineering advantages in a decade-long successful R&D effort, Mg powder is now employed in organic coatings (termed as Mg-rich primers as a sacrificial anode pigment to protect aerospace grade aluminum alloys against corrosion. Mg-rich primers have performed very well on aluminum alloys when compared against the current chromate standard, but the carcinogenic chromate-based coatings/pretreatments are being widely used by the Department of Defense (DoD to protect its infrastructure and fleets against corrosion damage. Factors such as reactivity of Mg particles in the coating matrix during exposure to aggressive corrosion environments, interaction of atmospheric gases with Mg particles and the impact of Mg dissolution, increases in pH and hydrogen gas liberation at coating-metal interface, and primer adhesion need to be considered for further development of Mg-rich primer technology.

Invading stacking primer: A trigger for high-efficiency isothermal amplification reaction with superior selectivity for detecting microRNA variants.

Science.gov (United States)

Liu, Weipeng; Zhu, Minjun; Liu, Hongxing; Wei, Jitao; Zhou, Xiaoming; Xing, Da

2016-07-15

Searching for a strategy to enhance the efficiency of nucleic acid amplification and achieve exquisite discrimination of nucleic acids at the single-base level for biological detection has become an exciting research direction in recent years. Here, we have developed a simple and universal primer design strategy which produces a fascinating effect on isothermal strand displacement amplification (iSDA). We refer to the resultant primer as "invading stacking primer (IS-Primer)" which is based on contiguous stacking hybridization and toehold-mediated exchange reaction and function by merely changing the hybridization location of the primer. Using the IS-Primer, the sensitivity in detecting the target miR-21 is improved approximately five fold compared with the traditional iSDA reaction. It was further demonstrated that the IS-Primer acts as an invading strand to initiate branch migration which can increase the efficiency of the untwisting of the hairpin probe. This effect is equivalent to reducing the free energy of the stem, and the technique shows superior selectivity for single-base mismatches. By demonstrating the enhanced effect of the IS-Primer in the iSDA reaction, this work may provide a potentially new avenue for developing more sensitive and selective nucleic acids assays. Copyright © 2016 Elsevier B.V. All rights reserved.

La ayuda oficial al desarrollo en el sector agrario

OpenAIRE

Areta García, Álvaro; Marín, Gonzalo

2006-01-01

El primer Objetivo de Desarrollo del Milenio habla de erradicar la pobreza extrema y el hambre. Por tanto, dado que la mayoría de la gente pobre vive en el medio rural o depende de la agricultura, y que en las naciones más pobres la agricultura prepara el terreno para el desarrollo económico, será imprescindible una gran inversión en el desarrollo rural y, por ende, en uno de sus “pilares” básicos, la agricultura. Sin embargo, el papel de la agricultura en el marco de la Ayuda Oficial al Desa...

Taxon-specific PCR primers to detect two inconspicuous arbuscular mycorrhizal fungi from temperate agricultural grassland

NARCIS (Netherlands)

Gamper, H.A.; Leuchtmann, A.

2007-01-01

Taxon-specific polymerase chain reaction (PCR) primers enable detection of arbuscular mycorrhizal fungi (AMF, Glomeromycota) in plant roots where the fungi lack discriminative morphological and biochemical characters. We designed and validated pairs of new PCR primers targeted to the flanking

Development and evaluation of new primers for PCR-based identification of Prevotella intermedia.

Science.gov (United States)

Zhou, Yanbin; Liu, Dali; Wang, Yiwei; Zhu, Cailian; Liang, Jingping; Shu, Rong

2014-08-01

The aim of this study was to develop new Prevotella intermedia-specific PCR primers based on the 16S rRNA. The new primer set, Pi-192 and Pi-468, increased the accuracy of PCR-based P. intermedia identification and could be useful in the detection of P. intermedia as well as epidemiological studies on periodontal disease. Copyright © 2014 Elsevier Ltd. All rights reserved.

Identification of differentially expressed genes induced by energy restriction using annealing control primer system from the liver and adipose tissues of broilers.

Science.gov (United States)

Wang, J W; Chen, W; Kang, X T; Huang, Y Q; Tian, Y D; Wang, Y B

2012-04-01

Female Arbor Acre broilers were divided into 2 groups at 18 d of age. One group of chickens had free access to feed (AL), and the other group of chickens had 30% energy restriction (ER). Adipose and hepatic RNA samples were collected at 48 d of age. We employed an accurate reverse-transcription (RT) PCR method that involves annealing control primers to identify the differentially expressed genes (DEG) between ER and AL groups. Using 20 annealing control primers, 43 differentially expressed bands (40 downregulated and 3 upregulated in the ER group) were detected from the hepatic tissue, whereas no differentially expressed bands were detected from the adipose tissue. It seems that energy restriction could induce more DEG in hepatic tissue than that in adipose tissue and could result in more gene-expression downregulation in hepatic tissue. Eight DEG (6 known and 2 unknown genes) were gained from hepatic tissue and confirmed by RT-PCR, which were all supported by released expressed sequence tag sequences. Their expressions were all downregulated by energy restriction in hepatic tissues. Six known genes are RPL7, RPLP1, FBXL12, ND1, ANTXR2, and SLC22A18, respectively, which seem to play essential roles in the protein translation, energy metabolism, and tumor inhibition. The alterations of gene expression in 3 selected genes, including ND1 (P < 0.01), FBXL12 (P < 0.01), and RPLP1 (P < 0.05), were supported by real-time quantitative RT-PCR reaction. Our data provide new insights on the metabolic state of broilers changed by energy restriction.

Molecular Basis for DNA Double-Strand Break Annealing and Primer Extension by an NHEJ DNA Polymerase

Directory of Open Access Journals (Sweden)

Nigel C. Brissett

2013-11-01

Full Text Available Nonhomologous end-joining (NHEJ is one of the major DNA double-strand break (DSB repair pathways. The mechanisms by which breaks are competently brought together and extended during NHEJ is poorly understood. As polymerases extend DNA in a 5′-3′ direction by nucleotide addition to a primer, it is unclear how NHEJ polymerases fill in break termini containing 3′ overhangs that lack a primer strand. Here, we describe, at the molecular level, how prokaryotic NHEJ polymerases configure a primer-template substrate by annealing the 3′ overhanging strands from opposing breaks, forming a gapped intermediate that can be extended in trans. We identify structural elements that facilitate docking of the 3′ ends in the active sites of adjacent polymerases and reveal how the termini act as primers for extension of the annealed break, thus explaining how such DSBs are extended in trans. This study clarifies how polymerases couple break-synapsis to catalysis, providing a molecular mechanism to explain how primer extension is achieved on DNA breaks.

Typing of multiple single-nucleotide polymorphisms using ribonuclease cleavage of DNA/RNA chimeric single-base extension primers and detection by MALDI-TOF mass spectrometry

DEFF Research Database (Denmark)

Mengel-From, Jonas; Sanchez Sanchez, Juan Jose; Børsting, Claus

2005-01-01

A novel single-base extension (SBE) assay using cleavable and noncleavable SBE primers in the same reaction mix is described. The cleavable SBE primers consisted of deoxyribonucleotides and one ribonucleotide (hereafter denoted chimeric primers), whereas the noncleavable SBE primers consisted....... A ribonuclease mix was developed to specifically cleave the chimeric primers, irrespective of the base of the ribonucleotide, whereas standard primers without a ribonucleotide were unaffected by the ribonuclease treatment. The SBE products were analyzed in linear mode using a matrix-assisted laser desorption...... containing 9 chimeric primers and 8 standard primers....

The astrobiology primer: an outline of general knowledge--version 1, 2006.

Science.gov (United States)

Billings, L; Cameron, V; Claire, M; Dick, G J; Domagal-Goldman, S D; Javaux, E J; Johnson, O J; Laws, C; Race, M S; Rask, J; Rummel, J D; Schelble, R T; Vance, S

2006-10-01

The Astrobiology Primer has been created as a reference tool for those who are interested in the interdisciplinary field of astrobiology. The field incorporates many diverse research endeavors, but it is our hope that this slim volume will present the reader with all he or she needs to know to become involved and to understand, at least at a fundamental level, the state of the art. Each section includes a brief overview of a topic and a short list of readable and important literature for those interested in deeper knowledge. Because of the great diversity of material, each section was written by a different author with a different expertise. Contributors, authors, and editors are listed at the beginning, along with a list of those chapters and sections for which they were responsible. We are deeply indebted to the NASA Astrobiology Institute (NAI), in particular to Estelle Dodson, David Morrison, Ed Goolish, Krisstina Wilmoth, and Rose Grymes for their continued enthusiasm and support. The Primer came about in large part because of NAI support for graduate student research, collaboration, and inclusion as well as direct funding. We have entitled the Primer version 1 in hope that it will be only the first in a series, whose future volumes will be produced every 3-5 years. This way we can insure that the Primer keeps up with the current state of research. We hope that it will be a great resource for anyone trying to stay abreast of an ever-changing field.

One fungus, which genes? Development and assessment of universal primers for potential secondary fungal DNA barcodes.

Science.gov (United States)

Stielow, J B; Lévesque, C A; Seifert, K A; Meyer, W; Iriny, L; Smits, D; Renfurm, R; Verkley, G J M; Groenewald, M; Chaduli, D; Lomascolo, A; Welti, S; Lesage-Meessen, L; Favel, A; Al-Hatmi, A M S; Damm, U; Yilmaz, N; Houbraken, J; Lombard, L; Quaedvlieg, W; Binder, M; Vaas, L A I; Vu, D; Yurkov, A; Begerow, D; Roehl, O; Guerreiro, M; Fonseca, A; Samerpitak, K; van Diepeningen, A D; Dolatabadi, S; Moreno, L F; Casaregola, S; Mallet, S; Jacques, N; Roscini, L; Egidi, E; Bizet, C; Garcia-Hermoso, D; Martín, M P; Deng, S; Groenewald, J Z; Boekhout, T; de Beer, Z W; Barnes, I; Duong, T A; Wingfield, M J; de Hoog, G S; Crous, P W; Lewis, C T; Hambleton, S; Moussa, T A A; Al-Zahrani, H S; Almaghrabi, O A; Louis-Seize, G; Assabgui, R; McCormick, W; Omer, G; Dukik, K; Cardinali, G; Eberhardt, U; de Vries, M; Robert, V

2015-12-01

The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic markers were tested across > 1 500 species (1 931 strains or specimens) and the outcomes of almost twenty thousand (19 577) polymerase chain reactions were evaluated. We tested several well-known primer pairs that amplify: i) sections of the nuclear ribosomal RNA gene large subunit (D1-D2 domains of 26/28S); ii) the complete internal transcribed spacer region (ITS1/2); iii) partial β -tubulin II (TUB2); iv) γ-actin (ACT); v) translation elongation factor 1-α (TEF1α); and vi) the second largest subunit of RNA-polymerase II (partial RPB2, section 5-6). Their PCR efficiencies were compared with novel candidate primers corresponding to: i) the fungal-specific translation elongation factor 3 (TEF3); ii) a small ribosomal protein necessary for t-RNA docking; iii) the 60S L10 (L1) RP; iv) DNA topoisomerase I (TOPI); v) phosphoglycerate kinase (PGK); vi) hypothetical protein LNS2; and vii) alternative sections of TEF1α. Results showed that several gene sections are accessible to universal primers (or primers universal for phyla) yielding a single PCR-product. Barcode gap and multi-dimensional scaling analyses revealed that some of the tested candidate markers have universal properties providing adequate infra- and inter-specific variation that make them attractive barcodes for species identification. Among these gene sections, a novel high fidelity primer pair for TEF1α, already widely used as a phylogenetic marker in mycology, has potential as a supplementary DNA barcode with superior resolution to ITS. Both TOPI and PGK show promise for the Ascomycota, while TOPI and LNS2 are attractive for the Pucciniomycotina, for which universal primers for ribosomal subunits often fail.

Promotion primer. Foerderfibel

Energy Technology Data Exchange (ETDEWEB)

1981-01-01

This revised edition of the promotion primer is to serve as a topical orientation aid for industrial firms, unions, boards and other bodies interested where the actions of governmental R and D and innovation policy are compiled and clearly arranged. It is important for the success of governmental aids that the institutions concerned are informed about all possibilities of the promotion, financing and advisory programme. Beyond the presentation of the research promotion sectors, the fiscal measures and the contractual as well as the joint research this revised edition focussess on the fields of consultative services for innovation and information. For many firms the access to qualified information and guidance is of particular importance. That is why this brochure points out the ways towards governmental research promotion. The BMFT has provided a remarkable contribution to research promotion by establishing information and consultative services for trade and industry.

Primer registro de la cotorra argentina (Myiopsitta monachus en Chihuahua, México

Directory of Open Access Journals (Sweden)

Ricardo Abel Soto-Cruz

2015-06-01

Full Text Available Reportamos el primer registro de la cotorra argentina (Myiopsitta monachus en las ciudades de Chihuahua y Delicias en Chihuahua, México. Observamos cinco individuos de esta especie de junio a diciembre de 2011 en las instalaciones de la Facultad de Zootecnia y Ecología de la Universidad Autónoma de Chihuahua; grupos de 2 a 12 individuos en el área urbana de la ciudad de Chihuahua durante 2012, y cuatro individuos en ciudad Delicias, a 80 km al sureste de la ciudad de Chihuahua, en el 2013. Previamente, en enero de 2011, se reportó, en el portal electrónico de aVerAves, el avistamiento de un individuo en el noroeste del estado. Dada la presencia de nidos activos en las ciudades de Chihuahua y Delicias, la especie podría estar ya establecida en esta parte del país. Recomendamos dar seguimiento a las poblaciones existentes de esta especie a fin de documentar los posibles riesgos a los ecosistemas en la región.

Gold nanoparticle-assisted primer walking for closing the human chromosomal gap

DEFF Research Database (Denmark)

Li, H; Shi, B; Li, X

2013-01-01

The finished sequence of the human genome still contains 260 euchromatic gaps. All the PCR-based genome walking techniques used to close gaps have common limitations, such as low efficiency and low specificity. We herein describe a strategy to solve this problem by employing gold nanoparticles (Au......NPs) to improve the efficiency in primer walking amplification. We used this strategy to close a gap in human chromosome 5 containing a DNA stretch composed of the 12SAT repeat. The obtained gap sequence is highly conserved among several mammalian genomes. The demonstrated AuNP-assisted primer walking strategy...

Conservative fragments in bacterial 16S rRNA genes and primer design for 16S ribosomal DNA amplicons in metagenomic studies

KAUST Repository

Wang, Yong

2009-10-09

Bacterial 16S ribosomal DNA (rDNA) amplicons have been widely used in the classification of uncultured bacteria inhabiting environmental niches. Primers targeting conservative regions of the rDNAs are used to generate amplicons of variant regions that are informative in taxonomic assignment. One problem is that the percentage coverage and application scope of the primers used in previous studies are largely unknown. In this study, conservative fragments of available rDNA sequences were first mined and then used to search for candidate primers within the fragments by measuring the coverage rate defined as the percentage of bacterial sequences containing the target. Thirty predicted primers with a high coverage rate (>90%) were identified, which were basically located in the same conservative regions as known primers in previous reports, whereas 30% of the known primers were associated with a coverage rate of <90%. The application scope of the primers was also examined by calculating the percentages of failed detections in bacterial phyla. Primers A519-539, E969- 983, E1063-1081, U515 and E517, are highly recommended because of their high coverage in almost all phyla. As expected, the three predominant phyla, Firmicutes, Gemmatimonadetes and Proteobacteria, are best covered by the predicted primers. The primers recommended in this report shall facilitate a comprehensive and reliable survey of bacterial diversity in metagenomic studies. © 2009 Wang, Qian.

Rapid and sensitive electrochemiluminescence detection of rotavirus by magnetic primer based reverse transcription-polymerase chain reaction

Energy Technology Data Exchange (ETDEWEB)

Zhan Fangfang; Zhou Xiaoming [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, College of Biophotonics, South China Normal University, Guangzhou 510631 (China); Xing Da, E-mail: xingda@scnu.edu.cn [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, College of Biophotonics, South China Normal University, Guangzhou 510631 (China)

2013-01-25

Graphical abstract: In this work, we have developed and demonstrated a magnetic primer based RT-PCR assay for ECL detection of rotavirus. In the presence of two functional primers (magnetic primer and TBR-primer) and PCR reagents, cDNA from RT was amplified directly onto MPs during PCR cycles of denaturation, annealing and extension. The resulting MPs-TBR complexes were easily loaded on the electrode surface and produced a concentrated ECL signal. The figure shows the schematic illustration of magnetic primer RT-PCR based ECL assay for rotavirus detection. Highlights: Black-Right-Pointing-Pointer A novel method for detection of rotavirus has been developed. Black-Right-Pointing-Pointer In the presence of magnetic primer, TBR-primer and PCR reagents, cDNA form RT was amplified directly onto MPs. Black-Right-Pointing-Pointer To obtain the best sensing and efficient performance, important parameters associated with the efficiency were investigated carefully. Black-Right-Pointing-Pointer The proposed method will find numerous applications in food safety field and clinical diagnosis. - Abstract: A novel method for detection of rotavirus has been developed by integrating magnetic primer based reverse transcription-polymerase chain reaction (RT-PCR) with electrochemiluminescence (ECL) detection. This is realized by accomplishing RT of rotavirus RNA in traditional way and performing PCR of the resulting cDNA fragment on the surface of magnetic particles (MPs). In order to implement PCR on MPs and achieve rapid ECL detection, forward and reverse primers are bounded to MPs and tris-(2,2 Prime -bipyridyl) ruthenium (TBR), respectively. After RT-PCR amplification, the TBR labels are directly enriched onto the surface of MPs. Then the MPs-TBR complexes can be loaded on the electrode surface and analyzed by magnetic ECL platform without any post-modification or post-incubation process. So some laborious manual operations can be avoided to achieve rapid yet sensitive detection

Effect of oligonucleotide primers in determining viral variability within hosts

Directory of Open Access Journals (Sweden)

Moya Andrés

2004-12-01

Full Text Available Abstract Background Genetic variability in viral populations is usually estimated by means of polymerase chain reaction (PCR based methods in which the relative abundance of each amplicon is assumed to be proportional to the frequency of the corresponding template in the initial sample. Although bias in template-to-product ratios has been described before, its relevance in describing viral genetic variability at the intrapatient level has not been fully assessed yet. Results To investigate the role of oligonucleotide design in estimating viral variability within hosts, genetic diversity in hepatitis C virus (HCV populations from eight infected patients was characterised by two parallel PCR amplifications performed with two slightly different sets of primers, followed by cloning and sequencing (mean = 89 cloned sequences per patient. Population genetics analyses of viral populations recovered by pairs of amplifications revealed that in seven patients statistically significant differences were detected between populations sampled with different set of primers. Conclusions Genetic variability analyses demonstrates that PCR selection due to the choice of primers, differing in their degeneracy degree at some nucleotide positions, can eclipse totally or partially viral variants, hence yielding significant different estimates of viral variability within a single patient and therefore eventually producing quite different qualitative and quantitative descriptions of viral populations within each host.

Effect of oligonucleotide primers in determining viral variability within hosts.

Science.gov (United States)

Bracho, Maria Alma; García-Robles, Inmaculada; Jiménez, Nuria; Torres-Puente, Manuela; Moya, Andrés; González-Candelas, Fernando

2004-12-09

Genetic variability in viral populations is usually estimated by means of polymerase chain reaction (PCR) based methods in which the relative abundance of each amplicon is assumed to be proportional to the frequency of the corresponding template in the initial sample. Although bias in template-to-product ratios has been described before, its relevance in describing viral genetic variability at the intrapatient level has not been fully assessed yet. To investigate the role of oligonucleotide design in estimating viral variability within hosts, genetic diversity in hepatitis C virus (HCV) populations from eight infected patients was characterised by two parallel PCR amplifications performed with two slightly different sets of primers, followed by cloning and sequencing (mean = 89 cloned sequences per patient). Population genetics analyses of viral populations recovered by pairs of amplifications revealed that in seven patients statistically significant differences were detected between populations sampled with different set of primers. Genetic variability analyses demonstrates that PCR selection due to the choice of primers, differing in their degeneracy degree at some nucleotide positions, can eclipse totally or partially viral variants, hence yielding significant different estimates of viral variability within a single patient and therefore eventually producing quite different qualitative and quantitative descriptions of viral populations within each host.

Brownfields Technology Primer: Selecting and Using Phytoremediation for Site Cleanup

Science.gov (United States)

This primer explains the phytoremediation process, discusses the potential advantages and considerations in selecting phytoremediation to clean up brownfields sites, and provides information on additional resources about phytoremediation.

DESAIN PRIMER UNTUK AMPLIFIKASI FRAGMEN GEN inhA ISOLAT 134 MULTIDRUG RESISTANCE TUBERCULOSIS (MDR-TB DENGAN METODE POLYMERASE CHAIN REACTION

Directory of Open Access Journals (Sweden)

Luk Ketut Budi Maitriani

2015-10-01

Full Text Available ABSTRAK    : Penelitian ini bertujuan untuk memperoleh sepasang primer terbaik hasil desain secara in silico menggunakan program Clone Manager Suite 6 (University of Groningen. Primer ini didesain untuk digunakan dalam mengamplifikasi fragmen gen inhA isolat klinis Multidrug Resistance Tuberculosis (MDR-TB mencakup kodon 94 (nukleotida 280-282. Kodon 94 gen inhA merupakan posisi yang sering mengalami mutasi dan mengakibatkan koresisten terhadap isoniazid dan ethionamid. Desain primer menggunakan sekuen gen inhA Mycobacterium tuberculosis yang diperoleh dari situs www.ncbi.nlm.nih.gov (GenBank : AF106077. Hasil desain diperoleh sepasang primer terbaik dan diuji secara in vitro menggunakan metode Polymerase Chain Reaction (PCR. Template DNA yang digunakan adalah isolat klinis MDR-TB. Proses amplifikasi diawali dengan denaturasi awal pada 95°C selama 15 menit dan diikuti oleh 45 siklus amplifikasi (denaturasi pada suhu 94°C selama 1 menit, annealing pada 56°C selama 1 menit 20 detik dan elongasi pada 72°C selama 2 menit serta diakhiri dengan elongasi akhir pada 72°C selama 10 menit. Produk PCR dideteksi menggunakan elektroforesis gel agarosa 1,5%. Kesimpulan penelitian adalah diperoleh sepasang primer terbaik berdasarkan kriteria pada program Clone Manager Suite 6 (University of Groningen, meliputi: panjang primer, %GC, Tm (melting temperature, interaksi primer (dimers dan hairpins, stabilitas primer, repeats, runs dan false priming. Primer tersebut meliputi, primer forward (pF-inhA 5’ CTGGTTAGCGGAATCATCAC 3’ dan primer reverse (pR-inhA 5’ CGACCGTCATCCA-GTTGTA 3’ dengan ukuran produk 460 pb.   ABSTRACT: The aim of this study was to obtain the best pair of primer as result in silico design using Clone Manager Suite 6 program (University of Groningen. The primer was designed for amplifying inhA gene fragment of Multidrug Resistance Tuberculosis (MDR-TB clinical isolates include codon 94 (nucleotide 280-282. Codon 94 of inhA gene is

FullSSR: Microsatellite Finder and Primer Designer

Directory of Open Access Journals (Sweden)

Sebastián Metz

2016-01-01

Full Text Available Microsatellites are genomic sequences comprised of tandem repeats of short nucleotide motifs widely used as molecular markers in population genetics. FullSSR is a new bioinformatic tool for microsatellite (SSR loci detection and primer design using genomic data from NGS assay. The software was tested with 2000 sequences of Oryza sativa shotgun sequencing project from the National Center of Biotechnology Information Trace Archive and with partial genome sequencing with ROCHE 454® from Caiman latirostris, Salvator merianae, Aegla platensis, and Zilchiopsis collastinensis. FullSSR performance was compared against other similar SSR search programs. The results of the use of this kind of approach depend on the parameters set by the user. In addition, results can be affected by the analyzed sequences because of differences among the genomes. FullSSR simplifies the detection of SSRs and primer design on a big data set. The command line interface of FullSSR was intended to be used as part of genomic analysis tools pipeline; however, it can be used as a stand-alone program because the results are easily interpreted for a nonexpert user.

Relación del desempeño académico de estudiantes de primer año de universidad en Chile y los instrumentos de selección para su ingreso

Directory of Open Access Journals (Sweden)

Gastón Vergara-Díaz

2017-01-01

Full Text Available Si bien el rendimiento académico del estudiantado que ingresa a las universidades chilenas ha sido objeto de múltiples estudios, pocas investigaciones han analizado la relación que tienen los instrumentos de selección de ingreso y el rendimiento académico posterior. En una muestra de 440 estudiantes de Ingeniería Comercial de la Universidad Austral de Chile, pertenecientes a cinco promociones de primer año, se estudiaron los instrumentos de admisión a la carrera, y se determinó cuáles explican mejor el rendimiento académico. Para ello se utilizaron los resultados de las pruebas de selección universitaria (PSU y las notas de enseñanza media (NEM obtenidos por el estudiantado, en relación con el promedio semestral ponderado (PSP del primer año universitario. Se determinó que el promedio de NEM explica mejor el rendimiento académico estudiantil, al presentar la mejor correlación con el rendimiento académico del primer semestre y de manera más fuerte en el segundo.

Influencia del bajo peso al nacer en el estado de salud durante el primer año

Directory of Open Access Journals (Sweden)

Orlando Ortiz Silva

1997-08-01

Full Text Available Se realizó un trabajo descriptivo-retrospectivo sobre la influencia del bajo peso al nacer en el estado de salud al año de edad en el municipio Jaruco, desde el 1ro. de enero de 1994 hasta el 31 de diciembre de 1995. Se estudiaron 2 grupos de niños: grupo 1: formado por 55 niños con peso menor de 2 500 g en el período estudiado y grupo 2: escogidos del resto de nacidos con peso superior a los 2 500 g, numéricamente similar. Se concluye que los niños con bajo peso al nacer no muestran diferencias en el desarrollo físico al año de edad, pero sí aumento en los índices de morbilidad ambulatoria y hospitalaria por infecciones respiratorias agudas, enfermedades diarreicas agudas, sepsis urinaria y anemia, así como un peso importante en la mortalidad infantil. Se recomiendan actividades de promoción y prevención para disminuir el bajo peso al nacer.A descriptive and retrospective study about the influence of low birth weight on the health status during the first year of life was conducted in the municipality of Jaruco from January 1, 1994, to december, 1995. Two gruops of children were analyzed: the first group was composed of 55 infants with less than 2 500 g in the studied period, and in the second group there was a similar amount of infants selected from the rest of those who were born with more than 2 500 g. It is concluded that infants with low birth weight show no differences in their physical development, but that there is an increase in the indexes of ambulatory and hospital morbidity resulting from respiratory tract infections, acute diarrheal diseases, urinary sepsis and anemia. It is also demonstrated the importance of promotion and prevention to reduce low birth weight.

Effect of saliva contamination and artificial aging on different primer/cement systems bonded to zirconia.

Science.gov (United States)

Pitta, João; Branco, Teresa C; Portugal, Jaime

2018-05-01

Saliva contamination has been shown to decrease bonding to zirconia. Adopting a less contamination-sensitive cement system may be an alternative to decontamination. The purpose of this in vitro study was to assess the ability of different primer/cement systems to promote a durable bond to zirconia after saliva contamination. Zirconia blocks (Lava Plus) (N=320) were airborne-particle abraded (50 μm Al 2 O 3 ) and divided into 32 experimental groups (n=10) according to the variables in the study: saliva contamination; primer/cement system (Panavia SA [PSA]; RelyX Unicem 2 [RU2]; Bifix SE [BSE]; Panavia F2.0 [PF2]; Scotchbond Universal + RelyX Ultimate [SBU+RXU]; Futurabond M+ + Bifix QM [FBM+BQM]; All-Bond Universal + Duo-link [ABU+DL]; Z-Prime Plus + Duo-link [ZPP+DL]; and aging period (72 hours; 30 days with 10 000 thermocycles at 5°C to 55°C). After half of the blocks had been contaminated with fresh human saliva for 10 minutes, rinsed with water, and air-dried, each primer/cement was applied. Polymerized composite resin disks were then placed over the cement, and the resin cement was light-polymerized for 20 seconds each at 2 opposite margins. After the aging time, the specimens were tested in shear (1 mm/min). The failure mode was classified as adhesive, cohesive, or mixed. Statistical analysis of the shear bond strength (SBS) data was performed with ANOVA followed by Tukey honest significant difference post hoc tests. Chi-square tests were used to analyze the failure mode data (α=.05). The mean SBS ranged between 4.2 and 34.5 MPa. Shear bond strength was influenced (Pcontamination, aging time). SBU+RXU and FBM+BQM showed a higher mean SBS than those of the other experimental groups (Pcontamination (P>.05). Failure was predominantly classified as adhesive. In general, saliva contamination and aging decreased bonding efficacy. Two systems, combining an application of a universal adhesive and a resin cement (SBU+RXU and FBM+BQM) were not affected by

Conserved PCR primer set designing for closely-related species to complete mitochondrial genome sequencing using a sliding window-based PSO algorithm.

Directory of Open Access Journals (Sweden)

Cheng-Hong Yang

Full Text Available BACKGROUND: Complete mitochondrial (mt genome sequencing is becoming increasingly common for phylogenetic reconstruction and as a model for genome evolution. For long template sequencing, i.e., like the entire mtDNA, it is essential to design primers for Polymerase Chain Reaction (PCR amplicons which are partly overlapping each other. The presented chromosome walking strategy provides the overlapping design to solve the problem for unreliable sequencing data at the 5' end and provides the effective sequencing. However, current algorithms and tools are mostly focused on the primer design for a local region in the genomic sequence. Accordingly, it is still challenging to provide the primer sets for the entire mtDNA. METHODOLOGY/PRINCIPAL FINDINGS: The purpose of this study is to develop an integrated primer design algorithm for entire mt genome in general, and for the common primer sets for closely-related species in particular. We introduce ClustalW to generate the multiple sequence alignment needed to find the conserved sequences in closely-related species. These conserved sequences are suitable for designing the common primers for the entire mtDNA. Using a heuristic algorithm particle swarm optimization (PSO, all the designed primers were computationally validated to fit the common primer design constraints, such as the melting temperature, primer length and GC content, PCR product length, secondary structure, specificity, and terminal limitation. The overlap requirement for PCR amplicons in the entire mtDNA is satisfied by defining the overlapping region with the sliding window technology. Finally, primer sets were designed within the overlapping region. The primer sets for the entire mtDNA sequences were successfully demonstrated in the example of two closely-related fish species. The pseudo code for the primer design algorithm is provided. CONCLUSIONS/SIGNIFICANCE: In conclusion, it can be said that our proposed sliding window-based PSO

Detection of Mycosphaerella graminicola in Wheat Leaves by a Microsatellite Dinucleotide Specific-Primer

Directory of Open Access Journals (Sweden)

Joseph-Alexander Verreet

2011-01-01

Full Text Available Early detection of infection is very important for efficient management of Mycosphaerella graminicola leaf blotch. To monitor and quantify the occurrence of this fungus during the growing season, a diagnostic method based on real-time PCR was developed. Standard and real-time PCR assays were developed using SYBR Green chemistry to quantify M. graminicola in vitro or in wheat samples. Microsatellite dinucleotide specific-primers were designed based on microsatellite repeats of sequences present in the genome of M. graminicola. Specificity was checked by analyzing DNA of 55 M. graminicola isolates obtained from different geographical origins. The method appears to be highly specific for detecting M. graminicola; no fluorescent signals were observed from 14 other closely related taxa. Primer (CT 7 G amplified a specific amplicon of 570 bp from all M. graminicola isolates. The primers did not amplify DNA extracted from 14 other fungal species. The approximate melting temperature (Tm of the (CT 7 G primer was 84.2 °C. The detection limit of the real-time PCR assay with the primer sets (CT 7 G is 10 fg/25 µL, as compared to 10 pg/25 µL using conventional PCR technology. From symptomless leaves, a PCR fragment could be generated two days after inoculation. Both conventional and real-time PCR could successfully detect the fungus from artificially inoculated wheat leaves. However, real-time PCR appeared much more sensitive than conventional PCR. The developed quantitative real-time PCR method proved to be rapid, sensitive, specific, cost-effective and reliable for the identification and quantification of M. graminicola in wheat.

Specific amplification of bacterial DNA by optimized so-called universal bacterial primers in samples rich of plant DNA.

Science.gov (United States)

Dorn-In, Samart; Bassitta, Rupert; Schwaiger, Karin; Bauer, Johann; Hölzel, Christina S

2015-06-01

Universal primers targeting the bacterial 16S-rRNA-gene allow quantification of the total bacterial load in variable sample types by qPCR. However, many universal primer pairs also amplify DNA of plants or even of archaea and other eukaryotic cells. By using these primers, the total bacterial load might be misevaluated, whenever samples contain high amounts of non-target DNA. Thus, this study aimed to provide primer pairs which are suitable for quantification and identification of bacterial DNA in samples such as feed, spices and sample material from digesters. For 42 primers, mismatches to the sequence of chloroplasts and mitochondria of plants were evaluated. Six primer pairs were further analyzed with regard to the question whether they anneal to DNA of archaea, animal tissue and fungi. Subsequently they were tested with sample matrix such as plants, feed, feces, soil and environmental samples. To this purpose, the target DNA in the samples was quantified by qPCR. The PCR products of plant and feed samples were further processed for the Single Strand Conformation Polymorphism method followed by sequence analysis. The sequencing results revealed that primer pair 335F/769R amplified only bacterial DNA in samples such as plants and animal feed, in which the DNA of plants prevailed. Copyright © 2015 Elsevier B.V. All rights reserved.

DENSIDAD CRÍTICA DE Meloidogyne exigua EN PLANTAS DE ALMÁCIGO DE CAFÉ VARIEDAD CATURRA

Directory of Open Access Journals (Sweden)

Mainor Rojas

2013-01-01

Full Text Available El objetivo del estudio fue evaluar el efecto de densidad creciente de Meloidogyne exigua sobre el desarrollo de plantas de almácigo. Se trasplantaron plántulas de café variedad caturra a bolsas de polietileno con 1335 cm3 de sustrato desinfectado, para establecer un ensayo con diseño de bloques completos al azar, con 8 repeticiones. Los tratamientos aplicados consistieron de poblaciones iniciales (Pi de 0; 0,125; 0,25; 0,5; 1; 2; 4; 8; 16; 32 y 64 huevos+J2/ cm3 de sustrato, aplicadas un mes después del trasplante. El modelo y=m+(1-m ZP-T aplicado 234 días después del trasplante para la altura, diámetro, número de nudos y peso fresco aéreo, indicó que el límite de tolerancia (T fue de 0,66; 0,06; 0,13 y 0,88 huevos+J2/cm3, respectivamente; la producción mínima relativa (m fue de 0,79; 0,79; 0,33 y 0,54 respectivamente, a Pi iguales o mayores a 64 huevos+J2/cm3. El índice de agallas alcanzó el máximo a partir de una Pi de 2; el pico máximo de nematodos en el suelo y las raíces se alcanzó con Pi entre 2 y 4; mientras la tasa máxima de reproducción fue de 114 con Pi de 0,125. Se concluyó que la densidad crítica fue cercana a cero huevos/cm3 de sustrato como población inicial, y que el almácigo se debe desarrollar libre de nematodos, ya que aún con Pi bajas se puede alcanzar la máxima población en corto tiempo.

Detection of enteroviruses and hepatitis a virus in water by consensus primer multiplex RT-PCR

Science.gov (United States)

Li, Jun-Wen; Wang, Xin-Wei; Yuan, Chang-Qing; Zheng, Jin-Lai; Jin, Min; Song, Nong; Shi, Xiu-Quan; Chao, Fu-Huan

2002-01-01

AIM: To develop a rapid detection method of enteroviruses and Hepatitis A virus (HAV). METHODS: A one-step, single-tube consensus primers multiplex RT-PCR was developed to simultaneously detect Poliovirus, Coxsackie virus, Echovirus and HAV. A general upstream primer and a HAV primer and four different sets of primers (5 primers) specific for Poliovirus, Coxsacki evirus, Echovirus and HAV cDNA were mixed in the PCR mixture to reverse transcript and amplify the target DNA. Four distinct amplified DNA segments representing Poliovirus, Coxsackie virus, Echovirus and HAV were identified by gel electrophoresis as 589-, 671-, 1084-, and 1128 bp sequences, respectively. Semi-nested PCR was used to confirm the amplified products for each enterovirus and HAV. RESULTS: All four kinds of viral genome RNA were detected, and producing four bands which could be differentiated by the band size on the gel. To confirm the specificity of the multiplex PCR products, semi-nested PCR was performed. For all the four strains tested gave positive results. The detection sensitivity of multiplex PCR was similar to that of monoplex RT-PCR which was 24 PFU for Poliovrus, 21 PFU for Coxsackie virus, 60 PFU for Echovirus and 105 TCID50 for HAV. The minimum amount of enteric viral RNA detected by semi-nested PCR was equivalent to 2.4 PFU for Poliovrus, 2.1 PFU for Coxsackie virus, 6.0 PFU for Echovirus and 10.5 TCID50 for HAV. CONCLUSION: The consensus primers multiplex RT-PCR has more advantages over monoplex RT-PCR for enteric viruses detection, namely, the rapid turnaround time and cost effectiveness. PMID:12174381

PIPEMicroDB: microsatellite database and primer generation tool for pigeonpea genome.

Science.gov (United States)

Sarika; Arora, Vasu; Iquebal, M A; Rai, Anil; Kumar, Dinesh

2013-01-01

Molecular markers play a significant role for crop improvement in desirable characteristics, such as high yield, resistance to disease and others that will benefit the crop in long term. Pigeonpea (Cajanus cajan L.) is the recently sequenced legume by global consortium led by ICRISAT (Hyderabad, India) and been analysed for gene prediction, synteny maps, markers, etc. We present PIgeonPEa Microsatellite DataBase (PIPEMicroDB) with an automated primer designing tool for pigeonpea genome, based on chromosome wise as well as location wise search of primers. Total of 123 387 Short Tandem Repeats (STRs) were extracted from pigeonpea genome, available in public domain using MIcroSAtellite tool (MISA). The database is an online relational database based on 'three-tier architecture' that catalogues information of microsatellites in MySQL and user-friendly interface is developed using PHP. Search for STRs may be customized by limiting their location on chromosome as well as number of markers in that range. This is a novel approach and is not been implemented in any of the existing marker database. This database has been further appended with Primer3 for primer designing of selected markers with left and right flankings of size up to 500 bp. This will enable researchers to select markers of choice at desired interval over the chromosome. Furthermore, one can use individual STRs of a targeted region over chromosome to narrow down location of gene of interest or linked Quantitative Trait Loci (QTLs). Although it is an in silico approach, markers' search based on characteristics and location of STRs is expected to be beneficial for researchers. Database URL: http://cabindb.iasri.res.in/pigeonpea/

Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders; FINAL

International Nuclear Information System (INIS)

Bilyard, G.R.; Word, C.J.; Weber, J.R.; Harding, A.K.

2000-01-01

This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of groups interacting about topics in bioremediation or the NABIR program. The primer also provides brief, useful models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums

Corrosion prevention of the rail by thermal spray coating of Zn-Al alloy; Zn-Al gokin yosha hifuku ni yoru reru no boshoku

Energy Technology Data Exchange (ETDEWEB)

Mizoguchi, S. [Nippon Steel Corp., Kitakyushu (Japan)] Urashima, C. [Kyushu Techno Research Corp., Fukuoka (Japan); Itai, K. [Nippon Steel Corp., Kitakyushu, Fukuoka (Japan). Technical Research Inst. of Yawata Works; Ichiriki, T.; Nishiki, M. [Kyushu Rail way comdany, Fukuoka (Japan)

1997-03-30

Replacement of the rail in under-sea tunnel such as the Kammon Tunnel is carried out very five years because of the severe corrosion caused by the humid state due to the leakage of sea water or the mist of sea water swept up by the passing trains. In this study, salt water spraying or sea water spraying test is carried out using Zn-Al alloy with the corrosion resistance and thermal spray efficiency even higher than those of Zn or Al. A rail coated by thermal spray of Zn-15mass%Al alloy has been laid by trial in the practical rail road of Kammon Tunnel for 5 years and 3 months, the deterioration degree of the coating, pitting depth, actual fatigue strength, etc. are evaluated. Further, these factors of a rail re-coated by Zincrich Primer+Tar Epoxy and a bare rail laid at the same time are evaluated for comparison. It is presumed by the results of the examination about the service life of a rail coated by the thermal spray of Zn-Al alloy based on the pitting depth in the rail base that the service life of such coated rail is more than twice as that of the bare rails used currently. 5 refs., 14 figs., 3 tabs.

Factores influyentes en el rendimiento académico de estudiantes del primer año de medicina

Directory of Open Access Journals (Sweden)

Delia Jara

2008-09-01

Full Text Available Introducción: El rendimiento académico dentro de la universidad es el producto de la influencia de múltiples factores, los cuales se ponen de manifiesto desde los primeros años de estudio. Objetivos: Identificar los factores que afectarían el rendimiento académico en los estudiantes de medicina del primer año de estudios. Diseño: Estudio observacional longitudinal. El tipo de muestreo utilizado fue no probabilístico por cuotas. Lugar: Facultad de Medicina de San Fernando, Universidad Nacional Mayor de San Marcos (UNMSM, Lima-Perú. Participantes: Estudiantes de medicina durante el primer año de estudios. Intervenciones: Un cuestionario aplicado a los participantes, examen físico, psicológico y análisis de laboratorio. Principales medidas de resultados: Factores que influyen en el rendimiento académico bajo. Resultados: Se evaluó 40 estudiantes de ambos sexos (14 mujeres y 26 varones, con edades comprendidas entre 18 y 30 años. Procedían de colegio estatal 31 (78% y de colegio privado 9 (23%; en cuanto a hábitos de estudio, 27 (67% refirieron leer las materias propias de la profesión, por lo menos una vez al día, mientras que 13 (33% lo hacía de manera semanal. El número de horas de estudio al día consistió en 1 a 2 horas al día en 10 (25%, 3 a 4 horas de estudio en 18 (45%, 5 a 6 horas de estudio em 10 (25% y 2 de ellos (5% refirieron estudiar solo en fechas de exámenes; 25 alumnos (62% tuvieron como estrategia de estudio solo el uso de la memoria, 7 (18% utilizaron la memoria más los apuntes de clase, 4 de ellos (10%, apuntes más esquemas, y 4 (10%, apuntes más esquemas y textos. El carácter predominante de los alumnos fue alegre en 22 (55% y no alegre en 18 (45%. La autoestima fue considerada alta en 15 de los participantes (37,5%, autoestima moderada en 21 (52,5% y autoestima baja en 4 (10%. El aspecto socioeconómico de los participantes reveló que en 17 de ellos (42,5% el ingreso familiar era igual o menor de

Multicolor-based discrimination of 21 short tandem repeats and amelogenin using four fluorescent universal primers.

Science.gov (United States)

Asari, Masaru; Okuda, Katsuhiro; Hoshina, Chisato; Omura, Tomohiro; Tasaki, Yoshikazu; Shiono, Hiroshi; Matsubara, Kazuo; Shimizu, Keiko

2016-02-01

The aim of this study was to develop a cost-effective genotyping method using high-quality DNA for human identification. A total of 21 short tandem repeats (STRs) and amelogenin were selected, and fluorescent fragments at 22 loci were simultaneously amplified in a single-tube reaction using locus-specific primers with 24-base universal tails and four fluorescent universal primers. Several nucleotide substitutions in universal tails and fluorescent universal primers enabled the detection of specific fluorescent fragments from the 22 loci. Multiplex polymerase chain reaction (PCR) produced intense FAM-, VIC-, NED-, and PET-labeled fragments ranging from 90 to 400 bp, and these fragments were discriminated using standard capillary electrophoretic analysis. The selected 22 loci were also analyzed using two commercial kits (the AmpFLSTR Identifiler Kit and the PowerPlex ESX 17 System), and results for two loci (D19S433 and D16S539) were discordant between these kits due to mutations at the primer binding sites. All genotypes from the 100 samples were determined using 2.5 ng of DNA by our method, and the expected alleles were completely recovered. Multiplex 22-locus genotyping using four fluorescent universal primers effectively reduces the costs to less than 20% of genotyping using commercial kits, and our method would be useful to detect silent alleles from commercial kit analysis. Copyright © 2015 Elsevier Inc. All rights reserved.

Efecto del tipo de sangre en la supervivencia y fecundidad del flebotomino Lutzomyia ovallesi Ortiz (Diptera: Psychodidae vector de Leishmania

Directory of Open Access Journals (Sweden)

Pedro Noguera

2006-10-01

Full Text Available Introducción. El potencial reproductivo de los flebotominos depende de varios factores, unode los cuales es el tipo de hospedador disponible como fuente sanguinea, este es importanteen determinar su capacidad de servir como vectores. Objetivo. Se estudia el efecto de la fuente de alimentación sanguínea sobre varios parámetrosbiológicos de L. ovallesi en condiciones de laboratorio. Materiales y métodos. Se utilizaron hembras de dos días de edad de L. ovallesi de colonia,alimentadas artificialmente a repleción usando membrana de pollo, con sangre de sietehospedadores vertebrados, caballo, perro, vaca, gallina, chivo, cochino y humano. Se determinóel tiempo de vida, tiempo de oviposición, tiempo de digestión sanguínea, número de huevospuestos, número de huevos retenidos y número de huevos totales. Resultados. Los resultados muestran la influencia de la fuente sanguínea sobre diferentesparámetros biológicos de L. ovallesi estudiados. Los resultados demuestran que con la sangrede gallina se obtienen mayor tiempo de oviposición (5,88 días, digestión más rápida (3,34días, mayor número de huevos retenidos (10,20 huevos por hembra y mayor fecundidad(30,80 huevos por hembra en comparación con los otros tipos de sangre. La sangre más satisfactoria fue la de gallina seguida, en orden descendente, por las de chivo, vaca, cochino,humano, perro y caballo. Conclusión. Los datos muestran que la sangre de gallina es la mejor fuente sanguínea entérminos bio-ecológicos para L. ovallesi, y la sangre de caballo la menos adecuada. Losresultados contribuyen al entendimiento de los mecanismos que influyen en las condicionesde cría en el laboratorio del flebotomino L. ovallesi y también de cómo ciertos factores de ladieta en los adultos afectan el potencial biológico y que podrían tener importante consecuenciasen la transmisión de Leishmania.

Análisis de estabilidad del reactor PFTR para una reacción con cinética de primer orden utilizando la funcional de Lyapunov

OpenAIRE

Héctor Armando Durán Peralta; Luis Fernando Córdoba C

2007-01-01

Abunda la literatura referente al análisis de estabilidad de reactores con parámetros globalizados de concentración y temperatura (por ejemplo el CSTR), en cambio es escasa la literatura sobre la estabilidad de reactores con parámetros distribuidos donde existe distribución espacial de concentración y temperatura, como es el caso del reactor tubular PFTR. Este documento analiza la estabilidad del reactor PFTR isotérmico y no isotérmico para una reacción con cinética de primer orden utilizando...

Análisis de estabilidad del reactor pftr para una reacción con cinética de primer orden utilizando la funcional de lyapunov

OpenAIRE

Durán Peralta, Héctor Armando; Córdoba C, Luis Fernando

2010-01-01

Abunda la literatura referente al análisis de estabilidad de reactores con parámetros globalizados de concentración y temperatura (por ejemplo el CSTR), en cambio es escasa la literatura sobre la estabilidad de reactores con parámetros distribuidos donde existe distribución espacial de concentración y temperatura, como es el caso del reactor tubular PFTR. Este documento analiza la estabilidad del reactor PFTR isotérmico y no isotérmico para una reacción con cinética de primer orden utilizand...

Primers for polymerase chain reaction to detect genomic DNA of Toxocara canis and T. cati.

Science.gov (United States)

Wu, Z; Nagano, I; Xu, D; Takahashi, Y

1997-03-01

Primers for polymerase chain reaction to amplify genomic DNA of both Toxocara canis and T. cati were constructed by adapting cloning and sequencing random amplified polymorphic DNA. The primers are expected to detect eggs and/or larvae of T. canis and T. cati, both of which are known to cause toxocariasis in humans.

Genome-Wide Characterization of Simple Sequence Repeat (SSR) Loci in Chinese Jujube and Jujube SSR Primer Transferability

Science.gov (United States)

Xiao, Jing; Zhao, Jin; Liu, Mengjun; Liu, Ping; Dai, Li; Zhao, Zhihui

2015-01-01

Chinese jujube (Ziziphus jujuba), an economically important species in the Rhamnaceae family, is a popular fruit tree in Asia. Here, we surveyed and characterized simple sequence repeats (SSRs) in the jujube genome. A total of 436,676 SSR loci were identified, with an average distance of 0.93 Kb between the loci. A large proportion of the SSRs included mononucleotide, dinucleotide and trinucleotide repeat motifs, which accounted for 64.87%, 24.40%, and 8.74% of all repeats, respectively. Among the mononucleotide repeats, A/T was the most common, whereas AT/TA was the most common dinucleotide repeat. A total of 30,565 primer pairs were successfully designed and screened using a series of criteria. Moreover, 725 of 1,000 randomly selected primer pairs were effective among 6 cultivars, and 511 of these primer pairs were polymorphic. Sequencing the amplicons of two SSRs across three jujube cultivars revealed variations in the repeats. The transferability of jujube SSR primers proved that 35/64 SSRs could be transferred across family boundary. Using jujube SSR primers, clustering analysis results from 15 species were highly consistent with the Angiosperm Phylogeny Group (APGIII) System. The genome-wide characterization of SSRs in Chinese jujube is very valuable for whole-genome characterization and marker-assisted selection in jujube breeding. In addition, the transferability of jujube SSR primers could provide a solid foundation for their further utilization. PMID:26000739

Signals and systems primer with Matlab

CERN Document Server

Poularikas, Alexander D

2006-01-01

Signals and Systems Primer with MATLAB® equally emphasizes the fundamentals of both analog and digital signals and systems. To ensure insight into the basic concepts and methods, the text presents a variety of examples that illustrate a wide range of applications, from microelectromechanical to worldwide communication systems. It also provides MATLAB functions and procedures for practice and verification of these concepts.Taking a pedagogical approach, the author builds a solid foundation in signal processing as well as analog and digital systems. The book first introduces orthogonal signals,

indCAPS: A tool for designing screening primers for CRISPR/Cas9 mutagenesis events.

Science.gov (United States)

Hodgens, Charles; Nimchuk, Zachary L; Kieber, Joseph J

2017-01-01

Genetic manipulation of organisms using CRISPR/Cas9 technology generally produces small insertions/deletions (indels) that can be difficult to detect. Here, we describe a technique to easily and rapidly identify such indels. Sequence-identified mutations that alter a restriction enzyme recognition site can be readily distinguished from wild-type alleles using a cleaved amplified polymorphic sequence (CAPS) technique. If a restriction site is created or altered by the mutation such that only one allele contains the restriction site, a polymerase chain reaction (PCR) followed by a restriction digest can be used to distinguish the two alleles. However, in the case of most CRISPR-induced alleles, no such restriction sites are present in the target sequences. In this case, a derived CAPS (dCAPS) approach can be used in which mismatches are purposefully introduced in the oligonucleotide primers to create a restriction site in one, but not both, of the amplified templates. Web-based tools exist to aid dCAPS primer design, but when supplied sequences that include indels, the current tools often fail to suggest appropriate primers. Here, we report the development of a Python-based, species-agnostic web tool, called indCAPS, suitable for the design of PCR primers used in dCAPS assays that is compatible with indels. This tool should have wide utility for screening editing events following CRISPR/Cas9 mutagenesis as well as for identifying specific editing events in a pool of CRISPR-mediated mutagenesis events. This tool was field-tested in a CRISPR mutagenesis experiment targeting a cytokinin receptor (AHK3) in Arabidopsis thaliana. The tool suggested primers that successfully distinguished between wild-type and edited alleles of a target locus and facilitated the isolation of two novel ahk3 null alleles. Users can access indCAPS and design PCR primers to employ dCAPS to identify CRISPR/Cas9 alleles at http://indcaps.kieber.cloudapps.unc.edu/.

Perfil de ingreso de alumnos con buen desempeño académico en el primer año de estudios. El caso de la Escuela de Diseño de la Universidad De La Salle Bajío

Directory of Open Access Journals (Sweden)

María Daniela Esparza Olmos

2011-01-01

Full Text Available Introducción: El sistema educativo universitario se ha enfrentado a varios retos en los últimos tiempos, lo que ha implicado establecer políticas de admisión que permitan seleccionar a los estudiantes que cumplan con el perfil de ingreso, permitiendo generar estrategias para mejorar su desempeño académico a lo largo de sus estudios, y con ello elevar las cifras de la eficiencia terminal. Es así como el objetivo de esta investigación fue caracterizar el perfil de ingreso de los alumnos que mostraron un buen desempeño académico en el primer año de la licenciatura de diseño industrial, diseño de modas y calzado, diseño gráfico y diseño ambiental de la Universidad De La Salle Bajío. Método: La distribución final de la muestra estuvo formada por 256 alumnos de ambos sexos al analizarse estadísticamente los resultados de sus pruebas en el proceso de admisión de las cohortes del 2005 al 2008, para posteriormente correlacionarlas con el promedio del primer año de sus estudios. Resultados: Los resultados permitieron observar las semejanzas y diferencias entre las cuatro licenciaturas con respecto al perfil general de ingreso en la Escuela de Diseño. Asimismo, se encontró que los alumnos que presentaron en periodo de excelencia, obtuvieron mejor desempeño académico en el primer año de estudios. Conclusión: Conocer el perfil de ingreso servirá de parámetro en los siguientes procesos de admisión, además permitirá diseñar estrategias que fortalezcan las capacidades y habilidades de los alumnos al ingresar a la educación superior, de tal manera que se eleven los índices de eficiencia terminal y con ello mejorar la calidad en los programas académicos de licenciatura en la Escuela de Diseño.

Transfer of primer binding site-mutated simian immunodeficiency virus vectors by genetically engineered artificial and hybrid tRNA-like primers

DEFF Research Database (Denmark)

Hansen, A C; Grunwald, T; Lund, Anders Henrik

2001-01-01

could be obtained by cotransfection of a gene for an engineered tRNA(Pro)-tRNA hybrid with a match to PBS-Pro. The importance of tRNA backbone identity was further analyzed by complementing the PBS-X2 vector with a gene for a matching x2 primer with a tRNA backbone, which led to three- to fourfold...

Recuperación nutricional de recién nacidos de muy bajo peso durante el primer año de vida

Directory of Open Access Journals (Sweden)

Virginia Díaz-Argüelles Ramírez-Corría

2003-06-01

Full Text Available Los recién nacidos de muy bajo peso al nacer tienen un doble reto en su crecimiento durante el primer año de vida, porque tienen escasas reservas energéticas, disminución de la capacidad para tolerar grandes ingestas, y elevadas necesidades de energía y macronutrientes para asegurar un crecimiento acelerado. El objetivo de este trabajo fue caracterizar el crecimiento durante el primer año de vida de recién nacidos de muy bajo peso y un grupo control de término. Para ello se realizó un estudio de cohorte en 25 recién nacidos con peso al nacer menor de 1 800 g y 34 semanas de edad gestacional, nacidos en el Hospital Ginecoobstétrico "Ramón González Coro", en Ciudad de La Habana, desde enero de 2000 hasta enero de 2001 y en 25 recién nacidos de buen peso a término como grupo control. Se evaluaron aspectos del desarrollo nutricional perinatal y antropométrico, mediante la utilización de la evolución del peso, talla, circunferencia cefálica y circunferencia del brazo, durante el primer año de vida. Se encontró que el crecimiento longitudinal fue bueno en recién nacidos de muy bajo peso, aunque no lograron los canales de crecimiento de lactantes de término al cumplir el año de edad. El peso para la edad fue el indicador que demoró más la recuperación.The very low birthweight newborns face a double challenge in their growth during the first year of life because they have little energy reserves, reduced capacity to tolerate large intakes and high energy and micronutrient requirements to assure an accelerated growth. The objective of this paper was to characterize the growth during the first year of life of very low birthweight newborns and a term control group. To this end, a cohort study was conducted on 25 newborns whose birthweight was under 1800g, with 34 weeks of gestational age, born at "Ramón Gónzalez Coro" Gynecological and Obstetric hospital in City of Havana from January, 2000 to January 2001 and on 25 term

Structure of Hepatitis C Virus Polymerase in Complex with Primer-Template RNA

Energy Technology Data Exchange (ETDEWEB)

Mosley, Ralph T.; Edwards, Thomas E.; Murakami, Eisuke; Lam, Angela M.; Grice, Rena L.; Du, Jinfa; Sofia, Michael J.; Furman, Philip A.; Otto, Michael J. (Pharmasset); (Emerald)

2012-08-01

The replication of the hepatitis C viral (HCV) genome is accomplished by the NS5B RNA-dependent RNA polymerase (RdRp), for which mechanistic understanding and structure-guided drug design efforts have been hampered by its propensity to crystallize in a closed, polymerization-incompetent state. The removal of an autoinhibitory {beta}-hairpin loop from genotype 2a HCV NS5B increases de novo RNA synthesis by >100-fold, promotes RNA binding, and facilitated the determination of the first crystallographic structures of HCV polymerase in complex with RNA primer-template pairs. These crystal structures demonstrate the structural realignment required for primer-template recognition and elongation, provide new insights into HCV RNA synthesis at the molecular level, and may prove useful in the structure-based design of novel antiviral compounds. Additionally, our approach for obtaining the RNA primer-template-bound structure of HCV polymerase may be generally applicable to solving RNA-bound complexes for other viral RdRps that contain similar regulatory {beta}-hairpin loops, including bovine viral diarrhea virus, dengue virus, and West Nile virus.

Microsatellite primers for a species of South African everlasting daisy (Helichrysum odoratissimum; Gnaphalieae, Asteraceae).

Science.gov (United States)

Glennon, Kelsey L; Cron, Glynis V

2016-05-01

Microsatellites were developed for the widespread Helichrysum odoratissimum (Asteraceae) to estimate gene flow across diploid populations and to test if gene flow occurs among other closely related lineages within this genus. Ten primer pairs were developed and tested using populations across South Africa; however, only seven primer pairs were polymorphic for the target species. The seven polymorphic primers amplified di- and trinucleotide repeats with up to 16 alleles per locus among 125 diploid individuals used for analyses. These markers can be used to estimate gene flow among populations of known ploidy level of H. odoratissimum to test evolutionary hypotheses. Furthermore, these markers amplify successfully in other Helichrysum species, including the other three taxonomic Group 4 species, and therefore can be used to inform taxonomic work on these species.

One fungus , which genes ? Development and assessment of universal primers for potential secondary fungal DNA barcodes

NARCIS (Netherlands)

Stielow, J B; Lévesque, C A; Seifert, K A; Meyer, W; Irinyi, L; Smits, D; Renfurm, R; Verkley, G J M; Groenewald, M; Chaduli, D; Lomascolo, A; Welti, S; Lesage-Meessen, L; Favel, A; Al-Hatmi, A M S; Damm, U; Yilmaz, N.; Houbraken, J.; Lombard, L.; Quaedvlieg, W.; Binder, M.; Vaas, L.A.I.; Vu, D.; Yurkov, A.; Begerow, D.; Roehl, O.; Guerreiro, M.; Fonseca, A.; Samerpitak, K.; Diepeningen, A.D. van; Dolatabadi, S.; Moreno, L.F.; Casaregola, S.; Mallet, S.; Jacques, N.; Roscini, L.; Egidi, E.; Bizet, C.; Garcia-Hermoso, D.; Martín, M.P.; Deng, S.; Groenewald, J.Z.; Boekhout, T.; Beer, Z.W. de; Barnes, I.; Duong, T.A.; Wingfield, M.J.; Hoog, G.S. de; Crous, P.W.; Lewis, C.T.; Hambleton, S.; Moussa, T.A.A.; Al-Zahrani, H.S.; Almaghrabi, O.A.; Louis-Seize, G.; Assabgui, R.; McCormick, W.; Omer, G.; Dukik, K.; Cardinali, G.; Eberhardt, U.; Vries, M. de; Robert, V.

2015-01-01

The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic

Detection of Ophiocordyceps sinensis and Its Common Adulterates Using Species-Specific Primers

Science.gov (United States)

Liu, Yang; Wang, Xiao-yue; Gao, Zi-tong; Han, Jian-ping; Xiang, Li

2017-01-01

Ophiocordyceps sinensis is a fungus that infects Hepialidae caterpillars, mummifying the larvae and producing characteristic fruiting bodies (stromata) that are processed into one of the most valued traditional Chinese medicines (TCM). The product commands a very high price due to a high demand but a very limited supply. Adulteration with other fungi is a common problem and there is a need to test preparation for the presence of the correct fungus. In the current study, a PCR-based approach for the identification of O. sinensis based on a segment of the internal transcribed spacer (ITS) region was developed. The segments is 146-bp in size and is likely to be amplified even in materials where processing led to DNA fragmentation. Primer development was based on the alignment of sequence data generated from a total of 89 samples of O. sinensis and potential adulterants as well as sequences date from 41 Ophiocordyceps species and 26 Cordyceps species available in GenBank. Tests with primer pair, DCF4/DCR4, demonstrated generation of an amplicon from DNA extracted from O. sinensis stromata, but not from extracts derived from adulterants. Species-specific primer pairs were also developed and tested for detection of the common adulterants, Cordyceps gunnii, Cordyceps cicadae, Cordyceps militaris, Cordyceps liangshanensis and Ophiocordyceps nutans. The collection of primers developed in the present study will be useful for the authentication of preparation claiming to only contain O. sinensis and for the detection of fungi used as adulterants in these preparations. PMID:28680424

Novel oligonucleotide primers reveal a high diversity of microbes which drive phosphorous turnover in soil.

Science.gov (United States)

Bergkemper, Fabian; Kublik, Susanne; Lang, Friederike; Krüger, Jaane; Vestergaard, Gisle; Schloter, Michael; Schulz, Stefanie

2016-06-01

Phosphorus (P) is of central importance for cellular life but likewise a limiting macronutrient in numerous environments. Certainly microorganisms have proven their ability to increase the phosphorus bioavailability by mineralization of organic-P and solubilization of inorganic-P. On the other hand they efficiently take up P and compete with other biota for phosphorus. However the actual microbial community that is associated to the turnover of this crucial macronutrient in different ecosystems remains largely anonymous especially taking effects of seasonality and spatial heterogeneity into account. In this study seven oligonucleotide primers are presented which target genes coding for microbial acid and alkaline phosphatases (phoN, phoD), phytases (appA), phosphonatases (phnX) as well as the quinoprotein glucose dehydrogenase (gcd) and different P transporters (pitA, pstS). Illumina amplicon sequencing of soil genomic DNA underlined the high rate of primer specificity towards the respective target gene which usually ranged between 98% and 100% (phoN: 87%). As expected the primers amplified genes from a broad diversity of distinct microorganisms. Using DNA from a beech dominated forest soil, the highest microbial diversity was detected for the alkaline phosphatase (phoD) gene which was amplified from 15 distinct phyla respectively 81 families. Noteworthy the primers also allowed amplification of phoD from 6 fungal orders. The genes coding for acid phosphatase (phoN) and the quinoprotein glucose dehydrogenase (gcd) were amplified from 20 respectively 17 different microbial orders. In comparison the phytase and phosphonatase (appA, phnX) primers covered 13 bacterial orders from 2 different phyla respectively. Although the amplified microbial diversity was apparently limited both primers reliably detected all orders that contributed to the P turnover in the investigated soil as revealed by a previous metagenomic approach. Genes that code for microbial P transporter

Violencia intrafamiliar como causa de trastorno depresivo en mujeres que acuden al Centro de Apoyo Integral las tres Manuelas y al Hospital Cantonal de Sangolquí durante el año 2011

OpenAIRE

Moreno Ronquillo, Tania Paulina

2014-01-01

El Trastorno Depresivo ocupa el primer lugar dentro de las causas de discapacidad en el mundo. La Violencia Intrafamiliar es un grave problema de Salud Pública, pudiendo ser una causa importante de depresión. Objetivo. Determinar si la Violencia Intrafamiliar es causa del desarrollo de Trastorno Depresivo en mujeres que acuden al Centro de Equidad y Justicia “Las Tres Manuelas”. Diseño: Observacional, Epidemiológico Analítico Longitudinal de casos y controles. Lugar y sujetos. El presente est...

Investigation on papillomavirus infection in dromedary camels in Al-Ahsa, Saudi Arabia

Directory of Open Access Journals (Sweden)

Abdelmalik Ibrahim Khalafalla

2017-06-01

Full Text Available We investigated two outbreaks of papillomatosis between 2013 and 2015 in Al Ahsa region of eastern Saudi Arabia involving fourteen dromedary camels. The disease affected both young and adult animals and occurred in coincidence with demodectic mange infestation. Diagnosis was made based on gross and histopathological characteristics of the wart lesion and was confirmed by PCR. Rolling circle amplification followed by degenerate primer PCR and sequencing of the amplicons revealed the presence of both Camelus dromedarius papillomavirus types 1 and 2, previously identified in infected dromedaries in Sudan.

One fungus, which genes? Development and assessment of universal primers for potential secondary fungal DNA barcodes

NARCIS (Netherlands)

Stielow, J.B.; Lévesque, C.A.; Seifert, K.A.; Meyer, W.; Irinyi, L.; Smits, D.; Renfurm, R.; Verkley, G.J.M.; Groenewald, M.; Chaduli, D.; Lomascolo, A.; Welti, S.; Lesage-Meessen, L.; Favel, A.; Al-Hatmi, A.M.S.; Damm, U.; Yilmaz, N.; Houbraken, J.; Lombard, L.; Quaedvlieg, W.; Binder, M.; Vaas, L.A.I.; Vu, D.; Yurkov, A.; Begerow, D.; Roehl, O.; Guerreiro, M.; Fonseca, A.; Samerpitak, K.; Diepeningen, van A.D.; Dolatabadi, S.; Moreno, L.F.; Casaregola, S.; Mallet, S.; Jacques, N.; Roscini, L.; Egidi, E.; Bizet, C.; Garcia-Hermoso, D.; Martin, M.P.; Deng, S.; Groenewald, J.Z.; Boekhout, T.; Beer, de Z.W.; Barnes, I.; Duong, T.A.; Wingfield, M.J.; Hoog, de G.S.; Crous, P.W.; Lewis, C.T.; Hambleton, S.; Moussa, T.A.A.; Al-Zahrani, H.S.; Almaghrabi, O.A.; Louis-Seize, G.; Assabgui, R.; McCormick, W.; Omer, G.; Dukik, K.; Cardinali, G.; Eberhardt, U.; Vries, de M.; Robert, V.

2015-01-01

The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic markers

Primer retention owing to the absence of RNase H1 is catastrophic for mitochondrial DNA replication.

Science.gov (United States)

Holmes, J Bradley; Akman, Gokhan; Wood, Stuart R; Sakhuja, Kiran; Cerritelli, Susana M; Moss, Chloe; Bowmaker, Mark R; Jacobs, Howard T; Crouch, Robert J; Holt, Ian J

2015-07-28

Encoding ribonuclease H1 (RNase H1) degrades RNA hybridized to DNA, and its function is essential for mitochondrial DNA maintenance in the developing mouse. Here we define the role of RNase H1 in mitochondrial DNA replication. Analysis of replicating mitochondrial DNA in embryonic fibroblasts lacking RNase H1 reveals retention of three primers in the major noncoding region (NCR) and one at the prominent lagging-strand initiation site termed Ori-L. Primer retention does not lead immediately to depletion, as the persistent RNA is fully incorporated in mitochondrial DNA. However, the retained primers present an obstacle to the mitochondrial DNA polymerase γ in subsequent rounds of replication and lead to the catastrophic generation of a double-strand break at the origin when the resulting gapped molecules are copied. Hence, the essential role of RNase H1 in mitochondrial DNA replication is the removal of primers at the origin of replication.

Rem Koolhaas y la nueva Babel. De la torre metropolitana al monumento al vacío

Directory of Open Access Journals (Sweden)

José Antonio Tallón

2015-05-01

Full Text Available Un primer acercamiento a las reflexiones de Rem Koolhaas en torno a la tipología de torre introduce al rascacielos neoyorquino como la alegoría del “automonumen­to”: una construcción en esencia destinada a reafirmar su sola presencia y que se distingue del resto por medio de su estatura, que la monumentaliza. La torre de Babel, símbolo inquebrantable de la leyenda de la construcción en altura, escenifi­ca una historia de construcción y destrucción que está vinculada ineludiblemente al pensamiento crítico de Rem Koolhaas en torno a la torre como tipología desa­creditada. Un recorrido por las distintas “Babel” que Rem Koolhaas cataloga en el glosario de términos incluido en el texto SMLXL construye un discurso en torno a la destrucción de la torre bíblica y la construcción de la nueva Babel koolhaasiana que inicia su recorrido con el rascacielos para acabar reclamando un nuevo estado de monumentalidad: la ausencia en su estado más puro representado por el muro, el máximo ejemplo de ausencia como la forma más elevada de presencia monu­mental. Una mirada crítica que comienza con la torre metropolitana como la nueva Babel para finalizar con el muro como el monumento al vacío

The effect of various primers on shear bond strength of zirconia ceramic and resin composite.

Science.gov (United States)

Sanohkan, Sasiwimol; Kukiattrakoon, Boonlert; Larpboonphol, Narongrit; Sae-Yib, Taewalit; Jampa, Thibet; Manoppan, Satawat

2013-11-01

To determine the in vitro shear bond strengths (SBS) of zirconia ceramic to resin composite after various primer treatments. Forty zirconia ceramic (Zeno, Wieland Dental) specimens (10 mm in diameter and 2 mm thick) were prepared, sandblasted with 50 μm alumina, and divided into four groups (n = 10). Three experimental groups were surface treated with three primers; CP (RelyX Ceramic Primer, 3M ESPE), AP (Alloy Primer, Kuraray Medical), and MP (Monobond Plus, Ivoclar Vivadent AG). One group was not treated and served as the control. All specimens were bonded to a resin composite (Filtek Supreme XT, 3M ESPE) cylinder with an adhesive system (Adper Scotchbond Multi-Purpose Plus Adhesive, 3M ESPE) and then stored in 100% humidity at 37°C for 24 h before SBS testing in a universal testing machine. Mean SBS (MPa) were analyzed with one-way analysis of variance (ANOVA) and the Tukey's Honestly Significant Difference (HSD) test (α = 0.05). Group AP yielded the highest mean and standard deviation (SD) value of SBS (16.8 ± 2.5 MPa) and Group C presented the lowest mean and SD value (15.4 ± 1.6 MPa). The SBS did not differ significantly among the groups (P = 0.079). Within the limitations of this study, the SBS values between zirconia ceramic to resin composite using various primers and untreated surface were not significantly different.

Blood Donation and Transfusion: A Primer for Health Educators.

Science.gov (United States)

Felts, W. Michael; Glascoff, Mary A.

1991-01-01

Presents a primer for health educators about blood donation and transfusion, examining the nature of human blood, the background of blood transfusion, blood donation criteria, risks related to homologous blood transfusion, directed blood donation, potential alternatives to homologous transfusion, and resources for education on the subject. (SM)

Small Commercial Building Re-tuning: A Primer

Energy Technology Data Exchange (ETDEWEB)

Cort, Katherine A.; Hostick, Donna J.; Underhill, Ronald M.; Fernandez, Nicholas; Katipamula, Srinivas

2013-09-30

To help building owners and managers address issues related to energy-efficient operation of small buildings, DOE has developed a Small Building Re-tuning training curriculum. This "primer" provides additional background information to understand some of the concepts presented in the Small Building Re-tuning training. The intent is that those who are less familiar with the buidling energy concepts will review this material before taking the building re-tuning training class.

Microsatellite Primer Development for Post Oak, Quercus stellata (Fagaceae

Directory of Open Access Journals (Sweden)

Warren B. Chatwin

2014-10-01

Full Text Available Premise of the study: The American Cross Timbers forest ecosystem runs from southeastern Kansas to Central Texas and is primarily composed of post oak (Quercus stellata. This old-growth forest currently occupies only about 2% of its ancestral range. To facilitate genetic research on this species, we developed microsatellite primers specific to post oak from reduced genomic libraries. Methods and Results: Two Q. stellata individuals, sampled from the northern and southern range of the post oak forest, were subject to genomic reduction and 454 pyrosequencing. Bioinformatic analysis identified putative microsatellites from which 12 polymorphic primer sets were screened on three populations. The number of alleles observed ranged from five to 20 across all populations, while observed and expected heterozygosity values ranged from 0.05 to 0.833 and 0.236 to 0.893, respectively, within individual populations. Conclusions: We report the development of microsatellite markers, specific to post oak, to aid the study of genetic diversity and population structure of extant forest remnants.

De-MetaST-BLAST: a tool for the validation of degenerate primer sets and data mining of publicly available metagenomes.

Directory of Open Access Journals (Sweden)

Christopher A Gulvik

Full Text Available Development and use of primer sets to amplify nucleic acid sequences of interest is fundamental to studies spanning many life science disciplines. As such, the validation of primer sets is essential. Several computer programs have been created to aid in the initial selection of primer sequences that may or may not require multiple nucleotide combinations (i.e., degeneracies. Conversely, validation of primer specificity has remained largely unchanged for several decades, and there are currently few available programs that allows for an evaluation of primers containing degenerate nucleotide bases. To alleviate this gap, we developed the program De-MetaST that performs an in silico amplification using user defined nucleotide sequence dataset(s and primer sequences that may contain degenerate bases. The program returns an output file that contains the in silico amplicons. When De-MetaST is paired with NCBI's BLAST (De-MetaST-BLAST, the program also returns the top 10 nr NCBI database hits for each recovered in silico amplicon. While the original motivation for development of this search tool was degenerate primer validation using the wealth of nucleotide sequences available in environmental metagenome and metatranscriptome databases, this search tool has potential utility in many data mining applications.

Beneath sci-fi sound: primer, science fiction sound design, and American independent cinema

OpenAIRE

Johnston, Nessa

2012-01-01

Primer is a very low budget science-fiction film that deals with the subject of time travel; however, it looks and sounds quite distinctively different from other films associated with the genre. While Hollywood blockbuster sci-fi relies on “sound spectacle” as a key attraction, in contrast Primer sounds “lo-fi” and screen-centred, mixed to two channel stereo rather than the now industry-standard 5.1 surround sound. Although this is partly a consequence of the economics of its production, the...

Primers As Socializing Agents in American and Finnish Schools.

Science.gov (United States)

Hyona, Jukka; And Others

1995-01-01

Content analysis of 12 Finnish and 18 American primers for grades 3 through 6 published primarily during the 1980s examined story type, plot setting, protagonist's characteristics, dramatic tasks, portrayals of family structure and parental responsibility, and extrafamilial peer and adult relationships. Results suggest that a nation's cultural…

Editorial: La Comunicación ¿al final de la crisis?

OpenAIRE

Tur-Viñes, Victoria

2015-01-01

Inauguramos el sexto año (V6) de publicación ininterrumpida de Revista Mediterránea de Comunicación con un ajuste importante en las fechas de publicación de los números semestrales. Adelantamos su publicación al principio de cada semestre, esto es, enero y julio. El objetivo es ganar tiempo de exposición en el año natural, aspecto que favorece los cálculos de algunos indicadores de impacto. Durante este año también queremos intensificar la presencia de la revista en bases de datos, primer pas...

Teaching Thermal Hydraulics & Numerical Methods: An Introductory Control Volume Primer

Energy Technology Data Exchange (ETDEWEB)

D. S. Lucas

2004-10-01

A graduate level course for Thermal Hydraulics (T/H) was taught through Idaho State University in the spring of 2004. A numerical approach was taken for the content of this course since the students were employed at the Idaho National Laboratory and had been users of T/H codes. The majority of the students had expressed an interest in learning about the Courant Limit, mass error, semi-implicit and implicit numerical integration schemes in the context of a computer code. Since no introductory text was found the author developed notes taught from his own research and courses taught for Westinghouse on the subject. The course started with a primer on control volume methods and the construction of a Homogeneous Equilibrium Model (HEM) (T/H) code. The primer was valuable for giving the students the basics behind such codes and their evolution to more complex codes for Thermal Hydraulics and Computational Fluid Dynamics (CFD). The course covered additional material including the Finite Element Method and non-equilibrium (T/H). The control volume primer and the construction of a three-equation (mass, momentum and energy) HEM code are the subject of this paper . The Fortran version of the code covered in this paper is elementary compared to its descendants. The steam tables used are less accurate than the available commercial version written in C Coupled to a Graphical User Interface (GUI). The Fortran version and input files can be downloaded at www.microfusionlab.com.

Propuesta de un sistema de transformación de plantas de papa (Solanum tuberosum sp. andigena var. Pastusa suprema mediado por Agrobacterium tumefaciens

Directory of Open Access Journals (Sweden)

López Alfredo

2007-06-01

Full Text Available

Se ha demostrado que la transformación de papa (Solanum tuberosum mediada por Agrobacterium tumefaciens es dependiente del genotipo y que la mayoría de protocolos de transformación reportados son ineficientes al aplicarlos en la subespecie andigena. En esta propuesta se manejaron los procesos iniciales de mejoramiento genético de la nueva variedad colombiana de papa Pastusa suprema (Solanum tuberosum sp. andigena que es altamente androestéril, característica de gran importancia para los organismos modificados genéticamente. Esta variedad resultó de la hibridación interespecífica de tres especies de papa (Solanum stoloniferum, Solanum phureja var. Yema de huevo y Solanum tuberosum sp. andigena var. Parda pastusa. Se transformaron explantes internodales mediante el vector pCambia2301 que posee un gen reportero de la β-glucoronidasa y un gen de resistencia a la kanamicina. Se obtuvo un porcentaje de transformación inicial de 31 ± 2,5%, que se expresó mediante formación de callo sobre medios de selección y una frecuencia final con base en el ensayo GUS de 30%. Este es el primer reporte de transformación de un híbrido interespecífico de tres especies diferentes.

Percepción de los estudiantes de enfermería en cuanto al comportamiento de fumar en México

Directory of Open Access Journals (Sweden)

Francisco Cruz Vazquez

2004-01-01

Full Text Available El estudio tiene como objetivo evaluar el comportamiento de fumar y la percepción de los factores que influeyen en ese comportamiento, entre estudiantes del primer año de Licenciatura en enfermería. Fueron entrevistado 36 alumnos del primer año de graduación en enfermería. Siendo 18 (50% fumadores, con edad media de 23,5 años; 75% del sexo femenino en cuanto al patron de consumo estos fuman de 2 a 6 cigarrillos al dia, empezaron a fumar en media con 15 años. En cuanto a la percepción de los alumnos, los fumadores se consideran más tímidos e inseguros que los no fumadores; 56% de éstos tienen un familiar fumador y perciben que estos tienen mayor riesgo de enfermar que los no fumadores. El grupo de amigos, el exceso de tareas y trabajo son fuertes influenciadores. Concluimos que el asunto es de extrema importancia, campañas educativas de ámbito preventivo en todos los niveles educacionales deben ser desarrollados además de la inserción de este tema en los currículos

Detection and typing of human papillomavirus in archival cervical cancer specimens by DNA amplification with consensus primers

NARCIS (Netherlands)

RESNICK, R. M.; Cornelissen, M. T.; WRIGHT, D. K.; EICHINGER, G. H.; FOX, H. S.; ter Schegget, J.; MANOS, M. M.

1990-01-01

We developed a polymerase chain reaction DNA amplification system using two distinct consensus oligonucleotide primer sets for the improved detection and typing of a broad spectrum of human genital papillomavirus (HPV) sequences, including those of novel viruses. The system incorporates one primer

Effects of three silane primers and five adhesive agents on the bond strength of composite material for a computer-aided design and manufacturing system.

Science.gov (United States)

Shinohara, Ayano; Taira, Yohsuke; Sakihara, Michino; Sawase, Takashi

2018-01-01

Objective The objective of this study was to evaluate the effects of combinations of silane primers and adhesive agents on the bond strength of a composite block for a computer-aided design and manufacturing system. Material and Methods Three silane primers [Clearfil Ceramic Primer (CP), Super-Bond PZ Primer (PZ), and GC Ceramic Primer II (GP)] were used in conjunction with five adhesive agents [G-Premio Bond (P-Bond), Repair Adhe Adhesive (R-Adhesive), Super-Bond D-Liner Dual (SB-Dual), Super-Bond C&B (SB-Self), and SB-Dual without tributylborane derivative (SB-Light)]. The surface of a composite block (Gradia Block) was ground with silicon carbide paper. After treatment with a silane primer, a adhesive agent was applied to each testing specimen. The specimens were then bonded with a light-curing resin composite. After 24 h, the shear bond strength values were determined and compared using a post hoc test (α=0.05, n=8/group). We also prepared control specimens without primer (No primer) and/or without adhesive agent (No adhesive). Results PZ/SB-Dual and GP/SB-Dual presented the highest bond strength, followed by GP/P-Bond, CP/SB-Dual, CP/R-Adhesive, No primer/SB-Dual, GP/R-Adhesive, CP/P-Bond, No primer/R-Adhesive, PZ/R-Adhesive, CP/SB-Self, PZ/P-Bond, PZ/SB-Self, and GP/SB-Self in descending order of bond strength. No primer/P-Bond, No primer/SB-Self, and all specimens in the SB-Light and No adhesive groups presented the lowest bond strengths. Conclusion A dual-curing adhesive agent (SB-Dual) containing a tributylborane derivative in combination with a silane primer (GP or PZ) presents a greater bond strength between the composite block and the repairing resin composite than the comparators used in the study.

Effect of a metal primer on the bond strength of the resin-metal interface Efeito de um primer para metais sobre a força de união da interface metal-resina

Directory of Open Access Journals (Sweden)

Anderson Pinheiro de Freitas

2004-06-01

Full Text Available To evaluate the effect of different surface treatments on shear bond strength between a metallic alloy (Co-Cr-Mo - Remanium CD and a resin cement (Rely X TM and to evaluate the mode of fracture after testing, forty couples of metallic-alloy disks were melted, regularized, polished, submitted to four thermal cycles (Vacuum, 960ºC, 8 minutes and randomly separated into four groups. Each group received a different type of treatment: Group PSP: Polished with sandpaper 600; Group PCP: Polished with sandpaper 600 and application of the metal primer Alloy Primer (Kuraray; Group JSP: Sandblasted with 100µm aluminum oxide; Group JCP: Sandblasted with 100mm aluminum oxide and treated with a metal Primer. The groups were cemented and stored in distilled water at 37ºC for 36 hours and submitted to the shear bond strength test. The mean and standard deviation (in Kgf/cm² obtained for each group was: PSP 4.0/0.4; PCP 88.9/33.6; JSP 163.2/27.6; JCP 144.5/54.0. After the statistical analysis the authors concluded that: the highest values were obtained for the sandblasted groups (JSP, JCP, regardless of the primer application; the Alloy Primer increased the retention between the Rely X cement and the polished surface of the Co-Cr-Mo alloy, yet its bond strength was not greater than that obtained with sandblasting; all specimens showed adhesive failures in the tested interface.Para avaliar o efeito de diferentes tratamentos superficiais sobre a resistência ao cisalhamento da união entre uma liga metálica (Co-Cr-Mo - Remanium CD e um cimento resinoso (Rely X TM e analisar o tipo de fratura durante a separação dos espécimes, quarenta pares de discos metálicos foram fundidos, regularizados e polidos, submetidos a quatro ciclos térmicos (vácuo, 960ºC, 8 minutos e divididos aleatoriamente em quatro grupos. Cada grupo recebeu um tipo de tratamento: Grupo PSP: Polimento com lixa d'água Nº 600; Grupo PCP: Polimento com lixa 600 e aplicação do

Primer: Fracture mechanics in the nuclear power industry

International Nuclear Information System (INIS)

Wessel, E.T.; Server, W.L.; Kennedy, E.L.

1990-01-01

This Primer is intended to familiarize utility engineers with the fracture mechanics technology and to provide the basis for a working knowledge of the subject. It is directed towards all the engineering disciplines that are involved either directly or indirectly with the structural reliability of electrical power generation equipment and systems. These engineering disciplines include such areas as: design and stress analysis, metallurgy and materials, nondestructive inspection and quality control, structural analysis and reliability engineering, chemical engineering and water chemistry control, and architectural engineering. This Primer does not provide a comprehensive, in-depth treatment of all the detailed aspects involved in fracture mechanics. It does, however, provide sufficient information and a common vocabulary that should enable engineers to: read and converse intelligently about the subject, understand and utilize ASME Codes and Regulatory Guides involving fracture mechanics, absorb technical information presented and discussed at various technical meetings, and begin to apply this technology towards actual engineering problems encountered in the course of their work. Example problems are provided to further enhance an understanding of fracture mechanics. Also, Appendix A describes fracture mechanics computer codes available through EPRI to analyze rotors, reactor pressure vessels and piping

Prevalencia y factores asociados al asma en niños de 5 a 14 años de un área rural del sur del Perú

Directory of Open Access Journals (Sweden)

César V. Munayco

2009-07-01

Full Text Available Objetivos. Determinar la prevalencia y los factores asociados al asma en niños de 5 a 14 años de una zona rural en la provincia de Ica, Perú. Materiales y métodos. Se realizó un estudio transversal en niños de 5 a 14 años del distrito de Santiago, Ica, en el año 2004. Se visitaron a las madres de los niños seleccionados a través de un muestreo aleatorio sistemático y se aplicó un cuestionario basado en el ISAAC, asimismo, se evaluaron factores asociados al asma. Tomando el desarrollo de asma como variable de respuesta, se efectuó un modelo de regresión logística binaria a fin de identificar los factores que se le asocian de manera independiente. Resultados. De un total de 200 sujetos, 186 fueron encuestados, 25 de ellos cumplían la definición de asma, la prevalencia global de asma fue de 13,5% (IC95%: 8,8 - 19,8%, predominando ligeramente en los niños menores de 5 años (39% respecto al resto de grupos de edad (16 y 7% para 6 a 10 y 11 a 14 años respectivamente. Dentro de los factores asociados a tener asma se encontraron el antecedente de padecer rinitis, haber recibido antibióticos durante el primer año de vida y tabaquismo del padre en el primer año de vida. Los factores protectores fueron haber tenido diarrea durante el primer año de vida y haber sido vacunados con BCG. Conclusiones. La prevalencia de asma en una zona rural es comparable con la de otras ciudades en el mundo. Se le asocian factores que pueden ser modificados como el tratamiento antibiótico durante el primer año de vida y el tabaquismo paterno.

Colagem ortodôntica em esmalte com presença ou ausência de contaminação salivar: é necessário o uso de adesivo auto-condicionante ou de adesivo hidrofílico? Orthodontic bonding in dry and saliva contaminated enamel: is a self-etching primer or a moisture-insensitive primer necessary?

Directory of Open Access Journals (Sweden)

Cristiane Becher Rosa

2008-06-01

Full Text Available OBJETIVO: o objetivo deste trabalho foi avaliar a resistência ao cisalhamento da colagem ortodôntica de um adesivo hidrofílico (Transbond Moisture-Insensitive Primer, 3M Unitek, Monrovia, Califórnia, de um adesivo auto-condicionante (Transbond Self-Etching Primer, 3M Unitek, Monrovia, Califórnia, e sem uso de adesivo, em superfícies de esmalte secas ou contaminadas por saliva. METODOLOGIA: incisivos bovinos (60 foram divididos em 6 grupos: (1 controle sem contaminação salivar (sem adesivo, (2 controle com contaminação salivar (sem adesivo, (3 adesivo auto-condicionante sem contaminação salivar, (4 adesivo auto-condicionante com contaminação salivar antes do adesivo, (5 adesivo hidrofílico sem contaminação salivar e (6 adesivo hidrofílico com contaminação salivar antes do adesivo. Braquetes metálicos foram colados com compósito (Transbond XT, 3M Unitek, Monrovia, Califórnia. Após a colagem, os corpos-de prova foram armazenados a 37±1ºC em ambiente úmido até a realização do teste de cisalhamento. Diferença estatística foi determinada com valor de probabilidade de 0,05 ou menos (p AIM: The purpose of this study was to evaluate the shear bond strength of orthodontic bonding with the use of a hydrophilic primer (Transbond Moisture-Insensitive Primer, 3M Unitek, Monrovia, Calif., a self-etching primer (Transbond Plus Self-etching Primer, 3M Unitek, Monrovia, Calif. and without primer application, in dry and saliva contaminated enamel surfaces. METHODS: Bovine incisors (60 were divided into 6 groups: (1 uncontaminated control (no primer, (2 control with saliva contamination (no primer, (3 uncontaminated self-etching primer, (4 saliva contamination before self-etching primer, (5 uncontaminated hydrophilic primer and (6 saliva contamination before hydrophilic primer. Stainless steel brackets were bonded with composite resin (Transbond XT, 3M Unitek, Monrovia, Calif.. After bonding, all samples were stored at 37±1°C in a

A method for automatically extracting infectious disease-related primers and probes from the literature

Directory of Open Access Journals (Sweden)

Pérez-Rey David

2010-08-01

Full Text Available Abstract Background Primer and probe sequences are the main components of nucleic acid-based detection systems. Biologists use primers and probes for different tasks, some related to the diagnosis and prescription of infectious diseases. The biological literature is the main information source for empirically validated primer and probe sequences. Therefore, it is becoming increasingly important for researchers to navigate this important information. In this paper, we present a four-phase method for extracting and annotating primer/probe sequences from the literature. These phases are: (1 convert each document into a tree of paper sections, (2 detect the candidate sequences using a set of finite state machine-based recognizers, (3 refine problem sequences using a rule-based expert system, and (4 annotate the extracted sequences with their related organism/gene information. Results We tested our approach using a test set composed of 297 manuscripts. The extracted sequences and their organism/gene annotations were manually evaluated by a panel of molecular biologists. The results of the evaluation show that our approach is suitable for automatically extracting DNA sequences, achieving precision/recall rates of 97.98% and 95.77%, respectively. In addition, 76.66% of the detected sequences were correctly annotated with their organism name. The system also provided correct gene-related information for 46.18% of the sequences assigned a correct organism name. Conclusions We believe that the proposed method can facilitate routine tasks for biomedical researchers using molecular methods to diagnose and prescribe different infectious diseases. In addition, the proposed method can be expanded to detect and extract other biological sequences from the literature. The extracted information can also be used to readily update available primer/probe databases or to create new databases from scratch.

Esteatosis en un burro (Equus asinus. Primer reporte en Colombia

Directory of Open Access Journals (Sweden)

José Cardona Á.

2011-12-01

Full Text Available Se describe un caso de esteatosis en un burro (Equus asinus, castrado, de 15 años de edad, procedente del municipio de San Antero (Córdoba, Colombia, al cual se le detectó ligamento nucal engrosado, duro y doloroso, dando la impresión de un doble cuello y edemas subcutáneos indurados en pared costal, abdominal y pectoral. Tambiénpresentó masas duras en la unión de músculos semimembranoso y semitendinoso. Por todo lo anterior, mostró dificultad para realizar movimientos coordinados del cuello, nuca y de traslado. Estos hallazgos obedecen principalmente a una deficiencia de selenio y vitamina E, sirviendo como parámetro diagnóstico para la identificación de esta enfermedad en equinos, por lo cual se determinó la actividad eritrocitica de la enzima glutatión peroxidada (GSH-Px, arrojando resultados muy bajos. Este cuadro es también conocido en equinos como enfermedad de la grasa amarilla o esteatitis, que produce degeneración del tejido adiposo, siendo reemplazado por tejido conectivo con depósitos de calcio. Puede estar asociada a miodegeneración nutricional o distrófica (enfermedad del músculo blanco. Es el primer reporte de esta enfermedad en burros(Equus asinus que se hace en Colombia.

Primer on molecular genetics. DOE Human Genome Program

Energy Technology Data Exchange (ETDEWEB)

1992-04-01

This report is taken from the April 1992 draft of the DOE Human Genome 1991--1992 Program Report, which is expected to be published in May 1992. The primer is intended to be an introduction to basic principles of molecular genetics pertaining to the genome project. The material contained herein is not final and may be incomplete. Techniques of genetic mapping and DNA sequencing are described.

Variación del peso durante el primer mes de vida en recién nacidos de término sanos con lactancia materna exclusiva

OpenAIRE

COVAS, MARÍA; ALDA, ERNESTO; VENTURA, SILVIA; BRAUNSTEIN, SILVIA; SERRALUNGA, GABRIELA; YÁÑEZ, LORETO

2008-01-01

La variación del peso en recién nacidos sanos resulta de interés clínico, principalmente en aquellos niños con lactancia materna exclusiva. Objetivos. Determinar el cambio relativo del peso al nacer durante el primer mes, en recién nacidos de término sanos, alimentados exclusivamente con pecho. Diseño. Observacional; tipo cohorte. Prospectivo. Población, material y métodos. Recién nacidos asistidos entre septiembre de 2000 y noviembre de 2001. Criterios de elegibilidad: recién nacidos de térm...

Adhesion of epoxy primer to hydrotalcite conversion coated AA2024

Science.gov (United States)

Leggat, Robert Benton, III

Hydrotalcite-based (HT) conversion coatings are being developed as an environmentally benign alternative to chromate conversion coatings (CCC). Accelerated exposure tests were conducted on epoxy primed, HT-modified AA2024 to gauge service performance. HT-based conversion coatings did not perform as well as the CCC when used with an epoxy primer. The current HT chemistries are optimized for stand-alone corrosion protection, however additional research into the primer/HT interactions is necessary before they can be implemented within a coating scheme. The relative contribution of mechanical and physico-chemical interactions in controlling adhesion has been investigated in this study. Practical adhesion tests were used to assess the dry and wet bond strength of epoxy primer on HT coatings using the pull-off tensile strength (POTS) as the figure of merit. The practical adhesion of HT coated samples generally fell between that observed for the CCC and bare AA2024. Laboratory testing was done to assess the physical and chemical properties of HT coatings. Contact angle measurements were performed using powders representative of different HT chemistries to evaluate the dispersive and acid-base character of the surface. The wet POTS correlated with the electrodynamic (dipole + dispersive) parameter of the surface tension. The HT surfaces were found to be predominantly basic. Given the basicity of epoxy, these results indicate that increasing the acidic character of HT coatings may increase the adhesion performance. This was supported by electrokinetic measurements in which the dry POTS was found to increase with decreasing conversion coating iso-electric point. The correlations with the dry and wet state adhesion are interpreted as indicating that dry state adhesion is optimized by minimizing unfavorable polar interactions between the basic epoxy and HT interfaces. Wet state adhesion, where polar interactions are disrupted, is dictated by non-polar bonding. FTIR

A Primer on Concepts and Applications of Proteomics in Neuroscience

DEFF Research Database (Denmark)

Hosp, Fabian; Mann, Matthias

2017-01-01

The enormous complexity of the central nervous system has impeded its systemic exploration for decades but powerful "omic" technologies are now pushing forward the frontiers of neuroscience research at an increasing pace. This Primer reviews the most recent progress in mass spectrometry (MS...

Caracterización de la fibrosis quística en el primer año de vida

Directory of Open Access Journals (Sweden)

Gladys Fuentes Fernández

Full Text Available Introducción: la fibrosis quística es una enfermedad multisistémica, genética y letal, con daño pulmonar temprano y progresivo en los casos típicos. Objetivo: caracterizar el diagnóstico de la fibrosis quística en niños menores de un año. Métodos: estudio transversal, descriptivo, a pacientes diagnosticados con fibrosis quística según sospecha clínica, en el primer año de vida, en el Hospital Pediátrico Centro Habana, en el período 1993-2013, según datos obtenidos de los registros clínicos. Resultados: del total de 44 pacientes diagnosticados en el periodo, 35 clasificaron como enfermedad pulmonar típica, de ellos 13 fueron diagnosticados durante el primer año de vida, 7/21 en el periodo 1993-2003 (33,3 % y 6/14 entre 2004-2013 (42,8 %. Cuando se suman las formas clínicas no típicas, el total de niños diagnosticados durante su primer año fue de 16, con edad media al diagnóstico de 4,9 meses; en 11 niños (68,8 % el diagnóstico fue antes de los 6 meses, con predominio de los varones (10-62,5 %. La desnutrición estuvo presente en el 62,5 %. La forma típica con insuficiencia pancreática se evidenció en el 75 % de los menores de un año estudiados, y se aisló Pseudomona aeruginosa en el 68,8 %. Predominaron las manifestaciones respiratorias como la polipnea y el tórax hiperinsuflado (15 niños, 93,8 %, así como el tiraje (14 niños, 87,5 %, mientras que la distensión abdominal (11, 68,8 % y la esteatorrea (10, 62,5 %, fueron las más frecuentes alteraciones digestivas. La radiografía torácica mostró algún grado de alteración en todos los niños. Conclusiones: es importante una alta sospecha clínica para el diagnóstico temprano de las formas típicas de la fibrosis quística.

The effects of pH on N-methacryloyl glycine primer on bond strength to acid-etched dentin.

Science.gov (United States)

Nishiyama, N; Suzuki, K; Asakura, T; Nakai, H; Yasuda, S; Nemoto, K

1996-07-01

To develop a more effective adhesive primer, it is imperative to understand the adhesion mechanisms of the resin to the demineralized dentin through a dentin primer. When the bonding agent was directly applied to the dentin etched by 40 wt % phosphoric acid without a primer pretreatment, the bond strength of the resin to the dentin was 5 MPa. Conversely, when the demineralized dentin was pretreated with the N-methacryloyl glycine (NM alpha A) primer solution with a pH value of 1.5, the bond strength increased considerably to 15 MPa. However, the bond strength dropped dramatically from 15 to 3 MPa when the sodium salt of NM alpha A was added, thereby increasing the pH value of the NM alpha A primer solution from 3.2 to 5.0. When the pH value was increased above 3.5 (pKa value), the number of ionized NM alpha A species increased in the solution. As a result, the bond strength of the resin fell to approximately 3 MPa. This result was obtained despite the 5-micron-thick hybrid layer that was created in the subsurface of the intertubular dentin. The number of unionized NM alpha A species increased by lowering the pH value below 3.5. As a result, the NM alpha A primer provided a higher bond strength of the resin to the demineralized dentin. In contrast, when 10 wt % citric acid containing 3 wt % ferric chloride was applied to the dentin, maximum bond strength was obtained when the pH value of the NM alpha A primer solution was 3.5. The pH dependency of the bond strength obtained following 10 wt % citric acid containing 3 wt % ferric chloride etching is different from the results obtained from 40 wt % phosphoric acid etching. This can be attributed to the difference in the characteristics of the demineralized collageous layer.

Transportation Management Area Planning Certification Review Primer: Revised January 18, 2018

Science.gov (United States)

2018-01-18

This primer outlines key concepts and expectations of a Transportation Management Area (TMA) Planning Certification Review. Reflecting on the collective experiences of past Certification Reviews, this includes references to relevant laws and regulati...

Determinación cuantitativa de vitamina C y pigmentos y procesamiento de la papa criolla, variedad yema de huevo (Solanum phureja Juz et Buck

Directory of Open Access Journals (Sweden)

Isabel Alvarez G.

2009-07-01

Full Text Available Empleando papa pardo'pastusa (Solanum tuberosum como control, se determinó el contenido de Vitamina C total en la papa criolla, variedad Yema de Huevo (Solanum phureja, Juz et Buck y se evaluaron las pérdidas durante la cocción y el freído. Se utilizaron los métodos colorimétrico y densitométrico: el primero dio resultados altos debido a sustancias interferentes; el segundo reportó los siguientes valores: criolla 21 mg/100 g, pardo-pastusa 18 mg/100 g (para muestra fresca. Las pérdidas de Vitamina C de papa criolla con piel fueron durante la cocción {92°C durante 25' de 1 9 % y en el freído (175°C por 3' de 30%. También se analizaron los carotenos y xantofilas dando: carotenos en papa criolla, 1.5 mg/100 g, en pardo-pastusa 0.5 mg/100 g (muestra fresca y xantofilas en papa criolla 0.6 mg/100 g, en pardo-pastusa 0.13 mg/100 g. Se procesó en las siguientes formas no tradicionales: en harinas compuestas aceptadas por ios consumidores, en una sustitución del 2 0% con puré; frita en tajadas con piel y pasabocas de puré. El tiempo de vida fue para frita tres semanas a 16°C V más de una semana a 25°C; para pasabocas cinco semanas y media a 16 C y un mes a 30°C.

Microsatellite Primers for Parkia biglobosa (Fabaceae: Mimosoideae) Reveal that a Single Plant Sires All Seeds Per Pod

DEFF Research Database (Denmark)

Lassen, Kristin Marie; Kjær, Erik Dahl; Ouédraogo, Moussa

2014-01-01

Premise of the study: Microsatellite primers were developed for an indigenous fruit tree, Parkia biglobosa, as a tool to study reproductive biology and population structure. Here we use the primers to determine the number of fathers per pod.  Methods and Results: Microsatellite loci were enriched...

Effect of clearfil protect bond and transbond plus self-etch primer on shear bond strength of orthodontic brackets

Directory of Open Access Journals (Sweden)

S Hamid Raji

2011-01-01

Conclusion: The shear bond strength of clearfil protect bond and transbond plus self-etch primer was enough for bonding the orthodontic brackets. The mode of failure of bonded brackets with these two self-etch primers is safe for enamel.

Detection of gunshot primer residue on bone in an experimental setting-an unexpected finding.

Science.gov (United States)

Berryman, Hugh E; Kutyla, Alicja K; Russell Davis, J

2010-03-01

Pork ribs with intact muscle tissue were used in an experimental attempt to identify bullet wipe on bone at distances from 1 to 6 feet with 0.45 caliber, full metal jacket ammunition. This resulted in the unexpected finding of primer-derived gunshot residue (GSR) deep within the wound tract. Of significance is the fact that the GSR was deposited on the bone, under the periosteum, after the bullet passed through a Ziploc bag and c. 1 inch of muscle tissue. It is also important to note that the GSR persisted on the bone after the periosteum was forcibly removed. The presence of primer-derived GSR on bone provides the potential to differentiate gunshot trauma from blunt trauma when the bone presents an atypical gunshot wound. In this study, the presence of gunshot primer residue at a distance of 6 feet demonstrates the potential for establishing maximum gun-to-target distance for remote shootings.

An anti-steroidogenic inhibitory primer pheromone in male sea lamprey (Petromyzon marinus)

Science.gov (United States)

Chung-Davidson, Yu-Wen; Wang, Huiyong; Bryan, Mara B.; Wu, Hong; Johnson, Nicholas S.; Li, Weiming

2013-01-01

Reproductive functions can be modulated by both stimulatory and inhibitory primer pheromones released by conspecifics. Many stimulatory primer pheromones have been documented, but relatively few inhibitory primer pheromones have been reported in vertebrates. The sea lamprey male sex pheromone system presents an advantageous model to explore the stimulatory and inhibitory primer pheromone functions in vertebrates since several pheromone components have been identified. We hypothesized that a candidate sex pheromone component, 7α, 12α-dihydroxy-5α-cholan-3-one-24-oic acid (3 keto-allocholic acid or 3kACA), exerts priming effects through the hypothalamic-pituitary-gonadal (HPG) axis. To test this hypothesis, we measured the peptide concentrations and gene expressions of lamprey gonadotropin releasing hormones (lGnRH) and the HPG output in immature male sea lamprey exposed to waterborne 3kACA. Exposure to waterborne 3kACA altered neuronal activation markers such as jun and jun N-terminal kinase (JNK), and lGnRH mRNA levels in the brain. Waterborne 3kACA also increased lGnRH-III, but not lGnRH-I or -II, in the forebrain. In the plasma, 3kACA exposure decreased all three lGnRH peptide concentrations after 1 h exposure. After 2 h exposure, 3kACA increased lGnRHI and -III, but decreased lGnRH-II peptide concentrations in the plasma. Plasma lGnRH peptide concentrations showed differential phasic patterns. Group housing condition appeared to increase the averaged plasma lGnRH levels in male sea lamprey compared to isolated males. Interestingly, 15α-hydroxyprogesterone (15α-P) concentrations decreased after prolonged 3kACA exposure (at least 24 h). To our knowledge, this is the only known synthetic vertebrate pheromone component that inhibits steroidogenesis in males.

Validation of a Non-Specific Dye Real-Time PCR Assay for Porcine Adulteration in Meatball Using ND5 Primer

Directory of Open Access Journals (Sweden)

Tri Joko Raharjo

2017-07-01

Full Text Available Porcine adulteration in meatball samples were analyzed using real-time polymerase chain reaction (RT-PCR, based on the ND5 primer obtained by previous study. This work consisted of three stages which were annealing temperature optimization, method validation, and application. DNA template was extracted using phenol-CIAA (chloroform-iso amyl alcohol method. The optimum annealing temperature for ND5 primers (forward primer 5'-CATTCGCCTCACTCACATTAACC-3' and reverse primer 5'-AAGAGAGAGTTCTACGGTCTGTAG-3' was 58.0 °C, obtained after testing annealing at 50.5 to 59.5 °C gradient temperature with 5 °C interval. Melting curve analysis was done at 65.0 to 95.0 °C, with increasing temperature for 0.5 °C per 2 sec. Method was validated for its specificity, precision and limit of detection. RT-PCR method with ND5 primers produced 227 bp DNA fragment with 78.50 °C Tm value. From eight commercial meatball samples, one was detected containing porcine. The methods showed high specificity and precision, with experimentally determined limits for porcine were no less than 1%.

Development of a microsatellite primer set to investigate the genetic ...

Indian Academy of Sciences (India)

Development of a microsatellite primer set to investigate the genetic population structure of Armadillidium nasatum (Crustacea, Oniscidea). Séverine Masson, Cédric Faivre, Isabelle Giraud, Catherine Souty-Grosset, Richard Cordaux, Carine Delaunay,. Didier Bouchon and Nicolas Bech. J. Genet. 93, 545-549. Table 1.

Development of specific primers for genus Fusarium and F. solani ...

African Journals Online (AJOL)

Yomi

2012-01-05

Jan 5, 2012 ... reproductive parts of plants. They are ... plant species in most parts of the world. .... 20 µl 2.5X master mix (Eppendorf) and 1 µl of each forward and ... List of primers developed for rapid detection of Fusarium sp. and F. solani.

From Kitāb al-ḥadā’iq to Kitāb al-dawā’ir: Reconsidering Ibn al-Sīd al-Batalyawsī’s Philosophical Treatise

Directory of Open Access Journals (Sweden)

Eliyahu, Ayala

2015-06-01

adscribe este tratado, teniendo en cuenta su texto, una revisión de los datos ya conocidos y la comparación entre este tratado y el resto de la producción de al-Batalyawsī. Como conclusión se propone, en primer lugar, que el Kitāb al-ḥadā’iq no es el título original del tratado, sino que debe ser Kitāb al-dawā’ir. Por otro lado, este Kitāb al-dawā’ir era originalmente parte (una de las versiones del Kitāb al-masā’il de al-Batalyawsī. En tercer lugar, las similitudes textuales y estilísticas entre este tratado con otras obras de al-Batalyawsī prueban su autoría. Además, el uso que al-Batalyawsī hace de fórmulas que ya encontramos en las Rasā’il Ikhwān al-Safā, y que aparecen en sus Kitāb al-ḥadā’iq y Kitāb al-masā’il, profundizan en la hipótesis del impacto que las Rasā’il causaron en el pensamiento del autor, así como en la estrecha conexión que existe entre el Kitāb al-ḥadā’iq y el Kitāb al-masā’il. De hecho, esta conexión resulta más clara cuando se atribuyen ambos tratados al género de «preguntas y respuestas» en la literatura árabe. Este artículo demuestra, por tanto, que el Kitāb al-dawā’ir de al-Batalyawsī debe entenderse como parte de su obra literaria y, así, como parte de la producción filosófica andalusí.

HTP-OligoDesigner: An Online Primer Design Tool for High-Throughput Gene Cloning and Site-Directed Mutagenesis.

Science.gov (United States)

Camilo, Cesar M; Lima, Gustavo M A; Maluf, Fernando V; Guido, Rafael V C; Polikarpov, Igor

2016-01-01

Following burgeoning genomic and transcriptomic sequencing data, biochemical and molecular biology groups worldwide are implementing high-throughput cloning and mutagenesis facilities in order to obtain a large number of soluble proteins for structural and functional characterization. Since manual primer design can be a time-consuming and error-generating step, particularly when working with hundreds of targets, the automation of primer design process becomes highly desirable. HTP-OligoDesigner was created to provide the scientific community with a simple and intuitive online primer design tool for both laboratory-scale and high-throughput projects of sequence-independent gene cloning and site-directed mutagenesis and a Tm calculator for quick queries.

Microsatellite primers for a species of South African everlasting daisy (Helichrysum odoratissimum; Gnaphalieae, Asteraceae)1

Science.gov (United States)

Glennon, Kelsey L.; Cron, Glynis V.

2016-01-01

Premise of the study: Microsatellites were developed for the widespread Helichrysum odoratissimum (Asteraceae) to estimate gene flow across diploid populations and to test if gene flow occurs among other closely related lineages within this genus. Methods and Results: Ten primer pairs were developed and tested using populations across South Africa; however, only seven primer pairs were polymorphic for the target species. The seven polymorphic primers amplified di- and trinucleotide repeats with up to 16 alleles per locus among 125 diploid individuals used for analyses. Conclusions: These markers can be used to estimate gene flow among populations of known ploidy level of H. odoratissimum to test evolutionary hypotheses. Furthermore, these markers amplify successfully in other Helichrysum species, including the other three taxonomic Group 4 species, and therefore can be used to inform taxonomic work on these species. PMID:27213125

Ares, Janus, Globalization: A Primer For The Military Leader in NATO

National Research Council Canada - National Science Library

Clemons, Dean

2002-01-01

...: international military and commercial investment; dual-use technologies; and export control. As a primer on these stakes for the rising military leader within the North Atlantic Treaty, the study elucidates the issue of cooperation vs...

Bayesian models a statistical primer for ecologists

CERN Document Server

Hobbs, N Thompson

2015-01-01

Bayesian modeling has become an indispensable tool for ecological research because it is uniquely suited to deal with complexity in a statistically coherent way. This textbook provides a comprehensive and accessible introduction to the latest Bayesian methods-in language ecologists can understand. Unlike other books on the subject, this one emphasizes the principles behind the computations, giving ecologists a big-picture understanding of how to implement this powerful statistical approach. Bayesian Models is an essential primer for non-statisticians. It begins with a definition of probabili

Determination of the species specificity of the primers for the detection of chicken and turkey meat by realtime PCR method

Directory of Open Access Journals (Sweden)

Lenka Maršálková

2014-07-01

Full Text Available The aim of this work was to use TaqMan Real-Time PCR for quantitative authentication of chicken and turkey meat. To meet this purpose, a specific pair of primers and TaqMan probe was used. The test was aimed at identifying the reaction cycle of turkey and chicken meat using by two sets of primers. With first set of primer designed for chicken we obtained the following results: Cp = 16.18 for 100% chicken DNA Cp = 29, 18 100% turkey DNA It was also amplified DNA of pig that exceeded the detection threshold fluorescence intensities in the 31.07 cycle (Cp = 31.07. Using primers designed for turkey we obtained the following results Cp = 31.16 for 100% CHDNA, Cp =16.18 100% TDNA. It was also amplified the 100% DNA of rabbit in 31.63 cycle (Cp = 31.63 and deer in cycle 32 (Cp = 32. The DNA of all other animal species was amplificated after more than 35 cycles (Cp >35. It follows that the second detection primer pair is specific enough to unrelated species of animals by 30 cycles of the reaction. Species authentication based on DNA analysis from this perspective overcomes all the shortcomings of proteins. At present, DNA analysis use different types of PCR. Is the most progressive Real-time PCR, which is suitable for the specific use of detection (primers and TaqMan probe. The TaqMan Real-time PCR is within the sensitivity and specificity, clearly one of the best methods for identifying the species of chicken and turkey meat. The specificity of this method, however, depends primarily on the specificity of the primers and TaqMan probe. The 30 cycle reaction was chosen by us as the threshold for specificity using primers for authentication chicken and turkey meat.

Primer for criticality calculations with DANTSYS

International Nuclear Information System (INIS)

Busch, R.D.

1996-01-01

With the closure of many experimental facilities, the nuclear criticality safety analyst is increasingly required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his or her facility. Typically, two types of codes are available: deterministic codes such as ANISN or DANTSYS that solve an approximate model exactly and Monte Carlo Codes such as KENO or MCNP that solve an exact model approximately. Often, the analyst feels that the deterministic codes are too simple and will not provide the necessary information, so most modeling uses Monte Carlo methods. This sometimes means that hours of effort are expended to produce results available in minutes from deterministic codes. A substantial amount of reliable information on nuclear systems can be obtained using deterministic methods if the user understands their limitations. To guide criticality specialists in this area, the Nuclear Criticality Safety Group at the University of New Mexico in cooperation with the Radiation Transport Group at Los Alamos National Laboratory has designed a primer to help the analyst understand and use the DANTSYS deterministic transport code for nuclear criticality safety analyses. (DANTSYS is the name of a suite of codes that users more commonly know as ONEDANT, TWODANT, TWOHEX, and THREEDANT.) It assumes a college education in a technical field, but there is no assumption of familiarity with neutronics codes in general or with DANTSYS in particular. The primer is designed to teach by example, with each example illustrating two or three DANTSYS features useful in criticality analyses

A web-based adaptive tutor to teach PCR primer design

NARCIS (Netherlands)

van Seters, Janneke R.; Wellink, Joan; Tramper, Johannes; Goedhart, Martin J.; Ossevoort, Miriam A.

2012-01-01

When students have varying prior knowledge, personalized instruction is desirable. One way to personalize instruction is by using adaptive e-learning to offer training of varying complexity. In this study, we developed a web-based adaptive tutor to teach PCR primer design: the PCR Tutor. We used

A Web-based Adaptive Tutor to Teach PCR Primer Design

NARCIS (Netherlands)

Seters, van J.R.; Wellink, J.; Tramper, J.; Goedhart, M.J.; Ossevoort, M.A.

2012-01-01

When students have varying prior knowledge, personalized instruction is desirable. One way to personalize instruction is by using adaptive e-learning to offer training of varying complexity. In this study, we developed a web-based adaptive tutor to teach PCR primer design: the PCR Tutor. We used

Radiation protection primer

International Nuclear Information System (INIS)

Aigner, R.; Melzer, E.; Seissler, H.

1986-01-01

This 'radiation protection primer' does not pretend to give absolute, final answers to the many questions that have been arising after the Chernobyl accident. What it is intended to supply, as a schematic overview of problems resulting from nuclear accidents, and a likewise systematic outline of possible solutions and sensible reactions to such an event. The book takes up questions such as: What has happened to the soil. Will future harvests be 'clean' again. What does radioactivity to our drinking water and other waters. What are the effects of a radioactive fallout on food. What may we eat or drink. What happens to the human body after intake of radioactive air, or - even only slightly - contaminated food or water. What can we do to protect our health, and the health of our children. Is there anything else we can do in order to avoid such a disaster in future, except from shutting-off all reactors. The book itself presents some answers and advice, along with a list of terms and explanations, and addresses to apply to for further advice and information. (orig./HP) [de

Bond strength of primer/cement systems to zirconia subjected to artificial aging.

Science.gov (United States)

Zhao, Li; Jian, Yu-Tao; Wang, Xiao-Dong; Zhao, Ke

2016-11-01

Creating reliable and durable adhesion to the nonactive zirconia surface is difficult and has limited zirconia use. The introduction of functional monomers such as 10-methacryloyloxydecyl dihydrogen phosphate (MDP) appears to have enhanced bond strength to zirconia. The purpose of this in vitro study was to evaluate the long-term bond strength of several MDP-containing primer/cement systems to zirconia. Zirconia blocks were divided into 6 groups (n=24) according to the 3 primers/cements to be bonded, as follows: Scotchbond Universal/RelyX Ultimate (SU/RU; consisting of MDP-containing primer/MDP-free cement); Clearfil ceramic primer/Panavia F (CCP/PAN; consisting ofMDP-containing/MDP-containing); and Z-Prime Plus/Duo-Link (ZP/DUO; consisting ofMDP-containing/MDP-free), which were compared with 3 nonprimed groups, RU, PAN, and DUO. After bonding, each group was further divided into 3 subgroups (n=8) according to the level of aging: 24-hour storage in water at 37°C (24H); 30-day storage at 37°C (30D); and 30-day storage at 37°C followed by 3000 thermal cycles (30D/TC). After aging, a shear bond strength test and failure mode analysis were performed. The data were analyzed using 2-way ANOVA (α=.05). After aging, nearly all primer/cement groups presented significantly higher bond strength than the related nonprimed groups for each level of aging (P<.05), except for CCP/PAN versus PAN with 24H (P=.741). SU/RU had the highest bond strength among the groups for all treatments (P<.05), except for CCP/PAN versus SU/RU with 30D/TC (P=.171). Among the nonprimed groups, only RU went through 30D/TC without premature debonding. With 24H and 30D, the failure modes in SU/RU and CCP/PAN were purely mixed, whereas those in the other groups were mainly adhesive, except for RU. The superiority of the initial bond strength in SU/RU may result from some functional components other than MDP. The presence of MDP in the cement did not appear to have a positive effect on long-term bond

Incorporating travel-time reliability into the congestion management process : a primer.

Science.gov (United States)

2015-02-01

This primer explains the value of incorporating travel-time reliability into the Congestion Management Process (CMP) : and identifies the most current tools available to assist with this effort. It draws from applied research and best practices : fro...

La polilla Copitarsia decolora: revisión del complejo de especies con base en la morfología genital masculina y de los huevos (Lepidoptera: Noctuidae

Directory of Open Access Journals (Sweden)

Andrés O Angulo

2010-06-01

Full Text Available Copitarsia decolora es una especie polífaga ampliamente distribuida con un gran número de cambios nominales debido a su plasticidad fenotípica. Examinamos 14 machos de México, Colombia, Venezuela, Perú y Chile y revisamos la literatura producida entre 2003 y 2008. Realizamos un análisis del clasper (digitus de los órganos genitales masculinos del complejo de C. decolora mediante una disección estándar. Utilizamos fotografías de microscopio electrónico de barrido (SEM del corion de los huevos como carácter taxonómico. El género Copitarsia queda compuesto por 23 especies. C. corruda se considera un sinónimo de C. decolora (Guenée.The moth Copitarsia decolora: a review of the species complex based on egg and male genital morphology (Lepidoptera: Noctuidae. Copitarsia decolora is a widely distributed polyphagous species with a large number of nominal changes due to phenotypic plasticity. We reviewed 14 males from Mexico, Colombia, Venezuela, Peru and Chile and the literature produced between 2003 and 2008. An analysis of the clasper complex of C. decolora male genitalia was performed by standard dissection. Scanning electron microscope (SEM photographs of eggs structures were used as taxonomic characters. The genus Copitarsia comprises 23 species. C. corruda is considered a synonym of C. decolora. Rev. Biol. Trop. 58 (2: 769-776. Epub 2010 June 02.

Bayesian models: A statistical primer for ecologists

Science.gov (United States)

Hobbs, N. Thompson; Hooten, Mevin B.

2015-01-01

Bayesian modeling has become an indispensable tool for ecological research because it is uniquely suited to deal with complexity in a statistically coherent way. This textbook provides a comprehensive and accessible introduction to the latest Bayesian methods—in language ecologists can understand. Unlike other books on the subject, this one emphasizes the principles behind the computations, giving ecologists a big-picture understanding of how to implement this powerful statistical approach.Bayesian Models is an essential primer for non-statisticians. It begins with a definition of probability and develops a step-by-step sequence of connected ideas, including basic distribution theory, network diagrams, hierarchical models, Markov chain Monte Carlo, and inference from single and multiple models. This unique book places less emphasis on computer coding, favoring instead a concise presentation of the mathematical statistics needed to understand how and why Bayesian analysis works. It also explains how to write out properly formulated hierarchical Bayesian models and use them in computing, research papers, and proposals.This primer enables ecologists to understand the statistical principles behind Bayesian modeling and apply them to research, teaching, policy, and management.Presents the mathematical and statistical foundations of Bayesian modeling in language accessible to non-statisticiansCovers basic distribution theory, network diagrams, hierarchical models, Markov chain Monte Carlo, and moreDeemphasizes computer coding in favor of basic principlesExplains how to write out properly factored statistical expressions representing Bayesian models

Experimental primers containing synthetic and natural compounds reduce enzymatic activity at the dentin–adhesive interface under cyclic loading

Science.gov (United States)

Sousa, Ana Beatriz Silva; de Mattos Pimenta Vidal, Cristina; Leme-Kraus, Ariene Arcas; de Carvalho Panzeri Pires-de-Souza, Fernanda; Bedran-Russo, Ana K.

2016-01-01

Objective To evaluate the effect of experimental primers (chlorhexidine, enriched mixture of proanthocyanidins and doxycycline) on the adhesive properties and gelatinolytic activity at dentin-resin interfaces of occlusal Class I restorations. Methods The inactivation of enzymes by the experimental primers was assessed by fluorescence assay and gelatin zymography. To assess the adhesive properties, occlusal Class I cavities were prepared in sound human molars, etched with phosphoric acid and restored with one of the primers and an etch-and-rinse adhesive system (Adper Single Bond Plus - 3M ESPE). After the restorative procedures, the specimens were divided into two subgroups (n = 6) consisting of storage in incubation buffer or axial cyclic loading at 50 N and 1,000,000 cycles. Then, the sectioned and sliced specimens were assigned to in situ zymography assay and microtensile bond strength (TBS) test. Results Fluorescence assay and gelatin zymography revealed that the experimental primers inactivated rMMPs. In situ zymography (2-way ANOVA, Tukey, p 0.05). Significance The use of experimental primers impaired the enzymatic activity at the dentin-adhesive interface after cyclic loading and the activity of rMMPs. Cyclic loading did not have a significant effect on the bond strength. PMID:27524231

Efficient One-Step Fusion PCR Based on Dual-Asymmetric Primers and Two-Step Annealing

DEFF Research Database (Denmark)

Liu, Yilan; Chen, Jinjin; Thygesen, Anders

2018-01-01

Gene splicing by fusion PCR is a versatile and widely used methodology, especially in synthetic biology. We here describe a rapid method for splicing two fragments by one-round fusion PCR with a dual-asymmetric primers and two-step annealing (ODT) method. During the process, the asymmetric...... intermediate fragments were generated in the early stage. Thereafter, they were hybridized in the subsequent cycles to serve as template for the target full-length product. The process parameters such as primer ratio, elongation temperature and cycle numbers were optimized. In addition, the fusion products...

El primer encuentro del padre con el bebé prematuro en la Unidad de Cuidados Intensivos Neonatales

Directory of Open Access Journals (Sweden)

Fernanda Martins Castro

2015-06-01

Full Text Available Objetivo: Describir el primer encuentro del padre con el hijo en la Unidad de Cuidados Intensivos Neonatales (UCIN y analizar el significado de este momento en la perspectiva de los padres. Método: estudio cualitativo, con ocho padres de niños prematuros, a través de entrevistas semi-estructuradas. Los datos se analizaron a través del análisis temático. Resultados: Surgieron tres núcleos temáticos: "primer encuentro con hijo prematuro: sentimientos paternales y emociones", "construcción de la relación entre los profesionales y los padres de los recién nacidos a partir del primer encuentro" y reconocimiento de la paternidad en el contexto de la UCIN. Conclusión: El primer encuentro del padre con su hijo en la UCIN provoca sentimientos y sorpresa, dolor, incertidumbre, alegría y esperanza. El equipo de salud debe estar preparado para brindar apoyo emocional, información y establecer una comunicación efectiva desde la primera visita.

Teaching Thermal Hydraulics and Numerical Methods: An Introductory Control Volume Primer

International Nuclear Information System (INIS)

D. S. Lucas

2004-01-01

A graduate level course for Thermal Hydraulics (T/H) was taught through Idaho State University in the spring of 2004. A numerical approach was taken for the content of this course since the students were employed at the Idaho National Laboratory and had been users of T/H codes. The majority of the students had expressed an interest in learning about the Courant Limit, mass error, semi-implicit and implicit numerical integration schemes in the context of a computer code. Since no introductory text was found the author developed notes taught from his own research and courses taught for Westinghouse on the subject. The course started with a primer on control volume methods and the construction of a Homogeneous Equilibrium Model (HEM) (T/H) code. The primer was valuable for giving the students the basics behind such codes and their evolution to more complex codes for Thermal Hydraulics and Computational Fluid Dynamics (CFD). The course covered additional material including the Finite Element Method and non-equilibrium (T/H). The control volume primer and the construction of a three-equation (mass, momentum and energy) HEM code are the subject of this paper . The Fortran version of the code covered in this paper is elementary compared to its descendants. The steam tables used are less accurate than the available commercial version written in C Coupled to a Graphical User Interface (GUI). The Fortran version and input files can be downloaded at www.microfusionlab.com

Comparison of Self-Etch Primers with Conventional Acid Etching System on Orthodontic Brackets

Science.gov (United States)

Zope, Amit; Zope-Khalekar, Yogita; Chitko, Shrikant S.; Kerudi, Veerendra V.; Patil, Harshal Ashok; Jaltare, Pratik; Dolas, Siddhesh G

2016-01-01

Introduction The self-etching primer system consists of etchant and primer dispersed in a single unit. The etching and priming are merged as a single step leading to fewer stages in bonding procedure and reduction in the number of steps that also reduces the chance of introduction of error, resulting in saving time for the clinician. It also results in smaller extent of enamel decalcification. Aim To compare the Shear Bond Strength (SBS) of orthodontic bracket bonded with Self-Etch Primers (SEP) and conventional acid etching system and to study the surface appearance of teeth after debonding; etching with conventional acid etch and self-etch priming, using stereomicroscope. Materials and Methods Five Groups (n=20) were created randomly from a total of 100 extracted premolars. In a control Group A, etching of enamel was done with 37% phosphoric acid and bonding of stainless steel brackets with Transbond XT (3M Unitek, Monrovia, California). Enamel conditioning in left over four Groups was done with self-etching primers and adhesives as follows: Group B-Transbond Plus (3M Unitek), Group C Xeno V+ (Dentsply), Group D-G-Bond (GC), Group E-One-Coat (Coltene). The Adhesive Remnant Index (ARI) score was also evaluated. Additionally, the surface roughness using profilometer were observed. Results Mean SBS of Group A was 18.26±7.5MPa, Group B was 10.93±4.02MPa, Group C was 6.88±2.91MPa while of Group D was 7.78±4.13MPa and Group E was 10.39±5.22MPa respectively. In conventional group ARI scores shows that over half of the adhesive was remaining on the surface of tooth (score 1 to 3). In self-etching primer groups ARI scores show that there was no or minor amount of adhesive remaining on the surface of tooth (score 4 and 5). SEP produces a lesser surface roughness on the enamel than conventional etching. However, statistical analysis shows significant correlation (pbracket bonding after enamel conditioning with any of the SEPs tested. The SEPs used in Groups C (Xeno V

A comparison of orthodontic bracket shear bond strength on enamel deproteinized by 5.25% sodium hypochlorite using total etch and self-etch primer

Science.gov (United States)

Ongkowidjaja, F.; Soegiharto, B. M.; Purbiati, M.

2017-08-01

The shear bond strength (SBS) can be increased by removing protein pellicles from the enamel surface by deproteinization using 5.25% sodium hypochlorite (NaOCl). The SBS of a self-etch primer is lower than that of a total etch primer; nonetheless, it prevents white spot lesions. This study aimed to assess the SBS of the Anyetch (AE) total etch primer and FL-Bond II Shofu (FL) self-etch primer after enamel deproteinization using 5.25% NaOCl. Forty eight human maxillary first premolars were extracted, cleaned, and divided into four groups. In group A, brackets were bonded to the enamel without deproteinization before etching (A1: 10 teeth using total etch primer (AE); A2: 10 teeth using self-etch primer (FL)). In group B, brackets were bonded to the enamel after deproteinization with 5.25% NaOCl before etching (B1: 10 teeth using total etch primer (AE); B2: 10 teeth using self-etch primer (FL)). Brackets were bonded using Transbond XT, stored in artificial saliva for 24 h at 37°C, mounted on acrylic cylinders, and debonded using a Shimadzu AG-5000 universal testing machine. There were no significant differences in SBS between the total etch (AE) groups (p > 0.05) and between the self-etch (FL) groups (p > 0.05). There were significant differences in SBS between groups A and B. The mean SBS for groups A1, A2, B1, and B2 was 12.91±3.99, 4.46±2.47, 13.06±3.66, and 3.62±2.36 MPa, respectively. Deproteinization using NaOCl did not affect the SBS of the total etch primer (AE) group; it reduced the SBS of the self-etch primer (FL) group, but not with a statistically significant difference.

Análisis de estabilidad del reactor PFTR para una reacción con cinética de primer orden utilizando la funcional de Lyapunov

Directory of Open Access Journals (Sweden)

Héctor Armando Durán Peralta

2007-01-01

Full Text Available Abunda la literatura referente al análisis de estabilidad de reactores con parámetros globalizados de concentración y temperatura (por ejemplo el CSTR, en cambio es escasa la literatura sobre la estabilidad de reactores con parámetros distribuidos donde existe distribución espacial de concentración y temperatura, como es el caso del reactor tubular PFTR. Este documento analiza la estabilidad del reactor PFTR isotérmico y no isotérmico para una reacción con cinética de primer orden utilizando la funcional de Lyapunov. Se trabaja con una cinética de primer orden pues un objetivo de este artículo es mostrar cómo se aplica la funcional de Lyapunov al análisis de un reactor de parámetros distribuidos, dado que es casi inexistente la literatura sobre el método de la funcional de Lyapunov aplicada a la estabilidad de reactores (técnica usada en el análisis de estabilidad de sistemas en ingeniería eléctrica. El análisis de estabilidad dio como resultado perfiles de temperatura y concentración asintóticamente estables para los casos PFTR isotérmico, no isotérmico con constante cinética independiente de la temperatura y PFTR no isotérmico adiabático. Para el PFTR con retiro de calor el análisis condujo a una región de estabilidad asintótica y a una región incierta donde puede o no haber oscilaciones.

A Primer on Observational Measurement.

Science.gov (United States)

Girard, Jeffrey M; Cohn, Jeffrey F

2016-08-01

Observational measurement plays an integral role in a variety of scientific endeavors within biology, psychology, sociology, education, medicine, and marketing. The current article provides an interdisciplinary primer on observational measurement; in particular, it highlights recent advances in observational methodology and the challenges that accompany such growth. First, we detail the various types of instrument that can be used to standardize measurements across observers. Second, we argue for the importance of validity in observational measurement and provide several approaches to validation based on contemporary validity theory. Third, we outline the challenges currently faced by observational researchers pertaining to measurement drift, observer reactivity, reliability analysis, and time/expense. Fourth, we describe recent advances in computer-assisted measurement, fully automated measurement, and statistical data analysis. Finally, we identify several key directions for future observational research to explore.

Comparative study on the use of specific and heterologous microsatellite primers in the stingless bees Melipona rufiventris and M. mondury (Hymenoptera, Apidae).

Science.gov (United States)

Lopes, Denilce Meneses; de Oliveira Campos, Lúcio Antônio; Salomão, Tânia Maria Fernandes; Tavares, Mara Garcia

2010-04-01

Due to their high degree of polymorphism, microsatellites are considered useful tools for studying population genetics. Nevertheless, studies of genetic diversity in stingless bees by means of these primers have revealed a low level of polymorphism, possibly the consequence of the heterologous primers used, since in most cases these were not specifically designed for the species under consideration. Herein we compared the number of polymorphic loci and alleles per locus, as well as observed heterozygosity in Melipona rufiventris and M. mondury populations, using specific and heterologous primers. The use of specific primers placed in evidence the greater frequency of polymorphic loci and alleles per locus, besides an expressive increase in observed heterozygosity in M. rufiventris and M. mondury, thereby reinforcing the idea that populational studies should be undertaken by preferably using species-specific microsatellite primers.

454-Pyrosequencing Analysis of Bacterial Communities from Autotrophic Nitrogen Removal Bioreactors Utilizing Universal Primers: Effect of Annealing Temperature.

Science.gov (United States)

Gonzalez-Martinez, Alejandro; Rodriguez-Sanchez, Alejandro; Rodelas, Belén; Abbas, Ben A; Martinez-Toledo, Maria Victoria; van Loosdrecht, Mark C M; Osorio, F; Gonzalez-Lopez, Jesus

2015-01-01

Identification of anaerobic ammonium oxidizing (anammox) bacteria by molecular tools aimed at the evaluation of bacterial diversity in autotrophic nitrogen removal systems is limited by the difficulty to design universal primers for the Bacteria domain able to amplify the anammox 16S rRNA genes. A metagenomic analysis (pyrosequencing) of total bacterial diversity including anammox population in five autotrophic nitrogen removal technologies, two bench-scale models (MBR and Low Temperature CANON) and three full-scale bioreactors (anammox, CANON, and DEMON), was successfully carried out by optimization of primer selection and PCR conditions (annealing temperature). The universal primer 530F was identified as the best candidate for total bacteria and anammox bacteria diversity coverage. Salt-adjusted optimum annealing temperature of primer 530F was calculated (47°C) and hence a range of annealing temperatures of 44-49°C was tested. Pyrosequencing data showed that annealing temperature of 45°C yielded the best results in terms of species richness and diversity for all bioreactors analyzed.

Development of Prevotella intermedia-specific PCR primers based on the nucleotide sequences of a DNA probe Pig27.

Science.gov (United States)

Kim, Min Jung; Hwang, Kyung Hwan; Lee, Young-Seok; Park, Jae-Yoon; Kook, Joong-Ki

2011-03-01

The aim of this study was to develop Prevotella intermedia-specific PCR primers based on the P. intermedia-specific DNA probe. The P. intermedia-specific DNA probe was screened by inverted dot blot hybridization and confirmed by Southern blot hybridization. The nucleotide sequences of the species-specific DNA probes were determined using a chain termination method. Southern blot analysis showed that the DNA probe, Pig27, detected only the genomic DNA of P. intermedia strains. PCR showed that the PCR primers, Pin-F1/Pin-R1, had species-specificity for P. intermedia. The detection limits of the PCR primer sets were 0.4pg of the purified genomic DNA of P. intermedia ATCC 49046. These results suggest that the PCR primers, Pin-F1/Pin-R1, could be useful in the detection of P. intermedia as well as in the development of a PCR kit in epidemiological studies related to periodontal diseases. Crown Copyright © 2010. Published by Elsevier B.V. All rights reserved.

Heterologous primer transferability and access to microsatellite loci polymorphism in ‘somnus’ passion fruit tree (Passiflora setacea DC

Directory of Open Access Journals (Sweden)

Douglas de Almeida Pereira

2015-09-01

Full Text Available Primer pairs that access microsatellite loci, initially constructed through the genome of Passiflora edulis Sims flavicarpa and P. alata, were tested concerning their ability to access microsatellite loci in ‘somnus’ passion fruit tree (P. setacea individuals. Seven out of the thirty one primer pairs tested were able to access DNA polymorphism in the genome of this wild Passiflora species, by evaluating six natural populations, located in a transition area between the biomes Caatinga and Cerrado, in the state of Bahia, Brazil. The number of alleles/loci was small, oscillating from 1 to 4. The average heterozygosity observed per locus in all populations ranged from 0.13 to 0.40. There was transference of heterologous microsatellite primer pairs from the Passiflora genus to ‘somnus’ passion fruit tree, constituting a new set of primers that access random co-dominant locus in this species, useful for conservationist purposes and pre-improvement of ‘somnus’ passion fruit tree.

Efecto del extracto de paico (chenopodium ambrosioides, en parásitos gastrointestinales de gallos de pelea (gallus domesticus.

Directory of Open Access Journals (Sweden)

Paola Rodríguez

2011-10-01

Full Text Available El uso empírico de las plantas como agentes de salud es ampliamente conocido en múltiplesculturas del mundo, conocimientos que son transmitidos de generación en generación. En la actualidad, las plantas medicinales y sus extractos, son utilizados con fines terapéuticos, instaurándose como una alternativa farmacológica, para diferentes patologías tanto en humanos como en animales. En la etnomedicina de algunas regiones de Latinoamérica, el paico (Chenopodium ambrosioides ha sido empleado en infusión de hojas y flores comocarminativo y digestivo, pero principalmente como antihelmíntico. Por lo tanto, el presenteestudio se realizó con el fin de evaluar el efecto antiparasitario del extracto de esta planta engallos de pelea (Gallus domesticus en un criadero de la ciudad de Tunja-Boyacá, ya que los propietarios de estas aves lo utilizan de manera artesanal como desparasitante natural. Para el trabajo se utilizaron 45 ejemplares, organizados en 3 grupos a los cuales, cada 15días y durante un mes, se les administró, por vía oral, 0,1 ml/ Kg de extracto de paico (grupoT2, 0.5ml/Kg de un medicamento comercial a base de Levamisol-Ivermectina (grupo T3 y0.5ml/ave de agua (grupo T1 control. Se recolectaron muestras de materia fecal con el objeto de determinar la presencia de huevos y/o larvas de parásitos, utilizando la técnica de Formol-Eter. Durante el estudio fueron identificados diferentes especies de ascaridia spp, heterakis gallinarum, eimeria sp, huevos y larvas de trichostrongylus. Posterior a la administracióndel tratamiento con extracto de paico se encontraron huevos de ascaridia galli, heterakis gallinarum, eimeria sp , y al suministrar la última dosis sólo se identificaron huevos de ascaridia galli e eimeria sp , lo que corrobora su efecto antiparasitario.

Composición química del huevo de Tortuga Golfina Lepidochelys olivacea (Testudines: Cheloniidae y su potencial como recurso alimenticio

Directory of Open Access Journals (Sweden)

María Isabel Castro-González

2011-12-01

Full Text Available Por su potencial como fuente alimenticia, se analizó la composición química de huevo de Lepidochelys olivácea en La Escobilla, Oaxaca, México. El Instituto de Ciencias del Mar y Limnología de la Universidad Nacional Autónoma de México proporcionó 250 muestras de huevo liofilizado de 25 tortugas, que se analizaron siguiendo métodos oficiales para humedad, cenizas, proteína, grasa, lípidos totales(LT y análisis microbiológicos; además de ácidos grasos(AG por cromatografía de gases, aminoácidos(AA, vitaminas y colesterol(col por HPLC. Los resultados fueron los siguientes: (g/100g humedad(4.7, cenizas(3.8, proteína(53.7 y grasa(47.4. AA esenciales (g aa/100g Proteína: Ile (4.4, Lys(6.6, Leu(7.4, Met+Cys (8.8, Phe+Tyr (10.8; retinol (340μg/100g, colecalciferol (5.9 μg/100g, tocoferol (8.6, tiamina (0.3 y riboflavina (1.1 (mg/100g. Y los de (LT, (AG y (Col se concentraron en tres grupos por peso de tortuga: (LT (44.3-48.7-49.1g/100g, (Col (518.4-522.5-728.7 mg/100g. Entonces se identificaron 17 AGSaturados, 8 AGMonoinsaturados y 11 AGPoliinsaturados. Los AGS más abundantes (mg/100g: C16:0 (485-1263, AGM: C16:1 (456-716, C18:1n-9c (904- 1754 y AGP: C20:4n-6 (105-217, EPA (48-103 y HA (97-189. También, existió diferencia significativa (Fisher, pChemical composition of eggs of the Olive Ridley Lepidochelys olivacea (Testudines: Cheloniidae and it’s potential as a food source. The Olive Ridley is a worldwide distributed species with high nesting production per season, and in La Escobilla Oaxaca, México, there is a 70% of non-hatched eggs that are lost. In order to evaluate their potential use as a source for human and animal food products, their chemical composition was analyzed. Lyophilized egg samples from 25 turtles were obtained and were analyzed following the analytical methods for fatty acids, protein, fat, ash, moisture, amino acids, vitamins, cholesterol and microbiological agents. The analytical composition obtained

Construcción de una identidad participativa: socialización en el primer año de estudios universitarios

Directory of Open Access Journals (Sweden)

José Luis Suárez Domínguez

2017-01-01

Full Text Available Este artículo explora la forma en cómo los estudiantes universitarios construyen una identidad de participación política mediante la socialización que ellos despliegan en el primer año de estudios dentro del área de humanidades en la Universidad Veracruzana. Esta socialización se condensa en la integración de diversos grupos que van complejizándose y cambiando su forma a lo largo del tiempo. Los grupos se articulan, a su vez, mediante un conjunto de prácticas que combinan tiempos, interacciones específicas y orientaciones diversas, generando con ello un sentido de pertenencia a la escuela al definirla bajo ciertos esquemas de legitimidad y reconocerla como un espacio válido desde el cual es posible formar parte de diversas actividades de protesta social.

Estudio de Impacto Ambiental de una Granja de Gallinas Ponedoras en Producción Ecológica en el término municipal de Iznalloz, Granada

OpenAIRE

MARTÍNEZ AYALA, ANTONIO JOSÉ

2012-01-01

El proyecto consiste en la construcción de una granja de huevos ecológicos en la comarca de Los Montes situada en la zona norte de la provincia de Granada, con los siguientes fines: -¿Producción de huevos ecológicos cubriendo así, la creciente demanda de la sociedad, cada vez más comprometida con el consumo responsable. -Fomentar la producción de huevos ecológicos respecto a la producción convencional. -¿Favorecer el desarrollo sostenible y el desarrollo local con sist...

Estudio de la comunicación verbal y no verbal y aplicación al discurso político

OpenAIRE

Ruano Flores, María de las Mercedes

2014-01-01

El trabajo está estructurado en dos apartados teóricos y un apartado práctico. El primer apartado teórico se centra en el estudio de la comunicación verbal y en el proceso de comunicación, y el segundo apartado se centra en la comunicación no verbal. En el apartado práctico encontramos la aplicación de los conocimientos al discurso político

Comparative study on the use of specific and heterologous microsatellite primers in the stingless bees Melipona rufiventris and M. mondury (Hymenoptera, Apidae

Directory of Open Access Journals (Sweden)

Denilce Meneses Lopes

2010-01-01

Full Text Available Due to their high degree of polymorphism, microsatellites are considered useful tools for studying population genetics. Nevertheless, studies of genetic diversity in stingless bees by means of these primers have revealed a low level of polymorphism, possibly the consequence of the heterologous primers used, since in most cases these were not specifically designed for the species under consideration. Herein we compared the number of polymorphic loci and alleles per locus, as well as observed heterozygosity in Melipona rufiventris and M. mondury populations, using specific and heterologous primers. The use of specific primers placed in evidence the greater frequency of polymorphic loci and alleles per locus, besides an expressive increase in observed heterozygosity in M. rufiventris and M. mondury, thereby reinforcing the idea that populational studies should be undertaken by preferably using species-specific microsatellite primers.

MCNPTM criticality primer and training experiences

International Nuclear Information System (INIS)

Briesmeister, J.; Forster, R.A.; Busch, R.

1995-01-01

With the closure of many experimental facilities, the nuclear criticality safety analyst is increasingly required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, the analyst may have little experience with the specific codes available at his or her facility. Usually, the codes are quite complex, black boxes capable of analyzing numerous problems with a myriad of input options. Documentation for these codes is designed to cover all the possible configurations and types of analyses but does not give much detail on any particular type of analysis. For criticality calculations, the user of a code is primarily interested in the value of the effective multiplication factor for a system (k eff ). Most codes will provide this, and truckloads of other information that may be less pertinent to criticality calculations. Based on discussions with code users in the nuclear criticality safety community, it was decided that a simple document discussing the ins and outs of criticality calculations with specific codes would be quite useful. The Transport Methods Group, XTM, at Los Alamos National Laboratory (LANL) decided to develop a primer for criticality calculations with their Monte Carlo code, MCNP. This was a joint task between LANL with a knowledge and understanding of the nuances and capabilities of MCNP and the University of New Mexico with a knowledge and understanding of nuclear criticality safety calculations and educating first time users of neutronics calculations. The initial problem was that the MCNP manual just contained too much information. Almost everything one needs to know about MCNP can be found in the manual; the problem is that there is more information than a user requires to do a simple k eff calculation. The basic concept of the primer was to distill the manual to create a document whose only focus was criticality calculations using MCNP

An Evolutionary/Biochemical Connection Between Promoter- and Primer-Dependent Polymerases Revealed by Selective Evolution of Ligands by Exponential Enrichment (SELEX).

Science.gov (United States)

Fenstermacher, Katherine J; Achuthan, Vasudevan; Schneider, Thomas D; DeStefano, Jeffrey J

2018-01-16

DNA polymerases (DNAPs) recognize 3' recessed termini on duplex DNA and carry out nucleotide catalysis. Unlike promoter-specific RNA polymerases (RNAPs), no sequence specificity is required for binding or initiation of catalysis. Despite this, previous results indicate that viral reverse transcriptases bind much more tightly to DNA primers that mimic the polypurine tract. In the current report, primer sequences that bind with high affinity to Taq and Klenow polymerases were identified using a modified Selective Evolution of Ligands by Exponential Enrichment (SELEX) approach. Two Taq -specific primers that bound ∼10 (Taq1) and over 100 (Taq2) times more stably than controls to Taq were identified. Taq1 contained 8 nucleotides (5' -CACTAAAG-3') that matched the phage T3 RNAP "core" promoter. Both primers dramatically outcompeted primers with similar binding thermodynamics in PCR reactions. Similarly, exonuclease minus Klenow polymerase also selected a high affinity primer that contained a related core promoter sequence from phage T7 RNAP (5' -ACTATAG-3'). For both Taq and Klenow, even small modifications to the sequence resulted in large losses in binding affinity suggesting that binding was highly sequence-specific. The results are discussed in the context of possible effects on multi-primer (multiplex) PCR assays, molecular information theory, and the evolution of RNAPs and DNAPs. Importance This work further demonstrates that primer-dependent DNA polymerases can have strong sequence biases leading to dramatically tighter binding to specific sequences. These may be related to biological function, or be a consequences of the structural architecture of the enzyme. New sequence specificity for Taq and Klenow polymerases were uncovered and among them were sequences that contained the core promoter elements from T3 and T7 phage RNA polymerase promoters. This suggests the intriguing possibility that phage RNA polymerases exploited intrinsic binding affinities of

Can previous acid etching increase the bond strength of a self-etching primer adhesive to enamel?

Directory of Open Access Journals (Sweden)

Ana Paula Morales Cobra Carvalho

2009-06-01

Full Text Available Because a greater research effort has been directed to analyzing the adhesive effectiveness of self etch primers to dentin, the aim of this study was to evaluate, by microtensile testing, the bond strength to enamel of a composite resin combined with a conventional adhesive system or with a self-etching primer adhesive, used according to its original prescription or used with previous acid etching. Thirty bovine teeth were divided into 3 groups with 10 teeth each (n= 10. In one of the groups, a self-etching primer (Clearfil SE Bond - Kuraray was applied in accordance with the manufacturer's instructions and, in the other, it was applied after previous acid etching. In the third group, a conventional adhesive system (Scotchbond Multipurpose Plus - 3M-ESPE was applied in accordance with the manufacturer's instructions. The results obtained by analysis of variance revealed significant differences between the adhesive systems (F = 22.31. The self-etching primer (Clearfil SE Bond presented lower enamel bond strength values than the conventional adhesive system (Scotchbond Multipurpose Plus (m = 39.70 ± 7.07 MPa both when used according to the original prescription (m = 27.81 ± 2.64 MPa and with previous acid etching (m = 25.08 ± 4.92 MPa.

Estudio clínico y de resonancia magnética orientado al conocimiento del sustrato patológico de la discapacidad en la esclerosis múltiple primariamente progresiva

OpenAIRE

Tur Gómez, Carmen

2015-01-01

Con el objetivo de contribuir al estudio de los mecanismos que subyacen al aumento de la discapacidad en la esclerosis múltiple primariamente progresiva (EMPP), fijamos tres objetivos principales. Asimismo, nos propusimos hacer una revisión de la literatura sobre EMPP publicada hasta el momento actual, utilizando la web www.pubmed.com como herramienta de trabajo, que sirviera como introducción a los estudios de la tesis. El primer objetivo consistió en investigar el grado de correlación entre...

Controlling Air Pollution; A Primer on Stationary Source Control Techniques.

Science.gov (United States)

Corman, Rena

This companion document to "Air Pollution Primer" is written for the nonexpert in air pollution; however, it does assume a familiarity with air pollution problems. This work is oriented toward providing the reader with knowledge about current and proposed air quality legislation and knowledge about available technology to meet these standards for…

Estimates of abundance and diversity of Shewanella genus in natural and engineered aqueous environments with newly designed primers.

Science.gov (United States)

Li, Bing-Bing; Cheng, Yuan-Yuan; Fan, Yang-Yang; Liu, Dong-Feng; Fang, Cai-Yun; Wu, Chao; Li, Wen-Wei; Yang, Zong-Chuang; Yu, Han-Qing

2018-05-12

Shewanella species have a diverse respiratory ability and wide distribution in environments and play an important role in bioremediation and the biogeochemical cycles of elements. Primers with more accuracy and broader coverage are required with consideration of the increasing number of Shewanella species and evaluation of their roles in various environments. In this work, a new primer set of 640F/815R was developed to quantify the abundance of Shewanella species in natural and engineered environments. In silico tools for primer evaluation, quantitative polymerase chain reaction (qPCR) and clone library results showed that 640F/815R had a higher specificity and coverage than the previous primers in quantitative analysis of Shewanella. Another newly developed primer pair of 211F/815cR was also adopted to analyze the Shewanella diversity and demonstrated to be the best candidate in terms of specificity and coverage. We detected more Shewanella-related species in freshwater environments and found them to be substantially different from those in marine environments. Abundance and diversity of Shewanella species in wastewater treatment plants were largely affected by the process and operating conditions. Overall, this study suggests that investigations of abundance and diversity of Shewanella in various environments are of great importance to evaluate their ecophysiology and potential ecological roles. Copyright © 2018 Elsevier B.V. All rights reserved.

Profil Gangguan Kognitif pada Tumor Intrakranial Primer dan Metastasis

OpenAIRE

Kartika Maharani; Andira Larasari; Tiara Aninditha; Yetty Ramli

2015-01-01

Gangguan kognitif sering menyertai pasien tumor intrakranial dan menjadi penyebab utama disabilitas. Perbedaan patofisiologi tumor intrakranial primer (TIP) dan metastasis (TM) menyebabkan perbedaan gambaran klinis dan derajat  gangguan kognitif. Tujuan penelitian ini untuk mengetahui prevalensi dan profil gangguan kognitif pasien TIP dan TM. Disain penelitian potong-lintang retrospektif menggunakan data sekunder dari Poliklinik Saraf RSCM pada bulan Januari 2011-Desember 2013. Subjek b...

A primer on the mortgage market and mortgage finance

OpenAIRE

Daniel J. McDonald; Daniel L. Thornton

2008-01-01

This article is a primer on mortgage finance. It discusses the basics of the mortgage market and mortgage finance. In so doing, it provides useful information that can aid individuals in making better mortgage finance decisions. The discussion and the tools are presented within the context of mortgage finance; however, these same principles and tools can be applied to a wide range of financial decisions.

Reformas al sistema de compensación y liquidación de pagos en el Ecuador

OpenAIRE

Ramírez Miño, Jorge Patricio

2004-01-01

En el presente trabajo se realiza un análisis de las reformas al Sistema de Pagos impulsadas por el Banco Central del Ecuador que comprende un conjunto de mecanismos e instrumentos electrónicos a través de los cuales canalizan transferencias de fondos entre instituciones financieras privadas y entidades que conforman el sector público. El primer capítulo contiene los antecedentes, aspectos metodológicos del estudio, incluyendo la definición del problema a investigar, hipótes...

Dos textos astrológicos conservados en el comentario al Sefer Yeṣirá de Yehudá ben Barzilay al-Bargeloní

Directory of Open Access Journals (Sweden)

Sela, Shlomo

2008-12-01

Full Text Available The main object of this article is to translate, scrutinize the contents and reveal the sources of two Hebrew astrological texts embedded in the commentary on Sefer Yeṣirah composed by Yehudah ben Barzilay, the leading Rabbinic authority in Barcelona in the first half of the 12th century. The first text arises great interest because it incorporates the first ever known horoscopic chart written in Hebrew. The second text includes a miscellany of cosmological and astrological theories. The analysis of both fragments reveals the reception of astrological texts by Jewish intellectuals in the Iberian Peninsula. In contrast with Abraham bar Ḥiyya and Abraham Ibn 'Ezra, who epitomize a renovating trend couching into a Hebrew mold various aspects of Greek and Arabic science, Ben Barzilay embodies a conservative trend which exclusively relies on Jewish astrological and scientific sources.Este artículo tiene como principal propósito traducir, estudiar los contenidos y descubrir las fuentes de dos textos astrológicos hebreos conservados en el comentario al Sefer Yeṣirá de Yehudá ben Barzilay, la principal autoridad rabínica de Barcelona en las primeras décadas del siglo XII. El primer texto despierta gran interés porque incorpora el primer horóscopo documentado escrito en lengua hebrea conocido. El segundo texto incorpora una miscelánea de teorías cosmológicas y astrológicas. El análisis de ambos fragmentos revela un caso especial de recepción de fuentes astrológicas y científicas por intelectuales judíos en la península Ibérica. En claro contraste con Abraham bar Ḥiyya y Abraham Ibn 'Ezra, que encarnan una corriente renovadora orientada a verter al hebreo diversos aspectos de la astrología y ciencia griega y árabe, Yehudá ben Barzilay representa una modalidad conservadora inclinada a la utilización de fuentes astrológicas y científicas de autores exclusivamente judíos.

Ovarian egg morphology in chalcidoid wasps (Hymenoptera: Chalcidoidea parasitizing gall wasps (Hymenoptera: Cynipidae

Directory of Open Access Journals (Sweden)

Vårdal, H.

2016-06-01

Full Text Available We provide morphological egg data of 26 species of 5 chalcidoid families associated with cynipid galls (Hymenoptera: Cynipidae from western Palaearctic, including the first egg data for the family Ormyridae. Adult chalcidoid species were reared from galls, and eggs obtained from dissected female ovaries were examined using scanning electron microscopy (SEM. The shape of the eggs varies from oval to elongate and tapered at both ends. Eggs of Eurytomidae as well as some Eulophidae, Eupelmidae and Pteromalidae are equipped with a peduncle at the anterior end. We found a positive correlation between long eggs and long ovipositors and confirmed the expectation that eggs of endoparasitoids are generally shorter and narrower than eggs of ectoparasitoids. We were able to locate the sperm entrance or micropyle at the anterior pole of eggs of several species. It is situated at the anterior end of the egg and at the end of the peduncle when present. In addition, the eggshells of the endoparasitoid Sycophila biguttata (Swederus, 1795 (Hymenoptera: Eurytomidae and the ectoparasitoid Cecidostiba fungosa (Geoffroy, 1785 (Hymenoptera: Pteromalidae, are for the first time described.En el presente trabajo se aportan datos morfol.gicos del huevo de 26 especies del Paleártico occidental pertenecientes a 5 familias de Chalcidoidea asociadas con agallas de cinípidos (Hymenoptera: Cynipidae, incluyendo los primeros datos del huevo de especies de Ormyridae. Los ejemplares adultos de las especies estudiadas fueron obtenidos por emergencia de agallas en laboratorio, los ovarios de las hembras diseccionados para obtener los huevos, que fueron finalmente estudiados utilizando técnicas de microscopía electronica de barrido. La forma de los huevos estudiados varía de ovalada a alargada y ahusada en ambos extremos. Los huevos de Eurytomidae, así como algunos de Eulophidae, Eupelmidae y Pteromalidae están provistos de un pedúnculo en el extremo anterior. Se encontr

Desbalance energético proteico en lactantes durante el primer año de vida*

Directory of Open Access Journals (Sweden)

Virginia Díaz-Argüelles Ramírez-Corría

2004-06-01

Full Text Available La alimentación de los lactantes durante el primer año de vida tiene gran influencia en el crecimiento y desarrollo posterior, sobre todo en el lactante de muy bajo peso al nacer. El objetivo de este trabajo fue caracterizar el consumo de energía y macronutrientes en un grupo de recién nacidos, con peso inferior a 1 800 g y compararlo con un grupo control de término, para conocer si existía un consumo adecuado durante el primer año de vida. Para ello, se realizó un estudio de cohorte en 25 recién nacidos con peso al nacer menor de 1800 g y 34 semanas de edad gestacional, en el Hospital Ginecoobstétrico "Ramón González Coro", en Ciudad de La Habana, desde enero del 2000 hasta enero del 2001 y en 25 recién nacidos de buen peso a término como grupo control. Se realizó encuesta dietética de registro de 3 días, y a los 4, 6, 9 y 12 meses de edad para evaluar el consumo de macronutrientes. Los datos se procesaron por el Programa para la evaluación del consumo de alimentos (CERES. El consumo de energía fue adecuado, pero con un desequilibrio manifiesto de los macronutrientes en uno y otro grupos, a expensas del consumo de proteínas que fue excesivo (5 g/kg/día durante todo el primer año de vida y una baja densidad energética de la dieta. Se hace necesaria una revisión de la ablactación en los lactantes, del tipo de leche utilizado durante los primeros meses de la lactancia y los hábitos alimentarios de la población, con el objetivo de mejorar su calidad durante los primeros años de la vida.The feeding of infants during the first year of life has a great influence on the further growth and development, mainly on the infant with very low birth weight. The objective of this paper was to characterize the intake of energy and macronutrients in a group of newborn infants with a weight under 1 800 g and to compare it with a term control group to know if there was an adequate consumption during the first year of life. To this end, a

A primer on pseudorandom generators

CERN Document Server

Goldreich, Oded

2010-01-01

A fresh look at the question of randomness was taken in the theory of computing: A distribution is pseudorandom if it cannot be distinguished from the uniform distribution by any efficient procedure. This paradigm, originally associating efficient procedures with polynomial-time algorithms, has been applied with respect to a variety of natural classes of distinguishing procedures. The resulting theory of pseudorandomness is relevant to science at large and is closely related to central areas of computer science, such as algorithmic design, complexity theory, and cryptography. This primer surveys the theory of pseudorandomness, starting with the general paradigm, and discussing various incarnations while emphasizing the case of general-purpose pseudorandom generators (withstanding any polynomial-time distinguisher). Additional topics include the "derandomization" of arbitrary probabilistic polynomial-time algorithms, pseudorandom generators withstanding space-bounded distinguishers, and several natural notions...

A primer on quantum fluids

CERN Document Server

Barenghi, Carlo

2016-01-01

The aim of this primer is to cover the essential theoretical information, quickly and concisely, in order to enable senior undergraduate and beginning graduate students to tackle projects in topical research areas of quantum fluids, for example, solitons, vortices and collective modes. The selection of the material, both regarding the content and level of presentation, draws on the authors analysis of the success of relevant research projects with newcomers to the field, as well as of the students feedback from many taught and self-study courses on the subject matter. Starting with a brief historical overview, this text covers particle statistics, weakly interacting condensates and their dynamics and finally superfluid helium and quantum turbulence. At the end of each chapter (apart from the first) there will be some exercises. Detailed solutions can be made available to instructors upon request to the authors. .

Making the connection: advancing traffic incident management in transportation planning : a primer.

Science.gov (United States)

2013-07-01

"The intent of this primer is to inform and guide traffic incident management (TIM) professionals and transportation planners to initiate and develop collaborative relationships and advance TIM programs through the metropolitan planning process. The ...

Discovery and gestation of the self in El Primer Libro and Albricia by Soledad Fariña

Directory of Open Access Journals (Sweden)

Ana María Riveros Soto

2017-11-01

Full Text Available Este estudio propone una lectura centrada en la configuración del sujeto poético presente en los poemarios El Primer Libro (1985 y Albricia (1988 de Soledad Fariña (1943, bajo la comprensión de un yo en proceso continuo de gestación y nacimiento, acción que opera como mecanismo de reconstitución de una subjetividad desarticulada y extraviada en el marco de las condiciones político-culturales impuestas por la dictadura militar chilena durante las décadas de 1970 y 1980. Por medio de la metáfora del viaje y de la búsqueda de un lenguaje nuevo, el sujeto intenta acceder a su estado primigenio en el encuentro con el yo materno y oponerse a la razón dominante, codificando y configurándose en la palabra "otra" a través del cuerpo-texto femenino. No obstante, tal proceso de gestación y hallazgo es intervenido y truncado por el impulso de la modernidad, lo que da paso a un yo malformado, escindido y descentrado, que busca constituirse en otro opuesto al logos, pugna que transforma el surgimiento del yo en un acto doloroso -un parto- efectuado desde la herida y fisura del cuerpo, en el intento por refundar al sujeto a partir de sus fragmentos, huellas y reminiscencias.

Astaxanthin from Crayfish (Procambarus clarkii as a Pigmentary Ingredient in the Feed of Laying Hens

Directory of Open Access Journals (Sweden)

Garrido-Fernández, J.

2008-06-01

Full Text Available Chicken egg yolks generally owe their color to yellow carotenoids. The addition of synthetic red pigments allows changes in color, from the original yellow to red hues which may be more appealing to consumers in certain markets.Our aim has been to test whether ground crayfish shells, which are a rich and natural source of astaxanthin, produce detectable changes in the coloration of egg yolks through the accumulation of this carotenoid. Laying hens were fed with a commercial feed mixed with crayfish powder and the carotenoid profiles of the yolks in the eggs laid during the trial were monitored by HPLC. The analyses showed a progressive increase in the astaxanthin concentration in the egg yolks, reaching similar levels to those obtained for the rest of present carotenoid pigments.La yema de huevo de gallina debe su coloración a la presencia de carotenoides de tonalidad amarilla. La adición de colorantes sintéticos de tonalidades rojas permite modificar e incrementar la coloración de la yema desde el amarillo original a tonos rojos que pueden ser demandados en ciertos mercados según las preferencias del consumidor. El objetivo del trabajo fue probar si un triturado obtenido a partir de caparazones de cangrejo, que es una fuente natural y rica en astaxanteno, produce cambios detectables en la coloración de la yema de huevo por la acumulación de dicho carotenoide. Las gallinas ponedoras se alimentaron con un pienso comercial al que se adicionó triturado de caparazón de cangrejo. Se realizó un seguimiento de los cambios en la composición carotenoide (mediante HPLC de la yema de los huevos puestos durante el periodo de alimentación suplementada. Los análisis mostraron una progresiva incorporación de astaxanteno que alcanzó niveles similares al resto de carotenoides presentes inicialmente en la yema.

Sobre la ecología de Brycon siebenthalae y Mylossoma duriventris (Piscis: Characidae, en el río Cafre, Orinoquia

Directory of Open Access Journals (Sweden)

Useche L. Carlos

1993-12-01

Full Text Available The ecology of the characids Bryeon siebenthalaey Mylossoma duriventriswas studied in the lower part of the río Cafre, a tributary of was studied the río Guayabero in the upper part of the río Guaviare system in Colombia. These lishes spawn in the early rainy season; theír diet consist mainly 01 Iruits, seeds, flowers and bark.En este trabajo se reportan nuevos aspectos sobre la biología de Bryeon siebenthalae (yamú y de Mylossoma duriventris (palometa. La reproducción de especies está altamente relacionada con la estacionalidad hídrica (lluvias-sequías la palometa desova tan pronto comienzan las lluvias a finales de abril, con un promedio de 125.000 huevos; el yamú desova aproximadamente 231.000 huevos, dos a tres semanas más tarde, mediados de mayo. El alto número de huevos implica que el desove debe efectuarse en niveles de aguas que faciliten su dispersión. Las dos especies comparten los hábitat (cursos del río, planos inundables. Es característico del yamú su mayor desplazamiento al remontar grandes corrientes y raudales, en el desarrollo de su comportamiento migratorio de tipo longitudinal, a diferencia de la palometa cuyos movimientos son preleriblemente de tipo local y lateral a la corriente. En ambas especies predomina un hábito alimenticio macroherbívoro, correspondiente a frutos, semillas, hojas. flores y cortezas: para el yamú en un 93% y para la palometa en 99%.

CONTROL DE FASCIOLA HEPATICA EN EL AGUA DE CONSUMO ANIMAL A TRAVÉS DE FILTRACIÓN RÁPIDA Y LENTA

Directory of Open Access Journals (Sweden)

Carolina González Morales

Full Text Available La fasciolosis bovina es una zoonosis causada por Fasciola hepatica, parásito que se adquiere al consumir agua o vegetales contaminados con el digeneo. Esta enfermedad ocasiona pérdidas económicas importantes en las regiones lecheras de Antioquia. En este trabajo, y con el objetivo de remover los huevos del parásito presentes en el agua, se diseñaron y construyeron dos filtros empleando como lecho filtrante arena industrial (T.E entre 0,45 y 0,55 mm, con los cuales se evaluó un sistema de filtración rápida operado a velocidades de 5 y 8 m/h (altura del lecho 60 cm y un sistema de filtración lenta a una velocidad de 1,46 m/h (alturas del lecho 30 y 40 cm. Se determinó la variación del caudal y la turbiedad del efluente durante la carrera de filtración y la eficiencia de remoción de los huevos del parásito. Los filtros operando bajo las características descritas, fueron 100% eficientes para remover los huevos de F. hepatica presentes en el agua. Los porcentajes de remoción de turbiedad fueron del 85,5 y 79,4% para filtros trabajando a velocidades de 5 m/h y 8 m/h, respectivamente. Los ensayos realizados para ambas alturas del lecho filtrante (30 y 40 cm operando con la velocidad de 1,46 m/h, mostraron una remoción promedio de turbiedad del 80,4 y 76,6%, respectivamente.

3G vector-primer plasmid for constructing full-length-enriched cDNA libraries.

Science.gov (United States)

Zheng, Dong; Zhou, Yanna; Zhang, Zidong; Li, Zaiyu; Liu, Xuedong

2008-09-01

We designed a 3G vector-primer plasmid for the generation of full-length-enriched complementary DNA (cDNA) libraries. By employing the terminal transferase activity of reverse transcriptase and the modified strand replacement method, this plasmid (assembled with a polydT end and a deoxyguanosine [dG] end) combines priming full-length cDNA strand synthesis and directional cDNA cloning. As a result, the number of steps involved in cDNA library preparation is decreased while simplifying downstream gene manipulation, sequencing, and subcloning. The 3G vector-primer plasmid method yields fully represented plasmid primed libraries that are equivalent to those made by the SMART (switching mechanism at 5' end of RNA transcript) approach.

High-throughput sequencing of 16S rRNA gene amplicons: effects of extraction procedure, primer length and annealing temperature.

Science.gov (United States)

Sergeant, Martin J; Constantinidou, Chrystala; Cogan, Tristan; Penn, Charles W; Pallen, Mark J

2012-01-01

The analysis of 16S-rDNA sequences to assess the bacterial community composition of a sample is a widely used technique that has increased with the advent of high throughput sequencing. Although considerable effort has been devoted to identifying the most informative region of the 16S gene and the optimal informatics procedures to process the data, little attention has been paid to the PCR step, in particular annealing temperature and primer length. To address this, amplicons derived from 16S-rDNA were generated from chicken caecal content DNA using different annealing temperatures, primers and different DNA extraction procedures. The amplicons were pyrosequenced to determine the optimal protocols for capture of maximum bacterial diversity from a chicken caecal sample. Even at very low annealing temperatures there was little effect on the community structure, although the abundance of some OTUs such as Bifidobacterium increased. Using shorter primers did not reveal any novel OTUs but did change the community profile obtained. Mechanical disruption of the sample by bead beating had a significant effect on the results obtained, as did repeated freezing and thawing. In conclusion, existing primers and standard annealing temperatures captured as much diversity as lower annealing temperatures and shorter primers.

A Web-Based Adaptive Tutor to Teach PCR Primer Design

Science.gov (United States)

van Seters, Janneke R.; Wellink, Joan; Tramper, Johannes; Goedhart, Martin J.; Ossevoort, Miriam A.

2012-01-01

When students have varying prior knowledge, personalized instruction is desirable. One way to personalize instruction is by using adaptive e-learning to offer training of varying complexity. In this study, we developed a web-based adaptive tutor to teach PCR primer design: the PCR Tutor. We used part of the Taxonomy of Educational Objectives (the…

A primer on physical-layer network coding

CERN Document Server

Liew, Soung Chang; Zhang, Shengli

2015-01-01

The concept of physical-layer network coding (PNC) was proposed in 2006 for application in wireless networks. Since then it has developed into a subfield of communications and networking with a wide following. This book is a primer on PNC. It is the outcome of a set of lecture notes for a course for beginning graduate students at The Chinese University of Hong Kong. The target audience is expected to have some prior background knowledge in communication theory and wireless communications, but not working knowledge at the research level. Indeed, a goal of this book/course is to allow the reader

454-Pyrosequencing Analysis of Bacterial Communities from Autotrophic Nitrogen Removal Bioreactors Utilizing Universal Primers: Effect of Annealing Temperature

Directory of Open Access Journals (Sweden)

Alejandro Gonzalez-Martinez

2015-01-01

Full Text Available Identification of anaerobic ammonium oxidizing (anammox bacteria by molecular tools aimed at the evaluation of bacterial diversity in autotrophic nitrogen removal systems is limited by the difficulty to design universal primers for the Bacteria domain able to amplify the anammox 16S rRNA genes. A metagenomic analysis (pyrosequencing of total bacterial diversity including anammox population in five autotrophic nitrogen removal technologies, two bench-scale models (MBR and Low Temperature CANON and three full-scale bioreactors (anammox, CANON, and DEMON, was successfully carried out by optimization of primer selection and PCR conditions (annealing temperature. The universal primer 530F was identified as the best candidate for total bacteria and anammox bacteria diversity coverage. Salt-adjusted optimum annealing temperature of primer 530F was calculated (47°C and hence a range of annealing temperatures of 44–49°C was tested. Pyrosequencing data showed that annealing temperature of 45°C yielded the best results in terms of species richness and diversity for all bioreactors analyzed.

Great Lakes rivermouths: a primer for managers

Science.gov (United States)

Pebbles, Victoria; Larson, James; Seelbach, Paul; Pebbles, Victoria; Larson, James; Seelbach, Paul

2013-01-01

Between the North American Great Lakes and their tributaries are the places where the confluence of river and lake waters creates a distinct ecosystem: the rivermouth ecosystem. Human development has often centered around these rivermouths, in part, because they provide a rich array of ecosystem services. Not surprisingly, centuries of intense human activity have led to substantial pressures on, and alterations to, these ecosystems, often diminishing or degrading their ecological functions and associated ecological services. Many Great Lakes rivermouths are the focus of intense restoration efforts. For example, 36 of the active Great Lakes Areas of Concern (AOCs) are rivermouths or areas that include one or more rivermouths. Historically, research of rivermouth ecosystems has been piecemeal, focused on the Great Lakes proper or on the upper reaches of tributaries, with little direct study of the rivermouth itself. Researchers have been divided among disciplines, agencies and institutions; and they often work independently and use disparate venues to communicate their work. Management has also been fragmented with a focus on smaller, localized, sub-habitat units and socio-political or economic elements, rather than system-level consideration. This Primer presents the case for a more holistic approach to rivermouth science and management that can enable restoration of ecosystem services with multiple benefits to humans and the Great Lakes ecosystem. A conceptual model is presented with supporting text that describes the structures and processes common to all rivermouths, substantiating the case for treating these ecosystems as an identifiable class.1 Ecological services provided by rivermouths and changes in how humans value those services over time are illustrated through case studies of two Great Lakes rivermouths—the St. Louis River and the Maumee River. Specific ecosystem services are identified in italics throughout this Primer and follow definitions described

Schrodinger's scat: a critical review of the currently available tiger (Panthera Tigris) and leopard (Panthera pardus) specific primers in India, and a novel leopard specific primer.

Science.gov (United States)

Maroju, Pranay Amruth; Yadav, Sonu; Kolipakam, Vishnupriya; Singh, Shweta; Qureshi, Qamar; Jhala, Yadvendradev

2016-02-09

Non-invasive sampling has opened avenues for the genetic study of elusive species, which has contributed significantly to their conservation. Where field based identity of non-invasive sample is ambiguous (e.g. carnivore scats), it is essential to establish identity of the species through molecular approaches. A cost effective procedure to ascertain species identity is to use species specific primers (SSP) for PCR amplification and subsequent resolution through agarose gel electrophoresis. However, SSPs if ill designed can often cross amplify non-target sympatric species. Herein we report the problem of cross amplification with currently published SSPs, which have been used in several recent scientific articles on tigers (Panthera tigris) and leopards (Panthera pardus) in India. Since these papers form pioneering research on which future work will be based, an early rectification is required so as to not propagate this error further. We conclusively show cross amplification of three of the four SSPs, in sympatric non-target species like tiger SSP amplifying leopard and striped hyena (Hyaena hyaena), and leopard SSP amplifying tiger, lion (Panthera leo persica) and clouded leopard (Neofelis nebulosa), with the same product size. We develop and test a non-cross-amplifying leopard specific primer pair within the mitochondrial cytochrome b region. We also standardize a duplex PCR method to screen tiger and leopard samples simultaneously in one PCR reaction to reduce cost and time. These findings suggest the importance of an often overlooked preliminary protocol of conclusive identification of species from non-invasive samples. The cross amplification of published primers in conspecifics suggests the need to revisit inferences drawn by earlier work.

El menor infractor que comete su primer delito

Directory of Open Access Journals (Sweden)

Antonia Luzón García

2014-10-01

Full Text Available Existe un consenso social y la sociedad se posiciona al lado del menor maltratado, la cosa cambia cuando el menor es infractor, entonces es declarado culpable y merecedor de castigo. El menor aun siendo infractor es un ser humano con pleno derechos establecidos en la Declaración de Derechos del Niño y en los textos internacionales sobre Derechos Humanos. Mediante la socialización se estrechan los vínculos entre el individuo y el sistema social en el que vive. Por ello, la socialización y sus implicaciones son de nuestro interés para este estudio y conocer qué lleva a un menor a cometer su primer delito. Una correcta socialización, de asunción de normas y valores sociales, pautas, creencias, ritos, etc., posibilita la adaptación y previene de la exclusión social. La combinación de la influencia que ha ejercido los agentes de socialización en el menor y los factores de riesgo como el clima familiar, la adaptación escolar, los rasgos de personalidad y el grupo de iguales nos va a permitir pronosticar la probabilidad de que el menor lleve a cabo comportamientos infractores. En este estudio se intentará demostrar que la mayoría de menores que realizan infracciones penales carecen de un adecuado proceso de socialización con desestructuración familiar, inadaptación escolar y la influencia negativa del grupo de iguales que faciliten una socialización positiva y sana. Este proceso de socialización es importante si queremos comprender el comportamiento humano, entendido como la interiorización de normas y valores que han ido estructurando la personalidad del niño, su manera de pensar, de actuar, en resumidas cuentas su desarrollo mental y social

Clonorchis sinensis

OpenAIRE

Guillén O., Alfredo; Clínica San Borja, Lima, Perú. Facultad de Tecnología Médica, universidad Nacional Federico Villarreal, Lima, Perú.; Delgado V., María; Clínica San Borja, Lima, Perú.; Morales C., Antonio; Clínica San Borja, Lima, Perú.

2004-01-01

Se presenta el caso de una paciente de origen asiático con un año de permanencia en el Perú, que acude a una clínica limeña por presentar diarrea acuosa, al realizar los análisis respectivos se encuentran huevos de Clonorchis sinensis. A case of an Asian patient living in Peru for one year, who presented to a Lima clinic with aqueous diarrhea. When laboratory studies were performed, Clonorchis sinensis ova in stools were found.

Incapacidades laborales: problemas en la reinserción al trabajo

Directory of Open Access Journals (Sweden)

Sampaio Rosana F.

1999-01-01

Full Text Available En este estudio transversal se evalúan los factores asociados con la probabilidad de reincorporación al trabajo de los trabajadores incapacitados permanentes para la profesión habitual por accidente de trabajo. La muestra la forman los casos atendidos por el Centro de Rehabilitación Profesional (CRP de Belo Horizonte, Brasil, en 1995. Se analiza el hecho del trabajador ser aceptado o no en el programa, así como la posterior reinserción laboral mediante modelos logit. Respecto al primer, los factores más influyentes fueron la edad, la presencia de Lesiones por Esfuerzo Repetitivo (LER y el nivel de estudios. Analizado el resultado del programa, se observa que los hombres jóvenes de alta escolarización son los que tienen mayor probabilidad de reinserción laboral (90,9%. Existe una incongruencia respecto a la admisión de los trabajadores y el resultado del programa: para su admisión, el trabajador debe cumplir un perfil exigido por el mercado en lo que se refiere a la edad y al nivel de estudios; los portadores de LER cumplen estos criterios y, sin embargo, son los que con mayor dificultad se reincorporan al trabajo. Se observa, así mismo, una discriminación laboral clara hacia las mujeres, a pesar del hecho que las mismas presentan iguales condiciones de edad o de nivel educativo que los hombres.

Incapacidades laborales: problemas en la reinserción al trabajo

Directory of Open Access Journals (Sweden)

Rosana F. Sampaio

1999-10-01

Full Text Available En este estudio transversal se evalúan los factores asociados con la probabilidad de reincorporación al trabajo de los trabajadores incapacitados permanentes para la profesión habitual por accidente de trabajo. La muestra la forman los casos atendidos por el Centro de Rehabilitación Profesional (CRP de Belo Horizonte, Brasil, en 1995. Se analiza el hecho del trabajador ser aceptado o no en el programa, así como la posterior reinserción laboral mediante modelos logit. Respecto al primer, los factores más influyentes fueron la edad, la presencia de Lesiones por Esfuerzo Repetitivo (LER y el nivel de estudios. Analizado el resultado del programa, se observa que los hombres jóvenes de alta escolarización son los que tienen mayor probabilidad de reinserción laboral (90,9%. Existe una incongruencia respecto a la admisión de los trabajadores y el resultado del programa: para su admisión, el trabajador debe cumplir un perfil exigido por el mercado en lo que se refiere a la edad y al nivel de estudios; los portadores de LER cumplen estos criterios y, sin embargo, son los que con mayor dificultad se reincorporan al trabajo. Se observa, así mismo, una discriminación laboral clara hacia las mujeres, a pesar del hecho que las mismas presentan iguales condiciones de edad o de nivel educativo que los hombres.

Incidencia del curso de Pre-cálculo en el desempeño en Cálculo I para estudiantes de primer ingreso de la Universidad Tecnológica de Panamá

OpenAIRE

Miller, Norma; Hernández, Alejandro

2011-01-01

La deficiente preparación matemática de los estudiantes que ingresan a la Universidad Tecnológica de Panamá es uno de los factores que contribuyen al alto porcentaje de estudiantes desaprobados en Cálculo I. A lo largo de los años la Universidad se ha enfrentado a este problema implementando diferentes modalidades de cursos preparatorios. En el verano del 2009 se ofreció por primera vez un curso de Pre-cálculo como nueva alternativa para preparar a los estudiantes de primer ingreso para cálcu...

Human immunodeficiency virus uses tRNA(Lys,3) as primer for reverse transcription in HeLa-CD4+ cells

NARCIS (Netherlands)

Das, A. T.; Koken, S. E.; Essink, B. B.; van Wamel, J. L.; Berkhout, B.

1994-01-01

Significant amounts of different tRNA molecules are present in retroviral particles, but one specific tRNA species functions as primer in reverse transcription. It is generally believed that the HIV-1 virus uses the tRNA(Lys,3) molecule as primer. This is based on sequence complementarity between

Routes to effective evacuation planning primer series : evacuating populations with special needs.

Science.gov (United States)

2009-04-01

Evacuation operations are conducted under the authority of, and based on decisions by, local and state authorities. The purpose of this primer, Evacuating Populations with Special Needs, is to provide local and state emergency managers, government of...

An improved primer set and amplification protocol with increased specificity and sensitivity targeting the Symbiodinium ITS2 region

KAUST Repository

Hume, Benjamin C.C.; Ziegler, Maren; Poulain, Julie; Pochon, Xavier; Romac, Sarah; Boissin, Emilie; de Vargas, Colomban; Planes, Serge; Wincker, Patrick; Voolstra, Christian R.

2018-01-01

The Internal Transcribed Spacer 2 (ITS2) rRNA gene is a commonly targeted genetic marker to assess diversity of Symbiodinium, a dinoflagellate genus of algal endosymbionts that is pervasively associated with marine invertebrates, and notably reef-building corals. Here we tested three commonly used ITS2 primer pairs (SYM_VAR_5.8S2/SYM_VAR_REV, ITSintfor2/ITSReverse, and ITS-DINO/ITS2Rev2) with regard to amplification specificity and sensitivity towards Symbiodinium, as well as sub-genera taxonomic bias. We tested these primers over a range of sample types including three coral species, coral surrounding water, reef surface water, and open ocean water to assess their suitability for use in large-scale next generation sequencing projects and to develop a standardised PCR protocol. We found the SYM_VAR_5.8S2/SYM_VAR_REV primers to perform superior to the other tested ITS2 primers. We therefore used this primer pair to develop a standardised PCR protocol. To do this, we tested the effect of PCR-to-PCR variation, annealing temperature, cycle number, and different polymerase systems on the PCR efficacy. The Symbiodinium ITS2 PCR protocol developed here delivers improved specificity and sensitivity towards Symbiodinium with apparent minimal sub-genera taxonomic bias across all sample types. In particular, the protocol’s ability to amplify Symbiodinium from a range of environmental sources will facilitate the study of Symbiodinium populations across biomes.

An improved primer set and amplification protocol with increased specificity and sensitivity targeting the Symbiodinium ITS2 region

KAUST Repository

Hume, Benjamin C.C.

2018-05-23

The Internal Transcribed Spacer 2 (ITS2) rRNA gene is a commonly targeted genetic marker to assess diversity of Symbiodinium, a dinoflagellate genus of algal endosymbionts that is pervasively associated with marine invertebrates, and notably reef-building corals. Here we tested three commonly used ITS2 primer pairs (SYM_VAR_5.8S2/SYM_VAR_REV, ITSintfor2/ITSReverse, and ITS-DINO/ITS2Rev2) with regard to amplification specificity and sensitivity towards Symbiodinium, as well as sub-genera taxonomic bias. We tested these primers over a range of sample types including three coral species, coral surrounding water, reef surface water, and open ocean water to assess their suitability for use in large-scale next generation sequencing projects and to develop a standardised PCR protocol. We found the SYM_VAR_5.8S2/SYM_VAR_REV primers to perform superior to the other tested ITS2 primers. We therefore used this primer pair to develop a standardised PCR protocol. To do this, we tested the effect of PCR-to-PCR variation, annealing temperature, cycle number, and different polymerase systems on the PCR efficacy. The Symbiodinium ITS2 PCR protocol developed here delivers improved specificity and sensitivity towards Symbiodinium with apparent minimal sub-genera taxonomic bias across all sample types. In particular, the protocol’s ability to amplify Symbiodinium from a range of environmental sources will facilitate the study of Symbiodinium populations across biomes.