WorldWideScience

Sample records for adjacent rrna nucleotide

  1. The aminoglycoside resistance methyltransferase Sgm impedes RsmF methylation at an adjacent rRNA nucleotide in the ribosomal A site

    Cubrilo, Sonja; Babić, Fedora; Douthwaite, Stephen;

    2009-01-01

    methylated nucleotides including m(4)Cm1402 and m(5)C1407. Modification at m(5)C1407 by the methyltransferase RsmF is impeded as Sgm gains access to its adjacent G1405 target on the 30S ribosomal subunit. An Sgm mutant (G135A), which is impaired in S-adenosylmethionine binding and confers lower resistance......Ribosome-targeting antibiotics block protein synthesis by binding at functionally important regions of the bacterial rRNA. Resistance is often conferred by addition of a methyl group at the antibiotic binding site within an rRNA region that is already highly modified with several nucleotide...... methylations. In bacterial rRNA, each methylation requires its own specific methyltransferase enzyme, and this raises the question as to how an extra methyltransferase conferring antibiotic resistance can be accommodated and how it can gain access to its nucleotide target within a short and functionally...

  2. The nucleotide sequence of 5S rRNA from Mycoplasma capricolum.

    Hori, H; Sawada, M.; Osawa, S; Murao, K; Ishikura, H

    1981-01-01

    The nucleotide sequence of 5S rRNA from Mycoplasma capricolum is UUGGUGGUAUAGCAUAGAGGUCACACCUGUUCCCAUGCCGAACACAGAAGUUAAGCUCUAUUACGGUGAAGAUAUUACU GAUGUGAGAAAAUAGCAAGCUGCCAGUUOH. The length is 107 nucleotides long, and the shortest in all the 5S rRNAs so far known. The sequence is more similar to those of the gram-positive bacteria than those of the gram-negative bacteria.

  3. New bioinformatic tools for analysis of nucleotide modifications in eukaryotic rRNA

    Piekna-Przybylska, Dorota; Decatur, Wayne A.; Fournier, Maurille J.

    2007-01-01

    This report presents a valuable new bioinformatics package for research on rRNA nucleotide modifications in the ribosome, especially those created by small nucleolar RNA:protein complexes (snoRNPs). The interactive service, which is not available elsewhere, enables a user to visualize the positions of pseudouridines, 2′-O-methylations, and base methylations in three-dimensional space in the ribosome and also in linear and secondary structure formats of ribosomal RNA. Our tools provide additio...

  4. YccW is the m5C methyltransferase specific for 23S rRNA nucleotide 1962

    Purta, Elzbieta; O'Connor, Michelle; Bujnicki, Janusz M;

    2008-01-01

    . However, YccW does not methylate assembled 50S subunits, and this is somewhat surprising as the published crystal structures show nucleotide C1962 to be fully accessible at the subunit interface. YccW-directed methylation at nucleotide C1962 is conserved in bacteria, and loss of this methylation in E....... coli marginally reduces its growth rate. YccW had previously eluded identification because it displays only limited sequence similarity to the m(5)C methyltransferases RsmB and RsmF and is in fact more similar to known m(5)U (5-methyluridine) RNA methyltransferases. In keeping with the previously...... proposed nomenclature system for bacterial rRNA methyltransferases, yccW is now designated as the rRNA large subunit methyltransferase gene rlmI....

  5. The conformation of 23S rRNA nucleotide A2058 determines its recognition by the ErmE methyltransferase

    Vester, B; Hansen, L H; Douthwaite, S

    1995-01-01

    it was shown that the A2057 and U2611 mutations alone and in combination alter the reactivity of A2058 and adjacent bases. However, mutagenizing position G-->A2032 in an adjacent loop, which has been implicated to interact with A2058, alters neither the ErmE methylation at A2058 nor the accessibility...... effects of mutations around position A2058 on methylation. Mutagenizing A2058 (to G or U) completely abolishes methylation of 23S rRNA by ErmE. No methylation occurred at other sites in the rRNA, demonstrating the fidelity of ErmE for A2058. Breaking the neighboring G2057-C2611 Watson-Crick base pair by...... introducing either an A2057 or a U2611 mutation, greatly reduces the rate of methylation at A2058. Methylation remains impaired after these mutations have been combined to create a new A2057-U2611 Watson-Crick base interaction. The conformation of this region in 23S rRNA was probed with chemical reagents and...

  6. YgdE is the 2'-O-ribose methyltransferase RlmM specific for nucleotide C2498 in bacterial 23S rRNA

    Purta, Elzbieta; O'Connor, Michelle; Bujnicki, Janusz M;

    2009-01-01

    The rRNAs of Escherichia coli contain four 2'-O-methylated nucleotides. Similar to other bacterial species and in contrast with Archaea and Eukaryota, the E. coli rRNA modifications are catalysed by specific methyltransferases that find their nucleotide targets without being guided by small...... ribosomes. Nucleotide C2498 is situated within a highly conserved and heavily modified rRNA sequence, and YgdE's activity is influenced by other modification enzymes that target this region. Phylogenetically, YgdE is placed in the cluster of orthologous groups COG2933 together with S...... complementary RNAs. We show here that the ygdE gene encodes the methyltransferase that catalyses 2'-O-methylation at nucleotide C2498 in the peptidyl transferase loop of E. coli 23S rRNA. Analyses of rRNAs using MALDI mass spectrometry showed that inactivation of the ygdE gene leads to loss of methylation at...

  7. Methanosarcina acetivorans 16S rRNA and transcription factor nucleotide fluctuation with implications in exobiology and pathology

    Holden, Todd; Tremberger, G., Jr.; Cheung, E.; Subramaniam, R.; Sullivan, R.; Schneider, P.; Flamholz, A.; Marchese, P.; Hiciano, O.; Yao, H.; Lieberman, D.; Cheung, T.

    2008-08-01

    Cultures of the methane-producing archaea Methanosarcina, have recently been isolated from Alaskan sediments. It has been proposed that methanogens are strong candidates for exobiological life in extreme conditions. The spatial environmental gradients, such as those associated with the polygons on Mars' surface, could have been produced by past methanogenesis activity. The 16S rRNA gene has been used routinely to classify phenotypes. Using the fractal dimension of nucleotide fluctuation, a comparative study of the 16S rRNA nucleotide fluctuation in Methanosarcina acetivorans C2A, Deinococcus radiodurans, and E. coli was conducted. The results suggest that Methanosarcina acetivorans has the lowest fractal dimension, consistent with its ancestral position in evolution. Variation in fluctuation complexity was also detected in the transcription factors. The transcription factor B (TFB) was found to have a higher fractal dimension as compared to transcription factor E (TFE), consistent with the fact that a single TFB in Methanosarcina acetivorans can code three different TATA box proteins. The average nucleotide pair-wise free energy of the DNA repair genes was found to be highest for Methanosarcina acetivorans, suggesting a relatively weak bonding, which is consistent with its low prevalence in pathology. Multitasking capacity comparison of type-I and type-II topoisomerases has been shown to correlate with fractal dimension using the methicillin-resistant strain MRSA 252. The analysis suggests that gene adaptation in a changing chemical environment can be measured in terms of bioinformatics. Given that the radiation resistant Deinococcus radiodurans is a strong candidate for an extraterrestrial origin and that the cold temperature Psychrobacter cryohalolentis K5 can function in Siberian permafrost, the fractal dimension comparison in this study suggests that a chemical resistant methanogen could exist in extremely cold conditions (such as that which existed on early

  8. 23S rRNA nucleotides in the peptidyl transferase center are essential for tryptophanase operon induction.

    Yang, Rui; Cruz-Vera, Luis R; Yanofsky, Charles

    2009-06-01

    Distinct features of the ribosomal peptide exit tunnel are known to be essential for recognition of specific amino acids of a nascent peptidyl-tRNA. Thus, a tryptophan residue at position 12 of the peptidyl-tRNA TnaC-tRNA(Pro) leads to the creation of a free tryptophan binding site within the ribosome at which bound tryptophan inhibits normal ribosome functions. The ribosomal processes that are inhibited are hydrolysis of TnaC-tRNA(Pro) by release factor 2 and peptidyl transfer of TnaC of TnaC-tRNA(Pro) to puromycin. These events are normally performed in the ribosomal peptidyl transferase center. In the present study, changes of 23S rRNA nucleotides in the 2585 region of the peptidyl transferase center, G2583A and U2584C, were observed to reduce maximum induction of tna operon expression by tryptophan in vivo without affecting the concentration of tryptophan necessary to obtain 50% induction. The growth rate of strains with ribosomes with either of these changes was not altered appreciably. In vitro analyses with mutant ribosomes with these changes showed that tryptophan was not as efficient in protecting TnaC-tRNA(Pro) from puromycin action as wild-type ribosomes. However, added tryptophan did prevent sparsomycin action as it normally does with wild-type ribosomes. These findings suggest that these two mutational changes act by reducing the ability of ribosome-bound tryptophan to inhibit peptidyl transferase activity rather than by reducing the ability of the ribosome to bind tryptophan. Thus, the present study identifies specific nucleotides within the ribosomal peptidyl transferase center that appear to be essential for effective tryptophan induction of tna operon expression. PMID:19329641

  9. Update on Pneumocystis carinii f. sp. hominis typing based on nucleotide sequence variations in internal transcribed spacer regions of rRNA genes

    Lee, C H; Helweg-Larsen, J; Tang, X; Jin, S; Li, B; Bartlett, M S; Lu, Jingquan; Lundgren, B; Lundgren, J D; Olsson, M; Lucas, Sandra; Roux, P; Cargnel, A; Atzori, C; Matos, O; Smith, J W

    1998-01-01

    Pneumocystis carinii f. sp. hominis isolates from 207 clinical specimens from nine countries were typed based on nucleotide sequence variations in the internal transcribed spacer regions I and II (ITS1 and ITS2, respectively) of rRNA genes. The number of ITS1 nucleotides has been revised from the...... previously reported 157 bp to 161 bp. Likewise, the number of ITS2 nucleotides has been changed from 177 to 192 bp. The number of ITS1 sequence types has increased from 2 to 15, and that of ITS2 has increased from 3 to 14. The 15 ITS1 sequence types are designated types A through O, and the 14 ITS2 types are...... named types a through n. A total of 59 types of P. carinii f. sp. hominis were found in this study....

  10. Development of polymerase chain reaction primer sets for diagnosis of Lyme disease and for species-specific identification of Lyme disease isolates by 16S rRNA signature nucleotide analysis.

    1992-01-01

    We have determined and compared partial 16S rRNA sequences from 23 Lyme disease spirochete isolates and aligned these with 8 sequences previously presented. The 16S rRNA signature nucleotide compositions were defined for each isolate and compared with the genomic species signature nucleotide sets previously established. To identify positions truly indicative of species classification which could serve as targets for polymerase chain reaction species-specific identification primers, 16S rRNA-b...

  11. Mapping important nucleotides in the peptidyl transferase centre of 23 S rRNA using a random mutagenesis approach

    Porse, B T; Garrett, R A

    1995-01-01

    Random mutations were generated in the lower half of the peptidyl transferase loop in domain V of 23 S rRNA from Escherichia coli using a polymerase chain reaction (PCR) approach, a rapid procedure for identifying mutants and a plasmid-based expression system. The effects of 21 single......-site mutations, at 18 different positions, on cell growth, mutant rRNA incorporation into ribosomes and peptidyl transferase activity of the mutant ribosomes were analysed. The general importance of the whole region for the peptidyl transferase centre was emphasized by the finding that 14 of the mutants were...... sick, or very sick, when ribosomes containing chromosomal-encoded 23 S rRNA were inhibited by erythromycin, and all except one of these exhibited low levels of peptidyl transferase activity in their mutated ribosomes. Two mutations, psi 2580-->C and U2584-->G that both yielded inactive ribosomes were...

  12. Single Nucleotide Polymorphism of SSU rRNA Gene among ‎Plasmodium Knowlesi Isolates of Sabah

    Fread Anderios; Daw Khin Saw Naing; Zaw Lin

    2012-01-01

    ackground: ‎The advent of PCR (Polymerase Chain Reaction) assays helped in correctly identifying ‎Plasmodium knowlesi, which was previously misdiagnosed by microscopy as Plasmodium ‎malarie in Sabah, Malaysia. The PCR-based diagnosis of P. knowlesi in Sabah is currently using a ‎set of oligonucleotide primers namely Pmk8 and Pmk9 that target one of the parasite’s small ‎subunit rRNA (SSU rRNA) genes. PCR also helped in discovering a variant form of P. malariae ‎which has a deletion of 19 bp ...

  13. YbeA is the m3Psi methyltransferase RlmH that targets nucleotide 1915 in 23S rRNA

    Purta, Elzbieta; Kaminska, Katarzyna H; Kasprzak, Joanna M;

    2008-01-01

    Pseudouridines in the stable RNAs of Bacteria are seldom subjected to further modification. There are 11 pseudouridine (Psi) sites in Escherichia coli rRNA, and further modification is found only at Psi1915 in 23S rRNA, where the N-3 position of the base becomes methylated. Here, we report the...... identity of the E. coli methyltransferase that specifically catalyzes methyl group addition to form m(3)Psi1915. Analyses of E. coli rRNAs using MALDI mass spectrometry showed that inactivation of the ybeA gene leads to loss of methylation at nucleotide Psi1915. Methylation is restored by complementing the...... knockout strain with a plasmid-encoded copy of ybeA. Homologs of the ybeA gene, and thus presumably the ensuing methylation at nucleotide m(3)Psi1915, are present in most bacterial lineages but are essentially absent in the Archaea and Eukaryota. Loss of ybeA function in E. coli causes a slight slowing of...

  14. Targeting single-nucleotide polymorphisms in the 16S rRNA gene to detect and differentiate Legionella pneumophila and non-Legionella pneumophila species.

    Zhan, Xiao-Yong; Hu, Chao-Hui; Zhu, Qing-Yi

    2016-08-01

    A PCR-based method targeting single-nucleotide polymorphisms (SNPs) in the 16S rRNA gene was developed for differential identification of Legionella pneumophila and non-Legionella pneumophila. Based on the bioinformatics analysis for 176 Legionella 16S rRNA gene fragments of 56 different Legionella species, a set of SNPs, A(628)C(629) was found to be highly specific to L. pneumophila strains. A multiplex assay was designed that was able to distinguish sites with limited sequence heterogeneity between L. pneumophila and non-L. pneumophila in the targeted 16S rRNA gene. The assay amplified a 261-bp amplicon for Legionella spp. and a set of 203- and 97-bp amplicons only specific to L. pneumophila species. Among 49 ATCC strains and 284 Legionella isolates from environmental water and clinical samples, 100 % of L. pneumophila and non-L. pneumophila strains were correctly identified and differentiated by this assay. The assay presents a more rapid, sensitive and alternative method to the currently available PCR-sequencing detection and differentiation method. PMID:27112927

  15. Identification of 5-hydroxycytidine at position 2501 concludes characterization of modified nucleotides in E. coli 23S rRNA

    Havelund, Jesper Foged; Giessing, Anders Michael Bernth; Hansen, Trine Møller;

    2011-01-01

    modification as 5-hydroxycytidine-a novel modification in RNA. Identification of 5-hydroxycytidine was completed by liquid chromatography under nonoxidizing conditions using a graphitized carbon stationary phase in combination with ion trap tandem mass spectrometry and by comparing the fragmentation behavior...... rRNA-has previously been characterized in the bacterium Escherichia coli. Despite a first report nearly 20 years ago, the chemical nature of the modification at position 2501 has remained elusive, and attempts to isolate it have so far been unsuccessful. We unambiguously identify this last unknown...... of the natural nucleoside with that of a chemically synthesized ditto. Furthermore, we show that 5-hydroxycytidine is also present in the equivalent position of 23S rRNA from the bacterium Deinococcus radiodurans. Given the unstable nature of 5-hydroxycytidine, this modification might be found in...

  16. Bimodal agonism: a new desensitization in a cyclic nucleotide-gated channel is coordinated by two adjacent binding domains

    Chan, Kerry (Siu Cheong)

    2008-01-01

    Cyclic nucleotide-gated (CNG) channels are activated by direct binding of cyclic nucleotide (CN) to the binding domain (BD). How CN binding is coupled to channel opening remains unresolved. Bimodal agonism is found in the catfish olfactory CNGA2 subtype when cGMP is the agonist: initial cGMP binding events activate the channel while additional cGMP binding events deactivate the channel. The C-terminal region of the BD was previously shown to determine ligand selectivity and efficacy; therefor...

  17. Modified nucleotides m2G966/m5C967 of Escherichia coli 16S rRNA are required for attenuation of tryptophan operon

    Prokhorova, Irina V.; Osterman, Ilya A.; Burakovsky, Dmitry E.; Serebryakova, Marina V.; Galyamina, Maria A.; Pobeguts, Olga V.; Altukhov, Ilya; Kovalchuk, Sergey; Alexeev, Dmitry G.; Govorun, Vadim M.; Bogdanov, Alexey A.; Sergiev, Petr V.; Dontsova, Olga A

    2013-01-01

    Ribosomes contain a number of modifications in rRNA, the function of which is unclear. Here we show – using proteomic analysis and dual fluorescence reporter in vivo assays – that m2G966 and m5C967 in 16S rRNA of Escherichia coli ribosomes are necessary for correct attenuation of tryptophan (trp) operon. Expression of trp operon is upregulated in the strain where RsmD and RsmB methyltransferases were deleted, which results in the lack of m2G966 and m5C967 modifications. The upregulation requi...

  18. Negative in vitro selection identifies the rRNA recognition motif for ErmE methyltransferase

    Nielsen, A K; Douthwaite, S; Vester, B

    1999-01-01

    the adjacent single-stranded region around A2058. An RNA transcript of 72 nt that displays this motif functions as an efficient substrate for the ErmE methyltransferase. Pools of degenerate RNAs were formed by doping 34-nt positions that extend over and beyond the putative Erm recognition motif within...... contained substitutions at single sites, and these are confined to 12 nucleotide positions. These nucleotides, corresponding to A2051-A2060, C2611, and A2614 in 23S rRNA, presumably comprise the RNA recognition motif for ErmE methyltransferase. The structure formed by these nucleotides is highly conserved...

  19. Modified nucleotides m2G966/m5C967 of Escherichia coli 16S rRNA are required for attenuation of tryptophan operon

    Prokhorova, Irina V.; Osterman, Ilya A.; Burakovsky, Dmitry E.; Serebryakova, Marina V.; Galyamina, Maria A.; Pobeguts, Olga V.; Altukhov, Ilya; Kovalchuk, Sergey; Alexeev, Dmitry G.; Govorun, Vadim M.; Bogdanov, Alexey A.; Sergiev, Petr V.; Dontsova, Olga A.

    2013-11-01

    Ribosomes contain a number of modifications in rRNA, the function of which is unclear. Here we show - using proteomic analysis and dual fluorescence reporter in vivo assays - that m2G966 and m5C967 in 16S rRNA of Escherichia coli ribosomes are necessary for correct attenuation of tryptophan (trp) operon. Expression of trp operon is upregulated in the strain where RsmD and RsmB methyltransferases were deleted, which results in the lack of m2G966 and m5C967 modifications. The upregulation requires the trpL attenuator, but is independent of the promotor of trp operon, ribosome binding site of the trpE gene, which follows trp attenuator and even Trp codons in the trpL sequence. Suboptimal translation initiation efficiency in the rsmB/rsmD knockout strain is likely to cause a delay in translation relative to transcription which causes misregulation of attenuation control of trp operon.

  20. Modified nucleotides m(2)G966/m(5)C967 of Escherichia coli 16S rRNA are required for attenuation of tryptophan operon.

    Prokhorova, Irina V; Osterman, Ilya A; Burakovsky, Dmitry E; Serebryakova, Marina V; Galyamina, Maria A; Pobeguts, Olga V; Altukhov, Ilya; Kovalchuk, Sergey; Alexeev, Dmitry G; Govorun, Vadim M; Bogdanov, Alexey A; Sergiev, Petr V; Dontsova, Olga A

    2013-01-01

    Ribosomes contain a number of modifications in rRNA, the function of which is unclear. Here we show--using proteomic analysis and dual fluorescence reporter in vivo assays--that m(2)G966 and m(5)C967 in 16S rRNA of Escherichia coli ribosomes are necessary for correct attenuation of tryptophan (trp) operon. Expression of trp operon is upregulated in the strain where RsmD and RsmB methyltransferases were deleted, which results in the lack of m(2)G966 and m(5)C967 modifications. The upregulation requires the trpL attenuator, but is independent of the promotor of trp operon, ribosome binding site of the trpE gene, which follows trp attenuator and even Trp codons in the trpL sequence. Suboptimal translation initiation efficiency in the rsmB/rsmD knockout strain is likely to cause a delay in translation relative to transcription which causes misregulation of attenuation control of trp operon. PMID:24241179

  1. Ribosomal proteins L11 and L10.(L12)4 and the antibiotic thiostrepton interact with overlapping regions of the 23 S rRNA backbone in the ribosomal GTPase centre

    Rosendahl, G; Douthwaite, S

    1993-01-01

    23 S rRNA. Within the ribosome, L11 also interacts with this rRNA region, although the protection effects are subtly different and extend to nucleotide 1098. The pentameric r-protein complex L10.(L12)4 binds to an adjacent site on the rRNA, protecting riboses at positions 1043, 1046 to 1049, 1053 to...... by L10.(L12)4 and other proteins within the ribosome. The antibiotics thiostrepton and micrococcin inhibit the catalytic functions of this region by slotting in between the accessible loops and interacting with nucleotides there....

  2. Isolation and Characterization of Lactococcus garvieae from Diseased Rainbow Trout (Oncorhynchus mykiss, Walbaum Cultured in Northern Iran Based on the Nucleotide Sequences of the 16s rRNA Gene

    Milad ADEL

    2014-08-01

    Full Text Available This study was done to determine the molecular and biochemical identification of some causative agents of lactococcosis in farmed rainbow trout in Mazandaran provenience (northern Iran. A total of 200 moribund rainbow trout, suspected of lactococcosis from 10 rainbow trout farms in Mazandaran province, were collected during spring 2012 to winter 2012. Sampling was done from the kidney, spleen, liver and brain and cultured aseptically onto brain heart infusion (BHI agar plates and incubated at 25 °C for 24 - 48 h. Results of bacteriological cultures of these organs showed 19 % Lactococcus garvieae (38 fish, 9 % Streptococcus spp., (18 fish, 17 % Yersinia spp. (36 fish, and 55 % of fish were culture negative. The PCR assay was developed based on the 16s rRNA gene of L. garvieae for the rapid and specific detection and identification of this pathogen from different sources. Two pairs of primers were designed based on the nucleotide sequences of the 16s rRNA gene of L. garvieae. After PCR assay on isolated bacterial colonies, DNAs extracted from 38 L. garvieae gave the expected 1107 bp PCR fragment of 16S rDNA sequences, which is specific for L. garvieae. The results of this study suggest the use of molecular methods along with current biochemical methods are effective diagnostic tools in the identification of L. garvieae. The combination of these methods for diagnosis of other bacterial disease is recommended.

  3. Complementary Roles of Yeast Rad4p and Rad34p in Nucleotide Excision Repair of Active and Inactive rRNA Gene Chromatin▿

    Tremblay, Maxime; Teng, Yumin; Paquette, Michel; Waters, Raymond; Conconi, Antonio

    2008-01-01

    Nucleotide excision repair (NER) removes a plethora of DNA lesions. It is performed by a large multisubunit protein complex that finds and repairs damaged DNA in different chromatin contexts and nuclear domains. The nucleolus is the most transcriptionally active domain, and in yeast, transcription-coupled NER occurs in RNA polymerase I-transcribed genes (rDNA). Here we have analyzed the roles of two members of the xeroderma pigmentosum group C family of proteins, Rad4p and Rad34p, during NER ...

  4. Specificity shifts in the rRNA and tRNA nucleotide targets of archaeal and bacterial m5U methyltransferases

    Auxilien, Sylvie; Rasmussen, Anette; Rose, Simon;

    2011-01-01

    Methyltransferase enzymes that use S-adenosylmethionine as a cofactor to catalyze 5-methyl uridine (m(5)U) formation in tRNAs and rRNAs are widespread in Bacteria and Eukaryota, but are restricted to the Thermococcales and Nanoarchaeota groups amongst the Archaea. The RNA m(5)U methyltransferases...... appear to have arisen in Bacteria and were then dispersed by horizontal transfer of an rlmD-type gene to the Archaea and Eukaryota. The bacterium Escherichia coli has three gene paralogs and these encode the methyltransferases TrmA that targets m(5)U54 in tRNAs, RlmC (formerly RumB) that modifies m(5)U......, however, neither of the two P. abyssi enzymes displays RlmD-like activity in vitro. PAB0719 acts in a TrmA-like manner to catalyze m(5)U54 methylation in P. abyssi tRNAs, and here we show that PAB0760 possesses RlmC-like activity and specifically methylates the nucleotide equivalent to U747 in P. abyssi...

  5. Primary and secondary structures of Tetrahymena and aphid 5.8S rRNAs: structural features of 5.8S rRNA which interacts with the 28S rRNA containing the hidden break.

    Fujiwara, H.; H. Ishikawa

    1982-01-01

    The Tetrahymena 5.8S rRNA is 154 nucleotides long, the shortest so far reported except for the split 5.8S rRNAs of Diptera (m5.8S plus 2S rRNA). In this molecule several nucleotides are deleted in the helix e (GC-rich stem) region. Upon constructing the secondary structure in accordance with "burp-gun" model, the Tetrahymena 5.8S rRNA forms a wide-open "muzzle" of the terminal regions due to both extra nucleotides and several unpaired bases. The aphid 5.8S rRNA consists of 161 nucleotides and...

  6. Nucleotide Metabolism

    Martinussen, Jan; Willemoës, M.; Kilstrup, Mogens

    2011-01-01

    Metabolic pathways are connected through their utilization of nucleotides as supplier of energy, allosteric effectors, and their role in activation of intermediates. Therefore, any attempt to exploit a given living organism in a biotechnological process will have an impact on nucleotide metabolis...

  7. Fragmentations of the large-subunit rRNA in the family Rhizobiaceae.

    Selenska-Pobell, S; Evguenieva-Hackenberg, E

    1995-01-01

    A 130-nucleotide-long rRNA species corresponding to the 5' end of the 23S rRNA gene was found in 96 strains belonging to different Rhizobium, Bradyrhizobium, and Agrobacterium species. Additional fragmentation in the central region of the large-subunit rRNA occurred in all agrobacteria, except Agrobacterium vitis, and in most Rhizobium leguminosarum and Rhizobium etli strains but did not occur in any of the other rhizobia and bradyrhizobia studied.

  8. Sites of interaction of streptogramin A and B antibiotics in the peptidyl transferase loop of 23 S rRNA and the synergism of their inhibitory mechanisms

    Porse, B T; Garrett, R A

    1999-01-01

    nucleotides in the peptidyl transferase loop of 23 S rRNA, including the two mutated nucleotides. An rRNA footprinting study, performed both in vivo and in vitro, on the A and B components complexed to Bacillus megaterium ribosomes, indicated that similar drug-induced effects occur on free ribosomes and...

  9. The tylosin resistance gene tlrB of Streptomyces fradiae encodes a methyltransferase that targets G748 in 23S rRNA

    Liu, M; Kirpekar, F; Van Wezel, G P;

    2000-01-01

    Streptomyces species indicates that in vivo TlrB modifies nucleotide G748 within helix 35 of 23S rRNA. Purified recombinant TlrB retains its activity and specificity in vitro and modifies G748 in 23S rRNA as well as in a 74 nucleotide RNA containing helix 35 and surrounding structures. Modification is...

  10. rRNA fragmentation induced by a yeast killer toxin.

    Kast, Alene; Klassen, Roland; Meinhardt, Friedhelm

    2014-02-01

    Virus like dsDNA elements (VLE) in yeast were previously shown to encode the killer toxins PaT and zymocin, which target distinct tRNA species via specific anticodon nuclease (ACNase) activities. Here, we characterize a third member of the VLE-encoded toxins, PiT from Pichia inositovora, and identify PiOrf4 as the cytotoxic subunit by conditional expression in Saccharomyces cerevisiae. In contrast to the tRNA targeting toxins, however, neither a change of the wobble uridine modification status by introduction of elp3 or trm9 mutations nor tRNA overexpression rescued from PiOrf4 toxicity. Consistent with a distinct RNA target, expression of PiOrf4 causes specific fragmentation of the 25S and 18S rRNA. A stable cleavage product comprising the first ∼ 130 nucleotides of the 18S rRNA was purified and characterized by linker ligation and subsequent reverse transcription; 3'-termini were mapped to nucleotide 131 and 132 of the 18S rRNA sequence, a region showing some similarity to the anticodon loop of tRNA(Glu)(UUC), the zymocin target. PiOrf4 residues Glu9 and His214, corresponding to catalytic sites Glu9 and His209 in the ACNase subunit of zymocin are essential for in vivo toxicity and rRNA fragmentation, raising the possibility of functionally conserved RNase modules in both proteins. PMID:24308908

  11. Mutations in the 16S rRNA Genes of Helicobacter pylori Mediate Resistance to Tetracycline

    Trieber, Catharine A.; Taylor, Diane E.

    2002-01-01

    Low-cost and rescue treatments for Helicobacter pylori infections involve combinations of several drugs including tetracycline. Resistance to tetracycline has recently emerged in H. pylori. The 16S rRNA gene sequences of two tetracycline-resistant clinical isolates (MIC = 64 μg/ml) were determined and compared to the consensus H. pylori 16S rRNA sequence. One isolate had four nucleotide substitutions, and the other had four substitutions and two deletions. Natural transformation with the 16S ...

  12. 16S rRNA Mutation Associated with Tetracycline Resistance in a Gram-Positive Bacterium

    Ross, Jeremy I.; Eady, E Anne; Cove, Jonathan H.; Cunliffe, William J.

    1998-01-01

    A genetic basis for tetracycline resistance in cutaneous propionibacteria was suggested by comparing the nucleotide sequences of the 16S rRNA genes from 16 susceptible and 21 resistant clinical isolates and 6 laboratory-selected tetracycline-resistant mutants of a susceptible strain. Fifteen clinical isolates resistant to tetracycline were found to have cytosine instead of guanine at a position cognate with Escherichia coli 16S rRNA base 1058 in a region important for peptide chain terminatio...

  13. Primary and secondary structure of 5.8S rRNA from the silkgland of Bombyx mori.

    Fujiwara, H.; Kawata, Y.; H. Ishikawa

    1982-01-01

    Nucleotide sequence of 5.8S rRNA of the silkworm, Bombyx mori has been determined by gel sequencing methods. The 5.8S rRNA was the longest so far reported, with the 5'-terminal sequence several nucleotides longer than those of the other organisms. Upon constructing the secondary structure in accordance with the "burp gun" model (12), the Bombyx 5.8S rRNA formed a wide-open "muzzle" due to several unpaired bases at the ends. The overall structure also appeared less stable with less G . C pairs...

  14. Adjacent segment disease.

    Virk, Sohrab S; Niedermeier, Steven; Yu, Elizabeth; Khan, Safdar N

    2014-08-01

    EDUCATIONAL OBJECTIVES As a result of reading this article, physicians should be able to: 1. Understand the forces that predispose adjacent cervical segments to degeneration. 2. Understand the challenges of radiographic evaluation in the diagnosis of cervical and lumbar adjacent segment disease. 3. Describe the changes in biomechanical forces applied to adjacent segments of lumbar vertebrae with fusion. 4. Know the risk factors for adjacent segment disease in spinal fusion. Adjacent segment disease (ASD) is a broad term encompassing many complications of spinal fusion, including listhesis, instability, herniated nucleus pulposus, stenosis, hypertrophic facet arthritis, scoliosis, and vertebral compression fracture. The area of the cervical spine where most fusions occur (C3-C7) is adjacent to a highly mobile upper cervical region, and this contributes to the biomechanical stress put on the adjacent cervical segments postfusion. Studies have shown that after fusion surgery, there is increased load on adjacent segments. Definitive treatment of ASD is a topic of continuing research, but in general, treatment choices are dictated by patient age and degree of debilitation. Investigators have also studied the risk factors associated with spinal fusion that may predispose certain patients to ASD postfusion, and these data are invaluable for properly counseling patients considering spinal fusion surgery. Biomechanical studies have confirmed the added stress on adjacent segments in the cervical and lumbar spine. The diagnosis of cervical ASD is complicated given the imprecise correlation of radiographic and clinical findings. Although radiological and clinical diagnoses do not always correlate, radiographs and clinical examination dictate how a patient with prolonged pain is treated. Options for both cervical and lumbar spine ASD include fusion and/or decompression. Current studies are encouraging regarding the adoption of arthroplasty in spinal surgery, but more long

  15. Pseudoknot in domain II of 23 S rRNA is essential for ribosome function

    Rosendahl, G; Hansen, L H; Douthwaite, S

    1995-01-01

    reveals increased accessibility in the rRNA structure close to the sites of the mutations. The degree to which the mutations increase rRNA accessibility correlates with the severity of their phenotypic effects. Nucleotide 1131G is extremely reactive to dimethyl sulphate modification in wild-type subunits......The structure of domain II in all 23 S (and 23 S-like) rRNAs is constrained by a pseudoknot formed between nucleotides 1005 and 1138, and between 1006 and 1137 (Escherichia coli numbering). These nucleotides are exclusively conserved as 1005C.1138G and 1006C.1137G pairs in all Bacteria, Archaea and...... chloroplasts, whereas 1005G.1138C and 1006U.1137A pairs occur in Eukarya. We have mutagenized nucleotides 1005C-->G, 1006C-->U, 1137G-->A and 1138G-->C, both individually and in combinations, in a 23 S rRNA gene from the bacterium E. coli. The ability of 23 S rRNA to support cell growth is reduced when either...

  16. Gordian adjacency for torus knots

    Feller, Peter

    2013-01-01

    A knot K is called Gordian adjacent to a knot L if there exists an unknotting sequence for L containing K. We provide a sufficient condition for Gordian adjacency of torus knots via the study of knots in the thickened torus. We also completely describe Gordian adjacency for torus knots of index 2 and 3 using Levine-Tristram signatures as obstructions to Gordian adjacency. Finally, Gordian adjacency for torus knots is compared to the notion of adjacency for plane curve singularities.

  17. Interaction of the tylosin-resistance methyltransferase RlmA II at its rRNA target differs from the orthologue RlmA I

    Douthwaite, Stephen; Jakobsen, Lene; Yoshizawa, Satoko;

    2008-01-01

    footprint contacts with nucleotides in stem-loops 33, 34 and 35, and does not interact elsewhere in the rRNA. Binding of RlmA(II) to the rRNA is dependent on the cofactor S-adenosylmethionine (or S-adenosylhomocysteine). RlmA(II) interacts with the same rRNA region as the orthologous enzyme RlmA(I) that...

  18. Recognition determinants for proteins and antibiotics within 23S rRNA

    Douthwalte, S; Voldborg, Bjørn Gunnar Rude; Hansen, Lykke Haastrup;

    1995-01-01

    Ribosomal RNAs fold into phylogenetically conserved secondary and tertiary structures that determine their function in protein synthesis. We have investigated Escherichia coli 23S rRNA to identify structural elements that interact with antibiotic and protein ligands. Using a combination of...... molecular genetic and biochemical probing techniques, we have concentrated on regions of the rRNA that are connected with specific functions. These are located in different domains within the 23S rRNA and include the ribosomal GTPase-associated center in domain II, which contains the binding sites for r......-proteins L10.(L12)4 and L11 and is inhibited by interaction with the antibiotic thiostrepton. The peptidyltransferase center within domain V is inhibited by macrolide, lincosamide, and streptogramin B antibiotics, which interact with the rRNA around nucleotide A2058. Drug resistance is conferred by mutations...

  19. Macrolide-ketolide inhibition of MLS-resistant ribosomes is improved by alternative drug interaction with domain II of 23S rRNA

    Douthwaite, S; Hansen, L H; Mauvais, P

    2000-01-01

    The macrolide antibiotic erythromycin and its 6-O-methyl derivative (clarithromycin) bind to bacterial ribosomes primarily through interactions with nucleotides in domains II and V of 23S rRNA. The domain II interaction occurs between nucleotide A752 and the macrolide 3-cladinose moiety. Removal ...

  20. Insights into the structure, function and evolution of the radical-SAM 23S rRNA methyltransferase Cfr that confers antibiotic resistance in bacteria

    Karminska, K. H.; Purta, E.; Hansen, L .H.; Bujnicki, J. M.; Vester, B.; Long, Katherine

    2010-01-01

    The Cfr methyltransferase confers combined resistance to five classes of antibiotics that bind to the peptidyl tranferase center of bacterial ribosomes by catalyzing methylation of the C-8 position of 23S rRNA nucleotide A2503. The same nucleotide is targeted by the housekeeping methyltransferase...

  1. Domain V of 23S rRNA contains all the structural elements necessary for recognition by the ErmE methyltransferase

    Vester, B; Douthwaite, S

    1994-01-01

    enzyme efficiently modifies 23S rRNA in vitro. Removal of most of the 23S rRNA structure, so that only domain V (nucleotides 2000 to 2624) remains, does not affect the efficiency of modification by the methyltransferase. In addition, modification still occurs after the rRNA tertiary structure has been......The ErmE methyltransferase from the erythromycin-producing actinomycete Saccharopolyspora erythraea dimethylates the N-6 position of adenine 2058 in domain V of 23S rRNA. This modification confers resistance to erythromycin and to other macrolide, lincosamide, and streptogramin B antibiotics. We...

  2. Altered features in the secondary structure of Vicia faba 5.8s rRNA.

    Nazar, R N; Wildeman, A G

    1981-01-01

    We have re-examined the nucleotide sequence of Vicia faba (broad bean) 5.8S rRNA using partial chemical degradation and a new approach to high temperature (65-80 degrees C) sequencing gels. The results indicate that the secondary structure was not completely disrupted in previous studies (Tanaka, Y., Dyer, T.A. and Brownlee, G.G. (1980) Nucleic Acid Res. 8, 1259-1272) and explain ambiguities between the nucleotide sequence and T1 ribonuclease digests. Despite this revision, estimates in the s...

  3. Piperidine nucleosides and nucleotides

    Kovačková, Soňa; Dračínský, Martin; Rosenberg, Ivan; Rejman, Dominik

    Lyon : Université de Lyon, 2010, s. 315-316. [International Roundtable on Nucleosides, Nucleotides and Nucleic Acids. IRT 2010. Lyon (FR), 29.08.2010-03.09.2010] Institutional research plan: CEZ:AV0Z40550506 Keywords : phosphonate analogs * piperidine nucleosides * piperidine nucleotides Subject RIV: CC - Organic Chemistry http://irt2010.univ-lyon1.fr

  4. Main: Nucleotide Analysis [KOME

    Full Text Available Nucleotide Analysis PLACE search result Result of signal search against PLACE : cis-acting regul ... atory DNA elements Database ... kome_place_search_result.zip kome_place_search_res ...

  5. Main: Nucleotide Analysis [KOME

    Full Text Available Nucleotide Analysis Japonica genome blast search result Result of blastn search against japonica genome... sequence kome_japonica_genome_blast_search_result.zip kome_japonica_genome_blast_search_result ...

  6. Main: Nucleotide Analysis [KOME

    Full Text Available Nucleotide Analysis Indica genome blast search result Result of blastn search against Indica genome... sequence (top hit only) kome_indica_genome_blast_search_result.zip kome_indica_genome_blast_search_result ...

  7. Main: Nucleotide Analysis [KOME

    Full Text Available Nucleotide Analysis GenBank blastx search ... result Result of blastx search ... against GenBank amino a ... cid sequence kome_genbank_blastx_search _result.zip kome_genbank_blastx_search _result ...

  8. Main: Nucleotide Analysis [KOME

    Full Text Available Nucleotide Analysis GenBank blastn search ... result Result of blastn search ... against GenBank nucleot ... ide sequence kome_genbank_blastn_search _result.zip kome_genbank_blastn_search _result ...

  9. Nucleotide diversity in gorillas.

    Yu, Ning; Jensen-Seaman, Michael I.; Chemnick, Leona; Ryder, Oliver; Li, Wen-Hsiung

    2004-01-01

    Comparison of the levels of nucleotide diversity in humans and apes may provide valuable information for inferring the demographic history of these species, the effect of social structure on genetic diversity, patterns of past migration, and signatures of past selection events. Previous DNA sequence data from both the mitochondrial and the nuclear genomes suggested a much higher level of nucleotide diversity in the African apes than in humans. Noting that the nuclear DNA data from the apes we...

  10. Sequence of the chloroplast 16S rRNA gene and its surrounding regions of Chlamydomonas reinhardii.

    Dron, M; Rahire, M; Rochaix, J D

    1982-01-01

    The sequence of a 2 kb DNA fragment containing the chloroplast 16S ribosomal RNA gene from Chlamydomonas reinhardii and its flanking regions has been determined. The algal 16S rRNA sequence (1475 nucleotides) and secondary structure are highly related to those found in bacteria and in the chloroplasts of higher plants. In contrast, the flanking regions are very different. In C. reinhardii the 16S rRNA gene is surrounded by AT rich segments of about 180 bases, which are followed by a long stre...

  11. Technologically important extremophile 16S rRNA sequence Shannon entropy and fractal property comparison with long term dormant microbes

    Holden, Todd; Gadura, N.; Dehipawala, S.; Cheung, E.; Tuffour, M.; Schneider, P.; Tremberger, G., Jr.; Lieberman, D.; Cheung, T.

    2011-10-01

    Technologically important extremophiles including oil eating microbes, uranium and rocket fuel perchlorate reduction microbes, electron producing microbes and electrode electrons feeding microbes were compared in terms of their 16S rRNA sequences, a standard targeted sequence in comparative phylogeny studies. Microbes that were reported to have survived a prolonged dormant duration were also studied. Examples included the recently discovered microbe that survives after 34,000 years in a salty environment while feeding off organic compounds from other trapped dead microbes. Shannon entropy of the 16S rRNA nucleotide composition and fractal dimension of the nucleotide sequence in terms of its atomic number fluctuation analyses suggest a selected range for these extremophiles as compared to other microbes; consistent with the experience of relatively mild evolutionary pressure. However, most of the microbes that have been reported to survive in prolonged dormant duration carry sequences with fractal dimension between 1.995 and 2.005 (N = 10 out of 13). Similar results are observed for halophiles, red-shifted chlorophyll and radiation resistant microbes. The results suggest that prolonged dormant duration, in analogous to high salty or radiation environment, would select high fractal 16S rRNA sequences. Path analysis in structural equation modeling supports a causal relation between entropy and fractal dimension for the studied 16S rRNA sequences (N = 7). Candidate choices for high fractal 16S rRNA microbes could offer protection for prolonged spaceflights. BioBrick gene network manipulation could include extremophile 16S rRNA sequences in synthetic biology and shed more light on exobiology and future colonization in shielded spaceflights. Whether the high fractal 16S rRNA sequences contain an asteroidlike extra-terrestrial source could be speculative but interesting.

  12. Renibacterium salmoninarum isolates from different sources possess two highly conserved copies of the rRNA operon .

    Grayson, T H; Alexander, S M; Cooper, L F; Gilpin, M L

    2000-07-01

    The nucleotide sequences of the rRNA genes and the 5' flanking region were determined for R. salmoninarum ATCC 33209T from overlapping products generated by PCR amplification from the genomic DNA. Comparison of the sequences with rRNA genes from a variety of bacteria demonstrated the close relatedness between R. salmoninarum and the high G+C group of the actinobacteria, in particular, Arthrobacter species. A regulatory element within the 5' leader of the rRNA operon was identical to an element, CL2, described for mycobacteria. PCR, DNA sequence analysis, and DNA hybridisation were performed to examine variation between isolates from diverse sources which represented the four 16S-23S rRNA intergenic spacer sequevars previously described for R. salmoninarum. Two 23S-5S rRNA intergenic spacer sequevars of identical length were found. DNA hybridisation using probes complementary to 23S rDNA and 16S rDNA identified two rRNA operons which were identical or nearly identical amongst 40 isolates sourced from a variety of countries. PMID:11016696

  13. Piperidine nucleosides and nucleotides

    Kovačková, Soňa; Pačes, Ondřej; Dračínský, Martin; Rosenberg, Ivan; Rejman, Dominik

    Manchester : University of Manchester, 2009. s. 50-50. [Nucleic Acids at the Chemistry - Biology Interface. 07.09.2009-08.09.2009, Manchester] R&D Projects: GA MZd NR9138; GA MŠk 2B06065 Institutional research plan: CEZ:AV0Z40550506 Keywords : phosphonate * piperidine nucleosides * nucleotides Subject RIV: CC - Organic Chemistry

  14. Effect of mutations in the A site of 16 S rRNA on aminoglycoside antibiotic-ribosome interaction

    Recht, M I; Douthwaite, S; Dahlquist, K D;

    1999-01-01

    Decoding of genetic information occurs upon interaction of an mRNA codon-tRNA anticodon complex with the small subunit of the ribosome. The ribosomal decoding region is associated with highly conserved sequences near the 3' end of 16 S rRNA. The decoding process is perturbed by the aminoglycoside...... of universally conserved nucleotides at 1406 to 1408 and 1494 to 1495 in the decoding region of plasmid-encoded bacterial 16 S rRNA. Phenotypic changes range from the benign effect of U1406-->A or A1408-->G substitutions, to the highly deleterious 1406G and 1495 mutations that assemble into 30 S subunits...... but are defective in forming functional ribosomes. Changes in the local conformation of the decoding region caused by these mutations were identified by chemical probing of isolated 30 S subunits. Ribosomes containing 16 S rRNA with mutations at positions 1408, 1407+1494, or 1495 had reduced affinity...

  15. Phylogenetic relationships of Salmonella based on rRNA sequences

    Christensen, H.; Nordentoft, Steen; Olsen, J.E.

    1998-01-01

    separated by 16S rRNA analysis and found to be closely related to the Escherichia coli and Shigella complex by both 16S and 23S rRNA analyses. The diphasic serotypes S. enterica subspp. I and VI were separated from the monophasic serotypes subspp. IIIa and IV, including S. bongori, by 23S rRNA sequence...

  16. Piperidine nucleosides and nucleotides

    Kovačková, Soňa; Pačes, Ondřej; Dračínský, Martin; Rosenberg, Ivan; Rejman, Dominik

    -, č. 52 (2008), s. 587-587. ISSN 0261-3166. [Joint Symposium of the International Roundtable on Nucleosides, Nucleotides and Nucleic Acids /18./ and the International Symposium on Nucleic Acid Chemistry /35./. Kyoto, 08.09.2008-12.09.2008] R&D Projects: GA MŠk(CZ) LC06077; GA MŠk 2B06065; GA MŠk LC512 Grant ostatní: GA MZd(CZ) NR9138 Institutional research plan: CEZ:AV0Z40550506 Keywords : piperidine * nucleosidation * phosphonate Subject RIV: CC - Organic Chemistry

  17. Single Nucleotide Polymorphism

    Børsting, Claus; Pereira, Vania; Andersen, Jeppe Dyrberg;

    2014-01-01

    Single nucleotide polymorphisms (SNPs) are the most frequent DNA sequence variations in the genome. They have been studied extensively in the last decade with various purposes in mind. In this chapter, we will discuss the advantages and disadvantages of using SNPs for human identification and...... briefly describe the methods that are preferred for SNP typing in forensic genetics. In addition, we will illustrate how SNPs can be used as investigative leads in the police investigation by discussing the use of ancestry informative markers and forensic DNA phenotyping. Modern DNA sequencing...

  18. Template polymerization of nucleotide analogues

    Orgel, L. E.

    1991-01-01

    Recent work on the template-directed reactions of the natural D-nucleotides has made it clear that l-nucleotides and nucleotide-like derivatives of other sugars would strongly inhibit the formation of long oligonucleotides. Consequently, attention is focusing on molecules simpler than nucleotides that might have acted as monomers of an information transfer system. We have begun a general exploration of the template directed reactions of diverse peptide analogues. I will present work by Dr. Taifeng Wu on oxidative oligomerization of phosphorothioates and of Dr. Mary Tohidi on the cyclic polymerization of nucleoside and related cyclic pyrophosphates.

  19. Downregulation of rRNA Transcription Triggers Cell Differentiation

    Yuki Hayashi; Takao Kuroda; Hiroyuki Kishimoto; Changshan Wang; Atsushi Iwama; Keiji Kimura

    2014-01-01

    Responding to various stimuli is indispensable for the maintenance of homeostasis. The downregulation of ribosomal RNA (rRNA) transcription is one of the mechanisms involved in the response to stimuli by various cellular processes, such as cell cycle arrest and apoptosis. Cell differentiation is caused by intra- and extracellular stimuli and is associated with the downregulation of rRNA transcription as well as reduced cell growth. The downregulation of rRNA transcription during differentiati...

  20. Adjacent Nucleotide Dependence in ncRNA and Order-1 SCFG for ncRNA Identification

    Wong, Thomas K. F.; Lam, Tak-Wah; Sung, Wing-Kin; Yiu, Siu-Ming

    2010-01-01

    Background: Non-coding RNAs (ncRNAs) are known to be involved in many critical biological processes, and identification of ncRNAs is an important task in biological research. A popular software, Infernal, is the most successful prediction tool and exhibits high sensitivity. The application of Infernal has been mainly focused on small suspected regions. We tried to apply Infernal on a chromosome level; the results have high sensitivity, yet contain many false positives. Further enhancing Infer...

  1. Interconversion of active and inactive 30 S ribosomal subunits is accompanied by a conformational change in the decoding region of 16 S rRNA

    Moazed, D; Van Stolk, B J; Douthwaite, S;

    1986-01-01

    Zamir, Elson and their co-workers have shown that 30 S ribosomal subunits are reversibly inactivated by depletion of monovalent or divalent cations. We have re-investigated the conformation of 16 S rRNA in the active and inactive forms of the 30 S subunit, using a strategy that is designed......' regions of 16 S rRNA. The inactive form also shows significantly decreased reactivity at positions 1533 to 1538 (the Shine-Dalgarno region), in agreement with earlier findings. The principal changes in reactivity involve the universally conserved nucleotides G926, C1395, A1398 and G1401. The three purines...

  2. Interactions of the TnaC nascent peptide with rRNA in the exit tunnel enable the ribosome to respond to free tryptophan

    Martínez, Allyson K.; GORDON, EMILY; Sengupta, Arnab; Shirole, Nitin; Klepacki, Dorota; Martinez-Garriga, Blanca; Brown, Lewis M.; Benedik, Michael J.; Yanofsky, Charles; Mankin, Alexander S.; Vazquez-Laslop, Nora; Sachs, Matthew S.; Cruz-Vera, Luis R.

    2013-01-01

    A transcriptional attenuation mechanism regulates expression of the bacterial tnaCAB operon. This mechanism requires ribosomal arrest induced by the regulatory nascent TnaC peptide in response to free L-tryptophan (L-Trp). In this study we demonstrate, using genetic and biochemical analyses, that in Escherichia coli, TnaC residue I19 and 23S rRNA nucleotide A2058 are essential for the ribosome’s ability to sense free L-Trp. We show that the mutational change A2058U in 23S rRNA reduces the con...

  3. The arabidopsis cyclic nucleotide interactome

    Donaldson, Lara

    2016-05-11

    Background Cyclic nucleotides have been shown to play important signaling roles in many physiological processes in plants including photosynthesis and defence. Despite this, little is known about cyclic nucleotide-dependent signaling mechanisms in plants since the downstream target proteins remain unknown. This is largely due to the fact that bioinformatics searches fail to identify plant homologs of protein kinases and phosphodiesterases that are the main targets of cyclic nucleotides in animals. Methods An affinity purification technique was used to identify cyclic nucleotide binding proteins in Arabidopsis thaliana. The identified proteins were subjected to a computational analysis that included a sequence, transcriptional co-expression and functional annotation analysis in order to assess their potential role in plant cyclic nucleotide signaling. Results A total of twelve cyclic nucleotide binding proteins were identified experimentally including key enzymes in the Calvin cycle and photorespiration pathway. Importantly, eight of the twelve proteins were shown to contain putative cyclic nucleotide binding domains. Moreover, the identified proteins are post-translationally modified by nitric oxide, transcriptionally co-expressed and annotated to function in hydrogen peroxide signaling and the defence response. The activity of one of these proteins, GLYGOLATE OXIDASE 1, a photorespiratory enzyme that produces hydrogen peroxide in response to Pseudomonas, was shown to be repressed by a combination of cGMP and nitric oxide treatment. Conclusions We propose that the identified proteins function together as points of cross-talk between cyclic nucleotide, nitric oxide and reactive oxygen species signaling during the defence response.

  4. International interlaboratory study comparing single organism 16S rRNA gene sequencing data: Beyond consensus sequence comparisons

    Nathan D. Olson

    2015-03-01

    Full Text Available This study presents the results from an interlaboratory sequencing study for which we developed a novel high-resolution method for comparing data from different sequencing platforms for a multi-copy, paralogous gene. The combination of PCR amplification and 16S ribosomal RNA gene (16S rRNA sequencing has revolutionized bacteriology by enabling rapid identification, frequently without the need for culture. To assess variability between laboratories in sequencing 16S rRNA, six laboratories sequenced the gene encoding the 16S rRNA from Escherichia coli O157:H7 strain EDL933 and Listeria monocytogenes serovar 4b strain NCTC11994. Participants performed sequencing methods and protocols available in their laboratories: Sanger sequencing, Roche 454 pyrosequencing®, or Ion Torrent PGM®. The sequencing data were evaluated on three levels: (1 identity of biologically conserved position, (2 ratio of 16S rRNA gene copies featuring identified variants, and (3 the collection of variant combinations in a set of 16S rRNA gene copies. The same set of biologically conserved positions was identified for each sequencing method. Analytical methods using Bayesian and maximum likelihood statistics were developed to estimate variant copy ratios, which describe the ratio of nucleotides at each identified biologically variable position, as well as the likely set of variant combinations present in 16S rRNA gene copies. Our results indicate that estimated variant copy ratios at biologically variable positions were only reproducible for high throughput sequencing methods. Furthermore, the likely variant combination set was only reproducible with increased sequencing depth and longer read lengths. We also demonstrate novel methods for evaluating variable positions when comparing multi-copy gene sequence data from multiple laboratories generated using multiple sequencing technologies.

  5. The complete nucleotide sequence of a 16S ribosomal RNA gene from a blue-green alga, Anacystis nidulans.

    Tomioka, N; Sugiura, M

    1983-01-01

    The complete nucleotide sequence of a 16S ribosomal RNA gene from a blue-green alga, Anacystis nidulans, has been determined. Its coding region is estimated to be 1,487 base pairs long, which is nearly identical to those reported for chloroplast 16S rRNA genes and is about 4% shorter than that of the Escherichia coli gene. The 16S rRNA sequence of A. nidulans has 83% homology with that of tobacco chloroplast and 74% homology with that of E. coli. Possible stem and loop structures of A. nidulans 16S rRNA sequences resemble more closely those of chloroplast 16S rRNAs than those of E. coli 16S rRNA. These observations support the endosymbiotic theory of chloroplast origin. PMID:6412038

  6. Downregulation of rRNA transcription triggers cell differentiation.

    Yuki Hayashi

    Full Text Available Responding to various stimuli is indispensable for the maintenance of homeostasis. The downregulation of ribosomal RNA (rRNA transcription is one of the mechanisms involved in the response to stimuli by various cellular processes, such as cell cycle arrest and apoptosis. Cell differentiation is caused by intra- and extracellular stimuli and is associated with the downregulation of rRNA transcription as well as reduced cell growth. The downregulation of rRNA transcription during differentiation is considered to contribute to reduced cell growth. However, the downregulation of rRNA transcription can induce various cellular processes; therefore, it may positively regulate cell differentiation. To test this possibility, we specifically downregulated rRNA transcription using actinomycin D or a siRNA for Pol I-specific transcription factor IA (TIF-IA in HL-60 and THP-1 cells, both of which have differentiation potential. The inhibition of rRNA transcription induced cell differentiation in both cell lines, which was demonstrated by the expression of the common differentiation marker CD11b. Furthermore, TIF-IA knockdown in an ex vivo culture of mouse hematopoietic stem cells increased the percentage of myeloid cells and reduced the percentage of immature cells. We also evaluated whether differentiation was induced via the inhibition of cell cycle progression because rRNA transcription is tightly coupled to cell growth. We found that cell cycle arrest without affecting rRNA transcription did not induce differentiation. To the best of our knowledge, our results demonstrate the first time that the downregulation of rRNA levels could be a trigger for the induction of differentiation in mammalian cells. Furthermore, this phenomenon was not simply a reflection of cell cycle arrest. Our results provide a novel insight into the relationship between rRNA transcription and cell differentiation.

  7. High-throughput nucleotide sequence analysis of diverse bacterial communities in leachates of decomposing pig carcasses

    Seung Hak Yang; Joung Soo Lim; Modabber Ahmed Khan; Bong Soo Kim; Dong Yoon Choi; Eun Young Lee; Hee Kwon Ahn

    2015-01-01

    The leachate generated by the decomposition of animal carcass has been implicated as an environmental contaminant surrounding the burial site. High-throughput nucleotide sequencing was conducted to investigate the bacterial communities in leachates from the decomposition of pig carcasses. We acquired 51,230 reads from six different samples (1, 2, 3, 4, 6 and 14 week-old carcasses) and found that sequences representing the phylum Firmicutes predominated. The diversity of bacterial 16S rRNA gen...

  8. The Identification of Discriminating Patterns from 16S rRNA Gene to Generate Signature for Bacillus Genus.

    More, Ravi P; Purohit, Hemant J

    2016-08-01

    The 16S ribosomal RNA (16S rRNA) gene has been widely used for the taxonomic classification of bacteria. A molecular signature is a set of nucleotide patterns, which constitute a regular expression that is specific to each particular taxon. Our main goal was to identify discriminating nucleotide patterns in 16S rRNA gene and then to generate signatures for taxonomic classification. To demonstrate our approach, we used the phylum Firmicutes as a model using representative taxa Bacilli (class), Bacillales (order), Bacillaceae (family), and Bacillus (genus), according to their dominance at each hierarchical taxonomic level. We applied combined composite vector and multiple sequence alignment approaches to generate gene-specific signatures. Further, we mapped all the patterns into the different hypervariable regions of 16S rRNA gene and confirmed the most appropriate distinguishing region as V3-V4 for targeted taxa. We also examined the evolution in discriminating patterns of signatures across taxonomic levels. We assessed the comparative classification accuracy of signatures with other methods (i.e., RDP Classifier, KNN, and SINA). Results revealed that the signatures for taxa Bacilli, Bacillales, Bacillaceae, and Bacillus could correctly classify isolate sequences with sensitivity of 0.99, 0.97, 0.94, and 0.89, respectively, and specificity close to 0.99. We developed signature-based software DNA Barcode Identification (DNA BarID) for taxonomic classification that is available at website http://www.neeri.res.in/DNA_BarID.htm . This pattern-based study provides a deeper understanding of taxon-specific discriminating patterns in 16S rRNA gene with respect to taxonomic classification. PMID:27104769

  9. Insights into the structure, function and evolution of the radical-SAM 23S rRNA methyltransferase Cfr that confers antibiotic resistance in bacteria

    Kaminska, Katarzyna H; Purta, Elzbieta; Hansen, Lykke H; Bujnicki, Janusz M; Vester, Birte; Long, Katherine S

    2010-01-01

    The Cfr methyltransferase confers combined resistance to five classes of antibiotics that bind to the peptidyl tranferase center of bacterial ribosomes by catalyzing methylation of the C-8 position of 23S rRNA nucleotide A2503. The same nucleotide is targeted by the housekeeping methyltransferase...... a 4Fe-4S cluster, a SAM molecule coordinated to the iron-sulfur cluster (SAM1) and a SAM molecule that is the putative methyl group donor (SAM2). All mutations at predicted functional sites affect Cfr activity significantly as assayed by antibiotic susceptibility testing and primer extension...

  10. UV-induced modifications in the peptidyl transferase loop of 23S rRNA dependent on binding of the streptogramin B antibiotic, pristinamycin IA

    Porse, B T; Kirillov, S V; Awayez, M J;

    1999-01-01

    The naturally occurring streptogramin B antibiotic, pristinamycin IA, which inhibits peptide elongation, can produce two modifications in 23S rRNA when bound to the Escherichia coli 70S ribosome and irradiated at 365 nm. Both drug-induced effects map to highly conserved nucleotides within the...... functionally important peptidyl transferase loop of 23S rRNA at positions m2A2503/psi2504 and G2061/A2062. The modification yields are influenced strongly, and differentially, by P-site-bound tRNA and strongly by some of the peptidyl transferase antibiotics tested, with chloramphenicol producing a shift in the...... latter modification to A2062/C2063. Pristinamycin IA can also produce a modification on binding to deproteinized, mature 23S rRNA, at position U2500/C2501. The same modification occurs on an approximately 37-nt fragment, encompassing positions approximately 2496-2532 of the peptidyl transferase loop that...

  11. Multi-site-specific 16S rRNA methyltransferase RsmF from Thermus thermophilus

    Demirci, Hasan; Larsen, Line H G; Hansen, Trine;

    2010-01-01

    Cells devote a significant effort toward the production of multiple modified nucleotides in rRNAs, which fine tune the ribosome function. Here, we report that two methyltransferases, RsmB and RsmF, are responsible for all four 5-methylcytidine (m(5)C) modifications in 16S rRNA of Thermus...... thermophilus. Like Escherichia coli RsmB, T. thermophilus RsmB produces m(5)C967. In contrast to E. coli RsmF, which introduces a single m(5)C1407 modification, T. thermophilus RsmF modifies three positions, generating m(5)C1400 and m(5)C1404 in addition to m(5)C1407. These three residues are clustered near...

  12. The nucleotide sequences of 5S rRNAs from a sea-cucumber, a starfish and a sea-urchin.

    Ohama, T; Hori, H; Osawa, S

    1983-01-01

    The nucleotide sequences of 5S rRNA from three echinoderms, a sea-cucumber Stichopus oshimae, a starfish Asterina pectinifera and a sea-urchin Hemicentrotus pulcherrimus have been determined. These 5S rRNAs are all 120 nucleotides long. The echinoderm sequences are more related to the sequences of proterostomes animals such as mollusc, annelids and some others (87% identity on average) than to those of vertebrates (82% identity on average).

  13. Phylogenetic relationships of Salmonella based on rRNA sequences

    Christensen, H.; Nordentoft, Steen; Olsen, J.E.

    1998-01-01

    To establish the phylogenetic relationships between the subspecies of Salmonella enterica (official name Salmonella choleraesuis), Salmonella bongori and related members of Enterobacteriaceae, sequence comparison of rRNA was performed by maximum-likelihood analysis. The two Salmonella species were...

  14. Homogenizing the dose for adjacent fields

    Difficulties are found in radiotherapy in the determination of the gap which should be left among adjacent fields on the skin. In order to homogenize the dose at a given depth, measurements are done with a wood phantom using films, thermoluminescent dosemeters and ionization chambers. Field match is checked according to tables related in the literature and experimental data. Two tables of field separation are built at various depths, one for simultaneous adjacent fields and the other for non-simultaneous adjacent fields. Tables must be checked and the additional distances corrected for each field

  15. Detect Adjacent Well by Analyzing Geomagnetic Anomalies

    Su Zhang

    2014-03-01

    Full Text Available This study describes a method of determining the position of adjacent well by analyzing geomagnetic anomalies in the drilling. In the experiment, put a casing in the geomagnetic field respectively to simulate 3 conditions, which are vertical well, deviated well and horizontal well. Study the interference of regional geomagnetic caused by casing, summary the law of the regional geomagnetic field anomalies caused by the adjacent casing. Experimental results show that: magnetic intensity distortion caused by deviated well is similar to that caused by horizontal well, but the distortion is different from vertical well. The scope and amplitude of N and E component magnetic intensity distortion will increase with the increase of casing inclination, meanwhile the scope and amplitude of V component distortion will decrease and the distortion value changes from negative to positive to the southwest of adjacent well. Through the analysis of geomagnetic anomalies, the position of the adjacent wells could be determined.

  16. Adjacency Algebra of Unitary Cayley Graph

    A. Satyanarayana Reddy

    2013-02-01

    Full Text Available A few properties of unitary Cayley graphs are explored using their eigenvalues. It is shown that the adjacency algebra of a unitary Cayley graph is a coherent algebra. Finally, a class of unitary Cayley graphs that are distance regular are also obtained.Key Words: Adjacency Algebra, Circulant Graph, Coherent Algebra, Distance Regular Graph,Ramanujan's sum .AMS(2010: 05C25, 05C50

  17. Hydrogen bonding and packing density are factors most strongly connected to limiting sites of high flexibility in the 16S rRNA in the 30S ribosome

    Ghosh Sujit K

    2009-07-01

    Full Text Available Abstract Background Conformational flexibility in structured RNA frequently is critical to function. The 30S ribosomal subunit exists in different conformations in different functional states due to changes in the central part of the 16S rRNA. We are interested in evaluating the factors that might be responsible for restricting flexibility to specific parts of the 16S rRNA using biochemical data obtained from the 30S subunit in solution. This problem was approached taking advantage of the observation that there must be a high degree of conformational flexibility at sites where UV photocrosslinking occurs and a lack of flexibility inhibits photoreactivity at many other sites that are otherwise suitable for reaction. Results We used 30S x-ray structures to quantify the properties of the nucleotide pairs at UV- and UVA-s4U-induced photocrosslinking sites in 16S rRNA and compared these to the properties of many hundreds of additional sites that have suitable geometry but do not undergo photocrosslinking. Five factors that might affect RNA flexibility were investigated – RNA interactions with ribosomal proteins, interactions with Mg2+ ions, the presence of long-range A minor motif interactions, hydrogen bonding and the count of neighboring heavy atoms around the center of each nucleobase to estimate the neighbor packing density. The two factors that are very different in the unreactive inflexible pairs compared to the reactive ones are the average number of hydrogen bonds and the average value for the number of neighboring atoms. In both cases, these factors are greater for the unreactive nucleotide pairs at a statistically very significant level. Conclusion The greater extent of hydrogen bonding and neighbor atom density in the unreactive nucleotide pairs is consistent with reduced flexibility at a majority of the unreactive sites. The reactive photocrosslinking sites are clustered in the 30S subunit and this indicates nonuniform patterns of

  18. A nested array of rRNA targeted probes for the detection and identification of enterococci by reverse hybridization.

    Behr, T; Koob, C; Schedl, M; Mehlen, A; Meier, H; Knopp, D; Frahm, E; Obst, U; Schleifer, K; Niessner, R; Ludwig, W

    2000-12-01

    Complete 23S and almost complete 16S rRNA gene sequences were determined for the type strains of the validly described Enterococcus species, Melissococcus pluton and Tetragenococcus halophilus. A comprehensive set of rRNA targeted specific oligonucleotide hybridization probes was designed according to the multiple probe concept. In silico probe design and evaluation was performed using the respective tools of the ARB program package in combination with the ARB databases comprising the currently available 16S as well as 23S rRNA primary structures. The probes were optimized with respect to their application for reverse hybridization in microplate format. The target comprising 16S and 23S rDNA was amplified and labeled by PCR (polymerase chain reaction) using general primers targeting a wide spectrum of bacteria. Alternatively, amplification of two adjacent rDNA fragments of enterococci was performed by using specific primers. In vitro evaluation of the probe set was done including all Enterococcus type strains, and a selection of other representatives of the gram-positive bacteria with a low genomic DNA G+C content. The optimized probe set was used to analyze enriched drinking water samples as well as original samples from waste water treatment plants. PMID:11249027

  19. On the complexity of adjacent resource scheduling

    Duin, C.W.; Sluis, van, P.

    2004-01-01

    We study the problem of scheduling resource(s) for jobs in an adjacent manner (ARS). The problem relates to fixed interval scheduling on the one hand, and to the problem of two-dimensional strip packing on the other hand. Further, there is a close relation with multiprocessor scheduling. A distinguishing characteristic is the constraint of resource-adjacency. As an application of ARS, consider an airport where passengers check in for their flight, joining lines before one or more desks; at th...

  20. Adjacent Instability after Instrumented Lumbar Fusion.

    Wen-Jer Chen

    2003-11-01

    Full Text Available The invention of pedicle screw instrumentation has greatly improved outcomes ofspinal fusion, which has become the treatment of choice for lumbar spondylolisthesis. Asresearchers accumulate experience, both theoretical and clinical advances are continuallybeing reported. A review of the literature and the experience of the authors show that thedevelopment of adjacent instability, as in the breakdown of a neighboring unfixed motionsegment, is a common consequence of an instrumented lumbar spine. This article reviewsthe risk factors and surgical treatment of adjacent instability. The authors believe that properpreoperative planning and complete surgical procedures are imperative to prevent adjacentinstability. For those who need revision surgery, meticulous surgical techniques can achievesatisfactory results.

  1. Applications of adenine nucleotide measurements in oceanography

    Holm-Hansen, O.; Hodson, R.; Azam, F.

    1975-01-01

    The methodology involved in nucleotide measurements is outlined, along with data to support the premise that ATP concentrations in microbial cells can be extrapolated to biomass parameters. ATP concentrations in microorganisms and nucleotide analyses are studied.

  2. Nucleotides in neuroregeneration and neuroprotection.

    Miras-Portugal, M Teresa; Gomez-Villafuertes, Rosa; Gualix, Javier; Diaz-Hernandez, Juan Ignacio; Artalejo, Antonio R; Ortega, Felipe; Delicado, Esmerilda G; Perez-Sen, Raquel

    2016-05-01

    Brain injury generates the release of a multitude of factors including extracellular nucleotides, which exhibit bi-functional properties and contribute to both detrimental actions in the acute phase and also protective and reparative actions in the later recovery phase to allow neuroregeneration. A promising strategy toward restoration of neuronal function is based on activation of endogenous adult neural stem/progenitor cells. The implication of purinergic signaling in stem cell biology, including regulation of proliferation, differentiation, and cell death has become evident in the last decade. In this regard, current strategies of acute transplantation of ependymal stem/progenitor cells after spinal cord injury restore altered expression of P2X4 and P2X7 receptors and improve functional locomotor recovery. The expression of both receptors is transcriptionally regulated by Sp1 factor, which plays a key role in the startup of the transcription machinery to induce regeneration-associated genes expression. Finally, general signaling pathways triggered by nucleotide receptors in neuronal populations converge on several intracellular kinases, such as PI3K/Akt, GSK3 and ERK1,2, as well as the Nrf-2/heme oxigenase-1 axis, which specifically link them to neuroprotection. In this regard, regulation of dual specificity protein phosphatases can become novel mechanism of actions for nucleotide receptors that associate them to cell homeostasis regulation. This article is part of the Special Issue entitled 'Purines in Neurodegeneration and Neuroregeneration'. PMID:26359530

  3. Adjacent stimulation and measurement patterns considered harmful

    We characterize the ability of electrical impedance tomography (EIT) to distinguish changes in internal conductivity distributions, and analyze it as a function of stimulation and measurement patterns. A distinguishability measure, z, is proposed which is related to the signal-to-noise ratio of a medium and to the probability of detection of conductivity changes in a region of interest. z is a function of the number of electrodes, the EIT stimulation and measurement protocol, the stimulation amplitude, the measurement noise, and the size and location of the contrasts. Using this measure we analyze various choices of stimulation and measurement patterns under the constraint of medical electrical safety limits (maximum current into the body). Analysis is performed for a planar placement of 16 electrodes for simulated 3D tank and chest shapes, and measurements in a saline tank. Results show that the traditional (and still most common) adjacent stimulation and measurement patterns have by far the poorest performance (by 6.9 ×). Good results are obtained for trigonometric patterns and for pair drive and measurement patterns separated by over 90°. Since the possible improvement over adjacent patterns is so large, we present this result as a call to action: adjacent patterns are harmful, and should be abandoned. We recommend using pair drive and measurement patterns separated by one electrode less than 180°. We describe an approach to modify an adjacent pattern EIT system by adjusting electrode placement

  4. Interactions of the TnaC nascent peptide with rRNA in the exit tunnel enable the ribosome to respond to free tryptophan.

    Martínez, Allyson K; Gordon, Emily; Sengupta, Arnab; Shirole, Nitin; Klepacki, Dorota; Martinez-Garriga, Blanca; Brown, Lewis M; Benedik, Michael J; Yanofsky, Charles; Mankin, Alexander S; Vazquez-Laslop, Nora; Sachs, Matthew S; Cruz-Vera, Luis R

    2014-01-01

    A transcriptional attenuation mechanism regulates expression of the bacterial tnaCAB operon. This mechanism requires ribosomal arrest induced by the regulatory nascent TnaC peptide in response to free L-tryptophan (L-Trp). In this study we demonstrate, using genetic and biochemical analyses, that in Escherichia coli, TnaC residue I19 and 23S rRNA nucleotide A2058 are essential for the ribosome's ability to sense free L-Trp. We show that the mutational change A2058U in 23S rRNA reduces the concentration dependence of L-Trp-mediated tna operon induction, whereas the TnaC I19L change suppresses this phenotype, restoring the sensitivity of the translating A2058U mutant ribosome to free L-Trp. These findings suggest that interactions between TnaC residue I19 and 23S rRNA nucleotide A2058 contribute to the creation of a regulatory L-Trp binding site within the translating ribosome. PMID:24137004

  5. Regulation of Arabidopsis thaliana 5S rRNA Genes.

    Vaillant, Isabelle; Tutois, Sylvie; Cuvillier, Claudine; Schubert, Ingo; Tourmente, Sylvette

    2007-05-01

    The Arabidopsis thaliana genome comprises around 1,000 copies of 5S rRNA genes encoding both major and minor 5S rRNAs. In mature wild-type leaves, the minor 5S rRNA genes are silent. Using different mutants of DNA methyltransferases (met1, cmt3 and met1 cmt3), components of the RNAi pathway (ago4) or post-translational histone modifier (hda6/sil1), we show that the corresponding proteins are needed to maintain proper methylation patterns at heterochromatic 5S rDNA repeats. Using reverse transcription-PCR and cytological analyses, we report that a decrease of 5S rDNA methylation at CG or CNG sites in these mutants leads to the release of 5S rRNA gene silencing which occurred without detectable changes of the 5S rDNA chromatin structure. In spite of severely reduced DNA methylation, the met1 cmt3 double mutant revealed no increase in minor 5S rRNA transcripts. Furthermore, the release of silencing of minor 5S rDNAs can be achieved without increased formation of euchromatic loops by 5S rDNA, and is independent from the global heterochromatin content. Additionally, fluorescence in situ hybridization with centromeric 180 bp repeats confirmed that these highly repetitive sequences, in spite of their elevated transcriptional activity in the DNA methyltransferase mutants (met1, cmt3 and met1 cmt3), remain within chromocenters of the mutant nuclei. PMID:17412735

  6. Mutations in domain II of 23 S rRNA facilitate translation of a 23 S rRNA-encoded pentapeptide conferring erythromycin resistance

    Dam, M; Douthwaite, S; Tenson, T;

    1996-01-01

    Mutations in domain II of Escherichia coli 23 S rRNA that cause resistance to erythromycin do so in a manner fundamentally different from mutations at the drug binding site in domain V of the 23 S rRNA. The domain II mutations are located in a hairpin structure between nucleotides 1198 and 1247....... This is close to a short open reading frame in the 23 S rRNA that encodes a pentapeptide (E-peptide) whose expression in vivo renders cells resistant to erythromycin. Therefore, a possible mechanism of resistance caused by domain II mutations may be related to an increased expression of the E-peptide. To test...... this hypothesis, a range of point mutations was generated in domain II of 23 S rRNA in the vicinity of the E-peptide open reading frame. We find a correlation between erythromycin resistance of the mutant clones and increased accessibility of the ribosome binding site of the E-peptide gene. Furthermore...

  7. A single mutation in the 15S rRNA gene confers nonsense suppressor activity and interacts with mRF1 the release factor in yeast mitochondria

    Ali Gargouri

    2015-08-01

    Full Text Available We have determined the nucleotide sequence of the mim3-1 mitochondrial ribosomal suppressor, acting on ochre mitochondrial mutations and one frameshift mutation in Saccharomyces cerevisiae. The 15s rRNA suppressor gene contains a G633 to C transversion. Yeast mitochondrial G633 corresponds to G517 of the E.coli 15S rRNA, which is occupied by an invariant G in all known small rRNA sequences. Interestingly, this mutation has occurred at the same position as the known MSU1 mitochondrial suppressor which changes G633 to A. The suppressor mutation lies in a highly conserved region of the rRNA, known in E.coli as the 530-loop, interacting with the S4, S5 and S12 ribosomal proteins. We also show an interesting interaction between the mitochondrial mim3-1 and the nuclear nam3-1 suppressors, both of which have the same action spectrum on mitochondrial mutations: nam3-1 abolishes the suppressor effect when present with mim3-1 in the same haploid cell. We discuss these results in the light of the nature of Nam3, identified by [1] as the yeast mitochondrial translation release factor. A hypothetical mechanism of suppression by "ribosome shifting" is also discussed in view of the nature of mutations suppressed and not suppressed.

  8. Adjacent Segment Pathology after Lumbar Spinal Fusion.

    Lee, Jae Chul; Choi, Sung-Woo

    2015-10-01

    One of the major clinical issues encountered after lumbar spinal fusion is the development of adjacent segment pathology (ASP) caused by increased mechanical stress at adjacent segments, and resulting in various radiographic changes and clinical symptoms. This condition may require surgical intervention. The incidence of ASP varies with both the definition and methodology adopted in individual studies; various risk factors for this condition have been identified, although a significant controversy still exists regarding their significance. Motion-preserving devices have been developed, and some studies have shown their efficacy of preventing ASP. Surgeons should be aware of the risk factors of ASP when planning a surgery, and accordingly counsel their patients preoperatively. PMID:26435804

  9. Nonequilibrium phenomena in adjacent electrically isolated nanostructures

    Khrapai, V. S.; Ludwig, S.; Kotthaus, J. P.; Tranitz, H. P.; Wegscheider, W.

    2008-01-01

    We report on nonequilibrium interaction phenomena between adjacent but electrostatically separated nanostructures in GaAs. A current flowing in one externally biased nanostructure causes an excitation of electrons in a circuit of a second nanostructure. As a result we observe a dc current generated in the unbiased second nanostructure. The results can be qualitatively explained in terms of acoustic phonon based energy transfer between the two mutually isolated circuits.

  10. In vitro cleavage of the simian virus 40 early polyadenylation site adjacent to a required downstream TG sequence.

    Sperry, A O; Berget, S M

    1986-01-01

    Exogenous RNA containing the simian virus 40 early polyadenylation site was efficiently and accurately polyadenylated in in vitro nuclear extracts. Correct cleavage required ATP. In the absence of ATP, nonpoly(A)+ products accumulated which were 18 to 20 nucleotides longer than the RNA generated by correct cleavage; the longer RNA terminated adjacent to the downstream TG element required for polyadenylation. In the presence of ATP analogs, alternate cleavage was not observed; instead, correct...

  11. Frequency and spectrum of mitochondrial 12S rRNA variants in 440 Han Chinese hearing impaired pediatric subjects from two otology clinics

    Zhou Jianjin

    2011-01-01

    Full Text Available Abstract Background Aminoglycoside ototoxicity is one of the common health problems. Mitochondrial 12S rRNA mutations are one of the important causes of aminoglycoside ototoxicity. However, the incidences of 12S rRNA mutations associated with aminoglycoside ototoxicity are less known. Methods A total of 440 Chinese pediatric hearing-impaired subjects were recruited from two otology clinics in the Ningbo and Wenzhou cities of Zhejiang Province, China. These subjects underwent clinical, genetic evaluation and molecular analysis of mitochondrial 12S rRNA. Resultant mtDNA variants were evaluated by structural and phylogenetic analysis. Results The study samples consisted of 227 males and 213 females. The age of all participants ranged from 1 years old to 18 years, with the median age of 9 years. Ninety-eight subjects (58 males and 40 females had a history of exposure to aminoglycosides, accounting for 22.3% cases of hearing loss in this cohort. Molecular analysis of 12S rRNA gene identified 41 (39 known and 2 novel variants. The incidences of the known deafness-associated 1555A > G, 1494C > T and 1095T > C mutations were 7.5%, 0.45% and 0.91% in this entire hearing-impaired subjects, respectively, and 21.4%, 2% and 2% among 98 subjects with aminoglycoside ototoxicity, respectively. The structural and phylogenetic evaluations showed that a novel 747A > G variant and known 839A > G, 1027A > G, 1310C > T and 1413T > C variants conferred increased sensitivity to aminoglycosides or nonsyndromic deafness as they were absent in 449 Chinese controls and localized at highly conserved nucleotides of this rRNA. However, other variants were polymorphisms. Of 44 subjects carrying one of definite or putative deafness-related 12S rRNA variants, only one subject carrying the 1413T > C variant harbored the 235DelC/299DelAT mutations in the GJB2 gene, while none of mutations in GJB2 gene was detected in other 43 subjects. Conclusions Mutations in mitochondrial 12S rRNA

  12. The effect of imidazole, cyanamide, and polyornithine on the condensation of nucleotides in aqueous systems.

    Ibanez, J.; Kimball, A. P.; Oro, J.

    1971-01-01

    Development of two models for the condensation of nucleotides under possibly prebiotic conditions. In the first of these models this type of reaction is promoted by the presence of imidazole and substituted imidazole compounds. The second model involves the condensation of mononucleotides with cyanamide in the presence and absence of a prototemplate such as polyornithine. A tentative mechanism for the role of imidazole catalysis in phosphodiester bond formation between adjacent TMP molecules is suggested.

  13. Detection of Borrelia-specific 16S rRNA sequence in total RNA extracted from Ixodes ricinus ticks

    Ž. Radulović

    2010-08-01

    Full Text Available A reverse transcriptase - polymerase chain reaction based assay for Borrelia species detection in ticks was developed. The method was based on amplification of 552 nucleotide bases long sequence of 16S rRNA, targeted by Borrelia specific primers. In the present study, total RNA extracted from Ixodes ricinus ticks was used as template. The results showed higher sensitivity for Borrelia detection as compared to standard dark-field microscopy. Method specificity was confirmed by cloning and sequencing of obtained 552 base pairs long amplicons. Phylogenetic analysis of obtained sequences showed that they belong to B. lusitaniae and B. afzelii genospecies. RT-PCR based method presented in this paper could be very useful as a screening test for detecting pathogen presence, especially when in investigations is required extraction of total RNA from ticks.

  14. A phylogenetic comparison of the 16S rRNA sequence of the fish pathogen, Renibacterium salmoninarum, to gram-positive bacteria.

    Gutenberger, S K; Giovannoni, S J; Field, K G; Fryer, J L; Rohovec, J S

    1991-01-15

    The 16S rRNA of Renibacterium salmoninarum, the causative agent of bacterial kidney disease in salmonids, was sequenced by reverse transcriptase to produce a nearly complete sequence (97%) of 1475 nucleotides. Phylogenetic comparisons to seventeen genera and signature sequence analysis indicated that R. salmoninarum was a member of the high G + C Gram-positive eubacterial subdivision although the reported G + C value is only 53%. A phylogenetic tree details the relationship of R. salmoninarum to ten actinomycetes from diverse environments. PMID:1709893

  15. Phylogenetic positions of two marine ciliates, Metanophrys similis and Pseudocohnilembus hargisi (Protozoa, Ciliophora, Scuticociliatia), inferred from complete small subunit rRNA gene sequences

    2006-01-01

    The small subunit rRNA (SSrRNA) gene was sequenced for two marine scuticociliates Metanophrys similis and Pseudocohnilembus hargisi. The results show that this gene comprises 1763 and 1753 nucleotides in the two marine ciliates respectively.Metanophrys similis is phylogenetically closely related to the clade containing Mesanophrys carcini and Anophyroides haemophila, which branches basally to other species within the order Philasterida. Pseudocohnilembus hargisi groups with its congener, P. marinus, with strong bootstrap support. Paranophrys magna groups with the clade including Cohnilembus and Uronema, representing a sister clade to that containing the two Pseudocohnilembus species.

  16. Nucleotide excision repair in humans.

    Spivak, Graciela

    2015-12-01

    The demonstration of DNA damage excision and repair replication by Setlow, Howard-Flanders, Hanawalt and their colleagues in the early 1960s, constituted the discovery of the ubiquitous pathway of nucleotide excision repair (NER). The serial steps in NER are similar in organisms from unicellular bacteria to complex mammals and plants, and involve recognition of lesions, adducts or structures that disrupt the DNA double helix, removal of a short oligonucleotide containing the offending lesion, synthesis of a repair patch copying the opposite undamaged strand, and ligation, to restore the DNA to its original form. The transcription-coupled repair (TCR) subpathway of NER, discovered nearly two decades later, is dedicated to the removal of lesions from the template DNA strands of actively transcribed genes. In this review I will outline the essential factors and complexes involved in NER in humans, and will comment on additional factors and metabolic processes that affect the efficiency of this important process. PMID:26388429

  17. Isolation of temperature-sensitive mutants of 16 S rRNA in Escherichia coli

    Triman, K; Becker, E; Dammel, C;

    1989-01-01

    Temperature-sensitive mutants have been isolated following hydroxylamine mutagenesis of a plasmid containing Escherichia coli rRNA genes carrying selectable markers for spectinomycin resistance (U1192 in 16 S rRNA) and erythromycin resistance (G2058 in 23 S rRNA). These antibiotic resistance alle...

  18. Kauffman's adjacent possible in word order evolution

    Ferrer-i-Cancho, Ramon

    2015-01-01

    Word order evolution has been hypothesized to be constrained by a word order permutation ring: transitions involving orders that are closer in the permutation ring are more likely. The hypothesis can be seen as a particular case of Kauffman's adjacent possible in word order evolution. Here we consider the problem of the association of the six possible orders of S, V and O to yield a couple of primary alternating orders as a window to word order evolution. We evaluate the suitability of various competing hypotheses to predict one member of the couple from the other with the help of information theoretic model selection. Our ensemble of models includes a six-way model that is based on the word order permutation ring (Kauffman's adjacent possible) and another model based on the dual two-way of standard typology, that reduces word order to basic orders preferences (e.g., a preference for SV over VS and another for SO over OS). Our analysis indicates that the permutation ring yields the best model when favoring pa...

  19. Factory waste influence on Elbrus adjacent area

    Complete text of publication follows. Two major burials of waste from concentrating mill of The Tyrnauz Tungsten-Molybdic Plant are situated at the recreation area of Elbrus adjacent territory. But it is significant that the strong winds periods are available here at the river Baksan valley constantly, which are transfers the particles of burials along that valley. The waste pollutes pastures and agricultural lands. The sampling of the buried material on the surface and of the soil of adjacent territory was fulfilled here in order to check up that assumption. The chemical analyses of the buried waste were performed at the X-ray spectrometer Philips PW2400. The results received showed the high quantity of some environmental threat elements. The soil sample analyses on 20 elements (including Ca, Ti, Mn, Fe, P, S, Cr, V, Co, Ni, Cu, Zn, Sr, Zr, Ba, Pb, As, Mo, W, Sn) showed the excess of maximum permissible concentrations (according to Russian Federation hygienic regulations 2.1.7.2041-06) of some investigated elements in the all researched samples. Some results of the investigations are shown below in the table 1. The excesses of maximum permissible concentrations were observed for phosphorus from 5.3 to 11.3 times as much; for sulphur from 3 to 8.75 times as much; for cobalt from 2.6 to 4.6 times as much; for nickel from 8.25 to 15.25 times as much; for copper from 9.3 to 22 times as much; for arsenic up to 10 and at one sample - to 28 times as much. At the MPC level was the lead contents and also at single instances - the manganese and vanadium contents. The excess of background contents were observed for molybdenum up to 8, tungsten - up to 38 and tin - up to 7 times as much. Presented data confirmed the supposition that buried waste pollutes pastures and agricultural lands of Elbrus adjacent area and that means the necessity of either more careful burial of these waste products, or their full recycling.

  20. Erythromycin binding is reduced in ribosomes with conformational alterations in the 23 S rRNA peptidyl transferase loop

    Douthwaite, S; Aagaard, C

    1993-01-01

    induced by mutations in the peptidyl transferase loop, and to determine how these changes affect drug interaction. Mutations at positions 2057 (G-->A) and 2058 (A-->G, or -->U), all of which confer drug resistance, induce a more open conformation in the peptidyl transferase loop. Erythromycin still...... protects against chemical modification in the mutant peptidyl transferase loops, but the affinity of the drug interaction is reduced 20-fold in the 2057A mutant, 10(3)-fold in the 2058U mutant and 10(4)-fold in the 2058G mutant. Single mutations at position 2032 in the adjacent hairpin loop, which have...... previously been shown to alter drug tolerances, gave no detectable effects on the structure of the peptidyl transferase loop or on erythromycin binding. Dual mutations at positions 2032 and 2058, however, induce a marked change in the rRNA conformation with opening of the phylogenetically conserved base...

  1. Seismicity in Azerbaijan and Adjacent Caspian Sea

    So far no general view on the geodynamic evolution of the Black Sea to the Caspian Sea region is elaborated. This is associated with the geological and structural complexities of the region revealed by geophysical, geochemical, petrologic, structural, and other studies. A clash of opinions on geodynamic conditions of the Caucasus region, sometimes mutually exclusive, can be explained by a simplified interpretation of the seismic data. In this paper I analyze available data on earthquake occurrences in Azerbaijan and the adjacent Caspian Sea region. The results of the analysis of macroseismic and instrumental data, seismic regime, and earthquake reoccurrence indicate that a level of seismicity in the region is moderate, and seismic event are concentrated in the shallow part of the lithosphere. Seismicity is mostly intra-plate, and spatial distribution of earthquake epicenters does not correlate with the plate boundaries

  2. Sublingual nucleotides and immune response to exercise

    Ostojic Sergej M

    2012-07-01

    Full Text Available Abstract Evidence exists regarding the potential role of exogenous nucleotides as regulators of the immune function in physically active humans, yet the potential use of nucleotides has been hindered by their low bioavailability after oral administration. We conducted a double-blind, placebo-controlled, randomized trial to assess the effect of sublingual nucleotides (50 mg/day on salivary and serum immunity indicators as compared to placebo, both administered to healthy males aged 20 to 25 years for 14 days. Sublingual administration of nucleotides for 14 days increased serum immunoglobulin A, natural killer cells count and cytotoxic activity, and offset the post-exercise drop of salivary immunoglobulins and lactoferrin (P  0.05. It seems that sublingual administration of nucleotides for two weeks considerably affected immune function in healthy males.

  3. Nucleotide sequence preservation of human mitochondrial DNA

    Recombinant DNA techniques have been used to quantitate the amount of nucleotide sequence divergence in the mitochondrial DNA population of individual normal humans. Mitochondrial DNA was isolated from the peripheral blood lymphocytes of five normal humans and cloned in M13 mp11; 49 kilobases of nucleotide sequence information was obtained from 248 independently isolated clones from the five normal donors. Both between- and within-individual differences were identified. Between-individual differences were identified in approximately = to 1/200 nucleotides. In contrast, only one within-individual difference was identified in 49 kilobases of nucleotide sequence information. This high degree of mitochondrial nucleotide sequence homogeneity in human somatic cells is in marked contrast to the rapid evolutionary divergence of human mitochondrial DNA and suggests the existence of mechanisms for the concerted preservation of mammalian mitochondrial DNA sequences in single organisms

  4. Discrimination of bacillus anthracis and closely related microorganisms by analysis of 16S and 23S rRNA with oligonucleotide microarray.

    Bavykin, S. G.; Mikhailovich, V. M.; Zakharyev, V. M.; Lysov, Y. P.; Kelly, J. J.; Alferov, O. S.; Jackman, J.; Stahl, D. A.; Mirzabekov, A. D.; Gavin, I. M.; Kukhtin, A. V.; Chandler, D. (Biochip Technology Center); (Engelhardt Inst. of Molecular Biology); (Northwestern Univ.); (Georgetown Univ.)

    2008-01-30

    Analysis of 16S rRNA sequences is a commonly used method for the identification and discrimination of microorganisms. However, the high similarity of 16S and 23S rRNA sequences of Bacillus cereus group organisms (up to 99-100%) and repeatedly failed attempts to develop molecular typing systems that would use DNA sequences to discriminate between species within this group have resulted in several suggestions to consider B. cereus and B. thuringiensis, or these two species together with B. anthracis, as one species. Recently, we divided the B. cereus group into seven subgroups, Anthracis, Cereus A and B, Thuringiensis A and B, and Mycoides A and B, based on 16S rRNA, 23S rRNA and gyrB gene sequences and identified subgroup-specific makers in each of these three genes. Here we for the first time demonstrated discrimination of these seven subgroups, including subgroup Anthracis, with a 3D gel element microarray of oligonucleotide probes targeting 16S and 23S rRNA markers. This is the first microarray enabled identification of B. anthracis and discrimination of these seven subgroups in pure cell cultures and in environmental samples using rRNA sequences. The microarray bearing perfect match/mismatch (p/mm) probe pairs was specific enough to discriminate single nucleotide polymorphisms (SNPs) and was able to identify targeted organisms in 5 min. We also demonstrated the ability of the microarray to determine subgroup affiliations for B. cereus group isolates without rRNA sequencing. Correlation of these seven subgroups with groupings based on multilocus sequence typing (MLST), fluorescent amplified fragment length polymorphism analysis (AFLP) and multilocus enzyme electrophoresis (MME) analysis of a wide spectrum of different genes, and the demonstration of subgroup-specific differences in toxin profiles, psychrotolerance, and the ability to harbor some plasmids, suggest that these seven subgroups are not based solely on neutral genomic polymorphisms, but instead reflect

  5. Detecting Adjacent Relativity of Engineering Drawing Entities with Container Window

    林福严; 邱友申; 秦吉胜

    2001-01-01

    Automatic recognition and interpretation of engineering drawing plays an important role in computer aided engineering. Detecting the positional relation between entities is an important topic in this research field. In this paper the concepts of adjacent relativity and container window of drawing entities were proposed. By means of container window, the adjacent irrelative entities can be detected quickly and effectively, which speeds up the process of adjacent relativity detection. Meanwhile, the algorithm of adjacent relativity detection was discussed.

  6. 'View From A Bridge': A New Perspective on Eukaryotic rRNA Base Modification.

    Sharma, Sunny; Lafontaine, Denis L J

    2015-10-01

    Eukaryotic rRNA are modified frequently, although the diversity of modifications is low: in yeast rRNA, there are only 12 different types out of a possible natural repertoire exceeding 112. All nine rRNA base methyltransferases (MTases) and one acetyltransferase have recently been identified in budding yeast, and several instances of crosstalk between rRNA, tRNA, and mRNA modifications are emerging. Although the machinery has largely been identified, the functions of most rRNA modifications remain to be established. Remarkably, a eukaryote-specific bridge, comprising a single ribosomal protein (RP) from the large subunit (LSU), contacts four rRNA base modifications across the ribosomal subunit interface, potentially probing for their presence. We hypothesize in this article that long-range allosteric communication involving rRNA modifications is taking place between the two subunits during translation or, perhaps, the late stages of ribosome assembly. PMID:26410597

  7. Characterising the Canine Oral Microbiome by Direct Sequencing of Reverse-Transcribed rRNA Molecules.

    McDonald, James E; Larsen, Niels; Pennington, Andrea; Connolly, John; Wallis, Corrin; Rooks, David J; Hall, Neil; McCarthy, Alan J; Allison, Heather E

    2016-01-01

    PCR amplification and sequencing of phylogenetic markers, primarily Small Sub-Unit ribosomal RNA (SSU rRNA) genes, has been the paradigm for defining the taxonomic composition of microbiomes. However, 'universal' SSU rRNA gene PCR primer sets are likely to miss much of the diversity therein. We sequenced a library comprising purified and reverse-transcribed SSU rRNA (RT-SSU rRNA) molecules from the canine oral microbiome and compared it to a general bacterial 16S rRNA gene PCR amplicon library generated from the same biological sample. In addition, we have developed BIONmeta, a novel, open-source, computer package for the processing and taxonomic classification of the randomly fragmented RT-SSU rRNA reads produced. Direct RT-SSU rRNA sequencing revealed that 16S rRNA molecules belonging to the bacterial phyla Actinobacteria, Bacteroidetes, Firmicutes, Proteobacteria and Spirochaetes, were most abundant in the canine oral microbiome (92.5% of total bacterial SSU rRNA). The direct rRNA sequencing approach detected greater taxonomic diversity (1 additional phylum, 2 classes, 1 order, 10 families and 61 genera) when compared with general bacterial 16S rRNA amplicons from the same sample, simultaneously provided SSU rRNA gene inventories of Bacteria, Archaea and Eukarya, and detected significant numbers of sequences not recognised by 'universal' primer sets. Proteobacteria and Spirochaetes were found to be under-represented by PCR-based analysis of the microbiome, and this was due to primer mismatches and taxon-specific variations in amplification efficiency, validated by qPCR analysis of 16S rRNA amplicons from a mock community. This demonstrated the veracity of direct RT-SSU rRNA sequencing for molecular microbial ecology. PMID:27276347

  8. Analysis of RAPD and mitochondrial 16S rRNA gene sequences from Trichiurus lepturus and Eupleurogrammus muticus in the Yellow Sea

    MENG Zining; ZHUANG Zhimeng; JIN Xianshi; TANG Qisheng; SU Yongquan

    2004-01-01

    Random amplified polymorphic DNA (RAPD) technique is applied to 12 individuals from each species of the hairtail fishes Trichiurus lepturus and Eupleurogrammus muticus in the Yellow Sea. The percentage of polymorphic sites, degree of genetic polymorphism and genetic distance are compared and the phylogenetic tree is constructed by Neighbor-joining method. The partial mitochondrial 16S rRNA gene is amplified by polymerase chain reaction (PCR) and the PCR products are directly sequenced after being purified. These sequences, together with the homologous sequences of another Trichiuridae species Lepidopus caudatus obtained from GenBank, are used to analyze nucleotide difference and to construct a UPGMA phylogenetic tree by means of biological informatics. Analysis shows: (1) the RAPD technique is a highly sensitive method for investigating genetic diversity in T. lepturus, and E. muticus. T. lepturus exhibits a lower polymorphism and genetic diversity than E. muticus; (2) according to the analysis of the partial mitochondrial 16S rRNA gene sequences, a very low intraspecific variation and considerably high divergence among species were found, which reveals a dual nature of conservatism and variability in mitochondrial 16S rRNA gene; (3) five primers generate the species-specific RAPD sites and these sites can be served as the molecular markers for species identification and (4) it can be proved at DNA variation level that T. lepturus and E. muticus are of two species respectively pertaining to different genera, which supports the Nelson taxonomic conclusion.

  9. Nucleotide Salvage Deficiencies, DNA Damage and Neurodegeneration

    Michael Fasullo

    2015-04-01

    Full Text Available Nucleotide balance is critically important not only in replicating cells but also in quiescent cells. This is especially true in the nervous system, where there is a high demand for adenosine triphosphate (ATP produced from mitochondria. Mitochondria are particularly prone to oxidative stress-associated DNA damage because nucleotide imbalance can lead to mitochondrial depletion due to low replication fidelity. Failure to maintain nucleotide balance due to genetic defects can result in infantile death; however there is great variability in clinical presentation for particular diseases. This review compares genetic diseases that result from defects in specific nucleotide salvage enzymes and a signaling kinase that activates nucleotide salvage after DNA damage exposure. These diseases include Lesch-Nyhan syndrome, mitochondrial depletion syndromes, and ataxia telangiectasia. Although treatment options are available to palliate symptoms of these diseases, there is no cure. The conclusions drawn from this review include the critical role of guanine nucleotides in preventing neurodegeneration, the limitations of animals as disease models, and the need to further understand nucleotide imbalances in treatment regimens. Such knowledge will hopefully guide future studies into clinical therapies for genetic diseases.

  10. Phylogenetic and genetic diversity analysis in Leptospira species based on the sequence homology pattern of 16S rRNA gene

    Pasupuleti Sreenivasa Rao

    2013-08-01

    Full Text Available Leptospirosis is a bacterial zoonosis, caused by pathogenic spirochete which belongs to the genus Leptospira. It exists in diverse ecological habitats and affects almost all the mammals including humans. Several online databases like NCBI etc will provide the complete genomic sequence data of various Leptospira species. However, the Phylogenetic and genetic diversity Analysis in Leptospira species based on 16S rRNA gene has not studied in detail. Therefore the present study was conducted. Sequences of various species related to genus Leptospira obtained from the NCBI database etc and aligned (CLUSTAL_X. Two Phylogenetic trees were constructed (MEGA-5 in which the first one is related to various serovars of L. interrogans and the other is related to various species of Leptospira. The Phylogenetic trees revealed the relationship and genetic diversity of various serovars of L. interrogans and the other Leptospira species, with their nearest phylogenetic relatives. In the first tree, two major clades were observed which were named as A and B, whereas in the second tree, three major clades were observed and named as A, B and C respectively. Aquifex pyrophilus strain has been used for out grouping in both the trees. The genetic distance between the species in the phylogenetic tree is presented by a bar which represents 0.5 nucleotide substitutions per alignment position in the 16S rRNA gene sequence among the various serovars of L. interrogans while 0.05 nucleotide substitutions in case of various species related to the genus Leptospira. Thus, the findings from the above study confirm that the genus Leptospira exhibits genetic diversity in the 16S rRNA gene. [Int J Res Med Sci 2013; 1(4.000: 369-377

  11. Nucleotide excision repair in the test tube.

    N.G.J. Jaspers (Nicolaas); J.H.J. Hoeijmakers (Jan)

    1995-01-01

    textabstractThe eukaryotic nucleotide excision-repair pathway has been reconstituted in vitro, an achievement that should hasten the full enzymological characterization of this highly complex DNA-repair pathway.

  12. Effects of nucleotides and nucleosides on coagulation

    Bune, Laurids; Thaning, Pia; Johansson, Pär I;

    2010-01-01

    Nucleotides, including ADP, ATP and uridine triphosphate (UTP), are discharged profusely in the circulation during many pathological conditions including sepsis. Sepsis can cause hypotension and systemic activation of the coagulation and fibrinolytic systems in humans, which may cause disseminate...

  13. Nucleotide Capacitance Calculation for DNA Sequencing

    Lu, Jun-Qiang; Zhang, X.-G.

    2008-01-01

    Using a first-principles linear response theory, the capacitance of the DNA nucleotides, adenine, cytosine, guanine, and thymine, are calculated. The difference in the capacitance between the nucleotides is studied with respect to conformational distortion. The result suggests that although an alternate current capacitance measurement of a single-stranded DNA chain threaded through a nanogap electrode may not be sufficient to be used as a standalone method for rapid DNA sequencing, the capaci...

  14. In vitro incorporation of LNA nucleotides.

    Veedu, Rakesh N; Vester, Birte; Wengel, Jesper

    2007-01-01

    An LNA modified nucleoside triphosphate 1 was synthesized in order to investigate its potential to act as substrate for DNA strand synthesis by polymerases. Primer extension assays for the incorporation experiments revealed that Phusion High Fidelity DNA polymerase is an efficient enzyme for incorporation of the LNA nucleotide and for extending strand to full length. It was also observed that pfu DNA polymerase could incorporate the LNA nucleotide but it failed to extend the strand to a full length product. PMID:18058567

  15. Analysis of Sequence Conservation at Nucleotide Resolution

    Asthana, Saurabh; Roytberg, Mikhail; Stamatoyannopoulos, John; Sunyaev, Shamil R.

    2007-01-01

    One of the major goals of comparative genomics is to understand the evolutionary history of each nucleotide in the human genome sequence, and the degree to which it is under selective pressure. Ascertainment of selective constraint at nucleotide resolution is particularly important for predicting the functional significance of human genetic variation and for analyzing the sequence substructure of cis-regulatory sequences and other functional elements. Current methods for analysis of sequence ...

  16. High throughput 16S rRNA gene amplicon sequencing

    Nierychlo, Marta; Larsen, Poul; Jørgensen, Mads Koustrup;

    S rRNA gene amplicon sequencing has been developed over the past few years and is now ready to use for more comprehensive studies related to plant operation and optimization thanks to short analysis time, low cost, high throughput, and high taxonomic resolution. In this study we show how 16S r...... belonging to the phylum Chloroflexi. Based on knowledge about their ecophysiology, other control measures were introduced and the bulking problem was reduced after 2 months. Besides changes in the filament abundance and composition also other changes in the microbial community were observed that likely...... correlated with the bacterial species composition in 25 Danish full-scale WWTPs with nutrient removal. Examples of properties were SVI, filament index, floc size, floc strength, content of cations and amount of extracellular polymeric substances. Multivariate statistics provided several important insights...

  17. Evaluation of the 16S and 12S rRNA genes as universal markers for the identification of commercial fish species in South Africa.

    Cawthorn, Donna-Mareè; Steinman, Harris Andrew; Witthuhn, R Corli

    2012-01-01

    The development of DNA-based methods for the identification of fish species is important for fisheries research and control, as well as for the detection of unintentional or fraudulent species substitutions in the marketplace. The aim of this study was to generate a comprehensive reference database of DNA sequences from the mitochondrial 16S and 12S ribosomal RNA (rRNA) genes for 53 commercial fish species in South Africa and to evaluate the applicability of these genetic markers for the identification of fish at the species level. The DNA extracted from all target species was readily amplified using universal primers targeting both rRNA gene regions. Sequences from the 16S and 12S rRNA genes were submitted to GenBank for the first time for 34% and 53% of the fish species, respectively. Cumulative analysis of the 16S rRNA gene sequences revealed mean conspecific, congeneric and confamilial Kimura two parameter (K2P) distances of 0.03%, 0.70% and 5.10% and the corresponding values at the 12S level were 0.03%, 1.00% and 5.57%. K2P neighbour-joining trees based on both sequence datasets generally clustered species in accordance with their taxonomic classifications. The nucleotide variation in both the 16S and 12S sequences was suitable for identifying the large majority of the examined fish specimens to at least the level of genus, but was found to be less useful for the explicit differentiation of certain congeneric fish species. It is recommended that one or more faster-evolving DNA regions be analysed to confirm the identities of closely-related fish species in South Africa. PMID:21963445

  18. Regulation of mammalian nucleotide metabolism and biosynthesis.

    Lane, Andrew N; Fan, Teresa W-M

    2015-02-27

    Nucleotides are required for a wide variety of biological processes and are constantly synthesized de novo in all cells. When cells proliferate, increased nucleotide synthesis is necessary for DNA replication and for RNA production to support protein synthesis at different stages of the cell cycle, during which these events are regulated at multiple levels. Therefore the synthesis of the precursor nucleotides is also strongly regulated at multiple levels. Nucleotide synthesis is an energy intensive process that uses multiple metabolic pathways across different cell compartments and several sources of carbon and nitrogen. The processes are regulated at the transcription level by a set of master transcription factors but also at the enzyme level by allosteric regulation and feedback inhibition. Here we review the cellular demands of nucleotide biosynthesis, their metabolic pathways and mechanisms of regulation during the cell cycle. The use of stable isotope tracers for delineating the biosynthetic routes of the multiple intersecting pathways and how these are quantitatively controlled under different conditions is also highlighted. Moreover, the importance of nucleotide synthesis for cell viability is discussed and how this may lead to potential new approaches to drug development in diseases such as cancer. PMID:25628363

  19. Fragmentation of 23S rRNA in Strains of Proteus and Providencia Results from Intervening Sequences in the rrn (rRNA) Genes

    Miller, Wayne L.; Pabbaraju, Kanti; Sanderson, Kenneth E.

    2000-01-01

    Intervening sequences (IVSs) were originally identified in the rrl genes for 23S rRNA (rrl genes, for large ribosomal subunit, part of rrn operon encoding rRNA) of Salmonella enterica serovars Typhimurium LT2 and Arizonae. These sequences are transcribed but later removed during RNase III processing of the rRNA, resulting in fragmentation of the 23S species; IVSs are uncommon, but have been reported in at least 10 bacterial genera. Through PCR amplification of IVS-containing regions of the rr...

  20. Louse (Insecta : Phthiraptera) mitochondrial 12S rRNA secondary structure is highly variable

    Page, R.D.M.; Cruickshank, R.; Johnson, K P

    2002-01-01

    Lice are ectoparasitic insects hosted by birds and mammals. Mitochondrial 12S rRNA sequences obtained from lice show considerable length variation and are very difficult to align. We show that the louse 12S rRNA domain III secondary structure displays considerable variation compared to other insects, in both the shape and number of stems and loops. Phylogenetic trees constructed from tree edit distances between louse 12S rRNA structures do not closely resemble trees constructed from sequence ...

  1. PIV Measurements and Mechanisms of Adjacent Synthetic Jets Interactions

    LUO Zhen-Bing; XIA Zhi-Xun

    2008-01-01

    Interactions of adjacent synthetic jet actuators with varying relative amplitude and the relative phase of driving voltage are measured using a particle image velocimetry(PIV).Varying relative amplitude or relative phase of driving voltage of the adjacent actuators vectors the direction of the ensuing merged jet of the adjacent synthetic jets.The vectoring mechanism of the adjacent vortex pairs,attract-impact causing deflection(AICD),is provided to explain why the merged jet is generally vectored to the side of the phase-leading synthetic jet or the synthetic jet with higher driving voltage.

  2. Structural basis for a six nucleotide genetic alphabet.

    Georgiadis, Millie M; Singh, Isha; Kellett, Whitney F; Hoshika, Shuichi; Benner, Steven A; Richards, Nigel G J

    2015-06-01

    Expanded genetic systems are most likely to work with natural enzymes if the added nucleotides pair with geometries that are similar to those displayed by standard duplex DNA. Here, we present crystal structures of 16-mer duplexes showing this to be the case with two nonstandard nucleobases (Z, 6-amino-5-nitro-2(1H)-pyridone and P, 2-amino-imidazo[1,2-a]-1,3,5-triazin-4(8H)one) that were designed to form a Z:P pair with a standard "edge on" Watson-Crick geometry, but joined by rearranged hydrogen bond donor and acceptor groups. One duplex, with four Z:P pairs, was crystallized with a reverse transcriptase host and adopts primarily a B-form. Another contained six consecutive Z:P pairs; it crystallized without a host in an A-form. In both structures, Z:P pairs fit canonical nucleobase hydrogen-bonding parameters and known DNA helical forms. Unique features include stacking of the nitro group on Z with the adjacent nucleobase ring in the A-form duplex. In both B- and A-duplexes, major groove widths for the Z:P pairs are approximately 1 Å wider than those of comparable G:C pairs, perhaps to accommodate the large nitro group on Z. Otherwise, ZP-rich DNA had many of the same properties as CG-rich DNA, a conclusion supported by circular dichroism studies in solution. The ability of standard duplexes to accommodate multiple and consecutive Z:P pairs is consistent with the ability of natural polymerases to biosynthesize those pairs. This, in turn, implies that the GACTZP synthetic genetic system can explore the entire expanded sequence space that additional nucleotides create, a major step forward in this area of synthetic biology. PMID:25961938

  3. Proofreading of misincorporated nucleotides in DNA transcription.

    Voliotis, Margaritis; Cohen, Netta; Molina-París, Carmen; Liverpool, Tanniemola B

    2012-06-01

    The accuracy of DNA transcription is crucial for the proper functioning of the cell. Although RNA polymerases demonstrate selectivity for correct nucleotides, additional active mechanisms of transcriptional error correction are required to achieve observed levels of fidelity. Recent experimental findings have shed light on a particular mechanism of transcriptional error correction involving: (i) diffusive translocation of the RNA polymerase along the DNA (backtracking) and (ii) irreversible RNA cleavage. This mechanism achieves preferential cleavage of misincorporated nucleotides by biasing the local rates of translocation. Here, we study how misincorporated nucleotides affect backtracking dynamics and how this effect determines the level of transcriptional fidelity. We consider backtracking as a diffusive process in a periodic, one-dimensional energy landscape, which at a coarse-grained level gives rise to a hopping process between neighboring local minima. We propose a model for how misincorporated nucleotides deform this energy landscape and hence affect the hopping rates. In particular, we show that this model can be used to derive both the theoretical limit on the fidelity (i.e. the minimum fraction of misincorporated nucleotides) and the actual fidelity relative to this optimum, achieved for specific combinations of the cleavage and polymerization rates. Finally, we study how external factors influencing backtracking dynamics affect transcriptional fidelity. We show that biologically relevant loads, similar to those exerted by nucleosomes or other transcriptional barriers, increase error correction. PMID:22643861

  4. Design and synthesis of ATP-based nucleotide analogues and profiling of nucleotide-binding proteins

    Wolters, Justina. C.; Roelfes, Johannes; Poolman, Bert

    2011-01-01

    Two nucleotide-based probes were designed and synthesized in order to enrich samples for specific classes of proteins by affinity-based protein profiling. We focused on the profiling of adenine nucleotide-binding proteins. Two properties were considered in the design of the probes: the bait needs to

  5. Eukaryotic rRNA Modification by Yeast 5-Methylcytosine-Methyltransferases and Human Proliferation-Associated Antigen p120.

    Gabrielle Bourgeois

    Full Text Available Modified nucleotide 5-methylcytosine (m5C is frequently present in various eukaryotic RNAs, including tRNAs, rRNAs and in other non-coding RNAs, as well as in mRNAs. RNA:m5C-methyltranferases (MTases Nop2 from S. cerevisiae and human proliferation-associated nucleolar antigen p120 are both members of a protein family called Nop2/NSUN/NOL1. Protein p120 is well-known as a tumor marker which is over-expressed in various cancer tissues. Using a combination of RNA bisulfite sequencing and HPLC-MS/MS analysis, we demonstrated here that p120 displays an RNA:m5C- MTase activity, which restores m5C formation at position 2870 in domain V of 25S rRNA in a nop2Δ yeast strain. We also confirm that yeast proteins Nop2p and Rcm1p catalyze the formation of m5C in domains V and IV, respectively. In addition, we do not find any evidence of m5C residues in yeast 18S rRNA. We also performed functional complementation of Nop2-deficient yeasts by human p120 and studied the importance of different sequence and structural domains of Nop2 and p120 for yeast growth and m5C-MTase activity. Chimeric protein formed by Nop2 and p120 fragments revealed the importance of Nop2 N-terminal domain for correct protein localization and its cellular function. We also validated that the presence of Nop2, rather than the m5C modification in rRNA itself, is required for pre-rRNA processing. Our results corroborate that Nop2 belongs to the large family of pre-ribosomal proteins and possesses two related functions in pre-rRNA processing: as an essential factor for cleavages and m5C:RNA:modification. These results support the notion of quality control during ribosome synthesis by such modification enzymes.

  6. On spectral hypergraph theory of the adjacency tensor

    Pearson, Kelly J.; Zhang, Tan

    2012-01-01

    We study both $H$ and $E/Z$-eigenvalues of the adjacency tensor of a uniform multi-hypergraph and give conditions for which the largest positive $H$ or $Z$-eigenvalue corresponds to a strictly positive eigenvector. We also investigate when the $E$-spectrum of the adjacency tensor is symmetric.

  7. Novel mutation in 16S rRNA associated with streptomycin dependence in Mycobacterium tuberculosis.

    Honoré, N; Marchal, G.; Cole, S T

    1995-01-01

    Molecular characterization of a streptomycin-dependent mutant of Mycobacterium tuberculosis revealed the presence of a novel mutation in the rrs gene encoding 16S rRNA. Insertion of an additional cytosine in the 530 loop of 16S rRNA, a region known to be involved in streptomycin susceptibility and resistance, was associated with streptomycin dependence.

  8. Study on Optimization of Phase Offset at Adjacent Intersections

    Yuanli GU

    2010-11-01

    Full Text Available Optimization of the phase offset at adjacent intersections is the key parameter regarding coordinated control of traffic signal for adjacent intersections, which decides the effect of the coordinated control for adjacent intersections. According to characters of saturated traffic flow of Chinese urban road, this thesis establishes a model for optimization of phase offset for adjacent interactions and finds a solution from such model by adopting genetic algorithm. The model is verified by actual traffic flow datum of two adjacent signal intersections on Changan Avenue. Then a comparison is made between the optimization result of such model and that of the existing mathematical method and SYNCHRO model, which indicates that the model established by this thesis can reduce the delay suffered by vehicles at the intersections and increase the traffic efficiency of the intersections.

  9. Exploiting the CRISPR/Cas9 PAM Constraint for Single-Nucleotide Resolution Interventions.

    Yi Li

    Full Text Available CRISPR/Cas9 is an enabling RNA-guided technology for genome targeting and engineering. An acute DNA binding constraint of the Cas9 protein is the Protospacer Adjacent Motif (PAM. Here we demonstrate that the PAM requirement can be exploited to specifically target single-nucleotide heterozygous mutations while exerting no aberrant effects on the wild-type alleles. Specifically, we target the heterozygous G13A activating mutation of KRAS in colorectal cancer cells and we show reversal of drug resistance to a MEK small-molecule inhibitor. Our study introduces a new paradigm in genome editing and therapeutic targeting via the use of gRNA to guide Cas9 to a desired protospacer adjacent motif.

  10. Exploiting the CRISPR/Cas9 PAM Constraint for Single-Nucleotide Resolution Interventions

    Li, Yi; Mendiratta, Saurabh; Ehrhardt, Kristina; Kashyap, Neha; White, Michael A.; Bleris, Leonidas

    2016-01-01

    CRISPR/Cas9 is an enabling RNA-guided technology for genome targeting and engineering. An acute DNA binding constraint of the Cas9 protein is the Protospacer Adjacent Motif (PAM). Here we demonstrate that the PAM requirement can be exploited to specifically target single-nucleotide heterozygous mutations while exerting no aberrant effects on the wild-type alleles. Specifically, we target the heterozygous G13A activating mutation of KRAS in colorectal cancer cells and we show reversal of drug resistance to a MEK small-molecule inhibitor. Our study introduces a new paradigm in genome editing and therapeutic targeting via the use of gRNA to guide Cas9 to a desired protospacer adjacent motif. PMID:26788852

  11. The effect of secondary compounds on the rumen microbial population structure measured by 16S rRNA and 18S rRNA

    Full text: Plant secondary compounds in the forages have an important role in determining forage quality. A method for evaluating their effects on microbial population structure was carried out using the in vitro gas syringe system followed by extraction of RNA and gel separation of 16S rRNA and 18S rRNA. Quantification of 16S rRNA and 18S rRNA bands indicated the prokaryote and eukaryote populations, respectively. Five types of plant materials, i.e. Nothopanax scutellarium (Mangkokan) leaves, Morinda citrifolia (Mengkudu) fruit, Sapindus rarak (lerak) fruit and two types of Sesbania sesban leaves (hgh saponin and low saponin) were tested and Pennisetum purpureum (rumput gajah, Indonesian name) was used as a control roughage. Presence of saponin in these plant materials was determined qualitatively by thin layer chromatography. Eukaryote population was found to be significantly affected by the above plant materials. Both types of S. sesban leaves caused total elimination of eukaryotes. S. rarak reduced both eukaryote and prokaryote populations. The observed inhibition of eukaryote population might be due to the presence of saponin in these plant materials. In another experiment, a methanol extract of S. rarak which contained saponin was included and its effect on in vitro fermentation of P. purpureum was evaluated. The results showed that at higher levels of inclusion of S. rarak methanol extract, eukaroytes were totally eliminated. Comparison was made between microbial mass calculated based on difference between apparent undigested residue and true undigested residue and microbial mass calculations based on 16S rRNA and 18S rRNA. Microbial mass calculated by difference method was much higher than the microbial mass calculated on the basis of 16S rRNA and 18S rRNA. The quantification of RNA can be a useful and rapid technique for an accurate assessment of the effect of new forage materials on the microbial population structure. Other parameters from in vitro

  12. Pyrrolidine analogues of nucleosides and nucleotides

    Rejman, Dominik; Pohl, Radek; Kovačková, Soňa; Kočalka, Petr; Švenková, Alžběta; Šanderová, Hana; Krásný, Libor; Rosenberg, Ivan

    -, č. 52 (2008), s. 577-578. ISSN 0261-3166. [Joint Symposium of the International Roundtable on Nucleosides, Nucleotides and Nucleic Acids /18./ and the International Symposium on Nucleic Acid Chemistry /35./. Kyoto, 08.09.2008-12.09.2008] R&D Projects: GA MŠk(CZ) LC06077; GA MŠk 2B06065; GA MZd NR9138 Institutional research plan: CEZ:AV0Z40550506; CEZ:AV0Z50200510; CEZ:AV0Z50520514 Keywords : pyrrolidine * nucleoside * nucleotide Subject RIV: CC - Organic Chemistry

  13. Subnuclear partitioning of rRNA genes between the nucleolus and nucleoplasm reflects alternative epiallelic states

    Pontvianne, Frederic; Blevins, Todd; Chandrasekhara, Chinmayi; Mozgová, Iva; Hassel, Christiane; Pontes, Olga M.F.; Tucker, Sarah; Mokroš, Petr; Muchová, Veronika; Fajkus, Jiří; Pikaard, Craig S.

    2013-01-01

    Eukaryotes can have thousands of 45S ribosomal RNA (rRNA) genes, many of which are silenced during development. Using fluorescence-activated sorting techniques, we show that active rRNA genes in Arabidopsis thaliana are present within sorted nucleoli, whereas silenced rRNA genes are excluded. DNA methyltransferase (met1), histone deacetylase (hda6), or chromatin assembly (caf1) mutants that disrupt silencing abrogate this nucleoplasmic–nucleolar partitioning. Bisulfite sequencing data indicate that active nucleolar rRNA genes are nearly completely demethylated at promoter CGs, whereas silenced genes are nearly fully methylated. Collectively, the data reveal that rRNA genes occupy distinct but changeable nuclear territories according to their epigenetic state. PMID:23873938

  14. Phylogenetic Analysis of Particle-Attached and Free-Living Bacterial Communities in the Columbia River, Its Estuary, and the Adjacent Coastal Ocean

    Crump, Byron C.; Armbrust, E. Virginia; Baross, John A.

    1999-01-01

    The Columbia River estuary is a dynamic system in which estuarine turbidity maxima trap and extend the residence time of particles and particle-attached bacteria over those of the water and free-living bacteria. Particle-attached bacteria dominate bacterial activity in the estuary and are an important part of the estuarine food web. PCR-amplified 16S rRNA genes from particle-attached and free-living bacteria in the Columbia River, its estuary, and the adjacent coastal ocean were cloned, and 2...

  15. The influence of different land uses on the structure of archaeal communities in Amazonian anthrosols based on 16S rRNA and amoA genes.

    Taketani, Rodrigo Gouvêa; Tsai, Siu Mui

    2010-05-01

    Soil from the Amazonian region is usually regarded as unsuitable for agriculture because of its low organic matter content and low pH; however, this region also contains extremely rich soil, the Terra Preta Anthrosol. A diverse archaeal community usually inhabits acidic soils, such as those found in the Amazon. Therefore, we hypothesized that this community should be sensitive to changes in the environment. Here, the archaeal community composition of Terra Preta and adjacent soil was examined in four different sites in the Brazilian Amazon under different anthropic activities. The canonical correspondence analysis of terminal restriction fragment length polymorphisms has shown that the archaeal community structure was mostly influenced by soil attributes that differentiate the Terra Preta from the adjacent soil (i.e., pH, sulfur, and organic matter). Archaeal 16S rRNA gene clone libraries indicated that the two most abundant genera in both soils were Candidatus nitrosphaera and Canditatus nitrosocaldus. An ammonia monoxygenase gene (amoA) clone library analysis indicated that, within each site, there was no significant difference between the clone libraries of Terra Preta and adjacent soils. However, these clone libraries indicated there were significant differences between sites. Quantitative PCR has shown that Terra Preta soils subjected to agriculture displayed a higher number of amoA gene copy numbers than in adjacent soils. On the other hand, soils that were not subjected to agriculture did not display significant differences on amoA gene copy numbers between Terra Preta and adjacent soils. Taken together, our findings indicate that the overall archaeal community structure in these Amazonian soils is determined by the soil type and the current land use. PMID:20204349

  16. Delayed acquisition of non-adjacent vocalic distributional regularities.

    Gonzalez-Gomez, Nayeli; Nazzi, Thierry

    2016-01-01

    The ability to compute non-adjacent regularities is key in the acquisition of a new language. In the domain of phonology/phonotactics, sensitivity to non-adjacent regularities between consonants has been found to appear between 7 and 10 months. The present study focuses on the emergence of a posterior-anterior (PA) bias, a regularity involving two non-adjacent vowels. Experiments 1 and 2 show that a preference for PA over AP (anterior-posterior) words emerges between 10 and 13 months in French-learning infants. Control experiments show that this bias cannot be explained by adjacent or positional preferences. The present study demonstrates that infants become sensitive to non-adjacent vocalic distributional regularities between 10 and 13 months, showing the existence of a delay for the acquisition of non-adjacent vocalic regularities compared to equivalent non-adjacent consonantal regularities. These results are consistent with the CV hypothesis, according to which consonants and vowels play different roles at different linguistic levels. PMID:25786491

  17. Interactions of adjacent pulsating, erupting and creeping solitons

    Song Li-Jun; Li Lu; Zhou Guo-Sheng

    2007-01-01

    This paper investigates the adjacent interactions of three novel solitons for the quintic complex Ginzburg-Landau equation, which are plain pulsating, erupting and creeping solitons. It is found that different performances are presented for different solitons due to isolated regions of the parameter space where they exist. For example, plain pulsating and erupting solitons exhibit mutual annihilation during collisions with the decrease of total energy, but for creeping soliton,the two adjacent pulses present soliton fusion without any loss of energy. Otherwise, the method for restraining the interactions is also found and it can suppress interacions between these two adjacent pulses effectively.

  18. Depletion of pre-16S rRNA in starved Escherichia coli cells.

    Cangelosi, G A; Brabant, W H

    1997-07-01

    Specific hybridization assays for intermediates in rRNA synthesis (pre-rRNA) may become useful for monitoring the growth activity of individual microbial species in complex natural systems. This possibility depends upon the assumption that rRNA processing in microbial cells continues after growth and pre-rRNA synthesis cease, resulting in drainage of the pre-rRNA pool. This is not the case in many eukaryotic cells, but less is known about the situation in bacteria. Therefore, we used DNA probes to measure steady-state cellular pre-16S rRNA pools during growth state transitions in Escherichia coli. Pre-16S rRNA became undetectable when cells entered the stationary phase on rich medium and was replenished upon restoration of favorable growth conditions. These fluctuations were of much greater magnitude than concurrent fluctuations in the mature 16S rRNA pool. The extent of pre-16S rRNA depletion depended upon the circumstances limiting growth. It was significantly more pronounced in carbon-energy-starved cells than in nitrogen-starved cells or in cells treated with energy uncouplers. In the presence of the transcriptional inhibitor rifampin, rates of pre-16S rRNA depletion in carbon-energy-starved cells and nitrogen-starved cells were similar, suggesting that the difference between these conditions resides primarily at the level of pre-rRNA synthesis. Chloramphenicol, which inhibits the final steps in rRNA maturation, halted pre-16S rRNA depletion under all conditions. The data show that E. coli cells continue to process pre-rRNA after growth and rrn operon transcription cease, leading to drainage of the pre-rRNA pool. This supports the feasibility of using pre-rRNA-targeted probes to monitor bacterial growth in natural systems, with the caveat that patterns of pre-rRNA depletion vary with the conditions limiting growth. PMID:9226253

  19. Griset: Pottery of the Great Basin and Adjacent Areas

    Forsyth, Donald W.

    1986-01-01

    Pottery of the Great Basin and Adjacent Areas. Suzanne Griset, ed. University of Utah Anthropological Papers No. Ill, 1986, 170 pp., 34 figs., 5 tables, annotated and indexed bibliography, $17.50 (paper).

  20. Sequencing of 16S rRNA Gene: A Rapid Tool for Identification of Bacillus anthracis

    Sacchi, Claudio T.; Whitney, Anne M.; Mayer, Leonard W.; Morey, Roger; Steigerwalt, Arnold; Boras, Ariana; Weyant, Robin S.; Popovic, Tanja

    2002-01-01

    In a bioterrorism event, a tool is needed to rapidly differentiate Bacillus anthracis from other closely related spore-forming Bacillus species. During the recent outbreak of bioterrorism-associated anthrax, we sequenced the 16S rRNA generom these species to evaluate the potential of 16S rRNA gene sequencing as a diagnostic tool. We found eight distinct 16S types among all 107 16S rRNA gene seqs fuences that differed from each other at 1 to 8 positions (0.06% to 0.5%). All 86 B. anthracis had...

  1. Molecular analysis of 18S rRNA gene of Cryptosporidium parasites from patients living in Iran, Malawi, Nigeria and Vietnam.

    Ghaffari, Salman; Kalantari, Narges

    2012-01-01

    Cryptosporidium species are one of the most common causes of gastrointestinal infection in humans around the world. This study has aimed to investigate the hyper variable region of the 18S rRNA gene in Cryptosporidium for exact parasite identification. DNA was extracted from 26 fecal samples from which initially Cryptosporidium oocysts were identified by Ziehl-Neelsen acid-fast , Auramine phenol and ELISA techniques. Nested PCR, targeting the most polymorphic region of the 18S rRNA gene and genotyping was performed by restriction endonuclease digestion of the PCR product followed by nucleotide sequencing and phylogenic analysis. Among 26 isolates analyzed, three species of Cryptosporidium were identified; 38.5% of the isolates were C. hominis while 53.8% of the isolates were C. parvum and 7.7% of the isolates were C. meleagridis, which the last two species have the potentially zoonotic transmission. The only 11T subtype of C. hominis was demonstrated. These strains clustered distinctly into either human or animal origin regardless of the geographical origin, age, or immunity status of the patients. In summary, this work is the first report of C. meleagridis infecting human in Iran. Moreover, it suggested that multi-locus study of Cryptosporidium species in developing countries would be necessary to determine the extent of transmission of cryptosporidiosis in the populations. PMID:24551771

  2. The phylogeny of Aerococcus and Pediococcus as determined by 16S rRNA sequence analysis: description of Tetragenococcus gen. nov.

    Collins, M D; Williams, A M; Wallbanks, S

    1990-08-01

    The phylogenetic interrelationships of the genera Pediococcus and Aerococcus were investigated using reverse transcriptase sequencing of 16S rRNA. The genus Pediococcus was found to be phylogenetically heterogeneous. The four species P. acidilactici, P. damnosus, P. parvulus and P. pentosaceus formed a phylogenetically distinct group. Within this pediococcal cluster, P. acidilactici was closely related to P. pentosaceus whereas P. damnosus showed a specific relationship with P. parvulus. The species P. dextrinicus, although showing significant sequence relatedness with these pediococcal species, was peripheral to the genus. Pediococcus halophilus exhibited low sequence homology with all of the species examined and formed a distinct line of descent. Pediococcus halophilus exhibited a closer affinity with enterococci and carnobacteria than with the other lactic acid bacteria. Pediococcus urinae-equi was phylogenetically very closely related to Aerococcus viridans. The 16S rRNA sequences of the type strains of these species differed by only two nucleotides (99.9% sequence homology) and clearly demonstrate that P. urinae-equi is a member of the genus Aerococcus. PMID:2227360

  3. Purification, crystallization and preliminary X-ray diffraction analysis of the 23S rRNA methyltransferase RlmJ from Escherichia coli

    The 23S rRNA methyltransferase RlmJ from E. coli has been cloned, expressed, purified and crystallized. X-ray diffraction data to 1.85 Å resolution have been collected from the apo RlmJ crystals. Methyltransferase RlmJ uses the cofactor S-adenosylmethionine to methylate the exocyclic nitrogen N6 of nucleotide A2030 in 23S rRNA during ribosome assembly in Escherichia coli. RlmJ with a C-terminal hexahistidine tag was overexpressed in E. coli and purified as a monomer using Ni2+-affinity and size-exclusion chromatography. The recombinant RlmJ was crystallized using the sitting-drop vapour-diffusion method and a full data set was collected to 1.85 Å resolution from a single apo crystal. The crystals belonged to space group P21, with unit-cell parameters a = 46.9, b = 77.8, c = 82.5 Å, β = 104°. Data analysis suggested two molecules per asymmetric unit and a Matthews coefficient of 2.20 Å3 Da−1

  4. The Mycoplasma gallisepticum 16S-23S rRNA intergenic spacer region sequence as a novel tool for epizootiological studies.

    Raviv, Ziv; Callison, S; Ferguson-Noel, N; Laibinis, V; Wooten, R; Kleven, S H

    2007-06-01

    Mycoplasma gallisepticum (MG) contains two sets of rRNA genes (5S, 16S and 23S) in its genome, but only one of the two is organized in an operon cluster and contains a unique 660-nucleotide intergenic spacer region (IGSR) between the 16S and the 23S rRNA genes. We designed a polymerase chain reaction (PCR) for the specific amplification of the complete MG IGSR segment. The MG IGSR PCR was tested on 18 avian mollicute species and was confirmed as MG specific. The reaction sensitivity was demonstrated by comparing it to the well-established MG mgc2 PCR. The MG IGSR sequence was found to be highly variable (discrimination [D] index of 0.950) among a variety of MG laboratory strains, vaccine strains, and field isolates. The sequencing of the MG IGSR appears to be a valuable single-locus sequence typing (SLST) tool for MG isolate differentiation in diagnostic cases and epizootiological studies. PMID:17626483

  5. The complete nucleotide sequence of the mitochondrial genome of the cabbage butterfly, Artogeia melete (Lepidoptera: Pieridae)

    Guiyun Hong; Shaotong Jiang; Miao Yu; Ying Yang; Feng Li; Fangsen Xue; Zhaojun Wei

    2009-01-01

    The complete mitochondrial genome (mitogenome) of Artogeia melete was determined as being composed of 15,140 bp, including 13 protein-coding genes (PCGs), 2rRNA genes, 22 tRNA genes, and one control region.The gene order of A. melete mitogenome is typical of Lepidoptera and differs from the insect ancestral type in the location of trnM. The A. melete mitogenome has a total of 119 bp of intergenic spacer sequences spread over 10 regions, ranging in sizes between 1 and 48 bp.The nucleotide composition of the A. melete mitogenome is also biased toward A + T nucleotides (79.77%),which is higher than that of Ochrogaster lunifer (77.84%), but lower than nine other lepidopterans sequenced. The PCGs have typical mitochondrial start codons, except for cox1, which contains the unusual CGA. The cox1, cox2, nad2, and had5 genes of the A.melete mitogenome have incomplete stop codons (T).The A. melete A + T-rich region contains some conserved structures that are similar to those found in other lepidopteran mitogenomes, including a structure combining the motif 'ATAGA', a 19-bp poly(T) stretch,a microsatellite (AT)n element, and a 9-bp poly(A)upstream trnM. The A. melete mitogenome contains a duplicated 36-bp repeat element, which consists of a 26-bp core sequence flanked by 10-bp perfectly inverted repeats.

  6. Pyrrolidine nucleotides conformationally constrained via hydrogen bonding

    Pohl, Radek; Poštová Slavětínská, Lenka; Rejman, Dominik

    Praha : Institute of Organic Chemistry and Biochemistry AS CR, v. v. i, 2014 - (Hocek, M.), s. 352-353 ISBN 978-80-86241-50-0. - (Collection Symposium Series. 14). [Symposium on Chemistry of Nucleic Acid Components /16./. Český Krumlov (CZ), 08.06.2014-13.06.2014] R&D Projects: GA ČR GA13-24880S Institutional support: RVO:61388963 Keywords : pyrrolidine nucleotides * PMEA * hydrogen bond Subject RIV: CC - Organic Chemistry

  7. Pyrrolidine nucleotide analogs with a tunable conformation

    Poštová Slavětínská, Lenka; Rejman, Dominik; Pohl, Radek

    2014-01-01

    Roč. 10, Aug 22 (2014), s. 1967-1980. ISSN 1860-5397 R&D Projects: GA ČR GA13-24880S Institutional support: RVO:61388963 Keywords : conformation * NMR * nucleic acids * nucleotide analog * phosphonic acid * pseudorotation * pyrrolidine Subject RIV: CC - Organic Chemistry Impact factor: 2.762, year: 2014 http://www.beilstein-journals.org/bjoc/single/articleFullText.htm?publicId=1860-5397-10-205

  8. Nucleotide Manipulatives to Illustrate the Central Dogma

    Sonja B. Yung

    2015-08-01

    Full Text Available The central dogma is a core concept that is critical for introductory biology and microbiology students to master. However, students often struggle to conceptualize the processes involved, and fail to move beyond simply memorizing the basic facts. To encourage critical thinking, we have designed a set of magnetic nucleotide manipulatives that allow students to model DNA structure, along with the processes of replication, transcription, and translation.

  9. Nucleotide Manipulatives to Illustrate the Central Dogma†

    Sonja B. Yung; Todd P. Primm

    2015-01-01

    The central dogma is a core concept that is critical for introductory biology and microbiology students to master. However, students often struggle to conceptualize the processes involved, and fail to move beyond simply memorizing the basic facts. To encourage critical thinking, we have designed a set of magnetic nucleotide manipulatives that allow students to model DNA structure, along with the processes of replication, transcription, and translation.

  10. Mitochondrial Adenine Nucleotide Transport and Cardioprotection

    Das, Samarjit; Steenbergen, Charles

    2011-01-01

    Mitochondria are highly metabolically active cell organelles that not only act as the powerhouse of the cell by supplying energy through ATP production, but also play a destructive role by initiating cell death pathways. Growing evidence recognizes that mitochondrial dysfunction is one of the major causes of cardiovascular disease. Under de-energized conditions, slowing of adenine nucleotide transport in and out of the mitochondria significantly attenuates myocardial ischemia-reperfusion inju...

  11. Investigation of molluscan phylogeny on the basis of 18S rRNA sequences.

    Winnepenninckx, B; Backeljau, T; De Wachter, R

    1996-12-01

    The 18S rRNA sequences of 12 molluscs, representing the extant classes Gastropoda, Bivalvia, Polyplacophora, Scaphopoda, and Caudofoveata, were determined and compared with selected known 18S rRNA sequences of Metazoa, including other Mollusca. These data do not provide support for a close relationship between Platyhelminthes (Turbellaria) and Mollusca, but rather suggest that the latter group belongs to a clade of eutrochozoan coelomates. The 18S rRNA data fail to recover molluscan, bivalve, or gastropod monophyly. However, the branching pattern of the eutrochozoan phyla and classes is unstable, probably due to the explosive Cambrian radiation during which these groups arose. Similarly, the 18S rRNA data do not provide a reliable signal for the molluscan interclass relationships. Nevertheless, we obtained strong preliminary support for phylogenetic inferences at more restricted taxonomic levels, such as the monophyly of Polyplacophora, Caenogastropoda, Euthyneura, Heterodonta, and Arcoida. PMID:8952075

  12. Phylogenetic relatedness determined between antibiotic resistance and 16S rRNA genes in actinobacteria

    Ságová-Marečková, M.; Ulanová, Dana; Šanderová, P.; Omelka, M.; Kameník, Zdeněk; Olšovská, J.; Kopecký, J.

    2015-01-01

    Roč. 15, APR 2015 (2015). ISSN 1471-2180 Institutional support: RVO:61388971 Keywords : Actinobacteria * 16S rRNA diversity * Resistance genes Subject RIV: EE - Microbiology , Virology Impact factor: 2.729, year: 2014

  13. Inhibition of Escherichia coli precursor-16S rRNA processing by mouse intestinal contents

    Licht, Tine Rask; Tolker-Nielsen, Tim; Holmstrøm, Kim; Krogfelt, Karen A.; Molin, Søren

    1999-01-01

    . We have applied fluorescence in situ hybridization of pre-16S rRNA to Escherichia coli cells growing in vitro in extracts from two different compartments of the mouse intestine: the caecal mucus layer, where E. coli grew rapidly, and the contents of the caecum, which supported much slower bacterial......The correlation between ribosome content and growth rate found in many bacterial species has proved useful for estimating the growth activity of individual cells by quantitative in situ rRNA hybridization. However, in dynamic environments, the stability of mature ribosomal RNA causes problems in...... using cellular rRNA contents for direct monitoring of bacterial growth activity in situ. In a recent paper, Cangelosi and Brabant suggested monitoring the content of precursors in rRNA synthesis (pre-rRNAs) as an alternative approach. These are rapidly broken down after the cessation of bacterial growth...

  14. Multiphasic interactions between nucleotides and target proteins

    Nissen, Per

    2016-01-01

    The nucleotides guanosine tetraphosphate (ppGpp) and guanosine pentaphosphate (pppGpp) bind to target proteins to promote bacterial survival (Corrigan et al. 2016). Thus, the binding of the nucleotides to RsgA, a GTPase, inhibits the hydrolysis of GTP. The dose response, taken to be curvilinear with respect to the logarithm of the inhibitor concentration, is instead much better (P<0.001 when the 6 experiments are combined) represented as multiphasic, with high to exceedingly high absolute r values for the straight lines, and with transitions in the form of non-contiguities (jumps). Profiles for the binding of radiolabeled nucleotides to HprT and Gmk, GTP synthesis enzymes, were, similarly, taken to be curvilinear with respect to the logarithm of the protein concentration. However, the profiles are again much better represented as multiphasic than as curvilinear (the P values range from 0.047 to <0.001 for each of the 8 experiments for binding of ppGpp and pppGpp to HprT). The binding of GTP to HprT and ...

  15. Visualization of cyclic nucleotide dynamics in neurons

    Kirill eGorshkov

    2014-12-01

    Full Text Available The second messengers cAMP and cGMP transduce many neuromodulatory signals from hormones and neurotransmitters into specific functional outputs. Their production, degradation and signaling are spatiotemporally regulated to achieve high specificity in signal transduction. The development of genetically encodable fluorescent biosensors has provided researchers with useful tools to study these versatile second messengers and their downstream effectors with unparalleled spatial and temporal resolution in cultured cells and living animals. In this review, we introduce the general design of these fluorescent biosensors and describe several of them in more detail. Then we discuss a few examples of using cyclic nucleotide fluorescent biosensors to study regulation of neuronal function and finish with a discussion of advances in the field. Although there has been significant progress made in understanding how the specific signaling of cyclic nucleotide second messengers is achieved, the mechanistic details in complex cell types like neurons are only just beginning to surface. Current and future fluorescent protein reporters will be essential to elucidate the role of cyclic nucleotide signaling dynamics in the functions of individual neurons and their networks.

  16. Type III effector activation via nucleotide binding, phosphorylation, and host target interaction.

    Darrell Desveaux

    2007-03-01

    Full Text Available The Pseudomonas syringae type III effector protein avirulence protein B (AvrB is delivered into plant cells, where it targets the Arabidopsis RIN4 protein (resistance to Pseudomonas maculicula protein 1 [RPM1]-interacting protein. RIN4 is a regulator of basal host defense responses. Targeting of RIN4 by AvrB is recognized by the host RPM1 nucleotide-binding leucine-rich repeat disease resistance protein, leading to accelerated defense responses, cessation of pathogen growth, and hypersensitive host cell death at the infection site. We determined the structure of AvrB complexed with an AvrB-binding fragment of RIN4 at 2.3 A resolution. We also determined the structure of AvrB in complex with adenosine diphosphate bound in a binding pocket adjacent to the RIN4 binding domain. AvrB residues important for RIN4 interaction are required for full RPM1 activation. AvrB residues that contact adenosine diphosphate are also required for initiation of RPM1 function. Nucleotide-binding residues of AvrB are also required for its phosphorylation by an unknown Arabidopsis protein(s. We conclude that AvrB is activated inside the host cell by nucleotide binding and subsequent phosphorylation and, independently, interacts with RIN4. Our data suggest that activated AvrB, bound to RIN4, is indirectly recognized by RPM1 to initiate plant immune system function.

  17. Functional interactions within 23S rRNA involving the peptidyltransferase center.

    Douthwaite, S

    1992-01-01

    A molecular genetic approach has been employed to investigate functional interactions within 23S rRNA. Each of the three base substitutions at guanine 2032 has been made. The 2032A mutation confers resistance to the antibiotics chloramphenicol and clindamycin, which interact with the 23S rRNA peptidyltransferase loop. All three base substitutions at position 2032 produce an erythromycin-hypersensitive phenotype. The 2032 substitutions were compared with and combined with a 12-bp deletion muta...

  18. A Sensitive Cyclic Nucleotide Phosphodiesterase Assay for Transient Enzyme Kinetics

    Lookeren Campagne, Michiel M. van; Haastert, Peter J.M. van

    1983-01-01

    A new assay for cyclic nucleotide phosphodiesterase has been developed by using reverse-phase column chromatography for the separation of product and substrate of the enzymatic reaction. The polar 5'-nucleotides are not retarded by the column, while the more lipophilic cyclic nucleotides bind to the

  19. Temporal distribution of bacterial community structure in the Changjiang Estuary hypoxia area and the adjacent East China Sea

    Bacterial community structure and the effects of environmental factors on the microbial community distribution were investigated in the Changjiang Estuary hypoxia area and its adjacent area in the East China Sea (ECS) in June, August and October, 2006. Profiles of bacterial communities were generated by denaturing gradient gel electrophoresis (DGGE) of 16S rRNA genes followed by DNA sequence analysis. The dominant bacterial groups were affiliated to Gammaproteobacteria, Cytophaga–Flavobacteria–Bacteroides (CFB), Deltaproteobacteria, Cyanobacteria and Firmicutes, which were mostly from the marine seawater ecosystem. Effects of environmental factors on the bacterial community distribution were analyzed by the ordination technique of canonical correspondence analysis (CCA). The environmental factors significantly influencing bacterial community structure were different in the three months; dissolved organic carbon (DOC) and temperature in June and nitrite in August. No environmental variables displayed significant influence on the bacterial community at the 5% level in October. The seasonal environmental heterogeneity in the Changjiang Estuary and the adjacent ECS, such as seasonal hydrodynamic conditions and riverine input of nutrients, might be the reason for the difference in the key environmental factors determining the bacterial community in the three months. (letter)

  20. Yersinia spp. Identification Using Copy Diversity in the Chromosomal 16S rRNA Gene Sequence.

    Hao, Huijing; Liang, Junrong; Duan, Ran; Chen, Yuhuang; Liu, Chang; Xiao, Yuchun; Li, Xu; Su, Mingming; Jing, Huaiqi; Wang, Xin

    2016-01-01

    API 20E strip test, the standard for Enterobacteriaceae identification, is not sufficient to discriminate some Yersinia species for some unstable biochemical reactions and the same biochemical profile presented in some species, e.g. Yersinia ferderiksenii and Yersinia intermedia, which need a variety of molecular biology methods as auxiliaries for identification. The 16S rRNA gene is considered a valuable tool for assigning bacterial strains to species. However, the resolution of the 16S rRNA gene may be insufficient for discrimination because of the high similarity of sequences between some species and heterogeneity within copies at the intra-genomic level. In this study, for each strain we randomly selected five 16S rRNA gene clones from 768 Yersinia strains, and collected 3,840 sequences of the 16S rRNA gene from 10 species, which were divided into 439 patterns. The similarity among the five clones of 16S rRNA gene is over 99% for most strains. Identical sequences were found in strains of different species. A phylogenetic tree was constructed using the five 16S rRNA gene sequences for each strain where the phylogenetic classifications are consistent with biochemical tests; and species that are difficult to identify by biochemical phenotype can be differentiated. Most Yersinia strains form distinct groups within each species. However Yersinia kristensenii, a heterogeneous species, clusters with some Yersinia enterocolitica and Yersinia ferderiksenii/intermedia strains, while not affecting the overall efficiency of this species classification. In conclusion, through analysis derived from integrated information from multiple 16S rRNA gene sequences, the discrimination ability of Yersinia species is improved using our method. PMID:26808495

  1. Nucleotide Excision Repair in Caenorhabditis elegans

    Hannes Lans; Wim Vermeulen

    2011-01-01

    Nucleotide excision repair (NER) plays an essential role in many organisms across life domains to preserve and faithfully transmit DNA to the next generation. In humans, NER is essential to prevent DNA damage-induced mutation accumulation and cell death leading to cancer and aging. NER is a versatile DNA repair pathway that repairs many types of DNA damage which distort the DNA helix, such as those induced by solar UV light. A detailed molecular model of the NER pathway has emerged from in vi...

  2. Nucleotide sequence of Klebsiella pneumoniae lac genes.

    Buvinger, W E; Riley, M

    1985-01-01

    The nucleotide sequences of the Klebsiella pneumoniae lacI and lacZ genes and part of the lacY gene were determined, and these genes were located and oriented relative to one another. The K. pneumoniae lac operon is divergent in that the lacI and lacZ genes are oriented head to head, and complementary strands are transcribed. Besides base substitutions, the lacZ genes of K. pneumoniae and Escherichia coli have suffered short distance shifts of reading frame caused by additions or deletions or...

  3. Histone displacement during nucleotide excision repair

    Dinant, C.; Bartek, J.; Bekker-Jensen, S.

    2012-01-01

    Nucleotide excision repair (NER) is an important DNA repair mechanism required for cellular resistance against UV light and toxic chemicals such as those found in tobacco smoke. In living cells, NER efficiently detects and removes DNA lesions within the large nuclear macromolecular complex called......, thus allowing repair proteins to efficiently access DNA. On the other hand, after completion of the repair, the chromatin must be returned to its previous undamaged state. Chromatin remodeling can refer to three separate but interconnected processes, histone post-translational modifications, insertion...

  4. Group edge choosability of planar graphs without adjacent short cycles

    Xin ZHANG; Liu, Guizhen

    2011-01-01

    In this paper, we aim to introduce the group version of edge coloring and list edge coloring, and prove that all 2-degenerate graphs along with some planar graphs without adjacent short cycles is group $(\\Delta(G)+1)$-edge-choosable while some planar graphs with large girth and maximum degree is group $\\Delta(G)$-edge-choosable.

  5. Biogeochemistry of hydrothermally and adjacent non-altered soils

    As a field/lab project, students in the Soil Biogeochemistry class of the University of Nevada, Reno described and characterized seven pedons, developed in hydrothermally and adjacent non-hydrothermally altered andesitic parent material near Reno, NV. Hydrothermally altered soils had considerably lo...

  6. PROBABILISTIC ZONING OF ADJACENT CATCHMENTS BY PHYSICAL MODELING

    Yu. B. Andreev

    2015-11-01

    Full Text Available Now the probabilistic zoning of avalanche sites is being made either on the basis of the available field data, or using the mathematical and physical modeling of avalanche dynamics processes. The work purpose consisted in research of interaction and compiling probabilistic zoning maps of two adjacent avalanche sites by a physical modeling method. For the two adjacent sites № 9 and 10 on the slope of northern exposition ofTchegetMountain(Elbrus region,Caucasus the model of this slope with the scale of 1: 2 500 was created. The model dimension is 0,82 × 1,1 ×0,57 m. This model was produced using the 4-mm plywood sheets imposed against each other. The model horizontals correspond to the10 mnatural ones. The model slope was also surfaced by thin gypsum lay and then varnished. The fine-grained sawdust (0.1 mm with a natural friction angle of 43º has been chosen as the loose material modeling snow. A series of experiments on modeling avalanche releases from the two sites were carried out resulted in the measurements of avalanche deposit parameters such as run-out distance and length, width and thickness of deposits. The similarity criteria were used during the experiments. The morphometric features of adjacent sites interaction are revealed. The basic result of the carried out work will consist in the probabilistic zoning map of two adjacent sites № 9 and 10.

  7. Classifying Coding DNA with Nucleotide Statistics

    Nicolas Carels

    2009-10-01

    Full Text Available In this report, we compared the success rate of classification of coding sequences (CDS vs. introns by Codon Structure Factor (CSF and by a method that we called Universal Feature Method (UFM. UFM is based on the scoring of purine bias (Rrr and stop codon frequency. We show that the success rate of CDS/intron classification by UFM is higher than by CSF. UFM classifies ORFs as coding or non-coding through a score based on (i the stop codon distribution, (ii the product of purine probabilities in the three positions of nucleotide triplets, (iii the product of Cytosine (C, Guanine (G, and Adenine (A probabilities in the 1st, 2nd, and 3rd positions of triplets, respectively, (iv the probabilities of G in 1st and 2nd position of triplets and (v the distance of their GC3 vs. GC2 levels to the regression line of the universal correlation. More than 80% of CDSs (true positives of Homo sapiens (>250 bp, Drosophila melanogaster (>250 bp and Arabidopsis thaliana (>200 bp are successfully classified with a false positive rate lower or equal to 5%. The method releases coding sequences in their coding strand and coding frame, which allows their automatic translation into protein sequences with 95% confidence. The method is a natural consequence of the compositional bias of nucleotides in coding sequences.

  8. Deep sequencing of subseafloor eukaryotic rRNA reveals active Fungi across marine subsurface provinces.

    William Orsi

    Full Text Available The deep marine subsurface is a vast habitat for microbial life where cells may live on geologic timescales. Because DNA in sediments may be preserved on long timescales, ribosomal RNA (rRNA is suggested to be a proxy for the active fraction of a microbial community in the subsurface. During an investigation of eukaryotic 18S rRNA by amplicon pyrosequencing, unique profiles of Fungi were found across a range of marine subsurface provinces including ridge flanks, continental margins, and abyssal plains. Subseafloor fungal populations exhibit statistically significant correlations with total organic carbon (TOC, nitrate, sulfide, and dissolved inorganic carbon (DIC. These correlations are supported by terminal restriction length polymorphism (TRFLP analyses of fungal rRNA. Geochemical correlations with fungal pyrosequencing and TRFLP data from this geographically broad sample set suggests environmental selection of active Fungi in the marine subsurface. Within the same dataset, ancient rRNA signatures were recovered from plants and diatoms in marine sediments ranging from 0.03 to 2.7 million years old, suggesting that rRNA from some eukaryotic taxa may be much more stable than previously considered in the marine subsurface.

  9. Chromosomal localization and sequence variation of 5S rRNA gene in five Capsicum species.

    Park, Y K; Park, K C; Park, C H; Kim, N S

    2000-02-29

    Chromosomal localization and sequence analysis of the 5S rRNA gene were carried out in five Capsicum species. Fluorescence in situ hybridization revealed that chromosomal location of the 5S rRNA gene was conserved in a single locus at a chromosome which was assigned to chromosome 1 by the synteny relationship with tomato. In sequence analysis, the repeating units of the 5S rRNA genes in the Capsicum species were variable in size from 278 bp to 300 bp. In sequence comparison of our results to the results with other Solanaceae plants as published by others, the coding region was highly conserved, but the spacer regions varied in size and sequence. T stretch regions, just after the end of the coding sequences, were more prominant in the Capsicum species than in two other plants. High G x C rich regions, which might have similar functions as that of the GC islands in the genes transcribed by RNA PolII, were observed after the T stretch region. Although we could not observe the TATA like sequences, an AT rich segment at -27 to -18 was detected in the 5S rRNA genes of the Capsicum species. Species relationship among the Capsicum species was also studied by the sequence comparison of the 5S rRNA genes. While C. chinense, C. frutescens, and C. annuum formed one lineage, C. baccatum was revealed to be an intermediate species between the former three species and C. pubescens. PMID:10774742

  10. Assembly of proteins and 5 S rRNA to transcripts of the major structural domains of 23 S rRNA

    Ostergaard, P; Phan, H; Johansen, L B;

    1998-01-01

    The six major structural domains of 23 S rRNA from Escherichia coli, and all combinations thereof, were synthesized as separate T7 transcripts and reconstituted with total 50 S subunit proteins. Analysis by one and two-dimensional gel electrophoresis demonstrated the presence of at least one......+VI. This indicates that there are two major protein assembly centres located at the ends of the 23 S rRNA, which is consistent with an earlier view that in vitro protein assembly nucleates around proteins L24 and L3. Although similar protein assembly patterns were observed over a range of temperature and magnesium...... approach was used to map the putative binding regions on domain V of protein L9 and the 5 S RNA-L5-L18 complex....

  11. Molecular phylogeny of Pneumocystis based on 5.8S rRNA gene and the internal transcribed spacers of rRNA gene sequences

    2008-01-01

    To clarify the phylogenetic relationships and species status of Pneumocystis, the 5.8S rRNA gene and the internal transcribed spacers (ITS, 1 and 2) of Pneumocystis rRNA derived from rat, gerbil and human were amplified, cloned and sequenced. The genetic distance matrix of six Pneumocystis species compared with other fungi like Taphrina and Saccharomyces indicated that the Pneumocystis genus contained multiple species including Pneumocystis from gerbil. The phylogenetic tree also showed that Pneumocystis from human and monkey formed one group and four rodent Pneumocystis formed another group. Among the four members, Pneumocystis wakefieldiae was most closely related to Pneumocystis murina and Pneumocystis carinii, and was least related to gerbil Pneumocystis.

  12. Human TRMU encoding the mitochondrial 5-methylaminomethyl-2-thiouridylate-methyltransferase is a putative nuclear modifier gene for the phenotypic expression of the deafness-associated 12S rRNA mutations

    Nuclear modifier genes have been proposed to modulate the phenotypic manifestation of human mitochondrial 12S rRNA A1491G mutation associated with deafness in many families world-wide. Here we identified and characterized the putative nuclear modifier gene TRMU encoding a highly conserved mitochondrial protein related to tRNA modification. A 1937 bp TRMU cDNA has been isolated and the genomic organization of TRMU has been elucidated. The human TRMU gene containing 11 exons encodes a 421 residue protein with a strong homology to the TRMU-like proteins of bacteria and other homologs. TRMU is ubiquitously expressed in various tissues, but abundantly in tissues with high metabolic rates including heart, liver, kidney, and brain. Immunofluorescence analysis of human 143B cells expressing TRMU-GFP fusion protein demonstrated that the human Trmu localizes and functions in mitochondrion. Furthermore, we show that in families with the deafness-associated 12S rRNA A1491G mutation there is highly suggestive linkage and linkage disequilibrium between microsatellite markers adjacent to TRMU and the presence of deafness. These observations suggest that human TRMU may modulate the phenotypic manifestation of the deafness-associated mitochondrial 12S rRNA mutations

  13. The unusual 23S rRNA gene of Coxiella burnetii: two self-splicing group I introns flank a 34-base-pair exon, and one element lacks the canonical omegaG.

    Raghavan, Rahul; Miller, Scott R; Hicks, Linda D; Minnick, Michael F

    2007-09-01

    We describe the presence and characteristics of two self-splicing group I introns in the sole 23S rRNA gene of Coxiella burnetii. The two group I introns, Cbu.L1917 and Cbu.L1951, are inserted at sites 1917 and 1951 (Escherichia coli numbering), respectively, in the 23S rRNA gene of C. burnetii. Both introns were found to be self-splicing in vivo and in vitro even though the terminal nucleotide of Cbu.L1917 is adenine and not the canonical conserved guanine, termed OmegaG, found in Cbu.L1951 and all other group I introns described to date. Predicted secondary structures for both introns were constructed and revealed that Cbu.L1917 and Cbu.L1951 were group IB2 and group IA3 introns, respectively. We analyzed strains belonging to eight genomic groups of C. burnetii to determine sequence variation and the presence or absence of the elements and found both introns to be highly conserved (>/=99%) among them. Although phylogenetic analysis did not identify the specific identities of donors, it indicates that the introns were likely acquired independently; Cbu.L1917 was acquired from other bacteria like Thermotoga subterranea and Cbu.L1951 from lower eukaryotes like Acanthamoeba castellanii. We also confirmed the fragmented nature of mature 23S rRNA in C. burnetii due to the presence of an intervening sequence. The presence of three selfish elements in C. burnetii's 23S rRNA gene is very unusual for an obligate intracellular bacterium and suggests a recent shift to its current lifestyle from a previous niche with greater opportunities for lateral gene transfer. PMID:17644584

  14. Exploring microbial diversity and taxonomy using SSU rRNA hypervariable tag sequencing.

    Susan M Huse

    2008-11-01

    Full Text Available Massively parallel pyrosequencing of hypervariable regions from small subunit ribosomal RNA (SSU rRNA genes can sample a microbial community two or three orders of magnitude more deeply per dollar and per hour than capillary sequencing of full-length SSU rRNA. As with full-length rRNA surveys, each sequence read is a tag surrogate for a single microbe. However, rather than assigning taxonomy by creating gene trees de novo that include all experimental sequences and certain reference taxa, we compare the hypervariable region tags to an extensive database of rRNA sequences and assign taxonomy based on the best match in a Global Alignment for Sequence Taxonomy (GAST process. The resulting taxonomic census provides information on both composition and diversity of the microbial community. To determine the effectiveness of using only hypervariable region tags for assessing microbial community membership, we compared the taxonomy assigned to the V3 and V6 hypervariable regions with the taxonomy assigned to full-length SSU rRNA sequences isolated from both the human gut and a deep-sea hydrothermal vent. The hypervariable region tags and full-length rRNA sequences provided equivalent taxonomy and measures of relative abundance of microbial communities, even for tags up to 15% divergent from their nearest reference match. The greater sampling depth per dollar afforded by massively parallel pyrosequencing reveals many more members of the "rare biosphere" than does capillary sequencing of the full-length gene. In addition, tag sequencing eliminates cloning bias and the sequences are short enough to be completely sequenced in a single read, maximizing the number of organisms sampled in a run while minimizing chimera formation. This technique allows the cost-effective exploration of changes in microbial community structure, including the rare biosphere, over space and time and can be applied immediately to initiatives, such as the Human Microbiome Project.

  15. Oligonucleotide Fingerprinting of rRNA Genes for Analysis of Fungal Community Composition

    Valinsky, Lea; Della Vedova, Gianluca; Jiang, Tao; Borneman, James

    2002-01-01

    Thorough assessments of fungal diversity are currently hindered by technological limitations. Here we describe a new method for identifying fungi, oligonucleotide fingerprinting of rRNA genes (OFRG). ORFG sorts arrayed rRNA gene (ribosomal DNA [rDNA]) clones into taxonomic clusters through a series of hybridization experiments, each using a single oligonucleotide probe. A simulated annealing algorithm was used to design an OFRG probe set for fungal rDNA. Analysis of 1,536 fungal rDNA clones d...

  16. Strength and Regulation of Seven rRNA Promoters in Escherichia coli.

    Michihisa Maeda

    Full Text Available The model prokaryote Escherichia coli contains seven copies of the rRNA operon in the genome. The presence of multiple rRNA operons is an advantage for increasing the level of ribosome, the key apparatus of translation, in response to environmental conditions. The complete sequence of E. coli genome, however, indicated the micro heterogeneity between seven rRNA operons, raising the possibility in functional heterogeneity and/or differential mode of expression. The aim of this research is to determine the strength and regulation of the promoter of each rRNA operon in E. coli. For this purpose, we used the double-fluorescent protein reporter pBRP system that was developed for accurate and precise determination of the promoter strength of protein-coding genes. For application of this promoter assay vector for measurement of the rRNA operon promoters devoid of the signal for translation, a synthetic SD sequence was added at the initiation codon of the reporter GFP gene, and then approximately 500 bp-sequence upstream each 16S rRNA was inserted in front of this SD sequence. Using this modified pGRS system, the promoter activity of each rrn operon was determined by measuring the rrn promoter-directed GFP and the reference promoter-directed RFP fluorescence, both encoded by a single and the same vector. Results indicated that: the promoter activity was the highest for the rrnE promoter under all growth conditions analyzed, including different growth phases of wild-type E. coli grown in various media; but the promoter strength of other six rrn promoters was various depending on the culture conditions. These findings altogether indicate that seven rRNA operons are different with respect to the regulation mode of expression, conferring an advantage to E. coli through a more fine-tuned control of ribosome formation in a wide range of environmental situations. Possible difference in the functional role of each rRNA operon is also discussed.

  17. A yeast transcription system for the 5S rRNA gene.

    Keulen, H.; Thomas, D. Y.

    1982-01-01

    A cell-free extract of yeast nuclei that can specifically transcribe cloned yeast 5S rRNA genes has been developed. Optima for transcription of 5S rDNA were determined and conditions of extract preparation leading to reproducible activities and specificities established. The major in vitro product has the same size and oligonucleotide composition as in vivo 5S rRNA. The in vitro transcription extract does not transcribe yeast tRNA genes. The extract does increase the transcription of tRNA gen...

  18. Depletion of pre-16S rRNA in starved Escherichia coli cells.

    Cangelosi, G A; Brabant, W H

    1997-01-01

    Specific hybridization assays for intermediates in rRNA synthesis (pre-rRNA) may become useful for monitoring the growth activity of individual microbial species in complex natural systems. This possibility depends upon the assumption that rRNA processing in microbial cells continues after growth and pre-rRNA synthesis cease, resulting in drainage of the pre-rRNA pool. This is not the case in many eukaryotic cells, but less is known about the situation in bacteria. Therefore, we used DNA prob...

  19. Strength and Regulation of Seven rRNA Promoters in Escherichia coli

    Maeda, Michihisa; Shimada, Tomohiro; Ishihama, Akira

    2015-01-01

    The model prokaryote Escherichia coli contains seven copies of the rRNA operon in the genome. The presence of multiple rRNA operons is an advantage for increasing the level of ribosome, the key apparatus of translation, in response to environmental conditions. The complete sequence of E. coli genome, however, indicated the micro heterogeneity between seven rRNA operons, raising the possibility in functional heterogeneity and/or differential mode of expression. The aim of this research is to determine the strength and regulation of the promoter of each rRNA operon in E. coli. For this purpose, we used the double-fluorescent protein reporter pBRP system that was developed for accurate and precise determination of the promoter strength of protein-coding genes. For application of this promoter assay vector for measurement of the rRNA operon promoters devoid of the signal for translation, a synthetic SD sequence was added at the initiation codon of the reporter GFP gene, and then approximately 500 bp-sequence upstream each 16S rRNA was inserted in front of this SD sequence. Using this modified pGRS system, the promoter activity of each rrn operon was determined by measuring the rrn promoter-directed GFP and the reference promoter-directed RFP fluorescence, both encoded by a single and the same vector. Results indicated that: the promoter activity was the highest for the rrnE promoter under all growth conditions analyzed, including different growth phases of wild-type E. coli grown in various media; but the promoter strength of other six rrn promoters was various depending on the culture conditions. These findings altogether indicate that seven rRNA operons are different with respect to the regulation mode of expression, conferring an advantage to E. coli through a more fine-tuned control of ribosome formation in a wide range of environmental situations. Possible difference in the functional role of each rRNA operon is also discussed. PMID:26717514

  20. TaxMan: a server to trim rRNA reference databases and inspect taxonomic coverage

    Brandt, B. W.; Bonder, M. J.; Huse, S.M.; Zaura, E.

    2012-01-01

    Amplicon sequencing of the hypervariable regions of the small subunit ribosomal RNA gene is a widely accepted method for identifying the members of complex bacterial communities. Several rRNA gene sequence reference databases can be used to assign taxonomic names to the sequencing reads using BLAST, USEARCH, GAST or the RDP classifier. Next-generation sequencing methods produce ample reads, but they are short, currently ∼100-450 nt (depending on the technology), as compared to the full rRNA g...

  1. Structure of the Hsp110:Hsc70 Nucleotide Exchange Machine

    Schuermann, Jonathan P.; Jiang, Jianwen; Cuellar, Jorge; Llorca, Oscar; Wang, Liping; Gimenez, Luis E.; Jin, Suping; Taylor, Alexander B.; Demeler, Borries; Morano, Kevin A.; Hart, P. John; Valpuesta, Jose M.; Lafer, Eileen M.; Sousa, Rui

    2008-01-01

    Hsp70s mediate protein folding, translocation, and macromolecular complex remodeling reactions. Their activities are regulated by proteins that exchange ADP for ATP from the nucleotide-binding domain (NBD) of the Hsp70. These nucleotide exchange factors (NEFs) include the Hsp110s, which are themselves members of the Hsp70 family. We report the structure of an Hsp110:Hsc70 nucleotide exchange complex. The complex is characterized by extensive protein:protein interactions and symmetric bridging...

  2. Regulation of nucleotide excision repair through ubiquitination

    Jia Li; Audesh Bhat; Wei Xiao

    2011-01-01

    Nucleotide excision repair (NER) is the most versatile DNA-repair pathway in all organisms.While bacteria require only three proteins to complete the incision step of NER,eukaryotes employ about 30 proteins to complete the same step.Here we summarize recent studies demonstrating that ubiquitination,a post-translational modification,plays critical roles in regulating the NER activity either dependent on or independent of ubiquitin-proteolysis.Several NER components have been shown as targets of ubiquitination while others are actively involved in the ubiquitination process.We argue through this analysis that ubiquitination serves to coordinate various steps of NER and meanwhile connect NER with other related pathways to achieve the efficient global DNA-damage response.

  3. Signal transduction by guanine nucleotide binding proteins.

    Spiegel, A M

    1987-01-01

    High affinity binding of guanine nucleotides and the ability to hydrolyze bound GTP to GDP are characteristics of an extended family of intracellular proteins. Subsets of this family include cytosolic initiation and elongation factors involved in protein synthesis, and cytoskeletal proteins such as tubulin (Hughes, S.M. (1983) FEBS Lett. 164, 1-8). A distinct subset of guanine nucleotide binding proteins is membrane-associated; members of this subset include the ras gene products (Ellis, R.W. et al. (1981) Nature 292, 506-511) and the heterotrimeric G-proteins (also termed N-proteins) (Gilman, A.G. (1984) Cell 36, 577-579). Substantial evidence indicates that G-proteins act as signal transducers by coupling receptors (R) to effectors (E). A similar function has been suggested but not proven for the ras gene products. Known G-proteins include Gs and Gi, the G-proteins associated with stimulation and inhibition, respectively, of adenylate cyclase; transducin (TD), the G-protein coupling rhodopsin to cGMP phosphodiesterase in rod photoreceptors (Bitensky, M.W. et al. (1981) Curr. Top. Membr. Transp. 15, 237-271; Stryer, L. (1986) Annu. Rev. Neurosci. 9, 87-119), and Go, a G-protein of unknown function that is highly abundant in brain (Sternweis, P.C. and Robishaw, J.D. (1984) J. Biol. Chem. 259, 13806-13813; Neer, E.J. et al. (1984) J. Biol. Chem. 259, 14222-14229). G-proteins also participate in other signal transduction pathways, notably that involving phosphoinositide breakdown. In this review, I highlight recent progress in our understanding of the structure, function, and diversity of G-proteins. PMID:2435586

  4. Improvement parameters in dynamic compaction adjacent to the slopes

    Elham Ghanbari

    2015-04-01

    Full Text Available Dynamic compaction is a cost-effective method commonly used for improvement of sandy soils. A number of researchers have investigated experimentally and numerically the improvement parameters of soils using dynamic compaction, such as crater depth, improvement depth, and radial improvement, however, these parameters are not studied for improvement adjacent to the slopes or trenches. In this research, four different slopes with different inclinations are modeled numerically using the finite element code ABAQUS, and impact loads of dynamic compaction are applied. The static factors of safety are kept similar for all trenches and determined numerically by application of gravity loads to the slope using strength reduction method (SRM. The analysis focuses on crater depth and improvement region which are compared to the state of flat ground. It can be observed that compacted area adjacent to the slopes is narrower and slightly away from the slope compared to the flat state. Moreover, crater depth increases with increase in slope inclination.

  5. Resonance-like tunneling across a barrier with adjacent wells

    S Mahadevan; P Prema; S K Agarwalla; B Sahu; C S Shastry

    2006-09-01

    We examine the behavior of transmission coefficient across the rectangular barrier when attractive potential well is present on one or both sides and also the same is studied for a smoother barrier with smooth adjacent wells having Woods–Saxon shape. We find that presence of well with suitable width and depth can substantially alter at energies below the barrier height leading to resonant-like structures. In a sense, this work is complementary to the resonant tunneling of particles across two rectangular barriers, which is being studied in detail in recent years with possible applications in mind. We interpret our results as due to resonant-like positive energy states generated by the adjacent wells. We describe in detail the possible potential application of these results in electronic devices using n-type oxygen-doped gallium arsenide and silicon dioxide. It is envisaged that these results will have applications in the design of tunneling devices.

  6. Regional Fault Systems of Qaidam Basin and Adjacent Orogenic Belts

    2003-01-01

    The purpose of this paper is to analyze the regional fault systems of Qaidam basin and adjacent orogenic belts. Field investigation and seismic interpretation indicate that five regional fault systems occurred in the Qaidam and adjacent mountain belts, controlling the development and evolution of the Qaidam basin. These fault systems are: (1)north Qaidam-Qilian Mountain fault system; (2) south Qaidam-East Kunlun Mountain fault system; (3)Altun strike-slip fault system; (4)Elashan strike-slip fault system, and (5) Gansen-Xiaochaidan fault system. It is indicated that the fault systems controlled the orientation of the Qaidam basin, the formation and distribution of secondary faults within the basin,the migration of depocenters and the distribution of hydrocarbon accumulation belt.

  7. In Vivo Effect of NusB and NusG on rRNA Transcription Antitermination

    Torres, Martha; Balada, Joan-Miquel; Zellars, Malcolm; Squires, Craig; Squires, Catherine L.

    2004-01-01

    Similarities between lambda and rRNA transcription antitermination have led to suggestions that they involve the same Nus factors. However, direct in vivo confirmation that rRNA antitermination requires all of the lambda Nus factors is lacking. We have therefore analyzed the in vivo role of NusB and NusG in rRNA transcription antitermination and have established that both are essential for it. We used a plasmid test system in which reporter gene mRNA was measured to monitor rRNA antiterminato...

  8. Concentric network symmetry grasps authors' styles in word adjacency networks

    Amancio, Diego R.; Filipi N. Silva; Costa, Luciano da F.

    2015-01-01

    Several characteristics of written texts have been inferred from statistical analysis derived from networked models. Even though many network measurements have been adapted to study textual properties at several levels of complexity, some textual aspects have been disregarded. In this paper, we study the symmetry of word adjacency networks, a well-known representation of text as a graph. A statistical analysis of the symmetry distribution performed in several novels showed that most of the wo...

  9. Soil Structure Interaction between Two Adjacent Buildings under Earthquake Load

    Mahmoud Yahyai; Masoud Mirtaheri; Mehrab Mahoutian; Amir S. Daryan

    2008-01-01

    In some cases, tall buildings are located in geotechnically unsuitable places, due to their high ratio of height to width; there is risk of uplift and other effects such as overturning and reduction structure serviceability during earthquake. This research is aimed to evaluate the effect of Soil-Structure Interaction (SSI) on seismic behavior of two adjacent 32 story buildings such as time period, base shear and displacements. The interaction effects are investigated for variable distance bet...

  10. Disrupted Turn Adjacency and Coherence Maintenance in Instant Messaging Conversations

    Berglund, Therese Örnberg

    2009-01-01

    This article reports on a study of coherence in text-based log files from 120 two-party Instant Messaging (IM) conversations among a group of international students at a design school. The goals of the study were to investigate whether disrupted turn adjacency was an obstacle to coherence and to identify the linguistic strategies employed to maintain coherence. Additional signs of problematic coherence creation were also investigated, focusing on explicit signs of miscommunication. In this pa...

  11. On heavy machines dynamical loading under adjacent links shocks

    Трубачев, Сергей Иванович; Лысюк, Дмитрий Степанович; Талимонова, Ольга Юрьевна

    2014-01-01

    The mathematical model, describing the dynamics under collision of heavy machinery adjacent links in the presence of gaps and other elements with a dead or smoothness zone of transfer functions of kinematic chains, is given. The model is designed using a procedure of "smoothing" discontinuous functions and regarding a variable structure. The specific example of a dynamic system and its numerical calculation is considered. The pressure between the roller and a workpiece is expressed by means o...

  12. Acyclic Edge Coloring of Planar Graphs without Adjacent Triangles

    Dezheng XIE; Yanqing WU

    2012-01-01

    An acyclic edge coloring of a graph G is a proper edge coloring such that there are no bichromatic cycles.The acyclic edge chromatic number of a graph G is the minimum number k such that there exists an acyclic edge coloring using k colors and is denoted by x'a(G).In this paper we prove that x'a(G)≤ Δ(G)+ 5 for planar graphs G without adjacent triangles.

  13. FMRI evidence of acupoints specificity in two adjacent acupoints.

    Liu, Hua; Xu, Jian-Yang; Li, Lin; Shan, Bao-Ci; Nie, Bin-Bin; Xue, Jing-Quan

    2013-01-01

    Objectives. Acupoint specificity is the foundation of acupuncture treatment. The aim of this study is to investigate whether the acupoint specificity exists in two adjacent acupoints. Design and Setting. Two adjacent real acupoints, LR3 (Taichong) and ST44 (Neiting), and a nearby nonacupoint were selected. Thirty-three health volunteers were divided into three groups in random order, and each group only received acupuncture at one of the three points. While they received acupuncture, fMRI scan was performed. Results. The common cerebral activated areas responding to LR3 and ST44 included the contralateral primary somatosensory area (SI) and ipsilateral cerebellum. Acupuncture at LR3 specifically activated contralateral middle occipital gyrus, ipsilateral medial frontal gyrus, superior parietal lobe, middle temporal gyrus, rostral anterior cingulate cortex (rACC), lentiform nucleus, insula, and contralateral thalamus. Stimulation at ST44 selectively activated ipsilateral secondary somatosensory area (SII), contralateral middle frontal gyrus, inferior frontal gyrus, lingual gyrus, lentiform nucleus, and bilateral posterior cingulate cortex (PCC). Conclusions. Acupuncture at adjacent acupoints elicits distinct cerebral activation patterns, and those specific patterns might be involved in the mechanism of the specific therapeutic effects of different acupoints. PMID:23762172

  14. Caracterização de rizóbios indicados para produção de inoculantes por meio de sequenciamento parcial do 16S rRNA Characterization of rhizobia indicated for inoculant production using 16S rRNA partial sequencing

    Bethânia Figueiredo Barbosa de Toledo

    2009-04-01

    Full Text Available O objetivo deste trabalho foi confrontar as sequências parciais do gene 16S rRNA de estirpes padrão de rizóbios com as de estirpes recomendadas para a produção de inoculantes no Brasil, com vistas à verificação da confiabilidade do sequenciamento parcial desse gene para a identificação rápida de estirpes. Foram realizados sequenciamentos através de reação em cadeia da polimerase (PCR com iniciadores relativos à região codificadora do gene 16S rRNA entre as bactérias estudadas. Os resultados foram analisados pela consulta de similaridade de nucleotídeos aos do "Basic Local Alignment Search Tool" (Blastn e por meio da interpretação de árvores filogenéticas geradas usando ferramentas de bioinformática. A classificação taxonômica das estirpes Semia recomendadas para inoculação de leguminosas com base em propriedades morfológicas e especificidade hospedeira não foi confirmada em todas as estirpes. A maioria das estirpes estudadas, consultadas no Blastn, é consistente com a classificação proposta pela construção de árvores filogenéticas das sequências destas estirpes, com base na similaridade pelo sequenciamento parcial do gene considerado.The aim of this work was to compare the partial sequences of 16S rRNA gene of rhizobia strain patterns already classified with strains recommended for the production of inoculants in Brazil, in order to verify the reliability of partial sequencing of the gene for the purpose of rapid identification of strains. Polymerase Chain Reaction (PCR sequencing using primers on the coding region of the 16S rRNA gene among the bacteria studied was conducted. The results were analyzed by consulting the nucleotides' similarity based on Basic Local Alignment Search Tool (Blastn and by interpreting the phylogenetic trees generated by bioinformatic tools. The taxonomic classification of Semia strains recommended for legume inoculation based on morphological properties and host specificity was

  15. Functional angiocoupling between follicles and adjacent corpus luteum in heifers.

    Ginther, O J; Siddiqui, M A R; Baldrighi, J M

    2016-07-15

    In single ovulating cattle, ipsilateral versus contralateral interovarian relationships refer to a dominant follicle (DF) and CL in the same versus opposite ovaries. The ipsilateral relationship consists of the DF-CL and the devoid (no DF or CL) intraovarian pattern, and the contralateral relationship consists of the DF pattern and the CL pattern. The DF-CL pattern involves positive effects on both the DF and CL when adjacent (≤3-mm apart) versus separated as follows: greater diameter of DF (e.g., 10.5 ± 0.4 vs. 9.0 ± 0.4 mm), greater percentage of the DF wall with color Doppler signals of blood flow (40.2% ± 2.0% vs. 24.5% ± 1.9%), greater cross-sectional area of the CL (2.2 ± 0.1 vs. 1.8 ± 0.2 cm(2)), and greater percentage of the entire CL with blood flow signals (51.8% ± 1.2% vs. 42.5% ± 3.1%). Additional examples of positive coupling are (1) future DF on Day 0 (day of ovulation) is closer to the CL than the future largest subordinate and (2) diameter of growing follicles on Day 0 and the growth rate on Days 0 to 2 are greater for follicles that are adjacent than separated from the CL. An example of a negative intraovarian effect is decreasing diameter and loss of future DF status of a largest follicle when adjacent to a regressing CL. The impact of the continuity of ovarian angioarchitecture during the periovulatory follicular wave was exemplified in 17 of 18 waves by conversion of an ovary with only the preovulatory follicle to the postovulatory DF-CL pattern. Functional angiocoupling from commonality in angioarchitecture of the DF and adjacent CL would account for both the positive two-way coupling between DF and CL during the luteal phase and the negative effect of a regressing CL on an adjacent follicle during luteolysis. PMID:27056414

  16. Methyltransferase Erm(37) Slips on rRNA to Confer Atypical Resistance in Mycobacterium tuberculosis

    Madsen, Ch. T.; Jakobsen, L.; Buriánková, Karolína; Doucet-Populaire, F.; Perdonet, J. L.; Douthwaite, S.

    2005-01-01

    Roč. 280, č. 47 (2005), s. 38942-38947. ISSN 0021-9258 R&D Projects: GA ČR GA310/03/0292 Institutional research plan: CEZ:AV0Z50200510 Keywords : methyltransferase erm * mycobacterium tuberculosis * rRNA Subject RIV: EE - Microbiology, Virology Impact factor: 5.854, year: 2005

  17. Archaeal rRNA operons, intron splicing and homing endonucleases, RNA polymerase operons and phylogeny

    Garrett, Roger Antony; Aagaard, Claus Sindbjerg; Andersen, Morten; Dalgaard, Jacob; Lykke-Andersen, Jens; Phan, Hoa T.N.; Trevisanato, Siro; Østergaard, Laust; Larsen, Niels; Leffers, Henrik

    1994-01-01

    Over the past decade our laboratory has had a strong interest in defining the phylogenetic status of the archaea. This has involved determining and analysing the sequences of operons of both rRNAs and RNA polymerases and it led to the discovery of the first archaeal rRNA intron. What follows is a...

  18. EmtA, a rRNA methyltransferase conferring high-level evernimicin resistance

    Mann, P. A.; Xiong, L.; Mankin, A. S.; Chau, A. S.; Najarian, D. J.; Mendrick, C. A.; Cramer, C. A.; Aarestrup, Frank Møller; Hare, R. S.; Black, T. A.; McNicholas, P. M.

    2001-01-01

    unique to the 23S rRNA extracted from resistant ribosomes. The pause corresponded to methylation of residue G2470 (Escherichia coli numbering). RNA footprinting revealed that G2470 is located within the evernimicin-binding site on the ribosome, thus providing an explanation for the reduced binding of the...

  19. Supramolecular hydrogel of kanamycin selectively sequesters 16S rRNA

    Yang, Zhimou; Kuang, Yi; Li, Xinming; Zhou, Ning; Zhang, Ye; Xu, Bing

    2012-01-01

    As the first example of hydrogelator derived from aminoglycoside antibiotics, the hydrogel of kanamycin indicates that the hydrogel of aminoglycosides preserve the specific interaction with their macromolecular targets (e.g., 16S rRNA), thus illustrating a simple approach to explore and identify possible biological targets of supramolecular nanofibers/hydrogels.

  20. Transcription analysis of the Streptomyces coelicolor A3(2) rrnA operon

    van Wezel, G P; Krab, I M; Douthwaite, S; Bibb, M J; Vijgenboom, E; Bosch, L

    1994-01-01

    Transcription start sites and processing sites of the Streptomyces coelicolor A3(2) rrnA operon have been investigated by a combination of in vivo and in vitro transcription analyses. The data from these approaches are consistent with the existence of four in vivo transcription sites, correspondi...

  1. An alternative strategy for bacterial ribosome synthesis: Bacillus subtilis rRNA transcription regulation

    Krásný, Libor; Gourse, Richard. L.

    2004-01-01

    Roč. 23, č. 22 (2004), s. 4473-4483. ISSN 0261-4189 Grant ostatní: National Institutes of Health(US) RO1 GM37048 Institutional research plan: CEZ:AV0Z5052915 Keywords : B. subtilis , GTP concentrations, rRNA transcription Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 10.492, year: 2004

  2. Chromosomal localization of genes encoding guanine nucleotide-binding protein subunits in mouse and human

    Blatt, C.; Eversole-Cire, P.; Cohn, V.H.; Zollman, S.; Fournier, R.E.K.; Mohandas, L.T.; Nesbitt, M.; Lugo, T.; Jones, D.T.; Reed, R.R.; Weiner, L.P.; Sparkes, R.S.; Simon, M.I. (Weizmann Institute, Rehovoth (Israel))

    1988-10-01

    A variety of genes have been identified that specify the synthesis of the components of guanine nucleotide-binding proteins (G proteins). Eight different guanine nucleotide-binding {alpha}-subunit proteins, two different {beta} subunits, and one {gamma} subunit have been described. Hybridization of cDNA clones with DNA from human-mouse somatic cell hybrids was used to assign many of these genes to human chromosomes. The retinal-specific transducin subunit genes GNAT1 and GNAT2 were on chromosomes 3 and 1; GNAI1, GNAI2, and GNAI3 were assigned to chromosomes 7, 3, and 1, respectively; GNAZ and GNAS were found on chromosomes 22 and 20. The {beta} subunits were also assigned-GNB1 to chromosome 1 and GNB2 to chromosome 7. Restriction fragment length polymorphisms were used to map the homologues of some of these genes in the mouse. GNAT1 and GNAI2 were found to map adjacent to each other on mouse chromosome 9 and GNAT2 was mapped on chromosome 17. The mouse GNB1 gene was assigned to chromosome 19. These mapping assignments will be useful in defining the extend of the G{alpha} gene family and may help in attempts to correlate specific genetic diseases and with genes corresponding to G proteins.

  3. Chromosomal localization of genes encoding guanine nucleotide-binding protein subunits in mouse and human.

    Blatt, C; Eversole-Cire, P; Cohn, V H; Zollman, S; Fournier, R E; Mohandas, L T; Nesbitt, M; Lugo, T; Jones, D T; Reed, R R

    1988-10-01

    A variety of genes have been identified that specify the synthesis of the components of guanine nucleotide-binding proteins (G proteins). Eight different guanine nucleotide-binding alpha-subunit proteins, two different beta subunits, and one gamma subunit have been described. Hybridization of cDNA clones with DNA from human-mouse somatic cell hybrids was used to assign many of these genes to human chromosomes. The retinal-specific transducin subunit genes GNAT1 and GNAT2 were on chromosomes 3 and 1; GNAI1, GNAI2, and GNAI3 were assigned to chromosomes 7, 3, and 1, respectively; GNAZ and GNAS were found on chromosomes 22 and 20. The beta subunits were also assigned--GNB1 to chromosome 1 and GNB2 to chromosome 7. Restriction fragment length polymorphisms were used to map the homologues of some of these genes in the mouse. GNAT1 and GNAI2 were found to map adjacent to each other on mouse chromosome 9 and GNAT2 was mapped on chromosome 17. The mouse GNB1 gene was assigned to chromosome 19. These mapping assignments will be useful in defining the extent of the G alpha gene family and may help in attempts to correlate specific genetic diseases with genes corresponding to G proteins. PMID:2902634

  4. Cyclic nucleotide specific phosphodiesterases of Leishmania major

    Linder Markus

    2006-03-01

    Full Text Available Abstract Background Leishmania represent a complex of important human pathogens that belong to the systematic order of the kinetoplastida. They are transmitted between their human and mammalian hosts by different bloodsucking sandfly vectors. In their hosts, the Leishmania undergo several differentiation steps, and their coordination and optimization crucially depend on numerous interactions between the parasites and the physiological environment presented by the fly and human hosts. Little is still known about the signalling networks involved in these functions. In an attempt to better understand the role of cyclic nucleotide signalling in Leishmania differentiation and host-parasite interaction, we here present an initial study on the cyclic nucleotide-specific phosphodiesterases of Leishmania major. Results This paper presents the identification of three class I cyclic-nucleotide-specific phosphodiesterases (PDEs from L. major, PDEs whose catalytic domains exhibit considerable sequence conservation with, among other, all eleven human PDE families. In contrast to other protozoa such as Dictyostelium, or fungi such as Saccharomyces cerevisiae, Candida ssp or Neurospora, no genes for class II PDEs were found in the Leishmania genomes. LmjPDEA contains a class I catalytic domain at the C-terminus of the polypeptide, with no other discernible functional domains elsewhere. LmjPDEB1 and LmjPDEB2 are coded for by closely related, tandemly linked genes on chromosome 15. Both PDEs contain two GAF domains in their N-terminal region, and their almost identical catalytic domains are located at the C-terminus of the polypeptide. LmjPDEA, LmjPDEB1 and LmjPDEB2 were further characterized by functional complementation in a PDE-deficient S. cerevisiae strain. All three enzymes conferred complementation, demonstrating that all three can hydrolyze cAMP. Recombinant LmjPDEB1 and LmjPDEB2 were shown to be cAMP-specific, with Km values in the low micromolar range

  5. Prebiotic nucleotide synthesis demonstration of a geologically plausible pathway

    Schwartz, A.W.; Veen, van der M.; Bisseling, T.; Chittenden, G.J.

    1975-01-01

    Mineral phosphate (apatite) is activated for the synthesis of nucleotides when dilute solutions containing nucleoside and ammonium oxalate are evaporated in its presence. A natural, igneous fluorapatite was found to be even more effective in nucleotide synthesis than the more soluble hydroxylapatite

  6. Nucleotide sequence of cloned rat serum albumin messenger RNA.

    Sargent, T D; Yang, M; Bonner, J.

    1981-01-01

    The nucleotide sequences of the recombinant DNA inserts of three bacterial plasmid clones containing nearly all of the rat serum albumin mRNA have been determined. A statistical analysis of the nucleotide sequence reveals a pattern of repeated internal homology that confirms the "intragenic triplication" model of albumin evolution.

  7. Oral microbiome profiles: 16S rRNA pyrosequencing and microarray assay comparison.

    Jiyoung Ahn

    Full Text Available OBJECTIVES: The human oral microbiome is potentially related to diverse health conditions and high-throughput technology provides the possibility of surveying microbial community structure at high resolution. We compared two oral microbiome survey methods: broad-based microbiome identification by 16S rRNA gene sequencing and targeted characterization of microbes by custom DNA microarray. METHODS: Oral wash samples were collected from 20 individuals at Memorial Sloan-Kettering Cancer Center. 16S rRNA gene survey was performed by 454 pyrosequencing of the V3-V5 region (450 bp. Targeted identification by DNA microarray was carried out with the Human Oral Microbe Identification Microarray (HOMIM. Correlations and relative abundance were compared at phylum and genus level, between 16S rRNA sequence read ratio and HOMIM hybridization intensity. RESULTS: The major phyla, Firmicutes, Proteobacteria, Bacteroidetes, Actinobacteria, and Fusobacteria were identified with high correlation by the two methods (r = 0.70∼0.86. 16S rRNA gene pyrosequencing identified 77 genera and HOMIM identified 49, with 37 genera detected by both methods; more than 98% of classified bacteria were assigned in these 37 genera. Concordance by the two assays (presence/absence and correlations were high for common genera (Streptococcus, Veillonella, Leptotrichia, Prevotella, and Haemophilus; Correlation = 0.70-0.84. CONCLUSION: Microbiome community profiles assessed by 16S rRNA pyrosequencing and HOMIM were highly correlated at the phylum level and, when comparing the more commonly detected taxa, also at the genus level. Both methods are currently suitable for high-throughput epidemiologic investigations relating identified and more common oral microbial taxa to disease risk; yet, pyrosequencing may provide a broader spectrum of taxa identification, a distinct sequence-read record, and greater detection sensitivity.

  8. Repair of adjacent single-strand breaks is often accompanied by the formation of tandem sequence duplications in plant genomes.

    Schiml, Simon; Fauser, Friedrich; Puchta, Holger

    2016-06-28

    Duplication of existing sequences is a major mechanism of genome evolution. It has been previously shown that duplications can occur by replication slippage, unequal sister chromatid exchange, homologous recombination, and aberrant double-strand break-induced synthesis-dependent strand annealing reactions. In a recent study, the abundant presence of short direct repeats was documented by comparative bioinformatics analysis of different rice genomes, and the hypothesis was put forward that such duplications might arise due to the concerted repair of adjacent single-strand breaks (SSBs). Applying the CRISPR/Cas9 technology, we were able to test this hypothesis experimentally in the model plant Arabidopsis thaliana Using a Cas9 nickase to induce adjacent genomic SSBs in different regions of the genome (genic, intergenic, and heterochromatic) and at different distances (∼20, 50, and 100 bps), we analyzed the repair outcomes by deep sequencing. In addition to deletions, we regularly detected the formation of direct repeats close to the break sites, independent of the genomic context. The formation of these duplications as well as deletions may be associated with the presence of microhomologies. Most interestingly, we found that even the induction of two SSBs on the same DNA strand can cause genome alterations, albeit at a much lower level. Because such a scenario reflects a natural step during nucleotide excision repair, and given that the germline is set aside only late during development in plants, the repair of adjacent SSBs indeed seems to have an important influence on the shaping of plant genomes during evolution. PMID:27307441

  9. A CA(+) pair adjacent to a sheared GA or AA pair stabilizes size-symmetric RNA internal loops.

    Chen, Gang; Kennedy, Scott D; Turner, Douglas H

    2009-06-23

    RNA internal loops are often important sites for folding and function. Residues in internal loops can have pKa values shifted close to neutral pH because of the local structural environment. A series of RNA internal loops were studied at different pH by UV absorbance versus temperature melting experiments and imino proton nuclear magnetic resonance (NMR). A stabilizing CA pair forms at pH 7 in the CG/AA and CA/AA nearest neighbors when the CA pair is the first noncanonical pair (loop-terminal pair) in 3 x 3 nucleotide and larger size-symmetric internal loops. These CG/AA and CA/AA nearest neighbors, with CA adjacent to a closing Watson-Crick pair, are further stabilized when the pH is lowered from 7 to 5.5. The results are consistent with a significantly larger fraction (from approximately 20% at pH 7 to approximately 90% at pH 5.5) of adenines being protonated at the N1 position to form stabilizing wobble CA+ pairs adjacent to a sheared GA or AA pair. The noncanonical pair adjacent to the GA pair in CG/AA can either stabilize or destabilize the loop, consistent with the sequence-dependent thermodynamics of GA pairs. No significant pH-dependent stabilization is found for most of the other nearest neighbor combinations involving CA pairs (e.g., CA/AG and AG/CA), which is consistent with the formation of various nonwobble pairs observed in different local sequence contexts in crystal and NMR structures. A revised free-energy model, including stabilization by wobble CA+ pairs, is derived for predicting stabilities of medium-size RNA internal loops. PMID:19485416

  10. Intrinsic resistance to aminoglycosides in Enterococcus faecium is conferred by the 16S rRNA m5C1404-specific methyltransferase EfmM

    Galimand, Marc; Schmitt, Emmanuelle; Panvert, Michel; Desmolaize, Benoît; Douthwaite, Stephen Roger; Mechulam, Yves; Courvalin, Patrice

    2011-01-01

    Aminoglycosides are ribosome-targeting antibiotics and a major drug group of choice in the treatment of serious enterococcal infections. Here we show that aminoglycoside resistance in Enterococcus faecium strain CIP 54-32 is conferred by the chromosomal gene efmM, encoding the E. faecium methyltr......Aminoglycosides are ribosome-targeting antibiotics and a major drug group of choice in the treatment of serious enterococcal infections. Here we show that aminoglycoside resistance in Enterococcus faecium strain CIP 54-32 is conferred by the chromosomal gene efmM, encoding the E. faecium...... locations are required for catalysis. The tertiary structure of EfmM is highly similar to that of RsmF, consistent with m(5)C formation at adjacent sites on the 30S subunit, while distinctive structural features account for the enzymes' respective specificities for nucleotides C1404 and C1407....

  11. Nucleolin is required for DNA methylation state and the expression of rRNA gene variants in Arabidopsis thaliana.

    Frédéric Pontvianne

    2010-11-01

    Full Text Available In eukaryotes, 45S rRNA genes are arranged in tandem arrays in copy numbers ranging from several hundred to several thousand in plants. Although it is clear that not all copies are transcribed under normal growth conditions, the molecular basis controlling the expression of specific sets of rRNA genes remains unclear. Here, we report four major rRNA gene variants in Arabidopsis thaliana. Interestingly, while transcription of one of these rRNA variants is induced, the others are either repressed or remain unaltered in A. thaliana plants with a disrupted nucleolin-like protein gene (Atnuc-L1. Remarkably, the most highly represented rRNA gene variant, which is inactive in WT plants, is reactivated in Atnuc-L1 mutants. We show that accumulated pre-rRNAs originate from RNA Pol I transcription and are processed accurately. Moreover, we show that disruption of the AtNUC-L1 gene induces loss of symmetrical DNA methylation without affecting histone epigenetic marks at rRNA genes. Collectively, these data reveal a novel mechanism for rRNA gene transcriptional regulation in which the nucleolin protein plays a major role in controlling active and repressed rRNA gene variants in Arabidopsis.

  12. Nucleotide Phosphohydrolase in Purified Vaccinia Virus

    Munyon, William; Paoletti, Enzo; Ospina, Julio; Grace, James T.

    1968-01-01

    Purified infectious vaccinia virus has been shown to contain an enzyme or enzymes that remove the terminal phosphate group from adenosine triphosphate (ATP), guanosine triphosphate (GTP), uridine triphosphate (UTP), and cytidine triphosphate (CTP). The Km for ATP of this enzyme is 5.5 × 10−4m, and the relative rates of the reaction with ATP, GTP, UTP, and CTP are 1.00, 0.34, 0.15, and 0.29, respectively. The virus enzyme does not react with any of the diphosphates. The rate of the reaction is proportional to the amount of virus added and is linear for 130 min. The virus nucleotide phosphohydrolase activity is greatly stimulated by Mg++ and very slightly stimulated by Ca++. The small residual activity observed in the absence of divalent cations is completely inhibited by ethylenediaminetetraacetic acid. Neither Na+ nor K+ ions, nor any mixture of these, was found to stimulate the reaction significantly, and ouabain, at 10−4m, inhibited the reaction by only 27%. The response of the vaccinia enzyme to mono- and divalent cations and to ouabain indicates that the vaccinia enzyme has different properties from those associated with microsomes and mitochondria. PMID:4986904

  13. Software for tag single nucleotide polymorphism selection

    Stram Daniel O

    2005-06-01

    Full Text Available Abstract This paper reviews the theoretical basis for single nucleotide polymorphism (SNP tagging and considers the use of current software made freely available for this task. A distinction between haplotype block-based and non-block-based approaches yields two classes of procedures. Analysis of two different sets of SNP genotype data from the HapMap is used to judge the practical aspects of using each of the programs considered, as well as to make some general observations about the performance of the programs in finding optimal sets of tagging SNPs. Pairwise R2 methods, while the simplest of those considered, do tend to pick more tagging SNPs than are strictly needed to predict unmeasured (non-tagging SNPs, since a combination of two or more tagging SNPs can form a prediction of SNPs that have no direct (pairwise surrogate. Block-based methods that exploit the linkage disequilibrium structure within haplotype blocks exploit this sort of redundancy, but run a risk of over-fitting if used without some care. A compromise approach which eliminates the need first to analyse block structure, but which still exploits simple relationships between SNPs, appears promising.

  14. Nucleotide Excision Repair in Caenorhabditis elegans

    Hannes Lans

    2011-01-01

    Full Text Available Nucleotide excision repair (NER plays an essential role in many organisms across life domains to preserve and faithfully transmit DNA to the next generation. In humans, NER is essential to prevent DNA damage-induced mutation accumulation and cell death leading to cancer and aging. NER is a versatile DNA repair pathway that repairs many types of DNA damage which distort the DNA helix, such as those induced by solar UV light. A detailed molecular model of the NER pathway has emerged from in vitro and live cell experiments, particularly using model systems such as bacteria, yeast, and mammalian cell cultures. In recent years, the versatility of the nematode C. elegans to study DNA damage response (DDR mechanisms including NER has become increasingly clear. In particular, C. elegans seems to be a convenient tool to study NER during the UV response in vivo, to analyze this process in the context of a developing and multicellular organism, and to perform genetic screening. Here, we will discuss current knowledge gained from the use of C. elegans to study NER and the response to UV-induced DNA damage.

  15. Quantification of Lincomycin Resistance Genes Associated with Lincomycin Residues in Waters and Soils Adjacent to Representative Swine Farms in China

    LiangLi

    2013-12-01

    Full Text Available Lincomycin is commonly used on swine farms for growth promotion as well as disease treatment and control. Consequently, lincomycin may accumulate in the environment adjacent to the swine farms in many ways, thereby influencing antibiotic resistance in the environment. Levels of lincomycin-resistance genes and lincomycin residues in water and soil samples collected from multiple sites near wastewater discharge areas were investigated in this study. Sixteen lincomycin-resistance and 16S rRNA genes were detected using real-time PCR. Three genes, lnu(F, erm(A and erm(B, were detected in all water and soil samples except control samples. Lincomycin residues were determined by rapid resolution liquid chromatography-tandem mass spectrometry, with concentrations detected as high as 9.29 ng/mL in water and 0.97 ng/g in soil. A gradual reduction in the levels of lincomycin-resistance genes and lincomycin residues in the waters and soils were detected from multiple sites along the path of wastewater discharging to the surrounding environment from the swine farms. Significant correlations were found between levels of lincomycin-resistance genes in paired water and soil samples (r = 0.885, p = 0.019, and between lincomycin-resistance genes and lincomycin residues (r = 0.975, p < 0.01. This study emphasized the potential risk of dissemination of lincomycin-resistance genes such as lnu(F, erm(A and erm(B, associated with lincomycin residues in surrounding environments adjacent to swine farms.

  16. Impact of adjacent land use on coastal wetland sediments.

    Karstens, Svenja; Buczko, Uwe; Jurasinski, Gerald; Peticzka, Robert; Glatzel, Stephan

    2016-04-15

    Coastal wetlands link terrestrial with marine ecosystems and are influenced from both land and sea. Therefore, they are ecotones with strong biogeochemical gradients. We analyzed sediment characteristics including macronutrients (C, N, P, K, Mg, Ca, S) and heavy metals (Mn, Fe, Cu, Zn, Al, Co, Cr, Ni) of two coastal wetlands dominated by Phragmites australis at the Darss-Zingst Bodden Chain, a lagoon system at the Southern Baltic Sea, to identify the impact of adjacent land use and to distinguish between influences from land or sea. In the wetland directly adjacent to cropland (study site Dabitz) heavy metal concentrations were significantly elevated. Fertilizer application led to heavy metal accumulation in the sediments of the adjacent wetland zones. In contrast, at the other study site (Michaelsdorf), where the hinterland has been used as pasture, heavy metal concentrations were low. While the amount of macronutrients was also influenced by vegetation characteristics (e.g. carbon) or water chemistry (e.g. sulfate), the accumulation of heavy metals is regarded as purely anthropogenic influence. A principal component analysis (PCA) based on the sediment data showed that the wetland fringes of the two study sites are not distinguishable, neither in their macronutrient status nor in their concentrations of heavy metals, whereas the interior zones exhibit large differences in terms of heavy metal concentrations. This suggests that seaside influences are minor compared to influences from land. Altogether, heavy metal concentrations were still below national precautionary and action values. However, if we regard the macronutrient and heavy metal concentrations in the wetland fringes as the natural background values, an accumulation of trace elements from agricultural production in the hinterland is apparent. Thus, coastal wetlands bordering croplands may function as effective pollutant buffers today, but the future development has to be monitored closely to avoid

  17. High-throughput nucleotide sequence analysis of diverse bacterial communities in leachates of decomposing pig carcasses

    Seung Hak Yang

    2015-09-01

    Full Text Available The leachate generated by the decomposition of animal carcass has been implicated as an environmental contaminant surrounding the burial site. High-throughput nucleotide sequencing was conducted to investigate the bacterial communities in leachates from the decomposition of pig carcasses. We acquired 51,230 reads from six different samples (1, 2, 3, 4, 6 and 14 week-old carcasses and found that sequences representing the phylum Firmicutes predominated. The diversity of bacterial 16S rRNA gene sequences in the leachate was the highest at 6 weeks, in contrast to those at 2 and 14 weeks. The relative abundance of Firmicutes was reduced, while the proportion of Bacteroidetes and Proteobacteria increased from 3–6 weeks. The representation of phyla was restored after 14 weeks. However, the community structures between the samples taken at 1–2 and 14 weeks differed at the bacterial classification level. The trend in pH was similar to the changes seen in bacterial communities, indicating that the pH of the leachate could be related to the shift in the microbial community. The results indicate that the composition of bacterial communities in leachates of decomposing pig carcasses shifted continuously during the study period and might be influenced by the burial site.

  18. An ElGamal Encryption Scheme of Adjacency Matrix and

    B. Ravi Kumar

    2015-10-01

    Full Text Available  Cryptography is the combination of Mathematics and Computer science. Cryptography is used for encryption and decryption of data using mathematics. Cryptography transit the information in an illegible manner such that only intended recipient will be able to decrypt the information. In the recent years, researchers developed several new encryption methods. Among such ElGamal encryption is the one laid a concede platform for the researchers in Cryptography. Ever science several mathematical models were applied for encryption/decryption. In this paper, we introduced an ElGamal encryption, which uses points on the elliptic curve, and finite state machines and adjacency matrix.

  19. Historical Earthquakes in the Yellow Sea and Its Adjacent Area

    Wu Ge; Wang Andong; Wu Di

    2005-01-01

    As a result of sorting out, estimating and cataloging of historical earthquakes, from the year of 2 A.D. to Aug., 1949, we found that there were 2187 earthquakes with M≥3.0 in the area of the Yellow Sea and its adjacent area. Among the earthquakes, the number of earthquakes with M ≥ 5.0 is 209, and at least 43 of the earthquakes caused serious losses, 20 of the earthquakes caused human causalities. It is demonstrated that there were 3 areas of historical earthquake concentration and the earthquake activity was higher in the 16th century and the first half if the 20th century.

  20. The kernel of the adjacency matrix of a rectangular mesh

    Tomei, Carlos; Vieira, Tania

    2002-01-01

    Given an m x n rectangular mesh, its adjacency matrix A, having only integer entries, may be interpreted as a map between vector spaces over an arbitrary field K. We describe the kernel of A: it is a direct sum of two natural subspaces whose dimensions are equal to $\\lceil c/2 \\rceil$ and $\\lfloor c/2 \\rfloor$, where c = gcd (m+1,n+1) - 1. We show that there are bases to both vector spaces, with entries equal to 0, 1 and -1. When K = Z/(2), the kernel elements of these subspaces are described...

  1. Experimental Tape Casting of Adjacently Graded Materials for Magnetic Refrigeration

    Bulatova, Regina

    graded thin films. The motivation to create such adjacently segmented structures stemmed from a search of material and a materials design alternative to the expensive rare earth element gadolinium which is widely used as a magnetic regenerator in the emerging magnetic refrigeration technology....... Conventional tape casting involves the preparation of specially formulated slurry, which is cast by a blade to a thin flat tape, then dried into flexible so-called green solid tape and can be subsequently sintered into a hard ceramic material. The principal difference and, at the same time, a challenge...

  2. The formation of adjacent triplex-duplex domainsin DNA.

    Nam, K. H.; Abhiraman, S; Wartell, R M

    1999-01-01

    The ability of single-stranded DNA oligomers to form adjacent triplex and duplex domains with two DNA structural motifs was examined. Helix-coil transition curves and a gel mobility shift assay were used to characterize the interaction of single-stranded oligomers 12-20 nt in length with a DNA hairpin and with a DNA duplex that has a dangling end. The 12 nt on the 5'-ends of the oligomers could form a triplex structure with the 12 bp stem of the hairpin or the duplex portion of the DNA with a...

  3. Adjacent Lumbar Disc Herniation after Lumbar Short Spinal Fusion

    Koshi Ninomiya; Koichi Iwatsuki; Yu-ichiro Ohnishi; Toshika Ohkawa; Toshiki Yoshimine

    2014-01-01

    A 70-year-old outpatient presented with a chief complaint of sudden left leg motor weakness and sensory disturbance. He had undergone L4/5 posterior interbody fusion with L3–5 posterior fusions for spondylolisthesis 3 years prior, and the screws were removed 1 year later. He has been followed up for 3 years, and there had been no adjacent segment problems before this presentation. Lumbar magnetic resonance imaging (MRI) showed a large L2/3 disc hernia descending to the L3/4 level. Compared to...

  4. Three-dimensional visualization of intracranial vessels and adjacent structures

    MR three-dimensional-Fourier-transform, gradient-echo sequences are available that allow the acquisition of high-quality data sets, suitable for three- dimensional image processing. Most recently, flow- compensated measurement sequences are used to achieve a three-dimensional perspective of the vascular anatomy. Spatial relationships between vessels and adjacent structures can be revealed by three-dimensional displays, showing both vessels and tissue surfaces (brain, tumor) in a three- dimensional manner. The image-processing techniques are based on the ray-tracing principle. The method can be used for the optimization of neurosurgical planning in the sellar region

  5. Exophytic Atheroma Mimicking Papillary Fibroelastoma Adjacent to the Aortic Valve.

    Cho, Tomoki; Tokunaga, Shigehiko; Yasuda, Shota; Izubuchi, Ryo; Masuda, Munetaka

    2015-09-01

    Follow-up echocardiography in a 69-year-old man with alcoholic cardiomyopathy showed a mass above the aortic valve near the left coronary ostium. Transesophageal echocardiography and computed tomography suggested a papillary fibroelastoma with a high risk of embolism. At operation we found an exophytic atheroma adjacent to the left coronary artery orifice. The atheroma was removed, and the patient made an uneventful recovery. We describe this very rare case of an exophytic atheroma mimicking a papillary fibroelastoma situated at the left coronary orifice. PMID:26354633

  6. A molecular biological study on identification of common septicemia bacteria using 16s-23s rRNA gene spacer regions

    傅君芬; 虞和永; 尚世强; 洪文澜; 陆淼泉; 李建平

    2002-01-01

    In the search for a rapid and reliable method for identification of bacteria in blood and cerebrospinal fluid , we developed a unified set of primers and used them under polymerase chain reaction(PCR) to amplify the spacer regions between the 16s and 23s genes in the prokaryotic rRNA genetic loci . Spacer regions within these loci showed a significant level of length and sequence polymorphism across most of the species lines. A generic pair of priming sequences was selected from highly conserved sequences in the 16s and 23s genes occurring adjacent to these polymorphic regions. This single set of primers and reaction conditions were used for the amplification of the 16s-23s spacer regions for 61 strains of standard bacteria and corresponding clinical isolates belonging to 20 genera and 27 species, including Listeria, Staphylococcus and Salmonella species, et al. When the spacer amplification products were resolved by electrophoresis, the resulting patterns could be used to distinguish most of the bacteria species within the test group, and the amplification products of the clinical isolates clustered at the standard species level. Some species presenting similar pattern were further analyzed by HinfI or AluI digestion or DNA clone and sequences analysis in order to establish the specific 16s-23s rRNA gene spacer regions map. Analysis of 42 blood specimens from septicemic neonates and 6 CSF specimens from suspected purulent meningitis patients by bacterial culture and PCR-RFLP(Restriction Fregament Length Polymorphism) showed that 15 specimens of blood culture were positive(35.7%) in the 42 septicemic neonates; 27 specimens were positive(64.2%) by PCR, and that the positive rate by PCR was significantly higher than that by blood culture(P<0.01). Among the 6 CSF specimens, one specimen found positive by blood culture was also positive by PCR, two found negative by blood culture showed positive by PCR; all three were S.epidermidis according to the DNA map. One C

  7. Adjacent stage impurity ratio in rare earth countercurrent extraction process

    CHENG Fuxiang; WU Sheng; LIAO Chunsheng; YAN Chunhua

    2013-01-01

    Impurity components decrease stage by stage in a cascade of rare earth (RE) extraction separation,and adjacent stage impurity ratio (ASIR) which is defined as the ratio of an impurity's contents in the aqueous/organic phase of two adjacent stages can be used to evaluate the capacity of impurity removal for the two stages.On the basis of extraction equilibrium and mass balance,the ASIR in a two-component extraction separation was deducted and its simplified expressions were given for different process sections according to reasonable assumptions.The calculation simulation was then carried out to obtain the ASIR distribution in the cascade.The results showed that in both the extraction and scrubbing sections the ASIR principally increased with the decrease of the molar proportion of the impurity but along with a flat appearing in the purification zone located in the middle of the cascade.The ASIR intuitively exhibits the nmning status of RE extraction separation and purification,which could provide a theoretic guide for investigating the influence factors of RE extraction separation process in practical industry.

  8. Adjacent segment disease in degenerative pathologies with posterior instrumentation

    Ana Guadalupe Ramírez Olvera

    2015-03-01

    Full Text Available OBJECTIVE: To establish the real incidence of adjacent segment disease after fusion, and to identify the levels and predisposing factors for the pathology, as well as the functional results. METHODS: a retrospective case series study with level of evidence IIB, in a sample of 179 patients diagnosed with stenosis of the lumbar spine, spondylolisthesis and degenerative scoliosis, submitted to surgery in the period 2005 to December 2013, with posterior instrumentation and posterolateral fusion, with follow-up from 2007 until May 2014, in which the symptomology and radiographic findings were evaluated, to establish the diagnosis and treatment. RESULTS: the study included 179 patients diagnosed with stenosis of the lumbar spine (n=116, isthmic and degenerative spondylolisthesis (n=50 and degenerative scoliosis (n=13; during the study, 20 cases of adjacent level segment were identified, 80% of which were treated surgically with extension of the instrumentation, while 20% were treated conservatively with NSAIDs and therapeutic blocks. CONCLUSION: An incidence of 11% was found, with an average of 3.25 years in diagnosis and treatment, a prevalence of females and diagnosis of stenosis of the lumbar canal on posterior instrumentation, a predominance of levels L4-L5; 80% were treated with extension of the instrumentation. The complications were persistent radiculopathy, infection of the surgical wound, and one death due to causes not related to the lumbar pathology.

  9. Stress Wave Interaction Between Two Adjacent Blast Holes

    Yi, Changping; Johansson, Daniel; Nyberg, Ulf; Beyglou, Ali

    2016-05-01

    Rock fragmentation by blasting is determined by the level and state of stress in the rock mass subjected to blasting. With the application of electronic detonators, some researchers stated that it is possible to achieve improved fragmentation through stress wave superposition with very short delay times. This hypothesis was studied through theoretical analysis in the paper. First, the stress in rock mass induced by a single-hole shot was analyzed with the assumptions of infinite velocity of detonation and infinite charge length. Based on the stress analysis of a single-hole shot, the stress history and tensile stress distribution between two adjacent holes were presented for cases of simultaneous initiation and 1 ms delayed initiation via stress superposition. The results indicated that the stress wave interaction is local around the collision point. Then, the tensile stress distribution at the extended line of two adjacent blast holes was analyzed for a case of 2 ms delay. The analytical results showed that the tensile stress on the extended line increases due to the stress wave superposition under the assumption that the influence of neighboring blast hole on the stress wave propagation can be neglected. However, the numerical results indicated that this assumption is unreasonable and yields contrary results. The feasibility of improving fragmentation via stress wave interaction with precise initiation was also discussed. The analysis in this paper does not support that the interaction of stress waves improves the fragmentation.

  10. Absorbed dose distribution analyses in irradiation with adjacent fields

    Because the special irradiation technique with adjacent fields is the most used in the case of medulloblastoma treatment, we consider very important to specify some general information about medulloblastoma. This malignant disease has a large incidence in children with age between 5-7 years. This tumor usually originates in the cerebellum and is referred to as primitive undifferentiated tumor. It may spread contiguously to the cerebellar peduncle, floor of the fourth ventricle, into the cervical spine. In addition, it may spread via the cerebrospinal fluid intracranially and/or to the spinal cord. For this purpose it is necessary to perform a treatment technique with cranial tangential fields combined with adjacent fields for the entire spinal cord to achieve a perfect coverage of the zones with malignant cells. The treatment in this case is an association between surgery-radio-chemotherapy, where the radiotherapy has a very important roll and a curative purpose. This is due to the fact that the migration of malignant cells in the body can't be controlled by surgery. Because of this special irradiation technique used in medulloblastoma treatment, we chase to describe in this paper this complex type of irradiation where the implications of the beams divergence in doses distribution are essentials

  11. Cardiac Na+ Current Regulation by Pyridine Nucleotides

    Liu, Man; Sanyal, Shamarendra; Gao, Ge; Gurung, Iman S.; Zhu, Xiaodong; Gaconnet, Georgia; Kerchner, Laurie J.; Shang, Lijuan L.; Huang, Christopher L-H.; Grace, Andrew; London, Barry; Dudley, Samuel C.

    2009-01-01

    Rationale Mutations in glycerol-3-phosphate dehydrogenase 1-like (GPD1-L) protein reduce cardiac Na+ current (INa) and cause Brugada Syndrome (BrS). GPD1-L has >80% amino acid homology with glycerol-3-phosphate dehydrogenase, which is involved in nicotinamide adenine dinucleotide (NAD)-dependent energy metabolism. Objective Therefore, we tested whether NAD(H) could regulate human cardiac sodium channels (Nav1.5). Methods and Results HEK293 cells stably expressing Nav1.5 and rat neonatal cardiomyocytes were used. The influence of NADH/NAD+ on arrhythmic risk was evaluated in wild-type or SCN5A+/− mouse heart. A280V GPD1-L caused a 2.48 ± 0.17-fold increase in intracellular NADH level (P<0.001). NADH application or co-transfection with A280V GPD1-L resulted in decreased INa (0.48 ± 0.09 or 0.19 ±0.04 of control group, respectively; P<0.01), which was reversed by NAD+, chelerythrine, or superoxide dismutase (SOD). NAD+ antagonism of the Na+ channel downregulation by A280V GPD1-L or NADH was prevented by a protein kinase A (PKA) inhibitor, PKAI6–22. The effects of NADH and NAD+ were mimicked by a phorbol ester and forskolin, respectively. Increasing intracellular NADH was associated with an increased risk of ventricular tachycardia (VT) in wild-type mouse hearts. Extracellular application of NAD+ to SCN5A+/− mouse hearts ameliorated the risk of VT. Conclusions Our results show that Nav1.5 is regulated by pyridine nucleotides, suggesting a link between metabolism and INa. This effect required protein kinase C (PKC) activation and was mediated by oxidative stress. NAD+ could prevent this effect by activating PKA. Mutations of GPD1-L may downregulate Nav1.5 by altering the oxidized to reduced NAD(H) balance. PMID:19745168

  12. Empirical Bayes analysis of single nucleotide polymorphisms

    Ickstadt Katja

    2008-03-01

    Full Text Available Abstract Background An important goal of whole-genome studies concerned with single nucleotide polymorphisms (SNPs is the identification of SNPs associated with a covariate of interest such as the case-control status or the type of cancer. Since these studies often comprise the genotypes of hundreds of thousands of SNPs, methods are required that can cope with the corresponding multiple testing problem. For the analysis of gene expression data, approaches such as the empirical Bayes analysis of microarrays have been developed particularly for the detection of genes associated with the response. However, the empirical Bayes analysis of microarrays has only been suggested for binary responses when considering expression values, i.e. continuous predictors. Results In this paper, we propose a modification of this empirical Bayes analysis that can be used to analyze high-dimensional categorical SNP data. This approach along with a generalized version of the original empirical Bayes method are available in the R package siggenes version 1.10.0 and later that can be downloaded from http://www.bioconductor.org. Conclusion As applications to two subsets of the HapMap data show, the empirical Bayes analysis of microarrays cannot only be used to analyze continuous gene expression data, but also be applied to categorical SNP data, where the response is not restricted to be binary. In association studies in which typically several ten to a few hundred SNPs are considered, our approach can furthermore be employed to test interactions of SNPs. Moreover, the posterior probabilities resulting from the empirical Bayes analysis of (prespecified interactions/genotypes can also be used to quantify the importance of these interactions.

  13. 多浆旱生植物霸王18SrRNA基因的克隆及序列分析%Cloning and sequence analysis of 18S rRNA gene fragment from succulent xerophyte Zygophyllum xanthoxylum

    胡静; 谢俊仁; 王锁民

    2012-01-01

    In order to reveal the relationship between succulent xerophyte Zygophyllum xanthoxylum and other plants and to provide evidences for the biologically evolution, total DNA was extracted from leaves of Z. xanthoxylurn seedlings, and the 18S rRNA gene was cloned by PCR using general primers and cloned into pGEM-T vector. The positive clone identified by PCR was sequenced. The sequencing result revealed that the 18S rRNA gene fragment from Z. xanthoxylum contains 1808 bp. Homology comparison with other plants 18S rRNA gene sequences in the GenBank showed that it shared over 96% nucleotide sequence homology, so it is concluded that 18S rRNA is very conservative gene in plants. However, Homology matrix and Blast showed that Z. xanthoxylurn shared high similarity (98%) with the identified 18S rRNA in Galearia fili formis , Cnidoscolus aconiti folius and Hevea brasiliensis. Phylogenetic tree analysis indicated that Z. xanthoxylum and Panax notoginseng were most consanguineously grouped.%为探讨多浆旱生植物霸王(Zygophyllum xanthoxylum)的生物进化历程及与其他植物的亲缘关系,本研究以霸王叶基因组DNA为模板,使用通用引物扩增其18SrRNA基因片段,并克隆到pGEM—T载体,阳性克隆经鉴定后进行测序。核苷酸序列分析结果表明,该片段长1808bp,所得序列与GenBank中注册的18SrRNA基因序列的同源性均在96%以上。可见,高等植物18SrRNA的基因非常保守。同源性分析与Blast比较结果表明,霸王与小盘木(Galearia filiformis)、驱虫苋(Cnidoscolus aconitifolius)及橡胶树(Herera brasiliensis)同源性最高。系统进化树分析表明,霸王与三七(Panax notoginseng)的亲缘关系最近。

  14. 罗氏沼虾18S rRNA基因生物素标记探针的制备及应用%Preparation and application of the biotin-labeled probe of 18S rRNA gene in Macrobrachium rosenbergii

    高风英; 叶星; 白俊杰; 吴锐全; 劳海华; 简清; 罗建仁

    2005-01-01

    Probes are essential for study of gene expression and regulation. In this study, a method was established to prepare the biotin-labeled probe for 18S rRNA gene of freshwater prawn, Macrobrachium rosenbergii. And the labeled method was used to produce a lysozyme gene probe, then applied in analysis of lysozyme gene expression. Primers were designed according to the nucleotide sequences of 18S rRNA of Decalxxta in order to isolate the 18S rRNA gene sequences of M. rosenbergii. Total genomic DNA was isolated from hepatopancreas of the freshwater prawn. A specific DNA fragment with desired size was amplified by PCR using the total DNA as templates. The DNA fragment was inserted into pGEM-T Easy vector and sequenced. The result of BLAST and alignment analysis confirmed that the DNA fragment isolated was the 18S rRNA gene of M. rosenbergii, which was 418 nt in length.Biotin-labeled probe of the 18S rRNA was then produced by PCR using the recombinant plasmid as templates. The biotin-21-dTTP and the non-labeled dNTP were added to the PCR reaction system. Ratio of the biotin-21-dTTP and the non-labeled dTFP was 3 to 1.The yield of the labeled probe is 300 ng·μL-1. The detection limit of the probe is 60 pg. A biotin-labeled probe of lysozyme gene was prepared by the same label method, and the yield of the lysozyme gene probe is 500 ng·μL-1. These biotin-labeled probes were applied in Northern dot blotting analysis of tissue distribution of lysoyzme mRNA of M. rosenbergii. Signals were scanned and quantified by Analysis System of Biology Image. The signal intensity ratio of the lysozyme to 18S rRNA represents the relative expression level of lysozyme mRNA. The results showed that the lysozyme mRNA existed in all the tissues checked, including eye,muscle, gill, hepatopancreas, haemocytes and intestine. But lysoyzme mRNA levels varied among different tissues. The highest level was found in the intestine, and the second was in the hepatopancreas and the lowest was in the

  15. Rapid identification of Renibacterium salmoninarum using an oligonucleotide probe complementary to 16S rRNA.

    Mattsson, J G; Gersdorf, H; Jansson, E; Hongslo, T; Göbel, U B; Johansson, K E

    1993-02-01

    Bacterial kidney disease in salmonid fish is caused by the slow-growing Gram-positive rod, Renibacterium salmoninarum. The partial sequence of 16S rRNA from R. salmoninarum was determined and compared with published bacterial 16S rRNA sequences. From this sequence information, a 30-bases-long oligonucleotide was designed and used as a specific probe for identification of R. salmoninarum in filter hybridization experiments. Strong specific hybridization signals were observed for all strains of R. salmoninarum tested. Furthermore, no cross-hybridization could be seen against 22 other bacterial species, among them other salmonid fish pathogens. The detection limit for the probe in direct filter hybridization by the dot-blot technique was 2.5 x 10(4) bacteria. It was also possible to detect R. salmoninarum in clinical samples by direct filter hybridization. PMID:8455640

  16. Transcriptional Activity of rRNA Genes in Barley Cells after Mutagenic Treatment.

    Kwasniewska, Jolanta; Jaskowiak, Joanna

    2016-01-01

    In the present study, the combination of the micronucleus test with analysis of the activity of the rRNA genes in mutagen-treated Hordeum vulgare (barley) by maleic hydrazide (MH) cells was performed. Simultaneously fluorescence in situ hybridization (FISH) with 25S rDNA as probes and an analysis of the transcriptional activity of 35S rRNA genes with silver staining were performed. The results showed that transcriptional activity is always maintained in the micronuclei although they are eliminated during the next cell cycle. The analysis of the transcriptional activity was extended to barley nuclei. MH influenced the fusion of the nucleoli in barley nuclei. The silver staining enabled detection of the nuclear bodies which arose after MH treatment. The results confirmed the usefulness of cytogenetic techniques in the characterization of micronuclei. Similar analyses can be now extended to other abiotic stresses to study the response of plant cells to the environment. PMID:27257817

  17. A renaissance for the pioneering 16S rRNA gene

    Tringe, Susannah; Hugenholtz, Philip

    2008-09-07

    Culture-independent molecular surveys using the 16S rRNA gene have become a mainstay for characterizing microbial community structure over the last quarter century. More recently this approach has been overshadowed by metagenomics, which provides a global overview of a community's functional potential rather than just an inventory of its inhabitants. However, the pioneering 16S rRNA gene is making a comeback in its own right thanks to a number of methodological advancements including higher resolution (more sequences), analysis of multiple related samples (e.g. spatial and temporal series) and improved metadata and use of metadata. The standard conclusion that microbial ecosystems are remarkably complex and diverse is now being replaced by detailed insights into microbial ecology and evolution based only on this one historically important marker gene.

  18. Nucleotide Excision Repair in Cellular Chromatin: Studies with Yeast from Nucleotide to Gene to Genome

    Simon Reed

    2012-09-01

    Full Text Available Here we review our development of, and results with, high resolution studies on global genome nucleotide excision repair (GGNER in Saccharomyces cerevisiae. We have focused on how GGNER relates to histone acetylation for its functioning and we have identified the histone acetyl tranferase Gcn5 and acetylation at lysines 9/14 of histone H3 as a major factor in enabling efficient repair. We consider results employing primarily MFA2 as a model gene, but also those with URA3 located at subtelomeric sequences. In the latter case we also see a role for acetylation at histone H4. We then go on to outline the development of a high resolution genome-wide approach that enables one to examine correlations between histone modifications and the nucleotide excision repair (NER of UV-induced cyclobutane pyrimidine dimers throughout entire genomes. This is an approach that will enable rapid advances in understanding the complexities of how compacted chromatin in chromosomes is processed to access DNA damage and then returned to its pre-damaged status to maintain epigenetic codes.

  19. Detection of Renibacterium salmoninarum in tissue samples by sequence capture and fluorescent PCR based on the 16S rRNA gene.

    Königsson, Malin Heldtander; Ballagi, Andras; Jansson, Eva; Johansson, Karl-Erik

    2005-02-25

    The 16S rRNA genes from eight isolates of Renibacterium salmoninarum with different origins and dates of isolation were sequenced to evaluate the possibility to construct a diagnostic PCR system with target sites within this gene. The sequences were found to be identical but for one single position in one of the isolates, and two regions with an adequate number of nucleotide differences as compared to closely related species were identified. Species-specific fluorescent PCR primers complementary to these regions were constructed as well as oligonucleotides for DNA preparation by sequence capture. A mimic molecule was constructed to be used as an internal control. The PCR was specific and allowed the detection of DNA equivalent to 1-10 R. salmoninarum genomes per reaction. The DNA preparation with sequence capture and analysis by PCR with a mimic was found to be a reliable method for analysis of kidneys from fish with BKD. The amount of PCR inhibiting substances present in the tissue was reduced, and the relevant DNA was concentrated in the capture step. Furthermore, the use of the mimic molecule in the system assured that false negative results could be identified. PMID:15708821

  20. rRNA genes from the lower chordate Herdmania momus: structural similarity with higher eukaryotes.

    Degnan, B M; Yan, J.; Hawkins, C J; Lavin, M F

    1990-01-01

    Ascidians, primitive chordates that have retained features of the likely progenitors to all vertebrates, are a useful model to study the evolutionary relationship of chordates to other animals. We have selected the well characterized ribosomal RNA (rRNA) genes to investigate this relationship, and we describe here the cloning and characterization of an entire ribosomal DNA (rDNA) tandem repeat unit from a lower chordate, the ascidian Herdmania momus. rDNA copy number and considerable sequence...

  1. Two distinct promoter elements in the human rRNA gene identified by linker scanning mutagenesis.

    Haltiner, M M; Smale, S T; Tjian, R

    1986-01-01

    A cell-free RNA polymerase I transcription system was used to evaluate the transcription efficiency of 21 linker scanning mutations that span the human rRNA gene promoter. Our analysis revealed the presence of two major control elements, designated the core and upstream elements, that affect the level of transcription initiation. The core element extends from -45 to +18 relative to the RNA start site, and transcription is severely affected (up to 100-fold) by linker scanning mutations in this...

  2. Phylogeny of the malarial genus Plasmodium, derived from rRNA gene sequences.

    Escalante, A A; Ayala, F. J.

    1994-01-01

    Malaria is among mankind's worst scourges, affecting many millions of people, particularly in the tropics. Human malaria is caused by several species of Plasmodium, a parasitic protozoan. We analyze the small subunit rRNA gene sequences of 11 Plasmodium species, including three parasitic to humans, to infer their evolutionary relationships. Plasmodium falciparum, the most virulent of the human species, is closely related to Plasmodium reichenowi, which is parasitic to chimpanzee. The estimate...

  3. Direct ribosome isolation from soil to extract bacterial rRNA for community analysis.

    Felske, A; B. Engelen; Nübel, U; Backhaus, H

    1996-01-01

    A simple method that combines an adapted ribosome isolation method and a common RNA extraction step has been developed for selective recovery of intact rRNA from natural microbial communities in soil. After mechanical cell lysis, ribosomes are separated by centrifugation steps, avoiding massive humic acid contamination and RNA degradation. The protocol accommodates the complex composition of soils by blocking adsorbing surfaces and humic acids with polyvinylpyrrolidone and bovine serum albumi...

  4. GJB2 and mitochondrial 12S rRNA susceptibility mutations in sudden deafness.

    Chen, Kaitian; Sun, Liang; Zong, Ling; Wu, Xuan; Zhan, Yuan; Dong, Chang; Cao, Hui; Tang, Haocheng; Jiang, Hongyan

    2016-06-01

    Genetic susceptibility may play an important role in the pathogenesis of sudden deafness. However, the specific genes involved are largely unknown. We sought to explore the frequency of GJB2 and mitochondrial 12S rRNA susceptibility mutations in patients with sudden deafness. Between September 2011 and May 2012, 62 consecutive patients with sudden deafness were seen. In 50 of these, no etiological factors for sudden deafness were found. We detected GJB2 and mitochondrial 12S rRNA variants by direct sequencing in these 50 patients and in 53-aged matched controls with normal hearing. In addition, we undertook functional analyses of the mitochondrial mutations which we detected, applying structural and phylogenetic analysis. GJB2 sequencing identified six mutations, including three pathogenic mutations (c.235delC, c.299-300delAT, c.109G>A) and three polymorphisms, in the study participants, giving an allele frequency of 15.0 %. A homozygous c.109G>A mutation was detected in two participants. A total of 16 variants in mitochondrial 12S rRNA gene were identified in the participants. No significant differences were found in GJB2 heterozygosity or in mitochondrial 12S rRNA variants between patients with sudden deafness and in controls. Our results suggest that the homozygous GJB2 c.109G>A mutation may be a cause of sudden deafness involving both ears. This finding should increase awareness of the likely role of genetic factors in the etiology of sudden deafness in general. PMID:26119842

  5. Impaired rRNA synthesis triggers homeostatic responses in hippocampal neurons

    Anna eKiryk

    2013-11-01

    Full Text Available Decreased rRNA synthesis and nucleolar disruption, known as nucleolar stress, are primary signs of cellular stress associated with aging and neurodegenerative disorders. Silencing of rDNA occurs during early stages of Alzheimer´s disease (AD and may play a role in dementia. Moreover aberrant regulation of the protein synthesis machinery is present in the brain of suicide victims and implicates the epigenetic modulation of rRNA. Recently, we developed unique mouse models characterized by nucleolar stress in neurons. We inhibited RNA polymerase I by genetic ablation of the basal transcription factor TIF-IA in adult hippocampal neurons. Nucleolar stress resulted in progressive neurodegeneration, although with a differential vulnerability within the CA1, CA3 and dentate gyrus. Here, we investigate the consequences of nucleolar stress on learning and memory. The mutant mice show normal performance in the Morris water maze and in other behavioral tests, suggesting the activation of adaptive mechanisms. In fact, we observe a significantly enhanced learning and re-learning corresponding to the initial inhibition of rRNA transcription. This phenomenon is accompanied by aberrant synaptic plasticity. By the analysis of nucleolar function and integrity, we find that the synthesis of rRNA is later restored. Gene expression profiling shows that thirty-six transcripts are differentially expressed in comparison to the control group in absence of neurodegeneration. Additionally, we observe a significant enrichment of the putative serum response factor (SRF binding sites in the promoters of the genes with changed expression, indicating potential adaptive mechanisms mediated by the mitogen-activated protein kinase pathway. In the dentate gyrus a neurogenetic response might compensate the initial molecular deficits. These results underscore the role of nucleolar stress in neuronal homeostasis and open a new ground for therapeutic strategies aiming at preserving

  6. Greengenes: Chimera-checked 16S rRNA gene database and workbenchcompatible in ARB

    DeSantis, T.Z.; Hugenholtz, P.; Larsen, N.; Rojas, M.; Brodie,E.L; Keller, K.; Huber, T.; Dalevi, D.; Hu, P.; Andersen, G.L.

    2006-02-01

    A 16S rRNA gene database (http://greengenes.lbl.gov) addresses limitations of public repositories by providing chimera-screening, standard alignments and taxonomic classification using multiple published taxonomies. It was revealed that incongruent taxonomic nomenclature exists among curators even at the phylum-level. Putative chimeras were identified in 3% of environmental sequences and 0.2% of records derived from isolates. Environmental sequences were classified into 100 phylum-level lineages within the Archaea and Bacteria.

  7. Phylogenetic Relationship of Phosphate Solubilizing Bacteria according to 16S rRNA Genes

    Mohammad Bagher Javadi Nobandegani; Halimi Mohd Saud; Wong Mui Yun

    2015-01-01

    Phosphate solubilizing bacteria (PSB) can convert insoluble form of phosphorous to an available form. Applications of PSB as inoculants increase the phosphorus uptake by plant in the field. In this study, isolation and precise identification of PSB were carried out in Malaysian (Serdang) oil palm field (University Putra Malaysia). Identification and phylogenetic analysis of 8 better isolates were carried out by 16S rRNA gene sequencing in which as a result five isolates belong to the Beta sub...

  8. 18S rRNA suggests that Entoprocta are protostomes, unrelated to Ectoprocta

    Mackey, L.Y.; Winnepenninckx, B.; Wachter, R.; Backeljau, T.; Emschermann, P.; Garey, J.R.

    1996-01-01

    The Ento- and Ectoprocta are sometimes placed together in the Bryozoa, which have variously been regarded as proto- or deuterostomes. However, Entoprocta have also been allied to the pseudocoelomates, while Ectoprocta are often united with the Brachiopoda and Phoronida in the (super)phylum Lophophorata. Hence, the phylogenetic relationships of these taxa are still much debated. We determined complete 18S rRNA sequences of two entoprocts, an ectoproct, an inarticulate brachiopod, a phoronid, t...

  9. The donor substrate site within the peptidyl transferase loop of 23 S rRNA and its putative interactions with the CCA-end of N-blocked aminoacyl-tRNA(Phe)

    Porse, B T; Thi-Ngoc, H P; Garrett, R A

    1996-01-01

    An RNA region associated with the donor substrate site, located at the base of the peptidyl transferase loop of 23 S rRNA, was subjected to a comprehensive single-site mutational study. Growth phenotypes of Escherichia coli cells were characterized on induction of synthesis of the mutated rRNAs and...... the mutated ribosomes were tested, selectively, for their capacity to generate peptide bonds under the conditions of the "fragment" assay. Most of the mutants exhibited dominant or recessive lethal growth phenotypes and, in general, defective growth correlated with low activities in peptide bond...... approach was employed to test for Watson-Crick base-pairing interactions between the -CCA end of the P-site bound tRNA(Phe) and this region of the peptidyl-transferase loop. Single nucleotide substitutions were introduced into the -CCA end of tRNA(Phe) and the ability of the 3'-terminal pentanucleotide...

  10. Characterization of Hydrocortisone Biometabolites and 18S rRNA Gene in Chlamydomonas reinhardtii Cultures

    Seyed Bagher Mosavi-Azam

    2008-10-01

    Full Text Available A unicellular microalga, Chlamydomonas reinhardtii, was isolated from rice paddy-field soil and water samples and used in the biotransformation of hydrocortisone (1. This strain has not been previously tested for steroid bioconversion. Fermentation was carried out in BG-11 medium supplemented with 0.05% substrate at 25ºC for 14 days of incubation. The products obtained were chromatographically purified and characterized using spectroscopic methods. 11b,17b-Dihydroxyandrost-4-en-3-one (2, 11b-hydroxyandrost-4-en-3,17-dione (3, 11b,17a,20b,21-tetrahydroxypregn-4-en-3-one (4 and prednisolone (5 were the main products of the bioconversion. The observed bioreaction features were the side chain degradation of the substrate to give compounds 2 and 3 and the 20-ketone reduction and 1,2-dehydrogenation affording compounds 4 and 5, respectively. A time course study showed the accumulation of product 2 from the second day of the fermentation and of compounds 3, 4 and 5 from the third day. All the metabolites reached their maximum concentration in seven days. Microalgal 18S rRNA gene was also amplified by PCR. PCR products were sequenced to confirm their authenticity as 18S rRNA gene of microalgae. The result of PCR blasted with other sequenced microalgae in NCBI showed 100% homology to the 18S small subunit rRNA of two Chlamydomonas reinhardtii spp.