WorldWideScience

Sample records for adjacent normal skin

  1. In ovo gene manipulation of melanocytes and their adjacent keratinocytes during skin pigmentation of chicken embryos.

    Murai, Hidetaka; Tadokoro, Ryosuke; Sakai, Ken-Ichiro; Takahashi, Yoshiko

    2015-04-01

    During skin pigmentation in avians and mammalians, melanin is synthesized in the melanocytes, and subsequently transferred to adjacently located keratinocytes, leading to a wide coverage of the body surface by melanin-containing cells. The behavior of melanocytes is influenced by keratinocytes shown mostly by in vitro studies. However, it has poorly been investigated how such intercellular cross-talk is regulated in vivo because of a lack of suitable experimental models. Using chicken embryos, we developed a method that enables in vivo gene manipulations of melanocytes and keratinocytes, where these cells are separately labeled by different genes. Two types of gene transfer techniques were combined: one was a retrovirus-mediated gene infection into the skin/keratinocytes, and the other was the in ovo DNA electroporation into neural crest cells, the origin of melanocytes. Since the Replication-Competent Avian sarcoma-leukosis virus long terminal repeat with Splice acceptor (RCAS) infection was available only for the White leghorn strain showing little pigmentation, melanocytes prepared from the Hypeco nera (pigmented) were back-transplanted into embryos of White leghorn. Prior to the transplantation, enhanced green fluorescent protein (EGFP)(+) Neo(r+) -electroporated melanocytes from Hypeco nera were selectively grown in G418-supplemented medium. In the skin of recipient White leghorn embryos infected with RCAS-mOrange, mOrange(+) keratinocytes and transplanted EGFP(+) melanocytes were frequently juxtaposed each other. High-resolution confocal microscopy also revealed that transplanted melanocytes exhibited normal behaviors regarding distribution patterns of melanocytes, dendrite morphology, and melanosome transfer. The method described in this study will serve as a useful tool to understand the mechanisms underlying intercellular regulations during skin pigmentation in vivo. PMID:25739909

  2. TP53 mutations in clinically normal mucosa adjacent to oral carcinomas

    Thode, Christenze; Bilde, Anders; von Buchwald, Christian;

    2010-01-01

    positive cells. Seven specimens contained both histological normal and dysplastic epithelial tissues adjacent to the tumour. A TP53 mutation was found in only one specimen; this mutation appeared in the normal mucosa, the adjacent tumour, and the epithelial dysplasia. CONCLUSION: We found that upregulation...

  3. Reproducible pattern of microRNA in normal human skin

    Holst, Line; Kaczkowski, Bogumil; Gniadecki, Robert

    2010-01-01

    RNA expression pattern in normal human skin. Here we investigated miRNA expression profiles from skin biopsies of 8 healthy volunteers taken from sun protected and mildly photo damaged skin using the modified protocol for miRNA extraction. We were able to show a constant pattern of miRNA expression between......MicroRNAs (miRNAs) regulate cell growth, differentiation and apoptosis via specific targeting of messenger RNA (mRNA). Aberrant mRNA expression contributes to pathological processes such as carcinogenesis. To take advantage of miRNA profiling in skin disease it is essential to investigate mi...... different individuals. We did not find any significant differences in miRNA expression between sun protected and mildly photodamaged skin. These results may be valuable for future design of studies on miRNA expression in skin disease....

  4. Melanocytic naevi clustered on normal background skin.

    Torchia, D

    2015-04-01

    Several types of maculopapular melanocytic naevi can occur in a multiple form, and be arranged in a nonrandom fashion on the skin. The most frequently reported segmentally grouped naevi are lentigines. Two types of segmentally arranged lentigines probably exist. The first is associated with neurofibromatosis (NF)1 or NF1 signs, features scattered light-brown lesions and can be considered a type of mosaic NF1. By contrast, non-NF1 associated lesions are characterized by densely packed, dark lesions, and can be defined as 'non-NF1 checkerboard-arranged lentigines'. Blue naevi, Spitz naevi and common acquired melanocytic naevi can occur, clustered in an agminated (or cannonball) shape. However, if large enough, they always follow a checkerboard pattern. Hence, such mosaic conditions should be termed 'checkerboard-arranged blue naevi', 'checkerboard-arranged Spitz naevi' and 'checkerboard-arranged common acquired melanocytic naevi'. Segmentally arranged dysplastic melanocytic naevi probably represent a mosaic form of dysplastic naevus syndrome. Dysplastic melanocytic naevi confined to a cutaneous segment could be defined as 'isolated segmental dysplastic naevus syndrome', while segmentally arranged dysplastic melanocytic naevi co-occurring with widespread, nonsegmental dysplastic melanocytic naevi might configure a 'superimposed segmental dysplastic naevus syndrome'. Small congenital melanocytic naevi are always grouped along Blaschko lines. The only other instances following Blaschko lines are the so-called 'linear lentiginous naevus' and a unique case of multiple deep penetrating naevi. PMID:25703021

  5. Osteopontin Expression in Normal Skin and Non-melanoma Skin Tumors

    Chang, Pi-Ling; Harkins, Louie; Hsieh, Yu-Hua; Hicks, Patricia; Sappayatosok, Kraisorn; Yodsanga, Somchai; Swasdison, Somporn; Chambers, Ann F.; Elmets, Craig A.; Ho, Kang-Jey

    2008-01-01

    Osteopontin (OPN) is an adhesive, matricellular glycoprotein, whose expression is elevated in many types of cancer and has been shown to facilitate tumorigenesis in vivo. To understand the role of OPN in human skin cancer, this study is designed to determine whether OPN is expressed in premalignant [solar/actinic keratosis (AK)] and in malignant skin lesions such as squamous cell carcinomas (SCC) and basal cell carcinomas (BCC), as well as in normal skin exposed or not exposed to sunlight. Im...

  6. Using infrared and Raman microspectroscopies to compare ex vivo involved psoriatic skin with normal human skin

    Leroy, Marie; Lefèvre, Thierry; Pouliot, Roxane; Auger, Michèle; Laroche, Gaétan

    2015-06-01

    Psoriasis is a chronic dermatosis that affects around 3% of the world's population. The etiology of this autoimmune pathology is not completely understood. The barrier function of psoriatic skin is known to be strongly altered, but the structural modifications at the origin of this dysfunction are not clear. To develop strategies to reduce symptoms of psoriasis or adequate substitutes for modeling, a deep understanding of the organization of psoriatic skin at a molecular level is required. Infrared and Raman microspectroscopies have been used to obtain direct molecular-level information on psoriatic and healthy human skin biopsies. From the intensities and positions of specific vibrational bands, the lipid and protein distribution and the lipid order have been mapped in the different layers of the skin. Results showed a similar distribution of lipids and collagen for normal and psoriatic human skin. However, psoriatic skin is characterized by heterogeneity in lipid/protein composition at the micrometer scale, a reduction in the definition of skin layer boundaries and a decrease in lipid chain order in the stratum corneum as compared to normal skin. A global decrease of the structural organization is exhibited in psoriatic skin that is compatible with an alteration of its barrier properties.

  7. Three-dimensional imaging of normal skin and nonmelanoma skin cancer with cellular resolution using Gabor domain optical coherence microscopy

    Lee, Kye-Sung; Zhao, Huimin; Ibrahim, Sherrif F; Meemon, Natthani; Khoudeir, Laura; Rolland, Jannick P.

    2012-01-01

    Abstract. We investigate morphological differences in three-dimensional (3-D) images with cellular resolution between nonmelanoma skin cancer and normal skin using Gabor domain optical coherence microscopy. As a result, we show for the first time cellular optical coherence images of 3-D features differentiating cancerous skin from normal skin. In addition, in vivo volumetric images of normal skin from different anatomic locations are shown and compared.

  8. Mechanical properties of normal skin and hypertrophic scars.

    Clark, J A; Cheng, J C; Leung, K S

    1996-09-01

    The non-linear viscoelastic properties of skin tissue were characterized by modulus of elasticity E, which represents stiffness, and percentage extension (strain, xi) at load intensities of 20, 40 and 100 gm. The latter property is a measure of the extensibility for both normal skin and hypertrophic scar. A quasi-static extensometer applies a standard rate of extension to the skin and its mechanical properties were obtained from 15 Chinese patients with burn injuries of superficial to full skin thickness burns. Clinical evaluation of hypertrophic scar is qualitative and depends on colour, thickness and hardness or firmness. Using mechanical properties assists in the characterization by providing a quantitative indicator. Higher scar grading is synonymous with increased stiffness and decreased extensibility. Correlation with clinical assessment was achieved with these in vivo viscoelastic properties. PMID:8884002

  9. Stress interactions between normal faults and adjacent strike-slip faults of 1997 Jiashi earthquake swarm

    ZHANG ZhuQi; CHEN John YongShun; LIN Jian

    2008-01-01

    During a 4-month period starting from 21 January, 1997, an earthquake swarm of seven major events (Ms≥6.0) struck the Jiashi region at the northwestern corner of the Tarim Basin in Xinjiang,, China.Previous relocation studies suggested that these strong earthquakes had occurred along at least two parallel rupture zones. According to the relocated hypocenters and focal mechanisms of the events, we have constructed fault models for these seven earthquakes to calculate the Coulomb stress changes produced by each of these events. Furthermore, we extended our model calculations to include an adjacent 1996 Ms=6.9 Artushi earthquake, which occurred one year before the Jiashi earthquake swarm.Our calculations show that the Coulomb stress change caused by the preceding events was around 0.05 MPa at the hypocenter of the 4th event, and higher than 0.08 MPa at the hypocenters of the 2nd,3rd, 5th and 6th events. Our results reveal a Coulomb stress interactive cycle of earthquake triggering between two adjacent normal and strike-slip faults.

  10. Stress interactions between normal faults and adjacent strike-slip faults of 1997 Jiashi earthquake swarm

    CHEN; John; YongShun

    2008-01-01

    During a 4-month period starting from 21 January, 1997, an earthquake swarm of seven major events (Ms≥6.0) struck the Jiashi region at the northwestern corner of the Tarim Basin in Xinjiang,, China. Previous relocation studies suggested that these strong earthquakes had occurred along at least two parallel rupture zones. According to the relocated hypocenters and focal mechanisms of the events, we have constructed fault models for these seven earthquakes to calculate the Coulomb stress changes produced by each of these events. Furthermore, we extended our model calculations to include an ad- jacent 1996 Ms=6.9 Artushi earthquake, which occurred one year before the Jiashi earthquake swarm. Our calculations show that the Coulomb stress change caused by the preceding events was around 0.05 MPa at the hypocenter of the 4th event, and higher than 0.08 MPa at the hypocenters of the 2nd, 3rd, 5th and 6th events. Our results reveal a Coulomb stress interactive cycle of earthquake triggering between two adjacent normal and strike-slip faults.

  11. Collagen IV in normal skin and in pathological processes

    Ana Maria Abreu-Velez

    2012-01-01

    Full Text Available Context: Type IV collagen is a type of collagen found primarily in the skin within the basement membrane zone. The type IV collagen C4 domain at the C-terminus is not removed in post-translational processing, and the fibers are thus link head-to-head, rather than in a parallel fashion. Also, type IV collagen lacks a glycine in every third amino-acid residue necessary for the tight collagen helix. Thus, the overall collagen-IV conformation is structurally more pliable and kinked, relative to other collagen subtypes. These structural features allow collagen IV to form sheets, which is the primary structural form found in the cutaneous basal lamina. There are six human genes associated with collagen IV, specifically COL4A1, COL4A2, COL4A3, COL4A4, COL4A5 and COL4A6. The aim of this review is to highlight the significance of this protein in normal skin, and in selected diseases. Results: The alpha 3 protein constituent of type IV collagen is thought to be the antigen implicated in Goodpasture′s syndrome, wherein the immune system attacks the basement membranes of the renal glomeruli and pulmonary alveoli. In addition, mutations to the genes coding for type IV collagen lead to the Alport syndrome. Furthermore, autoantibodies directed against denatured human type IV collagen have been described in rheumatoid arthritis, scleroderma, and SLE. Structural studies of collagen IV have been utilized to differentiate between subepidermal blistering diseases, including bullous pemphigoid, acquired epidermolysis bullosa, anti-epiligrin cicatricial pemphigoid, and bullous lupus erythematosus. Collagen IV is also of importance in wound healing and in embryogenesis. Conclusions: Pathological studies have demonstrated that minor structural differences in collagen IV can lead to distinct, clinically different diseases.

  12. Differences in gene expression in prostate cancer, normal appearing prostate tissue adjacent to cancer and prostate tissue from cancer free organ donors

    Typical high throughput microarrays experiments compare gene expression across two specimen classes – an experimental class and baseline (or comparison) class. The choice of specimen classes is a major factor in the differential gene expression patterns revealed by these experiments. In most studies of prostate cancer, histologically malignant tissue is chosen as the experimental class while normal appearing prostate tissue adjacent to the tumor (adjacent normal) is chosen as the baseline against which comparison is made. However, normal appearing prostate tissue from tumor free organ donors represents an alterative source of baseline tissue for differential expression studies. To examine the effect of using donor normal tissue as opposed to adjacent normal tissue as a baseline for prostate cancer expression studies, we compared, using oligonucleotide microarrays, the expression profiles of primary prostate cancer (tumor), adjacent normal tissue and normal tissue from tumor free donors. Statistical analysis using Significance Analysis of Microarrays (SAM) demonstrates the presence of unique gene expression profiles for each of these specimen classes. The tumor v donor expression profile was more extensive that the tumor v adjacent normal profile. The differentially expressed gene lists from tumor v donor, tumor v adjacent normal and adjacent normal v donor comparisons were examined to identify regulated genes. When donors were used as the baseline, similar genes are highly regulated in both tumor and adjacent normal tissue. Significantly, both tumor and adjacent normal tissue exhibit significant up regulation of proliferation related genes including transcription factors, signal transducers and growth regulators compared to donor tissue. These genes were not picked up in a direct comparison of tumor and adjacent normal tissues. The up-regulation of these gene types in both tissue types is an unexpected finding and suggests that normal appearing prostate tissue

  13. Normal tissue tolerance to external beam radiation therapy: Skin

    Acute skin toxicity is frequent during radiation therapy and can lead to temporary arrest of the treatment. Chronic toxicity can occur and conduct to cosmetic problems. Alopecia is the most frequent toxicity concerning hair and is most of the time reversible. Several factors linked to patients influence skin toxicity, such as under-nutrition, old age, obesity, smoking, skin diseases, autoimmune diseases, failure of DNA reparation. Skin, hair and nail toxicities depend also on radiation schedule. Acute toxicity is greater when dose per fraction increases. Chronic and acute toxicities are more often when total dose increases. Under 45 Gy, the risk of severe skin toxicity is low, and begins above 50 Gy. Skin toxicity depends also on the duration of radiotherapy and split course schedules are associated with less toxicities. Irradiation surface seems to influence skin toxicity but interaction is more complex. Reirradiation is often feasible in case of cancer recurrence but with a risk of grade 3-4 toxicity above all in head and neck cancer. The benefit/risk ratio has to be always precisely evaluated. Permanent alopecia is correlated with the follicle dose. Modern techniques of radiation therapy allow to spare skin. (authors)

  14. Reproducible pattern of microRNA in normal human skin

    Holst, Line; Kaczkowski, Bogumil; Gniadecki, Robert

    2010-01-01

    MicroRNAs (miRNAs) regulate cell growth, differentiation and apoptosis via specific targeting of messenger RNA (mRNA). Aberrant mRNA expression contributes to pathological processes such as carcinogenesis. To take advantage of miRNA profiling in skin disease it is essential to investigate mi...

  15. Skin innervation: important roles during normal and pathological cutaneous repair.

    Laverdet, Betty; Danigo, Aurore; Girard, Dorothée; Magy, Laurent; Demiot, Claire; Desmoulière, Alexis

    2015-08-01

    The skin is a highly sensitive organ. It is densely innervated with different types of sensory nerve endings, which discriminate between pain, temperature and touch. Autonomic nerve fibres which completely derive from sympathetic (cholinergic) neurons are also present. During all the phases of skin wound healing (inflammatory, proliferative and remodelling phases), neuromediators are involved. Several clinical observations indicate that damage to the peripheral nervous system influences wound healing, resulting in chronic wounds within the affected area. Patients with cutaneous sensory defects due to lepromatous leprosy, spinal cord injury and diabetic neuropathy develop ulcers that fail to heal. In addition, numerous experimental observations suggest that neurogenic stimuli profoundly affect wound repair after injury and that delayed wound healing is observed in animal models after surgical resection of cutaneous nerves. All these observations clearly suggest that innervation and neuromediators play a major role in wound healing. Interactions between neuromediators and different skin cells are certainly crucial in the healing process and ultimately the restoration of pain, temperature, and touch perceptions is a major challenge to solve in order to improve patients' quality of life. PMID:25799052

  16. Topical distribution of acyclovir in normal equine skin and equine sarcoids: An in vitro study.

    Haspeslagh, M; Taevernier, L; Maes, A A; Vlaminck, L E M; De Spiegeleer, B; Croubels, S M; Martens, A M

    2016-06-01

    Topical acyclovir application is an owner-friendly treatment for occult equine sarcoids, without the caustic side-effects other topical treatments have. Variable clinical success rates have been described, but it is not known to what rate and extent acyclovir penetrates in and through equine skin from a topical formulation. In the current study, an in vitro Franz diffusion model was used to determine the permeation parameters for a generic 5% acyclovir cetomacrogol cream for both healthy and sarcoid equine skin. The distribution of acyclovir between different layers of both skin types was also evaluated. While acyclovir penetrated through both skin types, significantly less acyclovir permeated to the deep dermis of sarcoid skin (197.62ng/mm(3)) compared to normal skin (459.41ng/mm(3)). Within sarcoid skin samples, significantly higher acyclovir concentrations were found in the epidermis (983.59ng/mm(3)) compared to the superficial dermis (450.02ng/mm(3)) and the deep dermis. At each sample point, significantly more acyclovir permeated to the receptor fluid through normal skin compared to sarcoid skin, which is reflected in the significantly higher permeation parameters of normal skin. Normal skin was found to be more permissive for acyclovir, but even in sarcoid skin, enough acyclovir reached the deep dermis to treat a Herpes simplex virus infection. In the case of equine sarcoids, the treatment is aimed at the Bovine papillomavirus and no information is available on the susceptibility of the DNA polymerase of this virus for acyclovir. Therefore, further research is needed to determine the efficacy of acyclovir to treat equine sarcoids. PMID:27234546

  17. Epidermal stem cells - role in normal, wounded and pathological psoriatic and cancer skin

    Kamstrup, M.; Faurschou, A.; Gniadecki, R.;

    2008-01-01

    In this review we focus on epidermal stem cells in the normal regeneration of the skin as well as in wounded and psoriatic skin. Furthermore, we discuss current data supporting the idea of cancer stem cells in the pathogenesis of skin carcinoma and malignant melanoma. Epidermal stem cells present...... stem cells or transit amplifying cells constitute a primary pathogenetic factor in the epidermal hyperproliferation seen in psoriasis. In cutaneous malignancies mounting evidence supports a stem cell origin in skin carcinoma and malignant melanoma and a possible existence of cancer stem cells...

  18. Reflectance spectrometry of normal and bruised human skins: experiments and modeling

    A stochastic photon transport model in multilayer skin tissue combined with reflectance spectroscopy measurements is used to study normal and bruised skins. The model is shown to provide a very good approximation to both normal and bruised real skin tissues by comparing experimental and simulated reflectance spectra. The sensitivity analysis of the skin reflectance spectrum to variations of skin layer thicknesses, blood oxygenation parameter and concentrations of main chromophores is performed to optimize model parameters. The reflectance spectrum of a developed bruise in a healthy adult is simulated, and the concentrations of bilirubin, blood volume fraction and blood oxygenation parameter are determined for different times as the bruise progresses. It is shown that bilirubin and blood volume fraction reach their peak values at 80 and 55 h after contusion, respectively, and the oxygenation parameter is lower than its normal value during 80 h after contusion occurred. The obtained time correlations of chromophore concentrations in developing contusions are shown to be consistent with previous studies. The developed model uses a detailed seven-layer skin approximation for contusion and allows one to obtain more biologically relevant results than those obtained with previous models using one- to three-layer skin approximations. A combination of modeling with spectroscopy measurements provides a new tool for detailed biomedical studies of human skin tissue and for age determination of contusions. (paper)

  19. Morphology and epidermal thickness of normal skin imaged by optical coherence tomography

    Mogensen, Mette; Morsy, Hanan A.; Thrane, Lars;

    2008-01-01

    is to describe normal skin morphology using OCT and polarization-sensitive OCT (PS-OCT), which is a way of representing birefringent tissue such as collagen in OCT images. Anatomical locations in 20 healthy volunteers were imaged, and epidermal thickness (ET) was measured and compared to age, gender...... adults. In glabrous skin the stratum corneum is visible. Children had larger ET (p <0.0001). Age had a negative correlation with ET (p <0.05). No gender- or skin-type-related differences in ET were found. Conclusion: This study contributes to understanding OCT and PS-OCT images of normal skin and...... indicates that OCT can be used for both the qualitative and quantitative assessment of skin. Copyright (C) 2008 S. Karger AG, Basel....

  20. IgG subclass switching and clonal expansion in cutaneous melanoma and normal skin.

    Saul, Louise; Ilieva, Kristina M; Bax, Heather J; Karagiannis, Panagiotis; Correa, Isabel; Rodriguez-Hernandez, Irene; Josephs, Debra H; Tosi, Isabella; Egbuniwe, Isioma U; Lombardi, Sara; Crescioli, Silvia; Hobbs, Carl; Villanova, Federica; Cheung, Anthony; Geh, Jenny L C; Healy, Ciaran; Harries, Mark; Sanz-Moreno, Victoria; Fear, David J; Spicer, James F; Lacy, Katie E; Nestle, Frank O; Karagiannis, Sophia N

    2016-01-01

    B cells participate in immune surveillance in human circulation and tissues, including tumors such as melanoma. By contrast, the role of humoral responses in cutaneous immunity is underappreciated. We report circulating skin-homing CD22+CLA+B cells in healthy volunteers and melanoma patients (n = 73) and CD22+ cells in melanoma and normal skin samples (n = 189). Normal and malignant skin featured mature IgG and CD22 mRNA, alongside mRNA for the transiently-expressed enzyme Activation-induced cytidine Deaminase (AID). Gene expression analyses of publically-available data (n = 234 GEO, n = 384 TCGA) confirmed heightened humoral responses (CD20, CD22, AID) in melanoma. Analyses of 51 melanoma-associated and 29 normal skin-derived IgG sequence repertoires revealed lower IgG1/IgGtotal representation compared with antibodies from circulating B cells. Consistent with AID, comparable somatic hypermutation frequencies and class-switching indicated affinity-matured antibodies in normal and malignant skin. A melanoma-associated antibody subset featured shorter complementarity-determining (CDR3) regions relative to those from circulating B cells. Clonal amplification in melanoma-associated antibodies and homology modeling indicated differential potential antigen recognition profiles between normal skin and melanoma sequences, suggesting distinct antibody repertoires. Evidence for IgG-expressing B cells, class switching and antibody maturation in normal and malignant skin and clonally-expanded antibodies in melanoma, support the involvement of mature B cells in cutaneous immunity. PMID:27411958

  1. Spectral analysis of blood perfusion in the free latissimus dorsi myocutaneous flap and in normal skin

    To find the properties in the oscillatory components of the cutaneous blood flow on the successful free flap, a wavelet transform was applied to the laser Doppler flowmetry (LDF) signals which were measured simultaneously on the surfaces of the free latissimus dorsi myocutaneous flap and on the adjacent intact skin of the healthy limb, of 18 patients. The frequency interval from 0.0095 to 1.6 Hz was examined and was divided into five subintervals (I: 0.0095-0.021 Hz; II: 0.021-0.052 Hz; III: 0.052-0.145 Hz; IV: 0.145-0.6 Hz and V: 0.6-1.6 Hz) corresponding to endothelial metabolic, neurogenic, myogenic, respiratory and cardiac origins. The average amplitude and total power in the frequency range 0.0095-1.6 Hz as well as within subintervals I, II, IV and V were significantly lower for signals measured on the free flap than those obtained in the healthy limb. However in interval III, they were significantly higher. The normalized spectral amplitude and power in the free flap were significantly lower in only two intervals, I and II, yet in interval III they were significantly higher; no statistical significance was observed in intervals IV and V. The distinctive finding made in this study, aside from the decrease of endothelial metabolic processes and sympathetic control, was the significant increase of myogenic activity in the free flap. It is hoped that this work will contribute towards knowledge on blood circulation in free flaps and make the monitoring by LDF more reliable

  2. Elemental composition of hypertrophic scar and normal skin tissue using proton induced X-ray emission

    Hypertrophic scars are a particular type of scar that can form after any type of dermal trauma. They are unsightly, red and elevated above normal skin level. At present no-one knows why these scars form and what form the treatment should take. Full thickness hypertrophic skin tissue as well as full thickness normal skin samples, obtained form the Restoration of Appearance and Function Trust (RAFT), Institute of Plastic Surgery, Mount Vernon Hospital, were analysed, using simultaneously both PIXE and RBS, with a 2 MeV proton beam. The epidermis was compared to the dermis on both normal and scarred tissue, and each was compared to the other, to see if there were any variations in elemental composition. In all the samples C, N and O detected by RBS and P, S, Cl, K, Ca, Fe detected by PIXE were found. In the majority of samples Zn and Cd were found, and in a few samples Sn was determined. Significant differences in concentrations, for the elements P, S, K and Cd, between the epidermis and dermis in both hypertrophic scarred and normal skin tissue were found. A difference was also detected between elemental concentrations in normal and scarred skin for the elements Ca, P, S, Fe and Cd. (author)

  3. The Influence of Normal Load and Sliding Speed on Frictional Properties of Skin

    Wei Tang; Shi-rong Ge; Hua Zhu; Xi-chuan Cao; Ning Li

    2008-01-01

    The study of frictional properties of human skin is important for medical research, skin care products and textile exploitation. In order to investigate the influence of normal load and sliding speed on the frictional properties of skin and its possible mechanism, tests were carried out on a multi-specimen friction tester. When the normal load increases from 0.1 N to 0.9 N,normal displacement and the friction coefficient of skin increase. The friction coefficient is dependent on the load, indicating that both adhesion and deformation contribute to the friction behaviour. The deformation friction was interpreted using the plough model of fiiction. When sliding speed increases from 0.5 mm·s-1 to 4 mm·s-1,the friction coefficient increases and "stick-slip" phenomena increase, indicating that hysteretic friction contributes to the friction. The hysteretic friction was interpreted using schematic of energy translation during the rigid spherical probe sliding on the soft skin surface, which provides an explanation for the influence of the sliding speed on the frictional characteristics of the skin.

  4. Influence of water and salt solutions on UVB irradiation of normal skin and psoriasis

    The influence of tap-water (TW) and salt solutions on the minimal erythema dose (MED) was investigated for normal human skin and uninvolved skin of psoriasis patients. MED (UVB) determinations on the forearm revealed that: (1) the MED definitely decreases whenever the arm is immersed in TW or NaCl solutions with a low concentration (4%) prior to UVB exposure, whereas almost saturated NaCl solution (26%), as well as locum Dead Sea water (LDSW), do not produce a change in the MED, and (2) the decrease in MED obtained by wetting the skin with TW was no longer present when the skin was allowed to dry for 20 min. A decrease in water uptake by skin (in vivo) and by callus (in vitro) was found as the salt concentration of the external solution increased. It is proposed that water taken up by the skin plays an important role in the sensitivity of the skin to UVB exposure. Bathing in TW or 4% NaCl prior to UVB exposure offered a slight to moderate improvement in psoriasis over UVB irradiation alone. Finally, it was shown that there is no obvious difference in clearance of the psoriatic skin between a bath in TW, 4% NaCl, or LDSW prior to UVB exposure. (orig.)

  5. Relationship between in vitro radiosensitivity of normal human skin fibroblasts and the occurrence of late normal tissue reactions after radiotherapy

    Late complications in normal tissues are limiting for the doses that can be administered during clinical radiotherapy. Awareness of these complications, and comprehension of the underlying biological mechanisms, is extremely important to improve cancer treatment. Fibrosis is one of the most critical injuries to radiotherapy. It varies significantly among patients despite of identical treatments. The large patient-to-patient variability of normal tissue sections to clinical radiation can possibly be accounted for by the considerable individual variation in cellular radiosensitivity of normal human fibroblasts, as shown in vitro. The purpose of the present investigation has been to analyze individual cellular radiosensitivity of normal human skin fibroblasts, as measured in a colony-forming assay, and the relationship to the occurrence of subcutaneous fibrosis after radiotherapy for breast cancer. (au) 97 refs

  6. Skin-pass rolling II - Studies of roughness transfer under combined normal and tangential loading

    Kijima, Hideo; Bay, Niels

    2008-01-01

    The influence of tool roughness on roughness transfer in skin-pass or temper rolling of steel strip is investigated, focusing on loading under combined normal and tangential displacement of tool relative to the workpiece. The calculated roughness transfer by an elasto-plastic finite element (FE......) simulation of plane strain indentation in authors’ previous paper [H. Kijima, N. Bay, Skin-pass rolling I—studies on roughness transfer and elongation under pure normal loading, International Journal of Machine Tools and Manufacture, May 2008, accepted for publication] is verified by experimental...

  7. High-resolution magnetic resonance imaging in study of the skin: Normal patterns

    Sans, Nicolas, E-mail: sans.n@chu-toulouse.fr [Service de Radiologie et Imagerie Medicale, Centre Hospitalier Universitaire Purpan, Place du Dr Baylac, TSA 40031, 31059 Toulouse Cedex 9 (France); Faruch, Marie; Chiavassa-Gandois, Helene; Ribes, Catherine Lalande Champetier de [Service de Radiologie et Imagerie Medicale, Centre Hospitalier Universitaire Purpan, Place du Dr Baylac, TSA 40031, 31059 Toulouse Cedex 9 (France); Paul, Carle [Service de Dermatologie, Centre Hospitalier Universitaire Larrey, Toulouse (France); Railhac, Jean-Jacques [Service de Radiologie et Imagerie Medicale, Centre Hospitalier Universitaire Purpan, Place du Dr Baylac, TSA 40031, 31059 Toulouse Cedex 9 (France)

    2011-11-15

    Purpose: To validate quantitative and qualitative criteria of normal healthy skin using high-resolution MR imaging. Materials and methods: FIESTA and spin echo sequences of the skin of the heel, back and calf were obtained in 31 healthy volunteers. A dedicated 3-in. coil for study of the skin was used to optimize reception sensitivity. Quantitative analysis was performed to measure skin thickness in these three sites and qualititative analysis aimed to differentiate the various skin layers. Results: With both sequences, the stratum corneum appeared as a hyperintense layer. The epidermis was visualized appeared as a fine, homogeneous, hyperintense line. The dermoepidermal junction was clearer particularly in the calf. The dermis was also identified in each sequence and in each anatomic site. The signal was hypointense in both sequences, homogeneous with spin echo and more heterogeneous with FIESTA. Moreover the interface between the papillary and the reticular dermis could be distinguished. The hypodermis was visualized in both sequences and in all sites and hypodermal inclusions in the dermis were seen particularly in the back and calf. Lastly, the pilosebaceous follicles and the deep vascular network of the reticular dermis were more clearly seen with FIESTA sequence. Measures of overall skin thickness and for each layer according to site, sex and MRI sequence were performed. Statistical analysis was then performed to seek significant differences between the results according to these parameters. Conclusion: MR imaging provides global analysis with high resolution of the various skin layers down to the hypodermis and the muscular fascia.

  8. Skin-pass rolling I – Studies on roughness transfer and elongation under pure normal loading

    Kijima, Hideo; Bay, Niels

    2008-01-01

    The influence of tool roughness in skin-pass or temper rolling of steel strip is investigated focusing on roughness transfer and strip elongation under pure normal loading, i.e. with no tangential shear between tool and workpiece. The process is simulated by an elasto-plastic FE simulation of plane...

  9. Development of gene microarray in screening differently expressed genes in keloid and normal-control skin

    陈伟; 付小兵; 葛世丽; 孙晓庆; 周岗; 赵志力; 盛志勇

    2004-01-01

    Background Keloid is an intricate lesion that is probably regulated by many genes. In this study, the authors used the technique of complementary DNA (cDNA) microarray to analyse abnormal gene expression in keloids and normal control skins. Methods The polymerase chain reaction (PCR) products of 8400 genes were spotted in an array on chemical-material-coated-glass plates. The DNAs were fixed on the glass plates. The total RNAs were isolated from freshly excised human keloid and normal control skins, and the mRNAs were then purified. The mRNA from both keloid and normal control skins were reversely transcribed to cDNAs, with the incorporation of fluorescent dUTP, for preparing the hybridisation probes. The mixed probes were then hybridised to the cDNA microarray. After thorough washing, the cDNA microarray was scanned for differing fluorescent signals from two types of tissues. Gene expression of tissue growth factor-β1 (TGF-β1) and of c-myc was detected with both RT-PCR and Northern blot hybridisation to confirm the effectiveness of cDNA microarray. Results Among the 8400 human genes, 402 were detected with different expression levels between keloid and normal control skins. Two hundred and fifty genes, including TGF-β1 and c-myc, were up-regulated and 152 genes were down-regulated. Higher expressions of TGF-β1 and c-myc in keloid were also revealed using RT-PCR and Northern blot methods. Conclusion cDNA microarray analysis provides a powerful tool for investigating differential gene expression in keloid and normal control skins. Keloid is a complicated lesion with many genes involved.

  10. Skin flora: Differences between people affected by Albinism and those with normally pigmented skin in Northern Tanzania – cross sectional study

    Kiprono Samson K

    2012-07-01

    Full Text Available Abstract Background Skin flora varies from one site of the body to another. Individual’s health, age and gender determine the type and the density of skin flora. Methods A 1 cm2 of the skin on the sternum was rubbed with sterile cotton swab socked in 0.9% normal saline and plated on blood agar. This was cultured at 35°C. The bacteria were identified by culturing on MacConkey agar, coagulase test, catalase test and gram staining. Swabs were obtained from 66 individuals affected by albinism and 31 individuals with normal skin pigmentation. Those with normal skin were either relatives or staying with the individuals affected by albinism who were recruited for the study. Results The mean age of the 97 recruited individuals was 30.6 (SD ± 14.9 years. The mean of the colony forming units was 1580.5 per cm2. Those affected by albinism had a significantly higher mean colony forming units (1680 CFU per cm2 as compared with 453.5 CFU per cm2 in those with normally pigmented skin (p = 0.023. The skin type and the severity of sun- damaged skin was significantly associated with a higher number of colony forming units (p = 0.038. Conclusion Individuals affected by albinism have a higher number of colony forming units which is associated with sun- damaged skin.

  11. Mast cells and atopic dermatitis. Stereological quantification of mast cells in atopic dermatitis and normal human skin

    Damsgaard, T E; Olesen, A B; Sørensen, Flemming Brandt;

    1997-01-01

    Stereological quantification of mast cell numbers was applied to sections of punch biopsies from lesional and nonlesional skin of atopic dermatitis patients and skin of healthy volunteers. We also investigated whether the method of staining and/or the fixative influenced the results of the...... determination of the mast cell profile numbers. The punch biopsies were taken from the same four locations in both atopic dermatitis patients and normal individuals. The locations were the scalp, neck and flexure of the elbow (lesional skin), and nates (nonlesional skin). Clinical scoring was carried out at the...... yielded the following results: (1) in atopic dermatitis lesional skin an increased number of mast cell profiles was found as compared with nonlesional skin, (2) comparing atopic dermatitis skin with normal skin, a significantly increased number of mast cell profiles per millimetre squared was found in...

  12. Assessment of Optical Coherence Tomography Imaging in the Diagnosis of Non-Melanoma Skin Cancer and Benign Lesions Versus Normal Skin:

    Mogensen, Mette; Jørgensen, Thomas Martini; Nürnberg, Birgit Meincke;

    2009-01-01

    BACKGROUND Optical coherence tomography (OCT) is an optical imaging technique that may be useful in diagnosis of non-melanoma skin cancer (NMSC). OBJECTIVES To describe OCT features in NMSC such as actinic keratosis (AK) and basal cell carcinoma (BCC) and in benign lesions and to assess the...... diagnostic accuracy of OCT in differentiating NMSC from benign lesions and normal skin. METHODS AND MATERIALS OCT and polarization-sensitive (PS) OCT from 104 patients were studied. Observer-blinded evaluation of OCT images from 64 BCCs, 1 baso-squamous carcinoma, 39 AKs, two malignant melanomas, nine benign...... lesions, and 105 OCT images from perilesional skin was performed; 50 OCT images of NMSC and 50 PS-OCT images of normal skin were evaluated twice. RESULTS Sensitivity was 79% to 94% and specificity 85% to 96% in differentiating normal skin from lesions. Important features were absence of well...

  13. Protoporphyrin IX formation and photobleaching in different layers of normal human skin

    Togsverd-Bo, Katrine; Idorn, Luise W; Philipsen, Peter A;

    2012-01-01

    human skin was tape-stripped and incubated with 20% methylaminolevulinate (MAL) or 20% hexylaminolevulinate (HAL) for 3 h. Fluorescence microscopy quantified PpIX accumulation in epidermis, superficial, mid and deep dermis, down to 2 mm. PpIX photobleaching by light-emitting diode (LED, 632 nm, 18 and......Topical photodynamic therapy (PDT) is used for various skin disorders, and selective targeting of specific skin structures is desirable. The objective was to assess accumulation of PpIX fluorescence and photobleaching within skin layers using different photosensitizers and light sources. Normal...... 37 J/cm(2)), intense pulsed light (IPL, 500-650 nm, 36 and 72 J/cm(2)) and long-pulsed dye laser (LPDL, 595 nm, 7.5 and 15 J/cm(2)) was measured using fluorescence photography and microscopy. We found higher PpIX fluorescence intensities in epidermis and superficial dermis in HAL-incubated skin than...

  14. The inflammatory and cytotoxic effects of a nitric oxide releasing cream on normal skin.

    Ormerod, A D; Copeland, P; Hay, I; Husain, A; Ewen, S W

    1999-09-01

    We describe the pro-inflammatory and cytotoxic effects of nitric oxide in vivo in human skin. Nitrite and ascorbic acid were mixed on the skin of 12 normal volunteers, three times daily, to release nitric oxide. Exposure to nitric oxide was varied by randomizing the concentration of nitrite and duration of application. Nitric oxide treated skin showed significant increases in cells expressing CD3, CD4, CD8, CD68, neutrophil elastase, ICAM-1, VCAM-1, nitrosotyrosine, p53, and apoptotic cells compared with skin treated with ascorbic acid alone. There was no significant increase in mast cells. Following application of nitric oxide there were significantly fewer CD1a positive Langerhans cells in the epidermis. These appeared to lose dendritic morphology and migrate from the epidermis. There was no significant difference in staining for Ki-67, a marker related to proliferating cell nuclear antigen, between active and control skin but staining was greater after exposure to higher dose nitric oxide than the low dose. Apoptosis, cytotoxicity, and p53 staining were relatively greater after 48 h exposure than after 24 h. These results suggest that nitric oxide is pro-inflammatory and is toxic to DNA, leading to the accumulation of p53 and subsequent apoptosis. High-dose nitric oxide paradoxically led to a smaller increase in macrophages and T cells than low dose suggesting an immunosuppressive effect of higher levels. PMID:10469339

  15. Incorporation of 14C-linoleic acid in cerebrosides of psoriatic and normal human skin

    It was shown that the incorporation of 14C-linoleic acid in cerebrosides of normal and psoriatic human skin is different. In psoriatic epidermis and corium the turnover of this fatty acid is significantly elevated. It is suggested that in psoriasis the epidermal cell is not able to build up a regular carbohydrate sequences of lipids because the false carbohydrate chain activates the degradation of glycolipids and in compensating for the increased degradation raises the synthesis rate of glycolipids. (orig./MG)

  16. Cyclooxygenase-2 expression is related to nuclear grade in ductal carcinoma in situ and is increased in its normal adjacent epithelium

    Shim, Veronica; Gauthier, Mona L.; Sudilovsky, Daniel; Mantei, Kristin; Chew, Karen L.; Moore, Dan H.; Cha, Imok; Tlsty, Thea D.; Esserman, Laura J.

    2003-01-01

    Cyclooxygenase-2 (COX-2) is emerging as an important cancer biomarker and is now an experimental target for solid tumor treatment.However, no study has exclusively focused on COX-2 expression in early lesions such as ductal carcinoma in situ (DCIS). We examined COX-2 expression by immunohistochemistry in 46 cases of women undergoing surgical resection for DCIS. We found that COX-2 expression was detected in 85% of all DCIS specimens, with increased COX-2 staining correlating with higher nuclear grade. Strikingly, COX-2 staining intensity in the normal adjacent epithelium was stronger than in the DCIS lesion itself. Our observations demonstrate that COX-2 is up-regulated in the normal adjacent epithelium and supports the hypothesis that the surrounding epithelial tissue is part of the disease process in DCIS.

  17. CD133 Expression in Normal Skin and in Epithelial Cutaneous Tumors

    S. H. Nam-Cha

    2013-01-01

    Full Text Available Background. Expression of human CD133 (human prominin-1 in cancer cells has been postulated to be a marker of stemness and is considered as a putative marker of cancer stem cells (CSCs. We designed a study to describe the expression pattern of CD133 in normal skin and in epithelial cutaneous neoplasms. Methods. The CD133 immunohistochemical expression of forty-three eccrine and apocrine tumors was compared to that observed in other epithelial tumors of the skin. In addition, flow cytometry was used to detect the CD133 expression of four epithelial skin neoplasms, including one porocarcinoma. Results. CD133 immunoreactivity at the apical or at the apicolateral surface of cells forming glandular structures was observed. Cells from solid areas of benign or malignant tumors were not stained. The porocarcinoma derived culture cells showed a 22% of CD133 positive cells using flow cytometry, while squamous cell carcinoma cultures contained less than 0.1%. Conclusions. These observations indicate that CD133 is a specific marker of glandular differentiation that could be included in the diagnostic panel of cutaneous tumors with possible eccrine or apocrine differentiation. However, the use of CD133 expression as a marker of CSCs should be interpreted with caution in experiments of skin.

  18. Sequence analysis of the CCG polymorphic region adjacent to the CAG triplet repeat of the HD gene in normal and HD chromosomes.

    Pêcheux, C; Mouret, J F; Dürr, A.; Agid, Y; Feingold, J; Brice, A; Dodé, C; Kaplan, J.C.

    1995-01-01

    The CAG expansion responsible for Huntington's disease (HD) is followed by an adjacent polymorphic CCG repeat region which may interfere with a PCR based diagnosis. We have sequenced this region in 52 unrelated HD patients, from both normal and HD chromosomes. Fifty percent of the normal alleles were (CCG)7(CCT)2, 48% (CCG)10(CCT)2, and 2% (CCG)7(CCT)3. In contrast (CCG)7(CCT)2 was found in 85% of the HD alleles which represents significant linkage disequilibrium with the HD mutation.

  19. The early response of p53-dependent proteins during radiotherapy in human rectal carcinoma and in adjacent normal tissue

    Stift, A; Prager, G; Selzer, E; Widder, J; Kandioler, D; Friedl, J; Teleky, B; Herbst, F; Wrba, F; Bergmann, M

    2003-01-01

    The aim of this study was to investigate the activation of the p53 pathway and the induction of apoptosis during preoperative radiotherapy in normal human rectal tissue and in rectal carcinoma. Twelve patients with rectal cancer of the lower third were enrolled in this study. Tumor specimens and adj

  20. Skin flora: Differences between people affected by Albinism and those with normally pigmented skin in Northern Tanzania – cross sectional study

    Kiprono Samson K; Masenga John E; Chaula Baraka M; Naafs Bernard

    2012-01-01

    Abstract Background Skin flora varies from one site of the body to another. Individual’s health, age and gender determine the type and the density of skin flora. Methods A 1 cm2 of the skin on the sternum was rubbed with sterile cotton swab socked in 0.9% normal saline and plated on blood agar. This was cultured at 35°C. The bacteria were identified by culturing on MacConkey agar, coagulase test, catalase test and gram staining. Swabs were obtained from 66 individuals affected by albinism and...

  1. Dermatitis Herpetiformis: Skin Manifestation of Celiac Disease

    ... is the first step in diagnosing DH. Direct immunofluorescence of clinically normal skin adjacent to a lesion ... serology confirm DH and should be taken as indirect evidence of small bowel damage. A biopsy of ...

  2. Action spectra for inactivation of normal and xeroderma pigmentosum human skin fibroblasts by ultraviolet radiations

    Action spectra for UV-induced lethality as measured by colony forming ability were determined both for a normal human skin fibroblast strain (1BR) and for an excision deficient xeroderma pigmentosum strain (XP4LO) assigned to complementation group A using 7 monochromatic wavelengths in the range 254-365 nm. The relative sensitivity of the XP strain compared to the normal skin fibroblasts shows a marked decrease at wavelengths longer than 313 nm, changing from a ratio of about 20 at the shorter wavelengths to just greater than 1.0 at the longer wavelengths. The action spectra thus indicate that the influence on cell inactivation of the DNA repair defect associated with XP cells is decreased and almost reaches zero at longer UV wavelengths. This would occur, for example, if the importance of pyrimidine dimers as the lethal lesion decreased with increasing wavelength. These results are consistent with pyrimidine dimers induced in DNA being the major lethal lesion in both cell strains over the wavelength range 254-313 nm. However, it is indicated that different mechanisms of inactivation operate at wavelengths longer than 313 nm. (author)

  3. Minimal erythema response (MED to solar simulated irradiation in normal Indian skin

    Mehta Rai Vandana

    2004-09-01

    Full Text Available BACKGROUND: Phototesting is an essential tool in the investigation of photodermatoses. AIMS: The main aim was to study the cutaneous response to UVR in terms of minimal erythema dose (MED to both UVA and UVB in normal Indian subjects with a solar simulator and to study the relationship of skin type to MED. METHODS: One hundred healthy volunteers not on any medication and without any history of photodermatoses were phototested using a solar simulator with whole spectrum irradiation (UVA, UVB and visible light and only visible and UVA radiation. The tested areas were marked with gentian violet and readings were taken after 24 hrs. RESULTS: Of the 100 volunteers, 48% were males and 52% were females, with a mean age of 36.6 ± 11.6 yrs. The most common skin type among Indians was type 5 (46% followed by type 4 (41%. The mean MED for UVB was 61.5 ± 17.25J/cm2. The MED for UVA could not be determined as none of the patients showed any erythema after irradiation for 45 minutes. CONCLUSIONS: As the MED is found to be low in idiopathic acquired photodermatoses, the MED in the normal population could serve as a baseline data in the investigation.

  4. Dynamic infrared imaging of cutaneous melanoma and normal skin in patients treated with BNCT

    Santa Cruz, G.A. [Dpto. de Instrumentacion y Control, Comision Nacional de Energia Atomica, Av. del Libertador 8250 (1429), Buenos Aires (Argentina)], E-mail: santacr@cnea.gov.ar; Bertotti, J.; Marin, J. [Universidad Favaloro, Solis 453 (1078), Buenos Aires (Argentina); Gonzalez, S.J. [Dpto. de Instrumentacion y Control, Comision Nacional de Energia Atomica, Av. del Libertador 8250 (1429), Buenos Aires (Argentina); CONICET, Avda. Rivadavia 1917 (1033), Buenos Aires (Argentina); Gossio, S. [FCEyN, Pabellon II, Ciudad Universitaria (1428), Buenos Aires (Argentina); Alvarez, D. [Fundacion Favaloro, Av. Belgrano 1746 (1093), Buenos Aires (Argentina); Roth, B.M.C.; Menendez, P. [Instituto de Oncologia Angel H. Roffo, Av. San Martin 5481 (1417), Buenos Aires (Argentina); Pereira, M.D. [Agencia Nacional de Promocion Cientifica y Tecnologica, PAV 22393 (Argentina); Albero, M.; Cubau, L.; Orellano, P. [INVAP S.E., F.P. Moreno 1089 (R8400AMU), S.C. de Bariloche, Rio Negro (Argentina); Liberman, S.J. [Dpto. de Instrumentacion y Control, Comision Nacional de Energia Atomica, Av. del Libertador 8250 (1429), Buenos Aires (Argentina)

    2009-07-15

    We recently initiated a program aimed to investigate the suitability of dynamic infrared imaging for following-up nodular melanoma patients treated with BNCT. The reason that makes infrared imaging attractive is the fact that it constitutes a functional and non-invasive imaging method, providing information on the normal and abnormal physiologic response of the nervous and vascular systems, as well as the local metabolic rate and inflammatory processes that ultimately appear as differences in the skin temperature. An infrared camera, with a focal plane array of 320x240 uncooled ferroelectric detectors is employed, which provides a video stream of the infrared emission in the 7-14 {mu}m wavelength band. A double blackbody is used as reference for absolute temperature calibration. After following a protocol for patient preparation and acclimatization, a basal study is performed. Subsequently, the anatomic region of interest is subjected to a provocation test (a cold stimulus), which induces an autonomic vasoconstriction reflex in normal structures, thus enhancing the thermal contrast due to the differences in the vasculature of the different skin regions. Radiation erythema reactions and melanoma nodules possess typically a faster temperature recovery than healthy, non-irradiated skin. However, some other non-pathological structures are also detectable by infrared imaging, (e.g. scars, vessels, arteriovenous anastomoses and injuries), thus requiring a multi-study comparison in order to discriminate the tumor signal. Besides the superficial nodules, which are readily noticeable by infrared imaging, we have detected thermal signals that are coincident with the location of non-palpable nodules, which are observable by CT and ultrasound. Diffuse regions of fast temperature recovery after a cold stimulus were observed between the third and sixth weeks post-BNCT, concurrent with the clinical manifestation of radiation erythema. The location of the erythematous visible and

  5. Laser-induced fluorescence and reflectance spectroscopy for the discrimination of basal cell carcinoma from the surrounding normal skin tissue.

    Drakaki, E; Kaselouris, E; Makropoulou, M; Serafetinides, A A; Tsenga, A; Stratigos, A J; Katsambas, A D; Antoniou, C

    2009-01-01

    The object of this study was to investigate whether laser-induced skin autofluorescence (LIF) and/or light reflectance spectra could provide a useful contrast between basal cell carcinoma (BCC) tissues and the surrounding healthy skin. Unstained human skin samples, excised from humans undergoing biopsy examination, were irradiated with a nitrogen laser (lambda = 337 nm) for excitation of autofluorescence and a tungsten halogen lamp for the reflectance measurements. The ex vivo spectroscopic results were correlated with the histopathology images to distinguish the areas of BCC from those of the surrounding health skin. A simple spectral analysis technique was also applied for better skin diagnosis. In conclusion, it seems that LIF and reflectance spectra could be used to differentiate neoplastic from normal skin tissue using an appropriate classification model analysis. PMID:19365155

  6. Dramatic increase in oxidative stress in carbon-irradiated normal human skin fibroblasts

    Skin complications were recently reported after carbon-ion (C-ion) radiation therapy. Oxidative stress is considered an important pathway in the appearance of late skin reactions. We evaluated oxidative stress in normal human skin fibroblasts after carbon-ion vs. X-ray irradiation. Survival curves and radiobiological parameters were calculated. DNA damage was quantified, as were lipid peroxidation (LPO), protein carbonylation and antioxidant enzyme activities. Reduced and oxidized glutathione ratios (GSH/GSSG) were determined. Pro-inflammatory cytokine secretion in culture supernatants was evaluated. The relative biological effectiveness (RBE) of C-ions vs. X-rays was 4.8 at D0 (irradiation dose corresponding to a surviving fraction of 37%). Surviving fraction at 2 Gy (SF2) was 71.8% and 7.6% for X-rays and C-ions, respectively. Compared with X-rays, immediate DNA damage was increased less after C-ions, but a late increase was observed at D10% (irradiation dose corresponding to a surviving fraction of 10%). LPO products and protein carbonyls were only increased 24 hours after C-ions. After X-rays, superoxide dismutase (SOD) activity was strongly increased immediately and on day 14 at D0% (irradiation dose corresponding to a surviving fraction of around 0%), catalase activity was unchanged and glutathione peroxidase (GPx) activity was increased only on day 14. These activities were decreased after C-ions compared with X-rays. GSH/GSSG was unchanged after X-rays but was decreased immediately after C-ion irradiation before an increase from day 7. Secretion of IL-6 was increased at late times after X-ray irradiation. After C-ion irradiation, IL-6 concentration was increased on day 7 but was lower compared with X-rays at later times. C-ion effects on normal human skin fibroblasts seemed to be harmful in comparison with X-rays as they produce late DNA damage, LPO products and protein carbonyls, and as they decrease antioxidant defences. Mechanisms leading to this

  7. Site-specific keloid fibroblasts alter the behaviour of normal skin and normal scar fibroblasts through paracrine signalling.

    Kevin J Ashcroft

    Full Text Available Keloid disease (KD is an abnormal cutaneous fibroproliferative disorder of unknown aetiopathogenesis. Keloid fibroblasts (KF are implicated as mediators of elevated extracellular matrix deposition. Aberrant secretory behaviour by KF relative to normal skin fibroblasts (NF may influence the disease state. To date, no previous reports exist on the ability of site-specific KF to induce fibrotic-like phenotypic changes in NF or normal scar fibroblasts (NS by paracrine mechanisms. Therefore, the aim of this study was to investigate the influence of conditioned media from site-specific KF on the cellular and molecular behaviour of both NF and NS enabled by paracrine mechanisms. Conditioned media was collected from cultured primary fibroblasts during a proliferative log phase of growth including: NF, NS, peri-lesional keloid fibroblasts (PKF and intra-lesional keloid fibroblasts (IKF. Conditioned media was used to grow NF, NS, PKF and IKF cells over 240 hrs. Cellular behavior was monitored through real time cell analysis (RTCA, proliferation rates and migration in a scratch wound assay. Fibrosis-associated marker expression was determined at both protein and gene level. PKF conditioned media treatment of both NF and NS elicited enhanced cell proliferation, spreading and viability as measured in real time over 240 hrs versus control conditioned media. Following PKF and IKF media treatments up to 240 hrs, both NF and NS showed significantly elevated proliferation rates (p<0.03 and migration in a scratch wound assay (p<0.04. Concomitant up-regulation of collagen I, fibronectin, α-SMA, PAI-1, TGF-β and CTGF (p<0.03 protein expression were also observed. Corresponding qRT-PCR analysis supported these findings (P<0.03. In all cases, conditioned media from growing marginal PKF elicited the strongest effects. In conclusion, primary NF and NS cells treated with PKF or IKF conditioned media exhibit enhanced expression of fibrosis-associated molecular markers

  8. Content of Androgen Receptor in Cultured Genital Skin Fibroblast From Different Ages of Chinese Normal Men

    卢建; 何立敏; 张金山; 杨震; 周云

    1995-01-01

    A ratpid, simple, reliable method is described for assaying androgen receptor (AR) in dispersed, whole, cultured human genital skin fibroblasts (GSF) with a synthetic androgen, 3H-methyltrienolone (3H-R1881). Receptors for androgen in GSF exhiblt high affinity (Kd=3.0±0.1 nmol/L), low binding capacity and androgen specificity. The content of AR in cultured GSF from 40 normal men varying in age from 1.5—60 years u:as also investigated by this assay. Scatchard analysis and slngle plot revealed the presence of 4.500-8500 binding sites per cell, mean number of AR in GSF of these men is 6288±1082 binding sites/cell. No significant difference was observed in the content of AR in different age groups. This result showed that the content of AR in these ceils did not change with age.

  9. Multiphoton imaging of excised normal skin and keloid scar: preliminary investigations

    Brewer, Michael B.; Yeh, Alvin T.; Torkian, Behrooz; Sun, Chung-Ho; Tromberg, Bruce J.; Wong, Brian J.

    2004-07-01

    Wound healing is a physiologic process that acts to repair disruptions in the continuity of tissue caused by injury or surgical incision. Keloids and hypertrophic scars are forms of aberrant wound healing, which are characterized by the overproduction of collagen, resulting in an excessive amount of scar tissue. Keloid tumors, by definition, grow outside the boundary of the original tissue damage. Multiphoton microscopy (MPM) is an imaging technique which allows imaging of living specimens, without the use of fixation or stains. Images of collagen fibers are produced by the second harmonic signal intensity generated by endogenous fluorescence through excitation by infrared laser light. A postauricular keloid tumor was excised from a patient. The tissue was dissected, and a portion was imaged using MPM. Normal skin tissue was isolated from a patient undergoing a facelift. A portion of this tissue was also dissected and imaged using MPM. MPM images were taken using a 63X water immersion objective lens on a two-photon microscope and a titanium-sapphire laser. Images were taken beginning at the surface of the tissue and moving in at intervals of 200 nm to a final depth of 30 μm. The two-photon images were used to reconstruct three-dimensional representations of the collagen matrix within the tissues, which are readily contrasted. Density of the collagen within each tissue was also ascertained using depth dependant decay of the image intensity. Multiphoton imaging was successfully used to image the collagen matrix of normal skin and a keloid scar, demonstrating differences in their microstructures.

  10. The macroscopic characteristics of normal rat skin and under the hyperthermia

    Shapovalov D.O.

    2008-01-01

    Full Text Available In this work with the use of different morphological and statistical methods on 28 mature rats macroscopic parameters of skin changes under the influence of pyrogenal was studied. The macroscopic parameters of rat skin were subject of the analysis (body weight, skin weight, thickness of skin, length of skin hairs. The regional features of rat skin structure has been determined not only at microscopic level but also on macroscopic. The skin weight of mature rats with the body weight 150 - 200 g varies within the limits of 24 - 45g (19 - 21% from body weight. The macroscopic parameters of skin have changed already after a single intraperitoneal introduction of pyrogenal. The thickness of skin and skin fold has changed the most active. Thus, the most difference was observed in the portions of skin with the list specific mass was. The maximal increase in thickness of skin and skin fold, as compared to the control, took place at the first introduction. The adaptation mechanism under hyperthermia realized through the vascular structures of derma and hypoderm, by the increase of diameter in vessels of a different caliber.

  11. Distribution and ultrastructure of pigment cells in the skins of normal and albino adult turbot, Scophthalmus Maximus

    GUO Huarong; HUANG Bing; QI Fei; ZHANG Shicui

    2007-01-01

    The distribution and ultrastructure of pigment cells in skins of normal and albino adult turbots were examined with transmission electron microscopy (TEM). Three types of pigment cells of melanophore, iridophore and xanthophore have been recognized in adult turbot skins. The skin color depends mainly on the amount and distribution of melanophore and iridophore, as xanthophore is quite rare. No pigment cells can be found in the epidermis of the skins. In the pigmented ocular skin of the turbot, melanophore and iridophore are usually co-localized in the dermis. This is quite different from the distribution in larvae skin. In albino and white blind skins of adult turbots, however, only iridophore monolayer still exists, while the melanophore monolayer disappears. This cytological evidence explains why the albino adult turbot, unlike its larvae, could never resume its body color no matter what environmental and nutritional conditions were provided. Endocytosis is quite active in the cellular membrane of the iridophore. This might be related to the formation of reflective platelet and stability of the iridophore.

  12. Studies on 133Xe wash-out from human skin: quantitative measurements of blood flow in normal and corticosteroid-treated skin

    Blood flow was measured by the 133Xe technique in normal and corticosteroid-treated skin. Epicutaneous and intracutaneous methods of tracer application were compared in normal skin. The two labeling methods were equally suitable for measuring cutaneous blood flow provided calculations in both cases were based on a biexponential resolution of the wash-out curve in its cutaneous and subcutaneous components and provided the traumatic hyperemia phase was considered, when intracutaneous application of the tracer was used. Results were invalidated if calculations were based on initial slope of the washout curves. Topical application of beta-methasone valerate resulted in a reduction in cutaneous blood flow as measured by the intracutaneous technique with curve resolution, whereas no effect could be demonstrated when calculations were based on the initial slopes of the curves. The 133Xe technique is a simple and reliable method for measuring cutaneous blood flow, which might prove useful in estimations of penetration ability and potency of topical corticosteroids

  13. DNA-protein crosslinking in normal human skin fibroblasts exposed to ultraviolet radiation

    Cultured normal human skin fibroblasts were exposed to different fluences of 254 nm UV and the levels of DNA-protein crosslinks (DPC) measured with alkaline elution immediately after irradiation or following a 24-hour incubation (370C). For cells exposed to 10J/m/sup 2/ and then incubated, the level of DPC decreased to that of unexposed cells. When the fluences increased, the levels of DPC measured following a 24-hour incubation increased as compared with non-incubated cells. At fluences higher than 100J/m/sup 2/, the DPC levels of incubated cells exceeded the DPC levels of non-incubated cells. When the single strand breaks (SSB) and double strand breaks (DSB) were measured under a deproteinized condition with alkaline elution and neutral elution, respectively, the levels of SSB and DSB were higher for cells with than for cells without post-irradiation incubation. The simultaneous increase of DPC and proteinase-sensitive SSB and DSB for cells given post-irradiation incubation suggests that a significant part of the DPC observed during post-UV-irradiation incubation were the DNA strand breaks that were tightly associated with proteins. A potential role for type II DNA topoisomerase in the formation of these DPC resulting from either the change in conformational structure caused by the presence of a high level of dimers or an involvement of this enzyme in dimer excision repair will be discussed

  14. DNA-protein crosslinking in normal human skin fibroblasts exposed to solar ultraviolet wavelengths

    Three normal human skin fibroblast cell lines were exposed to the simulated solar UV radiation produced by a fluorescent sunlamp (wavelength components shorter than either 295, 305 or 315 nm were excluded). The level of DNA-protein crosslinks (DPC) was then measured in those cells either immediately after irradiation or following a 24 h incubation. Cells were exposed to fluences that induce similar levels of DPC. For cells exposed to 10 kJ m-2 of sunlamp UV>295 nm, the level of DPC exhibited a 2-5-fold increase following incubation. In contrast, 40-100% of the DPC were removed upon incubation of cells irradiated with either 10 kJ m-2 of sunlamp UV>305 nm or 150 kJ m-2 of sunlamp UV>315 nm. A major difference between the effects induced by these wavelength regions is that, in addition to DPC, a very high level of pyrimidine dimers is also produced by sunlamp UV>295 nm, whereas much lower dimer yields result from treatment with either sunlamp UV>305 nm or sunlamp UV>315 nm. A potential role for type II DNA topoisomerase in the formation of these DPC resulting from either the change in conformational structure caused by the presence of a high level of dimers or an involvement of this enzyme in dimer excision repair is discussed. (author)

  15. Low doses of nanodiamonds and silica nanoparticles have beneficial hormetic effects in normal human skin fibroblasts in culture

    Mytych, Jennifer; Wnuk, Maciej; Rattan, Suresh

    2016-01-01

    Nanodiamonds (ND) and silica nanoparticles (SiO2-NP) have been much investigated for their toxicity at high doses, little is known about their biological activity at low concentrations. Here we report the biphasic dose response of ND and SiO2-NP in modulating normal human facial skin fibroblasts ...

  16. Analysis of differences of gene expressions in keloid and normal skin with the aid of cDNA microarray

    Chen Wei; Fu Xiaobing; Sun Xiaoqing; Sun Tongzhu; Zhao Zhili; Yang Yinhui; Sheng Zhiyong

    2003-01-01

    Background: Microarray analysis is a popular tool to investigate the function of genes that are responsible for the phenotype of the disease. Keloid is a intricate lesion which is probably modulated by interplay of many genes. We ventured to study the differences of gene expressions between keloids and normal skins with the aid of cDNA microarray in order to explore the molecular mechanism underlying keloid formation. Methods: The PCR products of 8400 human genes were spotted on a chip in array. The DNAs were then fixed on the glass plate by a series of treatments. Total RNAs was isolated from freshly excised human keloids and normal skin, and then was purified to mRNA by Oligotex. Both the mRNA from keloids and normal skin was reversely transcribed to cDNAs with the incorporations of fluorescent dUTP, for preparing the hybridization probes. The mixed probes were then hybridized to the cDNA microarray. After highly stringent washing, the cDNA microarray was scanned for the fluorescent signals to display the differences between two kinds of tissues. Results: Among 8400 human genes, there were 402 genes (4.79%) with different expression levels between the keloids and normal skins in all cases, 250were up-regulated (2.98%) and 152 down-regulated (1.81%). Analyses of collagen, fibronectin, proteoglycan,growth factors and apoptosis related molecule gene expression confirmed that our molecular data obtained by cDNA microarray were consistent with published biochemical and clinical observations of keloids. Conclusions: DNA microarray technology is an effective technique in screening for differences in gene expression between keloid and normal skin. Many genes are involved in the formation of keloids. Further analysis of the obtained genes will help understand the molecular mechanism of keloid formation.

  17. Effect of perorally administered pivmecillinam on the normal oropharyngeal, intestinal and skin microflora.

    Sullivan, A; Edlund, C; Svenungsson, B; Emtestam, L; Nord, C E

    2001-06-01

    To study the ecological effects of pivmecillinam on the human oropharyngeal, intestinal and skin microflora, 15 healthy volunteers were given pivmecillinam tablets 400 mg twice daily for 7 days. Saliva, stool and skin specimens were taken before (days -3 and 0) and on the 2nd, 4th and 7th days during the administration period and 14 and 21 days after the start of administration. Mecillinam caused no major changes in the aerobic or anaerobic oropharyngeal microflora. In the aerobic intestinal microflora there was a decrease in the numbers of Escherichia coli while no changes occurred in the anaerobic microflora. In the skin microflora there was a transient decrease in the numbers of Propionibacterium spp. underneath the wing of the nose. The major effect of pivmecillinam was seen on E. coli and to some extent on Propionibacterium spp. No further ecological disturbances were noticed in the oropharyngeal, intestinal or skin microflora. PMID:11450889

  18. Cold urticaria patients exhibit normal skin levels of functional mast cells and histamine after tolerance induction

    Kring Tannert, Line; Stahl Skov, Per; Bjerremann Jensen, Louise;

    2012-01-01

    Cold urticaria is a skin condition characterized by rapid appearance of itchy wheals and occasionally angioedema in response to cold stimulation. Antihistamines do not sufficiently protect all patients from symptoms, even when used in higher than standard doses. In these patients, desensitization...

  19. Noninvasive evaluation of collagen and hemoglobin contents and scattering property of in vivo keloid scars and normal skin using diffuse reflectance spectroscopy: pilot study

    Tseng, Sheng-Hao; Hsu, Chao-Kai; Yu-Yun Lee, Julia; Tzeng, Shih-Yu; Chen, Wan-Rung; Liaw, Yu-Kai

    2012-07-01

    Collagen is a rich component in skin that provides skin structure integrity; however, its contribution to the absorption and scattering properties of various types of skin has not been extensively studied. We considered the contribution of the collagen to the absorption spectrum of in vivo normal skin and keloids of 12 subjects derived from our diffuse reflectance spectroscopy (DRS) system in the wavelength range from 550 to 860 nm. It was found that the collagen concentration, the hemoglobin oxygen saturation, and the reduced scattering coefficient of keloids were remarkably different from that of normal skin. Our results suggest that our DRS system could assist clinicians in understanding the functional and structural condition of keloid scars. In the future, we will evaluate the accuracy of our system in the keloid diagnosis and investigate the applicability of our system for other skin-collagen-related studies.

  20. Identification and distribution of a novel Malassezia species yeast on normal equine skin.

    Nell, A; James, S A; Bond, C J; Hunt, B; Herrtage, M E

    2002-03-30

    This study aimed to investigate the distribution of Malassezia species yeasts on the skin of healthy horses. Acetate tape samples were obtained from the lip, axilla, interbulbar region, groin and anus of 12 healthy horses. The samples were stained and examined microscopically and sites harbouring yeast-like organisms were identified. Contact plates were applied to the skin at these sites and cultured at 26 degrees C and 32 degrees C. No growth was obtained on horse blood, Sabouraud's dextrose or modified Dixon's agar. A pure growth of a Malassezia-type organism was obtained on Sabouraud's dextrose agar enriched with oleic acid when it was incubated at 30 degrees C. It was identified by 26S ribosomal DNA D1/D2 sequence analysis as a member of the genus Malassezia, and most closely related to Malassezia sympodialis. However, the level of sequence divergence indicated that it was a novel species. PMID:11999275

  1. Collagen Content and Electrophoretic Analysis of Type I Collagen in Breast Skin of Heterozygous Naked Neck and Normally Feathered Commercial Broilers

    BİLGEN, Güldehen

    1999-01-01

    This study was conducted to evaluate the breast skin collagen content and electrophoretic analyses of type I collagen in heterozygous naked neck and normally feathered commercial chicks. A total of 72 birds from each genotype were randomly selected at 7 weeks and slaughtered. Breast skin was separated from each carcass and was analysed for collagen content and gel electrophopresis of type I collagen was performed. Males had significantly higher level of skin collagen content than females i...

  2. Trichohyalin-like 1 protein, a member of fused S100 proteins, is expressed in normal and pathologic human skin.

    Yamakoshi, Takako; Makino, Teruhiko; Ur Rehman, Mati; Yoshihisa, Yoko; Sugimori, Michiya; Shimizu, Tadamichi

    2013-03-01

    Trichohyalin-like 1 (TCHHL1) protein is a novel member of the fused-type S100 protein gene family. The deduced amino acid sequence of TCHHL1 contains an EF-hand domain in the N-terminus, one trans-membrane domain and a nuclear localization signal. We generated specific antibodies against the C-terminus of the TCHHL1 protein and examined the expression of TCHHL1 proteins in normal and pathological human skin. An immunohistochemical study showed that TCHHL1 proteins were expressed in the basal layer of the normal epidermis. In addition, signals of TCHHL1 proteins were observed around the nuclei of cultured growing keratinocytes. Accordingly, TCHHL1 mRNA has been detected in normal skin and cultured growing keratinocytes. Furthermore, TCHHL1 proteins were strongly expressed in the peripheral areas of tumor nests in basal cell carcinomas and squamous cell carcinomas. A dramatic increase in the number of Ki67 positive cells was observed in TCHHL1-expressing areas. The expression of TCHHL1 proteins also increased in non-cancerous hyperproliferative epidermal tissues such as those of psoriasis vulgaris and lichen planus. These findings highlight the possibility that TCHHL1 proteins are expressed in growing keratinocytes of the epidermis and might be associated with the proliferation of keratinocytes. PMID:23376073

  3. Normal skin and hypertrophic scar fibroblasts differentially regulate collagen and fibronectin expression as well as mitochondrial membrane potential in response to basic fibroblast growth factor

    Rui Song; Hui-Ning Bian; Wen Lai; Hua-De Chen; Ke-Seng Zhao

    2011-01-01

    Basic fibroblast growth factor (bFGF) regulates skin wound healing; however, the underlying mechanism remains to be defined. In the present study, we determined the effects of bFGF on the regulation of cell growth as well as collagen and fibronectin expression in fibroblasts from normal human skin and from hypertrophic scars. We then explored the involvement of mitochondria in mediating bFGF-inducedeffects on the fibroblasts. We isolated and cultivated normal and hypertrophic scar fibroblasts...

  4. In vivo study for the discrimination of cancerous and normal skin using fibre probe-based Raman spectroscopy.

    Schleusener, Johannes; Gluszczynska, Patrycja; Reble, Carina; Gersonde, Ingo; Helfmann, Jürgen; Fluhr, Joachim W; Lademann, Jürgen; Röwert-Huber, Joachim; Patzelt, Alexa; Meinke, Martina C

    2015-10-01

    Raman spectroscopy has proved its capability as an objective, non-invasive tool for the detection of various melanoma and non-melanoma skin cancers (NMSC) in a number of studies. Most publications are based on a Raman microspectroscopic ex vivo approach. In this in vivo clinical evaluation, we apply Raman spectroscopy using a fibre-coupled probe that allows access to a multitude of affected body sites. The probe design is optimized for epithelial sensitivity, whereby a large part of the detected signal originates from within the epidermal layer's depth down to the basal membrane where early stages of skin cancer develop. Data analysis was performed on measurements of 104 subjects scheduled for excision of lesions suspected of being malignant melanoma (MM) (n = 36), basal cell carcinoma (BCC) (n = 39) and squamous cell carcinoma (SCC) (n = 29). NMSC were discriminated from normal skin with a balanced accuracy of 73% (BCC) and 85% (SCC) using partial least squares discriminant analysis (PLS-DA). Discriminating MM and pigmented nevi (PN) resulted in a balanced accuracy of 91%. These results lie within the range of comparable in vivo studies and the accuracies achieved by trained dermatologists using dermoscopy. Discrimination proved to be unsuccessful between cancerous lesions and suspicious lesions that had been histopathologically verified as benign by dermoscopy. PMID:26010742

  5. Trichohyalin-like 1 protein, a member of fused S100 proteins, is expressed in normal and pathologic human skin

    Highlights: ► Trichohyalin-like 1 protein is a member of the fused-type S100 protein gene family. ► Specific antibodies against the C-terminus of the TCHHL1 protein were generated. ► TCHHL1 proteins were expressed in the basal layer of the normal epidermis. ► TCHHL1 proteins were strongly expressed in tumor nests of BCC and SCC. ► The expression of TCHHL1 proteins increased in epidermis of psoriasis vulgaris. - Abstract: Trichohyalin-like 1 (TCHHL1) protein is a novel member of the fused-type S100 protein gene family. The deduced amino acid sequence of TCHHL1 contains an EF-hand domain in the N-terminus, one trans-membrane domain and a nuclear localization signal. We generated specific antibodies against the C-terminus of the TCHHL1 protein and examined the expression of TCHHL1 proteins in normal and pathological human skin. An immunohistochemical study showed that TCHHL1 proteins were expressed in the basal layer of the normal epidermis. In addition, signals of TCHHL1 proteins were observed around the nuclei of cultured growing keratinocytes. Accordingly, TCHHL1 mRNA has been detected in normal skin and cultured growing keratinocytes. Furthermore, TCHHL1 proteins were strongly expressed in the peripheral areas of tumor nests in basal cell carcinomas and squamous cell carcinomas. A dramatic increase in the number of Ki67 positive cells was observed in TCHHL1-expressing areas. The expression of TCHHL1 proteins also increased in non-cancerous hyperproliferative epidermal tissues such as those of psoriasis vulgaris and lichen planus. These findings highlight the possibility that TCHHL1 proteins are expressed in growing keratinocytes of the epidermis and might be associated with the proliferation of keratinocytes

  6. Trichohyalin-like 1 protein, a member of fused S100 proteins, is expressed in normal and pathologic human skin

    Yamakoshi, Takako [Department of Dermatology, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Sugitani, Toyama 930-0194 (Japan); Makino, Teruhiko, E-mail: tmakino@med.u-toyama.ac.jp [Department of Dermatology, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Sugitani, Toyama 930-0194 (Japan); Ur Rehman, Mati; Yoshihisa, Yoko [Department of Dermatology, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Sugitani, Toyama 930-0194 (Japan); Sugimori, Michiya [Department of Integrative Neuroscience, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Sugitani, Toyama 930-0194 (Japan); Shimizu, Tadamichi, E-mail: shimizut@med.u-toyama.ac.jp [Department of Dermatology, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Sugitani, Toyama 930-0194 (Japan)

    2013-03-01

    Highlights: ► Trichohyalin-like 1 protein is a member of the fused-type S100 protein gene family. ► Specific antibodies against the C-terminus of the TCHHL1 protein were generated. ► TCHHL1 proteins were expressed in the basal layer of the normal epidermis. ► TCHHL1 proteins were strongly expressed in tumor nests of BCC and SCC. ► The expression of TCHHL1 proteins increased in epidermis of psoriasis vulgaris. - Abstract: Trichohyalin-like 1 (TCHHL1) protein is a novel member of the fused-type S100 protein gene family. The deduced amino acid sequence of TCHHL1 contains an EF-hand domain in the N-terminus, one trans-membrane domain and a nuclear localization signal. We generated specific antibodies against the C-terminus of the TCHHL1 protein and examined the expression of TCHHL1 proteins in normal and pathological human skin. An immunohistochemical study showed that TCHHL1 proteins were expressed in the basal layer of the normal epidermis. In addition, signals of TCHHL1 proteins were observed around the nuclei of cultured growing keratinocytes. Accordingly, TCHHL1 mRNA has been detected in normal skin and cultured growing keratinocytes. Furthermore, TCHHL1 proteins were strongly expressed in the peripheral areas of tumor nests in basal cell carcinomas and squamous cell carcinomas. A dramatic increase in the number of Ki67 positive cells was observed in TCHHL1-expressing areas. The expression of TCHHL1 proteins also increased in non-cancerous hyperproliferative epidermal tissues such as those of psoriasis vulgaris and lichen planus. These findings highlight the possibility that TCHHL1 proteins are expressed in growing keratinocytes of the epidermis and might be associated with the proliferation of keratinocytes.

  7. Promoter polymorphisms in the MATP (SLC45A2) gene are associated with normal human skin color variation.

    Graf, Justin; Voisey, Joanne; Hughes, Ian; van Daal, Angela

    2007-07-01

    Human pigmentation is a complex physical trait in which the membrane-associated transporter protein (MATP) plays an important role as it is involved in intracellular processing and trafficking of melanosomal proteins. Recently, pathogenic mutations in MATP have been shown to cause oculocutaneous albinism type 4, while other polymorphisms are known to have a role in normal pigmentation variation. We previously reported significant associations of two coding region polymorphisms with hair, skin, and eye color in Caucasians. Here we characterize the promoter region of MATP identifying two new transcription start sites and a novel duplication (c.-1176_-1174dupAAT). A total of 700 individuals from five different population groups (529 Caucasians, 38 Asians, 46 African Americans, 47 Australian Aborigines, and 40 Spanish Basques) were genotyped for known promoter polymorphisms c.-1721C>G (rs13289) and c.-1169G>A (rs6867641), as well as c.-1176_-1174dupAAT. Allele frequencies of all three polymorphisms were significantly different between population groups. In Caucasians, the -1721G, +dup, and -1169A alleles were significantly associated with olive skin color. The three promoter polymorphisms were found to be in linkage disequilibrium with each other but not with the two previously reported coding region polymorphisms. Functional analyses in a melanoma cell line showed that the promoter haplotype -1721G, +dup, -1169A significantly decreased MATP transcription. This report provides further evidence for the involvement of MATP in normal pigmentation variation by identifying associations between MATP alleles and skin color variation in Caucasians and demonstrating a functional significance of these polymorphisms. PMID:17358008

  8. Exploring the spatial dimension of estrogen and progesterone signaling: detection of nuclear labeling in lobular epithelial cells in normal mammary glands adjacent to breast cancer

    Grote, Anne; Abbas, Mahmoud; Linder, Nina; Kreipe, Hans H.; Lundin, Johan; Feuerhake, Friedrich

    2014-01-01

    Abstract Background Comprehensive spatial assessment of hormone receptor immunohistochemistry staining in digital whole slide images of breast cancer requires accurate detection of positive nuclei within biologically relevant regions of interest. Herein, we propose a combination of automated region labeling at low resolution and subsequent detailed tissue evaluation of subcellular structures in lobular structures adjacent to breast cancer, as a proof of concept for the approach to analy...

  9. Characterisation of a behavioural protocol for the assessment of nociception in normal and inflamed porcine skin

    di Giminiani, Pierpaolo

    2012-01-01

    cutaneous pain sensitivity following ultraviolet-B and capsaicin-induced inflammation in porcine skin. A series of experiments was performed to characterise the new experimental protocol, which included (1) the identification and quantification of reflexive behavioural responses indicative of the......The study of pain has been historically based on the investigation of human clinical conditions with the purpose of identifying the direct causes of pain to develop suitable analgesic treatments. The need to comprehend the mechanisms behind the processes of pain ignited the rapid development of pre......-clinical research, based on the investigation of experimental models designed to reproduce painful conditions or parts thereof. Animals play a fundamental role, since they provide the platform to reproduce human conditions in order to study the mechanisms behind pain processes, and during the last three decades...

  10. Semi-conservative deoxyribonucleic acid synthesis in unirradiated and ultraviolet-irradiated xeroderma pigmentosum and normal human skin fibroblasts

    Rates of semiconservative DNA synthesis have been investigated in asynchronous xeroderma pigmentosum (XP), XP variant, and normal human skin fibroblasts using the technique of cellular autoradiography. In unirradiated cells, no differences in DNA synthesis rates were detected among the three cell strains. Exposure to UV radiation caused the rate of DNA synthesis to decrease for at least three hours in all three cell strains. In the normal cell strain, recovery of the DNA synthetic rate occurred at later times following a UV fluence of 5 J/m2. At this same UV fluence, recovery was absent in classical XP cells during a 24 h post-irradiation period while it was slower than normal in XP variant cells. When the UV fluence to classical XP and XP variant cells was reduced so that survival in all three cell strains was approximately the same (25%), recovery of the DNA synthetic rate was similar in all three cell strains. These results are discussed in terms of current models of DNA replication in UV-irradiated cells and indicate: (1) that pyrimidine dimers are very effective blocks to DNA synthesis and (2) that there is no inherent defect in semiconservative DNA synthesis in either classical XP or XP variant cells which is independent of a defect in DNA repair capacity

  11. Perivascular infiltration in normal skin of patients with rheumatoid arthritis: association with rheumatoid factors and HLA-DR antigens.

    Bernelot Moens, H J; Ament, H J; Vroom, T M; Feltkamp, T E; van der Korst, J K

    1988-01-01

    The relation between immunohistological findings in biopsy specimens of apparently normal skin, HLA antigens, and rheumatoid factors (RF) was studied in 120 patients with rheumatoid arthritis (RA), selected for treatment with D-penicillamine. Perivascular infiltration (PVI) of more than three mononuclear cells was present in 77 (68%) of 114 patients, accompanied usually by the presence of IgM or C3, or both, in immunofluorescence studies. The number of perivascular cells was associated significantly with the titre of circulating RF. A weak relation of both perivascular cellular infiltration and RF with HLA-DR3 and DR4 did not reach statistical significance. It is concluded that the histological presence of perivascular inflammation is associated mainly with deposition of RF. It is suggested that the first is merely an epiphenomenon of the latter. PVI was not prognostic for the occurrence of the clinical syndrome of rheumatoid vasculitis. For practical purposes skin biopsies do not appear to be useful in the evaluation of individual patients with RA. PMID:3058055

  12. Validity of bioeffect dose response models for normal tissue early and late complications of the skin

    Background: The bioeffect of a physical dose depends on the nature of the tissue, fractionation scheme, dose rate and treatment time. Certainly, experienced radiotherapists are convinced of the existence of patient-to-patient variability in normal tissue response to radiotherapy for malignant tumours. The absorbed dose needs to be translated into a bioeffect dose, which takes into account treatment variables and the radiobiological characteristics of the relevant tissue. Various bioeffect models such as NSD, CRE, TDF and BED have been proposed to predict the biological effect of radiotherapy treatments. Aim: This study was aimed at deriving tolerance bioeffect dose values for normal tissue complication rate. Materials/Methods: Compiled clinical data of time dose fractionation schedules and incidence of erythema, desquamation and telangiectasia were used for the present analysis. Results: For erythema and desquamation the radiation dose varied from 23.9 to 55.1 Gy in 04 to 50 fractions (dose per fraction 1.1 to 7.3 Gy) in 11 to 40 days. For telangiectasia (score .1 at 3 years) the radiation dose varied from 25.8 to 55.1 Gy in 04 to 50 fractions (dose per fraction 1.1 to 7.3 Gy) in 11 to 40 days. For telangiectasia (score .2 at 5 years) the radiation dose varied from 25.8 to 63.0 Gy in 04 to 50 fractions (dose per fraction 1.1 to 7.3 Gy) in 11 to 68 days. For telangiectasia (score .1, .2, .3, .4 at 10 years) the radiation dose varied from 25.8 to 63.0 Gy in 04 to 35 fractions (dose per fraction 1.7 to 7.3 Gy) in 22 to 68 days. TDF and LQF values for erythema, desquamation and telangiectasia were evaluated with a/b values of 7.5 Gy, 11.2 Gy and 2.8 Gy respectively. TDF and LQF had a statistically significant correlation with probability of erythema, desquamation and telangiectasia (p<0.001). Conclusions: TDF and LQF values should be limited to 60 and 86 Gy in order to limit the probability of telangiectasia. (authors)

  13. Nonlinear spectral imaging of human normal skin, basal cell carcinoma and squamous cell carcinoma based on two-photon excited fluorescence and second-harmonic generation

    Xiong, S. Y.; Yang, J. G.; Zhuang, J.

    2011-10-01

    In this work, we use nonlinear spectral imaging based on two-photon excited fluorescence (TPEF) and second harmonic generation (SHG) for analyzing the morphology of collagen and elastin and their biochemical variations in basal cell carcinoma (BCC), squamous cell carcinoma (SCC) and normal skin tissue. It was found in this work that there existed apparent differences among BCC, SCC and normal skin in terms of their thickness of the keratin and epithelial layers, their size of elastic fibers, as well as their distribution and spectral characteristics of collagen. These differences can potentially be used to distinguish BCC and SCC from normal skin, and to discriminate between BCC and SCC, as well as to evaluate treatment responses.

  14. Establishment of field change by expression of cytokeratins 8/18, 19, and MMP-9 in an apparently normal oral mucosa adjacent to squamous cell carcinoma: A immunohistochemical study

    Alka D Kale

    2012-01-01

    Full Text Available Background: Squamous cell carcinoma is the most frequent malignancy of the oral cavity. The survival rate of this malignancy has not improved from past two decades. The major factors responsible for this could be due to loco regional and distant metastatic spread. However, the other important prognostic factor is concomitant occurrence and recurrence of multiple primary carcinomas in the head and neck region, which is explained as the concept of field cancerization. The evidence to support the field change in normal mucosa of Oral squamous cell carcinoma (OSCC through biological markers using immunohistochemistry has always been challenging. Aim: Hence, the aim of the present research is to identify changes in the expression of CK 8/18, 19, and MMP-9 to visualize field changes in the clinically normal mucosa adjacent to OSCC and compare with non neoplastic normal oral mucosa. Materials and Methods: 20 cases of OSCC with radical resection specimens were included in the study. Lesional tissue and adjacent normal looking mucosa were taken during grossing. Ten cases of non-neoplastic normal oral mucosa are also included in the study. Markers such as CK 8/18, CK 19, and MMP-9 are used by the immunohistochemical method in this present study. Result and Conclusion: The enhance expression of CK 8/18 (80%, CK 19 (70%, and MMP 9 (90% in ANM was noted and furthermore in six ANM showing severe dysplasia with enhance expression of CK 8/18, CK 19, and MMP 9 in the apparently normal oral mucosa can suggest a field cancerization.

  15. VEGF expression during the formation and development of radiation-induced skin ulcers and its effects on ulcer healing: a comparative study with normal wound healing

    Objective: To study VEGF expression during the formation and development of radiation-induced skin ulcers and its effects on ulcer healing. Methods: A rat model which was locally irradiated with 60Co γ-rays was used, and another rat model of simple skin wounds was made. Pathological changes were observed for 55 days. Immunohistochemistry, in situ hybridization and image analysis were performed to detect VEGF expression in the tissue of radiation skin ulcers and in the simple wounds. Results: Skin ulcers were found on day 14 after irradiation, and they were enlarged and deepened gradually during the observation period. In the irradiated skin, especially in the epidermal cells, fibroblasts and endothelial cells in the ulcer beds, the expression of VEGF was higher than that in normal skin. But VEGF expression was obviously decreased in the radiation ulcer beds compared to that in the surgical wound beds. Conclusion: After irradiation, the decreased expression of VEGF may play an important role in the formation, development and nonhealing mechanism of radiation skin ulcers

  16. Skin Graft

    Ruka Shimizu; Kazuo Kishi

    2012-01-01

    Skin graft is one of the most indispensable techniques in plastic surgery and dermatology. Skin grafts are used in a variety of clinical situations, such as traumatic wounds, defects after oncologic resection, burn reconstruction, scar contracture release, congenital skin deficiencies, hair restoration, vitiligo, and nipple-areola reconstruction. Skin grafts are generally avoided in the management of more complex wounds. Conditions with deep spaces and exposed bones normally require the use o...

  17. Erythema persists longer than one year in split-thickness skin graft donor sites

    Danielsen, Patricia L; Jorgensen, Lars N; Jørgensen, Bo; Karlsmark, Tonny; Ågren, Sven Per Magnus

    2013-01-01

    The recovery of skin function and appearance after harvest of split-thickness skin autografts is incompletely described. We followed the kinetics of skin restoration after a partial-thickness skin excision relative to adjacent normal skin over 12 months. Standardized donor site wounds were made on...... the thigh using a pneumatic dermatome in 19 consecutive Caucasian patients, median age 70 years, age range 44-86 years, who were undergoing skin graft surgery for leg ulcers. Transepidermal water loss (TEWL), erythema and pigmentation were measured quantitatively using non-invasive devices. The...

  18. Normal tissue tolerance to external beam radiation therapy: Skin; Dose de tolerance des tissus sains: la peau et les phaneres

    Ginot, A.; Doyen, J.; Hannoun-Levi, J.M.; Courdi, A. [Service d' oncologie-radiotherapie, centre Antoine-Lacassagne, 06 - Nice (France)

    2010-07-15

    Acute skin toxicity is frequent during radiation therapy and can lead to temporary arrest of the treatment. Chronic toxicity can occur and conduct to cosmetic problems. Alopecia is the most frequent toxicity concerning hair and is most of the time reversible. Several factors linked to patients influence skin toxicity, such as under-nutrition, old age, obesity, smoking, skin diseases, autoimmune diseases, failure of DNA reparation. Skin, hair and nail toxicities depend also on radiation schedule. Acute toxicity is greater when dose per fraction increases. Chronic and acute toxicities are more often when total dose increases. Under 45 Gy, the risk of severe skin toxicity is low, and begins above 50 Gy. Skin toxicity depends also on the duration of radiotherapy and split course schedules are associated with less toxicities. Irradiation surface seems to influence skin toxicity but interaction is more complex. Reirradiation is often feasible in case of cancer recurrence but with a risk of grade 3-4 toxicity above all in head and neck cancer. The benefit/risk ratio has to be always precisely evaluated. Permanent alopecia is correlated with the follicle dose. Modern techniques of radiation therapy allow to spare skin. (authors)

  19. Normal skin and hypertrophic scar fibroblasts differentially regulate collagen and fibronectin expression as well as mitochondrial membrane potential in response to basic fibroblast growth factor

    Rui Song

    2011-05-01

    Full Text Available Basic fibroblast growth factor (bFGF regulates skin wound healing; however, the underlying mechanism remains to be defined. In the present study, we determined the effects of bFGF on the regulation of cell growth as well as collagen and fibronectin expression in fibroblasts from normal human skin and from hypertrophic scars. We then explored the involvement of mitochondria in mediating bFGF-inducedeffects on the fibroblasts. We isolated and cultivated normal and hypertrophic scar fibroblasts from tissue biopsies of patients who underwent plastic surgery for repairing hypertrophic scars. The fibroblasts were then treated with different concentrations of bFGF (ranging from 0.1 to 1000 ng/mL. The growth of hypertrophic scar fibroblasts became slower with selective inhibition of type I collagen production after exposure to bFGF. However, type III collagen expression was affected in both normal and hypertrophic scar fibroblasts. Moreover, fibronectin expression in the normal fibroblasts was up-regulated after bFGF treatment. bFGF (1000 ng/mL also induced mitochondrial depolarization in hypertrophic scar fibroblasts (P < 0.01. The cellular ATP level decreased in hypertrophic scar fibroblasts (P < 0.05, while it increased in the normal fibroblasts following treatment with bFGF (P < 0.01. These data suggest that bFGF has differential effects and mechanisms on fibroblasts of the normal skin and hypertrophic scars, indicating that bFGF may play a role in the early phase of skin wound healing and post-burn scar formation.

  20. Tenskinmetric Evaluation of Surface Energy Changes in Adult Skin: Evidence from 834 Normal Subjects Monitored in Controlled Conditions

    Camilla Dal Bosco

    2014-03-01

    Full Text Available To evaluate the influence of the skin aging critical level on the adult skin epidermal functional state, an improved analytical method based on the skin surface energetic measurement (TVS modeling was developed. Tenskinmetric measurements were carried out non-invasively in controlled conditions by contact angle method using only a water-drop as reference standard liquid. Adult skin was monitored by TVS Observatory according to a specific and controlled thermal protocol (Camianta protocol in use at the interconnected “Mamma Margherita Terme spa” of Terme Euganee. From June to November 2013, the surface free energy and the epidermal hydration level of adult skin were evaluated on arrival of 265 male and 569 female adult volunteers (51–90 years of age and when they departed 2 weeks later. Sensitive measurements were carried out at 0.1 mN/m. High test compliance was obtained (93.2% of all guests. Very interesting results are obtained. The high sensitivity and discrimination power of tenskinmetry combined with a thermal Camianta protocol demonstrate the possibility to evaluate at baseline level the surface energetic changes and the skin reactivity which occurs on adult skin.

  1. Host-cell reactivation of UV-irradiated and chemically-treated herpes simplex virus-1 by xeroderma pigmentosum, xp heterozygotes and normal skin fibroblasts

    The host-cell reactivation of UV-irradiated and N-acetoxy-2-acetylamino-fluorene-treated herpes simplex virus type 1 strain MP was studied in normal and xeroderma pigmentosum human skin fibroblasts. Virus treated with either agent demonstrated lower survival in XP cells from complementation groups A, B, C and D than in normal fibroblasts. The relative reactivation ability of XP cells from the different genetic complementation groups was found to be the same for both irradiated and chemically treated virus. In addition, the inactivation kinetics for virus treated with either agent in the XP variant were comparable to that seen in normal skin fibroblasts. The addition of 2 or 4 mmoles caffeine to the post-infection assay medium had no effect on the inactivation kinetics of virus treated by either agent in the XP variant or in XP cells from the different genetic complementation groups. Treatment of the virus with nitrogen mustard resulted in equivalent survival in normal and XP genetic complementation group D cells. No apparent defect was observed in the ability of XP heterozygous skin fibroblasts to repair virus damaged with up to 100 μg N-acetoxy-2-acetylaminofluorene per ml. These findings indicate that the repair of UV-irradiated and N-acetoxy-2-acetylaminofluorene-treated virus is accomplished by the same pathway or different pathways sharing a common intermediate step and that the excision defect of XP cells plays little if any role in the reactivation of nitrogen mustard treated virus. (Auth.)

  2. Study of mast cell count in skin tags

    Zaher Hesham

    2007-01-01

    Full Text Available Background: Skin tags or acrochordons are common tumors of middle-aged and elderly subjects. They consist of loose fibrous tissue and occur mainly on the neck and major flexures as small, soft, pedunculated protrusions. Objectives: The aim was to compare the mast cells count in skin tags to adjacent normal skin in diabetic and nondiabetic participants in an attempt to elucidate the possible role of mast cells in the pathogenesis of skin tags. Participants and Methods: Thirty participants with skin tags were divided into group I (15 nondiabetic participants and group II (15 diabetic participants. Three biopsies were obtained from each participant: a large skin tag, a small skin tag and adjacent normal skin. Mast cell count from all the obtained sections was carried out, and the mast cell density was expressed as the average mast cell count/high power field (HPF. Results: A statistically significant increase in mast cells count in skin tags in comparison to normal skin was detected in group I and group II. There was no statistically significant difference between mast cell counts in skin tags of both the groups. Conclusion: Both the mast cell mediators and hyperinsulinemia are capable of inducing fibroblast proliferation and epidermal hyperplasia that are the main pathologic abnormalities seen in all types of skin tags. However, the presence of mast cells in all examined skin tags regardless of diabetes and obesity may point to the possible crucial role of mast cells in the etiogenesis of skin tags through its interaction with fibroblasts and keratinocytes.

  3. Host-cell reactivation of uv-irradiated and chemically treated Herpes simplex virus type 1 strain MP in normal and xeroderma pigmentosum skin fibroblasts

    The host-cell reactivation of UV-irradiated and N-acetoxy-2-acetylaminofluorene-treated herpes simplex virus type 1 strain mp was studied in normal human skin fibroblasts and xeroderma pigmentosum skin fibroblasts from XP genetic complementation groups A-D and in an XP variant. The increasing relative order for the host-cell reactivation of both types of damaged virus in the different complementation groups is A = D < B < C; XP variant = normal controls. XP complementation group D cells, which manifest the most severe inhibition of her ability for both UV-irradiated and N-acetoxy-2-acetylaminofluorene-treated virus, can reactivate nitrogen mustard treated HSV-1 mp to the same extent as normal cells. Together, these results indicate that (1) Excision repair of UV and N-acetoxy-2-acetylaminofluorene DNA damaged viruses share a common rate limiting enzymatic step and (2) The repair defect in xeroderma pigmentosum cells plays little or no role in the recovery of nitrogen mustard treated virus. The results of studies on the effect of caffeine on the survival of both UV- and N-acetoxy-2-acetylaminofluorene-treated virus in normal and XP cells imply that the reactivation of HSV-1 mp is mediated by an excision repair process with little if any recovery contributed by post-replication repair mechanisms. The host-cell reactivation of N-acetoxy-2-acetylaminofluorene-treated HSV-1 mp was also correlated with the defective UV-induced unscheduled DNA synthesis in two skin fibroblast strains established from a skin biopsy obtained from each of two juvenile females who had been clinically diagnosed as xeroderma pigmentosum. These findings are discussed in relation to the further characterization of the xeroderma pigmentosum phenotype and their possible utilization for the selection and isolation of new mammalian cell DNA repair mutants

  4. Hyperpigmentation of the skin associated with minocycline therapy

    Gordon, G.; Sparano, B.M.; Iatropoulos, M.J.

    1985-05-01

    Skin biopsy specimens and discolored fingernails from minocycline-treated patients were examined by light and electron microscopy, histochemistry, and energy-dispersive x-ray analysis. Both hyperpigmented and adjacent normally pigmented skin samples contained pigment-laden macrophages in the dermis, although these cells were more numerous in the hyperpigmented skin samples. Elemental analysis showed that both pigment deposits and stratum corneum of hyperpigmented skin samples contained iron and calcium. Discolored areas of fingernails from a minocycline-treated patient also contained iron and calcium. Both skin and nail discoloration were possibly due to the presence of an iron chelate of minocycline and/or quinoid derivatives of minocycline. The presence of iron-containing pigment in normal as well as hyperpigmented skin may have predisposed to formation of minocycline-associated pigment in these patients.

  5. Correlation between normal tissue complications and in vitro radiosensitivity of skin fibroblasts derived from radiotherapy patients treated for variety of tumors

    Purpose: To assess the relationship between fibroblast intrinsic radiosensitivity in vitro and late reactions of normal tissues in patients treated by definitive radiotherapy for variety of tumors. Patients and Methods: Ten patients were selected for this study. They were treated by radical radiotherapy for variety of tumors, including non-Hodgkin's lymphoma, prostate, glottic larynx, anal canal, cervix, bladder, thyroid gland, and tonsil pillar. Five patients did not develop any significant late reactions (normally sensitive group, NS). The other five developed late complications in different normal tissues and organs that proved to be fatal in one patient (clinically hyper-sensitive group, HS). Fibroblast cultures were established from punch skin biopsy and radiosensitivity in vitro was measured. The survival fraction at 2 Gy (SF2) was calculated and compared between the two groups. Results: SF2 ranged between 0.10 and 0.38 with a mean of 0.24. The mean SF2 for each of the NS and the HS groups were 0.31 and 0.17, respectively. The non-parametric rank test of Mann-Whitney shows that the difference between the two groups is statistically significant (p = 0.01). Conclusion: This study indicates that the in vitro radiosensitivity of skin fibroblasts is correlated with late complications in different organs and normal tissues following radiotherapy for variety of tumors. It also lends support to the existence of a common genetic component determining the radiosensitivity of cells targeted by the late effects of ionizing radiation. Key words:

  6. 毛细管电泳检测肺癌及癌旁正常组织蛋白质混合物差异%Capillary Electrophoresis Detection of Lung Cancer and Adjacent Normal Tissue Differences in Protein Mixture

    刘勇; 王荣; 高岚; 贾正平; 谢华; 张军莉; 马骏; 张爱梅; 谢希晖

    2011-01-01

    以建立的毛细管电泳(CE)-激光诱导荧光(LIF)检测蛋白质的方法对提取肺癌及癌旁正常组织蛋白质混合物(变性/活性)差异进行检测.采用异硫氰酸荧光素(FITC)为衍生剂,电泳缓冲液为1×TBE(TBE为Tris-硼酸-EDTA,变性电泳pH 10.0,活性电泳为pH 8.3且含有2 mg/L考马斯亮蓝),分离电压15 kV,柱温15℃,电动进样(10 kV×10 s),激发波长/发射波长=488/520 nm检测时,肺癌及癌旁正常组织蛋白质混合物样品得到较好分离且有明显差异.与目前常用蛋白分析方法:变性SDS-聚丙烯酰胺凝胶电泳(SDS-PAGE)以及活性蓝绿温和胶电泳(BN-PAGE)进行比较.BN-PAGE结果显示肺癌组织相比正常组织有较明显蛋白种类差异;SDS-PAGE结果表明一些蛋白质表达量差异也是肺癌及癌旁正常组织的显著差别,且主要集中在20~116 kDa.CE-LIF检测结果与PAGE结果大致相同,且CE-LIF检测蛋白质的灵敏度高于PAGE,能更准确反映肺癌及癌旁正常组织的蛋白质差异.结论是CE-LIF可用于蛋白质差异检测,时间短,效果较好,对活性蛋白质进行分析体现了其优点:可提供较强的动力--电压,及强动力下良好的温度稳定性.%Protein mixture (denatured and native) differences of extracted from lung cancer and adjacent normal tissue by established method of capillary electrophoresis (CE)-laser-induced fluorescence (LIF) detection of protein was detected using the fluorescein isothiocyanate (FITC) as a derivative agent. When detected by the 1 × TBE electrophoresis buffer solution (pH 10.0 of denaturing gel electrophoresis and pH 8.3of native gel electrophoresis containing 2 mg/L Coomassie brilliant blue), separation voltage of 15 kV, column temperature of 15 ℃, electric injection (10 kV × 10 s), and excitation wavelength/emission wavelength of 488/520 nm, lung cancer and adjacent normal tissue protein mixture samples obtained a better separation and there was significant difference

  7. Homogenizing the dose for adjacent fields

    Difficulties are found in radiotherapy in the determination of the gap which should be left among adjacent fields on the skin. In order to homogenize the dose at a given depth, measurements are done with a wood phantom using films, thermoluminescent dosemeters and ionization chambers. Field match is checked according to tables related in the literature and experimental data. Two tables of field separation are built at various depths, one for simultaneous adjacent fields and the other for non-simultaneous adjacent fields. Tables must be checked and the additional distances corrected for each field

  8. The myofibroblast markers α-SM actin and β-actin are differentially expressed in 2 and 3-D culture models of fibrotic and normal skin.

    Vozenin, M C; Lefaix, J L; Ridi, R; Biard, D S; Daburon, F; Martin, M

    1998-01-01

    To characterize the differences between fibrotic myofibroblasts and normal fibroblasts, we studied two differentiation markers: α-smooth muscle (SM) actin, a specific marker of myofibroblast differentiation, and β-actin, which is overexpressed in the fibrotic tissue. Experiments were performed on fibroblasts isolated from normal pig skin and on subcutaneous myofibroblasts isolated from pig radiation-induced fibrosis. Three culture models were used: cells in monolayers, equivalent dermis, consisting of fibroblasts embedded into a matrix composed of type I collagen, and in vitro reconstituted skin, in which the matrix and containing life fibroblasts were overlaid with keratinocytes. Samples were studied using immunofluorescence and western-blotting. In monolayers cultures, both fibrosis and normal cells expressed α-SM actin. Furthermore, similar amounts of β-actin protein were found. In these conditions, the resulting alterations in the phenotypes of cells made comparison of cultured fibrotic and normal cells irrelevant. Under the two 3-D culture models, normal fibroblasts no longer expressed α-SM actin. They expressed β-actin at the basal level. Moreover, the fibrotic myofibroblasts in both 3-D models retained their differentiation features, expressing α-SM actin and overexpressing β-actin. We found that this normalization was mainly related to the genomic programmation acquired by the cells in the tissue. Cellular motility and microenvironment were also involved, whereas cellular proliferation was not a major factor. Consequently, both three-dimensional models allowed the study of radiation-induced fibrosis in vitro, provided good extrapolations to in vivo conditions and avoided certain of culture artefacts. PMID:22359004

  9. Expression of Histo-Blood Group A Type 1, 2 and 3 Antigens in Normal Skin and Extramammary Paget’s Disease

    Tanaka, Aki; Kimura, Akihiko; Yamamoto, Yuki; Uede, Koji; Furukawa, Fukumi

    2008-01-01

    The distribution of histo-blood group A type 1, 2 and 3 antigens was investigated using immunohistochemistry in normal human skin and extramammary Paget’s disease (EMPD). We used monoclonal antibodies (mAbs) Bioclone-A (BA) and AR-1, which react with histo-blood group A type 1/2, and type 3 antigens, respectively. We found that A type 1, 2 and 3 antigens were expressed in the upper layer of the epidermis. We also found that the duct cells of the eccrine glands expressed A type 1/2 antigens an...

  10. A comprehensive two-dimensional gel protein database of noncultured unfractionated normal human epidermal keratinocytes: towards an integrated approach to the study of cell proliferation, differentiation and skin diseases

    Celis, J E; Madsen, Peder; Rasmussen, H H;

    1991-01-01

    207 known proteins in alphabetical order), "basal cell markers", "differentiation markers", "proteins highly up-regulated in psoriatic skin", "microsequenced proteins" and "human autoantigens". For reference, we have also included 2-D gel (isoelectric focusing) patterns of cultured normal and...

  11. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response

  12. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

    2014-11-14

    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

  13. Normal tissue response to low doses of radiotherapy assessed by molecular markers - A study of skin in patients treated for prostate cancer

    The aim of this study was to evaluate normal tissue response by molecular markers to multi fraction low doses of ionizing radiation, with the focus on changes in repopulation, estimated using Ki-67 as the proliferation marker, and on expressions of the p53 and p21 proteins, identified as key proteins in the DNA damage checkpoint. Repeated skin biopsies were taken from patients treated for prostate cancer with radiotherapy. The expressions of Ki-67, p53 and p21 of the keratinocytes in the basal cell layer of the epidermis were quantified immunohistochemically. The dose to the basal layer was 1.1 Gy per fraction, given five times per week for seven weeks. The indices of the three markers were determined over the whole period. A significant suppression of the Ki-67 index was observed during the first weeks, followed by a significant gradual increase in the Ki-67 index over the last weeks. The p53 and p21 protein levels were almost zero in the unirradiated skin. Upon irradiation, both the p53 and p21 index increased in a pattern very congruent to the Ki-67 index. In conclusion, daily fractions of about 1 Gy to the skin resulted in, for the keratinocytes in the basal layer, a cell growth arrest for a couple of weeks and a subsequent acceleration in repopulation during the following weeks of irradiation. The present findings also provided novel insights into the role of the p53/p21 pathway in the response of a normal epithelium to ionizing radiation as it is applied in radiotherapy

  14. Methylmalonic and propionic acidemias: lipid profiles of normal and affected human skin fibroblasts incubated with [1-14C]propionate

    Normal human skin fibroblasts and those from methylmalonic acidemia and propionic acidemia patients were grown in culture. Following incubation with [1-14C]propionate, the major lipid classes in the cells were separated by thin layer chromatography and isolated fractions analyzed by radio gas chromatography for the presence of odd-numbered long-chain fatty acids; the pattern of even-numbered long-chain fatty acids was obtained also. Normal fibroblasts incorporated a small percentage of propionate into odd-numbered fatty acids which were present in all lipids studied. The abnormal cells incorporated a larger amount while maintaining the characteristic ratios of odd-numbered fatty acids found in the normal line. Most of the radioactivity was associated with phospholipids which are the predominant constituents of cell membranes. A characteristic C15/C17 ratio was found for different phospholipids and the triglyceride fraction; pentadecanoic acid was the principal odd-numbered fatty acid utilized in the assembly of complex lipids. Compared to even-numbered long-chain fatty acids the absolute amount of odd-numbered fatty acids was low (1-2%), even in affected cells. An unusual polar lipid fraction was isolated in the course of the study. In the normal cell it contained several unlabeled eicosanoids which were missing from the same fraction of both affected cell lines

  15. Adjacent segment disease.

    Virk, Sohrab S; Niedermeier, Steven; Yu, Elizabeth; Khan, Safdar N

    2014-08-01

    EDUCATIONAL OBJECTIVES As a result of reading this article, physicians should be able to: 1. Understand the forces that predispose adjacent cervical segments to degeneration. 2. Understand the challenges of radiographic evaluation in the diagnosis of cervical and lumbar adjacent segment disease. 3. Describe the changes in biomechanical forces applied to adjacent segments of lumbar vertebrae with fusion. 4. Know the risk factors for adjacent segment disease in spinal fusion. Adjacent segment disease (ASD) is a broad term encompassing many complications of spinal fusion, including listhesis, instability, herniated nucleus pulposus, stenosis, hypertrophic facet arthritis, scoliosis, and vertebral compression fracture. The area of the cervical spine where most fusions occur (C3-C7) is adjacent to a highly mobile upper cervical region, and this contributes to the biomechanical stress put on the adjacent cervical segments postfusion. Studies have shown that after fusion surgery, there is increased load on adjacent segments. Definitive treatment of ASD is a topic of continuing research, but in general, treatment choices are dictated by patient age and degree of debilitation. Investigators have also studied the risk factors associated with spinal fusion that may predispose certain patients to ASD postfusion, and these data are invaluable for properly counseling patients considering spinal fusion surgery. Biomechanical studies have confirmed the added stress on adjacent segments in the cervical and lumbar spine. The diagnosis of cervical ASD is complicated given the imprecise correlation of radiographic and clinical findings. Although radiological and clinical diagnoses do not always correlate, radiographs and clinical examination dictate how a patient with prolonged pain is treated. Options for both cervical and lumbar spine ASD include fusion and/or decompression. Current studies are encouraging regarding the adoption of arthroplasty in spinal surgery, but more long

  16. Vibrotactile Presentation of Musical Notes to the Glabrous Skin for Adults with Normal Hearing or a Hearing Impairment: Thresholds, Dynamic Range and High-Frequency Perception

    Maté-Cid, Saúl; Fulford, Robert; Seiffert, Gary; Ginsborg, Jane

    2016-01-01

    Presentation of music as vibration to the skin has the potential to facilitate interaction between musicians with hearing impairments and other musicians during group performance. Vibrotactile thresholds have been determined to assess the potential for vibrotactile presentation of music to the glabrous skin of the fingertip, forefoot and heel. No significant differences were found between the thresholds for sinusoids representing notes between C1 and C6 when presented to the fingertip of participants with normal hearing and with a severe or profound hearing loss. For participants with normal hearing, thresholds for notes between C1 and C6 showed the characteristic U-shape curve for the fingertip, but not for the forefoot and heel. Compared to the fingertip, the forefoot had lower thresholds between C1 and C3, and the heel had lower thresholds between C1 and G2; this is attributed to spatial summation from the Pacinian receptors over the larger contactor area used for the forefoot and heel. Participants with normal hearing assessed the perception of high-frequency vibration using 1s sinusoids presented to the fingertip and were found to be more aware of transient vibration at the beginning and/or end of notes between G4 and C6 when stimuli were presented 10dB above threshold, rather than at threshold. An average of 94% of these participants reported feeling continuous vibration between G4 and G5 with stimuli presented 10dB above threshold. Based on the experimental findings and consideration of health effects relating to vibration exposure, a suitable range of notes for vibrotactile presentation of music is identified as being from C1 to G5. This is more limited than for human hearing but the fundamental frequencies of the human voice, and the notes played by many instruments, lie within it. However, the dynamic range might require compression to avoid the negative effects of amplitude on pitch perception. PMID:27191400

  17. In vitro radiosensitivity of skin fibroblasts can identify a group of radiotherapy patients having developed complications in a variety of normal tissues

    A retrospective study of the in vitro radiosensitivity of skin fibroblasts derived from two groups of patients treated by definitive radiotherapy for a variety of tumors who either displayed or did not display severe complications. Seven radiotherapy patients were selected: three treated for head and neck, prostate and non-Hodgkin lymphoma tumors, and did not develop any significant complications (control group); four patients were treated for bladder, thyroid, head and neck and anal canal tumors and developed serious acute and especially late reactions (hypersensitive group), Primary cell cultures of skin fibroblasts were established and their radiosensitivity studied by the clonogenic assay after exposing to single radiation doses ranging between 1 and 8 Gy. The survival fraction at 2 Gy (SF2) ranged from 0.27 to 0.38, with a mean of 0.33 for the control group, and from 0.10 to 0.20 with a mean of 0.17 for the hypersensitive group. The Mann-Whitney non-parametric test hypersensitive group. The Mann-Whitney non-parametric test showed that the difference between the two means was statistically significant (p = 0.03). The data are in favor of a correlation between the radiosensitivity of patients' fibroblasts and the reactions of different normal tissues to radiotherapy. This association supports the use of the clonogenic survival, or a surrogate test, as a predictive assay. The multiplicity of normal tissues and organs implicated in this association suggests the existence of genetic factors that determine, at least in part, the radiosensitivity of target cells involved in the expression of normal tissues complications following radiotherapy. (authors)

  18. Elemental analysis of tissue pellets for the differentiation of epidermal lesion and normal skin by laser-induced breakdown spectroscopy.

    Moon, Youngmin; Han, Jung Hyun; Shin, Sungho; Kim, Yong-Chul; Jeong, Sungho

    2016-05-01

    By laser induced breakdown spectroscopy (LIBS) analysis of epidermal lesion and dermis tissue pellets of hairless mouse, it is shown that Ca intensity in the epidermal lesion is higher than that in dermis, whereas Na and K intensities have an opposite tendency. It is demonstrated that epidermal lesion and normal dermis can be differentiated with high selectivity either by univariate or multivariate analysis of LIBS spectra with an intensity ratio difference by factor of 8 or classification accuracy over 0.995, respectively. PMID:27231610

  19. Investigation of Transcriptional Gene Profiling in Normal Murine Hair Follicular Substructures Using Next-Generation Sequencing to Provide Potential Insights Into Skin Disease.

    Lee, Jaein; Lee, Kang-In; Chung, Hyung Min

    2016-01-01

    Skin diseases, including hair-related diseases and neoplasia, are a major public health problem. While their prevalence is increasing, their treatment options are limited. Researchers have tried to investigate the genes and signal pathways underlying hair follicles (HFs) to develop genetically targeted therapies through microarrays, which represent an appropriate modality for the analysis of small genomes. To enable the comprehensive transcriptome analysis of large and/or complex transcriptomes, we performed RNA-seq using next-generation sequencing (NGS). We isolated interfollicular keratinocytes (IFKs), HFs, and dermal fibroblasts including dermal papilla cells (DFs-DPCs) from normal C57BL/6 murine skin, transplanted combinations of these samples into nude mice, and followed the mice over time. Sustained hair growth was supported by HFs and DFs-DPCs. We then investigated the pathways and the relevant gene ontology associated with any identified differentially expressed genes (DEGs). In addition, in the culture and flow cytometry (FCM), the HFs had a more quiescent cell cycle pattern than did the IFKs and DFs-DPCs. Therefore, the representative cell cycle-related gene expression of IFKs, HFs, and DFs-DPCs was analyzed by NGS. Our study will allow researchers to further investigate the potential interactions and signaling pathways that are active in HF-related diseases and cancer and may aid in future bioengineering applications. PMID:25995029

  20. Effect of treatment in fractionated schedules with the combination of x-irradiation and six cytotoxic drugs on the RIF-1 tumor and normal mouse skin

    RIF-1 tumors, implanted syngeneically in the gastrocnemius muscles of the right hind legs of C3H/Km mice, were treated either with X ray alone, drug alone, or drug and X ray combined. The drugs tested were bleomycin, BCNU, cis-diamminedichloro platinum, adriamycin, cyclophosphamide, and actinomycin-D. All drugs were administered either in the maximum tolerated dose or a dose that causes minimal tumor growth delay. Both drugs and X rays were administered either as a single dose or in five daily fractions. In addition to the single modality controls, seven different schedules of combined modalities were tested. Tumors were measured periodically after treatment in order that the day at which each tumor reached 4 times its initial cross-sectional area, i.e., its size at the time of treatment, could be determined. The effect of treatment on tumors was based upon excess growth delay (GD), i.e., T400% (treated)-T400% (untreated control). Treatment effects for the same combined modality schedules were also determined for normal skin, using the early skin reaction as an endpoint. Dose effect factors (DEF) were computed for all combined modality schedules and were based upon calculated radiation dose equivalents. We also calculated supra-additivity ratios, SR/sub I/ and SR/sub II/, therapeutic gain factors and adjusted therapeutic gain factors. The only drugs to produce significant supra-additivity with X rays were cis-Pt and cyclo

  1. Skin lesion KOH exam

    ... KOH exam is a test to diagnose a fungal infection of the skin . How the Test is Performed ... Performed This test is done to diagnose a fungal infection of the skin. Normal Results No fungus is ...

  2. Stages of Skin Cancer

    ... cells than in normal cells. For skin cancer, laser light is shined onto the skin and the drug becomes active and kills the cancer cells. Photodynamic therapy causes little damage to healthy tissue. Biologic therapy ...

  3. Skin Cancer Treatment

    ... cells than in normal cells. For skin cancer, laser light is shined onto the skin and the drug becomes active and kills the cancer cells. Photodynamic therapy causes little damage to healthy tissue. Biologic therapy ...

  4. Gordian adjacency for torus knots

    Feller, Peter

    2013-01-01

    A knot K is called Gordian adjacent to a knot L if there exists an unknotting sequence for L containing K. We provide a sufficient condition for Gordian adjacency of torus knots via the study of knots in the thickened torus. We also completely describe Gordian adjacency for torus knots of index 2 and 3 using Levine-Tristram signatures as obstructions to Gordian adjacency. Finally, Gordian adjacency for torus knots is compared to the notion of adjacency for plane curve singularities.

  5. EGF and EGFR expression during the formation and development of acute radiation-induced skin ulcers and their effects on ulcer healing: a comparative study with normal wound healing

    To study EGF and EGFR expression during the formation and development of radiation-induced skin ulcers and their effects on ulcer healing, a rat model which was locally irradiated with 60Co γ-rays was used, and another rat model of simple skin wounds was made as a control. Pathological changes were observed for 55d. Immuno-histochemistry in situ hybridization and image analysis were performed to detect EGF and EGFR expression in the tissue of radiation skin ulcers. Results: Skin ulcers were found on 14d after irradiation, and they were enlarged and deepened gradually during the observation period. In the irradiated skin, especially in the epidermal cells, fibroblasts and endothelial cells in the ulcer beds, the expression of EGF and EGFR was higher than that in normal skin. But their expression was obviously decreased in the radiation ulcer beds compared to that in the surgical wound beds. After irradiation, the decreased expression of EGF and EGFR may play an important role in the formation, development and nonhealing mechanism of radiation skin ulcers

  6. Expression of PDGF-B and PDGFR-β during the formation and development of acute radiation-induced skin ulcers and their effects on ulcer healing: a comparative study with normal wound healing

    Objective: To study the expression of PDGF-B and PDGFR-β during the formation and development of radiation-induced skin ulcers and their effects on ulcer healing. Methods: A rat model which was locally irradiated with 60Co γ-rays was used, and another rat model of surgical skin wounds was made. Pathological changes were observed for 55 days. Immunohistochemistry, in situ hybridization and image analysis were performed to detect PDGF-B and PDGFR-β expression in the tissue of radiation skin ulcers and surgical wounds. Results: Skin ulcers were found on day 14 after irradiation, and they were enlarged and deepened gradually during the observation period. In the irradiated skin, especially in the epidermal cells, fibroblasts and endothelial cells of the ulcer beds, the expressions of PDGF-B and PDGFR-β were higher than those in normal skin. But their expression were obviously decreased in the radiation ulcer beds compared to those in the surgical wound beds. Conclusion: After irradiation, the decreased expressions of PDGF-B and PDGFR-β may play an important role in the formation, development and nonhealing mechanism of radiation skin ulcers

  7. Effects of sulfate deprivation on the production of chondroitin/dermatan sulfate by cultures of skin fibroblasts from normal and diabetic individuals

    Human skin fibroblast monolayer cultures from two normal men, three Type I diabetic men, and one Type I diabetic woman were incubated with [3H]glucosamine in the presence of diminished concentrations of sulfate. Although total synthesis of [3H]chondroitin/dermatan glycosaminoglycans varied somewhat between cell lines, glycosaminoglycan production was not affected within any line when sulfate levels were decreased from 0.3 mM to 0.06 mM to 0.01 mM to 0 added sulfate. Lowering of sulfate concentrations resulted in diminished sulfation of chondroitin/dermatan in a progressive manner, so that overall sulfation dropped to as low as 19% for one of the lines. Sulfation of chondroitin to form chondroitin 4-sulfate and chondroitin 6-sulfate was progressively and equally affected by decreasing the sulfate concentration in the culture medium. However, sulfation to form dermatan sulfate was preserved to a greater degree, so that the relative proportion of dermatan sulfate to chondroitin sulfate increased. Essentially all the nonsulfated residues were susceptible to chondroitin AC lyase, indicating that little epimerization of glucuronic acid residues to iduronic acid had occurred in the absence of sulfation. These results confirm the previously described dependency of glucuronic/iduronic epimerization on sulfation, and indicate that sulfation of the iduronic acid-containing disaccharide residues of dermatan can take place with sulfate concentrations lower than those needed for 6-sulfation and 4-sulfation of the glucuronic acid-containing disaccharide residues of chondroitin. There were considerable differences among the six fibroblast lines in susceptibility to low sulfate medium and in the proportion of chondroitin 6-sulfate, chondroitin 4-sulfate, and dermatan sulfate. However, there was no pattern of differences between normals and diabetics

  8. Effects of sulfate deprivation on the production of chondroitin/dermatan sulfate by cultures of skin fibroblasts from normal and diabetic individuals

    Silbert, C.K.; Humphries, D.E.; Palmer, M.E.; Silbert, J.E. (Veterans Administration Outpatient Clinic, Boston, MA (USA))

    1991-02-15

    Human skin fibroblast monolayer cultures from two normal men, three Type I diabetic men, and one Type I diabetic woman were incubated with (3H)glucosamine in the presence of diminished concentrations of sulfate. Although total synthesis of (3H)chondroitin/dermatan glycosaminoglycans varied somewhat between cell lines, glycosaminoglycan production was not affected within any line when sulfate levels were decreased from 0.3 mM to 0.06 mM to 0.01 mM to 0 added sulfate. Lowering of sulfate concentrations resulted in diminished sulfation of chondroitin/dermatan in a progressive manner, so that overall sulfation dropped to as low as 19% for one of the lines. Sulfation of chondroitin to form chondroitin 4-sulfate and chondroitin 6-sulfate was progressively and equally affected by decreasing the sulfate concentration in the culture medium. However, sulfation to form dermatan sulfate was preserved to a greater degree, so that the relative proportion of dermatan sulfate to chondroitin sulfate increased. Essentially all the nonsulfated residues were susceptible to chondroitin AC lyase, indicating that little epimerization of glucuronic acid residues to iduronic acid had occurred in the absence of sulfation. These results confirm the previously described dependency of glucuronic/iduronic epimerization on sulfation, and indicate that sulfation of the iduronic acid-containing disaccharide residues of dermatan can take place with sulfate concentrations lower than those needed for 6-sulfation and 4-sulfation of the glucuronic acid-containing disaccharide residues of chondroitin. There were considerable differences among the six fibroblast lines in susceptibility to low sulfate medium and in the proportion of chondroitin 6-sulfate, chondroitin 4-sulfate, and dermatan sulfate. However, there was no pattern of differences between normals and diabetics.

  9. A screening of skin changes, with special emphasis on neurochemical marker antibody evaluation, in patients claiming to suffer from "screen dermatitis" as compared to normal healthy controls.

    Johansson, O; Hilliges, M; Han, S W

    1996-10-01

    In the present study, facial skin from so-called "screen dermatitis" patients were compared with corresponding material from normal healthy volunteers. The aim of the study was to evaluate possible markers to be used for future double-blind or blind provocation investigations. Differences were found for the biological markers calcitonin gene-related peptide (CGRP), somatostatin (SOM), vasoactive intestinal polypeptide (VIP), peptide histidine isoleucine amide (PHI), neuropeptide tyrosine (NPY), protein S-100 (S-100), neuron-specific enolase (NSE), protein gene product (PGP) 9.5 and phenylethanolamine N-methyltransferase (PNMT). The overall impression in the blind-coded material was such that it turned out easy to blindly separate the two groups from each other. However, no single marker was 100% able to pin-point the difference, although some were quite powerful in doing so (CGRP, SOM, S-100). However, it has to be pointed out that we cannot, based upon the present results, draw any definitive conclusions about the cause of the changes observed. Whether this is due to electric or magnetic fields, a surrounding airborne chemical, humidity, heating, stress factors, or something else, still remains an open question. Blind or double-blind provocations in a controlled environment are necessary to elucidate possible underlying causes for the changes reported in this investigation. PMID:8981027

  10. Skin graft

    Skin transplant; Skin autografting; FTSG; STSG; Split thickness skin graft; Full thickness skin graft ... site. Most people who are having a skin graft have a split-thickness skin graft. This takes ...

  11. Skin perfusion pressure measured with a photo sensor in an air-filled plastic balloon: validity and reproducibility on the lower leg in normal subjects and patients suspected of obliterative arterial disease

    An inflatable small plastic bag including a photo sensor was constructed for measurement of skin perfusion pressure avoiding the rim of the photo sensor over bony and tendineous surfaces of the tibia below the knee, at the ankle, and on the dorsal forefoot. Compression was obtained using a conical blood pressure cuff with continuous decrease from suprasystolic arm pressure. The validity of skin perfusion pressure with the new device was compared to that of isotope washout below the knee in normal subjects and in patients with an ischemic forefoot with acceptable agreement. The method had a high reproducibility within and between days in normal subjects. Compared to systolic arterial pressure measured using a strain gauge with a cuff on the ankle in normal subjects and patients with intermittent claudication the new device showed blood pressure in the skin closer to the diastolic pressure. The new pressure device thus had acceptable validity and reproducibility for estimation of the skin perfusion pressure and can be used on bony and tendineous sites on the lower limb in regions where critical wound healing is frequent, e.g. ankle and forefoot

  12. Presence of non-fibrillar amyloid beta protein in skin biopsies of Alzheimer's disease (AD), Down's syndrome and non-AD normal persons

    Wen, G Y; Wisniewski, H M; Blondal, H;

    1994-01-01

    A total of 66 skin biopsies from persons with Alzheimer's disease (AD) or Down's syndrome (DS) and from persons without AD were used in this study. The age range was from 7 to 89 years. Positive immunoreactivity of skin biopsies to monoclonal antibody 4G8, which is reactive to amino acid residue 17...

  13. Determination of minimal erythema dose of normal skin to ultraviolet rays%正常人紫外线最小红斑量的测定与分析

    叶聪秀; 万苗坚; 易金铃; 尹颂超; 李美荣; 赖维

    2013-01-01

    目的 探讨广州地区正常人紫外线最小红斑量(MED)的范围及其与性别、年龄、皮肤光生物学分型、季节和在广州地区生活时间长短的关系.方法 以GS2004型日光紫外模拟系统为光源,测定621例健康志愿者背部正常皮肤的MED值,在照射后(24±2)h由两位经验丰富的观察者同时评定.结果 621例受试者的MED均值为(1170.2±333.2)mJ/cm2,男性MED均值为(1132.8±339.4) mJ/cm2,女性MED均值为(1182.1±330.7) mJ/cm2,两者之间差异无统计学意义(P=0.20);30~50岁年龄组的MED值(1014.7±359.7)mJ/cm2,显著低于20~29岁年龄组(1222.9±304.3) mJ/cm2和50岁以上年龄组(1179.0±374.3) mJ/cm2的MED值(P<0.01);Ⅱ型光生物学皮肤MED值(673.5±228.3) mJ/cm2,显著低于Ⅲ型(1224.3±254.2) mJ/cm2和Ⅳ型皮肤(1363.1±278.5) mJ/cm2的MED值(P<0.01);不同季节测定的MED值差异有统计学意义(P<0.01),春季(969.2±355.8) mJ/cm2最低,夏季(969.24±355.8) mJ/cm2次之,但是秋季与冬季之间则差异无统计学意义(P>0.05);在广州地区生活5~10年组的MED值(1104.9±377.7) mJ/cm2,显著低于1~4年组和10年以上组(P<0.0l).结论 广州地区正常人紫外线MED值范围与中国其他地区正常人MEI)值有一定差异,陈与性别无明显关系外,与年龄、皮肤光生物学分型、季节和在广州地区生活时间长短均有关.%Objective To investigate the minimal erythema does (MED) of normal skin to UV in Guangzhou city,and to observe its relationship to sex,age,skin type,seasons and the years lived in Guangzhou.Methods 621 healthy subjects were exposed to Solar Simulator (GS2004) and the MED was measured and observed by two professional technicians after (24±2) hours.Results The average MED value of all subjects was (1170.2±333.2) mJ/cm2.In male and female group,the average MED values were (1132.8-339.4) mJ/cm2 and (1182.1 ± 330.7) mJ/cm2,respectively,and there was no significant difference between male and

  14. An elastic second skin

    Yu, Betty; Kang, Soo-Young; Akthakul, Ariya; Ramadurai, Nithin; Pilkenton, Morgan; Patel, Alpesh; Nashat, Amir; Anderson, Daniel G.; Sakamoto, Fernanda H.; Gilchrest, Barbara A.; Anderson, R. Rox; Langer, Robert

    2016-08-01

    We report the synthesis and application of an elastic, wearable crosslinked polymer layer (XPL) that mimics the properties of normal, youthful skin. XPL is made of a tunable polysiloxane-based material that can be engineered with specific elasticity, contractility, adhesion, tensile strength and occlusivity. XPL can be topically applied, rapidly curing at the skin interface without the need for heat- or light-mediated activation. In a pilot human study, we examined the performance of a prototype XPL that has a tensile modulus matching normal skin responses at low strain (skin barrier function, pharmaceutical delivery and wound dressings.

  15. Sun’s effect on skin

    The skin uses sunlight to help manufacture vitamin D, which is important for normal bone formation. But sometimes its ultraviolet light can be ... the pigment melanin. Melanin protects skin from the sun's ultraviolet rays, which can burn the skin, and ...

  16. Skin Diseases: Skin Health and Skin Diseases

    ... threatening skin cancer. The "ABCD's" of what to watch for with the moles on your skin: Asymmetry : ... skin cancer has been increasing. Exposure to the sun is a major factor. In 2006, over 30 ...

  17. Artificial skin. Jinko hifu

    Kifune, K. (Unitika Ltd., Osaka (Japan))

    1993-06-15

    In order to restore the human skin wounds, the transplantation is only one measure. The transplantation can take only when own skin is used, and there is no successful example by using other person's skin. When the own skin is not sufficient due to the too vast damage, the artificial skin, which can be regenerated as it is, is required. The artificial skin is said to be the most difficult organ among the artificial organs, even though its function is quite simple. Although there are the pig skin, the collagen membrane and the synthetic materials such as the polyurethane and so forth, as the materials similar to the artificial skin, they cover the wounds just until the cuticle is formed. Recently there is a cultivated skin. Firstly the normal skin with a size of the stamp is cut off, and then the cuticle cells are taken to pieces and cultivated, and consequently it is possible to increase the area by several 10 times. In addition, there is also a trial to make the artificial skin synthetically. Its upper layer is composed of the silicon, and the lower layer is the collagen membrane with a sponge structure. The silicon, membrane can be said to be an ideal artificial skin, because it detaches naturally. The chitin, which has recently appeared as the wound protection material, is also the promising material. 3 figs.

  18. Immunohistochemistry of porcine skin.

    Wollina, U; Berger, U; Mahrle, G

    1991-01-01

    The present paper reports immunohistological findings in porcine skin, which were obtained by use of mono- and polyclonal antihuman antibodies and either alkaline phosphatase anti-alkaline phosphatase (APAAP) or peroxidase (POX) technique. Epidermal staining was observed with antibodies to keratins (K 8.12, RSKE 60), filaggrin, and calmodulin (ACAM). Staining of connective tissue and vessels was achieved using antibodies to vimentin (V9(1)), collagen type IV, and fibronectin. In general, these antibodies gave a staining pattern similar to that of normal human skin. The similarities of immunoreactivity to poly- and monoclonal antihuman antibodies in porcine and human skin render porcine skin a reliable model in biomedical research. PMID:1710864

  19. Comparative potency of formulations of mometasone furoate in terms of inhibition of ′PIRHR′ in the forearm skin of normal human subjects measured with laser doppler velocimetry

    Kulhalli Prabhakar

    2005-01-01

    Full Text Available BACKGROUND AND AIMS: Topical glucocorticoid formulations are widely used for effective treatment and control of a variety of dermatoses. Mometasone furoate is a newer corticoid that has high potency but low systemic toxicity. Pharmaceutical factors are known to significantly influence potency and systemic absorption of topically applied glucocorticoids. We studied the potency of "Elocon", a topical formulation of mometasone furoate, compared with two other branded formulations of the same corticoid. METHODS: Corticoid potency was measured by employing a pharmacodynamic parameter of an inhibitory effect of the corticoid on post-ischemic-reactive-hyperemic-response (PIRHR in human forearm skin under occlusive dressing. The PIRHR was expressed in terms of % increase in the skin blood flow (SBF as measured with laser doppler velocimetry (LDV. RESULTS : All three active branded formulations of mometasone furoate produced significant inhibition of PIRHR. The AUC(0-2min of PIRHR was ( Mean ± SEM , Control = 213.52 ± 11.80, Placebo = 209.77 ± 19.31, Formulation A = 119.83 ± 13.71, Formulation C = 53.67 ± 4.85 and Formulation D = 111.46 ± 22.87. Formulation "C" exhibited significantly higher topical anti-inflammatory potency than formulations "A" or "D". CONCLUSIONS: Thus, branded formulations of the same glucocorticoid, mometasone furoate significantly differed in their topical anti-inflammatory potency. "Elocon" was significantly more potent than the two other branded formulations studied.

  20. Aging Skin

    ... email address Submit Home > Healthy Aging > Wellness Healthy Aging Aging skin More information on aging skin When it ... treated early. Return to top More information on Aging skin Read more from womenshealth.gov Varicose Veins ...

  1. Skin Conditions

    Your skin is your body's largest organ. It covers and protects your body. Your skin Holds body fluids in, preventing dehydration Keeps harmful ... it Anything that irritates, clogs, or inflames your skin can cause symptoms such as redness, swelling, burning, ...

  2. Cytotoxic and mutagenic effects of carcinogenic aromatic amides and polycyclic hydrocarbons and ultraviolet irradiation in normally repairing and repair-deficient (xeroderma pigmentosum) diploid human skin fibroblasts

    The cloning ability of fibroblasts taken from a xeroderma pigmentosum patient proved 2.5 to 3.5 times more sensitive to the cytotoxic effect of active derivatives of carcinogens or to uv irradiation than that of normal cells. They also exhibited a corresponding 2.5- to 3.5-fold greater increase in the frequency of induced mutations to 8-azaguanine resistance per survivor, which might have been expected since these XP cells exhibit less than 20 percent of the DNA-repairing capacity of the normal cells following exposure to such DNA-damaging agents

  3. A Validated Questionnaire for Quantifying Skin Oiliness

    Leslie S. Baumann; Randall D. Penfield; Clarke, Jennifer L.; Deysi K. Duque

    2014-01-01

    Increased sebum production is a common skin complaint and plays an important role in acne and oily scalp conditions. To choose the correct skin care products, which mostly are marketed for dry, oily or normal skin, the consumer must self-assess their skin type. Studies show that individuals incorrectly self-assess their sebum secretion levels. In order to be able to correctly determine skin oiliness, we have developed a six-item skin oiliness scale (SOS) that correlates...

  4. 中国首例可视化人体与正常人腰神经根的椎间行程及其毗邻关系%Intervertebral route of lumbar nerve root in relation to adjacent tissues in the first Chinese visible human and normal human

    游箭; 张绍祥; 邱明国; 李七渝; 陈伟; 陆明

    2005-01-01

    disk herniation recently. Posterior lateral route is often employed. Puncture route was investigated by the application of anatomic methods previously. However, there are relative fewer reports regarding the observation of the route of lumbar nerve root in intervertebral plane and triangle working area from thin section anatomy and CT section anatomy.OBJECTIVE: To clarify the intervertebral route and its adjacent relationship of lumbar nerve root on thin section and CT section to provide a anatomic gist for puncture route in PLDD.DESIGN: An observational study based on corpus and normal individual.SETTING: Department of radiology of a military medical university of Chinese PLA affiliated hospital and the department of anatomy of a military medical university of Chinese PLA.PARTICIPANTS: The collection of the first Chinese visible human was completed in the Department of Anatomy(laboratory of computer medicine) the Faculty of Medicine, Third Military Medical University of Chinese PLA in October 2002. Totally 53 subjects without confirmed vertebral and intervertebral disc diseases and other diseases of the adjacent organs received CT examination and measurement in the Department of Radiology of the Third Military Medical University of Chinese PLA Affiliated Southwest Hospital between january and March 2000.INTERVENTIONS: The intervertebral route of lumbar nerve root in the first Chinese visible human was observed descriptively. The route, morphology, size, adjacent structure, and the distance between puncture line and lumbar nerve in 53 normal individuals were observed and measured by CT.MAIN OUTCOME MEASURES: To describe the intervertebral route of lumbar nerve root in the first CVH and normal individual, to measure the intervertebral length and width of lumbar nerve, and the distance between puncture line and lumbar nerve.RESULTS: The first Chinese visible human lumbar has 48 layers of intervertebral space with a thickness of each layer of 1.0 mm. The route and

  5. 正常耳外耳轮到乳突距离的测量与分析%Measurement of the Distance from Helix to Mastoid Skin in Normal Ears

    唐新杰; 许枫; 孙楠; 张如鸿; 张群

    2015-01-01

    目的:为了使再造耳的颅耳角更稳定和更对称,测量正常耳外耳轮到乳突的距离并加以分析。方法选取100个正常耳分别测量耳上、中、下3点到乳突的距离并分析。同时选取5例正常耳进行三维测量。结果正常耳上、中、下3点到乳突的距离分别是(1.41±0.18) cm、(1.98±0.26) cm和(1.66±0.26) cm。通过以上数据分析,外耳轮到乳突的垂直距离的最远点在中间点,与1968年McDowell报道的外耳轮到乳突距离最远点在下1/3不符。三维测量结果与上述结果相符。结论国人外耳轮到乳突的距离,距离最大的点在中间点,应在此基础上定制二期耳支撑材料的形态与高度。%Objective To measure the distance from helix to mastoid skin, in order to achieve an acceptable projection of the ear and be symmetrical with the normal contralateral ear if present. Methods The distance from the upper, middle, and lower third of helix to mastoid skin of 100 healthy normal ears were measured. Meanwhile three-dimensional measurement models were made in 5 normal ears. Results The distance from helix to mastoid skin were (1.41±0.18) cm in upper third, (1.98± 0.26) cm in mid-portion and (1.66±0.26) cm in lower third. It was interesting that the distance from helix to mastoid skin of mid-dle third was higher than that of upper and lower third in Chinese population, not in accordance with McDowell's standard, in which the distance of lower third was higher than that of upper and middle. The software analysis result of the 5 3-dimensional measurement models was in accordance with manually measurements above. Conclusion In normal ears, the distance from the middle third of helix to mastoid skin is higher than that of upper and lower third in Chinese population, the shape and height of support material in the second stage of ear reconstruction should be made based on the above measurements.

  6. Potentiation by caffeine of x-ray damage to cultured human skin fibroblasts from normal subjects and ataxia-telangiectasia patients

    Caffeine was found to potentiate x-ray-induced killing of human diploid fibroblasts from a normal subject and an ataxia-telangiectasia (AT) patient when it was present at 2 mM concentration for 30 to 66 h postirradiation. The dose-modifying factor for caffeine-treated normal cells had an average value of 1.26 +- 0.13 which did not vary significantly with treatment time or x-ray dose. The dose-modifying factor for caffeine-treated AT cells was 1.12 +- 0.12 at 30 h, rose to 1.66 +- 0.17 at 41 h, and decreased to 1.31 +- 0.13 at 66 h. Thus no clear difference was observed between these two cell strains' susceptibility to postirradiation caffeine treatment

  7. The potentiation by caffeine of X-ray damage to cultured human skin fibroblasts from normal subjects and ataxia-telangiectasia patients

    Caffeine was found to potentiate X-ray-induced killing of human diploid fibroblasts from a normal subject and an ataxia-telangiectasia (AT) patient when it was present at 2 mM concentration for 30 to 66 hr postirradiation. The dose-modifying factor for caffeine-treated normal cells had an average value of 1.26 +/- 0.13 which did not vary significantly with treatment time or X-ray dose. The dose-modifying factor for caffeine-treated AT cells was 1.12 +/- 0.12 at 30 hr, rose to 1.66 +/- 0.17 at 41 hr, and decreased to 1.31 +/- 0.13 at 66 hr. Thus no clear difference was observed between these two cell strains' susceptibility to postirradiation caffeine treatment

  8. Effect of Equal Daily Doses Achieved by Different Power Densities of Low-Level Laser Therapy at 635 nm on Open Skin Wound Healing in Normal and Diabetic Rats

    Róbert Kilík

    2014-01-01

    Full Text Available Background and Objective. Despite the fact that the molecular mechanism of low-level laser therapy (LLLT is not yet known, the exploitation of phototherapy in clinical medicine and surgery is of great interest. The present study investigates the effects of LLLT on open skin wound healing in normal and diabetic rats. Materials and Methods. Four round full-thickness skin wounds on dorsum were performed in male adult nondiabetic (n=24 and diabetic (n=24 Sprague–Dawley rats. AlGaInP (635 nm, wavelength; 5 J/cm2, daily dose was used to deliver power densities of 1, 5, and 15 mW/cm2 three times daily until euthanasia. Results. PMNL infiltration was lower in the irradiated groups (15 mW/cm2. The synthesis and organisation of collagen fibres were consecutively enhanced in the 5 mW/cm2 and 15 mW/cm2 groups compared to the others in nondiabetic rats. In the diabetic group the only significant difference was recorded in the ratio PMNL/Ma at 15 mW/cm2. A significant difference in the number of newly formed capillaries in the irradiated group (5, 15 mW/cm2 was recorded on day six after injury compared to the control group. Conclusion. LLLT confers a protective effect against excessive inflammatory tissue response; it stimulates neovascularization and the early formation of collagen fibres.

  9. Sagging Skin

    ... turkey neck,” this occurs as skin loses its elasticity and in cases where individuals have lost a ... technique or procedure is appropriate for my skin type? Did the doctor show me before-and-after ...

  10. Skin Dictionary

    ... resources Meet our partners Español Donate Diseases and treatments Acne and rosacea Bumps and growths Color problems Contagious skin diseases Cosmetic treatments Dry / sweaty skin Eczema / dermatitis Hair and scalp ...

  11. Skin turgor

    ... up during a check. This can indicate severe dehydration that needs quick treatment. You have reduced skin turgor and are unable ... Urinalysis Intravenous fluids may be needed for severe ... treat other conditions that affect skin turgor and elasticity.

  12. Skin Cancer

    Skin cancer is the most common form of cancer in the United States. The two most common types ... face, neck, hands, and arms. Another type of skin cancer, melanoma, is more dangerous but less common. Anyone ...

  13. SKIN CANCER

    Made Putri Hendaria

    2013-03-01

    Full Text Available Skin is an organ which protect the human body from the environment. It was build by milion cells. According to the changes in human lifestyle which tends to unhealthy life, increasing ultraviolet radiation, toxins, and genetics makes the cells who build the skin do the abnormal growth being cancer cells. Classification of skin cancer is according the most common three types, they are Basal Cell Carcinoma, Squamous Cell Carcinoma, and Malignant Melanoma. More than 3,5 milion skin cancer cases was happened in United States, which makes it become the most common cancer type in that country. Skin cancer diagnosis is build from anamnesis, physic examination about skin eufloressence, using dermoscopy, and histopatologic examination as the gold standar. Therapy for skin cancer is classified to surgery and non surgery therapy and its prognostic is depend to the types of the skin cancer itself.

  14. Skin Aging

    ... too. Sunlight is a major cause of skin aging. You can protect yourself by staying out of ... person has smoked. Many products claim to revitalize aging skin or reduce wrinkles, but the Food and ...

  15. Skin Biopsy

    ... skin condition cannot be diagnosed by the patient's history and what the physician finds on examination alone. Confirming a clinical diagnosis may also be necessary prior to starting therapy. Skin biopsy types are as follows: Shave biopsies Punch biopsies ...

  16. Structure and Function of Your Skin

    ... Favorite Name: Category: Share: Yes No, Keep Private Structure & Function of Your Skin Share | What It Looks Like . . . Skin is a waterproof, flexible, but tough protective covering for your body. Normally the ...

  17. Treatment Options for Nonmelanoma Skin Cancer

    ... cells than in normal cells. For skin cancer, laser light is shined onto the skin and the drug becomes active and kills the cancer cells. Photodynamic therapy causes little damage to healthy tissue. Biologic therapy ...

  18. Cytokines and the Skin Barrier

    Jens Malte Baron

    2013-03-01

    Full Text Available The skin is the largest organ of the human body and builds a barrier to protect us from the harmful environment and also from unregulated loss of water. Keratinocytes form the skin barrier by undergoing a highly complex differentiation process that involves changing their morphology and structural integrity, a process referred to as cornification. Alterations in the epidermal cornification process affect the formation of the skin barrier. Typically, this results in a disturbed barrier, which allows the entry of substances into the skin that are immunologically reactive. This contributes to and promotes inflammatory processes in the skin but also affects other organs. In many common skin diseases, including atopic dermatitis and psoriasis, a defect in the formation of the skin barrier is observed. In these diseases the cytokine composition within the skin is different compared to normal human skin. This is the result of resident skin cells that produce cytokines, but also because additional immune cells are recruited. Many of the cytokines found in defective skin are able to influence various processes of differentiation and cornification. Here we summarize the current knowledge on cytokines and their functions in healthy skin and their contributions to inflammatory skin diseases.

  19. SKIN CANCER

    Made Putri Hendaria; AAGN Asmarajaya; Sri Maliawan

    2013-01-01

    Skin is an organ which protect the human body from the environment. It was build by milion cells. According to the changes in human lifestyle which tends to unhealthy life, increasing ultraviolet radiation, toxins, and genetics makes the cells who build the skin do the abnormal growth being cancer cells. Classification of skin cancer is according the most common three types, they are Basal Cell Carcinoma, Squamous Cell Carcinoma, and Malignant Melanoma. More than 3,5 milion skin cancer cases ...

  20. Skin graft

    ... caused a large amount of skin loss Burns Cosmetic reasons or reconstructive surgeries where there has been skin damage or skin ... anesthesia are: Reactions to medicines Problems with breathing Risks for this surgery are: Bleeding Chronic pain (rarely) Infection Loss of ...

  1. Skin Aging

    Your skin changes as you age. You might notice wrinkles, age spots and dryness. Your skin also becomes thinner and loses fat, making it ... heal, too. Sunlight is a major cause of skin aging. You can protect yourself by staying out ...

  2. Warfarin-Induced Skin Necrosis

    Kakagia, Despoina D.; Papanas, Nikolaos; Karadimas, Efthimios; Polychronidis, Alexandros

    2014-01-01

    Warfarin-induced skin necrosis is an infrequent complication occurring in individuals under warfarin treatment who have a thrombophilic history or after administration of large loading doses of warfarin particularly without simultaneous initial use of heparin. A 62-year-old lady developed skin necrosis 4 days after initiating warfarin therapy of 5 mg daily without initial co-administration of heparin. The patient had a normal clotting profile. Skin necrosis progressed to eschar formation afte...

  3. Determination of minimal erythema does of normal skin to ultraviolet rays among 621 healthy volunteers%广州地区正常人紫外线最小红斑量的测定

    叶聪秀; 万苗坚; 易金玲; 赖维

    2012-01-01

    目的:探讨广州地区正常人紫外线最小红斑量(minimal erythema does,MED)的范围及其与性别的关系.方法:以GS2004型日光紫外模拟系统为光源,测定330名健康志愿者背部正常皮肤的MED值.结果:330名受试者的MED均值为(1176.1±322.90)mJ/cm2,男性MED均值为(1132.8±339.38)mJ/cm2,女性MED均值为(1212.2±304.76)mJ/cm2,两者之间无统计学差异(P=0.12); Ⅱ型皮肤男性MED值显著低于女性(P=0.02);大于30岁男性MED值显著低于女性(P<0.05).结论:广州地区正常人紫外线MED值范围与中国其他地区正常人MED值有一定差异,其与性别关系不能笼统地分析,必须考虑年龄及皮肤光生物学分型的影响.%Objective To investigate the minimal erythema does (MED) of normal skin to UV in Guangzhou city, and observe its relationship to sex. Methods 330 healthy subjects were exposed to Solar Simulator (GS2004), and the MED was measured. Results The average MED value of all subjects was (1176.1 ±322.90) mJ/cm2. In male and female group, the average MED value were (1132.8±339.38) mJ/cm2 and (1212.2±304.76)mJ/cm2 respectively, and there was no significant difference between male and female (P =0.12). However, the male MED value in skin type II was significantly lower than those in female (P=0.02) ,and the male MED value in subjects aged over 30 was significantly lower than those in female (P<0.05). Conclusion The MED value of the subjects in Guangzhou was quite different from other cities according to the previous reports and related to gender while considering the skin types and age.

  4. Skin Picking Disorder

    Pinar Cetinay Aydin

    2014-08-01

    Full Text Available Skin picking disorder is not a dermatological disorder and it is a table characterized with picking skin excessively and repetitively, leading to damage in skin tissue. Unlike normal picking behaviour, psychogenic skin picking is repetitive and it can lead to severe damage in the skin and even complications which constitute vital danger. While some patients define frequent but short lasting picking attacks, others define rarer attacks which last a few hours. Skin picking disorder, which is not included in the classification systems up to DSM-5 as a separate diagnosis category, is included as an independent diagnosis in Obsessive Compulsive Disorder and Associated Disorders category in DSM-5. In case reports, open label studies and double blind studies selective serotonin reuptake inhibitors are shown to be effective in the treatment of skin picking disorder. Mostly, cognitive-behaviourial techniques are used and have been proven to be useful in psychotherapy. Habit reversal is one of the behaviourial techniques which are frequently applied, give positive results in which well-being state can be maintained. [Psikiyatride Guncel Yaklasimlar - Current Approaches in Psychiatry 2014; 6(4.000: 401-428

  5. Effect of normal human skin-derived mesenchymal stem cells on HaCaT cell proliferation%健康人皮肤间充质干细胞对HaCaT细胞增殖作用的研究

    王建华; 张开明; 刘瑞风; 甄莉

    2015-01-01

    Objective To investigate the effect of normal human skin-mesenchymal stem cells (S-MSCs) on HaCaT cell proliferation, so as to provide a theoretical basis for the role of S-MSCs in pathologic status. Methods Twenty cases of normal skin were harvested from surgically removed fresh redundant skin by courtesy of cosmetics and urology departments in our hospital. Under sterile conditions, the epidermal and dermal layers were separated, and the dermal MSCs were isolated and cultured. Flow cytometry was used to identify the MSCs and the multi-direc-tional differentiation and differentiated cells. The fifth passage of S-MSCs was co-cultured with HaCaT cells, and com-pared with the naturally proliferating S-MSCs. Real-time cell analysis system was employed to examine the HaCaT cell proliferation. At 72h after culture, the number of HaCaT cells was observed by cell counting. Results Under inverted phase contrast microscope, the normal human S-MSCs was slender and spindle cells with high expression of surface antigens CD29, CD44, CD73, CD90, and CD105, and negative expression of CD34, CD45 and HLA-DR. The S-MSCs could be induced to differentiate into adipocytes, osteoblasts and chondroblasts. The number of naturally cultured Ha-CaT cells was (2.74±0.36)×105, compared with (2.24±0.28)×105 for the number of HaCaT cells co-cultured with normal human S-MSCs. The difference was statistically significant (P<0.001). Conclusion Normal human skin-derived MSCs could inhibit the proliferation of HaCaT cells in vitro.%目的:探讨健康人皮肤间充质干细胞(S-MSCs)对HaCaT细胞增殖的作用,为研究S-MSCs在病理状态下的作用提供理论依据。方法健康人皮肤20份,均取自我院整形和泌尿外科手术切除的多余新鲜皮肤组织。在体外无菌条件下进行真表皮分离、培养真皮MSCs,流式细胞术进行细胞鉴定,多向诱导分化及分化细胞的鉴定,将培养至第5代的S-MSCs与HaCaT细胞共培养,并与

  6. Curious Skin

    Angel, G.

    2010-01-01

    Some of Henry Wellcome’s collection of tattoos on human skin will be on display in our forthcoming Skin exhibition. But how did the Parisian doctor from whom they were acquired come by his macabre collection of tattoos in the first place, and what did they mean to those whose skin they were on? It’s Gemma Angel‘s job to find out…

  7. Optical coherence tomography for imaging of skin and skin diseases

    Mogensen, Mette; Thrane, Lars; Jørgensen, Thomas Martini;

    2009-01-01

    , as have many diseases. The method can provide accurate measures of epidermal and nail changes in normal tissue. Skin cancer and other tumors, as well as inflammatory diseases, have been studied and good agreement found between OCT images and histopathological architecture. OCT also allows noninvasive......Optical coherence tomography (OCT) is an emerging imaging technology based on light reflection. It provides real-time images with up to 2-mm penetration into the skin and a resolution of approximately 10 μm. It is routinely used in ophthalmology. The normal skin and its appendages have been studied...... monitoring of morphologic changes in skin diseases and may have a particular role in the monitoring of medical treatment of nonmelanoma skin cancer. The technology is however still evolving and continued technological development will necessitate an ongoing evaluation of its diagnostic accuracy. Several...

  8. Sun’s effect on skin

    The skin uses sunlight to help manufacture vitamin D, which is important for normal bone formation. But sometimes its ultraviolet light can be ... the pigment melanin. Melanin protects skin from the sun’s ultraviolet rays, which can burn the skin, and ...

  9. EFSA Panel on Dietetic Products, Nutrition and Allergies (NDA); Scientific Opinion on the substantiation of health claims related to astaxanthin and protection of the skin from UV-induced damage (ID 1687, 1979), defence against Helicobacter pylori (ID 1686), contribution to normal spermatogenesis, (ID 1688), contribution to normal muscle function (ID 1685), and “immune system” (ID 1689, 1919, 1980) pursuant to Article 13(1) of Regulation (EC) No 1924/2006

    Tetens, Inge

    claims in relation to astaxanthin and protection of the skin from UV-induced damage, defence against Helicobacter pylori, contribution to normal spermatogenesis, contribution to normal muscle function, and “immune system”. The scientific substantiation is based on the information provided by the Member......Following a request from the European Commission, the Panel on Dietetic Products, Nutrition and Allergies was asked to provide a scientific opinion on a list of health claims pursuant to Article 13 of Regulation (EC) No 1924/2006. This opinion addresses the scientific substantiation of health...

  10. Fluorescence excitation-emission matrix spectroscopy of vitiligo skin in vivo (Conference Presentation)

    Zhao, Jianhua; Richer, Vincent; Al Jasser, Mohammed; Zandi, Soodabeh; Kollias, Nikiforos; Kalia, Sunil; Zeng, Haishan; Lui, Harvey

    2016-02-01

    Fluorescence signals depend on the intensity of the exciting light, the absorption properties of the constituent molecules, and the efficiency with which the absorbed photons are converted to fluorescence emission. The optical features and appearance of vitiligo have been explained primarily on the basis of reduced epidermal pigmentation, which results in abnormal white patches on the skin. The objective of this study is to explore the fluorescence properties of vitiligo and its adjacent normal skin using fluorescence excitation-emission matrix (EEM) spectroscopy. Thirty five (35) volunteers with vitiligo were acquired using a double-grating spectrofluorometer with excitation and emission wavelengths of 260-450 nm and 300-700 nm respectively. As expected, the most pronounced difference between the spectra obtained from vitiligo lesions compared to normally pigmented skin was that the overall fluorescence was much higher in vitiligo; these differences increased at shorter wavelengths, thus matching the characteristic spectral absorption of epidermal melanin. When comparing the fluorescence spectra from vitiligo to normal skin we detected three distinct spectral bands centered at 280nm, 310nm, and 335nm. The 280nm band may possibly be related to inflammation, whereas the 335 nm band may arise from collagen or keratin cross links. The source of the 310 nm band is uncertain; it is interesting to note its proximity to the 311 nm UV lamps used for vitiligo phototherapy. These differences are accounted for not only by changes in epidermal pigment content, but also by other optically active cutaneous biomolecules.

  11. Combined normal-phase and reversed-phase liquid chromatography/ESI-MS as a tool to determine the molecular diversity of A-type procyanidins in peanut skins

    Appeldoorn, M.M.; Vincken, J.P.; Sanders, M.B.; Hollman, P.C.H.; Gruppen, H.

    2009-01-01

    Peanut skins, a byproduct of the peanut butter industry, are a rich source of proanthocyanidins, which might be used in food supplements. Data on the molecular diversity of proanthocyanidins in peanut skins is limited and conflicting with respect to the ratio of double- (A-type) versus single-linked

  12. Skin Cancer in Skin of Color

    Bradford, Porcia T.

    2009-01-01

    Skin cancers in skin of color often present atypically or with advanced stage in comparison to Caucasian patients. Health care providers must maintain a high index of suspicion when examining skin lesions in skin of color.

  13. Skin Pigment

    ... This Article Medical Dictionary Also of Interest (Quiz) Vitiligo (Video) Hives Additional Content Medical News Overview of ... Version Pigment Disorders Overview of Skin Pigment Albinism Vitiligo Hyperpigmentation Melasma Melanin is the brown pigment that ...

  14. Skin abscess

    ... infection (often staphylococcus) A minor wound or injury Boils Folliculitis (infection in a hair follicle) A skin ... Elsevier Churchill Livingstone; 2009:chap 90. Read More Boils Endocarditis Folliculitis MRSA Osteomyelitis Update Date 11/12/ ...

  15. Development of an improved method for quantitative analysis of skin blotting: Increasing reliability and applicability for skin assessment

    Ogai, Kazuhiro; Matsumoto, Masaru; Minematsu, T; Kitamura, Keiichiro; Kobayashi, M.; Sugama, Junko; Sanada, Hiromi

    2015-01-01

    Objective A novel skin assessment tool named 'skin blotting' has been recently developed, which can easily predict the skin status to avoid its deterioration. The aim of this study was to propose a normalization method for skin blotting to compensate for individual differences that can hamper the quantitative comparisons and clinical applications. Methods To normalize individual differences, we utilized a total protein as a 'normalizer' with calibration curves. For evaluation, we performed a ...

  16. Skin color - patchy

    Patchy skin color is areas where the skin color is irregular. Mottling or mottled skin refers to blood vessel changes in ... in the skin cells that gives skin its color Growth of bacteria or other organisms on the ...

  17. Skin Cancer Screening

    ... Genetics of Skin Cancer Skin Cancer Screening Research Skin Cancer Screening (PDQ®)–Patient Version What is screening? Go ... These are called diagnostic tests . General Information About Skin Cancer Key Points Skin cancer is a disease in ...

  18. Skin Health and Skin Diseases

    ... watch for with the moles on your skin: Asymmetry : the shape of one half does not match ... Number 4 Pages 22 - 25 MedlinePlus | Subscribe | Magazine Information | Contact Us | Viewers & Players Friends of the National ...

  19. Malondialdehyde-derived epitopes in human skin result from acute exposure to solar UV and occur in nonmelanoma skin cancer tissue.

    Williams, Joshua D; Bermudez, Yira; Park, Sophia L; Stratton, Steven P; Uchida, Koji; Hurst, Craig A; Wondrak, Georg T

    2014-03-01

    Cutaneous exposure to solar ultraviolet radiation (UVR) is a causative factor in photoaging and photocarcinogenesis. In human skin, oxidative stress is widely considered a key mechanism underlying the detrimental effects of acute and chronic UVR exposure. The lipid peroxidation product malondialdehyde (MDA) accumulates in tissue under conditions of increased oxidative stress, and the occurrence of MDA-derived protein epitopes, including dihydropyridine-lysine (DHP), has recently been substantiated in human skin. Here we demonstrate for the first time that acute exposure to sub-apoptogenic doses of solar simulated UV light (SSL) causes the formation of free MDA and protein-bound MDA-derived epitopes in cultured human HaCaT keratinocytes and healthy human skin. Immunohistochemical staining revealed that acute exposure to SSL is sufficient to cause an almost twenty-fold increase in general MDA- and specific DHP-epitope content in human skin. When compared to dose-matched solar simulated UVA, complete SSL was more efficient generating both free MDA and MDA-derived epitopes. Subsequent tissue microarray (TMA) analysis revealed the prevalence of MDA- and DHP-epitopes in nonmelanoma skin cancer (NMSC). In squamous cell carcinoma tissue, both MDA- and DHP-epitopes were increased more than threefold as compared to adjacent normal tissue. Taken together, these date demonstrate the occurrence of MDA-derived epitopes in both solar UVR-exposed healthy human skin and NMSC TMA tissue; however, the potential utility of these epitopes as novel biomarkers of cutaneous photodamage and a functional role in the process of skin photocarcinogenesis remain to be explored. PMID:24584085

  20. Tactile perception of skin and skin cream by friction induced vibrations.

    Ding, Shuyang; Bhushan, Bharat

    2016-11-01

    Skin cream smooths, softens, and moistens skin by altering surface roughness and tribological properties of skin. Sliding generates vibrations that activate mechanoreceptors located in skin. The brain interprets tactile information to identify skin feel. Understanding the tactile sensing mechanisms of skin with and without cream treatment is important to numerous applications including cosmetics, textiles, and robotics sensors. In this study, frequency spectra of friction force and friction induced vibration signals were carried out to investigate tactile perception by an artificial finger sliding on skin. The influence of normal load, velocity, and cream treatment time were studied. Coherence between friction force and vibration signals were found. The amplitude of vibration decreased after cream treatment, leading to smoother perception. Increasing normal load or velocity between contacting surfaces generated a smoother perception with cream treatment, but rougher perception without treatment. As cream treatment time increases, skin becomes smoother. The related mechanisms are discussed. PMID:27474814

  1. Detect Adjacent Well by Analyzing Geomagnetic Anomalies

    Su Zhang

    2014-03-01

    Full Text Available This study describes a method of determining the position of adjacent well by analyzing geomagnetic anomalies in the drilling. In the experiment, put a casing in the geomagnetic field respectively to simulate 3 conditions, which are vertical well, deviated well and horizontal well. Study the interference of regional geomagnetic caused by casing, summary the law of the regional geomagnetic field anomalies caused by the adjacent casing. Experimental results show that: magnetic intensity distortion caused by deviated well is similar to that caused by horizontal well, but the distortion is different from vertical well. The scope and amplitude of N and E component magnetic intensity distortion will increase with the increase of casing inclination, meanwhile the scope and amplitude of V component distortion will decrease and the distortion value changes from negative to positive to the southwest of adjacent well. Through the analysis of geomagnetic anomalies, the position of the adjacent wells could be determined.

  2. Skin deposits in hereditary cystatin C amyloidosis

    Benedikz, Eirikur; Blöndal, H; Gudmundsson, G

    1990-01-01

    Clinically normal skin from 47 individuals aged 9-70 years was investigated. Cystatin C amyloid deposits were found in various locations of the skin by light and/or electron microscopy, in all 12 patients with a clinical history of hereditary cystatin C amyloidosis (HCCA). Six asymptomatic....... Skin from 12 individuals who served as controls and skin from 14 close relatives of the patients was negative for amyloid. Punch biopsy of the skin is a simple procedure which is of value for the diagnosis of HCCA, even before the appearance of clinical symptoms. This method might also be of use in...

  3. Adjacency Algebra of Unitary Cayley Graph

    A. Satyanarayana Reddy

    2013-02-01

    Full Text Available A few properties of unitary Cayley graphs are explored using their eigenvalues. It is shown that the adjacency algebra of a unitary Cayley graph is a coherent algebra. Finally, a class of unitary Cayley graphs that are distance regular are also obtained.Key Words: Adjacency Algebra, Circulant Graph, Coherent Algebra, Distance Regular Graph,Ramanujan's sum .AMS(2010: 05C25, 05C50

  4. Do We Know What Causes Melanoma Skin Cancer?

    ... melanoma skin cancer be prevented? What causes melanoma skin cancer? Many risk factors for melanoma have been found, ... such as CDKN2A (also known as p16 ) and CDK4 that prevent them from doing their normal job ...

  5. Skin Cancer: Biology, Risk Factors & Treatment | NIH MedlinePlus the Magazine

    ... of this page please turn Javascript on. Feature: Skin Cancer Skin Cancer: Biology, Risk Factors & Treatment Past Issues / Summer ... that make up tissues. Tissues make up the skin and other organs of the body. Normal cells ...

  6. The Aging Prostate Is Never "Normal"

    Schlomm, Thorsten; Weischenfeldt, Joachim; Korbel, Jan; Sauter, Guido

    2015-01-01

    We argue against the recently published statement that tumor-specific molecular alterations found in "normal" prostate tissue from cancer patients challenge focal therapy approaches that only target a visible cancer lesion and not the adjacent molecular field....

  7. Pathological skin picking: case presentation and review of the literature

    Maria Isabela Sarbu; Mircea Tampa; Diana Leahu; Cristina Raileanu; Vasile Benea; Simona Roxana Georgescu

    2015-01-01

    Pathological skin picking is a condition in which patients induce skin lesions through repetitive, compulsive excoriations of normal skin or skin with minor surface irregularities and they admit their role in the production of the lesions, but are unable to stop their behavior. Psychiatric comorbidities most often associated with skin picking include obsessive-compulsive disorder (OCD), anxiety disorders, mood disorders, body dysmorphic disorders, trichotillomania and compulsive-buying disord...

  8. Skin perfusion pressure measured with a photo sensor in an air-filled plastic balloon: validity and reproducibility on the lower leg in normal subjects and patients suspected of obliterative arterial disease

    Nielsen, Steen Levin; Nielsen, Anne Lerberg; Vind, Susanne Haase;

    2011-01-01

    An inflatable small plastic bag including a photo sensor was constructed for measurement of skin perfusion pressure avoiding the rim of the photo sensor over bony and tendineous surfaces of the tibia below the knee, at the ankle, and on the dorsal forefoot. Compression was obtained using a conical...

  9. Allergy testing - skin

    Patch tests - allergy; Scratch tests - allergy; Skin tests - allergy; RAST test ... There are three common methods of allergy skin testing. The skin prick test involves: Placing a small amount of substances that may be causing your symptoms on the skin, ...

  10. Skin Care and Aging

    ... Home » Skin Care and Aging Heath and Aging Skin Care and Aging Dry Skin and Itching Bruises Wrinkles Age Spots ... doctor. For More Information About Skin Care and Aging American Academy of Dermatology 1-866-503-7546 ( ...

  11. Skin Care and Aging

    ... page please turn Javascript on. Skin Care and Aging How Aging Affects Skin Your skin changes with age. It ... if they bother you. See additional resources on aging skin, including information on treatment options, specific conditions, ...

  12. Skin Pigmentation Disorders

    Pigmentation means coloring. Skin pigmentation disorders affect the color of your skin. Your skin gets its color from a pigment called melanin. Special cells in the skin make melanin. When these cells become damaged or ...

  13. Skin Substitutes

    Zavan, Barbara; Vindigni, Vincenzo; Cortivo, Roberta; Abatangelo, Giovanni

    2010-01-01

    The many studies conducted so far reveal that Tissue Engineering of the skin is only at the beginning of its use in human applications. Burns patients were the first targets for such tissue substitutes, then chronic diseases, such as venous ulcers, have followed. The more experience is gained from the surgeon, the more feedback for the basic scientist to improve the product and to broaden clinical indications. Nowadays, progress in cell culture and biomedical material technologies have added ...

  14. Skin aging:

    Puizina-Ivić, Neira

    2008-01-01

    There are two main processes that induce skin aging: intrinsic and extrinsic. A stochastic process that implies random cell damage as a result of mutations during metabolic processes due to the production of free radicals is also implicated. Extrinsic aging is caused by environmental factors such as sun exposure, air pollution, smoking, alcohol abuse, and poor nutrition. Intrinsicaging reflects the genetic background and depends on time. Various expressions of intrinsic aging include smooth, ...

  15. Does the sailfish skin reduce the skin friction like the shark skin?

    Sagong, Woong; Kim, Chulkyu; Choi, Sangho; Jeon, Woo-Pyung; Choi, Haecheon

    2008-10-01

    The sailfish is the fastest sea animal, reaching its maximum speed of 110 km/h. On its skin, a number of V-shaped protrusions pointing downstream exist. Thus, in the present study, the possibility of reducing the skin friction using its shape is investigated in a turbulent boundary layer. We perform a parametric study by varying the height and width of the protrusion, the spanwise and streamwise spacings between adjacent ones, and their overall distribution pattern, respectively. Each protrusion induces a pair of streamwise vortices, producing low and high shear stresses at its center and side locations, respectively. These vortices also interact with those induced from adjacent protrusions. As a result, the drag is either increased or unchanged for most of the cases considered. Some of these cases show that the skin friction itself is reduced but the total drag including the form drag on the protrusion is larger than that of a smooth surface. In a few cases, the drag is decreased only slightly (˜1%) but this amount is within the experimental uncertainty. Since the shape of present protrusions is similar to that used by Sirovich and Karlsson [Nature (London) 388, 753 (1997)] where V-shaped protrusions pointing upstream were considered, we perform another set of experiments following their study. However, we do not obtain any drag reduction even with random distribution of those V-shaped protrusions.

  16. Cutaneous skin tag

    Skin tag; Acrochordon; Fibroepithelial polyp ... have diabetes. They are thought to occur from skin rubbing against skin. ... The tag sticks out of the skin and may have a short, narrow stalk connecting it to the surface of the skin. Some skin tags are as long as ...

  17. Stereological quantification of lymphocytes in skin biopsies from atopic dermatitis patients

    Ellingsen, A R; Sørensen, Flemming Brandt; Larsen, J O; Deleuran, M S; Thestrup-Pedersen, K

    2001-01-01

    active eczema in 8 adults with AD and from clinically normal skin from 4 of the patients. Five persons without allergy or skin disease served as controls. The mean number of lymphocytes in 4-mm skin biopsies was 469,000 and 124,000 in active eczema and in clinically normal skin, respectively. Compared...

  18. Adjacent Instability after Instrumented Lumbar Fusion.

    Wen-Jer Chen

    2003-11-01

    Full Text Available The invention of pedicle screw instrumentation has greatly improved outcomes ofspinal fusion, which has become the treatment of choice for lumbar spondylolisthesis. Asresearchers accumulate experience, both theoretical and clinical advances are continuallybeing reported. A review of the literature and the experience of the authors show that thedevelopment of adjacent instability, as in the breakdown of a neighboring unfixed motionsegment, is a common consequence of an instrumented lumbar spine. This article reviewsthe risk factors and surgical treatment of adjacent instability. The authors believe that properpreoperative planning and complete surgical procedures are imperative to prevent adjacentinstability. For those who need revision surgery, meticulous surgical techniques can achievesatisfactory results.

  19. On the complexity of adjacent resource scheduling

    Duin, C.W.; Sluis, van, P.

    2004-01-01

    We study the problem of scheduling resource(s) for jobs in an adjacent manner (ARS). The problem relates to fixed interval scheduling on the one hand, and to the problem of two-dimensional strip packing on the other hand. Further, there is a close relation with multiprocessor scheduling. A distinguishing characteristic is the constraint of resource-adjacency. As an application of ARS, consider an airport where passengers check in for their flight, joining lines before one or more desks; at th...

  20. Skin to skin care:heat balance.

    Karlsson, H.

    1996-01-01

    Skin to skin care has been practised in primitive and high technology cultures for body temperature preservation in neonates. Regional skin temperature and heat flow was measured in moderately hypothermic term neonates to quantitate the heat transfer occurring during one hour of skin to skin care. Nine healthy newborns with a mean rectal temperature of 36.3 degrees C were placed skin to skin on their mothers' chests. The mean (SD) rectal temperature increased by 0.7 (0.4) degrees C to 37.0 de...

  1. Skin and hair changes during pregnancy

    Most women have changes in their skin, hair, and nails during pregnancy. Most of these are normal and go away after pregnancy. ... changes in the texture and growth of your hair and nails during pregnancy. Some women say that ...

  2. Skin and hair changes during pregnancy

    Kroumpouzos G. Skin disease in pregnancy and puerperium. In: Gabbe SG, Niebyl JR, Simpson JL, et al, eds. Obstetrics: Normal and Problem Pregnancies . 6th ed. Philadelphia, PA: Elsevier Saunders; 2012:chap ...

  3. Adjacent stimulation and measurement patterns considered harmful

    We characterize the ability of electrical impedance tomography (EIT) to distinguish changes in internal conductivity distributions, and analyze it as a function of stimulation and measurement patterns. A distinguishability measure, z, is proposed which is related to the signal-to-noise ratio of a medium and to the probability of detection of conductivity changes in a region of interest. z is a function of the number of electrodes, the EIT stimulation and measurement protocol, the stimulation amplitude, the measurement noise, and the size and location of the contrasts. Using this measure we analyze various choices of stimulation and measurement patterns under the constraint of medical electrical safety limits (maximum current into the body). Analysis is performed for a planar placement of 16 electrodes for simulated 3D tank and chest shapes, and measurements in a saline tank. Results show that the traditional (and still most common) adjacent stimulation and measurement patterns have by far the poorest performance (by 6.9 ×). Good results are obtained for trigonometric patterns and for pair drive and measurement patterns separated by over 90°. Since the possible improvement over adjacent patterns is so large, we present this result as a call to action: adjacent patterns are harmful, and should be abandoned. We recommend using pair drive and measurement patterns separated by one electrode less than 180°. We describe an approach to modify an adjacent pattern EIT system by adjusting electrode placement

  4. Lead and the skin

    Allen, B.R.; Moore, M.R.; Hunter, J.A.A.

    1975-01-01

    The increasing use of lead will continue to give rise to problems of toxicity. Protective measures have resulted in florid lead poisoning becoming rare. Attention has recently turned to the possibility of prolonged exposure to low doses of lead causing morbidity in the absence of the classical clinical features of poisoning. Lead is absorbed mostly through the lungs and gastrointestinal tract. Some is also absorbed through the skin but with inorganic compounds the amount is small. Shortly after the most widely used compound, tetraethyl lead, was first manufactured, cases of toxicity began to occur. Manufacture was forbidden until plant design produced greater safety. Significant absorption can occur through the skin. The hazard to those handling leaded gasoline in a normal manner is probably small, mainly because 95 percent of a dose applied to the open skin surface evaporates. Hair has been used as a biopsy material to assess lead exposure. The biological effects of lead poisoning are discussed, including the synergistic effects of lead and agents provoking porphyria.

  5. PREPARATIVE SKIN PREPARATION AND SURGICAL WOUND INFECTION

    Anjanappa; Arjun

    2015-01-01

    BACKGROUND AND OBJECTIVE: It is an established fact now that the normal skin of healthy human beings harbours a rich bacterial fl ora. Normally considered non - pathogenic , these organisms way be a potential source of infection of the surgical wound. Approximately 20% of the resident flora is beyond the reach of surgical scrubs and antiseptics. The goal of surgical preparation of the skin with antiseptics is to remove transient and pathogenic microorganism...

  6. SKIN AND HAIR CHANGES AFTER FORTY

    Manisha

    2014-04-01

    Full Text Available Aging is a continuous, dynamic, and an irreversible process. Direct exposure to ultra-violet radiations, skin is particularly prone to early aging, known as photo aging. Skin aging is particularly important because of its visibility and social impact. As women age we will notice changes to our skin and hair during the menopause. Dry, thinning, fragile, less tolerant and sagging skin are common complaints. The main reasons for the change in skin is the loss of estrogen, testosterone and dehydroepiandrosterone (DHEA etc, 1, 2, 3 from the age of 35 onwards up to menopause, the more we have had long-term exposure to the elements, such as sun and wind the more this becomes evident. Estrogen is very involved in the normal function of the skin. It directly affects the function of key cells in the skin, like the fibroblast (produces collagen and elastin, keratinocyte (closely involved in skin protection and melanocytes (involved in evenness of skin color, etc.. It also helps regulate hair follicle function (hair production as well as sebaceous gland activity (producing skin oils. After the age of forty most of women enters menopause, during which estrogens levels decreases, which leads to different types of hair and skin changes which has been described in this article.

  7. Anyone Can Get Skin Cancer

    ... Cancer Skin Cancer Screening Research Anyone Can Get Skin Cancer Order the free Anyone Can Get Skin Cancer ... true that only people with light skin get skin cancer? No. Anyone can get skin cancer. It's more ...

  8. Sustained Impairments in Cutaneous Vasodilation and Sweating in Grafted Skin Following Long-Term Recovery

    Davis, Scott L.; Shibasaki, Manabu; David A Low; Cui, Jian; Keller, David M.; Wingo, Jonathan E.; Purdue, Gary F.; Hunt, John L.; Arnoldo, Brett D.; Kowalske, Karen J.; Crandall, Craig G.

    2009-01-01

    We previously identified impaired cutaneous vasodilation and sweating in grafted skin 5 to 9 months postsurgery. The aim of this investigation was to test the hypothesis that cutaneous vasodilation, but not sweating, is restored as the graft heals. Skin blood flow and sweat rate were assessed from grafted skin and adjacent noninjured skin in three groups of subjects: 5 to 9 months postsurgery (n = 13), 2 to 3 years postsurgery (n = 13), and 4 to 8 years postsurgery (n = 13) during three separ...

  9. The Thermomagnetic Instability in Superconducting Films with Adjacent Metal Layer

    Vestgården, J. I.; Galperin, Y. M.; Johansen, T. H.

    2013-12-01

    Dendritic flux avalanches is a frequently encountered consequence of the thermomagnetic instability in type-II superconducting films. The avalanches, which are potentially harmful for superconductor-based devices, can be suppressed by an adjacent normal metal layer, even when the two layers are not in thermal contact. The suppression of the avalanches in this case is due to so-called magnetic braking, caused by eddy currents generated in the metal layer by propagating magnetic flux. We develop a theory of magnetic braking by analyzing coupled electrodynamics and heat flow in a superconductor-normal metal bilayer. The equations are solved by linearization and by numerical simulation of the avalanche dynamics. We find that in an uncoated superconductor, even a uniform thermomagnetic instability can develop into a dendritic flux avalanche. The mechanism is that a small non-uniformity caused by the electromagnetic non-locality induces a flux-flow hot spot at a random position. The hot spot quickly develops into a finger, which at high speeds penetrates into the superconductor, forming a branching structure. Magnetic braking slows the avalanches, and if the normal metal conductivity is sufficiently high, it can suppress the formation of the dendritic structure. During avalanches, the braking by the normal metal layer prevents the temperature from exceeding the transition temperature of the superconductor. Analytical criteria for the instability threshold are developed using the linear stability analysis. The criteria are found to match quantitatively the instability onsets obtained in simulations.

  10. Increased apoptosis in gastric mucosa adjacent to intestinal metaplasia

    van Grieken, N C T; Meijer, G A; zur Hausen, A; Meuwissen, S G M; Baak, J P A; Kuipers, E J

    2003-01-01

    Background: The biological processes involved in the development of gastric mucosal atrophy and intestinal metaplasia are still incompletely understood. Reports testing the hypothesis that apoptosis leads to atrophy have yielded conflicting results. The availability of new antibodies for the detection of apoptotic cells in tissue sections has facilitated the analysis of the role of apoptosis in the gastritis–atrophy–intestinal metaplasia sequence. Methods: Archival material from 40 gastric resection specimens with normal mucosa (n = 5), chronic active gastritis (n = 17), or intestinal metaplasia (n = 18) was studied. Immunohistochemistry was performed using antibodies directed against cleaved cytokeratin 18 and active caspase 3. Slides were scored on a 0–3 scale for the presence of apoptotic cells. Results: Normal gastric mucosa contained low numbers of apoptotic cells at the surface epithelium (mean score, 0.20). This number was significantly increased in cases with chronic gastritis (mean score, 1.06) and in those with intestinal metaplasia (mean score, 2.56). Within the intestinal metaplasia cases, 44 different foci of intestinal metaplasia were identified. In 39 of these 44 areas, concentrations of apoptotic cells were seen immediately adjacent to the foci of intestinal metaplasia, but not in the metaplastic epithelium itself. Conclusions: Apoptosis is uncommon in normal gastric mucosa. Chronic inflammation and intestinal metaplasia are associated with increased apoptosis, but occur mainly at the mucosal surface and not in the deeper layers. These findings do not support the concept that apoptosis underlies the loss of gastric glands and leads to atrophy, but the observed concentration of apoptotic epithelial cells adjacent to foci of intestinal metaplasia could be related to heterogeneity of epithelial damage, causing apoptosis, to which intestinal metaplasia is a response. PMID:12719456

  11. Adjacent Segment Pathology after Lumbar Spinal Fusion.

    Lee, Jae Chul; Choi, Sung-Woo

    2015-10-01

    One of the major clinical issues encountered after lumbar spinal fusion is the development of adjacent segment pathology (ASP) caused by increased mechanical stress at adjacent segments, and resulting in various radiographic changes and clinical symptoms. This condition may require surgical intervention. The incidence of ASP varies with both the definition and methodology adopted in individual studies; various risk factors for this condition have been identified, although a significant controversy still exists regarding their significance. Motion-preserving devices have been developed, and some studies have shown their efficacy of preventing ASP. Surgeons should be aware of the risk factors of ASP when planning a surgery, and accordingly counsel their patients preoperatively. PMID:26435804

  12. Nonequilibrium phenomena in adjacent electrically isolated nanostructures

    Khrapai, V. S.; Ludwig, S.; Kotthaus, J. P.; Tranitz, H. P.; Wegscheider, W.

    2008-01-01

    We report on nonequilibrium interaction phenomena between adjacent but electrostatically separated nanostructures in GaAs. A current flowing in one externally biased nanostructure causes an excitation of electrons in a circuit of a second nanostructure. As a result we observe a dc current generated in the unbiased second nanostructure. The results can be qualitatively explained in terms of acoustic phonon based energy transfer between the two mutually isolated circuits.

  13. Skin color - patchy

    ... page: //medlineplus.gov/ency/article/003224.htm Skin color - patchy To use the sharing features on this page, please enable JavaScript. Patchy skin color is areas where the skin color is irregular. ...

  14. Skin Cancer Foundation

    ... Fundraising Event | About Us | Store The Skin Cancer Foundation The Skin Cancer Foundation is the only international organization devoted solely to ... About Us Contact Us © 2016 The Skin Cancer Foundation | 149 Madison Avenue Suite 901 New York, NY ...

  15. Learning about Skin Cancer

    ... Why Deadly Skin Cancers Spread 2000 News Release Learning About Skin Cancer What are the most common ... skin surface. When a melanoma becomes thick and deep, the disease often spreads to other parts of ...

  16. Skin care and incontinence

    Incontinence - skin care ... or bowels (called incontinence) are at risk of skin problems around the buttocks, hips, genitals, and the ... rectum (perineum). Excess moisture in these areas makes skin problems such as redness, peeling, irritation, and yeast ...

  17. An atlas of normal skeletal scintigraphy

    This atlas was compiled to provide the neophyte as well as the experienced radiologist and the nuclear medicine physician with a reference on normal skeletal scintigraphy as an aid in distinguishing normal variations in skeletal uptake from abnormal findings. Each skeletal scintigraph is labeled, and utilizing an identical scale, a relevant skeletal photograph and radiograph are placed adjacent to the scintigraph

  18. Volume effect and skin reaction

    Volume effect has been investigated about late skin necrosis. Tolerance dose of skin by single irradiation has been suggested to increase from 20∼22.5 Gy for 2.0 cm in diameter to more than 50 Gy for 1.0 cm in diameter. It is consistent with the volume effect for acute skin reaction. Similar relationship has been reported for normal tissue tolerance of central nervous system. The volume effect where a large difference in threshold dose is evident has not been explained by statistical calculation, such as critical element models. White matter necrosis rate has been simulated well using Monte Carlo calculation postulating inter-elemental migration but not by models assuming elemental independence. (author)

  19. Laser ablation of human atherosclerotic plaque without adjacent tissue injury

    Grundfest, W. S.; Litvack, F.; Forrester, J. S.; Goldenberg, T.; Swan, H. J. C.

    1985-01-01

    Seventy samples of human cadaver atherosclerotic aorta were irradiated in vitro using a 308 nm xenon chloride excimer laser. Energy per pulse, pulse duration and frequency were varied. For comparison, 60 segments were also irradiated with an argon ion and an Nd:YAG laser operated in the continuous mode. Tissue was fixed in formalin, sectioned and examined microscopically. The Nd:YAG and argon ion-irradiated tissue exhibited a central crater with irregular edges and concentric zones of thermal and blast injury. In contrast, the excimer laser-irradiated tissue had narrow deep incisions with minimal or no thermal injury. These preliminary experiments indicate that the excimer laser vaporizes tissue in a manner different from that of the continuous wave Nd:YAG or argon ion laser. The sharp incision margins and minimal damage to adjacent normal tissue suggest that the excimer laser is more desirable for general surgical and intravascular uses than are the conventionally used medical lasers.

  20. Kauffman's adjacent possible in word order evolution

    Ferrer-i-Cancho, Ramon

    2015-01-01

    Word order evolution has been hypothesized to be constrained by a word order permutation ring: transitions involving orders that are closer in the permutation ring are more likely. The hypothesis can be seen as a particular case of Kauffman's adjacent possible in word order evolution. Here we consider the problem of the association of the six possible orders of S, V and O to yield a couple of primary alternating orders as a window to word order evolution. We evaluate the suitability of various competing hypotheses to predict one member of the couple from the other with the help of information theoretic model selection. Our ensemble of models includes a six-way model that is based on the word order permutation ring (Kauffman's adjacent possible) and another model based on the dual two-way of standard typology, that reduces word order to basic orders preferences (e.g., a preference for SV over VS and another for SO over OS). Our analysis indicates that the permutation ring yields the best model when favoring pa...

  1. Skin Cancer Prevention

    ... the lower part of the epidermis. They make melanin , the pigment that gives skin its natural color. When skin is exposed to the sun, melanocytes make more pigment, causing the skin to tan, or darken. The dermis contains blood and lymph vessels , hair follicles , and glands . Enlarge Anatomy of the skin, ...

  2. Dry Skin (Xerosis)

    ... resources Meet our partners Español Donate Diseases and treatments Acne and rosacea Bumps and growths Color problems Contagious skin diseases ... Dry skin public SPOT Skin Cancer™ Diseases and treatments Acne and rosacea Bumps and growths Color problems Contagious skin diseases ...

  3. Estrogens and aging skin

    Thornton, M. Julie

    2013-01-01

    Estrogen deficiency following menopause results in atrophic skin changes and acceleration of skin aging. Estrogens significantly modulate skin physiology, targeting keratinocytes, fibroblasts, melanocytes, hair follicles and sebaceous glands, and improve angiogenesis, wound healing and immune responses. Estrogen insufficiency decreases defense against oxidative stress; skin becomes thinner with less collagen, decreased elasticity, increased wrinkling, increased dryness and reduced vascularity...

  4. Stiff skin syndrome.

    Geng, S; Lei, X; Toyohara, J P; Zhan, P; Wang, J; Tan, S

    2006-07-01

    Stiff skin syndrome is a rare disorder characterized by pronounced skin induration, mild hypertrichosis and limited joint mobility, predominantly on the buttocks and thighs. Many heterogeneous cases have been reported under the name of stiff skin syndrome. We present a case of stiff skin syndrome from China, the diagnosis based on the patient's typical clinical and histopathological features. PMID:16836505

  5. Friction and durability of virgin and damaged skin with and without skin cream treatment using atomic force microscopy

    Bharat Bhushan

    2012-11-01

    Full Text Available Skin can be damaged by the environment easily. Skin cream is an effective and rapid way to moisten the skin by changing the skin surface properties. Rat skin and pig skin are common animal models for studies and were used as skin samples in this study. The nano- and macroscale friction and durability of damaged skin were measured and compared with those of virgin (intact/undamaged skin. The effect of skin cream on friction and durability of damaged and virgin skin samples is discussed. The effects of velocity, normal load, relative humidity and number of cycles were studied. The nanoscale studies were performed by using atomic force microscope (AFM, and macroscale studies were performed by using a pin-on-disk (POD reciprocating tribometer. It was found that damaged skin has different mechanical properties, surface roughness, contact angle, friction and durability compared to that of virgin skin. But similar changes occur after skin cream treatment. Rat and pig skin show similar trends in friction and durability.

  6. Risks of Skin Cancer Screening

    ... Genetics of Skin Cancer Skin Cancer Screening Research Skin Cancer Screening (PDQ®)–Patient Version What is screening? Go ... These are called diagnostic tests . General Information About Skin Cancer Key Points Skin cancer is a disease in ...

  7. Keratins and skin disease.

    Knöbel, Maria; O'Toole, Edel A; Smith, Frances J D

    2015-06-01

    Mutations in keratin genes cause a diverse spectrum of skin, hair and mucosal disorders. Cutaneous disorders include epidermolysis bullosa simplex, palmoplantar keratoderma, epidermolytic ichthyosis and pachyonychia congenita. Both clinical and laboratory observations confirm a major role for keratins in maintaining epidermal cell-cell adhesion. When normal tissue homeostasis is disturbed, for example, during wound healing and cancer, keratins play an important non-mechanical role. Post-translational modifications including glycosylation and phosphorylation of keratins play an important role in protection of epithelial cells from injury. Keratins also play a role in modulation of the immune response. A current focus in the area of keratins and disease is the development of new treatments including small inhibitory RNA (siRNA) to mutant keratins and small molecules to modulate keratin expression. PMID:25620412

  8. Factory waste influence on Elbrus adjacent area

    Complete text of publication follows. Two major burials of waste from concentrating mill of The Tyrnauz Tungsten-Molybdic Plant are situated at the recreation area of Elbrus adjacent territory. But it is significant that the strong winds periods are available here at the river Baksan valley constantly, which are transfers the particles of burials along that valley. The waste pollutes pastures and agricultural lands. The sampling of the buried material on the surface and of the soil of adjacent territory was fulfilled here in order to check up that assumption. The chemical analyses of the buried waste were performed at the X-ray spectrometer Philips PW2400. The results received showed the high quantity of some environmental threat elements. The soil sample analyses on 20 elements (including Ca, Ti, Mn, Fe, P, S, Cr, V, Co, Ni, Cu, Zn, Sr, Zr, Ba, Pb, As, Mo, W, Sn) showed the excess of maximum permissible concentrations (according to Russian Federation hygienic regulations 2.1.7.2041-06) of some investigated elements in the all researched samples. Some results of the investigations are shown below in the table 1. The excesses of maximum permissible concentrations were observed for phosphorus from 5.3 to 11.3 times as much; for sulphur from 3 to 8.75 times as much; for cobalt from 2.6 to 4.6 times as much; for nickel from 8.25 to 15.25 times as much; for copper from 9.3 to 22 times as much; for arsenic up to 10 and at one sample - to 28 times as much. At the MPC level was the lead contents and also at single instances - the manganese and vanadium contents. The excess of background contents were observed for molybdenum up to 8, tungsten - up to 38 and tin - up to 7 times as much. Presented data confirmed the supposition that buried waste pollutes pastures and agricultural lands of Elbrus adjacent area and that means the necessity of either more careful burial of these waste products, or their full recycling.

  9. Terahertz pulse imaging in reflection geometry of human skin cancer and skin tissue

    We demonstrate the application of terahertz pulse imaging (TPI) in reflection geometry for the study of skin tissue and related cancers both in vitro and in vivo. The sensitivity of terahertz radiation to polar molecules, such as water, makes TPI suitable for studying the hydration levels in the skin and the determination of the lateral spread of skin cancer pre-operatively. By studying the terahertz pulse shape in the time domain we have been able to differentiate between diseased and normal tissue for the study of basal cell carcinoma (BCC). Basal cell carcinoma has shown a positive terahertz contrast, and inflammation and scar tissue a negative terahertz contrast compared to normal tissue. In vivo measurements on the stratum corneum have enabled visualization of the stratum corneum-epidermis interface and the study of skin hydration levels. These results demonstrate the potential of terahertz pulse imaging for the study of skin tissue and its related disorders, both in vitro and in vivo

  10. Terahertz pulse imaging in reflection geometry of human skin cancer and skin tissue

    Woodward, Ruth M [Cavendish Laboratory, University of Cambridge, Madingley Road, Cambridge (United Kingdom); Cole, Bryan E [TeraView Limited, 302/304 Cambridge Science Park, Milton Road, Cambridge (United Kingdom); Wallace, Vincent P [TeraView Limited, 302/304 Cambridge Science Park, Milton Road, Cambridge (United Kingdom); Pye, Richard J [Department of Dermatology, Addenbrooke' s Hospital, Cambridge (United Kingdom); Arnone, Donald D [TeraView Limited, 302/304 Cambridge Science Park, Milton Road, Cambridge (United Kingdom); Linfield, Edmund H [Cavendish Laboratory, University of Cambridge, Madingley Road, Cambridge (United Kingdom); Pepper, Michael [Cavendish Laboratory, University of Cambridge, Madingley Road, Cambridge (United Kingdom)

    2002-11-07

    We demonstrate the application of terahertz pulse imaging (TPI) in reflection geometry for the study of skin tissue and related cancers both in vitro and in vivo. The sensitivity of terahertz radiation to polar molecules, such as water, makes TPI suitable for studying the hydration levels in the skin and the determination of the lateral spread of skin cancer pre-operatively. By studying the terahertz pulse shape in the time domain we have been able to differentiate between diseased and normal tissue for the study of basal cell carcinoma (BCC). Basal cell carcinoma has shown a positive terahertz contrast, and inflammation and scar tissue a negative terahertz contrast compared to normal tissue. In vivo measurements on the stratum corneum have enabled visualization of the stratum corneum-epidermis interface and the study of skin hydration levels. These results demonstrate the potential of terahertz pulse imaging for the study of skin tissue and its related disorders, both in vitro and in vivo.

  11. Seismicity in Azerbaijan and Adjacent Caspian Sea

    So far no general view on the geodynamic evolution of the Black Sea to the Caspian Sea region is elaborated. This is associated with the geological and structural complexities of the region revealed by geophysical, geochemical, petrologic, structural, and other studies. A clash of opinions on geodynamic conditions of the Caucasus region, sometimes mutually exclusive, can be explained by a simplified interpretation of the seismic data. In this paper I analyze available data on earthquake occurrences in Azerbaijan and the adjacent Caspian Sea region. The results of the analysis of macroseismic and instrumental data, seismic regime, and earthquake reoccurrence indicate that a level of seismicity in the region is moderate, and seismic event are concentrated in the shallow part of the lithosphere. Seismicity is mostly intra-plate, and spatial distribution of earthquake epicenters does not correlate with the plate boundaries

  12. CANDU fuel bundle skin friction factor

    Single-phase, incompressible fluid flow skin friction factor correlations, primarily for CANDU 37-rod fuel bundles, were reviewed. The correlations originated from curve-fits to flow test data, mostly with new fuel bundles in new pressure tubes (flow tubes), without internal heating. Skin friction in tubes containing fuel bundles (noncircular flow geometry) was compared to that in equivalent diameter smooth circular tubes. At Reynolds numbers typical of normal flows in CANDU fuel channels, the skin friction in tubes containing bundles is 8 to 15% higher than in equivalent diameter smooth circular tubes. Since the correlations are based on scattered results from measurements, the skin friction with bundles may be even higher than indicated above. The information permits over- or under-prediction of the skin friction, or choosing an intermediate value of friction, with allowance for surface roughnesses, in thermal-hydraulic analyses of CANDU heat transport systems. (author) 9 refs., 2 figs

  13. Detecting Adjacent Relativity of Engineering Drawing Entities with Container Window

    林福严; 邱友申; 秦吉胜

    2001-01-01

    Automatic recognition and interpretation of engineering drawing plays an important role in computer aided engineering. Detecting the positional relation between entities is an important topic in this research field. In this paper the concepts of adjacent relativity and container window of drawing entities were proposed. By means of container window, the adjacent irrelative entities can be detected quickly and effectively, which speeds up the process of adjacent relativity detection. Meanwhile, the algorithm of adjacent relativity detection was discussed.

  14. Skin disease among farmers using wastewater in rice cultivation in Nam Dinh, Vietnam

    Do, Thuy Trang; van der Hoek, Wim; Nguyen, Dang Tuan;

    2007-01-01

    OBJECTIVE: To assess the risk of skin disease among farmers occupationally exposed to wastewater. METHODS: One-year follow-up study with monthly assessments of wastewater exposure and skin disease in Nam Dinh, northern Vietnam, in two adjacent communes with contrasting levels of wastewater use. In...

  15. Ribosomal protein s6-ps240 is expressed in lesional skin from patients with autoimmune skin blistering diseases

    Ana Maria Abreu Velez

    2013-01-01

    Full Text Available Background: The in situ signaling transduction within skin biopsies from patients affected by autoimmune skin blistering diseases is not well-characterized. Aim : In autoimmune skin blistering diseases, autoantibodies seem to trigger several intracellular signaling pathways and we investigated the presence of the phosphorylated form of ribosomal protein S6-pS240 within autoimmune skin blistering diseases biopsies. Materials and Methods: We utilized immunohistochemistry to evaluate the presence of S6-pS240 in lesional skin biopsies of patients affected by autoimmune skin blistering diseases including patients with an endemic and nonendemic pemphigus foliaceus (non EPF, with bullous pemphigoid (BP, pemphigus vulgaris (PV, dermatitis herpetiformis (DH, and the respective controls. Results: Most autoimmune bullous skin diseases biopsies stained positive for S6-pS240 around lesional blisters, including adjacent areas of the epidermis; and within upper dermal inflammatory infiltrates, and/or mesenchymal-endothelial cell junctions within the dermis. Conclusions: We document that S6-pS240 is expressed in lesional areas of skin biopsies from patients with autoimmune skin blistering diseases, as well as on eccrine glands and piloerector muscles. Thus, the role of this molecule in autoimmune skin blistering diseases warrants further study.

  16. OCT imaging of skin cancer and other dermatological diseases

    Mogensen, Mette; Thrane, Lars; Jørgensen, Thomas Martini;

    2009-01-01

    Optical coherence tomography (OCT) provides clinicians and researchers with micrometer-resolution, in vivo, cross-sectional images of human skin up to several millimeter depth. This review of OCT imaging applied within dermatology covers the application of OCT to normal skin, and reports on a lar...... number of applications in the fields of non-melanoma skin cancer, malignant melanomas, psoriasis and dermatitis, infestations, bullous skin diseases, tattoos, nails, haemangiomas, and other skin diseases. (© 2009 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim)...

  17. Cultures of cancer patient's skin tissue fibroblast and radiosensitivity assay

    In order to test the radiosensitivity of normal skin tissue, the authors cultured cancer patient's skin tissue fibroblast, surviving fraction experiment was employed to provide data for understanding of the different radiosensitivity among the cancer patients, Method: cancer patient's skin tissue fibroblast were cultured in vitro by the way of tar's attachment, cells were irradiated by graded doses of γ-ray , cell dose response experiment was used to test the radiosensitivity of cell. Result: Cancer patient's skin fibroblast could be propagated and passaged by the method of culture in vitro. Radiosensitivity are different among the various cancer patient's skin tissue fibroblasts

  18. Healthy Skin Matters

    ... your health, talk to your doctor or a physical therapist to find out what kinds of activities are ... the treatment of diseases of the skin. Follicle (FALL-lick-el). The opening in the skin where ...

  19. Examine Your Skin

    ... Support Donate Share Facebook Twitter Newsletter Examine Your Skin Watch the video below and in only two minutes, you can learn to examine your skin. A special thanks to Dr. Martin Weinstock, MD, ...

  20. Aging changes in skin

    ... pigments seem to provide some protection against sun-induced skin damage. Blue-eyed, fair-skinned people show ... 80. Women gradually produce less oil beginning after menopause. This can make it harder to keep the ...

  1. Dry Skin Relief

    ... resources Meet our partners Español Donate Diseases and treatments Acne and rosacea Bumps and growths Color problems Contagious skin diseases Cosmetic treatments Dry / sweaty skin Eczema / dermatitis Hair and scalp ...

  2. CSD skin test

    ... this page: //medlineplus.gov/ency/article/003385.htm CSD skin test To use the sharing features on this page, please enable JavaScript. The cat scratch disease (CSD) skin test was once used to help ...

  3. Allergic Skin Conditions

    ... can trigger eczema, especially in young children. Skin staph infections can cause flare-ups in children as well. ... oral corticosteroids are also prescribed. If a skin staph infection is suspected to be a trigger for an ...

  4. Examine Your Skin

    Full Text Available ... Suggestions Examine Your Skin Newly Diagnosed? Understanding Your Pathology Biopsy: The First Step Sentinel Node Biopsy Melanoma ... Suggestions Examine Your Skin Newly Diagnosed? Understanding Your Pathology Biopsy: The First Step Sentinel Node Biopsy Melanoma ...

  5. Squamous cell skin cancer

    ... earliest form of squamous cell cancer is called Bowen disease (or squamous cell carcinoma in situ). This type ... cancer; Squamous cell carcinoma of the skin Images Bowen's disease on the hand Keratoacanthoma Keratoacanthoma Skin cancer, squamous ...

  6. Skin Cancer Trends

    ... Search The CDC Cancel Submit Search The CDC Skin Cancer Note: Javascript is disabled or is not supported ... Cervical Colorectal (Colon) Lung Ovarian Prostate Cancer Home Skin Cancer Trends Language: English Español (Spanish) Recommend on Facebook ...

  7. Examine Your Skin

    Full Text Available ... Support Donate Share Facebook Twitter Newsletter Examine Your Skin Watch the video below and in only two minutes, you can learn to examine your skin. A special thanks to Dr. Martin Weinstock, MD, ...

  8. Artificial Skin in Robotics

    Strohmayr, Michael

    2012-01-01

    Artificial Skin - A comprehensive interface for system-environment interaction - This thesis investigates a multifunctional artificial skin as touch sensitive whole-body cover for robotic systems. To further the evolution from tactile sensors to an implementable artificial skin a general concept for the design process is derived. A standard test procedure is proposed to evaluate the performance. The artificial skin contributes to a safe and intuitive physical human robot interaction.

  9. Chemical shift MR imaging of the skin

    MR imaging with conventional spin-echo pulse sequences has not found wide application in the evaluation of skin pathology. This paper reports that this study was designed to determine the value of chemical shift imaging (CSI) compared with conventional pulse sequences for the noninvasive evaluation of connective tissue and neoplastic disease of the skin and underlying fascia. The studies were acquired in patients and volunteers on a whole-body system at 1.5 T and small surface coils. Comparisons were made between T1- and T2-weighted gradient-echo, spin-echo, and hybrid lipid and water-suppressed CSI series (Chopper-Dixon combined with frequency-selective pulse). CSI improves detail in the hypodermis by eliminating unwanted (lipid) signal and chemical shift misregistration artifact. The detail of water-based signal is improved in the deeper layers of the skin by improved tissue contrast and elimination of the disturbing adjacent dominant fat-based signal. MR imaging has the potential to provide information that can complement skin biopsy. A more optimal choice of pulse sequences can improve the sensitivity of MR imaging to water-based pathology and allow noninvasive visualization of deep layers. The CSI sequences may be useful in the evaluation of infiltrative and neoplastic disease of the skin, particularly as they are adapted into microimaging methods with local gradient coils

  10. Friction induced skin tags.

    Allegue, Francisco; Fachal, Carmen; Pérez-Pérez, Lidia

    2008-01-01

    Skin tags are common benign neoplasm located predominantly in intertriginous skin. Generally of cosmetic concern, they can be easily treated with cryotherapy, electrodessication or snip-excision. Despite their high incidence data about their etiopathogenesis are scarce in the medical literature. We describe a patient who developed multiple skin tags arranged in a linear fashion suggesting an etiopathogenic role for friction. PMID:18627719

  11. Microbiome and skin diseases

    Zeeuwen, P.L.; Kleerebezem, M.; Timmerman, H.M.; Schalkwijk, J.

    2013-01-01

    Purpose of review: This article reviews recent findings on the skin microbiome. It provides an update on the current understanding of the role of microbiota in healthy skin and in inflammatory and allergic skin diseases. Recent findings: Advances in computing and high-throughput sequencing technolog

  12. Microbiome and skin diseases

    Zeeuwen, P.L.J.M.; Kleerebezem, M.; Timmerman, H.M.; Schalkwijk, J.

    2013-01-01

    PURPOSE OF REVIEW: This article reviews recent findings on the skin microbiome. It provides an update on the current understanding of the role of microbiota in healthy skin and in inflammatory and allergic skin diseases. RECENT FINDINGS: Advances in computing and high-throughput sequencing technolog

  13. Skin self-exam

    Skin cancer - self-exam; Melanoma - self-exam; Basal cell cancer - self-exam; Squamous cell - self-exam; Skin mole - self-exam ... do not agree on whether or not skin self-exams should be performed. So there is no ...

  14. Skin as a potential source of infectious foot and mouth disease aerosols

    Dillon, Michael B.

    2011-01-01

    This review examines whether exfoliated, virus-infected animal skin cells could be an important source of infectious foot and mouth disease virus (FMDV) aerosols. Infectious material rafting on skin cell aerosols is an established means of transmitting other diseases. The evidence for a similar mechanism for FMDV is: (i) FMDV is trophic for animal skin and FMDV epidermis titres are high, even in macroscopically normal skin; (ii) estimates for FMDV skin cell aerosol emissions appear consistent...

  15. What Is Melanoma Skin Cancer?

    ... statistics for melanoma skin cancer What is melanoma skin cancer? Cancer starts when cells in the body begin ... causing the skin to tan or darken. Melanoma skin cancers Melanoma is a cancer that begins in the ...

  16. Large field of view multiphoton microscopy of human skin

    Balu, Mihaela; Mikami, Hideharu; Hou, Jue; Potma, Eric O.; Tromberg, Bruce J.

    2016-03-01

    Clinical examination crucially relies on the ability to quickly examine large tissue areas and rapidly zoom in to regions of interest. Skin lesions often show irregularity in color and appearance in general, especially when they start to progress towards malignancy. Large field of view (FOV) and automatic translation of the imaging area are critical in the assessment of the entire lesion. Imaging of limited FOVs of the lesion can easily result in false negative diagnosis. We present a multiphoton microscope based on two-photon excited fluorescence and second-harmonic generation that images FOVs of about 0.8 mm2 (without stitching adjacent FOVs) at speeds of 10 frames/second (800 x 800 pixels) with lateral and axial resolutions of 0.5 μm and 2.5 μm, respectively. The main novelty of this instrument is the design of the scan head, which includes a fast galvanometric scanner, relay optics, a beam expander and a high NA objective lens. We optimized the system based on the Olympus 25x, 1.05NA water immersion lens, that features a long working distance of 1 mm. Proper tailoring of the beam expander, which consists of the scan and tube lens elements, enables scaling of the FOV. The design criteria include a flat wavefront of the beam, minimum field curvature, and suppressed spherical aberrations. All aberrations in focus are below the Marechal criterion of 0.07λ rms for diffraction-limited performance. We demonstrate the practical utility of this microscope by ex-vivo imaging of wide FOVs in normal human skin.

  17. Sensitive skin: An overview

    Arun C Inamadar

    2013-01-01

    Full Text Available Sensitive skin is less tolerant to frequent and prolonged use of cosmetics and toiletries. It is self-diagnosed and typically unaccompanied by any obvious physical signs of irritation. With the change in lifestyle and also with increased opportunity to use many new brands of cosmetics and toiletries, there has been an increase in females complaining of unique sensation in their facial skin. Sensitive skin presents as smarting, burning, stinging, itching, and/or tight sensation in their facial skin. The condition is found in more than 50% of women and 40% of men, creating a sizable demand for products designed to minimize skin sensitivity. Good numbers of invasive and non-invasive tests are designed to evaluate and predict the sensitive skin. Management includes guidelines for selecting suitable cosmetics and toiletries in sensitive skin individuals.

  18. Pursuing prosthetic electronic skin.

    Chortos, Alex; Liu, Jia; Bao, Zhenan

    2016-09-01

    Skin plays an important role in mediating our interactions with the world. Recreating the properties of skin using electronic devices could have profound implications for prosthetics and medicine. The pursuit of artificial skin has inspired innovations in materials to imitate skin's unique characteristics, including mechanical durability and stretchability, biodegradability, and the ability to measure a diversity of complex sensations over large areas. New materials and fabrication strategies are being developed to make mechanically compliant and multifunctional skin-like electronics, and improve brain/machine interfaces that enable transmission of the skin's signals into the body. This Review will cover materials and devices designed for mimicking the skin's ability to sense and generate biomimetic signals. PMID:27376685

  19. Feasibility of global skin friction diagnostics using temperature sensitive paint

    This paper develops the principle of global skin friction diagnostics based on temperature sensitive paint (TSP) measurements in flows. The asymptotic form of the energy equation at a wall is derived, and its inverse solution is sought by using the variational method to extract a relative or normalized skin friction field from TSP-measured surface temperature fields. The selection of the relevant parameters (the Lagrange multiplier and the standard deviation of a Gaussian filter) and the intrinsic limitations of this method are discussed in the light of uncertainty analysis. Experimental implementation of this method is described, and the feasibility of TSP-based global skin friction diagnostics is examined in impinging jet experiments. The normalized skin friction distributions extracted by using this method are in fairly good agreement with hot-film skin friction measurements and the theoretical solutions in the normal and oblique impinging jets

  20. Hyaluronic acid: A key molecule in skin aging

    Papakonstantinou, Eleni; Roth, Michael; Karakiulakis, George

    2012-01-01

    Skin aging is a multifactorial process consisting of two distinct and independent mechanisms: intrinsic and extrinsic aging. Youthful skin retains its turgor, resilience and pliability, among others, due to its high content of water. Daily external injury, in addition to the normal process of aging, causes loss of moisture. The key molecule involved in skin moisture is hyaluronic acid (HA) that has unique capacity in retaining water. There are multiple sites for the control of HA synthesis, d...

  1. Experimental diabetes exacerbates skin transplant rejection in rats

    Flávio Pola dos Reis; Angelo Sementilli; Antonio Ricardo de Toledo Gagliardi

    2013-01-01

    PURPOSE: To investigate the effect of chronic experimental diabetes on skin allografts in rats as a simple model that could clarify some basic aspects and mechanisms involved in transplant rejection in diabetes compared to normal animals. METHODS: Skin grafting was performed with fragments of tail skin from sex matched non diabetic Wistar rats engrafted onto the thoracic area of diabetic and non diabetic recipients. Grafts were scored for rejection every other day and were removed on day 14. ...

  2. Skin manifestations in a case of trisomy 16 mosaicism

    Ousager, Lilian Bomme; Brandrup, Flemming; Andersen, Charlotte Brasch;

    2006-01-01

    We present a 48-year-old man with unilateral dermatological manifestations including hypertrichosis, telangiectasia, hyperkeratosis and hyperpigmentation. Additional findings included skeletal abnormalities and left-sided hearing loss. Skin biopsies showed changes characteristic of porokeratosis........ Fibroblast karyotyping from affected skin demonstrated trisomy 16 mosaicism, in contrast to the normal karyotype in unaffected skin and blood lymphocytes. The possible role of trisomy 16 in porokeratosis is discussed....

  3. PIV Measurements and Mechanisms of Adjacent Synthetic Jets Interactions

    LUO Zhen-Bing; XIA Zhi-Xun

    2008-01-01

    Interactions of adjacent synthetic jet actuators with varying relative amplitude and the relative phase of driving voltage are measured using a particle image velocimetry(PIV).Varying relative amplitude or relative phase of driving voltage of the adjacent actuators vectors the direction of the ensuing merged jet of the adjacent synthetic jets.The vectoring mechanism of the adjacent vortex pairs,attract-impact causing deflection(AICD),is provided to explain why the merged jet is generally vectored to the side of the phase-leading synthetic jet or the synthetic jet with higher driving voltage.

  4. 生理盐水联合酒精应用的不同方式对皮试消毒的效果分析%An Analysis on Effect of Different Application Ways of Normal Saline plus Alcohol on Skin Test

    罗艳; 孔碧华; 李冬芬

    2015-01-01

    Objective:To study the sterilizing effect of different application ways of sodium chloride(0 .9% ) plus alcohol(75% ) in the area of skin test .Methods:Select a total of 600 cases of patients who were infused in clinic and has to have a allergy skin test of tetanus antitoxin in some hospital during the period from January 2013 to December , randomly divide them into wiping group and spraying group .The wiping group were wiped with sodium chloride (0 .9% ) firstly ,and then were sterilized with alcohol(75% ) in the same way ,finally took the skin test .The spraying group were sterilized with alcohol(75% ) in the same way above first ,and then were sprayed with the spray bottle containing sodium chloride(0 .9% ) towards the area wiped with alcohol ,dry the sterilized area with sterile swabs and take the skin test .20 minutes later ,Compare and observe the false positive rate after skin test ,infection rate ,the prev‐alence of anaphylactic reaction after medication in the two groups ,sterilizing quantity in sterilized area .Results:False positive rate of the wiping group and spraying group was 0 .7% and 3 .3 respectively (P< 0 .05) .None of them showed any skin infection and allergy in both group .As for the quantity of sterilized bacteria in the two groups after medicating ,the quantity of the wiping group was less than that of spraying group ,the difference was comparatively obvious (P<0 .05) .Conclusion:The safety application of the wipe and spray of normal saline plus and alcohol in the sterilization of skin test lower the false positive rate resulted from skin sanitizer ,alleviate patients'suffering and it is more effective ,saves health resources ,reduces the workload and improves clinical working efficiency .%目的:探讨运用0.9%氯化钠(即生理盐水)联合75%乙醇应用的不同方式对皮试区皮肤消毒效果的研究。方法:选取某院2013年1~12月的门诊输液需进行过伤风抗病毒素过敏皮试的患者共600

  5. Impact of electromechanical parameter variations in treatment volume doses and adjacent structures

    ICRU Report 62 recommends that radiotherapy treatment dose should be prescribed in such a way that the dose to the target volume varies no more than 10%. In order to keep this goal, a very important role is played by the quality assurance (QA) of the treatment unit associated to the high level work of the personnel involved in planning and patient treatment. This paper shows the influence of the main electrical and mechanical linear accelerator parameters: field size, source-skin distance, gantry angle and light x radiation field coincidence in tumor volume and adjacent organ doses. We simulated a cubic tumor and a cubic adjacent critical organ in a cubic phantom and used a 3D Prowess system for planning. The treatment has been simulated for a 6 MV linear accelerator. We simulated two treatment planning: one using all the parameters inside their tolerance limits and another doubling these limits. The final results have show that, if the irradiation machine operates out of the tolerance limits, the dose variation in the planning target volume (PTV) can goes till ± 5,8% and in the critical adjacent organ till ± 7,7%. Therefore we concluded that, according to the complexity of the treatment, it can be necessary to reduce the tolerance levels advised by the IAEA/TECDOC - 1151. (author)

  6. Skin-sparing mastectomy.

    González, Eduardo G; Rancati, Alberto O

    2015-12-01

    The surgical treatment of breast cancer has evolved rapidly in recent decades. Conservative treatment was adopted in the late 1970s, with rates above 70%, and this was followed by a period during which the indications for surgical intervention were expanded to those patients at high risk for BRCA1, BRCA2 mutations, and also due to new staging standards and use of nuclear magnetic resonance. This increase in the indications for mastectomy coincided with the availability of immediate breast reconstruction as an oncologically safe and important surgical procedure for prevention of sequelae. Immediate reconstruction was first aimed at correcting the consequences of treatment, and almost immediately, the challenge of the technique became the achievement of a satisfactory breast appearance and shape, as well as normal consistency. The skin-sparing mastectomy (SSM) in conservation first and nipple-areola complex (NAC) later was a result of this shift that occurred from the early 1990s to the present. The objective of this review is to present all these developments specifically in relation to SSM and analyze our personal experience as well as the experience of surgeons worldwide with an emphasis on the fundamental aspects, indications, surgical technique, complications, oncological safety, and cosmetic results of this procedure. PMID:26645008

  7. Ectodermal dysplasia-skin fragility syndrome

    Vijay S Adhe

    2011-01-01

    Full Text Available Ectodermal dysplasia-skin fragility (EDSF syndrome is a rare and first described inherited disorder of desmosomes. It occurs due to loss-of-function mutations in PKP1 gene resulting in poorly formed desmosomes and loss of desmosomal and epidermal integrity. We report a case of a 2-year-old Indian male child who presented with palmoplantar hyperkeratosis with fissuring, short, sparse, and easily pluckable scalp hair, nail dystrophy, and multiple erosions over the skin. Skin biopsy showed epidermal hyperplasia with widening of intercellular spaces. His developmental milestones were delayed but intelligence was normal. Echocardiography, X-ray chest, and electrocardiogram were normal. Very few cases of this syndrome have been reported in the literature. We consider this as the first case report from India.

  8. Skin mirrors human aging.

    Nikolakis, Georgios; Makrantonaki, Evgenia; Zouboulis, Christos C

    2013-12-01

    Abstract Aged skin exhibits disturbed lipid barrier, angiogenesis, production of sweat, immune functions, and calcitriol synthesis as well as the tendency towards development of certain benign or malignant diseases. These complex biological processes comprise endogenous and exogenous factors. Ethnicity also markedly influences the phenotype of skin aging. The theories of cellular senescence, telomere shortening and decreased proliferative capacity, mitochondrial DNA single mutations, the inflammation theory, and the free radical theory try to explain the biological background of the global aging process, which is mirrored in the skin. The development of advanced glycation end-products and the declining hormonal levels are major factors influencing intrinsic aging. Chronic photodamage of the skin is the prime factor leading to extrinsic skin aging. The deterioration of important skin functions, due to intrinsic and extrinsic aging, leads to clinical manifestations, which mirror several internal age-associated diseases such as diabetes, arterial hypertension and malignancies. PMID:25436743

  9. Possible role for metallothionein in the cellular defense mechanism against UVB irradiation in neonatal human skin fibroblasts

    The role of metallothionein (MT) in protecting skin cells against UVB irradiation was investigated. Fibroblast strains from normal adult (HS-K) and neonatal (NB1RGB) human skins as well as keratinocyte strains from human skin (SV40-HSK) and newborn Balb/c mouse skin (Pam 212) were exposed to UVB irradiation. (Author)

  10. On spectral hypergraph theory of the adjacency tensor

    Pearson, Kelly J.; Zhang, Tan

    2012-01-01

    We study both $H$ and $E/Z$-eigenvalues of the adjacency tensor of a uniform multi-hypergraph and give conditions for which the largest positive $H$ or $Z$-eigenvalue corresponds to a strictly positive eigenvector. We also investigate when the $E$-spectrum of the adjacency tensor is symmetric.

  11. In vivo study of human skin using pulsed terahertz radiation

    Pickwell, E [Semiconductor Physics Group, Cavendish Laboratory, Cambridge University, Madingley Road, Cambridge CB3 0HE (United Kingdom); Cole, B E [TeraView Ltd, Unit 302/4 Cambridge Science Park, Cambridge CB4 0WG (United Kingdom); Fitzgerald, A J [TeraView Ltd, Unit 302/4 Cambridge Science Park, Cambridge CB4 0WG (United Kingdom); Pepper, M [Semiconductor Physics Group, Cavendish Laboratory, Cambridge University, Madingley Road, Cambridge CB3 0HE (United Kingdom); Wallace, V P [TeraView Ltd, Unit 302/4 Cambridge Science Park, Cambridge CB4 0WG (United Kingdom)

    2004-05-07

    Studies in terahertz (THz) imaging have revealed a significant difference between skin cancer (basal cell carcinoma) and healthy tissue. Since water has strong absorptions at THz frequencies and tumours tend to have different water content from normal tissue, a likely contrast mechanism is variation in water content. Thus, we have previously devised a finite difference time-domain (FDTD) model which is able to closely simulate the interaction of THz radiation with water. In this work we investigate the interaction of THz radiation with normal human skin on the forearm and palm of the hand in vivo. We conduct the first ever systematic in vivo study of the response of THz radiation to normal skin. We take in vivo reflection measurements of normal skin on the forearm and palm of the hand of 20 volunteers. We compare individual examples of THz responses with the mean response for the areas of skin under investigation. Using the in vivo data, we demonstrate that the FDTD model can be applied to biological tissue. In particular, we successfully simulate the interaction of THz radiation with the volar forearm. Understanding the interaction of THz radiation with normal skin will form a step towards developing improved imaging algorithms for diagnostic detection of skin cancer and other tissue disorders using THz radiation.

  12. Chronologic and actinically induced aging in human facial skin

    Clinical and histologic stigmata of aging are much more prominent in habitually sun-exposed skin than in sun-protected skin, but other possible manifestations of actinically induced aging are almost unexplored. We have examined the interrelation of chronologic and actinic aging using paired preauricular (sun-exposed) and postauricular (sun-protected) skin specimens. Keratinocyte cultures derived from sun-exposed skin consistently had a shorter in vitro lifespan but increased plating efficiency compared with cultures derived from adjacent sun-protected skin of the same individual, confirming a previous study of different paired body sites. Electron microscopic histologic sections revealed focal abnormalities of keratinocyte proliferation and alignment in vitro especially in those cultures derived from sun-exposed skin and decreased intercellular contact in stratified colonies at late passage, regardless of donor site. One-micron histologic sections of the original biopsy specimens revealed no striking site-related keratinocyte alterations, but sun-exposed specimens had fewer epidermal Langerhans cells (p less than 0.001), averaging approximately 50 percent the number in sun-protected skin, a possible exaggeration of the previously reported age-associated decrease in this cell population. These data suggest that sun exposure indeed accelerates aging by several criteria and that, regardless of mechanism, environmental factors may adversely affect the appearance and function of aging skin in ways amenable to experimental quantitation

  13. Normal saline wound dressing--is it really normal?

    Lim, J K; Saliba, L; Smith, M J; McTavish, J; Raine, C; Curtin, P

    2000-01-01

    Gauze swabs soaked in normal saline are frequently used as dressing on open wounds. Their exact mechanism of action is not known. This study was designed to assess the hypothesis that normal saline dressings act in part as an osmotic dressing. Ten patients had skin ulcers (n = 10) dressed with normal saline soaked sponges. Acting as controls (n = 10) identical sponges were placed upon intact skin. The sponge fluid osmolarity and electrolyte concentrations were serially assayed to test our hypothesis. In the control group, the osmolarity, sodium and chloride concentrations increased with time as a result of evaporation, altering it from an isotonic to a hypertonic dressing. However, in the ulcer group, the osmolarity, sodium and chloride concentrations in the sponge fluid remained relatively isotonic with time. This result is statistically significant (Pisotonicity. The dressing remains functional provided that the wound fluid is absorbed freely from the wound. This process is terminated when either the dressing completely absorbs the wound fluid or the dressing dries out. The latter often occurs prematurely in a contaminated wound or in a wound where exudate forms a non-permeable barrier which prevents osmosis and allows the remaining water in the dressing to evaporate completely. This correlates with the observation in clinical practice that for maximum efficacy the dressing should be changed regularly. PMID:10657448

  14. Real significance of skin contamination is

    For five decades, health physicists have discussed the thickness, area, significance of radioactive contamination and the exposures to various portions of the skin. Concern about instances of skin contamination extend beyond the resultant organ dose simply because it is a recognizable and quantifiable event. As such, there is a tendency for management and regulatory agencies to use it as a trend indicator. The final result is a score card similar to the list of OSHA reportable accidents. In fact, the skin contamination incidence rate has a somewhat different meaning to the health physicist, to the manager, and to the regulator. The question must then be asked, What is the true significance of skin contamination, Is it the resultant skin dose, Is it an indicator of loss of control, Is it both or neither. In order to answer these questions, Rockwell Hanford Operations began analysis of the previous five years records of skin contamination cases. Since by policy each incidence of skin contamination is documented, a large percentage of the 425 records analyzed were of low level activity (less than 100 dpm/cm2) on the extremeties, primarily hands and fingers. Most of these cases were readily decontaminated with soap and water. Individual elements studied included: detection/monitoring methods and limits; impact of type of operation on the incidence rate; causes of and methods for reduction of the incidence rate; reporting and documentation; and dose assessment. Results of the study indicate that skin contamination rarely presents a beta dose problem because it is normally highly localized on the extremeties. Only in unusual cases does it represent a potential for internal deposition. Thus, the real importance of skin contamination incidence is as an indicator of deteriorating conditions and should be reviewed by health physicists, managers and regulators as such

  15. Sensitive skin: An overview

    Inamadar, Arun C.; Aparna Palit

    2013-01-01

    Sensitive skin is less tolerant to frequent and prolonged use of cosmetics and toiletries. It is self-diagnosed and typically unaccompanied by any obvious physical signs of irritation. With the change in lifestyle and also with increased opportunity to use many new brands of cosmetics and toiletries, there has been an increase in females complaining of unique sensation in their facial skin. Sensitive skin presents as smarting, burning, stinging, itching, and/or tight sensation in their facial...

  16. Archaea on human skin

    Alexander J Probst; Auerbach, Anna K.; Christine Moissl-Eichinger

    2013-01-01

    The recent era of exploring the human microbiome has provided valuable information on microbial inhabitants, beneficials and pathogens. Screening efforts based on DNA sequencing identified thousands of bacterial lineages associated with human skin but provided only incomplete and crude information on Archaea. Here, we report for the first time the quantification and visualization of Archaea from human skin. Based on 16 S rRNA gene copies Archaea comprised up to 4.2% of the prokaryotic skin mi...

  17. Skin tribology: Science friction?

    Heide, van der, M.; X. Zeng; Masen, M.A.

    2013-01-01

    The application of tribological knowledge is not just restricted to optimizing mechanical and chemical engineering problems. In fact, effective solutions to friction and wear related questions can be found in our everyday life. An important part is related to skin tribology, as the human skin is frequently one of the interacting surfaces in relative motion. People seem to solve these problems related to skin friction based upon a trial-and-error strategy and based upon on our sense for touch....

  18. Study on Optimization of Phase Offset at Adjacent Intersections

    Yuanli GU

    2010-11-01

    Full Text Available Optimization of the phase offset at adjacent intersections is the key parameter regarding coordinated control of traffic signal for adjacent intersections, which decides the effect of the coordinated control for adjacent intersections. According to characters of saturated traffic flow of Chinese urban road, this thesis establishes a model for optimization of phase offset for adjacent interactions and finds a solution from such model by adopting genetic algorithm. The model is verified by actual traffic flow datum of two adjacent signal intersections on Changan Avenue. Then a comparison is made between the optimization result of such model and that of the existing mathematical method and SYNCHRO model, which indicates that the model established by this thesis can reduce the delay suffered by vehicles at the intersections and increase the traffic efficiency of the intersections.

  19. Neuromodulators for Aging Skin

    ... Skin Rejuvenation Soft-tissue Fillers Combination: Soft-tissue Fillers and Neuromodulators Neuromodulators – wrinkle-relaxing injections of botulinum toxin commercially known as Botox, Dysport ...

  20. Skin Images Segmentation

    Ali E. Zaart

    2010-01-01

    Full Text Available Problem statement: Image segmentation is a fundamental step in many applications of image processing. Skin cancer has been the most common of all new cancers detected each year. At early stage detection of skin cancer, simple and economic treatment can cure it mostly. An accurate segmentation of skin images can help the diagnosis to define well the region of the cancer. The principal approach of segmentation is based on thresholding (classification that is lied to the problem of the thresholds estimation. Approach: The objective of this study is to develop a method to segment the skin images based on a mixture of Beta distributions. We assume that the data in skin images can be modeled by a mixture of Beta distributions. We used an unsupervised learning technique with Beta distribution to estimate the statistical parameters of the data in skin image and then estimate the thresholds for segmentation. Results: The proposed method of skin images segmentation was implemented and tested on different skin images. We obtained very good results in comparing with the same techniques with Gamma distribution. Conclusion: The experiment showed that the proposed method obtained very good results but it requires more testing on different types of skin images.

  1. Bone Marrow Cell Transfer into Fetal Circulation Can Ameliorate Genetic Skin Diseases by Providing Fibroblasts to the Skin and Inducing Immune Tolerance

    Chino, Takenao; Tamai, Katsuto; Yamazaki, Takehiko; Otsuru, Satoru; Kikuchi, Yasushi; Nimura, Keisuke; Endo, Masayuki; Nagai, Miki; Uitto, Jouni; Kitajima, Yasuo; Kaneda, Yasufumi

    2008-01-01

    Recent studies have shown that skin injury recruits bone marrow-derived fibroblasts (BMDFs) to the site of injury to accelerate tissue repair. However, whether uninjured skin can recruit BMDFs to maintain skin homeostasis remains uncertain. Here, we investigated the appearance of BMDFs in normal mouse skin after embryonic bone marrow cell transplantation (E-BMT) with green fluorescent protein-transgenic bone marrow cells (GFP-BMCs) via the vitelline vein, which traverses the uterine wall and ...

  2. Delayed acquisition of non-adjacent vocalic distributional regularities.

    Gonzalez-Gomez, Nayeli; Nazzi, Thierry

    2016-01-01

    The ability to compute non-adjacent regularities is key in the acquisition of a new language. In the domain of phonology/phonotactics, sensitivity to non-adjacent regularities between consonants has been found to appear between 7 and 10 months. The present study focuses on the emergence of a posterior-anterior (PA) bias, a regularity involving two non-adjacent vowels. Experiments 1 and 2 show that a preference for PA over AP (anterior-posterior) words emerges between 10 and 13 months in French-learning infants. Control experiments show that this bias cannot be explained by adjacent or positional preferences. The present study demonstrates that infants become sensitive to non-adjacent vocalic distributional regularities between 10 and 13 months, showing the existence of a delay for the acquisition of non-adjacent vocalic regularities compared to equivalent non-adjacent consonantal regularities. These results are consistent with the CV hypothesis, according to which consonants and vowels play different roles at different linguistic levels. PMID:25786491

  3. Shark skin: function in locomotion.

    Wainwright, S A; Vosburgh, F; Hebrank, J H

    1978-11-17

    Hydrostatic pressure under the skin of sharks varies with swimming speed. Stress in the skin varies with the internal pressure, and the skin stress controls skin stiffness. Locomotory muscles attach to the skin which is thus a whole-body exotendon whose mechanical advantage in transmitting muscular contraction is greater than that of the endoskeleton. PMID:17807247

  4. Effect of Age on Tooth Shade, Skin Color and Skin-Tooth Color Interrelationship in Saudi Arabian Subpopulation

    Haralur, Satheesh B

    2015-01-01

    Background: Dental restoration or prosthesis in harmony with adjacent natural teeth color is indispensable part for the successful esthetic outcome. The studies indicate is existence of correlation between teeth and skin color. Teeth and skin color are changed over the aging process. The aim of the study was to explore the role of age on the tooth and skin color parameters, and to investigate the effect of ageing on teeth-skin color correlation. Materials and Methods: Total of 225 Saudi Arabian ethnic subjects was divided into three groups of 75 each. The groups were divided according to participant’s age. The participant’s age for Group I, Group II, and Group III was 18-29 years, 30-50 years, and above 50 years, respectively. The tooth color was identified by spectrophotometer in CIE Lab parameters. The skin color was registered with skin surface photography. The data were statistically analyzed with one-way ANOVA and correlation tests with SPSS 18 software. Results: The Group I had the highest ‘L’ value of 80.26, Group III recorded the least value of 76.66. The Group III had highest yellow value ‘b’ at 22.72, while Group I had 19.19. The skin ‘L’ value was highest in the young population; the elder population had the increased red value ‘a’ in comparison to younger subjects. The ‘L’ tooth color parameter had a strong positive linear correlation with skin color in young and adult subjects. While Group III teeth showed the strong positive correlation with ‘b’ parameter at malar region. Conclusion: The elder subjects had darker and yellow teeth in comparison with younger subjects. The reddening of the skin was observed as age-related skin color change. The age had a strong influence on the teeth-skin color correlation. PMID:26464536

  5. Skin to posterior lumbar epidural space distance

    To measure the clinically relevant skin to posterior lumbar epidural space distance in adult surgical patients and to correlate this distance with the patient physical factors to construct a model for the prediction of this distance using the correlation. The study was carried out in 100 patients divided into three groups, who were scheduled for different surgical procedures. Group-I consisted of female patients scheduled for lower segment caesarian section (L.S.C.S); group-II adult non-pregnant females undergoing elective surgery and group-III adult males undergoing different surgical procedures. Epidural anaesthesia was given, using loss of resistance (LOR) technique, and skin to posterior epidural space was measured. The mean skin to posterior lumbar epidural space distance was found to be 3.8 +- 0.5 cm in group-I, 3.76 +- 0.7 cm in group- II and 4.0 +- 0.5 cm in group-III. Skin to posterior epidural space distance correlates best with weight of the patient. Posterior lumbar skin to epidural space distance has been found to be less than what is normal in rest of the world. These results may be used as a guideline for performing successful epidural blocks in Pakistani population. A reliable model using patient physical factors to predict skin to posterior epidural space distance could not be constructed. (author)

  6. Examine Your Skin

    Full Text Available ... Your Skin Watch the video below and in only two minutes, you can learn to examine your skin. A special thanks to Dr. Martin Weinstock, MD, PhD, Professor of Dermatology, Brown University, for permission to use this video. UPDATED: February ...

  7. Deformable skinning on bones

    Larsen, Bent Dalgaard; Petersen, Kim Steen; Jakobsen, Bjarke

    2001-01-01

    Applying skin to a model is a relatively simple task to implement. Nonetheless it seems that no good resource exists that describes both the concepts and math necessary to understand and implement skinning. The intention of this article is an attempt to give a thoroughly description of the theore...

  8. Skin Diseases: Skin and Sun—Not a good mix

    Skip Navigation Bar Home Current Issue Past Issues Skin Diseases Skin and Sun —Not a good mix Past Issues / ... of this page please turn Javascript on. Good skin care begins with sun safety. Whether it is ...

  9. Frequent DPH3 promoter mutations in skin cancers.

    Denisova, Evgeniya; Heidenreich, Barbara; Nagore, Eduardo; Rachakonda, P Sivaramakrishna; Hosen, Ismail; Akrap, Ivana; Traves, Víctor; García-Casado, Zaida; López-Guerrero, José Antonio; Requena, Celia; Sanmartin, Onofre; Serra-Guillén, Carlos; Llombart, Beatriz; Guillén, Carlos; Ferrando, Jose; Gimeno, Enrique; Nordheim, Alfred; Hemminki, Kari; Kumar, Rajiv

    2015-11-01

    Recent reports suggested frequent occurrence of cancer associated somatic mutations within regulatory elements of the genome. Based on initial exome sequencing of 21 melanomas, we report frequent somatic mutations in skin cancers in a bidirectional promoter of diphthamide biosynthesis 3 (DPH3) and oxidoreductase NAD-binding domain containing 1 (OXNAD1) genes. The UV-signature mutations occurred at sites adjacent and within a binding motif for E-twenty six/ternary complex factors (Ets/TCF), at -8 and -9 bp from DPH3 transcription start site. Follow up screening of 586 different skin lesions showed that the DPH3 promoter mutations were present in melanocytic nevi (2/114; 2%), melanoma (30/304; 10%), basal cell carcinoma of skin (BCC; 57/137; 42%) and squamous cell carcinoma of skin (SCC; 12/31; 39%). Reporter assays carried out in one melanoma cell line for DPH3 and OXNAD1 orientations showed statistically significant increased promoter activity due to -8/-9CC > TT tandem mutations; although, no effect of the mutations on DPH3 and OXNAD1 transcription in tumors was observed. The results from this study show occurrence of frequent somatic non-coding mutations adjacent to a pre-existing binding site for Ets transcription factors within the directional promoter of DPH3 and OXNAD1 genes in three major skin cancers. The detected mutations displayed typical UV signature; however, the functionality of the mutations remains to be determined. PMID:26416425

  10. Interactions of adjacent pulsating, erupting and creeping solitons

    Song Li-Jun; Li Lu; Zhou Guo-Sheng

    2007-01-01

    This paper investigates the adjacent interactions of three novel solitons for the quintic complex Ginzburg-Landau equation, which are plain pulsating, erupting and creeping solitons. It is found that different performances are presented for different solitons due to isolated regions of the parameter space where they exist. For example, plain pulsating and erupting solitons exhibit mutual annihilation during collisions with the decrease of total energy, but for creeping soliton,the two adjacent pulses present soliton fusion without any loss of energy. Otherwise, the method for restraining the interactions is also found and it can suppress interacions between these two adjacent pulses effectively.

  11. Stratum corneum integrity as a predictor for peristomal skin problems in ostomates

    Nybaek, H; Lophaven, Søren Nymand; Karlsmark, T;

    2010-01-01

    disruption [sodium lauryl sulphate (SLS) 0.25%]. RESULTS: Patients and controls had a highly significant increase in TEWL value in the peristomal area compared with nonperistomal contralateral abdominal skin (P < 0.0001 for both groups). The skin barrier of normal-looking contralateral skin of ostomates was...

  12. Bionanomaterials for skin regeneration

    Leonida, Mihaela D

    2016-01-01

    This book gives a concise overview of bionanomaterials with applications for skin regeneration. The advantages and challenges of nanoscale materials are covered in detail, giving a basic view of the skin structure and conditions that require transdermal or topical applications. Medical applications, such as wound healing, care for burns, skin disease, and cosmetic care, such as aging of the skin and photodamage, and how they benefit from bionanomaterials, are described in detail. A final chapter is devoted to the ethical and social issues related to the use of bionanomaterials for skin regeneration. This is an ideal book for researchers in materials science, medical scientists specialized in dermatology, and cosmetic chemists working in formulations. It can also serve as a reference for nanotechnologists, dermatologists, microbiologists, engineers, and polymer chemists, as well as students studying in these fields.

  13. Pathological skin picking: case presentation and review of the literature

    Maria Isabela Sarbu

    2015-04-01

    Full Text Available Pathological skin picking is a condition in which patients induce skin lesions through repetitive, compulsive excoriations of normal skin or skin with minor surface irregularities and they admit their role in the production of the lesions, but are unable to stop their behavior. Psychiatric comorbidities most often associated with skin picking include obsessive-compulsive disorder (OCD, anxiety disorders, mood disorders, body dysmorphic disorders, trichotillomania and compulsive-buying disorder. We report the case of a 17 year old female patient who addressed the dermatology department of our hospital with an eruption consisting of erythematous papules and plaques. The local examination revealed several clues of paramount importance in drawing the final conclusion and the psychiatric examination helped establish the diagnosis of pathological skin picking in a patient with obsessive-compulsive disorder.

  14. The role of the skin microbiome in atopic dermatitis.

    Williams, Michael R; Gallo, Richard L

    2015-11-01

    Atopic dermatitis (AD) is a common skin disease that affects a large proportion of the population worldwide. The incidence of AD has increased over the last several decades along with AD's burden on the physical and psychological health of the patient and family. However, current advances in understanding the mechanisms behind the pathophysiology of AD are leading to a hopeful outlook for the future. Staphylococcus aureus (S. aureus) colonization on AD skin has been directly correlated to disease severity but the functions of other members of the skin bacterial community may be equally important. Applying knowledge gained from understanding the role of the skin microbiome in maintaining normal skin immune function, and addressing the detrimental consequences of microbial dysbiosis in driving inflammation, is a promising direction for development of new treatments. This review discusses current preclinical and clinical research focused on determining how the skin microbiome may influence the development of AD. PMID:26404536

  15. Prevalence of Common Skin Diseases and Their Associated Factors among Military Personnel in Korea: A Cross-sectional Study

    Bae, Jung Min; Ha, Beomman; Lee, Hongsun; Park, Chang Keun; Kim, Hyun Joon; Park, Young Min

    2012-01-01

    This study was conducted to clarify the prevalence of common skin diseases and their associated factors among military personnel in Korea. Four dermatologists visited adjacent military units and examined soldiers. A structured questionnaire that included questions about known skin diseases, demographic information, and questions for the Perceived Stress Index was completed for each participant. The soldiers that had been diagnosed with a skin disease answered one additional questionnaire (Ski...

  16. A study on the quantitative evaluation of skin barrier function

    Maruyama, Tomomi; Kabetani, Yasuhiro; Kido, Michiko; Yamada, Kenji; Oikaze, Hirotoshi; Takechi, Yohei; Furuta, Tomotaka; Ishii, Shoichi; Katayama, Haruna; Jeong, Hieyong; Ohno, Yuko

    2015-03-01

    We propose a quantitative evaluation method of skin barrier function using Optical Coherence Microscopy system (OCM system) with coherency of near-infrared light. There are a lot of skin problems such as itching, irritation and so on. It has been recognized skin problems are caused by impairment of skin barrier function, which prevents damage from various external stimuli and loss of water. To evaluate skin barrier function, it is a common strategy that they observe skin surface and ask patients about their skin condition. The methods are subjective judgements and they are influenced by difference of experience of persons. Furthermore, microscopy has been used to observe inner structure of the skin in detail, and in vitro measurements like microscopy requires tissue sampling. On the other hand, it is necessary to assess objectively skin barrier function by quantitative evaluation method. In addition, non-invasive and nondestructive measuring method and examination changes over time are needed. Therefore, in vivo measurements are crucial for evaluating skin barrier function. In this study, we evaluate changes of stratum corneum structure which is important for evaluating skin barrier function by comparing water-penetrated skin with normal skin using a system with coherency of near-infrared light. Proposed method can obtain in vivo 3D images of inner structure of body tissue, which is non-invasive and non-destructive measuring method. We formulate changes of skin ultrastructure after water penetration. Finally, we evaluate the limit of performance of the OCM system in this work in order to discuss how to improve the OCM system.

  17. Sun Safety: Save Your Skin

    Full Text Available ... brown hair been treated for skin cancer a family member who's had skin cancer If you take ... Day” offers simple steps that you and your family can take to prevent sun-related skin cancer, ...

  18. Griset: Pottery of the Great Basin and Adjacent Areas

    Forsyth, Donald W.

    1986-01-01

    Pottery of the Great Basin and Adjacent Areas. Suzanne Griset, ed. University of Utah Anthropological Papers No. Ill, 1986, 170 pp., 34 figs., 5 tables, annotated and indexed bibliography, $17.50 (paper).

  19. Skin and Psyche : Diversionary Symbiosis

    Sharma, YK; Sudarsanan, S.; Bhatnagar, A

    2005-01-01

    A significant proportion of patients with skin diseases have associated psychosocial factors. Not only does psychopathology manifest on the skin in absence of any real skin disease, primary skin disorders can also be exacerbated by emotional stress adversely influencing the homeostasis of immunological and inflammatory processes in deeper layers of the skin. Furthermore, many patients develop emotional problems as a result of having disfiguring skin diseases. In addition, some patients having...

  20. Archaea on human skin.

    Alexander J Probst

    Full Text Available The recent era of exploring the human microbiome has provided valuable information on microbial inhabitants, beneficials and pathogens. Screening efforts based on DNA sequencing identified thousands of bacterial lineages associated with human skin but provided only incomplete and crude information on Archaea. Here, we report for the first time the quantification and visualization of Archaea from human skin. Based on 16 S rRNA gene copies Archaea comprised up to 4.2% of the prokaryotic skin microbiome. Most of the gene signatures analyzed belonged to the Thaumarchaeota, a group of Archaea we also found in hospitals and clean room facilities. The metabolic potential for ammonia oxidation of the skin-associated Archaea was supported by the successful detection of thaumarchaeal amoA genes in human skin samples. However, the activity and possible interaction with human epithelial cells of these associated Archaea remains an open question. Nevertheless, in this study we provide evidence that Archaea are part of the human skin microbiome and discuss their potential for ammonia turnover on human skin.

  1. Occupational skin cancers

    Gawkrodger, D.J. [Royal Hallamshire Hospital, Sheffield (United Kingdom). Dept. of Dermatology

    2004-10-01

    Skin cancer due to occupation is more common than is generally recognized, although it is difficult to obtain an accurate estimate of its prevalence. Over the past two centuries, occupational skin cancers have particularly been due to industrial exposure of men (it seems more so than women) to chemical carcinogens such as polycyclic hydrocarbons (e.g. from coal tar products) or to arsenic. Industrial processes have improved in most Western countries to limit this type of exposure, but those with outdoor occupations are still exposed to solar ultraviolet irradiation without this being widely recognized as an industrial hazard. Ionizing radiation such as X-rays can also cause skin cancer. Occupational skin cancers often resemble skin tumours found in non-occupational subjects, e.g. basal cell carcinoma, squamous cell carcinoma and malignant melanoma, but some pre-malignant lesions can be more specific and point to an occupational origin, e.g. tar keratoses or arsenical keratoses. An uncommon but well-recognized cause of occupational skin cancer is that which results from scar formation following an industrial burn. In the future it will be necessary to focus on preventative measures, e.g. for outdoor workers, the need to cover up in the sun and use sun protective creams and a campaign for earlier recognition of skin cancers, which are usually curable if treated in their early stages.

  2. Hydromagnetic flow and heat transfer adjacent to a stretching vertical sheet in a micropolar fluid

    Yacob Nor Azizah

    2013-01-01

    Full Text Available An analysis is carried out for the steady two-dimensional mixed convection flow adjacent to a stretching vertical sheet immersed in an incompressible electrically conducting micropolar fluid. The stretching velocity and the surface temperature are assumed to vary linearly with the distance from the leading edge. The governing partial differential equations are transformed into a system of ordinary differential equations, which is then solved numerically using a finite difference scheme known as the Keller box method. The effects of magnetic and material parameters on the flow and heat transfer characteristics are discussed. It is found that the magnetic field reduces both the skin friction coefficient and the heat transfer rate at the surface for any given K and λ. Conversely, both of them increase as the material parameter increases for fixed values of M and λ.

  3. Analysis of effect of different construction methods of piles on the end effect on skin friction of piles

    ZHOU Hongbo; CHEN Zhuchang

    2007-01-01

    Based on the comparative analysis of end effect on skin friction of displacement-pile (driven pile),the end effect on skin friction of bored pile is studied.The end effect on skin friction between driven pile and bored pile is different and the end effect on skin friction of bored pile is reduce of skin friction in the soil layer adjacent to the pile end.The degradation degree of skin friction is deduced with the increase of the distance from pile end.The concept of additional mud cake formed by the effect of cushion at the bottom of borehole during pouring concrete is introduced to explain the mechanism of end effect on skin friction of the bored pile.The test results of post-grouting piles indicate that the post-grouting technique is an effective way to improve the end effect on skin friction of bored pile.

  4. Skin disorders at sea.

    Lucas, Ray; Boniface, Keith; Hite, Michael

    2010-01-01

    The purpose of this study is to characterize the types of skin disorders occurring at sea requiring acute treatment. The case logs of a tele-medicine service for US flagged ships at sea were reviewed from March 1, 2006 until March 1, 2009. Of 1844 total cases, 10% (n = 183) were for skin disorders. Sixty-eight percent (n = 125) were infections, 14% (n = 25) were inflammatory, 7% (n = 13) were environmental, and 11% (n = 20) were non-specific rashes. Cutaneous abscesses and cellulitis (n = 84) were the most common acute skin disorders encountered. In some cases (n = 81), still digital photographs aided in the diagnosis. PMID:20496321

  5. Autogenous skin transplant for repair of traumatic ventral hernia in sheep

    Nazhvani Dehghani, Seifollah; Nasrollahy, Mohtaram

    2006-01-01

    Traumatic ventral abdominal hernia is common in sheep. Fifteen adult sheep affected with large ventral hernia defect were treated. Skin was harvested from the same sheep and replaced for the defective abdominal muscle and sutured. Subcutaneous tissue and skin were opposed over the transplanted skin and sutured. The animals were evaluated clinically, haematologically and by biopsy. Clinically, the animals ate and drank normally after surgery. The transplanted skins were perfectly secured in pl...

  6. Mouse Genetic Models Reveal Surprising Functions of IκB Kinase Alpha in Skin Development and Skin Carcinogenesis

    Xia, Xiaojun [The Methodist Hospital Research Institute, Houston, TX 77030 (United States); Park, Eunmi [Department of Radiation Oncology, Dana-Farber Cancer Institute, Harvard Medical School, Boston, MA 02115 (United States); Fischer, Susan M. [Department of Molecular Carcinogenesis, The University of Texas MD Anderson Cancer Center, Smithville, TX 78967 (United States); Hu, Yinling, E-mail: huy2@mail.nih.gov [Cancer and Inflammation Program, Center for Cancer Research, Frederick National Laboratory for Cancer Research, Frederick, MD 21701 (United States)

    2013-02-15

    Gene knockout studies unexpectedly reveal a pivotal role for IκB kinase alpha (IKKα) in mouse embryonic skin development. Skin carcinogenesis experiments show that Ikkα heterozygous mice are highly susceptible to chemical carcinogen or ultraviolet B light (UVB) induced benign and malignant skin tumors in comparison to wild-type mice. IKKα deletion mediated by keratin 5 (K5).Cre or K15.Cre in keratinocytes induces epidermal hyperplasia and spontaneous skin squamous cell carcinomas (SCCs) in Ikkα floxed mice. On the other hand, transgenic mice overexpressing IKKα in the epidermis, under the control of a truncated loricrin promoter or K5 promoter, develop normal skin and show no defects in the formation of the epidermis and other epithelial organs, and the transgenic IKKα represses chemical carcinogen or UVB induced skin carcinogenesis. Moreover, IKKα deletion mediated by a mutation, which generates a stop codon in the Ikkα gene, has been reported in a human autosomal recessive lethal syndrome. Downregulated IKKα and Ikkα mutations and deletions are found in human skin SCCs. The collective evidence not only highlights the importance of IKKα in skin development, maintaining skin homeostasis, and preventing skin carcinogenesis, but also demonstrates that mouse models are extremely valuable tools for revealing the mechanisms underlying these biological events, leading our studies from bench side to bedside.

  7. Mouse Genetic Models Reveal Surprising Functions of IκB Kinase Alpha in Skin Development and Skin Carcinogenesis

    Gene knockout studies unexpectedly reveal a pivotal role for IκB kinase alpha (IKKα) in mouse embryonic skin development. Skin carcinogenesis experiments show that Ikkα heterozygous mice are highly susceptible to chemical carcinogen or ultraviolet B light (UVB) induced benign and malignant skin tumors in comparison to wild-type mice. IKKα deletion mediated by keratin 5 (K5).Cre or K15.Cre in keratinocytes induces epidermal hyperplasia and spontaneous skin squamous cell carcinomas (SCCs) in Ikkα floxed mice. On the other hand, transgenic mice overexpressing IKKα in the epidermis, under the control of a truncated loricrin promoter or K5 promoter, develop normal skin and show no defects in the formation of the epidermis and other epithelial organs, and the transgenic IKKα represses chemical carcinogen or UVB induced skin carcinogenesis. Moreover, IKKα deletion mediated by a mutation, which generates a stop codon in the Ikkα gene, has been reported in a human autosomal recessive lethal syndrome. Downregulated IKKα and Ikkα mutations and deletions are found in human skin SCCs. The collective evidence not only highlights the importance of IKKα in skin development, maintaining skin homeostasis, and preventing skin carcinogenesis, but also demonstrates that mouse models are extremely valuable tools for revealing the mechanisms underlying these biological events, leading our studies from bench side to bedside

  8. Ultrastructure of elastosis in facial rhytidectomy skin

    Skin from 19 facial rhytidectomies performed in patients with chronic solar damage was compared with postauricular skin from patients of similar age. Light microscopy demonstrated large areas of amorphous material that stained PAS positive in all 19 face-lift specimens, while none of the controls had such material. Electron microscopy of the ''elastotic'' material revealed large amorphous masses of granular material, with loss of the microfilament component of normal elastin. Current theories suggest that the elastotic material in solar-damaged skin is a product of radiation-damaged fibroblasts, rather than being either collagen or degenerated elastin. Such knowledge may help the plastic surgeons encourage rhytidectomy patients to protect themselves from solar radiation

  9. Effecting skin renewal: a multifaceted approach.

    Widgerow, Alan D; Grekin, Steven K

    2011-06-01

    The skin undergoes intrinsic aging as a normal course, but exposure to ultraviolet (UV) light results in major cumulative damage that manifests as the typical aged photodamaged skin. UV irradiation produces a sequence of changes within the skin layers starting with signaling processes following DNA damage and culminating in nonabsorbed fragmentation of collagen and other proteins within the extracellular matrix. These fragments promote the synthesis of matrix metalloproteinases (MMPs) that further aggravate the damage to the ground substance and add to fragment accumulation. This study describes a unique sequential approach to controlling this photodamage - inhibition of signaling, inhibition of MMPs, proteasome stimulation and mopping up of fragments, stimulation of procollagen and collagen production, and uniform packaging of new collagen fibers. Thus, a multifaceted approach is introduced with presentation of a unique product formulation based on these research principles. PMID:21649818

  10. In vivo multiphoton tomography of skin cancer

    König, Karsten; Riemann, Iris; Ehlers, Alexander; Buckle, Rainer; Dimitrow, Enrico; Kaatz, Martin; Fluhr, Joachim; Elsner, Peter

    2006-02-01

    The multiphoton tomograph DermaInspect was used to perform first clinical studies on the early non-invasive detection of skin cancer based on non-invasive optical sectioning of skin by two-photon autofluorescence and second harmonic generation. In particular, deep-tissue pigmented lesions -nevi- have been imaged with intracellular resolution using near infrared (NIR) femtosecond laser radiation. So far, more than 250 patients have been investigated. Cancerous tissues showed significant morphological differences compared to normal skin layers. In the case of malignant melanoma, the occurrence of luminescent melanocytes has been detected. Multiphoton tomography will become a novel non-invasive method to obtain high-resolution 3D optical biopsies for early cancer detection, treatment control, and in situ drug screening.

  11. Effect observation on repairing of soft tissue defect with tissue skin flaps%组织皮瓣修复软组织缺损的效果观察

    王占厚; 于晓姗; 王立明; 李格当

    2002-01-01

    @@ Backgroud: With the development of microsurgery and clinical applied anatomy, skin flaps and musculocutaneous flaps with vessel pedicles are primary choices in treatment of soft tissue defect. The transfer of skin flaps and muscular skin flaps with vessel pedicles is rather easy and need't special instruments. Because of utilization of adjacent tissue, the outline is good after operation.

  12. PREPARATIVE SKIN PREPARATION AND SURGICAL WOUND INFECTION

    Anjanappa

    2015-01-01

    Full Text Available BACKGROUND AND OBJECTIVE: It is an established fact now that the normal skin of healthy human beings harbours a rich bacterial fl ora. Normally considered non - pathogenic , these organisms way be a potential source of infection of the surgical wound. Approximately 20% of the resident flora is beyond the reach of surgical scrubs and antiseptics. The goal of surgical preparation of the skin with antiseptics is to remove transient and pathogenic microorganisms on the skin surface and to reduce the resident flora to a low level. Povidone iodine (I odophors and chlorhexidine are most often used antiseptics for pre - operative skin preparation. OBJECTIVES : To evaluate the efficacy of povidone iodine alone and in combination with antiseptic agent containing alcoholic chlorhexidine in preoperative skin p reparation by taking swab culture. (2 To compare the rate of postoperative wound infection in both the groups. METHODS: One hundred patients (fifty in each group undergoing clean elective surgery with no focus of infection on the body were included in th e study. The pre - operative skin preparation in each group is done with the respective antiseptic regimen. In both the groups after application of antiseptics , sterile saline swab culture was taken immediately from site of incision. In cases which showed gr owth of organisms , the bacteria isolated were identified by their morphological and cultural characteristics. Grams staining , coagulase test and antibiotic sensitivity test were done wherever necessary and difference in colonization rates was determined as a measure of efficacy of antiseptic regimen. RESULTS: The results of the study showed that when compared to povidone iodine alone , using a combination of povidone iodine and alcoholic solution of chlorhexidine , the colonization rates of the site of incisi on were reduced significantly. As for the rate of post - operative wound infection , it is also proven that wound infections are also

  13. Skin or nail culture

    Mucosal culture; Culture - skin; Culture - mucosal; Nail culture; Culture - fingernail; Fingernail culture ... There, it is placed in a special dish (culture). It is then watched to see if bacteria, ...

  14. Examine Your Skin

    Full Text Available ... Centers Online Resources The Melanoma Book Clinical Trials Patient Access Grant: Apply Download a Skin Self-Exam Card Download a Patient Navigation Card Events, Webinars & Videos Events, Webinars & Videos ...

  15. Dry Skin (Xerosis)

    ... skin may have cracks that resemble a dry lake bed. Inflammation of the areas may lead to ... free creams or ointments Preparations containing alpha-hydroxy acids such as glycolic acid or lactic acid Creams ...

  16. Skin Allergy Quiz

    ... Training Grants & Awards Program Directors Practice Resources ASTHMA IQ Consultation and Referral Guidelines Practice Financial Survey Practice ... Your local allergist can do a skin prick test or blood test to find out if you ...

  17. Laser Skin Renewal

    ... rashes clinical tools newsletter | contact Share | Skin Renewal, Laser A A A BEFORE: This patient wanted the appearance of his acne scars minimized by laser treatment. Procedure Overview Photorejuvenation, simply put, is the ...

  18. Layers of the Skin

    ... Review Abstracting, Coding, & Staging ICD-O Site Codes Morphology & Grade Extent of Disease Evaluation Physical Exam Lab ... the majority of the structure of the skin, hair, and nails. The squamous cell layer is the ...

  19. Necrotizing Skin Infections

    ... and Treatment Medical Dictionary Also of Interest (Quiz) Vitiligo (Video) Hives Additional Content Medical News Necrotizing Skin ... Professional Version Also of Interest Test your knowledge Vitiligo is a loss of melanocytes (cells that produce ...

  20. Fungal Skin Infections

    ... Skin Infections Medical Dictionary Also of Interest (Quiz) Vitiligo (Video) Hives Additional Content Medical News Overview of ... Professional Version Also of Interest Test your knowledge Vitiligo is a loss of melanocytes (cells that produce ...

  1. Aging changes in skin

    ... developing heat stroke increases. Growths such as skin tags , warts , rough patches (keratoses), and other blemishes are ... to the principles of the Health on the Net Foundation (www.hon.ch). The information provided herein ...

  2. Changes of color coordinates of biological tissue with superficial skin damage due to mechanical trauma

    Pteruk, Vail; Mokanyuk, Olexander; Kvaternuk, Olena; Yakenina, Lesya; Kotyra, Andrzej; Romaniuk, Ryszard S.; Dussembayeva, Shynar

    2015-12-01

    Change of color coordinates of normal and pathological biological tissues is based on calculated spectral diffuse reflection. The proposed color coordinates of normal and pathological biological tissues of skin provided using standard light sources, allowing accurately diagnose skin damage due to mechanical trauma with a blunt object for forensic problems.

  3. Spiritual and religious aspects of skin and skin disorders

    Shenefelt PD

    2014-08-01

    Full Text Available Philip D Shenefelt,1 Debrah A Shenefelt2 1Dermatology and Cutaneous Surgery, University of South Florida, Tampa, 2Congregation Or Ahavah, Lutz, FL, USA Abstract: Skin and skin disorders have had spiritual aspects since ancient times. Skin, hair, and nails are visible to self and others, and touchable by self and others. The skin is a major sensory organ. Skin also expresses emotions detectable by others through pallor, coldness, "goose bumps", redness, warmth, or sweating. Spiritual and religious significances of skin are revealed through how much of the skin has been and continues to be covered with what types of coverings, scalp and beard hair cutting, shaving and styling, skin, nail, and hair coloring and decorating, tattooing, and intentional scarring of skin. Persons with visible skin disorders have often been stigmatized or even treated as outcasts. Shamans and other spiritual and religious healers have brought about healing of skin disorders through spiritual means. Spiritual and religious interactions with various skin disorders such as psoriasis, leprosy, and vitiligo are discussed. Religious aspects of skin and skin diseases are evaluated for several major religions, with a special focus on Judaism, both conventional and kabbalistic. Keywords: skin, skin disorders, spiritual, religious

  4. Cure of skin cancer. Surgical cure of skin cancer

    In this chapter authors studied the cure of skin cancer in particular the surgical cure of skin cancer. They noted that surgical cure of skin cancer is remain one of the primary and most important methods in treatment of skin cancer

  5. Skin Diseases: Cross-section of human skin

    Skip Navigation Bar Home Current Issue Past Issues Skin Diseases Cross-section of human skin Past Issues / Fall 2008 Table of Contents For ... Logical Images, Inc. I n the areas of skin health and skin diseases, the NIH's National Institute ...

  6. Comparison of xenobiotic metabolizing enzyme activities in ex vivo human skin and reconstructed human skin models from SkinEthic.

    Eilstein, Joan; Léreaux, Guillaume; Budimir, Natali; Hussler, Georges; Wilkinson, Simon; Duché, Daniel

    2014-09-01

    Skin function is not limited to a physical barrier. According to its total surface area, it is also considered as an extra-hepatic metabolizing organ. In vitro engineered human skins have been developed to replace limited ex vivo normal human skin samples (NHS). Thus, assessing and comparing skin models from SkinEthic [Episkin™, RHE™ and the full thickness model (FTM)] with NHS in terms of metabolic capability are essential. The apparent activities of main cutaneous isoforms of cytochrome P450-dependent monooxygenases (CYP1A1/1B1, 2B6/2C18/2E1, 3A5/3A7), esterase, glutathione-S-[(GST), A, M, P, T], N-acetyl-(NAT1), uridinyl-diphosphate glucuronyl-(UDPGT 1A family) and sulfo-(SULT1A1) transferases were determined using probe substrates. Mean activities indicative of CYP1A1/1B1 (expressed as pmol/mg protein/6 h) in RHE™ (2.8) and FTM (2.6) were very similar to NHS (3.0) while Episkin™ showed a higher activity (9.1). Activities of CYP3A5/3A7 in FTM (3.3) and Episkin™ (3.6) were similar to NHS (3.8) while activity in RHE™ (13.3) was higher. CYP2B6/2C18/2E1 activity was below LOQ (0.5) in all skin models and NHS. Comparable intrinsic metabolic clearances were measured between NHS and skin models for esterase, UDPGT, GST and NAT1 activities. SULT1A1 activity toward probe substrates was not detected in skin models and observed at the limit of detection in NHS. Weak cytochrome P450-dependent monooxygenases, high esterase and transferase activities suggested that NHS and skin models exhibited limited functionalization and much greater detoxification (hydrolytic and conjugating) capacities. These results demonstrate that skin models are similar to NHS in terms of metabolic functionality toward xenobiotics investigated and useful tools to assess both the local efficiency and safety of cosmetics. PMID:24658324

  7. Designing pliable structural Skins

    Tamke, Martin; Peters, Brady; Nielsen, Stig Anton; Andersen, Niels Jakubiak; Campbell, Reese; Stasiuk, David

    2013-01-01

    Structural stability can be formed through structured or seemingly unstructured approaches to fold, plead or crumble paper. This paper reports on two projects that showcase how computational design approaches can help to widen the understanding and use of structural skins.......Structural stability can be formed through structured or seemingly unstructured approaches to fold, plead or crumble paper. This paper reports on two projects that showcase how computational design approaches can help to widen the understanding and use of structural skins....

  8. Nicotinamide and the skin.

    Chen, Andrew C; Damian, Diona L

    2014-08-01

    Nicotinamide, an amide form of vitamin B3, boosts cellular energy and regulates poly-ADP-ribose-polymerase 1, an enzyme with important roles in DNA repair and the expression of inflammatory cytokines. Nicotinamide shows promise for the treatment of a wide range of dermatological conditions, including autoimmune blistering disorders, acne, rosacea, ageing skin and atopic dermatitis. In particular, recent studies have also shown it to be a potential agent for reducing actinic keratoses and preventing skin cancers. PMID:24635573

  9. Human Skin Fungal Diversity

    Findley, Keisha; OH, JULIA; Yang, Joy; Conlan, Sean; Deming, Clayton; Meyer, Jennifer A.; Schoenfeld, Deborah; Nomicos, Effie; Park, Morgan; ,; Kong, Heidi H.; Segre, Julia A

    2013-01-01

    Traditional culture-based methods have incompletely defined the etiology of common recalcitrant human fungal skin diseases including athlete’s foot and toenail infections. Skin protects humans from invasion by pathogenic microorganisms, while providing a home for diverse commensal microbiota 1 . Bacterial genomic sequence data have generated novel hypotheses about species and community structures underlying human disorders 2,3,4 . However, microbial diversity is not limited to bacteria; micro...

  10. Mantoux Tuberculin Skin Test

    2006-11-22

    Learn how to evaluate people for latent TB infection with the Mantoux tuberculin skin test. This podcast includes sections on administering and reading the Mantoux tuberculin skin test, the standard method for detecting latent TB infection since the 1930s.  Created: 11/22/2006 by National Center for HIV, STD and TB Prevention (NCHHSTP).   Date Released: 12/12/2006.

  11. Elevated Aurora Kinase A Protein Expression in Diabetic Skin Tissue

    Cho, Moon Kyun; An, Je Min; Kang, Sang Gue

    2014-01-01

    Background Aurora kinase A (Aurora-A) plays an important role in the regulation of mitosis and cytokinesis. Dysregulated Aurora-A leads to mitotic faults and results in pathological conditions. No studies on Aurora-A expression in human diabetic skin tissue have been reported. In light of this, we explored the expression of Aurora-A in human diabetic skin tissue. Methods Aurora-A protein was evaluated by western blotting in 6 human diabetic skin tissue and 6 normal skin specimens. Results Increased expression of Aurora-A protein was detected in all diabetic skin tissue samples in both western blot analysis and immunohistochemical staining. However, in the case of the normal skin tissue, no bands of Aurora-A protein were detected in either the western blotting analysis or the immunohistochemical staining. Conclusions Thus far, there have been no studies on the expression of Aurora-A in diabetic skin tissue. However, we believe that oxidative DNA damage related to the expression of Aurora-A protein and Aurora-A could be involved inhuman diabetic skin tissue. PMID:24511492

  12. DOSHIC PHYSIOLOGY OF SKIN

    Shivprasad Chiplunkar

    2013-06-01

    Full Text Available The balance of dosha  represents the healthy state and imbalance will cause various diseases. In normalcy doshas will be performing their own functions and individual doshas will be having their own specific sites. By telling the various sthana of each dosha, different function that is taken up by individual dosha in different sites has been highlighted.By mentioning ‘sparshanendriyam’ as one of the sthana of vata dosha the sensory functions of skin to vata dosha has been emphasised. By mentioning ‘sparshanam’ as one of the sthana of pittadosha, the function of colouring/pigmentation of skin, which is majorly carried out  by melanocytes by secreting melanin pigment has been highlighted. Meda is one among the sthanas of kapha dosha; this can be considered as the adipose tissue of skin/below skin. Since sweda is mala of meda it can be also considered as the secretions from the eccrine glands.With respect to skin, sensory functions, both tactile and thermal is carried out by vata dosha more specifically vyana vata, pigmentation to the skin carried out by meloncytes by secreting melanin, it is nothing but function of pitta dosha more specifically brajaka pitta with the help of udana vata and finally production of sweat in sweat glands is the function of kapha. So there is the need for further study and research regarding the sthanas of all three doshas in different structures/organs in the body and its physiology.

  13. Ultraflexible organic photonic skin

    Yokota, Tomoyuki; Zalar, Peter; Kaltenbrunner, Martin; Jinno, Hiroaki; Matsuhisa, Naoji; Kitanosako, Hiroki; Tachibana, Yutaro; Yukita, Wakako; Koizumi, Mari; Someya, Takao

    2016-01-01

    Thin-film electronics intimately laminated onto the skin imperceptibly equip the human body with electronic components for health-monitoring and information technologies. When electronic devices are worn, the mechanical flexibility and/or stretchability of thin-film devices helps to minimize the stress and discomfort associated with wear because of their conformability and softness. For industrial applications, it is important to fabricate wearable devices using processing methods that maximize throughput and minimize cost. We demonstrate ultraflexible and conformable three-color, highly efficient polymer light-emitting diodes (PLEDs) and organic photodetectors (OPDs) to realize optoelectronic skins (oe-skins) that introduce multiple electronic functionalities such as sensing and displays on the surface of human skin. The total thickness of the devices, including the substrate and encapsulation layer, is only 3 μm, which is one order of magnitude thinner than the epidermal layer of human skin. By integrating green and red PLEDs with OPDs, we fabricate an ultraflexible reflective pulse oximeter. The device unobtrusively measures the oxygen concentration of blood when laminated on a finger. On-skin seven-segment digital displays and color indicators can visualize data directly on the body. PMID:27152354

  14. Hyperspectral imaging of skin and lung cancers

    Zherdeva, Larisa A.; Bratchenko, Ivan A.; Alonova, Marina V.; Myakinin, Oleg O.; Artemyev, Dmitry N.; Moryatov, Alexander A.; Kozlov, Sergey V.; Zakharov, Valery P.

    2016-04-01

    The problem of cancer control requires design of new approaches for instrumental diagnostics, as the accuracy of cancer detection on the first step of diagnostics in clinics is slightly more than 50%. In this study, we present a method of visualization and diagnostics of skin and lung tumours based on registration and processing of tissues hyperspectral images. In a series of experiments registration of hyperspectral images of skin and lung tissue samples is carried out. Melanoma, basal cell carcinoma, nevi and benign tumours are studied in skin ex vivo and in vivo experiments; adenocarcinomas and squamous cell carcinomas are studied in ex vivo lung experiments. In a series of experiments the typical features of diffuse reflection spectra for pathological and normal tissues were found. Changes in tissues morphology during the tumour growth lead to the changes of blood and pigments concentration, such as melanin in skin. That is why tumours and normal tissues maybe differentiated with information about spectral response in 500-600 nm and 600 - 670 nm areas. Thus, hyperspectral imaging in the visible region may be a useful tool for cancer detection as it helps to estimate spectral properties of tissues and determine malignant regions for precise resection of tumours.

  15. Spiritual and religious aspects of skin and skin disorders

    Shenefelt, Philip

    2014-01-01

    Philip D Shenefelt,1 Debrah A Shenefelt2 1Dermatology and Cutaneous Surgery, University of South Florida, Tampa, 2Congregation Or Ahavah, Lutz, FL, USA Abstract: Skin and skin disorders have had spiritual aspects since ancient times. Skin, hair, and nails are visible to self and others, and touchable by self and others. The skin is a major sensory organ. Skin also expresses emotions detectable by others through pallor, coldness, "goose bumps", redness, warmth, or sweating. ...

  16. Spiritual and religious aspects of skin and skin disorders

    Shenefelt PD; Shenefelt DA

    2014-01-01

    Philip D Shenefelt,1 Debrah A Shenefelt2 1Dermatology and Cutaneous Surgery, University of South Florida, Tampa, 2Congregation Or Ahavah, Lutz, FL, USA Abstract: Skin and skin disorders have had spiritual aspects since ancient times. Skin, hair, and nails are visible to self and others, and touchable by self and others. The skin is a major sensory organ. Skin also expresses emotions detectable by others through pallor, coldness, "goose bumps", redness, warmth, or sweating. Spiritua...

  17. The Relationship Between Morphology of Lumbar Disc Herniation and MRI Changes in Adjacent Vertebral Bodies

    Hamed Reyhani Kermani

    2013-12-01

    Full Text Available   Background: Intervertebral disc herniation has two common types, extrusion and protrusion, which may affect the adjacent vertebrae.In addition, it is associated with significant signal changes in T1 MRI (short TR/TE and T2 MRI (long TR/TE.   Methods: The present study is a cross-sectional analytic one, in which sampling was performed retrospectively. Cases were randomly selected from the patients undergoing discectomy in our department in a one-year period. Before surgery, MRI images, T1-weighted and T2-weighted sagittal cuts were interpreted by an expert radiologist. Signal intensity of the upper and the lower adjacent vertebra and the operated herniated disc were compared with the normal discs, both in T1-weighted and T2-weighted. Changes in signal intensity were recorded in qualitative variables. Statistical analysis was then performed between two groups. Results: In the present study, we have evaluated 170 patients undergoing lumbar disc herniation surgery, which included 97 protruded and 86 extruded discs. The patients’ age ranged from 21 to 78 years old, with an average of 43.03 ±11.4 years. Evaluating the type of discopathy with the presence of signal changes (hypo or hyper signal changes demonstrated more signal changes in upper adjacent vertebrae in T2-weighted MRI (45.3%. However, patients with protruded discs showed less changes (30.9%. It showed that the difference was statistically significant (P

  18. The Relationship Between Morphology of Lumbar Disc Herniation and MRI Changes in Adjacent Vertebral Bodies

    Hamed Reyhani Kermani

    2013-12-01

    Full Text Available Background: Intervertebral disc herniation has two common types, extrusion and protrusion, which may affect the adjacent vertebrae.In addition, it is associated with significant signal changes in T1 MRI (short TR/TE and T2 MRI (long TR/TE.   Methods: The present study is a cross-sectional analytic one, in which sampling was performed retrospectively. Cases were randomly selected from the patients undergoing discectomy in our department in a one-year period. Before surgery, MRI images, T1-weighted and T2-weighted sagittal cuts were interpreted by an expert radiologist. Signal intensity of the upper and the lower adjacent vertebra and the operated herniated disc were compared with the normal discs, both in T1-weighted and T2-weighted. Changes in signal intensity were recorded in qualitative variables. Statistical analysis was then performed between two groups. Results: In the present study, we have evaluated 170 patients undergoing lumbar disc herniation surgery, which included 97 protruded and 86 extruded discs. The patients’ age ranged from 21 to 78 years old, with an average of 43.03 ±11.4 years. Evaluating the type of discopathy with the presence of signal changes (hypo or hyper signal changes demonstrated more signal changes in upper adjacent vertebrae in T2-weighted MRI (45.3%. However, patients with protruded discs showed less changes (30.9%. It showed that the difference was statistically significant (P

  19. Skin aging and oxidative stress

    Sayeeda Ahsanuddin

    2016-05-01

    Full Text Available Skin aging occurs through two main pathways, intrinsic and extrinsic. These pathways have significant interaction in contributing to the aging phenotype, which includes skin laxity, wrinkling, pigmentation irregularities, and the appearance of neoplastic skin lesions. Here, we review the critical role that oxidative stress plays in skin aging, including its effects on signaling pathways involved in skin matrix formation and degradation, proteasome activity, as well as DNA structure. Furthermore, we discuss the recent literature surrounding the prevention and treatment of skin aging. Although current research is suggestive of the role of antioxidants in anti-aging skin therapies, further research is much needed to explore its role in humans.

  20. Genetic indicators of radiotherapy normal tissue response

    Full text: The aims of this study are to identify a genetic signature for adverse normal tissue damage from clinical radiotherapy (RT) in breast cancer patients, and to characterize the differentially-regulated genes involved. We have chosen to use skin expression profiling for four main reasons; (1) skin is the tissue that expresses the damage and so is directly relevant to the investigation, (2) skin biopsies can be snap frozen to preserve and maintain the in vivo expression profile of the patient, (3) skin punch biopsies are minimally invasive which equates to a high participation rate from RT patients (4) radiosensitivity testing and similar assays of cultured cells have only a low correlation with clinical adverse reaction. We expect our molecular profiling approach will give insight into the inherent genetic status of the patient that has not been demonstrated in cellular assays. We have begun collecting and processing skin punch biopsies from unirradiated sites from informed, consenting patients with adverse (severe acute or late) reaction to the skin or subcutaneous tissue following a standard course of RT, and normal controls. We have profiled biopsies from 7 adverse normal tissue reaction patients and 4 controls. Analyses of this data has identified 202 differentially expressed genes (p<0.01) and a class prediction algorithm correctly identified as adverse reaction or normal reaction 6/7 (86%) of our test samples that it could predict. We plan to focus on the function of some of these genes to determine their biological and clinical relevance. This will include detailed analysis of several of the gene products in an effort to address why these genes are associated with clinical reaction and what signaling pathways are involved. We plan to expand our sample number to 50 severe normal tissue late reaction (RTOG Grade 3 or 4), 50 severe acute normal tissue reaction and 50 no late or acute reaction to RT (RTOG 0) patients. An expected outcome is to fabricate

  1. Patient experiences living with split thickness skin grafts.

    Burnett, L N; Carr, E; Tapp, D; Raffin Bouchal, S; Horch, J D; Biernaskie, J; Gabriel, V

    2014-09-01

    The standard of care for deep burns is autologous split thickness skin grafting. Although adequate to resurface a deep wound, the resulting skin is chronically abnormal. The purpose of this study was to describe the experience of patients with split thickness skin grafts to help guide future investigations related to skin regeneration. In this study, an interpretive description qualitative methodology was employed. Subjects participated in a two-part single patient interview that was recorded and transcribed. A nurse with experience in clinical burn care coded and interpreted the data. Participants were recruited through presentation to a university based outpatient burn clinic for follow up from autologous split thickness skin grafting. Eight male patients and four female patients 20-62 years old ranging 2-29 months post-skin grafting were enrolled in the study. The most significant concerns voiced by patients were identified and organized into five themes: (1) a new normal, (2) split thickness skin graft symptoms, (3) appearance of new skin, (4) coping, and (5) participation in future clinical trials. Participants reported that the abnormalities related to their split thickness skin grafts were significant enough that they would be willing to participate in a future clinical trial investigating new cell-based therapies. PMID:24794227

  2. Biomechanics of Artificial Disc Replacements Adjacent to a 2-Level Fusion in 4-Level Hybrid Constructs: An In Vitro Investigation.

    Liao, Zhenhua; Fogel, Guy R; Wei, Na; Gu, Hongsheng; Liu, Weiqiang

    2015-01-01

    BACKGROUND The ideal procedure for multilevel cervical degenerative disc diseases remains controversial. Recent studies on hybrid surgery combining anterior cervical discectomy and fusion (ACDF) and artificial cervical disc replacement (ACDR) for 2-level and 3-level constructs have been reported in the literature. The purpose of this study was to estimate the biomechanics of 3 kinds of 4-level hybrid constructs, which are more likely to be used clinically compared to 4-level arthrodesis. MATERIAL AND METHODS Eighteen human cadaveric spines (C2-T1) were evaluated in different testing conditions: intact, with 3 kinds of 4-level hybrid constructs (hybrid C3-4 ACDR+C4-6 ACDF+C6-7ACDR; hybrid C3-5ACDF+C5-6ACDR+C6-7ACDR; hybrid C3-4ACDR+C4-5ACDR+C5-7ACDF); and 4-level fusion. RESULTS Four-level fusion resulted in significant decrease in the C3-C7 ROM compared with the intact spine. The 3 different 4-level hybrid treatment groups caused only slight change at the instrumented levels compared to intact except for flexion. At the adjacent levels, 4-level fusion resulted in significant increase of contribution of both upper and lower adjacent levels. However, for the 3 hybrid constructs, significant changes of motion increase far lower than 4P at adjacent levels were only noted in partial loading conditions. No destabilizing effect or hypermobility were observed in any 4-level hybrid construct. CONCLUSIONS Four-level fusion significantly eliminated motion within the construct and increased motion at the adjacent segments. For all 3 different 4-level hybrid constructs, ACDR normalized motion of the index segment and adjacent segments with no significant hypermobility. Compared with the 4-level ACDF condition, the artificial discs in 4-level hybrid constructs had biomechanical advantages compared to fusion in normalizing adjacent level motion. PMID:26694835

  3. Skin aging and oxidative stress

    Sayeeda Ahsanuddin; Minh Lam; Baron, Elma D.

    2016-01-01

    Skin aging occurs through two main pathways, intrinsic and extrinsic. These pathways have significant interaction in contributing to the aging phenotype, which includes skin laxity, wrinkling, pigmentation irregularities, and the appearance of neoplastic skin lesions. Here, we review the critical role that oxidative stress plays in skin aging, including its effects on signaling pathways involved in skin matrix formation and degradation, proteasome activity, as well as DNA structure. Furthermo...

  4. Bathing in a magnesium-rich Dead Sea salt solution improves skin barrier function, enhances skin hydration, and reduces inflammation in atopic dry skin.

    Proksch, Ehrhardt; Nissen, Hans-Peter; Bremgartner, Markus; Urquhart, Colin

    2005-02-01

    Magnesium salts, the prevalent minerals in Dead Sea water, are known to exhibit favorable effects in inflammatory diseases. We examined the efficacy of bathing atopic subjects in a salt rich in magnesium chloride from deep layers of the Dead Sea (Mavena(R) Dermaline Mg(46) Dead Sea salt, Mavena AG, Belp, Switzerland). Volunteers with atopic dry skin submerged one forearm for 15 min in a bath solution containing 5% Dead Sea salt. The second arm was submerged in tap water as control. Before the study and at weeks 1-6, transepidermal water loss (TEWL), skin hydration, skin roughness, and skin redness were determined. We found one subgroup with a normal and one subgroup with an elevated TEWL before the study. Bathing in the Dead Sea salt solution significantly improved skin barrier function compared with the tap water-treated control forearm in the subgroup with elevated basal TEWL. Skin hydration was enhanced on the forearm treated with the Dead Sea salt in each group, which means the treatment moisturized the skin. Skin roughness and redness of the skin as a marker for inflammation were significantly reduced after bathing in the salt solution. This demonstrates that bathing in the salt solution was well tolerated, improved skin barrier function, enhanced stratum corneum hydration, and reduced skin roughness and inflammation. We suggest that the favorable effects of bathing in the Dead Sea salt solution are most likely related to the high magnesium content. Magnesium salts are known to bind water, influence epidermal proliferation and differentiation, and enhance permeability barrier repair. PMID:15689218

  5. Best Merge Region Growing Segmentation with Integrated Non-Adjacent Region Object Aggregation

    Tilton, James C.; Tarabalka, Yuliya; Montesano, Paul M.; Gofman, Emanuel

    2012-01-01

    Best merge region growing normally produces segmentations with closed connected region objects. Recognizing that spectrally similar objects often appear in spatially separate locations, we present an approach for tightly integrating best merge region growing with non-adjacent region object aggregation, which we call Hierarchical Segmentation or HSeg. However, the original implementation of non-adjacent region object aggregation in HSeg required excessive computing time even for moderately sized images because of the required intercomparison of each region with all other regions. This problem was previously addressed by a recursive approximation of HSeg, called RHSeg. In this paper we introduce a refined implementation of non-adjacent region object aggregation in HSeg that reduces the computational requirements of HSeg without resorting to the recursive approximation. In this refinement, HSeg s region inter-comparisons among non-adjacent regions are limited to regions of a dynamically determined minimum size. We show that this refined version of HSeg can process moderately sized images in about the same amount of time as RHSeg incorporating the original HSeg. Nonetheless, RHSeg is still required for processing very large images due to its lower computer memory requirements and amenability to parallel processing. We then note a limitation of RHSeg with the original HSeg for high spatial resolution images, and show how incorporating the refined HSeg into RHSeg overcomes this limitation. The quality of the image segmentations produced by the refined HSeg is then compared with other available best merge segmentation approaches. Finally, we comment on the unique nature of the hierarchical segmentations produced by HSeg.

  6. Spiritual and religious aspects of skin and skin disorders.

    Shenefelt, Philip D; Shenefelt, Debrah A

    2014-01-01

    Skin and skin disorders have had spiritual aspects since ancient times. Skin, hair, and nails are visible to self and others, and touchable by self and others. The skin is a major sensory organ. Skin also expresses emotions detectable by others through pallor, coldness, "goose bumps", redness, warmth, or sweating. Spiritual and religious significances of skin are revealed through how much of the skin has been and continues to be covered with what types of coverings, scalp and beard hair cutting, shaving and styling, skin, nail, and hair coloring and decorating, tattooing, and intentional scarring of skin. Persons with visible skin disorders have often been stigmatized or even treated as outcasts. Shamans and other spiritual and religious healers have brought about healing of skin disorders through spiritual means. Spiritual and religious interactions with various skin disorders such as psoriasis, leprosy, and vitiligo are discussed. Religious aspects of skin and skin diseases are evaluated for several major religions, with a special focus on Judaism, both conventional and kabbalistic. PMID:25120377

  7. Spiritual and religious aspects of skin and skin disorders

    Shenefelt, Philip D; Shenefelt, Debrah A

    2014-01-01

    Skin and skin disorders have had spiritual aspects since ancient times. Skin, hair, and nails are visible to self and others, and touchable by self and others. The skin is a major sensory organ. Skin also expresses emotions detectable by others through pallor, coldness, “goose bumps”, redness, warmth, or sweating. Spiritual and religious significances of skin are revealed through how much of the skin has been and continues to be covered with what types of coverings, scalp and beard hair cutting, shaving and styling, skin, nail, and hair coloring and decorating, tattooing, and intentional scarring of skin. Persons with visible skin disorders have often been stigmatized or even treated as outcasts. Shamans and other spiritual and religious healers have brought about healing of skin disorders through spiritual means. Spiritual and religious interactions with various skin disorders such as psoriasis, leprosy, and vitiligo are discussed. Religious aspects of skin and skin diseases are evaluated for several major religions, with a special focus on Judaism, both conventional and kabbalistic. PMID:25120377

  8. Nerve conduction studies in upper extremities: skin temperature corrections.

    Halar, E M; DeLisa, J A; Soine, T L

    1983-09-01

    The relationship of skin to near nerve (NN) temperature and to nerve conduction velocity (NCV) and distal latency (DL) was studied in 34 normal adult subjects before and after cooling both upper extremities. Median and ulnar motor and sensory NCV, DL, and NN temperature were determined at ambient temperature (mean X skin temp = 33 C) and after cooling, at approximately 26, 28, and 30 C of forearm skin temperature. Skin temperatures on the volar side of the forearm, wrist, palm, and fingers and NN temperature at the forearm, midpalm, and thenar or hypothenar eminence were compared with respective NCV and DL. Results showed a significant linear correlation between skin temperature and NN temperature at corresponding sites (r2 range, 0.4-0.84; p less than 0.005). Furthermore, both skin and NN temperatures correlated significantly with respective NCV and DL. Midline wrist skin temperature showed the best correlation to NCV and DL. Median motor and sensory NCV were altered 1.5 and 1.4m/sec/C degree and their DL 0.2 msec/C degree of wrist skin temperature change, respectively. Ulnar motor and sensory NCV were changed 2.1 and 1.6m/sec/C degree respectively, and 0.2 msec/C degree wrist temperature for motor and sensory DL. Average ambient skin temperature at the wrist (33 C) was used as a standard skin temperature in the temperature correction formula: NCV or DL(temp corrected) = CF(Tst degree - Tm degree) + obtained NCV or DL, where Tst = 33 C for wrist, Tm = the measured skin temperature, and CF = correction factor of tested nerve. Use of temperature correction formula for NCV and DL is suggested in patients with changed wrist skin temperature outside 29.6-36.4C temperature range. PMID:6615178

  9. Applications of positron annihilation to dermatology and skin cancer

    Liu, Guang; Chen, Hongmin; Chakka, Lakshmi [Department of Chemistry, University of Missouri-Kansas City, Kansas City, MO 64110 (United States); Gadzia, Joseph E. [Dermatology, Department of Internal Medicine, University of Kansas Medical Center, Kansas City, KS 66103 and Kansas Medical Clinic, Topeka, KS 66614 (United States); Jean, Y.C. [Department of Chemistry, University of Missouri-Kansas City, Kansas City, MO 64110 (United States); R and D Center for Membrane Technology, Chung Yuan Christian University, Chung-Li (China)

    2007-07-01

    Positronium annihilation lifetime experiments have been performed to investigate the interaction between skin cancer and positronium for human skin samples. Positronium annihilation lifetime is found to be shorter and intensity is found to be less for the samples with basal cell carcinoma and squamous cell carcinoma than the normal skin samples. These results indicate a reduction of free volume in the molecular level for the skin with cancer with respect to the skin without cancer. Positron annihilation spectroscopy may be potentially developed as a new noninvasive and external method for dermatology clinics, early detection of cancer, and nano-PET technology in the future. (copyright 2007 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)

  10. Evaluation of the stress distribution change at the adjacent facet joints after lumbar fusion surgery: a biomechanical study.

    Ma, Jianxiong; Jia, Haobo; Ma, Xinlong; Xu, Weiguo; Yu, Jingtao; Feng, Rui; Wang, Jie; Xing, Dan; Wang, Ying; Zhu, Shaowen; Yang, Yang; Chen, Yang; Ma, Baoyi

    2014-07-01

    Spinal fusion surgery has been widely applied in clinical treatment, and the spinal fusion rate has improved markedly. However, its postoperative complications, especially adjacent segment degeneration, have increasingly attracted the attention of spinal surgeons. The most common pathological condition at adjacent segments is hypertrophic degenerative arthritis of the facet joint. To study the stress distribution changes at the adjacent facet joint after lumbar fusion with pedicle screw fixation, human cadaver lumbar spines were used in the present study, and electrical resistance strain gauges were attached on L1-L4 articular processes parallel or perpendicular to the articular surface of facet joints. Subsequently, electrical resistance strain gauge data were measured using anYJ-33 static resistance strain indicator with three types of models: the intact model, the laminectomy model, and the fusion model with pedicle screw fixation. The strain changes in the measurement sites indirectly reflect the stress changes. Significant differences in strain were observed between the normal and laminectomy state at all facet joints. Significant differences in strain were observed between the normal and the pedicle screw fixation fusion state at the L1/2 and L3/4 facet joints. The increased stress on the facet joints after lumbar fusion with pedicle screw fixation may be the cause of adjacent segment degeneration. PMID:24963037

  11. Double-Skin Facade

    Kalyanova, Olena

    Double-Skin Facades (DSF) are gaining popularity that, in fact, appears to be independent from sturdy critics of the concept in the past years. DSF buildings are being built in Europe and worldwide, DSF concept is being taught at schools of architecture and fully glazed office buildings are being...... to perform the simulations. To fill in the gap of lacking experimental data a range of measurements was carried out in an outdoor, double-skin façade full-scale test facility ‘The Cube'. As a result, three complete sets of experimental data were composed. These are available for external air curtain...... IEA Annex 34/43, subtask E "Double-Skin Facade". The results of empirical validation are discussed in this work. Discussion and analysis of experimental results is carried out. It has lead to hypothesis of recirculation flow phenomenon in the DSF cavity. Finally, a suggestion of a new numerical model...

  12. Thyroid and skin

    Dogra Alka

    2006-01-01

    Full Text Available The association of thyroid disorders with skin manifestations is complex. Both hypothryoidism and hyperthyroidism are known to cause these changes. In order to study this association of skin changes in relation to hypothyroidism, a study was carried out in the outpatients department of Dermatology of Dayanand Medical College and Hospital, Ludhiana, over a period of 3 months from Jan-March 2005. Thirty two patients were enrolled in the study and parameters were noted regarding history, general symptoms, cutaneous signs and associated diseases. We found gain in weight (71.85% and lethargy (65.62% to be the most common complaints. On cutaneous examination, dry, coarse texture of the skin (56%, pigmentary disorders (37.5% and telogen effluvium (40.62% were the most common findings. Other associated disorders were vitiligo, melasma, pemphigus, alopecia areata, xanthelasma palpebrarum, etc.

  13. Extreme skin depth waveguides

    Jahani, Saman

    2014-01-01

    Recently, we introduced a paradigm shift in light confinement strategy and introduced a class of extreme skin depth (e-skid) photonic structures (S. Jahani and Z. Jacob, "Transparent sub-diffraction optics: nanoscale light confinement without metal," Optica 1, 96-100 (2014)). Here, we analytically establish that figures of merit related to light confinement in dielectric waveguides are fundamentally tied to the skin depth of waves in the cladding. We contrast the propagation characteristics of the fundamental mode of e-skid waveguides and conventional waveguides to show that the decay constant in the cladding is dramatically larger in e-skid waveguides, which is the origin of sub-diffraction confinement. Finally, we propose an approach to verify the reduced skin depth in experiment using the decrease in the Goos-H\\"anchen phase shift.

  14. Epidermal skin grafting.

    Herskovitz, Ingrid; Hughes, Olivia B; Macquhae, Flor; Rakosi, Adele; Kirsner, Robert

    2016-09-01

    Autologous skin grafts, such as full- and split-thickness, have long been part of the reconstructive ladder as an option to close skin defects. Although they are effective in providing coverage, they require the need for a trained surgeon, use of anaesthesia and operating room and creation of a wound at the donor site. These drawbacks can be overcome with the use of epidermal skin grafts (ESGs), which can be harvested without the use of anaesthesia in an office setting and with minimal to no scarring at the donor site. ESGs consist only of the epidermal layer and have emerged as an appealing alternative to other autologous grafts for the treatment of acute and chronic wounds. In this article, we provide an overview of epidermal grafting and its role in wound management. PMID:27547964

  15. Environment and the skin

    The skin is an important organ of defense adaptation and a portal of entry for xenobiotics. It is vulnerable to physical, chemical, and biologic agents and capable of expressing responses to these agents in a variety of pathologic patterns. These patterns are characterized by morphologic and functional features which are elicited by careful examination and test procedures. Cutaneous cancer may result from exposure to nonionizing as well as ionizing radiation, to specific identifiable chemical hazards, and may be enhanced by trauma. Cutaneous hazards of chemical sources are largely found in the workplace and among consumer products, including drugs and toilet goods. Environmental skin diseases and injuries are preventable. Prior to use assessment for safety and for possible risks from exposure to an agent, product, or process is of primary importance in the prevention and control of environmental skin disease and injury

  16. Smoking and skin disease

    Thomsen, S F; Sørensen, L T

    2010-01-01

    Tobacco smoking is a serious and preventable health hazard that can cause or exacerbate a number of diseases and shorten life expectancy, but the role of smoking as an etiologic factor in the development of skin disease is largely unknown. Although epidemiological evidence is sparse, findings...... suggest that tobacco smoking is a contributing factor in systemic lupus erythematosus, psoriasis, palmoplantar pustulosis, cutaneous squamous cell carcinoma, hidradenitis suppurativa, and genital warts. In contrast, smoking may confer some protective effects and mitigate other skin diseases, notably...... pemphigus vulgaris, pyoderma gangrenosum, aphthous ulcers, and Behçet's disease. Various degenerative dermatologic conditions are also impacted by smoking, such as skin wrinkling and dysregulated wound healing, which can result in post-surgical complications and delayed or even arrested healing of chronic...

  17. Postseismic deformation and body forces shaping the Apennines and adjacent sedimentary basins in Umbria-Marche

    A. Aoudia

    2008-06-01

    Full Text Available The geodynamic complexity of the Apennines and adjacent sedimentary basins in Umbria-Marche (North-Central Italy makes the dynamics of the present day deformation and its relationships with the seismicity less well understood. In this paper, we argue that, further to buoyancy forces, postseismic deformation of earthquakes taking place on the Apennines contributes to the regional deformation. We investigate the interaction between the normal faulting system responsible of the 1997 Umbria-Marche earthquake sequence (Colfiorito fault and the low angle normal faulting system bordering the sedimentary basins, namely the Altotiberina fault. We set-up a 2D finite element model of the lithosphere-asthenosphere accounting for lateral heterogeneities and investigate how this heterogeneous structure is capable of localizing strain under the Umbria-Marche sedimentary basins, providing a way for the Colfiorito fault to influence the evolution of the Altotiberina fault. We show how the two different length and time scale processes, namely postseismic deformation and buoyancy, are complementary in shaping the Apennines and adjacent sedimentary basins. The high resolution deformation patterns modeled in this study can hardly be reproduced by a model accounting only for external forces such as a rotating or subducting or retreating Adria.

  18. Traumatic degloving lesion of penile and scrotal skin

    Luiz A. Zanettini

    2005-06-01

    Full Text Available Avulsions of penile and scrotal skin are uncommon events and are caused mainly by accidents with industrial machines and agricultural machine belts. We report the case of a 30-year old patient with avulsion and traumatic degloving of the penile and scrotal skin, with exposure of the cavernous bodies, spongy body, and testes due to an industrial machine accident. Reconstruction was performed in steps, achieving a satisfactory esthetic result, normal voiding and reestablished sexual function.

  19. Tunable Engineered Skin Mechanics via Coaxial Electrospun Fiber Core Diameter

    Blackstone, Britani Nicole; Drexler, Jason William; Powell, Heather Megan

    2014-01-01

    Autologous engineered skin (ES) offers promise as a treatment for massive full thickness burns. Unfortunately, ES is orders of magnitude weaker than normal human skin causing it to be difficult to apply surgically and subject to damage by mechanical shear in the early phases of engraftment. In addition, no manufacturing strategy has been developed to tune ES biomechanics to approximate the native biomechanics at different anatomic locations. To enhance and tune ES biomechanics, a coaxial (CoA...

  20. Group edge choosability of planar graphs without adjacent short cycles

    Xin ZHANG; Liu, Guizhen

    2011-01-01

    In this paper, we aim to introduce the group version of edge coloring and list edge coloring, and prove that all 2-degenerate graphs along with some planar graphs without adjacent short cycles is group $(\\Delta(G)+1)$-edge-choosable while some planar graphs with large girth and maximum degree is group $\\Delta(G)$-edge-choosable.

  1. PROBABILISTIC ZONING OF ADJACENT CATCHMENTS BY PHYSICAL MODELING

    Yu. B. Andreev

    2015-11-01

    Full Text Available Now the probabilistic zoning of avalanche sites is being made either on the basis of the available field data, or using the mathematical and physical modeling of avalanche dynamics processes. The work purpose consisted in research of interaction and compiling probabilistic zoning maps of two adjacent avalanche sites by a physical modeling method. For the two adjacent sites № 9 and 10 on the slope of northern exposition ofTchegetMountain(Elbrus region,Caucasus the model of this slope with the scale of 1: 2 500 was created. The model dimension is 0,82 × 1,1 ×0,57 m. This model was produced using the 4-mm plywood sheets imposed against each other. The model horizontals correspond to the10 mnatural ones. The model slope was also surfaced by thin gypsum lay and then varnished. The fine-grained sawdust (0.1 mm with a natural friction angle of 43º has been chosen as the loose material modeling snow. A series of experiments on modeling avalanche releases from the two sites were carried out resulted in the measurements of avalanche deposit parameters such as run-out distance and length, width and thickness of deposits. The similarity criteria were used during the experiments. The morphometric features of adjacent sites interaction are revealed. The basic result of the carried out work will consist in the probabilistic zoning map of two adjacent sites № 9 and 10.

  2. Biogeochemistry of hydrothermally and adjacent non-altered soils

    As a field/lab project, students in the Soil Biogeochemistry class of the University of Nevada, Reno described and characterized seven pedons, developed in hydrothermally and adjacent non-hydrothermally altered andesitic parent material near Reno, NV. Hydrothermally altered soils had considerably lo...

  3. Intelligent skin: Real virtual

    Bühlmann, Vera

    2006-01-01

    What will it feel like to live in a city, where houses court each other in springtime? The 'intelligent-skin' project investigates the potential of media-façades in terms of corporate communication: what does it mean to build houses out of bricks of mediality? What does it imply to say that communication literally takes place? The virtualization of housing through large sized media skins will introduce medial milieus into our urban spheres to come – they might seize to function as add-ons...

  4. [Skin and hand disinfection].

    Mathis, U

    1991-04-01

    In modern medicine, hygiene has become an issue of ever increasing importance. Disinfection of hands is crucial, since hands are the main vector of bacteria. Successful disinfection depends not only on the appropriate choice of an active agent, but equally so on proper techniques and skin care. The spectre and the time profile of activity as well as the skin-protecting properties of the chosen disinfectant must be known. Basic knowledge of disinfection is necessary for a rational interpretation of the information given in the glossy printed material of advertisement. PMID:1858061

  5. Laser system for optical biopsy and in-vivo study of the human skin

    Borisova, Ekaterina G.; Avramov, Lachezar A.

    2001-04-01

    The aim of this study was to perform a preliminary evaluation of the diagnostic potential of noninvasive laser-induced autofluorescence spectroscopy (LIAFS) for human skin in vivo. The autofluorescence characterization of tissue relies on different spectral properties of tissue. It was demonstrated a differentiation between normal skin and skin with vitaligo. In our experimental investigation of the autofluorescence spectrum of human skin in vivo a nitrogen laser with excitation wavelength 337 nm was used. Two fluorescence bands were observed at 440 and 490 nm, these were attributed to reduced nicotinamide adenine dinucleotide (NADH) and collagen. The intensity of the NADH emission band was markedly reduced in the skin with vitaligo compared with the normal skin, which could indicate different redox conditions in skin with vitaligo. The autofluorescence spectrum of human skin depends on the main internal absorbers, which are blood and melanin. In this study was described the effect caused by melanin content on the shape of the autofluorescence spectrum of human skin. Human skin fluorescence spectrum might provide dermatologists with important information and such investigations are successfully used now in skin disease diagnostics, in investigation of the environmental factor impact or for evaluation of treatment efficiency. The goal of this work is optimization of detection and diagnosis of hollow organs and skin.

  6. Skin Basement Membrane: The Foundation of Epidermal Integrity—BM Functions and Diverse Roles of Bridging Molecules Nidogen and Perlecan

    Dirk Breitkreutz

    2013-01-01

    Full Text Available The epidermis functions in skin as first defense line or barrier against environmental impacts, resting on extracellular matrix (ECM of the dermis underneath. Both compartments are connected by the basement membrane (BM, composed of a set of distinct glycoproteins and proteoglycans. Herein we are reviewing molecular aspects of BM structure, composition, and function regarding not only (i the dermoepidermal interface but also (ii the resident microvasculature, primarily focusing on the per se nonscaffold forming components perlecan and nidogen-1 and nidogen-2. Depletion or functional deficiencies of any BM component are lethal at some stage of development or around birth, though BM defects vary between organs and tissues. Lethality problems were overcome by developmental stage- and skin-specific gene targeting or by cell grafting and organotypic (3D cocultures of normal or defective cells, which allows recapitulating BM formation de novo. Thus, evidence is accumulating that BM assembly and turnover rely on mechanical properties and composition of the adjacent ECM and the dynamics of molecular assembly, including further “minor” local components, nidogens largely functioning as catalysts or molecular adaptors and perlecan as bridging stabilizer. Collectively, orchestration of BM assembly, remodeling, and the role of individual players herein are determined by the developmental, tissue-specific, or functional context.

  7. Study of surfactant-skin interactions by skin impedance measurements.

    Lu, Guojin; Moore, David J

    2012-02-01

    The stratum corneum (SC) plays a very critical physiological role as skin barrier in regulating water loss through the skin and protects the body from a wide range of physical and chemical exogenous insults. Surfactant-containing formulations can induce skin damage and irritation owing to surfactant absorption and penetration. It is generally accepted that reduction in skin barrier properties occurs only after surfactants have penetrated/permeated into the skin barrier. To mitigate the harshness of surfactant-based cleansing products, penetration/permeation of surfactants should be reduced. Skin impedance measurements have been taken in vitro on porcine skin using vertical Franz diffusion cells to investigate the impact of surfactants, temperature and pH on skin barrier integrity. These skin impedance results demonstrate excellent correlation with other published methods for assessing skin damage and irritation from different surfactant chemistry, concentration, pH, time of exposure and temperature. This study demonstrates that skin impedance can be utilized as a routine approach to screen surfactant-containing formulations for their propensity to compromise the skin barrier and hence likely lead to skin irritation. PMID:21923733

  8. THE ROLE OF UDVARTHANA ON SKIN HEALTH

    Shital O. Chavan

    2013-06-01

    Full Text Available Approaching towards modern life style, every person is conscious about his/her look and using number of cosmetics which are made up of chemicals and freely available in market to make their skin looks beautiful without knowing the consequence produced by chemical (Cosmetics on the skin. To prevent such complication and to increase the beauty of one’s facial look, we selected one of the ancient techniques of daily routine Udvarthana as a subject research to know the effect of Udwartana on skin health according to Samhita’s as per modern life. Face is mirror, which perhaps reflects our individuality from others. Our face is a part of attraction and gives the image of our fitness hence application of Udvartana is done only on face. The results were assessed on manifestation of improvement in skin health, such as symptomatic changes after application. 30 normal individuals of age group 16-30 years were recruited in trial. Sample were assessed and evaluated on the basis of subjective parameters at interval of 15 days for two months. Selection of drugs for Udvarthana was done from Varnadi Gana in Astanga Sangraha Sutrasthana 15/88. Fine powder of drug was mixed with plain water and applied on face till gets dried before bath. There were significant changes in symptomatically criteria when calculated by Willcoxan’s5 test. We got significant result in symptoms of facial skin in experimental group after two month i.e. p<0.05. The finding suggests that Udvarthana is an effective, safe, easy way for healthy skin.

  9. Comparison of skin dose between conventional radiotherapy and IMRT

    The purpose of this study was to measure skin dose using radiochromic film for two step-and-shoot IMRT fields and compare the results to the skin dose for a conventional open field. All exposures were made using a 6 MV photon beam produced by a Varian 21 EX linear accelerator (Varian Medical Systems, CA, USA) equipped with a Millennium 120 leaf MLC. Three different field configurations were used, these were an open field, a step-and-shoot IMRT field and a clinical IMRT field. The mean ratio of the skin dose to dose at dmax for an open 10 x 10 cm2 field at 100 cm SSD was 0.178 ± 0.003. The step-and-shoot IMRT field consisted of 1 cm wide strips of decreasing intensity that were delivered using a step-and-shoot technique across a 10 x 10 cm2 field. The ratio of skin dose to dose at dmax ranged from 0.180 to 0.257, with the low intensity steps having a higher relative skin dose compared to the high intensity steps. A model was derived that attributed these variations to the electron contamination from both the adjacent and more distant high intensity steps. The clinical field consisted of a 25 segment 9.8 x 10.0 cm2 beam arrangement. The ratio of skin dose to dose at dmax for the clinical IMRT field ranged from 0.093 to 0.284. The results indicated that an IMRT field produced only minor changes in the relative skin dose, with variations potentially attributable to fluctuations in the electron contamination produced by neighbouring regions of different intensity. The use of an individual IMRT field does not significantly increase the skin dose above that of a conventional photon field

  10. Effect of lipopolysaccharide on the biological characteristics of human skin fibroblasts and hypertrophic scar tissue formation.

    Yang, Hongming; Hu, Chao; Li, Fengyu; Liang, Liming; Liu, Lingying

    2013-06-01

    Burn injury-mediated destruction of the skin barrier normally induces microbial invasion, in turn leading to the development of systemic infection and occasional septic shock by the release of endotoxins. The objective of this work was to study the influence of lipopolysaccharide (LPS) on the biological characteristics of normal skin fibroblasts and to elucidate the influence of LPS in the initial stage of skin wound healing. Twenty patients with hypertrophic scar in proliferative stage were selected randomly and primary cultures were established from fibroblasts derived from their hypertrophic scar tissue and normal skin. Normal skin fibroblasts of passage 3 were stimulated with different concentrations of LPS. LPS stimulated the proliferation and collagen synthesis of fibroblasts within a certain extent of concentrations (0.005-0.5 μg/mL) (P effect on normal skin fibroblasts-continuous passage of these fibroblasts resulted in ultrastructural pattern similar to fibroblasts derived from hypertrophic scar tissue, and the findings was substantiated by hematoxylin and eosin staining and immunohistochemistry detection of proliferation cell nuclear antigen, type I procollagen and α-smooth muscle actin. Our results suggest that LPS might convert normal skin fibroblasts to hypertrophic scar tissue fibroblasts and participate in the formation of hypertrophic scar; hence, appropriate concentration of LPS may have no effect or be beneficial to skin wound healing, whereas excessive concentration of LPS may delay the time of wound healing. PMID:23653386

  11. About Skin-to-Skin Care (Kangaroo Care)

    ... Prenatal Baby Bathing & Skin Care Breastfeeding Crying & Colic Diapers & Clothing Feeding & Nutrition Preemie Sleep Teething & Tooth Care Toddler Preschool Gradeschool Teen Young Adult Healthy Children > Ages & Stages > Baby > Preemie > About Skin- ...

  12. Differentially Expressed miRNAs in Acute Wound Healing of the Skin

    Li, Ping; He, Quanyong; LUO, CHENGQUN; QIAN, LIYUAN

    2015-01-01

    Abstract The aim of the present study was to compare expression of microRNAs (miRNAs) from scar and normal skin areas in patients who suffered acute injuries in the skin. A total of 9 patients with acute injuries in the skin who received surgical treatment from December 2012 to March 2013 were included in this pilot study. Specimens from the hypertrophic scar and normal skin areas were obtained from the same patient during surgery. To screen for differentially expressed miRNAs, we applied 3 s...

  13. Slicing, skinning, and grafting

    Dumas, David; Kent IV, Richard P.

    2007-01-01

    We prove that a Bers slice is never algebraic, meaning that its Zariski closure in the character variety has strictly larger dimension. A corollary is that skinning maps are never constant. The proof uses grafting and the theory of complex projective structures.

  14. Skin peeling syndrome

    Sharma Rajeev; Kumar Ashok

    1994-01-01

    We are reporting a case of skin peeling syndrome, a rare disorder in which sudden generalized exfoliation of the stratum corneum occurs. Histopathologically, there was well formed subcorneal pustule filled with polymorphs and nuclear dust, considering this to be a varient of subcorneal pustular dermatosis, we have put the patient on Dapsone.

  15. PPD skin test

    ... have been infected with the bacteria that cause TB. You may need treatment to lower the risk of the disease coming back (reactivation of the disease). A positive skin test does not mean that a person has active TB. More tests must be done to check whether ...

  16. Skin Conditions during Pregnancy

    ... line that runs from the navel to the pubic hair • Stretch marks •Acne • Spider veins • Varicose veins • Changes ... Nigra: A line running from the navel to pubic hair that darkens during pregnancy. Melasma: A common skin ...

  17. Researches on skin decontamination

    Living 4∼6 week-aged San Yuan white pigs (Suzhou, China) were used in skin decontamination experiments. Following a standard procedure, SM series of decontamination agents were used for decontamination of liquid nuclides. The results of immediate decontamination were as follows: K(decontamination efficiency) = 97.7% (decontamination factor DF = 43.5) for 131I; K>99% (DF>100) for 90Sr/90Y, MFP and U + TRU; K = 99.9% (DF 1000) for 137Cs. In 3 h-delayed decontamination, DF = 27∼67 (K 96.3%∼98.5) for the nuclides mentioned above. When the initiatory MFP contamination increased from 20 to 300 s-1·cm-2, the value of DF by immediate decontamination increased from 20 to 173 with the remaining activity not higher than 10 Bq·cm-2, and no additional decontamination was needed. For radioactive ash contamination of skin, DF 57∼1000 (K = 98.2%∼99.9%) in 4 h-delayed decontamination. SM series of decontamination agents are neutral liquid or cream without any irritative effect on skin. They are effective and easy to use in skin decontamination. (5 refs., 4 figs., 3 tabs.)

  18. Light and skin disease

    Because of the depletion of ozone in the stratosphere due to chlorofluorocarbons, the screening effect of this ozone layer on ultraviolet radiation (especially the so-called UV-B component) is reduced. This paper describes the impact of increased UV radiation on the human skin. Because of the 'ozone-hole', a distinct increase in the rate of skin cancer is to be expected which will affect all living beings but most of all man - an indirect consequence of the climate development. What makes the increased intensity of UV-B radiation so harmful is the fact that light-induced skin damage accumulates for the period of the life-time of the individual and cannot be reversed. A further thinning of stratospheric ozone would let through, in addition, the more short-waved ('harder') UV-C radiation. The latter, though clinically not significant currently, would then account for a further increase in the rate of malignant skin disease world-wide. (orig.)

  19. Preventing Skin Cancer

    2016-05-18

    A man and a woman talk about how they’ve learned to protect their skin from the sun over the years. .  Created: 5/18/2016 by National Center for Chronic Disease Prevention and Health Promotion (NCCDPHP).   Date Released: 5/18/2016.

  20. Chemokines and skin diseases.

    Sugaya, Makoto

    2015-04-01

    Chemokines are small molecules that induce chemotaxis and activation of certain subsets of leukocytes. The expression patterns of chemokines and chemokine receptors are specific to certain organs and cells. Therefore, chemokines are important to elucidate the mechanism of organ-specific human diseases. CCL17 expressed by Langerhans cells, blood endothelial cells, and fibroblasts plays a key role in attracting Th2 cells and tumor cells of adult T-cell leukemia/lymphoma and mycosis fungoides/Sézary syndrome into the skin, developing various Th2-type inflammatory skin diseases as well as cutaneous lymphoma. CCL11 and CCL26 expressed by skin-resident cells, such as fibroblasts, blood endothelial cells, and keratinocytes, induce infiltration of CCR3-expressing cells such as Th2 cells and eosinophils. CCL11 may also serve as an autocrine as well as a paracrine in anaplastic large cell lymphoma. CX3CL1 expressed on blood endothelial cells leads to infiltration of CX3CR1(+) immune cells, such as mast cells, neutrophils, and macrophages, playing important roles in wound healing, tumor immunity, and vasculitis. Biologics targeting chemokines and their receptors are promising strategies for various skin diseases that are resistant to the current therapy. PMID:25182982

  1. Skin painting studies

    In order to estimate eventual risks to human health as a consequence of incidental and prolonged skin contact, it is necessary to obtain some information on the potential of coal-derived liquids to elicit skin cancer. In addition, it also must be established whether prolonged dermal exposure will produce signs of toxicity not only on the skin but to internal organs. During the past 2 years, they completed a life-long skin painting study with mice designed to answer some of these questions. The following materials were tested: Raw H-coal blend, containing 5700 ppm N; H-coal blend after low hydrotreatment (2650 ppm N); H-coal blend after high hydrotreatment (0.2 ppm N); H-coal home heating oil, a devolatilized version of the high-hydrotreatment H-coal blend; and an H-coal reformed naphtha. Two petroleum-derived references samples were used: Petroleum No. 2 fuel oil and high catalytically cracked naphtha. Benzo(a)pyrene was used as reference substance. Experimental animals were male and female C3H mice

  2. Skin prick test in patients with chronic allergic skin disorders

    Pooja Bains; Alka Dogra

    2015-01-01

    Background: Chronic allergic skin disorders are the inflammatory and proliferative conditions in which both genetic and environmental factors play important roles. Chronic idiopathic urticaria (CIU) and atopic dermatitis (AD) are among the most common chronic allergic skin disorders. These can be provoked by various food and aeroallergens. Skin prick tests (SPTs) represent the cheapest and most effective method to diagnose type I hypersensitivity. Positive skin tests with a history suggestive...

  3. Effect of Photofrin on skin reflection of basal cell nevus syndrome patients

    Grossweiner, Leonard I.; Jones, Linda R.; Koehler, Irmgard K.; Bilgin, Mehmet D.

    1996-04-01

    Skin reflection spectra were measured before and 24 hours after administration of Photofrin (Reg. TM) to basal cell nevus syndrome (BCNS) patients. The drug reduced the reflectivity of uninvolved BCNS skin and increased the reflectivity of basal cell cancers. Photofrin (Reg. TM) absorption in normal rat skin and uninvolved BCNS skin was resolved by the diffusion approximation. Optical constants calculated with a two-layer skin model indicate that the drug increased light scattering in tumor tissues. The possible use of reflection spectra for PDT light dosimetry is discussed.

  4. Self-normalized processes

    Heyde, C C

    2008-01-01

    Self-normalized processes are of common occurrence in probabilistic and statistical studies. This volume covers developments in the area, including self-normalized large and moderate deviations, and laws of the iterated logarithms for self-normalized martingales. It treats the theory and applications of self-normalization.

  5. Impact of prebiotics and probiotics on skin health.

    Al-Ghazzewi, F H; Tester, R F

    2014-06-01

    This review discusses the role of pre- and probiotics with respect to improving skin health by modulating the cutaneous microbiota. The skin ecosystem is a complex environment covered with a diverse microbiota community. These are classified as either transient or resident, where some are considered as beneficial, some essentially neutral and others pathogenic or at least have the capacity to be pathogenic. Colonisation varies between different parts of the body due to different environmental factors. Pre- and probiotic beneficial effects can be delivered topically or systemically (by ingestion). The pre- and probiotics have the capacity to optimise, maintain and restore the microbiota of the skin in different ways. Topical applications of probiotic bacteria have a direct effect at the site of application by enhancing the skin natural defence barriers. Probiotics as well as resident bacteria can produce antimicrobial peptides that benefit cutaneous immune responses and eliminate pathogens. In cosmetic formulations, prebiotics can be applied to the skin microbiota directly and increase selectively the activity and growth of beneficial 'normal' skin microbiota. Little is known about the efficacy of topically applied prebiotics. Nutritional products containing prebiotics and/or probiotics have a positive effect on skin by modulating the immune system and by providing therapeutic benefits for atopic diseases. This review underlines the potential use of pre- and probiotics for skin health. PMID:24583611

  6. Biophysical basis for noninvasive skin cancer detection using Raman spectroscopy

    Feng, Xu; Moy, Austin J.; Markey, Mia K.; Fox, Matthew C.; Reichenberg, Jason S.; Tunnell, James W.

    2016-03-01

    Raman spectroscopy (RS) is proving to be a valuable tool for real time noninvasive skin cancer detection via optical fiber probe. However, current methods utilizing RS for skin cancer diagnosis rely on statistically based algorithms to provide tissue classification and do not elucidate the underlying biophysical changes of skin tissue. Therefore, we aim to use RS to explore skin biochemical and structural characteristics and then correlate the Raman spectrum of skin tissue with its disease state. We have built a custom confocal micro-Raman spectrometer system with an 830nm laser light. The high resolution capability of the system allows us to measure spectroscopic features from individual tissue components in situ. Raman images were collected from human skin samples from Mohs surgical biopsy, which were then compared with confocal laser scanning, two-photon fluorescence and hematoxylin and eosin-stained images to develop a linear model of skin tissue Raman spectra. In this model, macroscopic tissue spectra obtained from RS fiber probe were fit into a linear combination of individual basis spectra of primary skin constituents. The fit coefficient of the model explains the biophysical changes spanning a range of normal and various disease states. The model allows for determining parameters similar to that a pathologist is familiar reading and will be a significant guidance in developing RS diagnostic decision schemes.

  7. Benign and malignant skin lesions in renal transplant recipients

    Ghaninejad H

    2009-01-01

    Full Text Available Background: Skin lesions - benign and malignant - occur frequently in organ transplant recipients receiving long-term immunosuppressive therapy. These patients are at greater risk of skin cancers. Aims: To study dermatologic problems in renal transplant recipients (RTRs. Methods: One hundred patients (53 men and 47 women were consecutively examined for benign and malignant skin complications since transplantation in Razi Hospital in Tehran Medical University. The main immunosuppressive therapy regimen in these patients was a combination of prednisolone, azathioprine, and cyclosporine. Results: The early and most common complication was cosmetic side effects that occurred in 98% patients. Skin infections occurred in 83% of the patients and most of them were viral infections (65%, especially of human papilloma viruses (HPVs in 40% of the patients. We found six cases of malignancy in these patients in that four cases were skin cancers, including one case of SCC, one BCC, and two cases of Kaposi′s sarcoma. Dermatologic problems occur most frequently in RTRs, especially skin cancers which have higher frequency in these patients than general population, particularly, Kaposi sarcoma. Sun exposure has an important role in developing epithelial skin cancers following transplantation. The age of developing skin cancer in these patients was early than normal population. Conclusion: Our results emphasize the importance of dermatologic examinations and monitoring RTRs to obtain an early diagnosis and treatment of cutaneous manifestations.

  8. Acetylcysteine in random skin flap in rats

    Abla Luiz Eduardo Felipe

    2005-01-01

    Full Text Available PURPOSE: Analyze the ability of Acetylcysteine to reduce distal necrosis in a random skin flap, in the rat. METHODS: The present study utilized 28 adult male Wistar-EPM rats distributed, at random, in two groups of 14 animals. Control group rats (CG received distilled water and Acetylcysteine group animals (NACG received NAC (300 mg/kg by oral infusion, 15 minutes before flap elevation. On the seventh postoperative day, percentage of distal necrosis was determined and skin samples collected in order to allow determination of MDA levels. RESULTS: The mean necrotic area in CG group (control was 66 % and in NACG group (Acetylcysteine 52 %, a statistically significant difference according to the Mann-Whitney test (U calc = 25; U crit = 45. MDA levels were lower in the CG flap skin samples than in the NACG samples (U calc = 24; U crit = 45, the oposite being true in the normal skin samples (U calc = 10; U crit = 45. CONCLUSION: Acetylcysteine was effective, according to the model used, reducing the percentage of distal necrosis in NACG rats.

  9. Radiation Therapy for Skin Cancer

    ... skin cells called melanocytes that produce skin color ( melanin ). Radiation therapy is used mostly for melanomas that ... in addition to surgery, chemotherapy or biologic therapy. Hair Epidermis Dermis Subcutaneous Hair Follicle Vein Artery © ASTRO ...

  10. Sun Safety: Save Your Skin

    Full Text Available ... For Consumers Consumer Updates Sun Safety: Save Your Skin! Share Tweet Linkedin Pin it More sharing options ... show that exposure to the sun can cause skin cancer. Harmful rays from the sun—and from ...

  11. Tips for Relieving Dry Skin

    ... resources Meet our partners Español Donate Diseases and treatments Acne and rosacea Bumps and growths Color problems Contagious skin diseases Cosmetic treatments Dry / sweaty skin Eczema / dermatitis Hair and scalp ...

  12. Sun Safety: Save Your Skin

    Full Text Available ... have pale skin blond, red, or light brown hair been treated for skin cancer a family member ... the sun. If you don't have much hair, apply sunscreen to the top of your head, ...

  13. Drugs Approved for Skin Cancer

    ... Ask about Your Treatment Research Drugs Approved for Skin Cancer This page lists cancer drugs approved by the Food and Drug Administration (FDA) for skin cancer, including drugs for basal cell carcinoma and melanoma. ...

  14. Skin lesion removal-aftercare

    ... aftercare; Nevi - removal aftercare; Scissor excision aftercare; Skin tag removal aftercare; Mole removal aftercare; Skin cancer removal ... to the principles of the Health on the Net Foundation (www.hon.ch). The information provided herein ...

  15. Sun Safety: Save Your Skin

    Full Text Available ... that exposure to the sun can cause skin cancer. Harmful rays from the sun—and from sunlamps ... enjoying the outdoors, the National Council on Skin Cancer Prevention (NCSCP) has designated May 25, 2012 as “ ...

  16. Sun Safety: Save Your Skin

    Full Text Available ... all types of skin damage caused by sunlight water resistance—sunscreen that stays on your skin longer, even if it gets wet. Reapply water-resistant sunscreens as instructed on the label back ...

  17. Aspergillus antigen skin test (image)

    The aspergillus antigen skin test determines whether or not a person has been exposed to the mold aspergillus. It is performed by injecting an aspergillus antigen under the skin with a needle. After 48 ...

  18. Sun Safety: Save Your Skin

    Full Text Available ... against all types of skin damage caused by sunlight water resistance—sunscreen that stays on your skin ... go out. back to top Protect the Eyes Sunlight reflecting off snow, sand, or water further increases ...

  19. SKIN DETECTION OF ANIMATION CHARACTERS

    Kazi Tanvir Ahmed Siddiqui

    2015-02-01

    Full Text Available The increasing popularity of animes makes it vulnerable to unwanted usages like copyright violations and pornography. That’s why, we need to develop a method to detect and recognize animation characters. Skin detection is one of the most important steps in this way. Though there are some methods to detect human skin color, but those methods do not work properly for anime characters. Anime skin varies greatly from human skin in color, texture, tone and in different kinds of lighting. They also vary greatly among themselves. Moreover, many other things (for example leather, shirt, hair etc., which are not skin, can have color similar to skin. In this paper, we have proposed three methods that can identify an anime character’s skin more successfully as compared with Kovac, Swift, Saleh and Osman methods, which are primarily designed for human skin detection. Our methods are based on RGB values and their comparative relations.

  20. Skin - abnormally dark or light

    ... ency/article/003242.htm Skin - abnormally dark or light To use the sharing features on this page, ... the hands. The bronze color can range from light to dark (in fair-skinned people) with the ...

  1. Tissue Engineered Human Skin Equivalents

    Zheng Zhang; Michniak-Kohn, Bozena B.

    2012-01-01

    Human skin not only serves as an important barrier against the penetration of exogenous substances into the body, but also provides a potential avenue for the transport of functional active drugs/reagents/ingredients into the skin (topical delivery) and/or the body (transdermal delivery). In the past three decades, research and development in human skin equivalents have advanced in parallel with those in tissue engineering and regenerative medicine. The human skin equivalents are used commerc...

  2. A REVIEW ON SKIN CANCER

    S. Ramya Silpa; Chidvila V

    2013-01-01

    Skin cancer can be of 2 types mainly. They are malignant melanoma and non-malignant melanoma. Skin cancer mainly occurs due to exposure of sunlight. Ozone depletion and chemical exposures are other factors involved in precipitating skin cancer. Mutations of p53 gene are involved in UV- induced carcinogenesis. P53 gene acts vital in development of SCC. So, prevention of skin cancer is the main criteria. Regular application of sunscreens could be one of the primary prevention. The purpose of pr...

  3. Expression of p63 and Cyclooxygenase-2 and Their Correlation in Skin Tumors

    WU Yan; LIU Houjun; LI Jiawen

    2007-01-01

    To study the expression of p63 and cyclooxygenase-2 (cox-2) in skin tumors and evaluate the correlation between p63 and cox-2, the expressions of cox-2 and p63 were measured by streptavidin-peroxidase complex immunohistochemical technique in 17 cases of skin squamous cell carcinoma (SCC), 19 cases of Bowen's disease(Bowen), 11 cases of actinic keratosis(AK), 12 cases of seborreic keratosis(SK) and 13 specimens of normal skin. Our results showed that the expression of p63 in skin squamous cell carcinoma, Bowen's disease and actinic keratosis were significantly higher than that in seborreic keratosis, while the expression of p63 in seborreic keratosis was significantly higher than that in normal skin. The expression of cox-2 in skin squamous cell carcinoma,Bowen's disease and actinic keratosis were significantly higher than that in seborreic keratosis, while no statistical difference was noted in the expression of cox-2 between seborreic keratosis and normal skin. Cox-2 expression was positively correlated with the high p63 expression in malignant skin tumors. The increased expression of cox-2 and p63 may play an important role in the development of skin tumors and work synergetically in malignant skin tumors.

  4. Improvement parameters in dynamic compaction adjacent to the slopes

    Elham Ghanbari

    2015-04-01

    Full Text Available Dynamic compaction is a cost-effective method commonly used for improvement of sandy soils. A number of researchers have investigated experimentally and numerically the improvement parameters of soils using dynamic compaction, such as crater depth, improvement depth, and radial improvement, however, these parameters are not studied for improvement adjacent to the slopes or trenches. In this research, four different slopes with different inclinations are modeled numerically using the finite element code ABAQUS, and impact loads of dynamic compaction are applied. The static factors of safety are kept similar for all trenches and determined numerically by application of gravity loads to the slope using strength reduction method (SRM. The analysis focuses on crater depth and improvement region which are compared to the state of flat ground. It can be observed that compacted area adjacent to the slopes is narrower and slightly away from the slope compared to the flat state. Moreover, crater depth increases with increase in slope inclination.

  5. Resonance-like tunneling across a barrier with adjacent wells

    S Mahadevan; P Prema; S K Agarwalla; B Sahu; C S Shastry

    2006-09-01

    We examine the behavior of transmission coefficient across the rectangular barrier when attractive potential well is present on one or both sides and also the same is studied for a smoother barrier with smooth adjacent wells having Woods–Saxon shape. We find that presence of well with suitable width and depth can substantially alter at energies below the barrier height leading to resonant-like structures. In a sense, this work is complementary to the resonant tunneling of particles across two rectangular barriers, which is being studied in detail in recent years with possible applications in mind. We interpret our results as due to resonant-like positive energy states generated by the adjacent wells. We describe in detail the possible potential application of these results in electronic devices using n-type oxygen-doped gallium arsenide and silicon dioxide. It is envisaged that these results will have applications in the design of tunneling devices.

  6. Regional Fault Systems of Qaidam Basin and Adjacent Orogenic Belts

    2003-01-01

    The purpose of this paper is to analyze the regional fault systems of Qaidam basin and adjacent orogenic belts. Field investigation and seismic interpretation indicate that five regional fault systems occurred in the Qaidam and adjacent mountain belts, controlling the development and evolution of the Qaidam basin. These fault systems are: (1)north Qaidam-Qilian Mountain fault system; (2) south Qaidam-East Kunlun Mountain fault system; (3)Altun strike-slip fault system; (4)Elashan strike-slip fault system, and (5) Gansen-Xiaochaidan fault system. It is indicated that the fault systems controlled the orientation of the Qaidam basin, the formation and distribution of secondary faults within the basin,the migration of depocenters and the distribution of hydrocarbon accumulation belt.

  7. Microbial Skin Inhabitants: Friends Forever.

    Dorrestein, Pieter C; Gallo, Richard L; Knight, Rob

    2016-05-01

    To gain insight into the stability of the microbial communities that inhabit our skin, Oh et al., in a tour-de-force effort, map the human skin metagenomes over time. Remarkably, their data indicate that the individual, not the environment, primarily drives the composition of skin microbial communities. PMID:27153488

  8. Skin Cancers of the Feet

    ... skin of the lower legs and feet. Skin cancers affecting the feet may have a very different appearance from those arising on the rest of the body. For this reason, a podiatrist's knowledge and clinical training is of ... and malignant skin tumors. Learn the ABCDs of melanoma. If you notice ...

  9. Skin Pedagogies and Abject Bodies

    Kenway, Jane; Bullen, Elizabeth

    2011-01-01

    How does the beauty industry "narrate the skin"? What does it teach women from different cultural groups about the female body? How does skin function as a site where female subjection and abjection are produced and reproduced? In this paper we examine the skin industry pointing to its extreme commodification of the female body and to the…

  10. On heavy machines dynamical loading under adjacent links shocks

    Трубачев, Сергей Иванович; Лысюк, Дмитрий Степанович; Талимонова, Ольга Юрьевна

    2014-01-01

    The mathematical model, describing the dynamics under collision of heavy machinery adjacent links in the presence of gaps and other elements with a dead or smoothness zone of transfer functions of kinematic chains, is given. The model is designed using a procedure of "smoothing" discontinuous functions and regarding a variable structure. The specific example of a dynamic system and its numerical calculation is considered. The pressure between the roller and a workpiece is expressed by means o...

  11. Acyclic Edge Coloring of Planar Graphs without Adjacent Triangles

    Dezheng XIE; Yanqing WU

    2012-01-01

    An acyclic edge coloring of a graph G is a proper edge coloring such that there are no bichromatic cycles.The acyclic edge chromatic number of a graph G is the minimum number k such that there exists an acyclic edge coloring using k colors and is denoted by x'a(G).In this paper we prove that x'a(G)≤ Δ(G)+ 5 for planar graphs G without adjacent triangles.

  12. Concentric network symmetry grasps authors' styles in word adjacency networks

    Amancio, Diego R.; Filipi N. Silva; Costa, Luciano da F.

    2015-01-01

    Several characteristics of written texts have been inferred from statistical analysis derived from networked models. Even though many network measurements have been adapted to study textual properties at several levels of complexity, some textual aspects have been disregarded. In this paper, we study the symmetry of word adjacency networks, a well-known representation of text as a graph. A statistical analysis of the symmetry distribution performed in several novels showed that most of the wo...

  13. Soil Structure Interaction between Two Adjacent Buildings under Earthquake Load

    Mahmoud Yahyai; Masoud Mirtaheri; Mehrab Mahoutian; Amir S. Daryan

    2008-01-01

    In some cases, tall buildings are located in geotechnically unsuitable places, due to their high ratio of height to width; there is risk of uplift and other effects such as overturning and reduction structure serviceability during earthquake. This research is aimed to evaluate the effect of Soil-Structure Interaction (SSI) on seismic behavior of two adjacent 32 story buildings such as time period, base shear and displacements. The interaction effects are investigated for variable distance bet...

  14. Disrupted Turn Adjacency and Coherence Maintenance in Instant Messaging Conversations

    Berglund, Therese Örnberg

    2009-01-01

    This article reports on a study of coherence in text-based log files from 120 two-party Instant Messaging (IM) conversations among a group of international students at a design school. The goals of the study were to investigate whether disrupted turn adjacency was an obstacle to coherence and to identify the linguistic strategies employed to maintain coherence. Additional signs of problematic coherence creation were also investigated, focusing on explicit signs of miscommunication. In this pa...

  15. Heterogeneous Stem Cells in Skin Homeostatis and Wound Repair

    Anna Meilana

    2015-08-01

    Full Text Available BACKGROUND: The skin protects mammals from insults, infection and dehydration and enables thermoregulation and sensory perception. Various skin-resident cells carry out these diverse functions. Constant turnover of cells and healing upon injury necessitate multiple reservoirs of stem cells. The skin is a complex organ harboring several distinct populations of stem cells and a rich array of cell types. Advances in genetic and imaging tools have brought new findings about the lineage relationships between skin stem cells and their progeny. Such knowledge may offer novel avenues for therapeutics and regenerative medicine. CONTENT: In the past years, our view of the mechanisms that govern skin homeostasis and regeneration have markedly changed. New populations of stem cells have been identified that behave spatio-temporally differently in healthy tissues and in situations of damage, indicating that a great level of stem cell heterogeneity is present in the skin. There are believed to be distinct populations of stem cells in different locations. The lineages that they feed are normally constrained by signals from their local environment, but they can give rise to all epidermal lineages in response to appropriate stimuli. Given the richness of structures such as blood vessels, subcutaneous fat, innervation and the accumulation of fibroblasts under the upper parts of the rete ridges (in the case of human skin, it is reasonable to speculate that the microenvironment might be essential for interfollicular epidermal homeostasis. The bloodstream is probably the main source of long-range signals reaching the skin, and cues provided by the vascular niche might be essential for skin homeostasis. SUMMARY: A key function of the interfollicular epidermis is to act as a protective interface between the body and the external environment, and it contains several architectural elements that enable it to fulfill this function. All elements of the epidermis play

  16. FMRI evidence of acupoints specificity in two adjacent acupoints.

    Liu, Hua; Xu, Jian-Yang; Li, Lin; Shan, Bao-Ci; Nie, Bin-Bin; Xue, Jing-Quan

    2013-01-01

    Objectives. Acupoint specificity is the foundation of acupuncture treatment. The aim of this study is to investigate whether the acupoint specificity exists in two adjacent acupoints. Design and Setting. Two adjacent real acupoints, LR3 (Taichong) and ST44 (Neiting), and a nearby nonacupoint were selected. Thirty-three health volunteers were divided into three groups in random order, and each group only received acupuncture at one of the three points. While they received acupuncture, fMRI scan was performed. Results. The common cerebral activated areas responding to LR3 and ST44 included the contralateral primary somatosensory area (SI) and ipsilateral cerebellum. Acupuncture at LR3 specifically activated contralateral middle occipital gyrus, ipsilateral medial frontal gyrus, superior parietal lobe, middle temporal gyrus, rostral anterior cingulate cortex (rACC), lentiform nucleus, insula, and contralateral thalamus. Stimulation at ST44 selectively activated ipsilateral secondary somatosensory area (SII), contralateral middle frontal gyrus, inferior frontal gyrus, lingual gyrus, lentiform nucleus, and bilateral posterior cingulate cortex (PCC). Conclusions. Acupuncture at adjacent acupoints elicits distinct cerebral activation patterns, and those specific patterns might be involved in the mechanism of the specific therapeutic effects of different acupoints. PMID:23762172

  17. Serotonin in human skin

    Jianguo Huang; Qiying Gong; Guiming Li

    2005-01-01

    In this review the authors summarize data of a potential role for serotonin in human skin physiology and pathology. The uncovering of endogenous serotonin synthesis and its transformation to melatonin underlines a putative important role of this pathway in melanocyte physiology and pathology. Pathways of the biosynthesis and biodegradation of serotonin have been characterized in human beings and its major cellular populations. Moreover, receptors of serotonin are expressed on keratinocytes, melanocytes, and fibroblasts and these mediate phenotypic actions on cellular proliferation and differentiation. And the widespread expression of a cutaneous seorotoninergic system indicates considerable selectivity of action to facilitate intra-, auto-, or paracrine mechanisms that define and influence skin function in a highly compartmentalized manner. Melatonin, in turn, can also act as a hormone, neurotransmitter, cytokine, biological modifier and immunomodulator. Thus, Serotonin local synthesis and cellular localization could thus become of great importance in the diagnosis and management of cutaneous pathology.

  18. Skin barrier in rosacea.

    Addor, Flavia Alvim Sant'Anna

    2016-01-01

    Recent studies about the cutaneous barrier demonstrated consistent evidence that the stratum corneum is a metabolically active structure and also has adaptive functions, may play a regulatory role in the inflammatory response with activation of keratinocytes, angiogenesis and fibroplasia, whose intensity depends primarily on the intensity the stimulus. There are few studies investigating the abnormalities of the skin barrier in rosacea, but the existing data already show that there are changes resulting from inflammation, which can generate a vicious circle caused a prolongation of flare-ups and worsening of symptoms. This article aims to gather the most relevant literature data about the characteristics and effects of the state of the skin barrier in rosacea. PMID:26982780

  19. Skin contamination dosimeter

    Hamby, David M.; Farsoni, Abdollah T.; Cazalas, Edward

    2011-06-21

    A technique and device provides absolute skin dosimetry in real time at multiple tissue depths simultaneously. The device uses a phoswich detector which has multiple scintillators embedded at different depths within a non-scintillating material. A digital pulse processor connected to the phoswich detector measures a differential distribution (dN/dH) of count rate N as function of pulse height H for signals from each of the multiple scintillators. A digital processor computes in real time from the differential count-rate distribution for each of multiple scintillators an estimate of an ionizing radiation dose delivered to each of multiple depths of skin tissue corresponding to the multiple scintillators embedded at multiple corresponding depths within the non-scintillating material.

  20. Skin Cancer: Biology, Risk Factors & Treatment

    ... turn Javascript on. Feature: Skin Cancer Skin Cancer: Biology, Risk Factors & Treatment Past Issues / Summer 2013 Table ... Articles Skin Cancer Can Strike Anyone / Skin Cancer: Biology, Risk Factors & Treatment / Timely Healthcare Checkup Catches Melanoma ...

  1. Functional angiocoupling between follicles and adjacent corpus luteum in heifers.

    Ginther, O J; Siddiqui, M A R; Baldrighi, J M

    2016-07-15

    In single ovulating cattle, ipsilateral versus contralateral interovarian relationships refer to a dominant follicle (DF) and CL in the same versus opposite ovaries. The ipsilateral relationship consists of the DF-CL and the devoid (no DF or CL) intraovarian pattern, and the contralateral relationship consists of the DF pattern and the CL pattern. The DF-CL pattern involves positive effects on both the DF and CL when adjacent (≤3-mm apart) versus separated as follows: greater diameter of DF (e.g., 10.5 ± 0.4 vs. 9.0 ± 0.4 mm), greater percentage of the DF wall with color Doppler signals of blood flow (40.2% ± 2.0% vs. 24.5% ± 1.9%), greater cross-sectional area of the CL (2.2 ± 0.1 vs. 1.8 ± 0.2 cm(2)), and greater percentage of the entire CL with blood flow signals (51.8% ± 1.2% vs. 42.5% ± 3.1%). Additional examples of positive coupling are (1) future DF on Day 0 (day of ovulation) is closer to the CL than the future largest subordinate and (2) diameter of growing follicles on Day 0 and the growth rate on Days 0 to 2 are greater for follicles that are adjacent than separated from the CL. An example of a negative intraovarian effect is decreasing diameter and loss of future DF status of a largest follicle when adjacent to a regressing CL. The impact of the continuity of ovarian angioarchitecture during the periovulatory follicular wave was exemplified in 17 of 18 waves by conversion of an ovary with only the preovulatory follicle to the postovulatory DF-CL pattern. Functional angiocoupling from commonality in angioarchitecture of the DF and adjacent CL would account for both the positive two-way coupling between DF and CL during the luteal phase and the negative effect of a regressing CL on an adjacent follicle during luteolysis. PMID:27056414

  2. Lyme Borreliosis and Skin

    Biju Vasudevan; Manas Chatterjee

    2013-01-01

    Lyme disease is a multisystem illness which is caused by the strains of spirochete Borrelia burgdorferi sensu lato and transmitted by the tick, Ixodes. Though very commonly reported from the temperate regions of the world, the incidence has increased worldwide due to increasing travel and changing habitats of the vector. Few cases have been reported from the Indian subcontinent too. Skin manifestations are the earliest to occur, and diagnosing these lesions followed by appropriate treatment, ...

  3. "Ser diferente é normal?"/"Being different: is it normal?"

    Viviane Veras

    2007-01-01

    Full Text Available A pergunta título deste trabalho retoma o slogan “Ser diferente é normal”, que é parte da campanha criada para uma organização não-governamental que atende portadores de Síndrome de Down. O objetivo é a inclusão social da pessoa com deficiência e o primeiro passo foi propor a inclusão de um grupo de diferentes no grupo dito normal. No vídeo de lançamento da campanha, o diferente, identificado como normal, é mostrado por meio de exemplos – um negro com cabelo black-power, um skin-head, um corpo tatuado, um corpo feminino halterofílico, uma família hippie, uma garota com síndrome de Down. A visão da adolescente dançando reduz, de certo modo, o efeito imaginário que vai além da síndrome, uma vez que apenas o corpo com seus olhinhos puxados se destacam, e não se interrogam questões cognitivas. Minha proposta é refletir sobre o estatuto paradoxal do exemplo, tal como é trabalhado nesse vídeo: se, por definição, um exemplo mostra de fato seu pertencimento a uma classe, pode-se concluir que é exatamente por ser exemplar que ele se encontra fora dela, no exato momento em que a exibe e define. The question in the title of this paper refers to the slogan "ser diferente é normal" ("It´s normal to be different", which is part of a campaign created for a NGO that supports people with Down syndrome. The objective of the campaign is to promote the social inclusion of individuals with Down syndrome, and the first step was to propose the inclusion of a group of "differents" in the so-called normal group. The film launching the campaign shows the different identified as normal by means of examples: a black man exhibiting blackpower haircut, a skin-head, a tattooed body, an over-athletic female body, a hippie family and a girl with Down syndrome. The vision of the dancing teenager lessens the imaginary effect that surpasses the syndrome, since only her body and her little oriental eyes stand out and no cognitive issues are

  4. Skin metastases of lung cancer:

    Kecelj, Peter; Košnik, Mitja; Požek, Igor; Triller Vadnal, Katja; Triller, Nadja

    2008-01-01

    Skin metastases of lung cancer are rare. In over a 3-year period we found only14 cases of skin metastases among 1,614 patients with lung cancer admittedto the University Clinic of Respiratory and Allergic Diseases in Golnik. The metastases are usually manifested on the skin of the chest. Skin metastases are symptoms of progressive disease, and usually a sign of a poor prognosis. The median survival time of lung cancer patients with skin metastases was 85 days from the time of detection of the...

  5. Skin care in ethnic populations.

    Cole, Patrick D; Hatef, Daniel A; Taylor, Susan; Bullocks, Jamal M

    2009-08-01

    Use of over-the-counter cosmetics, approaches to hygiene, and many basic dermatologic principles differ between individuals with Caucasian skin and ethnic skin. Still, comparatively few publications highlight these variations or discuss appropriate management. Among many ethnic patients, issues related to skin hydration, restoration of even pigmentation, hair removal, and acne care remain problematic yet not fully addressed. As well, there are some dermatologic conditions that may be rare in Caucasian skin but are much more common in the ethnic patient. Here, we discuss various aspects of skin hydration, dyschromia, sunscreen use, and chemical depilatories in the ethnic population. PMID:20676310

  6. A REVIEW ON SKIN CANCER

    S. Ramya Silpa

    2013-08-01

    Full Text Available Skin cancer can be of 2 types mainly. They are malignant melanoma and non-malignant melanoma. Skin cancer mainly occurs due to exposure of sunlight. Ozone depletion and chemical exposures are other factors involved in precipitating skin cancer. Mutations of p53 gene are involved in UV- induced carcinogenesis. P53 gene acts vital in development of SCC. So, prevention of skin cancer is the main criteria. Regular application of sunscreens could be one of the primary prevention. The purpose of present review is to outline types, pathogenesis, diagnosis, prevention and treatment of skin cancer.

  7. SKIN RADIATION IN PANORAMIC

    Herry Irawan

    2015-06-01

    Full Text Available Dental panoramic radiograph in Indonesia has been widely used. Modern diagnostic imaging equipment with minimum radiation is still very limited. One of the conditions in nuclear safety law, UU 10/1997, is an optimization of all radiation sources with DRL through skin dose measurements. In Indonesia, the national DRL has not been established yet, and there were no reports on the study of panoramic skin dose in Indonesia. The aim of this preliminary study was to obtain a panoramic skin dose radiation as reference to establish DRL in Indonesia. Panoramic radiographs of sixteen female and fifteen male patients, aged 4 – 48 years, were taken using the standard conventional method, with TLD chips attached in location groups. The chips were then read with the detector and integrator of BATAN, in high and low temperature condition at the same time. It was revealed that behind the right and left ear were the regions with the highest radiation dose received, followed by the back of the neck, left jaw, right jaw, and chin. The result of this study has shown the importance of DRL in Indonesia since the use of modern diagnostic imaging equipement that limits radiation dose to the minimum level is still very limited.

  8. Study on skin decontamination

    Chinese San-Yuan white pigs 4∼6 weeks old were used in skin decontamination experiments. The decontamination agents used were the SM series of decontamination agents. In immediate decontamination test, K 97.7% (DF = 43.5) was obtained for 131I, K>99%(DF>100) for 90Sr/90Y, MFP and U + TRU, K = 99.9%(DF = 1000) for 137Cs. DF = 27∼67 (K 96.3%∼98.5%) was obtained for the nuclides mentioned above in 3 h delayed decontamination test. When the initial contamination level of MFP increased from 200 to 3000 cps/10 cm2, the remained activity was still lower than 10 Bq/cm2 after decontamination, and no additional decontamination is needed. For radioactive ashes contamination, DF = 57∼1000 (K 98.2%∼99.9%) was reached in 4 h-delayed decontamination. The SM series of decontamination agents are neutral liquid or cream having no stimulating effect to skin. It is effective and easy to use in skin decontamination

  9. The Pinking Shears: A Novel Tool for Improving Skin Graft Cosmesis

    Cormac W. Joyce, MB BCh

    2014-12-01

    Full Text Available Summary: A significant aesthetic disadvantage to split skin grafts is the obvious transition between the graft and the normal skin. We report on a novel method to interrupt this transition point by using pinking shears, which are dressmaking scissors with saw-toothed blades that create a chevron pattern instead of a straight edge. We describe a case where the pinking shears were utilized on a split skin graft and Integra for reconstruction of the skin on a volar forearm. This technique allows for breaking-up of the transition point between the skin graft and normal skin and gives rise to an improved aesthetic outcome as the boundary is significantly less well-defined. This novel method shows promise and further study is certainly warranted.

  10. Normal Pressure Hydrocephalus

    ... involves surgical placement of a shunt in the brain to drain excess CSF into the abdomen where it can be absorbed as part of the normal circulatory process. This allows the brain ventricles to return to their normal size. Regular ...

  11. Ultraviolet radiation and skin cancer.

    Narayanan, Deevya L; Saladi, Rao N; Fox, Joshua L

    2010-09-01

    Skin cancer is the most common type of cancer in fair-skinned populations in many parts of the world. The incidence, morbidity and mortality rates of skin cancers are increasing and, therefore, pose a significant public health concern. Ultraviolet radiation (UVR) is the major etiologic agent in the development of skin cancers. UVR causes DNA damage and genetic mutations, which subsequently lead to skin cancer. A clearer understanding of UVR is crucial in the prevention of skin cancer. This article reviews UVR, its damaging effects on the skin and its relationship to UV immunosuppression and skin cancer. Several factors influence the amount of UVR reaching the earth's surface, including ozone depletion, UV light elevation, latitude, altitude, and weather conditions. The current treatment modalities utilizing UVR (i.e. phototherapy) can also predispose to skin cancers. Unnecessary exposure to the sun and artificial UVR (tanning lamps) are important personal attributable risks. This article aims to provide a comprehensive overview of skin cancer with an emphasis on carefully evaluated statistics, the epidemiology of UVR-induced skin cancers, incidence rates, risk factors, and preventative behaviors & strategies, including personal behavioral modifications and public educational initiatives. PMID:20883261

  12. Photothermal Radiometry for Skin Research

    Perry Xiao

    2016-02-01

    Full Text Available Photothermal radiometry is an infrared remote sensing technique that has been used for skin and skin appendages research, in the areas of skin hydration, hydration gradient, skin hydration depth profiling, skin thickness measurements, skin pigmentation measurements, effect of topically applied substances, transdermal drug delivery, moisture content of bio-materials, membrane permeation, and nail and hair measurements. Compared with other technologies, photothermal radiometry has the advantages of non-contact, non-destructive, quick to make a measurement (a few seconds, and being spectroscopic in nature. It is also colour blind, and can work on any arbitrary sample surfaces. It has a unique depth profiling capability on a sample surface (typically the top 20 µm, which makes it particularly suitable for skin measurements. In this paper, we present a review of the photothermal radiometry work carried out in our research group. We will first introduce the theoretical background, then illustrate its applications with experimental results.

  13. Is My Penis Normal?

    ... I Help a Friend Who Cuts? Is My Penis Normal? KidsHealth > For Teens > Is My Penis Normal? Print A A A Text Size en ... any guy who's ever worried about whether his penis is a normal size. There's a fairly wide ...

  14. Experimental diabetes exacerbates skin transplant rejection in rats

    Flávio Pola dos Reis

    2013-05-01

    Full Text Available PURPOSE: To investigate the effect of chronic experimental diabetes on skin allografts in rats as a simple model that could clarify some basic aspects and mechanisms involved in transplant rejection in diabetes compared to normal animals. METHODS: Skin grafting was performed with fragments of tail skin from sex matched non diabetic Wistar rats engrafted onto the thoracic area of diabetic and non diabetic recipients. Grafts were scored for rejection every other day and were removed on day 14. Skin grafts were graded according to the following itens: no rejection; or rejection including: acute, chronic and humoral and/or cellular rejection. Statistical analysis was performed using JMP 5.1 software with ANOVA test. Diabetes was induced with IV injection of alloxan 40 mg/kg. RESULTS: Inflammatory vascular infiltrate compromising the endothelium with areas of fibrinoid necrosis and thrombosis characteristics of acute humoral rejection and subendothelial lymphocyte infiltrate typical of acute cellular rejection were significantly (p<0.003 higher in diabetic than in non diabetic recipients as the inflammatory infiltrate in the epidermis (p<0.002. CONCLUSION: Skin transplant acute rejection from chronic alloxan diabetic rats to normal tissue was significantly more intense than the acute rejection between normal rats.

  15. A Note on Markov Normalized Magnetic Eigenmaps

    Cloninger, Alexander

    2016-01-01

    We note that building a magnetic Laplacian from the Markov transition matrix, rather than the graph adjacency matrix, yields several benefits for the magnetic eigenmaps algorithm. The two largest benefits are that the embedding becomes more stable as a function of the rotation parameter g, and the principal eigenvector of the magnetic Laplacian now converges to the page rank of the network as a function of diffusion time. We show empirically that this normalization improves the phase and real/imaginary embeddings of the low-frequency eigenvectors of the magnetic Laplacian.

  16. Degenerative alterations of dermal collagen fiber bundles in photodamaged human skin and UV-irradiated hairless mouse skin: possible effect on decreasing skin mechanical properties and appearance of wrinkles.

    Nishimori, Y; Edwards, C; Pearse, A; Matsumoto, K; Kawai, M; Marks, R

    2001-12-01

    Dermal collagen fiber bundles (DCFB) are the major constructional element in the dermis. Although degenerative alterations of DCFB have been reported in chronologically aged skin, changes in photodamaged skin have not been fully investigated. We report ultrastructural alterations of DCFB, and their relation to skin elasticity using photodamaged human skin and UV-irradiated hairless mouse skin. The degree to which DCFB were intact and closely packed was evaluated and scored blindly. Exposed skin (outer forearm) exhibited marked ultrastructural degeneration. In UV-irradiated hairless mouse skin, the intact ultrastructural appearance of DCFB was gradually lost with increasing UV dosage; however, marked alterations in DCFB ultrastructure were absent in either human inner upper arm (unexposed) skin or nonirradiated age-matched control mouse skin. Skin mechanical properties were measured using a Cutometer SEM 474 suction extensometer, recording Ue* immediate deformation, Uv* viscous deformation, Uf* final deformation, and Ur* immediate contraction, all normalized for skin thickness. Uf*, Ue*, Uv*, and Ur/Uf were significantly decreased in exposed compared with unexposed skin. Significant positive correlations between degenerative alterations of DCFB and the decrease in Uf*, Ue*, and Uv* were seen. Changes of "% area of wrinkles" in UV-irradiated mouse skin was significantly correlated with degenerative changes of DCFB. Based on these results, we confirm observations made by others that chronic photodamage may have more severe effects on degeneration of DCFB than that of chronologic aging alone. Furthermore, degeneration of DCFB as detected ultrastructurally may, by its effect on skin elasticity, result in an increase in the appearance of wrinkles. PMID:11886509

  17. Do normal hips dislocate?

    Alshameeri, Zeiad; Rehm, Andreas

    2014-11-01

    There have been a small number of case reports describing late normal-hip dislocations in children who were later diagnosed with developmental dysplasia of the hip. Here, we contest the assumption that normal hips can dislocate. We argue that (as in our case) the ultrasound scans in all published case reports on late dislocated normal hips did not show results that were entirely normal and therefore, so far, there has been no convincing evidence of a dislocation of a normal hip. We also want to highlight the importance of meticulous ultrasound and clinical assessments of high-risk children by an experienced orthopaedic surgeon. PMID:25144883

  18. Comparison of Decontamination Methods for Human Skin Grafts.

    Mann-Salinas, Elizabeth A; Joyner, Denar D; Guymon, Charles H; Ward, Catherine L; Rathbone, Christopher R; Jones, John A; Akers, Kevin S

    2015-01-01

    Skin grafts intended for autologous transplant may be dropped on the operating room floor during handling. The authors examined optimal procedures for decontaminating tissue intended for burn surgery. Porcine skin (5 × 5 cm sections) harvested from expired animals using standard procedures was inoculated with either 10(6) CFU/ml Staphylococcus aureus or Klebsiella pneumoniae. Decontaminating strategies were compared: 10% povidone iodine, 0.04% chlorhexidine, or 50 U/ml bacitracin for injection, and mechanical agitation using normal saline or sterile water; each agent was applied for 60 seconds. Each skin section was blended and plated on agar for bacterial enumeration using the spread plate method. Tissue viability was evaluated in parallel using a cell viability reagent, along with a control (heat at 200 °C for 5 min). Bacterial counts were log transformed; one-way ANOVA with Tukey-Kramer HSD analysis were performed. Concentration of organisms porcine skin. PMID:25383978

  19. Novel biodegradable porous scaffold applied to skin regeneration.

    Hui-Min Wang

    Full Text Available Skin wound healing is an important lifesaving issue for massive lesions. A novel porous scaffold with collagen, hyaluronic acid and gelatin was developed for skin wound repair. The swelling ratio of this developed scaffold was assayed by water absorption capacity and showed a value of over 20 g water/g dried scaffold. The scaffold was then degraded in time- and dose-dependent manners by three enzymes: lysozyme, hyaluronidase and collagenase I. The average pore diameter of the scaffold was 132.5±8.4 µm measured from SEM images. With human skin cells growing for 7 days, the SEM images showed surface fractures on the scaffold due to enzymatic digestion, indicating the biodegradable properties of this scaffold. To simulate skin distribution, the human epidermal keratinocytes, melanocytes and dermal fibroblasts were seeded on the porous scaffold and the cross-section immunofluorescent staining demonstrated normal human skin layer distributions. The collagen amount was also quantified after skin cells seeding and presented an amount 50% higher than those seeded on culture wells. The in vivo histological results showed that the scaffold ameliorated wound healing, including decreasing neutrophil infiltrates and thickening newly generated skin compared to the group without treatments.

  20. Dry skin in the elderly: complexities of a common problem.

    White-Chu, E Foy; Reddy, Madhuri

    2011-01-01

    Dry skin, or xerosis, is a common skin condition in older adults, but it is not a normal part of aging. The geriatric patient may have several incurable, but treatable, chronic diseases that affect their skin. Xerosis in older adults is multifactorial: intrinsic changes in keratinization and lipid content, use of diuretics and similar medications, and overuse of heaters or air conditioners all contribute. Xerosis causes pruritus, which then leads to excoriations and risk of skin infections. Patients can minimize the effect of xerosis by increasing the ambient humidity, modifying their bathing technique and products, and using emollients to replace the lipid components of the skin. Care should be made to avoid skin sensitizers, such as lanolin, aloe vera, and parabens, that are commonly found in emollients. These may lead to a delayed hypersensitivity reaction. This contribution reviews the intrinsic and extrinsic aging processes of skin aging and advises practical changes in environment and emollient application that can be distributed to patients. PMID:21146730

  1. Correlation between Focal Nodular Low Signal Changes in Hoffa's Fat Pad Adjacent to Anterior Femoral Cartilage and Focal Cartilage Defect Underlying This Region and Its Possible Implication

    Ng, Wuey Min

    2016-01-01

    Purpose. This study investigates the association between focal nodular mass with low signal in Hoffa's fat pad adjacent to anterior femoral cartilage of the knee (FNMHF) and focal cartilage abnormality in this region. Method. The magnetic resonance fast imaging employing steady-state acquisition sequence (MR FIESTA) sagittal and axial images of the B1 and C1 region (described later) of 148 patients were independently evaluated by two reviewers and categorized into four categories: normal, FNMHF with underlying focal cartilage abnormality, FNMHF with normal cartilage, and cartilage abnormality with no FNMHF. Results. There was a significant association (p = 0.00) between FNMHF and immediate adjacent focal cartilage abnormality with high interobserver agreement. The absence of focal nodular lesions next to the anterior femoral cartilage has a very high negative predictive value for chondral injury (97.8%). Synovial biopsy of focal nodular lesion done during arthroscopy revealed some fibrocollagenous tissue and no inflammatory cells. Conclusion. We postulate that the FNMHF adjacent to the cartilage defects is a form of normal healing response to the cartilage damage. One patient with FHMHF and underlying cartilage abnormality was rescanned six months later. In this patient, the FNMHF disappeared and normal cartilage was observed in the adjacent region which may support this theory.

  2. Impact of adjacent land use on coastal wetland sediments.

    Karstens, Svenja; Buczko, Uwe; Jurasinski, Gerald; Peticzka, Robert; Glatzel, Stephan

    2016-04-15

    Coastal wetlands link terrestrial with marine ecosystems and are influenced from both land and sea. Therefore, they are ecotones with strong biogeochemical gradients. We analyzed sediment characteristics including macronutrients (C, N, P, K, Mg, Ca, S) and heavy metals (Mn, Fe, Cu, Zn, Al, Co, Cr, Ni) of two coastal wetlands dominated by Phragmites australis at the Darss-Zingst Bodden Chain, a lagoon system at the Southern Baltic Sea, to identify the impact of adjacent land use and to distinguish between influences from land or sea. In the wetland directly adjacent to cropland (study site Dabitz) heavy metal concentrations were significantly elevated. Fertilizer application led to heavy metal accumulation in the sediments of the adjacent wetland zones. In contrast, at the other study site (Michaelsdorf), where the hinterland has been used as pasture, heavy metal concentrations were low. While the amount of macronutrients was also influenced by vegetation characteristics (e.g. carbon) or water chemistry (e.g. sulfate), the accumulation of heavy metals is regarded as purely anthropogenic influence. A principal component analysis (PCA) based on the sediment data showed that the wetland fringes of the two study sites are not distinguishable, neither in their macronutrient status nor in their concentrations of heavy metals, whereas the interior zones exhibit large differences in terms of heavy metal concentrations. This suggests that seaside influences are minor compared to influences from land. Altogether, heavy metal concentrations were still below national precautionary and action values. However, if we regard the macronutrient and heavy metal concentrations in the wetland fringes as the natural background values, an accumulation of trace elements from agricultural production in the hinterland is apparent. Thus, coastal wetlands bordering croplands may function as effective pollutant buffers today, but the future development has to be monitored closely to avoid

  3. Three-dimensional visualization of intracranial vessels and adjacent structures

    MR three-dimensional-Fourier-transform, gradient-echo sequences are available that allow the acquisition of high-quality data sets, suitable for three- dimensional image processing. Most recently, flow- compensated measurement sequences are used to achieve a three-dimensional perspective of the vascular anatomy. Spatial relationships between vessels and adjacent structures can be revealed by three-dimensional displays, showing both vessels and tissue surfaces (brain, tumor) in a three- dimensional manner. The image-processing techniques are based on the ray-tracing principle. The method can be used for the optimization of neurosurgical planning in the sellar region

  4. Historical Earthquakes in the Yellow Sea and Its Adjacent Area

    Wu Ge; Wang Andong; Wu Di

    2005-01-01

    As a result of sorting out, estimating and cataloging of historical earthquakes, from the year of 2 A.D. to Aug., 1949, we found that there were 2187 earthquakes with M≥3.0 in the area of the Yellow Sea and its adjacent area. Among the earthquakes, the number of earthquakes with M ≥ 5.0 is 209, and at least 43 of the earthquakes caused serious losses, 20 of the earthquakes caused human causalities. It is demonstrated that there were 3 areas of historical earthquake concentration and the earthquake activity was higher in the 16th century and the first half if the 20th century.

  5. The kernel of the adjacency matrix of a rectangular mesh

    Tomei, Carlos; Vieira, Tania

    2002-01-01

    Given an m x n rectangular mesh, its adjacency matrix A, having only integer entries, may be interpreted as a map between vector spaces over an arbitrary field K. We describe the kernel of A: it is a direct sum of two natural subspaces whose dimensions are equal to $\\lceil c/2 \\rceil$ and $\\lfloor c/2 \\rfloor$, where c = gcd (m+1,n+1) - 1. We show that there are bases to both vector spaces, with entries equal to 0, 1 and -1. When K = Z/(2), the kernel elements of these subspaces are described...

  6. Experimental Tape Casting of Adjacently Graded Materials for Magnetic Refrigeration

    Bulatova, Regina

    graded thin films. The motivation to create such adjacently segmented structures stemmed from a search of material and a materials design alternative to the expensive rare earth element gadolinium which is widely used as a magnetic regenerator in the emerging magnetic refrigeration technology....... Conventional tape casting involves the preparation of specially formulated slurry, which is cast by a blade to a thin flat tape, then dried into flexible so-called green solid tape and can be subsequently sintered into a hard ceramic material. The principal difference and, at the same time, a challenge...

  7. The formation of adjacent triplex-duplex domainsin DNA.

    Nam, K. H.; Abhiraman, S; Wartell, R M

    1999-01-01

    The ability of single-stranded DNA oligomers to form adjacent triplex and duplex domains with two DNA structural motifs was examined. Helix-coil transition curves and a gel mobility shift assay were used to characterize the interaction of single-stranded oligomers 12-20 nt in length with a DNA hairpin and with a DNA duplex that has a dangling end. The 12 nt on the 5'-ends of the oligomers could form a triplex structure with the 12 bp stem of the hairpin or the duplex portion of the DNA with a...

  8. Adjacent Lumbar Disc Herniation after Lumbar Short Spinal Fusion

    Koshi Ninomiya; Koichi Iwatsuki; Yu-ichiro Ohnishi; Toshika Ohkawa; Toshiki Yoshimine

    2014-01-01

    A 70-year-old outpatient presented with a chief complaint of sudden left leg motor weakness and sensory disturbance. He had undergone L4/5 posterior interbody fusion with L3–5 posterior fusions for spondylolisthesis 3 years prior, and the screws were removed 1 year later. He has been followed up for 3 years, and there had been no adjacent segment problems before this presentation. Lumbar magnetic resonance imaging (MRI) showed a large L2/3 disc hernia descending to the L3/4 level. Compared to...

  9. Exophytic Atheroma Mimicking Papillary Fibroelastoma Adjacent to the Aortic Valve.

    Cho, Tomoki; Tokunaga, Shigehiko; Yasuda, Shota; Izubuchi, Ryo; Masuda, Munetaka

    2015-09-01

    Follow-up echocardiography in a 69-year-old man with alcoholic cardiomyopathy showed a mass above the aortic valve near the left coronary ostium. Transesophageal echocardiography and computed tomography suggested a papillary fibroelastoma with a high risk of embolism. At operation we found an exophytic atheroma adjacent to the left coronary artery orifice. The atheroma was removed, and the patient made an uneventful recovery. We describe this very rare case of an exophytic atheroma mimicking a papillary fibroelastoma situated at the left coronary orifice. PMID:26354633

  10. An ElGamal Encryption Scheme of Adjacency Matrix and

    B. Ravi Kumar

    2015-10-01

    Full Text Available  Cryptography is the combination of Mathematics and Computer science. Cryptography is used for encryption and decryption of data using mathematics. Cryptography transit the information in an illegible manner such that only intended recipient will be able to decrypt the information. In the recent years, researchers developed several new encryption methods. Among such ElGamal encryption is the one laid a concede platform for the researchers in Cryptography. Ever science several mathematical models were applied for encryption/decryption. In this paper, we introduced an ElGamal encryption, which uses points on the elliptic curve, and finite state machines and adjacency matrix.

  11. Exploration and Study of Deep Crustal Structure in the Quanzhou Basin and Its Adjacent Area

    Zhu Jinfang; Fang Shengming; Zhang Xiankang; Qu Guosheng; Huang Zonglin; Hong Xing; Liu Baojin; Yang Zhuoxin; Duan Yonghong

    2006-01-01

    The Quanzhou basin and its adjacent areas locate in the middle of the southeastern coast seismic belt on the Chinese mainland. The very fine geometry structure of this area from near ground to Moho interface and the relationship between the deep and shallow faults are obtained based on deep seismic reflection profiling. This profile is the first deep seismic reflection profile in this area and it indicates that the crust can be divided into the upper crust and the lower crust and the thickness of crust is from 29.5 km to 31 km in this area. The upper crust and the lower crust can be also divided into two layers. There are shallow normal faults developed in the upper crust and extending to the depth from 6 km to 12 km. The angle of those listric faults decreases with depth and the faults joint into the C1 interface (detachment surface). There is a high angle fault under the Yong'an-Jinjiang fault belt which cuts off the interface of the upper crust and the lower crust and the Moho interface. Although there is no connection between the shallow and the deep faults, it offers deep structural environment for moderate and strong earthquake because of the deep high angle fault. This exploration result improves the reliability and precision of explanation of deep crustal structure in this area. The pull-apart and listric normal fault model indicates that the upper crust structure accords to the dynamic process of Taiwan Straits. This is helpful for seismicity estimation of Quanzhou and its adjacent area and important for obtaining more of the dynamic process of the southeast coast seismic belt.

  12. Extracellular Matrix Modulation: Optimizing Skin Care and Rejuvenation Procedures.

    Widgerow, Alan D; Fabi, Sabrina G; Palestine, Roberta F; Rivkin, Alexander; Ortiz, Arisa; Bucay, Vivian W; Chiu, Annie; Naga, Lina; Emer, Jason; Chasan, Paul E

    2016-04-01

    Normal aging and photoaging of the skin are chronic processes that progress gradually. The extracellular matrix (ECM), constituting over 70% of the skin, is the central hub for repair and regeneration of the skin. As such, the ECM is the area where changes related to photodamage are most evident. Degradation of the ECM with fragmentation of proteins significantly affects cross talk and signaling between cells, the matrix, and its constituents. The accumulation of collagen fragments, amorphous elastin agglutinations, and abnormal cross-linkages between the collagen fragments impedes the ECM from its normal repair and regenerative capacity, which manifests as wrinkled, non-elastic skin. Similar to how the chronic wound healing process requires wound bed preparation before therapeutic intervention, treatment of chronic aging of the skin would likely benefit from a "skin bed preparation" to optimize the outcome of rejuvenation procedures and skin maintenance programs. This involves introducing agents that can combat stress-induced oxidation, proteasome dysfunction, and non-enzymatic cross linkages involved in glycation end products, to collectively modulate this damaged ECM, and upregulate neocollagenesis and elastin production. Agents of particular interest are matrikines, peptides originating from the fragmentation of matrix proteins that exhibit a wide range of biological activities. Peptides of this type (tripeptide and hexapeptide) are incorporated in ALASTIN™ Skin Nectar with TriHex™ technology (ALASTIN Skincare, Inc., Carlsbad, CA), which is designed to target ECM modulation with a goal of optimizing results following invasive and non-invasive dermal rejuvenating procedures. J Drugs Dermatol. 2016;15(Suppl 4):s63-s71. PMID:27050707

  13. Effects of radiation on levels of DNA damage in normal non-adjacent mucosa from colorectal cancer cases.

    Sheridan, Juliette

    2013-03-01

    Defects in DNA repair pathways have been linked with colorectal cancer (CRC). Adjuvant radiotherapy has become commonplace in the treatment of rectal cancer however it is associated with a higher rate of second cancer formation. It is known that radiation results in DNA damage directly or indirectly by radiation-induced bystander effect (RIBE) by causing double-strand breaks (DSBs). The majority of work in RIBE has been performed in cell lines and limited studies have been in or ex vivo.

  14. Interaction of dermatologically relevant nanoparticles with skin cells and skin

    Annika Vogt; Fiorenza Rancan; Sebastian Ahlberg; Berouz Nazemi; Chun Sik Choe; Darvin, Maxim E.; Sabrina Hadam; Ulrike Blume-Peytavi; Kateryna Loza; Jörg Diendorf; Matthias Epple; Christina Graf; Eckart Rühl; Meinke, Martina C; Jürgen Lademann

    2014-01-01

    The investigation of nanoparticle interactions with tissues is complex. High levels of standardization, ideally testing of different material types in the same biological model, and combinations of sensitive imaging and detection methods are required. Here, we present our studies on nanoparticle interactions with skin, skin cells, and biological media. Silica, titanium dioxide and silver particles were chosen as representative examples for different types of skin exposure to nanomaterials, e....

  15. Brain-Skin Connection: Stress, Inflammation and Skin Aging

    Chen, Ying; Lyga, John

    2014-01-01

    The intricate relationship between stress and skin conditions has been documented since ancient times. Recent clinical observations also link psychological stress to the onset or aggravation of multiple skin diseases. However, the exact underlying mechanisms have only been studied and partially revealed in the past 20 years or so. In this review, the authors will discuss the recent discoveries in the field of “Brain-Skin Connection”, summarizing findings from the overlapping fields of psychol...

  16. [Increased expression of proliferation keratins K 6 and K 16 in unaffected skin in exacerbated psoriasis].

    Wevers, A; Arnold, H G; Bonnekoh, B; Schulze, H J; Mahrle, G

    1990-05-01

    The in vivo expression of the proliferation keratins K 6 and K 16 is characteristic for hyperproliferative diseases and positive in psoriatic lesions. Our study was performed in order to investigate the in vitro expression of proliferation keratins and to settle the question whether they are also inducible in organ cultures of uninvolved psoriatic skin, possibly differing from normal skin. PMID:1696047

  17. Skin signs in Ehlers-Danlos syndrome: clinical tests and para-clinical methods

    Remvig, L; Duhn, Ph; Ullman, S;

    2010-01-01

    The criteria for Ehlers-Danlos syndrome (EDS) and the hypermobility syndrome (HMS) should be reliable. Examination for general joint hypermobility has high reliability but there is only sparse information on the reliability of skin tests, and no information on the level of normal skin extensibility...

  18. Skin signs in Ehlers-Danlos syndrome: clinical tests and para-clinical methods

    Remvig, Lars; Duhn, Ph; Ullman, S;

    2010-01-01

    Objective: The criteria for Ehlers-Danlos syndrome (EDS) and the hypermobility syndrome (HMS) should be reliable. Examination for general joint hypermobility has high reliability but there is only sparse information on the reliability of skin tests, and no information on the level of normal skin...

  19. Climate change and skin.

    Balato, N; Ayala, F; Megna, M; Balato, A; Patruno, C

    2013-02-01

    Global climate appears to be changing at an unprecedented rate. Climate change can be caused by several factors that include variations in solar radiation received by earth, oceanic processes (such as oceanic circulation), plate tectonics, and volcanic eruptions, as well as human-induced alterations of the natural world. Many human activities, such as the use of fossil fuel and the consequent accumulation of greenhouse gases in the atmosphere, land consumption, deforestation, industrial processes, as well as some agriculture practices are contributing to global climate change. Indeed, many authors have reported on the current trend towards global warming (average surface temperature has augmented by 0.6 °C over the past 100 years), decreased precipitation, atmospheric humidity changes, and global rise in extreme climatic events. The magnitude and cause of these changes and their impact on human activity have become important matters of debate worldwide, representing climate change as one of the greatest challenges of the modern age. Although many articles have been written based on observations and various predictive models of how climate change could affect social, economic and health systems, only few studies exist about the effects of this change on skin physiology and diseases. However, the skin is the most exposed organ to environment; therefore, cutaneous diseases are inclined to have a high sensitivity to climate. For example, global warming, deforestation and changes in precipitation have been linked to variations in the geographical distribution of vectors of some infectious diseases (leishmaniasis, lyme disease, etc) by changing their spread, whereas warm and humid environment can also encourage the colonization of the skin by bacteria and fungi. The present review focuses on the wide and complex relationship between climate change and dermatology, showing the numerous factors that are contributing to modify the incidence and the clinical pattern of many

  20. Epidemiology of skin cancer.

    Leiter, Ulrike; Eigentler, Thomas; Garbe, Claus

    2014-01-01

    Melanoma and nonmelanoma skin cancer (NMSC) are now the most common types of cancer in white populations. Both tumor entities show an increasing incidence rate worldwide but a stable or decreasing mortality rate. NMSC is the most common cancer in white-skinned individuals with a worldwide increasing incidence. NMSC is an increasing problem for health care services worldwide which causes significant morbidity. The rising incidence rates of NMSC are probably caused by a combination of increased exposure to ultraviolet (UV) or sun light, increased outdoor activities, changes in clothing style, increased longevity, ozone depletion, genetics and in some cases, immune suppression. An intensive UV exposure in childhood and adolescence was causative for the development of basal cell carcinoma (BCC) whereas for the etiology of SCC a chronic UV exposure in the earlier decades was accused. Cutaneous melanoma is the most rapidly increasing cancer in white populations, in the last 3 decades incidence rates have risen up to 5-fold. In 2008 melanoma was on place 5 in women and on place 8 in men of the most common solid tumor entities in Germany. The frequency of its occurrence is closely associated with the constitutive color of the skin, and the geographical zone. Changes in outdoor activities and exposure to sunlight during the past 50 years are an important factor for the increasing incidence of melanoma. Mortality rates of melanoma show a stabilization in the USA, Australia and also in European countries. In contrast to SCC, melanoma risk seems to be associated with an intermittent exposure to sunlight. Prevention campaigns aim on reducing incidence and achieving earlier diagnosis, which resulted in an ongoing trend toward thin melanoma since the last two decades. However, the impact of primary prevention measures on incidence rates of melanoma is unlikely to be seen in the near future, rather increasing incidence rates to 40-50/100,000 inhabitants/year should be expected in

  1. In vivo study of the human skin by the method of laser-induced fluorescence spectroscopy

    The goals of this study are to perform a preliminary evaluation of the diagnostic potential of noninvasive laser-induced auto-fluorescence spectroscopy (LIAFS) for human skin and optimize of detection and diagnosis of hollow organs and skin. In recent years, there has been growing interest in the use of laser-induced fluorescence to discriminate disease from normal surrounding tissue. The most fluorescence studies have used exogenous fluorophores of this discrimination. The laser-induced auto-fluorescence which is used for diagnosis of tissues in the human body avoids administration of any drugs. In this study a technique for optical biopsy of in vivo human skin is presented. The auto-fluorescence characterization of tissue relies on different spectral properties of tissues. It was demonstrated a differentiation between normal skin and skin with vitiligo. Two main endogenous fluorophores in the human skin account for most of the cellular auto-fluorescence for excitation wavelength 337 nm reduced from of nicotinamide adenine dinucleotide and collagen. The auto-fluorescence spectrum of human skin depend on main internal absorbers which are blood and melanin. In this study was described the effect caused by blood and melanin content on the shape of the auto-fluorescence spectrum of human skin. Human skin fluorescence spectrum might provide dermatologists with important information and such investigations are successfully used now in skin disease diagnostics, in investigation of the environmental factor impact or for evaluation of treatment efficiency. (authors)

  2. One-sheet spiraling full thickness skin graft for penile resurfacing after paraffinoma excision

    Theddeus O.H. Prasetyono

    2011-08-01

    Full Text Available In the midst of on-going non-illicit practice of silicone or paraffin injection to enlarge penis, the author reported 3 cases of surgical treatment to resurface the body of the penis after excision of the destructed penile skin using full thickness skin graft. The skin excision was performed technically through penile body degloving procedure. Full thickness skin graft was then applied as a single sheet donor tissue to cover the denuded penile body spirally. The full thickness graft, which is relatively easy to be performed, is no doubt much thinner than a skin flap, while it also bears a smaller degree of secondary contraction than split skin graft. The color of the skin is considerably matched as it comes from the groin, which is a nearby area of penis. The size and skin sensitization of the penis looks to be natural. The only disadvantage is the common possibility of either spiral or circular junctional scar in between graft edges and between the graft and the penile mucosa and skin to develop hypertrophic scar. However, this possible scar problem applies also to any other surgical scar with any donor tissue. Fortunately, the 3 cases posed no scar problem and normal appearance. All the patients have also regained their normal sexual function. (Med J Indones 2011; 20:222-5Keywords: full thickness skin graft, paraffinoma, siliconoma, sexual function

  3. Alkalis and Skin.

    Greenwood, John E; Tan, Jin Lin; Ming, Justin Choong Tzen; Abell, Andrew D

    2016-01-01

    The aim of this editorial is to provide an overview of the chemical interactions occurring in the skin of our patients on contact with alkaline agents. Strongly basic alkali is highly aggressive and will readily hydrolyze (or cleave) key biological molecules such as lipids and proteins. This phenomenon is known as saponification in the case of lipids and liquefactive denaturation for peptides and proteins. A short section on current first-aid concepts is included. A better understanding of the basic science behind alkali burns will make us better teachers and provide an insight into the urgency needed in treating these common and dangerous chemical injuries. PMID:26182072

  4. Distribution and degradation of albumin in extensive skin disease

    Worm, Anne-Marie; Taaning, E; Rossing, N;

    1981-01-01

    The distribution and degradation of albumin were determined in twelve patients with extensive skin disease and in ten control subjects by measuring the metabolic turnover and transcapillary escape of 132 I-labelled albumin. The ratio of intravascular to total mass of albumin was normal. Thus the...... catabolic rate of albumin supports the concept of a causal relationship between these parameters....

  5. Adjacent stage impurity ratio in rare earth countercurrent extraction process

    CHENG Fuxiang; WU Sheng; LIAO Chunsheng; YAN Chunhua

    2013-01-01

    Impurity components decrease stage by stage in a cascade of rare earth (RE) extraction separation,and adjacent stage impurity ratio (ASIR) which is defined as the ratio of an impurity's contents in the aqueous/organic phase of two adjacent stages can be used to evaluate the capacity of impurity removal for the two stages.On the basis of extraction equilibrium and mass balance,the ASIR in a two-component extraction separation was deducted and its simplified expressions were given for different process sections according to reasonable assumptions.The calculation simulation was then carried out to obtain the ASIR distribution in the cascade.The results showed that in both the extraction and scrubbing sections the ASIR principally increased with the decrease of the molar proportion of the impurity but along with a flat appearing in the purification zone located in the middle of the cascade.The ASIR intuitively exhibits the nmning status of RE extraction separation and purification,which could provide a theoretic guide for investigating the influence factors of RE extraction separation process in practical industry.

  6. Adjacent segment disease in degenerative pathologies with posterior instrumentation

    Ana Guadalupe Ramírez Olvera

    2015-03-01

    Full Text Available OBJECTIVE: To establish the real incidence of adjacent segment disease after fusion, and to identify the levels and predisposing factors for the pathology, as well as the functional results. METHODS: a retrospective case series study with level of evidence IIB, in a sample of 179 patients diagnosed with stenosis of the lumbar spine, spondylolisthesis and degenerative scoliosis, submitted to surgery in the period 2005 to December 2013, with posterior instrumentation and posterolateral fusion, with follow-up from 2007 until May 2014, in which the symptomology and radiographic findings were evaluated, to establish the diagnosis and treatment. RESULTS: the study included 179 patients diagnosed with stenosis of the lumbar spine (n=116, isthmic and degenerative spondylolisthesis (n=50 and degenerative scoliosis (n=13; during the study, 20 cases of adjacent level segment were identified, 80% of which were treated surgically with extension of the instrumentation, while 20% were treated conservatively with NSAIDs and therapeutic blocks. CONCLUSION: An incidence of 11% was found, with an average of 3.25 years in diagnosis and treatment, a prevalence of females and diagnosis of stenosis of the lumbar canal on posterior instrumentation, a predominance of levels L4-L5; 80% were treated with extension of the instrumentation. The complications were persistent radiculopathy, infection of the surgical wound, and one death due to causes not related to the lumbar pathology.

  7. Absorbed dose distribution analyses in irradiation with adjacent fields

    Because the special irradiation technique with adjacent fields is the most used in the case of medulloblastoma treatment, we consider very important to specify some general information about medulloblastoma. This malignant disease has a large incidence in children with age between 5-7 years. This tumor usually originates in the cerebellum and is referred to as primitive undifferentiated tumor. It may spread contiguously to the cerebellar peduncle, floor of the fourth ventricle, into the cervical spine. In addition, it may spread via the cerebrospinal fluid intracranially and/or to the spinal cord. For this purpose it is necessary to perform a treatment technique with cranial tangential fields combined with adjacent fields for the entire spinal cord to achieve a perfect coverage of the zones with malignant cells. The treatment in this case is an association between surgery-radio-chemotherapy, where the radiotherapy has a very important roll and a curative purpose. This is due to the fact that the migration of malignant cells in the body can't be controlled by surgery. Because of this special irradiation technique used in medulloblastoma treatment, we chase to describe in this paper this complex type of irradiation where the implications of the beams divergence in doses distribution are essentials

  8. Stress Wave Interaction Between Two Adjacent Blast Holes

    Yi, Changping; Johansson, Daniel; Nyberg, Ulf; Beyglou, Ali

    2016-05-01

    Rock fragmentation by blasting is determined by the level and state of stress in the rock mass subjected to blasting. With the application of electronic detonators, some researchers stated that it is possible to achieve improved fragmentation through stress wave superposition with very short delay times. This hypothesis was studied through theoretical analysis in the paper. First, the stress in rock mass induced by a single-hole shot was analyzed with the assumptions of infinite velocity of detonation and infinite charge length. Based on the stress analysis of a single-hole shot, the stress history and tensile stress distribution between two adjacent holes were presented for cases of simultaneous initiation and 1 ms delayed initiation via stress superposition. The results indicated that the stress wave interaction is local around the collision point. Then, the tensile stress distribution at the extended line of two adjacent blast holes was analyzed for a case of 2 ms delay. The analytical results showed that the tensile stress on the extended line increases due to the stress wave superposition under the assumption that the influence of neighboring blast hole on the stress wave propagation can be neglected. However, the numerical results indicated that this assumption is unreasonable and yields contrary results. The feasibility of improving fragmentation via stress wave interaction with precise initiation was also discussed. The analysis in this paper does not support that the interaction of stress waves improves the fragmentation.

  9. Epithelial cell cultures from normal and cancerous human tissues.

    Owens, R B; Smith, H S; Nelson-Rees, W A; Springer, E L

    1976-04-01

    Thirty epithelial cell strains were isolated from human carcinomas and normal epithelial tissues by collagenase digestion and selective removal of fibroblasts with trypsin-Versene. Most strains were obtained from metastatic carcinomas or epithelia of the urinary and intestinal tracts. The success rate for growth of both neoplastic and normal tissues (excluding skin) was 38%. Six of these strains showed gross morphologic and chromosome changes typical of malignant cells. Nine resembled normal epithelium. The other 15 exhibited some degree of morphologic change from normal. PMID:176412

  10. Recurrent Batch Normalization

    Cooijmans, Tim; Ballas, Nicolas; Laurent, César; Gülçehre, Çağlar; Courville, Aaron

    2016-01-01

    We propose a reparameterization of LSTM that brings the benefits of batch normalization to recurrent neural networks. Whereas previous works only apply batch normalization to the input-to-hidden transformation of RNNs, we demonstrate that it is both possible and beneficial to batch-normalize the hidden-to-hidden transition, thereby reducing internal covariate shift between time steps. We evaluate our proposal on various sequential problems such as sequence classification, language modeling an...

  11. Analysis of Normal-Tumour Tissue Interaction in Tumours: Prediction of Prostate Cancer Features from the Molecular Profile of Adjacent Normal Cells

    Trevino, Victor; Tadesse, Mahlet G.; Vannucci, Marina; Al-Shahrour, Fatima; Antczak, Philipp; Durant, Sarah; Bikfalvi, Andreas; Dopazo, Joaquin; Campbell, Moray J.; Falciani, Francesco

    2011-01-01

    Statistical modelling, in combination with genome-wide expression profiling techniques, has demonstrated that the molecular state of the tumour is sufficient to infer its pathological state. These studies have been extremely important in diagnostics and have contributed to improving our understanding of tumour biology. However, their importance in in-depth understanding of cancer patho-physiology may be limited since they do not explicitly take into consideration the fundamental role of the t...

  12. Lower corticosteroid skin blanching response is associated with severe COPD.

    Susan J M Hoonhorst

    Full Text Available BACKGROUND: Chronic obstructive pulmonary disease (COPD is characterized by chronic airflow limitation caused by ongoing inflammatory and remodeling processes of the airways and lung tissue. Inflammation can be targeted by corticosteroids. However, airway inflammation is generally less responsive to steroids in COPD than in asthma. The underlying mechanisms are yet unclear. This study aimed to assess whether skin corticosteroid insensitivity is associated with COPD and COPD severity using the corticosteroid skin blanching test. METHODS: COPD patients GOLD stage I-IV (n = 27, 24, 22, and 16 respectively and healthy never-smokers and smokers (n = 28 and 56 respectively were included. Corticosteroid sensitivity was assessed by the corticosteroid skin blanching test. Budesonide was applied in 8 logarithmically increasing concentrations (0-100 μg/ml on subject's forearm. Assessment of blanching was performed after 7 hours using a 7-point scale (normal skin to intense blanching. All subjects performed spirometry and body plethysmography. RESULTS: Both GOLD III and GOLD IV COPD patients showed significantly lower skin blanching responses than healthy never-smokers and smokers, GOLD I, and GOLD II patients. Their area under the dose-response curve values of the skin blanching response were 586 and 243 vs. 1560, 1154, 1380, and 1309 respectively, p<0.05. Lower FEV1 levels and higher RV/TLC ratios were significantly associated with lower skin blanching responses (p = 0.001 and p = 0.004 respectively. GOLD stage I, II, III and IV patients had similar age and packyears. CONCLUSIONS: In this study, severe and very severe COPD patients had lower skin corticosteroid sensitivity than mild and moderate COPD patients and non-COPD controls with comparable age and packyears. Our findings together suggest that the reduced skin blanching response fits with a subgroup of COPD patients that has an early-onset COPD phenotype.

  13. Microscopic contact area and friction between medical textiles and skin.

    Derler, S; Rotaru, G-M; Ke, W; El Issawi-Frischknecht, L; Kellenberger, P; Scheel-Sailer, A; Rossi, R M

    2014-10-01

    The mechanical contact between medical textiles and skin is relevant in the health care for patients with vulnerable skin or chronic wounds. In order to gain new insights into the skin-textile contact on the microscopic level, the 3D surface topography of a normal and a new hospital bed sheet with a regular surface structure was measured using a digital microscope. The topographic data was analysed concerning material distribution and real contact area against smooth surfaces as a function of surface deformations. For contact conditions that are relevant for the skin of patients lying in a hospital bed it was found that the order of magnitude of the ratio of real and apparent contact area between textiles and skin or a mechanical skin model lies between 0.02 and 0.1 and that surface deformations, i.e. penetration of the textile surface asperities into skin or a mechanical skin model, range from 10 to 50µm. The performed analyses of textile 3D surface topographies and comparisons with previous friction measurement results provided information on the relationship between microscopic surface properties and macroscopic friction behaviour of medical textiles. In particular, the new bed sheet was found to be characterised by a trend towards a smaller microscopic contact area (up to a factor of two) and by a larger free interfacial volume (more than a factor of two) in addition to a 1.5 times lower shear strength when in contact with counter-surfaces. The applied methods can be useful to develop improved and skin-adapted materials and surfaces for medical applications. PMID:25047353

  14. [Radiotherapy of skin cancers].

    Hennequin, C; Rio, E; Mahé, M-A

    2016-09-01

    The indications of radiotherapy for skin cancers are not clearly defined because of the lack of randomised trials or prospective studies. For basal cell carcinomas, radiotherapy frequently offers a good local control, but a randomized trial showed that surgery is more efficient and less toxic. Indications of radiotherapy are contra-indications of surgery for patients older than 60, non-sclerodermiform histology and occurring in non-sensitive areas. Adjuvant radiotherapy could be proposed to squamous cell carcinomas, in case of poor prognostic factors. Dose of 60 to 70Gy are usually required, and must be modulated to the size of the lesions. Adjuvant radiotherapy seems beneficial for desmoplastic melanomas but not for the other histological types. Prophylactic nodal irradiation (45 to 50Gy), for locally advanced tumours (massive nodal involvement), decreases the locoregional failure rate but do not increase survival. Adjuvant radiotherapy (50 to 56Gy) for Merckel cell carcinomas increases also the local control rate, as demonstrated by meta-analysis and a large epidemiological study. Nodal areas must be included, if there is no surgical exploration (sentinel lymph node dissection). Kaposi sarcomas are radiosensitive and could be treated with relatively low doses (24 to 30Gy). Also, cutaneous lymphomas are good indications for radiotherapy: B lymphomas are electively treated with limited fields. The role of total skin electron therapy for T-lymphomas is still discussed; but palliative radiotherapy is very efficient in case of cutaneous nodules. PMID:27522189

  15. Neutron Skins and Neutron Stars

    Piekarewicz, J

    2013-01-01

    The neutron-skin thickness of heavy nuclei provides a fundamental link to the equation of state of neutron-rich matter, and hence to the properties of neutron stars. The Lead Radius Experiment ("PREX") at Jefferson Laboratory has recently provided the first model-independence evidence on the existence of a neutron-rich skin in 208Pb. In this contribution we examine how the increased accuracy in the determination of neutron skins expected from the commissioning of intense polarized electron be...

  16. Skin Care in Ethnic Populations

    Cole, Patrick D.; Hatef, Daniel A.; Taylor, Susan; Bullocks, Jamal M.

    2009-01-01

    Use of over-the-counter cosmetics, approaches to hygiene, and many basic dermatologic principles differ between individuals with Caucasian skin and ethnic skin. Still, comparatively few publications highlight these variations or discuss appropriate management. Among many ethnic patients, issues related to skin hydration, restoration of even pigmentation, hair removal, and acne care remain problematic yet not fully addressed. As well, there are some dermatologic conditions that may be rare in ...

  17. Skin contamination - prevention and decontaminating

    A detailed examination is made of the structure of human skin. Measures were drawn up to prevent skin contamination in nuclear installations as well as contaminated skin was decontaminated from the personnel. By systematically applying these measures a significant level of success was achieved in preventing contamination in nuclear installations. Cases where more far-reaching chemical methods had to be used were kept to a minimum. (R.P.)

  18. Skin Infections Due to Corynebacterium

    Meltem Türkmen; Derya Aytimur

    2010-01-01

    Corynebacteria are Gram-positive, non-sporulated, non-capsulated, aerobic diphtheroid bacteria accounting for nearly 50%of the natural skin biocene. This bacterial family is responsible for various skin diseases such as cutaneous diphteria, cromhydrosis, bromhydrosis but the most common of them are pitted keratolysis, trichobacteriosis and erythrasma. A warm and moist environment and poor hygiene are the predisposition factors for these three diseases. Although this skin diseases are seen mor...

  19. Occupational Skin Diseases in Korea

    Ahn, Yeon-Soon; Kim, Min-Gi

    2010-01-01

    Skin disease is the most common occupational disease, but the reported number is small in Korea due to a difficulty of detection and diagnosis in time. We described various official statistics and data from occupational skin disease surveillance system, epidemiological surveys and cases published in scientific journals. Until 1981, 2,222 cases of occupational skin disease were reported by Korean employee's regular medical check-up, accounting for 4.9% of the total occupational diseases. There...

  20. Protecting the skin during thyroidectomy

    Renan Bezerra Lira

    2014-01-01

    Full Text Available In this note we describe the standard technical maneuver used in our department to protect the skin during thyroidectomy in order to get the best aesthetic result. We use surgical gloves to protect the skin during these operations to reduce the negative impact of thermal trauma and mechanical retractors and energy delivery devices at the edges of the skin incised. This practice is effective, inexpensive, rapid, reproducible and showed no complication in our experience of over 2,500 thyroidectomies.

  1. Targeted Therapy in Nonmelanoma Skin Cancers

    Spallone, Giulia; Botti, Elisabetta; Costanzo, Antonio, E-mail: antonio.costanzo@uniroma2.it [Department of Dermatology, University of Rome “Tor Vergata”, Via Montpellier 1, 00199, Rome (Italy)

    2011-05-03

    Nonmelanoma skin cancer (NMSC) is the most prevalent cancer in light-skinned populations, and includes mainly Basal Cell Carcinomas (BCC), representing around 75% of NMSC and Squamous Cell Carcinomas (SCC). The incidence of these tumors is continuously growing. It was found that the overall number of procedures for NMSC in US rose by 76%, from 1,158,298 in 1992 to 2,048,517 in 2006. Although mortality from NMSC tends to be very low, clearly the morbidity related to these skin cancers is very high. Treatment options for NMSC include both surgical and nonsurgical interventions. Surgery was considered the gold standard therapy, however, advancements in the knowledge of pathogenic mechanisms of NMSCs led to the identification of key targets for drug intervention and to the consequent development of several targeted therapies. These represent the future in treatment of these common forms of cancer ensuring a high cure rate, preservation of the maximal amount of normal surrounding tissue and optimal cosmetic outcome. Here, we will review recent advancements in NMSC targeted therapies focusing on BCC and SCC.

  2. Targeted Therapy in Nonmelanoma Skin Cancers

    Giulia Spallone

    2011-05-01

    Full Text Available Nonmelanoma skin cancer (NMSC is the most prevalent cancer in light-skinned populations, and includes mainly Basal Cell Carcinomas (BCC, representing around 75% of NMSC and Squamous Cell Carcinomas (SCC. The incidence of these tumors is continuously growing. It was found that the overall number of procedures for NMSC in US rose by 76%, from 1,158,298 in 1992 to 2,048,517 in 2006. Although mortality from NMSC tends to be very low, clearly the morbidity related to these skin cancers is very high. Treatment options for NMSC include both surgical and nonsurgical interventions. Surgery was considered the gold standard therapy, however, advancements in the knowledge of pathogenic mechanisms of NMSCs led to the identification of key targets for drug intervention and to the consequent development of several targeted therapies. These represent the future in treatment of these common forms of cancer ensuring a high cure rate, preservation of the maximal amount of normal surrounding tissue and optimal cosmetic outcome. Here, we will review recent advancements in NMSC targeted therapies focusing on BCC and SCC.

  3. SKIN KINETICS AND DERMAL CLEARANCE

    Prakash Shashi

    2012-08-01

    Full Text Available Availability of several therapeutic and cosmetic formulations for topical application has made the research on skin kinetics as a topic of current interest. Topical formulations are typically meant for local effect although there is always a chance that the low molecular weight chemicals are easily transported across the skin layer and make it available in the systemic circulation. Thus there is a major concern about the transport of chemical moieties following the topical application of cosmetics and therapeutic formulations and the real time measurement of the molecules in the skin layer has become obligatory. It is well known that the properties of both drug and the excipients have identical role in determining the skin permeability of chemical moieties. In the last decade several investigations have been carried out in this filed using several in vitro and in vivo models. This review provides a brief account on the basics of skin kinetics, parameters assessed, various techniques and methods adapted in skin kinetic studies. Moreover, we have also discussed about the micro-environment inside the skin layer and the possible mechanism of drug depot formation, skin metabolism and clearance of molecules from the skin layers.

  4. HOX genes in the skin

    YANG Mei; LI Qing-feng; ZHANG Feng

    2010-01-01

    @@ Deep skin wounds heal by scar formation with a loss of its original appearance, structure and function.However, when the same damage occurs to the skin of an early gestational fetus, complete regeneration can be observed. Despite significant research in the field of skin regeneration, many mysteries remain, such as the loss of wound healing ability with maturity, the differences in healing at different parts of the body, and the presence of hypertrophic scars and keloids in some races but not in others. The finding of HOX genes in the skin provides new explanations to these conundrums.

  5. Skin Infections Due to Corynebacterium

    Meltem Türkmen

    2010-03-01

    Full Text Available Corynebacteria are Gram-positive, non-sporulated, non-capsulated, aerobic diphtheroid bacteria accounting for nearly 50%of the natural skin biocene. This bacterial family is responsible for various skin diseases such as cutaneous diphteria, cromhydrosis, bromhydrosis but the most common of them are pitted keratolysis, trichobacteriosis and erythrasma. A warm and moist environment and poor hygiene are the predisposition factors for these three diseases. Although this skin diseases are seen more frequently, they usually mistaken for a mycotic infection by general practitioners, with subsequent antimycotic treatment. Here skin diseases compromised with Corynebacterium are presented with their demographic features and discussed on the basis of a literature review.

  6. Infrared sensing based sensitive skin

    CAO Zheng-cai; FU Yi-li; WANG Shu-guo; JIN Bao

    2006-01-01

    Developed robotics sensitive skin is a modularized, flexible, mini-type array of infrared sensors with data processing capabilities, which can be used to cover the body of a robot. Depending on the infrared sensors and periphery processing circuit, robotics sensitive skin can in real-time provide existence and distance information about obstacles for robots within sensory areas. The methodology of designing sensitive skin and the algorithm of a mass of IR data fusion are presented. The experimental results show that the multi-joint robot with this sensitive skin can work autonomously in an unknown environment.

  7. Skin temperature during sunbathing--relevance for skin cancer

    Petersen, Bibi; Philipsen, Peter Alshede; Wulf, Hans Christian

    2014-01-01

    It has been found that exposure to heat and infrared radiation (IR) can be carcinogenic, and that a combination of ultraviolet radiation (UVR) and IR possibly amplifies carcinogenesis. To investigate how the skin temperature is affected by sunbathing, we measured the skin temperature on 20 health...

  8. The Bivariate Normal Copula

    Christian Meyer

    2009-01-01

    We collect well known and less known facts about the bivariate normal distribution and translate them into copula language. In addition, we prove a very general formula for the bivariate normal copula, we compute Gini's gamma, and we provide improved bounds and approximations on the diagonal.

  9. Functioning of catfish electroreceptors: Influence of calcium and sodium concentration on the skin potential

    Schouten, V.J.A.; Bretschneider, F.

    1980-01-01

    1. 1. The skin potential of catfish was measured in order to test the hypothesis that it controls electroreceptor sensitivity. 2. 2. The skin potential depends on the “milieu extérieur” in the same way as reported lor goldfish (Fig. 2). 3. 3. The variation of the skin potential is very large compared with the normal stimulus range of electroreceptors. 4. 4. Calcium strongly influences the skin potential, but the latter “adapts” to calcium concentrations of 0.3-3.0 mM (Fig. 3). 5. 5. Ion-depen...

  10. The Nemean Lion’s Skin in Athenian Art1 (Pl. ΧI-XVII)

    Cohen, Beth

    2013-01-01

    Herakles’ lion skin, was by no means a gift from the gods; the young hero produced it with his own hands – supposedly resourcefully skinning the corpse of the invulnerable Nemean lion with its own claws, after strangling the beast to death in his first labor. Although in daily life skinning an animal may normally have required two men, on an Athenian black-figure cup in Munich the young hero toils alone to skin the dead cat, which lies belly up with its tail tied to a tree. Save for this late...

  11. Wnt inhibitory factor (WIF)-1 promotes melanogenesis in normal human melanocytes.

    Park, Tae Jun; Kim, Misun; Kim, Hyeran; Park, Sun Yi; Park, Kyoung-Chan; Ortonne, Jean-Paul; Kang, Hee Young

    2014-01-01

    Wnt signaling plays a role in the differentiation as well as the development of melanocytes. Using a microarray analysis, hyperpigmentary skin of melasma expressed high levels of Wnt inhibitory factor-1 (WIF-1) compared with perilesional normal skin. In this study, the expression and functional roles of WIF-1 on melanocytes were investigated. WIF-1 was expressed both in the melanocytes of normal human skin and in cultured melanocytes. The upregulation of WIF-1 on cultured normal human melanocytes significantly induced expressions of MITF and tyrosinase, which were associated with increased melanin content and tyrosinase activity. Consistent with the stimulatory effect of WIF-1, WIF-1 siRNA reduced melanogenesis in the cells. Moreover, WIF-1 increases pigmentation in melanocytes co-cultured with WIF-1-overexpressed fibroblasts and of organ-cultured human skin. These findings suggest that melanocytes express WIF-1 constitutively in vivo and in vitro and that WIF-1 promotes melanogenesis in normal human melanocytes. PMID:24131586

  12. Analysis of blasting damage in adjacent mining excavations

    Nick Yugo

    2015-06-01

    Full Text Available Following a small-scale wedge failure at Yukon Zinc's Wolverine Mine in Yukon, Canada, a vibration monitoring program was added to the existing rockbolt pull testing regime. The failure in the 1150 drift occurred after numerous successive blasts in an adjacent tunnel had loosened friction bolts passing through an unmapped fault. Analysis of blasting vibration revealed that support integrity is not compromised unless there is a geological structure to act as a failure plane. The peak particle velocity (PPV rarely exceeded 250 mm/s with a frequency larger than 50 Hz. As expected, blasting more competent rock resulted in higher PPVs. In such cases, reducing the round length from 3.5 m to 2.0 m was an effective means of limiting potential rock mass and support damage.

  13. Acyclic 6-choosability of planar graphs without adjacent short cycles

    WANG WeiFan; ZHANG Ge; CHEN Min

    2014-01-01

    A proper vertex coloring of a graph G is acyclic if G contains no bicolored cycles.Given a list assignment L={L(v)|v∈V}of G,we say that G is acyclically L-colorable if there exists a proper acyclic coloringπof G such thatπ(v)∈L(v)for all v∈V.If G is acyclically L-colorable for any list assignment L with|L(v)|k for all v∈V(G),then G is acyclically k-choosable.In this paper,we prove that every planar graph G is acyclically 6-choosable if G does not contain 4-cycles adjacent to i-cycles for each i∈{3,4,5,6}.This improves the result by Wang and Chen(2009).

  14. Adjacent Lumbar Disc Herniation after Lumbar Short Spinal Fusion

    Koshi Ninomiya

    2014-01-01

    Full Text Available A 70-year-old outpatient presented with a chief complaint of sudden left leg motor weakness and sensory disturbance. He had undergone L4/5 posterior interbody fusion with L3–5 posterior fusions for spondylolisthesis 3 years prior, and the screws were removed 1 year later. He has been followed up for 3 years, and there had been no adjacent segment problems before this presentation. Lumbar magnetic resonance imaging (MRI showed a large L2/3 disc hernia descending to the L3/4 level. Compared to the initial MRI, this hernia occurred in an “intact” disc among multilevel severely degenerated discs. Right leg paresis and bladder dysfunction appeared a few days after admission. Microscopic lumbar disc herniotomy was performed. The right leg motor weakness improved just after the operation, but the moderate left leg motor weakness and difficulty in urination persisted.

  15. New adjacent vertebral body fracture after percutaneous vertebroplasty

    Percutaneous vertebroplasty is widely used as a treatment for painful osteoporotic compression fractures and malignant osteolytic tumors. Although the procedure appears to provide dramatic pain relief promote life quality but also with some complications. Additional adjacent vertebral body fracture are frequently reported after vertebroplasty but the cause relationship between the procedure and new-onset vertebral fracture remains unknown. New compression fractures following percutaneous vertebroplasty may not be a complication of the procedure itself, but rather as a part of the course of underlying pathology. The crucial point of discussion in this paper is whether vertebroplasty predisposes the development of additional vertebral fractures, at a rate higher than that seen in the absence of vertebroplasty, but no definitive answer to this question is yet to come. This review explores and attempts to comprehend the data both of supporting and refuting a relationship between vertebroplasty and the development of subsequent fractures. (authors)

  16. Migration of PCBs from Sealants to Adjacent Material

    Andersen, Helle Vibeke; Gunnarsen, Lars Bo; Kampmann, Kristoffer

    2015-01-01

    PCB in sealants can migrate into porous surfaces like concrete and brick and contaminate these materials. The study focuses on an analysis of concentration profiles in relation to alleviation of PCB contamination. The PCB content was determined in 20 samples of concrete and 6 samples of brick...... concentration of the adjacent material. The profiles of PCB concentration into the materials showed some variation, though in general there is a tendency of relative higher concentration near the primary source in concrete and longer migration at low concentrations in brick. The concentration profiles seemed to...... fit an exponential function for concrete and a power function for brick. Based on the sample series, a worst case scenario for migration was defined. For concrete, it showed that a concentration of less than 50 ppm in the material (hazardous waste) was reached at a distance of 5 cm, whereas for bricks...

  17. Soil Structure Interaction between Two Adjacent Buildings under Earthquake Load

    Mahmoud Yahyai

    2008-01-01

    Full Text Available In some cases, tall buildings are located in geotechnically unsuitable places, due to their high ratio of height to width; there is risk of uplift and other effects such as overturning and reduction structure serviceability during earthquake. This research is aimed to evaluate the effect of Soil-Structure Interaction (SSI on seismic behavior of two adjacent 32 story buildings such as time period, base shear and displacements. The interaction effects are investigated for variable distance between the two buildings. Three types of soil such as soft clay, sandy gravel and compacted sandy gravel are considered for this study. The result obtained that the interaction effect increases time period of both buildings base shear and lateral displacement of the structures increases.

  18. Classical Hodgkin Lymphoma Arising Adjacent to a Breast Implant.

    Ryan, Ciara; Ged, Yasser; Quinn, Fiona; Walker, Jan; Kennedy, John; Gillham, Charles; Pittaluga, Stefania; McDermott, Ronan; Vandenberghe, Elisabeth; Grant, Cliona; Flavin, Richard

    2016-08-01

    Breast implant-associated lymphoma has recently gained wide recognition. Anaplastic large cell lymphoma (ALCL) is the most frequently diagnosed subtype in this setting but the spectrum is broadening. A 66-year-old woman developed swelling and itch around her saline implant 6 years after its insertion. Imaging revealed a fluid collection surrounding the implant with an adjacent mass. Microscopy showed sclerotic tissue punctuated by discrete cellular nodules comprising small lymphocytes, eosinophils and interspersed large atypical Hodgkin Reed-Sternberg (HRS)-like cells. The HRS-like cells stained positively for CD30 and CD15 by immunohistochemistry. Small T-lymphocytes formed rosettes around HRS-like cells. Appearances were consistent with classical Hodgkin lymphoma (HL). Multiplex polymerase chain reaction demonstrated no clonal rearrangements of immunoglobulin or T-cell receptor genes, however, a t(14;18)(q32;q21)BCL2-JH translocation involving the major breakpoint region of the bcl2 gene was present. Staging positron emission tomography-computed tomography scan revealed FDG-avid masses in the right axilla and pelvis. Subsequent pathological examination identified low-grade follicular lymphoma (FL) with a t(14;18) translocation at these sites. To our knowledge, this is the first case of HL arising adjacent to a breast implant. An awareness of this diagnosis is important as classical HL, with its prominent mixed inflammatory background, may be overlooked as a reactive process when histologically assessing capsulectomy specimens. It is also important in the differential diagnosis for implant-associated ALCL as both contain large atypical CD30-positive cells highlighting the need for full immunohistochemical and molecular workup in such cases. This case also adds to the large body of literature regarding the association between HL and FL. PMID:26888955

  19. Flexible and fragmentable tandem photosensitive nanocrystal skins

    Akhavan, S.; Uran, C.; Bozok, B.; Gungor, K.; Kelestemur, Y.; Lesnyak, V.; Gaponik, N.; Eychmüller, A.; Demir, H. V.

    2016-02-01

    We proposed and demonstrated the first account of large-area, semi-transparent, tandem photosensitive nanocrystal skins (PNSs) constructed on flexible substrates operating on the principle of photogenerated potential buildup, which avoid the need for applying an external bias and circumvent the current-matching limitation between junctions. We successfully fabricated and operated the tandem PNSs composed of single monolayers of colloidal water-soluble CdTe and CdHgTe nanocrystals (NCs) in adjacent junctions on a Kapton polymer tape. Owing to the usage of a single NC layer in each junction, noise generation was significantly reduced while keeping the resulting PNS films considerably transparent. In each junction, photogenerated excitons are dissociated at the interface of the semi-transparent Al electrode and the NC layer, with holes migrating to the contact electrode and electrons trapped in the NCs. As a result, the tandem PNSs lead to an open-circuit photovoltage buildup equal to the sum of those of the two single junctions, exhibiting a total voltage buildup of 128.4 mV at an excitation intensity of 75.8 μW cm-2 at 350 nm. Furthermore, we showed that these flexible PNSs could be bent over 3.5 mm radius of curvature and cut out in arbitrary shapes without damaging the operation of individual parts and without introducing any significant loss in the total sensitivity. These findings indicate that the NC skins are promising as building blocks to make low-cost, flexible, large-area UV/visible sensing platforms with highly efficient full-spectrum conversion.We proposed and demonstrated the first account of large-area, semi-transparent, tandem photosensitive nanocrystal skins (PNSs) constructed on flexible substrates operating on the principle of photogenerated potential buildup, which avoid the need for applying an external bias and circumvent the current-matching limitation between junctions. We successfully fabricated and operated the tandem PNSs composed of

  20. The Sensitive Skin Syndrome

    Hadar Lev-Tov

    2012-01-01

    Full Text Available Sensitive skin syndrome (SSS is a common and challenging condition, yet little is known about its underlying pathophysiology. Patients with SSS often present with subjective complaints of severe facial irritation, burning, and/or stinging after application of cosmetic products. These complaints are out of proportion to the objective clinical findings. Defined as a self-diagnosed condition lacking any specific objective findings, SSS is by definition difficult to quantify and, therefore, the scientific community has yet to identify an acceptable objective screening test. In this overview we review recent epidemiological studies, present current thinking on the pathophysiology leading to SSS, discuss the challenges SSS presents, and recommend a commonsense approach to management.

  1. Making nuclear 'normal'

    The mechanics of the Swiss NPPs' 'come and see' programme 1995-1999 were illustrated in our contributions to all PIME workshops since 1996. Now, after four annual 'waves', all the country has been covered by the NPPs' invitation to dialogue. This makes PIME 2000 the right time to shed some light on one particular objective of this initiative: making nuclear 'normal'. The principal aim of the 'come and see' programme, namely to give the Swiss NPPs 'a voice of their own' by the end of the nuclear moratorium 1990-2000, has clearly been attained and was commented on during earlier PIMEs. It is, however, equally important that Swiss nuclear energy not only made progress in terms of public 'presence', but also in terms of being perceived as a normal part of industry, as a normal branch of the economy. The message that Swiss nuclear energy is nothing but a normal business involving normal people, was stressed by several components of the multi-prong campaign: - The speakers in the TV ads were real - 'normal' - visitors' guides and not actors; - The testimonials in the print ads were all real NPP visitors - 'normal' people - and not models; - The mailings inviting a very large number of associations to 'come and see' activated a typical channel of 'normal' Swiss social life; - Spending money on ads (a new activity for Swiss NPPs) appears to have resulted in being perceived by the media as a normal branch of the economy. Today we feel that the 'normality' message has well been received by the media. In the controversy dealing with antinuclear arguments brought forward by environmental organisations journalists nowadays as a rule give nuclear energy a voice - a normal right to be heard. As in a 'normal' controversy, the media again actively ask themselves questions about specific antinuclear claims, much more than before 1990 when the moratorium started. The result is that in many cases such arguments are discarded by journalists, because they are, e.g., found to be

  2. The thyroid hormone receptors modulate the skin response to retinoids.

    Laura García-Serrano

    Full Text Available BACKGROUND: Retinoids play an important role in skin homeostasis and when administered topically cause skin hyperplasia, abnormal epidermal differentiation and inflammation. Thyroidal status in humans also influences skin morphology and function and we have recently shown that the thyroid hormone receptors (TRs are required for a normal proliferative response to 12-O-tetradecanolyphorbol-13-acetate (TPA in mice. METHODOLOGY/PRINCIPAL FINDINGS: We have compared the epidermal response of mice lacking the thyroid hormone receptor binding isoforms TRα1 and TRβ to retinoids and TPA. Reduced hyperplasia and a decreased number of proliferating cells in the basal layer in response to 9-cis-RA and TPA were found in the epidermis of TR-deficient mice. Nuclear levels of proteins important for cell proliferation were altered, and expression of keratins 5 and 6 was also reduced, concomitantly with the decreased number of epidermal cell layers. In control mice the retinoid (but not TPA induced parakeratosis and diminished expression of keratin 10 and loricrin, markers of early and terminal epidermal differentiation, respectively. This reduction was more accentuated in the TR deficient animals, whereas they did not present parakeratosis. Therefore, TRs modulate both the proliferative response to retinoids and their inhibitory effects on skin differentiation. Reduced proliferation, which was reversed upon thyroxine treatment, was also found in hypothyroid mice, demonstrating that thyroid hormone binding to TRs is required for the normal response to retinoids. In addition, the mRNA levels of the pro-inflammatory cytokines TNFα and IL-6 and the chemotactic proteins S1008A and S1008B were significantly elevated in the skin of TR knock-out mice after TPA or 9-cis-RA treatment and immune cell infiltration was also enhanced. CONCLUSIONS/SIGNIFICANCE: Since retinoids are commonly used for the treatment of skin disorders, these results demonstrating that TRs

  3. The effects of mucopolysaccharide polysulphate on hydration and elasticity of human skin.

    Wanitphakdeedecha, Rungsima; Eimpunth, Sasima; Manuskiatti, Woraphong

    2011-01-01

    Background. Mucopolysaccharide polysulphate (MPS) has been used in medicine as an anti-inflammatory and antithrombotic agent for over 50 years. Its chemical structure permits considerable hydrogen bonding with adjacent water molecules, which effectively leads to hydration of the surrounding tissue. In addition, it stimulates endogenous hyaluronate synthesis, resulting in an increase in water-binding capacity and viscoelasticity of the skin. Objective. To study the efficacy of 0.1% MPS on hydration and elasticity of human skin. Methods. The first part of this study was a randomized double blind placebo-controlled study which included 60 female volunteers aged 30-45 years with dry skin, defined by Corneometer CM 825. The volunteers were treated with either 0.1% MPS or vehicle control. All subjects were asked to apply 1 g of cream to their face twice daily for a total period of 4 weeks. Skin hydration and elasticity were measured at baseline and week 4 with Corneometer CM 825 and cutometer MPA 580, respectively, at forehead and both cheeks. The second part of this study focused on the efficacy of 0.1% MPS on skin hydration after single application. 20 female volunteers aged 30-45 years with dry skin, defined by Corneometer CM 825, were recruited to the study. All subjects were asked to apply 2 g of 0.1% MPS cream on entirely randomly selected forearm. Skin hydration at the middle of both forearms was measured at baseline, immediately after application, and every 1 hour after application for a period of 10 hours. Results. 57 subjects (28 in vehicle control group, 29 in MPS) completed treatment protocol. The baseline skin hydration of both groups was not significantly different (P = 0.47). Hower, there was a statistically significant difference in skin hydration at 4 weeks between MPS and placebo group (P = 0.01). Skin elasticity was significantly improved at week 4 in both groups (vehicle-control, P < 0.01, and MPS, P < 0.01). However, no significant

  4. The Effects of Mucopolysaccharide Polysulphate on Hydration and Elasticity of Human Skin

    Rungsima Wanitphakdeedecha

    2011-01-01

    Full Text Available Background. Mucopolysaccharide polysulphate (MPS has been used in medicine as an anti-inflammatory and antithrombotic agent for over 50 years. Its chemical structure permits considerable hydrogen bonding with adjacent water molecules, which effectively leads to hydration of the surrounding tissue. In addition, it stimulates endogenous hyaluronate synthesis, resulting in an increase in water-binding capacity and viscoelasticity of the skin. Objective. To study the efficacy of 0.1% MPS on hydration and elasticity of human skin. Methods. The first part of this study was a randomized double blind placebo-controlled study which included 60 female volunteers aged 30–45 years with dry skin, defined by Corneometer CM 825. The volunteers were treated with either 0.1% MPS or vehicle control. All subjects were asked to apply 1 g of cream to their face twice daily for a total period of 4 weeks. Skin hydration and elasticity were measured at baseline and week 4 with Corneometer CM 825 and cutometer MPA 580, respectively, at forehead and both cheeks. The second part of this study focused on the efficacy of 0.1% MPS on skin hydration after single application. 20 female volunteers aged 30–45 years with dry skin, defined by Corneometer CM 825, were recruited to the study. All subjects were asked to apply 2 g of 0.1% MPS cream on entirely randomly selected forearm. Skin hydration at the middle of both forearms was measured at baseline, immediately after application, and every 1 hour after application for a period of 10 hours. Results. 57 subjects (28 in vehicle control group, 29 in MPS completed treatment protocol. The baseline skin hydration of both groups was not significantly different (P=0.47. Hower, there was a statistically significant difference in skin hydration at 4 weeks between MPS and placebo group (P=0.01. Skin elasticity was significantly improved at week 4 in both groups (vehicle-control, P<0.01, and MPS, P<0.01. However, no

  5. Human skin hypoxia modulates cerebrovascular and autonomic functions.

    Olivia Pucci

    Full Text Available Because the skin is an oxygen sensor in amphibians and mice, we thought to confirm this function also in humans. The human upright posture, however, introduces additional functional demands for the maintenance of oxygen homeostasis in which cerebral blood flow and autonomic nervous system (ANS function may also be involved. We examined nine males and three females. While subjects were breathing ambient air, at sea level, we changed gases in a plastic body-bag during two conditions of the experiment such as to induce skin hypoxia (with pure nitrogen or skin normoxia (with air. The subjects performed a test of hypoxic ventilatory drive during each condition of the experiment. We found no differences in the hypoxic ventilatory drive tests. However, ANS function and cerebral blood flow velocities were modulated by skin hypoxia and the effect was significantly greater on the left than right middle cerebral arteries. We conclude that skin hypoxia modulates ANS function and cerebral blood flow velocities and this might impact life styles and tolerance to ambient hypoxia at altitude. Thus the skin in normal humans, in addition to its numerous other functions, is also an oxygen sensor.

  6. Human skin hypoxia modulates cerebrovascular and autonomic functions.

    Pucci, Olivia; Qualls, Clifford; Battisti-Charbonney, Anne; Balaban, Dahlia Y; Fisher, Joe A; Duffin, Jim; Appenzeller, Otto

    2012-01-01

    Because the skin is an oxygen sensor in amphibians and mice, we thought to confirm this function also in humans. The human upright posture, however, introduces additional functional demands for the maintenance of oxygen homeostasis in which cerebral blood flow and autonomic nervous system (ANS) function may also be involved. We examined nine males and three females. While subjects were breathing ambient air, at sea level, we changed gases in a plastic body-bag during two conditions of the experiment such as to induce skin hypoxia (with pure nitrogen) or skin normoxia (with air). The subjects performed a test of hypoxic ventilatory drive during each condition of the experiment. We found no differences in the hypoxic ventilatory drive tests. However, ANS function and cerebral blood flow velocities were modulated by skin hypoxia and the effect was significantly greater on the left than right middle cerebral arteries. We conclude that skin hypoxia modulates ANS function and cerebral blood flow velocities and this might impact life styles and tolerance to ambient hypoxia at altitude. Thus the skin in normal humans, in addition to its numerous other functions, is also an oxygen sensor. PMID:23056597

  7. Urostomy - stoma and skin care

    ... your skin and kidneys. About your stoma Your stoma is made from the part of your small intestine called the ileum. Your ureter is attached to a small piece of your ileum and pulled through the skin of your abdomen. A stoma is very delicate. A healthy stoma is pinkish- ...

  8. Dry skin - self-care

    ... scrubbing your skin. Shave right after bathing, when hair is soft. Wear soft, comfortable clothing next to your skin. Avoid rough fabrics like wool. Wash clothes with detergents that are free of dyes or fragrances. Drink plenty of water. Ease itchy ...

  9. Air Pollution and the skin

    Eleni eDrakaki

    2014-05-01

    Full Text Available The increase of air pollution over the years has major effects on the human skin. The skin is exposed to ultraviolet radiation (UVR and environmental air pollutants such as polycyclic aromatic hydrocarbons (PAHs, volatile organic compounds (VOCs, oxides, particulate matter (PM, ozone (O3 and cigarette smoke. Although human skin acts as a biological shield against pro-oxidative chemical and physical air pollutants, the prolonged or repetitive exposure to high levels of these pollutants may have profound negative effects on the skin. Exposure of the skin to air pollutants has been associated with skin aging and inflammatory or allergic skin conditions such as atopic dermatitis, eczema, psoriasis or acne, while skin cancer is among the most serious effects. On the other hand, some air pollutants (ie, ozone, nitrogen dioxide, and sulfur dioxide and scattering particulates (clouds and soot in the troposphere reduce the effects of shorter wavelength UVR and significant reductions in UV irradiance have been observed in polluted urban areas.

  10. Skin Barrier Function and Allergens

    Engebretsen, Kristiane Aasen; Thyssen, Jacob Pontoppidan

    2016-01-01

    The skin is an important barrier protecting us from mechanical insults, microorganisms, chemicals and allergens, but, importantly, also reducing water loss. A common hallmark for many dermatoses is a compromised skin barrier function, and one could suspect an elevated risk of contact sensitization...

  11. Pain-induced skin autoimmunity

    Odoardi, Francesca; Neuhuber, Winfried; Flügel, Alexander

    2014-01-01

    A recent paper published in Nature reports sensory nerve fibers in the skin that give local immune cells important instructions for the organization of an immune response; in this particular case the cooperation between the nervous and immune systems had disastrous consequences, namely an auto-destruction of the skin.

  12. Expression of Apoptosis Related Protein in Skin Lesions of Lichen Planus and Its Implication

    Xu'e CHEN; Yan WU; Jiawen LI; Zhixiang LIU; Qing YUE; Houjun LIU

    2008-01-01

    In order to investigate the role of Caspase-3 and Bax in the pathogenesis of lichen planus, immunohistochemistry was used to detect the expression of Caspase-3 and Bax in skin lesions of the patients with lichen planus and skin tissues of normal subjects. The results showed that positive rate of Caspase-3 and Bax expression in lichen planus were significantly higher than that in normal skins (both P<0.05). Meanwhile, there was a obvious correlation between the increase of Caspase-3 and that of Bax in lichen planus. The expression of Caspase-3 and Bax might play an important role in the development of lichen planus.

  13. Reliability of skin testing as a measure of nutritional state

    The reliability of skin testing to assess the nutritional state was evaluated in 257 patients who received total parenteral nutrition (TPN). The nutritional state was assessed by determining body composition, by multiple-isotope dilution. Immunocompetence was simultaneously evaluated by skin testing with five recall antigens. These measurements were carried out before and at two-week intervals during TPN. A statistically significant relationship existed between the response to skin testing and the nutritional state. A body composition consistent with malnutrition was present in the anergic patients, while body composition was normal in the patients who reacted normally to skin testing. However, a considerable overlap existed as 43% of the reactive patients were malnourished, and 21% of the anergic patients were normally nourished. Thirty-seven (43%) of the 86 anergic patients converted and became reactive during TPN, and their body composition improved significantly. The remaining 49 anergic patients (57%) did not convert, and their body composition did not change despite similar nutritional support. The principal difference between the two groups of anergic patients was the nature of the therapy administered. In the anergic patients who converted, therapy was aggressive and appropriate, and clinical improvement occurred in 23 (62.2%) of the patients, with a mortality of 5.4%. In the 49 patients who remained anergic, therapy was often inappropriate or unsuccessful, with clinical improvement in only three (6.1%) of the patients and a mortality of 42.8%. The data demonstrated a significant relationship between the response to skin testing and the nutritional state. However, because of the wide overlap, skin testing does not accurately assess a person's nutritional state. The persistence of the anergic state is indicative of a lack of response to therapy

  14. Shared values and normality

    ZHANG Wen-hua; PANG Xue-cheng

    2006-01-01

    This paper investigates the relationship between the normality and the shared values for a meromorphic function on the unit disc △.Based on Marty's normality criterion and through a detailed analysis of the meromorphic functions,it is shown that if for every f∈F,f and f(k) share a and b on △ and the zeros of f(z)-a are of multiplicity k≥3,then F is normal on △,where F is a family of meromorphic functions on the unit disc △,and a and b are distinct values.

  15. Normality in Analytical Psychology

    Steve Myers(CERN)

    2013-01-01

    Although C.G. Jung’s interest in normality wavered throughout his career, it was one of the areas he identified in later life as worthy of further research. He began his career using a definition of normality which would have been the target of Foucault’s criticism, had Foucault chosen to review Jung’s work. However, Jung then evolved his thinking to a standpoint that was more aligned to Foucault’s own. Thereafter, the post Jungian concept of normality has remained relatively undeveloped by c...

  16. Normalizers of Irreducible Subfactors

    Smith, Roger R.; White, Stuart A.; Wiggins, Alan D.

    2007-01-01

    We consider normalizers of an irreducible inclusion $N\\subseteq M$ of $\\mathrm{II}_1$ factors. In the infinite index setting an inclusion $uNu^*\\subseteq N$ can be strict, forcing us to also investigate the semigroup of one-sided normalizers. We relate these normalizers of $N$ in $M$ to projections in the basic construction and show that every trace one projection in the relative commutant $N'\\cap $ is of the form $u^*e_Nu$ for some unitary $u\\in M$ with $uNu^*\\subseteq N$. This enabl...

  17. Some physical considerations in whole skin electron beam therapy

    Holt, J.G.; Perry, D.J.

    1982-09-01

    The short range of low-energy electrons has made them suitable for the treatment of skin lesions, especially when extensive areas must be irradiated with special considerations to save the normal underlying tissue. This report covers some salient features of total body electron irradiation: the construction of the large fields required, x-ray contamination levels, and multiple-field techniques. While the investigation is essentially experimental, we also indicate the results of calculations. We conclude most generally that treatment planning with whole skin irradiations can be as precise as with smaller fields.

  18. Tubuloreticular inclusions in skin biopsies from patients with HIV infection

    Pedersen, C; Horn, T; Junge, Jette;

    1989-01-01

    Skin biopsies obtained from apparently normal skin from 15 HIV infected patients and 6 anti-HIV negative patients were examined by electron microscopy. Tubuloreticular inclusions (TRI) were detected within the cytoplasm of capillary endothelial cells in 5/5 AIDS patients and in 2/5 patients with...... AIDS related conditions. Biopsies from 5 asymptomatic HIV positive patients and the 6 control subjects were without ultrastructural alterations. The occurrence of TRI was related to low numbers of CD 4+ lymphocytes. 5/7 patients with TRI had elevated serum interferon activity, and in all of the...

  19. Skin decontamination of glyphosate from human skin in vitro.

    Zhai, H; Chan, H P; Hui, X; Maibach, H I

    2008-06-01

    This study compared three model decontaminant solutions (tap water, isotonic saline, and hypertonic saline) for their ability to remove a model herbicide (glyphosate) from an in vitro human skin model. Human cadaver skin was dosed (approximately 375microg) of [14C]-glyphosate on 3cm2 per skin. After each exposure time (1, 3, and 30min post-dosing, respectively), the surface skin was washed three times (4ml per time) with each solution. After washing, the skin was stripped twice with tape discs. Lastly, the wash solutions, strippings, receptor fluid, and remainder of skin were liquid scintillation analyzer counted to determine the amount of glyphosate. There were no statistical differences among these groups at any time points. The total mass balance recovery at three time exposure points was between 94.8% and 102.4%. The wash off rates (glyphosate in wash solutions) at three different exposure times is 79-101.2%. Thus the three tested decontaminants possess similar effectiveness in removing glyphosate from skin. This in vitro model is not only economic and rapid, but also provides quantitative data that may aid screening for optimal decontaminants. PMID:18407393

  20. Periostin in Skin Tissue Skin-Related Diseases

    Yukie Yamaguchi

    2014-01-01

    Recently, periostin—a matricellular protein—has been highlighted for its pivotal functions in the skin. Analysis of periostin null mice has revealed that periostin contributes to collagen fibrillogenesis, collagen cross-linking, and the formation of ECM meshwork via interactions with other ECM components. Periostin expression is enhanced by mechanical stress or skin injury; this is indicative of the physiologically protective functions of periostin, which promotes wound repair by acting on keratinocytes and fibroblasts. Along with its physiological functions, periostin plays pathogenic roles in skin fibrosis and chronic allergic inflammation. In systemic sclerosis (SSc patients, periostin levels reflect the severity of skin fibrosis. Periostin null mice have shown reduced skin fibrosis in a bleomycin-induced SSc mouse model, indicating a key role of periostin in fibrosis. Moreover, in atopic dermatitis (AD, attenuated AD phenotype has been observed in periostin null mice in a house dust mite extract-induced AD mouse model. Th2 cytokine-induced periostin acts on keratinocytes to produce inflammatory cytokines that further enhance the Th2 response, thereby sustaining and amplifying chronic allergic inflammation. Thus, periostin is deeply involved in the pathogenesis of AD and other inflammation-related disorders affecting the skin. Understanding the dynamic actions of periostin would be key to dissecting pathogenesis of skin-related diseases and to developing novel therapeutic strategies.