WorldWideScience

Sample records for adjacent rrna nucleotide

  1. The aminoglycoside resistance methyltransferase Sgm impedes RsmF methylation at an adjacent rRNA nucleotide in the ribosomal A site

    Cubrilo, Sonja; Babić, Fedora; Douthwaite, Stephen;

    2009-01-01

    methylated nucleotides including m(4)Cm1402 and m(5)C1407. Modification at m(5)C1407 by the methyltransferase RsmF is impeded as Sgm gains access to its adjacent G1405 target on the 30S ribosomal subunit. An Sgm mutant (G135A), which is impaired in S-adenosylmethionine binding and confers lower resistance......Ribosome-targeting antibiotics block protein synthesis by binding at functionally important regions of the bacterial rRNA. Resistance is often conferred by addition of a methyl group at the antibiotic binding site within an rRNA region that is already highly modified with several nucleotide...... methylations. In bacterial rRNA, each methylation requires its own specific methyltransferase enzyme, and this raises the question as to how an extra methyltransferase conferring antibiotic resistance can be accommodated and how it can gain access to its nucleotide target within a short and functionally...

  2. The nucleotide sequence of 5S rRNA from Mycoplasma capricolum.

    Hori, H; Sawada, M.; Osawa, S; Murao, K; Ishikura, H

    1981-01-01

    The nucleotide sequence of 5S rRNA from Mycoplasma capricolum is UUGGUGGUAUAGCAUAGAGGUCACACCUGUUCCCAUGCCGAACACAGAAGUUAAGCUCUAUUACGGUGAAGAUAUUACU GAUGUGAGAAAAUAGCAAGCUGCCAGUUOH. The length is 107 nucleotides long, and the shortest in all the 5S rRNAs so far known. The sequence is more similar to those of the gram-positive bacteria than those of the gram-negative bacteria.

  3. New bioinformatic tools for analysis of nucleotide modifications in eukaryotic rRNA

    Piekna-Przybylska, Dorota; Decatur, Wayne A.; Fournier, Maurille J.

    2007-01-01

    This report presents a valuable new bioinformatics package for research on rRNA nucleotide modifications in the ribosome, especially those created by small nucleolar RNA:protein complexes (snoRNPs). The interactive service, which is not available elsewhere, enables a user to visualize the positions of pseudouridines, 2′-O-methylations, and base methylations in three-dimensional space in the ribosome and also in linear and secondary structure formats of ribosomal RNA. Our tools provide additio...

  4. YccW is the m5C methyltransferase specific for 23S rRNA nucleotide 1962

    Purta, Elzbieta; O'Connor, Michelle; Bujnicki, Janusz M;

    2008-01-01

    . However, YccW does not methylate assembled 50S subunits, and this is somewhat surprising as the published crystal structures show nucleotide C1962 to be fully accessible at the subunit interface. YccW-directed methylation at nucleotide C1962 is conserved in bacteria, and loss of this methylation in E....... coli marginally reduces its growth rate. YccW had previously eluded identification because it displays only limited sequence similarity to the m(5)C methyltransferases RsmB and RsmF and is in fact more similar to known m(5)U (5-methyluridine) RNA methyltransferases. In keeping with the previously...... proposed nomenclature system for bacterial rRNA methyltransferases, yccW is now designated as the rRNA large subunit methyltransferase gene rlmI....

  5. The conformation of 23S rRNA nucleotide A2058 determines its recognition by the ErmE methyltransferase

    Vester, B; Hansen, L H; Douthwaite, S

    1995-01-01

    it was shown that the A2057 and U2611 mutations alone and in combination alter the reactivity of A2058 and adjacent bases. However, mutagenizing position G-->A2032 in an adjacent loop, which has been implicated to interact with A2058, alters neither the ErmE methylation at A2058 nor the accessibility...... effects of mutations around position A2058 on methylation. Mutagenizing A2058 (to G or U) completely abolishes methylation of 23S rRNA by ErmE. No methylation occurred at other sites in the rRNA, demonstrating the fidelity of ErmE for A2058. Breaking the neighboring G2057-C2611 Watson-Crick base pair by...... introducing either an A2057 or a U2611 mutation, greatly reduces the rate of methylation at A2058. Methylation remains impaired after these mutations have been combined to create a new A2057-U2611 Watson-Crick base interaction. The conformation of this region in 23S rRNA was probed with chemical reagents and...

  6. YgdE is the 2'-O-ribose methyltransferase RlmM specific for nucleotide C2498 in bacterial 23S rRNA

    Purta, Elzbieta; O'Connor, Michelle; Bujnicki, Janusz M;

    2009-01-01

    The rRNAs of Escherichia coli contain four 2'-O-methylated nucleotides. Similar to other bacterial species and in contrast with Archaea and Eukaryota, the E. coli rRNA modifications are catalysed by specific methyltransferases that find their nucleotide targets without being guided by small...... ribosomes. Nucleotide C2498 is situated within a highly conserved and heavily modified rRNA sequence, and YgdE's activity is influenced by other modification enzymes that target this region. Phylogenetically, YgdE is placed in the cluster of orthologous groups COG2933 together with S...... complementary RNAs. We show here that the ygdE gene encodes the methyltransferase that catalyses 2'-O-methylation at nucleotide C2498 in the peptidyl transferase loop of E. coli 23S rRNA. Analyses of rRNAs using MALDI mass spectrometry showed that inactivation of the ygdE gene leads to loss of methylation at...

  7. Methanosarcina acetivorans 16S rRNA and transcription factor nucleotide fluctuation with implications in exobiology and pathology

    Holden, Todd; Tremberger, G., Jr.; Cheung, E.; Subramaniam, R.; Sullivan, R.; Schneider, P.; Flamholz, A.; Marchese, P.; Hiciano, O.; Yao, H.; Lieberman, D.; Cheung, T.

    2008-08-01

    Cultures of the methane-producing archaea Methanosarcina, have recently been isolated from Alaskan sediments. It has been proposed that methanogens are strong candidates for exobiological life in extreme conditions. The spatial environmental gradients, such as those associated with the polygons on Mars' surface, could have been produced by past methanogenesis activity. The 16S rRNA gene has been used routinely to classify phenotypes. Using the fractal dimension of nucleotide fluctuation, a comparative study of the 16S rRNA nucleotide fluctuation in Methanosarcina acetivorans C2A, Deinococcus radiodurans, and E. coli was conducted. The results suggest that Methanosarcina acetivorans has the lowest fractal dimension, consistent with its ancestral position in evolution. Variation in fluctuation complexity was also detected in the transcription factors. The transcription factor B (TFB) was found to have a higher fractal dimension as compared to transcription factor E (TFE), consistent with the fact that a single TFB in Methanosarcina acetivorans can code three different TATA box proteins. The average nucleotide pair-wise free energy of the DNA repair genes was found to be highest for Methanosarcina acetivorans, suggesting a relatively weak bonding, which is consistent with its low prevalence in pathology. Multitasking capacity comparison of type-I and type-II topoisomerases has been shown to correlate with fractal dimension using the methicillin-resistant strain MRSA 252. The analysis suggests that gene adaptation in a changing chemical environment can be measured in terms of bioinformatics. Given that the radiation resistant Deinococcus radiodurans is a strong candidate for an extraterrestrial origin and that the cold temperature Psychrobacter cryohalolentis K5 can function in Siberian permafrost, the fractal dimension comparison in this study suggests that a chemical resistant methanogen could exist in extremely cold conditions (such as that which existed on early

  8. 23S rRNA nucleotides in the peptidyl transferase center are essential for tryptophanase operon induction.

    Yang, Rui; Cruz-Vera, Luis R; Yanofsky, Charles

    2009-06-01

    Distinct features of the ribosomal peptide exit tunnel are known to be essential for recognition of specific amino acids of a nascent peptidyl-tRNA. Thus, a tryptophan residue at position 12 of the peptidyl-tRNA TnaC-tRNA(Pro) leads to the creation of a free tryptophan binding site within the ribosome at which bound tryptophan inhibits normal ribosome functions. The ribosomal processes that are inhibited are hydrolysis of TnaC-tRNA(Pro) by release factor 2 and peptidyl transfer of TnaC of TnaC-tRNA(Pro) to puromycin. These events are normally performed in the ribosomal peptidyl transferase center. In the present study, changes of 23S rRNA nucleotides in the 2585 region of the peptidyl transferase center, G2583A and U2584C, were observed to reduce maximum induction of tna operon expression by tryptophan in vivo without affecting the concentration of tryptophan necessary to obtain 50% induction. The growth rate of strains with ribosomes with either of these changes was not altered appreciably. In vitro analyses with mutant ribosomes with these changes showed that tryptophan was not as efficient in protecting TnaC-tRNA(Pro) from puromycin action as wild-type ribosomes. However, added tryptophan did prevent sparsomycin action as it normally does with wild-type ribosomes. These findings suggest that these two mutational changes act by reducing the ability of ribosome-bound tryptophan to inhibit peptidyl transferase activity rather than by reducing the ability of the ribosome to bind tryptophan. Thus, the present study identifies specific nucleotides within the ribosomal peptidyl transferase center that appear to be essential for effective tryptophan induction of tna operon expression. PMID:19329641

  9. Update on Pneumocystis carinii f. sp. hominis typing based on nucleotide sequence variations in internal transcribed spacer regions of rRNA genes

    Lee, C H; Helweg-Larsen, J; Tang, X; Jin, S; Li, B; Bartlett, M S; Lu, Jingquan; Lundgren, B; Lundgren, J D; Olsson, M; Lucas, Sandra; Roux, P; Cargnel, A; Atzori, C; Matos, O; Smith, J W

    1998-01-01

    Pneumocystis carinii f. sp. hominis isolates from 207 clinical specimens from nine countries were typed based on nucleotide sequence variations in the internal transcribed spacer regions I and II (ITS1 and ITS2, respectively) of rRNA genes. The number of ITS1 nucleotides has been revised from the...... previously reported 157 bp to 161 bp. Likewise, the number of ITS2 nucleotides has been changed from 177 to 192 bp. The number of ITS1 sequence types has increased from 2 to 15, and that of ITS2 has increased from 3 to 14. The 15 ITS1 sequence types are designated types A through O, and the 14 ITS2 types are...... named types a through n. A total of 59 types of P. carinii f. sp. hominis were found in this study....

  10. Development of polymerase chain reaction primer sets for diagnosis of Lyme disease and for species-specific identification of Lyme disease isolates by 16S rRNA signature nucleotide analysis.

    1992-01-01

    We have determined and compared partial 16S rRNA sequences from 23 Lyme disease spirochete isolates and aligned these with 8 sequences previously presented. The 16S rRNA signature nucleotide compositions were defined for each isolate and compared with the genomic species signature nucleotide sets previously established. To identify positions truly indicative of species classification which could serve as targets for polymerase chain reaction species-specific identification primers, 16S rRNA-b...

  11. Mapping important nucleotides in the peptidyl transferase centre of 23 S rRNA using a random mutagenesis approach

    Porse, B T; Garrett, R A

    1995-01-01

    Random mutations were generated in the lower half of the peptidyl transferase loop in domain V of 23 S rRNA from Escherichia coli using a polymerase chain reaction (PCR) approach, a rapid procedure for identifying mutants and a plasmid-based expression system. The effects of 21 single......-site mutations, at 18 different positions, on cell growth, mutant rRNA incorporation into ribosomes and peptidyl transferase activity of the mutant ribosomes were analysed. The general importance of the whole region for the peptidyl transferase centre was emphasized by the finding that 14 of the mutants were...... sick, or very sick, when ribosomes containing chromosomal-encoded 23 S rRNA were inhibited by erythromycin, and all except one of these exhibited low levels of peptidyl transferase activity in their mutated ribosomes. Two mutations, psi 2580-->C and U2584-->G that both yielded inactive ribosomes were...

  12. Single Nucleotide Polymorphism of SSU rRNA Gene among ‎Plasmodium Knowlesi Isolates of Sabah

    Fread Anderios; Daw Khin Saw Naing; Zaw Lin

    2012-01-01

    ackground: ‎The advent of PCR (Polymerase Chain Reaction) assays helped in correctly identifying ‎Plasmodium knowlesi, which was previously misdiagnosed by microscopy as Plasmodium ‎malarie in Sabah, Malaysia. The PCR-based diagnosis of P. knowlesi in Sabah is currently using a ‎set of oligonucleotide primers namely Pmk8 and Pmk9 that target one of the parasite’s small ‎subunit rRNA (SSU rRNA) genes. PCR also helped in discovering a variant form of P. malariae ‎which has a deletion of 19 bp ...

  13. YbeA is the m3Psi methyltransferase RlmH that targets nucleotide 1915 in 23S rRNA

    Purta, Elzbieta; Kaminska, Katarzyna H; Kasprzak, Joanna M;

    2008-01-01

    Pseudouridines in the stable RNAs of Bacteria are seldom subjected to further modification. There are 11 pseudouridine (Psi) sites in Escherichia coli rRNA, and further modification is found only at Psi1915 in 23S rRNA, where the N-3 position of the base becomes methylated. Here, we report the...... identity of the E. coli methyltransferase that specifically catalyzes methyl group addition to form m(3)Psi1915. Analyses of E. coli rRNAs using MALDI mass spectrometry showed that inactivation of the ybeA gene leads to loss of methylation at nucleotide Psi1915. Methylation is restored by complementing the...... knockout strain with a plasmid-encoded copy of ybeA. Homologs of the ybeA gene, and thus presumably the ensuing methylation at nucleotide m(3)Psi1915, are present in most bacterial lineages but are essentially absent in the Archaea and Eukaryota. Loss of ybeA function in E. coli causes a slight slowing of...

  14. Targeting single-nucleotide polymorphisms in the 16S rRNA gene to detect and differentiate Legionella pneumophila and non-Legionella pneumophila species.

    Zhan, Xiao-Yong; Hu, Chao-Hui; Zhu, Qing-Yi

    2016-08-01

    A PCR-based method targeting single-nucleotide polymorphisms (SNPs) in the 16S rRNA gene was developed for differential identification of Legionella pneumophila and non-Legionella pneumophila. Based on the bioinformatics analysis for 176 Legionella 16S rRNA gene fragments of 56 different Legionella species, a set of SNPs, A(628)C(629) was found to be highly specific to L. pneumophila strains. A multiplex assay was designed that was able to distinguish sites with limited sequence heterogeneity between L. pneumophila and non-L. pneumophila in the targeted 16S rRNA gene. The assay amplified a 261-bp amplicon for Legionella spp. and a set of 203- and 97-bp amplicons only specific to L. pneumophila species. Among 49 ATCC strains and 284 Legionella isolates from environmental water and clinical samples, 100 % of L. pneumophila and non-L. pneumophila strains were correctly identified and differentiated by this assay. The assay presents a more rapid, sensitive and alternative method to the currently available PCR-sequencing detection and differentiation method. PMID:27112927

  15. Identification of 5-hydroxycytidine at position 2501 concludes characterization of modified nucleotides in E. coli 23S rRNA

    Havelund, Jesper Foged; Giessing, Anders Michael Bernth; Hansen, Trine Møller;

    2011-01-01

    modification as 5-hydroxycytidine-a novel modification in RNA. Identification of 5-hydroxycytidine was completed by liquid chromatography under nonoxidizing conditions using a graphitized carbon stationary phase in combination with ion trap tandem mass spectrometry and by comparing the fragmentation behavior...... rRNA-has previously been characterized in the bacterium Escherichia coli. Despite a first report nearly 20 years ago, the chemical nature of the modification at position 2501 has remained elusive, and attempts to isolate it have so far been unsuccessful. We unambiguously identify this last unknown...... of the natural nucleoside with that of a chemically synthesized ditto. Furthermore, we show that 5-hydroxycytidine is also present in the equivalent position of 23S rRNA from the bacterium Deinococcus radiodurans. Given the unstable nature of 5-hydroxycytidine, this modification might be found in...

  16. Bimodal agonism: a new desensitization in a cyclic nucleotide-gated channel is coordinated by two adjacent binding domains

    Chan, Kerry (Siu Cheong)

    2008-01-01

    Cyclic nucleotide-gated (CNG) channels are activated by direct binding of cyclic nucleotide (CN) to the binding domain (BD). How CN binding is coupled to channel opening remains unresolved. Bimodal agonism is found in the catfish olfactory CNGA2 subtype when cGMP is the agonist: initial cGMP binding events activate the channel while additional cGMP binding events deactivate the channel. The C-terminal region of the BD was previously shown to determine ligand selectivity and efficacy; therefor...

  17. Modified nucleotides m2G966/m5C967 of Escherichia coli 16S rRNA are required for attenuation of tryptophan operon

    Prokhorova, Irina V.; Osterman, Ilya A.; Burakovsky, Dmitry E.; Serebryakova, Marina V.; Galyamina, Maria A.; Pobeguts, Olga V.; Altukhov, Ilya; Kovalchuk, Sergey; Alexeev, Dmitry G.; Govorun, Vadim M.; Bogdanov, Alexey A.; Sergiev, Petr V.; Dontsova, Olga A

    2013-01-01

    Ribosomes contain a number of modifications in rRNA, the function of which is unclear. Here we show – using proteomic analysis and dual fluorescence reporter in vivo assays – that m2G966 and m5C967 in 16S rRNA of Escherichia coli ribosomes are necessary for correct attenuation of tryptophan (trp) operon. Expression of trp operon is upregulated in the strain where RsmD and RsmB methyltransferases were deleted, which results in the lack of m2G966 and m5C967 modifications. The upregulation requi...

  18. Negative in vitro selection identifies the rRNA recognition motif for ErmE methyltransferase

    Nielsen, A K; Douthwaite, S; Vester, B

    1999-01-01

    the adjacent single-stranded region around A2058. An RNA transcript of 72 nt that displays this motif functions as an efficient substrate for the ErmE methyltransferase. Pools of degenerate RNAs were formed by doping 34-nt positions that extend over and beyond the putative Erm recognition motif within...... contained substitutions at single sites, and these are confined to 12 nucleotide positions. These nucleotides, corresponding to A2051-A2060, C2611, and A2614 in 23S rRNA, presumably comprise the RNA recognition motif for ErmE methyltransferase. The structure formed by these nucleotides is highly conserved...

  19. Modified nucleotides m2G966/m5C967 of Escherichia coli 16S rRNA are required for attenuation of tryptophan operon

    Prokhorova, Irina V.; Osterman, Ilya A.; Burakovsky, Dmitry E.; Serebryakova, Marina V.; Galyamina, Maria A.; Pobeguts, Olga V.; Altukhov, Ilya; Kovalchuk, Sergey; Alexeev, Dmitry G.; Govorun, Vadim M.; Bogdanov, Alexey A.; Sergiev, Petr V.; Dontsova, Olga A.

    2013-11-01

    Ribosomes contain a number of modifications in rRNA, the function of which is unclear. Here we show - using proteomic analysis and dual fluorescence reporter in vivo assays - that m2G966 and m5C967 in 16S rRNA of Escherichia coli ribosomes are necessary for correct attenuation of tryptophan (trp) operon. Expression of trp operon is upregulated in the strain where RsmD and RsmB methyltransferases were deleted, which results in the lack of m2G966 and m5C967 modifications. The upregulation requires the trpL attenuator, but is independent of the promotor of trp operon, ribosome binding site of the trpE gene, which follows trp attenuator and even Trp codons in the trpL sequence. Suboptimal translation initiation efficiency in the rsmB/rsmD knockout strain is likely to cause a delay in translation relative to transcription which causes misregulation of attenuation control of trp operon.

  20. Modified nucleotides m(2)G966/m(5)C967 of Escherichia coli 16S rRNA are required for attenuation of tryptophan operon.

    Prokhorova, Irina V; Osterman, Ilya A; Burakovsky, Dmitry E; Serebryakova, Marina V; Galyamina, Maria A; Pobeguts, Olga V; Altukhov, Ilya; Kovalchuk, Sergey; Alexeev, Dmitry G; Govorun, Vadim M; Bogdanov, Alexey A; Sergiev, Petr V; Dontsova, Olga A

    2013-01-01

    Ribosomes contain a number of modifications in rRNA, the function of which is unclear. Here we show--using proteomic analysis and dual fluorescence reporter in vivo assays--that m(2)G966 and m(5)C967 in 16S rRNA of Escherichia coli ribosomes are necessary for correct attenuation of tryptophan (trp) operon. Expression of trp operon is upregulated in the strain where RsmD and RsmB methyltransferases were deleted, which results in the lack of m(2)G966 and m(5)C967 modifications. The upregulation requires the trpL attenuator, but is independent of the promotor of trp operon, ribosome binding site of the trpE gene, which follows trp attenuator and even Trp codons in the trpL sequence. Suboptimal translation initiation efficiency in the rsmB/rsmD knockout strain is likely to cause a delay in translation relative to transcription which causes misregulation of attenuation control of trp operon. PMID:24241179

  1. Ribosomal proteins L11 and L10.(L12)4 and the antibiotic thiostrepton interact with overlapping regions of the 23 S rRNA backbone in the ribosomal GTPase centre

    Rosendahl, G; Douthwaite, S

    1993-01-01

    23 S rRNA. Within the ribosome, L11 also interacts with this rRNA region, although the protection effects are subtly different and extend to nucleotide 1098. The pentameric r-protein complex L10.(L12)4 binds to an adjacent site on the rRNA, protecting riboses at positions 1043, 1046 to 1049, 1053 to...... by L10.(L12)4 and other proteins within the ribosome. The antibiotics thiostrepton and micrococcin inhibit the catalytic functions of this region by slotting in between the accessible loops and interacting with nucleotides there....

  2. Complementary Roles of Yeast Rad4p and Rad34p in Nucleotide Excision Repair of Active and Inactive rRNA Gene Chromatin▿

    Tremblay, Maxime; Teng, Yumin; Paquette, Michel; Waters, Raymond; Conconi, Antonio

    2008-01-01

    Nucleotide excision repair (NER) removes a plethora of DNA lesions. It is performed by a large multisubunit protein complex that finds and repairs damaged DNA in different chromatin contexts and nuclear domains. The nucleolus is the most transcriptionally active domain, and in yeast, transcription-coupled NER occurs in RNA polymerase I-transcribed genes (rDNA). Here we have analyzed the roles of two members of the xeroderma pigmentosum group C family of proteins, Rad4p and Rad34p, during NER ...

  3. Isolation and Characterization of Lactococcus garvieae from Diseased Rainbow Trout (Oncorhynchus mykiss, Walbaum Cultured in Northern Iran Based on the Nucleotide Sequences of the 16s rRNA Gene

    Milad ADEL

    2014-08-01

    Full Text Available This study was done to determine the molecular and biochemical identification of some causative agents of lactococcosis in farmed rainbow trout in Mazandaran provenience (northern Iran. A total of 200 moribund rainbow trout, suspected of lactococcosis from 10 rainbow trout farms in Mazandaran province, were collected during spring 2012 to winter 2012. Sampling was done from the kidney, spleen, liver and brain and cultured aseptically onto brain heart infusion (BHI agar plates and incubated at 25 °C for 24 - 48 h. Results of bacteriological cultures of these organs showed 19 % Lactococcus garvieae (38 fish, 9 % Streptococcus spp., (18 fish, 17 % Yersinia spp. (36 fish, and 55 % of fish were culture negative. The PCR assay was developed based on the 16s rRNA gene of L. garvieae for the rapid and specific detection and identification of this pathogen from different sources. Two pairs of primers were designed based on the nucleotide sequences of the 16s rRNA gene of L. garvieae. After PCR assay on isolated bacterial colonies, DNAs extracted from 38 L. garvieae gave the expected 1107 bp PCR fragment of 16S rDNA sequences, which is specific for L. garvieae. The results of this study suggest the use of molecular methods along with current biochemical methods are effective diagnostic tools in the identification of L. garvieae. The combination of these methods for diagnosis of other bacterial disease is recommended.

  4. Specificity shifts in the rRNA and tRNA nucleotide targets of archaeal and bacterial m5U methyltransferases

    Auxilien, Sylvie; Rasmussen, Anette; Rose, Simon;

    2011-01-01

    Methyltransferase enzymes that use S-adenosylmethionine as a cofactor to catalyze 5-methyl uridine (m(5)U) formation in tRNAs and rRNAs are widespread in Bacteria and Eukaryota, but are restricted to the Thermococcales and Nanoarchaeota groups amongst the Archaea. The RNA m(5)U methyltransferases...... appear to have arisen in Bacteria and were then dispersed by horizontal transfer of an rlmD-type gene to the Archaea and Eukaryota. The bacterium Escherichia coli has three gene paralogs and these encode the methyltransferases TrmA that targets m(5)U54 in tRNAs, RlmC (formerly RumB) that modifies m(5)U......, however, neither of the two P. abyssi enzymes displays RlmD-like activity in vitro. PAB0719 acts in a TrmA-like manner to catalyze m(5)U54 methylation in P. abyssi tRNAs, and here we show that PAB0760 possesses RlmC-like activity and specifically methylates the nucleotide equivalent to U747 in P. abyssi...

  5. Primary and secondary structures of Tetrahymena and aphid 5.8S rRNAs: structural features of 5.8S rRNA which interacts with the 28S rRNA containing the hidden break.

    Fujiwara, H.; H. Ishikawa

    1982-01-01

    The Tetrahymena 5.8S rRNA is 154 nucleotides long, the shortest so far reported except for the split 5.8S rRNAs of Diptera (m5.8S plus 2S rRNA). In this molecule several nucleotides are deleted in the helix e (GC-rich stem) region. Upon constructing the secondary structure in accordance with "burp-gun" model, the Tetrahymena 5.8S rRNA forms a wide-open "muzzle" of the terminal regions due to both extra nucleotides and several unpaired bases. The aphid 5.8S rRNA consists of 161 nucleotides and...

  6. Nucleotide Metabolism

    Martinussen, Jan; Willemoës, M.; Kilstrup, Mogens

    2011-01-01

    Metabolic pathways are connected through their utilization of nucleotides as supplier of energy, allosteric effectors, and their role in activation of intermediates. Therefore, any attempt to exploit a given living organism in a biotechnological process will have an impact on nucleotide metabolis...

  7. Fragmentations of the large-subunit rRNA in the family Rhizobiaceae.

    Selenska-Pobell, S; Evguenieva-Hackenberg, E

    1995-01-01

    A 130-nucleotide-long rRNA species corresponding to the 5' end of the 23S rRNA gene was found in 96 strains belonging to different Rhizobium, Bradyrhizobium, and Agrobacterium species. Additional fragmentation in the central region of the large-subunit rRNA occurred in all agrobacteria, except Agrobacterium vitis, and in most Rhizobium leguminosarum and Rhizobium etli strains but did not occur in any of the other rhizobia and bradyrhizobia studied.

  8. Sites of interaction of streptogramin A and B antibiotics in the peptidyl transferase loop of 23 S rRNA and the synergism of their inhibitory mechanisms

    Porse, B T; Garrett, R A

    1999-01-01

    nucleotides in the peptidyl transferase loop of 23 S rRNA, including the two mutated nucleotides. An rRNA footprinting study, performed both in vivo and in vitro, on the A and B components complexed to Bacillus megaterium ribosomes, indicated that similar drug-induced effects occur on free ribosomes and...

  9. The tylosin resistance gene tlrB of Streptomyces fradiae encodes a methyltransferase that targets G748 in 23S rRNA

    Liu, M; Kirpekar, F; Van Wezel, G P;

    2000-01-01

    Streptomyces species indicates that in vivo TlrB modifies nucleotide G748 within helix 35 of 23S rRNA. Purified recombinant TlrB retains its activity and specificity in vitro and modifies G748 in 23S rRNA as well as in a 74 nucleotide RNA containing helix 35 and surrounding structures. Modification is...

  10. rRNA fragmentation induced by a yeast killer toxin.

    Kast, Alene; Klassen, Roland; Meinhardt, Friedhelm

    2014-02-01

    Virus like dsDNA elements (VLE) in yeast were previously shown to encode the killer toxins PaT and zymocin, which target distinct tRNA species via specific anticodon nuclease (ACNase) activities. Here, we characterize a third member of the VLE-encoded toxins, PiT from Pichia inositovora, and identify PiOrf4 as the cytotoxic subunit by conditional expression in Saccharomyces cerevisiae. In contrast to the tRNA targeting toxins, however, neither a change of the wobble uridine modification status by introduction of elp3 or trm9 mutations nor tRNA overexpression rescued from PiOrf4 toxicity. Consistent with a distinct RNA target, expression of PiOrf4 causes specific fragmentation of the 25S and 18S rRNA. A stable cleavage product comprising the first ∼ 130 nucleotides of the 18S rRNA was purified and characterized by linker ligation and subsequent reverse transcription; 3'-termini were mapped to nucleotide 131 and 132 of the 18S rRNA sequence, a region showing some similarity to the anticodon loop of tRNA(Glu)(UUC), the zymocin target. PiOrf4 residues Glu9 and His214, corresponding to catalytic sites Glu9 and His209 in the ACNase subunit of zymocin are essential for in vivo toxicity and rRNA fragmentation, raising the possibility of functionally conserved RNase modules in both proteins. PMID:24308908

  11. Mutations in the 16S rRNA Genes of Helicobacter pylori Mediate Resistance to Tetracycline

    Trieber, Catharine A.; Taylor, Diane E.

    2002-01-01

    Low-cost and rescue treatments for Helicobacter pylori infections involve combinations of several drugs including tetracycline. Resistance to tetracycline has recently emerged in H. pylori. The 16S rRNA gene sequences of two tetracycline-resistant clinical isolates (MIC = 64 μg/ml) were determined and compared to the consensus H. pylori 16S rRNA sequence. One isolate had four nucleotide substitutions, and the other had four substitutions and two deletions. Natural transformation with the 16S ...

  12. 16S rRNA Mutation Associated with Tetracycline Resistance in a Gram-Positive Bacterium

    Ross, Jeremy I.; Eady, E Anne; Cove, Jonathan H.; Cunliffe, William J.

    1998-01-01

    A genetic basis for tetracycline resistance in cutaneous propionibacteria was suggested by comparing the nucleotide sequences of the 16S rRNA genes from 16 susceptible and 21 resistant clinical isolates and 6 laboratory-selected tetracycline-resistant mutants of a susceptible strain. Fifteen clinical isolates resistant to tetracycline were found to have cytosine instead of guanine at a position cognate with Escherichia coli 16S rRNA base 1058 in a region important for peptide chain terminatio...

  13. Primary and secondary structure of 5.8S rRNA from the silkgland of Bombyx mori.

    Fujiwara, H.; Kawata, Y.; H. Ishikawa

    1982-01-01

    Nucleotide sequence of 5.8S rRNA of the silkworm, Bombyx mori has been determined by gel sequencing methods. The 5.8S rRNA was the longest so far reported, with the 5'-terminal sequence several nucleotides longer than those of the other organisms. Upon constructing the secondary structure in accordance with the "burp gun" model (12), the Bombyx 5.8S rRNA formed a wide-open "muzzle" due to several unpaired bases at the ends. The overall structure also appeared less stable with less G . C pairs...

  14. Adjacent segment disease.

    Virk, Sohrab S; Niedermeier, Steven; Yu, Elizabeth; Khan, Safdar N

    2014-08-01

    EDUCATIONAL OBJECTIVES As a result of reading this article, physicians should be able to: 1. Understand the forces that predispose adjacent cervical segments to degeneration. 2. Understand the challenges of radiographic evaluation in the diagnosis of cervical and lumbar adjacent segment disease. 3. Describe the changes in biomechanical forces applied to adjacent segments of lumbar vertebrae with fusion. 4. Know the risk factors for adjacent segment disease in spinal fusion. Adjacent segment disease (ASD) is a broad term encompassing many complications of spinal fusion, including listhesis, instability, herniated nucleus pulposus, stenosis, hypertrophic facet arthritis, scoliosis, and vertebral compression fracture. The area of the cervical spine where most fusions occur (C3-C7) is adjacent to a highly mobile upper cervical region, and this contributes to the biomechanical stress put on the adjacent cervical segments postfusion. Studies have shown that after fusion surgery, there is increased load on adjacent segments. Definitive treatment of ASD is a topic of continuing research, but in general, treatment choices are dictated by patient age and degree of debilitation. Investigators have also studied the risk factors associated with spinal fusion that may predispose certain patients to ASD postfusion, and these data are invaluable for properly counseling patients considering spinal fusion surgery. Biomechanical studies have confirmed the added stress on adjacent segments in the cervical and lumbar spine. The diagnosis of cervical ASD is complicated given the imprecise correlation of radiographic and clinical findings. Although radiological and clinical diagnoses do not always correlate, radiographs and clinical examination dictate how a patient with prolonged pain is treated. Options for both cervical and lumbar spine ASD include fusion and/or decompression. Current studies are encouraging regarding the adoption of arthroplasty in spinal surgery, but more long

  15. Pseudoknot in domain II of 23 S rRNA is essential for ribosome function

    Rosendahl, G; Hansen, L H; Douthwaite, S

    1995-01-01

    reveals increased accessibility in the rRNA structure close to the sites of the mutations. The degree to which the mutations increase rRNA accessibility correlates with the severity of their phenotypic effects. Nucleotide 1131G is extremely reactive to dimethyl sulphate modification in wild-type subunits......The structure of domain II in all 23 S (and 23 S-like) rRNAs is constrained by a pseudoknot formed between nucleotides 1005 and 1138, and between 1006 and 1137 (Escherichia coli numbering). These nucleotides are exclusively conserved as 1005C.1138G and 1006C.1137G pairs in all Bacteria, Archaea and...... chloroplasts, whereas 1005G.1138C and 1006U.1137A pairs occur in Eukarya. We have mutagenized nucleotides 1005C-->G, 1006C-->U, 1137G-->A and 1138G-->C, both individually and in combinations, in a 23 S rRNA gene from the bacterium E. coli. The ability of 23 S rRNA to support cell growth is reduced when either...

  16. Gordian adjacency for torus knots

    Feller, Peter

    2013-01-01

    A knot K is called Gordian adjacent to a knot L if there exists an unknotting sequence for L containing K. We provide a sufficient condition for Gordian adjacency of torus knots via the study of knots in the thickened torus. We also completely describe Gordian adjacency for torus knots of index 2 and 3 using Levine-Tristram signatures as obstructions to Gordian adjacency. Finally, Gordian adjacency for torus knots is compared to the notion of adjacency for plane curve singularities.

  17. Interaction of the tylosin-resistance methyltransferase RlmA II at its rRNA target differs from the orthologue RlmA I

    Douthwaite, Stephen; Jakobsen, Lene; Yoshizawa, Satoko;

    2008-01-01

    footprint contacts with nucleotides in stem-loops 33, 34 and 35, and does not interact elsewhere in the rRNA. Binding of RlmA(II) to the rRNA is dependent on the cofactor S-adenosylmethionine (or S-adenosylhomocysteine). RlmA(II) interacts with the same rRNA region as the orthologous enzyme RlmA(I) that...

  18. Recognition determinants for proteins and antibiotics within 23S rRNA

    Douthwalte, S; Voldborg, Bjørn Gunnar Rude; Hansen, Lykke Haastrup;

    1995-01-01

    Ribosomal RNAs fold into phylogenetically conserved secondary and tertiary structures that determine their function in protein synthesis. We have investigated Escherichia coli 23S rRNA to identify structural elements that interact with antibiotic and protein ligands. Using a combination of...... molecular genetic and biochemical probing techniques, we have concentrated on regions of the rRNA that are connected with specific functions. These are located in different domains within the 23S rRNA and include the ribosomal GTPase-associated center in domain II, which contains the binding sites for r......-proteins L10.(L12)4 and L11 and is inhibited by interaction with the antibiotic thiostrepton. The peptidyltransferase center within domain V is inhibited by macrolide, lincosamide, and streptogramin B antibiotics, which interact with the rRNA around nucleotide A2058. Drug resistance is conferred by mutations...

  19. Macrolide-ketolide inhibition of MLS-resistant ribosomes is improved by alternative drug interaction with domain II of 23S rRNA

    Douthwaite, S; Hansen, L H; Mauvais, P

    2000-01-01

    The macrolide antibiotic erythromycin and its 6-O-methyl derivative (clarithromycin) bind to bacterial ribosomes primarily through interactions with nucleotides in domains II and V of 23S rRNA. The domain II interaction occurs between nucleotide A752 and the macrolide 3-cladinose moiety. Removal ...

  20. Insights into the structure, function and evolution of the radical-SAM 23S rRNA methyltransferase Cfr that confers antibiotic resistance in bacteria

    Karminska, K. H.; Purta, E.; Hansen, L .H.; Bujnicki, J. M.; Vester, B.; Long, Katherine

    2010-01-01

    The Cfr methyltransferase confers combined resistance to five classes of antibiotics that bind to the peptidyl tranferase center of bacterial ribosomes by catalyzing methylation of the C-8 position of 23S rRNA nucleotide A2503. The same nucleotide is targeted by the housekeeping methyltransferase...

  1. Domain V of 23S rRNA contains all the structural elements necessary for recognition by the ErmE methyltransferase

    Vester, B; Douthwaite, S

    1994-01-01

    enzyme efficiently modifies 23S rRNA in vitro. Removal of most of the 23S rRNA structure, so that only domain V (nucleotides 2000 to 2624) remains, does not affect the efficiency of modification by the methyltransferase. In addition, modification still occurs after the rRNA tertiary structure has been......The ErmE methyltransferase from the erythromycin-producing actinomycete Saccharopolyspora erythraea dimethylates the N-6 position of adenine 2058 in domain V of 23S rRNA. This modification confers resistance to erythromycin and to other macrolide, lincosamide, and streptogramin B antibiotics. We...

  2. Altered features in the secondary structure of Vicia faba 5.8s rRNA.

    Nazar, R N; Wildeman, A G

    1981-01-01

    We have re-examined the nucleotide sequence of Vicia faba (broad bean) 5.8S rRNA using partial chemical degradation and a new approach to high temperature (65-80 degrees C) sequencing gels. The results indicate that the secondary structure was not completely disrupted in previous studies (Tanaka, Y., Dyer, T.A. and Brownlee, G.G. (1980) Nucleic Acid Res. 8, 1259-1272) and explain ambiguities between the nucleotide sequence and T1 ribonuclease digests. Despite this revision, estimates in the s...

  3. Piperidine nucleosides and nucleotides

    Kovačková, Soňa; Dračínský, Martin; Rosenberg, Ivan; Rejman, Dominik

    Lyon : Université de Lyon, 2010, s. 315-316. [International Roundtable on Nucleosides, Nucleotides and Nucleic Acids. IRT 2010. Lyon (FR), 29.08.2010-03.09.2010] Institutional research plan: CEZ:AV0Z40550506 Keywords : phosphonate analogs * piperidine nucleosides * piperidine nucleotides Subject RIV: CC - Organic Chemistry http://irt2010.univ-lyon1.fr

  4. Main: Nucleotide Analysis [KOME

    Full Text Available Nucleotide Analysis GenBank blastx search ... result Result of blastx search ... against GenBank amino a ... cid sequence kome_genbank_blastx_search _result.zip kome_genbank_blastx_search _result ...

  5. Main: Nucleotide Analysis [KOME

    Full Text Available Nucleotide Analysis GenBank blastn search ... result Result of blastn search ... against GenBank nucleot ... ide sequence kome_genbank_blastn_search _result.zip kome_genbank_blastn_search _result ...

  6. Main: Nucleotide Analysis [KOME

    Full Text Available Nucleotide Analysis PLACE search result Result of signal search against PLACE : cis-acting regul ... atory DNA elements Database ... kome_place_search_result.zip kome_place_search_res ...

  7. Main: Nucleotide Analysis [KOME

    Full Text Available Nucleotide Analysis Japonica genome blast search result Result of blastn search against japonica genome... sequence kome_japonica_genome_blast_search_result.zip kome_japonica_genome_blast_search_result ...

  8. Main: Nucleotide Analysis [KOME

    Full Text Available Nucleotide Analysis Indica genome blast search result Result of blastn search against Indica genome... sequence (top hit only) kome_indica_genome_blast_search_result.zip kome_indica_genome_blast_search_result ...

  9. Nucleotide diversity in gorillas.

    Yu, Ning; Jensen-Seaman, Michael I.; Chemnick, Leona; Ryder, Oliver; Li, Wen-Hsiung

    2004-01-01

    Comparison of the levels of nucleotide diversity in humans and apes may provide valuable information for inferring the demographic history of these species, the effect of social structure on genetic diversity, patterns of past migration, and signatures of past selection events. Previous DNA sequence data from both the mitochondrial and the nuclear genomes suggested a much higher level of nucleotide diversity in the African apes than in humans. Noting that the nuclear DNA data from the apes we...

  10. Sequence of the chloroplast 16S rRNA gene and its surrounding regions of Chlamydomonas reinhardii.

    Dron, M; Rahire, M; Rochaix, J D

    1982-01-01

    The sequence of a 2 kb DNA fragment containing the chloroplast 16S ribosomal RNA gene from Chlamydomonas reinhardii and its flanking regions has been determined. The algal 16S rRNA sequence (1475 nucleotides) and secondary structure are highly related to those found in bacteria and in the chloroplasts of higher plants. In contrast, the flanking regions are very different. In C. reinhardii the 16S rRNA gene is surrounded by AT rich segments of about 180 bases, which are followed by a long stre...

  11. Technologically important extremophile 16S rRNA sequence Shannon entropy and fractal property comparison with long term dormant microbes

    Holden, Todd; Gadura, N.; Dehipawala, S.; Cheung, E.; Tuffour, M.; Schneider, P.; Tremberger, G., Jr.; Lieberman, D.; Cheung, T.

    2011-10-01

    Technologically important extremophiles including oil eating microbes, uranium and rocket fuel perchlorate reduction microbes, electron producing microbes and electrode electrons feeding microbes were compared in terms of their 16S rRNA sequences, a standard targeted sequence in comparative phylogeny studies. Microbes that were reported to have survived a prolonged dormant duration were also studied. Examples included the recently discovered microbe that survives after 34,000 years in a salty environment while feeding off organic compounds from other trapped dead microbes. Shannon entropy of the 16S rRNA nucleotide composition and fractal dimension of the nucleotide sequence in terms of its atomic number fluctuation analyses suggest a selected range for these extremophiles as compared to other microbes; consistent with the experience of relatively mild evolutionary pressure. However, most of the microbes that have been reported to survive in prolonged dormant duration carry sequences with fractal dimension between 1.995 and 2.005 (N = 10 out of 13). Similar results are observed for halophiles, red-shifted chlorophyll and radiation resistant microbes. The results suggest that prolonged dormant duration, in analogous to high salty or radiation environment, would select high fractal 16S rRNA sequences. Path analysis in structural equation modeling supports a causal relation between entropy and fractal dimension for the studied 16S rRNA sequences (N = 7). Candidate choices for high fractal 16S rRNA microbes could offer protection for prolonged spaceflights. BioBrick gene network manipulation could include extremophile 16S rRNA sequences in synthetic biology and shed more light on exobiology and future colonization in shielded spaceflights. Whether the high fractal 16S rRNA sequences contain an asteroidlike extra-terrestrial source could be speculative but interesting.

  12. Renibacterium salmoninarum isolates from different sources possess two highly conserved copies of the rRNA operon .

    Grayson, T H; Alexander, S M; Cooper, L F; Gilpin, M L

    2000-07-01

    The nucleotide sequences of the rRNA genes and the 5' flanking region were determined for R. salmoninarum ATCC 33209T from overlapping products generated by PCR amplification from the genomic DNA. Comparison of the sequences with rRNA genes from a variety of bacteria demonstrated the close relatedness between R. salmoninarum and the high G+C group of the actinobacteria, in particular, Arthrobacter species. A regulatory element within the 5' leader of the rRNA operon was identical to an element, CL2, described for mycobacteria. PCR, DNA sequence analysis, and DNA hybridisation were performed to examine variation between isolates from diverse sources which represented the four 16S-23S rRNA intergenic spacer sequevars previously described for R. salmoninarum. Two 23S-5S rRNA intergenic spacer sequevars of identical length were found. DNA hybridisation using probes complementary to 23S rDNA and 16S rDNA identified two rRNA operons which were identical or nearly identical amongst 40 isolates sourced from a variety of countries. PMID:11016696

  13. Piperidine nucleosides and nucleotides

    Kovačková, Soňa; Pačes, Ondřej; Dračínský, Martin; Rosenberg, Ivan; Rejman, Dominik

    Manchester : University of Manchester, 2009. s. 50-50. [Nucleic Acids at the Chemistry - Biology Interface. 07.09.2009-08.09.2009, Manchester] R&D Projects: GA MZd NR9138; GA MŠk 2B06065 Institutional research plan: CEZ:AV0Z40550506 Keywords : phosphonate * piperidine nucleosides * nucleotides Subject RIV: CC - Organic Chemistry

  14. Effect of mutations in the A site of 16 S rRNA on aminoglycoside antibiotic-ribosome interaction

    Recht, M I; Douthwaite, S; Dahlquist, K D;

    1999-01-01

    Decoding of genetic information occurs upon interaction of an mRNA codon-tRNA anticodon complex with the small subunit of the ribosome. The ribosomal decoding region is associated with highly conserved sequences near the 3' end of 16 S rRNA. The decoding process is perturbed by the aminoglycoside...... of universally conserved nucleotides at 1406 to 1408 and 1494 to 1495 in the decoding region of plasmid-encoded bacterial 16 S rRNA. Phenotypic changes range from the benign effect of U1406-->A or A1408-->G substitutions, to the highly deleterious 1406G and 1495 mutations that assemble into 30 S subunits...... but are defective in forming functional ribosomes. Changes in the local conformation of the decoding region caused by these mutations were identified by chemical probing of isolated 30 S subunits. Ribosomes containing 16 S rRNA with mutations at positions 1408, 1407+1494, or 1495 had reduced affinity...

  15. Phylogenetic relationships of Salmonella based on rRNA sequences

    Christensen, H.; Nordentoft, Steen; Olsen, J.E.

    1998-01-01

    separated by 16S rRNA analysis and found to be closely related to the Escherichia coli and Shigella complex by both 16S and 23S rRNA analyses. The diphasic serotypes S. enterica subspp. I and VI were separated from the monophasic serotypes subspp. IIIa and IV, including S. bongori, by 23S rRNA sequence...

  16. Piperidine nucleosides and nucleotides

    Kovačková, Soňa; Pačes, Ondřej; Dračínský, Martin; Rosenberg, Ivan; Rejman, Dominik

    -, č. 52 (2008), s. 587-587. ISSN 0261-3166. [Joint Symposium of the International Roundtable on Nucleosides, Nucleotides and Nucleic Acids /18./ and the International Symposium on Nucleic Acid Chemistry /35./. Kyoto, 08.09.2008-12.09.2008] R&D Projects: GA MŠk(CZ) LC06077; GA MŠk 2B06065; GA MŠk LC512 Grant ostatní: GA MZd(CZ) NR9138 Institutional research plan: CEZ:AV0Z40550506 Keywords : piperidine * nucleosidation * phosphonate Subject RIV: CC - Organic Chemistry

  17. Single Nucleotide Polymorphism

    Børsting, Claus; Pereira, Vania; Andersen, Jeppe Dyrberg;

    2014-01-01

    Single nucleotide polymorphisms (SNPs) are the most frequent DNA sequence variations in the genome. They have been studied extensively in the last decade with various purposes in mind. In this chapter, we will discuss the advantages and disadvantages of using SNPs for human identification and...... briefly describe the methods that are preferred for SNP typing in forensic genetics. In addition, we will illustrate how SNPs can be used as investigative leads in the police investigation by discussing the use of ancestry informative markers and forensic DNA phenotyping. Modern DNA sequencing...

  18. Template polymerization of nucleotide analogues

    Orgel, L. E.

    1991-01-01

    Recent work on the template-directed reactions of the natural D-nucleotides has made it clear that l-nucleotides and nucleotide-like derivatives of other sugars would strongly inhibit the formation of long oligonucleotides. Consequently, attention is focusing on molecules simpler than nucleotides that might have acted as monomers of an information transfer system. We have begun a general exploration of the template directed reactions of diverse peptide analogues. I will present work by Dr. Taifeng Wu on oxidative oligomerization of phosphorothioates and of Dr. Mary Tohidi on the cyclic polymerization of nucleoside and related cyclic pyrophosphates.

  19. Downregulation of rRNA Transcription Triggers Cell Differentiation

    Yuki Hayashi; Takao Kuroda; Hiroyuki Kishimoto; Changshan Wang; Atsushi Iwama; Keiji Kimura

    2014-01-01

    Responding to various stimuli is indispensable for the maintenance of homeostasis. The downregulation of ribosomal RNA (rRNA) transcription is one of the mechanisms involved in the response to stimuli by various cellular processes, such as cell cycle arrest and apoptosis. Cell differentiation is caused by intra- and extracellular stimuli and is associated with the downregulation of rRNA transcription as well as reduced cell growth. The downregulation of rRNA transcription during differentiati...

  20. Adjacent Nucleotide Dependence in ncRNA and Order-1 SCFG for ncRNA Identification

    Wong, Thomas K. F.; Lam, Tak-Wah; Sung, Wing-Kin; Yiu, Siu-Ming

    2010-01-01

    Background: Non-coding RNAs (ncRNAs) are known to be involved in many critical biological processes, and identification of ncRNAs is an important task in biological research. A popular software, Infernal, is the most successful prediction tool and exhibits high sensitivity. The application of Infernal has been mainly focused on small suspected regions. We tried to apply Infernal on a chromosome level; the results have high sensitivity, yet contain many false positives. Further enhancing Infer...

  1. Interactions of the TnaC nascent peptide with rRNA in the exit tunnel enable the ribosome to respond to free tryptophan

    Martínez, Allyson K.; GORDON, EMILY; Sengupta, Arnab; Shirole, Nitin; Klepacki, Dorota; Martinez-Garriga, Blanca; Brown, Lewis M.; Benedik, Michael J.; Yanofsky, Charles; Mankin, Alexander S.; Vazquez-Laslop, Nora; Sachs, Matthew S.; Cruz-Vera, Luis R.

    2013-01-01

    A transcriptional attenuation mechanism regulates expression of the bacterial tnaCAB operon. This mechanism requires ribosomal arrest induced by the regulatory nascent TnaC peptide in response to free L-tryptophan (L-Trp). In this study we demonstrate, using genetic and biochemical analyses, that in Escherichia coli, TnaC residue I19 and 23S rRNA nucleotide A2058 are essential for the ribosome’s ability to sense free L-Trp. We show that the mutational change A2058U in 23S rRNA reduces the con...

  2. Interconversion of active and inactive 30 S ribosomal subunits is accompanied by a conformational change in the decoding region of 16 S rRNA

    Moazed, D; Van Stolk, B J; Douthwaite, S;

    1986-01-01

    Zamir, Elson and their co-workers have shown that 30 S ribosomal subunits are reversibly inactivated by depletion of monovalent or divalent cations. We have re-investigated the conformation of 16 S rRNA in the active and inactive forms of the 30 S subunit, using a strategy that is designed......' regions of 16 S rRNA. The inactive form also shows significantly decreased reactivity at positions 1533 to 1538 (the Shine-Dalgarno region), in agreement with earlier findings. The principal changes in reactivity involve the universally conserved nucleotides G926, C1395, A1398 and G1401. The three purines...

  3. The arabidopsis cyclic nucleotide interactome

    Donaldson, Lara

    2016-05-11

    Background Cyclic nucleotides have been shown to play important signaling roles in many physiological processes in plants including photosynthesis and defence. Despite this, little is known about cyclic nucleotide-dependent signaling mechanisms in plants since the downstream target proteins remain unknown. This is largely due to the fact that bioinformatics searches fail to identify plant homologs of protein kinases and phosphodiesterases that are the main targets of cyclic nucleotides in animals. Methods An affinity purification technique was used to identify cyclic nucleotide binding proteins in Arabidopsis thaliana. The identified proteins were subjected to a computational analysis that included a sequence, transcriptional co-expression and functional annotation analysis in order to assess their potential role in plant cyclic nucleotide signaling. Results A total of twelve cyclic nucleotide binding proteins were identified experimentally including key enzymes in the Calvin cycle and photorespiration pathway. Importantly, eight of the twelve proteins were shown to contain putative cyclic nucleotide binding domains. Moreover, the identified proteins are post-translationally modified by nitric oxide, transcriptionally co-expressed and annotated to function in hydrogen peroxide signaling and the defence response. The activity of one of these proteins, GLYGOLATE OXIDASE 1, a photorespiratory enzyme that produces hydrogen peroxide in response to Pseudomonas, was shown to be repressed by a combination of cGMP and nitric oxide treatment. Conclusions We propose that the identified proteins function together as points of cross-talk between cyclic nucleotide, nitric oxide and reactive oxygen species signaling during the defence response.

  4. International interlaboratory study comparing single organism 16S rRNA gene sequencing data: Beyond consensus sequence comparisons

    Nathan D. Olson

    2015-03-01

    Full Text Available This study presents the results from an interlaboratory sequencing study for which we developed a novel high-resolution method for comparing data from different sequencing platforms for a multi-copy, paralogous gene. The combination of PCR amplification and 16S ribosomal RNA gene (16S rRNA sequencing has revolutionized bacteriology by enabling rapid identification, frequently without the need for culture. To assess variability between laboratories in sequencing 16S rRNA, six laboratories sequenced the gene encoding the 16S rRNA from Escherichia coli O157:H7 strain EDL933 and Listeria monocytogenes serovar 4b strain NCTC11994. Participants performed sequencing methods and protocols available in their laboratories: Sanger sequencing, Roche 454 pyrosequencing®, or Ion Torrent PGM®. The sequencing data were evaluated on three levels: (1 identity of biologically conserved position, (2 ratio of 16S rRNA gene copies featuring identified variants, and (3 the collection of variant combinations in a set of 16S rRNA gene copies. The same set of biologically conserved positions was identified for each sequencing method. Analytical methods using Bayesian and maximum likelihood statistics were developed to estimate variant copy ratios, which describe the ratio of nucleotides at each identified biologically variable position, as well as the likely set of variant combinations present in 16S rRNA gene copies. Our results indicate that estimated variant copy ratios at biologically variable positions were only reproducible for high throughput sequencing methods. Furthermore, the likely variant combination set was only reproducible with increased sequencing depth and longer read lengths. We also demonstrate novel methods for evaluating variable positions when comparing multi-copy gene sequence data from multiple laboratories generated using multiple sequencing technologies.

  5. The complete nucleotide sequence of a 16S ribosomal RNA gene from a blue-green alga, Anacystis nidulans.

    Tomioka, N; Sugiura, M

    1983-01-01

    The complete nucleotide sequence of a 16S ribosomal RNA gene from a blue-green alga, Anacystis nidulans, has been determined. Its coding region is estimated to be 1,487 base pairs long, which is nearly identical to those reported for chloroplast 16S rRNA genes and is about 4% shorter than that of the Escherichia coli gene. The 16S rRNA sequence of A. nidulans has 83% homology with that of tobacco chloroplast and 74% homology with that of E. coli. Possible stem and loop structures of A. nidulans 16S rRNA sequences resemble more closely those of chloroplast 16S rRNAs than those of E. coli 16S rRNA. These observations support the endosymbiotic theory of chloroplast origin. PMID:6412038

  6. Downregulation of rRNA transcription triggers cell differentiation.

    Yuki Hayashi

    Full Text Available Responding to various stimuli is indispensable for the maintenance of homeostasis. The downregulation of ribosomal RNA (rRNA transcription is one of the mechanisms involved in the response to stimuli by various cellular processes, such as cell cycle arrest and apoptosis. Cell differentiation is caused by intra- and extracellular stimuli and is associated with the downregulation of rRNA transcription as well as reduced cell growth. The downregulation of rRNA transcription during differentiation is considered to contribute to reduced cell growth. However, the downregulation of rRNA transcription can induce various cellular processes; therefore, it may positively regulate cell differentiation. To test this possibility, we specifically downregulated rRNA transcription using actinomycin D or a siRNA for Pol I-specific transcription factor IA (TIF-IA in HL-60 and THP-1 cells, both of which have differentiation potential. The inhibition of rRNA transcription induced cell differentiation in both cell lines, which was demonstrated by the expression of the common differentiation marker CD11b. Furthermore, TIF-IA knockdown in an ex vivo culture of mouse hematopoietic stem cells increased the percentage of myeloid cells and reduced the percentage of immature cells. We also evaluated whether differentiation was induced via the inhibition of cell cycle progression because rRNA transcription is tightly coupled to cell growth. We found that cell cycle arrest without affecting rRNA transcription did not induce differentiation. To the best of our knowledge, our results demonstrate the first time that the downregulation of rRNA levels could be a trigger for the induction of differentiation in mammalian cells. Furthermore, this phenomenon was not simply a reflection of cell cycle arrest. Our results provide a novel insight into the relationship between rRNA transcription and cell differentiation.

  7. High-throughput nucleotide sequence analysis of diverse bacterial communities in leachates of decomposing pig carcasses

    Seung Hak Yang; Joung Soo Lim; Modabber Ahmed Khan; Bong Soo Kim; Dong Yoon Choi; Eun Young Lee; Hee Kwon Ahn

    2015-01-01

    The leachate generated by the decomposition of animal carcass has been implicated as an environmental contaminant surrounding the burial site. High-throughput nucleotide sequencing was conducted to investigate the bacterial communities in leachates from the decomposition of pig carcasses. We acquired 51,230 reads from six different samples (1, 2, 3, 4, 6 and 14 week-old carcasses) and found that sequences representing the phylum Firmicutes predominated. The diversity of bacterial 16S rRNA gen...

  8. The Identification of Discriminating Patterns from 16S rRNA Gene to Generate Signature for Bacillus Genus.

    More, Ravi P; Purohit, Hemant J

    2016-08-01

    The 16S ribosomal RNA (16S rRNA) gene has been widely used for the taxonomic classification of bacteria. A molecular signature is a set of nucleotide patterns, which constitute a regular expression that is specific to each particular taxon. Our main goal was to identify discriminating nucleotide patterns in 16S rRNA gene and then to generate signatures for taxonomic classification. To demonstrate our approach, we used the phylum Firmicutes as a model using representative taxa Bacilli (class), Bacillales (order), Bacillaceae (family), and Bacillus (genus), according to their dominance at each hierarchical taxonomic level. We applied combined composite vector and multiple sequence alignment approaches to generate gene-specific signatures. Further, we mapped all the patterns into the different hypervariable regions of 16S rRNA gene and confirmed the most appropriate distinguishing region as V3-V4 for targeted taxa. We also examined the evolution in discriminating patterns of signatures across taxonomic levels. We assessed the comparative classification accuracy of signatures with other methods (i.e., RDP Classifier, KNN, and SINA). Results revealed that the signatures for taxa Bacilli, Bacillales, Bacillaceae, and Bacillus could correctly classify isolate sequences with sensitivity of 0.99, 0.97, 0.94, and 0.89, respectively, and specificity close to 0.99. We developed signature-based software DNA Barcode Identification (DNA BarID) for taxonomic classification that is available at website http://www.neeri.res.in/DNA_BarID.htm . This pattern-based study provides a deeper understanding of taxon-specific discriminating patterns in 16S rRNA gene with respect to taxonomic classification. PMID:27104769

  9. Insights into the structure, function and evolution of the radical-SAM 23S rRNA methyltransferase Cfr that confers antibiotic resistance in bacteria

    Kaminska, Katarzyna H; Purta, Elzbieta; Hansen, Lykke H; Bujnicki, Janusz M; Vester, Birte; Long, Katherine S

    2010-01-01

    The Cfr methyltransferase confers combined resistance to five classes of antibiotics that bind to the peptidyl tranferase center of bacterial ribosomes by catalyzing methylation of the C-8 position of 23S rRNA nucleotide A2503. The same nucleotide is targeted by the housekeeping methyltransferase...... a 4Fe-4S cluster, a SAM molecule coordinated to the iron-sulfur cluster (SAM1) and a SAM molecule that is the putative methyl group donor (SAM2). All mutations at predicted functional sites affect Cfr activity significantly as assayed by antibiotic susceptibility testing and primer extension...

  10. UV-induced modifications in the peptidyl transferase loop of 23S rRNA dependent on binding of the streptogramin B antibiotic, pristinamycin IA

    Porse, B T; Kirillov, S V; Awayez, M J;

    1999-01-01

    The naturally occurring streptogramin B antibiotic, pristinamycin IA, which inhibits peptide elongation, can produce two modifications in 23S rRNA when bound to the Escherichia coli 70S ribosome and irradiated at 365 nm. Both drug-induced effects map to highly conserved nucleotides within the...... functionally important peptidyl transferase loop of 23S rRNA at positions m2A2503/psi2504 and G2061/A2062. The modification yields are influenced strongly, and differentially, by P-site-bound tRNA and strongly by some of the peptidyl transferase antibiotics tested, with chloramphenicol producing a shift in the...... latter modification to A2062/C2063. Pristinamycin IA can also produce a modification on binding to deproteinized, mature 23S rRNA, at position U2500/C2501. The same modification occurs on an approximately 37-nt fragment, encompassing positions approximately 2496-2532 of the peptidyl transferase loop that...

  11. Multi-site-specific 16S rRNA methyltransferase RsmF from Thermus thermophilus

    Demirci, Hasan; Larsen, Line H G; Hansen, Trine;

    2010-01-01

    Cells devote a significant effort toward the production of multiple modified nucleotides in rRNAs, which fine tune the ribosome function. Here, we report that two methyltransferases, RsmB and RsmF, are responsible for all four 5-methylcytidine (m(5)C) modifications in 16S rRNA of Thermus...... thermophilus. Like Escherichia coli RsmB, T. thermophilus RsmB produces m(5)C967. In contrast to E. coli RsmF, which introduces a single m(5)C1407 modification, T. thermophilus RsmF modifies three positions, generating m(5)C1400 and m(5)C1404 in addition to m(5)C1407. These three residues are clustered near...

  12. The nucleotide sequences of 5S rRNAs from a sea-cucumber, a starfish and a sea-urchin.

    Ohama, T; Hori, H; Osawa, S

    1983-01-01

    The nucleotide sequences of 5S rRNA from three echinoderms, a sea-cucumber Stichopus oshimae, a starfish Asterina pectinifera and a sea-urchin Hemicentrotus pulcherrimus have been determined. These 5S rRNAs are all 120 nucleotides long. The echinoderm sequences are more related to the sequences of proterostomes animals such as mollusc, annelids and some others (87% identity on average) than to those of vertebrates (82% identity on average).

  13. Phylogenetic relationships of Salmonella based on rRNA sequences

    Christensen, H.; Nordentoft, Steen; Olsen, J.E.

    1998-01-01

    To establish the phylogenetic relationships between the subspecies of Salmonella enterica (official name Salmonella choleraesuis), Salmonella bongori and related members of Enterobacteriaceae, sequence comparison of rRNA was performed by maximum-likelihood analysis. The two Salmonella species were...

  14. Homogenizing the dose for adjacent fields

    Difficulties are found in radiotherapy in the determination of the gap which should be left among adjacent fields on the skin. In order to homogenize the dose at a given depth, measurements are done with a wood phantom using films, thermoluminescent dosemeters and ionization chambers. Field match is checked according to tables related in the literature and experimental data. Two tables of field separation are built at various depths, one for simultaneous adjacent fields and the other for non-simultaneous adjacent fields. Tables must be checked and the additional distances corrected for each field

  15. Detect Adjacent Well by Analyzing Geomagnetic Anomalies

    Su Zhang

    2014-03-01

    Full Text Available This study describes a method of determining the position of adjacent well by analyzing geomagnetic anomalies in the drilling. In the experiment, put a casing in the geomagnetic field respectively to simulate 3 conditions, which are vertical well, deviated well and horizontal well. Study the interference of regional geomagnetic caused by casing, summary the law of the regional geomagnetic field anomalies caused by the adjacent casing. Experimental results show that: magnetic intensity distortion caused by deviated well is similar to that caused by horizontal well, but the distortion is different from vertical well. The scope and amplitude of N and E component magnetic intensity distortion will increase with the increase of casing inclination, meanwhile the scope and amplitude of V component distortion will decrease and the distortion value changes from negative to positive to the southwest of adjacent well. Through the analysis of geomagnetic anomalies, the position of the adjacent wells could be determined.

  16. Adjacency Algebra of Unitary Cayley Graph

    A. Satyanarayana Reddy

    2013-02-01

    Full Text Available A few properties of unitary Cayley graphs are explored using their eigenvalues. It is shown that the adjacency algebra of a unitary Cayley graph is a coherent algebra. Finally, a class of unitary Cayley graphs that are distance regular are also obtained.Key Words: Adjacency Algebra, Circulant Graph, Coherent Algebra, Distance Regular Graph,Ramanujan's sum .AMS(2010: 05C25, 05C50

  17. Hydrogen bonding and packing density are factors most strongly connected to limiting sites of high flexibility in the 16S rRNA in the 30S ribosome

    Ghosh Sujit K

    2009-07-01

    Full Text Available Abstract Background Conformational flexibility in structured RNA frequently is critical to function. The 30S ribosomal subunit exists in different conformations in different functional states due to changes in the central part of the 16S rRNA. We are interested in evaluating the factors that might be responsible for restricting flexibility to specific parts of the 16S rRNA using biochemical data obtained from the 30S subunit in solution. This problem was approached taking advantage of the observation that there must be a high degree of conformational flexibility at sites where UV photocrosslinking occurs and a lack of flexibility inhibits photoreactivity at many other sites that are otherwise suitable for reaction. Results We used 30S x-ray structures to quantify the properties of the nucleotide pairs at UV- and UVA-s4U-induced photocrosslinking sites in 16S rRNA and compared these to the properties of many hundreds of additional sites that have suitable geometry but do not undergo photocrosslinking. Five factors that might affect RNA flexibility were investigated – RNA interactions with ribosomal proteins, interactions with Mg2+ ions, the presence of long-range A minor motif interactions, hydrogen bonding and the count of neighboring heavy atoms around the center of each nucleobase to estimate the neighbor packing density. The two factors that are very different in the unreactive inflexible pairs compared to the reactive ones are the average number of hydrogen bonds and the average value for the number of neighboring atoms. In both cases, these factors are greater for the unreactive nucleotide pairs at a statistically very significant level. Conclusion The greater extent of hydrogen bonding and neighbor atom density in the unreactive nucleotide pairs is consistent with reduced flexibility at a majority of the unreactive sites. The reactive photocrosslinking sites are clustered in the 30S subunit and this indicates nonuniform patterns of

  18. A nested array of rRNA targeted probes for the detection and identification of enterococci by reverse hybridization.

    Behr, T; Koob, C; Schedl, M; Mehlen, A; Meier, H; Knopp, D; Frahm, E; Obst, U; Schleifer, K; Niessner, R; Ludwig, W

    2000-12-01

    Complete 23S and almost complete 16S rRNA gene sequences were determined for the type strains of the validly described Enterococcus species, Melissococcus pluton and Tetragenococcus halophilus. A comprehensive set of rRNA targeted specific oligonucleotide hybridization probes was designed according to the multiple probe concept. In silico probe design and evaluation was performed using the respective tools of the ARB program package in combination with the ARB databases comprising the currently available 16S as well as 23S rRNA primary structures. The probes were optimized with respect to their application for reverse hybridization in microplate format. The target comprising 16S and 23S rDNA was amplified and labeled by PCR (polymerase chain reaction) using general primers targeting a wide spectrum of bacteria. Alternatively, amplification of two adjacent rDNA fragments of enterococci was performed by using specific primers. In vitro evaluation of the probe set was done including all Enterococcus type strains, and a selection of other representatives of the gram-positive bacteria with a low genomic DNA G+C content. The optimized probe set was used to analyze enriched drinking water samples as well as original samples from waste water treatment plants. PMID:11249027

  19. Adjacent Instability after Instrumented Lumbar Fusion.

    Wen-Jer Chen

    2003-11-01

    Full Text Available The invention of pedicle screw instrumentation has greatly improved outcomes ofspinal fusion, which has become the treatment of choice for lumbar spondylolisthesis. Asresearchers accumulate experience, both theoretical and clinical advances are continuallybeing reported. A review of the literature and the experience of the authors show that thedevelopment of adjacent instability, as in the breakdown of a neighboring unfixed motionsegment, is a common consequence of an instrumented lumbar spine. This article reviewsthe risk factors and surgical treatment of adjacent instability. The authors believe that properpreoperative planning and complete surgical procedures are imperative to prevent adjacentinstability. For those who need revision surgery, meticulous surgical techniques can achievesatisfactory results.

  20. On the complexity of adjacent resource scheduling

    Duin, C.W.; Sluis, van, P.

    2004-01-01

    We study the problem of scheduling resource(s) for jobs in an adjacent manner (ARS). The problem relates to fixed interval scheduling on the one hand, and to the problem of two-dimensional strip packing on the other hand. Further, there is a close relation with multiprocessor scheduling. A distinguishing characteristic is the constraint of resource-adjacency. As an application of ARS, consider an airport where passengers check in for their flight, joining lines before one or more desks; at th...

  1. Applications of adenine nucleotide measurements in oceanography

    Holm-Hansen, O.; Hodson, R.; Azam, F.

    1975-01-01

    The methodology involved in nucleotide measurements is outlined, along with data to support the premise that ATP concentrations in microbial cells can be extrapolated to biomass parameters. ATP concentrations in microorganisms and nucleotide analyses are studied.

  2. Nucleotides in neuroregeneration and neuroprotection.

    Miras-Portugal, M Teresa; Gomez-Villafuertes, Rosa; Gualix, Javier; Diaz-Hernandez, Juan Ignacio; Artalejo, Antonio R; Ortega, Felipe; Delicado, Esmerilda G; Perez-Sen, Raquel

    2016-05-01

    Brain injury generates the release of a multitude of factors including extracellular nucleotides, which exhibit bi-functional properties and contribute to both detrimental actions in the acute phase and also protective and reparative actions in the later recovery phase to allow neuroregeneration. A promising strategy toward restoration of neuronal function is based on activation of endogenous adult neural stem/progenitor cells. The implication of purinergic signaling in stem cell biology, including regulation of proliferation, differentiation, and cell death has become evident in the last decade. In this regard, current strategies of acute transplantation of ependymal stem/progenitor cells after spinal cord injury restore altered expression of P2X4 and P2X7 receptors and improve functional locomotor recovery. The expression of both receptors is transcriptionally regulated by Sp1 factor, which plays a key role in the startup of the transcription machinery to induce regeneration-associated genes expression. Finally, general signaling pathways triggered by nucleotide receptors in neuronal populations converge on several intracellular kinases, such as PI3K/Akt, GSK3 and ERK1,2, as well as the Nrf-2/heme oxigenase-1 axis, which specifically link them to neuroprotection. In this regard, regulation of dual specificity protein phosphatases can become novel mechanism of actions for nucleotide receptors that associate them to cell homeostasis regulation. This article is part of the Special Issue entitled 'Purines in Neurodegeneration and Neuroregeneration'. PMID:26359530

  3. Adjacent stimulation and measurement patterns considered harmful

    We characterize the ability of electrical impedance tomography (EIT) to distinguish changes in internal conductivity distributions, and analyze it as a function of stimulation and measurement patterns. A distinguishability measure, z, is proposed which is related to the signal-to-noise ratio of a medium and to the probability of detection of conductivity changes in a region of interest. z is a function of the number of electrodes, the EIT stimulation and measurement protocol, the stimulation amplitude, the measurement noise, and the size and location of the contrasts. Using this measure we analyze various choices of stimulation and measurement patterns under the constraint of medical electrical safety limits (maximum current into the body). Analysis is performed for a planar placement of 16 electrodes for simulated 3D tank and chest shapes, and measurements in a saline tank. Results show that the traditional (and still most common) adjacent stimulation and measurement patterns have by far the poorest performance (by 6.9 ×). Good results are obtained for trigonometric patterns and for pair drive and measurement patterns separated by over 90°. Since the possible improvement over adjacent patterns is so large, we present this result as a call to action: adjacent patterns are harmful, and should be abandoned. We recommend using pair drive and measurement patterns separated by one electrode less than 180°. We describe an approach to modify an adjacent pattern EIT system by adjusting electrode placement

  4. Interactions of the TnaC nascent peptide with rRNA in the exit tunnel enable the ribosome to respond to free tryptophan.

    Martínez, Allyson K; Gordon, Emily; Sengupta, Arnab; Shirole, Nitin; Klepacki, Dorota; Martinez-Garriga, Blanca; Brown, Lewis M; Benedik, Michael J; Yanofsky, Charles; Mankin, Alexander S; Vazquez-Laslop, Nora; Sachs, Matthew S; Cruz-Vera, Luis R

    2014-01-01

    A transcriptional attenuation mechanism regulates expression of the bacterial tnaCAB operon. This mechanism requires ribosomal arrest induced by the regulatory nascent TnaC peptide in response to free L-tryptophan (L-Trp). In this study we demonstrate, using genetic and biochemical analyses, that in Escherichia coli, TnaC residue I19 and 23S rRNA nucleotide A2058 are essential for the ribosome's ability to sense free L-Trp. We show that the mutational change A2058U in 23S rRNA reduces the concentration dependence of L-Trp-mediated tna operon induction, whereas the TnaC I19L change suppresses this phenotype, restoring the sensitivity of the translating A2058U mutant ribosome to free L-Trp. These findings suggest that interactions between TnaC residue I19 and 23S rRNA nucleotide A2058 contribute to the creation of a regulatory L-Trp binding site within the translating ribosome. PMID:24137004

  5. Regulation of Arabidopsis thaliana 5S rRNA Genes.

    Vaillant, Isabelle; Tutois, Sylvie; Cuvillier, Claudine; Schubert, Ingo; Tourmente, Sylvette

    2007-05-01

    The Arabidopsis thaliana genome comprises around 1,000 copies of 5S rRNA genes encoding both major and minor 5S rRNAs. In mature wild-type leaves, the minor 5S rRNA genes are silent. Using different mutants of DNA methyltransferases (met1, cmt3 and met1 cmt3), components of the RNAi pathway (ago4) or post-translational histone modifier (hda6/sil1), we show that the corresponding proteins are needed to maintain proper methylation patterns at heterochromatic 5S rDNA repeats. Using reverse transcription-PCR and cytological analyses, we report that a decrease of 5S rDNA methylation at CG or CNG sites in these mutants leads to the release of 5S rRNA gene silencing which occurred without detectable changes of the 5S rDNA chromatin structure. In spite of severely reduced DNA methylation, the met1 cmt3 double mutant revealed no increase in minor 5S rRNA transcripts. Furthermore, the release of silencing of minor 5S rDNAs can be achieved without increased formation of euchromatic loops by 5S rDNA, and is independent from the global heterochromatin content. Additionally, fluorescence in situ hybridization with centromeric 180 bp repeats confirmed that these highly repetitive sequences, in spite of their elevated transcriptional activity in the DNA methyltransferase mutants (met1, cmt3 and met1 cmt3), remain within chromocenters of the mutant nuclei. PMID:17412735

  6. Mutations in domain II of 23 S rRNA facilitate translation of a 23 S rRNA-encoded pentapeptide conferring erythromycin resistance

    Dam, M; Douthwaite, S; Tenson, T;

    1996-01-01

    Mutations in domain II of Escherichia coli 23 S rRNA that cause resistance to erythromycin do so in a manner fundamentally different from mutations at the drug binding site in domain V of the 23 S rRNA. The domain II mutations are located in a hairpin structure between nucleotides 1198 and 1247....... This is close to a short open reading frame in the 23 S rRNA that encodes a pentapeptide (E-peptide) whose expression in vivo renders cells resistant to erythromycin. Therefore, a possible mechanism of resistance caused by domain II mutations may be related to an increased expression of the E-peptide. To test...... this hypothesis, a range of point mutations was generated in domain II of 23 S rRNA in the vicinity of the E-peptide open reading frame. We find a correlation between erythromycin resistance of the mutant clones and increased accessibility of the ribosome binding site of the E-peptide gene. Furthermore...

  7. A single mutation in the 15S rRNA gene confers nonsense suppressor activity and interacts with mRF1 the release factor in yeast mitochondria

    Ali Gargouri

    2015-08-01

    Full Text Available We have determined the nucleotide sequence of the mim3-1 mitochondrial ribosomal suppressor, acting on ochre mitochondrial mutations and one frameshift mutation in Saccharomyces cerevisiae. The 15s rRNA suppressor gene contains a G633 to C transversion. Yeast mitochondrial G633 corresponds to G517 of the E.coli 15S rRNA, which is occupied by an invariant G in all known small rRNA sequences. Interestingly, this mutation has occurred at the same position as the known MSU1 mitochondrial suppressor which changes G633 to A. The suppressor mutation lies in a highly conserved region of the rRNA, known in E.coli as the 530-loop, interacting with the S4, S5 and S12 ribosomal proteins. We also show an interesting interaction between the mitochondrial mim3-1 and the nuclear nam3-1 suppressors, both of which have the same action spectrum on mitochondrial mutations: nam3-1 abolishes the suppressor effect when present with mim3-1 in the same haploid cell. We discuss these results in the light of the nature of Nam3, identified by [1] as the yeast mitochondrial translation release factor. A hypothetical mechanism of suppression by "ribosome shifting" is also discussed in view of the nature of mutations suppressed and not suppressed.

  8. Adjacent Segment Pathology after Lumbar Spinal Fusion.

    Lee, Jae Chul; Choi, Sung-Woo

    2015-10-01

    One of the major clinical issues encountered after lumbar spinal fusion is the development of adjacent segment pathology (ASP) caused by increased mechanical stress at adjacent segments, and resulting in various radiographic changes and clinical symptoms. This condition may require surgical intervention. The incidence of ASP varies with both the definition and methodology adopted in individual studies; various risk factors for this condition have been identified, although a significant controversy still exists regarding their significance. Motion-preserving devices have been developed, and some studies have shown their efficacy of preventing ASP. Surgeons should be aware of the risk factors of ASP when planning a surgery, and accordingly counsel their patients preoperatively. PMID:26435804

  9. Nonequilibrium phenomena in adjacent electrically isolated nanostructures

    Khrapai, V. S.; Ludwig, S.; Kotthaus, J. P.; Tranitz, H. P.; Wegscheider, W.

    2008-01-01

    We report on nonequilibrium interaction phenomena between adjacent but electrostatically separated nanostructures in GaAs. A current flowing in one externally biased nanostructure causes an excitation of electrons in a circuit of a second nanostructure. As a result we observe a dc current generated in the unbiased second nanostructure. The results can be qualitatively explained in terms of acoustic phonon based energy transfer between the two mutually isolated circuits.

  10. In vitro cleavage of the simian virus 40 early polyadenylation site adjacent to a required downstream TG sequence.

    Sperry, A O; Berget, S M

    1986-01-01

    Exogenous RNA containing the simian virus 40 early polyadenylation site was efficiently and accurately polyadenylated in in vitro nuclear extracts. Correct cleavage required ATP. In the absence of ATP, nonpoly(A)+ products accumulated which were 18 to 20 nucleotides longer than the RNA generated by correct cleavage; the longer RNA terminated adjacent to the downstream TG element required for polyadenylation. In the presence of ATP analogs, alternate cleavage was not observed; instead, correct...

  11. Frequency and spectrum of mitochondrial 12S rRNA variants in 440 Han Chinese hearing impaired pediatric subjects from two otology clinics

    Zhou Jianjin

    2011-01-01

    Full Text Available Abstract Background Aminoglycoside ototoxicity is one of the common health problems. Mitochondrial 12S rRNA mutations are one of the important causes of aminoglycoside ototoxicity. However, the incidences of 12S rRNA mutations associated with aminoglycoside ototoxicity are less known. Methods A total of 440 Chinese pediatric hearing-impaired subjects were recruited from two otology clinics in the Ningbo and Wenzhou cities of Zhejiang Province, China. These subjects underwent clinical, genetic evaluation and molecular analysis of mitochondrial 12S rRNA. Resultant mtDNA variants were evaluated by structural and phylogenetic analysis. Results The study samples consisted of 227 males and 213 females. The age of all participants ranged from 1 years old to 18 years, with the median age of 9 years. Ninety-eight subjects (58 males and 40 females had a history of exposure to aminoglycosides, accounting for 22.3% cases of hearing loss in this cohort. Molecular analysis of 12S rRNA gene identified 41 (39 known and 2 novel variants. The incidences of the known deafness-associated 1555A > G, 1494C > T and 1095T > C mutations were 7.5%, 0.45% and 0.91% in this entire hearing-impaired subjects, respectively, and 21.4%, 2% and 2% among 98 subjects with aminoglycoside ototoxicity, respectively. The structural and phylogenetic evaluations showed that a novel 747A > G variant and known 839A > G, 1027A > G, 1310C > T and 1413T > C variants conferred increased sensitivity to aminoglycosides or nonsyndromic deafness as they were absent in 449 Chinese controls and localized at highly conserved nucleotides of this rRNA. However, other variants were polymorphisms. Of 44 subjects carrying one of definite or putative deafness-related 12S rRNA variants, only one subject carrying the 1413T > C variant harbored the 235DelC/299DelAT mutations in the GJB2 gene, while none of mutations in GJB2 gene was detected in other 43 subjects. Conclusions Mutations in mitochondrial 12S rRNA

  12. The effect of imidazole, cyanamide, and polyornithine on the condensation of nucleotides in aqueous systems.

    Ibanez, J.; Kimball, A. P.; Oro, J.

    1971-01-01

    Development of two models for the condensation of nucleotides under possibly prebiotic conditions. In the first of these models this type of reaction is promoted by the presence of imidazole and substituted imidazole compounds. The second model involves the condensation of mononucleotides with cyanamide in the presence and absence of a prototemplate such as polyornithine. A tentative mechanism for the role of imidazole catalysis in phosphodiester bond formation between adjacent TMP molecules is suggested.

  13. Detection of Borrelia-specific 16S rRNA sequence in total RNA extracted from Ixodes ricinus ticks

    Ž. Radulović

    2010-08-01

    Full Text Available A reverse transcriptase - polymerase chain reaction based assay for Borrelia species detection in ticks was developed. The method was based on amplification of 552 nucleotide bases long sequence of 16S rRNA, targeted by Borrelia specific primers. In the present study, total RNA extracted from Ixodes ricinus ticks was used as template. The results showed higher sensitivity for Borrelia detection as compared to standard dark-field microscopy. Method specificity was confirmed by cloning and sequencing of obtained 552 base pairs long amplicons. Phylogenetic analysis of obtained sequences showed that they belong to B. lusitaniae and B. afzelii genospecies. RT-PCR based method presented in this paper could be very useful as a screening test for detecting pathogen presence, especially when in investigations is required extraction of total RNA from ticks.

  14. Phylogenetic positions of two marine ciliates, Metanophrys similis and Pseudocohnilembus hargisi (Protozoa, Ciliophora, Scuticociliatia), inferred from complete small subunit rRNA gene sequences

    2006-01-01

    The small subunit rRNA (SSrRNA) gene was sequenced for two marine scuticociliates Metanophrys similis and Pseudocohnilembus hargisi. The results show that this gene comprises 1763 and 1753 nucleotides in the two marine ciliates respectively.Metanophrys similis is phylogenetically closely related to the clade containing Mesanophrys carcini and Anophyroides haemophila, which branches basally to other species within the order Philasterida. Pseudocohnilembus hargisi groups with its congener, P. marinus, with strong bootstrap support. Paranophrys magna groups with the clade including Cohnilembus and Uronema, representing a sister clade to that containing the two Pseudocohnilembus species.

  15. A phylogenetic comparison of the 16S rRNA sequence of the fish pathogen, Renibacterium salmoninarum, to gram-positive bacteria.

    Gutenberger, S K; Giovannoni, S J; Field, K G; Fryer, J L; Rohovec, J S

    1991-01-15

    The 16S rRNA of Renibacterium salmoninarum, the causative agent of bacterial kidney disease in salmonids, was sequenced by reverse transcriptase to produce a nearly complete sequence (97%) of 1475 nucleotides. Phylogenetic comparisons to seventeen genera and signature sequence analysis indicated that R. salmoninarum was a member of the high G + C Gram-positive eubacterial subdivision although the reported G + C value is only 53%. A phylogenetic tree details the relationship of R. salmoninarum to ten actinomycetes from diverse environments. PMID:1709893

  16. Nucleotide excision repair in humans.

    Spivak, Graciela

    2015-12-01

    The demonstration of DNA damage excision and repair replication by Setlow, Howard-Flanders, Hanawalt and their colleagues in the early 1960s, constituted the discovery of the ubiquitous pathway of nucleotide excision repair (NER). The serial steps in NER are similar in organisms from unicellular bacteria to complex mammals and plants, and involve recognition of lesions, adducts or structures that disrupt the DNA double helix, removal of a short oligonucleotide containing the offending lesion, synthesis of a repair patch copying the opposite undamaged strand, and ligation, to restore the DNA to its original form. The transcription-coupled repair (TCR) subpathway of NER, discovered nearly two decades later, is dedicated to the removal of lesions from the template DNA strands of actively transcribed genes. In this review I will outline the essential factors and complexes involved in NER in humans, and will comment on additional factors and metabolic processes that affect the efficiency of this important process. PMID:26388429

  17. Kauffman's adjacent possible in word order evolution

    Ferrer-i-Cancho, Ramon

    2015-01-01

    Word order evolution has been hypothesized to be constrained by a word order permutation ring: transitions involving orders that are closer in the permutation ring are more likely. The hypothesis can be seen as a particular case of Kauffman's adjacent possible in word order evolution. Here we consider the problem of the association of the six possible orders of S, V and O to yield a couple of primary alternating orders as a window to word order evolution. We evaluate the suitability of various competing hypotheses to predict one member of the couple from the other with the help of information theoretic model selection. Our ensemble of models includes a six-way model that is based on the word order permutation ring (Kauffman's adjacent possible) and another model based on the dual two-way of standard typology, that reduces word order to basic orders preferences (e.g., a preference for SV over VS and another for SO over OS). Our analysis indicates that the permutation ring yields the best model when favoring pa...

  18. Isolation of temperature-sensitive mutants of 16 S rRNA in Escherichia coli

    Triman, K; Becker, E; Dammel, C;

    1989-01-01

    Temperature-sensitive mutants have been isolated following hydroxylamine mutagenesis of a plasmid containing Escherichia coli rRNA genes carrying selectable markers for spectinomycin resistance (U1192 in 16 S rRNA) and erythromycin resistance (G2058 in 23 S rRNA). These antibiotic resistance alle...

  19. Factory waste influence on Elbrus adjacent area

    Complete text of publication follows. Two major burials of waste from concentrating mill of The Tyrnauz Tungsten-Molybdic Plant are situated at the recreation area of Elbrus adjacent territory. But it is significant that the strong winds periods are available here at the river Baksan valley constantly, which are transfers the particles of burials along that valley. The waste pollutes pastures and agricultural lands. The sampling of the buried material on the surface and of the soil of adjacent territory was fulfilled here in order to check up that assumption. The chemical analyses of the buried waste were performed at the X-ray spectrometer Philips PW2400. The results received showed the high quantity of some environmental threat elements. The soil sample analyses on 20 elements (including Ca, Ti, Mn, Fe, P, S, Cr, V, Co, Ni, Cu, Zn, Sr, Zr, Ba, Pb, As, Mo, W, Sn) showed the excess of maximum permissible concentrations (according to Russian Federation hygienic regulations 2.1.7.2041-06) of some investigated elements in the all researched samples. Some results of the investigations are shown below in the table 1. The excesses of maximum permissible concentrations were observed for phosphorus from 5.3 to 11.3 times as much; for sulphur from 3 to 8.75 times as much; for cobalt from 2.6 to 4.6 times as much; for nickel from 8.25 to 15.25 times as much; for copper from 9.3 to 22 times as much; for arsenic up to 10 and at one sample - to 28 times as much. At the MPC level was the lead contents and also at single instances - the manganese and vanadium contents. The excess of background contents were observed for molybdenum up to 8, tungsten - up to 38 and tin - up to 7 times as much. Presented data confirmed the supposition that buried waste pollutes pastures and agricultural lands of Elbrus adjacent area and that means the necessity of either more careful burial of these waste products, or their full recycling.

  20. Erythromycin binding is reduced in ribosomes with conformational alterations in the 23 S rRNA peptidyl transferase loop

    Douthwaite, S; Aagaard, C

    1993-01-01

    induced by mutations in the peptidyl transferase loop, and to determine how these changes affect drug interaction. Mutations at positions 2057 (G-->A) and 2058 (A-->G, or -->U), all of which confer drug resistance, induce a more open conformation in the peptidyl transferase loop. Erythromycin still...... protects against chemical modification in the mutant peptidyl transferase loops, but the affinity of the drug interaction is reduced 20-fold in the 2057A mutant, 10(3)-fold in the 2058U mutant and 10(4)-fold in the 2058G mutant. Single mutations at position 2032 in the adjacent hairpin loop, which have...... previously been shown to alter drug tolerances, gave no detectable effects on the structure of the peptidyl transferase loop or on erythromycin binding. Dual mutations at positions 2032 and 2058, however, induce a marked change in the rRNA conformation with opening of the phylogenetically conserved base...

  1. Seismicity in Azerbaijan and Adjacent Caspian Sea

    So far no general view on the geodynamic evolution of the Black Sea to the Caspian Sea region is elaborated. This is associated with the geological and structural complexities of the region revealed by geophysical, geochemical, petrologic, structural, and other studies. A clash of opinions on geodynamic conditions of the Caucasus region, sometimes mutually exclusive, can be explained by a simplified interpretation of the seismic data. In this paper I analyze available data on earthquake occurrences in Azerbaijan and the adjacent Caspian Sea region. The results of the analysis of macroseismic and instrumental data, seismic regime, and earthquake reoccurrence indicate that a level of seismicity in the region is moderate, and seismic event are concentrated in the shallow part of the lithosphere. Seismicity is mostly intra-plate, and spatial distribution of earthquake epicenters does not correlate with the plate boundaries

  2. Nucleotide sequence preservation of human mitochondrial DNA

    Recombinant DNA techniques have been used to quantitate the amount of nucleotide sequence divergence in the mitochondrial DNA population of individual normal humans. Mitochondrial DNA was isolated from the peripheral blood lymphocytes of five normal humans and cloned in M13 mp11; 49 kilobases of nucleotide sequence information was obtained from 248 independently isolated clones from the five normal donors. Both between- and within-individual differences were identified. Between-individual differences were identified in approximately = to 1/200 nucleotides. In contrast, only one within-individual difference was identified in 49 kilobases of nucleotide sequence information. This high degree of mitochondrial nucleotide sequence homogeneity in human somatic cells is in marked contrast to the rapid evolutionary divergence of human mitochondrial DNA and suggests the existence of mechanisms for the concerted preservation of mammalian mitochondrial DNA sequences in single organisms

  3. Sublingual nucleotides and immune response to exercise

    Ostojic Sergej M

    2012-07-01

    Full Text Available Abstract Evidence exists regarding the potential role of exogenous nucleotides as regulators of the immune function in physically active humans, yet the potential use of nucleotides has been hindered by their low bioavailability after oral administration. We conducted a double-blind, placebo-controlled, randomized trial to assess the effect of sublingual nucleotides (50 mg/day on salivary and serum immunity indicators as compared to placebo, both administered to healthy males aged 20 to 25 years for 14 days. Sublingual administration of nucleotides for 14 days increased serum immunoglobulin A, natural killer cells count and cytotoxic activity, and offset the post-exercise drop of salivary immunoglobulins and lactoferrin (P  0.05. It seems that sublingual administration of nucleotides for two weeks considerably affected immune function in healthy males.

  4. Discrimination of bacillus anthracis and closely related microorganisms by analysis of 16S and 23S rRNA with oligonucleotide microarray.

    Bavykin, S. G.; Mikhailovich, V. M.; Zakharyev, V. M.; Lysov, Y. P.; Kelly, J. J.; Alferov, O. S.; Jackman, J.; Stahl, D. A.; Mirzabekov, A. D.; Gavin, I. M.; Kukhtin, A. V.; Chandler, D. (Biochip Technology Center); (Engelhardt Inst. of Molecular Biology); (Northwestern Univ.); (Georgetown Univ.)

    2008-01-30

    Analysis of 16S rRNA sequences is a commonly used method for the identification and discrimination of microorganisms. However, the high similarity of 16S and 23S rRNA sequences of Bacillus cereus group organisms (up to 99-100%) and repeatedly failed attempts to develop molecular typing systems that would use DNA sequences to discriminate between species within this group have resulted in several suggestions to consider B. cereus and B. thuringiensis, or these two species together with B. anthracis, as one species. Recently, we divided the B. cereus group into seven subgroups, Anthracis, Cereus A and B, Thuringiensis A and B, and Mycoides A and B, based on 16S rRNA, 23S rRNA and gyrB gene sequences and identified subgroup-specific makers in each of these three genes. Here we for the first time demonstrated discrimination of these seven subgroups, including subgroup Anthracis, with a 3D gel element microarray of oligonucleotide probes targeting 16S and 23S rRNA markers. This is the first microarray enabled identification of B. anthracis and discrimination of these seven subgroups in pure cell cultures and in environmental samples using rRNA sequences. The microarray bearing perfect match/mismatch (p/mm) probe pairs was specific enough to discriminate single nucleotide polymorphisms (SNPs) and was able to identify targeted organisms in 5 min. We also demonstrated the ability of the microarray to determine subgroup affiliations for B. cereus group isolates without rRNA sequencing. Correlation of these seven subgroups with groupings based on multilocus sequence typing (MLST), fluorescent amplified fragment length polymorphism analysis (AFLP) and multilocus enzyme electrophoresis (MME) analysis of a wide spectrum of different genes, and the demonstration of subgroup-specific differences in toxin profiles, psychrotolerance, and the ability to harbor some plasmids, suggest that these seven subgroups are not based solely on neutral genomic polymorphisms, but instead reflect

  5. Detecting Adjacent Relativity of Engineering Drawing Entities with Container Window

    林福严; 邱友申; 秦吉胜

    2001-01-01

    Automatic recognition and interpretation of engineering drawing plays an important role in computer aided engineering. Detecting the positional relation between entities is an important topic in this research field. In this paper the concepts of adjacent relativity and container window of drawing entities were proposed. By means of container window, the adjacent irrelative entities can be detected quickly and effectively, which speeds up the process of adjacent relativity detection. Meanwhile, the algorithm of adjacent relativity detection was discussed.

  6. 'View From A Bridge': A New Perspective on Eukaryotic rRNA Base Modification.

    Sharma, Sunny; Lafontaine, Denis L J

    2015-10-01

    Eukaryotic rRNA are modified frequently, although the diversity of modifications is low: in yeast rRNA, there are only 12 different types out of a possible natural repertoire exceeding 112. All nine rRNA base methyltransferases (MTases) and one acetyltransferase have recently been identified in budding yeast, and several instances of crosstalk between rRNA, tRNA, and mRNA modifications are emerging. Although the machinery has largely been identified, the functions of most rRNA modifications remain to be established. Remarkably, a eukaryote-specific bridge, comprising a single ribosomal protein (RP) from the large subunit (LSU), contacts four rRNA base modifications across the ribosomal subunit interface, potentially probing for their presence. We hypothesize in this article that long-range allosteric communication involving rRNA modifications is taking place between the two subunits during translation or, perhaps, the late stages of ribosome assembly. PMID:26410597

  7. Characterising the Canine Oral Microbiome by Direct Sequencing of Reverse-Transcribed rRNA Molecules.

    McDonald, James E; Larsen, Niels; Pennington, Andrea; Connolly, John; Wallis, Corrin; Rooks, David J; Hall, Neil; McCarthy, Alan J; Allison, Heather E

    2016-01-01

    PCR amplification and sequencing of phylogenetic markers, primarily Small Sub-Unit ribosomal RNA (SSU rRNA) genes, has been the paradigm for defining the taxonomic composition of microbiomes. However, 'universal' SSU rRNA gene PCR primer sets are likely to miss much of the diversity therein. We sequenced a library comprising purified and reverse-transcribed SSU rRNA (RT-SSU rRNA) molecules from the canine oral microbiome and compared it to a general bacterial 16S rRNA gene PCR amplicon library generated from the same biological sample. In addition, we have developed BIONmeta, a novel, open-source, computer package for the processing and taxonomic classification of the randomly fragmented RT-SSU rRNA reads produced. Direct RT-SSU rRNA sequencing revealed that 16S rRNA molecules belonging to the bacterial phyla Actinobacteria, Bacteroidetes, Firmicutes, Proteobacteria and Spirochaetes, were most abundant in the canine oral microbiome (92.5% of total bacterial SSU rRNA). The direct rRNA sequencing approach detected greater taxonomic diversity (1 additional phylum, 2 classes, 1 order, 10 families and 61 genera) when compared with general bacterial 16S rRNA amplicons from the same sample, simultaneously provided SSU rRNA gene inventories of Bacteria, Archaea and Eukarya, and detected significant numbers of sequences not recognised by 'universal' primer sets. Proteobacteria and Spirochaetes were found to be under-represented by PCR-based analysis of the microbiome, and this was due to primer mismatches and taxon-specific variations in amplification efficiency, validated by qPCR analysis of 16S rRNA amplicons from a mock community. This demonstrated the veracity of direct RT-SSU rRNA sequencing for molecular microbial ecology. PMID:27276347

  8. Analysis of RAPD and mitochondrial 16S rRNA gene sequences from Trichiurus lepturus and Eupleurogrammus muticus in the Yellow Sea

    MENG Zining; ZHUANG Zhimeng; JIN Xianshi; TANG Qisheng; SU Yongquan

    2004-01-01

    Random amplified polymorphic DNA (RAPD) technique is applied to 12 individuals from each species of the hairtail fishes Trichiurus lepturus and Eupleurogrammus muticus in the Yellow Sea. The percentage of polymorphic sites, degree of genetic polymorphism and genetic distance are compared and the phylogenetic tree is constructed by Neighbor-joining method. The partial mitochondrial 16S rRNA gene is amplified by polymerase chain reaction (PCR) and the PCR products are directly sequenced after being purified. These sequences, together with the homologous sequences of another Trichiuridae species Lepidopus caudatus obtained from GenBank, are used to analyze nucleotide difference and to construct a UPGMA phylogenetic tree by means of biological informatics. Analysis shows: (1) the RAPD technique is a highly sensitive method for investigating genetic diversity in T. lepturus, and E. muticus. T. lepturus exhibits a lower polymorphism and genetic diversity than E. muticus; (2) according to the analysis of the partial mitochondrial 16S rRNA gene sequences, a very low intraspecific variation and considerably high divergence among species were found, which reveals a dual nature of conservatism and variability in mitochondrial 16S rRNA gene; (3) five primers generate the species-specific RAPD sites and these sites can be served as the molecular markers for species identification and (4) it can be proved at DNA variation level that T. lepturus and E. muticus are of two species respectively pertaining to different genera, which supports the Nelson taxonomic conclusion.

  9. Nucleotide Salvage Deficiencies, DNA Damage and Neurodegeneration

    Michael Fasullo

    2015-04-01

    Full Text Available Nucleotide balance is critically important not only in replicating cells but also in quiescent cells. This is especially true in the nervous system, where there is a high demand for adenosine triphosphate (ATP produced from mitochondria. Mitochondria are particularly prone to oxidative stress-associated DNA damage because nucleotide imbalance can lead to mitochondrial depletion due to low replication fidelity. Failure to maintain nucleotide balance due to genetic defects can result in infantile death; however there is great variability in clinical presentation for particular diseases. This review compares genetic diseases that result from defects in specific nucleotide salvage enzymes and a signaling kinase that activates nucleotide salvage after DNA damage exposure. These diseases include Lesch-Nyhan syndrome, mitochondrial depletion syndromes, and ataxia telangiectasia. Although treatment options are available to palliate symptoms of these diseases, there is no cure. The conclusions drawn from this review include the critical role of guanine nucleotides in preventing neurodegeneration, the limitations of animals as disease models, and the need to further understand nucleotide imbalances in treatment regimens. Such knowledge will hopefully guide future studies into clinical therapies for genetic diseases.

  10. Phylogenetic and genetic diversity analysis in Leptospira species based on the sequence homology pattern of 16S rRNA gene

    Pasupuleti Sreenivasa Rao

    2013-08-01

    Full Text Available Leptospirosis is a bacterial zoonosis, caused by pathogenic spirochete which belongs to the genus Leptospira. It exists in diverse ecological habitats and affects almost all the mammals including humans. Several online databases like NCBI etc will provide the complete genomic sequence data of various Leptospira species. However, the Phylogenetic and genetic diversity Analysis in Leptospira species based on 16S rRNA gene has not studied in detail. Therefore the present study was conducted. Sequences of various species related to genus Leptospira obtained from the NCBI database etc and aligned (CLUSTAL_X. Two Phylogenetic trees were constructed (MEGA-5 in which the first one is related to various serovars of L. interrogans and the other is related to various species of Leptospira. The Phylogenetic trees revealed the relationship and genetic diversity of various serovars of L. interrogans and the other Leptospira species, with their nearest phylogenetic relatives. In the first tree, two major clades were observed which were named as A and B, whereas in the second tree, three major clades were observed and named as A, B and C respectively. Aquifex pyrophilus strain has been used for out grouping in both the trees. The genetic distance between the species in the phylogenetic tree is presented by a bar which represents 0.5 nucleotide substitutions per alignment position in the 16S rRNA gene sequence among the various serovars of L. interrogans while 0.05 nucleotide substitutions in case of various species related to the genus Leptospira. Thus, the findings from the above study confirm that the genus Leptospira exhibits genetic diversity in the 16S rRNA gene. [Int J Res Med Sci 2013; 1(4.000: 369-377

  11. Effects of nucleotides and nucleosides on coagulation

    Bune, Laurids; Thaning, Pia; Johansson, Pär I;

    2010-01-01

    Nucleotides, including ADP, ATP and uridine triphosphate (UTP), are discharged profusely in the circulation during many pathological conditions including sepsis. Sepsis can cause hypotension and systemic activation of the coagulation and fibrinolytic systems in humans, which may cause disseminate...

  12. Nucleotide excision repair in the test tube.

    N.G.J. Jaspers (Nicolaas); J.H.J. Hoeijmakers (Jan)

    1995-01-01

    textabstractThe eukaryotic nucleotide excision-repair pathway has been reconstituted in vitro, an achievement that should hasten the full enzymological characterization of this highly complex DNA-repair pathway.

  13. In vitro incorporation of LNA nucleotides.

    Veedu, Rakesh N; Vester, Birte; Wengel, Jesper

    2007-01-01

    An LNA modified nucleoside triphosphate 1 was synthesized in order to investigate its potential to act as substrate for DNA strand synthesis by polymerases. Primer extension assays for the incorporation experiments revealed that Phusion High Fidelity DNA polymerase is an efficient enzyme for incorporation of the LNA nucleotide and for extending strand to full length. It was also observed that pfu DNA polymerase could incorporate the LNA nucleotide but it failed to extend the strand to a full length product. PMID:18058567

  14. Nucleotide Capacitance Calculation for DNA Sequencing

    Lu, Jun-Qiang; Zhang, X.-G.

    2008-01-01

    Using a first-principles linear response theory, the capacitance of the DNA nucleotides, adenine, cytosine, guanine, and thymine, are calculated. The difference in the capacitance between the nucleotides is studied with respect to conformational distortion. The result suggests that although an alternate current capacitance measurement of a single-stranded DNA chain threaded through a nanogap electrode may not be sufficient to be used as a standalone method for rapid DNA sequencing, the capaci...

  15. Analysis of Sequence Conservation at Nucleotide Resolution

    Asthana, Saurabh; Roytberg, Mikhail; Stamatoyannopoulos, John; Sunyaev, Shamil R.

    2007-01-01

    One of the major goals of comparative genomics is to understand the evolutionary history of each nucleotide in the human genome sequence, and the degree to which it is under selective pressure. Ascertainment of selective constraint at nucleotide resolution is particularly important for predicting the functional significance of human genetic variation and for analyzing the sequence substructure of cis-regulatory sequences and other functional elements. Current methods for analysis of sequence ...

  16. High throughput 16S rRNA gene amplicon sequencing

    Nierychlo, Marta; Larsen, Poul; Jørgensen, Mads Koustrup;

    S rRNA gene amplicon sequencing has been developed over the past few years and is now ready to use for more comprehensive studies related to plant operation and optimization thanks to short analysis time, low cost, high throughput, and high taxonomic resolution. In this study we show how 16S r...... belonging to the phylum Chloroflexi. Based on knowledge about their ecophysiology, other control measures were introduced and the bulking problem was reduced after 2 months. Besides changes in the filament abundance and composition also other changes in the microbial community were observed that likely...... correlated with the bacterial species composition in 25 Danish full-scale WWTPs with nutrient removal. Examples of properties were SVI, filament index, floc size, floc strength, content of cations and amount of extracellular polymeric substances. Multivariate statistics provided several important insights...

  17. Evaluation of the 16S and 12S rRNA genes as universal markers for the identification of commercial fish species in South Africa.

    Cawthorn, Donna-Mareè; Steinman, Harris Andrew; Witthuhn, R Corli

    2012-01-01

    The development of DNA-based methods for the identification of fish species is important for fisheries research and control, as well as for the detection of unintentional or fraudulent species substitutions in the marketplace. The aim of this study was to generate a comprehensive reference database of DNA sequences from the mitochondrial 16S and 12S ribosomal RNA (rRNA) genes for 53 commercial fish species in South Africa and to evaluate the applicability of these genetic markers for the identification of fish at the species level. The DNA extracted from all target species was readily amplified using universal primers targeting both rRNA gene regions. Sequences from the 16S and 12S rRNA genes were submitted to GenBank for the first time for 34% and 53% of the fish species, respectively. Cumulative analysis of the 16S rRNA gene sequences revealed mean conspecific, congeneric and confamilial Kimura two parameter (K2P) distances of 0.03%, 0.70% and 5.10% and the corresponding values at the 12S level were 0.03%, 1.00% and 5.57%. K2P neighbour-joining trees based on both sequence datasets generally clustered species in accordance with their taxonomic classifications. The nucleotide variation in both the 16S and 12S sequences was suitable for identifying the large majority of the examined fish specimens to at least the level of genus, but was found to be less useful for the explicit differentiation of certain congeneric fish species. It is recommended that one or more faster-evolving DNA regions be analysed to confirm the identities of closely-related fish species in South Africa. PMID:21963445

  18. Regulation of mammalian nucleotide metabolism and biosynthesis.

    Lane, Andrew N; Fan, Teresa W-M

    2015-02-27

    Nucleotides are required for a wide variety of biological processes and are constantly synthesized de novo in all cells. When cells proliferate, increased nucleotide synthesis is necessary for DNA replication and for RNA production to support protein synthesis at different stages of the cell cycle, during which these events are regulated at multiple levels. Therefore the synthesis of the precursor nucleotides is also strongly regulated at multiple levels. Nucleotide synthesis is an energy intensive process that uses multiple metabolic pathways across different cell compartments and several sources of carbon and nitrogen. The processes are regulated at the transcription level by a set of master transcription factors but also at the enzyme level by allosteric regulation and feedback inhibition. Here we review the cellular demands of nucleotide biosynthesis, their metabolic pathways and mechanisms of regulation during the cell cycle. The use of stable isotope tracers for delineating the biosynthetic routes of the multiple intersecting pathways and how these are quantitatively controlled under different conditions is also highlighted. Moreover, the importance of nucleotide synthesis for cell viability is discussed and how this may lead to potential new approaches to drug development in diseases such as cancer. PMID:25628363

  19. Fragmentation of 23S rRNA in Strains of Proteus and Providencia Results from Intervening Sequences in the rrn (rRNA) Genes

    Miller, Wayne L.; Pabbaraju, Kanti; Sanderson, Kenneth E.

    2000-01-01

    Intervening sequences (IVSs) were originally identified in the rrl genes for 23S rRNA (rrl genes, for large ribosomal subunit, part of rrn operon encoding rRNA) of Salmonella enterica serovars Typhimurium LT2 and Arizonae. These sequences are transcribed but later removed during RNase III processing of the rRNA, resulting in fragmentation of the 23S species; IVSs are uncommon, but have been reported in at least 10 bacterial genera. Through PCR amplification of IVS-containing regions of the rr...

  20. Louse (Insecta : Phthiraptera) mitochondrial 12S rRNA secondary structure is highly variable

    Page, R.D.M.; Cruickshank, R.; Johnson, K P

    2002-01-01

    Lice are ectoparasitic insects hosted by birds and mammals. Mitochondrial 12S rRNA sequences obtained from lice show considerable length variation and are very difficult to align. We show that the louse 12S rRNA domain III secondary structure displays considerable variation compared to other insects, in both the shape and number of stems and loops. Phylogenetic trees constructed from tree edit distances between louse 12S rRNA structures do not closely resemble trees constructed from sequence ...

  1. PIV Measurements and Mechanisms of Adjacent Synthetic Jets Interactions

    LUO Zhen-Bing; XIA Zhi-Xun

    2008-01-01

    Interactions of adjacent synthetic jet actuators with varying relative amplitude and the relative phase of driving voltage are measured using a particle image velocimetry(PIV).Varying relative amplitude or relative phase of driving voltage of the adjacent actuators vectors the direction of the ensuing merged jet of the adjacent synthetic jets.The vectoring mechanism of the adjacent vortex pairs,attract-impact causing deflection(AICD),is provided to explain why the merged jet is generally vectored to the side of the phase-leading synthetic jet or the synthetic jet with higher driving voltage.

  2. Structural basis for a six nucleotide genetic alphabet.

    Georgiadis, Millie M; Singh, Isha; Kellett, Whitney F; Hoshika, Shuichi; Benner, Steven A; Richards, Nigel G J

    2015-06-01

    Expanded genetic systems are most likely to work with natural enzymes if the added nucleotides pair with geometries that are similar to those displayed by standard duplex DNA. Here, we present crystal structures of 16-mer duplexes showing this to be the case with two nonstandard nucleobases (Z, 6-amino-5-nitro-2(1H)-pyridone and P, 2-amino-imidazo[1,2-a]-1,3,5-triazin-4(8H)one) that were designed to form a Z:P pair with a standard "edge on" Watson-Crick geometry, but joined by rearranged hydrogen bond donor and acceptor groups. One duplex, with four Z:P pairs, was crystallized with a reverse transcriptase host and adopts primarily a B-form. Another contained six consecutive Z:P pairs; it crystallized without a host in an A-form. In both structures, Z:P pairs fit canonical nucleobase hydrogen-bonding parameters and known DNA helical forms. Unique features include stacking of the nitro group on Z with the adjacent nucleobase ring in the A-form duplex. In both B- and A-duplexes, major groove widths for the Z:P pairs are approximately 1 Å wider than those of comparable G:C pairs, perhaps to accommodate the large nitro group on Z. Otherwise, ZP-rich DNA had many of the same properties as CG-rich DNA, a conclusion supported by circular dichroism studies in solution. The ability of standard duplexes to accommodate multiple and consecutive Z:P pairs is consistent with the ability of natural polymerases to biosynthesize those pairs. This, in turn, implies that the GACTZP synthetic genetic system can explore the entire expanded sequence space that additional nucleotides create, a major step forward in this area of synthetic biology. PMID:25961938

  3. Proofreading of misincorporated nucleotides in DNA transcription.

    Voliotis, Margaritis; Cohen, Netta; Molina-París, Carmen; Liverpool, Tanniemola B

    2012-06-01

    The accuracy of DNA transcription is crucial for the proper functioning of the cell. Although RNA polymerases demonstrate selectivity for correct nucleotides, additional active mechanisms of transcriptional error correction are required to achieve observed levels of fidelity. Recent experimental findings have shed light on a particular mechanism of transcriptional error correction involving: (i) diffusive translocation of the RNA polymerase along the DNA (backtracking) and (ii) irreversible RNA cleavage. This mechanism achieves preferential cleavage of misincorporated nucleotides by biasing the local rates of translocation. Here, we study how misincorporated nucleotides affect backtracking dynamics and how this effect determines the level of transcriptional fidelity. We consider backtracking as a diffusive process in a periodic, one-dimensional energy landscape, which at a coarse-grained level gives rise to a hopping process between neighboring local minima. We propose a model for how misincorporated nucleotides deform this energy landscape and hence affect the hopping rates. In particular, we show that this model can be used to derive both the theoretical limit on the fidelity (i.e. the minimum fraction of misincorporated nucleotides) and the actual fidelity relative to this optimum, achieved for specific combinations of the cleavage and polymerization rates. Finally, we study how external factors influencing backtracking dynamics affect transcriptional fidelity. We show that biologically relevant loads, similar to those exerted by nucleosomes or other transcriptional barriers, increase error correction. PMID:22643861

  4. Design and synthesis of ATP-based nucleotide analogues and profiling of nucleotide-binding proteins

    Wolters, Justina. C.; Roelfes, Johannes; Poolman, Bert

    2011-01-01

    Two nucleotide-based probes were designed and synthesized in order to enrich samples for specific classes of proteins by affinity-based protein profiling. We focused on the profiling of adenine nucleotide-binding proteins. Two properties were considered in the design of the probes: the bait needs to

  5. Eukaryotic rRNA Modification by Yeast 5-Methylcytosine-Methyltransferases and Human Proliferation-Associated Antigen p120.

    Gabrielle Bourgeois

    Full Text Available Modified nucleotide 5-methylcytosine (m5C is frequently present in various eukaryotic RNAs, including tRNAs, rRNAs and in other non-coding RNAs, as well as in mRNAs. RNA:m5C-methyltranferases (MTases Nop2 from S. cerevisiae and human proliferation-associated nucleolar antigen p120 are both members of a protein family called Nop2/NSUN/NOL1. Protein p120 is well-known as a tumor marker which is over-expressed in various cancer tissues. Using a combination of RNA bisulfite sequencing and HPLC-MS/MS analysis, we demonstrated here that p120 displays an RNA:m5C- MTase activity, which restores m5C formation at position 2870 in domain V of 25S rRNA in a nop2Δ yeast strain. We also confirm that yeast proteins Nop2p and Rcm1p catalyze the formation of m5C in domains V and IV, respectively. In addition, we do not find any evidence of m5C residues in yeast 18S rRNA. We also performed functional complementation of Nop2-deficient yeasts by human p120 and studied the importance of different sequence and structural domains of Nop2 and p120 for yeast growth and m5C-MTase activity. Chimeric protein formed by Nop2 and p120 fragments revealed the importance of Nop2 N-terminal domain for correct protein localization and its cellular function. We also validated that the presence of Nop2, rather than the m5C modification in rRNA itself, is required for pre-rRNA processing. Our results corroborate that Nop2 belongs to the large family of pre-ribosomal proteins and possesses two related functions in pre-rRNA processing: as an essential factor for cleavages and m5C:RNA:modification. These results support the notion of quality control during ribosome synthesis by such modification enzymes.

  6. On spectral hypergraph theory of the adjacency tensor

    Pearson, Kelly J.; Zhang, Tan

    2012-01-01

    We study both $H$ and $E/Z$-eigenvalues of the adjacency tensor of a uniform multi-hypergraph and give conditions for which the largest positive $H$ or $Z$-eigenvalue corresponds to a strictly positive eigenvector. We also investigate when the $E$-spectrum of the adjacency tensor is symmetric.

  7. Novel mutation in 16S rRNA associated with streptomycin dependence in Mycobacterium tuberculosis.

    Honoré, N; Marchal, G.; Cole, S T

    1995-01-01

    Molecular characterization of a streptomycin-dependent mutant of Mycobacterium tuberculosis revealed the presence of a novel mutation in the rrs gene encoding 16S rRNA. Insertion of an additional cytosine in the 530 loop of 16S rRNA, a region known to be involved in streptomycin susceptibility and resistance, was associated with streptomycin dependence.

  8. Study on Optimization of Phase Offset at Adjacent Intersections

    Yuanli GU

    2010-11-01

    Full Text Available Optimization of the phase offset at adjacent intersections is the key parameter regarding coordinated control of traffic signal for adjacent intersections, which decides the effect of the coordinated control for adjacent intersections. According to characters of saturated traffic flow of Chinese urban road, this thesis establishes a model for optimization of phase offset for adjacent interactions and finds a solution from such model by adopting genetic algorithm. The model is verified by actual traffic flow datum of two adjacent signal intersections on Changan Avenue. Then a comparison is made between the optimization result of such model and that of the existing mathematical method and SYNCHRO model, which indicates that the model established by this thesis can reduce the delay suffered by vehicles at the intersections and increase the traffic efficiency of the intersections.

  9. Exploiting the CRISPR/Cas9 PAM Constraint for Single-Nucleotide Resolution Interventions.

    Yi Li

    Full Text Available CRISPR/Cas9 is an enabling RNA-guided technology for genome targeting and engineering. An acute DNA binding constraint of the Cas9 protein is the Protospacer Adjacent Motif (PAM. Here we demonstrate that the PAM requirement can be exploited to specifically target single-nucleotide heterozygous mutations while exerting no aberrant effects on the wild-type alleles. Specifically, we target the heterozygous G13A activating mutation of KRAS in colorectal cancer cells and we show reversal of drug resistance to a MEK small-molecule inhibitor. Our study introduces a new paradigm in genome editing and therapeutic targeting via the use of gRNA to guide Cas9 to a desired protospacer adjacent motif.

  10. Exploiting the CRISPR/Cas9 PAM Constraint for Single-Nucleotide Resolution Interventions

    Li, Yi; Mendiratta, Saurabh; Ehrhardt, Kristina; Kashyap, Neha; White, Michael A.; Bleris, Leonidas

    2016-01-01

    CRISPR/Cas9 is an enabling RNA-guided technology for genome targeting and engineering. An acute DNA binding constraint of the Cas9 protein is the Protospacer Adjacent Motif (PAM). Here we demonstrate that the PAM requirement can be exploited to specifically target single-nucleotide heterozygous mutations while exerting no aberrant effects on the wild-type alleles. Specifically, we target the heterozygous G13A activating mutation of KRAS in colorectal cancer cells and we show reversal of drug resistance to a MEK small-molecule inhibitor. Our study introduces a new paradigm in genome editing and therapeutic targeting via the use of gRNA to guide Cas9 to a desired protospacer adjacent motif. PMID:26788852

  11. The effect of secondary compounds on the rumen microbial population structure measured by 16S rRNA and 18S rRNA

    Full text: Plant secondary compounds in the forages have an important role in determining forage quality. A method for evaluating their effects on microbial population structure was carried out using the in vitro gas syringe system followed by extraction of RNA and gel separation of 16S rRNA and 18S rRNA. Quantification of 16S rRNA and 18S rRNA bands indicated the prokaryote and eukaryote populations, respectively. Five types of plant materials, i.e. Nothopanax scutellarium (Mangkokan) leaves, Morinda citrifolia (Mengkudu) fruit, Sapindus rarak (lerak) fruit and two types of Sesbania sesban leaves (hgh saponin and low saponin) were tested and Pennisetum purpureum (rumput gajah, Indonesian name) was used as a control roughage. Presence of saponin in these plant materials was determined qualitatively by thin layer chromatography. Eukaryote population was found to be significantly affected by the above plant materials. Both types of S. sesban leaves caused total elimination of eukaryotes. S. rarak reduced both eukaryote and prokaryote populations. The observed inhibition of eukaryote population might be due to the presence of saponin in these plant materials. In another experiment, a methanol extract of S. rarak which contained saponin was included and its effect on in vitro fermentation of P. purpureum was evaluated. The results showed that at higher levels of inclusion of S. rarak methanol extract, eukaroytes were totally eliminated. Comparison was made between microbial mass calculated based on difference between apparent undigested residue and true undigested residue and microbial mass calculations based on 16S rRNA and 18S rRNA. Microbial mass calculated by difference method was much higher than the microbial mass calculated on the basis of 16S rRNA and 18S rRNA. The quantification of RNA can be a useful and rapid technique for an accurate assessment of the effect of new forage materials on the microbial population structure. Other parameters from in vitro

  12. Pyrrolidine analogues of nucleosides and nucleotides

    Rejman, Dominik; Pohl, Radek; Kovačková, Soňa; Kočalka, Petr; Švenková, Alžběta; Šanderová, Hana; Krásný, Libor; Rosenberg, Ivan

    -, č. 52 (2008), s. 577-578. ISSN 0261-3166. [Joint Symposium of the International Roundtable on Nucleosides, Nucleotides and Nucleic Acids /18./ and the International Symposium on Nucleic Acid Chemistry /35./. Kyoto, 08.09.2008-12.09.2008] R&D Projects: GA MŠk(CZ) LC06077; GA MŠk 2B06065; GA MZd NR9138 Institutional research plan: CEZ:AV0Z40550506; CEZ:AV0Z50200510; CEZ:AV0Z50520514 Keywords : pyrrolidine * nucleoside * nucleotide Subject RIV: CC - Organic Chemistry

  13. Subnuclear partitioning of rRNA genes between the nucleolus and nucleoplasm reflects alternative epiallelic states

    Pontvianne, Frederic; Blevins, Todd; Chandrasekhara, Chinmayi; Mozgová, Iva; Hassel, Christiane; Pontes, Olga M.F.; Tucker, Sarah; Mokroš, Petr; Muchová, Veronika; Fajkus, Jiří; Pikaard, Craig S.

    2013-01-01

    Eukaryotes can have thousands of 45S ribosomal RNA (rRNA) genes, many of which are silenced during development. Using fluorescence-activated sorting techniques, we show that active rRNA genes in Arabidopsis thaliana are present within sorted nucleoli, whereas silenced rRNA genes are excluded. DNA methyltransferase (met1), histone deacetylase (hda6), or chromatin assembly (caf1) mutants that disrupt silencing abrogate this nucleoplasmic–nucleolar partitioning. Bisulfite sequencing data indicate that active nucleolar rRNA genes are nearly completely demethylated at promoter CGs, whereas silenced genes are nearly fully methylated. Collectively, the data reveal that rRNA genes occupy distinct but changeable nuclear territories according to their epigenetic state. PMID:23873938

  14. Phylogenetic Analysis of Particle-Attached and Free-Living Bacterial Communities in the Columbia River, Its Estuary, and the Adjacent Coastal Ocean

    Crump, Byron C.; Armbrust, E. Virginia; Baross, John A.

    1999-01-01

    The Columbia River estuary is a dynamic system in which estuarine turbidity maxima trap and extend the residence time of particles and particle-attached bacteria over those of the water and free-living bacteria. Particle-attached bacteria dominate bacterial activity in the estuary and are an important part of the estuarine food web. PCR-amplified 16S rRNA genes from particle-attached and free-living bacteria in the Columbia River, its estuary, and the adjacent coastal ocean were cloned, and 2...

  15. The influence of different land uses on the structure of archaeal communities in Amazonian anthrosols based on 16S rRNA and amoA genes.

    Taketani, Rodrigo Gouvêa; Tsai, Siu Mui

    2010-05-01

    Soil from the Amazonian region is usually regarded as unsuitable for agriculture because of its low organic matter content and low pH; however, this region also contains extremely rich soil, the Terra Preta Anthrosol. A diverse archaeal community usually inhabits acidic soils, such as those found in the Amazon. Therefore, we hypothesized that this community should be sensitive to changes in the environment. Here, the archaeal community composition of Terra Preta and adjacent soil was examined in four different sites in the Brazilian Amazon under different anthropic activities. The canonical correspondence analysis of terminal restriction fragment length polymorphisms has shown that the archaeal community structure was mostly influenced by soil attributes that differentiate the Terra Preta from the adjacent soil (i.e., pH, sulfur, and organic matter). Archaeal 16S rRNA gene clone libraries indicated that the two most abundant genera in both soils were Candidatus nitrosphaera and Canditatus nitrosocaldus. An ammonia monoxygenase gene (amoA) clone library analysis indicated that, within each site, there was no significant difference between the clone libraries of Terra Preta and adjacent soils. However, these clone libraries indicated there were significant differences between sites. Quantitative PCR has shown that Terra Preta soils subjected to agriculture displayed a higher number of amoA gene copy numbers than in adjacent soils. On the other hand, soils that were not subjected to agriculture did not display significant differences on amoA gene copy numbers between Terra Preta and adjacent soils. Taken together, our findings indicate that the overall archaeal community structure in these Amazonian soils is determined by the soil type and the current land use. PMID:20204349

  16. Delayed acquisition of non-adjacent vocalic distributional regularities.

    Gonzalez-Gomez, Nayeli; Nazzi, Thierry

    2016-01-01

    The ability to compute non-adjacent regularities is key in the acquisition of a new language. In the domain of phonology/phonotactics, sensitivity to non-adjacent regularities between consonants has been found to appear between 7 and 10 months. The present study focuses on the emergence of a posterior-anterior (PA) bias, a regularity involving two non-adjacent vowels. Experiments 1 and 2 show that a preference for PA over AP (anterior-posterior) words emerges between 10 and 13 months in French-learning infants. Control experiments show that this bias cannot be explained by adjacent or positional preferences. The present study demonstrates that infants become sensitive to non-adjacent vocalic distributional regularities between 10 and 13 months, showing the existence of a delay for the acquisition of non-adjacent vocalic regularities compared to equivalent non-adjacent consonantal regularities. These results are consistent with the CV hypothesis, according to which consonants and vowels play different roles at different linguistic levels. PMID:25786491

  17. Interactions of adjacent pulsating, erupting and creeping solitons

    Song Li-Jun; Li Lu; Zhou Guo-Sheng

    2007-01-01

    This paper investigates the adjacent interactions of three novel solitons for the quintic complex Ginzburg-Landau equation, which are plain pulsating, erupting and creeping solitons. It is found that different performances are presented for different solitons due to isolated regions of the parameter space where they exist. For example, plain pulsating and erupting solitons exhibit mutual annihilation during collisions with the decrease of total energy, but for creeping soliton,the two adjacent pulses present soliton fusion without any loss of energy. Otherwise, the method for restraining the interactions is also found and it can suppress interacions between these two adjacent pulses effectively.

  18. Depletion of pre-16S rRNA in starved Escherichia coli cells.

    Cangelosi, G A; Brabant, W H

    1997-07-01

    Specific hybridization assays for intermediates in rRNA synthesis (pre-rRNA) may become useful for monitoring the growth activity of individual microbial species in complex natural systems. This possibility depends upon the assumption that rRNA processing in microbial cells continues after growth and pre-rRNA synthesis cease, resulting in drainage of the pre-rRNA pool. This is not the case in many eukaryotic cells, but less is known about the situation in bacteria. Therefore, we used DNA probes to measure steady-state cellular pre-16S rRNA pools during growth state transitions in Escherichia coli. Pre-16S rRNA became undetectable when cells entered the stationary phase on rich medium and was replenished upon restoration of favorable growth conditions. These fluctuations were of much greater magnitude than concurrent fluctuations in the mature 16S rRNA pool. The extent of pre-16S rRNA depletion depended upon the circumstances limiting growth. It was significantly more pronounced in carbon-energy-starved cells than in nitrogen-starved cells or in cells treated with energy uncouplers. In the presence of the transcriptional inhibitor rifampin, rates of pre-16S rRNA depletion in carbon-energy-starved cells and nitrogen-starved cells were similar, suggesting that the difference between these conditions resides primarily at the level of pre-rRNA synthesis. Chloramphenicol, which inhibits the final steps in rRNA maturation, halted pre-16S rRNA depletion under all conditions. The data show that E. coli cells continue to process pre-rRNA after growth and rrn operon transcription cease, leading to drainage of the pre-rRNA pool. This supports the feasibility of using pre-rRNA-targeted probes to monitor bacterial growth in natural systems, with the caveat that patterns of pre-rRNA depletion vary with the conditions limiting growth. PMID:9226253

  19. Griset: Pottery of the Great Basin and Adjacent Areas

    Forsyth, Donald W.

    1986-01-01

    Pottery of the Great Basin and Adjacent Areas. Suzanne Griset, ed. University of Utah Anthropological Papers No. Ill, 1986, 170 pp., 34 figs., 5 tables, annotated and indexed bibliography, $17.50 (paper).

  20. Sequencing of 16S rRNA Gene: A Rapid Tool for Identification of Bacillus anthracis

    Sacchi, Claudio T.; Whitney, Anne M.; Mayer, Leonard W.; Morey, Roger; Steigerwalt, Arnold; Boras, Ariana; Weyant, Robin S.; Popovic, Tanja

    2002-01-01

    In a bioterrorism event, a tool is needed to rapidly differentiate Bacillus anthracis from other closely related spore-forming Bacillus species. During the recent outbreak of bioterrorism-associated anthrax, we sequenced the 16S rRNA generom these species to evaluate the potential of 16S rRNA gene sequencing as a diagnostic tool. We found eight distinct 16S types among all 107 16S rRNA gene seqs fuences that differed from each other at 1 to 8 positions (0.06% to 0.5%). All 86 B. anthracis had...

  1. Purification, crystallization and preliminary X-ray diffraction analysis of the 23S rRNA methyltransferase RlmJ from Escherichia coli

    The 23S rRNA methyltransferase RlmJ from E. coli has been cloned, expressed, purified and crystallized. X-ray diffraction data to 1.85 Å resolution have been collected from the apo RlmJ crystals. Methyltransferase RlmJ uses the cofactor S-adenosylmethionine to methylate the exocyclic nitrogen N6 of nucleotide A2030 in 23S rRNA during ribosome assembly in Escherichia coli. RlmJ with a C-terminal hexahistidine tag was overexpressed in E. coli and purified as a monomer using Ni2+-affinity and size-exclusion chromatography. The recombinant RlmJ was crystallized using the sitting-drop vapour-diffusion method and a full data set was collected to 1.85 Å resolution from a single apo crystal. The crystals belonged to space group P21, with unit-cell parameters a = 46.9, b = 77.8, c = 82.5 Å, β = 104°. Data analysis suggested two molecules per asymmetric unit and a Matthews coefficient of 2.20 Å3 Da−1

  2. The Mycoplasma gallisepticum 16S-23S rRNA intergenic spacer region sequence as a novel tool for epizootiological studies.

    Raviv, Ziv; Callison, S; Ferguson-Noel, N; Laibinis, V; Wooten, R; Kleven, S H

    2007-06-01

    Mycoplasma gallisepticum (MG) contains two sets of rRNA genes (5S, 16S and 23S) in its genome, but only one of the two is organized in an operon cluster and contains a unique 660-nucleotide intergenic spacer region (IGSR) between the 16S and the 23S rRNA genes. We designed a polymerase chain reaction (PCR) for the specific amplification of the complete MG IGSR segment. The MG IGSR PCR was tested on 18 avian mollicute species and was confirmed as MG specific. The reaction sensitivity was demonstrated by comparing it to the well-established MG mgc2 PCR. The MG IGSR sequence was found to be highly variable (discrimination [D] index of 0.950) among a variety of MG laboratory strains, vaccine strains, and field isolates. The sequencing of the MG IGSR appears to be a valuable single-locus sequence typing (SLST) tool for MG isolate differentiation in diagnostic cases and epizootiological studies. PMID:17626483

  3. The phylogeny of Aerococcus and Pediococcus as determined by 16S rRNA sequence analysis: description of Tetragenococcus gen. nov.

    Collins, M D; Williams, A M; Wallbanks, S

    1990-08-01

    The phylogenetic interrelationships of the genera Pediococcus and Aerococcus were investigated using reverse transcriptase sequencing of 16S rRNA. The genus Pediococcus was found to be phylogenetically heterogeneous. The four species P. acidilactici, P. damnosus, P. parvulus and P. pentosaceus formed a phylogenetically distinct group. Within this pediococcal cluster, P. acidilactici was closely related to P. pentosaceus whereas P. damnosus showed a specific relationship with P. parvulus. The species P. dextrinicus, although showing significant sequence relatedness with these pediococcal species, was peripheral to the genus. Pediococcus halophilus exhibited low sequence homology with all of the species examined and formed a distinct line of descent. Pediococcus halophilus exhibited a closer affinity with enterococci and carnobacteria than with the other lactic acid bacteria. Pediococcus urinae-equi was phylogenetically very closely related to Aerococcus viridans. The 16S rRNA sequences of the type strains of these species differed by only two nucleotides (99.9% sequence homology) and clearly demonstrate that P. urinae-equi is a member of the genus Aerococcus. PMID:2227360

  4. Molecular analysis of 18S rRNA gene of Cryptosporidium parasites from patients living in Iran, Malawi, Nigeria and Vietnam.

    Ghaffari, Salman; Kalantari, Narges

    2012-01-01

    Cryptosporidium species are one of the most common causes of gastrointestinal infection in humans around the world. This study has aimed to investigate the hyper variable region of the 18S rRNA gene in Cryptosporidium for exact parasite identification. DNA was extracted from 26 fecal samples from which initially Cryptosporidium oocysts were identified by Ziehl-Neelsen acid-fast , Auramine phenol and ELISA techniques. Nested PCR, targeting the most polymorphic region of the 18S rRNA gene and genotyping was performed by restriction endonuclease digestion of the PCR product followed by nucleotide sequencing and phylogenic analysis. Among 26 isolates analyzed, three species of Cryptosporidium were identified; 38.5% of the isolates were C. hominis while 53.8% of the isolates were C. parvum and 7.7% of the isolates were C. meleagridis, which the last two species have the potentially zoonotic transmission. The only 11T subtype of C. hominis was demonstrated. These strains clustered distinctly into either human or animal origin regardless of the geographical origin, age, or immunity status of the patients. In summary, this work is the first report of C. meleagridis infecting human in Iran. Moreover, it suggested that multi-locus study of Cryptosporidium species in developing countries would be necessary to determine the extent of transmission of cryptosporidiosis in the populations. PMID:24551771

  5. The complete nucleotide sequence of the mitochondrial genome of the cabbage butterfly, Artogeia melete (Lepidoptera: Pieridae)

    Guiyun Hong; Shaotong Jiang; Miao Yu; Ying Yang; Feng Li; Fangsen Xue; Zhaojun Wei

    2009-01-01

    The complete mitochondrial genome (mitogenome) of Artogeia melete was determined as being composed of 15,140 bp, including 13 protein-coding genes (PCGs), 2rRNA genes, 22 tRNA genes, and one control region.The gene order of A. melete mitogenome is typical of Lepidoptera and differs from the insect ancestral type in the location of trnM. The A. melete mitogenome has a total of 119 bp of intergenic spacer sequences spread over 10 regions, ranging in sizes between 1 and 48 bp.The nucleotide composition of the A. melete mitogenome is also biased toward A + T nucleotides (79.77%),which is higher than that of Ochrogaster lunifer (77.84%), but lower than nine other lepidopterans sequenced. The PCGs have typical mitochondrial start codons, except for cox1, which contains the unusual CGA. The cox1, cox2, nad2, and had5 genes of the A.melete mitogenome have incomplete stop codons (T).The A. melete A + T-rich region contains some conserved structures that are similar to those found in other lepidopteran mitogenomes, including a structure combining the motif 'ATAGA', a 19-bp poly(T) stretch,a microsatellite (AT)n element, and a 9-bp poly(A)upstream trnM. The A. melete mitogenome contains a duplicated 36-bp repeat element, which consists of a 26-bp core sequence flanked by 10-bp perfectly inverted repeats.

  6. Pyrrolidine nucleotides conformationally constrained via hydrogen bonding

    Pohl, Radek; Poštová Slavětínská, Lenka; Rejman, Dominik

    Praha : Institute of Organic Chemistry and Biochemistry AS CR, v. v. i, 2014 - (Hocek, M.), s. 352-353 ISBN 978-80-86241-50-0. - (Collection Symposium Series. 14). [Symposium on Chemistry of Nucleic Acid Components /16./. Český Krumlov (CZ), 08.06.2014-13.06.2014] R&D Projects: GA ČR GA13-24880S Institutional support: RVO:61388963 Keywords : pyrrolidine nucleotides * PMEA * hydrogen bond Subject RIV: CC - Organic Chemistry

  7. Pyrrolidine nucleotide analogs with a tunable conformation

    Poštová Slavětínská, Lenka; Rejman, Dominik; Pohl, Radek

    2014-01-01

    Roč. 10, Aug 22 (2014), s. 1967-1980. ISSN 1860-5397 R&D Projects: GA ČR GA13-24880S Institutional support: RVO:61388963 Keywords : conformation * NMR * nucleic acids * nucleotide analog * phosphonic acid * pseudorotation * pyrrolidine Subject RIV: CC - Organic Chemistry Impact factor: 2.762, year: 2014 http://www.beilstein-journals.org/bjoc/single/articleFullText.htm?publicId=1860-5397-10-205

  8. Mitochondrial Adenine Nucleotide Transport and Cardioprotection

    Das, Samarjit; Steenbergen, Charles

    2011-01-01

    Mitochondria are highly metabolically active cell organelles that not only act as the powerhouse of the cell by supplying energy through ATP production, but also play a destructive role by initiating cell death pathways. Growing evidence recognizes that mitochondrial dysfunction is one of the major causes of cardiovascular disease. Under de-energized conditions, slowing of adenine nucleotide transport in and out of the mitochondria significantly attenuates myocardial ischemia-reperfusion inju...

  9. Nucleotide Manipulatives to Illustrate the Central Dogma

    Sonja B. Yung

    2015-08-01

    Full Text Available The central dogma is a core concept that is critical for introductory biology and microbiology students to master. However, students often struggle to conceptualize the processes involved, and fail to move beyond simply memorizing the basic facts. To encourage critical thinking, we have designed a set of magnetic nucleotide manipulatives that allow students to model DNA structure, along with the processes of replication, transcription, and translation.

  10. Nucleotide Manipulatives to Illustrate the Central Dogma†

    Sonja B. Yung; Todd P. Primm

    2015-01-01

    The central dogma is a core concept that is critical for introductory biology and microbiology students to master. However, students often struggle to conceptualize the processes involved, and fail to move beyond simply memorizing the basic facts. To encourage critical thinking, we have designed a set of magnetic nucleotide manipulatives that allow students to model DNA structure, along with the processes of replication, transcription, and translation.

  11. Investigation of molluscan phylogeny on the basis of 18S rRNA sequences.

    Winnepenninckx, B; Backeljau, T; De Wachter, R

    1996-12-01

    The 18S rRNA sequences of 12 molluscs, representing the extant classes Gastropoda, Bivalvia, Polyplacophora, Scaphopoda, and Caudofoveata, were determined and compared with selected known 18S rRNA sequences of Metazoa, including other Mollusca. These data do not provide support for a close relationship between Platyhelminthes (Turbellaria) and Mollusca, but rather suggest that the latter group belongs to a clade of eutrochozoan coelomates. The 18S rRNA data fail to recover molluscan, bivalve, or gastropod monophyly. However, the branching pattern of the eutrochozoan phyla and classes is unstable, probably due to the explosive Cambrian radiation during which these groups arose. Similarly, the 18S rRNA data do not provide a reliable signal for the molluscan interclass relationships. Nevertheless, we obtained strong preliminary support for phylogenetic inferences at more restricted taxonomic levels, such as the monophyly of Polyplacophora, Caenogastropoda, Euthyneura, Heterodonta, and Arcoida. PMID:8952075

  12. Phylogenetic relatedness determined between antibiotic resistance and 16S rRNA genes in actinobacteria

    Ságová-Marečková, M.; Ulanová, Dana; Šanderová, P.; Omelka, M.; Kameník, Zdeněk; Olšovská, J.; Kopecký, J.

    2015-01-01

    Roč. 15, APR 2015 (2015). ISSN 1471-2180 Institutional support: RVO:61388971 Keywords : Actinobacteria * 16S rRNA diversity * Resistance genes Subject RIV: EE - Microbiology , Virology Impact factor: 2.729, year: 2014

  13. Inhibition of Escherichia coli precursor-16S rRNA processing by mouse intestinal contents

    Licht, Tine Rask; Tolker-Nielsen, Tim; Holmstrøm, Kim; Krogfelt, Karen A.; Molin, Søren

    1999-01-01

    . We have applied fluorescence in situ hybridization of pre-16S rRNA to Escherichia coli cells growing in vitro in extracts from two different compartments of the mouse intestine: the caecal mucus layer, where E. coli grew rapidly, and the contents of the caecum, which supported much slower bacterial......The correlation between ribosome content and growth rate found in many bacterial species has proved useful for estimating the growth activity of individual cells by quantitative in situ rRNA hybridization. However, in dynamic environments, the stability of mature ribosomal RNA causes problems in...... using cellular rRNA contents for direct monitoring of bacterial growth activity in situ. In a recent paper, Cangelosi and Brabant suggested monitoring the content of precursors in rRNA synthesis (pre-rRNAs) as an alternative approach. These are rapidly broken down after the cessation of bacterial growth...

  14. Visualization of cyclic nucleotide dynamics in neurons

    Kirill eGorshkov

    2014-12-01

    Full Text Available The second messengers cAMP and cGMP transduce many neuromodulatory signals from hormones and neurotransmitters into specific functional outputs. Their production, degradation and signaling are spatiotemporally regulated to achieve high specificity in signal transduction. The development of genetically encodable fluorescent biosensors has provided researchers with useful tools to study these versatile second messengers and their downstream effectors with unparalleled spatial and temporal resolution in cultured cells and living animals. In this review, we introduce the general design of these fluorescent biosensors and describe several of them in more detail. Then we discuss a few examples of using cyclic nucleotide fluorescent biosensors to study regulation of neuronal function and finish with a discussion of advances in the field. Although there has been significant progress made in understanding how the specific signaling of cyclic nucleotide second messengers is achieved, the mechanistic details in complex cell types like neurons are only just beginning to surface. Current and future fluorescent protein reporters will be essential to elucidate the role of cyclic nucleotide signaling dynamics in the functions of individual neurons and their networks.

  15. Multiphasic interactions between nucleotides and target proteins

    Nissen, Per

    2016-01-01

    The nucleotides guanosine tetraphosphate (ppGpp) and guanosine pentaphosphate (pppGpp) bind to target proteins to promote bacterial survival (Corrigan et al. 2016). Thus, the binding of the nucleotides to RsgA, a GTPase, inhibits the hydrolysis of GTP. The dose response, taken to be curvilinear with respect to the logarithm of the inhibitor concentration, is instead much better (P<0.001 when the 6 experiments are combined) represented as multiphasic, with high to exceedingly high absolute r values for the straight lines, and with transitions in the form of non-contiguities (jumps). Profiles for the binding of radiolabeled nucleotides to HprT and Gmk, GTP synthesis enzymes, were, similarly, taken to be curvilinear with respect to the logarithm of the protein concentration. However, the profiles are again much better represented as multiphasic than as curvilinear (the P values range from 0.047 to <0.001 for each of the 8 experiments for binding of ppGpp and pppGpp to HprT). The binding of GTP to HprT and ...

  16. Type III effector activation via nucleotide binding, phosphorylation, and host target interaction.

    Darrell Desveaux

    2007-03-01

    Full Text Available The Pseudomonas syringae type III effector protein avirulence protein B (AvrB is delivered into plant cells, where it targets the Arabidopsis RIN4 protein (resistance to Pseudomonas maculicula protein 1 [RPM1]-interacting protein. RIN4 is a regulator of basal host defense responses. Targeting of RIN4 by AvrB is recognized by the host RPM1 nucleotide-binding leucine-rich repeat disease resistance protein, leading to accelerated defense responses, cessation of pathogen growth, and hypersensitive host cell death at the infection site. We determined the structure of AvrB complexed with an AvrB-binding fragment of RIN4 at 2.3 A resolution. We also determined the structure of AvrB in complex with adenosine diphosphate bound in a binding pocket adjacent to the RIN4 binding domain. AvrB residues important for RIN4 interaction are required for full RPM1 activation. AvrB residues that contact adenosine diphosphate are also required for initiation of RPM1 function. Nucleotide-binding residues of AvrB are also required for its phosphorylation by an unknown Arabidopsis protein(s. We conclude that AvrB is activated inside the host cell by nucleotide binding and subsequent phosphorylation and, independently, interacts with RIN4. Our data suggest that activated AvrB, bound to RIN4, is indirectly recognized by RPM1 to initiate plant immune system function.

  17. Functional interactions within 23S rRNA involving the peptidyltransferase center.

    Douthwaite, S

    1992-01-01

    A molecular genetic approach has been employed to investigate functional interactions within 23S rRNA. Each of the three base substitutions at guanine 2032 has been made. The 2032A mutation confers resistance to the antibiotics chloramphenicol and clindamycin, which interact with the 23S rRNA peptidyltransferase loop. All three base substitutions at position 2032 produce an erythromycin-hypersensitive phenotype. The 2032 substitutions were compared with and combined with a 12-bp deletion muta...

  18. A Sensitive Cyclic Nucleotide Phosphodiesterase Assay for Transient Enzyme Kinetics

    Lookeren Campagne, Michiel M. van; Haastert, Peter J.M. van

    1983-01-01

    A new assay for cyclic nucleotide phosphodiesterase has been developed by using reverse-phase column chromatography for the separation of product and substrate of the enzymatic reaction. The polar 5'-nucleotides are not retarded by the column, while the more lipophilic cyclic nucleotides bind to the

  19. Temporal distribution of bacterial community structure in the Changjiang Estuary hypoxia area and the adjacent East China Sea

    Bacterial community structure and the effects of environmental factors on the microbial community distribution were investigated in the Changjiang Estuary hypoxia area and its adjacent area in the East China Sea (ECS) in June, August and October, 2006. Profiles of bacterial communities were generated by denaturing gradient gel electrophoresis (DGGE) of 16S rRNA genes followed by DNA sequence analysis. The dominant bacterial groups were affiliated to Gammaproteobacteria, Cytophaga–Flavobacteria–Bacteroides (CFB), Deltaproteobacteria, Cyanobacteria and Firmicutes, which were mostly from the marine seawater ecosystem. Effects of environmental factors on the bacterial community distribution were analyzed by the ordination technique of canonical correspondence analysis (CCA). The environmental factors significantly influencing bacterial community structure were different in the three months; dissolved organic carbon (DOC) and temperature in June and nitrite in August. No environmental variables displayed significant influence on the bacterial community at the 5% level in October. The seasonal environmental heterogeneity in the Changjiang Estuary and the adjacent ECS, such as seasonal hydrodynamic conditions and riverine input of nutrients, might be the reason for the difference in the key environmental factors determining the bacterial community in the three months. (letter)

  20. Yersinia spp. Identification Using Copy Diversity in the Chromosomal 16S rRNA Gene Sequence.

    Hao, Huijing; Liang, Junrong; Duan, Ran; Chen, Yuhuang; Liu, Chang; Xiao, Yuchun; Li, Xu; Su, Mingming; Jing, Huaiqi; Wang, Xin

    2016-01-01

    API 20E strip test, the standard for Enterobacteriaceae identification, is not sufficient to discriminate some Yersinia species for some unstable biochemical reactions and the same biochemical profile presented in some species, e.g. Yersinia ferderiksenii and Yersinia intermedia, which need a variety of molecular biology methods as auxiliaries for identification. The 16S rRNA gene is considered a valuable tool for assigning bacterial strains to species. However, the resolution of the 16S rRNA gene may be insufficient for discrimination because of the high similarity of sequences between some species and heterogeneity within copies at the intra-genomic level. In this study, for each strain we randomly selected five 16S rRNA gene clones from 768 Yersinia strains, and collected 3,840 sequences of the 16S rRNA gene from 10 species, which were divided into 439 patterns. The similarity among the five clones of 16S rRNA gene is over 99% for most strains. Identical sequences were found in strains of different species. A phylogenetic tree was constructed using the five 16S rRNA gene sequences for each strain where the phylogenetic classifications are consistent with biochemical tests; and species that are difficult to identify by biochemical phenotype can be differentiated. Most Yersinia strains form distinct groups within each species. However Yersinia kristensenii, a heterogeneous species, clusters with some Yersinia enterocolitica and Yersinia ferderiksenii/intermedia strains, while not affecting the overall efficiency of this species classification. In conclusion, through analysis derived from integrated information from multiple 16S rRNA gene sequences, the discrimination ability of Yersinia species is improved using our method. PMID:26808495

  1. Nucleotide Excision Repair in Caenorhabditis elegans

    Hannes Lans; Wim Vermeulen

    2011-01-01

    Nucleotide excision repair (NER) plays an essential role in many organisms across life domains to preserve and faithfully transmit DNA to the next generation. In humans, NER is essential to prevent DNA damage-induced mutation accumulation and cell death leading to cancer and aging. NER is a versatile DNA repair pathway that repairs many types of DNA damage which distort the DNA helix, such as those induced by solar UV light. A detailed molecular model of the NER pathway has emerged from in vi...

  2. Nucleotide sequence of Klebsiella pneumoniae lac genes.

    Buvinger, W E; Riley, M

    1985-01-01

    The nucleotide sequences of the Klebsiella pneumoniae lacI and lacZ genes and part of the lacY gene were determined, and these genes were located and oriented relative to one another. The K. pneumoniae lac operon is divergent in that the lacI and lacZ genes are oriented head to head, and complementary strands are transcribed. Besides base substitutions, the lacZ genes of K. pneumoniae and Escherichia coli have suffered short distance shifts of reading frame caused by additions or deletions or...

  3. Histone displacement during nucleotide excision repair

    Dinant, C.; Bartek, J.; Bekker-Jensen, S.

    2012-01-01

    Nucleotide excision repair (NER) is an important DNA repair mechanism required for cellular resistance against UV light and toxic chemicals such as those found in tobacco smoke. In living cells, NER efficiently detects and removes DNA lesions within the large nuclear macromolecular complex called......, thus allowing repair proteins to efficiently access DNA. On the other hand, after completion of the repair, the chromatin must be returned to its previous undamaged state. Chromatin remodeling can refer to three separate but interconnected processes, histone post-translational modifications, insertion...

  4. Group edge choosability of planar graphs without adjacent short cycles

    Xin ZHANG; Liu, Guizhen

    2011-01-01

    In this paper, we aim to introduce the group version of edge coloring and list edge coloring, and prove that all 2-degenerate graphs along with some planar graphs without adjacent short cycles is group $(\\Delta(G)+1)$-edge-choosable while some planar graphs with large girth and maximum degree is group $\\Delta(G)$-edge-choosable.

  5. PROBABILISTIC ZONING OF ADJACENT CATCHMENTS BY PHYSICAL MODELING

    Yu. B. Andreev

    2015-11-01

    Full Text Available Now the probabilistic zoning of avalanche sites is being made either on the basis of the available field data, or using the mathematical and physical modeling of avalanche dynamics processes. The work purpose consisted in research of interaction and compiling probabilistic zoning maps of two adjacent avalanche sites by a physical modeling method. For the two adjacent sites № 9 and 10 on the slope of northern exposition ofTchegetMountain(Elbrus region,Caucasus the model of this slope with the scale of 1: 2 500 was created. The model dimension is 0,82 × 1,1 ×0,57 m. This model was produced using the 4-mm plywood sheets imposed against each other. The model horizontals correspond to the10 mnatural ones. The model slope was also surfaced by thin gypsum lay and then varnished. The fine-grained sawdust (0.1 mm with a natural friction angle of 43º has been chosen as the loose material modeling snow. A series of experiments on modeling avalanche releases from the two sites were carried out resulted in the measurements of avalanche deposit parameters such as run-out distance and length, width and thickness of deposits. The similarity criteria were used during the experiments. The morphometric features of adjacent sites interaction are revealed. The basic result of the carried out work will consist in the probabilistic zoning map of two adjacent sites № 9 and 10.

  6. Biogeochemistry of hydrothermally and adjacent non-altered soils

    As a field/lab project, students in the Soil Biogeochemistry class of the University of Nevada, Reno described and characterized seven pedons, developed in hydrothermally and adjacent non-hydrothermally altered andesitic parent material near Reno, NV. Hydrothermally altered soils had considerably lo...

  7. Classifying Coding DNA with Nucleotide Statistics

    Nicolas Carels

    2009-10-01

    Full Text Available In this report, we compared the success rate of classification of coding sequences (CDS vs. introns by Codon Structure Factor (CSF and by a method that we called Universal Feature Method (UFM. UFM is based on the scoring of purine bias (Rrr and stop codon frequency. We show that the success rate of CDS/intron classification by UFM is higher than by CSF. UFM classifies ORFs as coding or non-coding through a score based on (i the stop codon distribution, (ii the product of purine probabilities in the three positions of nucleotide triplets, (iii the product of Cytosine (C, Guanine (G, and Adenine (A probabilities in the 1st, 2nd, and 3rd positions of triplets, respectively, (iv the probabilities of G in 1st and 2nd position of triplets and (v the distance of their GC3 vs. GC2 levels to the regression line of the universal correlation. More than 80% of CDSs (true positives of Homo sapiens (>250 bp, Drosophila melanogaster (>250 bp and Arabidopsis thaliana (>200 bp are successfully classified with a false positive rate lower or equal to 5%. The method releases coding sequences in their coding strand and coding frame, which allows their automatic translation into protein sequences with 95% confidence. The method is a natural consequence of the compositional bias of nucleotides in coding sequences.

  8. Chromosomal localization and sequence variation of 5S rRNA gene in five Capsicum species.

    Park, Y K; Park, K C; Park, C H; Kim, N S

    2000-02-29

    Chromosomal localization and sequence analysis of the 5S rRNA gene were carried out in five Capsicum species. Fluorescence in situ hybridization revealed that chromosomal location of the 5S rRNA gene was conserved in a single locus at a chromosome which was assigned to chromosome 1 by the synteny relationship with tomato. In sequence analysis, the repeating units of the 5S rRNA genes in the Capsicum species were variable in size from 278 bp to 300 bp. In sequence comparison of our results to the results with other Solanaceae plants as published by others, the coding region was highly conserved, but the spacer regions varied in size and sequence. T stretch regions, just after the end of the coding sequences, were more prominant in the Capsicum species than in two other plants. High G x C rich regions, which might have similar functions as that of the GC islands in the genes transcribed by RNA PolII, were observed after the T stretch region. Although we could not observe the TATA like sequences, an AT rich segment at -27 to -18 was detected in the 5S rRNA genes of the Capsicum species. Species relationship among the Capsicum species was also studied by the sequence comparison of the 5S rRNA genes. While C. chinense, C. frutescens, and C. annuum formed one lineage, C. baccatum was revealed to be an intermediate species between the former three species and C. pubescens. PMID:10774742

  9. Deep sequencing of subseafloor eukaryotic rRNA reveals active Fungi across marine subsurface provinces.

    William Orsi

    Full Text Available The deep marine subsurface is a vast habitat for microbial life where cells may live on geologic timescales. Because DNA in sediments may be preserved on long timescales, ribosomal RNA (rRNA is suggested to be a proxy for the active fraction of a microbial community in the subsurface. During an investigation of eukaryotic 18S rRNA by amplicon pyrosequencing, unique profiles of Fungi were found across a range of marine subsurface provinces including ridge flanks, continental margins, and abyssal plains. Subseafloor fungal populations exhibit statistically significant correlations with total organic carbon (TOC, nitrate, sulfide, and dissolved inorganic carbon (DIC. These correlations are supported by terminal restriction length polymorphism (TRFLP analyses of fungal rRNA. Geochemical correlations with fungal pyrosequencing and TRFLP data from this geographically broad sample set suggests environmental selection of active Fungi in the marine subsurface. Within the same dataset, ancient rRNA signatures were recovered from plants and diatoms in marine sediments ranging from 0.03 to 2.7 million years old, suggesting that rRNA from some eukaryotic taxa may be much more stable than previously considered in the marine subsurface.

  10. Assembly of proteins and 5 S rRNA to transcripts of the major structural domains of 23 S rRNA

    Ostergaard, P; Phan, H; Johansen, L B;

    1998-01-01

    The six major structural domains of 23 S rRNA from Escherichia coli, and all combinations thereof, were synthesized as separate T7 transcripts and reconstituted with total 50 S subunit proteins. Analysis by one and two-dimensional gel electrophoresis demonstrated the presence of at least one......+VI. This indicates that there are two major protein assembly centres located at the ends of the 23 S rRNA, which is consistent with an earlier view that in vitro protein assembly nucleates around proteins L24 and L3. Although similar protein assembly patterns were observed over a range of temperature and magnesium...... approach was used to map the putative binding regions on domain V of protein L9 and the 5 S RNA-L5-L18 complex....

  11. Molecular phylogeny of Pneumocystis based on 5.8S rRNA gene and the internal transcribed spacers of rRNA gene sequences

    2008-01-01

    To clarify the phylogenetic relationships and species status of Pneumocystis, the 5.8S rRNA gene and the internal transcribed spacers (ITS, 1 and 2) of Pneumocystis rRNA derived from rat, gerbil and human were amplified, cloned and sequenced. The genetic distance matrix of six Pneumocystis species compared with other fungi like Taphrina and Saccharomyces indicated that the Pneumocystis genus contained multiple species including Pneumocystis from gerbil. The phylogenetic tree also showed that Pneumocystis from human and monkey formed one group and four rodent Pneumocystis formed another group. Among the four members, Pneumocystis wakefieldiae was most closely related to Pneumocystis murina and Pneumocystis carinii, and was least related to gerbil Pneumocystis.

  12. Human TRMU encoding the mitochondrial 5-methylaminomethyl-2-thiouridylate-methyltransferase is a putative nuclear modifier gene for the phenotypic expression of the deafness-associated 12S rRNA mutations

    Nuclear modifier genes have been proposed to modulate the phenotypic manifestation of human mitochondrial 12S rRNA A1491G mutation associated with deafness in many families world-wide. Here we identified and characterized the putative nuclear modifier gene TRMU encoding a highly conserved mitochondrial protein related to tRNA modification. A 1937 bp TRMU cDNA has been isolated and the genomic organization of TRMU has been elucidated. The human TRMU gene containing 11 exons encodes a 421 residue protein with a strong homology to the TRMU-like proteins of bacteria and other homologs. TRMU is ubiquitously expressed in various tissues, but abundantly in tissues with high metabolic rates including heart, liver, kidney, and brain. Immunofluorescence analysis of human 143B cells expressing TRMU-GFP fusion protein demonstrated that the human Trmu localizes and functions in mitochondrion. Furthermore, we show that in families with the deafness-associated 12S rRNA A1491G mutation there is highly suggestive linkage and linkage disequilibrium between microsatellite markers adjacent to TRMU and the presence of deafness. These observations suggest that human TRMU may modulate the phenotypic manifestation of the deafness-associated mitochondrial 12S rRNA mutations

  13. The unusual 23S rRNA gene of Coxiella burnetii: two self-splicing group I introns flank a 34-base-pair exon, and one element lacks the canonical omegaG.

    Raghavan, Rahul; Miller, Scott R; Hicks, Linda D; Minnick, Michael F

    2007-09-01

    We describe the presence and characteristics of two self-splicing group I introns in the sole 23S rRNA gene of Coxiella burnetii. The two group I introns, Cbu.L1917 and Cbu.L1951, are inserted at sites 1917 and 1951 (Escherichia coli numbering), respectively, in the 23S rRNA gene of C. burnetii. Both introns were found to be self-splicing in vivo and in vitro even though the terminal nucleotide of Cbu.L1917 is adenine and not the canonical conserved guanine, termed OmegaG, found in Cbu.L1951 and all other group I introns described to date. Predicted secondary structures for both introns were constructed and revealed that Cbu.L1917 and Cbu.L1951 were group IB2 and group IA3 introns, respectively. We analyzed strains belonging to eight genomic groups of C. burnetii to determine sequence variation and the presence or absence of the elements and found both introns to be highly conserved (>/=99%) among them. Although phylogenetic analysis did not identify the specific identities of donors, it indicates that the introns were likely acquired independently; Cbu.L1917 was acquired from other bacteria like Thermotoga subterranea and Cbu.L1951 from lower eukaryotes like Acanthamoeba castellanii. We also confirmed the fragmented nature of mature 23S rRNA in C. burnetii due to the presence of an intervening sequence. The presence of three selfish elements in C. burnetii's 23S rRNA gene is very unusual for an obligate intracellular bacterium and suggests a recent shift to its current lifestyle from a previous niche with greater opportunities for lateral gene transfer. PMID:17644584

  14. Exploring microbial diversity and taxonomy using SSU rRNA hypervariable tag sequencing.

    Susan M Huse

    2008-11-01

    Full Text Available Massively parallel pyrosequencing of hypervariable regions from small subunit ribosomal RNA (SSU rRNA genes can sample a microbial community two or three orders of magnitude more deeply per dollar and per hour than capillary sequencing of full-length SSU rRNA. As with full-length rRNA surveys, each sequence read is a tag surrogate for a single microbe. However, rather than assigning taxonomy by creating gene trees de novo that include all experimental sequences and certain reference taxa, we compare the hypervariable region tags to an extensive database of rRNA sequences and assign taxonomy based on the best match in a Global Alignment for Sequence Taxonomy (GAST process. The resulting taxonomic census provides information on both composition and diversity of the microbial community. To determine the effectiveness of using only hypervariable region tags for assessing microbial community membership, we compared the taxonomy assigned to the V3 and V6 hypervariable regions with the taxonomy assigned to full-length SSU rRNA sequences isolated from both the human gut and a deep-sea hydrothermal vent. The hypervariable region tags and full-length rRNA sequences provided equivalent taxonomy and measures of relative abundance of microbial communities, even for tags up to 15% divergent from their nearest reference match. The greater sampling depth per dollar afforded by massively parallel pyrosequencing reveals many more members of the "rare biosphere" than does capillary sequencing of the full-length gene. In addition, tag sequencing eliminates cloning bias and the sequences are short enough to be completely sequenced in a single read, maximizing the number of organisms sampled in a run while minimizing chimera formation. This technique allows the cost-effective exploration of changes in microbial community structure, including the rare biosphere, over space and time and can be applied immediately to initiatives, such as the Human Microbiome Project.

  15. Strength and Regulation of Seven rRNA Promoters in Escherichia coli.

    Michihisa Maeda

    Full Text Available The model prokaryote Escherichia coli contains seven copies of the rRNA operon in the genome. The presence of multiple rRNA operons is an advantage for increasing the level of ribosome, the key apparatus of translation, in response to environmental conditions. The complete sequence of E. coli genome, however, indicated the micro heterogeneity between seven rRNA operons, raising the possibility in functional heterogeneity and/or differential mode of expression. The aim of this research is to determine the strength and regulation of the promoter of each rRNA operon in E. coli. For this purpose, we used the double-fluorescent protein reporter pBRP system that was developed for accurate and precise determination of the promoter strength of protein-coding genes. For application of this promoter assay vector for measurement of the rRNA operon promoters devoid of the signal for translation, a synthetic SD sequence was added at the initiation codon of the reporter GFP gene, and then approximately 500 bp-sequence upstream each 16S rRNA was inserted in front of this SD sequence. Using this modified pGRS system, the promoter activity of each rrn operon was determined by measuring the rrn promoter-directed GFP and the reference promoter-directed RFP fluorescence, both encoded by a single and the same vector. Results indicated that: the promoter activity was the highest for the rrnE promoter under all growth conditions analyzed, including different growth phases of wild-type E. coli grown in various media; but the promoter strength of other six rrn promoters was various depending on the culture conditions. These findings altogether indicate that seven rRNA operons are different with respect to the regulation mode of expression, conferring an advantage to E. coli through a more fine-tuned control of ribosome formation in a wide range of environmental situations. Possible difference in the functional role of each rRNA operon is also discussed.

  16. A yeast transcription system for the 5S rRNA gene.

    Keulen, H.; Thomas, D. Y.

    1982-01-01

    A cell-free extract of yeast nuclei that can specifically transcribe cloned yeast 5S rRNA genes has been developed. Optima for transcription of 5S rDNA were determined and conditions of extract preparation leading to reproducible activities and specificities established. The major in vitro product has the same size and oligonucleotide composition as in vivo 5S rRNA. The in vitro transcription extract does not transcribe yeast tRNA genes. The extract does increase the transcription of tRNA gen...

  17. Oligonucleotide Fingerprinting of rRNA Genes for Analysis of Fungal Community Composition

    Valinsky, Lea; Della Vedova, Gianluca; Jiang, Tao; Borneman, James

    2002-01-01

    Thorough assessments of fungal diversity are currently hindered by technological limitations. Here we describe a new method for identifying fungi, oligonucleotide fingerprinting of rRNA genes (OFRG). ORFG sorts arrayed rRNA gene (ribosomal DNA [rDNA]) clones into taxonomic clusters through a series of hybridization experiments, each using a single oligonucleotide probe. A simulated annealing algorithm was used to design an OFRG probe set for fungal rDNA. Analysis of 1,536 fungal rDNA clones d...

  18. Depletion of pre-16S rRNA in starved Escherichia coli cells.

    Cangelosi, G A; Brabant, W H

    1997-01-01

    Specific hybridization assays for intermediates in rRNA synthesis (pre-rRNA) may become useful for monitoring the growth activity of individual microbial species in complex natural systems. This possibility depends upon the assumption that rRNA processing in microbial cells continues after growth and pre-rRNA synthesis cease, resulting in drainage of the pre-rRNA pool. This is not the case in many eukaryotic cells, but less is known about the situation in bacteria. Therefore, we used DNA prob...

  19. Strength and Regulation of Seven rRNA Promoters in Escherichia coli

    Maeda, Michihisa; Shimada, Tomohiro; Ishihama, Akira

    2015-01-01

    The model prokaryote Escherichia coli contains seven copies of the rRNA operon in the genome. The presence of multiple rRNA operons is an advantage for increasing the level of ribosome, the key apparatus of translation, in response to environmental conditions. The complete sequence of E. coli genome, however, indicated the micro heterogeneity between seven rRNA operons, raising the possibility in functional heterogeneity and/or differential mode of expression. The aim of this research is to determine the strength and regulation of the promoter of each rRNA operon in E. coli. For this purpose, we used the double-fluorescent protein reporter pBRP system that was developed for accurate and precise determination of the promoter strength of protein-coding genes. For application of this promoter assay vector for measurement of the rRNA operon promoters devoid of the signal for translation, a synthetic SD sequence was added at the initiation codon of the reporter GFP gene, and then approximately 500 bp-sequence upstream each 16S rRNA was inserted in front of this SD sequence. Using this modified pGRS system, the promoter activity of each rrn operon was determined by measuring the rrn promoter-directed GFP and the reference promoter-directed RFP fluorescence, both encoded by a single and the same vector. Results indicated that: the promoter activity was the highest for the rrnE promoter under all growth conditions analyzed, including different growth phases of wild-type E. coli grown in various media; but the promoter strength of other six rrn promoters was various depending on the culture conditions. These findings altogether indicate that seven rRNA operons are different with respect to the regulation mode of expression, conferring an advantage to E. coli through a more fine-tuned control of ribosome formation in a wide range of environmental situations. Possible difference in the functional role of each rRNA operon is also discussed. PMID:26717514

  20. TaxMan: a server to trim rRNA reference databases and inspect taxonomic coverage

    Brandt, B. W.; Bonder, M. J.; Huse, S.M.; Zaura, E.

    2012-01-01

    Amplicon sequencing of the hypervariable regions of the small subunit ribosomal RNA gene is a widely accepted method for identifying the members of complex bacterial communities. Several rRNA gene sequence reference databases can be used to assign taxonomic names to the sequencing reads using BLAST, USEARCH, GAST or the RDP classifier. Next-generation sequencing methods produce ample reads, but they are short, currently ∼100-450 nt (depending on the technology), as compared to the full rRNA g...

  1. Structure of the Hsp110:Hsc70 Nucleotide Exchange Machine

    Schuermann, Jonathan P.; Jiang, Jianwen; Cuellar, Jorge; Llorca, Oscar; Wang, Liping; Gimenez, Luis E.; Jin, Suping; Taylor, Alexander B.; Demeler, Borries; Morano, Kevin A.; Hart, P. John; Valpuesta, Jose M.; Lafer, Eileen M.; Sousa, Rui

    2008-01-01

    Hsp70s mediate protein folding, translocation, and macromolecular complex remodeling reactions. Their activities are regulated by proteins that exchange ADP for ATP from the nucleotide-binding domain (NBD) of the Hsp70. These nucleotide exchange factors (NEFs) include the Hsp110s, which are themselves members of the Hsp70 family. We report the structure of an Hsp110:Hsc70 nucleotide exchange complex. The complex is characterized by extensive protein:protein interactions and symmetric bridging...

  2. Regulation of nucleotide excision repair through ubiquitination

    Jia Li; Audesh Bhat; Wei Xiao

    2011-01-01

    Nucleotide excision repair (NER) is the most versatile DNA-repair pathway in all organisms.While bacteria require only three proteins to complete the incision step of NER,eukaryotes employ about 30 proteins to complete the same step.Here we summarize recent studies demonstrating that ubiquitination,a post-translational modification,plays critical roles in regulating the NER activity either dependent on or independent of ubiquitin-proteolysis.Several NER components have been shown as targets of ubiquitination while others are actively involved in the ubiquitination process.We argue through this analysis that ubiquitination serves to coordinate various steps of NER and meanwhile connect NER with other related pathways to achieve the efficient global DNA-damage response.

  3. Signal transduction by guanine nucleotide binding proteins.

    Spiegel, A M

    1987-01-01

    High affinity binding of guanine nucleotides and the ability to hydrolyze bound GTP to GDP are characteristics of an extended family of intracellular proteins. Subsets of this family include cytosolic initiation and elongation factors involved in protein synthesis, and cytoskeletal proteins such as tubulin (Hughes, S.M. (1983) FEBS Lett. 164, 1-8). A distinct subset of guanine nucleotide binding proteins is membrane-associated; members of this subset include the ras gene products (Ellis, R.W. et al. (1981) Nature 292, 506-511) and the heterotrimeric G-proteins (also termed N-proteins) (Gilman, A.G. (1984) Cell 36, 577-579). Substantial evidence indicates that G-proteins act as signal transducers by coupling receptors (R) to effectors (E). A similar function has been suggested but not proven for the ras gene products. Known G-proteins include Gs and Gi, the G-proteins associated with stimulation and inhibition, respectively, of adenylate cyclase; transducin (TD), the G-protein coupling rhodopsin to cGMP phosphodiesterase in rod photoreceptors (Bitensky, M.W. et al. (1981) Curr. Top. Membr. Transp. 15, 237-271; Stryer, L. (1986) Annu. Rev. Neurosci. 9, 87-119), and Go, a G-protein of unknown function that is highly abundant in brain (Sternweis, P.C. and Robishaw, J.D. (1984) J. Biol. Chem. 259, 13806-13813; Neer, E.J. et al. (1984) J. Biol. Chem. 259, 14222-14229). G-proteins also participate in other signal transduction pathways, notably that involving phosphoinositide breakdown. In this review, I highlight recent progress in our understanding of the structure, function, and diversity of G-proteins. PMID:2435586

  4. Improvement parameters in dynamic compaction adjacent to the slopes

    Elham Ghanbari

    2015-04-01

    Full Text Available Dynamic compaction is a cost-effective method commonly used for improvement of sandy soils. A number of researchers have investigated experimentally and numerically the improvement parameters of soils using dynamic compaction, such as crater depth, improvement depth, and radial improvement, however, these parameters are not studied for improvement adjacent to the slopes or trenches. In this research, four different slopes with different inclinations are modeled numerically using the finite element code ABAQUS, and impact loads of dynamic compaction are applied. The static factors of safety are kept similar for all trenches and determined numerically by application of gravity loads to the slope using strength reduction method (SRM. The analysis focuses on crater depth and improvement region which are compared to the state of flat ground. It can be observed that compacted area adjacent to the slopes is narrower and slightly away from the slope compared to the flat state. Moreover, crater depth increases with increase in slope inclination.

  5. Resonance-like tunneling across a barrier with adjacent wells

    S Mahadevan; P Prema; S K Agarwalla; B Sahu; C S Shastry

    2006-09-01

    We examine the behavior of transmission coefficient across the rectangular barrier when attractive potential well is present on one or both sides and also the same is studied for a smoother barrier with smooth adjacent wells having Woods–Saxon shape. We find that presence of well with suitable width and depth can substantially alter at energies below the barrier height leading to resonant-like structures. In a sense, this work is complementary to the resonant tunneling of particles across two rectangular barriers, which is being studied in detail in recent years with possible applications in mind. We interpret our results as due to resonant-like positive energy states generated by the adjacent wells. We describe in detail the possible potential application of these results in electronic devices using n-type oxygen-doped gallium arsenide and silicon dioxide. It is envisaged that these results will have applications in the design of tunneling devices.

  6. Regional Fault Systems of Qaidam Basin and Adjacent Orogenic Belts

    2003-01-01

    The purpose of this paper is to analyze the regional fault systems of Qaidam basin and adjacent orogenic belts. Field investigation and seismic interpretation indicate that five regional fault systems occurred in the Qaidam and adjacent mountain belts, controlling the development and evolution of the Qaidam basin. These fault systems are: (1)north Qaidam-Qilian Mountain fault system; (2) south Qaidam-East Kunlun Mountain fault system; (3)Altun strike-slip fault system; (4)Elashan strike-slip fault system, and (5) Gansen-Xiaochaidan fault system. It is indicated that the fault systems controlled the orientation of the Qaidam basin, the formation and distribution of secondary faults within the basin,the migration of depocenters and the distribution of hydrocarbon accumulation belt.

  7. In Vivo Effect of NusB and NusG on rRNA Transcription Antitermination

    Torres, Martha; Balada, Joan-Miquel; Zellars, Malcolm; Squires, Craig; Squires, Catherine L.

    2004-01-01

    Similarities between lambda and rRNA transcription antitermination have led to suggestions that they involve the same Nus factors. However, direct in vivo confirmation that rRNA antitermination requires all of the lambda Nus factors is lacking. We have therefore analyzed the in vivo role of NusB and NusG in rRNA transcription antitermination and have established that both are essential for it. We used a plasmid test system in which reporter gene mRNA was measured to monitor rRNA antiterminato...

  8. On heavy machines dynamical loading under adjacent links shocks

    Трубачев, Сергей Иванович; Лысюк, Дмитрий Степанович; Талимонова, Ольга Юрьевна

    2014-01-01

    The mathematical model, describing the dynamics under collision of heavy machinery adjacent links in the presence of gaps and other elements with a dead or smoothness zone of transfer functions of kinematic chains, is given. The model is designed using a procedure of "smoothing" discontinuous functions and regarding a variable structure. The specific example of a dynamic system and its numerical calculation is considered. The pressure between the roller and a workpiece is expressed by means o...

  9. Acyclic Edge Coloring of Planar Graphs without Adjacent Triangles

    Dezheng XIE; Yanqing WU

    2012-01-01

    An acyclic edge coloring of a graph G is a proper edge coloring such that there are no bichromatic cycles.The acyclic edge chromatic number of a graph G is the minimum number k such that there exists an acyclic edge coloring using k colors and is denoted by x'a(G).In this paper we prove that x'a(G)≤ Δ(G)+ 5 for planar graphs G without adjacent triangles.

  10. Concentric network symmetry grasps authors' styles in word adjacency networks

    Amancio, Diego R.; Filipi N. Silva; Costa, Luciano da F.

    2015-01-01

    Several characteristics of written texts have been inferred from statistical analysis derived from networked models. Even though many network measurements have been adapted to study textual properties at several levels of complexity, some textual aspects have been disregarded. In this paper, we study the symmetry of word adjacency networks, a well-known representation of text as a graph. A statistical analysis of the symmetry distribution performed in several novels showed that most of the wo...

  11. Soil Structure Interaction between Two Adjacent Buildings under Earthquake Load

    Mahmoud Yahyai; Masoud Mirtaheri; Mehrab Mahoutian; Amir S. Daryan

    2008-01-01

    In some cases, tall buildings are located in geotechnically unsuitable places, due to their high ratio of height to width; there is risk of uplift and other effects such as overturning and reduction structure serviceability during earthquake. This research is aimed to evaluate the effect of Soil-Structure Interaction (SSI) on seismic behavior of two adjacent 32 story buildings such as time period, base shear and displacements. The interaction effects are investigated for variable distance bet...

  12. Disrupted Turn Adjacency and Coherence Maintenance in Instant Messaging Conversations

    Berglund, Therese Örnberg

    2009-01-01

    This article reports on a study of coherence in text-based log files from 120 two-party Instant Messaging (IM) conversations among a group of international students at a design school. The goals of the study were to investigate whether disrupted turn adjacency was an obstacle to coherence and to identify the linguistic strategies employed to maintain coherence. Additional signs of problematic coherence creation were also investigated, focusing on explicit signs of miscommunication. In this pa...

  13. FMRI evidence of acupoints specificity in two adjacent acupoints.

    Liu, Hua; Xu, Jian-Yang; Li, Lin; Shan, Bao-Ci; Nie, Bin-Bin; Xue, Jing-Quan

    2013-01-01

    Objectives. Acupoint specificity is the foundation of acupuncture treatment. The aim of this study is to investigate whether the acupoint specificity exists in two adjacent acupoints. Design and Setting. Two adjacent real acupoints, LR3 (Taichong) and ST44 (Neiting), and a nearby nonacupoint were selected. Thirty-three health volunteers were divided into three groups in random order, and each group only received acupuncture at one of the three points. While they received acupuncture, fMRI scan was performed. Results. The common cerebral activated areas responding to LR3 and ST44 included the contralateral primary somatosensory area (SI) and ipsilateral cerebellum. Acupuncture at LR3 specifically activated contralateral middle occipital gyrus, ipsilateral medial frontal gyrus, superior parietal lobe, middle temporal gyrus, rostral anterior cingulate cortex (rACC), lentiform nucleus, insula, and contralateral thalamus. Stimulation at ST44 selectively activated ipsilateral secondary somatosensory area (SII), contralateral middle frontal gyrus, inferior frontal gyrus, lingual gyrus, lentiform nucleus, and bilateral posterior cingulate cortex (PCC). Conclusions. Acupuncture at adjacent acupoints elicits distinct cerebral activation patterns, and those specific patterns might be involved in the mechanism of the specific therapeutic effects of different acupoints. PMID:23762172

  14. Caracterização de rizóbios indicados para produção de inoculantes por meio de sequenciamento parcial do 16S rRNA Characterization of rhizobia indicated for inoculant production using 16S rRNA partial sequencing

    Bethânia Figueiredo Barbosa de Toledo

    2009-04-01

    Full Text Available O objetivo deste trabalho foi confrontar as sequências parciais do gene 16S rRNA de estirpes padrão de rizóbios com as de estirpes recomendadas para a produção de inoculantes no Brasil, com vistas à verificação da confiabilidade do sequenciamento parcial desse gene para a identificação rápida de estirpes. Foram realizados sequenciamentos através de reação em cadeia da polimerase (PCR com iniciadores relativos à região codificadora do gene 16S rRNA entre as bactérias estudadas. Os resultados foram analisados pela consulta de similaridade de nucleotídeos aos do "Basic Local Alignment Search Tool" (Blastn e por meio da interpretação de árvores filogenéticas geradas usando ferramentas de bioinformática. A classificação taxonômica das estirpes Semia recomendadas para inoculação de leguminosas com base em propriedades morfológicas e especificidade hospedeira não foi confirmada em todas as estirpes. A maioria das estirpes estudadas, consultadas no Blastn, é consistente com a classificação proposta pela construção de árvores filogenéticas das sequências destas estirpes, com base na similaridade pelo sequenciamento parcial do gene considerado.The aim of this work was to compare the partial sequences of 16S rRNA gene of rhizobia strain patterns already classified with strains recommended for the production of inoculants in Brazil, in order to verify the reliability of partial sequencing of the gene for the purpose of rapid identification of strains. Polymerase Chain Reaction (PCR sequencing using primers on the coding region of the 16S rRNA gene among the bacteria studied was conducted. The results were analyzed by consulting the nucleotides' similarity based on Basic Local Alignment Search Tool (Blastn and by interpreting the phylogenetic trees generated by bioinformatic tools. The taxonomic classification of Semia strains recommended for legume inoculation based on morphological properties and host specificity was

  15. Functional angiocoupling between follicles and adjacent corpus luteum in heifers.

    Ginther, O J; Siddiqui, M A R; Baldrighi, J M

    2016-07-15

    In single ovulating cattle, ipsilateral versus contralateral interovarian relationships refer to a dominant follicle (DF) and CL in the same versus opposite ovaries. The ipsilateral relationship consists of the DF-CL and the devoid (no DF or CL) intraovarian pattern, and the contralateral relationship consists of the DF pattern and the CL pattern. The DF-CL pattern involves positive effects on both the DF and CL when adjacent (≤3-mm apart) versus separated as follows: greater diameter of DF (e.g., 10.5 ± 0.4 vs. 9.0 ± 0.4 mm), greater percentage of the DF wall with color Doppler signals of blood flow (40.2% ± 2.0% vs. 24.5% ± 1.9%), greater cross-sectional area of the CL (2.2 ± 0.1 vs. 1.8 ± 0.2 cm(2)), and greater percentage of the entire CL with blood flow signals (51.8% ± 1.2% vs. 42.5% ± 3.1%). Additional examples of positive coupling are (1) future DF on Day 0 (day of ovulation) is closer to the CL than the future largest subordinate and (2) diameter of growing follicles on Day 0 and the growth rate on Days 0 to 2 are greater for follicles that are adjacent than separated from the CL. An example of a negative intraovarian effect is decreasing diameter and loss of future DF status of a largest follicle when adjacent to a regressing CL. The impact of the continuity of ovarian angioarchitecture during the periovulatory follicular wave was exemplified in 17 of 18 waves by conversion of an ovary with only the preovulatory follicle to the postovulatory DF-CL pattern. Functional angiocoupling from commonality in angioarchitecture of the DF and adjacent CL would account for both the positive two-way coupling between DF and CL during the luteal phase and the negative effect of a regressing CL on an adjacent follicle during luteolysis. PMID:27056414

  16. Methyltransferase Erm(37) Slips on rRNA to Confer Atypical Resistance in Mycobacterium tuberculosis

    Madsen, Ch. T.; Jakobsen, L.; Buriánková, Karolína; Doucet-Populaire, F.; Perdonet, J. L.; Douthwaite, S.

    2005-01-01

    Roč. 280, č. 47 (2005), s. 38942-38947. ISSN 0021-9258 R&D Projects: GA ČR GA310/03/0292 Institutional research plan: CEZ:AV0Z50200510 Keywords : methyltransferase erm * mycobacterium tuberculosis * rRNA Subject RIV: EE - Microbiology, Virology Impact factor: 5.854, year: 2005

  17. Archaeal rRNA operons, intron splicing and homing endonucleases, RNA polymerase operons and phylogeny

    Garrett, Roger Antony; Aagaard, Claus Sindbjerg; Andersen, Morten; Dalgaard, Jacob; Lykke-Andersen, Jens; Phan, Hoa T.N.; Trevisanato, Siro; Østergaard, Laust; Larsen, Niels; Leffers, Henrik

    1994-01-01

    Over the past decade our laboratory has had a strong interest in defining the phylogenetic status of the archaea. This has involved determining and analysing the sequences of operons of both rRNAs and RNA polymerases and it led to the discovery of the first archaeal rRNA intron. What follows is a...

  18. An alternative strategy for bacterial ribosome synthesis: Bacillus subtilis rRNA transcription regulation

    Krásný, Libor; Gourse, Richard. L.

    2004-01-01

    Roč. 23, č. 22 (2004), s. 4473-4483. ISSN 0261-4189 Grant ostatní: National Institutes of Health(US) RO1 GM37048 Institutional research plan: CEZ:AV0Z5052915 Keywords : B. subtilis , GTP concentrations, rRNA transcription Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 10.492, year: 2004

  19. Transcription analysis of the Streptomyces coelicolor A3(2) rrnA operon

    van Wezel, G P; Krab, I M; Douthwaite, S; Bibb, M J; Vijgenboom, E; Bosch, L

    1994-01-01

    Transcription start sites and processing sites of the Streptomyces coelicolor A3(2) rrnA operon have been investigated by a combination of in vivo and in vitro transcription analyses. The data from these approaches are consistent with the existence of four in vivo transcription sites, correspondi...

  20. Supramolecular hydrogel of kanamycin selectively sequesters 16S rRNA

    Yang, Zhimou; Kuang, Yi; Li, Xinming; Zhou, Ning; Zhang, Ye; Xu, Bing

    2012-01-01

    As the first example of hydrogelator derived from aminoglycoside antibiotics, the hydrogel of kanamycin indicates that the hydrogel of aminoglycosides preserve the specific interaction with their macromolecular targets (e.g., 16S rRNA), thus illustrating a simple approach to explore and identify possible biological targets of supramolecular nanofibers/hydrogels.

  1. EmtA, a rRNA methyltransferase conferring high-level evernimicin resistance

    Mann, P. A.; Xiong, L.; Mankin, A. S.; Chau, A. S.; Najarian, D. J.; Mendrick, C. A.; Cramer, C. A.; Aarestrup, Frank Møller; Hare, R. S.; Black, T. A.; McNicholas, P. M.

    2001-01-01

    unique to the 23S rRNA extracted from resistant ribosomes. The pause corresponded to methylation of residue G2470 (Escherichia coli numbering). RNA footprinting revealed that G2470 is located within the evernimicin-binding site on the ribosome, thus providing an explanation for the reduced binding of the...

  2. Chromosomal localization of genes encoding guanine nucleotide-binding protein subunits in mouse and human

    Blatt, C.; Eversole-Cire, P.; Cohn, V.H.; Zollman, S.; Fournier, R.E.K.; Mohandas, L.T.; Nesbitt, M.; Lugo, T.; Jones, D.T.; Reed, R.R.; Weiner, L.P.; Sparkes, R.S.; Simon, M.I. (Weizmann Institute, Rehovoth (Israel))

    1988-10-01

    A variety of genes have been identified that specify the synthesis of the components of guanine nucleotide-binding proteins (G proteins). Eight different guanine nucleotide-binding {alpha}-subunit proteins, two different {beta} subunits, and one {gamma} subunit have been described. Hybridization of cDNA clones with DNA from human-mouse somatic cell hybrids was used to assign many of these genes to human chromosomes. The retinal-specific transducin subunit genes GNAT1 and GNAT2 were on chromosomes 3 and 1; GNAI1, GNAI2, and GNAI3 were assigned to chromosomes 7, 3, and 1, respectively; GNAZ and GNAS were found on chromosomes 22 and 20. The {beta} subunits were also assigned-GNB1 to chromosome 1 and GNB2 to chromosome 7. Restriction fragment length polymorphisms were used to map the homologues of some of these genes in the mouse. GNAT1 and GNAI2 were found to map adjacent to each other on mouse chromosome 9 and GNAT2 was mapped on chromosome 17. The mouse GNB1 gene was assigned to chromosome 19. These mapping assignments will be useful in defining the extend of the G{alpha} gene family and may help in attempts to correlate specific genetic diseases and with genes corresponding to G proteins.

  3. Chromosomal localization of genes encoding guanine nucleotide-binding protein subunits in mouse and human.

    Blatt, C; Eversole-Cire, P; Cohn, V H; Zollman, S; Fournier, R E; Mohandas, L T; Nesbitt, M; Lugo, T; Jones, D T; Reed, R R

    1988-10-01

    A variety of genes have been identified that specify the synthesis of the components of guanine nucleotide-binding proteins (G proteins). Eight different guanine nucleotide-binding alpha-subunit proteins, two different beta subunits, and one gamma subunit have been described. Hybridization of cDNA clones with DNA from human-mouse somatic cell hybrids was used to assign many of these genes to human chromosomes. The retinal-specific transducin subunit genes GNAT1 and GNAT2 were on chromosomes 3 and 1; GNAI1, GNAI2, and GNAI3 were assigned to chromosomes 7, 3, and 1, respectively; GNAZ and GNAS were found on chromosomes 22 and 20. The beta subunits were also assigned--GNB1 to chromosome 1 and GNB2 to chromosome 7. Restriction fragment length polymorphisms were used to map the homologues of some of these genes in the mouse. GNAT1 and GNAI2 were found to map adjacent to each other on mouse chromosome 9 and GNAT2 was mapped on chromosome 17. The mouse GNB1 gene was assigned to chromosome 19. These mapping assignments will be useful in defining the extent of the G alpha gene family and may help in attempts to correlate specific genetic diseases with genes corresponding to G proteins. PMID:2902634

  4. Cyclic nucleotide specific phosphodiesterases of Leishmania major

    Linder Markus

    2006-03-01

    Full Text Available Abstract Background Leishmania represent a complex of important human pathogens that belong to the systematic order of the kinetoplastida. They are transmitted between their human and mammalian hosts by different bloodsucking sandfly vectors. In their hosts, the Leishmania undergo several differentiation steps, and their coordination and optimization crucially depend on numerous interactions between the parasites and the physiological environment presented by the fly and human hosts. Little is still known about the signalling networks involved in these functions. In an attempt to better understand the role of cyclic nucleotide signalling in Leishmania differentiation and host-parasite interaction, we here present an initial study on the cyclic nucleotide-specific phosphodiesterases of Leishmania major. Results This paper presents the identification of three class I cyclic-nucleotide-specific phosphodiesterases (PDEs from L. major, PDEs whose catalytic domains exhibit considerable sequence conservation with, among other, all eleven human PDE families. In contrast to other protozoa such as Dictyostelium, or fungi such as Saccharomyces cerevisiae, Candida ssp or Neurospora, no genes for class II PDEs were found in the Leishmania genomes. LmjPDEA contains a class I catalytic domain at the C-terminus of the polypeptide, with no other discernible functional domains elsewhere. LmjPDEB1 and LmjPDEB2 are coded for by closely related, tandemly linked genes on chromosome 15. Both PDEs contain two GAF domains in their N-terminal region, and their almost identical catalytic domains are located at the C-terminus of the polypeptide. LmjPDEA, LmjPDEB1 and LmjPDEB2 were further characterized by functional complementation in a PDE-deficient S. cerevisiae strain. All three enzymes conferred complementation, demonstrating that all three can hydrolyze cAMP. Recombinant LmjPDEB1 and LmjPDEB2 were shown to be cAMP-specific, with Km values in the low micromolar range

  5. Prebiotic nucleotide synthesis demonstration of a geologically plausible pathway

    Schwartz, A.W.; Veen, van der M.; Bisseling, T.; Chittenden, G.J.

    1975-01-01

    Mineral phosphate (apatite) is activated for the synthesis of nucleotides when dilute solutions containing nucleoside and ammonium oxalate are evaporated in its presence. A natural, igneous fluorapatite was found to be even more effective in nucleotide synthesis than the more soluble hydroxylapatite

  6. Nucleotide sequence of cloned rat serum albumin messenger RNA.

    Sargent, T D; Yang, M; Bonner, J.

    1981-01-01

    The nucleotide sequences of the recombinant DNA inserts of three bacterial plasmid clones containing nearly all of the rat serum albumin mRNA have been determined. A statistical analysis of the nucleotide sequence reveals a pattern of repeated internal homology that confirms the "intragenic triplication" model of albumin evolution.

  7. Oral microbiome profiles: 16S rRNA pyrosequencing and microarray assay comparison.

    Jiyoung Ahn

    Full Text Available OBJECTIVES: The human oral microbiome is potentially related to diverse health conditions and high-throughput technology provides the possibility of surveying microbial community structure at high resolution. We compared two oral microbiome survey methods: broad-based microbiome identification by 16S rRNA gene sequencing and targeted characterization of microbes by custom DNA microarray. METHODS: Oral wash samples were collected from 20 individuals at Memorial Sloan-Kettering Cancer Center. 16S rRNA gene survey was performed by 454 pyrosequencing of the V3-V5 region (450 bp. Targeted identification by DNA microarray was carried out with the Human Oral Microbe Identification Microarray (HOMIM. Correlations and relative abundance were compared at phylum and genus level, between 16S rRNA sequence read ratio and HOMIM hybridization intensity. RESULTS: The major phyla, Firmicutes, Proteobacteria, Bacteroidetes, Actinobacteria, and Fusobacteria were identified with high correlation by the two methods (r = 0.70∼0.86. 16S rRNA gene pyrosequencing identified 77 genera and HOMIM identified 49, with 37 genera detected by both methods; more than 98% of classified bacteria were assigned in these 37 genera. Concordance by the two assays (presence/absence and correlations were high for common genera (Streptococcus, Veillonella, Leptotrichia, Prevotella, and Haemophilus; Correlation = 0.70-0.84. CONCLUSION: Microbiome community profiles assessed by 16S rRNA pyrosequencing and HOMIM were highly correlated at the phylum level and, when comparing the more commonly detected taxa, also at the genus level. Both methods are currently suitable for high-throughput epidemiologic investigations relating identified and more common oral microbial taxa to disease risk; yet, pyrosequencing may provide a broader spectrum of taxa identification, a distinct sequence-read record, and greater detection sensitivity.

  8. Repair of adjacent single-strand breaks is often accompanied by the formation of tandem sequence duplications in plant genomes.

    Schiml, Simon; Fauser, Friedrich; Puchta, Holger

    2016-06-28

    Duplication of existing sequences is a major mechanism of genome evolution. It has been previously shown that duplications can occur by replication slippage, unequal sister chromatid exchange, homologous recombination, and aberrant double-strand break-induced synthesis-dependent strand annealing reactions. In a recent study, the abundant presence of short direct repeats was documented by comparative bioinformatics analysis of different rice genomes, and the hypothesis was put forward that such duplications might arise due to the concerted repair of adjacent single-strand breaks (SSBs). Applying the CRISPR/Cas9 technology, we were able to test this hypothesis experimentally in the model plant Arabidopsis thaliana Using a Cas9 nickase to induce adjacent genomic SSBs in different regions of the genome (genic, intergenic, and heterochromatic) and at different distances (∼20, 50, and 100 bps), we analyzed the repair outcomes by deep sequencing. In addition to deletions, we regularly detected the formation of direct repeats close to the break sites, independent of the genomic context. The formation of these duplications as well as deletions may be associated with the presence of microhomologies. Most interestingly, we found that even the induction of two SSBs on the same DNA strand can cause genome alterations, albeit at a much lower level. Because such a scenario reflects a natural step during nucleotide excision repair, and given that the germline is set aside only late during development in plants, the repair of adjacent SSBs indeed seems to have an important influence on the shaping of plant genomes during evolution. PMID:27307441

  9. A CA(+) pair adjacent to a sheared GA or AA pair stabilizes size-symmetric RNA internal loops.

    Chen, Gang; Kennedy, Scott D; Turner, Douglas H

    2009-06-23

    RNA internal loops are often important sites for folding and function. Residues in internal loops can have pKa values shifted close to neutral pH because of the local structural environment. A series of RNA internal loops were studied at different pH by UV absorbance versus temperature melting experiments and imino proton nuclear magnetic resonance (NMR). A stabilizing CA pair forms at pH 7 in the CG/AA and CA/AA nearest neighbors when the CA pair is the first noncanonical pair (loop-terminal pair) in 3 x 3 nucleotide and larger size-symmetric internal loops. These CG/AA and CA/AA nearest neighbors, with CA adjacent to a closing Watson-Crick pair, are further stabilized when the pH is lowered from 7 to 5.5. The results are consistent with a significantly larger fraction (from approximately 20% at pH 7 to approximately 90% at pH 5.5) of adenines being protonated at the N1 position to form stabilizing wobble CA+ pairs adjacent to a sheared GA or AA pair. The noncanonical pair adjacent to the GA pair in CG/AA can either stabilize or destabilize the loop, consistent with the sequence-dependent thermodynamics of GA pairs. No significant pH-dependent stabilization is found for most of the other nearest neighbor combinations involving CA pairs (e.g., CA/AG and AG/CA), which is consistent with the formation of various nonwobble pairs observed in different local sequence contexts in crystal and NMR structures. A revised free-energy model, including stabilization by wobble CA+ pairs, is derived for predicting stabilities of medium-size RNA internal loops. PMID:19485416

  10. Intrinsic resistance to aminoglycosides in Enterococcus faecium is conferred by the 16S rRNA m5C1404-specific methyltransferase EfmM

    Galimand, Marc; Schmitt, Emmanuelle; Panvert, Michel; Desmolaize, Benoît; Douthwaite, Stephen Roger; Mechulam, Yves; Courvalin, Patrice

    2011-01-01

    Aminoglycosides are ribosome-targeting antibiotics and a major drug group of choice in the treatment of serious enterococcal infections. Here we show that aminoglycoside resistance in Enterococcus faecium strain CIP 54-32 is conferred by the chromosomal gene efmM, encoding the E. faecium methyltr......Aminoglycosides are ribosome-targeting antibiotics and a major drug group of choice in the treatment of serious enterococcal infections. Here we show that aminoglycoside resistance in Enterococcus faecium strain CIP 54-32 is conferred by the chromosomal gene efmM, encoding the E. faecium...... locations are required for catalysis. The tertiary structure of EfmM is highly similar to that of RsmF, consistent with m(5)C formation at adjacent sites on the 30S subunit, while distinctive structural features account for the enzymes' respective specificities for nucleotides C1404 and C1407....

  11. Nucleolin is required for DNA methylation state and the expression of rRNA gene variants in Arabidopsis thaliana.

    Frédéric Pontvianne

    2010-11-01

    Full Text Available In eukaryotes, 45S rRNA genes are arranged in tandem arrays in copy numbers ranging from several hundred to several thousand in plants. Although it is clear that not all copies are transcribed under normal growth conditions, the molecular basis controlling the expression of specific sets of rRNA genes remains unclear. Here, we report four major rRNA gene variants in Arabidopsis thaliana. Interestingly, while transcription of one of these rRNA variants is induced, the others are either repressed or remain unaltered in A. thaliana plants with a disrupted nucleolin-like protein gene (Atnuc-L1. Remarkably, the most highly represented rRNA gene variant, which is inactive in WT plants, is reactivated in Atnuc-L1 mutants. We show that accumulated pre-rRNAs originate from RNA Pol I transcription and are processed accurately. Moreover, we show that disruption of the AtNUC-L1 gene induces loss of symmetrical DNA methylation without affecting histone epigenetic marks at rRNA genes. Collectively, these data reveal a novel mechanism for rRNA gene transcriptional regulation in which the nucleolin protein plays a major role in controlling active and repressed rRNA gene variants in Arabidopsis.

  12. Nucleotide Excision Repair in Caenorhabditis elegans

    Hannes Lans

    2011-01-01

    Full Text Available Nucleotide excision repair (NER plays an essential role in many organisms across life domains to preserve and faithfully transmit DNA to the next generation. In humans, NER is essential to prevent DNA damage-induced mutation accumulation and cell death leading to cancer and aging. NER is a versatile DNA repair pathway that repairs many types of DNA damage which distort the DNA helix, such as those induced by solar UV light. A detailed molecular model of the NER pathway has emerged from in vitro and live cell experiments, particularly using model systems such as bacteria, yeast, and mammalian cell cultures. In recent years, the versatility of the nematode C. elegans to study DNA damage response (DDR mechanisms including NER has become increasingly clear. In particular, C. elegans seems to be a convenient tool to study NER during the UV response in vivo, to analyze this process in the context of a developing and multicellular organism, and to perform genetic screening. Here, we will discuss current knowledge gained from the use of C. elegans to study NER and the response to UV-induced DNA damage.

  13. Software for tag single nucleotide polymorphism selection

    Stram Daniel O

    2005-06-01

    Full Text Available Abstract This paper reviews the theoretical basis for single nucleotide polymorphism (SNP tagging and considers the use of current software made freely available for this task. A distinction between haplotype block-based and non-block-based approaches yields two classes of procedures. Analysis of two different sets of SNP genotype data from the HapMap is used to judge the practical aspects of using each of the programs considered, as well as to make some general observations about the performance of the programs in finding optimal sets of tagging SNPs. Pairwise R2 methods, while the simplest of those considered, do tend to pick more tagging SNPs than are strictly needed to predict unmeasured (non-tagging SNPs, since a combination of two or more tagging SNPs can form a prediction of SNPs that have no direct (pairwise surrogate. Block-based methods that exploit the linkage disequilibrium structure within haplotype blocks exploit this sort of redundancy, but run a risk of over-fitting if used without some care. A compromise approach which eliminates the need first to analyse block structure, but which still exploits simple relationships between SNPs, appears promising.

  14. Nucleotide Phosphohydrolase in Purified Vaccinia Virus

    Munyon, William; Paoletti, Enzo; Ospina, Julio; Grace, James T.

    1968-01-01

    Purified infectious vaccinia virus has been shown to contain an enzyme or enzymes that remove the terminal phosphate group from adenosine triphosphate (ATP), guanosine triphosphate (GTP), uridine triphosphate (UTP), and cytidine triphosphate (CTP). The Km for ATP of this enzyme is 5.5 × 10−4m, and the relative rates of the reaction with ATP, GTP, UTP, and CTP are 1.00, 0.34, 0.15, and 0.29, respectively. The virus enzyme does not react with any of the diphosphates. The rate of the reaction is proportional to the amount of virus added and is linear for 130 min. The virus nucleotide phosphohydrolase activity is greatly stimulated by Mg++ and very slightly stimulated by Ca++. The small residual activity observed in the absence of divalent cations is completely inhibited by ethylenediaminetetraacetic acid. Neither Na+ nor K+ ions, nor any mixture of these, was found to stimulate the reaction significantly, and ouabain, at 10−4m, inhibited the reaction by only 27%. The response of the vaccinia enzyme to mono- and divalent cations and to ouabain indicates that the vaccinia enzyme has different properties from those associated with microsomes and mitochondria. PMID:4986904

  15. Impact of adjacent land use on coastal wetland sediments.

    Karstens, Svenja; Buczko, Uwe; Jurasinski, Gerald; Peticzka, Robert; Glatzel, Stephan

    2016-04-15

    Coastal wetlands link terrestrial with marine ecosystems and are influenced from both land and sea. Therefore, they are ecotones with strong biogeochemical gradients. We analyzed sediment characteristics including macronutrients (C, N, P, K, Mg, Ca, S) and heavy metals (Mn, Fe, Cu, Zn, Al, Co, Cr, Ni) of two coastal wetlands dominated by Phragmites australis at the Darss-Zingst Bodden Chain, a lagoon system at the Southern Baltic Sea, to identify the impact of adjacent land use and to distinguish between influences from land or sea. In the wetland directly adjacent to cropland (study site Dabitz) heavy metal concentrations were significantly elevated. Fertilizer application led to heavy metal accumulation in the sediments of the adjacent wetland zones. In contrast, at the other study site (Michaelsdorf), where the hinterland has been used as pasture, heavy metal concentrations were low. While the amount of macronutrients was also influenced by vegetation characteristics (e.g. carbon) or water chemistry (e.g. sulfate), the accumulation of heavy metals is regarded as purely anthropogenic influence. A principal component analysis (PCA) based on the sediment data showed that the wetland fringes of the two study sites are not distinguishable, neither in their macronutrient status nor in their concentrations of heavy metals, whereas the interior zones exhibit large differences in terms of heavy metal concentrations. This suggests that seaside influences are minor compared to influences from land. Altogether, heavy metal concentrations were still below national precautionary and action values. However, if we regard the macronutrient and heavy metal concentrations in the wetland fringes as the natural background values, an accumulation of trace elements from agricultural production in the hinterland is apparent. Thus, coastal wetlands bordering croplands may function as effective pollutant buffers today, but the future development has to be monitored closely to avoid

  16. Quantification of Lincomycin Resistance Genes Associated with Lincomycin Residues in Waters and Soils Adjacent to Representative Swine Farms in China

    LiangLi

    2013-12-01

    Full Text Available Lincomycin is commonly used on swine farms for growth promotion as well as disease treatment and control. Consequently, lincomycin may accumulate in the environment adjacent to the swine farms in many ways, thereby influencing antibiotic resistance in the environment. Levels of lincomycin-resistance genes and lincomycin residues in water and soil samples collected from multiple sites near wastewater discharge areas were investigated in this study. Sixteen lincomycin-resistance and 16S rRNA genes were detected using real-time PCR. Three genes, lnu(F, erm(A and erm(B, were detected in all water and soil samples except control samples. Lincomycin residues were determined by rapid resolution liquid chromatography-tandem mass spectrometry, with concentrations detected as high as 9.29 ng/mL in water and 0.97 ng/g in soil. A gradual reduction in the levels of lincomycin-resistance genes and lincomycin residues in the waters and soils were detected from multiple sites along the path of wastewater discharging to the surrounding environment from the swine farms. Significant correlations were found between levels of lincomycin-resistance genes in paired water and soil samples (r = 0.885, p = 0.019, and between lincomycin-resistance genes and lincomycin residues (r = 0.975, p < 0.01. This study emphasized the potential risk of dissemination of lincomycin-resistance genes such as lnu(F, erm(A and erm(B, associated with lincomycin residues in surrounding environments adjacent to swine farms.

  17. Three-dimensional visualization of intracranial vessels and adjacent structures

    MR three-dimensional-Fourier-transform, gradient-echo sequences are available that allow the acquisition of high-quality data sets, suitable for three- dimensional image processing. Most recently, flow- compensated measurement sequences are used to achieve a three-dimensional perspective of the vascular anatomy. Spatial relationships between vessels and adjacent structures can be revealed by three-dimensional displays, showing both vessels and tissue surfaces (brain, tumor) in a three- dimensional manner. The image-processing techniques are based on the ray-tracing principle. The method can be used for the optimization of neurosurgical planning in the sellar region

  18. Historical Earthquakes in the Yellow Sea and Its Adjacent Area

    Wu Ge; Wang Andong; Wu Di

    2005-01-01

    As a result of sorting out, estimating and cataloging of historical earthquakes, from the year of 2 A.D. to Aug., 1949, we found that there were 2187 earthquakes with M≥3.0 in the area of the Yellow Sea and its adjacent area. Among the earthquakes, the number of earthquakes with M ≥ 5.0 is 209, and at least 43 of the earthquakes caused serious losses, 20 of the earthquakes caused human causalities. It is demonstrated that there were 3 areas of historical earthquake concentration and the earthquake activity was higher in the 16th century and the first half if the 20th century.

  19. The kernel of the adjacency matrix of a rectangular mesh

    Tomei, Carlos; Vieira, Tania

    2002-01-01

    Given an m x n rectangular mesh, its adjacency matrix A, having only integer entries, may be interpreted as a map between vector spaces over an arbitrary field K. We describe the kernel of A: it is a direct sum of two natural subspaces whose dimensions are equal to $\\lceil c/2 \\rceil$ and $\\lfloor c/2 \\rfloor$, where c = gcd (m+1,n+1) - 1. We show that there are bases to both vector spaces, with entries equal to 0, 1 and -1. When K = Z/(2), the kernel elements of these subspaces are described...

  20. Experimental Tape Casting of Adjacently Graded Materials for Magnetic Refrigeration

    Bulatova, Regina

    graded thin films. The motivation to create such adjacently segmented structures stemmed from a search of material and a materials design alternative to the expensive rare earth element gadolinium which is widely used as a magnetic regenerator in the emerging magnetic refrigeration technology....... Conventional tape casting involves the preparation of specially formulated slurry, which is cast by a blade to a thin flat tape, then dried into flexible so-called green solid tape and can be subsequently sintered into a hard ceramic material. The principal difference and, at the same time, a challenge...

  1. The formation of adjacent triplex-duplex domainsin DNA.

    Nam, K. H.; Abhiraman, S; Wartell, R M

    1999-01-01

    The ability of single-stranded DNA oligomers to form adjacent triplex and duplex domains with two DNA structural motifs was examined. Helix-coil transition curves and a gel mobility shift assay were used to characterize the interaction of single-stranded oligomers 12-20 nt in length with a DNA hairpin and with a DNA duplex that has a dangling end. The 12 nt on the 5'-ends of the oligomers could form a triplex structure with the 12 bp stem of the hairpin or the duplex portion of the DNA with a...

  2. Adjacent Lumbar Disc Herniation after Lumbar Short Spinal Fusion

    Koshi Ninomiya; Koichi Iwatsuki; Yu-ichiro Ohnishi; Toshika Ohkawa; Toshiki Yoshimine

    2014-01-01

    A 70-year-old outpatient presented with a chief complaint of sudden left leg motor weakness and sensory disturbance. He had undergone L4/5 posterior interbody fusion with L3–5 posterior fusions for spondylolisthesis 3 years prior, and the screws were removed 1 year later. He has been followed up for 3 years, and there had been no adjacent segment problems before this presentation. Lumbar magnetic resonance imaging (MRI) showed a large L2/3 disc hernia descending to the L3/4 level. Compared to...

  3. Exophytic Atheroma Mimicking Papillary Fibroelastoma Adjacent to the Aortic Valve.

    Cho, Tomoki; Tokunaga, Shigehiko; Yasuda, Shota; Izubuchi, Ryo; Masuda, Munetaka

    2015-09-01

    Follow-up echocardiography in a 69-year-old man with alcoholic cardiomyopathy showed a mass above the aortic valve near the left coronary ostium. Transesophageal echocardiography and computed tomography suggested a papillary fibroelastoma with a high risk of embolism. At operation we found an exophytic atheroma adjacent to the left coronary artery orifice. The atheroma was removed, and the patient made an uneventful recovery. We describe this very rare case of an exophytic atheroma mimicking a papillary fibroelastoma situated at the left coronary orifice. PMID:26354633

  4. An ElGamal Encryption Scheme of Adjacency Matrix and

    B. Ravi Kumar

    2015-10-01

    Full Text Available  Cryptography is the combination of Mathematics and Computer science. Cryptography is used for encryption and decryption of data using mathematics. Cryptography transit the information in an illegible manner such that only intended recipient will be able to decrypt the information. In the recent years, researchers developed several new encryption methods. Among such ElGamal encryption is the one laid a concede platform for the researchers in Cryptography. Ever science several mathematical models were applied for encryption/decryption. In this paper, we introduced an ElGamal encryption, which uses points on the elliptic curve, and finite state machines and adjacency matrix.

  5. High-throughput nucleotide sequence analysis of diverse bacterial communities in leachates of decomposing pig carcasses

    Seung Hak Yang

    2015-09-01

    Full Text Available The leachate generated by the decomposition of animal carcass has been implicated as an environmental contaminant surrounding the burial site. High-throughput nucleotide sequencing was conducted to investigate the bacterial communities in leachates from the decomposition of pig carcasses. We acquired 51,230 reads from six different samples (1, 2, 3, 4, 6 and 14 week-old carcasses and found that sequences representing the phylum Firmicutes predominated. The diversity of bacterial 16S rRNA gene sequences in the leachate was the highest at 6 weeks, in contrast to those at 2 and 14 weeks. The relative abundance of Firmicutes was reduced, while the proportion of Bacteroidetes and Proteobacteria increased from 3–6 weeks. The representation of phyla was restored after 14 weeks. However, the community structures between the samples taken at 1–2 and 14 weeks differed at the bacterial classification level. The trend in pH was similar to the changes seen in bacterial communities, indicating that the pH of the leachate could be related to the shift in the microbial community. The results indicate that the composition of bacterial communities in leachates of decomposing pig carcasses shifted continuously during the study period and might be influenced by the burial site.

  6. A molecular biological study on identification of common septicemia bacteria using 16s-23s rRNA gene spacer regions

    傅君芬; 虞和永; 尚世强; 洪文澜; 陆淼泉; 李建平

    2002-01-01

    In the search for a rapid and reliable method for identification of bacteria in blood and cerebrospinal fluid , we developed a unified set of primers and used them under polymerase chain reaction(PCR) to amplify the spacer regions between the 16s and 23s genes in the prokaryotic rRNA genetic loci . Spacer regions within these loci showed a significant level of length and sequence polymorphism across most of the species lines. A generic pair of priming sequences was selected from highly conserved sequences in the 16s and 23s genes occurring adjacent to these polymorphic regions. This single set of primers and reaction conditions were used for the amplification of the 16s-23s spacer regions for 61 strains of standard bacteria and corresponding clinical isolates belonging to 20 genera and 27 species, including Listeria, Staphylococcus and Salmonella species, et al. When the spacer amplification products were resolved by electrophoresis, the resulting patterns could be used to distinguish most of the bacteria species within the test group, and the amplification products of the clinical isolates clustered at the standard species level. Some species presenting similar pattern were further analyzed by HinfI or AluI digestion or DNA clone and sequences analysis in order to establish the specific 16s-23s rRNA gene spacer regions map. Analysis of 42 blood specimens from septicemic neonates and 6 CSF specimens from suspected purulent meningitis patients by bacterial culture and PCR-RFLP(Restriction Fregament Length Polymorphism) showed that 15 specimens of blood culture were positive(35.7%) in the 42 septicemic neonates; 27 specimens were positive(64.2%) by PCR, and that the positive rate by PCR was significantly higher than that by blood culture(P<0.01). Among the 6 CSF specimens, one specimen found positive by blood culture was also positive by PCR, two found negative by blood culture showed positive by PCR; all three were S.epidermidis according to the DNA map. One C

  7. Adjacent stage impurity ratio in rare earth countercurrent extraction process

    CHENG Fuxiang; WU Sheng; LIAO Chunsheng; YAN Chunhua

    2013-01-01

    Impurity components decrease stage by stage in a cascade of rare earth (RE) extraction separation,and adjacent stage impurity ratio (ASIR) which is defined as the ratio of an impurity's contents in the aqueous/organic phase of two adjacent stages can be used to evaluate the capacity of impurity removal for the two stages.On the basis of extraction equilibrium and mass balance,the ASIR in a two-component extraction separation was deducted and its simplified expressions were given for different process sections according to reasonable assumptions.The calculation simulation was then carried out to obtain the ASIR distribution in the cascade.The results showed that in both the extraction and scrubbing sections the ASIR principally increased with the decrease of the molar proportion of the impurity but along with a flat appearing in the purification zone located in the middle of the cascade.The ASIR intuitively exhibits the nmning status of RE extraction separation and purification,which could provide a theoretic guide for investigating the influence factors of RE extraction separation process in practical industry.

  8. Adjacent segment disease in degenerative pathologies with posterior instrumentation

    Ana Guadalupe Ramírez Olvera

    2015-03-01

    Full Text Available OBJECTIVE: To establish the real incidence of adjacent segment disease after fusion, and to identify the levels and predisposing factors for the pathology, as well as the functional results. METHODS: a retrospective case series study with level of evidence IIB, in a sample of 179 patients diagnosed with stenosis of the lumbar spine, spondylolisthesis and degenerative scoliosis, submitted to surgery in the period 2005 to December 2013, with posterior instrumentation and posterolateral fusion, with follow-up from 2007 until May 2014, in which the symptomology and radiographic findings were evaluated, to establish the diagnosis and treatment. RESULTS: the study included 179 patients diagnosed with stenosis of the lumbar spine (n=116, isthmic and degenerative spondylolisthesis (n=50 and degenerative scoliosis (n=13; during the study, 20 cases of adjacent level segment were identified, 80% of which were treated surgically with extension of the instrumentation, while 20% were treated conservatively with NSAIDs and therapeutic blocks. CONCLUSION: An incidence of 11% was found, with an average of 3.25 years in diagnosis and treatment, a prevalence of females and diagnosis of stenosis of the lumbar canal on posterior instrumentation, a predominance of levels L4-L5; 80% were treated with extension of the instrumentation. The complications were persistent radiculopathy, infection of the surgical wound, and one death due to causes not related to the lumbar pathology.

  9. Absorbed dose distribution analyses in irradiation with adjacent fields

    Because the special irradiation technique with adjacent fields is the most used in the case of medulloblastoma treatment, we consider very important to specify some general information about medulloblastoma. This malignant disease has a large incidence in children with age between 5-7 years. This tumor usually originates in the cerebellum and is referred to as primitive undifferentiated tumor. It may spread contiguously to the cerebellar peduncle, floor of the fourth ventricle, into the cervical spine. In addition, it may spread via the cerebrospinal fluid intracranially and/or to the spinal cord. For this purpose it is necessary to perform a treatment technique with cranial tangential fields combined with adjacent fields for the entire spinal cord to achieve a perfect coverage of the zones with malignant cells. The treatment in this case is an association between surgery-radio-chemotherapy, where the radiotherapy has a very important roll and a curative purpose. This is due to the fact that the migration of malignant cells in the body can't be controlled by surgery. Because of this special irradiation technique used in medulloblastoma treatment, we chase to describe in this paper this complex type of irradiation where the implications of the beams divergence in doses distribution are essentials

  10. Stress Wave Interaction Between Two Adjacent Blast Holes

    Yi, Changping; Johansson, Daniel; Nyberg, Ulf; Beyglou, Ali

    2016-05-01

    Rock fragmentation by blasting is determined by the level and state of stress in the rock mass subjected to blasting. With the application of electronic detonators, some researchers stated that it is possible to achieve improved fragmentation through stress wave superposition with very short delay times. This hypothesis was studied through theoretical analysis in the paper. First, the stress in rock mass induced by a single-hole shot was analyzed with the assumptions of infinite velocity of detonation and infinite charge length. Based on the stress analysis of a single-hole shot, the stress history and tensile stress distribution between two adjacent holes were presented for cases of simultaneous initiation and 1 ms delayed initiation via stress superposition. The results indicated that the stress wave interaction is local around the collision point. Then, the tensile stress distribution at the extended line of two adjacent blast holes was analyzed for a case of 2 ms delay. The analytical results showed that the tensile stress on the extended line increases due to the stress wave superposition under the assumption that the influence of neighboring blast hole on the stress wave propagation can be neglected. However, the numerical results indicated that this assumption is unreasonable and yields contrary results. The feasibility of improving fragmentation via stress wave interaction with precise initiation was also discussed. The analysis in this paper does not support that the interaction of stress waves improves the fragmentation.

  11. Cardiac Na+ Current Regulation by Pyridine Nucleotides

    Liu, Man; Sanyal, Shamarendra; Gao, Ge; Gurung, Iman S.; Zhu, Xiaodong; Gaconnet, Georgia; Kerchner, Laurie J.; Shang, Lijuan L.; Huang, Christopher L-H.; Grace, Andrew; London, Barry; Dudley, Samuel C.

    2009-01-01

    Rationale Mutations in glycerol-3-phosphate dehydrogenase 1-like (GPD1-L) protein reduce cardiac Na+ current (INa) and cause Brugada Syndrome (BrS). GPD1-L has >80% amino acid homology with glycerol-3-phosphate dehydrogenase, which is involved in nicotinamide adenine dinucleotide (NAD)-dependent energy metabolism. Objective Therefore, we tested whether NAD(H) could regulate human cardiac sodium channels (Nav1.5). Methods and Results HEK293 cells stably expressing Nav1.5 and rat neonatal cardiomyocytes were used. The influence of NADH/NAD+ on arrhythmic risk was evaluated in wild-type or SCN5A+/− mouse heart. A280V GPD1-L caused a 2.48 ± 0.17-fold increase in intracellular NADH level (P<0.001). NADH application or co-transfection with A280V GPD1-L resulted in decreased INa (0.48 ± 0.09 or 0.19 ±0.04 of control group, respectively; P<0.01), which was reversed by NAD+, chelerythrine, or superoxide dismutase (SOD). NAD+ antagonism of the Na+ channel downregulation by A280V GPD1-L or NADH was prevented by a protein kinase A (PKA) inhibitor, PKAI6–22. The effects of NADH and NAD+ were mimicked by a phorbol ester and forskolin, respectively. Increasing intracellular NADH was associated with an increased risk of ventricular tachycardia (VT) in wild-type mouse hearts. Extracellular application of NAD+ to SCN5A+/− mouse hearts ameliorated the risk of VT. Conclusions Our results show that Nav1.5 is regulated by pyridine nucleotides, suggesting a link between metabolism and INa. This effect required protein kinase C (PKC) activation and was mediated by oxidative stress. NAD+ could prevent this effect by activating PKA. Mutations of GPD1-L may downregulate Nav1.5 by altering the oxidized to reduced NAD(H) balance. PMID:19745168

  12. Empirical Bayes analysis of single nucleotide polymorphisms

    Ickstadt Katja

    2008-03-01

    Full Text Available Abstract Background An important goal of whole-genome studies concerned with single nucleotide polymorphisms (SNPs is the identification of SNPs associated with a covariate of interest such as the case-control status or the type of cancer. Since these studies often comprise the genotypes of hundreds of thousands of SNPs, methods are required that can cope with the corresponding multiple testing problem. For the analysis of gene expression data, approaches such as the empirical Bayes analysis of microarrays have been developed particularly for the detection of genes associated with the response. However, the empirical Bayes analysis of microarrays has only been suggested for binary responses when considering expression values, i.e. continuous predictors. Results In this paper, we propose a modification of this empirical Bayes analysis that can be used to analyze high-dimensional categorical SNP data. This approach along with a generalized version of the original empirical Bayes method are available in the R package siggenes version 1.10.0 and later that can be downloaded from http://www.bioconductor.org. Conclusion As applications to two subsets of the HapMap data show, the empirical Bayes analysis of microarrays cannot only be used to analyze continuous gene expression data, but also be applied to categorical SNP data, where the response is not restricted to be binary. In association studies in which typically several ten to a few hundred SNPs are considered, our approach can furthermore be employed to test interactions of SNPs. Moreover, the posterior probabilities resulting from the empirical Bayes analysis of (prespecified interactions/genotypes can also be used to quantify the importance of these interactions.

  13. 多浆旱生植物霸王18SrRNA基因的克隆及序列分析%Cloning and sequence analysis of 18S rRNA gene fragment from succulent xerophyte Zygophyllum xanthoxylum

    胡静; 谢俊仁; 王锁民

    2012-01-01

    In order to reveal the relationship between succulent xerophyte Zygophyllum xanthoxylum and other plants and to provide evidences for the biologically evolution, total DNA was extracted from leaves of Z. xanthoxylurn seedlings, and the 18S rRNA gene was cloned by PCR using general primers and cloned into pGEM-T vector. The positive clone identified by PCR was sequenced. The sequencing result revealed that the 18S rRNA gene fragment from Z. xanthoxylum contains 1808 bp. Homology comparison with other plants 18S rRNA gene sequences in the GenBank showed that it shared over 96% nucleotide sequence homology, so it is concluded that 18S rRNA is very conservative gene in plants. However, Homology matrix and Blast showed that Z. xanthoxylurn shared high similarity (98%) with the identified 18S rRNA in Galearia fili formis , Cnidoscolus aconiti folius and Hevea brasiliensis. Phylogenetic tree analysis indicated that Z. xanthoxylum and Panax notoginseng were most consanguineously grouped.%为探讨多浆旱生植物霸王(Zygophyllum xanthoxylum)的生物进化历程及与其他植物的亲缘关系,本研究以霸王叶基因组DNA为模板,使用通用引物扩增其18SrRNA基因片段,并克隆到pGEM—T载体,阳性克隆经鉴定后进行测序。核苷酸序列分析结果表明,该片段长1808bp,所得序列与GenBank中注册的18SrRNA基因序列的同源性均在96%以上。可见,高等植物18SrRNA的基因非常保守。同源性分析与Blast比较结果表明,霸王与小盘木(Galearia filiformis)、驱虫苋(Cnidoscolus aconitifolius)及橡胶树(Herera brasiliensis)同源性最高。系统进化树分析表明,霸王与三七(Panax notoginseng)的亲缘关系最近。

  14. 罗氏沼虾18S rRNA基因生物素标记探针的制备及应用%Preparation and application of the biotin-labeled probe of 18S rRNA gene in Macrobrachium rosenbergii

    高风英; 叶星; 白俊杰; 吴锐全; 劳海华; 简清; 罗建仁

    2005-01-01

    Probes are essential for study of gene expression and regulation. In this study, a method was established to prepare the biotin-labeled probe for 18S rRNA gene of freshwater prawn, Macrobrachium rosenbergii. And the labeled method was used to produce a lysozyme gene probe, then applied in analysis of lysozyme gene expression. Primers were designed according to the nucleotide sequences of 18S rRNA of Decalxxta in order to isolate the 18S rRNA gene sequences of M. rosenbergii. Total genomic DNA was isolated from hepatopancreas of the freshwater prawn. A specific DNA fragment with desired size was amplified by PCR using the total DNA as templates. The DNA fragment was inserted into pGEM-T Easy vector and sequenced. The result of BLAST and alignment analysis confirmed that the DNA fragment isolated was the 18S rRNA gene of M. rosenbergii, which was 418 nt in length.Biotin-labeled probe of the 18S rRNA was then produced by PCR using the recombinant plasmid as templates. The biotin-21-dTTP and the non-labeled dNTP were added to the PCR reaction system. Ratio of the biotin-21-dTTP and the non-labeled dTFP was 3 to 1.The yield of the labeled probe is 300 ng·μL-1. The detection limit of the probe is 60 pg. A biotin-labeled probe of lysozyme gene was prepared by the same label method, and the yield of the lysozyme gene probe is 500 ng·μL-1. These biotin-labeled probes were applied in Northern dot blotting analysis of tissue distribution of lysoyzme mRNA of M. rosenbergii. Signals were scanned and quantified by Analysis System of Biology Image. The signal intensity ratio of the lysozyme to 18S rRNA represents the relative expression level of lysozyme mRNA. The results showed that the lysozyme mRNA existed in all the tissues checked, including eye,muscle, gill, hepatopancreas, haemocytes and intestine. But lysoyzme mRNA levels varied among different tissues. The highest level was found in the intestine, and the second was in the hepatopancreas and the lowest was in the

  15. Transcriptional Activity of rRNA Genes in Barley Cells after Mutagenic Treatment.

    Kwasniewska, Jolanta; Jaskowiak, Joanna

    2016-01-01

    In the present study, the combination of the micronucleus test with analysis of the activity of the rRNA genes in mutagen-treated Hordeum vulgare (barley) by maleic hydrazide (MH) cells was performed. Simultaneously fluorescence in situ hybridization (FISH) with 25S rDNA as probes and an analysis of the transcriptional activity of 35S rRNA genes with silver staining were performed. The results showed that transcriptional activity is always maintained in the micronuclei although they are eliminated during the next cell cycle. The analysis of the transcriptional activity was extended to barley nuclei. MH influenced the fusion of the nucleoli in barley nuclei. The silver staining enabled detection of the nuclear bodies which arose after MH treatment. The results confirmed the usefulness of cytogenetic techniques in the characterization of micronuclei. Similar analyses can be now extended to other abiotic stresses to study the response of plant cells to the environment. PMID:27257817

  16. A renaissance for the pioneering 16S rRNA gene

    Tringe, Susannah; Hugenholtz, Philip

    2008-09-07

    Culture-independent molecular surveys using the 16S rRNA gene have become a mainstay for characterizing microbial community structure over the last quarter century. More recently this approach has been overshadowed by metagenomics, which provides a global overview of a community's functional potential rather than just an inventory of its inhabitants. However, the pioneering 16S rRNA gene is making a comeback in its own right thanks to a number of methodological advancements including higher resolution (more sequences), analysis of multiple related samples (e.g. spatial and temporal series) and improved metadata and use of metadata. The standard conclusion that microbial ecosystems are remarkably complex and diverse is now being replaced by detailed insights into microbial ecology and evolution based only on this one historically important marker gene.

  17. Rapid identification of Renibacterium salmoninarum using an oligonucleotide probe complementary to 16S rRNA.

    Mattsson, J G; Gersdorf, H; Jansson, E; Hongslo, T; Göbel, U B; Johansson, K E

    1993-02-01

    Bacterial kidney disease in salmonid fish is caused by the slow-growing Gram-positive rod, Renibacterium salmoninarum. The partial sequence of 16S rRNA from R. salmoninarum was determined and compared with published bacterial 16S rRNA sequences. From this sequence information, a 30-bases-long oligonucleotide was designed and used as a specific probe for identification of R. salmoninarum in filter hybridization experiments. Strong specific hybridization signals were observed for all strains of R. salmoninarum tested. Furthermore, no cross-hybridization could be seen against 22 other bacterial species, among them other salmonid fish pathogens. The detection limit for the probe in direct filter hybridization by the dot-blot technique was 2.5 x 10(4) bacteria. It was also possible to detect R. salmoninarum in clinical samples by direct filter hybridization. PMID:8455640

  18. Nucleotide Excision Repair in Cellular Chromatin: Studies with Yeast from Nucleotide to Gene to Genome

    Simon Reed

    2012-09-01

    Full Text Available Here we review our development of, and results with, high resolution studies on global genome nucleotide excision repair (GGNER in Saccharomyces cerevisiae. We have focused on how GGNER relates to histone acetylation for its functioning and we have identified the histone acetyl tranferase Gcn5 and acetylation at lysines 9/14 of histone H3 as a major factor in enabling efficient repair. We consider results employing primarily MFA2 as a model gene, but also those with URA3 located at subtelomeric sequences. In the latter case we also see a role for acetylation at histone H4. We then go on to outline the development of a high resolution genome-wide approach that enables one to examine correlations between histone modifications and the nucleotide excision repair (NER of UV-induced cyclobutane pyrimidine dimers throughout entire genomes. This is an approach that will enable rapid advances in understanding the complexities of how compacted chromatin in chromosomes is processed to access DNA damage and then returned to its pre-damaged status to maintain epigenetic codes.

  19. Detection of Renibacterium salmoninarum in tissue samples by sequence capture and fluorescent PCR based on the 16S rRNA gene.

    Königsson, Malin Heldtander; Ballagi, Andras; Jansson, Eva; Johansson, Karl-Erik

    2005-02-25

    The 16S rRNA genes from eight isolates of Renibacterium salmoninarum with different origins and dates of isolation were sequenced to evaluate the possibility to construct a diagnostic PCR system with target sites within this gene. The sequences were found to be identical but for one single position in one of the isolates, and two regions with an adequate number of nucleotide differences as compared to closely related species were identified. Species-specific fluorescent PCR primers complementary to these regions were constructed as well as oligonucleotides for DNA preparation by sequence capture. A mimic molecule was constructed to be used as an internal control. The PCR was specific and allowed the detection of DNA equivalent to 1-10 R. salmoninarum genomes per reaction. The DNA preparation with sequence capture and analysis by PCR with a mimic was found to be a reliable method for analysis of kidneys from fish with BKD. The amount of PCR inhibiting substances present in the tissue was reduced, and the relevant DNA was concentrated in the capture step. Furthermore, the use of the mimic molecule in the system assured that false negative results could be identified. PMID:15708821

  20. Phylogeny of the malarial genus Plasmodium, derived from rRNA gene sequences.

    Escalante, A A; Ayala, F. J.

    1994-01-01

    Malaria is among mankind's worst scourges, affecting many millions of people, particularly in the tropics. Human malaria is caused by several species of Plasmodium, a parasitic protozoan. We analyze the small subunit rRNA gene sequences of 11 Plasmodium species, including three parasitic to humans, to infer their evolutionary relationships. Plasmodium falciparum, the most virulent of the human species, is closely related to Plasmodium reichenowi, which is parasitic to chimpanzee. The estimate...

  1. Direct ribosome isolation from soil to extract bacterial rRNA for community analysis.

    Felske, A; B. Engelen; Nübel, U; Backhaus, H

    1996-01-01

    A simple method that combines an adapted ribosome isolation method and a common RNA extraction step has been developed for selective recovery of intact rRNA from natural microbial communities in soil. After mechanical cell lysis, ribosomes are separated by centrifugation steps, avoiding massive humic acid contamination and RNA degradation. The protocol accommodates the complex composition of soils by blocking adsorbing surfaces and humic acids with polyvinylpyrrolidone and bovine serum albumi...

  2. rRNA genes from the lower chordate Herdmania momus: structural similarity with higher eukaryotes.

    Degnan, B M; Yan, J.; Hawkins, C J; Lavin, M F

    1990-01-01

    Ascidians, primitive chordates that have retained features of the likely progenitors to all vertebrates, are a useful model to study the evolutionary relationship of chordates to other animals. We have selected the well characterized ribosomal RNA (rRNA) genes to investigate this relationship, and we describe here the cloning and characterization of an entire ribosomal DNA (rDNA) tandem repeat unit from a lower chordate, the ascidian Herdmania momus. rDNA copy number and considerable sequence...

  3. Two distinct promoter elements in the human rRNA gene identified by linker scanning mutagenesis.

    Haltiner, M M; Smale, S T; Tjian, R

    1986-01-01

    A cell-free RNA polymerase I transcription system was used to evaluate the transcription efficiency of 21 linker scanning mutations that span the human rRNA gene promoter. Our analysis revealed the presence of two major control elements, designated the core and upstream elements, that affect the level of transcription initiation. The core element extends from -45 to +18 relative to the RNA start site, and transcription is severely affected (up to 100-fold) by linker scanning mutations in this...

  4. 18S rRNA suggests that Entoprocta are protostomes, unrelated to Ectoprocta

    Mackey, L.Y.; Winnepenninckx, B.; Wachter, R.; Backeljau, T.; Emschermann, P.; Garey, J.R.

    1996-01-01

    The Ento- and Ectoprocta are sometimes placed together in the Bryozoa, which have variously been regarded as proto- or deuterostomes. However, Entoprocta have also been allied to the pseudocoelomates, while Ectoprocta are often united with the Brachiopoda and Phoronida in the (super)phylum Lophophorata. Hence, the phylogenetic relationships of these taxa are still much debated. We determined complete 18S rRNA sequences of two entoprocts, an ectoproct, an inarticulate brachiopod, a phoronid, t...

  5. Phylogenetic Relationship of Phosphate Solubilizing Bacteria according to 16S rRNA Genes

    Mohammad Bagher Javadi Nobandegani; Halimi Mohd Saud; Wong Mui Yun

    2015-01-01

    Phosphate solubilizing bacteria (PSB) can convert insoluble form of phosphorous to an available form. Applications of PSB as inoculants increase the phosphorus uptake by plant in the field. In this study, isolation and precise identification of PSB were carried out in Malaysian (Serdang) oil palm field (University Putra Malaysia). Identification and phylogenetic analysis of 8 better isolates were carried out by 16S rRNA gene sequencing in which as a result five isolates belong to the Beta sub...

  6. Impaired rRNA synthesis triggers homeostatic responses in hippocampal neurons

    Anna eKiryk

    2013-11-01

    Full Text Available Decreased rRNA synthesis and nucleolar disruption, known as nucleolar stress, are primary signs of cellular stress associated with aging and neurodegenerative disorders. Silencing of rDNA occurs during early stages of Alzheimer´s disease (AD and may play a role in dementia. Moreover aberrant regulation of the protein synthesis machinery is present in the brain of suicide victims and implicates the epigenetic modulation of rRNA. Recently, we developed unique mouse models characterized by nucleolar stress in neurons. We inhibited RNA polymerase I by genetic ablation of the basal transcription factor TIF-IA in adult hippocampal neurons. Nucleolar stress resulted in progressive neurodegeneration, although with a differential vulnerability within the CA1, CA3 and dentate gyrus. Here, we investigate the consequences of nucleolar stress on learning and memory. The mutant mice show normal performance in the Morris water maze and in other behavioral tests, suggesting the activation of adaptive mechanisms. In fact, we observe a significantly enhanced learning and re-learning corresponding to the initial inhibition of rRNA transcription. This phenomenon is accompanied by aberrant synaptic plasticity. By the analysis of nucleolar function and integrity, we find that the synthesis of rRNA is later restored. Gene expression profiling shows that thirty-six transcripts are differentially expressed in comparison to the control group in absence of neurodegeneration. Additionally, we observe a significant enrichment of the putative serum response factor (SRF binding sites in the promoters of the genes with changed expression, indicating potential adaptive mechanisms mediated by the mitogen-activated protein kinase pathway. In the dentate gyrus a neurogenetic response might compensate the initial molecular deficits. These results underscore the role of nucleolar stress in neuronal homeostasis and open a new ground for therapeutic strategies aiming at preserving

  7. Greengenes: Chimera-checked 16S rRNA gene database and workbenchcompatible in ARB

    DeSantis, T.Z.; Hugenholtz, P.; Larsen, N.; Rojas, M.; Brodie,E.L; Keller, K.; Huber, T.; Dalevi, D.; Hu, P.; Andersen, G.L.

    2006-02-01

    A 16S rRNA gene database (http://greengenes.lbl.gov) addresses limitations of public repositories by providing chimera-screening, standard alignments and taxonomic classification using multiple published taxonomies. It was revealed that incongruent taxonomic nomenclature exists among curators even at the phylum-level. Putative chimeras were identified in 3% of environmental sequences and 0.2% of records derived from isolates. Environmental sequences were classified into 100 phylum-level lineages within the Archaea and Bacteria.

  8. GJB2 and mitochondrial 12S rRNA susceptibility mutations in sudden deafness.

    Chen, Kaitian; Sun, Liang; Zong, Ling; Wu, Xuan; Zhan, Yuan; Dong, Chang; Cao, Hui; Tang, Haocheng; Jiang, Hongyan

    2016-06-01

    Genetic susceptibility may play an important role in the pathogenesis of sudden deafness. However, the specific genes involved are largely unknown. We sought to explore the frequency of GJB2 and mitochondrial 12S rRNA susceptibility mutations in patients with sudden deafness. Between September 2011 and May 2012, 62 consecutive patients with sudden deafness were seen. In 50 of these, no etiological factors for sudden deafness were found. We detected GJB2 and mitochondrial 12S rRNA variants by direct sequencing in these 50 patients and in 53-aged matched controls with normal hearing. In addition, we undertook functional analyses of the mitochondrial mutations which we detected, applying structural and phylogenetic analysis. GJB2 sequencing identified six mutations, including three pathogenic mutations (c.235delC, c.299-300delAT, c.109G>A) and three polymorphisms, in the study participants, giving an allele frequency of 15.0 %. A homozygous c.109G>A mutation was detected in two participants. A total of 16 variants in mitochondrial 12S rRNA gene were identified in the participants. No significant differences were found in GJB2 heterozygosity or in mitochondrial 12S rRNA variants between patients with sudden deafness and in controls. Our results suggest that the homozygous GJB2 c.109G>A mutation may be a cause of sudden deafness involving both ears. This finding should increase awareness of the likely role of genetic factors in the etiology of sudden deafness in general. PMID:26119842

  9. The donor substrate site within the peptidyl transferase loop of 23 S rRNA and its putative interactions with the CCA-end of N-blocked aminoacyl-tRNA(Phe)

    Porse, B T; Thi-Ngoc, H P; Garrett, R A

    1996-01-01

    An RNA region associated with the donor substrate site, located at the base of the peptidyl transferase loop of 23 S rRNA, was subjected to a comprehensive single-site mutational study. Growth phenotypes of Escherichia coli cells were characterized on induction of synthesis of the mutated rRNAs and...... the mutated ribosomes were tested, selectively, for their capacity to generate peptide bonds under the conditions of the "fragment" assay. Most of the mutants exhibited dominant or recessive lethal growth phenotypes and, in general, defective growth correlated with low activities in peptide bond...... approach was employed to test for Watson-Crick base-pairing interactions between the -CCA end of the P-site bound tRNA(Phe) and this region of the peptidyl-transferase loop. Single nucleotide substitutions were introduced into the -CCA end of tRNA(Phe) and the ability of the 3'-terminal pentanucleotide...

  10. rRNA Binding Sites and the Molecular Mechanism of Action of the Tetracyclines.

    Chukwudi, Chinwe U

    2016-08-01

    The tetracycline antibiotics are known to be effective in the treatment of both infectious and noninfectious disease conditions. The 16S rRNA binding mechanism currently held for the antibacterial action of the tetracyclines does not explain their activity against viruses, protozoa that lack mitochondria, and noninfectious conditions. Also, the mechanism by which the tetracyclines selectively inhibit microbial protein synthesis against host eukaryotic protein synthesis despite conservation of ribosome structure and functions is still questionable. Many studies have investigated the binding of the tetracyclines to the 16S rRNA using the small ribosomal subunit of different bacterial species, but there seems to be no agreement between various reports on the exact binding site on the 16S rRNA. The wide range of activity of the tetracyclines against a broad spectrum of bacterial pathogens, viruses, protozoa, and helminths, as well as noninfectious conditions, indicates a more generalized effect on RNA. In the light of recent evidence that the tetracyclines bind to various synthetic double-stranded RNAs (dsRNAs) of random base sequences, suggesting that the double-stranded structures may play a more important role in the binding of the tetracyclines to RNA than the specific base pairs, as earlier speculated, it is imperative to consider possible alternative binding modes or sites that could help explain the mechanisms of action of the tetracyclines against various pathogens and disease conditions. PMID:27246781

  11. Characterization of Hydrocortisone Biometabolites and 18S rRNA Gene in Chlamydomonas reinhardtii Cultures

    Seyed Bagher Mosavi-Azam

    2008-10-01

    Full Text Available A unicellular microalga, Chlamydomonas reinhardtii, was isolated from rice paddy-field soil and water samples and used in the biotransformation of hydrocortisone (1. This strain has not been previously tested for steroid bioconversion. Fermentation was carried out in BG-11 medium supplemented with 0.05% substrate at 25ºC for 14 days of incubation. The products obtained were chromatographically purified and characterized using spectroscopic methods. 11b,17b-Dihydroxyandrost-4-en-3-one (2, 11b-hydroxyandrost-4-en-3,17-dione (3, 11b,17a,20b,21-tetrahydroxypregn-4-en-3-one (4 and prednisolone (5 were the main products of the bioconversion. The observed bioreaction features were the side chain degradation of the substrate to give compounds 2 and 3 and the 20-ketone reduction and 1,2-dehydrogenation affording compounds 4 and 5, respectively. A time course study showed the accumulation of product 2 from the second day of the fermentation and of compounds 3, 4 and 5 from the third day. All the metabolites reached their maximum concentration in seven days. Microalgal 18S rRNA gene was also amplified by PCR. PCR products were sequenced to confirm their authenticity as 18S rRNA gene of microalgae. The result of PCR blasted with other sequenced microalgae in NCBI showed 100% homology to the 18S small subunit rRNA of two Chlamydomonas reinhardtii spp.

  12. Molecular systematics of Volvocales (Chlorophyceae, Chlorophyta) based on exhaustive 18S rRNA phylogenetic analyses.

    Nakada, Takashi; Misawa, Kazuharu; Nozaki, Hisayoshi

    2008-07-01

    The taxonomy of Volvocales (Chlorophyceae, Chlorophyta) was traditionally based solely on morphological characteristics. However, because recent molecular phylogeny largely contradicts the traditional subordinal and familial classifications, no classification system has yet been established that describes the subdivision of Volvocales in a manner consistent with the phylogenetic relationships. Towards development of a natural classification system at and above the generic level, identification and sorting of hundreds of sequences based on subjective phylogenetic definitions is a significant step. We constructed an 18S rRNA gene phylogeny based on 449 volvocalean sequences collected using exhaustive BLAST searches of the GenBank database. Many chimeric sequences, which can cause fallacious phylogenetic trees, were detected and excluded during data collection. The results revealed 21 strongly supported primary clades within phylogenetically redefined Volvocales. Phylogenetic classification following PhyloCode was proposed based on the presented 18S rRNA gene phylogeny along with the results of previous combined 18S and 26S rRNA and chloroplast multigene analyses. PMID:18430591

  13. Details of gastropod phylogeny inferred from 18S rRNA sequences.

    Winnepenninckx, B; Steiner, G; Backeljau, T; De Wachter, R

    1998-02-01

    Some generally accepted viewpoints on the phylogenetic relationships within the molluscan class Gastropoda are reassessed by comparing complete 18S rRNA sequences. Phylogenetic analyses were performed using the neighbor-joining and maximum parsimony methods. The previously suggested basal position of Archaeogastropoda, including Neritimorpha and Vetigastropoda, in the gastropod clade is confirmed. The present study also provides new molecular evidence for the monophyly of both Caenogastropoda and Euthyneura (Pulmonata and Opisthobranchia), making Prosobranchia paraphyletic. The relationships within Caenogastropoda and Euthyneura data turn out to be very unstable on the basis of the present 18S rRNA sequences. The present 18S rRNA data question, but are insufficient to decide on, muricacean (Neogastropoda), neotaenioglossan, pulmonate, or stylommatophoran monophyly. The analyses also focus on two systellommatophoran families, namely, Veronicellidae and Onchidiidae. It is suggested that Systellommatophora are not a monophyletic unit but, due to the lack of stability in the euthyneuran clade, their affinity to either Opisthobranchia or Pulmonata could not be determined. PMID:9479694

  14. Efficient Nucleic Acid Extraction and 16S rRNA Gene Sequencing for Bacterial Community Characterization.

    Anahtar, Melis N; Bowman, Brittany A; Kwon, Douglas S

    2016-01-01

    There is a growing appreciation for the role of microbial communities as critical modulators of human health and disease. High throughput sequencing technologies have allowed for the rapid and efficient characterization of bacterial communities using 16S rRNA gene sequencing from a variety of sources. Although readily available tools for 16S rRNA sequence analysis have standardized computational workflows, sample processing for DNA extraction remains a continued source of variability across studies. Here we describe an efficient, robust, and cost effective method for extracting nucleic acid from swabs. We also delineate downstream methods for 16S rRNA gene sequencing, including generation of sequencing libraries, data quality control, and sequence analysis. The workflow can accommodate multiple samples types, including stool and swabs collected from a variety of anatomical locations and host species. Additionally, recovered DNA and RNA can be separated and used for other applications, including whole genome sequencing or RNA-seq. The method described allows for a common processing approach for multiple sample types and accommodates downstream analysis of genomic, metagenomic and transcriptional information. PMID:27168460

  15. Analysis of blasting damage in adjacent mining excavations

    Nick Yugo

    2015-06-01

    Full Text Available Following a small-scale wedge failure at Yukon Zinc's Wolverine Mine in Yukon, Canada, a vibration monitoring program was added to the existing rockbolt pull testing regime. The failure in the 1150 drift occurred after numerous successive blasts in an adjacent tunnel had loosened friction bolts passing through an unmapped fault. Analysis of blasting vibration revealed that support integrity is not compromised unless there is a geological structure to act as a failure plane. The peak particle velocity (PPV rarely exceeded 250 mm/s with a frequency larger than 50 Hz. As expected, blasting more competent rock resulted in higher PPVs. In such cases, reducing the round length from 3.5 m to 2.0 m was an effective means of limiting potential rock mass and support damage.

  16. Acyclic 6-choosability of planar graphs without adjacent short cycles

    WANG WeiFan; ZHANG Ge; CHEN Min

    2014-01-01

    A proper vertex coloring of a graph G is acyclic if G contains no bicolored cycles.Given a list assignment L={L(v)|v∈V}of G,we say that G is acyclically L-colorable if there exists a proper acyclic coloringπof G such thatπ(v)∈L(v)for all v∈V.If G is acyclically L-colorable for any list assignment L with|L(v)|k for all v∈V(G),then G is acyclically k-choosable.In this paper,we prove that every planar graph G is acyclically 6-choosable if G does not contain 4-cycles adjacent to i-cycles for each i∈{3,4,5,6}.This improves the result by Wang and Chen(2009).

  17. Adjacent Lumbar Disc Herniation after Lumbar Short Spinal Fusion

    Koshi Ninomiya

    2014-01-01

    Full Text Available A 70-year-old outpatient presented with a chief complaint of sudden left leg motor weakness and sensory disturbance. He had undergone L4/5 posterior interbody fusion with L3–5 posterior fusions for spondylolisthesis 3 years prior, and the screws were removed 1 year later. He has been followed up for 3 years, and there had been no adjacent segment problems before this presentation. Lumbar magnetic resonance imaging (MRI showed a large L2/3 disc hernia descending to the L3/4 level. Compared to the initial MRI, this hernia occurred in an “intact” disc among multilevel severely degenerated discs. Right leg paresis and bladder dysfunction appeared a few days after admission. Microscopic lumbar disc herniotomy was performed. The right leg motor weakness improved just after the operation, but the moderate left leg motor weakness and difficulty in urination persisted.

  18. New adjacent vertebral body fracture after percutaneous vertebroplasty

    Percutaneous vertebroplasty is widely used as a treatment for painful osteoporotic compression fractures and malignant osteolytic tumors. Although the procedure appears to provide dramatic pain relief promote life quality but also with some complications. Additional adjacent vertebral body fracture are frequently reported after vertebroplasty but the cause relationship between the procedure and new-onset vertebral fracture remains unknown. New compression fractures following percutaneous vertebroplasty may not be a complication of the procedure itself, but rather as a part of the course of underlying pathology. The crucial point of discussion in this paper is whether vertebroplasty predisposes the development of additional vertebral fractures, at a rate higher than that seen in the absence of vertebroplasty, but no definitive answer to this question is yet to come. This review explores and attempts to comprehend the data both of supporting and refuting a relationship between vertebroplasty and the development of subsequent fractures. (authors)

  19. Migration of PCBs from Sealants to Adjacent Material

    Andersen, Helle Vibeke; Gunnarsen, Lars Bo; Kampmann, Kristoffer

    2015-01-01

    PCB in sealants can migrate into porous surfaces like concrete and brick and contaminate these materials. The study focuses on an analysis of concentration profiles in relation to alleviation of PCB contamination. The PCB content was determined in 20 samples of concrete and 6 samples of brick...... concentration of the adjacent material. The profiles of PCB concentration into the materials showed some variation, though in general there is a tendency of relative higher concentration near the primary source in concrete and longer migration at low concentrations in brick. The concentration profiles seemed to...... fit an exponential function for concrete and a power function for brick. Based on the sample series, a worst case scenario for migration was defined. For concrete, it showed that a concentration of less than 50 ppm in the material (hazardous waste) was reached at a distance of 5 cm, whereas for bricks...

  20. Soil Structure Interaction between Two Adjacent Buildings under Earthquake Load

    Mahmoud Yahyai

    2008-01-01

    Full Text Available In some cases, tall buildings are located in geotechnically unsuitable places, due to their high ratio of height to width; there is risk of uplift and other effects such as overturning and reduction structure serviceability during earthquake. This research is aimed to evaluate the effect of Soil-Structure Interaction (SSI on seismic behavior of two adjacent 32 story buildings such as time period, base shear and displacements. The interaction effects are investigated for variable distance between the two buildings. Three types of soil such as soft clay, sandy gravel and compacted sandy gravel are considered for this study. The result obtained that the interaction effect increases time period of both buildings base shear and lateral displacement of the structures increases.

  1. Laser ablation of human atherosclerotic plaque without adjacent tissue injury

    Grundfest, W. S.; Litvack, F.; Forrester, J. S.; Goldenberg, T.; Swan, H. J. C.

    1985-01-01

    Seventy samples of human cadaver atherosclerotic aorta were irradiated in vitro using a 308 nm xenon chloride excimer laser. Energy per pulse, pulse duration and frequency were varied. For comparison, 60 segments were also irradiated with an argon ion and an Nd:YAG laser operated in the continuous mode. Tissue was fixed in formalin, sectioned and examined microscopically. The Nd:YAG and argon ion-irradiated tissue exhibited a central crater with irregular edges and concentric zones of thermal and blast injury. In contrast, the excimer laser-irradiated tissue had narrow deep incisions with minimal or no thermal injury. These preliminary experiments indicate that the excimer laser vaporizes tissue in a manner different from that of the continuous wave Nd:YAG or argon ion laser. The sharp incision margins and minimal damage to adjacent normal tissue suggest that the excimer laser is more desirable for general surgical and intravascular uses than are the conventionally used medical lasers.

  2. Classical Hodgkin Lymphoma Arising Adjacent to a Breast Implant.

    Ryan, Ciara; Ged, Yasser; Quinn, Fiona; Walker, Jan; Kennedy, John; Gillham, Charles; Pittaluga, Stefania; McDermott, Ronan; Vandenberghe, Elisabeth; Grant, Cliona; Flavin, Richard

    2016-08-01

    Breast implant-associated lymphoma has recently gained wide recognition. Anaplastic large cell lymphoma (ALCL) is the most frequently diagnosed subtype in this setting but the spectrum is broadening. A 66-year-old woman developed swelling and itch around her saline implant 6 years after its insertion. Imaging revealed a fluid collection surrounding the implant with an adjacent mass. Microscopy showed sclerotic tissue punctuated by discrete cellular nodules comprising small lymphocytes, eosinophils and interspersed large atypical Hodgkin Reed-Sternberg (HRS)-like cells. The HRS-like cells stained positively for CD30 and CD15 by immunohistochemistry. Small T-lymphocytes formed rosettes around HRS-like cells. Appearances were consistent with classical Hodgkin lymphoma (HL). Multiplex polymerase chain reaction demonstrated no clonal rearrangements of immunoglobulin or T-cell receptor genes, however, a t(14;18)(q32;q21)BCL2-JH translocation involving the major breakpoint region of the bcl2 gene was present. Staging positron emission tomography-computed tomography scan revealed FDG-avid masses in the right axilla and pelvis. Subsequent pathological examination identified low-grade follicular lymphoma (FL) with a t(14;18) translocation at these sites. To our knowledge, this is the first case of HL arising adjacent to a breast implant. An awareness of this diagnosis is important as classical HL, with its prominent mixed inflammatory background, may be overlooked as a reactive process when histologically assessing capsulectomy specimens. It is also important in the differential diagnosis for implant-associated ALCL as both contain large atypical CD30-positive cells highlighting the need for full immunohistochemical and molecular workup in such cases. This case also adds to the large body of literature regarding the association between HL and FL. PMID:26888955

  3. Increased apoptosis in gastric mucosa adjacent to intestinal metaplasia

    van Grieken, N C T; Meijer, G A; zur Hausen, A; Meuwissen, S G M; Baak, J P A; Kuipers, E J

    2003-01-01

    Background: The biological processes involved in the development of gastric mucosal atrophy and intestinal metaplasia are still incompletely understood. Reports testing the hypothesis that apoptosis leads to atrophy have yielded conflicting results. The availability of new antibodies for the detection of apoptotic cells in tissue sections has facilitated the analysis of the role of apoptosis in the gastritis–atrophy–intestinal metaplasia sequence. Methods: Archival material from 40 gastric resection specimens with normal mucosa (n = 5), chronic active gastritis (n = 17), or intestinal metaplasia (n = 18) was studied. Immunohistochemistry was performed using antibodies directed against cleaved cytokeratin 18 and active caspase 3. Slides were scored on a 0–3 scale for the presence of apoptotic cells. Results: Normal gastric mucosa contained low numbers of apoptotic cells at the surface epithelium (mean score, 0.20). This number was significantly increased in cases with chronic gastritis (mean score, 1.06) and in those with intestinal metaplasia (mean score, 2.56). Within the intestinal metaplasia cases, 44 different foci of intestinal metaplasia were identified. In 39 of these 44 areas, concentrations of apoptotic cells were seen immediately adjacent to the foci of intestinal metaplasia, but not in the metaplastic epithelium itself. Conclusions: Apoptosis is uncommon in normal gastric mucosa. Chronic inflammation and intestinal metaplasia are associated with increased apoptosis, but occur mainly at the mucosal surface and not in the deeper layers. These findings do not support the concept that apoptosis underlies the loss of gastric glands and leads to atrophy, but the observed concentration of apoptotic epithelial cells adjacent to foci of intestinal metaplasia could be related to heterogeneity of epithelial damage, causing apoptosis, to which intestinal metaplasia is a response. PMID:12719456

  4. Nucleotide Sequence - KOME | LSDB Archive [Life Science Database Archive metadata

    Full Text Available [ Credits ] BLAST Search Image Search Home About Archive Update History Contact us ...rtio About This Database Database Description Download License Update History of This Database Site Policy | Contact Us Nucleotide Sequence - KOME | LSDB Archive ...

  5. Nucleotide Metabolism and its Control in Lactic Acid Bacteria

    Kilstrup, Mogens; Hammer, Karin; Jensen, Peter Ruhdal;

    2005-01-01

    Most metabolic reactions are connected through either their utilization of nucleotides or their utilization of nucleotides or their regulation by these metabolites. In this review the biosynthetic pathways for pyrimidine and purine metabolism in lactic acid bacteria are described including the...... interconversion pathways, the formation of deoxyribonucleotides and the salvage pathways for use of exogenous precursors. The data for the enzymatic and the genetic regulation of these pathways are reviewed, as well as the gene organizations in different lactic acid bacteria. Mutant phenotypes and methods for...... manipulation of nucleotide pools are also discussed. Our aim is to provide an overview of the physiology and genetics of nucleotide metabolism and its regulation that will facilitate the interpretation of data arising from genetics, metabolomics, proteomics, and transcriptomics in lactic acid bacteria....

  6. Association study of nonsynonymous single nucleotide polymorphisms in schizophrenia

    Carrera, Noa; Arrojo, Manuel; Sanjuán, Julio;

    2012-01-01

    Genome-wide association studies using several hundred thousand anonymous markers present limited statistical power. Alternatively, association studies restricted to common nonsynonymous single nucleotide polymorphisms (nsSNPs) have the advantage of strongly reducing the multiple testing problem...

  7. Design of 16S rRNA gene primers for 454 pyrosequencing of the human foregut microbiome

    Carlos; W; Nossa; William; E; Oberdorf; Jφrn; A; Aas; Bruce; J; Paster; Todd; Z; DeSantis; Eoin; L; Brodie; Daniel; Malamud; Michael; A; Poles

    2010-01-01

    AIM:To design and validate broad-range 16S rRNA primers for use in high throughput sequencing to classify bacteria isolated from the human foregut microbiome.METHODS:A foregut microbiome dataset was constructed using 16S rRNA gene sequences obtained from oral,esophageal,and gastric microbiomes produced by Sanger sequencing in previous studies represented by 219 bacterial species.Candidate primers evaluated were from the European rRNA database.To assess the effect of sequence length on accuracy of classifica...

  8. Tissue-specific accelerated aging in nucleotide excision repair deficiency

    Laura J. Niedernhofer

    2008-01-01

    Nucleotide excision repair (NER) is a multi-step DNA repair mechanism that removes helix-distorting modified nucleotides from the genome. NER is divided into two subpathways depending on the location of DNA damage in the genome and how it is first detected. Global genome NER identifies and repairs DNA lesions throughout the genome. This subpathway of NER primarily protects against the accumulation of mutations in the genome. Transcription-coupled (TC) NER rapidly repairs lesions in the transc...

  9. Nucleotide sequence and genome organization of carnation mottle virus RNA.

    Guilley, H; Carrington, J C; Balàzs, E; Jonard, G; Richards, K; Morris, T J

    1985-01-01

    The complete nucleotide sequence of carnation mottle genomic RNA (4003 nucleotides) is presented. The sequence was determined for cloned cDNA copies of viral RNA containing over 99% of the sequence and was completed by direct sequence analysis of RNA and cDNA transcripts. The sequence contains two long open reading frames which together can account for observed translation products. One translation product would arise by suppression of an amber termination codon and the sequence raises the po...

  10. Quantitative Analysis of Guanine Nucleotide Exchange Factors (GEFs) as Enzymes

    Randazzo, Paul A.; Jian, Xiaoying; Chen, Pei-Wen; Zhai, Peng; Soubias, Olivier; Northup, John K.

    2014-01-01

    The proteins that possess guanine nucleotide exchange factor (GEF) activity, which include about ~800 G protein coupled receptors (GPCRs), 1 15 Arf GEFs, 2 81 Rho GEFs, 3 8 Ras GEFs, 4 and others for other families of GTPases, 5 catalyze the exchange of GTP for GDP on all regulatory guanine nucleotide binding proteins. Despite their importance as catalysts, relatively few exchange factors (we are aware of only eight for ras superfamily members) have been rigorously characterized kinetically. ...

  11. Thermodynamics of RNA duplexes modified with unlocked nucleic acid nucleotides

    Pasternak, Anna; Wengel, Jesper

    2010-01-01

    Thermodynamics provides insights into the influence of modified nucleotide residues on stability of nucleic acids and is crucial for designing duplexes with given properties. In this article, we introduce detailed thermodynamic analysis of RNA duplexes modified with unlocked nucleic acid (UNA) nucleotide residues. We investigate UNA single substitutions as well as model mismatch and dangling end effects. UNA residues placed in a central position makes RNA duplex structure less favourable by 4...

  12. An efficient rRNA removal method for RNA sequencing in GC-rich bacteria

    Peano Clelia

    2013-01-01

    Full Text Available Abstract Background Next generation sequencing (NGS technologies have revolutionized gene expression studies and functional genomics analysis. However, further improvement of RNA sequencing protocols is still desirable, in order to reduce NGS costs and to increase its accuracy. In bacteria, a major problem in RNA sequencing is the abundance of ribosomal RNA (rRNA, which accounts for 95-98% of total RNA and can therefore hinder sufficient coverage of mRNA, the main focus of transcriptomic studies. Thus, efficient removal of rRNA is necessary to achieve optimal coverage, good detection sensitivity and reliable results. An additional challenge is presented by microorganisms with GC-rich genomes, in which rRNA removal is less efficient. Results In this work, we tested two commercial kits for rRNA removal, either alone or in combination, on Burkholderia thailandensis. This bacterium, chosen as representative of the important Burkholderia genus, which includes both pathogenic and environmental bacteria, has a rather large (6.72 Mb and GC-rich (67.7% genome. Each enriched mRNA sample was sequenced through paired-end Illumina GAIIx run in duplicate, yielding between 10 and 40 million reads. We show that combined treatment with both kits allows an mRNA enrichment of more than 238-fold, enabling the sequencing of almost all (more than 90% B. thailandensis transcripts from less than 10 million reads, without introducing any bias in mRNA relative abundance, thus preserving differential expression profile. Conclusions The mRNA enrichment protocol presented in this work leads to an increase in detection sensitivity up to 770% compared to total RNA; such increased sensitivity allows for a corresponding reduction in the number of sequencing reads necessary for the complete analysis of whole transcriptome expression profiling. Thus we can conclude that the MICROBExpress/Ovation combined rRNA removal method could be suitable for RNA sequencing of whole

  13. An introduction to recurrent nucleotide interactions in RNA.

    Sweeney, Blake A; Roy, Poorna; Leontis, Neocles B

    2015-01-01

    RNA secondary structure diagrams familiar to molecular biologists summarize at a glance the folding of RNA chains to form Watson–Crick paired double helices. However, they can be misleading: First of all, they imply that the nucleotides in loops and linker segments, which can amount to 35% to 50% of a structured RNA, do not significantly interact with other nucleotides. Secondly, they give the impression that RNA molecules are loosely organized in three-dimensional (3D) space. In fact, structured RNAs are compactly folded as a result of numerous long-range, sequence-specific interactions, many of which involve loop or linker nucleotides. Here, we provide an introduction for students and researchers of RNA on the types, prevalence, and sequence variations of inter-nucleotide interactions that structure and stabilize RNA 3D motifs and architectures, using Escherichia coli (E. coli) 16S ribosomal RNA as a concrete example. The picture that emerges is that almost all nucleotides in structured RNA molecules, including those in nominally single-stranded loop or linker regions, form specific interactions that stabilize functional structures or mediate interactions with other molecules. The small number of noninteracting, ‘looped-out’ nucleotides make it possible for the RNA chain to form sharp turns. Base-pairing is the most specific interaction in RNA as it involves edge-to-edge hydrogen bonding (H-bonding) of the bases. Non-Watson–Crick base pairs are a significant fraction (30% or more) of base pairs in structured RNAs. PMID:25664365

  14. Nucleotide-sugar transporters: structure, function and roles in vivo

    Handford M.

    2006-01-01

    Full Text Available The glycosylation of glycoconjugates and the biosynthesis of polysaccharides depend on nucleotide-sugars which are the substrates for glycosyltransferases. A large proportion of these enzymes are located within the lumen of the Golgi apparatus as well as the endoplasmic reticulum, while many of the nucleotide-sugars are synthesized in the cytosol. Thus, nucleotide-sugars are translocated from the cytosol to the lumen of the Golgi apparatus and endoplasmic reticulum by multiple spanning domain proteins known as nucleotide-sugar transporters (NSTs. These proteins were first identified biochemically and some of them were cloned by complementation of mutants. Genome and expressed sequence tag sequencing allowed the identification of a number of sequences that may encode for NSTs in different organisms. The functional characterization of some of these genes has shown that some of them can be highly specific in their substrate specificity while others can utilize up to three different nucleotide-sugars containing the same nucleotide. Mutations in genes encoding for NSTs can lead to changes in development in Drosophila melanogaster or Caenorhabditis elegans, as well as alterations in the infectivity of Leishmania donovani. In humans, the mutation of a GDP-fucose transporter is responsible for an impaired immune response as well as retarded growth. These results suggest that, even though there appear to be a fair number of genes encoding for NSTs, they are not functionally redundant and seem to play specific roles in glycosylation.

  15. Shifts of microbial community structure in soils of a photovoltaic plant observed using tag-encoded pyrosequencing of 16S rRNA.

    Wu, Shijin; Li, Yuan; Wang, Penghua; Zhong, Li; Qiu, Lequan; Chen, Jianmeng

    2016-04-01

    The environmental risk of fluoride and chloride pollution is pronounced in soils adjacent to solar photovoltaic sites. The elevated levels of fluoride and chloride in these soils have had significant impacts on the population size and overall biological activity of the soil microbial communities. The microbial community also plays an essential role in remediation of these soils. Questions remain as to how the fluoride and chloride contamination and subsequent remediation at these sites have impacted the population structure of the soil microbial communities. We analyzed the microbial communities in soils collected from close to a solar photovoltaic enterprise by pyrosequencing of the 16S rRNA tag. In addition, we used multivariate statistics to identity the relationships shared between sequence diversity and heterogeneity in the soil environment. The overall microbial communities were surprisingly diverse, harboring a wide variety of taxa and sharing significant correlations with different degrees of fluoride and chloride contamination. The contaminated soils harbored abundant bacteria that were probably resistant to the high acidity, high fluoride and chloride concentration, and high osmotic pressure environment. The dominant genera were Sphingomonas, Subgroup_6_norank, Clostridium sensu stricto, Nitrospira, Rhizomicrobium, and Acidithiobacillus. The results of this study provide new information regarding a previously uncharacterized ecosystem and show the value of high-throughput sequencing in the study of complex ecosystems. PMID:26695154

  16. Species identification and profiling of complex microbial communities using shotgun Illumina sequencing of 16S rRNA amplicon sequences.

    Ong, SH; Kukkillaya, VU; Wilm, A; Lay, C; Ho, EX; Low, L; Hibberd, ML; Nagarajan, N.

    2013-01-01

    The high throughput and cost-effectiveness afforded by short-read sequencing technologies, in principle, enable researchers to perform 16S rRNA profiling of complex microbial communities at unprecedented depth and resolution. Existing Illumina sequencing protocols are, however, limited by the fraction of the 16S rRNA gene that is interrogated and therefore limit the resolution and quality of the profiling. To address this, we present the design of a novel protocol for shotgun Illumina sequenc...

  17. Intervening Sequences in rrl Genes and Fragmentation of 23S rRNA in Genera of the Family Enterobacteriaceae

    Pronk, Loes M; Sanderson, Kenneth E.

    2001-01-01

    Intervening sequences (IVSs) in the rrl genes for 23S rRNA are transcribed but later removed by RNase III without religation during RNA processing, leading to fragmented rRNA. We examined about 240 strains of the family Enterobacteriaceae for presence of IVSs using PCR. No IVSs were detected in strains belonging to Escherichia, Shigella, Enterobacter, Erwinia, Ewingella, Hafnia, Kluyvera, Morganella, Pantoea, or Serratia. Previously unreported IVSs were detected in Klebsiella oxytoca, Citroba...

  18. Transcriptional down-regulation and rRNA cleavage in Dictyostelium discoideum mitochondria during Legionella pneumophila infection.

    Chenyu Zhang

    Full Text Available Bacterial pathogens employ a variety of survival strategies when they invade eukaryotic cells. The amoeba Dictyostelium discoideum is used as a model host to study the pathogenic mechanisms that Legionella pneumophila, the causative agent of Legionnaire's disease, uses to kill eukaryotic cells. Here we show that the infection of D. discoideum by L. pneumophila results in a decrease in mitochondrial messenger RNAs, beginning more than 8 hours prior to detectable host cell death. These changes can be mimicked by hydrogen peroxide treatment, but not by other cytotoxic agents. The mitochondrial large subunit ribosomal RNA (LSU rRNA is also cleaved at three specific sites during the course of infection. Two LSU rRNA fragments appear first, followed by smaller fragments produced by additional cleavage events. The initial LSU rRNA cleavage site is predicted to be on the surface of the large subunit of the mitochondrial ribosome, while two secondary sites map to the predicted interface with the small subunit. No LSU rRNA cleavage was observed after exposure of D. discoideum to hydrogen peroxide, or other cytotoxic chemicals that kill cells in a variety of ways. Functional L. pneumophila type II and type IV secretion systems are required for the cleavage, establishing a correlation between the pathogenesis of L. pneumophila and D. discoideum LSU rRNA destruction. LSU rRNA cleavage was not observed in L. pneumophila infections of Acanthamoeba castellanii or human U937 cells, suggesting that L. pneumophila uses distinct mechanisms to interrupt metabolism in different hosts. Thus, L. pneumophila infection of D. discoideum results in dramatic decrease of mitochondrial RNAs, and in the specific cleavage of mitochondrial rRNA. The predicted location of the cleavage sites on the mitochondrial ribosome suggests that rRNA destruction is initiated by a specific sequence of events. These findings suggest that L. pneumophila specifically disrupts mitochondrial

  19. Uncovering the polymerase-induced cytotoxicity of an oxidized nucleotide

    Freudenthal, Bret D.; Beard, William A.; Perera, Lalith; Shock, David D.; Kim, Taejin; Schlick, Tamar; Wilson, Samuel H.

    2015-01-01

    Oxidative stress promotes genomic instability and human diseases. A common oxidized nucleoside is 8-oxo-7,8-dihydro-2'-deoxyguanosine, which is found both in DNA (8-oxo-G) and as a free nucleotide (8-oxo-dGTP). Nucleotide pools are especially vulnerable to oxidative damage. Therefore cells encode an enzyme (MutT/MTH1) that removes free oxidized nucleotides. This cleansing function is required for cancer cell survival and to modulate Escherichia coli antibiotic sensitivity in a DNA polymerase (pol)-dependent manner. How polymerases discriminate between damaged and non-damaged nucleotides is not well understood. This analysis is essential given the role of oxidized nucleotides in mutagenesis, cancer therapeutics, and bacterial antibiotics. Even with cellular sanitizing activities, nucleotide pools contain enough 8-oxo-dGTP to promote mutagenesis. This arises from the dual coding potential where 8-oxo-dGTP(anti) base pairs with cytosine and 8-oxo-dGTP(syn) uses its Hoogsteen edge to base pair with adenine. Here we use time-lapse crystallography to follow 8-oxo-dGTP insertion opposite adenine or cytosine with human pol β, to reveal that insertion is accommodated in either the syn- or anti-conformation, respectively. For 8-oxo-dGTP(anti) insertion, a novel divalent metal relieves repulsive interactions between the adducted guanine base and the triphosphate of the oxidized nucleotide. With either templating base, hydrogen-bonding interactions between the bases are lost as the enzyme reopens after catalysis, leading to a cytotoxic nicked DNA repair intermediate. Combining structural snapshots with kinetic and computational analysis reveals how 8-oxo-dGTP uses charge modulation during insertion that can lead to a blocked DNA repair intermediate.

  20. A deterministic seismic hazard map of India and adjacent areas

    A seismic hazard map of the territory of India and adjacent areas has been prepared using a deterministic approach based on the computation of synthetic seismograms complete of all main phases. The input data set consists of structural models, seismogenic zones, focal mechanisms and earthquake catalogue. The synthetic seismograms have been generated by the modal summation technique. The seismic hazard, expressed in terms of maximum displacement (DMAX), maximum velocity (VMAX), and design ground acceleration (DGA), has been extracted from the synthetic signals and mapped on a regular grid of 0.2 deg. x 0.2 deg. over the studied territory. The estimated values of the peak ground acceleration are compared with the observed data available for the Himalayan region and found in good agreement. Many parts of the Himalayan region have the DGA values exceeding 0.6 g. The epicentral areas of the great Assam earthquakes of 1897 and 1950 represent the maximum hazard with DGA values reaching 1.2-1.3 g. (author)

  1. Characterization of adjacent breast tumors using oligonucleotide microarrays

    Current methodology often cannot distinguish second primary breast cancers from multifocal disease, a potentially important distinction for clinical management. In the present study we evaluated the use of oligonucleotide-based microarray analysis in determining the clonality of tumors by comparing gene expression profiles. Total RNA was extracted from two tumors with no apparent physical connection that were located in the right breast of an 87-year-old woman diagnosed with invasive ductal carcinoma (IDC). The RNA was hybridized to the Affymetrix Human Genome U95A Gene Chip® (12,500 known human genes) and analyzed using the Gene Chip Analysis Suite® 3.3 (Affymetrix, Inc, Santa Clara, CA, USA) and JMPIN® 3.2.6 (SAS Institute, Inc, Cary, NC, USA). Gene expression profiles of tumors from five additional patients were compared in order to evaluate the heterogeneity in gene expression between tumors with similar clinical characteristics. The adjacent breast tumors had a pairwise correlation coefficient of 0.987, and were essentially indistinguishable by microarray analysis. Analysis of gene expression profiles from different individuals, however, generated a pairwise correlation coefficient of 0.710. Transcriptional profiling may be a useful diagnostic tool for determining tumor clonality and heterogeneity, and may ultimately impact on therapeutic decision making

  2. Particulate Matter Levels in Ambient Air Adjacent to Industrial Area

    Mohamed, R. M. S. R.; Nizam, N. M. S.; Al-Gheethi, A. A.; Lajis, A.; Kassim, A. H. M.

    2016-07-01

    Air quality in the residential areas adjacent to the industrial regions is of great concern due to the association with human health risks. In this work, the concentrations of particulate matter (PM10) in the ambient air of UTHM campus was investigated tostudy the air qualityand their compliance to the Malaysian Ambient Air Quality Guidelines (AAQG). The PM10 samples were taken over 24 hours from the most significant area at UTHM including Stadium, KolejKediamanTunDr. Ismail (KKTDI) and MakmalBahan. The meteorological parameters; temperature, relative humidity, wind speed and wind direction as well as particulate matterwere estimated by using E-Sampler Particulate Matter (PM10) Collector. The highest concentrations of PM10 (55.56 µg/m3) was recorded at MakmalBahan during the working and weekend days. However, these concentrations are less than 150 pg/m3. It can be concluded that although UTHM is surrounded by the industrial area, the air quality in the campus still within the standards limits.

  3. Seismic responses of two adjacent buildings. II. Interaction

    Celebi, Mehmet

    1993-01-01

    Presented in this part of the two-part paper is a study of the relations between earthquake motions recorded from two, adjacent, seven-story buildings, from a downhole below the foundation of one of the buildings and from three free-field sites, all within one city block. This unique data set was obtained during the Whittier-Narrows, Calif. earthquake of Oct. 1, 1987, Part I includes background information on the two buildings, the site, and the data set. Building response characteristics of a code-type instrumented building (A) and an extensively instrumented building (B) are also studied. In this part, spectral analysis techniques are used to study the relationships between the motions of the roofs and basements, the downhole and the free-field sites. It is asserted that there is building-soil-building interaction between the two buildings at a frequency of 2.35 Hz. Furthermore, the free-field motions are shown to be influenced by the presence of the buildings.

  4. Can Logging in Equatorial Africa Affect Adjacent Parks?

    Jeremy W. Lichstein

    2005-06-01

    Full Text Available Tropical deforestation can cause fundamental regional-scale shifts in vegetation structure and diversity. This is particularly true in Africa. Although national parks are being established to protect areas from deforestation and to conserve biodiversity, these parks are not immune to disturbances outside their boundaries. We used regional-scale atmospheric simulation experiments to investigate how deforestation in timber concessions might affect precipitation inside adjacent, undisturbed national parks in the equatorial African countries of Gabon and the Republic of Congo. The experiments revealed a complex response. Some parks showed rainfall reduced as much as 15%, while others showed slight increases. Rainfall inside parks was particularly sensitive to upwind deforestation along the path of airborne moisture traveling inland from the ocean. A variety of shortcomings in the current modeling procedures limit the ability to extrapolate from experiments such as ours to provide spatially explicit, long-term forecasts of climate. We describe what advances in modeling are needed to produce regional-scale predictions that are robust enough to be useful to managers and policy makers.

  5. Concentric network symmetry grasps authors' styles in word adjacency networks

    Amancio, Diego R.; Silva, Filipi N.; Costa, Luciano da F.

    2015-06-01

    Several characteristics of written texts have been inferred from statistical analysis derived from networked models. Even though many network measurements have been adapted to study textual properties at several levels of complexity, some textual aspects have been disregarded. In this paper, we study the symmetry of word adjacency networks, a well-known representation of text as a graph. A statistical analysis of the symmetry distribution performed in several novels showed that most of the words do not display symmetric patterns of connectivity. More specifically, the merged symmetry displayed a distribution similar to the ubiquitous power-law distribution. Our experiments also revealed that the studied metrics do not correlate with other traditional network measurements, such as the degree or the betweenness centrality. The discriminability power of the symmetry measurements was verified in the authorship attribution task. Interestingly, we found that specific authors prefer particular types of symmetric motifs. As a consequence, the authorship of books could be accurately identified in 82.5% of the cases, in a dataset comprising books written by 8 authors. Because the proposed measurements for text analysis are complementary to the traditional approach, they can be used to improve the characterization of text networks, which might be useful for applications based on stylistic classification.

  6. The Thermomagnetic Instability in Superconducting Films with Adjacent Metal Layer

    Vestgården, J. I.; Galperin, Y. M.; Johansen, T. H.

    2013-12-01

    Dendritic flux avalanches is a frequently encountered consequence of the thermomagnetic instability in type-II superconducting films. The avalanches, which are potentially harmful for superconductor-based devices, can be suppressed by an adjacent normal metal layer, even when the two layers are not in thermal contact. The suppression of the avalanches in this case is due to so-called magnetic braking, caused by eddy currents generated in the metal layer by propagating magnetic flux. We develop a theory of magnetic braking by analyzing coupled electrodynamics and heat flow in a superconductor-normal metal bilayer. The equations are solved by linearization and by numerical simulation of the avalanche dynamics. We find that in an uncoated superconductor, even a uniform thermomagnetic instability can develop into a dendritic flux avalanche. The mechanism is that a small non-uniformity caused by the electromagnetic non-locality induces a flux-flow hot spot at a random position. The hot spot quickly develops into a finger, which at high speeds penetrates into the superconductor, forming a branching structure. Magnetic braking slows the avalanches, and if the normal metal conductivity is sufficiently high, it can suppress the formation of the dendritic structure. During avalanches, the braking by the normal metal layer prevents the temperature from exceeding the transition temperature of the superconductor. Analytical criteria for the instability threshold are developed using the linear stability analysis. The criteria are found to match quantitatively the instability onsets obtained in simulations.

  7. Adjacent-cell preconditioners for accelerating multidimensional neutron transport methods

    The Adjacent-cell Preconditioner (AP) is derived for accelerating generic fixed-weight, Weighted Diamond Difference (WDD) neutron transport methods in multidimensional Cartesian geometry. The AP is determined by requiring: (a) the eigenvalue of the combined mesh sweep-AP iterations to vanish in the vicinity of the origin in Fourier space; and (b) the diagonal and off-diagonal elements of the preconditioner to satisfy a diffusion-like condition. The spectra of the resulting iterations for a wide range of problem parameters exhibit a spectral radius smaller than .25, that vanishes implying immediate convergence for very large computational cells. More importantly, unlike other unconditionally stable acceleration schemes, the AP is cell-centered and its spectral radius remains small when the cell aspect ratio approaches 0 or ∞. Testing of the AP and comparison of its rate of convergence to the standard Source Iterations (SI) for Burre's Suite of Test Problems (BSTeP) demonstrates its high efficiency in reducing the number of iterations required to achieve convergence, especially for optically thick cells where acceleration is most needed

  8. Molecular epidemiology of Plasmodium species prevalent in Yemen based on 18 s rRNA

    A Azazy Ahmed

    2010-11-01

    Full Text Available Abstract Background Malaria is an endemic disease in Yemen and is responsible for 4.9 deaths per 100,000 population per year and 43,000 disability adjusted life years lost. Although malaria in Yemen is caused mainly by Plasmodium falciparum and Plasmodium vivax, there are no sequence data available on the two species. This study was conducted to investigate the distribution of the Plasmodium species based on the molecular detection and to study the molecular phylogeny of these parasites. Methods Blood samples from 511 febrile patients were collected and a partial region of the 18 s ribosomal RNA (18 s rRNA gene was amplified using nested PCR. From the 86 positive blood samples, 13 Plasmodium falciparum and 4 Plasmodium vivax were selected and underwent cloning and, subsequently, sequencing and the sequences were subjected to phylogenetic analysis using the neighbor-joining and maximum parsimony methods. Results Malaria was detected by PCR in 86 samples (16.8%. The majority of the single infections were caused by P. falciparum (80.3%, followed by P. vivax (5.8%. Mixed infection rates of P. falciparum + P. vivax and P. falciparum + P. malariae were 11.6% and 2.3%, respectively. All P. falciparum isolates were grouped with the strain 3D7, while P. vivax isolates were grouped with the strain Salvador1. Phylogenetic trees based on 18 s rRNA placed the P. falciparum isolates into three sub-clusters and P. vivax into one cluster. Sequence alignment analysis showed 5-14.8% SNP in the partial sequences of the 18 s rRNA of P. falciparum. Conclusions Although P. falciparum is predominant, P. vivax, P. malariae and mixed infections are more prevalent than has been revealed by microscopy. This overlooked distribution should be considered by malaria control strategy makers. The genetic polymorphisms warrant further investigation.

  9. The role of human ribosomal proteins in the maturation of rRNA and ribosome production

    Robledo, Sara; Rachel A Idol; Crimmins, Dan L.; Ladenson, Jack H.; Mason, Philip J.; Bessler, Monica

    2008-01-01

    Production of ribosomes is a fundamental process that occurs in all dividing cells. It is a complex process consisting of the coordinated synthesis and assembly of four ribosomal RNAs (rRNA) with about 80 ribosomal proteins (r-proteins) involving more than 150 nonribosomal proteins and other factors. Diamond Blackfan anemia (DBA) is an inherited red cell aplasia caused by mutations in one of several r-proteins. How defects in r-proteins, essential for proliferation in all cells, lead to a hum...

  10. Structures of nucleolus and transcription sites of rRNA genes in rat liver cells

    2000-01-01

    We observed the ultrastructure of nucleolus in rat liver cells by conventional electronmicroscopy, and employed cytochemistry NAMA-Ur DNA specific stain method to analyze the distributionand position of nucleolar DNA in situ. The results showed that nucleolar DNA of rat livercells comes from nucleolus-associated chromatin, and continuously extends in the dense fibrillarcomponent (DFC) of nucleolus, localizes at the periphery of fibrillar center (FC) and in DFC. Furthermore,by employing anti-DNA/RNA hybrid antibodies, we directly and selectively labeled transcriptionsites of rRNA genes and testified that localization of transcription sites not only to DFC butalso to the periphery of FC.

  11. Functional interactions within 23S rRNA involving the peptidyltransferase center

    Douthwaite, S

    1992-01-01

    A molecular genetic approach has been employed to investigate functional interactions within 23S rRNA. Each of the three base substitutions at guanine 2032 has been made. The 2032A mutation confers resistance to the antibiotics chloramphenicol and clindamycin, which interact with the 23S r...... chloramphenicol. Introduction of the domain II deletion into these double-mutation constructs gives rise to erythromycin resistance. The results are interpreted as indicating that position 2032 interacts with the peptidyltransferase loop and that there is a functional connection between domains II and V....

  12. Evolution of green plants as deduced from 5S rRNA sequences

    Hori, Hiroshi; Lim, Byung-Lak; OSAWA, Syozo

    1985-01-01

    We have constructed a phylogenic tree for green plants by comparing 5S rRNA sequences. The tree suggests that the emergence of most of the uni- and multicellular green algae such as Chlamydomonas, Spirogyra, Ulva, and Chlorella occurred in the early stage of green plant evolution. The branching point of Nitella is a little earlier than that of land plants and much later than that of the above green algae, supporting the view that Nitella-like green algae may be the direct precursor to land pl...

  13. Phosphorus-33-labeled nucleotide 5'-triphosphates: Applications in DNA analysis

    Synthesis of [γ-33P] adenosine 5'-triphosphate and [α-33P]2'-deoxyadenosine 5'-triphosphate was accomplished in a way similar to the preparation of 32P-labeled nucleotides. These nucleotides were then used in a variety of molecular biological applications. The techniques of DNA sequencing and nucleic acid hybridization were used to evaluate potential applications for 33P labeled nucleotides. The 33P nucleotides were compared with the 32P and 35S nucleotide equivalents for the ability to serve as substrates for various enzymes used to label DNA, T4-bacteriophage polynucleotide kinase, E. coli DNA polymerase, and T7 DNA polymerase. The products of there reactions were either separated by polyacrylamide gel electrophoresis (DNA sequencing) or used as hybridization probes on a nylon membrane. The isotopically labeled DNA was detected by autoradiography on X-ray film. The film was evaluated for relative sensitivity of the film versus time for each isotope and the sharpness or resolution of the exposed bands on the film

  14. Wall shear stress in intracranial aneurysms and adjacent arteries

    Fuyu Wang; Bainan Xu; Zhenghui Sun; Chen Wu; Xiaojun Zhang

    2013-01-01

    Hemodynamic parameters play an important role in aneurysm formation and growth. However, it is difficult to directly observe a rapidly growing de novo aneurysm in a patient. To investigate possible associations between hemodynamic parameters and the formation and growth of intracranial aneurysms, the present study constructed a computational model of a case with an internal carotid artery aneurysm and an anterior communicating artery aneurysm, based on the CT angiography findings of a patient. To simulate the formation of the anterior communicating artery aneurysm and the growth of the internal carotid artery aneurysm, we then constructed a model that virtually removed the anterior communicating artery aneurysm, and a further two models that also progressively decreased the size of the internal carotid artery aneurysm. Computational simulations of the fluid dynamics of the four models were performed under pulsatile flow conditions, and wall shear stress was compared among the different models. In the three aneurysm growth models, increasing size of the aneurysm was associated with an increased area of low wall shear stress, a significant decrease in wall shear stress at the dome of the aneurysm, and a significant change in the wall shear stress of the parent artery. The wall shear stress of the anterior communicating artery remained low, and was significantly lower than the wall shear stress at the bifurcation of the internal carotid artery or the bifurcation of the middle cerebral artery. After formation of the anterior communicating artery aneurysm, the wall shear stress at the dome of the internal carotid artery aneurysm increased significantly, and the wall shear stress in the upstream arteries also changed significantly. These findings indicate that low wall shear stress may be associated with the initiation and growth of aneurysms, and that aneurysm formation and growth may influence hemodynamic parameters in the local and adjacent arteries.

  15. A Burkholderia pseudomallei type III secreted protein, BopE, facilitates bacterial invasion of epithelial cells and exhibits guanine nucleotide exchange factor activity

    M.P. Stevens; Friebel, A; Taylor, L A; Wood, M W; Brown, P. J.; Hardt, W D; Galyov, E E

    2003-01-01

    We report the characterization of BopE, a type III secreted protein that is encoded adjacent to the Burkholderia pseudomallei bsa locus and is homologous to Salmonella enterica SopE/SopE2. Inactivation of bopE impaired bacterial entry into HeLa cells, indicating that BopE facilitates invasion. Consistent with this notion, BopE expressed in eukaryotic cells induced rearrangements in the subcortical actin cytoskeleton, and purified BopE exhibited guanine nucleotide exchange factor activity for ...

  16. Dynamics of Charge Transfer in Ordered and Chaotic Nucleotide Sequences

    Fialko, N S

    2013-01-01

    Charge transfer is considered in systems composed of a donor, an acceptor and bridge sites of (AT) nucleotide pairs. For a bridge consisting of 180 (AT) pairs, three cases are dealt with: a uniform case, when all the nucleotides in each strand are identical; an ordered case, when nucleotides in each DNA strand are arranged in an orderly fashion; a chaotic case, when (AT) and (TA) pairs are arranged randomly. It is shown that in all the cases a charge transfer from a donor to an acceptor can take place. All other factors being equal, the transfer is the most efficient in the uniform case, the ordered and chaotic cases are less and the least efficient, accordingly. The results obtained are in agreement with experimental data on long-range charge transfer in DNA.

  17. GENE 16S RRNA SEQUENCE PHYLOGENETIC ANALYSIS OF LYSINE PRODUCERS STRAINS

    G. S. Andriiash

    2014-12-01

    Full Text Available The phylogenetic relationships of strainsproducers of essential amino acids of aspartate family Brevibacterium sp. UCM Ac-674 (Brevibacterium sp. 90, Brevibacterium sp. IMV Ac-5004 (Brevibacterium sp. 90H, Brevibacterium sp. UCM Ac-675 (Brevibacterium sp. E531, mutant strain Brevibacterium sp. IMV B-7447 from the «Collections strains and lines of plants for food and agricultural biotechnology SO “Institute for Food Biotechnology and Genomics” of National Academy of Sciences of Ukraine were investigated. The affiliation strain Brevibacterium sp. IMV B-7447 to the genus Brevibacterium within the sequences of the genes based on 16S rRNA was confirmed. The dendogram of phylogenetic relationships of studied strains and related strains Brevibacterium from database GenBank was constructed. It was shown that by the criterion of homology gene sequences based on 16S rRNA the investigated strains-producers belong to three phylogenetic groups. It was established that the mutant strain Brevibacterium sp. ІMV B-7447 has no analogues in the database GenBank.

  18. Analysis of Guanine Nucleotide Binding and Exchange Kinetics of the Escherichia coli GTPase Era

    Sullivan, S M; Mishra, R.; Neubig, R. R.; Maddock, J. R.

    2000-01-01

    Era is an essential Escherichia coli guanine nucleotide binding protein that appears to play a number of cellular roles. Although the kinetics of Era guanine nucleotide binding and hydrolysis have been described, guanine nucleotide exchange rates have never been reported. Here we describe a kinetic analysis of guanine nucleotide binding, exchange, and hydrolysis by Era using the fluorescent mant (N-methyl-3′-O-anthraniloyl) guanine nucleotide analogs. The equilibrium binding constants (KD) fo...

  19. Fluorescence chemosensors with pyrene and their interaction with nucleotide phosphate

    李华平; 汪鹏飞; 吴世康

    1999-01-01

    A group of fluorescence chemosensor with pyrene, compounds (Ⅰ), (Ⅱ) and (Ⅲ), were synthesized The fluorescence spectra and the lifetime of these compounds were carefully measured. The fluorescence quenching spec tra of pyrenyl butyric acid, compounds (Ⅰ), (Ⅱ) and (Ⅲ) by different nucleotide phosphates, AMP ADP, ATP dTTP, were also recorded and studied. The quenching and the stability constants were calculated by Stern-Volmer equa tion and eq. (2), respectively. The mechanism of interaction between fluorescence chemosensor and nucleotide phos phate was didscussed based on the comparison of the results obtained with the CPK model of free molecules of these com pounds in the ground state.

  20. Exogenous Nucleotides Antagonize the Developmental Toxicity of Ethanol In Vitro

    Jie Zhao; Jia-Xi Zhao; Ya-Jun Xu

    2013-01-01

    The objective of this study was to assess whether nucleotides supplementation in vitro could suppress ethanol-induced developmental toxicity in mouse. The models of whole embryo culture (WEC) and midbrain (MB) cell micromass culture were used in this study. In WEC system, exposure to 4.0 mg/mL ethanol for 48 h yielded various developmental malformations of the mice embryos. Nucleotides supplementation (0.16, 0.80, 4.00, 20.00, and 100.00 mg/L) improved the growth parameters to some extent, an...

  1. Activated Ras interacts with the Ral guanine nucleotide dissociation stimulator.

    Hofer, F.; Fields, S; Schneider, C; Martin, G S

    1994-01-01

    The yeast two-hybrid system was used to identify proteins that interact with Ras. The H-Ras protein was found to interact with a guanine nucleotide dissociation stimulator (GDS) that has been previously shown to regulate guanine nucleotide exchange on another member of the Ras protein family, Ral. The interaction is mediated by the C-terminal, noncatalytic segment of the RalGDS and can be detected both in vivo, using the two-hybrid system, and in vitro, with purified recombinant proteins. The...

  2. Biocuration of functional annotation at the European nucleotide archive.

    Gibson, Richard; Alako, Blaise; Amid, Clara; Cerdeño-Tárraga, Ana; Cleland, Iain; Goodgame, Neil; Ten Hoopen, Petra; Jayathilaka, Suran; Kay, Simon; Leinonen, Rasko; Liu, Xin; Pallreddy, Swapna; Pakseresht, Nima; Rajan, Jeena; Rosselló, Marc; Silvester, Nicole; Smirnov, Dmitriy; Toribio, Ana Luisa; Vaughan, Daniel; Zalunin, Vadim; Cochrane, Guy

    2016-01-01

    The European Nucleotide Archive (ENA; http://www.ebi.ac.uk/ena) is a repository for the submission, maintenance and presentation of nucleotide sequence data and related sample and experimental information. In this article we report on ENA in 2015 regarding general activity, notable published data sets and major achievements. This is followed by a focus on sustainable biocuration of functional annotation, an area which has particularly felt the pressure of sequencing growth. The importance of functional annotation, how it can be submitted and the shifting role of the biocurator in the context of increasing volumes of data are all discussed. PMID:26615190

  3. Analysis of the Precursor rRNA Fractions of Rapidly Growing Mycobacteria: Quantification by Methods That Include the Use of a Promoter (rrnA P1) as a Novel Standard†

    Menéndez, María del Carmen; Rebollo, María José; Núñez, María del Carmen; Cox, Robert A.; García, María Jesús

    2005-01-01

    Mycobacterial species are able to control rRNA production through variations in the number and strength of promoters controlling their rrn operons. Mycobacterium chelonae and M. fortuitum are members of the rapidly growing mycobacterial group. They carry a total of five promoters each, encoded, respectively, by one and two rrn operons per genome. Quantification of precursor rrn transcriptional products (pre-rrn) has allowed detection of different promoter usage during cell growth. Bacteria growing in several culture media with different nutrient contents were compared. Balanced to stationary phases were analyzed. Most promoters were found to be used at different levels depending on the stage of bacterial growth and the nutrient content of the culture medium. Some biological implications are discussed. Sequences of the several promoters showed motifs that could be correlated to their particular level of usage. A product corresponding to the first rrnA promoter in both species, namely, rrnA P1, was found to contribute at a low and near-constant level to pre-rRNA synthesis, regardless of the culture medium used and the stage of growth analyzed. This product was used as a standard to quantitate rRNA gene expression by real-time PCR when M. fortuitum infected macrophages. It was shown that this bacterium actively synthesizes rRNA during the course of infection and that one of its rrn operons is preferentially used under such conditions. PMID:15629925

  4. Changes in rRNA levels during stress invalidates results from mRNA blotting: Fluorescence in situ rRNA hybridization permits renormalization for estimation of cellular mRNA levels

    Hansen, M.C.; Nielsen, A.K.; Molin, Søren; Hammer, Karin; Kilstrup, Mogens

    2001-01-01

    experiments, in which mRNA levels routinely are normalized to a fixed amount of extracted total RNA. The cellular levels of specific mRNA species were estimated using a renormalization with the total RNA content per cell. By a combination of fluorescence in situ rRNA hybridization, which estimates the...... relative level of rRNA per cell, and slot blotting to rRNA probes, which estimates the level of rRNA per extracted total RNA, the amount of RNA per cell was calculated in a series of heat shock experiments with the gram-positive bacterium Lactococcus lactis. It was found that the level of rRNA per cell......Regulation of gene expression can be analyzed by a number of different techniques. Some techniques monitor the level of specific mRNA directly, and others monitor indirectly by determining the level of enzymes encoded by the mRNA. Each method has its own inherent way of normalization. When results...

  5. Evolutionary origin of Plasmodium and other Apicomplexa based on rRNA genes.

    Escalante, A.A.; Ayala, F J

    1995-01-01

    We have explored the evolutionary history of the Apicomplexa and two related protistan phyla, Dinozoa and Ciliophora, by comparing the nucleotide sequences of small subunit ribosomal RNA genes. We conclude that the Plasmodium lineage, to which the malarial parasites belong, diverged from other apicomplexan lineages (piroplasmids and coccidians) several hundred million years ago, perhaps even before the Cambrian. The Plasmodium radiation, which gave rise to several species parasitic to humans,...

  6. KAMG: A Tool for Converting Blood Ties and Affinity Ties into Adjacency Matrices

    Hang Xiong

    2016-07-01

    Full Text Available Kinship Adjacency Matrix Generator (KAMG is a browser-based software for creating adjacency matrices using the information of kinship ties. Specifically, it is capable of converting the family trees in the format of GEDCOM files into adjacency matrices of blood relationship. With the data of intermarriages between different families, it can further create the adjacency matrix of affinity relationship for the families. The outcomes can be directly used to create networks. KAMG is written in JavaScript and implemented on web browsers. It is completely open source and the source code is publicly available on GitHub.

  7. Isolation and analysis of a novel gene, HXC-26, adjacent to the rab GDP dissociation inhibitor gene located at human chromosome Xq28 region.

    Toyoda, A; Sakai, T; Sugiyama, Y; Kusuda, J; Hashimoto, K; Maeda, H

    1996-10-31

    We screened potential promoter regions from NotI-linking cosmid clones mapped on human chromosome Xq28 region with our constructed trapping vector and isolated six fragments containing transcription activity. Using one of the obtained fragments as a probe, a novel gene was isolated by screening a human skeletal muscle cDNA library. The isolated cDNA, termed HXC-26, contained an open reading frame of 975 nucleotides encoding 325 amino acids (38,848 Da). The HXC-26 gene was composed of 13 exons that span approximately 8 kb. Several potential GC boxes were found in the putative promoter region, but no typical TATA box. The HXC-26 gene associated with a CpG island was located adjacent to the rab GDP dissociation inhibitor (GDI) gene. PMID:9039504

  8. Discordant 16S and 23S rRNA gene phylogenies for the genus Helicobacter: implications for phylogenetic inference and systematics.

    Dewhirst, Floyd E; Shen, Zeli; Scimeca, Michael S; Stokes, Lauren N; Boumenna, Tahani; Chen, Tsute; Paster, Bruce J; Fox, James G

    2005-09-01

    Analysis of 16S rRNA gene sequences has become the primary method for determining prokaryotic phylogeny. Phylogeny is currently the basis for prokaryotic systematics. Therefore, the validity of 16S rRNA gene-based phylogenetic analyses is of fundamental importance for prokaryotic systematics. Discrepancies between 16S rRNA gene analyses and DNA-DNA hybridization and phenotypic analyses have been noted in the genus Helicobacter. To clarify these discrepancies, we sequenced the 23S rRNA genes for 55 helicobacter strains representing 41 taxa (>2,700 bases per sequence). Phylogenetic-tree construction using neighbor-joining, parsimony, and maximum likelihood methods for 23S rRNA gene sequence data yielded stable trees which were consistent with other phenotypic and genotypic methods. The 16S rRNA gene sequence-derived trees were discordant with the 23S rRNA gene trees and other data. Discrepant 16S rRNA gene sequence data for the helicobacters are consistent with the horizontal transfer of 16S rRNA gene fragments and the creation of mosaic molecules with loss of phylogenetic information. These results suggest that taxonomic decisions must be supported by other phylogenetically informative macromolecules, such as the 23S rRNA gene, when 16S rRNA gene-derived phylogeny is discordant with other credible phenotypic and genotypic methods. This study found Wolinella succinogenes to branch with the unsheathed-flagellum cluster of helicobacters by 23S rRNA gene analyses and whole-genome comparisons. This study also found intervening sequences (IVSs) in the 23S rRNA genes of strains of 12 Helicobacter species. IVSs were found in helices 10, 25, and 45, as well as between helices 31' and 27'. Simultaneous insertion of IVSs at three sites was found in H. mesocricetorum. PMID:16109952

  9. RiboFR-Seq: a novel approach to linking 16S rRNA amplicon profiles to metagenomes

    Zhang, Yanming; Ji, Peifeng; Wang, Jinfeng; Zhao, Fangqing

    2016-01-01

    16S rRNA amplicon analysis and shotgun metagenome sequencing are two main culture-independent strategies to explore the genetic landscape of various microbial communities. Recently, numerous studies have employed these two approaches together, but downstream data analyses were performed separately, which always generated incongruent or conflict signals on both taxonomic and functional classifications. Here we propose a novel approach, RiboFR-Seq (Ribosomal RNA gene flanking region sequencing), for capturing both ribosomal RNA variable regions and their flanking protein-coding genes simultaneously. Through extensive testing on clonal bacterial strain, salivary microbiome and bacterial epibionts of marine kelp, we demonstrated that RiboFR-Seq could detect the vast majority of bacteria not only in well-studied microbiomes but also in novel communities with limited reference genomes. Combined with classical amplicon sequencing and shotgun metagenome sequencing, RiboFR-Seq can link the annotations of 16S rRNA and metagenomic contigs to make a consensus classification. By recognizing almost all 16S rRNA copies, the RiboFR-seq approach can effectively reduce the taxonomic abundance bias resulted from 16S rRNA copy number variation. We believe that RiboFR-Seq, which provides an integrated view of 16S rRNA profiles and metagenomes, will help us better understand diverse microbial communities. PMID:26984526

  10. RiboFR-Seq: a novel approach to linking 16S rRNA amplicon profiles to metagenomes.

    Zhang, Yanming; Ji, Peifeng; Wang, Jinfeng; Zhao, Fangqing

    2016-06-01

    16S rRNA amplicon analysis and shotgun metagenome sequencing are two main culture-independent strategies to explore the genetic landscape of various microbial communities. Recently, numerous studies have employed these two approaches together, but downstream data analyses were performed separately, which always generated incongruent or conflict signals on both taxonomic and functional classifications. Here we propose a novel approach, RiboFR-Seq (Ribosomal RNA gene flanking region sequencing), for capturing both ribosomal RNA variable regions and their flanking protein-coding genes simultaneously. Through extensive testing on clonal bacterial strain, salivary microbiome and bacterial epibionts of marine kelp, we demonstrated that RiboFR-Seq could detect the vast majority of bacteria not only in well-studied microbiomes but also in novel communities with limited reference genomes. Combined with classical amplicon sequencing and shotgun metagenome sequencing, RiboFR-Seq can link the annotations of 16S rRNA and metagenomic contigs to make a consensus classification. By recognizing almost all 16S rRNA copies, the RiboFR-seq approach can effectively reduce the taxonomic abundance bias resulted from 16S rRNA copy number variation. We believe that RiboFR-Seq, which provides an integrated view of 16S rRNA profiles and metagenomes, will help us better understand diverse microbial communities. PMID:26984526

  11. Metagenomic 16s rRNA investigation of microbial communities in the Black Sea estuaries in South-West of Ukraine.

    Bobrova, Oleksandra; Kristoffersen, Jon Bent; Oulas, Anastasis; Ivanytsia, Volodymyr

    2016-01-01

    The Black Sea estuaries represent interfaces of the sea and river environments. Microorganisms that inhabit estuarine water play an integral role in all biochemical processes that occur there and form unique ecosystems. There are many estuaries located in the Southern-Western part of Ukraine and some of them are already separated from the sea. The aim of this research was to determine the composition of microbial communities in the Khadzhibey, Dniester and Sukhyi estuaries by metagenomic 16S rDNA analysis. This study is the first complex analysis of estuarine microbiota based on isolation of total DNA from a biome that was further subjected to sequencing. DNA was extracted from water samples and sequenced on the Illumina Miseq platform using primers to the V4 variable region of the 16S rRNA gene. Computer analysis of the obtained raw sequences was done with QIIME (Quantitative Insights Into Microbial Ecology) software. As the outcome, 57970 nucleotide sequences were retrieved. Bioinformatic analysis of bacterial community in the studied samples demonstrated a high taxonomic diversity of Prokaryotes at above genus level. It was shown that majority of 16S rDNA bacterial sequences detected in the estuarine samples belonged to phyla Cyanobacteria, Proteobacteria, Bacteroidetes, Actinobacteria, Verrucomicrobia, Planctomycetes. The Khadhzibey estuary was dominated by the Proteobacteria phylum, while Dniester and Sukhyi estuaries were characterized by dominance of Cyanobacteria. The differences in bacterial populations between the Khadzhibey, Dniester and Sukhyi estuaries were demonstrated through the Beta-diversity analysis. It showed that the Khadzhibey estuary's microbial community significantly varies from the Sukhyi and Dniester estuaries. The majority of identified bacterial species is known as typical inhabitants of marine environments, however, for 2.5% of microbial population members in the studied estuaries no relatives were determined. PMID:26929931

  12. The nucleotide sequences of two leghemoglobin genes from soybean

    Wiborg, O; Hyldig-Nielsen, J J; Jensen, E O; Paludan, K; Marcker, K A

    1982-01-01

    We present the complete nucleotide sequences of two leghemoglobin genes isolated from soybean DNA. Both genes contain three intervening sequences in identical positions. Comparison of the coding sequences with known amino-acid sequences of soybean leghemoglobins suggest that the two genes...

  13. A Laboratory Exercise for Genotyping Two Human Single Nucleotide Polymorphisms

    Fernando, James; Carlson, Bradley; LeBard, Timothy; McCarthy, Michael; Umali, Finianne; Ashton, Bryce; Rose, Ferrill F., Jr.

    2016-01-01

    The dramatic decrease in the cost of sequencing a human genome is leading to an era in which a wide range of students will benefit from having an understanding of human genetic variation. Since over 90% of sequence variation between humans is in the form of single nucleotide polymorphisms (SNPs), a laboratory exercise has been devised in order to…

  14. Nucleotide excision repair I: from E.coli to yeast.

    J.H.J. Hoeijmakers (Jan)

    1993-01-01

    textabstractGenetic information is constantly deteriorating, mainly as a consequence of the action of numerous genotoxic agents. In order to cope with this fundamental problem, all living organisms have acquired a complex network of DNA repair systems to safeguard their genetic integrity. Nucleotide

  15. DNA Nucleotides Detection via capacitance properties of Graphene

    Khadempar, Nahid; Berahman, Masoud; Yazdanpanah, Arash

    2016-05-01

    In the present paper a new method is suggested to detect the DNA nucleotides on a first-principles calculation of the electronic features of DNA bases which chemisorbed to a graphene sheet placed between two gold electrodes in a contact-channel-contact system. The capacitance properties of graphene in the channel are surveyed using non-equilibrium Green's function coupled with the Density Functional Theory. Thus, the capacitance properties of graphene are theoretically investigated in a biological environment, and, using a novel method, the effect of the chemisorbed DNA nucleotides on electrical charges on the surface of graphene is deciphered. Several parameters in this method are also extracted including Electrostatic energy, Induced density, induced electrostatic potential, Electron difference potential and Electron difference density. The qualitative and quantitative differences among these parameters can be used to identify DNA nucleotides. Some of the advantages of this approach include its ease and high accuracy. What distinguishes the current research is that it is the first experiment to investigate the capacitance properties of gaphene changes in the biological environment and the effect of chemisorbed DNA nucleotides on the surface of graphene on the charge.

  16. Extracellular nucleotide derivatives protect cardiomyctes against hypoxic stress

    Golan, O; Issan, Y; Isak, A;

    2011-01-01

    protective effect is not mediated via those receptors. We found that a wide variety of triphosphate and diphosphate nucleotides (TTP, ITP, deoxyGTP, and GDP), provided significant cardioprotective effect. GMP, guanosine, and ribose phosphate provided no cardioprotective effect. Moreover, we observed that tri...

  17. NMR study of conformationally restricted acylic phosphonate nucleotides

    Poštová Slavětínská, Lenka; Pohl, Radek; Rejman, Dominik

    Hersonissos : -, 2013. s. 609-609. [EUROMAR 2013. A European Magnetic Resonance Meeting. 30.06.2013-05.07.2013, Hersonissos] R&D Projects: GA ČR GA13-24880S Institutional support: RVO:61388963 Keywords : acyclic phosphonate nucleotides * conformation * pyrrolidine ring * NMR spectra * PSEUROT program * pD dependence * molecular modeling Subject RIV: CB - Analytical Chemistry, Separation

  18. Nucleotide diversity and linkage disequilibrium in balsam poplar (Populus balsamifera).

    Olson, Matthew S; Robertson, Amanda L; Takebayashi, Naoki; Silim, Salim; Schroeder, William R; Tiffin, Peter

    2010-04-01

    *Current perceptions that poplars have high levels of nucleotide variation, large effective population sizes, and rapid decay of linkage disequilibrium are based primarily on studies from one poplar species, Populus tremula. *We analysed 590 gene fragments (average length 565 bp) from each of 15 individuals from different populations from throughout the range of Populus balsamifera. *Nucleotide diversity (theta(total) = 0.0028, pi = 0.0027) was low compared with other trees and model agricultural systems. Patterns of nucleotide diversity and site frequency spectra were consistent with purifying selection on replacement and intron sites. When averaged across all loci we found no evidence for decay of linkage disequilibrium across 750 bp, consistent with the low estimates of the scaled recombination parameter, rho = 0.0092. *Compared with P. tremula, a well studied congener with a similar distribution, P. balsamifera has low diversity and low effective recombination, both of which indicate a lower effective population size in P. balsamifera. Patterns of diversity and linkage indicate that there is considerable variation in population genomic patterns among poplar species and unlike P. tremula, association mapping techniques in balsam poplar should consider sampling single nucleotide polymorphisms (SNPs) at well-spaced intervals. PMID:20122131

  19. Single nucleotide polymorphism (SNP) detection on a magnetoresistive sensor

    Rizzi, Giovanni; Østerberg, Frederik Westergaard; Dufva, Martin;

    2013-01-01

    We present a magnetoresistive sensor platform for hybridization assays and demonstrate its applicability on single nucleotide polymorphism (SNP) genotyping. The sensor relies on anisotropic magnetoresistance in a new geometry with a local negative reference and uses the magnetic field from the...

  20. Nucleotide excision repair by dual incisions in plants.

    Canturk, Fazile; Karaman, Muhammet; Selby, Christopher P; Kemp, Michael G; Kulaksiz-Erkmen, Gulnihal; Hu, Jinchuan; Li, Wentao; Lindsey-Boltz, Laura A; Sancar, Aziz

    2016-04-26

    Plants use light for photosynthesis and for various signaling purposes. The UV wavelengths in sunlight also introduce DNA damage in the form of cyclobutane pyrimidine dimers (CPDs) and pyrimidine (6-4) pyrimidone photoproducts [(6-4)PPs] that must be repaired for the survival of the plant. Genome sequencing has revealed the presence of genes for both CPD and (6-4)PP photolyases, as well as genes for nucleotide excision repair in plants, such as Arabidopsis and rice. Plant photolyases have been purified, characterized, and have been shown to play an important role in plant survival. In contrast, even though nucleotide excision repair gene homologs have been found in plants, the mechanism of nucleotide excision repair has not been investigated. Here we used the in vivo excision repair assay developed in our laboratory to demonstrate that Arabidopsis removes CPDs and (6-4)PPs by a dual-incision mechanism that is essentially identical to the mechanism of dual incisions in humans and other eukaryotes, in which oligonucleotides with a mean length of 26-27 nucleotides are removed by incising ∼20 phosphodiester bonds 5' and 5 phosphodiester bonds 3' to the photoproduct. PMID:27071131

  1. Cyclization of nucleotide analogues as an obstacle to polymerization

    Hill, A. R. Jr; Nord, L. D.; Orgel, L. E.; Robins, R. K.

    1988-01-01

    Cyclization of activated nucleotide analogues by intramolecular phosphodiester-bond formation is likely to compete very effectively with template-directed condensation except in the cases of ribo- and arabinonucleotides. This could have excluded derivatives of most sugars from growing polyribonucleotide chains and thus reduced chain-termination in prebiotic polynucleotide synthesis.

  2. Single Nucleotide Polymorphisms Predict Symptom Severity of Autism Spectrum Disorder

    Jiao, Yun; Chen, Rong; Ke, Xiaoyan; Cheng, Lu; Chu, Kangkang; Lu, Zuhong; Herskovits, Edward H.

    2012-01-01

    Autism is widely believed to be a heterogeneous disorder; diagnosis is currently based solely on clinical criteria, although genetic, as well as environmental, influences are thought to be prominent factors in the etiology of most forms of autism. Our goal is to determine whether a predictive model based on single-nucleotide polymorphisms (SNPs)…

  3. Novel modified nucleobases, nucleosides and nucleotides: biological activity and applications

    Hocek, Michal

    Louvain-La Neuve : -, 2007. PL4. [ Organic Chemistry , Present and Future. 10.04.2007-13.04.2007, Louvain-La-Neuve] R&D Projects: GA MŠk 1M0508; GA MŠk LC512 Institutional research plan: CEZ:AV0Z40550506 Keywords : nucleobases * nucleosides * nucleotides Subject RIV: CC - Organic Chemistry

  4. Spatiotemporal regulation of Rap guanine nucleotide exchange factors

    Consonni, S.V.

    2014-01-01

    Guanine nucleotide exchange factors (GEFs) and GTPase activating proteins (GAPs) orchestrate the activity of small G-proteins. In response to extracellular stimuli, GEFs and GAPs activate signaling cascades regulated by G-proteins by controlling their regulation in time and in space. Generally, GEFs

  5. THE NUCLEOTIDE RECEPTORS ON MOUSE C2C12 MYOTUBES

    HENNING, RH; NELEMANS, A; VANDENAKKER, J; DENHERTOG, A

    1992-01-01

    1 The response of C2C12 mouse myotubes to stimulation with adenosine triphosphate (ATP) and other nucleotides was studied by measuring changes in membrane potential. 2 A transient hyperpolarization followed by a slowly declining depolarization of the cells was observed in the presence of ATP (10-mu-

  6. Guanosine nucleotide precursor for flavinogenesis of Eremothecium Ashbyii.

    Mitsuda, H; Nakajima, K

    1975-01-01

    The purine precursor in the riboflavin biosynthetic pathway in Eremothecium ashbyii was examined using a guanine analogue, 8-azaguanine, with non-growing cell systems. 1. Riboflavin formation in the culture filtrate was determined at 0, 5, 10 and 20 hr after start of the incubation of the non-growing cells in the presence of xanthine or 8-azaguanine (1 mM, respectively). At 20 hr of incubation, the addition of xanthine stimulated riboflavin formation by 36% and the addition of 8-azaguanine inhibited the formation by 57%. 2. Acid soluble nucleotide pools in the cells were followed at 0, 5, 10 and 20 hr of the incubation period in the presence of xanthine or 8-azaguanine by means of anion exchange column chromatography. The result showed that the GTP pool changed markedly despite the fact that the adenosine nucleotide pool was almost constant irrespective of the presence or absence of these purines till 10 hr of incubation. But, the decrease of the former was overcome in part by the addition of flavinogenic xanthine. Furthermore, the total amounts of GTP and guanosine accumulated in cells in the presence of 8-azaguanine reached the maximum already at 5 hr, attaining a level twice as much as the GTP contents of the control. 3. The role of guanosine nucleotide pool in riboflavin formation was further examined using 8-azaguanine. In this experiment the drug was added to the suspension of non-growing cells at 3 hr or 6 hr after the incubation was started and the reaction was continued till the 12th hr. A more clear-cut correlationship between riboflavin formation and guanosine nucleotide pool was oberved by this experiment. The guanosine nucleotide pool (consisting of GMP, GDP and GTP) increased simultaneously with the inhibition of riboflavin formation. Of the guanosine nucleotides pools, the GMP pool increased 2.7 times above normal upon the addition of 8-azaguanine during the incubation for 6 hr and 5.3 fold for 9 hr. While, the GTP pool increased 1.9 fold above

  7. Global regulation of nucleotide biosynthetic genes by c-Myc.

    Yen-Chun Liu

    Full Text Available BACKGROUND: The c-Myc transcription factor is a master regulator and integrates cell proliferation, cell growth and metabolism through activating thousands of target genes. Our identification of direct c-Myc target genes by chromatin immunoprecipitation (ChIP coupled with pair-end ditag sequencing analysis (ChIP-PET revealed that nucleotide metabolic genes are enriched among c-Myc targets, but the role of Myc in regulating nucleotide metabolic genes has not been comprehensively delineated. METHODOLOGY/PRINCIPAL FINDINGS: Here, we report that the majority of genes in human purine and pyrimidine biosynthesis pathway were induced and directly bound by c-Myc in the P493-6 human Burkitt's lymphoma model cell line. The majority of these genes were also responsive to the ligand-activated Myc-estrogen receptor fusion protein, Myc-ER, in a Myc null rat fibroblast cell line, HO.15 MYC-ER. Furthermore, these targets are also responsive to Myc activation in transgenic mouse livers in vivo. To determine the functional significance of c-Myc regulation of nucleotide metabolism, we sought to determine the effect of loss of function of direct Myc targets inosine monophosphate dehydrogenases (IMPDH1 and IMPDH2 on c-Myc-induced cell growth and proliferation. In this regard, we used a specific IMPDH inhibitor mycophenolic acid (MPA and found that MPA dramatically inhibits c-Myc-induced P493-6 cell proliferation through S-phase arrest and apoptosis. CONCLUSIONS/SIGNIFICANCE: Taken together, these results demonstrate the direct induction of nucleotide metabolic genes by c-Myc in multiple systems. Our finding of an S-phase arrest in cells with diminished IMPDH activity suggests that nucleotide pool balance is essential for c-Myc's orchestration of DNA replication, such that uncoupling of these two processes create DNA replication stress and apoptosis.

  8. 16S rRNA gene sequencing as a tool to study microbial populations in foods and process environments

    Buschhardt, Tasja; Hansen, Tina Beck; Bahl, Martin Iain; Asser Hansen, Martin; Abu Al-Soud, Waleed; Aabo, Søren

    and their role in food safety. During method optimization, we have identified several factors which distort the characterization of microbial populations, including DNA extraction methods, DNA polymerases, and most importantly the analyzed fragment of the 16S rRNA gene. Methods: This study...... culture methods as cross reference. Results: Taxonomic assignments and abundances of sequences in the total community and in the Enterobacteriaceae subpopulation were affected by the 16S rRNA gene variable region, DNA extraction methods, and polymerases chosen. However, community compositions were very......Introduction: Methodological constraints during culturing and biochemical testing have left the true microbiological diversity of foods and process environments unexplored. Culture-independent molecular methods, such as 16S rRNA gene sequencing, may provide deeper insight into microbial communities...

  9. 16S rRNA amplicon sequencing dataset for conventionalized and conventionally raised zebrafish larvae.

    Davis, Daniel J; Bryda, Elizabeth C; Gillespie, Catherine H; Ericsson, Aaron C

    2016-09-01

    Data presented here contains metagenomic analysis regarding the sequential conventionalization of germ-free zebrafish embryos. Zebrafish embryos that underwent a germ-free sterilization process immediately after fertilization were promptly exposed to and raised to larval stage in conventional fish water. At 6 days postfertilization (dpf), these "conventionalized" larvae were compared to zebrafish larvae that were raised in conventional fish water never undergoing the initial sterilization process. Bacterial 16S rRNA amplicon sequencing was performed on DNA isolated from homogenates of the larvae revealing distinct microbiota variations between the two groups. The dataset described here is also related to the research article entitled "Microbial modulation of behavior and stress responses in zebrafish larvae" (Davis et al., 2016) [1]. PMID:27508247

  10. Identification of the microbiota in carious dentin lesions using 16S rRNA gene sequencing.

    Junko Obata

    Full Text Available While mutans streptococci have long been assumed to be the specific pathogen responsible for human dental caries, the concept of a complex dental caries-associated microbiota has received significant attention in recent years. Molecular analyses revealed the complexity of the microbiota with the predominance of Lactobacillus and Prevotella in carious dentine lesions. However, characterization of the dentin caries-associated microbiota has not been extensively explored in different ethnicities and races. In the present study, the bacterial communities in the carious dentin of Japanese subjects were analyzed comprehensively with molecular approaches using the16S rRNA gene. Carious dentin lesion samples were collected from 32 subjects aged 4-76 years, and the 16S rRNA genes, amplified from the extracted DNA with universal primers, were sequenced with a pyrosequencer. The bacterial composition was classified into clusters I, II, and III according to the relative abundance (high, middle, low of Lactobacillus. The bacterial composition in cluster II was composed of relatively high proportions of Olsenella and Propionibacterium or subdominated by heterogeneous genera. The bacterial communities in cluster III were characterized by the predominance of Atopobium, Prevotella, or Propionibacterium with Streptococcus or Actinomyces. Some samples in clusters II and III, mainly related to Atopobium and Propionibacterium, were novel combinations of microbiota in carious dentin lesions and may be characteristic of the Japanese population. Clone library analysis revealed that Atopobium sp. HOT-416 and P. acidifaciens were specific species associated with dentinal caries among these genera in a Japanese population. We summarized the bacterial composition of dentinal carious lesions in a Japanese population using next-generation sequencing and found typical Japanese types with Atopobium or Propionibacterium predominating.

  11. Phylogenetic relationships of Arthrospira strains inferred from 16S rRNA gene and cpcBA-IGS sequences

    Chi-Yong Ahn

    2012-06-01

    Full Text Available Arthrospira platensis and Arthrospira maxima are species of cyanobacteria used in health foods, animal feed, food additives, and fine chemicals. This study conducted a comparison of the 16S rRNA gene and cpcBA-intergenic spacer (cpcBA-IGS sequences in Arthrospira strains from culture collections around the world. A cluster analysis divided the 10 Arthrospira strains into two main genotypic clusters, designated I and II, where Group I contained A. platensis SAG 86.79, UTEX 2340, A. maxima KCTC AG30054, and SAG 49.88, while Group II contained A. platensis PCC 9108, NIES 39, NIES 46, and SAG 257.80. However, although A. platensis PCC 9223 belonged to Group II-2 based on its cpcBA-IGS sequence, this strain also belonged to Group I based on its 16S rRNA gene sequence. Phylogenetic analyses based on the 16S rRNA gene and cpcBA-IGS sequences showed no division between A. platensis and A. maxima, plus the 16S rRNA gene and cpcBAIGS sequence clusters did not indicate any well-defined geographical distribution, instead overlapping in a rather interesting way. Therefore, the current study supports some previous conclusions based on 16S rRNA gene and cpcBA-IGS sequences, which found that Arthrospira taxa are monophyletic. However, when compared with 16S rRNA sequences, cpcBA-IGS sequences may be better suited to resolve close relationships and intraspecies variability.

  12. Phylogenetic relationships within the family Halomonadaceae based on comparative 23S and 16S rRNA gene sequence analysis.

    de la Haba, Rafael R; Arahal, David R; Márquez, M Carmen; Ventosa, Antonio

    2010-04-01

    A phylogenetic study of the family Halomonadaceae was carried out based on complete 16S rRNA and 23S rRNA gene sequences. Several 16S rRNA genes of type strains were resequenced, and 28 new sequences of the 23S rRNA gene were obtained. Currently, the family includes nine genera (Carnimonas, Chromohalobacter, Cobetia, Halomonas, Halotalea, Kushneria, Modicisalibacter, Salinicola and Zymobacter). These genera are phylogenetically coherent except Halomonas, which is polyphyletic. This genus comprises two clearly distinguished clusters: group 1 includes Halomonas elongata (the type species) and the species Halomonas eurihalina, H. caseinilytica, H. halmophila, H. sabkhae, H. almeriensis, H. halophila, H. salina, H. organivorans, H. koreensis, H. maura and H. nitroreducens. Group 2 comprises the species Halomonas aquamarina, H. meridiana, H. axialensis, H. magadiensis, H. hydrothermalis, H. alkaliphila, H. venusta, H. boliviensis, H. neptunia, H. variabilis, H. sulfidaeris, H. subterranea, H. janggokensis, H. gomseomensis, H. arcis and H. subglaciescola. Halomonas salaria forms a cluster with Chromohalobacter salarius and the recently described genus Salinicola, and their taxonomic affiliation requires further study. More than 20 Halomonas species are phylogenetically not within the core constituted by the Halomonas sensu stricto cluster (group 1) or group 2 and, since their positions on the different phylogenetic trees are not stable, they cannot be recognized as additional groups either. In general, there is excellent agreement between the phylogenies based on the two rRNA gene sequences, but the 23S rRNA gene showed higher resolution in the differentiation of species of the family Halomonadaceae. PMID:19656941

  13. High-throughput profiling of nucleotides and nucleotide sugars to evaluate their impact on antibody N-glycosylation.

    Villiger, Thomas K; Steinhoff, Robert F; Ivarsson, Marija; Solacroup, Thomas; Stettler, Matthieu; Broly, Hervé; Krismer, Jasmin; Pabst, Martin; Zenobi, Renato; Morbidelli, Massimo; Soos, Miroslav

    2016-07-10

    Recent advances in miniaturized cell culture systems have facilitated the screening of media additives on productivity and protein quality attributes of mammalian cell cultures. However, intracellular components are not routinely measured due to the limited throughput of available analytical techniques. In this work, time profiling of intracellular nucleotides and nucleotide sugars of CHO-S cell fed-batch processes in a micro-scale bioreactor system was carried out using a recently developed high-throughput method based on matrix-assisted laser desorption/ionization (MALDI) time-of-flight mass spectrometry (TOF-MS). Supplementation of various media additives significantly altered the intracellular nucleotides and nucleotide sugars that are inextricably linked to the process of glycosylation. The results revealed that UDP-Gal synthesis appeared to be particularly limiting whereas the impact of elevated UDP-GlcNAc and GDP-Fuc levels on the final glycosylation patterns was only marginally important. In contrast, manganese and asparagine supplementation altered the glycan profiles without affecting intracellular components. The combination of miniaturized cell cultures and high-throughput analytical techniques serves therefore as a useful tool for future quality driven media optimization studies. PMID:27131894

  14. Fluorides leaching from restorative materials and the effect on adjacent teeth

    Qvist, Vibeke; Poulsen, Agneta; Teglers, Poul Thorpen;

    2010-01-01

    Placing a Class II restoration in a tooth changes the local environment, including that for the adjacent tooth. Apart from the change to a less- or non-cariogenic environment for the restored tooth, the effect of leachable components from a restoration in the adjacent tooth should be taken into c...

  15. TP53 mutations in clinically normal mucosa adjacent to oral carcinomas

    Thode, Christenze; Bilde, Anders; von Buchwald, Christian;

    2010-01-01

    positive cells. Seven specimens contained both histological normal and dysplastic epithelial tissues adjacent to the tumour. A TP53 mutation was found in only one specimen; this mutation appeared in the normal mucosa, the adjacent tumour, and the epithelial dysplasia. CONCLUSION: We found that upregulation...

  16. 33 CFR 110.140 - Buzzards Bay, Nantucket Sound, and adjacent waters, Mass.

    2010-07-01

    ... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Buzzards Bay, Nantucket Sound, and adjacent waters, Mass. 110.140 Section 110.140 Navigation and Navigable Waters COAST GUARD..., Nantucket Sound, and adjacent waters, Mass. (a) New Bedford Outer Harbor—(1) Anchorage A. West of...

  17. Treatment Outcome and Patient Satisfaction with Two Adjacent Implant-Supported Restorations in the Esthetic Zone

    Tymstra, Nynke; Meijer, Henny J. A.; Stellingsma, Kees; Raghoebar, Gerry M.; Vissink, Arjan

    2010-01-01

    The purpose of this study was to evaluate the clinical and radiographic parameters as well as the esthetic outcome of two adjacent implant-supported restorations and the surrounding peri-implant mucosa in the maxillary esthetic zone. Ten patients were treated with two adjacent implants in the anteri

  18. 33 CFR 334.70 - Buzzards Bay, and adjacent waters, Mass.; danger zones for naval operations.

    2010-07-01

    ... 33 Navigation and Navigable Waters 3 2010-07-01 2010-07-01 false Buzzards Bay, and adjacent waters, Mass.; danger zones for naval operations. 334.70 Section 334.70 Navigation and Navigable Waters CORPS OF ENGINEERS, DEPARTMENT OF THE ARMY, DEPARTMENT OF DEFENSE DANGER ZONE AND RESTRICTED AREA REGULATIONS § 334.70 Buzzards Bay, and adjacent...

  19. Exploring internal features of 16S rRNA gene for identification of clinically relevant species of the genus Streptococcus

    Verma Mansi; Lal Devi; Lal Rup

    2011-01-01

    Abstract Background Streptococcus is an economically important genus as a number of species belonging to this genus are human and animal pathogens. The genus has been divided into different groups based on 16S rRNA gene sequence similarity. The variability observed among the members of these groups is low and it is difficult to distinguish them. The present study was taken up to explore 16S rRNA gene sequence to develop methods that can be used for preliminary identification and can supplemen...

  20. SSU rRNA reveals a sequential increase in shell complexity among the euglyphid testate amoebae (Rhizaria: Euglyphida)

    Lara, Enrique; Heger, Thierry J; Mitchell, Edward A D; Meisterfeld, Ralf; Ekelund, Flemming

    2007-01-01

    The existing data on the molecular phylogeny of filose testate amoebae from order Euglyphida has revealed contradictions between traditional morphological classification and SSU rRNA phylogeny and, moreover, the position of several important genera remained unknown. We therefore carried out a study...... aiming to fill several important gaps and better understand the relationships among the main euglyphid testate amoebae and the evolutionary steps that led to the present diversity at a higher level. We obtained new SSU rRNA sequences from five genera and seven species. This new phylogeny obtained shows...

  1. The Ribosomal Database Project (RDP-II): sequences and tools for high-throughput rRNA analysis

    Cole, J. R.; Chai, B.; Farris, R. J.; Wang, Q; Kulam, S. A.; McGarrell, D. M.; Garrity, G M; Tiedje, J M

    2004-01-01

    The Ribosomal Database Project (RDP-II) provides the research community with aligned and annotated rRNA gene sequences, along with analysis services and a phylogenetically consistent taxonomic framework for these data. Updated monthly, these services are made available through the RDP-II website (http://rdp.cme.msu.edu/). RDP-II release 9.21 (August 2004) contains 101 632 bacterial small subunit rRNA gene sequences in aligned and annotated format. High-throughput tools for initial taxonomic p...

  2. Changes in growth, rRNA content, and cell morphology of Listeria monocytogenes induced by CO2 up- and downshift

    Jydegaard-Axelsen, A.M.; Aaes-Jorgensen, A.; Koch, A.G.; Stoumann Jensen, J.; Knochel, S.

    2005-01-01

    Cell morphology, rRNA content, and growth were examined for Listeria monocytogenes LO28 and EGD, respectively, grown in brain-heart infusion (BHI) and on slices of sausage at 10degreesC in 100% CO2, 100% N-2, and air. In CO2, filamentous cells were formed by both strains on sausage slices and by L...... unchanged. On sausage slices, the number of colony forming units also increased rapidly for both strains in response to CO2 downshift. Large variations in rRNA content of individual cells were observed in the tested scenarios. The results demonstrate the risk of underestimating the number of infectious...

  3. Assessing the Fecal Microbiota: An Optimized Ion Torrent 16S rRNA Gene-Based Analysis Protocol

    Foroni, Elena; Duranti, Sabrina; Turroni, Francesca; Lugli, Gabriele Andrea; Sanchez, Borja; Martín, Rebeca; Gueimonde, Miguel; van Sinderen, Douwe; Margolles, Abelardo; Ventura, Marco

    2013-01-01

    Assessing the distribution of 16S rRNA gene sequences within a biological sample represents the current state-of-the-art for determination of human gut microbiota composition. Advances in dissecting the microbial biodiversity of this ecosystem have very much been dependent on the development of novel high-throughput DNA sequencing technologies, like the Ion Torrent. However, the precise representation of this bacterial community may be affected by the protocols used for DNA extraction as well as by the PCR primers employed in the amplification reaction. Here, we describe an optimized protocol for 16S rRNA gene-based profiling of the fecal microbiota. PMID:23869230

  4. Molecular genetic monitoring of bacterial communities in manzala lake, egypt, based on 16S rRNA gene analysis

    El Saied, H.E.

    2007-01-01

    A first molecular genetic study on the diversity of bacterial communities at Manzala Lake, Egypt, was determined by culture-independent 16S rRNA gene analysis. Bulk DNAs were extracted from water and sediment at two different sampling sites namely; Bashtir and Genka, in the lake. The 16S rRNA gene was positively amplified by polymerase chain reaction (PCR) from bulk DNA of each sample, cloned and sequenced. The sequence analysis of one hundred clones from each clone library obtained number of...

  5. Defining reference sequences for Nocardia species by similarity and clustering analyses of 16S rRNA gene sequence data.

    Manal Helal

    Full Text Available BACKGROUND: The intra- and inter-species genetic diversity of bacteria and the absence of 'reference', or the most representative, sequences of individual species present a significant challenge for sequence-based identification. The aims of this study were to determine the utility, and compare the performance of several clustering and classification algorithms to identify the species of 364 sequences of 16S rRNA gene with a defined species in GenBank, and 110 sequences of 16S rRNA gene with no defined species, all within the genus Nocardia. METHODS: A total of 364 16S rRNA gene sequences of Nocardia species were studied. In addition, 110 16S rRNA gene sequences assigned only to the Nocardia genus level at the time of submission to GenBank were used for machine learning classification experiments. Different clustering algorithms were compared with a novel algorithm or the linear mapping (LM of the distance matrix. Principal Components Analysis was used for the dimensionality reduction and visualization. RESULTS: The LM algorithm achieved the highest performance and classified the set of 364 16S rRNA sequences into 80 clusters, the majority of which (83.52% corresponded with the original species. The most representative 16S rRNA sequences for individual Nocardia species have been identified as 'centroids' in respective clusters from which the distances to all other sequences were minimized; 110 16S rRNA gene sequences with identifications recorded only at the genus level were classified using machine learning methods. Simple kNN machine learning demonstrated the highest performance and classified Nocardia species sequences with an accuracy of 92.7% and a mean frequency of 0.578. CONCLUSION: The identification of centroids of 16S rRNA gene sequence clusters using novel distance matrix clustering enables the identification of the most representative sequences for each individual species of Nocardia and allows the quantitation of inter- and intra

  6. Slow formation of stable complexes during coincubation of a minimal rRNA and ribosomal protein S4

    Mayerle, Megan; Bellur, Deepti L.; Woodson, Sarah A.

    2011-01-01

    Ribosomal protein S4 binds and stabilizes a five-helix junction in the 5’ domain of the 16S rRNA, and is one of two proteins responsible for nucleating 30S ribosome assembly. Upon binding, both protein S4 and the five-helix junction reorganize their structures. We show that labile S4 complexes rearrange to stable complexes within a few minutes at 42°C, with longer coincubation leading to an increased population of stable complexes. In contrast, prefolding the rRNA has a smaller effect on stab...

  7. Adjacency effect estimation by ground spectra measurement and satellite optical sensor synchronous observation data

    Jianwen Ma; Xue Chen

    2006-01-01

    @@ This paper addresses the estimation of adjacency effect of CBERS-2 image.The adjacency effect influences the digital number (DN) value of a pixel by adding surrounding scattering signals and path scattering signals.Based on the theory of radiation transfer model,a procedure is designed to measure the reflectance from the surface target materials and the materials in a box,which is 1.5 m above the surface to avoid upwelling reflectance.The results show that the adjacency effect varies from visible,near infrared and becomes steady within short infrared wavelength region;the adjacency effect weakens with the increase of distance between testing sites.The adjacency effect of CBERS-2 image is corrected and the quality of the resulting image is improved.

  8. Assessment of heavy metal levels in surface sediments of estuaries and adjacent coastal areas in China

    Liu, Xianbin; Li, Deliang; Song, Guisheng

    2016-05-01

    This article investigates the variations of contamination levels of heavy metals such as copper, lead, chromium, cadmium, zinc, arsenic, and mercury over time in surface sediments of the Changjiang River Estuary (CRE), Yellow River Estuary (YRE), Pearl River Estuary (PRE), and their adjacent coastal areas in China. The contamination factor (CF), pollution load index (PLI), and geoaccumulation index (I geo) are used to evaluate the quality of the surface sediments in the study areas. The results showed that the CRE, YRE, and their adjacent coastal areas were at a low risk of contamination in terms of heavy metals, while the PRE and its adjacent coastal area were at a moderate level. By comparison, the concentrations of heavy metals in the surface sediments of the YRE and its adjacent coastal area were relatively lower than those in the CRE, PRE, and their adjacent coastal areas.

  9. Automated identification of medically important bacteria by 16S rRNA gene sequencing using a novel comprehensive database, 16SpathDB

    Woo, Patrick C. Y.; Teng, Jade L. L.; Yeung, Juilian M. Y.; Tse, Herman; Lau, Susanna K. P.; Yuen, Kwok-Yung

    2011-01-01

    Despite the increasing use of 16S rRNA gene sequencing, interpretation of 16S rRNA gene sequence results is one of the most difficult problems faced by clinical microbiologists and technicians. To overcome the problems we encountered in the existing databases during 16S rRNA gene sequence interpretation, we built a comprehensive database, 16SpathDB (http://147.8.74.24/16SpathDB) based on the 16S rRNA gene sequences of all medically important bacteria listed in the Manual of Clinical Microbiol...

  10. Estimation of 16S rRNA gene copy number in several probiotic Lactobacillus strains isolated from the gastrointestinal tract of chicken

    Lee, Chin Mei; Sieo, Chin Chin; Abdullah, Norhani; Ho, Yin Wan

    2008-01-01

    The copy numbers of 16S rRNA genes in 12 probiotic Lactobacillus strains of poultry origin were analyzed. Genomic DNA of the strains was digested with restriction endonucleases that do not cut within the 16S rRNA gene of the strains. This was followed by Southern hybridization with a biotinylated probe complementary to the 16S rRNA gene. The copy number of the 16S rRNA gene within a Lactobacillus species was found to be conserved. From the hybridization results, Lactobacillus salivarius I 24 ...

  11. Nucleotide diversity in the mitochondrial and nuclear compartments of Chlamydomonas reinhardtii: investigating the origins of genome architecture

    Lee Robert W

    2008-05-01

    Full Text Available Abstract Background The magnitude of intronic and intergenic DNA can vary substantially both within and among evolutionary lineages; however, the forces responsible for this disparity in genome compactness are conjectural. One explanation, termed the mutational-burden hypothesis, posits that genome compactness is primarily driven by two nonadaptive processes: mutation and random genetic drift – the effects of which can be discerned by measuring the nucleotide diversity at silent sites (πsilent, defined as noncoding sites and the synonymous sites of protein-coding regions. The mutational-burden hypothesis holds that πsilent is negatively correlated to genome compactness. We used the model organism Chlamydomonas reinhardtii, which has a streamlined, coding-dense mitochondrial genome and an noncompact, intron-rich nuclear genome, to investigate the mutational-burden hypothesis. For measuring πsilent we sequenced the complete mitochondrial genome and portions of 7 nuclear genes from 7 geographical isolates of C. reinhardtii. Results We found significantly more nucleotide diversity in the nuclear compartment of C. reinhardtii than in the mitochondrial compartment: net values of πsilent for the nuclear and mitochondrial genomes were 32 × 10-3 and 8.5 × 10-3, respectively; and when insertions and deletions (indels are factored in, these values become 49 × 10-3 for the nuclear DNA and 11 × 10-3 for the mitochondrial DNA (mtDNA. Furthermore, our investigations of C. reinhardtii revealed 4 previously undiscovered mitochondrial introns, one of which contains a fragment of the large-subunit (LSU rRNA gene and another of which is found in a region of the LSU-rRNA gene not previously reported (for any taxon to contain introns. Conclusion At first glance our results are in opposition to the mutational-burden hypothesis: πsilent was approximately 4 times greater in the nuclear compartment of C. reinhardtii relative to the mitochondrial compartment

  12. Modification of survival of gamma irradiated mice by adenosine nucleotides

    The administration prior to irradiation of adenosine triphosphate (ATP) or other adenosine nucleotides, singly or in combination, increased the radioresistance of mice. Post-irradiation treatment with the adenosine nucleotides had no effect on the survival of the irradiated mice. Dose reduction factors of 2.32 could be obtained by pretreatment of mice with the following combination of protective agents: S-2(4-aminobutylamino)ethyl phosphorothioic aced (WR 2822), cysteamine (MEA) and ATP. Since cyclic AMP levels were unchanged in the spleen or gut by administration of cysteamine and other protectors it is unlikely that the increase in protection was due to changes in cyclic AMP levels. The calcium salt of ATP provided a higher level of protection than the ATP alone, indicating that the protective mechanism of ATP is probably not related to anoxia. (orig.)

  13. Genome-wide patterns of nucleotide polymorphism in domesticated rice

    Caicedo, Ana L; Williamson, Scott H; Hernandez, Ryan D;

    2007-01-01

    Domesticated Asian rice (Oryza sativa) is one of the oldest domesticated crop species in the world, having fed more people than any other plant in human history. We report the patterns of DNA sequence variation in rice and its wild ancestor, O. rufipogon, across 111 randomly chosen gene fragments......, and use these to infer the evolutionary dynamics that led to the origins of rice. There is a genome-wide excess of high-frequency derived single nucleotide polymorphisms (SNPs) in O. sativa varieties, a pattern that has not been reported for other crop species. We developed several alternative models...... plausible explanations for patterns of variation in domesticated rice varieties. If selective sweeps are indeed the explanation for the observed nucleotide data of domesticated rice, it suggests that strong selection can leave its imprint on genome-wide polymorphism patterns, contrary to expectations that...

  14. Nucleotide analogs based on pentaerythritol — An hypothesis

    Schwartz, Alan W.

    1993-06-01

    The synthesis of ribose and ribose-based nucleotides under reasonable prebiotic conditions has not been achieved. Glycerol has been suggested as a structural unit that might have preceded ribose in the evolutionary emergence of RNA. Template-directed oligomerizations of nucleotide analogs based on glycerol, however, have been only partially successful. Recent studies on the effect of ultraviolet irradiation of formaldehyde solutions have shown that the reduced sugar pentaerythritol is formed with great specificity. I argue that pentaerythritol is potentially capable of being converted by simple chemistry into a series of nucleoside analogs related to barbituric acid. These analogs may be able to take part in nucleic acid-like interactions and could therefore be of potential interest as a new class of candidates as RNA precursors.

  15. Identification of cyclic nucleotide gated channels using regular expressions

    Zelman, Alice K.

    2013-09-03

    Cyclic nucleotide-gated channels (CNGCs) are nonselective cation channels found in plants, animals, and some bacteria. They have a six-transmembrane/one- pore structure, a cytosolic cyclic nucleotide-binding domain, and a cytosolic calmodulin-binding domain. Despite their functional similarities, the plant CNGC family members appear to have different conserved amino acid motifs within corresponding functional domains than animal and bacterial CNGCs do. Here we describe the development and application of methods employing plant CNGC-specific sequence motifs as diagnostic tools to identify novel candidate channels in different plants. These methods are used to evaluate the validity of annotations of putative orthologs of CNGCs from plant genomes. The methods detail how to employ regular expressions of conserved amino acids in functional domains of annotated CNGCs and together with Web tools such as PHI-BLAST and ScanProsite to identify novel candidate CNGCs in species including Physcomitrella patens. © Springer Science+Business Media New York 2013.

  16. The nucleotide exchange factors of Hsp70 molecular chaperone

    Andreas eBracher

    2015-04-01

    Full Text Available Molecular chaperones of the Hsp70 family form an important hub in the cellular protein folding networks in bacteria and eukaryotes, connecting translation with the downstream machineries of protein folding and degradation. The Hsp70 folding cycle is driven by two types of cochaperones: J-domain proteins stimulate ATP hydrolysis by Hsp70, while nucleotide exchange factors (NEFs promote replacement of Hsp70-bound ADP with ATP. Bacteria and organelles of bacterial origin have only one known NEF type for Hsp70, GrpE. In contrast, a large diversity of Hsp70 NEFs has been discovered in the eukaryotic cell. These NEFs belong to the Hsp110/Grp170, HspBP1/Sil1 and BAG domain protein families. In this short review we compare the structures and molecular mechanisms of nucleotide exchange factors for Hsp70 and discuss how these cochaperones contribute to protein folding and quality control in the cell.

  17. Antibiotic interactions at the GTPase-associated centre within Escherichia coli 23S rRNA

    Egebjerg, J; Douthwaite, S; Garrett, R A

    1989-01-01

    A comprehensive range of chemical reagents and ribonucleases was employed to investigate the interaction of the antibiotics thiostrepton and micrococcin with the ribosomal protein L11-23S RNA complex and with the 50S subunit. Both antibiotics block processes associated with the ribosomal A-site b...... important exception, however, occurred at nucleotide A1067 within a terminal loop where thiostrepton protected the N-1 position while micrococcin rendered it more reactive. This difference correlates with the opposite effects of the two antibiotics on GTPase activity....... differ in their effects on GTP hydrolysis, which is inhibited by thiostrepton and stimulated by micrococcin. The interaction sites of both drugs were shown to occur within the nucleotide sequences A1067-A1098 within the protein L11 binding site on 23S RNA. This region of the ribosome structure is......A comprehensive range of chemical reagents and ribonucleases was employed to investigate the interaction of the antibiotics thiostrepton and micrococcin with the ribosomal protein L11-23S RNA complex and with the 50S subunit. Both antibiotics block processes associated with the ribosomal A-site but...

  18. The Role of Cyclic Nucleotide Signaling Pathways in Cancer: Targets for Prevention and Treatment

    Fajardo, Alexandra M.; Piazza, Gary A. [Drug Discovery Research Center, Mitchell Cancer Institute, University of South Alabama, 1660 Springhill Ave, Suite 3029, Mobile, AL 36604 (United States); Tinsley, Heather N., E-mail: htinsley@montevallo.edu [Department of Biology, Chemistry, and Mathematics, University of Montevallo, Station 6480, Montevallo, AL 35115 (United States)

    2014-02-26

    For more than four decades, the cyclic nucleotides cyclic AMP (cAMP) and cyclic GMP (cGMP) have been recognized as important signaling molecules within cells. Under normal physiological conditions, cyclic nucleotides regulate a myriad of biological processes such as cell growth and adhesion, energy homeostasis, neuronal signaling, and muscle relaxation. In addition, altered cyclic nucleotide signaling has been observed in a number of pathophysiological conditions, including cancer. While the distinct molecular alterations responsible for these effects vary depending on the specific cancer type, several studies have demonstrated that activation of cyclic nucleotide signaling through one of three mechanisms—induction of cyclic nucleotide synthesis, inhibition of cyclic nucleotide degradation, or activation of cyclic nucleotide receptors—is sufficient to inhibit proliferation and activate apoptosis in many types of cancer cells. These findings suggest that targeting cyclic nucleotide signaling can provide a strategy for the discovery of novel agents for the prevention and/or treatment of selected cancers.

  19. Spontaneous formation and base pairing of plausible prebiotic nucleotides in water.

    Cafferty, Brian J; Fialho, David M; Khanam, Jaheda; Krishnamurthy, Ramanarayanan; Hud, Nicholas V

    2016-01-01

    The RNA World hypothesis presupposes that abiotic reactions originally produced nucleotides, the monomers of RNA and universal constituents of metabolism. However, compatible prebiotic reactions for the synthesis of complementary (that is, base pairing) nucleotides and mechanisms for their mutual selection within a complex chemical environment have not been reported. Here we show that two plausible prebiotic heterocycles, melamine and barbituric acid, form glycosidic linkages with ribose and ribose-5-phosphate in water to produce nucleosides and nucleotides in good yields. Even without purification, these nucleotides base pair in aqueous solution to create linear supramolecular assemblies containing thousands of ordered nucleotides. Nucleotide anomerization and supramolecular assemblies favour the biologically relevant β-anomer form of these ribonucleotides, revealing abiotic mechanisms by which nucleotide structure and configuration could have been originally favoured. These findings indicate that nucleotide formation and selection may have been robust processes on the prebiotic Earth, if other nucleobases preceded those of extant life. PMID:27108699

  20. Spontaneous formation and base pairing of plausible prebiotic nucleotides in water

    Cafferty, Brian J.; Fialho, David M.; Khanam, Jaheda; Krishnamurthy, Ramanarayanan; Hud, Nicholas V.

    2016-01-01

    The RNA World hypothesis presupposes that abiotic reactions originally produced nucleotides, the monomers of RNA and universal constituents of metabolism. However, compatible prebiotic reactions for the synthesis of complementary (that is, base pairing) nucleotides and mechanisms for their mutual selection within a complex chemical environment have not been reported. Here we show that two plausible prebiotic heterocycles, melamine and barbituric acid, form glycosidic linkages with ribose and ribose-5-phosphate in water to produce nucleosides and nucleotides in good yields. Even without purification, these nucleotides base pair in aqueous solution to create linear supramolecular assemblies containing thousands of ordered nucleotides. Nucleotide anomerization and supramolecular assemblies favour the biologically relevant β-anomer form of these ribonucleotides, revealing abiotic mechanisms by which nucleotide structure and configuration could have been originally favoured. These findings indicate that nucleotide formation and selection may have been robust processes on the prebiotic Earth, if other nucleobases preceded those of extant life. PMID:27108699

  1. Molecular genetic characterization of two pedigrees with mitochondrial 12S rRNA C1494T mutation and aminoglycoside-induced hearing loss%两个线粒体12S rRNA C1494T突变及药物性耳聋家系的分子遗传学研究

    李海峰; 陈智斌; 邢光前

    2011-01-01

    the two families. Sequence analysis of the complete mitochondrial genomes in two probands revealed the distinct sets of mtDNA polymorphism (52 other nucleotide changes), in addition to the identical 12S rRNA C1494T mutation. None of these 52 variants, however, were shown to be pathogenic. The whole mitochondrial genome of proband from each of the two families was established that they belong to mitochondrial haplogroups D4 and D5a respectively. No mutations were identified in either TRMU gene or MTO1 gene. Conclusion:C 1494T mutation in the mitochondrial 12S rRNA gene is the main molecular mechanism responsible for the hearing loss in the two pedigrees, and the use of aminoglycnside antibiotics may enhance the phenotypic manifestation of deafnessassociated mitochondrial mutation. Mitochondrial haplogroups and nuclear genes (TRMU and MT01), however, seems not play a role in the phenotypic expression of C 1494T mutation in these two families.

  2. iCLIP: Protein–RNA interactions at nucleotide resolution

    Huppertz I; Attig J; D'Ambrogio A.; Eastonb L; Sibley CR; Sugimoto Y; Tajnik M; K\\xf6nig J; Ule J

    2014-01-01

    RNA-binding proteins (RBPs) are key players in the post-transcriptional regulation of gene expression. Precise knowledge about their binding sites is therefore critical to unravel their molecular function and to understand their role in development and disease. Individual-nucleotide resolution UV crosslinking and immunoprecipitation (iCLIP) identifies protein-RNA crosslink sites on a genome-wide scale. The high resolution and specificity of this method are achieved by an intramolecular cDNA c...

  3. Synthesis of sugar-nucleotide analogs as potential glycosyltransferase inhibitors

    Kóšiová, Ivana; Koiš, P.; Rosenberg, Ivan

    2007-01-01

    Roč. 101, č. 11 (2007), s. 949-950. ISSN 0009-2770. [Pokroky v organické, bioorganické a farmaceutické chemii /42./. 16.11.2007-18.11.2007, Liblice] R&D Projects: GA ČR GA202/05/0628 Grant ostatní: SSTAA(SK) APVV-51-046505 Institutional research plan: CEZ:AV0Z40550506 Keywords : glycosylation * glycosyltransferase * nucleotide analogs * nucleoside phosphonates Subject RIV: CC - Organic Chemistry

  4. Conformation of pyrrolidine ring in pyrrolidine nucleotide analogues

    Pohl, Radek; Buděšínský, Miloš; Rejman, Dominik; Kočalka, Petr; Rosenberg, Ivan

    Praha : Institute of Organic Chemistry and Biochemistry ASCR, 2008 - (Hocek, M.), s. 435-436 ISBN 978-80-86241-29-6. - (Collection Symposium Series. 10). [Symposium on Chemistry of Nucleic Acid Components /14./. Český Krumlov (CZ), 08.06.2008-13.06.2008] R&D Projects: GA MŠk 2B06065 Institutional research plan: CEZ:AV0Z40550506 Keywords : NMR spectroscopy * conformation analysis * nucleotides Subject RIV: CC - Organic Chemistry

  5. Isolation and nucleotide sequence of the gene encoding human rhodopsin.

    Nathans, J; Hogness, D S

    1984-01-01

    We have isolated and completely sequenced the gene encoding human rhodopsin. The coding region of the human rhodopsin gene is interrupted by four introns, which are located at positions analogous to those found in the previously characterized bovine rhodopsin gene. The amino acid sequence of human rhodopsin, deduced from the nucleotide sequence of its gene, is 348 residues long and is 93.4% homologous to that of bovine rhodopsin. Interestingly, those portions of the polypeptide chain predicte...

  6. Single nucleotide polymorphisms of complement component 5 and periodontitis

    L. Chai; Zee, KY; Song, YQ; Leung, WK

    2010-01-01

    BACKGROUND AND OBJECTIVE: Polymorphisms of host defence genes might increase one's risks for periodontitis. This study investigated whether tagging single nucleotide polymorphisms (SNPs) of the gene encoding complement component 5 (C5) are associated with periodontitis in a Hong Kong Chinese population. MATERIAL AND METHODS: Eleven tagging SNPs of 229 patients with at least moderate periodontitis and 207 control subjects without periodontitis were genotyped using an i-plexGOLD MassARRAY mass-...

  7. Utilizing Single Nucleotide Polymorphism Analysis in Determining Parentage of Cattle

    Elbert, Nicole M.

    2013-01-01

    Parentage identification within cattle herds is an important aspect of record keeping. It is essential for accurate registration within a purebred association and decision making for production purposes, such as replacement heifer and sire selection. Methods used to identify parentage have evolved from utilizing blood protein antigens, restriction fragment length polymorphism (RFLP) and microsatellites to the current technology of analyzing DNA profiles for differing single nucleotide polymor...

  8. Nucleotide sequence composition and method for detection of neisseria gonorrhoeae

    Lo, A.; Yang, H.L.

    1990-02-13

    This patent describes a composition of matter that is specific for {ital Neisseria gonorrhoeae}. It comprises: at least one nucleotide sequence for which the ratio of the amount of the sequence which hybridizes to chromosomal DNA of {ital Neisseria gonorrhoeae} to the amount of the sequence which hybridizes to chromosomal DNA of {ital Neisseria meningitidis} is greater than about five. The ratio being obtained by a method described.

  9. Haplotype Information and Linkage Disequilibrium Mapping for Single Nucleotide Polymorphisms

    Lu, Xin; Niu, Tianhua; Liu, Jun

    2003-01-01

    Single nucleotide polymorphisms in the human genome have become an increasingly popular topic in that their analyses promise to be a key step toward personalized medicine. We investigate two related questions, how much the haplotype information contributes to linkage disequilibrium (LD) mapping and whether an in silico haplotype construction preceding the LD analysis can help. For disease gene mapping, using both simulated and real data sets on cystic fibrosis and the Alzheimer disease, we re...

  10. Haplotype Information and Linkage Disequilibrium Mapping for Single Nucleotide Polymorphisms

    Lu, Xin; Niu, Tianhua; Liu, Jun S.

    2003-01-01

    Single nucleotide polymorphisms in the human genome have become an increasingly popular topic in that their analyses promise to be a key step toward personalized medicine. We investigate two related questions, how much the haplotype information contributes to linkage disequilibrium (LD) mapping and whether an in silico haplotype construction preceding the LD analysis can help. For disease gene mapping, using both simulated and real data sets on cystic fibrosis and the Alzheimer disease,...

  11. Expression of Vesicular Nucleotide Transporter in Rat Odontoblasts

    Ikeda, Erina; Goto, Tetsuya; Gunjigake, Kaori; Kuroishi, Kayoko; Ueda, Masae; Kataoka, Shinji; Toyono, Takashi; Nakatomi, Mitsushiro; Seta, Yuji; Kitamura, Chiaki; NISHIHARA, Tatsuji; Kawamoto, Tatsuo

    2016-01-01

    Several theories have been proposed regarding pain transmission mechanisms in tooth. However, the exact signaling mechanism from odontoblasts to pulp nerves remains to be clarified. Recently, ATP-associated pain transmission has been reported, but it is unclear whether ATP is involved in tooth pain transmission. In the present study, we focused on the vesicular nucleotide transporter (VNUT), a transporter of ATP into vesicles, and examined whether VNUT was involved in ATP release from odontob...

  12. MGMT expression: insights into its regulation. 2. Single nucleotide polymorphisms

    Iatsyshyna A. P.; Pidpala O. V.; Lukash L. L.

    2013-01-01

    High intra- and interindividual variations in the expression levels of the human O6-methylguanine-DNA methyltransferase (MGMT) gene have been observed. This DNA repair enzyme can be a cause of resistance of cancer cells to alkylating chemotherapy. It has been studied the association of single nucleotide polymorphisms (SNPs) of MGMT with the risk for different types of cancer, progression-free survival in patients with cancer treated with alkylating chemotherapy, as well as an effect of SNPs o...

  13. A Simple Strategy for Glycosyltransferase-Catalyzed Aminosugar Nucleotide Synthesis

    Zhang, Jianjun; Singh, Shanteri; Hughes, Ryan R.; Zhou, Maoquan; Sunkara, Manjula; Morris, Andrew J.; Thorson, Jon S.

    2014-01-01

    A set of 2-chloro-4-nitrophenyl glucosamino/xylosaminosides were synthesized and assessed as potential substrates in the context of glycosyltransferase-catalyzed formation of the corresponding UDP/TDP-α-D-glucosamino-/xylosaminosugars and single vessel transglycosylation reactions with a model acceptor. This study highlights a robust platform for aminosugar nucleotide synthesis and reveals OleD Loki as a proficient catalyst for U/TDP-aminosugar synthesis and utilization.

  14. Single nucleotide polymorphisms predict symptom severity of autism spectrum disorder

    Jiao, Yun; Chen, Rong; Ke, Xiaoyan; Cheng, Lu; Chu, Kangkang; Lu, Zuhong; Herskovits, Edward H

    2012-01-01

    Autism is widely believed to be a heterogeneous disorder; diagnosis is currently based solely on clinical criteria, although genetic, as well as environmental, influences are thought to be prominent factors in the etiology of most forms of autism. Our goal is to determine whether a predictive model based on single-nucleotide polymorphisms (SNPs) can predict symptom severity of autism spectrum disorder (ASD). We divided 118 ASD children into a mild/moderate autism group (n = 65) and a severe a...

  15. SSE: a nucleotide and amino acid sequence analysis platform

    Simmonds Peter

    2012-01-01

    Abstract Background There is an increasing need to develop bioinformatic tools to organise and analyse the rapidly growing amount of nucleotide and amino acid sequence data in organisms ranging from viruses to eukaryotes. Finding A simple sequence editor (SSE) was developed to create an integrated environment where sequences can be aligned, annotated, classified and directly analysed by a number of built-in bioinformatic programs. SSE incorporates a sequence editor for the creation of sequenc...

  16. Analysis of Single Nucleotide Polymorphism Panels for Bovine DNA Identification

    Blanchard, Kimberly A.

    2013-01-01

    Single nucleotide polymorphisms (SNPs) are single base-pair variations that exist between individuals. There are approximately a million or more SNPs located throughout the genome of each individual animal. Therefore, by taking advantage of these unique polymorphisms, SNPs can be used to resolve questions of unknown parentage in the livestock industry. Currently a panel of 88 SNPs, obtained from a panel of 121 SNPs originally created by USDA-MARC, is commercially available from Fluidigm®. The...

  17. Scambio, a novel guanine nucleotide exchange factor for Rho

    Groffen John; Senadheera Dinithi; Haataja Leena; Hemmeryckx Bianca; Curtis Christina; Heisterkamp Nora

    2004-01-01

    Abstract Background Small GTPases of the Rho family are critical regulators of various cellular functions including actin cytoskeleton organization, activation of kinase cascades and mitogenesis. For this reason, a major objective has been to understand the mechanisms of Rho GTPase regulation. Here, we examine the function of a novel protein, Scambio, which shares homology with the DH-PH domains of several known guanine nucleotide exchange factors for Rho family members. Results Scambio is lo...

  18. Spatiotemporal regulation of Rap guanine nucleotide exchange factors

    Consonni, S.V.

    2014-01-01

    Guanine nucleotide exchange factors (GEFs) and GTPase activating proteins (GAPs) orchestrate the activity of small G-proteins. In response to extracellular stimuli, GEFs and GAPs activate signaling cascades regulated by G-proteins by controlling their regulation in time and in space. Generally, GEFs function as activators of G-proteins by promoting their GTP-bound state while GAPs serve as inhibitors by increasing the rate of GTP hydrolysis. Our understanding of the mechanisms of regulation o...

  19. Monovar: single-nucleotide variant detection in single cells.

    Zafar, Hamim; Wang, Yong; Nakhleh, Luay; Navin, Nicholas; Chen, Ken

    2016-06-01

    Current variant callers are not suitable for single-cell DNA sequencing, as they do not account for allelic dropout, false-positive errors and coverage nonuniformity. We developed Monovar (https://bitbucket.org/hamimzafar/monovar), a statistical method for detecting and genotyping single-nucleotide variants in single-cell data. Monovar exhibited superior performance over standard algorithms on benchmarks and in identifying driver mutations and delineating clonal substructure in three different human tumor data sets. PMID:27088313

  20. The effect of mitochondrial dysfunction on cytosolic nucleotide metabolism

    Madsen, Claus Desler; Lykke, Anne; Rasmussen, Lene Juel

    2010-01-01

    Several enzymes of the metabolic pathways responsible for metabolism of cytosolic ribonucleotides and deoxyribonucleotides are located in mitochondria. Studies described in this paper suggest dysfunction of the mitochondria to affect these metabolic pathways and limit the available levels of...... cytosolic ribonucleotides and deoxyribonucleotides, which in turn can result in aberrant RNA and DNA synthesis. Mitochondrial dysfunction has been linked to genomic instability, and it is possible that the limiting effect of mitochondrial dysfunction on the levels of nucleotides and resulting aberrant RNA...

  1. Single-nucleotide polymorphism identification and genotyping in Camelina sativa

    Singh, Ravinder; Bollina, Venkatesh; Higgins, Erin E.; Clarke, Wayne E.; Eynck, Christina; Sidebottom, Christine; Gugel, Richard; Snowdon, Rod; Parkin, Isobel A. P.

    2015-01-01

    Camelina sativa, a largely relict crop, has recently returned to interest due to its potential as an industrial oilseed. Molecular markers are key tools that will allow C. sativa to benefit from modern breeding approaches. Two complementary methodologies, capture of 3′ cDNA tags and genomic reduced-representation libraries, both of which exploited second generation sequencing platforms, were used to develop a low density (768) Illumina GoldenGate single nucleotide polymorphism (SNP) array. Th...

  2. Genome-wide patterns of nucleotide polymorphism in domesticated rice.

    Ana L Caicedo

    2007-09-01

    Full Text Available Domesticated Asian rice (Oryza sativa is one of the oldest domesticated crop species in the world, having fed more people than any other plant in human history. We report the patterns of DNA sequence variation in rice and its wild ancestor, O. rufipogon, across 111 randomly chosen gene fragments, and use these to infer the evolutionary dynamics that led to the origins of rice. There is a genome-wide excess of high-frequency derived single nucleotide polymorphisms (SNPs in O. sativa varieties, a pattern that has not been reported for other crop species. We developed several alternative models to explain contemporary patterns of polymorphisms in rice, including a (i selectively neutral population bottleneck model, (ii bottleneck plus migration model, (iii multiple selective sweeps model, and (iv bottleneck plus selective sweeps model. We find that a simple bottleneck model, which has been the dominant demographic model for domesticated species, cannot explain the derived nucleotide polymorphism site frequency spectrum in rice. Instead, a bottleneck model that incorporates selective sweeps, or a more complex demographic model that includes subdivision and gene flow, are more plausible explanations for patterns of variation in domesticated rice varieties. If selective sweeps are indeed the explanation for the observed nucleotide data of domesticated rice, it suggests that strong selection can leave its imprint on genome-wide polymorphism patterns, contrary to expectations that selection results only in a local signature of variation.

  3. Nucleotide Sequencing and Identification of Some Wild Mushrooms

    Sudip Kumar Das

    2013-01-01

    Full Text Available The rDNA-ITS (Ribosomal DNA Internal Transcribed Spacers fragment of the genomic DNA of 8 wild edible mushrooms (collected from Eastern Chota Nagpur Plateau of West Bengal, India was amplified using ITS1 (Internal Transcribed Spacers 1 and ITS2 primers and subjected to nucleotide sequence determination for identification of mushrooms as mentioned. The sequences were aligned using ClustalW software program. The aligned sequences revealed identity (homology percentage from GenBank data base of Amanita hemibapha [CN (Chota Nagpur 1, % identity 99 (JX844716.1], Amanita sp. [CN 2, % identity 98 (JX844763.1], Astraeus hygrometricus [CN 3, % identity 87 (FJ536664.1], Termitomyces sp. [CN 4, % identity 90 (JF746992.1], Termitomyces sp. [CN 5, % identity 99 (GU001667.1], T. microcarpus [CN 6, % identity 82 (EF421077.1], Termitomyces sp. [CN 7, % identity 76 (JF746993.1], and Volvariella volvacea [CN 8, % identity 100 (JN086680.1]. Although out of 8 mushrooms 4 could be identified up to species level, the nucleotide sequences of the rest may be relevant to further characterization. A phylogenetic tree is constructed using Neighbor-Joining method showing interrelationship between/among the mushrooms. The determined nucleotide sequences of the mushrooms may provide additional information enriching GenBank database aiding to molecular taxonomy and facilitating its domestication and characterization for human benefits.

  4. Scambio, a novel guanine nucleotide exchange factor for Rho

    Groffen John

    2004-04-01

    Full Text Available Abstract Background Small GTPases of the Rho family are critical regulators of various cellular functions including actin cytoskeleton organization, activation of kinase cascades and mitogenesis. For this reason, a major objective has been to understand the mechanisms of Rho GTPase regulation. Here, we examine the function of a novel protein, Scambio, which shares homology with the DH-PH domains of several known guanine nucleotide exchange factors for Rho family members. Results Scambio is located on human chromosome 14q11.1, encodes a protein of around 181 kDa, and is highly expressed in both heart and skeletal muscle. In contrast to most DH-PH-domain containing proteins, it binds the activated, GTP-bound forms of Rac and Cdc42. However, it fails to associate with V14RhoA. Immunofluorescence studies indicate that Scambio and activated Rac3 colocalize in membrane ruffles at the cell periphery. In accordance with these findings, Scambio does not activate either Rac or Cdc42 but rather, stimulates guanine nucleotide exchange on RhoA and its close relative, RhoC. Conclusion Scambio associates with Rac in its activated conformation and functions as a guanine nucleotide exchange factor for Rho.

  5. Cyclic nucleotide regulation of cardiac sympatho-vagal responsiveness.

    Li, Dan; Paterson, David J

    2016-07-15

    Cyclic adenosine monophosphate (cAMP) and cyclic guanosine monophosphate (cGMP) are now recognized as important intracellular signalling molecules that modulate cardiac sympatho-vagal balance in the progression of heart disease. Recent studies have identified that a significant component of autonomic dysfunction associated with several cardiovascular pathologies resides at the end organ, and is coupled to impairment of cyclic nucleotide targeted pathways linked to abnormal intracellular calcium handling and cardiac neurotransmission. Emerging evidence also suggests that cyclic nucleotide coupled phosphodiesterases (PDEs) play a key role limiting the hydrolysis of cAMP and cGMP in disease, and as a consequence this influences the action of the nucleotide on its downstream biological target. In this review, we illustrate the action of nitric oxide-CAPON signalling and brain natriuretic peptide on cGMP and cAMP regulation of cardiac sympatho-vagal transmission in hypertension and ischaemic heart disease. Moreover, we address how PDE2A is now emerging as a major target that affects the efficacy of soluble/particulate guanylate cyclase coupling to cGMP in cardiac dysautonomia. PMID:26915722

  6. The secondary structure of large-subunit rRNA divergent domains, a marker for protist evolution

    Lenaers, G; Nielsen, Henrik; Engberg, J;

    1988-01-01

    ), Tetrahymena thermophila (ciliate), Physarum polycephalum and Dictyostelium discoideum (slime moulds), Crithidia fasciculata and Giardia lamblia (parasitic flagellates). The folding for the D3, D7a and D10 divergent domains has been refined and a consensus model for the protist 24-26S rRNA structure is...

  7. Variation in secondary structure of the 16S rRNA molecule in cyanobacteria with implications for phylogenetic analysis

    Řeháková, Klára; Johansen, J. R.; Bowen, M.B.; Martin, M.P.; Sheil, C.A.

    2014-01-01

    Roč. 14, č. 2 (2014), s. 161-178. ISSN 1802-5439 Institutional support: RVO:60077344 Keywords : 16S rRNA secondary structure * cyanobacteria * phylogeny Subject RIV: EE - Microbiology, Virology Impact factor: 1.930, year: 2014

  8. The Cfr rRNA methyltransferase confers resistance to Phenicols, Lincosamides, Oxazolidinones, Pleuromutilins, and Streptogramin A antibiotics

    Long, K. S.; Poehlsgaard, Jacob; Kehrenberg, C.; Schwarz, S.; Vester, B.

    2006-01-01

    A novel multidrug resistance phenotype mediated by the Cfr rRNA methyltransferase is observed in Staphylococcus aureus and Escherichia coli. The cfr gene has previously been identified as a phenicol and lincosamide resistance gene on plasmids isolated from Staphylococcus spp. of animal origin and...

  9. A pseudouridylation switch in rRNA is implicated in ribosome function during the life cycle of Trypanosoma brucei.

    Chikne, Vaibhav; Doniger, Tirza; Rajan, K Shanmugha; Bartok, Osnat; Eliaz, Dror; Cohen-Chalamish, Smadar; Tschudi, Christian; Unger, Ron; Hashem, Yaser; Kadener, Sebastian; Michaeli, Shulamit

    2016-01-01

    The protozoan parasite Trypanosoma brucei, which causes devastating diseases in humans and animals in sub-Saharan Africa, undergoes a complex life cycle between the mammalian host and the blood-feeding tsetse fly vector. However, little is known about how the parasite performs most molecular functions in such different environments. Here, we provide evidence for the intriguing possibility that pseudouridylation of rRNA plays an important role in the capacity of the parasite to transit between the insect midgut and the mammalian bloodstream. Briefly, we mapped pseudouridines (Ψ) on rRNA by Ψ-seq in procyclic form (PCF) and bloodstream form (BSF) trypanosomes. We detected 68 Ψs on rRNA, which are guided by H/ACA small nucleolar RNAs (snoRNA). The small RNome of both life cycle stages was determined by HiSeq and 83 H/ACAs were identified. We observed an elevation of 21 Ψs modifications in BSF as a result of increased levels of the guiding snoRNAs. Overexpression of snoRNAs guiding modification on H69 provided a slight growth advantage to PCF parasites at 30 °C. Interestingly, these modifications are predicted to significantly alter the secondary structure of the large subunit (LSU) rRNA suggesting that hypermodified positions may contribute to the adaption of ribosome function during cycling between the two hosts. PMID:27142987

  10. FiveS rRNA sequences and fatty acid profiles of colourless sulfur-oxidising bacteria

    LokaBharathi, P.A.; Ortiz-conde, B.A; Nair, S.; Chandramohan, D.; Colwell, R.R.

    these at the molecular level, 5S ribosomal ribonucleic acid (5S rRNA) sequences have been determined. Fatty acid profiles showed strain 29 to be related to Pseudomonas vesicularis with an E.D. of 5.965 and similarity index of 0.182. The nearest organism of strain 82...

  11. Comparison of gull-specific assays targeting 16S rRNA gene of Catellicoccus marimammalium and Streptococcus spp.

    Gulls have been implicated as a source of fecal contamination in inland and coastal waters. Only one gull-specific assay is currently available (i.e., gull2 qPCR assay). This assay is based on the 16S rRNA gene of Catellicocclls marimammalium and has showed a high level of host-s...

  12. Species identification and profiling of complex microbial communities using shotgun Illumina sequencing of 16S rRNA amplicon sequences.

    Swee Hoe Ong

    Full Text Available The high throughput and cost-effectiveness afforded by short-read sequencing technologies, in principle, enable researchers to perform 16S rRNA profiling of complex microbial communities at unprecedented depth and resolution. Existing Illumina sequencing protocols are, however, limited by the fraction of the 16S rRNA gene that is interrogated and therefore limit the resolution and quality of the profiling. To address this, we present the design of a novel protocol for shotgun Illumina sequencing of the bacterial 16S rRNA gene, optimized to amplify more than 90% of sequences in the Greengenes database and with the ability to distinguish nearly twice as many species-level OTUs compared to existing protocols. Using several in silico and experimental datasets, we demonstrate that despite the presence of multiple variable and conserved regions, the resulting shotgun sequences can be used to accurately quantify the constituents of complex microbial communities. The reconstruction of a significant fraction of the 16S rRNA gene also enabled high precision (>90% in species-level identification thereby opening up potential application of this approach for clinical microbial characterization.

  13. 16S rRNA gene sequencing in routine identification of anaerobic bacteria isolated from blood cultures

    Justesen, Ulrik Stenz; Skov, Marianne Nielsine; Knudsen, Elisa;

    2010-01-01

    A comparison between conventional identification and 16S rRNA gene sequencing of anaerobic bacteria isolated from blood cultures in a routine setting was performed (n = 127). With sequencing, 89% were identified to the species level, versus 52% with conventional identification. The times for...... identification were 1.5 days and 2.8 days, respectively....

  14. Highly divergent 18S rRNA gene paralogs in a Cryptosporidium genotype from eastern chipmunks (Tamias striatus)

    Stenger, B.L.S.; Clark, M.E.; Kváč, Martin; Khan, E.; Giddings, C.W.; Dyer, N.W.; Schultz, J.L.; McEvoy, J.M.

    2015-01-01

    Roč. 32, JUN 2015 (2015), s. 113-123. ISSN 1567-1348 R&D Projects: GA MŠk(CZ) LH11061 Institutional support: RVO:60077344 Keywords : Cryptosporidium * Paralogy * 18S rRNA * 18S rDNA Subject RIV: GJ - Animal Vermins ; Diseases, Veterinary Medicine Impact factor: 3.015, year: 2014

  15. Taxonomy of the genus Rhexinema (Ulvophyceae) based on phylogeny of the 18S rRNA and morphology

    Caisová, Lenka

    2009-01-01

    Roč. 48, č. 4 (2009), s. 15-15. ISSN 0031-8884. [International Phycological Congress /9./. 02.08.2009-08.08.2009, Tokyo] Institutional research plan: CEZ:AV0Z60050516 Keywords : Rhexinema * 18S rRNA * morphology Subject RIV: EF - Botanics

  16. A Fluorimetric Readout Reporting the Kinetics of Nucleotide-Induced Human Ribonucleotide Reductase Oligomerization

    Fu, Yuan; Lin, Hongyu; Wisitpitthaya, Somsinee; Blessing, William A.; Aye, Yimon

    2014-01-01

    Human ribonucleotide reductase (hRNR) is a target of nucleotide chemotherapeutics in clinical use. The nucleotide-induced oligomeric regulation of hRNR subunit α is increasingly being recognized as an innate and drug-relevant mechanism for enzyme activity modulation. In the presence of negative feedback inhibitor dATP and leukemia drug clofarabine nucleotides, hRNR-α assembles into catalytically inert hexameric complexes, whereas nucleotide effectors that govern substrate specificity typicall...

  17. Performance-enhancing effects of dietary nucleotides: do mitochondria play a role?

    Sergej M. Ostojic

    2015-09-01

    Full Text Available Nucleotides are group of natural biomonomeric molecules and novel dietary supplements with performance-enhancing attributes. However, their mechanisms of action and target biological structures are poorly understood and identified. This short paper overviews the possible role of mitochondria during the utilization of nucleotides for exercise performance. Mitochondria-related effects of nucleotides have been identified, along with obstacles for dietary nucleotides delivery to the organelle.

  18. Adjacency Preserving Bijection Maps of Hermitian Matrices over any Division Ring with an Involution

    Li Ping HUANG

    2007-01-01

    Let D be any division ring with an involution, H(D) be the space of all n × n hermitian matrices over D. Two hermitian matrices A and B are said to be adjacent if rank(A - B) =1. It is proved that if ψ is a bijective map from H(D)(n ≥ 2) to itself such that ψ preserves the adjacency,then ψ-1 also preserves the adjacency. Moreover, if H(D)≠F3(F2), then ψ preserves the arithmetic distance. Thus, an open problem posed by Wan Zhe-Xian is answered for geometry of symmetric and hermitian matrices.

  19. Nucleotide sequences specific to Brucella and methods for the detection of Brucella

    McCready, Paula M. (Tracy, CA); Radnedge, Lyndsay (San Mateo, CA); Andersen, Gary L. (Berkeley, CA); Ott, Linda L. (Livermore, CA); Slezak, Thomas R. (Livermore, CA); Kuczmarski, Thomas A. (Livermore, CA)

    2009-02-24

    Nucleotide sequences specific to Brucella that serves as a marker or signature for identification of this bacterium were identified. In addition, forward and reverse primers and hybridization probes derived from these nucleotide sequences that are used in nucleotide detection methods to detect the presence of the bacterium are disclosed.

  20. Isolation of Cronobacter spp. (formerly Enterobacter sakazakii from infant food, herbs and environmental samples and the subsequent identification and confirmation of the isolates using biochemical, chromogenic assays, PCR and 16S rRNA sequencing

    Samara Nawal A

    2009-10-01

    Full Text Available Abstract Background Cronobacter spp. (formerly Enterobacter sakazakii, are a group of Gram-negative pathogens that have been implicated as causative agents of meningitis and necrotizing enterocolitis in infants. The pathogens are linked to infant formula; however, they have also been isolated from a wide range of foods and environmental samples. Results In this study, 233 samples of food, infant formula and environment were screened for the presence of Cronobacter spp. in an attempt to find its source. Twenty nine strains were isolated from samples of spices, herbs, infant foods, and dust obtained from household vacuum cleaners. Among the 76 samples of infant food, infant formula, milk powder and non-milk dairy products tested, only one sample of infant food contained Cronobacter spp. (1.4%. The other Cronobacter spp. isolates recovered include two from household vacuum dust, and 26 from 67 samples of herbs and spices. Among the food categories analyzed, herbs and spices harbored the highest number of isolates, indicating plants as a possible reservoir of this pathogen. Initial screening with API 20E test strips yielded 42 presumptive isolates. Further characterization using 3 chromogenic media (α-MUG, DFI and EsPM and 8 sets of PCR primers detecting ITS (internal transcribed spacer sequences, 16S rRNA, zpx, gluA, gluB, OmpA genes followed by nucleotide sequencing of some PCR amplicons did not confirm the identity of all the isolates as none of the methods proved to be free of both false positives or false negatives. The final confirmation step was done by 16S rRNA sequence analysis identifying only 29 of the 42 isolates as Cronobacter spp. Conclusion Our studies showed that Cronobacter spp. are highly diverse and share many phenotypic traits with other Enterobacteriaceae members highlighting the need to use several methods to confirm the identity of this pathogen. None of the biochemical, chromogenic or PCR primers proved to be a reliable

  1. n-Nucleotide circular codes in graph theory.

    Fimmel, Elena; Michel, Christian J; Strüngmann, Lutz

    2016-03-13

    The circular code theory proposes that genes are constituted of two trinucleotide codes: the classical genetic code with 61 trinucleotides for coding the 20 amino acids (except the three stop codons {TAA,TAG,TGA}) and a circular code based on 20 trinucleotides for retrieving, maintaining and synchronizing the reading frame. It relies on two main results: the identification of a maximal C(3) self-complementary trinucleotide circular code X in genes of bacteria, eukaryotes, plasmids and viruses (Michel 2015 J. Theor. Biol. 380, 156-177. (doi:10.1016/j.jtbi.2015.04.009); Arquès & Michel 1996 J. Theor. Biol. 182, 45-58. (doi:10.1006/jtbi.1996.0142)) and the finding of X circular code motifs in tRNAs and rRNAs, in particular in the ribosome decoding centre (Michel 2012 Comput. Biol. Chem. 37, 24-37. (doi:10.1016/j.compbiolchem.2011.10.002); El Soufi & Michel 2014 Comput. Biol. Chem. 52, 9-17. (doi:10.1016/j.compbiolchem.2014.08.001)). The univerally conserved nucleotides A1492 and A1493 and the conserved nucleotide G530 are included in X circular code motifs. Recently, dinucleotide circular codes were also investigated (Michel & Pirillo 2013 ISRN Biomath. 2013, 538631. (doi:10.1155/2013/538631); Fimmel et al. 2015 J. Theor. Biol. 386, 159-165. (doi:10.1016/j.jtbi.2015.08.034)). As the genetic motifs of different lengths are ubiquitous in genes and genomes, we introduce a new approach based on graph theory to study in full generality n-nucleotide circular codes X, i.e. of length 2 (dinucleotide), 3 (trinucleotide), 4 (tetranucleotide), etc. Indeed, we prove that an n-nucleotide code X is circular if and only if the corresponding graph [Formula: see text] is acyclic. Moreover, the maximal length of a path in [Formula: see text] corresponds to the window of nucleotides in a sequence for detecting the correct reading frame. Finally, the graph theory of tournaments is applied to the study of dinucleotide circular codes. It has full equivalence between the combinatorics

  2. The nucleotide sequence and genome organization of Plasmopara halstedii virus

    Göpfert Jens C

    2011-03-01

    Full Text Available Abstract Background Only very few viruses of Oomycetes have been studied in detail. Isometric virions were found in different isolates of the oomycete Plasmopara halstedii, the downy mildew pathogen of sunflower. However, complete nucleotide sequences and data on the genome organization were lacking. Methods Viral RNA of different P. halstedii isolates was subjected to nucleotide sequencing and analysis of the viral genome. The N-terminal sequence of the viral coat protein was determined using Top-Down MALDI-TOF analysis. Results The complete nucleotide sequences of both single-stranded RNA segments (RNA1 and RNA2 were established. RNA1 consisted of 2793 nucleotides (nt exclusive its 3' poly(A tract and a single open-reading frame (ORF1 of 2745 nt. ORF1 was framed by a 5' untranslated region (5' UTR of 18 nt and a 3' untranslated region (3' UTR of 30 nt. ORF1 contained motifs of RNA-dependent RNA polymerases (RdRp and showed similarities to RdRp of Scleropthora macrospora virus A (SmV A and viruses within the Nodaviridae family. RNA2 consisted of 1526 nt exclusive its 3' poly(A tract and a second ORF (ORF2 of 1128 nt. ORF2 coded for the single viral coat protein (CP and was framed by a 5' UTR of 164 nt and a 3' UTR of 234 nt. The deduced amino acid sequence of ORF2 was verified by nano-LC-ESI-MS/MS experiments. Top-Down MALDI-TOF analysis revealed the N-terminal sequence of the CP. The N-terminal sequence represented a region within ORF2 suggesting a proteolytic processing of the CP in vivo. The CP showed similarities to CP of SmV A and viruses within the Tombusviridae family. Fragments of RNA1 (ca. 1.9 kb and RNA2 (ca. 1.4 kb were used to analyze the nucleotide sequence variation of virions in different P. halstedii isolates. Viral sequence variation was 0.3% or less regardless of their host's pathotypes, the geographical origin and the sensitivity towards the fungicide metalaxyl. Conclusions The results showed the presence of a single and new

  3. De novo Synthesis and Assembly of rRNA into Ribosomal Subunits during Cold Acclimation in Escherichia coli.

    Piersimoni, Lolita; Giangrossi, Mara; Marchi, Paolo; Brandi, Anna; Gualerzi, Claudio O; Pon, Cynthia L

    2016-04-24

    During the cold adaptation that follows a cold stress, bacterial cells undergo many physiological changes and extensive reprogramming of their gene expression pattern. Bulk gene expression is drastically reduced, while a set of cold shock genes is selectively and transiently expressed. The initial stage of cold acclimation is characterized by the establishment of a stoichiometric imbalance of the translation initiation factors (IFs)/ribosomes ratio that contributes to the preferential translation of cold shock transcripts. Whereas de novo synthesis of the IFs following cold stress has been documented, nothing was known concerning the activity of the rrn operons during the cold acclimation period. In this work, we focus on the expression of the rrn operons and the fate of rRNA after temperature downshift. We demonstrate that in Escherichia coli, rRNA synthesis does not stop during the cold acclimation phase, but continues with greater contribution of the P2 compared to the P1 promoter and all seven rrn operons are active, although their expression levels change with respect to pre-stress conditions. Eight hours after the 37°→10°C temperature downshift, the newly transcribed rRNA represents up to 20% of total rRNA and is preferentially found in the polysomes. However, with respect to the de novo synthesis of the IFs, both rRNA transcription and maturation are slowed down drastically by cold stress, thereby accounting in part for the stoichiometric imbalance of the IFs/ribosomes. Overall, our data indicate that new ribosomes, which are possibly suitable to function at low temperature, are slowly assembled during cold acclimation. PMID:26953262

  4. Efficient subtraction of insect rRNA prior to transcriptome analysis of Wolbachia-Drosophila lateral gene transfer

    Kumar Nikhil

    2012-05-01

    Full Text Available Abstract Background Numerous methods exist for enriching bacterial or mammalian mRNA prior to transcriptome experiments. Yet there persists a need for methods to enrich for mRNA in non-mammalian animal systems. For example, insects contain many important and interesting obligate intracellular bacteria, including endosymbionts and vector-borne pathogens. Such obligate intracellular bacteria are difficult to study by traditional methods. Therefore, genomics has greatly increased our understanding of these bacteria. Efficient subtraction methods are needed for removing both bacteria and insect rRNA in these systems to enable transcriptome-based studies. Findings A method is described that efficiently removes >95% of insect rRNA from total RNA samples, as determined by microfluidics and transcriptome sequencing. This subtraction yielded a 6.2-fold increase in mRNA abundance. Such a host rRNA-depletion strategy, in combination with bacterial rRNA depletion, is necessary to analyze transcription of obligate intracellular bacteria. Here, transcripts were identified that arise from a lateral gene transfer of an entire Wolbachia bacterial genome into a Drosophila ananassae chromosome. In this case, an rRNA depletion strategy is preferred over polyA-based enrichment since transcripts arising from bacteria-to-animal lateral gene transfer may not be poly-adenylated. Conclusions This enrichment method yields a significant increase in mRNA abundance when poly-A selection is not suitable. It can be used in combination with bacterial rRNA subtraction to enable experiments to simultaneously measure bacteria and insect mRNA in vector and endosymbiont biology experiments.

  5. A Method for Quantification of Nucleotides and Nucleotide Analogues in Thymidine Kinase Assays Utilizing Lanthanum Phosphate Co-Precipitation

    Gammon, ST; Bernstein, M; Schuster, DP; Piwnica-Worms, D

    2007-01-01

    Current methodologies for quantifying radiolabeled nucleoside monophosphates and nucleoside analogues result in high retention of unphosphorylated guanosine nucleosides in the case of lanthanum chloride precipitation or inconsistent retention of nucleotides in the case of DEAE cellulose filter papers. This study describes an innovative method for quantifying TK activity that is compatible with both purine and pyrimidine nucleoside analogues by utilizing lanthanum phosphate co-precipitation at...

  6. Diversity and distribution of eukaryotic microbes in and around a brine pool adjacent to the Thuwal cold seeps in the Red Sea

    Wang, Yong

    2014-02-04

    A hypoxic/suboxic brine pool at a depth of about 850 m was discovered near the Thuwal cold seeps in the Red Sea. Filled with high concentrations of hydrogen sulfide and ammonia, such a brine pool might limit the spread of eukaryotic organisms. Here, we compared the communities of the eukaryotic microbes in a microbial mat, sediments and water samples distributed in 7 sites within and adjacent to the brine pool. Taxonomic classification of the pyrosequenced 18S rRNA amplicon reads showed that fungi highly similar to the species identified along the Arabic coast were almost ubiquitous in the water and sediment samples, supporting their wide distribution in various environments. The microbial mat displayed the highest species diversity and contained grazers and a considerable percentage of unclassified species. Phylogeny-based methods revealed novel lineages representing a majority of the reads from the interface between the sea water and brine pool. Phylogenetic relationships with more reference sequences suggest that the lineages were affiliated with novel Alveolata and Euglenozoa inhabiting the interface where chemosynthetic prokaryotes are highly proliferative due to the strong chemocline and halocline. The brine sediments harbored abundant species highly similar to invertebrate gregarine parasites identified in different oxygen-depleted sediments. Therefore, the present findings support the uniqueness of some microbial eukaryotic groups in this cold seep brine system. 2014 Wang, Zhang, Cao, Shek, Tian, Wong, Batang, Al-suwailem and Qian.

  7. Development of a Multiplex PCR Method for Detection of the Genes Encoding 16S rRNA, Coagulase, Methicillin Resistance and Enterotoxins in Staphylococcus aureus

    A multiplex PCR method was developed for simultaneous detection of the genes encoding methicillin resistance (mecA), staphylococcal enterotoxins A, B and C (sea, seb and sec), coagulase (coa) and 16S rRNA. The primers for amplification of the 16S rRNA gene were specific for Staphylococcus spp., and ...

  8. Comparison of COBAS AMPLICOR Neisseria gonorrhoeae PCR, including confirmation with N. gonorrhoeae-specific 16S rRNA PCR, with traditional culture

    Luijt, D.S.; Bos, P.A.; van Zwet, A.A.; Voorst-Vader, P.C.; Schirm, J.

    2005-01-01

    : A total of 3,023 clinical specimens were tested for Neisseria gonorrhoeae by using COBAS AMPLICOR (CA) PCR and confirmation of positives by N. gonorrhoeae-specific 16S rRNA PCR. The sensitivity of CA plus 16S rRNA PCR was 98.8%, compared to 68.2% for culture. Confirmation of CA positives increased

  9. Comparison of COBAS AMPLICOR Neissefia gonorrhoeae PCR, including confirmation with N-gonorrhoeae-specific 16S rRNA PCR, with traditional culture

    Luijt, DS; Bos, PAJ; van Zwet, AA; Vader, PCV; Schirm, J

    2005-01-01

    A total of 3,023 clinical specimens were tested for Neisseria gonorrhoeae by using COBAS AMPLICOR (CA) PCR and confirmation of positives by N. gonorrhoeae-specific 16S rRNA PCR. The sensitivity of CA plus 16S rRNA PCR was 98.8%, compared to 68.2% for culture. Confirmation of CA positives increased t

  10. Absolute Quantification of Enterococcal 23S rRNA Gene Using Digital PCR.

    Wang, Dan; Yamahara, Kevan M; Cao, Yiping; Boehm, Alexandria B

    2016-04-01

    We evaluated the ability of chip-based digital PCR (dPCR) to quantify enterococci, the fecal indicator recommended by the United States Environmental Protection Agency (USEPA) for water-quality monitoring. dPCR uses Poisson statistics to estimate the number of DNA fragments in a sample with a specific sequence. Underestimation may occur when a gene is redundantly encoded in the genome and multiple copies of that gene are on one DNA fragment. When genomic DNA (gDNA) was extracted using two commercial DNA extraction kits, we confirmed that dPCR could discern individual copies of the redundant 23s rRNA gene in the enterococcal genome. dPCR quantification was accurate when compared to the nominal concentration inferred from fluorometer measurements (linear regression slope = 0.98, intercept = 0.03, R(2) = 0.99, and p value humic acid caused a similar level of inhibition in both dPCR and qPCR, but calcium inhibited dPCR to a lesser degree than qPCR. Inhibition of dPCR was partially relieved when the number of thermal cycles was increased. Based on these results, we conclude that dPCR is a viable option for enumerating enterococci in ambient water. PMID:26903207

  11. Molecular identification of adulteration in mutton based on mitochondrial 16S rRNA gene.

    Xu, Jia; Zhao, Wei; Zhu, Mengru; Wen, Yuanju; Xie, Tao; He, Xiaoqian; Zhang, Yongfeng; Cao, Suizhong; Niu, Lili; Zhang, Hongping; Zhong, Tao

    2016-01-01

    The aim of this study is to set up a protocol for identification of the adulteration in mutton based on mitochondrial 16S rRNA gene. The multiplex polymerase chain reaction (multi-PCR) assay was carried out to trace the impure DNA in mutton. A universal primer pair yielded an approximate 610 bp fragment in mutton, pork, duck, chicken, horse and cat meats. The amplicons of multi-PCR assay represented the species-specific products, which could be discriminated by the size ranging from 106 bp to 532 bp. Subsequently, the authentication of each fragment was also confirmed by sequencing. Random analyses of adulterants with various meats yielded the identical results to their components, showing the suitability of the multi-PCR assay for tracing of adulterant meats with high-accuracy and precision. This assay was sensitive to detect the species-specific DNA in different proportional mixtures of mutton and duck/pork (9.1%-90.9%). In conclusion, this multi-PCR assay successfully discriminated the double-, triple-, quadruple-, and quintuple-mixtures containing variant counterparts. This method will be particularly useful in the detection of mutton adulteration in processed foods further. PMID:24739005

  12. Correspondence Associated with the Agreement for Drainage on Lands Adjacent to Tewaukon National Widlife

    US Fish and Wildlife Service, Department of the Interior — This document contains correspondence associated with the cooperative agreement for drainage on lands adjacent to the Tewaukon National Wildlife Refuge. This...

  13. Cooperative Agreement for Road Improvement Adjacent to Tewaukon National Wildlife Refuge

    US Fish and Wildlife Service, Department of the Interior — This cooperative agreement concerns the construction of a road bridge and approaches adjacent to the Tewaukon National Wildlife Refuge. This agreement is between...

  14. Cooperative Agreement Concerning Drainage on Lands Adjacent to Tewaukon National Wildlife Refuge

    US Fish and Wildlife Service, Department of the Interior — This cooperative agreement concerns a matter of drainage on lands adjacent to Tewaukon National Wildlife Refuge. This agreement is between Mr. Harold Lee landowner,...

  15. Oceanographic Observations made adjacent to the Chandeleur Islands, Louisiana, July-November, 2010.

    U.S. Geological Survey, Department of the Interior — A program to measure waves, water levels, and currents near the Chandeleur Islands, Louisiana and adjacent berm construction site was conducted by the U.S....

  16. Correspondence Associated with the Agreement for Road Improvement Adjacent to Tewaukon National Widlife Refuge

    US Fish and Wildlife Service, Department of the Interior — This document contains correspondence associated with the cooperative agreement for the construction of a road bridge and approaches adjacent to the Tewaukon...

  17. Smarandachely Adjacent-vertex-distinguishing Proper Edge Coloring of K4∨Kn

    CHEN Xiang-en; YAO Bing

    2014-01-01

    Let f be a proper edge coloring of G using k colors. For each x ∈ V (G), the set of the colors appearing on the edges incident with x is denoted by Sf (x) or simply S(x) if no confusion arise. If S(u) S(v) and S(v) S(u) for any two adjacent vertices u and v, then f is called a Smarandachely adjacent vertex distinguishing proper edge col-oring using k colors, or k-SA-edge coloring. The minimum number k for which G has a Smarandachely adjacent-vertex-distinguishing proper edge coloring using k colors is called the Smarandachely adjacent-vertex-distinguishing proper edge chromatic number, or SA-edge chromatic number for short, and denoted byχsa(G). In this paper, we have discussed the SA-edge chromatic number of K4∨Kn.

  18. Oil samples and geochemical analyses of Afghanistan and adjacent areas (oilafg.shp)

    U.S. Geological Survey, Department of the Interior — This shapefile contains points that describe the location of oil samples collected in Afghanistan and adjacent areas, and the results of organic geochemical analysis.

  19. Study on Ground Motion Attenuation Relation in Shanghai and Its Adjacent Region

    Shi Shuzhong; Shen Jianwen

    2004-01-01

    Based on intensity data in Shanghai and its adjacent region, the intensity attenuation relation is determined. Selecting the western United States as a reference area where there are rich strong ground motion records and intensity data, and by determining ground motion attenuation relation in an area lacking in strong ground motion data, we obtain the ground motion attenuation relation in Shanghai and its adjacent region.

  20. fMRI Evidence of Acupoints Specificity in Two Adjacent Acupoints

    Hua Liu; Jian-Yang Xu; Lin Li; Bao-Ci Shan; Bin-Bin Nie; Jing-quan Xue

    2013-01-01

    Objectives. Acupoint specificity is the foundation of acupuncture treatment. The aim of this study is to investigate whether the acupoint specificity exists in two adjacent acupoints. Design and Setting. Two adjacent real acupoints, LR3 (Taichong) and ST44 (Neiting), and a nearby nonacupoint were selected. Thirty-three health volunteers were divided into three groups in random order, and each group only received acupuncture at one of the three points. While they received acupuncture, fMRI sca...

  1. Risk Factors for the Development of Adjacent Segment Disease Following Anterior Cervical Arthrodesis

    Ezgi Akar; Mehmet Ufuk Akmil; Merih İş

    2015-01-01

    Aim: The aim of this study was to clinically and radiologically evaluate the efficacy of anterior cervical discectomy and fusion (ACDF) in the treatment of adjacent level degeneration. Methods: We retrospectively evaluated 89 patients (55 females, 34 males) who underwent ACDF. Adjacent segment degeneration findings were evaluated by investigating new osteophyte formation, growth of existing osteophytes, ossification of the anterior longitudinal ligament, presence of inter...

  2. Anterior Cervical Corpectomy and Fusion Accelerates Degenerative Disease at Adjacent Vertebral Segments

    Pickett, Gwynedd E.; Duggal, Neil; Theodore, Nicholas; Sonntag, Volker K.H.

    2008-01-01

    Background Anterior cervical corpectomy provides the most direct and thorough surgical approach for anterior decompression when spinal cord compression is found directly behind the vertebral body. However, anterior cervical fusion has been shown to be associated with the development of new degenerative changes at levels immediately adjacent to the fused segments. Th e incidence of adjacent segment disease (ASD) following anterior cervical corpectomy has not been widely reported. We set out to...

  3. Carbon sources supporting benthic mineralization in mangrove and adjacent seagrass sediments (Gazi Bay, Kenya)

    BOUILLON, S; Moens, T.; F. Dehairs

    2004-01-01

    The origin of carbon substrates used by in situ sedimentary bacterial communities was investigated in an intertidal mangrove ecosystem and in adjacent seagrass beds in Gazi bay (Kenya) by δ13C analysis of bacteria-specific PLFA (phospholipid fatty acids) and bulk organic carbon. Export of mangrove-derived organic matter to the adjacent seagrass-covered bay was evident from sedimentary total organic carbon (TOC) and δ13CTOC data. PLFA δ13C data indicate tha...

  4. Evaluation of caries in deciduous second molar and adjacent permanent molar in mixed dentition

    Srinivasan, Daya; Louis, C. Joe

    2015-01-01

    Aim: This study was done to evaluate association of caries in deciduous second molar and adjacent permanent first molar, tooth surface more involved in permanent first molar and to assess the parental awareness regarding the eruption of permanent first molar. Subjects and Methods: Three hundred and ten children (160 boys, 150 girls) of mixed dentition aged between 6 and 11 years were included. Presence or absence of paired association of caries in primary second molar and adjacent permanent f...

  5. Maxillary second molar impaction in the adjacent ectopic third molar: Report of five rare cases

    Bernardo Q Souki; Cheib, Paula L.; de Brito, Gabriela M.; Pinto, Larissa S. M. C.

    2015-01-01

    Maxillary second molar impaction in the adjacent ectopic third molar is a rare condition that practitioners might face in the field of pediatric dentistry and orthodontics. The early diagnosis and extraction of the adjacent ectopic third molar have been advocated, and prior research has reported a high rate of spontaneous eruption following third molar removal. However, some challenges in the daily practice are that the early diagnosis of this type of tooth impaction is difficult with convent...

  6. Oxazolidinone resistance mutations in 23S rRNA of Escherichia coli reveal the central region of domain V as the primary site of drug action

    Xiong, L; Kloss, P; Douthwaite, S; Andersen, N M; Swaney, S; Shinabarger, D L; Mankin, A S

    2000-01-01

    resistance mutations were clustered in the vicinity of the central loop of domain V of 23S rRNA, suggesting that this rRNA region plays a major role in the interaction of the drug with the ribosome. Although the central loop of domain V is an essential integral component of the ribosomal peptidyl transferase......, we selected Escherichia coli oxazolidinone-resistant mutants, which contained a randomly mutagenized plasmid-borne rRNA operon. The same mutation, G2032 to A, was identified in the 23S rRNA genes of several independent resistant isolates. Engineering of this mutation by site-directed mutagenesis in...... the wild-type rRNA operon produced an oxazolidinone resistance phenotype, establishing that the G2032A substitution was the determinant of resistance. Engineered U and C substitutions at G2032, as well as a G2447-to-U mutation, also conferred resistance to oxazolidinone. All the characterized...

  7. Risk Factors for the Development of Adjacent Segment Disease Following Anterior Cervical Arthrodesis

    Ezgi Akar

    2015-06-01

    Full Text Available Aim: The aim of this study was to clinically and radiologically evaluate the efficacy of anterior cervical discectomy and fusion (ACDF in the treatment of adjacent level degeneration. Methods: We retrospectively evaluated 89 patients (55 females, 34 males who underwent ACDF. Adjacent segment degeneration findings were evaluated by investigating new osteophyte formation, growth of existing osteophytes, ossification of the anterior longitudinal ligament, presence of intervertebral disc space narrowing, sagittal alignment and range of motion (ROM using serial radiographs and magnetic resonance imaging. Results: The mean age of the 89 patients was 41.3 (24-76 years. The mean follow-up duration was 34.3 (12-64 months. Radiographic evidence of adjacent segment degeneration was observed in 12 patients (13.4%. Nine (75% patients had new complaints. Of the patients who had degenerative changes, 7 were (58% were male, 5 (42% were female; the mean age was 46 (30- 62 years. It was observed that the level of fusion and the number of fusion did not increase the adjacent segment degeneration. All of 12 patients were observed to have a non lordotic cervical spine and increased ROM. Conclusion: Development of degeneration at the level adjacent to region anterior cervical discectomy and fusion performed is higher compared to non-adjacent levels. The level of fusion and the number of fusion levels have no effect on the development of degeneration. (The Medical Bulletin of Haseki 2015; 53:120-3

  8. An updated 18S rRNA phylogeny of tunicates based on mixture and secondary structure models

    Shenkar Noa

    2009-08-01

    Full Text Available Abstract Background Tunicates have been recently revealed to be the closest living relatives of vertebrates. Yet, with more than 2500 described species, details of their evolutionary history are still obscure. From a molecular point of view, tunicate phylogenetic relationships have been mostly studied based on analyses of 18S rRNA sequences, which indicate several major clades at odds with the traditional class-level arrangements. Nonetheless, substantial uncertainty remains about the phylogenetic relationships and taxonomic status of key groups such as the Aplousobranchia, Appendicularia, and Thaliacea. Results Thirty new complete 18S rRNA sequences were acquired from previously unsampled tunicate species, with special focus on groups presenting high evolutionary rate. The updated 18S rRNA dataset has been aligned with respect to the constraint on homology imposed by the rRNA secondary structure. A probabilistic framework of phylogenetic reconstruction was adopted to accommodate the particular evolutionary dynamics of this ribosomal marker. Detailed Bayesian analyses were conducted under the non-parametric CAT mixture model accounting for site-specific heterogeneity of the evolutionary process, and under RNA-specific doublet models accommodating the occurrence of compensatory substitutions in stem regions. Our results support the division of tunicates into three major clades: 1 Phlebobranchia + Thaliacea + Aplousobranchia, 2 Appendicularia, and 3 Stolidobranchia, but the position of Appendicularia could not be firmly resolved. Our study additionally reveals that most Aplousobranchia evolve at extremely high rates involving changes in secondary structure of their 18S rRNA, with the exception of the family Clavelinidae, which appears to be slowly evolving. This extreme rate heterogeneity precluded resolving with certainty the exact phylogenetic placement of Aplousobranchia. Finally, the best fitting secondary-structure and CAT-mixture models

  9. Binding of nucleotides to nucleoside diphosphate kinase: a calorimetric study.

    Cervoni, L; Lascu, I; Xu, Y; Gonin, P; Morr, M; Merouani, M; Janin, J; Giartosio, A

    2001-04-17

    The source of affinity for substrates of human nucleoside diphosphate (NDP) kinases is particularly important in that its knowledge could be used to design more effective antiviral nucleoside drugs (e.g., AZT). We carried out a microcalorimetric study of the binding of enzymes from two organisms to various nucleotides. Isothermal titration calorimetry has been used to characterize the binding in terms of Delta G degrees, Delta H degrees and Delta S degrees. Thermodynamic parameters of the interaction of ADP with the hexameric NDP kinase from Dictyostelium discoideum and with the tetrameric enzyme from Myxococcus xanthus, at 20 degrees C, were similar and, in both cases, binding was enthalpy-driven. The interactions of ADP, 2'deoxyADP, GDP, and IDP with the eukaryotic enzyme differed in enthalpic and entropic terms, whereas the Delta G degrees values obtained were similar due to enthalpy--entropy compensation. The binding of the enzyme to nonphysiological nucleotides, such as AMP--PNP, 3'deoxyADP, and 3'-deoxy-3'-amino-ADP, appears to differ in several respects. Crystallography of the protein bound to 3'-deoxy-3'-amino-ADP showed that the drug was in a distorted position, and was unable to interact correctly with active site side chains. The interaction of pyrimidine nucleoside diphosphates with the hexameric enzyme is characterized by a lower affinity than that with purine nucleotides. Titration showed the stoichiometry of the interaction to be abnormal, with 9--12 binding sites/hexamer. The presence of supplementary binding sites might have physiological implications. PMID:11294625

  10. Study of sperm cell phosphorylating systems using nucleotide photoaffinity probes

    The major thrust of the research presented in this thesis was to identify specific nucleotide binding proteins and phosphoproteins of rat caput and cauda sperm. Also, the differences in these proteins between caput and cauda sperm were investigated as well as determination of the membrane sidedness of the proteins and their location in either the head or tail/mid-piece region. In addition, the effects of small molecular weight modifers such as cGMP, cAMP and Ca2+ on the detection of binding proteins and phosphorylated proteins was studied. The technique used to identify and locate nucleotide binding proteins was photoaffinity labeling using the proven 8-azidopurine nucleotide analogs of cAMP, ATP and GTP in radioactive form. The first study presented involved the use of [32P]8-N 3cAMP which showed that both caput and cauda sperm contained both type I and type II regulatory subunits (R/sub I/ and R/sub II/, respectively) of the cAMP dependent kinases and that the great majority of the regulatory subunits were located in the tail/mid-piece section and not in the sperm head. The second phase of this study involved the use of [γ32P]8-azidoadensosine triphosphate ([γ32P]8-N3ATP) and (γ32P)8-azidoguanosine triphosphate ([γ32P]8-N3GTP) to photolable specific ATP and GTP binding proteins and to phosphorylate specific phosphoproteins. Again, this was done on caput versus cauda sperm and the location of the majority of the photolabeled or phosphorylated proteins was shown to be in the tail/mid-piece fraction. In addition, considerable differences were found in both the phosphorylated and photolabeled proteins of caput versus cauda sperm

  11. Comparative nucleotide diversity across North American and European populus species.

    Ismail, Mohamed; Soolanayakanahally, Raju Y; Ingvarsson, Pär K; Guy, Robert D; Jansson, Stefan; Silim, Salim N; El-Kassaby, Yousry A

    2012-06-01

    Nucleotide polymorphisms in two North American balsam poplars (Populus trichocarpa Torr. & Gray and P. balsamifera L.; section Tacamahaca), and one Eurasian aspen (P. tremula L.; section Populus) were compared using nine loci involved in defense, stress response, photoperiodism, freezing tolerance, and housekeeping. Nucleotide diversity varied among species and was highest for P. tremula (θ(w) = 0.005, π(T) = 0.007) as compared to P. balsamifera (θ(w) = 0.004, π(T) = 0.005) or P. trichocarpa (θ(w) = 0.002, π(T) = 0.003). Across species, the defense and the stress response loci accounted for the majority of the observed level of nucleotide diversity. In general, the studied loci did not deviate from neutral expectation either at the individual locus (non-significant normalized Fay and Wu's H) or at the multi-locus level (non-significant HKA test). Using molecular clock analysis, section Tacamahaca probably shared a common ancestor with section Populus approximately 4.5 million year ago. Divergence between the two closely related balsam poplars was about 0.8 million years ago, a pattern consistent with an isolation-with-migration (IM) model. As expected, P. tremula showed a five-fold higher substitution rate (2 × 10(-8) substitution/site/year) compared to the North American species (0.4 × 10(-8) substitution/site/year), probably reflecting its complex demographic history. Linkage disequilibrium (LD) varied among species with a more rapid decay in the North American species (balsam poplar species likely reflects the recent time of their divergence. PMID:22562720

  12. Bioinformatics comparison of sulfate-reducing metabolism nucleotide sequences

    Tremberger, G.; Dehipawala, Sunil; Nguyen, A.; Cheung, E.; Sullivan, R.; Holden, T.; Lieberman, D.; Cheung, T.

    2015-09-01

    The sulfate-reducing bacteria can be traced back to 3.5 billion years ago. The thermodynamics details of the sulfur cycle have been well documented. A recent sulfate-reducing bacteria report (Robator, Jungbluth, et al , 2015 Jan, Front. Microbiol) with Genbank nucleotide data has been analyzed in terms of the sulfite reductase (dsrAB) via fractal dimension and entropy values. Comparison to oil field sulfate-reducing sequences was included. The AUCG translational mass fractal dimension versus ATCG transcriptional mass fractal dimension for the low temperature dsrB and dsrA sequences reported in Reference Thirteen shows correlation R-sq ~ 0.79 , with a probably of about 3% in simulation. A recent report of using Cystathionine gamma-lyase sequence to produce CdS quantum dot in a biological method, where the sulfur is reduced just like in the H2S production process, was included for comparison. The AUCG mass fractal dimension versus ATCG mass fractal dimension for the Cystathionine gamma-lyase sequences was found to have R-sq of 0.72, similar to the low temperature dissimilatory sulfite reductase dsr group with 3% probability, in contrary to the oil field group having R-sq ~ 0.94, a high probable outcome in the simulation. The other two simulation histograms, namely, fractal dimension versus entropy R-sq outcome values, and di-nucleotide entropy versus mono-nucleotide entropy R-sq outcome values are also discussed in the data analysis focusing on low probability outcomes.

  13. Nucleotide sequence of the triosephosphate isomerase gene from Macaca mulatta

    Old, S.E.; Mohrenweiser, H.W. (Univ. of Michigan, Ann Arbor (USA))

    1988-09-26

    The triosephosphate isomerase gene from a rhesus monkey, Macaca mulatta, charon 34 library was sequenced. The human and chimpanzee enzymes differ from the rhesus enzyme at ASN 20 and GLU 198. The nucleotide sequence identity between rhesus and human is 97% in the coding region and >94% in the flanking regions. Comparison of the rhesus and chimp genes, including the intron and flanking sequences, does not suggest a mechanism for generating the two TPI peptides of proliferating cells from hominoids and a single peptide from the rhesus gene.

  14. Usefulness of single nucleotide polymorphism data for estimating population parameters.

    Kuhner, M K; Beerli, P; Yamato, J; Felsenstein, J

    2000-01-01

    Single nucleotide polymorphism (SNP) data can be used for parameter estimation via maximum likelihood methods as long as the way in which the SNPs were determined is known, so that an appropriate likelihood formula can be constructed. We present such likelihoods for several sampling methods. As a test of these approaches, we consider use of SNPs to estimate the parameter Theta = 4N(e)micro (the scaled product of effective population size and per-site mutation rate), which is related to the br...

  15. Metal-based chemosensors for amino acids, peptides, and nucleotides

    Buryak, Andrey

    2007-01-01

    An organometallic 4d transition metal complex [Cp*RhCl2]2, together with commercially available dyes, was used to construct indicator displacement assays (IDAs) for the detection of peptides, amino acids, and nucleotides. The combination of the Cp*Rh complex with the dye azophloxine was found to form a chemosensing ensemble for the sequence-selective detection of histidine- and methionine-containing peptides in water at neutral pH. A strong interaction of the rhodium complex with peptides bea...

  16. Metal-based chemosensors for amino acids, peptides, and nucleotides

    Buryak, Andrey; Severin, Kay

    2008-01-01

    An organometallic 4d transition metal complex [Cp*RhCl2]2, together with commercially available dyes, was used to construct indicator displacement assays (IDAs) for the detection of peptides, amino acids, and nucleotides. The combination of the Cp*Rh complex with the dye azophloxine was found to form a chemosensing ensemble for the sequence-selective detection of histidine- and methionine-containing peptides in water at neutral pH. A strong interaction of the rhodium complex with peptides bea...

  17. Purine nucleotide synthesis in cultured rat embryos undergoing organogenesis

    The authors show that de n ovo synthesis is the sole source of the purine nucleotides required for in vitro rat embryonic growth during organogenesis. The presence of high levels of activity of purine catabolic enzymes in the homologous serum essential for culture prohibits the salvage of purine. While the 3-carbon atom of serine is the major source of one carbon units for purine ring synthesis there is a significant contribution from the 2-ring carbon atom of tryptophan. The paper describes in detail the incorporation of (1-14C)glycine into the acid soluble phase and other processes connected with de novo purine synthesis

  18. Nucleotide sequence of a spinach chloroplast valine tRNA.

    Sprouse, H M; Kashdan, M; Otis, L; Dudock, B

    1981-01-01

    The nucleotide sequence of a spinach chloroplast valine tRNA (sp. chl. tRNA Val) has been determined. This tRNA shows essentially equal homology to prokaryotic valine tRNAs (58-65% homology) and to the mitochondrial valine tRNAs of lower eukaryotes (yeast and N. crassa, 61-62% homology). Sp. chl. tRNA Val shows distinctly lower homology to mouse mitochondrial valine tRNA (53% homology) and to eukaryotic cytoplasmic valine tRNAs (47-53% homology). Sp. chl. tRNA Val, like all other chloroplast ...

  19. 16S rRNA gene survey of microbial communities in Winogradsky columns.

    Ethan A Rundell

    Full Text Available A Winogradsky column is a clear glass or plastic column filled with enriched sediment. Over time, microbial communities in the sediment grow in a stratified ecosystem with an oxic top layer and anoxic sub-surface layers. Winogradsky columns have been used extensively to demonstrate microbial nutrient cycling and metabolic diversity in undergraduate microbiology labs. In this study, we used high-throughput 16s rRNA gene sequencing to investigate the microbial diversity of Winogradsky columns. Specifically, we tested the impact of sediment source, supplemental cellulose source, and depth within the column, on microbial community structure. We found that the Winogradsky columns were highly diverse communities but are dominated by three phyla: Proteobacteria, Bacteroidetes, and Firmicutes. The community is structured by a founding population dependent on the source of sediment used to prepare the columns and is differentiated by depth within the column. Numerous biomarkers were identified distinguishing sample depth, including Cyanobacteria, Alphaproteobacteria, and Betaproteobacteria as biomarkers of the soil-water interface, and Clostridia as a biomarker of the deepest depth. Supplemental cellulose source impacted community structure but less strongly than depth and sediment source. In columns dominated by Firmicutes, the family Peptococcaceae was the most abundant sulfate reducer, while in columns abundant in Proteobacteria, several Deltaproteobacteria families, including Desulfobacteraceae, were found, showing that different taxonomic groups carry out sulfur cycling in different columns. This study brings this historical method for enrichment culture of chemolithotrophs and other soil bacteria into the modern era of microbiology and demonstrates the potential of the Winogradsky column as a model system for investigating the effect of environmental variables on soil microbial communities.

  20. In situ hybridization of phytoplankton using fluorescently labeled rRNA probes.

    Groben, René; Medlin, Linda

    2005-01-01

    Phytoplankton are one of the major components of ecosystem processes and play an important role in many biogeochemical cycles in the marine and freshwater environment. Despite their importance, many microalgae are poorly described and little is known of broad spatial and temporal scale trends in their abundance and distribution. Reasons for this are that microalgae are often small, lack distinct morphological features, and are unculturable, which make analyses difficult. It is now possible by using molecular biological techniques to advance our knowledge of aquatic biodiversity and to understand how biodiversity supports ecosystem structure, dynamics, and resilience. We present in this chapter a brief review of the progress that has been made in analyzing microalgae from populations to the species level. The described methods range from DNA fingerprinting techniques, such as random amplified polymorphic DNA (RAPD), amplified fragment length polymorphisms (AFLPs), and simple sequence repeats (SSRs), to microsatellites, which are used in population studies, to sequence analysis, which help to reconstruct the evolutionary history of organisms and to examine relationships at various taxonomic levels. Special emphasis is given to the application of molecular probes for the identification and characterization of microalgal taxa. The fast and secure identification of phytoplankton, especially of toxic species, is important from an ecological and economical point of view and whole-cell hybridization with specific fluorochrome-labeled probes followed by fluorescence microscopy or flow cytometry offers a fast method for this purpose. In this context, we present a detailed protocol for fluorescence in situ hybridization (FISH) of ribosomal RNA (rRNA) probes that can be applied to many algal cell types and discuss practical considerations of its use. PMID:15865974

  1. Testing wetland axioms at a watershed scale: Case studies of the aggregate hydrologic effects of non-adjacent wetlands

    Wetlands not adjacent to streams (i.e. “non-adjacent wetlands”) are hypothesized to affect downgradient hydrology in a number of ways. Non-adjacent wetlands may, for example, attenuate peak flows, serve as focal points for groundwater recharge, and decrease streamflow...

  2. Phylogenetic relationships between Sarcocystis species from reindeer and other Sarcocystidae deduced from ssu rRNA gene sequences

    Dahlgren, S.S.; Oliveira, Rodrigo Gouveia; Gjerde, B.

    2008-01-01

    Six Sarcocystis species from reindeer (S. grueneri, S. rangi, S. tarandivulpes, S. hardangeri, S. rangiferi and S. tarandi) have previously been genetically characterised. The aim of this study was to identify possible definitive hosts for S. hardangeri, S. rangiferi and S. tarandi by including the...... six species in phylogenetic analyses of the Sarcocystidae, and also to investigate the phylogenetic relationships between the species from reindeer and those from other hosts. The study also aimed at revealing whether the inclusion of six Sarcocystis species from the same intermediate host would have...... any effect on previously inferred phylogenetic relationships within the Sarcocystidae. The complete small subunit (ssu) rRNA gene sequences of all six Sarcocystis species from reindeer were used in the phylogenetic analyses along with ssu rRNA gene sequences of 85 other members of the Coccidea. Trees...

  3. Distribution of DNA and localization of rRNA transcription in G2 phase nucleolus of Physarum polycephalum

    2001-01-01

    Using electron microscopy, NAMA-Ur DNA selective staining and BrUTP incorporation, the nucleo lus ultrastructure, the distribution of DNA and the rRNA transcription sites in nucleolus of G2 phase Physarum poly cephalum were studied. The nucleolus was found to be different in structure from that of other plant cells. Fibrillar cen tern (FCs) were present in a large amount all over the nucleolus. DNA was distributed both in dense fibrillar components (DFC) and in FC. The DNA in the nucleolus was less condensed than that of the chromosome territory. These changes suggested that the transcription was active within the nucleolus. BrUTP incorporation localized the rRNA transcription in DFC and at the interface of FC and DFC, suggesting that the DNA in FC is in a storage form and only the rDNA in DFC is transcribed.

  4. Phylogeny of the cuttlefishes (Mollusca:Cephalopoda) based on mitochondrial COI and 16S rRNA gene sequence data

    LIN Xiangzhi; ZHENG Xiaodong; XIAO Shu; WANG Rucai

    2004-01-01

    To clarify cuttlefish phylogeny, mitochondrial cytochrome c oxidase subunit I (COI) gene and partial 16S rRNA gene are sequenced for 13 cephalopod species. Phylogenetic trees are constructed, with the neighbor-joining method.Coleoids are divided into two main lineages, Decabrachia and Octobrachia. The monophyly of the order Sepioidea,which includes the families Sepiidae, Sepiolidae and Idiosepiidae, is not supported. From the two families of Sepioidea examined, the Sepiolidae are polyphyletic and are excluded from the order. On the basis of 16S rRNA and amino acid of COI gene sequences data, the two genera (Sepiella and Sepia) from the Sepiidae can be distinguished, but do not have a visible boundary using COI gene sequences. The reason is explained. This suggests that the 16S rDNA of cephalopods is a precious tool to analyze taxonomic relationships at the genus level, and COI gene is fitter at a higher taxonomic level (i.e., family).

  5. Validation of a PCR Assay for Chlamydophila abortus rRNA gene detection in a murine model

    Francielle Gibson da Silva-Zacarias

    2009-11-01

    Full Text Available Chlamydophila abortus (C. abortus is associated with reproductive problems in cattle, sheep, and goats. Diagnosis of C. abortus using embryonated chicken eggs or immortalized cell lines has a very low sensitivity. Polymerase chain reaction (PCR assays have been used to detect C. abortus infection in clinical specimens and organ fragments, such as placenta, fetal organs, vaginal secretions, and semen. The aim of this study was to develop a PCR assay for the amplification of an 856-bp fragment of the rRNA gene of the Chlamydiaceae family. The PCR assay was evaluated using organs from 15 mice experimentally infected with the S26/3 reference strain of C. abortus. The results of the rRNA PCR were compared to the results from another PCR system (Omp2 PCR that has been previously described for the Omp2 (outer major protein gene from the Chlamydiaceae family. From the 15 C. abortus-inoculated mice, 13 (K=0.84, standard error =0.20 tested positive using the rRNA PCR assay and 9 (K=0.55, standard error=0.18 tested positive using the Omp2 PCR assay. The detection limit, measured using inclusion-forming units (IFU, for C. abortus with the rRNA PCR (1.05 IFU was 100-fold lower than for the Omp2 PCR (105 IFU. The higher sensitivity of the rRNA PCR, as compared to the previously described PCR assay, and the specificity of the assay, demonstrated using different pathogenic microorganisms of the bovine reproductive system, suggest that the new PCR assay developed in this study can be used for the molecular diagnosis of C. abortus in abortion and other reproductive failures in bovines, caprines, and ovines.Chlamydophila abortus (C. abortus é frequentemente associada a distúrbios reprodutivos em bovinos, ovinos e caprinos. Para o diagnóstico, os métodos de cultivo em ovo embrionado de galinha e em células de linhagem contínua apresentam baixa sensibilidade. A reação em cadeia da polimerase (PCR tem sido utilizada em placenta, órgãos fetais, secre

  6. Identification of bacteria associated with underground parts of Crocus sativus by 16S rRNA gene targeted metagenomic approach.

    Ambardar, Sheetal; Sangwan, Naseer; Manjula, A; Rajendhran, J; Gunasekaran, P; Lal, Rup; Vakhlu, Jyoti

    2014-10-01

    Saffron (Crocus sativus L), an autumn-flowering perennial sterile plant, reproduces vegetatively by underground corms. Saffron has biannual corm-root cycle that makes it an interesting candidate to study microbial dynamics in its rhizosphere and cormosphere (area under influence of corm). Culture independent 16S rRNA gene metagenomic study of rhizosphere and cormosphere of Saffron during flowering stage revealed presence of 22 genera but none of the genus was common in all the three samples. Bulk soil bacterial community was represented by 13 genera with Acidobacteria being dominant. In rhizosphere, out of eight different genera identified, Pseudomonas was the most dominant genus. Cormosphere bacteria comprised of six different genera, dominated by the genus Pantoea. This study revealed that the bacterial composition of all the three samples is significantly different (P rhizosphere, cormosphere and bulk soil of Saffron, using cultivation independent 16S rRNA gene targeted metagenomic approach. PMID:24989343

  7. Community structure, cellular rRNA content, and activity of sulfate-reducing bacteria in marine Arctic sediments

    Ravenschlag, K.; Sahm, K.; Knoblauch, C.;

    2000-01-01

    The community structure of sulfate-reducing bacteria (SRB) of a marine Arctic sediment (Smeerenburg-fjorden, Svalbard) a-as characterized by both fluorescence in situ hybridization (FISH) and rRNA slot blot hybridization by using group- and genus-specific 16S rRNA-targeted oligonucleotide probes......, The SRB community was dominated by members of the Desulfosarcina-Desulfococcus group. This group accounted for up to 73% of the SRB detected and up to 70% of the SRB rRNA detected. The predominance was shown to be a common feature for different stations along the coast of Svalbard, In a top......-Desulfococcus group. A group of clone sequences (group SVAL1) most closely related to Desulfosarcina variabilis (91.2% sequence similarity) was dominant and was shown to be most abundant in situ, accounting for up to 54.8% of the total SRB detected. A comparison of the two methods used for quantification showed...

  8. rRNA Gene Expression of Abundant and Rare Activated-Sludge Microorganisms and Growth Rate Induced Micropollutant Removal.

    Vuono, David C; Regnery, Julia; Li, Dong; Jones, Zackary L; Holloway, Ryan W; Drewes, Jörg E

    2016-06-21

    The role of abundant and rare taxa in modulating the performance of wastewater-treatment systems is a critical component of making better predictions for enhanced functions such as micropollutant biotransformation. In this study, we compared 16S rRNA genes (rDNA) and rRNA gene expression of taxa in an activated-sludge-treatment plant (sequencing batch membrane bioreactor) at two solids retention times (SRTs): 20 and 5 days. These two SRTs were used to influence the rates of micropollutant biotransformation and nutrient removal. Our results show that rare taxa (micropollutant biotransformation. An analysis of micropollutant-associated degradation genes via metagenomics and direct measurements of a suite of micropollutants and nutrients further corroborates the loss of enhanced functions at 5-day SRT operation. This work advances our knowledge of the underlying ecosystem properties and dynamics of abundant and rare organisms associated with enhanced functions in engineered systems. PMID:27196630

  9. Assay of cyclic nucleotide phosphodiesterase using radiolabeled and fluorescent substrates

    There are four major classes of phosphodiesterase with different specificities for cAMP and cGMP and different allosteric regulators. Type I phosphodiesterase is activated by calmodulin plus Ca/sup 2+/ and has a higher affinity for cGMP than cAMP. Type II phosphodiesterase likewise has a higher affinity for cGMP than cAMP, but the activity toward one substrate is markedly stimulated by low (micromolar) concentrations of the other nucleotide. Type III phosphodiesterase has a higher affinity for cAMP than cGMP; its activity is increased in responsive cells by certain hormones, e.g., insulin, isoproterenol. Type IV phosphodiesterase is the cGMP-specific enzyme, which also has an allosteric binding site for cGMP. An example of this class of enzyme is the one from retinal rod outer segments, which is activated by light via rhodopsin and the guanine nucleotide-binding protein transducin. There appears to be little structural relatedness among these enzymes based on immunologic analysis, consistent with the possibility that divergent forms evolved from an ancestral enzyme. Determination of the amount of a specific form of phosphodiesterase in crude material is often difficult. Modification of assay conditions by judicious choice of substrate and/or inhibitor concentrations may selectively favor (or reduce) the activity of a particular form; in many instances, however, some fractionation of enzymes may be necessary. This is discussed more fully in the final section of this chapter

  10. Single Nucleotide Polymorphism Analysis of Protamine Genes in Infertile Men

    Ahamad Salamian

    2008-01-01

    Full Text Available Background: Single nucleotide polymorphism (SNPs are considered as one of the underlyingcauses of male infertility. Proper sperm chromatin packaging which involves replacement ofhistones with protamines has profound effect on male fertility. Over 20 SNPs have been reportedfor the protamine 1 and 2.Materials and Methods: The aim of this study was to evaluate the frequency of two previouslyreported SNPs using polymerase chain reaction (PCR-restriction fragment length polymorphism(RFLP approach in 35, 96 and 177 normal, oligozoospermic and azoospermic individuals. TheseSNPs are: 1. A base pair substitution (G at position 197 instead of T in protamine type 1 Openreading frame (ORF including untranslated region, which causes an Arg residue change to Serresidue in a highly conserved region. 2. cytidine nucleotide change to thymidine in position of 248of protamine type 2 ORF which caused a nonsense point mutation.Results: The two mentioned SNPs were not present in the studied population, thus concluding thatthese SNPs can not serves as molecular markers for male infertility diagnosis.Conclusion: The results of our study reveal that in a selected Iranian population, the SNP G197Tand C248T are completely absent and are not associated with male infertility and therefore theseSNPs may not represent a molecular marker for genetic diagnosis of male infertility.

  11. Single nucleotide polymorphism analysis of European archaeological M. leprae DNA.

    Claire L Watson

    Full Text Available BACKGROUND: Leprosy was common in Europe eight to twelve centuries ago but molecular confirmation of this has been lacking. We have extracted M. leprae ancient DNA (aDNA from medieval bones and single nucleotide polymorphism (SNP typed the DNA, this provides insight into the pattern of leprosy transmission in Europe and may assist in the understanding of M. leprae evolution. METHODS AND FINDINGS: Skeletons have been exhumed from 3 European countries (the United Kingdom, Denmark and Croatia and are dated around the medieval period (476 to 1350 A.D.. we tested for the presence of 3 previously identified single nucleotide polymorphisms (SNPs in 10 aDNA extractions. M. leprae aDNA was extracted from 6 of the 10 bone samples. SNP analysis of these 6 extractions were compared to previously analysed European SNP data using the same PCR assays and were found to be the same. Testing for the presence of SNPs in M. leprae DNA extracted from ancient bone samples is a novel approach to analysing European M. leprae DNA and the findings concur with the previously published data that European M. leprae strains fall in to one group (SNP group 3. CONCLUSIONS: These findings support the suggestion that the M. leprae genome is extremely stable and show that archaeological M. leprae DNA can be analysed to gain detailed information about the genotypic make-up of European leprosy, which may assist in the understanding of leprosy transmission worldwide.

  12. Nucleotide variation in the Toxoplasma gondii micronemal protein 8 gene.

    Li, Z Y; Song, H Q; Wang, C R; Zhu, X Q

    2016-01-01

    Toxoplasma gondii is a successful opportunistic protozoan distributed worldwide, which can infect all vertebrates, leading to serious infection, blindness, and abortion. Micronemal (MIC) proteins are critically important for T. gondii infection, as they participate in various stages of the Toxoplasma life cycle, including invasion and attachment to host cells. MIC8 secretion relies on the concentration of intracellular calcium, and can mediate the invasion of T. gondii by interacting with soluble MIC3. To investigate genetic diversity of the MIC8 gene, 16 T. gondii strains from different hosts and geographical locations, and two reference isolates (ToxoDB: TGME49_245490 and TGVEG_245490) were examined in this study. The results showed that all the examined MIC8 genes are 2055 bp, with an A+T content ranging from 50.2 to 50.6%. Conversely, lower levels of variation were detected within their nucleotide and amino acid sequences. Phylogenetic analyses indicated that three classical genotypes of T. gondii and the ToxoDB#9 genotype did not group exclusively via Bayesian inference, maximum parsimony, neighbor joining, and/or maximum likelihood assays based on the nucleotide and amino acid sequences of the MIC8 gene. In summary, the T. gondii MIC8 gene is not a suitable marker for population genetic studies of this parasite. PMID:27173337

  13. Structure and function of nucleotide sugar transporters: Current progress

    Barbara Hadley

    2014-06-01

    Full Text Available The proteomes of eukaryotes, bacteria and archaea are highly diverse due, in part, to the complex post-translational modification of protein glycosylation. The diversity of glycosylation in eukaryotes is reliant on nucleotide sugar transporters to translocate specific nucleotide sugars that are synthesised in the cytosol and nucleus, into the endoplasmic reticulum and Golgi apparatus where glycosylation reactions occur. Thirty years of research utilising multidisciplinary approaches has contributed to our current understanding of NST function and structure. In this review, the structure and function, with reference to various disease states, of several NSTs including the UDP-galactose, UDP-N-acetylglucosamine, UDP-N-acetylgalactosamine, GDP-fucose, UDP-N-acetylglucosamine/UDP-glucose/GDP-mannose and CMP-sialic acid transporters will be described. Little is known regarding the exact structure of NSTs due to difficulties associated with crystallising membrane proteins. To date, no three-dimensional structure of any NST has been elucidated. What is known is based on computer predictions, mutagenesis experiments, epitope-tagging studies, in-vitro assays and phylogenetic analysis. In this regard the best-characterised NST to date is the CMP-sialic acid transporter (CST. Therefore in this review we will provide the current state-of-play with respect to the structure–function relationship of the (CST. In particular we have summarised work performed by a number groups detailing the affect of various mutations on CST transport activity, efficiency, and substrate specificity.

  14. Evaluation of published single nucleotide polymorphisms associated with acute GVHD.

    Chien, Jason W; Zhang, Xinyi Cindy; Fan, Wenhong; Wang, Hongwei; Zhao, Lue Ping; Martin, Paul J; Storer, Barry E; Boeckh, Michael; Warren, Edus H; Hansen, John A

    2012-05-31

    Candidate genetic associations with acute GVHD (aGVHD) were evaluated with the use of genotyped and imputed single-nucleotide polymorphism data from genome-wide scans of 1298 allogeneic hematopoietic cell transplantation (HCT) donors and recipients. Of 40 previously reported candidate SNPs, 6 were successfully genotyped, and 10 were imputed and passed criteria for analysis. Patient and donor genotypes were assessed for association with grades IIb-IV and III-IV aGVHD, stratified by donor type, in univariate and multivariate allelic, recessive and dominant models. Use of imputed genotypes to replicate previous IL10 associations was validated. Similar to previous publications, the IL6 donor genotype for rs1800795 was associated with a 20%-50% increased risk for grade IIb-IV aGVHD after unrelated HCT in the allelic (adjusted P = .011) and recessive (adjusted P = .0013) models. The donor genotype was associated with a 60% increase in risk for grade III-IV aGVHD after related HCT (adjusted P = .028). Other associations were found for IL2, CTLA4, HPSE, and MTHFR but were inconsistent with original publications. These results illustrate the advantages of using imputed single-nucleotide polymorphism data in genetic analyses and demonstrate the importance of validation in genetic association studies. PMID:22282500

  15. Determination of 16S rRNA Sequences of Enterococci and Application to Species Identification of Nonmotile Enterococcus gallinarum Isolates

    Patel, Robin; Piper, Kerryl E.; Rouse, Mark S; Steckelberg, James M.; Uhl, Jim R.; Kohner, Peggy; Hopkins, Marlene K.; Cockerill, Franklin R.; Kline, Bruce C.

    1998-01-01

    The 16S rRNA sequences of enterococcal species E. faecium, E. faecalis, E. gallinarum, E. casseliflavus/flavescens, E. dispar, E. pseudoavium, E. sulfureus, E. malodoratus, E. raffinosus, E. cecorum, E. hirae, E. saccharolyticus, E. seriolicida, E. mundtii, E. avium, E. durans, E. columbae, and E. solitarius are presented herein. These data were utilized to confirm the species identification of two nonmotile E. gallinarum isolates which had been previously phenotypically identified as E. faec...

  16. Unique 16S rRNA sequences of Eurythenes gryllus (Crustacea: Amphipoda: Lysianassidae) from the Gulf of Mexico abyssal plain

    Elva Escobar-Briones; Eduardo Nájera-Hillman; Fernando Álvarez

    2010-01-01

    Amphipods of the species Eurythenes gryllus were collected at 2 locations on the abyssal plain (~3 400 m) of the Gulf of Mexico in order to test whether or not these scavenger amphipods are isolated in this peripheral sea or show connectivity by their predominant swimming behavior, moving horizontally along the abyssal water masses in the region. Partial sequences of the mitochondrial 16S rRNA gene from 2 individuals of E. gryllus were determined and showed small differences when compared to ...

  17. Molecular characterization of Sarcocystis species from Polish roe deer based on ssu rRNA and cox1 sequence analysis.

    Kolenda, Rafał; Ugorski, Maciej; Bednarski, Michał

    2014-08-01

    Sarcocysts from four Polish roe deer were collected and examined by light microscopy, small subunit ribosomal RNA (ssu rRNA), and the subunit I of cytochrome oxidase (cox1) sequence analysis. This resulted in identification of Sarcocystis gracilis, Sarcocystis oviformis, and Sarcocystis silva. However, we were unable to detect Sarcocystis capreolicanis, the fourth Sarcocystis species found previously in Norwegian roe deer. Polish sarcocysts isolated from various tissues differed in terms of their shape and size and were larger than the respective Norwegian isolates. Analysis of ssu rRNA gene revealed the lack of differences between Sarcocystis isolates belonging to one species and a very low degree of genetic diversity between Polish and Norwegian sarcocysts, ranging from 0.1% for Sarcocystis gracilis and Sarcocystis oviformis to 0.44% for Sarcocystis silva. Contrary to the results of the ssu rRNA analysis, small intraspecies differences in cox1 sequences were found among Polish Sarcocystis gracilis and Sarcocystis silva isolates. The comparison of Polish and Norwegian cox1 sequences representing the same Sarcocystis species revealed similar degree of sequence identity, namely 99.72% for Sarcocystis gracilis, 98.76% for Sarcocystis silva, and 99.85% for Sarcocystis oviformis. Phylogenetic reconstruction and genetic population analyses showed an unexpected high degree of identity between Polish and Norwegian isolates. Moreover, cox1 gene sequences turned out to be more accurate than ssu rRNA when used to reveal phylogenetic relationships among closely related species. The results of our study revealed that the same Sarcocystis species isolated from the same hosts living in different geographic regions show a very high level of genetic similarity. PMID:24948101

  18. Influence of DNA extraction on oral microbial profiles obtained via 16S rRNA gene sequencing

    Diaz, Patricia I.; Abusleme, Loreto; Hong, Bo-Young; Amanda K. Dupuy; Linda D Strausbaugh

    2014-01-01

    Background and objective: The advent of next-generation sequencing has significantly facilitated characterization of the oral microbiome. Despite great efforts in streamlining the processes of sequencing and data curation, upstream steps required for amplicon library generation could still influence 16S rRNA gene-based microbial profiles. Among upstream processes, DNA extraction is a critical step that could represent a great source of bias. Accounting for bias introduced by extraction proced...

  19. Use of 16S rRNA Sequencing for Identification of Actinobacillus ureae Isolated from a Cerebrospinal Fluid Sample

    Whitelaw, A. C.; Shankland, I. M.; Elisha, B. G.

    2002-01-01

    Actinobacillus ureae, previously Pasteurella ureae, has on rare occasions been described as a cause of human infection. Owing to its rarity, it may not be easily identified in clinical microbiology laboratories by standard tests. This report describes a patient with acute bacterial meningitis due to A. ureae. The identity of the isolate was determined by means of DNA sequence analysis of a portion of the 16S rRNA gene.

  20. Analysis of Mixed Sequencing Chromatograms and Its Application in Direct 16S rRNA Gene Sequencing of Polymicrobial Samples▿

    Kommedal, Øyvind; Karlsen, Bjarte; Sæbø, Øystein

    2008-01-01

    Investigation of clinical samples by direct 16S rRNA gene sequencing provides the possibility to detect nonviable bacteria and bacteria with special growth requirements. This approach has been particularly valuable for the diagnosis of patients who have received antibiotics prior to sample collection. In specimens containing more than one bacterium, direct sequencing gives mixed chromatograms that complicate further interpretation. We designed an algorithm able to analyze these ambiguous chro...

  1. Cilantro microbiome before and after nonselective pre-enrichment for Salmonella using 16S rRNA and metagenomic sequencing

    Jarvis, Karen G.; White, James R.; Grim, Christopher J.; Ewing, Laura; Ottesen, Andrea R; Beaubrun, Junia Jean-Gilles; Pettengill, James B; Brown, Eric; Hanes, Darcy E.

    2015-01-01

    Background Salmonella enterica is a common cause of foodborne gastroenteritis in the United States and is associated with outbreaks in fresh produce such as cilantro. Salmonella culture-based detection methods are complex and time consuming, and improvments to increase detection sensitivity will benefit consumers. In this study, we used 16S rRNA sequencing to determine the microbiome of cilantro. We also investigated changes to the microbial community prior to and after a 24-hour nonselective...

  2. Plastid 16S rRNA gene diversity among eukaryotic picophytoplankton sorted by flow cytometry from the South Pacific Ocean.

    Xiao Li Shi

    Full Text Available The genetic diversity of photosynthetic picoeukaryotes was investigated in the South East Pacific Ocean. Genetic libraries of the plastid 16S rRNA gene were constructed on picoeukaryote populations sorted by flow cytometry, using two different primer sets, OXY107F/OXY1313R commonly used to amplify oxygenic organisms, and PLA491F/OXY1313R, biased towards plastids of marine algae. Surprisingly, the two sets revealed quite different photosynthetic picoeukaryote diversity patterns, which were moreover different from what we previously reported using the 18S rRNA nuclear gene as a marker. The first 16S primer set revealed many sequences related to Pelagophyceae and Dictyochophyceae, the second 16S primer set was heavily biased toward Prymnesiophyceae, while 18S sequences were dominated by Prasinophyceae, Chrysophyceae and Haptophyta. Primer mismatches with major algal lineages is probably one reason behind this discrepancy. However, other reasons, such as DNA accessibility or gene copy numbers, may be also critical. Based on plastid 16S rRNA gene sequences, the structure of photosynthetic picoeukaryotes varied along the BIOSOPE transect vertically and horizontally. In oligotrophic regions, Pelagophyceae, Chrysophyceae, and Prymnesiophyceae dominated. Pelagophyceae were prevalent at the DCM depth and Chrysophyceae at the surface. In mesotrophic regions Pelagophyceae were still important but Chlorophyta contribution increased. Phylogenetic analysis revealed a new clade of Prasinophyceae (clade 16S-IX, which seems to be restricted to hyper-oligotrophic stations. Our data suggest that a single gene marker, even as widely used as 18S rRNA, provides a biased view of eukaryotic communities and that the use of several markers is necessary to obtain a complete image.

  3. Analysis of the 16S–23S rRNA Gene Internal Transcribed Spacer Region in Klebsiella Species▿

    wang, Min; Cao, Boyang; Yu, Qunfang; Liu, Lei; Gao, Qili; Wang, Lei; Feng, Lu

    2008-01-01

    The 16S-23S rRNA gene internal transcribed spacer (ITS) regions of Klebsiella spp., including Klebsiella pneumoniae subsp. pneumoniae, Klebsiella pneumoniae subsp. ozaenae, Klebsiella pneumoniae subsp. rhinoscleromatis, Klebsiella oxytoca, Klebsiella planticola, Klebsiella terrigena, and Klebsiella ornithinolytica, were characterized, and the feasibility of using ITS sequences to discriminate Klebsiella species and subspecies was explored. A total of 336 ITS sequences from 21 representative s...

  4. An intramolecular recombination mechanism for the formation of the rRNA gene palindrome of Tetrahymena thermophila.

    Butler, D. K.; Yasuda, L E; Yao, M C

    1995-01-01

    Large palindromic DNAs are found in a wide variety of eukaryotic cells. In Tetrahymena thermophila, a large palindrome is formed from a single rRNA gene (rDNA) during nuclear differentiation. We present evidence that a key step in the formation of the rDNA palindrome of T. thermophila involves homologous intramolecular recombination. Heteroduplex micronuclear rDNA molecules were constructed in vitro and microinjected into developing macronuclei, where they formed palindromes. Analysis of the ...

  5. Analysis of 16S rRNA amplicon sequencing options on the Roche/454 next-generation titanium sequencing platform.

    Hideyuki Tamaki

    Full Text Available BACKGROUND: 16S rRNA gene pyrosequencing approach has revolutionized studies in microbial ecology. While primer selection and short read length can affect the resulting microbial community profile, little is known about the influence of pyrosequencing methods on the sequencing throughput and the outcome of microbial community analyses. The aim of this study is to compare differences in output, ease, and cost among three different amplicon pyrosequencing methods for the Roche/454 Titanium platform METHODOLOGY/PRINCIPAL FINDINGS: The following three pyrosequencing methods for 16S rRNA genes were selected in this study: Method-1 (standard method is the recommended method for bi-directional sequencing using the LIB-A kit; Method-2 is a new option designed in this study for unidirectional sequencing with the LIB-A kit; and Method-3 uses the LIB-L kit for unidirectional sequencing. In our comparison among these three methods using 10 different environmental samples, Method-2 and Method-3 produced 1.5-1.6 times more useable reads than the standard method (Method-1, after quality-based trimming, and did not compromise the outcome of microbial community analyses. Specifically, Method-3 is the most cost-effective unidirectional amplicon sequencing method as it provided the most reads and required the least effort in consumables management. CONCLUSIONS: Our findings clearly demonstrated that alternative pyrosequencing methods for 16S rRNA genes could drastically affect sequencing output (e.g. number of reads before and after trimming but have little effect on the outcomes of microbial community analysis. This finding is important for both researchers and sequencing facilities utilizing 16S rRNA gene pyrosequencing for microbial ecological studies.

  6. Sequence analysis of 16S rRNA from mycoplasmas by direct solid-phase DNA sequencing.

    Pettersson, B; Johansson, K. E.; Uhlén, M

    1994-01-01

    Automated solid-phase DNA sequencing was used for determination of partial 16S ribosomal DNA sequences of mycoplasmas. The sequence information was used to establish phylogenetic relationships of 11 different mycoplasmas whose 16S rRNA sequences had not been determined earlier. A biotinylated fragment corresponding to positions 344 to 939 in the Escherichia coli sequence was generated by PCR. The PCR product was immobilized onto streptavidin-coated paramagnetic beads, and direct sequencing wa...

  7. Bacterial Community Diversity of Oil-Contaminated Soils Assessed by High Throughput Sequencing of 16S rRNA Genes

    Mu Peng; Xiaoxue Zi; Qiuyu Wang

    2015-01-01

    Soil bacteria play a major role in ecological and biodegradable function processes in oil-contaminated soils. Here, we assessed the bacterial diversity and changes therein in oil-contaminated soils exposed to different periods of oil pollution using 454 pyrosequencing of 16S rRNA genes. No less than 24,953 valid reads and 6246 operational taxonomic units (OTUs) were obtained from all five studied samples. OTU richness was relatively higher in contaminated soils than clean samples. Acidobacte...

  8. The B chromosomes of the African cichlid fish Haplochromis obliquidens harbour 18S rRNA gene copies

    Martins Cesar

    2010-01-01

    Full Text Available Abstract Background Diverse plant and animal species have B chromosomes, also known as accessory, extra or supernumerary chromosomes. Despite being widely distributed among different taxa, the genomic nature and genetic behavior of B chromosomes are still poorly understood. Results In this study we describe the occurrence of B chromosomes in the African cichlid fish Haplochromis obliquidens. One or two large B chromosome(s occurring in 39.6% of the analyzed individuals (both male and female were identified. To better characterize the karyotype and assess the nature of the B chromosomes, fluorescence in situ hybridization (FISH was performed using probes for telomeric DNA repeats, 18S and 5S rRNA genes, SATA centromeric satellites, and bacterial artificial chromosomes (BACs enriched in repeated DNA sequences. The B chromosomes are enriched in repeated DNAs, especially non-active 18S rRNA gene-like sequences. Conclusion Our results suggest that the B chromosome could have originated from rDNA bearing subtelo/acrocentric A chromosomes through formation of an isochromosome, or by accumulation of repeated DNAs and rRNA gene-like sequences in a small proto-B chromosome derived from the A complement.

  9. The phylogenetic relationship of the family Lutjanidae based on analyses of AFLP and mitochondrial 12S rRNA sequences

    ZHANG Junbin; LIU Xin

    2006-01-01

    Fishes of the family Lutjanidae are commercially important in South China Sea. However,the phylogeny of Lutjanids is still unclear and there are many controversies over it. Herein, studies about the phylogeny of Lutjanids were performed based on Amplified Fragment Length Polymorphism (AFLP) analysis of genome DNA and sequence analysis of mitochondrial 12S rRNA gene, and 10 Lutjanidae species and 1 Lethrinidae species were employed.The topologies of minimum evolution (ME) trees based on the two analyses respectively were congruent except for positions of genera Pristipomoides and Caesio. The optimal substitution model TrN + G for DNA sequences of 12S rRNA genes in Lutjanids was obtained using MODELTEST 3.6 software and maximum likelihood (ML) analysis supports the topology displayed by the ME tree. The test of log-likelihood suggests that the use of molecular clock calibrations to estimate species divergence time appeared valid. Phylogenetic analyses using AFLP data and DNA sequences of mitochondrial 12S rRNA genes indicated the monophyly of Lutjanus genra. However, further studies are required to reveal the phylogenetic relationship among other genera. In addition, the results demonstrated that AFLP genetic marker was suitable for the phylogenetic analysis of Lutjanids.

  10. Analysis of the mouse gut microbiome using full-length 16S rRNA amplicon sequencing.

    Shin, Jongoh; Lee, Sooin; Go, Min-Jeong; Lee, Sang Yup; Kim, Sun Chang; Lee, Chul-Ho; Cho, Byung-Kwan

    2016-01-01

    Demands for faster and more accurate methods to analyze microbial communities from natural and clinical samples have been increasing in the medical and healthcare industry. Recent advances in next-generation sequencing technologies have facilitated the elucidation of the microbial community composition with higher accuracy and greater throughput than was previously achievable; however, the short sequencing reads often limit the microbial composition analysis at the species level due to the high similarity of 16S rRNA amplicon sequences. To overcome this limitation, we used the nanopore sequencing platform to sequence full-length 16S rRNA amplicon libraries prepared from the mouse gut microbiota. A comparison of the nanopore and short-read sequencing data showed that there were no significant differences in major taxonomic units (89%) except one phylotype and three taxonomic units. Moreover, both sequencing data were highly similar at all taxonomic resolutions except the species level. At the species level, nanopore sequencing allowed identification of more species than short-read sequencing, facilitating the accurate classification of the bacterial community composition. Therefore, this method of full-length 16S rRNA amplicon sequencing will be useful for rapid, accurate and efficient detection of microbial diversity in various biological and clinical samples. PMID:27411898

  11. TaxCollector: Modifying Current 16S rRNA Databases for the Rapid Classification at Six Taxonomic Levels

    Eric W. Triplett

    2010-07-01

    Full Text Available The high level of conservation of 16S ribosomal RNA gene (16S rRNA in all Prokaryotes makes this gene an ideal tool for the rapid identification and classification of these microorganisms. Databases such as the Ribosomal Database Project II (RDP-II and the Greengenes Project offer access to sets of ribosomal RNA sequence databases useful in identification of microbes in a culture-independent analysis of microbial communities. However, these databases do not contain all of the taxonomic levels attached to the published names of the bacterial and archaeal sequences. TaxCollector is a set of scripts developed in Python language that attaches taxonomic information to all 16S rRNA sequences in the RDP-II and Greengenes databases. These modified databases are referred to as TaxCollector databases, which when used in conjunction with BLAST allow for rapid classification of sequences from any environmental or clinical source at six different taxonomic levels, from domain to species. The TaxCollector database prepared from the RDP-II database is an important component of a new 16S rRNA pipeline called PANGEA. The usefulness of TaxCollector databases is demonstrated with two very different datasets obtained using samples from a clinical setting and an agricultural soil. The six TaxCollector scripts are freely available on http://taxcollector.sourceforge.net and on http://www.microgator.org.

  12. Evolutionary History of the Chaetognaths Inferred from Actin and 18S-28S rRNA Paralogous Genes

    J.P. Casanova

    2006-01-01

    Full Text Available The chaetognaths constitute a small and enigmatic phylum of marine invertebrates whose phylogenetic affinities remain uncertain. Our phylogenetical investigations inferred from partial paralogous 18S-28S rRNA genes suggest that the event resulting in the presence of two classes of rRNA genes would have occurred at approximately 300-400 million years and prior to the radiation of extant chaetognath, whereas the taxon, according to both molecular and paleontological data, would be dated from at least the Early Cambrian. These divergent rRNA genes could be the result of a whole ribosomal cluster duplication or of an allopolyploid event during a crisis period, since, the fossil are lacking posterioly to the post-Carboniferous period (c.a., 300 million years. In addition, actin phylogeny evidenced that the cytoplasmic chaetognath actin clustered with the cytoplasmic insect actins, while the muscular chaetognath actins are placed basal to all muscular vertebrate actins. The present study suggests that the gene conversion mechanisms could be inefficient in this taxon; this could explain the conservation of extremely divergent paralogous sequences in the chaetognath genomes which could be correlated to the difficulties to identify a sister group between chaetognaths and other taxa among metazoans.

  13. Slow formation of stable complexes during coincubation of a minimal rRNA and ribosomal protein S4

    Mayerle, Megan; Bellur, Deepti L.; Woodson, Sarah A.

    2011-01-01

    Ribosomal protein S4 binds and stabilizes a five-helix junction in the 5’ domain of the 16S rRNA, and is one of two proteins responsible for nucleating 30S ribosome assembly. Upon binding, both protein S4 and the five-helix junction reorganize their structures. We show that labile S4 complexes rearrange to stable complexes within a few minutes at 42°C, with longer coincubation leading to an increased population of stable complexes. In contrast, prefolding the rRNA has a smaller effect on stable S4 binding. Experiments with minimal rRNA fragments show this structural change depends only on 16S residues within the S4 binding site. SHAPE chemical-probing experiments showed that S4 strongly stabilizes the five-helix junction and helix 18 pseudoknot, which become tightly folded within the first minute of S4 binding. However, a kink in helix 16 that makes specific contacts with the S4 N-terminal extension, and a right angle motif between helices 3, 4 and 18, require a minute or more to become fully structured. Surprisingly, S4 structurally reorganizes the 530-loop and increases the flexibility of helix 3, which is proposed to undergo a conformational switch during 30S assembly. These elements of the S4 binding site may require other 30S proteins to reach a stable conformation. PMID:21821049

  14. Adjacent Codons Act in Concert to Modulate Translation Efficiency in Yeast.

    Gamble, Caitlin E; Brule, Christina E; Dean, Kimberly M; Fields, Stanley; Grayhack, Elizabeth J

    2016-07-28

    Translation elongation efficiency is largely thought of as the sum of decoding efficiencies for individual codons. Here, we find that adjacent codon pairs modulate translation efficiency. Deploying an approach in Saccharomyces cerevisiae that scored the expression of over 35,000 GFP variants in which three adjacent codons were randomized, we have identified 17 pairs of adjacent codons associated with reduced expression. For many pairs, codon order is obligatory for inhibition, implying a more complex interaction than a simple additive effect. Inhibition mediated by adjacent codons occurs during translation itself as GFP expression is restored by increased tRNA levels or by non-native tRNAs with exact-matching anticodons. Inhibition operates in endogenous genes, based on analysis of ribosome profiling data. Our findings suggest translation efficiency is modulated by an interplay between tRNAs at adjacent sites in the ribosome and that this concerted effect needs to be considered in predicting the functional consequences of codon choice. PMID:27374328

  15. Uplink scheduling and adjacent-channel coupling loss analysis for TD-LTE deployment.

    Yeo, Woon-Young; Moon, Sung Ho; Kim, Jae-Hoon

    2014-01-01

    TD-LTE, one of the two duplexing modes in LTE, operates in unpaired spectrum and has the advantages of TDD-based technologies. It is expected that TD-LTE will be more rapidly deployed in near future and most of WiMax operators will upgrade their networks to TD-LTE gradually. Before completely upgrading to TD-LTE, WiMax may coexist with TD-LTE in an adjacent frequency band. In addition, multiple TD-LTE operators may deploy their networks in adjacent bands. When more than one TDD network operates in adjacent frequency bands, severe interference may happen due to adjacent channel interference (ACI) and unsynchronized operations. In this paper, coexistence issues between TD-LTE and other systems are analyzed and coexistence requirements are provided. This paper has three research objectives. First, frame synchronization between TD-LTE and WiMax is discussed by investigating possible combinations of TD-LTE and WiMax configurations. Second, an uplink scheduling algorithm is proposed to utilize a leakage pattern of ACI in synchronized operations. Third, minimum requirements for coexistence in unsynchronized operations are analyzed by introducing a concept of adjacent-channel coupling loss. From the analysis and simulation results, we can see that coexistence of TD-LTE with other TDD systems is feasible if the two networks are synchronized. For the unsynchronized case, some special cell-site engineering techniques may be required to reduce the ACI. PMID:24707214

  16. Non-target adjacent stimuli classification improves performance of classical ERP-based brain computer interface

    Ceballos, G. A.; Hernández, L. F.

    2015-04-01

    Objective. The classical ERP-based speller, or P300 Speller, is one of the most commonly used paradigms in the field of Brain Computer Interfaces (BCI). Several alterations to the visual stimuli presentation system have been developed to avoid unfavorable effects elicited by adjacent stimuli. However, there has been little, if any, regard to useful information contained in responses to adjacent stimuli about spatial location of target symbols. This paper aims to demonstrate that combining the classification of non-target adjacent stimuli with standard classification (target versus non-target) significantly improves classical ERP-based speller efficiency. Approach. Four SWLDA classifiers were trained and combined with the standard classifier: the lower row, upper row, right column and left column classifiers. This new feature extraction procedure and the classification method were carried out on three open databases: the UAM P300 database (Universidad Autonoma Metropolitana, Mexico), BCI competition II (dataset IIb) and BCI competition III (dataset II). Main results. The inclusion of the classification of non-target adjacent stimuli improves target classification in the classical row/column paradigm. A gain in mean single trial classification of 9.6% and an overall improvement of 25% in simulated spelling speed was achieved. Significance. We have provided further evidence that the ERPs produced by adjacent stimuli present discriminable features, which could provide additional information about the spatial location of intended symbols. This work promotes the searching of information on the peripheral stimulation responses to improve the performance of emerging visual ERP-based spellers.

  17. Identification of protein-RNA interaction sites using the information of spatial adjacent residues

    Cheng Yong-Mei

    2011-10-01

    Full Text Available Abstract Background Protein-RNA interactions play an important role in numbers of fundamental cellular processes such as RNA splicing, transport and translation, protein synthesis and certain RNA-mediated enzymatic processes. The more knowledge of Protein-RNA recognition can not only help to understand the regulatory mechanism, the site-directed mutagenesis and regulation of RNA–protein complexes in biological systems, but also have a vitally effecting for rational drug design. Results Based on the information of spatial adjacent residues, novel feature extraction methods were proposed to predict protein-RNA interaction sites with SVM-KNN classifier. The total accuracies of spatial adjacent residue profile feature and spatial adjacent residues weighted accessibility solvent area feature are 78%, 67.07% respectively in 5-fold cross-validation test, which are 1.4%, 3.79% higher than that of sequence neighbour residue profile feature and sequence neighbour residue accessibility solvent area feature. Conclusions The results indicate that the performance of feature extraction method using the spatial adjacent information is superior to the sequence neighbour information approach. The performance of SVM-KNN classifier is little better than that of SVM. The feature extraction method of spatial adjacent information with SVM-KNN is very effective for identifying protein-RNA interaction sites and may at least play a complimentary role to the existing methods.

  18. Telomere length in hepatocellular carcinoma and paired adjacent non-tumor tissues by quantitative PCR.

    Zhang, Yujing; Shen, Jing; Ming-Whei; Lee, Yu Po-Huang; Santella, Regina M

    2007-12-01

    Telomere shortening limits the proliferative capacity of human cells, restrains the regenerative capacity of organ systems during chronic diseases and aging and also induces chromosomal instability as well as initiation of cancer. Previous studies demonstrated that telomeres are often significantly shorter in tumor tissue, including hepatocellular carcinoma (HCC), compared to the surrounding tissue, but telomere length in HCC tissues was not correlated with several clinical parameters, such as age, sex, HBV or HCV infections and tumor size. In the present study, the telomere length ratio of 36 paired HCC, and their adjacent non-tumor tissues was measured by quantitative PCR (Q-PCR). The mean telomere lengths (SD) for HCC and adjacent non-tumor tissues were 0.26 (0.10) and 0.47 (0.20) respectively (t = 6.22, P telomere length in tumor and adjacent non-tumor tissues. The number of tumors with telomere length shorter than 0.50 was much higher than that of adjacent non-tumor tissues; more than 90% of the tissues with telomere length > or = 0.50 were adjacent non-tumor tissues. The correlations between telomere length and aflatoxin B1- and polycyclic aromatic hydrocarbon-DNA adducts level, p53 mutations and p16 hypermethylation status were also tested, but no significant associations were found. The relationship between telomere length shortening, chemical carcinogen exposure, and genetic and epigenetic changes in hepatocarcinogenesis needs further investigation. PMID:18058461

  19. Limitations of metazoan 18S rRNA sequence data : implications for reconstructing a phylogeny of the animal kingdom and inferring the reality of the cambrian explosion

    Abouheif, Ehab; Zardoya, Rafael; Meyer, Axel

    1998-01-01

    We document the phylogenetic behavior of the 18S rRNA molecule in 67 taxa from 28 metazoan phyla and assess the effects of among-site rate variation on reconstructing phylogenies of the animal kingdom. This empirical assessment was undertaken to clarify further the limits of resolution of the 18S rRNA gene as a phylogenetic marker and to address the question of whether 18S rRNA phylogenies can be used as a source of evidence to infer the reality of a Cambrian explosion. A notable degree of am...

  20. Quantification of Hyphomicrobium Populations in Activated Sludge from an Industrial Wastewater Treatment System as Determined by 16S rRNA Analysis

    Layton, A C; Karanth, P. N.; Lajoie, C. A.; Meyers, A J; Gregory, I. R.; Stapleton, R. D.; Taylor, D E; Sayler, G. S.

    2000-01-01

    The bacterial community structure of the activated sludge from a 25 million-gal-per-day industrial wastewater treatment plant was investigated using rRNA analysis. 16S ribosomal DNA (rDNA) libraries were created from three sludge samples taken on different dates. Partial rRNA gene sequences were obtained for 46 rDNA clones, and nearly complete 16S rRNA sequences were obtained for 18 clones. Seventeen of these clones were members of the beta subdivision, and their sequences showed high homolog...

  1. An Upper Bound for the Adjacent Vertex Distinguishing Acyclic Edge Chromatic Number of a Graph

    Xin-sheng Liu; Ming-qiang An; Yang Gao

    2009-01-01

    A proper k-edge coloring of a graph G is called adjacent vertex distinguishing acyclic edge coloring if there is no 2-colored cycle in G and the color set of edges incident to u is not equal to the color set of edges incident to v,where uv ∈ E(G).The adjacent vertex distinguishing acyclic edge chromatic number of G,denoted by χαα(G),is the minimal number of colors in an adjacent vertex distinguishing acyclic edge coloring of G.In this paper we prove that if G(V,E)is a graph with no isolated edges,then χαα(G)≤32△.

  2. A method of 3D CAD model retrieval based on feature adjacent graph

    Shi, Min; Zhang, Shusheng

    2013-03-01

    To reuse the 3D CAD model, a new method of 3D CAD model retrieval based on feature adjacent graph is proposed. First, a representation of feature adjacent graph for the CAD model is extracted by automatic identification-based and interactive identification-assisted. Next, the vertex product graph of the two CAD model's feature adjacent graphs is constructed, and then the ant colony algorithm is employed to detect the maximum-cliques in the vertex product graph. At last, the similarity of the models is calculated by comparing the maximum-cliques. Experimental results show that this method can realize the 3D CAD model retrieval and its efficiency meets the requirements of applications.

  3. The speciation of marine particulate iron adjacent to active and passive continental margins

    Lam, Phoebe J.; Ohnemus, Daniel C.; Marcus, Matthew A.

    2012-03-01

    We use synchrotron-based chemical-species mapping techniques to compare the speciation of suspended (1-51 μm) marine particulate iron collected in two open ocean environments adjacent to active and passive continental margins. Chemical-species mapping provides speciation information for heterogeneous environmental samples, and is especially good for detecting spectroscopically distinct trace minerals and species that could not be detectable by other methods. The average oxidation state of marine particulate iron determined by chemical-species mapping is comparable to that determined by standard bulk X-ray Absorption Near Edge Structure spectroscopy. Using chemical-species mapping, we find that up to 43% of particulate Fe in the Northwest Pacific at the depth of the adjacent active continental margin is in the Fe(II) state, with the balance Fe(III). In contrast, particulate iron in the eastern tropical North Atlantic, which receives the highest dust deposition on Earth and is adjacent to a passive margin, is dominated by weathered and oxidized Fe compounds, with Fe(III) contributing 90% of total iron. The balance is composed primarily of Fe(II)-containing species, but we detected individual pyrite particles in some samples within an oxygen minimum zone in the upper thermocline. Several lines of evidence point to the adjacent Mauritanian continental shelf as the source of pyrite to the water column. The speciation of suspended marine particulate iron reflects the mineralogy of iron from the adjacent continental margins. Since the solubility of particulate iron has been shown to be a function of its speciation, this may have implications for the bioavailability of particulate iron adjacent to passive compared to active continental margins.

  4. Microemulsions as model fluids for enhanced oil recovery: dynamics adjacent to planar hydrophilic walls

    Frielinghaus, H.; Holderer, O.; Lipfert, F.; Kerscher, M.; Mattauch, S.; Richter, D.

    2012-10-01

    After the dynamics of microemulsions adjacent to a planar hydrophilic wall have been characterized using grazing incidence neutron spin echo spectroscopy, the model of Seifert was employed to explain the discovered acceleration for the surface near lamellar ordered membranes. Reflections of hydrodynamic waves by the wall - or the volume conservation between the membrane and the wall - explain faster relaxations and, therefore, a lubrication effect that is important for flow fields in narrow pores. The whole scenery is now spectated by using different scenarios of a bicontinuous microemulsion exposed to clay particles and of a lamellar microemulsion adjacent to a planar wall. The Seifert concept could successfully be transferred to the new problems.

  5. Microstructural evolution adjacent to grain boundaries under cascade damage conditions and helium production

    Trinkaus, H.; Singh, B.N.; Victoria, M.

    1996-01-01

    be absorbed by extended sinks such as dislocations and grain boundaries (GBs). The loss of SIAs by this process causes a vacancy supersaturation representing an efficient driving force for void swelling, in particular in regions adjacent to GBs. Enhanced swelling in regions adjacent to GBs has been observed...... in several metals subject to irradiation by both fast fission neutrons and 600 MeV protons. In the latter case, however, the width of the region of enhanced swelling is smaller and the amount of swelling is significantly lower than in the former case. Recently, enhanced swelling near GBs as induced...

  6. Computation and analysis of the geomagnetic field model in China and its adjacent area for 2003

    GU Zuo-wen; AN Zhen-chang; GAO Jin-tian; ZHAN Zhi-jia; YAO Tong-qi; HAN Wei; CHEN Bin

    2006-01-01

    Based on the geomagnetic data at 135 stations and 35 observatories in China in 2003, the Taylor polynomial model and the spherical cap harmonic model in China and its adjacent area for 2003 were established. In the model calculation, the truncation order of the model and the influences of the boundary restriction on the model calculation were carefully analyzed. The results show that the geomagnetic data used are precise and reliable, and the selection of the truncation order is reasonable. The Taylor polynomial model and the spherical cap harmonic model in China and its adjacent area established in this paper are consistent very well.

  7. Action of ''Bipenst'' preparation and dimethylsulfoxide on the adenyl nucleotide content in liver of irradiated animals

    Action of parenteral administration of a biostimulator ''Bipenst'' and a 10; dimethylsulfoxide solution on the level of adenyl nucleotides in the liver of rats subjected to a single whole-body irradiation (243 R) has been studied. It has been found that the level of adenyl nucleotides in the liver of irradiated animals decreases, and adenyl nucleotide content normalizes under the action of the preparations under study

  8. Neutralizing monoclonal antibody against ras oncogene product p21 which impairs guanine nucleotide exchange.

    Hattori, S; Clanton, D J; Satoh, T.; Nakamura, S.; Kaziro, Y; Kawakita, M; Shih, T Y

    1987-01-01

    The neutralizing monoclonal antibody Y13-259 severely hampers the nucleotide exchange reaction between p21-bound and exogenous guanine nucleotides but does not interfere with the association of GDP to p21. These results suggest that the nucleotide exchange reaction is critical for p21 function. Interestingly, the v-ras p21 has a much faster dissociation rate than the p21 of the c-ras proto-oncogene.

  9. The complete nucleotide sequence of the RNA coding for the primary translation product of foot and mouth disease virus.

    1984-01-01

    The complete nucleotide sequence of the coding region of foot and mouth disease virus RNA (strain A1061) is presented. The sequence extends from the primary initiation site, approximately 1200 nucleotide from the 5' end of the genome, in an open translational reading frame of 6,999 nucleotides to a termination codon 93 nucleotides from the 3' terminal poly (A). Available amino acid sequence data correlates with that predicted from the nucleotide sequence. The amino acid sequence around cleava...

  10. Enzymatic polymerisation involving 2'-amino-LNA nucleotides.

    Johannsen, Marie W; Veedu, Rakesh N; Madsen, Andreas Stahl; Wengel, Jesper

    2012-05-15

    The triphosphate of the thymine derivative of 2'-amino-LNA (2'-amino-LNA-TTP) was synthesised and found to be a good substrate for Phusion® HF DNA polymerase, allowing enzymatic synthesis of modified DNA encoded by an unmodified template. To complement this, 2'-amino-LNA-T phosphoramidites were incorporated into DNA oligonucleotides which were used as templates for enzymatic synthesis of unmodified DNA using either KOD, KOD XL or Phusion polymerases. 2'-Amino-LNA-T in the template and 2'-amino-LNA-TTP as a substrate both decreased reaction rate and yield compared to unmodified DNA, especially for sequences with multiple 2'-amino-LNA-T nucleotides. PMID:22503454

  11. Radicals of DNA and DNA nucleotides generated by ionising radiation

    A first stage of cell processes leading to DNA damage of initiated by radical reactions. In a model system such transformations were generated by ionising radiation which involves production of electron loss and electron gain centers of the substrate and radical formation. Using cryogenic ESR spectroscopy it was found that the DNA nucleotides, which convert to radical anions upon electron capture undergo the separation of unpaired spin and charge due to protonation. Circular and linear dichroism studies enabled to conclude that iron ions(III) induce strong changes in the DNA helical structure indicating their coordination with nitrogen bases. The repair of DNA radicals produced via radiolytic oxidation, i.e. the guanine radical cation and the allyl type radical of thymine, is possible at elevated temperatures due to the involvement of sulphydryl groups. The influence of the thiol charge is then limited

  12. Pinched flow fractionation devices for detection of single nucleotide polymorphisms

    Larsen, A.V.; Poulsen, L.; Birgens, H.;

    2008-01-01

    We demonstrate a new and flexible micro fluidic based method for genotyping single nucleotide polymorphisms ( SNPs). The method relies on size separation of selectively hybridized polystyrene microspheres in a micro fluidic pinched flow fractionation (PFF) device. The micro fluidic PFF devices with......, synthesized using human DNA samples from individuals with point mutations in the HBB gene. Following a stringent wash, the beads were separated in a PFF device and the fluorescent signal from the beads was analyzed. Patients being wildtypes, heterozygotes or mutated respectively for the investigated mutation...... could reliably be diagnosed in the PFF device. This indicates that the PFF technique can be used for accurate and fast genotyping of SNPs Udgivelsesdato: 2008...

  13. Single nucleotide variations: biological impact and theoretical interpretation.

    Katsonis, Panagiotis; Koire, Amanda; Wilson, Stephen Joseph; Hsu, Teng-Kuei; Lua, Rhonald C; Wilkins, Angela Dawn; Lichtarge, Olivier

    2014-12-01

    Genome-wide association studies (GWAS) and whole-exome sequencing (WES) generate massive amounts of genomic variant information, and a major challenge is to identify which variations drive disease or contribute to phenotypic traits. Because the majority of known disease-causing mutations are exonic non-synonymous single nucleotide variations (nsSNVs), most studies focus on whether these nsSNVs affect protein function. Computational studies show that the impact of nsSNVs on protein function reflects sequence homology and structural information and predict the impact through statistical methods, machine learning techniques, or models of protein evolution. Here, we review impact prediction methods and discuss their underlying principles, their advantages and limitations, and how they compare to and complement one another. Finally, we present current applications and future directions for these methods in biological research and medical genetics. PMID:25234433

  14. The adsorption and reaction of adenine nucleotides on montmorillonite

    Ferris, James P.; Hagan, William J., Jr.

    1986-01-01

    The binding of AMP to Zn(2+)-montmorillonite is investigated in the presence of salts and Good's zwitterion buffers, PIPES and MES. The initial concentrations of nucleotide and the percent adsorbtion are used to calculate the adsorption isotherms, and the Langmuir adsorption equation is used for the analysis of data. The adsorption coefficient was found to be three times greater in the presence of 0.2 M PIPES than in its absence. In addition, basal spacings measured by X-ray diffraction were increased by the buffer. These results are interpreted in terms of a model in which the adsorption of AMP is mediated by a Zn(2+) complex of PIPES in different orientations in the interlamellar region of the montmorillonite. Mixed ligand complexes of this type are reminiscent of the complexes observed between metal ions and biological molecules in living systems.

  15. Efficient fidelity control by stepwise nucleotide selection in polymerase elongation

    Yu, Jin

    2014-01-01

    Polymerases select nucleotides before incorporating them for chemical synthesis during gene replication or transcription. How the selection proceeds stepwise efficiently to achieve sufficiently high fidelity and speed is essential for polymerase function. We examined step-by-step selections that have conformational transition rates tuned one at time in the polymerase elongation cycle, with a controlled differentiation free energy at each checkpoint. The elongation is sustained at non-equilibrium steady state with constant free energy input and heat dissipation. It is found that error reduction capability does not improve for selection checkpoints down the reaction path. Hence, it is essential to select early to achieve an efficient fidelity control. In particular, for two consecutive selections that reject the wrong substrate back and inhibit it forward from a same kinetic state, the same error rates are obtained at the same free energy differentiation. The initial screening is indispensible for maintaining t...

  16. The nucleotide sequence of the bacteriophage T5 ltf gene.

    Kaliman, A V; Kulshin, V E; Shlyapnikov, M G; Ksenzenko, V N; Kryukov, V M

    1995-06-01

    The nucleotide sequence of the bacteriophage T5 Bg/II-BamHI fragment (4,835 bp in length) known to carry a gene encoding the LTF protein which forms the phage L-shaped tail fibers was determined. It was shown to contain an open reading frame for 1,396 amino acid residues that corresponds to a protein of 147.8 kDa. The coding region of ltf gene is preceded by a typical Shine-Dalgarno sequence. Downstream from the ltf gene there is a strong transcription terminator. Data bank analysis of the LTF protein sequence reveals 55.1% identity to the hypothetical protein ORF 401 of bacteriophage lambda in a segment of 118 amino acids overlap. PMID:7789514

  17. Fluorogenic Labeling of 5-Formylpyrimidine Nucleotides in DNA and RNA.

    Samanta, Biswajit; Seikowski, Jan; Höbartner, Claudia

    2016-01-26

    5-Formylcytosine (5fC) and 5-formyluracil (5fU) are natural nucleobase modifications that are generated by oxidative modification of 5-methylcytosine and thymine (or 5-methyluracil). Herein, we describe chemoselective labeling of 5-formylpyrimidine nucleotides in DNA and RNA by fluorogenic aldol-type condensation reactions with 2,3,3-trimethylindole derivatives. Mild and specific reaction conditions were developed for 5fU and 5fC to produce hemicyanine-like chromophores with distinct photophysical properties. Residue-specific detection was established by fluorescence readout as well as primer-extension assays. The reactions were optimized on DNA oligonucleotides and were equally suitable for the modification of 5fU- and 5fC-modified RNA. This direct labeling approach of 5-formylpyrimidines is expected to help in elucidating the occurrence, enzymatic transformations, and functional roles of these epigenetic/epitranscriptomic nucleobase modifications in DNA and RNA. PMID:26679556

  18. Computational learning on specificity-determining residue-nucleotide interactions

    Wong, Ka-Chun

    2015-11-02

    The protein–DNA interactions between transcription factors and transcription factor binding sites are essential activities in gene regulation. To decipher the binding codes, it is a long-standing challenge to understand the binding mechanism across different transcription factor DNA binding families. Past computational learning studies usually focus on learning and predicting the DNA binding residues on protein side. Taking into account both sides (protein and DNA), we propose and describe a computational study for learning the specificity-determining residue-nucleotide interactions of different known DNA-binding domain families. The proposed learning models are compared to state-of-the-art models comprehensively, demonstrating its competitive learning performance. In addition, we describe and propose two applications which demonstrate how the learnt models can provide meaningful insights into protein–DNA interactions across different DNA binding families.

  19. A nucleotide-level coarse-grained model of RNA

    Šulc, Petr; Ouldridge, Thomas E; Doye, Jonathan P K; Louis, Ard A

    2014-01-01

    We present a new, nucleotide-level model for RNA, oxRNA, based on the coarse-graining methodology recently developed for the oxDNA model of DNA. The model is designed to reproduce structural, mechanical and thermodynamic properties of RNA, and the coarse-graining level aims to retain the relevant physics for RNA hybridization and the structure of single- and double-stranded RNA. In order to explore its strengths and weaknesses, we test the model in a range of nanotechnological and biological settings. Applications explored include the folding thermodynamics of a pseudoknot, the formation of a kissing loop complex, the structure of a hexagonal RNA nanoring, and the unzipping of a hairpin motif. We argue that the model can be used for efficient simulations of the structure of systems with thousands of base pairs, and for the assembly of systems of up to hundreds of base pairs. The source code implementing the model is released for public use.

  20. Computational identification of candidate nucleotide cyclases in higher plants

    Wong, Aloysius Tze

    2013-09-03

    In higher plants guanylyl cyclases (GCs) and adenylyl cyclases (ACs) cannot be identified using BLAST homology searches based on annotated cyclic nucleotide cyclases (CNCs) of prokaryotes, lower eukaryotes, or animals. The reason is that CNCs are often part of complex multifunctional proteins with different domain organizations and biological functions that are not conserved in higher plants. For this reason, we have developed CNC search strategies based on functionally conserved amino acids in the catalytic center of annotated and/or experimentally confirmed CNCs. Here we detail this method which has led to the identification of >25 novel candidate CNCs in Arabidopsis thaliana, several of which have been experimentally confirmed in vitro and in vivo. We foresee that the application of this method can be used to identify many more members of the growing family of CNCs in higher plants. © Springer Science+Business Media New York 2013.