WorldWideScience

Sample records for adhesins

  1. EHEC Adhesins

    McWilliams, Brian D.; Torres, Alfredo G.

    2014-01-01

    Adhesins are a group of proteins in enterohemorrhagic Escherichia coli (EHEC) that are involved in the attachment or colonization of this pathogen to abiotic (plastic or steel) and biological surfaces, such as those found in bovine and human intestines. This review provides the most up-to-date information on these essential adhesion factors, summarizing important historical discoveries and analyzing the current and future state of this research. In doing so, the proteins intimin and Tir are d...

  2. EHEC Adhesins

    McWilliams, Brian D.; Torres, Alfredo G.

    2014-01-01

    Adhesins are a group of proteins in enterohemorrhagic Escherichia coli (EHEC) that are involved in the attachment or colonization of this pathogen to abiotic (plastic or steel) and biological surfaces, such as those found in bovine and human intestines. This review provides the most up-to-date information on these essential adhesion factors, summarizing important historical discoveries and analyzing the current and future state of this research. In doing so, the proteins intimin and Tir are discussed in depth, especially regarding their role in the development of attaching and effacing lesions and in EHEC virulence. Further, a series of fimbrial proteins (Lpf1, Lpf2, curli, ECP, F9, ELF, Sfp, HCP, and type 1 fimbriae) are also described, emphasizing their various contributions to adherence and colonization of different surfaces and their potential use as genetic markers in detection and classification of different EHEC serotypes. This review also discusses the role of several autotransporter proteins (EhaA-D, EspP, Saa and Sab, and Cah), as well as other proteins associated with adherence, such as flagella, EibG, Iha, and OmpA. While these proteins have all been studied to varying degrees, all of the adhesins summarized in this chapter have been linked to different stages of the EHEC life cycle, making them good targets for the development of more effective diagnostics and therapeutics. PMID:25635238

  3. Adhesins of Bartonella spp.

    O'Rourke, Fiona; Schmidgen, Thomas; Kaiser, Patrick O; Linke, Dirk; Kempf, Volkhard A J

    2011-01-01

    Adhesion to host cells represents the first step in the infection process and one of the decisive features in the pathogenicity of Bartonella spp. B. henselae and B. quintana are considered to be the most important human pathogenic species, responsible for cat scratch disease, bacillary angiomatosis, trench fever and other diseases. The ability to cause vasculoproliferative disorders and intraerythrocytic bacteraemia are unique features of the genus Bartonella. Consequently, the interaction with endothelial cells and erythrocytes is a focus in Bartonella research. The genus harbours a variety of trimeric autotransporter adhesins (TAAs) such as the Bartonella adhesin A (BadA) of B. henselae and the variably expressed outer-membrane proteins (Vomps) of B. quintana, which display remarkable variations in length and modular construction. These adhesins mediate many of the biologically-important properties of Bartonella spp. such as adherence to endothelial cells and extracellular matrix proteins and induction of angiogenic gene programming. There is also significant evidence that the laterally acquired Trw-conjugation systems of Bartonella spp. mediate host-specific adherence to erythrocytes. Other potential adhesins are the filamentous haemagglutinins and several outer membrane proteins. The exact molecular functions of these adhesins and their interplay with other pathogenicity factors (e.g., the VirB/D4 type 4 secretion system) need to be analysed in detail to understand how these pathogens adapt to their mammalian hosts. PMID:21557057

  4. Mannoprotein Adhesin of Candida albicans Germ Tubes

    VARDAR-ÜNLÜ, Gülhan

    1998-01-01

    The production and detection of a mannoprotein adhesin (MPA) of the hyphal-form cells of C. albicans on plastic petri dishes was investigated. Using Concanavalin A-coated latex microspheres, the MPA was detected on the plastic surface on which C. albicans produced germ tubes. The adhesin was extracted using dithiothreitol and iodoacetamide. It did not inhibit the adhesion of the yeast-form C. albicans to buccal epithelial cells (BEC). This suggested that the MPA of the hyphal-form ...

  5. Molecular design of Mycoplasma hominis Vaa adhesin

    Boesen, Thomas; Fedosova, Natalya U.; Kjeldgaard, Morten;

    2001-01-01

    The variable adherence-associated (Vaa) adhesin of the opportunistic human pathogen Mycoplasma hominis is a surface-exposed, membrane-associated protein involved in the attachment of the bacterium to host cells. The molecular masses of recombinant 1 and 2 cassette forms of the protein determined by...

  6. Lectinlike adhesins in the Bacteroides fragilis group.

    Rogemond, V; Guinet, R M

    1986-01-01

    Lectinlike adhesins were identified in the Bacteroides fragilis group by using sugars immobilized on agarose beads either with whole bacteria by direct microscopic examination or with soluble extracts by immunoaffinoelectrophoresis. These two methods allowed the identification of two sugars reacting with whole bacteria and with the corresponding extracts: alpha-D-glucosamine and D-galactosamine. Among eight strains tested representing seven species, the two strains of B. fragilis were equally...

  7. Bioaccumulation of heavy metals by fimbrial designer adhesins

    Schembri, Mark; Kjærgaard, Kristian; Klemm, Per

    1999-01-01

    Naturally occurring adhesins bind to specific molecular targets in a lock-and-key fashion due to the composition of the binding domain of the adhesin. By introduction of random peptide libraries in a suitable surface exposed carrier protein it is possible to create and select designer adhesins wi...... for the bioaccumulation of heavy metals from the environment. (C) 1999 Federation of European Microbiological Societies. Published by Elsevier Science B.V. All rights reserved....

  8. Binding characteristics of Escherichia coli adhesins in human urinary bladder.

    Virkola, R; Westerlund, B; Holthöfer, H; Parkkinen, J; Kekomäki, M; Korhonen, T K

    1988-01-01

    We studied domains in the human bladder that acted as receptors for Escherichia coli P, S, type 1, type 1C, and O75X fimbriae or adhesin and domains in the human kidneys that were receptors for E. coli type 1C fimbriae. Binding sites in frozen tissue sections were localized by direct staining with fluorochrome-labeled recombinant strains and by indirect immunofluorescence with the purified adhesins. In the bladder, the P and S fimbriae showed closely similar binding to the epithelial and musc...

  9. Lectin-Glycan Interaction Network-Based Identification of Host Receptors of Microbial Pathogenic Adhesins

    Ielasi, Francesco S.; Alioscha-Perez, Mitchel; Donohue, Dagmara; Claes, Sandra; Sahli, Hichem; Schols, Dominique

    2016-01-01

    ABSTRACT The first step in the infection of humans by microbial pathogens is their adherence to host tissue cells, which is frequently based on the binding of carbohydrate-binding proteins (lectin-like adhesins) to human cell receptors that expose glycans. In only a few cases have the human receptors of pathogenic adhesins been described. A novel strategy—based on the construction of a lectin-glycan interaction (LGI) network—to identify the potential human binding receptors for pathogenic adhesins with lectin activity was developed. The new approach is based on linking glycan array screening results of these adhesins to a human glycoprotein database via the construction of an LGI network. This strategy was used to detect human receptors for virulent Escherichia coli (FimH adhesin), and the fungal pathogens Candida albicans (Als1p and Als3p adhesins) and C. glabrata (Epa1, Epa6, and Epa7 adhesins), which cause candidiasis. This LGI network strategy allows the profiling of potential adhesin binding receptors in the host with prioritization, based on experimental binding data, of the most relevant interactions. New potential targets for the selected adhesins were predicted and experimentally confirmed. This methodology was also used to predict lectin interactions with envelope glycoproteins of human-pathogenic viruses. It was shown that this strategy was successful in revealing that the FimH adhesin has anti-HIV activity. PMID:27406561

  10. The role of Actinobacillus actinomycetemcomitans fimbrial adhesin on MMP-8 activity in aggressive periodontitis pathogenesis

    Rini Devijanti Ridwan

    2012-12-01

    Full Text Available Background: Actinobacillus actinomycetemcomitans (A. actinomycetemcomitans is Gram negative and a major bacterial agent associated with aggressive periodontitis in young adult, this bacteria was an important factor in pathogenesis of aggressive periodontitis. A. actinomycetemcomitans possesses fimbriae with an adhesin protein that was the first bacterial molecules to make physical contact with host. Purpose: The objective of this research was to analyzed the influence of A. actinomycetemcomitans fimbrial adhesin protein induction on MMP-8 activity. Methods: The research was an experimental laboratory study, the step in this study were isolation and identification A. actinomycetemcomitans, characterize A. actinomycetemcomitans adhesin and study the role of A. actinomycetemcomitans adhesin in Wistar rats. Results: The result of this research on the role of adhesin in Wistar rats after analysis with Analysis of Variance (ANOVA showed significant differences in the control group with group induction with A. actinomycetemcomitans, A. actinomycetemcomitans plus adhesin and adhesin. MMP-8 activity increased with induction A. actinomycetemcomitans and 24 kDa A. actinomycetemcomitans adhesin. This fimbrial adhesin protein showed that A. actinomycetemcomitans has the ability to adhesion, colonization and invasion for host in aggressive periodontitis pathogenesis. Conclusion: A. actinomycetemcomitans fimbrial adhesin protein induction increasing MMP-8 activity for aggressive periodontitis pathogenesis.Latar belakang: A. actinomycetemcomitans merupakan salah satu bakteri Gram negatif yang terkait dengan periodontitis agresif yang menyerang penderita usia muda dan merupakan faktor penting dalam patogenesis periodontitis agresif. A. actimycetemcomitans mempunyai fimbriae dengan protein adhesin yang merupakan molekul pertama dari bakteri untuk melakukan kontak fisik dengan host. Tujuan: Tujuan penelitian ini adalah menganalisis pengaruh induksi adhesin A

  11. Hydrophobic adhesin of E coli in ulcerative colitis.

    Burke, D A; Axon, A T

    1988-01-01

    Pathogenic E coli have adhesive properties which are mirrored by an increase in their surface hydrophobicity. E coli isolated from patients with ulcerative colitis possess a mannose resistant adhesin similar to that found in pathogenic E coli. In this study 42 E coli isolates from patients with colitis have been compared with 15 from controls to assess hydrophobicity and cellular adherence. The salting out method and the buccal epithelial cell technique were used respectively. E coli isolated...

  12. Surface adhesins and exopolymers of selected foodborne pathogens

    Jaglic, Zoran; Desvaux, Mickaël; Weiss, Agnes;

    2014-01-01

    of bacterial surface structures are involved in this process and these promote bacterial adhesion in a more or less specific manner. In this review, we will focus on those surface adhesins and exopolymers in selected foodborne pathogens that are involved mainly in primary adhesion. Their role in biofilm...... development will also be considered when appropriate. Both the clinical impact and implications for food safety of such adhesion will be discussed....

  13. The Giant Adhesin SiiE of Salmonella enterica

    Britta Barlag

    2015-01-01

    Full Text Available Salmonella enterica is a Gram-negative, food-borne pathogen, which colonizes the intestinal tract and invades enterocytes. Invasion of polarized cells depends on the SPI1-encoded type III secretion system (T3SS and the SPI4-encoded type I secretion system (T1SS. The substrate of this T1SS is the non-fimbrial giant adhesin SiiE. With a size of 595 kDa, SiiE is the largest protein of the Salmonella proteome and consists of 53 repetitive bacterial immunoglobulin (BIg domains, each containing several conserved residues. As known for other T1SS substrates, such as E. coli HlyA, Ca2+ ions bound by conserved D residues within the BIg domains stabilize the protein and facilitate secretion. The adhesin SiiE mediates the first contact to the host cell and thereby positions the SPI1-T3SS to initiate the translocation of a cocktail of effector proteins. This leads to actin remodeling, membrane ruffle formation and bacterial internalization. SiiE binds to host cell apical membranes in a lectin-like manner. GlcNAc and α2–3 linked sialic acid-containing structures are ligands of SiiE. Since SiiE shows repetitive domain architecture, we propose a zipper-like binding mediated by each individual BIg domain. In this review, we discuss the characteristics of the SPI4-T1SS and the giant adhesin SiiE.

  14. Novel roles for the AIDA adhesin from diarrheagenic Escherichia coli:

    Sherlock, Orla; Schembri, Mark; Reisner, A.;

    2004-01-01

    Diarrhea-causing Escherichia coli strains are responsible for numerous cases of gastrointestinal disease and constitute a serious health problem throughout the world. The ability to recognize and attach to host intestinal surfaces is an essential step in the pathogenesis of such strains. AIDA is a...... potent bacterial adhesin associated with some diarrheagenic E. coli strains. AIDA mediates bacterial attachment to a broad variety of human and other mammalian cells. It is a surface-displayed autotransporter protein and belongs to the selected group of bacterial glycoproteins; only the glycosylated form...... binds to mammalian cells. Here, we show that AIDA possesses self-association characteristics and can mediate autoaggregation of E. coli cells. We demonstrate that intercellular AIDA-AIDA interaction is responsible for bacterial autoaggregation. Interestingly, AIDA-expressing cells can interact with...

  15. Regions important for the adhesin activity of Moraxella catarrhalis Hag

    Lafontaine Eric R

    2007-07-01

    Full Text Available Abstract Background The Moraxella catarrhalis Hag protein, an Oca autotransporter adhesin, has previously been shown to be important for adherence of this respiratory tract pathogen to human middle ear and A549 lung cells. Results The present study demonstrates that adherence of M. catarrhalis isogenic hag mutant strains to the human epithelial cell lines Chang (conjunctival and NCIH292 (lung is reduced by 50–93%. Furthermore, expressing Hag in a heterologous Escherichia coli background substantially increased the adherence of recombinant bacteria to NCIH292 cells and murine type IV collagen. Hag did not, however, increase the attachment of E. coli to Chang cells. These results indicate that Hag directly mediates adherence to NCIH292 lung cells and collagen, but is not sufficient to confer binding to conjunctival monolayers. Several in-frame deletions were engineered within the hag gene of M. catarrhalis strain O35E and the resulting proteins were tested for their ability to mediate binding to NCIH292 monolayers, middle ear cells, and type IV collagen. These experiments revealed that epithelial cell and collagen binding properties are separable, and that residues 385–705 of this ~2,000 amino acid protein are important for adherence to middle ear and NCIH292 cells. The region of O35E-Hag encompassing aa 706 to 1194 was also found to be required for adherence to collagen. In contrast, β-roll repeats present in Hag, which are structural features conserved in several Oca adhesins and responsible for the adhesive properties of Yersinia enterocolitica YadA, are not important for Hag-mediated adherence. Conclusion Hag is a major adherence factor for human cells derived from various anatomical sites relevant to pathogenesis by M. catarrhalis and its structure-function relationships differ from those of other, closely-related autotransporter proteins.

  16. A spatially localized rhomboid protease cleaves cell surface adhesins essential for invasion by Toxoplasma

    Brossier, Fabien; Jewett, Travis J.; Sibley, L. David; Urban, Sinisa

    2005-01-01

    Apicomplexan parasites cause serious human and animal diseases, the treatment of which requires identification of new therapeutic targets. Host-cell invasion culminates in the essential cleavage of parasite adhesins, and although the cleavage site for several adhesins maps within their transmembrane domains, the protease responsible for this processing has not been discovered. We have identified, cloned, and characterized the five nonmitochondrial rhomboid intramembrane proteases encoded in t...

  17. Detection of Mycoplasma pneumoniae adhesin (P1) in the nonhemadsorbing population of virulent Mycoplasma pneumoniae.

    Kahane, I; Tucker, S.; Baseman, J B

    1985-01-01

    Mycoplasma pneumoniae organisms possessing a hemadsorbing-negative (HA-) phenotype comprise more than 50% of the population of virulent M. pneumoniae cultures. Monoclonal antibody to P1, the major adhesin of M. pneumoniae reacts with this HA- mycoplasma fraction based upon radioimmunoprecipitation and immunoblotting. Demonstration of P1 in the entire mycoplasma population suggests that topological organization of this adhesin in the membrane or the physiological state of the mycoplasmas may d...

  18. Diversity of Expressed vlhA Adhesin Sequences and Intermediate Hemagglutination Phenotypes in Mycoplasma synoviae▿

    May, Meghan; Brown, Daniel R.

    2011-01-01

    A reservoir of pseudogene alleles encoding the primary adhesin VlhA occurs in the avian pathogen Mycoplasma synoviae. Recombination between this reservoir and its single expression site was predicted to result in lineages of M. synoviae that each express a different vlhA allele as a consequence of host immune responses to those antigens. Such interstrain diversity at the vlhA expression site, including major differences in the predicted secondary structures of their expressed adhesins, was co...

  19. Identification and Characterization of a Novel Adhesin Unique to Oral Fusobacteria

    Han, Yiping W.; Ikegami, Akihiko; Rajanna, Chythanya; Kawsar, Hameem I.; Zhou, Yun; Li, Mei; Sojar, Hakimuddin T.; Genco, Robert J.; Kuramitsu, Howard K.; Deng, Cheri X.

    2005-01-01

    Fusobacterium nucleatum is a gram-negative anaerobe that is prevalent in periodontal disease and infections of different parts of the body. The organism has remarkable adherence properties, binding to partners ranging from eukaryotic and prokaryotic cells to extracellular macromolecules. Understanding its adherence is important for understanding the pathogenesis of F. nucleatum. In this study, a novel adhesin, FadA (Fusobacterium adhesin A), was demonstrated to bind to the surface proteins of...

  20. Structure and copy number of gene clusters related to the pap P-adhesin operon of uropathogenic Escherichia coli.

    Arthur, M; Campanelli, C; Arbeit, R D; Kim, C.; Steinbach, S; C. E. Johnson; Rubin, R H; Goldstein, R.

    1989-01-01

    The structurally related pap and prs operons of the uropathogenic Escherichia coli isolate J96 encode a P and an F adhesin that mediate bacterial attachment to the human P blood group antigen and the Forssman antigen, respectively. Using probes prepared from different segments of the pap operon, Southern blot hybridizations were performed to characterize pap-related sequences of 30 E. coli clinical isolates expressing different adhesin phenotypes. Gene clusters encoding P and F adhesins displ...

  1. Sticky Matrix: Adhesion Mechanism of the Staphylococcal Polysaccharide Intercellular Adhesin.

    Formosa-Dague, Cécile; Feuillie, Cécile; Beaussart, Audrey; Derclaye, Sylvie; Kucharíková, Soňa; Lasa, Iñigo; Van Dijck, Patrick; Dufrêne, Yves F

    2016-03-22

    The development of bacterial biofilms on surfaces leads to hospital-acquired infections that are difficult to fight. In Staphylococci, the cationic polysaccharide intercellular adhesin (PIA) forms an extracellular matrix that connects the cells together during biofilm formation, but the molecular forces involved are unknown. Here, we use advanced force nanoscopy techniques to unravel the mechanism of PIA-mediated adhesion in a clinically relevant methicillin-resistant Staphylococcus aureus (MRSA) strain. Nanoscale multiparametric imaging of the structure, adhesion, and elasticity of bacteria expressing PIA shows that the cells are surrounded by a soft and adhesive matrix of extracellular polymers. Cell surface softness and adhesion are dramatically reduced in mutant cells deficient for the synthesis of PIA or under unfavorable growth conditions. Single-cell force spectroscopy demonstrates that PIA promotes cell-cell adhesion via the multivalent electrostatic interaction with polyanionic teichoic acids on the S. aureus cell surface. This binding mechanism rationalizes, at the nanoscale, the well-known ability of PIA to strengthen intercellular adhesion in staphylococcal biofilms. Force nanoscopy offers promising prospects for understanding the fundamental forces in antibiotic-resistant biofilms and for designing anti-adhesion compounds targeting matrix polymers. PMID:26908275

  2. Entamoeba histolytica: Adhesins and Lectins in the Trophozoite Surface

    Magdalena Aguirre García

    2015-02-01

    Full Text Available Entamoeba histolytica is the causative agent of amebiasis in humans and is responsible for 100,000 deaths annually, making it the third leading cause of death due to a protozoan parasite. Pathogenesis appears to result from the potent cytotoxic activity of the parasite, which kills host cells within minutes. Although the mechanism is unknown, it is well established to be contact-dependent. The life cycle of the parasite alternates with two forms: the resistant cyst and the invasive trophozoite. The adhesive interactions between the parasite and surface glycoconjugates of host cells, as well as those lining the epithelia, are determinants for invasion of human tissues, for its cytotoxic activity, and finally for the outcome of the disease. In this review we present an overview of the information available on the amebic lectins and adhesins that are responsible of those adhesive interactions and we also refer to their effect on the host immune response. Finally, we present some concluding remarks and perspectives in the field.

  3. Identification of novel adhesins of M. tuberculosis H37Rv using integrated approach of multiple computational algorithms and experimental analysis.

    Sanjiv Kumar

    Full Text Available Pathogenic bacteria interacting with eukaryotic host express adhesins on their surface. These adhesins aid in bacterial attachment to the host cell receptors during colonization. A few adhesins such as Heparin binding hemagglutinin adhesin (HBHA, Apa, Malate Synthase of M. tuberculosis have been identified using specific experimental interaction models based on the biological knowledge of the pathogen. In the present work, we carried out computational screening for adhesins of M. tuberculosis. We used an integrated computational approach using SPAAN for predicting adhesins, PSORTb, SubLoc and LocTree for extracellular localization, and BLAST for verifying non-similarity to human proteins. These steps are among the first of reverse vaccinology. Multiple claims and attacks from different algorithms were processed through argumentative approach. Additional filtration criteria included selection for proteins with low molecular weights and absence of literature reports. We examined binding potential of the selected proteins using an image based ELISA. The protein Rv2599 (membrane protein binds to human fibronectin, laminin and collagen. Rv3717 (N-acetylmuramoyl-L-alanine amidase and Rv0309 (L,D-transpeptidase bind to fibronectin and laminin. We report Rv2599 (membrane protein, Rv0309 and Rv3717 as novel adhesins of M. tuberculosis H37Rv. Our results expand the number of known adhesins of M. tuberculosis and suggest their regulated expression in different stages.

  4. Localization of adhesins on the surface of a pathogenic bacterial envelope through atomic force microscopy

    Arnal, L.; Longo, G.; Stupar, P.; Castez, M. F.; Cattelan, N.; Salvarezza, R. C.; Yantorno, O. M.; Kasas, S.; Vela, M. E.

    2015-10-01

    Bacterial adhesion is the first and a significant step in establishing infection. This adhesion normally occurs in the presence of flow of fluids. Therefore, bacterial adhesins must be able to provide high strength interactions with their target surface in order to maintain the adhered bacteria under hydromechanical stressing conditions. In the case of B. pertussis, a Gram-negative bacterium responsible for pertussis, a highly contagious human respiratory tract infection, an important protein participating in the adhesion process is a 220 kDa adhesin named filamentous haemagglutinin (FHA), an outer membrane and also secreted protein that contains recognition domains to adhere to ciliated respiratory epithelial cells and macrophages. In this work, we obtained information on the cell-surface localization and distribution of the B. pertussis adhesin FHA using an antibody-functionalized AFM tip. Through the analysis of specific molecular recognition events we built a map of the spatial distribution of the adhesin which revealed a non-homogeneous pattern. Moreover, our experiments showed a force induced reorganization of the adhesin on the surface of the cells, which could explain a reinforced adhesive response under external forces. This single-molecule information contributes to the understanding of basic molecular mechanisms used by bacterial pathogens to cause infectious disease and to gain insights into the structural features by which adhesins can act as force sensors under mechanical shear conditions.Bacterial adhesion is the first and a significant step in establishing infection. This adhesion normally occurs in the presence of flow of fluids. Therefore, bacterial adhesins must be able to provide high strength interactions with their target surface in order to maintain the adhered bacteria under hydromechanical stressing conditions. In the case of B. pertussis, a Gram-negative bacterium responsible for pertussis, a highly contagious human respiratory tract

  5. Neisseria adhesin A variation and revised nomenclature scheme.

    Bambini, Stefania; De Chiara, Matteo; Muzzi, Alessandro; Mora, Marirosa; Lucidarme, Jay; Brehony, Carina; Borrow, Ray; Masignani, Vega; Comanducci, Maurizio; Maiden, Martin C J; Rappuoli, Rino; Pizza, Mariagrazia; Jolley, Keith A

    2014-07-01

    Neisseria adhesin A (NadA), involved in the adhesion and invasion of Neisseria meningitidis into host tissues, is one of the major components of Bexsero, a novel multicomponent vaccine licensed for protection against meningococcal serogroup B in Europe, Australia, and Canada. NadA has been identified in approximately 30% of clinical isolates and in a much lower proportion of carrier isolates. Three protein variants were originally identified in invasive meningococci and named NadA-1, NadA-2, and NadA-3, whereas most carrier isolates either lacked the gene or harbored a different variant, NadA-4. Further analysis of isolates belonging to the sequence type 213 (ST-213) clonal complex identified NadA-5, which was structurally similar to NadA-4, but more distantly related to NadA-1, -2, and -3. At the time of this writing, more than 89 distinct nadA allele sequences and 43 distinct peptides have been described. Here, we present a revised nomenclature system, taking into account the complete data set, which is compatible with previous classification schemes and is expandable. The main features of this new scheme include (i) the grouping of the previously named NadA-2 and NadA-3 variants into a single NadA-2/3 variant, (ii) the grouping of the previously assigned NadA-4 and NadA-5 variants into a single NadA-4/5 variant, (iii) the introduction of an additional variant (NadA-6), and (iv) the classification of the variants into two main groups, named groups I and II. To facilitate querying of the sequences and submission of new allele sequences, the nucleotide and amino acid sequences are available at http://pubmlst.org/neisseria/NadA/. PMID:24807056

  6. Assessment of Adhesins as an Indicator of Pathovar-Associated Virulence Factors in Bovine Escherichia coli

    Valat, Charlotte; Forest, Karine; Auvray, Frédéric; Métayer, Véronique; Méheut, Thomas; Polizzi, Charlène; Gay, Emilie; Haenni, Marisa; Oswald, Eric; Madec, Jean-Yves

    2014-01-01

    The CS31A, F17, and F5 adhesins are usually targeted by serology-based methods to detect pathogenic Escherichia coli associated with calf enteritis. However, the virulence traits of the selected isolates are still poorly described. Here, from a set of 349 diarrheagenic E. coli isolates from cattle, we demonstrated a 70.8% concordance rate (Cohen's kappa, 0.599) between serology- and PCR-based approaches for the detection of adhesins under field conditions. A 79% to 82.4% correspondence betwee...

  7. FungalRV: adhesin prediction and immunoinformatics portal for human fungal pathogens

    Ramachandran Srinivasan

    2011-04-01

    Full Text Available Abstract Background The availability of sequence data of human pathogenic fungi generates opportunities to develop Bioinformatics tools and resources for vaccine development towards benefitting at-risk patients. Description We have developed a fungal adhesin predictor and an immunoinformatics database with predicted adhesins. Based on literature search and domain analysis, we prepared a positive dataset comprising adhesin protein sequences from human fungal pathogens Candida albicans, Candida glabrata, Aspergillus fumigatus, Coccidioides immitis, Coccidioides posadasii, Histoplasma capsulatum, Blastomyces dermatitidis, Pneumocystis carinii, Pneumocystis jirovecii and Paracoccidioides brasiliensis. The negative dataset consisted of proteins with high probability to function intracellularly. We have used 3945 compositional properties including frequencies of mono, doublet, triplet, and multiplets of amino acids and hydrophobic properties as input features of protein sequences to Support Vector Machine. Best classifiers were identified through an exhaustive search of 588 parameters and meeting the criteria of best Mathews Correlation Coefficient and lowest coefficient of variation among the 3 fold cross validation datasets. The "FungalRV adhesin predictor" was built on three models whose average Mathews Correlation Coefficient was in the range 0.89-0.90 and its coefficient of variation across three fold cross validation datasets in the range 1.2% - 2.74% at threshold score of 0. We obtained an overall MCC value of 0.8702 considering all 8 pathogens, namely, C. albicans, C. glabrata, A. fumigatus, B. dermatitidis, C. immitis, C. posadasii, H. capsulatum and P. brasiliensis thus showing high sensitivity and specificity at a threshold of 0.511. In case of P. brasiliensis the algorithm achieved a sensitivity of 66.67%. A total of 307 fungal adhesins and adhesin like proteins were predicted from the entire proteomes of eight human pathogenic fungal

  8. The influence of adhesin protein from Aggregatibacter actinomycetemcomitans on IL-8 and MMP-8 titre in aggressive periodontitis

    Rini Revijanti Ridwan

    2015-03-01

    Full Text Available Background: Adhesion can actually be considered as a part of both a powerful survival mechanism and a virulence mechanism for bacterial pathogens. Bacterial adhesin is an instrument for bacteria to do invasion to host. Bacterial adhesin depends on ligand interaction as a signaling mediator that will influence invasion and increase pro and anti-inflammatory because of the influence of the receptors of innate immune response. Aggregatibacter actimycetemcomitans has fimbriae included in type IV pili containing mostly with protein weighed 6.5 kDa and at least with protein weighed 54 kDa. Purpose: The purpose of this research is to analyze the influence of the induction of adhesin protein derived from A. actinomycetemcomitans on IL-8 and MMP-8 titre of Wistar rats. Methods: Adhesin protein derived from A. actinomycetemcomitans weighed 24 kDa was induced on the maxillary first molar sulcus of Wistar rats to prove that adhesin protein could affect IL-8 and MMP-8 titre. Next, to determine its influence, Elisa technique was conducted. Results: It is known that the levels of IL-8 and MMP-8 titre were increased in the group induced with adhesin protein derived from A. actinomycetemcomitans compared with the control group. Conclusion: It can be concluded that adhesin protein derived from A. actinomycetemcomitans can cause alveolar bone damage through the increasing levels of IL-8 and MMP-8 in aggressive periodontitis.

  9. Identification, characterization and cloning of Entamoeba histolytica adhesins: Their potential use in diagnosis

    Entamoeba histolytica adhesins were detected by the generation of monoclonal antibodies (MAbs) inhibitors of adhesion. In other experiments trophozoites were radiolabeled with 125I or with (35S)-methionine and incubated with red blood cells (RBS's) or epithelial MDCK cells. Labeled amebic proteins of 210, 160, 112, 90, 70, 50 and 24 kDa were detected adhered on RBCs. Iodinated MDCK proteins formed ligand-receptor complexes with amebic proteins of 112 kDa, 90 and 48 to 50 kDa, when incubated with amebic proteins separated by gel electrophoresis. When RBC's interacted with adherence-deficient mutants, used in this work as highly negative genetic controls, proteins of 112 and 90 kDa appeared diminished on RBS surface, in comparison with wild type strain. The 112 kDa adhesin was not detected in a monoxenic nonpathogenic E. histolytica strain, isolated from an asymptomatic carrier. An E. histolytica DNA library was constructed in lambda gt-11, and recombinant clones were selected using polyclonal antibodies against the 112 kDa adhesin. In spite of the fact that DNA of the parasite was cloned, production of the hybrid protein in Escherichia coli was relatively efficient. Correlation of the presence of adhesins with the virulence of E. histolytica trophozoites encourage us to propose these proteins and their antibodies as good candidates in the design of reliable and inexpensive diagnosis and vaccine methods. (author). 23 refs, 7 figs, 2 tabs

  10. Expression and Immunological Characterization of the Carboxy-Terminal Region of the P1 Adhesin Protein of Mycoplasma pneumoniae

    Chaudhry, Rama; Nisar, Nazima; Hora, Bhavna; Chirasani, Sridhar Reddy; Malhotra, Pawan

    2005-01-01

    Mycoplasma pneumoniae is the causative agent of primary atypical pneumonia in humans. Adherence of M. pneumoniae to host cells requires several adhesin proteins, such as P1, P30, and P116. A major limitation in developing a specific diagnostic test for M. pneumoniae is the inability to express adhesin proteins in heterologous expression systems due to unusual usage of the UGA stop codon, leading to premature termination of these proteins in Escherichia coli. In the present study, we successfu...

  11. Functional characterization of a mucus-specific LPXTG surface adhesin from probiotic Lactobacillus rhamnosus GG.

    von Ossowski, Ingemar; Satokari, Reetta; Reunanen, Justus; Lebeer, Sarah; De Keersmaecker, Sigrid C J; Vanderleyden, Jos; de Vos, Willem M; Palva, Airi

    2011-07-01

    In spite of the wealth of clinical evidence supporting the health benefits of Lactobacillus rhamnosus GG in humans, there is still a lack of understanding of the molecular mechanisms behind its probiosis. Current knowledge suggests that the health-promoting effects of this probiotic strain might be partly dependent on its persistence in the intestine and adhesion to mucosal surfaces. Moreover, L. rhamnosus GG contains mucus-binding pili that might also explain the occupation of its ecological niche as a comparatively less stringent allochthonous intestine-dwelling bacterium. To uncover additional surface proteins involved in mucosal adhesion, we investigated the adherence properties of the only predicted protein (LGG_02337) in L. rhamnosus GG that exhibits homology with a known mucus-binding domain. We cloned a recombinant form of the gene for this putative mucus adhesin and established that the purified protein readily adheres to human intestinal mucus. We also showed that this mucus adhesin is visibly distributed throughout the cell surface and participates in the adhesive interaction between L. rhamnosus GG and mucus, although less prominently than the mucus-binding pili in this strain. Based on primary structural comparisons, we concluded that the current annotation of the LGG_02337 protein likely does not accurately reflect its predicted properties, and we propose that this mucus-specific adhesin be called the mucus-binding factor (MBF). Finally, we interpret our results to mean that L. rhamnosus GG MBF, as an active mucus-specific surface adhesin with a presumed ancillary involvement in pilus-mediated mucosal adhesion, plays a part in the adherent mechanisms during intestinal colonization by this probiotic. PMID:21602388

  12. Escherichia coli F41 adhesin: genetic organization, nucleotide sequence, and homology with the K88 determinant.

    1988-01-01

    The genetic organization of the polypeptides required for the biosynthesis of the F41 adhesin of enterotoxigenic Escherichia coli strains was investigated. Maxicell analysis demonstrated that a recombinant plasmid which mediated mannose-resistant hemagglutination and F41 antigen production encoded four polypeptides of 29, 30, 32, and 86 kilodaltons. The 29-kilodalton protein was identified as the F41 antigen, and the nucleotide sequence of the gene was determined. Extensive homology was obser...

  13. Dependence of Bacterial Protein Adhesins on Toll-Like Receptors for Proinflammatory Cytokine Induction

    Hajishengallis, George; Martin, Michael; Sojar, Hakimuddin T.; Sharma, Ashu; Schifferle, Robert E.; DeNardin, Ernesto; Russell, Michael W.; Genco, Robert J.

    2002-01-01

    Toll-like receptors (TLRs) are important signal transducers that mediate inflammatory reactions induced by microbes through pattern recognition of virulence molecules such as lipopolysaccharide (LPS) and lipoproteins. We investigated whether proinflammatory cytokine responses induced by certain bacterial protein adhesins may also depend on TLRs. In differentiated THP-1 mononuclear cells stimulated by LPS-free recombinant fimbrillin (rFimA) from Porphyromonas gingivalis, cytokine release was a...

  14. Crystallization and preliminary X-ray data of the FadA adhesin from Fusobacterium nucleatum

    The FadA adhesin from F. nucleatum, which is involved in bacterial attachment and invasion of human oral epithelial cells, has been crystallized in space group P61 or P65, and X-ray data have been collected to 1.9 Å resolution. Fusobacterium nucleatum is a Gram-negative anaerobe prevalent in the oral cavity that is associated with periodontal disease, preterm birth and infections in other parts of the human body. The bacteria attach to and invade epithelial and endothelial cells in the gum tissue and elsewhere via a 13.7 kDa adhesin protein FadA (Fusobacterium adhesin A). FadA exists in two forms: the intact form (pre-FadA), consisting of 129 amino acids, and the mature form (mFadA), which lacks an 18-residue signal sequence. Both forms have been expressed in Escherichia coli and purified. mFadA has been crystallized. The crystals belong to the hexagonal space group P61 or P65, with unit-cell parameters a = b = 59.3, c = 125.7 Å and one molecule per asymmetric unit. The crystals exhibit an unusually high solvent content of 74%. Synchrotron X-ray data have been collected to 1.9 Å. The crystals are suitable for X-ray structure determination. The crystal structure of FadA may provide a basis for the development of therapeutic agents to combat periodontal disease and other infections associated with F. nucleatum

  15. Chimeric FimH adhesin of type 1 fimbriae: a bacterial surface display system for heterologous sequences

    Pallesen, L; Poulsen, LK; Christiansen, Gunna; Klemm, P

    1995-01-01

    The FimH adhesin of type 1 fimbriae has been tested as a display system for heterologous protein segments on the surface of Escherichia coli. This was carried out by introduction of restriction site handles (BglII sites) in two different positions in the fimH gene, followed by in-frame insertion of...... heterologous DNA segments encoding two reporter sequences. In the selected positions such insertions did not significantly alter the function of the FimH protein with regard to surface location and adhesive ability. The system seemed to be quite flexible, since chimeric versions of the FimH adhesin containing...... feasibility study point to the possibility of using the FimH adhesin as a general surface display system for sizeable protein segments....

  16. Crystallization and preliminary X-ray data of the FadA adhesin from Fusobacterium nucleatum

    Nithianantham, Stanley [Department of Biochemistry, School of Medicine, Case Western Reserve University, Cleveland, OH 44106-4935 (United States); Xu, Minghua [Department of Biological Sciences, School of Dentistry, Case Western Reserve University, 10900 Euclid Avenue, Cleveland, OH 44106-4905 (United States); Wu, Nan [Department of Biochemistry, School of Medicine, Case Western Reserve University, Cleveland, OH 44106-4935 (United States); Han, Yiping W., E-mail: ywh2@case.edu [Department of Biological Sciences, School of Dentistry, Case Western Reserve University, 10900 Euclid Avenue, Cleveland, OH 44106-4905 (United States); Department of Pathology, Case Western Reserve University, 10900 Euclid Avenue, Cleveland, OH 44106 (United States); Shoham, Menachem, E-mail: ywh2@case.edu [Department of Biochemistry, School of Medicine, Case Western Reserve University, Cleveland, OH 44106-4935 (United States)

    2006-12-01

    The FadA adhesin from F. nucleatum, which is involved in bacterial attachment and invasion of human oral epithelial cells, has been crystallized in space group P6{sub 1} or P6{sub 5}, and X-ray data have been collected to 1.9 Å resolution. Fusobacterium nucleatum is a Gram-negative anaerobe prevalent in the oral cavity that is associated with periodontal disease, preterm birth and infections in other parts of the human body. The bacteria attach to and invade epithelial and endothelial cells in the gum tissue and elsewhere via a 13.7 kDa adhesin protein FadA (Fusobacterium adhesin A). FadA exists in two forms: the intact form (pre-FadA), consisting of 129 amino acids, and the mature form (mFadA), which lacks an 18-residue signal sequence. Both forms have been expressed in Escherichia coli and purified. mFadA has been crystallized. The crystals belong to the hexagonal space group P6{sub 1} or P6{sub 5}, with unit-cell parameters a = b = 59.3, c = 125.7 Å and one molecule per asymmetric unit. The crystals exhibit an unusually high solvent content of 74%. Synchrotron X-ray data have been collected to 1.9 Å. The crystals are suitable for X-ray structure determination. The crystal structure of FadA may provide a basis for the development of therapeutic agents to combat periodontal disease and other infections associated with F. nucleatum.

  17. Bifunctional Role of the Treponema pallidum Extracellular Matrix Binding Adhesin Tp0751 ▿

    Houston, Simon; Hof, Rebecca; Francescutti, Teresa; Hawkes, Aaron; Boulanger, Martin J.; Cameron, Caroline E.

    2011-01-01

    Treponema pallidum, the causative agent of syphilis, is a highly invasive pathogenic spirochete capable of attaching to host cells, invading the tissue barrier, and undergoing rapid widespread dissemination via the circulatory system. The T. pallidum adhesin Tp0751 was previously shown to bind laminin, the most abundant component of the basement membrane, suggesting a role for this adhesin in host tissue colonization and bacterial dissemination. We hypothesized that similar to that of other invasive pathogens, the interaction of T. pallidum with host coagulation proteins, such as fibrinogen, may also be crucial for dissemination via the circulatory system. To test this prediction, we used enzyme-linked immunosorbent assay (ELISA) methodology to demonstrate specific binding of soluble recombinant Tp0751 to human fibrinogen. Click-chemistry-based palmitoylation profiling of heterologously expressed Tp0751 confirmed the presence of a lipid attachment site within this adhesin. Analysis of the Tp0751 primary sequence revealed the presence of a C-terminal putative HEXXH metalloprotease motif, and in vitro degradation assays confirmed that recombinant Tp0751 purified from both insect and Escherichia coli expression systems degrades human fibrinogen and laminin. The proteolytic activity of Tp0751 was abolished by the presence of the metalloprotease inhibitor 1,10-phenanthroline. Further, inductively coupled plasma-mass spectrometry showed that Tp0751 binds zinc and calcium. Collectively, these results indicate that Tp0751 is a zinc-dependent, membrane-associated protease that exhibits metalloprotease-like characteristics. However, site-directed mutagenesis of the HEXXH motif to HQXXH did not abolish the proteolytic activity of Tp0751, indicating that further mutagenesis studies are required to elucidate the critical active site residues associated with this protein. This study represents the first published description of a T. pallidum protease capable of degrading host

  18. Crystal structure of JlpA, a surface-exposed lipoprotein adhesin of Campylobacter jejuni

    Kawai, Fumihiro; Paek, Seonghee; Choi, Kyoung-Jae; Prouty, Michael; Kanipes, Margaret I.; Guerry, Patricia; Yeo, Hye-Jeong

    2012-01-01

    The Campylobacter jejuni JlpA protein is a surface-exposed lipoprotein that was discovered as an adhesin promoting interaction with host epithelium cells, an early critical step in the pathogenesis of C. jejuni disease. Increasing evidence ascertained that JlpA is antigenic, indicating a role of JlpA in immune response during the infectious process. Here, we report the crystal structure of JlpA at 2.7Å resolution, revealing a catcher's mitt shaped unclosed half β-barrel. Although the apparent...

  19. Essential Roles and Regulation of the Legionella pneumophila Collagen-Like Adhesin during Biofilm Formation

    Julia Mallegol; Carla Duncan; Akriti Prashar; Jannice So; Low, Donald E.; Mauricio Terebeznik; Cyril Guyard

    2012-01-01

    Legionellosis is mostly caused by Legionella pneumophila (Lp) and is defined by a severe respiratory illness with a case fatality rate ranging from 5 to 80%. In a previous study, we showed that a glycosaminoglycan (GAG)-binding adhesin of Lp, named Lcl, is produced during legionellosis and is unique to the L. pneumophila species. Importantly, a mutant depleted in Lcl (Δlpg2644) is impaired in adhesion to GAGs and epithelial cells and in biofilm formation. Here, we examine the molecular functi...

  20. K88 Fimbrial Adhesin Targeting of Microspheres Containing Gentamicin Made with Albumin Glycated with Lactose.

    Sarabia-Sainz, Andre-I; Sarabia-Sainz, Hector Manuel; Montfort, Gabriela Ramos-Clamont; Mata-Haro, Veronica; Guzman-Partida, Ana María; Guzman, Roberto; Garcia-Soto, Mariano; Vazquez-Moreno, Luz

    2015-01-01

    The formulation and characterization of gentamicin-loaded microspheres as a delivery system targeting enterotoxigenic Escherichia coli K88 (E. coli K88) was investigated. Glycated albumin with lactose (BSA-glucose-β (4-1) galactose) was used as the microsphere matrix (MS-Lac) and gentamicin included as the transported antibiotic. The proposed target strategy was that exposed galactoses of MS-Lac could be specifically recognized by E. coli K88 adhesins, and the delivery of gentamicin would inhibit bacterial growth. Lactosylated microspheres (MS-Lac1, MS-Lac2 and MS-Lac3) were obtained using a water-in-oil emulsion, containing gentamicin, followed by crosslinking with different concentrations of glutaraldehyde. Electron microscopy displayed spherical particles with a mean size of 10-17 µm. In vitro release of gentamicin from MS-Lac was best fitted to a first order model, and the antibacterial activity of encapsulated and free gentamicin was comparable. MS-Lac treatments were recognized by plant galactose-specific lectins from Ricinus communis and Sophora japonica and by E. coli K88 adhesins. Results indicate MS-Lac1, produced with 4.2 mg/mL of crosslinker, as the best treatment and that lactosylated microsphere are promising platforms to obtain an active, targeted system against E. coli K88 infections. PMID:26389896

  1. K88 Fimbrial Adhesin Targeting of Microspheres Containing Gentamicin Made with Albumin Glycated with Lactose

    Sarabia-Sainz, Andre-i; Sarabia-Sainz, Hector Manuel; Ramos-Clamont Montfort, Gabriela; Mata-Haro, Veronica; Guzman-Partida, Ana María; Guzman, Roberto; Garcia-Soto, Mariano; Vazquez-Moreno, Luz

    2015-01-01

    The formulation and characterization of gentamicin-loaded microspheres as a delivery system targeting enterotoxigenic Escherichia coli K88 (E. coli K88) was investigated. Glycated albumin with lactose (BSA-glucose-β (4-1) galactose) was used as the microsphere matrix (MS-Lac) and gentamicin included as the transported antibiotic. The proposed target strategy was that exposed galactoses of MS-Lac could be specifically recognized by E. coli K88 adhesins, and the delivery of gentamicin would inhibit bacterial growth. Lactosylated microspheres (MS-Lac1, MS-Lac2 and MS-Lac3) were obtained using a water-in-oil emulsion, containing gentamicin, followed by crosslinking with different concentrations of glutaraldehyde. Electron microscopy displayed spherical particles with a mean size of 10–17 µm. In vitro release of gentamicin from MS-Lac was best fitted to a first order model, and the antibacterial activity of encapsulated and free gentamicin was comparable. MS-Lac treatments were recognized by plant galactose-specific lectins from Ricinus communis and Sophora japonica and by E. coli K88 adhesins. Results indicate MS-Lac1, produced with 4.2 mg/mL of crosslinker, as the best treatment and that lactosylated microsphere are promising platforms to obtain an active, targeted system against E. coli K88 infections. PMID:26389896

  2. Expression and functional identification of the hypothetical adhesin P32 from Mycoplasma genitalium

    LIN BO LI; YI MOU WU; WEN BO ZHANG; MIN JUN YU

    2006-01-01

    Mycoplasma genitalium is the main causative agent for non-gonococcal and non-chlamydial urethritis. P32 is the putative surface-exposed membrane protein of M. genitalium and it has substaintial identity in amino acid sequence with adhesin protein P30 from M. pneumoniae. Since M. pneumoniae mutants lacking P30 protein is defective in cytadherence, P32 protein has been proposed to be an essential adhesin implicated in the adherence of M. genitalium to host cells. The prokaryotic expression vector pET-30 ( + )/p32 was constructed in the present study, and the recombinant protein was expressed in E. coli and purified under denaturing condition. As demonstrated by the immunoblotting analysis, the recombinant protein could react with rabbit antisera against M. genitalium, and adherence inhibition assays were performed with antisera against this recombinant protein. It was demonstrated that P32 protein apperared to be an adhesion protein of M. genitalium, thus providing the experimental basis for better understanding of the pathogenesis of M. genitalium infection and for the development of the related vaccines against the infection.

  3. BigA is a novel adhesin of Brucella that mediates adhesion to epithelial cells.

    Czibener, Cecilia; Merwaiss, Fernando; Guaimas, Francisco; Del Giudice, Mariela Giselda; Serantes, Diego Armando Rey; Spera, Juan Manuel; Ugalde, Juan Esteban

    2016-04-01

    Adhesion to cells is the initial step in the infectious cycle of basically all pathogenic bacteria, and to do so, microorganisms have evolved surface molecules that target different cellular receptors. Brucella is an intracellular pathogen that infects a wide range of mammals whose virulence is completely dependent on the capacity to replicate in phagocytes. Although much has been done to elucidate how Brucella multiplies in macrophages, we still do not understand how bacteria invade epithelial cells to perform a replicative cycle or what adhesion molecules are involved in the process. We report the identification in Brucella abortus of a novel adhesin that harbours a bacterial immunoglobulin-like domain and demonstrate that this protein is involved in the adhesion to polarized epithelial cells such as the Caco-2 and Madin-Darby canine kidney models targeting the bacteria to the cell-cell interaction membrane. While deletion of the gene significantly reduced adhesion, over-expression dramatically increased it. Addition of the recombinant protein to cells induced cytoskeleton rearrangements and showed that this adhesin targets proteins of the cell-cell interaction membrane in confluent cultures. PMID:26400021

  4. K88 Fimbrial Adhesin Targeting of Microspheres Containing Gentamicin Made with Albumin Glycated with Lactose

    Andre-i Sarabia-Sainz

    2015-09-01

    Full Text Available The formulation and characterization of gentamicin-loaded microspheres as a delivery system targeting enterotoxigenic Escherichia coli K88 (E. coli K88 was investigated. Glycated albumin with lactose (BSA-glucose-β (4-1 galactose was used as the microsphere matrix (MS-Lac and gentamicin included as the transported antibiotic. The proposed target strategy was that exposed galactoses of MS-Lac could be specifically recognized by E. coli K88 adhesins, and the delivery of gentamicin would inhibit bacterial growth. Lactosylated microspheres (MS-Lac1, MS-Lac2 and MS-Lac3 were obtained using a water-in-oil emulsion, containing gentamicin, followed by crosslinking with different concentrations of glutaraldehyde. Electron microscopy displayed spherical particles with a mean size of 10–17 µm. In vitro release of gentamicin from MS-Lac was best fitted to a first order model, and the antibacterial activity of encapsulated and free gentamicin was comparable. MS-Lac treatments were recognized by plant galactose-specific lectins from Ricinus communis and Sophora japonica and by E. coli K88 adhesins. Results indicate MS-Lac1, produced with 4.2 mg/mL of crosslinker, as the best treatment and that lactosylated microsphere are promising platforms to obtain an active, targeted system against E. coli K88 infections.

  5. Neutralizing monoclonal antibody epitopes of the Entamoeba histolytica galactose adhesin map to the cysteine-rich extracellular domain of the 170-kilodalton subunit.

    Mann, B J; Chung, C Y; Dodson, J M; Ashley, L S; Braga, L L; Snodgrass, T L

    1993-01-01

    Entamoeba histolytica adheres to human colonic mucins and colonic epithelial cells via a galactose-binding adhesin. The adhesin is a heterodimeric glycoprotein composed of 170- and 35-kDa subunits. Fragments of the hgl1 gene encoding the 170-kDa subunit were expressed as recombinant fusion proteins in Escherichia coli and reacted with anti-adhesin monoclonal antibodies (MAbs) or pooled human immune sera. The MAbs tested recognize seven distinct epitopes on the 170-kDa subunit and have distinc...

  6. A sialoreceptor binding motif in the Mycoplasma synoviae adhesin VlhA.

    Meghan May

    Full Text Available Mycoplasma synoviae depends on its adhesin VlhA to mediate cytadherence to sialylated host cell receptors. Allelic variants of VlhA arise through recombination between an assemblage of promoterless vlhA pseudogenes and a single transcription promoter site, creating lineages of M. synoviae that each express a different vlhA allele. The predicted full-length VlhA sequences adjacent to the promoter of nine lineages of M. synoviae varying in avidity of cytadherence were aligned with that of the reference strain MS53 and with a 60-a.a. hemagglutinating VlhA C-terminal fragment from a Tunisian lineage of strain WVU1853(T. Seven different sequence variants of an imperfectly conserved, single-copy, 12-a.a. candidate cytadherence motif were evident amid the flanking variable residues of the 11 total sequences examined. The motif was predicted to adopt a short hairpin structure in a low-complexity region near the C-terminus of VlhA. Biotinylated synthetic oligopeptides representing four selected variants of the 12-a.a. motif, with the whole synthesized 60-a.a. fragment as a positive control, differed (P<0.01 in the extent they bound to chicken erythrocyte membranes. All bound to a greater extent (P<0.01 than scrambled or irrelevant VlhA domain negative control peptides did. Experimentally introduced branched-chain amino acid (BCAA substitutions Val3Ile and Leu7Ile did not significantly alter binding, whereas fold-destabilizing substitutions Thr4Gly and Ala9Gly tended to reduce it (P<0.05. Binding was also reduced to background levels (P<0.01 when the peptides were exposed to desialylated membranes, or were pre-saturated with free sialic acid before exposure to untreated membranes. From this evidence we conclude that the motif P-X-(BCAA-X-F-X-(BCAA-X-A-K-X-G binds sialic acid and likely mediates VlhA-dependent M. synoviae attachment to host cells. This conserved mechanism retains the potential for fine-scale rheostasis in binding avidity, which could be a

  7. Characterization of Helicobacter pylori adhesin thiol peroxidase (HP0390) purified from Escherichia coli

    Huyen Thi Minh Nguyen; Kwang-Ho Nam; Yasar Saleem; Key-Sun Kim

    2010-06-01

    The antioxidant protein, adhesin thiol peroxidase (HpTpx or HP0390), plays an important role in enabling Helicobacter pylori to survive gastric oxidative stress. The bacterium colonizes the host stomach and produces gastric cancer. However, little information is available about the biochemical characteristics of HpTpx. We expressed recombinant HpTpx in Escherichia coli, purified to homogeneity, and characterized it. The results showed that HpTpx existed in a monomeric hydrodynamic form and the enzyme fully retained its peroxidase and antioxidant activities. The catalytic reaction of the enzyme was similar to an atypical 2-cysteine peroxiredoxin (Prx). The conformation of the enzyme was observed in the presence and absence of dithiothreitol (DTT); similar to other known thiol peroxidases, conformational change was observed in HpTpx by the addition of DTT.

  8. FimH adhesin from host unrestricted Salmonella Enteritidis binds to different glycoprotein ligands expressed by enterocytes from sheep, pig and cattle than FimH adhesins from host restricted Salmonella Abortus-ovis, Salmonella Choleraesuis and Salmonella Dublin.

    Grzymajło, Krzysztof; Ugorski, Maciej; Kolenda, Rafał; Kędzierska, Anna; Kuźmińska-Bajor, Marta; Wieliczko, Alina

    2013-10-25

    Adhesion to gut tissues and colonization of the alimentary tract, two important stages in the pathogenesis of Salmonella, are mediated by FimH adhesin of type 1 fimbriae. It was suggested that minor differences in the structure of FimH are most likely associated with differences in adhesion specificities, and may determine the tropism of various Salmonella serovars to different species and tissues. We investigated this hypothesis by comparing the binding properties of FimH proteins from three Salmonella enterica serovars with limited (Choleraesuis, Dublin) or restricted (Abortusovis) host ranges to FimH from broad host range S. Enteritidis and mannose inactive FimH from S. Gallinarum. Although all active variants of FimH protein were able to bind mannose-rich glycoproteins (RNase B, HRP and Man-BSA) with comparable affinity measured by surface plasmon resonance, there were significant differences in the binding profiles of the FimH proteins from host restricted serovars and host unrestricted serovar Enteritidis, to glycoproteins from enterocyte cell lines established in vitro and derived from sheep, pig and cattle. When low-binding FimH adhesin from S. Enteritidis was subjected to Western blot analysis, it bound to surface membrane protein of about 130 kDa, and high-binding FimH adhesins from S. Abortusovis, S. Choleraesuis and S. Dublin bound to surface membrane protein of about 55 kDa present in each cell line. Differential binding of FimH proteins from host-restricted and broad-host-range Salmonella to intestinal receptors was confirmed using mutant FimH adhesins obtained by site-directed mutagenesis. It was found that the low-binding variant of FimH from S. Choleraesuis with mutation Leu57Pro lost the ability to bind protein band of 55 kDa, but instead interacted with glycoprotein of about 130 kDa. On the other hand, the high-binding variant of FimH adhesin from S. Enteritids with mutation Asn101Ser did not bind to its receptor of 130 kDa, but instead it

  9. Identification and characterization of a novel Plasmodium falciparum adhesin involved in erythrocyte invasion.

    Nidhi Hans

    Full Text Available Malaria remains a major health problem worldwide. All clinical symptoms of malaria are attributed to the asexual blood stages of the parasite life cycle. Proteins resident in apical organelles and present on the surface of P. falciparum merozoites are considered promising candidates for the development of blood stage malaria vaccines. In the present study, we have identified and characterized a microneme associated antigen, PfMA [PlasmoDB Gene ID: PF3D7_0316000, PFC0700c]. The gene was selected by applying a set of screening criteria such as transcriptional upregulation at late schizogony, inter-species conservation and the presence of signal sequence or transmembrane domains. The gene sequence of PfMA was found to be conserved amongst various Plasmodium species. We experimentally demonstrated that the transcript for PfMA was expressed only in the late blood stages of parasite consistent with a putative role in erythrocyte invasion. PfMA was localized by immunofluorescence and immuno-electron microscopy to be in the micronemes, an apical organelle of merozoites. The functional role of the PfMA protein in erythrocyte invasion was identified as a parasite adhesin involved in direct attachment with the target erythrocyte. PfMA was demonstrated to bind erythrocytes in a sialic acid independent, chymotrypsin and trypsin resistant manner and its antibodies inhibited P. falciparum erythrocyte invasion. Invasion of erythrocytes is a complex multistep process that involves a number of redundant ligand-receptor interactions many of which still remain unknown and even uncharacterized. Our work has identified and characterized a novel P. falciparum adhesin involved in erythrocyte invasion.

  10. Evolution of Salmonella enterica virulence via point mutations in the fimbrial adhesin.

    Dagmara I Kisiela

    Full Text Available Whereas the majority of pathogenic Salmonella serovars are capable of infecting many different animal species, typically producing a self-limited gastroenteritis, serovars with narrow host-specificity exhibit increased virulence and their infections frequently result in fatal systemic diseases. In our study, a genetic and functional analysis of the mannose-specific type 1 fimbrial adhesin FimH from a variety of serovars of Salmonella enterica revealed that specific mutant variants of FimH are common in host-adapted (systemically invasive serovars. We have found that while the low-binding shear-dependent phenotype of the adhesin is preserved in broad host-range (usually systemically non-invasive Salmonella, the majority of host-adapted serovars express FimH variants with one of two alternative phenotypes: a significantly increased binding to mannose (as in S. Typhi, S. Paratyphi C, S. Dublin and some isolates of S. Choleraesuis, or complete loss of the mannose-binding activity (as in S. Paratyphi B, S. Choleraesuis and S. Gallinarum. The functional diversification of FimH in host-adapted Salmonella results from recently acquired structural mutations. Many of the mutations are of a convergent nature indicative of strong positive selection. The high-binding phenotype of FimH that leads to increased bacterial adhesiveness to and invasiveness of epithelial cells and macrophages usually precedes acquisition of the non-binding phenotype. Collectively these observations suggest that activation or inactivation of mannose-specific adhesive properties in different systemically invasive serovars of Salmonella reflects their dynamic trajectories of adaptation to a life style in specific hosts. In conclusion, our study demonstrates that point mutations are the target of positive selection and, in addition to horizontal gene transfer and genome degradation events, can contribute to the differential pathoadaptive evolution of Salmonella.

  11. Identification and Characterization of a Novel Adhesin Unique to Oral Fusobacteria

    Han, Yiping W.; Ikegami, Akihiko; Rajanna, Chythanya; Kawsar, Hameem I.; Zhou, Yun; Li, Mei; Sojar, Hakimuddin T.; Genco, Robert J.; Kuramitsu, Howard K.; Deng, Cheri X.

    2005-01-01

    Fusobacterium nucleatum is a gram-negative anaerobe that is prevalent in periodontal disease and infections of different parts of the body. The organism has remarkable adherence properties, binding to partners ranging from eukaryotic and prokaryotic cells to extracellular macromolecules. Understanding its adherence is important for understanding the pathogenesis of F. nucleatum. In this study, a novel adhesin, FadA (Fusobacterium adhesin A), was demonstrated to bind to the surface proteins of the oral mucosal KB cells. FadA is composed of 129 amino acid (aa) residues, including an 18-aa signal peptide, with calculated molecular masses of 13.6 kDa for the intact form and 12.6 kDa for the secreted form. It is highly conserved among F. nucleatum, Fusobacterium periodonticum, and Fusobacterium simiae, the three most closely related oral species, but is absent in the nonoral species, including Fusobacterium gonidiaformans, Fusobacterium mortiferum, Fusobacterium naviforme, Fusobacterium russii, and Fusobacterium ulcerans. In addition to FadA, F. nucleatum ATCC 25586 and ATCC 49256 also encode two paralogues, FN1529 and FNV2159, each sharing 31% identity with FadA. A double-crossover fadA deletion mutant, F. nucleatum 12230-US1, was constructed by utilizing a novel sonoporation procedure. The mutant had a slightly slower growth rate, yet its binding to KB and Chinese hamster ovarian cells was reduced by 70 to 80% compared to that of the wild type, indicating that FadA plays an important role in fusobacterial colonization in the host. Furthermore, due to its uniqueness to oral Fusobacterium species, fadA may be used as a marker to detect orally related fusobacteria. F. nucleatum isolated from other parts of the body may originate from the oral cavity. PMID:16030227

  12. Re-evaluation of a bacterial antifreeze protein as an adhesin with ice-binding activity.

    Shuaiqi Guo

    Full Text Available A novel role for antifreeze proteins (AFPs may reside in an exceptionally large 1.5-MDa adhesin isolated from an Antarctic Gram-negative bacterium, Marinomonas primoryensis. MpAFP was purified from bacterial lysates by ice adsorption and gel electrophoresis. We have previously reported that two highly repetitive sequences, region II (RII and region IV (RIV, divide MpAFP into five distinct regions, all of which require mM Ca(2+ levels for correct folding. Also, the antifreeze activity is confined to the 322-residue RIV, which forms a Ca(2+-bound beta-helix containing thirteen Repeats-In-Toxin (RTX-like repeats. RII accounts for approximately 90% of the mass of MpAFP and is made up of ∼120 tandem 104-residue repeats. Because these repeats are identical in DNA sequence, their number was estimated here by pulsed-field gel electrophoresis. Structural homology analysis by the Protein Homology/analogY Recognition Engine (Phyre2 server indicates that the 104-residue RII repeat adopts an immunoglobulin beta-sandwich fold that is typical of many secreted adhesion proteins. Additional RTX-like repeats in RV may serve as a non-cleavable signal sequence for the type I secretion pathway. Immunodetection shows both repeated regions are uniformly distributed over the cell surface. We suggest that the development of an AFP-like domain within this adhesin attached to the bacterial outer surface serves to transiently bind the host bacteria to ice. This association would keep the bacteria within the upper reaches of the water column where oxygen and nutrients are potentially more abundant. This novel envirotactic role would give AFPs a third function, after freeze avoidance and freeze tolerance: that of transiently binding an organism to ice.

  13. Competitive inhibition of adherence of enterotoxigenic Escherichia coli,enteropathogenic Escherichia coli and Clostridium difficile to intestinal epithelial cell line Lovo by purified adhesin of Bifidobacterium adolescentis 1027

    Shi-Shun Zhong; Zhen-Shu Zhang; Ji-De Wang; Zhuo-Sheng Lai; Qun-Ying Wang; Ling-Jia Pan; Yue-Xin Ren

    2004-01-01

    AIM: To observe competitive inhibition of adherence of enterotoxigenic Escherichia coli(ETEC), enteropathogenic Escherichia coli(EPEC) and Clostridium difficile ( C. difficile)to intestinal epithelial cell line Lovo by purified adhesin of Bifidobacterium adolescentis 1027 (B. ado 1027).METHODS: The binding of bacteria to intestinal epithelial cell line Lovo was counted by adhesion assay. The inhibition of adherence of ETEC, EPEC and C. difficile to intestinal epithelial cell line Lovo by purified adhesin of B. ado 1027was evaluated quantitatively by flow cytometry.RESULTS: The purified adhesin at the concentration of 10μg/mL, 20μg/mL and 30μg/mL except at 1μg/mL and 5μg/mL could inhibit significantly the adhesion of ETEC,EPEC and C. difficile to intestinal epithelial cell line Lovo.Moreover, we observed that a reduction in bacterial adhesion was occurred with increase in the concentration of adhesin,and MFI (Mean fluorescent intensity) was decreased with increase in the concentration of adhesin.CONCLUSION: The purified adhesin of B. ado 1027 can inhibit the adhesion of ETEC, EPEC and C. difficile to intestinal epithelial cell line Lovo in a dose-dependent manner.

  14. BslA, the S-layer adhesin of B. anthracis, is a virulence factor for anthrax pathogenesis

    Kern, Justin; Schneewind, Olaf

    2009-01-01

    Microbial pathogens use adhesive surface proteins to bind to and interact with host tissues, events that are universal for the pathogenesis of infectious diseases. A surface adhesin of Bacillus anthracis, the causative agent of anthrax, required to mediate these steps has not been discovered. Previous work identified BslA, an S-layer protein, to be necessary and sufficient for adhesion of the anthrax vaccine strain, Bacillus anthracis Sterne, to host cells. Here we asked whether encapsulated ...

  15. Cloning and characterization of the S fimbrial adhesin II complex of an Escherichia coli O18:K1 meningitis isolate.

    Hacker, J; Kestler, H; Hoschützky, H; Jann, K; Lottspeich, F; Korhonen, T K

    1993-01-01

    S fimbrial adhesins (Sfa), which are able to recognize sialic acid-containing receptors on eukaryotic cells, are produced by Escherichia coli strains causing urinary tract infections or newborn meningitis. We recently described the cloning and molecular characterization of a determinant, termed sfaI, from the chromosome of an E. coli urinary tract infection strain. Here we present data concerning a S fimbria-specific gene cluster, designated sfaII, of an E. coli newborn meningitis strain. Lik...

  16. Comparison of the Common Adhesin Coding Operons Distribution in Uropathogenic and Phylogenetic Group B2 and A Escherichia coli Isolates

    Rahdar; Rashki; Miri

    2014-01-01

    Background Escherichia coli is one of the most causative pathogen of urinary tract infection. Urinary tract infections (UTIs) are the second most common cause of morbidity and remain a serious health concern among the clinicians. The severity of UTI caused by uropathogenic E. coli (UPEC) is due to the expression of a wide spectrum of virulent factors such as adhesin coding operons. Little is known about the relationship between the E. coli genetic background and the acquisition o...

  17. An Acinetobacter trimeric autotransporter adhesin reaped from cells exhibits its nonspecific stickiness via a highly stable 3D structure

    Shogo Yoshimoto; Hajime Nakatani; Keita Iwasaki; Katsutoshi Hori

    2016-01-01

    Trimeric autotransporter adhesins (TAAs), cell surface proteins of Gram-negative bacteria, mediate bacterial adhesion to host cells and extracellular matrix proteins. However, AtaA, a TAA in the nonpathogenic Acinetobacter sp. strain Tol 5, shows nonspecific, high adhesiveness to abiotic material surfaces as well as to biotic surfaces. AtaA is a homotrimer of polypeptides comprising 3,630 amino acids and forms long nanofibers; therefore, it is too large and structurally complex to be produced...

  18. Identification of Polymorphonuclear Leukocyte and HL-60 Cell Receptors for Adhesins of Streptococcus gordonii and Actinomyces naeslundii

    Ruhl, Stefan; Cisar, John O.; Sandberg, Ann L.

    2000-01-01

    Interactions of oral streptococci and actinomyces with polymorphonuclear leukocytes (PMNs), mediated by sialic acid- and Gal/GalNAc-reactive adhesins, respectively, result in activation of the PMNs and thereby may contribute to the initiation of oral inflammation. Sialidase treatment of PMNs or HL-60 cells abolished adhesion of Streptococcus gordonii but was required for adhesion of Actinomyces naeslundii. The same effects of sialidase were noted for adhesion of these bacteria to a major 150-...

  19. Heterologous Expression of the Treponema pallidum Laminin-Binding Adhesin Tp0751 in the Culturable Spirochete Treponema phagedenis▿

    Cameron, Caroline E.; Kuroiwa, Janelle M. Y.; Yamada, Mitsunori; Francescutti, Teresa; Chi, Bo; Kuramitsu, Howard K.

    2008-01-01

    Treponema pallidum subsp. pallidum, the causative agent of syphilis, is an unculturable, genetically intractable bacterium. Here we report the use of the shuttle vector pKMR4PEMCS for the expression of a previously identified T. pallidum laminin-binding adhesin, Tp0751, in the nonadherent, culturable spirochete Treponema phagedenis. Heterologous expression of Tp0751 in T. phagedenis was confirmed via reverse transcriptase PCR analysis with tp0751 gene-specific primers and immunofluorescence a...

  20. Identification of Burkholderia mallei and Burkholderia pseudomallei adhesins for human respiratory epithelial cells

    Hogan Robert J

    2010-09-01

    Full Text Available Abstract Background Burkholderia pseudomallei and Burkholderia mallei cause the diseases melioidosis and glanders, respectively. A well-studied aspect of pathogenesis by these closely-related bacteria is their ability to invade and multiply within eukaryotic cells. In contrast, the means by which B. pseudomallei and B. mallei adhere to cells are poorly defined. The purpose of this study was to identify adherence factors expressed by these organisms. Results Comparative sequence analyses identified a gene product in the published genome of B. mallei strain ATCC23344 (locus # BMAA0649 that resembles the well-characterized Yersinia enterocolitica autotransporter adhesin YadA. The gene encoding this B. mallei protein, designated boaA, was expressed in Escherichia coli and shown to significantly increase adherence to human epithelial cell lines, specifically HEp2 (laryngeal cells and A549 (type II pneumocytes, as well as to cultures of normal human bronchial epithelium (NHBE. Consistent with these findings, disruption of the boaA gene in B. mallei ATCC23344 reduced adherence to all three cell types by ~50%. The genomes of the B. pseudomallei strains K96243 and DD503 were also found to contain boaA and inactivation of the gene in DD503 considerably decreased binding to monolayers of HEp2 and A549 cells and to NHBE cultures. A second YadA-like gene product highly similar to BoaA (65% identity was identified in the published genomic sequence of B. pseudomallei strain K96243 (locus # BPSL1705. The gene specifying this protein, termed boaB, appears to be B. pseudomallei-specific. Quantitative attachment assays demonstrated that recombinant E. coli expressing BoaB displayed greater binding to A549 pneumocytes, HEp2 cells and NHBE cultures. Moreover, a boaB mutant of B. pseudomallei DD503 showed decreased adherence to these respiratory cells. Additionally, a B. pseudomallei strain lacking expression of both boaA and boaB was impaired in its ability to

  1. Dependence of Bacterial Protein Adhesins on Toll-Like Receptors for Proinflammatory Cytokine Induction

    Hajishengallis, George; Martin, Michael; Sojar, Hakimuddin T.; Sharma, Ashu; Schifferle, Robert E.; DeNardin, Ernesto; Russell, Michael W.; Genco, Robert J.

    2002-01-01

    Toll-like receptors (TLRs) are important signal transducers that mediate inflammatory reactions induced by microbes through pattern recognition of virulence molecules such as lipopolysaccharide (LPS) and lipoproteins. We investigated whether proinflammatory cytokine responses induced by certain bacterial protein adhesins may also depend on TLRs. In differentiated THP-1 mononuclear cells stimulated by LPS-free recombinant fimbrillin (rFimA) from Porphyromonas gingivalis, cytokine release was abrogated by monoclonal antibodies (MAbs) to CD14 and TLR4 but not to TLR2. Similar experiments using anti-β2 integrin MAbs suggested that β2 integrins (CD11/CD18) also play a role in cytokine induction by rFimA or native fimbriae. Minor fimbriae (distinct from the fimA-encoded major fimbriae) of P. gingivalis induced proinflammatory cytokine release in a CD14- and TLR2-dependent mode. Cytokine induction by BspA, a leucine-rich repeat protein from Bacteroides forsythus, depended heavily on CD14 and TLR2. We also found that the ability of the streptococcal protein AgI/II to stimulate cytokine release depended partially on CD14 and TLR4, and the AgI/II segment that possibly interacts with these receptors was identified as its N-terminal saliva-binding region. When THP-1 cells were exposed to rFimA for 24 h, surface expression of CD14 and CD18 was decreased and the cells became hyporesponsive to cytokine induction by a second challenge with rFimA. However, tolerance induction was abolished when the THP-1 cells were pretreated with rFimA in the presence of either anti-CD14 MAb or anti-TLR4 MAb. Induction of cross-tolerance between rFimA and LPS correlated with downregulation of the pattern recognition receptors involved. Our data suggest that the CD14-TLR2/4 system is involved in cytokine production and tolerance induction upon interaction with certain proinflammatory bacterial protein adhesins. PMID:11874886

  2. Investigation of anti-WI-1 adhesin antibody-mediated protection in experimental pulmonary blastomycosis.

    Wüthrich, M; Klein, B S

    2000-05-01

    Infection with Blastomyces dermatitidis elicits strong antibody responses to the surface adhesin WI-1. The antibodies are directed chiefly against the adhesive domain, a 25-amino-acid repeat. Tandem-repeat-specific monoclonal antibodies (mAbs) were studied for their opsonic activity in vitro and their capacity to adoptively transfer protection in murine experimental blastomycosis. mAbs to WI-1 enhanced binding and entry of B. dermatitidis yeasts into J774. 16 cells but did not enhance killing or growth inhibition of the yeast. Passive transfer of 8 mAbs to WI-1 into 3 different inbred strains of mice also did not improve the course of experimental infection and sometimes worsened it. mu-deficient mice were more resistant to experimental blastomycosis than were intact littermates, and passive transfer of the mAbs into these mice did not protect them against experimental infection. Thus, antibody to WI-1 does not appear to improve the outcome of murine blastomycosis and may enhance the infection. PMID:10823774

  3. Essential roles and regulation of the Legionella pneumophila collagen-like adhesin during biofilm formation.

    Julia Mallegol

    Full Text Available Legionellosis is mostly caused by Legionella pneumophila (Lp and is defined by a severe respiratory illness with a case fatality rate ranging from 5 to 80%. In a previous study, we showed that a glycosaminoglycan (GAG-binding adhesin of Lp, named Lcl, is produced during legionellosis and is unique to the L. pneumophila species. Importantly, a mutant depleted in Lcl (Δlpg2644 is impaired in adhesion to GAGs and epithelial cells and in biofilm formation. Here, we examine the molecular function(s of Lcl and the transcriptional regulation of its encoding gene during different stages of the biofilm development. We show that the collagen repeats and the C-terminal domains of Lcl are crucial for the production of biofilm. We present evidence that Lcl is involved in the early step of surface attachment but also in intercellular interactions. Furthermore, we address the relationship between Lcl gene regulation during biofilm formation and quorum sensing (QS. In a static biofilm assay, we show that Lcl is differentially regulated during growth phases and biofilm formation. Moreover, we show that the transcriptional regulation of lpg2644, mediated by a prototype of QS signaling homoserine lactone (3OC12-HSL, may play a role during the biofilm development. Thus, transcriptional down-regulation of lpg2644 may facilitate the dispersion of Lp to reinitiate biofilm colonization on a distal surface.

  4. Essential roles and regulation of the Legionella pneumophila collagen-like adhesin during biofilm formation.

    Mallegol, Julia; Duncan, Carla; Prashar, Akriti; So, Jannice; Low, Donald E; Terebeznik, Mauricio; Guyard, Cyril

    2012-01-01

    Legionellosis is mostly caused by Legionella pneumophila (Lp) and is defined by a severe respiratory illness with a case fatality rate ranging from 5 to 80%. In a previous study, we showed that a glycosaminoglycan (GAG)-binding adhesin of Lp, named Lcl, is produced during legionellosis and is unique to the L. pneumophila species. Importantly, a mutant depleted in Lcl (Δlpg2644) is impaired in adhesion to GAGs and epithelial cells and in biofilm formation. Here, we examine the molecular function(s) of Lcl and the transcriptional regulation of its encoding gene during different stages of the biofilm development. We show that the collagen repeats and the C-terminal domains of Lcl are crucial for the production of biofilm. We present evidence that Lcl is involved in the early step of surface attachment but also in intercellular interactions. Furthermore, we address the relationship between Lcl gene regulation during biofilm formation and quorum sensing (QS). In a static biofilm assay, we show that Lcl is differentially regulated during growth phases and biofilm formation. Moreover, we show that the transcriptional regulation of lpg2644, mediated by a prototype of QS signaling homoserine lactone (3OC12-HSL), may play a role during the biofilm development. Thus, transcriptional down-regulation of lpg2644 may facilitate the dispersion of Lp to reinitiate biofilm colonization on a distal surface. PMID:23029523

  5. Specificity of Campylobacter jejuni Adhesin PEB3 for Phosphates and Structural Differences among Its Ligand Complexes

    Min, Tongpil; Vedadi, Masoud; Watson, David C.; Wasney, Gregory A.; Munger, Christine; Cygler, Miroslaw; Matte, Allan; Young, N. Martin; (NRCC); (McGill); (Toronto)

    2009-04-22

    PEB3 is a glycoprotein adhesin from Campylobacter jejuni whose structure suggested a role in transport. We have investigated potential ligands for PEB3 and characterized their binding properties using biophysical methods in solution and by X-ray crystallography. A thermal aggregation assay of PEB3 with a library of physiological compounds identified three possible ligands [3-phosphoglycerate (3-PG), phosphoenolpyruvate (PEP), and aconitate], which stabilized wild-type PEB3 but did not stabilize either a PEB3 form containing two mutations at the ligand-binding site, T138A/S139A, or a second PEB3 mutant, K135E, at a site {approx}14 {angstrom} away. Fluorescence titration experiments and cocrystal structures with various ligands were used to characterize the binding of 3-PG, PEP, and phosphate to PEB3. Further, a C. jejuni growth experiment in minimal medium supplemented with 3-PG showed that this molecule enhances the growth of wild-type C. jejuni, but not of the PEB3 mutants. Crystallographic analysis of PEB3 complexes revealed that the Ser171-Gln180 region in the presence of 3-PG or other phosphates is helical and similar to those of other transport proteins, but it is nonhelical when citrate is bound. The K135E mutation resulted in expression of a more highly glycosylated form of PEB3 in vivo, and its crystal structure showed the conformation of the first two residues of the glycan. On the basis of our findings, we suggest that PEB3 is a transport protein that may function in utilization of 3-PG or other phosphate-containing molecules from the host.

  6. Infection by Helicobacter pylori expressing the BabA adhesin is influenced by the secretor phenotype.

    Azevedo, M; Eriksson, S; Mendes, N; Serpa, J; Figueiredo, C; Resende, L P; Ruvoën-Clouet, N; Haas, R; Borén, T; Le Pendu, J; David, L

    2008-07-01

    Helicobacter pylori (Hp) infects half the world's population and causes diverse gastric lesions, from gastritis to gastric cancer. Our aim was to evaluate the significance of secretor and Lewis status in infection and in vitro adherence by Hp expressing BabA adhesin. We enrolled 304 Hp-infected individuals from Northern Portugal. Gastric biopsies, blood and saliva were collected. Polymerase chain reaction (PCR) and immunofluorescence were used to detect BabA+ Hp in gastric biopsies. In vitro adherence by a BabA expressing Hp strain to gastric biopsies was performed. Secretor status was identified by Ulex, a lectin that recognizes secretor-dependent glycan structures in saliva and in gastric mucosa, and by Lewis(a/b) antibodies, and indirectly by identification of an inactivating mutation in the FUT2 gene (G428A). BabA status of infecting Hp was associated with CagA and VacAs1 (p < 0.05), intercellular localization of Hp (p < 0.01) and the presence of intestinal metaplasia (p < 0.05) and degenerative alterations (p < 0.005) in the biopsies. BabA was associated (p < 0.05) with Ulex staining of gastric biopsies and, although not significantly, to absence of homozygosity for FUT2 G428A inactivating polymorphism. In vitro Hp adherence was higher in cases wild-type or heterozygous for FUT2 G428A mutation (p < 0.0001), cases staining for Ulex (p < 0.0001) and a(-)b+ and a(-)b(-) secretor phenotypes (p < 0.001). In conclusion, BabA+ Hp infection/adhesion is secretor-dependent and associated with the severity of gastric lesions. PMID:18498114

  7. Evaluation of the role of Mycobacterium tuberculosis pili (MTP) as an adhesin, invasin, and cytokine inducer of epithelial cells

    Saiyur Ramsugit; Balakrishna Pillay; Manormoney Pillay

    2016-01-01

    Abstract This study was undertaken in order to assess the involvement of Mycobacterium tuberculosis pili (MTP) as an adhesin, invasin, and cytokine inducer in the M. tuberculosis-epithelial cell interaction. A MTP-deficient strain of M. tuberculosis demonstrated a significant reduction of 69.39% (p = 0.047) and 56.20% (p = 0.033) in its ability to adhere to and invade A549 pulmonary epithelial cells, respectively, in comparison with the wild-type strain. Complementation of the MTP-deficient m...

  8. Upregulation of the Adhesin Gene EPA1 Mediated by PDR1 in Candida glabrata Leads to Enhanced Host Colonization.

    Vale-Silva, Luis A; Moeckli, Beat; Torelli, Riccardo; Posteraro, Brunella; Sanguinetti, Maurizio; Sanglard, Dominique

    2016-01-01

    Candida glabrata is the second most common Candida species causing disseminated infection, after C. albicans. C. glabrata is intrinsically less susceptible to the widely used azole antifungal drugs and quickly develops secondary resistance. Resistance typically relies on drug efflux with transporters regulated by the transcription factor Pdr1. Gain-of-function (GOF) mutations in PDR1 lead to a hyperactive state and thus efflux transporter upregulation. Our laboratory has characterized a collection of C. glabrata clinical isolates in which azole resistance was found to correlate with increased virulence in vivo. Contributing phenotypes were the evasion of adhesion and phagocytosis by macrophages and an increased adhesion to epithelial cells. These phenotypes were found to be dependent on PDR1 GOF mutation and/or C. glabrata strain background. In the search for the molecular effectors, we found that PDR1 hyperactivity leads to overexpression of specific cell wall adhesins of C. glabrata. Further study revealed that EPA1 regulation, in particular, explained the increase in adherence to epithelial cells. Deleting EPA1 eliminates the increase in adherence in an in vitro model of interaction with epithelial cells. In a murine model of urinary tract infection, PDR1 hyperactivity conferred increased ability to colonize the bladder and kidneys in an EPA1-dependent way. In conclusion, this study establishes a relationship between PDR1 and the regulation of cell wall adhesins, an important virulence attribute of C. glabrata. Furthermore, our data show that PDR1 hyperactivity mediates increased adherence to host epithelial tissues both in vitro and in vivo through upregulation of the adhesin gene EPA1. IMPORTANCE Candida glabrata is an important fungal pathogen in human diseases and is also rapidly acquiring drug resistance. Drug resistance can be mediated by the transcriptional activator PDR1, and this results in the upregulation of multidrug transporters. Intriguingly

  9. Novel Molecular Variants of Allele I of the Escherichia coli P Fimbrial Adhesin Gene papG

    Johnson, James R.; Stell, Adam L.; Kaster, Nicholas; Fasching, Claudine; O'Bryan, Timothy T.

    2002-01-01

    P fimbriae of extraintestinal pathogenic Escherichia coli mediate digalactoside-specific adherence via the tip adhesin molecule PapG, which occurs in three known variants (I to III), which are encoded by the corresponding three alleles of papG. In the present study, newly discovered variants of papG allele I and the respective wild-type source strains were characterized. One of the new papG allele I variants conferred a unique agglutination phenotype that combined the phenotypes associated wi...

  10. Evaluation of the role of Mycobacterium tuberculosis pili (MTP) as an adhesin, invasin, and cytokine inducer of epithelial cells.

    Ramsugit, Saiyur; Pillay, Balakrishna; Pillay, Manormoney

    2016-01-01

    This study was undertaken in order to assess the involvement of Mycobacterium tuberculosis pili (MTP) as an adhesin, invasin, and cytokine inducer in the M. tuberculosis-epithelial cell interaction. A MTP-deficient strain of M. tuberculosis demonstrated a significant reduction of 69.39% (p=0.047) and 56.20% (p=0.033) in its ability to adhere to and invade A549 pulmonary epithelial cells, respectively, in comparison with the wild-type strain. Complementation of the MTP-deficient mutant restored its adhesion and invasion capacity back to the wild-type levels. Overall, it was found that similar concentrations of IL-1β, IL-4, IL-6, IL-8, G-CSF, IFN-γ, MCP-1, and TNF-α were induced in A549 cells infected with the MTP-proficient and MTP-deficient strains. However, at 48h post-infection, the MTP-deficient mutant induced significantly lower levels of TNF-α than the wild-type strain (p=0.033). Furthermore, at 72h post-infection, the mutant induced significantly higher levels of IL-8 than the wild-type (p=0.005). We conclude that MTP is an adhesin/invasin of epithelial cells and, while playing a role in M. tuberculosis entry, they do not appear to largely influence the epithelial cell cytokine response. PMID:26748229

  11. Structures of C-mannosylated anti-adhesives bound to the type 1 fimbrial FimH adhesin

    Jerome de Ruyck

    2016-05-01

    Full Text Available Selective inhibitors of the type 1 fimbrial adhesin FimH are recognized as attractive alternatives for antibiotic therapies and prophylaxes against Escherichia coli infections such as urinary-tract infections. To construct these inhibitors, the α-d-mannopyranoside of high-mannose N-glycans, recognized with exclusive specificity on glycoprotein receptors by FimH, forms the basal structure. A hydrophobic aglycon is then linked to the mannose by the O1 oxygen inherently present in the α-anomeric configuration. Substitution of this O atom by a carbon introduces a C-glycosidic bond, which may enhance the therapeutic potential of such compounds owing to the inability of enzymes to degrade C-glycosidic bonds. Here, the first crystal structures of the E. coli FimH adhesin in complex with C-glycosidically linked mannopyranosides are presented. These findings explain the role of the spacer in positioning biphenyl ligands for interactions by means of aromatic stacking in the tyrosine gate of FimH and how the normally hydrated C-glycosidic link is tolerated. As these new compounds can bind FimH, it can be assumed that they have the potential to serve as potent new antagonists of FimH, paving the way for the design of a new family of anti-adhesive compounds against urinary-tract infections.

  12. [Role of Bacterial Adhesin RAPA1 in Formation of Efficient Symbiosis of Rhizobium leguminosarum with Bean Plants].

    Nigmatullina, L R; Lavina, A M; Vershinina, Z R; Baimiev, Al Kh

    2015-01-01

    Bacterial adhesins, the proteins responsible for attachment of plant growth-promoting rhizobacteria to plant roots, are involved in formation of stable associative symbioses. In the present work enhanced expression of the rapA1 adhesin gene in Rhizobium leguminosarum PVu5 was shown to improve the efficiency of nodulation on bean roots inoculated with the modified strain. The rapA1 gene was cloned into the pJN105Turbo plasmid, this construct was used for transformation of R. leguminosarum PVu5, bean plants were inoculated by this transgenic strain, and efficiency of root nodule formation was determined. In the plants treated with rapA1-transgenic rhizobia, the number of root nodules was on average two times higher than in the plants inoculated with the original strain. Aggregation of R. leguminosarum was achieved when the rapA1 gene expression was enhanced either in rhizobia or in the co-cultured modified strain E. coli pJN105TurboRapA1. PMID:26964360

  13. Endocytosis-inducer adhesins produced by enteropathogenic serogroups of Escherichia coli participate on bacterial attachment to infant enterocytes

    João Ramos Costa Andrade

    1987-03-01

    Full Text Available Enteropathogenic E. coli (EPEC infection of Hep-2 cells preoceeds through bacterial attachment to cell surface and internalization of adhered bacteria. EPEC attachment is a prerequisite for cell infection and is mediated by adhesins that recognize carbohydrate-containing receptors on cell membrane. Such endocytosis-inducer adhesins (EIA also promote EPEC binding to infant enterocytes, suggesting that EIA may have an important role on EPEC gastroenteritis.A infecção de células Hep-2 por E. coli enteropatogênicas (ECEP implica na aderência bacteriana e posterior interiorização dos microrganismos aderidos por um mecanismo de endocitose. A aderência das ECEP é pré-requisito para a infecção e é mediada por adesinas que reconhecem receptores inibidos por certas oses na membrana celular. Tais "adesinas indutoras da endocitose" (AIE também promovem a ligação bacteriana a enterócitos obtidos do intestino delgado de lactente, sugerindo que as AIE possam desempenhar algum papel nas diarréias causadas por ECEP.

  14. Nanowire Arrays as Cell Force Sensors To Investigate Adhesin-Enhanced Holdfast of Single Cell Bacteria and Biofilm Stability.

    Sahoo, Prasana K; Janissen, Richard; Monteiro, Moniellen P; Cavalli, Alessandro; Murillo, Duber M; Merfa, Marcus V; Cesar, Carlos L; Carvalho, Hernandes F; de Souza, Alessandra A; Bakkers, Erik P A M; Cotta, Monica A

    2016-07-13

    Surface attachment of a planktonic bacteria, mediated by adhesins and extracellular polymeric substances (EPS), is a crucial step for biofilm formation. Some pathogens can modulate cell adhesiveness, impacting host colonization and virulence. A framework able to quantify cell-surface interaction forces and their dependence on chemical surface composition may unveil adhesiveness control mechanisms as new targets for intervention and disease control. Here we employed InP nanowire arrays to dissect factors involved in the early stage biofilm formation of the phytopathogen Xylella fastidiosa. Ex vivo experiments demonstrate single-cell adhesion forces up to 45 nN, depending on the cell orientation with respect to the surface. Larger adhesion forces occur at the cell poles; secreted EPS layers and filaments provide additional mechanical support. Significant adhesion force enhancements were observed for single cells anchoring a biofilm and particularly on XadA1 adhesin-coated surfaces, evidencing molecular mechanisms developed by bacterial pathogens to create a stronger holdfast to specific host tissues. PMID:27336224

  15. Exploiting chimeric human antibodies to characterize a protective epitope of Neisseria adhesin A, one of the Bexsero vaccine components.

    Bertoldi, Isabella; Faleri, Agnese; Galli, Barbara; Lo Surdo, Paola; Liguori, Alessia; Norais, Nathalie; Santini, Laura; Masignani, Vega; Pizza, Mariagrazia; Giuliani, Marzia Monica

    2016-01-01

    Neisseria adhesin A (NadA) is one of the antigens of Bexsero, the recently licensed multicomponent vaccine against serogroup B Neisseria meningitidis (MenB). NadA belongs to the class of oligomeric coiled-coil adhesins and is able to mediate adhesion and invasion of human epithelial cells. As a vaccine antigen, NadA has been shown to induce high levels of bactericidal antibodies; however, the domains important for protective response are still unknown. In order to further investigate its immunogenic properties, we have characterized the murine IgG1 mAb (6E3) that was able to recognize the 2 main antigenic variants of NadA on the surface of MenB strains. The epitope targeted by mAb 6E3 was mapped by hydrogen-deuterium exchange mass spectrometry and shown to be located on the coiled-coil stalk region of NadA (aa 206-249). Although no serum bactericidal activity was observed for murine IgG1 mAb 6E3, functional activity was restored when using chimeric antibodies in which the variable regions of the murine mAb 6E3 were fused to human IgG3 constant regions, thus confirming the protective nature of the mAb 6E3 epitope. The use of chimeric antibody molecules will enable future investigations of complement-mediated antibody functionality independently of the Fc-mediated differences in complement activation. PMID:26304221

  16. Structures of C-mannosylated anti-adhesives bound to the type 1 fimbrial FimH adhesin.

    de Ruyck, Jerome; Lensink, Marc F; Bouckaert, Julie

    2016-05-01

    Selective inhibitors of the type 1 fimbrial adhesin FimH are recognized as attractive alternatives for antibiotic therapies and prophylaxes against Escherichia coli infections such as urinary-tract infections. To construct these inhibitors, the α-d-mannopyranoside of high-mannose N-glycans, recognized with exclusive specificity on glycoprotein receptors by FimH, forms the basal structure. A hydrophobic aglycon is then linked to the mannose by the O1 oxygen inherently present in the α-anomeric configuration. Substitution of this O atom by a carbon introduces a C-glycosidic bond, which may enhance the therapeutic potential of such compounds owing to the inability of enzymes to degrade C-glycosidic bonds. Here, the first crystal structures of the E. coli FimH adhesin in complex with C-glycosidically linked mannopyranosides are presented. These findings explain the role of the spacer in positioning biphenyl ligands for interactions by means of aromatic stacking in the tyrosine gate of FimH and how the normally hydrated C-glycosidic link is tolerated. As these new compounds can bind FimH, it can be assumed that they have the potential to serve as potent new antagonists of FimH, paving the way for the design of a new family of anti-adhesive compounds against urinary-tract infections. PMID:27158502

  17. Oral streptococci utilize a Siglec-like domain of serine-rich repeat adhesins to preferentially target platelet sialoglycans in human blood.

    Lingquan Deng

    2014-12-01

    Full Text Available Damaged cardiac valves attract blood-borne bacteria, and infective endocarditis is often caused by viridans group streptococci. While such bacteria use multiple adhesins to maintain their normal oral commensal state, recognition of platelet sialoglycans provides an intermediary for binding to damaged valvular endocardium. We use a customized sialoglycan microarray to explore the varied binding properties of phylogenetically related serine-rich repeat adhesins, the GspB, Hsa, and SrpA homologs from Streptococcus gordonii and Streptococcus sanguinis species, which belong to a highly conserved family of glycoproteins that contribute to virulence for a broad range of Gram-positive pathogens. Binding profiles of recombinant soluble homologs containing novel sialic acid-recognizing Siglec-like domains correlate well with binding of corresponding whole bacteria to arrays. These bacteria show multiple modes of glycan, protein, or divalent cation-dependent binding to synthetic glycoconjugates and isolated glycoproteins in vitro. However, endogenous asialoglycan-recognizing clearance receptors are known to ensure that only fully sialylated glycans dominate in the endovascular system, wherein we find these particular streptococci become primarily dependent on their Siglec-like adhesins for glycan-mediated recognition events. Remarkably, despite an excess of alternate sialoglycan ligands in cellular and soluble blood components, these adhesins selectively target intact bacteria to sialylated ligands on platelets, within human whole blood. These preferred interactions are inhibited by corresponding recombinant soluble adhesins, which also preferentially recognize platelets. Our data indicate that circulating platelets may act as inadvertent Trojan horse carriers of oral streptococci to the site of damaged endocardium, and provide an explanation why it is that among innumerable microbes that gain occasional access to the bloodstream, certain viridans group

  18. A Structural Model for Binding of the Serine-Rich Repeat Adhesin GspB to Host Carbohydrate Receptors

    Pyburn, Tasia M.; Bensing, Barbara A.; Xiong, Yan Q.; Melancon, Bruce J.; Tomasiak, Thomas M.; Ward, Nicholas J.; Yankovskaya, Victoria; Oliver, Kevin M.; Cecchini, Gary; Sulikowski, Gary A.; Tyska, Matthew J.; Sullam, Paul M.; Iverson, T.M. (VA); (UCLA); (Vanderbilt); (UCSF)

    2014-10-02

    GspB is a serine-rich repeat (SRR) adhesin of Streptococcus gordonii that mediates binding of this organism to human platelets via its interaction with sialyl-T antigen on the receptor GPIb{alpha}. This interaction appears to be a major virulence determinant in the pathogenesis of infective endocarditis. To address the mechanism by which GspB recognizes its carbohydrate ligand, we determined the high-resolution x-ray crystal structure of the GspB binding region (GspB{sub BR}), both alone and in complex with a disaccharide precursor to sialyl-T antigen. Analysis of the GspB{sub BR} structure revealed that it is comprised of three independently folded subdomains or modules: (1) an Ig-fold resembling a CnaA domain from prokaryotic pathogens; (2) a second Ig-fold resembling the binding region of mammalian Siglecs; (3) a subdomain of unique fold. The disaccharide was found to bind in a pocket within the Siglec subdomain, but at a site distinct from that observed in mammalian Siglecs. Confirming the biological relevance of this binding pocket, we produced three isogenic variants of S. gordonii, each containing a single point mutation of a residue lining this binding pocket. These variants have reduced binding to carbohydrates of GPIb{alpha}. Further examination of purified GspB{sub BR}-R484E showed reduced binding to sialyl-T antigen while S. gordonii harboring this mutation did not efficiently bind platelets and showed a significant reduction in virulence, as measured by an animal model of endocarditis. Analysis of other SRR proteins revealed that the predicted binding regions of these adhesins also had a modular organization, with those known to bind carbohydrate receptors having modules homologous to the Siglec and Unique subdomains of GspBBR. This suggests that the binding specificity of the SRR family of adhesins is determined by the type and organization of discrete modules within the binding domains, which may affect the tropism of organisms for different tissues.

  19. Structural and Functional Analysis of Cell Wall-anchored Polypeptide Adhesin BspA in Streptococcus agalactiae.

    Rego, Sara; Heal, Timothy J; Pidwill, Grace R; Till, Marisa; Robson, Alice; Lamont, Richard J; Sessions, Richard B; Jenkinson, Howard F; Race, Paul R; Nobbs, Angela H

    2016-07-29

    Streptococcus agalactiae (group B Streptococcus, GBS) is the predominant cause of early-onset infectious disease in neonates and is responsible for life-threatening infections in elderly and immunocompromised individuals. Clinical manifestations of GBS infection include sepsis, pneumonia, and meningitis. Here, we describe BspA, a deviant antigen I/II family polypeptide that confers adhesive properties linked to pathogenesis in GBS. Heterologous expression of BspA on the surface of the non-adherent bacterium Lactococcus lactis confers adherence to scavenger receptor gp340, human vaginal epithelium, and to the fungus Candida albicans Complementary crystallographic and biophysical characterization of BspA reveal a novel β-sandwich adhesion domain and unique asparagine-dependent super-helical stalk. Collectively, these findings establish a new bacterial adhesin structure that has in effect been hijacked by a pathogenic Streptococcus species to provide competitive advantage in human mucosal infections. PMID:27311712

  20. Structural and Functional Analysis of a New Subfamily of Glycosyltransferases Required for Glycosylation of Serine-rich Streptococcal Adhesins

    Zhu, Fan; Erlandsen, Heidi; Ding, Lei; Li, Jingzhi; Huang, Ying; Zhou, Meixian; Liang, Xiaobo; Ma, Jinbiao; Wu, Hui (UAB)

    2011-09-16

    Serine-rich repeat glycoproteins (SRRPs) are a growing family of bacterial adhesins found in many streptococci and staphylococci; they play important roles in bacterial biofilm formation and pathogenesis. Glycosylation of this family of adhesins is essential for their biogenesis. A glucosyltransferase (Gtf3) catalyzes the second step of glycosylation of a SRRP (Fap1) from an oral streptococcus, Streptococcus parasanguinis. Although Gtf3 homologs are highly conserved in SRRP-containing streptococci, they share minimal homology with functionally known glycosyltransferases. We report here the 2.3 {angstrom} crystal structure of Gtf3. The structural analysis indicates that Gtf3 forms a tetramer and shares significant structural homology with glycosyltransferases from GT4, GT5, and GT20 subfamilies. Combining crystal structural analysis with site-directed mutagenesis and in vitro glycosyltransferase assays, we identified residues that are required for UDP- or UDP-glucose binding and for oligomerization of Gtf3 and determined their contribution to the enzymatic activity of Gtf3. Further in vivo studies revealed that the critical amino acid residues identified by the structural analysis are crucial for Fap1 glycosylation in S. parasanguinis in vivo. Moreover, Gtf3 homologs from other streptococci were able to rescue the gtf3 knock-out mutant of S. parasanguinis in vivo and catalyze the sugar transfer to the modified SRRP substrate in vitro, demonstrating the importance and conservation of the Gtf3 homologs in glycosylation of SRRPs. As the Gtf3 homologs only exist in SRRP-containing streptococci, we conclude that the Gtf3 homologs represent a unique subfamily of glycosyltransferases.

  1. Inhibition of Bifidobacterium Cell Wall 51.74 kDa Adhesin Isolated from Infants Feces Towards Adhesion of Enteric Phatogen E. coli on Enterocyte Balb/C Mice

    I Sukrama

    2012-01-01

    Full Text Available Objectives: To determine 51.74 kDa adhesin of Bifidobacterium sp cell wall isolated from infants feces as an anti adhesion of E. coli on enterocyte mice. Methods: Randomized Posttest-Only Control Group Design was employed to investigate adherence ability of this adhesin towards E.coli adhesion on mice entherocyte. Results: In this research, it was obtained, that the 51.74 kDa adhesin cell wall of Bifidobacterium sp has an ability to inhibit adhesion of E. coli on mice enterocyte. The ability was increased as an increase of adhsein concentration. Conclusions: that can be drawn from this research is the finding of 51.74 kDa adhesin cell wall of Bifidobacterium sp isolated from infants feces that can inhibit adhseion of E. coli on mice enterocyte. Future work that can be carried out are further researches concerning whether these protein can be applied to inhibit adherence of other pathogen bacteria

  2. Identification of glycoprotein receptors within the human salivary proteome for the lectin-like BabA and SabA adhesins of Helicobacter pylori by fluorescence-based 2-D bacterial overlay.

    Walz, Anke; Odenbreit, Stefan; Stühler, Kai; Wattenberg, Andreas; Meyer, Helmut E; Mahdavi, Jafar; Borén, Thomas; Ruhl, Stefan

    2009-03-01

    Because gastric infection by Helicobacter pylori takes place via the oral route, possible interactions of this bacterium with human salivary proteins could occur. By using modified 1- and 2-D bacterial overlay, binding of H. pylori adhesins BabA and SabA to the whole range of salivary proteins was explored. Bound salivary receptor molecules were identified by MALDI-MS and by comparison to previously established proteome maps of whole and glandular salivas. By use of adhesin-deficient mutants, binding of H. pylori to MUC7 and gp-340 could be linked to the SabA and BabA adhesins, respectively, whereas binding to MUC5B was associated with both adhesins. Binding of H. pylori to the proline-rich glycoprotein was newly detected and assigned to BabA adhesin whereas the SabA adhesin was found to mediate binding to newly detected receptor molecules, including carbonic anhydrase VI, secretory component, heavy chain of secretory IgA1, parotid secretory protein and zinc-alpha(2)-glycoprotein. Some of these salivary glycoproteins are known to act as scavenger molecules or are involved in innate immunity whereas others might come to modify the pathogenetic properties of this organism. In general, this 2-D bacterial overlay technique represents a useful supplement in adhesion studies of bacteria with complex protein mixtures. PMID:19253298

  3. Transcription profile of Trichophyton rubrum conidia grown on keratin reveals the induction of an adhesin-like protein gene with a tandem repeat pattern

    Bitencourt, Tamires Aparecida; Macedo, Claudia; Franco, Matheus Eloy; Assis, Amanda Freire; Komoto, Tatiana Takahasi; Stehling, Eliana Guedes; Beleboni, Rene Oliveira; Malavazi, Iran; Marins, Mozart; Fachin, Ana Lúcia

    2016-01-01

    Background Trichophyton rubrum is a cosmopolitan filamentous fungus that can infect human keratinized tissue (skin, nails and, rarely, hair) and is the major agent of all chronic and recurrent dermatophytoses. The dermatophyte infection process is initiated through the release of arthroconidial adhesin, which binds to the host stratum corneum. The conidia then germinate, and fungal hyphae invade keratinized skin structures through the secretion of proteases. Although arthroconidia play a cent...

  4. The Actinobacillus pleuropneumoniae HMW1C-Like Glycosyltransferase Mediates N-Linked Glycosylation of the Haemophilus influenzae HMW1 Adhesin

    Choi, Kyoung-Jae; Grass, Susan; Paek, Seonghee; St. Geme, Joseph W.; Yeo, Hye-Jeong

    2010-01-01

    The Haemophilus influenzae HMW1 adhesin is an important virulence exoprotein that is secreted via the two-partner secretion pathway and is glycosylated at multiple asparagine residues in consensus N-linked sequons. Unlike the heavily branched glycans found in eukaryotic N-linked glycoproteins, the modifying glycan structures in HMW1 are mono-hexoses or di-hexoses. Recent work demonstrated that the H. influenzae HMW1C protein is the glycosyltransferase responsible for transferring glucose and ...

  5. Detection of pap, sfa, afa, foc, and fim Adhesin-Encoding Operons in Uropathogenic Escherichia coli Isolates Collected From Patients With Urinary Tract Infection

    Rahdar

    2015-08-01

    Full Text Available Background Uropathogenic Escherichia coli (UPEC with its virulence factors is the most prevalent cause of urinary tract infection (UTI. Objectives; This study aimed to determine the occurrence of fim, pap, sfa, and afa genes among 100 UPEC isolates collected from patients diagnosed with UTI. Materials and Methods A total of 100 UPEC isolates were obtained from urine samples of patients with UTI. The prevalence of 5 virulence genes encoding type 1 fimbriae (fimH, pili associated with pyelonephritis (pap, S and F1C fimbriae (sfa and foc and afimbrial adhesins (afa were determined through PCR method. We also investigated the phylogenetic background of all isolates. In addition, the distribution of adhesin-encoding operons between the phylogroups was assessed. Results The prevalence of genes encoding for fimbrial adhesive systems was 95% for fim, 57% for pap, 16% for foc, and 81% for sfa. The operons encoding for afa afimbrial adhesins were identified in 12% of isolates. The various combinations of detected genes were designated as virulence patterns. The fim gene, which occurred in strains from all phylogenetic groups (A, B1, B2, and D was evaluated and no significant differences were found among these groups. Conversely, significant differences were observed in relation to pap, afa, foc, and sfa operons. Conclusions These results indicate that the PCR method is a powerful genotypic assay for the detection of adhesin-encoding operons. Thus, this assay can be recommended for clinical use to detect virulent urinary E. coli strains, as well as epidemiological studies.

  6. Detection of Fusobacterium Nucleatum and fadA Adhesin Gene in Patients with Orthodontic Gingivitis and Non-Orthodontic Periodontal Inflammation

    Liu, Ping; Liu, Yi; Wang, Jianning; Guo, Yang; Zhang, Yujie; Xiao, Shuiqing

    2014-01-01

    Fusobacterium nucleatum is one of the most abundant gram-negative bacilli colonizing the subgingival plaque and closely associated with periodontal disease. However it is unclear whether F. nucleatum is involved in gingival inflammation under orthodontic appliance. A novel adhesin, FadA, which is unique to oral Fusobacteria, is required for F. nucleatum binding and invasion to epithelial cells and thus may play an important role in colonization of Fusobacterium in the host. In this study, we ...

  7. Lcl of Legionella pneumophila Is an Immunogenic GAG Binding Adhesin That Promotes Interactions with Lung Epithelial Cells and Plays a Crucial Role in Biofilm Formation ▿

    Duncan, Carla; Prashar, Akriti; So, Jannice; Tang, Patrick; Low, Donald E.; Terebiznik, Mauricio; Guyard, Cyril

    2011-01-01

    Legionellosis is mostly caused by Legionella pneumophila and is defined by a severe respiratory illness with a case fatality rate ranging from 5 to 80%. In vitro and in vivo, interactions of L. pneumophila with lung epithelial cells are mediated by the sulfated glycosaminoglycans (GAGs) of the host extracellular matrix. In this study, we have identified several Legionella heparin binding proteins. We have shown that one of these proteins, designated Lcl, is a polymorphic adhesin of L. pneumop...

  8. Protection of gerbils from amebic liver abscess by immunization with a recombinant protein derived from the 170-kilodalton surface adhesin of Entamoeba histolytica.

    Zhang, T.; Stanley, S L

    1994-01-01

    The protozoan parasite Entamoeba histolytica causes extensive morbidity and mortality worldwide through intestinal infection and amebic liver abscess. Here we show that vaccination of gerbils, a standard model for amebic liver abscess, with recombinant proteins derived from the 170-kDa galactose-binding adhesin of E. histolytica and the serine-rich E. histolytica protein or a combination of the two recombinant antigens provides excellent protection against subsequent hepatic challenge with vi...

  9. Staphylococcus epidermidis polysaccharide intercellular adhesin induces IL-8 expression in human astrocytes via a mechanism involving TLR2.

    Stevens, Niall T

    2009-03-01

    Staphylococcus epidermidis is an opportunistic biofilm-forming pathogen associated with neurosurgical device-related meningitis. Expression of the polysaccharide intercellular adhesin (PIA) on its surface promotes S. epidermidis biofilm formation. Here we investigated the pro-inflammatory properties of PIA against primary and transformed human astrocytes. PIA induced IL-8 expression in a dose- and\\/or time-dependent manner from U373 MG cells and primary normal human astrocytes. This effect was inhibited by depletion of N-acetyl-beta-d-glucosamine polymer from the PIA preparation with Lycopersicon esculentum lectin or sodium meta-periodate. Expression of dominant-negative versions of the TLR2 and TLR4 adaptor proteins MyD88 and Mal in U373 MG cells inhibited PIA-induced IL-8 production. Blocking IL-1 had no effect. PIA failed to induce IL-8 production from HEK293 cells stably expressing TLR4. However, in U373 MG cells which express TLR2, neutralization of TLR2 impaired PIA-induced IL-8 production. In addition to IL-8, PIA also induced expression of other cytokines from U373 MG cells including IL-6 and MCP-1. These data implicate PIA as an important immunogenic component of the S. epidermidis biofilm that can regulate pro-inflammatory cytokine production from human astrocytes, in part, via TLR2.

  10. Trimeric autotransporter adhesins in members of the Burkholderia cepacia complex: a multifunctional family of proteins implicated in virulence

    Arsénio Mendes Fialho

    2011-12-01

    Full Text Available Trimeric autotransporter adhesins (TAAs are multimeric surface proteins, involved in various biological traits of pathogenic Gram-negative bacteria including adherence, biofilm formation, invasion, survival within eukaryotic cells, serum resistance and cytotoxicity. TAAs have a modular architecture composed by a conserved membrane-anchored C-terminal domain and a variable number of stalk and head domains. In this study, a bioinformatic approach has been used to analyze the distribution and architecture of TAAs among Burkholderia cepacia complex (Bcc genomes. Fifteen genomes were probed revealing a total of 74 encoding sequences. Compared with other bacterial species, the Bcc genomes contain a disproportionately large number of TAAs (two genes to up to 8 genes, such as in B.cenocepacia. Phylogenetic analysis showed that the TAAs grouped into at least eight distinct clusters. TAAs with serine-rich repeats are clearly well separated from others, thereby representing a different evolutionary lineage. Comparative gene mapping across Bcc genomes reveals that TAA genes are inserted within conserved synteny blocks. We further focused our analysis on the epidemic strain B. cenocepacia J2315 in which 7 TAAs were annotated. Among these, 3 TAA-encoding genes (BCAM019, BCAM0223 and BCAM0224 are organized into a cluster and are candidates for multifunctional virulence factors. Here we review the current insights into the functional role of BCAM0224 as a model locus.

  11. A food-grade fimbrial adhesin FaeG expression system in Lactococcus lactis and Lactobacillus casei.

    Lu, W W; Wang, T; Wang, Y; Xin, M; Kong, J

    2016-03-01

    Enterotoxigenic Escherichia coli (ETEC) infection is the major cause of diarrhea in neonatal piglets. The fimbriae as colonizing factor in the pathogenesis of ETEC constitute a primary target for vaccination against ETEC. Lactic acid bacteria (LAB) are attractive tools to deliver antigens at the mucosal level. With the safety of genetically modified LAB in mind, a food-grade secretion vector (pALRc or pALRb) was constructed with DNA entirely from LAB, including the replicon, promoter, signal peptide, and selection marker alanine racemase gene (alr). To evaluate the feasibility of the system, the nuclease gene (nuc) from Staphylococcus aureus was used as a reporter to be expressed in both Lactococcus lactis and Lactobacillus casei. Subsequently, the extracellular secretion of the fimbrial adhesin FaeG of ETEC was confirmed by Western blot analysis. These results showed that this food-grade expression system has potential as the delivery vehicle for the safe use of genetically modified LAB for the development of vaccines against ETEC infection. PMID:26825016

  12. A distinct sortase SrtB anchors and processes a streptococcal adhesin AbpA with a novel structural property

    Liang, Xiaobo; Liu, Bing; Zhu, Fan; Scannapieco, Frank A.; Haase, Elaine M.; Matthews, Steve; Wu, Hui

    2016-01-01

    Surface display of proteins by sortases in Gram-positive bacteria is crucial for bacterial fitness and virulence. We found a unique gene locus encoding an amylase-binding adhesin AbpA and a sortase B in oral streptococci. AbpA possesses a new distinct C-terminal cell wall sorting signal. We demonstrated that this C-terminal motif is required for anchoring AbpA to cell wall. In vitro and in vivo studies revealed that SrtB has dual functions, anchoring AbpA to the cell wall and processing AbpA into a ladder profile. Solution structure of AbpA determined by NMR reveals a novel structure comprising a small globular α/β domain and an extended coiled-coil heliacal domain. Structural and biochemical studies identified key residues that are crucial for amylase binding. Taken together, our studies document a unique sortase/adhesion substrate system in streptococci adapted to the oral environment rich in salivary amylase. PMID:27492581

  13. Study of the structural and dynamic effects in the FimH adhesin upon α-d-heptyl mannose binding.

    Vanwetswinkel, Sophie; Volkov, Alexander N; Sterckx, Yann G J; Garcia-Pino, Abel; Buts, Lieven; Vranken, Wim F; Bouckaert, Julie; Roy, René; Wyns, Lode; van Nuland, Nico A J

    2014-02-27

    Uropathogenic Escherichia coli cause urinary tract infections by adhering to mannosylated receptors on the human urothelium via the carbohydrate-binding domain of the FimH adhesin (FimHL). Numerous α-d-mannopyranosides, including α-d-heptyl mannose (HM), inhibit this process by interacting with FimHL. To establish the molecular basis of the high-affinity HM binding, we solved the solution structure of the apo form and the crystal structure of the FimHL-HM complex. NMR relaxation analysis revealed that protein dynamics were not affected by the sugar binding, yet HM addition promoted protein dimerization, which was further confirmed by small-angle X-ray scattering. Finally, to address the role of Y48, part of the "tyrosine gate" believed to govern the affinity and specificity of mannoside binding, we characterized the FimHL Y48A mutant, whose conformational, dynamical, and HM binding properties were found to be very similar to those of the wild-type protein. PMID:24476493

  14. Phage display revisited: Epitope mapping of a monoclonal antibody directed against Neisseria meningitidis adhesin A using the PROFILER technology.

    Cariccio, Veronica Lanza; Domina, Maria; Benfatto, Salvatore; Venza, Mario; Venza, Isabella; Faleri, Agnese; Bruttini, Marco; Bartolini, Erika; Giuliani, Marzia Monica; Santini, Laura; Brunelli, Brunella; Norais, Nathalie; Borgogni, Erica; Midiri, Angelina; Galbo, Roberta; Romeo, Letizia; Biondo, Carmelo; Masignani, Vega; Teti, Giuseppe; Felici, Franco; Beninati, Concetta

    2016-01-01

    There is a strong need for rapid and reliable epitope mapping methods that can keep pace with the isolation of increasingly larger numbers of mAbs. We describe here the identification of a conformational epitope using Phage-based Representation OF ImmunoLigand Epitope Repertoire (PROFILER), a recently developed high-throughput method based on deep sequencing of antigen-specific lambda phage-displayed libraries. A novel bactericidal monoclonal antibody (mAb 9F11) raised against Neisseria meningitidis adhesin A (NadA), an important component of the Bexsero(®) anti-meningococcal vaccine, was used to evaluate the technique in comparison with other epitope mapping methods. The PROFILER technology readily identified NadA fragments that were capable of fully recapitulating the reactivity of the entire antigen against mAb 9F11. Further analysis of these fragments using mutagenesis and hydrogen-deuterium exchange mass-spectrometry allowed us to identify the binding site of mAb 9F11 (A250-D274) and an adjoining sequence (V275-H312) that was also required for the full functional reconstitution of the epitope. These data suggest that, by virtue of its ability to detect a great variety of immunoreactive antigen fragments in phage-displayed libraries, the PROFILER technology can rapidly and reliably identify epitope-containing regions and provide, in addition, useful clues for the functional characterization of conformational mAb epitopes. PMID:26963435

  15. An Acinetobacter trimeric autotransporter adhesin reaped from cells exhibits its nonspecific stickiness via a highly stable 3D structure.

    Yoshimoto, Shogo; Nakatani, Hajime; Iwasaki, Keita; Hori, Katsutoshi

    2016-01-01

    Trimeric autotransporter adhesins (TAAs), cell surface proteins of Gram-negative bacteria, mediate bacterial adhesion to host cells and extracellular matrix proteins. However, AtaA, a TAA in the nonpathogenic Acinetobacter sp. strain Tol 5, shows nonspecific, high adhesiveness to abiotic material surfaces as well as to biotic surfaces. AtaA is a homotrimer of polypeptides comprising 3,630 amino acids and forms long nanofibers; therefore, it is too large and structurally complex to be produced as a recombinant protein. In this study, we isolated AtaA's passenger domain (AtaA PSD), which is translocated to the cell surface through the C-terminal transmembrane domain and exhibits biological functions, using a new method. We introduced a protease recognition site and reaped AtaA nanofibers 225 nm in length from the cell surface through proteolytic cleavage with a specific protease. Biochemical and biophysical analyses of the purified native AtaA PSD revealed that it has a stable structure under alkaline and acidic conditions. Temperatures above 80 °C, which disrupted AtaA's higher-order structure but maintained the full-length AtaA polypeptide, inactivated AtaA's nonspecific adhesiveness, suggesting that the stickiness of AtaA requires its 3D structure. This finding refutes the widespread but vague speculation that large unfolded polypeptides readily stick to various surfaces. PMID:27305955

  16. A distinct sortase SrtB anchors and processes a streptococcal adhesin AbpA with a novel structural property.

    Liang, Xiaobo; Liu, Bing; Zhu, Fan; Scannapieco, Frank A; Haase, Elaine M; Matthews, Steve; Wu, Hui

    2016-01-01

    Surface display of proteins by sortases in Gram-positive bacteria is crucial for bacterial fitness and virulence. We found a unique gene locus encoding an amylase-binding adhesin AbpA and a sortase B in oral streptococci. AbpA possesses a new distinct C-terminal cell wall sorting signal. We demonstrated that this C-terminal motif is required for anchoring AbpA to cell wall. In vitro and in vivo studies revealed that SrtB has dual functions, anchoring AbpA to the cell wall and processing AbpA into a ladder profile. Solution structure of AbpA determined by NMR reveals a novel structure comprising a small globular α/β domain and an extended coiled-coil heliacal domain. Structural and biochemical studies identified key residues that are crucial for amylase binding. Taken together, our studies document a unique sortase/adhesion substrate system in streptococci adapted to the oral environment rich in salivary amylase. PMID:27492581

  17. Investigation of 16 genes encoding adhesin in Staphylococcus spp%葡萄球菌属16种黏附素编码基因研究

    董筱莉; 韩兰秀; 周剑波; 金花; 张丽君; 王敏霞

    2014-01-01

    目的:调查一组凝固酶阳性葡萄球菌黏附素编码基因携带状况,分析黏附素编码基因及荚膜抗原编码基因检出率。方法收集2013年3-9月江苏省江阴市人民医院住院患者标本中分离的凝固酶阳性葡萄球菌共20株,用spa基因PCR检测作金黄色葡萄球菌的分子鉴定,再采用聚合酶链反应(PCR)的方法分析16种黏附素编码基因和荚膜抗原的型别编码基因(cap5、cap8)。结果20株凝固酶阳性葡萄球菌中13株为金黄色葡萄球菌,其余7株为非金黄色葡萄球菌;13株金黄色葡萄球菌黏附素编码基因每一株均有阳性检出,除 s as X基因阳性率低外,其余均较高;荚膜抗原编码基因12株有阳性检出;7株非金黄色葡萄球菌无任何黏附素与荚膜抗原编码基因检出。结论对金黄色葡萄球菌进行16种黏附素编码基因及2种荚膜抗原编码基因联合检测研究尚为国内外首次,13株金黄色葡萄球菌黏附素编码基因及荚膜抗原编码基因高检出率可能与菌株定植及感染相关。%OBJECTIVE To investigate the distribution of the genes encoding adhesin in a group of Staphylococcus spp and analyze the detection rate of the genes encoding adhesin and the genes encoding capsular antigen . METHODS A total of 20 strains of coagulase‐negative Staphylococcus were isolated from the specimens that were obtained from the hospitalized patients who were treated in the Jiangyin People's Hospital from Mar 2013 to Sep 2013 ,then the molecular identification of Staphylococcus aureus was performed by using spa PCR ,and the 16 genes encoding adhesion and the genes encoding capsular antigen (cap5、cap8) were analyzed by means of polymer‐ase‐chain‐reaction (PCR) .RESULTS Of the 20 strains of coagulase‐negative Staphylococcus ,13 strains were the S .aureus ,and the rest of 7 strains were non‐S .aureus;each of the 13 strains of S .aureus was tested positive for the gene

  18. Adaptaci??n del ???Cuestionario de Evaluaci??n de la Adhesi??n al Tratamiento antirretroviral??? (CEAT-VIH) para su uso en Per??

    Tafur-Valderrama, E.; Ortiz, C; Alfaro, C.O.; Garc??a-Jim??nez, Emilio; Faus D??der, Mar??a Jos??

    2008-01-01

    Objetivos: El objetivo de este estudio fue adaptar y validar el ???Cuestionario para evaluar la adhesi??n al tratamiento antirretroviral??? (CEAT-VIH) para su uso en el Per??, en pacientes VIH y SIDA en tratamiento antirretroviral de gran actividad (TARGA). M??todos: Se evalu?? la comprensi??n del cuestionario as?? como sus propiedades psicom??tricas en una muestra de 41 pacientes con VIH y SIDA en tratamiento antirretroviral de gran actividad (TARGA) por m??s de tres meses. El ...

  19. The soluble recombinant Neisseria meningitidis adhesin NadA(Δ351-405) stimulates human monocytes by binding to extracellular Hsp90.

    Cecchini, Paola; Tavano, Regina; Polverino de Laureto, Patrizia; Franzoso, Susanna; Mazzon, Cristina; Montanari, Paolo; Papini, Emanuele

    2011-01-01

    The adhesin NadA favors cell adhesion/invasion by hypervirulent Neisseria meningitidis B (MenB). Its recombinant form NadA(Δ351-405,) devoid of the outer membrane domain, is an immunogenic candidate for an anti-MenB vaccine able to stimulate monocytes, macrophages and dendritic cells. In this study we investigated the molecular mechanism of NadA(Δ351-405) cellular effects in monocytes. We show that NadA(Δ351-405) (against which we obtained polyclonal antibodies in rabbits), binds to hsp90, but not to other extracellular homologous heat shock proteins grp94 and hsp70, in vitro and on the surface of monocytes, in a temperature dependent way. Pre-incubation of monocytes with the MenB soluble adhesin interfered with the binding of anti-hsp90 and anti-hsp70 antibodies to hsp90 and hsp70 at 37°C, a condition in which specific cell-binding occurs, but not at 0°C, a condition in which specific cell-binding is very diminished. Conversely, pre-incubation of monocytes with anti-hsp90 and anti-hsp70 antibodies did not affected NadA(Δ351-405) cell binding in any temperature condition, indicating that it associates to another receptor on their plasma membrane and then laterally diffuses to encounter hsp90. Consistently, polymixin B interfered with NadA(Δ351-405) /hsp90 association, abrogated the decrease of anti-hsp90 antibodies binding to the cell surface due to NadA(Δ351-405) and inhibited adhesin-induced cytokine/chemokine secretion without affecting monocyte-adhesin binding. Co-stimulation of monocytes with anti-hsp90 antibodies and NadA(Δ351-405) determined a stronger but polymixin B insensitive cell activation. This indicated that the formation of a recombinant NadA/hsp90/hsp70 complex, although essential for full monocyte stimulation, can be replaced by anti-hsp90 antibody/hsp90 binding. Finally, the activation of monocytes by NadA(Δ351-405) alone or in the presence of anti-hsp90 antibodies were both inhibited by neutralizing anti-TLR4 antibodies, but not by

  20. Comparison of Surface Proteomes of Adherence Variants of Listeria Monocytogenes Using LC-MS/MS for Identification of Potential Surface Adhesins.

    Tiong, Hung King; Hartson, Steven D; Muriana, Peter M

    2016-01-01

    The ability of Listeria monocytogenes to adhere and form biofilms leads to persistence in food processing plants and food-associated listeriosis. The role of specific surface proteins as adhesins to attach Listeria cells to various contact surfaces has not been well characterized to date. In prior research comparing different methods for surface protein extraction, the Ghost urea method revealed cleaner protein content as verified by the least cytoplasmic protein detected in surface extracts using LC-MS/MS. The same technique was utilized to extract and detect surface proteins among two surface-adherent phenotypic strains of L. monocytogenes (i.e., strongly and weakly adherent). Of 640 total proteins detected among planktonic and sessile cells, 21 protein members were exclusively detected in the sessile cells. Relative LC-MS/MS detection and quantification of surface-extracted proteins from the planktonic weakly adherent (CW35) and strongly adherent strains (99-38) were examined by protein mass normalization of proteins. We found that L. monocytogenes 99-38 exhibited a total of 22 surface proteins that were over-expressed: 11 proteins were detected in surface extracts of both sessile and planktonic 99-38 that were ≥5-fold over-expressed while another 11 proteins were detected only in planktonic 99-38 cells that were ≥10-fold over-expressed. Our results suggest that these protein members are worthy of further investigation for their involvement as surface adhesins. PMID:27196934

  1. Expression, purification and X-ray crystallographic analysis of the Helicobacter pylori blood group antigen-binding adhesin BabA.

    Subedi, Suresh; Moonens, Kristof; Romão, Ema; Lo, Alvin; Vandenbussche, Guy; Bugaytsova, Jeanna; Muyldermans, Serge; Borén, Thomas; Remaut, Han

    2014-12-01

    Helicobacter pylori is a human pathogen that colonizes about 50% of the world's population, causing chronic gastritis, duodenal ulcers and even gastric cancer. A steady emergence of multiple antibiotic resistant strains poses an important public health threat and there is an urgent requirement for alternative therapeutics. The blood group antigen-binding adhesin BabA mediates the intimate attachment to the host mucosa and forms a major candidate for novel vaccine and drug development. Here, the recombinant expression and crystallization of a soluble BabA truncation (BabA(25-460)) corresponding to the predicted extracellular adhesin domain of the protein are reported. X-ray diffraction data for nanobody-stabilized BabA(25-460) were collected to 2.25 Å resolution from a crystal that belonged to space group P21, with unit-cell parameters a = 50.96, b = 131.41, c = 123.40 Å, α = 90.0, β = 94.8, γ = 90.0°, and which was predicted to contain two BabA(25-460)-nanobody complexes per asymmetric unit. PMID:25484214

  2. Expression, crystallization and preliminary X-ray data analysis of NT-Als9-2, a fungal adhesin from Candida albicans

    Details of the expression and crystallization of the N-terminal fragment of Als9-2, an adhesin from the human commensal/pathogenic fungus C. albicans, are reported. Preliminary analysis of the collected X-ray data is also discussed. Candida albicans is a common human fungal commensal that can also cause a range of infections from skin/mucosal ‘thrush’ to severe systemic candidiasis. Adherence to host cells is one of the key determinants of Candida pathogenesis. The Als family of surface proteins has been implicated in adhesion of C. albicans, yet limited information has been published on the structure and mechanism of these fungal adhesins. The N-terminal region of these proteins has been shown to possess adhesive properties, making it a possible target for new therapeutic strategies. Recombinant NT-Als9-2 from C. albicans (residues 18–329) was overexpressed in Escherichia coli, purified and crystallized. Diffraction data were collected to 2.0 Å resolution. The crystals belonged to space group P212121, with unit-cell parameters a = 34.73, b = 68.71, c = 120.03 Å, α = β = γ = 90° and one molecule in the asymmetric unit. Platinum-derivatized crystals belonged to the same space group, with similar unit-cell parameters, although they were not completely isomorphous

  3. Proteolytic processing of the cilium adhesin MHJ_0194 (P123J ) in Mycoplasma hyopneumoniae generates a functionally diverse array of cleavage fragments that bind multiple host molecules.

    Raymond, Benjamin B A; Jenkins, Cheryl; Seymour, Lisa M; Tacchi, Jessica L; Widjaja, Michael; Jarocki, Veronica M; Deutscher, Ania T; Turnbull, Lynne; Whitchurch, Cynthia B; Padula, Matthew P; Djordjevic, Steven P

    2015-03-01

    Mycoplasma hyopneumoniae, the aetiological agent of porcine enzootic pneumonia, regulates the presentation of proteins on its cell surface via endoproteolysis, including those of the cilial adhesin P123 (MHJ_0194). These proteolytic cleavage events create functional adhesins that bind to proteoglycans and glycoproteins on the surface of ciliated and non-ciliated epithelial cells and to the circulatory host molecule plasminogen. Two dominant cleavage events of the P123 preprotein have been previously characterized; however, immunoblotting studies suggest that more complex processing events occur. These extensive processing events are characterized here. The functional significance of the P97 cleavage fragments is also poorly understood. Affinity chromatography using heparin, fibronectin and plasminogen as bait and peptide arrays were used to expand our knowledge of the adhesive capabilities of P123 cleavage fragments and characterize a novel binding motif in the C-terminus of P123. Further, we use immunohistochemistry to examine in vivo, the biological significance of interactions between M. hyopneumoniae and fibronectin and show that M. hyopneumoniae induces fibronectin deposition at the site of infection on the ciliated epithelium. Our data supports the hypothesis that M. hyopneumoniae possesses the molecular machinery to influence key molecular communication pathways in host cells. PMID:25293691

  4. The Staphylococcus aureus lineage-specific markers collagen adhesin and toxic shock syndrome toxin 1 distinguish multilocus sequence typing clonal complexes within spa clonal complexes.

    Deurenberg, Ruud H; Rijnders, Michelle I A; Sebastian, Silvie; Welling, Maaike A; Beisser, Patrick S; Stobberingh, Ellen E

    2009-10-01

    Spa typing/based upon repeat pattern (BURP) sometimes cannot differentiate multilocus sequence typing (MLST) clonal complexes (CCs) within spa-CCs. It has been observed previously that virulence factors, such as collagen adhesin (CNA) and toxic shock syndrome toxin 1 (TSST-1), are associated with certain Staphylococcus aureus lineages. Analysis of methicillin-sensitive and methicillin-resistant S. aureus by spa typing/BURP and detection of CNA and TSST-1 observed an association between CNA and MLST CC1, 12, 22, 30, 45, 51, and 239 and between TSST-1 and MLST CC30. In spa-CC 012, associated with MLST CC7, CC15, and CC30, MLST CC30 could be distinguished from MLST CC7 and CC15 with CNA and TSST-1 as lineage-specific markers. Lineage-specific markers can overcome clustering of nonrelated MLST CCs into 1 spa-CC. PMID:19748421

  5. The pneumococcal serine-rich repeat protein is an intra-species bacterial adhesin that promotes bacterial aggregation in vivo and in biofilms.

    Carlos J Sanchez

    Full Text Available The Pneumococcal serine-rich repeat protein (PsrP is a pathogenicity island encoded adhesin that has been positively correlated with the ability of Streptococcus pneumoniae to cause invasive disease. Previous studies have shown that PsrP mediates bacterial attachment to Keratin 10 (K10 on the surface of lung cells through amino acids 273-341 located in the Basic Region (BR domain. In this study we determined that the BR domain of PsrP also mediates an intra-species interaction that promotes the formation of large bacterial aggregates in the nasopharynx and lungs of infected mice as well as in continuous flow-through models of mature biofilms. Using numerous methods, including complementation of mutants with BR domain deficient constructs, fluorescent microscopy with Cy3-labeled recombinant (rBR, Far Western blotting of bacterial lysates, co-immunoprecipitation with rBR, and growth of biofilms in the presence of antibodies and competitive peptides, we determined that the BR domain, in particular amino acids 122-166 of PsrP, promoted bacterial aggregation and that antibodies against the BR domain were neutralizing. Using similar methodologies, we also determined that SraP and GspB, the Serine-rich repeat proteins (SRRPs of Staphylococcus aureus and Streptococcus gordonii, respectively, also promoted bacterial aggregation and that their Non-repeat domains bound to their respective SRRPs. This is the first report to show the presence of biofilm-like structures in the lungs of animals infected with S. pneumoniae and show that SRRPs have dual roles as host and bacterial adhesins. These studies suggest that recombinant Non-repeat domains of SRRPs (i.e. BR for S. pneumoniae may be useful as vaccine antigens to protect against Gram-positive bacteria that cause infection.

  6. Emerging ST121/agr4 community-associated methicillin-resistant Staphylococcus aureus (MRSA) with strong adhesin and cytolytic activities: trigger for MRSA pneumonia and fatal aspiration pneumonia in an influenza-infected elderly.

    Wan, T-W; Tomita, Y; Saita, N; Konno, K; Iwao, Y; Hung, W-C; Teng, L-J; Yamamoto, T

    2016-09-01

    The pathogenesis of community-associated methicillin-resistant Staphylococcus aureus (CA-MRSA) pneumonia in influenza-infected elderly individuals has not yet been elucidated in detail. In the present study, a 92-year-old man infected with influenza developed CA-MRSA pneumonia. His CA-MRSA was an emerging type, originated in ST121/agr4 S. aureus, with diversities of Panton-Valentine leucocidin (PVL)(-)/spat5110/SCCmecV(+) versus PVL(+)/spat159((etc.))/SCCmec (-), but with common virulence potentials of strong adhesin and cytolytic activities. Resistance to erythromycin/clindamycin (inducible-type) and gentamicin was detected. Pneumonia improved with the administration of levofloxacin, but with the subsequent development of fatal aspiration pneumonia. Hence, characteristic CA-MRSA with strong adhesin and cytolytic activities triggered influenza-related sequential complications. PMID:27358743

  7. Evidence for the Sialylation of PilA, the PI-2a Pilus-Associated Adhesin of Streptococcus agalactiae Strain NEM316.

    Eric Morello

    Full Text Available Streptococcus agalactiae (or Group B Streptococcus, GBS is a commensal bacterium present in the intestinal and urinary tracts of approximately 30% of humans. We and others previously showed that the PI-2a pilus polymers, made of the backbone pilin PilB, the tip adhesin PilA and the cell wall anchor protein PilC, promote adhesion to host epithelia and biofilm formation. Affinity-purified PI-2a pili from GBS strain NEM316 were recognized by N-acetylneuraminic acid (NeuNAc, also known as sialic acid specific lectins such as Elderberry Bark Lectin (EBL suggesting that pili are sialylated. Glycan profiling with twenty different lectins combined with monosaccharide composition by HPLC suggested that affinity-purified PI-2a pili are modified by N-glycosylation and decorated with sialic acid attached to terminal galactose. Analysis of various relevant mutants in the PI-2a pilus operon by flow-cytometry and electron microscopy analyses pointed to PilA as the pilus subunit modified by glycosylation. Double labeling using PilB antibody and EBL lectin, which specifically recognizes N-acetylneuraminic acid attached to galactose in α-2, 6, revealed a characteristic binding of EBL at the tip of the pilus structures, highly reminiscent of PilA localization. Expression of a secreted form of PilA using an inducible promoter showed that this recombinant PilA binds specifically to EBL lectin when produced in the native GBS context. In silico search for potentially glycosylated asparagine residues in PilA sequence pointed to N427 and N597, which appear conserved and exposed in the close homolog RrgA from S. pneumoniae, as likely candidates. Conversion of these two asparagyl residues to glutamyl resulted in a higher instability of PilA. Our results provide the first evidence that the tip PilA adhesin can be glycosylated, and suggest that this modification is critical for PilA stability and may potentially influence interactions with the host.

  8. More than a marine propeller--the flagellum of the probiotic Escherichia coli strain Nissle 1917 is the major adhesin mediating binding to human mucus.

    Troge, Anja; Scheppach, Wolfgang; Schroeder, Bjoern O; Rund, Stefan A; Heuner, Klaus; Wehkamp, Jan; Stange, Eduard F; Oelschlaeger, Tobias A

    2012-12-01

    The flagellum of the probiotic Escherichia coli strain Nissle 1917 (EcN) is not just responsible for motility, but also for EcN's ability to induce the production of human β-defensin 2. Here, we report a third function of this EcN organell. In this study we investigated the role of the EcN flagellum in adhesion to different host tissues by ex vivo and in vitro studies. Ex vivo studies with cryosections of human gut biopsies revealed that the flagellum of EcN is most likely important for efficient adhesion to the human intestinal tract. These results and in vitro studies with different epithelial cells indicated that the presence of mucus is important for efficient mediation of adhesion by the flagellum of EcN. We observed direct interaction between isolated flagella from EcN wild type and porcine mucin 2 as well as human mucus. However, we could not observe any interaction of the flagella with murine mucus. For the first time, we identified the mucus component gluconate as one receptor for the binding of flagella from EcN and were able to exclude the flagellin domain D3 as a responsible interaction partner. We propose that the flagellum of EcN is its major adhesin in vivo, which enables this probiotic strain to compete efficiently for binding sites on host tissue with several bacterial pathogens. PMID:23131416

  9. AtaA, a new member of the trimeric autotransporter adhesins from Acinetobacter sp. Tol 5 mediating high adhesiveness to various abiotic surfaces.

    Masahito Ishikawa

    Full Text Available Acinetobacter sp. Tol 5 exhibits an autoagglutinating nature and noteworthy adhesiveness to various abiotic surfaces from hydrophobic plastics to hydrophilic glass and stainless steel. Although previous studies have suggested that bacterionanofibers on Tol 5 cells are involved in the adhesive phenotype of Tol 5, the fiber that directly mediates Tol 5 adhesion has remained unknown. Here, we present a new member of trimeric autotransporter adhesins designated AtaA, which we discovered by analyzing a less adhesive mutant of Tol 5, T1, obtained by transposon mutagenesis. AtaA forms thinner and shorter nanofibers than fimbriae on Tol 5 cells. We performed target disruption of ataA by allelic marker exchange, and the resulting ΔataA strain was complemented with ataA on the Escherichia coli-Acinetobacter shuttle vector, which was newly constructed. These results proved that AtaA is essential for Tol 5's autoagglutinating nature and high adhesiveness to surfaces of various materials. In addition, the adhesiveness to solid surfaces mediated by AtaA is notably higher than that mediated by YadA of Yersinia enterocolitica WA-314. Moreover, and importantly, these characteristics can be conferred to the non-adhesive, non-agglutinating bacterium Acinetobacter sp. ADP1 in trans by transformation with ataA, with expected applications to microbial immobilization.

  10. Specific binding of a naturally occurring amyloidogenic fragment of Streptococcus mutans adhesin P1 to intact P1 on the cell surface characterized by solid state NMR spectroscopy

    Tang, Wenxing; Bhatt, Avni [University of Florida, Department of Biochemistry and Molecular Biology, College of Medicine (United States); Smith, Adam N. [University of Florida, Department of Chemistry, College of Liberal Arts and Sciences (United States); Crowley, Paula J.; Brady, L. Jeannine, E-mail: jbrady@dental.ufl.edu [University of Florida, Department of Oral Biology, College of Dentistry (United States); Long, Joanna R., E-mail: jrlong@ufl.edu [University of Florida, Department of Biochemistry and Molecular Biology, College of Medicine (United States)

    2016-02-15

    The P1 adhesin (aka Antigen I/II or PAc) of the cariogenic bacterium Streptococcus mutans is a cell surface-localized protein involved in sucrose-independent adhesion and colonization of the tooth surface. The immunoreactive and adhesive properties of S. mutans suggest an unusual functional quaternary ultrastructure comprised of intact P1 covalently attached to the cell wall and interacting with non-covalently associated proteolytic fragments thereof, particularly the ∼57-kDa C-terminal fragment C123 previously identified as Antigen II. S. mutans is capable of amyloid formation when grown in a biofilm and P1 is among its amyloidogenic proteins. The C123 fragment of P1 readily forms amyloid fibers in vitro suggesting it may play a role in the formation of functional amyloid during biofilm development. Using wild-type and P1-deficient strains of S. mutans, we demonstrate that solid state NMR (ssNMR) spectroscopy can be used to (1) globally characterize cell walls isolated from a Gram-positive bacterium and (2) characterize the specific binding of heterologously expressed, isotopically-enriched C123 to cell wall-anchored P1. Our results lay the groundwork for future high-resolution characterization of the C123/P1 ultrastructure and subsequent steps in biofilm formation via ssNMR spectroscopy, and they support an emerging model of S. mutans colonization whereby quaternary P1-C123 interactions confer adhesive properties important to binding to immobilized human salivary agglutinin.

  11. Enhanced effect of BCG vaccine against pulmonary Mycobacterium tuberculosis infection in mice with lung Th17 response to mycobacterial heparin-binding hemagglutinin adhesin antigen.

    Fukui, Masayuki; Shinjo, Kikuko; Umemura, Masayuki; Shigeno, Satoko; Harakuni, Tetsuya; Arakawa, Takeshi; Matsuzaki, Goro

    2015-12-01

    Although the BCG vaccine can prevent tuberculosis (TB) in infants, its ability to prevent adult pulmonary TB is reportedly limited. Therefore, development of a novel effective vaccine against pulmonary TB has become an international research priority. We have previously reported that intranasal vaccination of mice with a mycobacterial heparin-binding hemagglutinin adhesin (HBHA) plus mucosal adjuvant cholera toxin (CT) enhances production of IFN-γ and anti-HBHA antibody and suppresses extrapulmonary bacterial dissemination after intranasal infection with BCG. In the present study, the effects of intranasal HBHA + CT vaccine on murine pulmonary Mycobacterium tuberculosis (Mtb) infection were examined. Intranasal HBHA + CT vaccination alone failed to reduce the bacterial burden in the infected lung. However, a combination vaccine consisting of s.c. BCG priming and an intranasal HBHA + CT booster significantly enhanced protective immunity against pulmonary Mtb infection on day 14 compared with BCG vaccine alone. Further, it was found that intranasal HBHA + CT vaccine enhanced not only IFN-γ but also IL-17A production by HBHA-specific T cells in the lung after pulmonary Mtb infection. Therefore, this combination vaccine may be a good candidate for a new vaccine strategy against pulmonary TB. PMID:26577130

  12. The Actinobacillus pleuropneumoniae HMW1C-like glycosyltransferase mediates N-linked glycosylation of the Haemophilus influenzae HMW1 adhesin.

    Kyoung-Jae Choi

    Full Text Available The Haemophilus influenzae HMW1 adhesin is an important virulence exoprotein that is secreted via the two-partner secretion pathway and is glycosylated at multiple asparagine residues in consensus N-linked sequons. Unlike the heavily branched glycans found in eukaryotic N-linked glycoproteins, the modifying glycan structures in HMW1 are mono-hexoses or di-hexoses. Recent work demonstrated that the H. influenzae HMW1C protein is the glycosyltransferase responsible for transferring glucose and galactose to the acceptor sites of HMW1. An Actinobacillus pleuropneumoniae protein designated ApHMW1C shares high-level homology with HMW1C and has been assigned to the GT41 family, which otherwise contains only O-glycosyltransferases. In this study, we demonstrated that ApHMW1C has N-glycosyltransferase activity and is able to transfer glucose and galactose to known asparagine sites in HMW1. In addition, we found that ApHMW1C is able to complement a deficiency of HMW1C and mediate HMW1 glycosylation and adhesive activity in whole bacteria. Initial structure-function studies suggested that ApHMW1C consists of two domains, including a 15-kDa N-terminal domain and a 55-kDa C-terminal domain harboring glycosyltransferase activity. These findings suggest a new subfamily of HMW1C-like glycosyltransferases distinct from other GT41 family O-glycosyltransferases.

  13. Specific binding of a naturally occurring amyloidogenic fragment of Streptococcus mutans adhesin P1 to intact P1 on the cell surface characterized by solid state NMR spectroscopy

    The P1 adhesin (aka Antigen I/II or PAc) of the cariogenic bacterium Streptococcus mutans is a cell surface-localized protein involved in sucrose-independent adhesion and colonization of the tooth surface. The immunoreactive and adhesive properties of S. mutans suggest an unusual functional quaternary ultrastructure comprised of intact P1 covalently attached to the cell wall and interacting with non-covalently associated proteolytic fragments thereof, particularly the ∼57-kDa C-terminal fragment C123 previously identified as Antigen II. S. mutans is capable of amyloid formation when grown in a biofilm and P1 is among its amyloidogenic proteins. The C123 fragment of P1 readily forms amyloid fibers in vitro suggesting it may play a role in the formation of functional amyloid during biofilm development. Using wild-type and P1-deficient strains of S. mutans, we demonstrate that solid state NMR (ssNMR) spectroscopy can be used to (1) globally characterize cell walls isolated from a Gram-positive bacterium and (2) characterize the specific binding of heterologously expressed, isotopically-enriched C123 to cell wall-anchored P1. Our results lay the groundwork for future high-resolution characterization of the C123/P1 ultrastructure and subsequent steps in biofilm formation via ssNMR spectroscopy, and they support an emerging model of S. mutans colonization whereby quaternary P1-C123 interactions confer adhesive properties important to binding to immobilized human salivary agglutinin

  14. Detection of fusobacterium nucleatum and fadA adhesin gene in patients with orthodontic gingivitis and non-orthodontic periodontal inflammation.

    Ping Liu

    Full Text Available Fusobacterium nucleatum is one of the most abundant gram-negative bacilli colonizing the subgingival plaque and closely associated with periodontal disease. However it is unclear whether F. nucleatum is involved in gingival inflammation under orthodontic appliance. A novel adhesin, FadA, which is unique to oral Fusobacteria, is required for F. nucleatum binding and invasion to epithelial cells and thus may play an important role in colonization of Fusobacterium in the host. In this study, we evaluated the prevalence of F. nucleatum and its virulence factor FadA adhesion gene (fadA in 169 subgingival biofilm samples from 55 cases of gingivitis patients with orthodontic appliances, 49 cases of gingivitis patients without orthodontic treatment, 35 cases of periodontitis patients and 30 cases of periodontally healthy people via PCR. The correlations between the F. nucleatum/fadA and gingivitis index(GIwas also analyzed. The detection rate of F. nucleatum/fadA in periodontitis group and non-orthodontic gingivitis group was higher than the other two groups (p<0.01 while it was higher in orthodontic gingivitis group than in health people (p<0.05. An obviously positive correlation was observed between the prevalence of F. nucleatum/fadA and GI. F. nucleatum carrying fadA may be more closely related to the development of gingivitis and periodontal disease compared with orthodontic gingivitis.

  15. Detection of fusobacterium nucleatum and fadA adhesin gene in patients with orthodontic gingivitis and non-orthodontic periodontal inflammation.

    Liu, Ping; Liu, Yi; Wang, Jianning; Guo, Yang; Zhang, Yujie; Xiao, Shuiqing

    2014-01-01

    Fusobacterium nucleatum is one of the most abundant gram-negative bacilli colonizing the subgingival plaque and closely associated with periodontal disease. However it is unclear whether F. nucleatum is involved in gingival inflammation under orthodontic appliance. A novel adhesin, FadA, which is unique to oral Fusobacteria, is required for F. nucleatum binding and invasion to epithelial cells and thus may play an important role in colonization of Fusobacterium in the host. In this study, we evaluated the prevalence of F. nucleatum and its virulence factor FadA adhesion gene (fadA) in 169 subgingival biofilm samples from 55 cases of gingivitis patients with orthodontic appliances, 49 cases of gingivitis patients without orthodontic treatment, 35 cases of periodontitis patients and 30 cases of periodontally healthy people via PCR. The correlations between the F. nucleatum/fadA and gingivitis index(GI)was also analyzed. The detection rate of F. nucleatum/fadA in periodontitis group and non-orthodontic gingivitis group was higher than the other two groups (pgingivitis group than in health people (pgingivitis and periodontal disease compared with orthodontic gingivitis. PMID:24416378

  16. The Yersinia adhesin YadA collagen-binding domain structure is a novel left-handed parallel beta-roll.

    Nummelin, Heli; Merckel, Michael C; Leo, Jack C; Lankinen, Hilkka; Skurnik, Mikael; Goldman, Adrian

    2004-02-25

    The crystal structure of the recombinant collagen-binding domain of Yersinia adhesin YadA from Yersinia enterocolitica serotype O:3 was solved at 1.55 A resolution. The trimeric structure is composed of head and neck regions, and the collagen binding head region is a novel nine-coiled left-handed parallel beta-roll. Before the beta-roll, the polypeptide loops from one monomer to the rest, and after the beta-roll the neck region does the same, making the transition from the globular head region to the narrower stalk domain. This creates an intrinsically stable 'lock nut' structure. The trimeric form of YadA is required for collagen binding, and mutagenesis of its surface residues allowed identification of a putative collagen-binding surface. Furthermore, a new structure-sequence motif for YadA beta-roll was used to identify putative YadA-head-like domains in a variety of human and plant pathogens. Such domains may therefore be a common bacterial strategy for avoiding host response. PMID:14765110

  17. The Yersinia adhesin YadA collagen-binding domain structure is a novel left-handed parallel β-roll

    Nummelin, Heli; Merckel, Michael C; Leo, Jack C; Lankinen, Hilkka; Skurnik, Mikael; Goldman, Adrian

    2004-01-01

    The crystal structure of the recombinant collagen-binding domain of Yersinia adhesin YadA from Yersinia enterocolitica serotype O:3 was solved at 1.55 Å resolution. The trimeric structure is composed of head and neck regions, and the collagen binding head region is a novel nine-coiled left-handed parallel β-roll. Before the β-roll, the polypeptide loops from one monomer to the rest, and after the β-roll the neck region does the same, making the transition from the globular head region to the narrower stalk domain. This creates an intrinsically stable ‘lock nut' structure. The trimeric form of YadA is required for collagen binding, and mutagenesis of its surface residues allowed identification of a putative collagen-binding surface. Furthermore, a new structure–sequence motif for YadA β-roll was used to identify putative YadA-head-like domains in a variety of human and plant pathogens. Such domains may therefore be a common bacterial strategy for avoiding host response. PMID:14765110

  18. Purification, crystallization and preliminary X-ray diffraction analysis of the carbohydrate-binding region of the Streptococcus gordonii adhesin GspB

    Pyburn, Tasia M.; Yankovskaya, Victoria; Bensing, Barbara A.; Cecchini, Gary; Sullam, Paul M.; Iverson, T.M. (VA); (Vanderbilt); (UCSF)

    2012-07-11

    The carbohydrate-binding region of the bacterial adhesin GspB from Streptococcus gordonii strain M99 (GspB{sub BR}) was expressed in Escherichia coli and purified using affinity and size-exclusion chromatography. Separate sparse-matrix screening of GspB{sub BR} buffered in either 20 mM Tris pH 7.4 or 20 mM HEPES pH 7.5 resulted in different crystallographic behavior such that different precipitants, salts and additives supported crystallization of GspB{sub BR} in each buffer. While both sets of conditions supported crystal growth in space group P2{sub 1}2{sub 1}2{sub 1}, the crystals had distinct unit-cell parameters of a = 33.3, b = 86.7, c = 117.9 {angstrom} for crystal form 1 and a = 34.6, b = 98.3, c = 99.0 {angstrom} for crystal form 2. Additive screening improved the crystals grown in both conditions such that diffraction extended to beyond 2 {angstrom} resolution. A complete data set has been collected to 1.3 {angstrom} resolution with an overall R{sub merge} value of 0.04 and an R{sub merge} value of 0.33 in the highest resolution shell.

  19. Lcl of Legionella pneumophila Is an Immunogenic GAG Binding Adhesin That Promotes Interactions with Lung Epithelial Cells and Plays a Crucial Role in Biofilm Formation ▿

    Duncan, Carla; Prashar, Akriti; So, Jannice; Tang, Patrick; Low, Donald E.; Terebiznik, Mauricio; Guyard, Cyril

    2011-01-01

    Legionellosis is mostly caused by Legionella pneumophila and is defined by a severe respiratory illness with a case fatality rate ranging from 5 to 80%. In vitro and in vivo, interactions of L. pneumophila with lung epithelial cells are mediated by the sulfated glycosaminoglycans (GAGs) of the host extracellular matrix. In this study, we have identified several Legionella heparin binding proteins. We have shown that one of these proteins, designated Lcl, is a polymorphic adhesin of L. pneumophila that is produced during legionellosis. Homologues of Lcl are ubiquitous in L. pneumophila serogroups but are undetected in other Legionella species. Recombinant Lcl binds to GAGs, and a Δlpg2644 mutant demonstrated reduced binding to GAGs and human lung epithelial cells. Importantly, we showed that the Δlpg2644 strain is dramatically impaired in biofilm formation. These data delineate the role of Lcl in the GAG binding properties of L. pneumophila and provide molecular evidence regarding its role in L. pneumophila adherence and biofilm formation. PMID:21422183

  20. Lcl of Legionella pneumophila is an immunogenic GAG binding adhesin that promotes interactions with lung epithelial cells and plays a crucial role in biofilm formation.

    Duncan, Carla; Prashar, Akriti; So, Jannice; Tang, Patrick; Low, Donald E; Terebiznik, Mauricio; Guyard, Cyril

    2011-06-01

    Legionellosis is mostly caused by Legionella pneumophila and is defined by a severe respiratory illness with a case fatality rate ranging from 5 to 80%. In vitro and in vivo, interactions of L. pneumophila with lung epithelial cells are mediated by the sulfated glycosaminoglycans (GAGs) of the host extracellular matrix. In this study, we have identified several Legionella heparin binding proteins. We have shown that one of these proteins, designated Lcl, is a polymorphic adhesin of L. pneumophila that is produced during legionellosis. Homologues of Lcl are ubiquitous in L. pneumophila serogroups but are undetected in other Legionella species. Recombinant Lcl binds to GAGs, and a Δlpg2644 mutant demonstrated reduced binding to GAGs and human lung epithelial cells. Importantly, we showed that the Δlpg2644 strain is dramatically impaired in biofilm formation. These data delineate the role of Lcl in the GAG binding properties of L. pneumophila and provide molecular evidence regarding its role in L. pneumophila adherence and biofilm formation. PMID:21422183

  1. Cilium adhesin P216 (MHJ_0493) is a target of ectodomain shedding and aminopeptidase activity on the surface of Mycoplasma hyopneumoniae.

    Tacchi, Jessica L; Raymond, Benjamin B A; Jarocki, Veronica M; Berry, Iain J; Padula, Matthew P; Djordjevic, Steven P

    2014-06-01

    MHJ_0493 (P216) is a highly expressed cilium adhesin in Mycoplasma hyopneumoniae. P216 undergoes cleavage at position 1074 in the S/T-X-F↓-X-D/E-like motif (1072)T-N-F↓Q-E(1076) generating N-terminal and C-terminal fragments of 120 kDa (P120) and 85 kDa (P85) on the surface of M. hyopneumoniae. Here we show that several S/T-X-F↓X-D/E-like motifs exist in P216 but only (1072)T-N-F↓Q-E(1076) and (1344)I-T-F↓A-D-Y(1349) were determined to be bona fide processing sites by identifying semitryptic peptides consistent with cleavage at the phenylalanine residue. The location of S/T-X-F↓-X-D/E-like motifs within or abutting regions of protein disorder greater than 40 consecutive amino acids is consistent with our hypothesis that site access influences the cleavage efficiency. Approximately 20 cleavage fragments of P216 were identified on the surface of M. hyopneumoniae by LC-MS/MS analysis of biotinylated proteins and 2D SDS-PAGE. LC-MS/MS analysis of semitryptic peptides within P216 identified novel cleavage sites. Moreover, detection of a series of overlapping semitryptic peptides that differed by the loss a single amino acid at their N-terminus is consistent with aminopeptidase activity on the surface of M. hyopneumoniae. P120 and P85 and their cleavage fragments bind heparin and cell-surface proteins derived from porcine epithelial-like cells, indicating that P216 cleavage fragments retain the ability to bind glycosaminoglycans. PMID:24804907

  2. A multifaceted study of stigma/style cysteine-rich adhesin (SCA)-like Arabidopsis lipid transfer proteins (LTPs) suggests diversified roles for these LTPs in plant growth and reproduction

    Chae, Keun; Gonong, Benedict J.; Kim, Seung-Chul; Kieslich, Chris A.; Morikis, Dimitrios; Balasubramanian, Shruthi; Lord, Elizabeth M

    2010-01-01

    Lily stigma/style cysteine-rich adhesin (SCA), a plant lipid transfer protein (LTP) which is secreted into the extracellular matrix, functions in pollen tube guidance in fertilization. A gain-of-function mutant (ltp5-1) for Arabidopsis LTP5, an SCA-like molecule, was recently shown to display defects in sexual reproduction. In the current study, it is reported that ltp5-1 plants have dwarfed primary shoots, delayed hypocotyl elongation, various abnormal tissue fusions, and display multibranch...

  3. The knockdown of each component of the cysteine proteinase-adhesin complex of Entamoeba histolytica (EhCPADH) affects the expression of the other complex element as well as the in vitro and in vivo virulence.

    Ocádiz-Ruiz, Ramón; Fonseca, Wendy; Linford, Alicia S; Yoshino, Timothy P; Orozco, Esther; Rodríguez, Mario A

    2016-01-01

    Entamoeba histolytica is the protozoan parasite causative of human amoebiasis, disease responsible for 40 000-100 000 deaths annually. The cysteine proteinase-adhesin complex of this parasite (EhCPADH) is a heterodimeric protein formed by a cysteine protease (EhCP112) and an adhesin (EhADH) that plays an important role in the cytopathic mechanism of this parasite. The coding genes for EhCP112 and EhADH are adjacent in the E. histolytica genome, suggesting that their expression may be co-regulated, but this hypothesis has not yet been confirmed. Here, we performed the knockdown of EhCP112 and EhADH using gene-specific short-hairpin RNAs (shRNA), and the effect of these knockdowns on the expression of both complex components as well as on the in vitro and in vivo virulence was analysed. Results showed that the knockdown of one of the EhCPADH components produced a simultaneous downregulation of the other protein. Accordingly, a concomitant reduction in the overall expression of the complex was observed. The downregulation of each component also produced a significant decrease in the in vitro and in vivo virulence of trophozoites. These results demonstrated that the expression of EhCP112 and EhADH is co-regulated and confirmed that the EhCPADH complex plays an important role in E. histolytica virulence. PMID:26521708

  4. Enhanced immunogenicity of pneumococcal surface adhesin A (PsaA in mice via fusion to recombinant human B lymphocyte stimulator (BLyS

    Mambula Salamatu S

    2011-02-01

    Full Text Available Abstract Background B lymphocyte stimulator (BLyS is a member of the tumor necrosis factor superfamily of ligands that mediates its action through three known receptors. BLyS has been shown to enhance the production of antibodies against heterologous antigens when present at elevated concentrations, supporting an immunostimulatory role for BLyS in vivo. Methods We constructed a fusion protein consisting of human BLyS and Pneumococcal Surface Adhesin A (PsaA and used this molecule to immunize mice. The immunostimulatory attributes mediated by BLyS in vivo were evaluated by characterizing immune responses directed against PsaA. Results The PsaA-BLyS fusion protein was able to act as a co-stimulant for murine spleen cell proliferation induced with F(ab'2 fragments of anti-IgM in vitro in a fashion similar to recombinant BLyS, and immunization of mice with the PsaA-BLyS fusion protein resulted in dramatically elevated serum antibodies specific for PsaA. Mice immunized with PsaA admixed with recombinant BLyS exhibited only modest elevations in PsaA-specific responses following two immunizations, while mice immunized twice with PsaA alone exhibited undetectable PsaA-specific serum antibody responses. Sera obtained from PsaA-BLyS immunized mice exhibited high titers of IgG1, IgG2a, IgG2b, and IgG3, but no IgA, while mice immunized with PsaA admixed with BLyS exhibited only elevated titers of IgG1 following two immunizations. Splenocytes from PsaA-BLyS immunized mice exhibited elevated levels of secretion of IL-2, IL-4 and IL-5, and a very modest but consistent elevation of IFN-γ following in vitro stimulation with PsaA. In contrast, mice immunized with either PsaA admixed with BLyS or PsaA alone exhibited modestly elevated to absent PsaA-specific recall responses for the same cytokines. Mice deficient for one of the three receptors for BLyS designated Transmembrane activator, calcium modulator, and cyclophilin ligand [CAML] interactor (TACI exhibited

  5. Potential use of a recombinant replication-defective adenovirus vector carrying the C-terminal portion of the P97 adhesin protein as a vaccine against Mycoplasma hyopneumoniae in swine.

    Okamba, Faust René; Arella, Maximilien; Music, Nedzad; Jia, Jian Jun; Gottschalk, Marcelo; Gagnon, Carl A

    2010-07-01

    Mycoplasma hyopneumoniae causes severe economic losses to the swine industry worldwide and the prevention of its related disease, enzootic porcine pneumonia, remains a challenge. The P97 adhesin protein of M. hyopneumoniae should be a good candidate for the development of a subunit vaccine because antibodies produced against P97 could prevent the adhesion of the pathogen to the respiratory epithelial cells in vitro. In the present study, a P97 recombinant replication-defective adenovirus (rAdP97c) subunit vaccine efficiency was evaluated in pigs. The rAdP97c vaccine was found to induce both strong P97 specific humoral and cellular immune responses. The rAdP97c vaccinated pigs developed a lower amount of macroscopic lung lesions (18.5 + or - 9.6%) compared to the unvaccinated and challenged animals (45.8 + or - 11.5%). rAdP97c vaccine reduced significantly the severity of inflammatory response and the amount of M. hyopneumoniae in the respiratory tract. Furthermore, the average daily weight gain was slightly improved in the rAdP97c vaccinated pigs (0.672 + or - 0.068 kg/day) compared to the unvaccinated and challenged animals (0.568 + or - 0.104 kg/day). A bacterin-based commercial vaccine (Suvaxyn MH-one) was more efficient to induce a protective immune response than rAdP97c even if it did not evoke a P97 specific immune response. These results suggest that immunodominant antigens other than P97 adhesin are also important in the induction of a protective immune response and should be taken into account in the future development of M. hyopneumoniae subunit vaccines. PMID:20472025

  6. Role of ARF6, Rab11 and external Hsp90 in the trafficking and recycling of recombinant-soluble Neisseria meningitidis adhesin A (rNadA in human epithelial cells.

    Giuseppe Bozza

    Full Text Available Neisseria meningitidis adhesin A (NadA is a meningococcus surface protein thought to assist in the adhesion of the bacterium to host cells. We have previously shown that NadA also promotes bacterial internalization in a heterologous expression system. Here we have used the soluble recombinant NadA (rNadA lacking the membrane anchor region to characterize its internalization route in Chang epithelial cells. Added to the culture medium, rNadA internalizes through a PI3K-dependent endocytosis process not mediated by the canonical clathrin or caveolin scaffolds, but instead follows an ARF6-regulated recycling pathway previously described for MHC-I. The intracellular pool of rNadA reaches a steady state level within one hour of incubation and colocalizes in endocytic vesicles with MHC-I and with the extracellularly labeled chaperone Hsp90. Treatment with membrane permeated and impermeable Hsp90 inhibitors 17-AAG and FITC-GA respectively, lead to intracellular accumulation of rNadA, strongly suggesting that the extracellular secreted pool of the chaperone is involved in rNadA intracellular trafficking. A significant number of intracellular vesicles containing rNadA recruit Rab11, a small GTPase associated to recycling endosomes, but do not contain transferrin receptor (TfR. Interestingly, cell treatment with Hsp90 inhibitors, including the membrane-impermeable FITC-GA, abolished Rab11-rNadA colocalization but do not interfere with Rab11-TfR colocalization. Collectively, these results are consistent with a model whereby rNadA internalizes into human epithelial cells hijacking the recycling endosome pathway and recycle back to the surface of the cell via an ARF6-dependent, Rab11 associated and Hsp90-regulated mechanism. The present study addresses for the first time a meningoccoccal adhesin mechanism of endocytosis and suggests a possible entry pathway engaged by N. meningitidis in primary infection of human epithelial cells.

  7. Immunization with the Haemophilus ducreyi trimeric autotransporter adhesin DsrA with alum, CpG or imiquimod generates a persistent humoral immune response that recognizes the bacterial surface.

    Samo, Melissa; Choudhary, Neelima R; Riebe, Kristina J; Shterev, Ivo; Staats, Herman F; Sempowski, Gregory D; Leduc, Isabelle

    2016-02-24

    The Ducreyi serum resistance A (DsrA) protein of Haemophilus ducreyi belongs to a large family of multifunctional outer membrane proteins termed trimeric autotransporter adhesins responsible for resistance to the bactericidal activity of human complement (serum resistance), agglutination and adhesion. The ability of DsrA to confer serum resistance and bind extracellular matrix proteins lies in its N-terminal passenger domain. We have previously reported that immunization with a recombinant form of the passenger domain of DsrA, rNT-DsrA, in complete/incomplete Freund's adjuvant, protects against a homologous challenge in swine. We present herein the results of an immunogenicity study in mice aimed at investigating the persistence, type of immune response, and the effect of immunization route and adjuvants on surrogates of protection. Our results indicate that a 20 μg dose of rNT-DsrA administered with alum elicited antisera with comparable bacterial surface reactivity to that obtained with complete/incomplete Freund's adjuvant. At that dose, high titers and bacterial surface reactivity persisted for 211 days after the first immunization. Administration of rNT-DsrA with CpG or imiquimod as adjuvants elicited a humoral response with similar quantity and quality of antibodies (Abs) as seen with Freund's adjuvant. Furthermore, intramuscular administration of rNT-DsrA elicited high-titer Abs with significantly higher reactivity to the bacterial surface than those obtained with subcutaneous immunization. All rNT-DsrA/adjuvant combinations tested, save CpG, elicited a Th2-type response. Taken together, these findings show that a 20 μg dose of rNT-DsrA administered with the adjuvants alum, CpG or imiquimod elicits high-quality Abs with reactivity to the bacterial surface that could protect against an H. ducreyi infection. PMID:26812077

  8. The pneumococcal surface adhesin A (PsaA) protein and its application in conjugate vaccine%肺炎球菌PsaA抗原及其在结合疫苗中的应用

    樊小英; 薛红刚; 郭蓉; 胡菁; 卢佳丽; 朱越雄

    2011-01-01

    目的 应用基因工程技术表达和制备肺炎链球菌表面黏附素A(pneumococcal surface adhesin A,PsaA),并与细菌荚膜多糖耦联制备成多糖蛋白结合疫苗,探讨PsaA作为肺炎球菌蛋白载体在增强结合疫苗中其他细菌多糖抗原的免疫原性的同时,还能获得对肺炎球菌的抗体反应,从而达到用一种结合疫苗能诱导出针对两种细菌的抗体免疫应答的目的 .方法 从肺炎链球菌基因组中扩增psaA基因,将目的 基因插入原核表达载体pET-28a,获得重组质粒pET28a-psaA,通过转化进入大肠杆菌BL21中,经IPTG诱导,采用DEAE-阴离子交换层析法纯化基因重组rPsaA蛋白.将纯化到的rPsaA蛋白与A群脑膜炎荚膜多糖(group A meningococcal polysaccharide,GAMP)耦联成多糖蛋白结合疫苗后,用小鼠动物模型进行免疫实验,检测该疫苗的免疫原性,用ELISA法测定该疫苗在小鼠体内产生的针对肺炎球菌和脑膜炎球菌两种病原菌特异性抗原的抗体水平.结果 成功克隆基因重组表达质粒,而且表达的PsaA蛋白在载体上的组氨酸标签之前终止表达,不带有组氨酸标签,保证疫苗的安全性.SDS-PAGE技术分析表明:rPsaA蛋白高效表达,约为菌体蛋白的60%,蛋白质相对分子质量约为37×103,而且蛋白的可溶性好,不形成包涵体,用DEAE-阴离子交换层析法纯化其纯度可达80%以上.纯化到的PsaA蛋白与荚膜多糖耦联成功,应用于小鼠免疫实验,PsaA蛋白载体能显著增强A群脑膜炎荚膜多糖抗原的免疫原性,并同时产生针对肺炎球菌蛋白抗原和脑膜炎球菌多糖抗原的特异性抗体.结论 利用基因工程技术获得无组氨酸标签的PsaA蛋白,并将它与A群脑膜炎荚膜多糖耦联,可以在增强荚膜多糖抗原免疫原性的同时,提高疫苗的免疫保护效果,探讨了给儿童接种一种疫苗能同时预防肺炎和脑膜炎两种传染病的可能性.%Objective To express and purify the

  9. Fimbrial adhesins from extraintestinal Escherichia coli

    Klemm, Per; Hancock, Viktoria; Schembri, Mark A.

    2010-01-01

    Extraintestinal pathogenic Escherichia coli (ExPEC) represent an important subclass of E. coli that cause a wide spectrum of diseases in human and animal hosts. Fimbriae are key virulence factors of ExPEC strains. These long surface located rod-shaped organelles mediate receptor-specific attachment...

  10. Phage display and immunological identification of efficient T- and B-combined antigenic epitopes in Helicobacter pylori adhesin A%幽门螺杆菌黏附素A有效T和B联合抗原表位噬菌体展示和抗原性测定

    罗冬娇; 严瑾; 冯雪鸣; 丁威; 俞利平; 陈小囡; 严杰

    2010-01-01

    目的 分析并确定幽门螺杆菌黏附素A(HpaA)分子中有效T细胞和B细胞联合(T/B)抗原表位.方法 重组表达HpaA(rHpaA)并免疫家兔制备抗血清.采用生物信息学技术预测和分析HpaA分子中T细胞和B细胞表位,PCB扩增T/B联合表位肽片段并构建其噬菌体展示系统.采用PEG/NaCl沉淀法提纯展示了T/B联合表位的重组噬菌体PⅢ蛋白(rPⅢ).分别以商品化幽门螺杆菌全菌IgG抗体和rHpaA抗血清为一抗,采用Western blot和ELISA对rPⅢ蛋白中展示的T/B联合表位进行筛选和鉴定.采用MTT检测rHpaA免疫小鼠脾细胞在不同重组噬菌体蛋白刺激下的增殖情况.结果 HpaA分子中共有5个T/B联合表位:HpaA10、HpaA37、HpaA79、HpaA116和HpaA143.所有T/B联合表位均成功地展示于M13噬菌体PⅢ蛋白表面.Western blot、ELISA和淋巴细胞增殖试验结果 均显示,HpaA116是优势抗原表位,HpaA37和HpaA79为有效抗原表位,HpaA10和HpaA143为无效抗原表位.结论 本研究成功地构建了幽门螺杆菌HpaA的T/B联合表位肽噬菌体展示系统.HpaA37和HpaA79,尤其是HpaA116是HpaA有效T/B联合抗原表位.%Objective To analyze and determine the efficient T- and B-combined (T/B) antigenic epitopes in Helicobacter pylori adhesin A. Methods Recombinant HpaA (rHpaA) was expressed for immunizing rabbit to generate antiserum. T- and B-cell epitopes in HpaA molecule were predicted by using bioinformatic technique. The segments to encode T/B combined epitope peptides were amplified by PCR and the phage display systems of T/B combined epitopes were subsequently constructed. PEG/NaCl precipitation method was applied to extract the recombinant phage PⅢ (rPⅢ) that displayed T/B combined epitopes. By using either commercial IgG against whole-cell of Helicobacter pylori or rHpaA antiserum as the primary antibody, the T/B combined epitopes displayed in rP Ⅲ s were screened and identified by Western blot and ELISA. MTT was applied to

  11. Bioaccumulation of heavy metals by fimbrial designer adhesins

    Schembri, Mark; Kjærgaard, Kristian; Klemm, Per

    1999-01-01

    . By serial selection and enrichment procedures specific sequences were identified which conferred the ability on recombinant cells to adhere to various metal oxides (PbO2, CoO, MnO2, Cr2O3 ) The properties inherent in these sequences permitted the distinct recognition of metals to varying degrees...... for the bioaccumulation of heavy metals from the environment. (C) 1999 Federation of European Microbiological Societies. Published by Elsevier Science B.V. All rights reserved....

  12. Structural and molecular insights into novel surface-exposed mucus adhesins from Lactobacillus reuteri human strains.

    Etzold, Sabrina; MacKenzie, Donald A; Jeffers, Faye; Walshaw, John; Roos, Stefan; Hemmings, Andrew M; Juge, Nathalie

    2014-05-01

    The mucus layer covering the gastrointestinal tract is the first point of contact of the intestinal microbiota with the host. Cell surface macromolecules are critical for adherence of commensal bacteria to mucus but structural information is scarce. Here we report the first molecular and structural characterization of a novel cell-surface protein, Lar_0958 from Lactobacillus reuteri JCM 1112(T) , mediating adhesion of L. reuteri human strains to mucus. Lar_0958 is a modular protein of 133 kDa containing six repeat domains, an N-terminal signal sequence and a C-terminal anchoring motif (LPXTG). Lar_0958 homologues are expressed on the cell-surface of L. reuteri human strains, as shown by flow-cytometry and immunogold microscopy. Adhesion of human L. reuteri strains to mucus in vitro was significantly reduced in the presence of an anti-Lar_0958 antibody and Lar_0958 contribution to adhesion was further confirmed using a L. reuteri ATCC PTA 6475 lar_0958 KO mutant (6475-KO). The X-ray crystal structure of a single Lar_0958 repeat, determined at 1.5 Å resolution, revealed a divergent immunoglobulin (Ig)-like β-sandwich fold, sharing structural homology with the Ig-like inter-repeat domain of internalins of the food borne pathogen Listeria monocytogenes. These findings provide unique structural insights into cell-surface protein repeats involved in adhesion of Gram-positive bacteria to the intestine. PMID:24593252

  13. Filamentous hemagglutinin of Bordetella pertussis: a key adhesin with immunomodulatory properties?

    Villarino Romero, Rodrigo; Osička, Radim; Šebo, Peter

    2014-01-01

    Roč. 9, č. 12 (2014), s. 1339-1360. ISSN 1746-0913 R&D Projects: GA ČR(CZ) P302/11/0580; GA ČR(CZ) GA13-14547S Institutional support: RVO:61388971 Keywords : Bordetella * adhesion * integrins * filamentous hemagglutinin Subject RIV: EE - Microbiology, Virology Impact factor: 4.275, year: 2014

  14. VARIABILITY OF PHENOTYPIC, PROTEOMIC AND TRANSCRIPTOMIC EXPRESSION OF STAPHYLOCOCCUS AUREUS SURFACE ADHESINS

    Ythier M.

    2012-01-01

    Staphylococcus aureus is a highly successful pathogen responsible of a wide variety of diseases, from minor skin infection to life-threatening sepsis or infective endocarditis, as well as food poisoning and toxic shock syndrome. This heterogeneity of infections and the ability of S. aureus to develop antibiotic-resistance to virtually any available drugs reflect its extraordinary capacity to adapt and survive in a great variety of environments. The pathogenesis of S. aureus infection involves...

  15. Characterization of two heparan sulphate-binding sites in the mycobacterial adhesin Hlp

    Previato Jose O

    2008-05-01

    Full Text Available Abstract Background The histone-like Hlp protein is emerging as a key component in mycobacterial pathogenesis, being involved in the initial events of host colonization by interacting with laminin and glycosaminoglycans (GAGs. In the present study, nuclear magnetic resonance (NMR was used to map the binding site(s of Hlp to heparan sulfate and identify the nature of the amino acid residues directly involved in this interaction. Results The capacity of a panel of 30 mer synthetic peptides covering the full length of Hlp to bind to heparin/heparan sulfate was analyzed by solid phase assays, NMR, and affinity chromatography. An additional active region between the residues Gly46 and Ala60 was defined at the N-terminal domain of Hlp, expanding the previously defined heparin-binding site between Thr31 and Phe50. Additionally, the C-terminus, rich in Lys residues, was confirmed as another heparan sulfate binding region. The amino acids in Hlp identified as mediators in the interaction with heparan sulfate were Arg, Val, Ile, Lys, Phe, and Thr. Conclusion Our data indicate that Hlp interacts with heparan sulfate through two distinct regions of the protein. Both heparan sulfate-binding regions here defined are preserved in all mycobacterial Hlp homologues that have been sequenced, suggesting important but possibly divergent roles for this surface-exposed protein in both pathogenic and saprophic species.

  16. Identification of Mannheimia haemolytica Adhesins Involved in Binding to Bovine Bronchial Epithelial Cells▿

    Kisiela, Dagmara I.; Czuprynski, Charles J.

    2008-01-01

    Mannheimia haemolytica, a commensal organism of the upper respiratory tract in cattle, is the principal bacterial pathogen associated with the bovine respiratory disease complex. Adherence to the respiratory mucosa is a crucial event in its pathogenesis. However, the bacterial components that contribute to this process are not fully characterized. In this study, we demonstrated that M. haemolytica adhered to bovine bronchial epithelial cells (BBEC) in vitro and that adherence was inhibited by...

  17. Structure determination and analysis of a haemolytic gingipain adhesin domain from Porphyromonas gingivalis

    Li, N.; Yun, P.; Nadkarni, M.A.; Ghadikolaee, N.B.; Nguyen, K.A.; Lee, M.; Hunter, N.; Collyer, C.A. (Sydney)

    2010-08-27

    Porphyromonas gingivalis is an obligately anaerobic bacterium recognized as an aetiological agent of adult periodontitis. P. gingivalis produces cysteine proteinases, the gingipains. The crystal structure of a domain within the haemagglutinin region of the lysine gingipain (Kgp) is reported here. The domain was named K2 as it is the second of three homologous structural modules in Kgp. The K2 domain structure is a 'jelly-roll' fold with two anti-parallel {beta}-sheets. This fold topology is shared with adhesive domains from functionally diverse receptors such as MAM domains, ephrin receptor ligand binding domains and a number of carbohydrate binding modules. Possible functions of K2 were investigated. K2 induced haemolysis of erythrocytes in a dose-dependent manner that was augmented by the blocking of anion transport. Further, cysteine-activated arginine gingipain RgpB, which degrades glycophorin A, sensitized erythrocytes to the haemolytic effect of K2. Cleaved K2, similar to that found in extracted Kgp, lacks the haemolytic activity indicating that autolysis of Kgp may be a staged process which is artificially enhanced by extraction of the protein. The data indicate a functional role for K2 in the integrated capacity conferred by Kgp to enable the porphyrin auxotroph P. gingivalis to capture essential haem from erythrocytes.

  18. A genomic region involved in the formation of adhesin fibers in Bacillus cereus biofilms

    Joaquín eCaro-Astorga

    2015-01-01

    Full Text Available Bacillus cereus is a bacterial pathogen that is responsible for many recurrent disease outbreaks due to food contamination. Spores and biofilms are considered the most important reservoirs of B. cereus in contaminated fresh vegetables and fruits. Biofilms are bacterial communities that are difficult to eradicate from biotic and abiotic surfaces because of their stable and extremely strong extracellular matrix. These extracellular matrixes contain exopolysaccharides, proteins, extracellular DNA, and other minor components. Although B. cereus can form biofilms, the bacterial features governing assembly of the protective extracellular matrix are not known. Using the well-studied bacterium B. subtilis as a model, we identified two genomic loci in B. cereus, which encodes two orthologs of the amyloid-like protein TasA of B. subtilis and a SipW signal peptidase. Deletion of this genomic region in B. cereus inhibited biofilm assembly; notably, mutation of the putative signal peptidase SipW caused the same phenotype. However, mutations in tasA or calY did not completely prevent biofilm formation; strains that were mutated for either of these genes formed phenotypically different surface attached biofilms. Electron microscopy studies revealed that TasA polymerizes to form long and abundant fibers on cell surfaces, whereas CalY does not aggregate similarly. Heterologous expression of this amyloid-like cassette in a B. subtilis strain lacking the factors required for the assembly of TasA amyloid-like fibers revealed i the involvement of this B. cereus genomic region in formation of the air-liquid interphase pellicles and ii the intrinsic ability of TasA to form fibers similar to the amyloid-like fibers produced by its B. subtilis ortholog.

  19. Influence of divalent cations and pH adsorption of a bacterial polysaccharide adhesin

    Bhosle, N.B.; Suci, P.A.; Baty, A.M.; Weiner, R.M.; Geesey, G.G.

    structure, are more “deformable” (15) and therefore may provide a versatile set of interactions which are directly related to functional group chemistry (16), and can be catered to serve specific types of adhesive functions to inert surfaces. In support... isolated and partially characterized. Studies of its adsorption behavior indicated fr2ps bound relatively strongly to an oxide surface (germanium) when ranked against an acidic polysaccharide (alginate), globular blood proteins, and a disordered protein...

  20. Functional Characterization of a Mucus-Specific LPXTG Surface Adhesin from Probiotic Lactobacillus rhamnosus GG ▿

    von Ossowski, I; Satokari, R.; Reunanen, J.; Lebeer, Sarah; De Keersmaecker, Sigrid; Vanderleyden, Jos; DE VOS W.M.; Palva, A.

    2011-01-01

    In spite of the wealth of clinical evidence supporting the health benefits of Lactobacillus rhamnosus GG in humans, there is still a lack of understanding of the molecular mechanisms behind its probiosis. Current knowledge suggests that the health-promoting effects of this probiotic strain might be partly dependent on its persistence in the intestine and adhesion to mucosal surfaces. Moreover, L. rhamnosus GG contains mucus-binding pili that might also explain the occupation of its ecological...

  1. Functional characterization of a mucus-specific LPXTG surface adhesin from probiotic Lactobacillus rhamnosus GG

    Ossowski, von, I.; Vos, de, W.M.; Palva, A.

    2011-01-01

    In spite of the wealth of clinical evidence supporting the health benefits of Lactobacillus rhamnosus GG in humans, there is still a lack of understanding of the molecular mechanisms behind its probiosis. Current knowledge suggests that the health-promoting effects of this probiotic strain might be partly dependent on its persistence in the intestine and adhesion to mucosal surfaces. Moreover, L. rhamnosus GG contains mucus-binding pili that might also explain the occupation of its ecological...

  2. Lucilia sericata Chymotrypsin Disrupts Protein Adhesin-Mediated Staphylococcal Biofilm Formation

    Harris, Llinos G.; Nigam, Yamni; Sawyer, James; Mack, Dietrich; Pritchard, David I.

    2013-01-01

    Staphylococcus aureus and Staphylococcus epidermidis biofilms cause chronic infections due to their ability to form biofilms. The excretions/secretions of Lucilia sericata larvae (maggots) have effective activity for debridement and disruption of bacterial biofilms. In this paper, we demonstrate how chymotrypsin derived from maggot excretions/secretions disrupts protein-dependent bacterial biofilm formation mechanisms.

  3. Identification of Burkholderia mallei and Burkholderia pseudomallei adhesins for human respiratory epithelial cells

    Hogan Robert J; Wooten Ronald M; Grose William; Lazarus John J; Lipski Serena; Balder Rachel; Woods Donald E; Lafontaine Eric R

    2010-01-01

    Abstract Background Burkholderia pseudomallei and Burkholderia mallei cause the diseases melioidosis and glanders, respectively. A well-studied aspect of pathogenesis by these closely-related bacteria is their ability to invade and multiply within eukaryotic cells. In contrast, the means by which B. pseudomallei and B. mallei adhere to cells are poorly defined. The purpose of this study was to identify adherence factors expressed by these organisms. Results Comparative sequence analyses ident...

  4. Biofilm formation as a function of adhesin, growth medium, substratum and strain type

    Hancock, Viktoria; Witsø, Ingun Lund; Klemm, Per

    2011-01-01

    Biofilm formation is involved in the majority of bacterial infections. Comparing six Escherichia coli and Klebsiella pneumoniae isolates revealed significant differences in biofilm formation depending on the growth medium. Fimbriae are known to be involved in biofilm formation, and type 1, F1C and...

  5. Plasmodium falciparum Adhesins Play an Essential Role in Signalling and Activation of Invasion into Human Erythrocytes.

    Wai-Hong Tham

    2015-12-01

    Full Text Available The most severe form of malaria in humans is caused by the protozoan parasite Plasmodium falciparum. The invasive form of malaria parasites is termed a merozoite and it employs an array of parasite proteins that bind to the host cell to mediate invasion. In Plasmodium falciparum, the erythrocyte binding-like (EBL and reticulocyte binding-like (Rh protein families are responsible for binding to specific erythrocyte receptors for invasion and mediating signalling events that initiate active entry of the malaria parasite. Here we have addressed the role of the cytoplasmic tails of these proteins in activating merozoite invasion after receptor engagement. We show that the cytoplasmic domains of these type 1 membrane proteins are phosphorylated in vitro. Depletion of PfCK2, a kinase implicated to phosphorylate these cytoplasmic tails, blocks P. falciparum invasion of red blood cells. We identify the crucial residues within the PfRh4 cytoplasmic domain that are required for successful parasite invasion. Live cell imaging of merozoites from these transgenic mutants show they attach but do not penetrate erythrocytes implying the PfRh4 cytoplasmic tail conveys signals important for the successful completion of the invasion process.

  6. RIFINs are adhesins implicated in severe Plasmodium falciparum malaria

    Goel, Suchi; Palmkvist, Mia; Moll, Kirsten;

    2015-01-01

    Rosetting is a virulent Plasmodium falciparum phenomenon associated with severe malaria. Here we demonstrate that P. falciparum–encoded repetitive interspersed families of polypeptides (RIFINs) are expressed on the surface of infected red blood cells (iRBCs), where they bind to RBCs—preferentiall......Rosetting is a virulent Plasmodium falciparum phenomenon associated with severe malaria. Here we demonstrate that P. falciparum–encoded repetitive interspersed families of polypeptides (RIFINs) are expressed on the surface of infected red blood cells (iRBCs), where they bind to RBCs......—preferentially of blood group A—to form large rosettes and mediate microvascular binding of iRBCs. We suggest that RIFINs have a fundamental role in the development of severe malaria and thereby contribute to the varying global distribution of ABO blood groups in the human population....

  7. Phenotypical characterization and adhesin identification in Escherichia coli strains isolated from dogs with urinary tract infections

    Renato Pariz Maluta

    2012-03-01

    Full Text Available Pathogenic strains of Escherichia coli are the most common bacteria associated with urinary tract infections in both humans and companion animals. Standard biochemical tests may be useful in demonstrating detailed phenotypical characteristics of these strains. Thirteen strains of E. coli isolated from dogs with UTIs were submitted to biochemical tests, serotyping for O and H antigens and antimicrobial resistance testing. Furthermore, the presence of papC, sfa, and afa genes was evaluated by PCR, and genetic relationships were established using enterobacterial repetitive intergenic consensus PCR (ERIC-PCR. The antimicrobial that showed the highest resistance rate among the isolates was nalidixic acid (76.9%, followed by cephalotin (69.2%, sulfamethoxazole + trimethoprim (61.5%, tetracycline (61.5%, streptomycin (53.8%, ciprofloxacin (53.8%, ampicillin (46.2%, gentamicin (30.8% and chloramphenicol (23.1%. No isolate was resistant either to meropenem or nitrofurantoin. Among the five clusters that were identified using ERIC-PCR, one cluster (A had only one strain, which belonged to a serotype with zoonotic potential (O6:H31 and showed the genes papC+, sfa+, afa-. Strains with the genes papC-, sfa+, afa- were found in two other clusters (C and D, whereas all strains in clusters B and E possessed papC-, sfa-, afa- genes. Sucrose and raffinose phenotypic tests showed some ability in discriminating clusters A, B and C from clusters D and E.

  8. A Communal Bacterial Adhesin Anchors Biofilm and Bystander Cells to Surfaces

    Absalon, Cedric; Van Dellen, Katrina; Paula I. Watnick

    2011-01-01

    Author Summary The bacterial multilayer biofilm consists of matrix-enclosed cells attached to each other to form large aggregates. The base of these aggregates may be attached to a living or non-living surface. The biofilm matrix most often contains at least one exopolysaccharide component and may also contain protein and DNA. While much is known about the exopolysaccharide component of the Gram-negative biofilm matrix, little is known about the function of biofilm matrix proteins. We hypothe...

  9. Adherence of Candida albicans germ tubes to plastic: ultrastructural and molecular studies of fibrillar adhesins.

    Tronchin, G; Bouchara, J P; Robert, R; Senet, J M

    1988-01-01

    Germ tubes of Candida albicans produced an additional fibrillar surface layer responsible for enhanced adherence to plastic. The correlation between germination of C. albicans and adherence of germ tubes to a plastic matrix led us to consider the existence of germ tube-specific adhesive components involved in the attachment process. Using concanavalin A-sensitized latex microspheres, we first detected extracellular molecules on the plastic surface after removal of the adherent germ tubes. Ele...

  10. Association of number of tandem repeats in two important adhesins in Mycoplasma hyopneumoniae

    L. F. dos Santos

    2015-10-01

    Full Text Available RESUMODiversidade genética de Mycoplasma hyopneumoniae tem sido relatada em análise múltipla de repetições em tandem em número variável (MLVA. O objetivo deste estudo foi descrever a distribuição espacial e a heterogeneidade genética de tipos de M. hyopneumoniae no Brasil, bem como investigar a correlação entre regiões de repetição 1 (RR1 e 3 (RR3 de duas adesinas importantes (P97 e P146. Foram identificados 39 tipos de MLVA baseados no número de repetições em tandem em P97 RR1 e RR3 P146. A correlação negativa significativa (Spearman's rho = -0,26; P = 0,022 entre P97 RR1 e RR3 P146 foi observada, o que sugere um possível mecanismo compensatório que permitiria a bactéria manter a sua capacidade de adesão. Os resultados contribuem para compreender a epidemiologia das M. hyopneumoniae no quarto maior país produtor de suínos do mundo.

  11. DNA as an Adhesin: Bacillus cereus Requires Extracellular DNA To Form Biofilms▿ †

    Vilain, Sébastien; Pretorius, Jakobus M.; Theron, Jacques; Brözel, Volker S.

    2009-01-01

    The soil saprophyte Bacillus cereus forms biofilms at solid-liquid interfaces. The composition of the extracellular polymeric matrix is not known, but biofilms of other bacteria are encased in polysaccharides, protein, and also extracellular DNA (eDNA). A Tn917 screen for strains impaired in biofilm formation at a solid-liquid interface yielded several mutants. Three mutants deficient in the purine biosynthesis genes purA, purC, and purL were biofilm impaired, but they grew planktonically lik...

  12. Valency conversion in the type 1 fimbrial adhesin of Escherichia coli

    Sokurenko, E.V.; Schembri, Mark; Trintchina, E.; Kjærgaard, Kristian; Hasty, D.L.; Klemm, Per

    2001-01-01

    FimH protein is a lectin-like adhesive subunit of type 1, or mannose-sensitive, fimbriae that are found on the surface of most Escherichia coli strains. All naturally occurring FimH variants demonstrate a conserved mannotriose-specific (i.e. multivalent) binding. Here, we demonstrate that replace...

  13. Phenotypical characterization and adhesin identification in Escherichia coli strains isolated from dogs with urinary tract infections.

    Maluta, Renato Pariz; Stella, Ariel Eurides; Riccardi, Kátia; Rigobelo, Everlon Cid; Marin, José Moacir; Carvalho, Marileda Bonafim; de Ávila, Fernando Antonio

    2012-01-01

    Pathogenic strains of Escherichia coli are the most common bacteria associated with urinary tract infections in both humans and companion animals. Standard biochemical tests may be useful in demonstrating detailed phenotypical characteristics of these strains. Thirteen strains of E. coli isolated from dogs with UTIs were submitted to biochemical tests, serotyping for O and H antigens and antimicrobial resistance testing. Furthermore, the presence of papC, sfa, and afa genes was evaluated by PCR, and genetic relationships were established using enterobacterial repetitive intergenic consensus PCR (ERIC-PCR). The antimicrobial that showed the highest resistance rate among the isolates was nalidixic acid (76.9%), followed by cephalotin (69.2%), sulfamethoxazole + trimethoprim (61.5%), tetracycline (61.5%), streptomycin (53.8%), ciprofloxacin (53.8%), ampicillin (46.2%), gentamicin (30.8%) and chloramphenicol (23.1%). No isolate was resistant either to meropenem or nitrofurantoin. Among the five clusters that were identified using ERIC-PCR, one cluster (A) had only one strain, which belonged to a serotype with zoonotic potential (O6:H31) and showed the genes papC+, sfa+, afa-. Strains with the genes papC-, sfa+, afa- were found in two other clusters (C and D), whereas all strains in clusters B and E possessed papC-, sfa-, afa- genes. Sucrose and raffinose phenotypic tests showed some ability in discriminating clusters A, B and C from clusters D and E. PMID:24031842

  14. Delivery of a Chlamydial Adhesin N-PmpC Subunit Vaccine to the Ocular Mucosa Using Particulate Carriers.

    Aleksandra Inic-Kanada

    Full Text Available Trachoma, caused by the intracellular bacterium Chlamydia trachomatis (Ct, remains the world's leading preventable infectious cause of blindness. Recent attempts to develop effective vaccines rely on modified chlamydial antigen delivery platforms. As the mechanisms engaged in the pathology of the disease are not fully understood, designing a subunit vaccine specific to chlamydial antigens could improve safety for human use. We propose the delivery of chlamydia-specific antigens to the ocular mucosa using particulate carriers, bacterial ghosts (BGs. We therefore characterized humoral and cellular immune responses after conjunctival and subcutaneous immunization with a N-terminal portion (amino acid 1-893 of the chlamydial polymorphic membrane protein C (PmpC of Ct serovar B, expressed in probiotic Escherichia coli Nissle 1917 bacterial ghosts (EcN BGs in BALB/c mice. Three immunizations were performed at two-week intervals, and the immune responses were evaluated two weeks after the final immunization in mice. In a guinea pig model of ocular infection animals were immunized in the same manner as the mice, and protection against challenge was assessed two weeks after the last immunization. N-PmpC was successfully expressed within BGs and delivery to the ocular mucosa was well tolerated without signs of inflammation. N-PmpC-specific mucosal IgA levels in tears yielded significantly increased levels in the group immunized via the conjunctiva compared with the subcutaneously immunized mice. Immunization with N-PmpC EcN BGs via both immunization routes prompted the establishment of an N-PmpC-specific IFNγ immune response. Immunization via the conjunctiva resulted in a decrease in intensity of the transitional inflammatory reaction in conjunctiva of challenged guinea pigs compared with subcutaneously and non-immunized animals. The delivery of the chlamydial subunit vaccine to the ocular mucosa using a particulate carrier, such as BGs, induced both humoral and cellular immune responses. Further investigations are needed to improve the immunization scheme and dosage.

  15. Delivery of a Chlamydial Adhesin N-PmpC Subunit Vaccine to the Ocular Mucosa Using Particulate Carriers.

    Inic-Kanada, Aleksandra; Stojanovic, Marijana; Schlacher, Simone; Stein, Elisabeth; Belij-Rammerstorfer, Sandra; Marinkovic, Emilija; Lukic, Ivana; Montanaro, Jacqueline; Schuerer, Nadine; Bintner, Nora; Kovacevic-Jovanovic, Vesna; Krnjaja, Ognjen; Mayr, Ulrike Beate; Lubitz, Werner; Barisani-Asenbauer, Talin

    2015-01-01

    Trachoma, caused by the intracellular bacterium Chlamydia trachomatis (Ct), remains the world's leading preventable infectious cause of blindness. Recent attempts to develop effective vaccines rely on modified chlamydial antigen delivery platforms. As the mechanisms engaged in the pathology of the disease are not fully understood, designing a subunit vaccine specific to chlamydial antigens could improve safety for human use. We propose the delivery of chlamydia-specific antigens to the ocular mucosa using particulate carriers, bacterial ghosts (BGs). We therefore characterized humoral and cellular immune responses after conjunctival and subcutaneous immunization with a N-terminal portion (amino acid 1-893) of the chlamydial polymorphic membrane protein C (PmpC) of Ct serovar B, expressed in probiotic Escherichia coli Nissle 1917 bacterial ghosts (EcN BGs) in BALB/c mice. Three immunizations were performed at two-week intervals, and the immune responses were evaluated two weeks after the final immunization in mice. In a guinea pig model of ocular infection animals were immunized in the same manner as the mice, and protection against challenge was assessed two weeks after the last immunization. N-PmpC was successfully expressed within BGs and delivery to the ocular mucosa was well tolerated without signs of inflammation. N-PmpC-specific mucosal IgA levels in tears yielded significantly increased levels in the group immunized via the conjunctiva compared with the subcutaneously immunized mice. Immunization with N-PmpC EcN BGs via both immunization routes prompted the establishment of an N-PmpC-specific IFNγ immune response. Immunization via the conjunctiva resulted in a decrease in intensity of the transitional inflammatory reaction in conjunctiva of challenged guinea pigs compared with subcutaneously and non-immunized animals. The delivery of the chlamydial subunit vaccine to the ocular mucosa using a particulate carrier, such as BGs, induced both humoral and cellular immune responses. Further investigations are needed to improve the immunization scheme and dosage. PMID:26656797

  16. Structural Context for Protein N-glycosylation in Bacteria: The Structure of PEB3, an Adhesin from Campylobacter Jejuni

    Rangarajan,E.; Bhatia, S.; Watson, D.; Munger, C.; Cygler, M.; Matte, A.; Young, N.

    2007-01-01

    Campylobacter jejuni is unusual among bacteria in possessing a eukaryotic-like system for N-linked protein glycosylation at Asn residues in sequons of the type Asp/Glu-Xaa-Asn-Xaa-Ser/Thr. However, little is known about the structural context of the glycosylated sequons, limiting the design of novel recombinant glycoproteins. To obtain more information on sequon structure, we have determined the crystal structure of the PEB3 (Cj0289c) dimer. PEB3 has the class II periplasmic-binding protein fold, with each monomer having two domains with a ligand-binding site containing citrate located between them, and overall resembles molybdate- and sulfate-binding proteins. The sequon around Asn90 is located within a surface-exposed loop joining two structural elements. The three key residues are well exposed on the surface; hence, they may be accessible to the PglB oligosaccharyltransferase in the folded state.

  17. Upregulation of the Adhesin Gene EPA1 Mediated by PDR1 in Candida glabrata Leads to Enhanced Host Colonization

    Vale-Silva, Luis A.; Moeckli, Beat; Torelli, Riccardo; Posteraro, Brunella; Sanguinetti, Maurizio; Sanglard, Dominique

    2016-01-01

    ABSTRACT Candida glabrata is the second most common Candida species causing disseminated infection, after C. albicans. C. glabrata is intrinsically less susceptible to the widely used azole antifungal drugs and quickly develops secondary resistance. Resistance typically relies on drug efflux with transporters regulated by the transcription factor Pdr1. Gain-of-function (GOF) mutations in PDR1 lead to a hyperactive state and thus efflux transporter upregulation. Our laboratory has characterize...

  18. Construction of attenuated Salmonella typhimurium Strain expressing Helicobacter pylori conservative region of adhesin antigen and its immunogenicity

    Yang Bai; Ya-Li Zhang; Ji-De Wang; Zhao-Shan Zhang; Dian-Yuan Zhou

    2004-01-01

    AIM: To construct a non-resistant and attenuated Salmonella typhimurium (S. typhimurium) strain which expresses conservative region of adhesion AB of Helicobacter pylori (H pylori) and evaluate its immunogenicity.METHODS: The AB gene amplified by PCR was inserted into the expression vector pYA248 containing asd gene and through two transformations introduced into the delta Cya, delta Crp, delta Asd attenuated Salmonella typhimurium strain, constructing balanced lethal attenuated Salmonella typhimurium strains X4072 (pYA248-AB). Bridged ELISA method was used to measure the expression of AB antigen in sonic ate and culture supernatant. According to the method described by Meacock, stability of the recombinant was evaluated. Semi-lethal capacity test was used to evaluate the safety of recombinant. The immunogenicity of recombinant was evaluated with animal experiments.RESULTS: The attenuated S. typhimurium X4072 (pYA248-AB) which expresses AB was successfully constructed.Furthermore, bridged ELISA assay showed that the content of AB in recombinant X4072 (pYA248- AB) culture supematant was higher than that was in thallus lyric liquor. And after recombinant X4072 (pYA248- AB) was cultured for 100generations without selection pressure, the entire recombinant bacteria selected randomly could grow, and the AB antigen was defected positive by ELISA. The growth curve of the recombinant bacteria showed that the growth states of X4072 (pYA248) and X4072 (pYA248-AB) were basically consistent. The survival rate of C57BL/6 was still 100%, at 30 d after mice taking X4072 (pYA248-AB) 1.0×1010 cfu orally. Oral immunization of mice with X4072 (pYA248-AB)induced a specific immune response.CONCLUSION: In vitro recombinant plasmid appears to be stable and experiments on animals showed that the recombinant strains were safe and immunogenic in vitro,which providing a new live oral vaccine candidate for protection and care of H pylori infection.

  19. The AgI/II family adhesin AspA is required for respiratory infection by Streptococcus pyogenes.

    Linda Franklin

    Full Text Available Streptococcus pyogenes (GAS is a human pathogen that causes pharyngitis and invasive diseases such as toxic shock syndrome and sepsis. The upper respiratory tract is the primary reservoir from which GAS can infect new hosts and cause disease. The factors involved in colonisation are incompletely known however. Previous evidence in oral streptococci has shown that the AgI/II family proteins are involved. We hypothesized that the AspA member of this family might be involved in GAS colonization. We describe a novel mouse model of GAS colonization of the nasopharynx and lower respiratory tract to elucidate these interactions. We used two clinical M serotypes expressing AspA, and their aspA gene deletant isogenic mutants in experiments using adherence assays to respiratory epithelium, macrophage phagocytosis and neutrophil killing assays and in vivo models of respiratory tract colonisation and infection. We demonstrated the requirement for AspA in colonization of the respiratory tract. AspA mutants were cleared from the respiratory tract and were deficient in adherence to epithelial cells, and susceptible to phagocytosis. Expression of AspA in the surrogate host Lactococcus lactis protected bacteria from phagocytosis. Our results suggest that AspA has an essential role in respiratory infection, and may function as a novel anti-phagocytic factor.

  20. Production of F4 Fimbrial Adhesin in Plants: a Model for Oral Porcine Vaccine against Enterotoxigenic Escherichia coli

    Joensuu, Jussi

    2006-01-01

    F4 fimbriae of enterotoxigenic Escherichia coli (ETEC) are highly stable multimeric structures with a capacity to evoke mucosal immune responses. With these characters F4 offer a unique model system to study oral vaccination against ETEC-induced porcine postweaning diarrhea. Postweaning diarrhea is a major problem in piggeries worldwide and results in significant economic losses. No vaccine is currently available to protect weaned piglets against ETEC infections. Transgenic plants provide an ...

  1. Two Arginine Residues of Streptococcus gordonii Sialic Acid-Binding Adhesin Hsa Are Essential for Interaction to Host Cell Receptors

    Urano-Tashiro, Yumiko; Takahashi, Yukihiro; Oguchi, Riyo; Konishi, Kiyoshi

    2016-01-01

    Hsa is a large, serine-rich protein of Streptococcus gordonii DL1 that mediates binding to α2-3-linked sialic acid termini of glycoproteins, including platelet glycoprotein Ibα, and erythrocyte membrane protein glycophorin A, and band 3. The binding of Hsa to platelet glycoprotein Ibα contributes to the pathogenesis of infective endocarditis. This interaction appears to be mediated by a second non-repetitive region (NR2) of Hsa. However, the molecular details of the interaction between the Hsa NR2 region and these glycoproteins are not well understood. In the present study, we identified the amino acid residues of the Hsa NR2 region that are involved in sialic acid recognition. To identify the sialic acid-binding site of Hsa NR2 region, we prepared various mutants of Hsa NR2 fused with glutathione transferase. Fusion proteins harboring Arg340 to Asn (R340N) or Arg365 to Asn (R365N) substitutions in the NR2 domain exhibited significantly reduced binding to human erythrocytes and platelets. A sugar-binding assay showed that these mutant proteins abolished binding to α2-3-linked sialic acid. Furthermore, we established S. gordonii DL1 derivatives that encoded the corresponding Hsa mutant protein. In whole-cell assays, these mutant strains showed significant reductions in hemagglutination, in platelet aggregation, and in adhesion to human leukocytes. These results indicate that the Arg340 and Arg365 residues of Hsa play an important role in the binding of Hsa to α2-3-linked sialic acid-containing glycoproteins. PMID:27101147

  2. Fibronectin Binding to the Treponema pallidum Adhesin Protein Fragment rTp0483 on Functionalized Self-Assembled Monolayers

    Dickerson, Matthew T.; Abney, Morgan B.; Cameron, Caroline E.; Knecht, Marc; Bachas, Leonidas G.; Anderson, Kimberly W.

    2012-01-01

    Past work has shown that Treponema pallidum, the causative agent of syphilis, binds host fibronectin (FN). FN and other host proteins are believed to bind to rare outer membrane proteins (OMPs) of T. pallidum, and it is postulated that this interaction may facilitate cell attachment and mask antigenic targets on the surface. This research seeks to prepare a surface capable of mimicking the FN binding ability of T. pallidum in order to investigate the impact of FN binding with adsorbed Tp0483 on the host response to the surface. By understanding this interaction it may be possible to develop more effective treatments for infection and possibly mimic the stealth properties of the bacteria. Functionalized self-assembled monolayers (SAMs) on0 gold were used to investigate rTp0483 and FN adsorption. Using a quartz crystal microbalance (QCM) rTp0483 adsorption and subsequent FN adsorption onto rTp0483 was determined to be higher on negatively charged carboxylate-terminated self-assembled monolayers (−COO− SAMs) compared to the other surfaces analyzed. Kinetic analysis of rTp0483 adsorption using surface plasmon resonance (SPR) supported this finding. Kinetic analysis of FN adsorption using SPR revealed a multi-step event, where the concentration of immobilized rTp0483 plays a role in FN binding. An examination of relative QCM dissipation energy compared to the shift in frequency showed a correlation between the physical properties of adsorbed rTp0483 and SAM surface chemistry. In addition, AFM images of rTp0483 on selected SAMs illustrated a preference of rTp0483 to bind as aggregates. Adsorption on −COO− SAMs was more uniform across the surface, which may help further explain why FN bound more strongly. rTp0483 antibody studies suggested the involvement of amino acids 274–289 and 316–333 in binding between rTp0483 to FN, while a peptide blocking study only showed inhibition of binding with amino acids 316–333. Finally, surface adsorbed rTp0483 with FN bound significantly less anti-RGD and gelatin compared to FN adsorbed directly to −COO− SAMs indicating that one or both binding regions may play a role in binding between rTp0483 and FN. PMID:22175441

  3. Modulation of Fibronectin Adhesins and Other Virulence Factors in a Teicoplanin-Resistant Derivative of Methicillin-Resistant Staphylococcus aureus

    Renzoni, Adriana; Francois, Patrice; Li, Dongmei; Kelley, William L.; Lew, Daniel P.; Vaudaux, Pierre; Schrenzel, Jacques

    2004-01-01

    The impact of glycopeptide resistance on the molecular regulation of Staphylococcus aureus virulence and attachment to host tissues is poorly documented. We compared stable teicoplanin-resistant methicillin-resistant S. aureus (MRSA) strain 14-4 with its teicoplanin-susceptible MRSA parent, strain MRGR3, which exhibits a high degree of virulence in a rat model of chronic foreign body MRSA infection. The levels of fibronectin-mediated adhesion and surface display of fibronectin-binding proteins were higher in teicoplanin-resistant strain 14-4 than in its teicoplanin-susceptible parent or a teicoplanin-susceptible revertant (strain 14-4rev) that spontaneously emerged during tissue cage infection. Quantitative reverse transcription-PCR (qRT-PCR) showed four- and twofold higher steady-state levels of fnbA and fnbB transcripts, respectively, in strain 14-4 than in its teicoplanin-susceptible counterparts. Analysis of global regulatory activities by qRT-PCR revealed a strong reduction in the steady-state levels of RNAIII and RNAII in the teicoplanin-resistant strain compared to in its teicoplanin-susceptible counterparts. In contrast, sarA mRNA levels were more than fivefold higher in strain 14-4 than in MRGR3 and 14-4rev. Furthermore, the alternative transcription factor sigma B had a higher level of functional activity in the teicoplanin-resistant strain than in its teicoplanin-susceptible counterparts, as evidenced by significant increases in both the sigma B-dependent asp23 mRNA levels and the sarA P3 promoter-derived transcript levels, as assayed by qRT-PCR and Northern blotting, respectively. These data provide further evidence that the emergence of glycopeptide resistance is linked by still poorly understood molecular pathways with significant pleiotropic changes in the expression and regulation of some major virulence genes. These molecular and phenotypic changes may have a profound impact on the bacterial adhesion and colonization properties of such multiresistant organisms. PMID:15273106

  4. Modulation of Fibronectin Adhesins and Other Virulence Factors in a Teicoplanin-Resistant Derivative of Methicillin-Resistant Staphylococcus aureus

    Renzoni, Adriana; Francois, Patrice; Li, Dongmei; Kelley, William L; Lew, Daniel P.; Vaudaux, Pierre; Schrenzel, Jacques

    2004-01-01

    The impact of glycopeptide resistance on the molecular regulation of Staphylococcus aureus virulence and attachment to host tissues is poorly documented. We compared stable teicoplanin-resistant methicillin-resistant S. aureus (MRSA) strain 14-4 with its teicoplanin-susceptible MRSA parent, strain MRGR3, which exhibits a high degree of virulence in a rat model of chronic foreign body MRSA infection. The levels of fibronectin-mediated adhesion and surface display of fibronectin-binding protein...

  5. Molecular Variability of the Adhesin-Encoding Gene pvpA among Mycoplasma gallisepticum Strains and Its Application in Diagnosis

    Liu, T.; García, M; Levisohn, S.; Yogev, D.; Kleven, S. H.

    2001-01-01

    Mycoplasma gallisepticum is an important pathogen of chickens and turkeys that causes considerable economic losses to the poultry industry worldwide. The reemergence of M. gallisepticum outbreaks among poultry, the increased use of live M. gallisepticum vaccines, and the detection of M. gallisepticum in game and free-flying song birds has strengthened the need for molecular diagnostic and strain differentiation tests. Molecular techniques, including restriction fragment length polymorphism of...

  6. The multifunctional LigB adhesin binds homeostatic proteins with potential roles in cutaneous infection by pathogenic Leptospira interrogans.

    Henry A Choy

    Full Text Available Leptospirosis is a potentially fatal zoonotic disease in humans and animals caused by pathogenic spirochetes, such as Leptospira interrogans. The mode of transmission is commonly limited to the exposure of mucous membrane or damaged skin to water contaminated by leptospires shed in the urine of carriers, such as rats. Infection occurs during seasonal flooding of impoverished tropical urban habitats with large rat populations, but also during recreational activity in open water, suggesting it is very efficient. LigA and LigB are surface localized proteins in pathogenic Leptospira strains with properties that could facilitate the infection of damaged skin. Their expression is rapidly induced by the increase in osmolarity encountered by leptospires upon transition from water to host. In addition, the immunoglobulin-like repeats of the Lig proteins bind proteins that mediate attachment to host tissue, such as fibronectin, fibrinogen, collagens, laminin, and elastin, some of which are important in cutaneous wound healing and repair. Hemostasis is critical in a fresh injury, where fibrinogen from damaged vasculature mediates coagulation. We show that fibrinogen binding by recombinant LigB inhibits fibrin formation, which could aid leptospiral entry into the circulation, dissemination, and further infection by impairing healing. LigB also binds fibroblast fibronectin and type III collagen, two proteins prevalent in wound repair, thus potentially enhancing leptospiral adhesion to skin openings. LigA or LigB expression by transformation of a nonpathogenic saprophyte, L. biflexa, enhances bacterial adhesion to fibrinogen. Our results suggest that by binding homeostatic proteins found in cutaneous wounds, LigB could facilitate leptospirosis transmission. Both fibronectin and fibrinogen binding have been mapped to an overlapping domain in LigB comprising repeats 9-11, with repeat 11 possibly enhancing binding by a conformational effect. Leptospirosis patient antibodies react with the LigB domain, suggesting applications in diagnosis and vaccines that are currently limited by the strain-specific leptospiral lipopolysaccharide coats.

  7. The multifunctional LigB adhesin binds homeostatic proteins with potential roles in cutaneous infection by pathogenic Leptospira interrogans.

    Choy, Henry A; Kelley, Melissa M; Croda, Julio; Matsunaga, James; Babbitt, Jane T; Ko, Albert I; Picardeau, Mathieu; Haake, David A

    2011-01-01

    Leptospirosis is a potentially fatal zoonotic disease in humans and animals caused by pathogenic spirochetes, such as Leptospira interrogans. The mode of transmission is commonly limited to the exposure of mucous membrane or damaged skin to water contaminated by leptospires shed in the urine of carriers, such as rats. Infection occurs during seasonal flooding of impoverished tropical urban habitats with large rat populations, but also during recreational activity in open water, suggesting it is very efficient. LigA and LigB are surface localized proteins in pathogenic Leptospira strains with properties that could facilitate the infection of damaged skin. Their expression is rapidly induced by the increase in osmolarity encountered by leptospires upon transition from water to host. In addition, the immunoglobulin-like repeats of the Lig proteins bind proteins that mediate attachment to host tissue, such as fibronectin, fibrinogen, collagens, laminin, and elastin, some of which are important in cutaneous wound healing and repair. Hemostasis is critical in a fresh injury, where fibrinogen from damaged vasculature mediates coagulation. We show that fibrinogen binding by recombinant LigB inhibits fibrin formation, which could aid leptospiral entry into the circulation, dissemination, and further infection by impairing healing. LigB also binds fibroblast fibronectin and type III collagen, two proteins prevalent in wound repair, thus potentially enhancing leptospiral adhesion to skin openings. LigA or LigB expression by transformation of a nonpathogenic saprophyte, L. biflexa, enhances bacterial adhesion to fibrinogen. Our results suggest that by binding homeostatic proteins found in cutaneous wounds, LigB could facilitate leptospirosis transmission. Both fibronectin and fibrinogen binding have been mapped to an overlapping domain in LigB comprising repeats 9-11, with repeat 11 possibly enhancing binding by a conformational effect. Leptospirosis patient antibodies react with the LigB domain, suggesting applications in diagnosis and vaccines that are currently limited by the strain-specific leptospiral lipopolysaccharide coats. PMID:21347378

  8. Characterization of Streptococcus gordonii (S. sanguis) PK488 adhesin-mediated coaggregation with Actinomyces naeslundii PK606.

    Kolenbrander, P. E.; Andersen, R N

    1990-01-01

    Intergeneric coaggregation of Streptococcus gordonii (S. sanguis) PK488 and Actinomyces naeslundii PK606 was studied by using coaggregation-defective (Cog-) mutants of both strains. A streptococcal protein of 38 kilodaltons was identified with anti-S. gordonii serum absorbed with Cog- cells of the streptococcus. Absorbed immunoglobulin G specifically blocked coaggregation of the streptococcus-actinomyces pair but did not affect the coaggregation of the streptococcus with other coaggregation p...

  9. Cloning of the Streptococcus gordonii PK488 gene, encoding an adhesin which mediates coaggregation with Actinomyces naeslundii PK606.

    Andersen, R N; Ganeshkumar, N.; Kolenbrander, P. E.

    1993-01-01

    Coaggregation between Streptococcus gordonii PK488 and Actinomyces naeslundii PK606 is mediated by a 38-kDa streptococcal protein, designated ScaA. The gene, scaA, which encodes this protein has been cloned into Escherichia coli. A genomic S. gordonii PK488 library (in Lambda ZAP II) was screened with anti-S. gordonii immunoglobulin G absorbed with S. gordonii PK1804, an isogenic coaggregation-defective mutant of strain PK488. A positive recombinant phage was isolated, and a phagemid designat...

  10. Adhesion to human cells by Escherichia coli lacking the major subunit of a digalactoside-specific pilus-adhesin.

    Uhlin, B E; Norgren, M; Båga, M; Normark, S

    1985-01-01

    Pathogenic bacteria frequently possess pili with specific binding properties that allow them to attach to epithelial tissue. In Escherichia coli, the pili associated with pyelonephritis (Pap pili) bind to digalactoside-containing glycolipids on the uroepithelium. Transposon-insertion mutants and deletion mutants of the cloned genetic determinant encoding synthesis of such digalactoside-binding Pap pili have been studied in E. coli K-12. Mutants that completely lack synthesis of the major Pap ...

  11. Allelic Variation of the Lyme Disease Spirochete Adhesin DbpA Influences Spirochetal Binding to Decorin, Dermatan Sulfate, and Mammalian Cells▿

    Benoit, Vivian M.; Fischer, Joshua R.; Lin, Yi-Pin; Parveen, Nikhat; Leong, John M.

    2011-01-01

    After transmission by an infected tick, the Lyme disease spirochete, Borrelia burgdorferi sensu lato, colonizes the mammalian skin and may disseminate systemically. The three major species of Lyme disease spirochete—B. burgdorferi sensu stricto, B. garinii, and B. afzelii—are associated with different chronic disease manifestations. Colonization is likely promoted by the ability to bind to target tissues, and Lyme disease spirochetes utilize multiple adhesive molecules to interact with divers...

  12. Biofilm formation in Bacillus thuringiensis : Investigation of the roles of a putative cell surface adhesin and a chemotaxis-related protein responsive to cyclic-di-GMP

    2010-01-01

    The Bacillus cereus group of bacteria is a subgroup in the Bacillus genus and consists of six different species. Research has evolved mainly around B. cereus, B. thuringiensis and B. anthracis, an opportunistic pathogen capable of food poisoning and infections in mammals, an insecticidal pathogen which can also be an opportunistic pathogen in mammals, and an opportunistic pathogen capable of causing cutaneous and or/systemic anthrax in mammals, respectively. These species are closely related ...

  13. Cloning and characterization of the S fimbrial adhesin (SfaII) complex of an Escherichia coli O18:K1 meningitis isolate

    Hacker, Jörg; Kestler, H; Hoschützky, H; Jann, K; Lottspeich, F; Korhonen, T K

    2011-01-01

    S fimbrial adbesins (Sfa), which are able to recognize sialic acid-containing receptors on eukaryotic cells, are produced by Escherichia coli strains causing urinary tract infections or newbom meningitis. We recently described tbe cloning and molecular cbaracterization of a determinant, termed sftJI, from the chromosome of an E. coli urinary tract infection strain. Herewe present data conceming a S fimbria-specific gene duster, designated sfall, of an E. coli newbom meningitis strain. Like tb...

  14. Probing the receptor recognition site of the FimH adhesin by fimbriae-displayed FimH-FocH hybrids

    Knudsen, Thomas Borch; Klemm, Per

    1998-01-01

    H. Surprisingly, it was also found that similar fusions containingbetween 56 and 66% FimH still conferred binding to yeast cells, D-mannose-BSA and D-mannose-beads but did not give riseto agglutination. The receptor binding capacity of fusions containing 50% or less of the FimH N-terminal region was...... virtuallyabolished. The results point to the presence of a D-mannose-receptor-binding core domain in FimH, the affinity of which ismodulated by other sectors of the protein to enable binding to extended mannose-containing targets....

  15. Helicobacter pylori adhesion and patho-adaptation : the role of BabA and SabA adhesins in persistent infection and chronic inflammation

    Mahdavi, Jafar

    2004-01-01

    Helicobacter pylori (H. pylori) is a human-specific gastric pathogen which is responsible for a spectrum of diseases ranging from superficial gastritis to gastric and duodenal ulceration, and which is also highly associated with gastric cancer. The pathogenesis of severe gastric disorders caused by H. pylori is multifactorial and involves complex interactions between the microbe and the gastric mucosa. H. pylori expresses several adhesion proteins. These molecules have important roles in the ...

  16. Generation of an attenuated Salmonella-delivery strains expressing adhesin and toxin antigens for progressive atrophic rhinitis, and evaluation of its immune responses in a murine model.

    Byeon, Hoyeon; Hur, Jin; Kim, Bo Ram; Lee, John Hwa

    2014-09-01

    An expression/secretion plasmid containing genes encoding the FimA, CP39, PtfA, ToxA and F1P2 antigens associated with porcine pneumonic pasteurellosis and progressive atrophic rhinitis (PAR) was constructed and harbored in an attenuated Salmonella Typhimurium, which was used as the vaccine candidate. The immune responses induced by this delivery strain were investigated in a murine model. Each antigen secreted from the delivery strain was confirmed by Western blot analysis. Thirty BALB/c mice were divided equally into two groups; group A were intranasally inoculated with the mixture of the five delivery strains, and group B were inoculated with sterile PBS. In group A, all antigen-specific serum IgG were significantly increased compared to those of group B from the 2nd week post-inoculation (WPI) till the 8th WPI. All antigen-specific mucosal IgA in group A were also significantly greater than those of group B. In addition, the significant splenic lymphocyte proliferative responses, the elevations of CD3(+)CD4(+), CD3(+)CD8(+) and B-cell populations, and the induction of IFN-γ expression in group A were observed. In conclusion, the mixture of five delivery strains expressing specific antigen for these diseases was found to be capable of inducing significant humoral and cellular immune responses. PMID:25045826

  17. Induction of Fibronectin Adhesins in Quinolone-Resistant Staphylococcus aureus by Subinhibitory Levels of Ciprofloxacin or by Sigma B Transcription Factor Activity Is Mediated by Two Separate Pathways

    Li, Dongmei; Renzoni, Adriana; Estoppey, Tristan; Bisognano, Carmelo; Francois, Patrice; Kelley, William L; Lew, Daniel P.; Schrenzel, Jacques; Vaudaux, Pierre

    2005-01-01

    We recently reported on the involvement of a RecA-LexA-dependent pathway in the ciprofloxacin-triggered upregulation of fibronectin-binding proteins (FnBPs) by fluoroquinolone-resistant Staphylococcus aureus. The potential additional contribution of the transcription factor sigma B (SigB) to the ciprofloxacin-triggered upregulation of FnBPs was studied in isogenic mutants of fluoroquinolone-resistant strain RA1 (a topoisomerase IV gyrase double mutant of S. aureus NCTC strain 8325), which exh...

  18. Induction of Fibronectin Adhesins in Quinolone-Resistant Staphylococcus aureus by Subinhibitory Levels of Ciprofloxacin or by Sigma B Transcription Factor Activity Is Mediated by Two Separate Pathways

    Li, Dongmei; Renzoni, Adriana; Estoppey, Tristan; Bisognano, Carmelo; Francois, Patrice; Kelley, William L.; Lew, Daniel P.; Schrenzel, Jacques; Vaudaux, Pierre

    2005-01-01

    We recently reported on the involvement of a RecA-LexA-dependent pathway in the ciprofloxacin-triggered upregulation of fibronectin-binding proteins (FnBPs) by fluoroquinolone-resistant Staphylococcus aureus. The potential additional contribution of the transcription factor sigma B (SigB) to the ciprofloxacin-triggered upregulation of FnBPs was studied in isogenic mutants of fluoroquinolone-resistant strain RA1 (a topoisomerase IV gyrase double mutant of S. aureus NCTC strain 8325), which exhibited widely different levels of SigB activity, as assessed by quantitative reverse transcription-PCR of their respective sigB and SigB-dependent asp23 transcript levels. These mutants were Tn551 insertion sigB strain TE1 and rsbU+ complemented strain TE2, which exhibited a wild-type SigB operon. Levels of FnBP surface display and fibronectin-mediated adhesion were lower in sigB mutant TE1 or higher in the rsbU+-restored strain TE2 compared to their sigB+ but rsbU parent, strain RA1, exhibiting low levels of SigB activity. Steady-state fnbA and fnbB transcripts levels were similar in strains TE1 and RA1 but increased by 4- and 12-fold, respectively, in strain TE2 compared to those in strain RA1. In contrast, fibronectin-mediated adhesion of strains TE1, RA1, and TE2 was similarly enhanced by growth in the presence of one-eighth the MIC of ciprofloxacin, which led to a significantly higher increase in their fnbB transcript levels compared to the increase in their fnbA transcript levels. Increased SigB levels led to a significant reduction in agr RNAIII; in contrast, it led to a slight increase in sarA transcript levels. In conclusion, upregulation of FnBPs by increased SigB levels and ciprofloxacin exposure in fluoroquinolone-resistant S. aureus occurs via independent pathways whose concerted actions may significantly promote bacterial adhesion and colonization. PMID:15728884

  19. Suppression subtractive hybridization identifies an autotransporter adhesin gene of E. coli IMT5155 specifically associated with avian pathogenic Escherichia coli (APEC)

    Dai Jianjun; Wang Shaohui; Guerlebeck Doreen; Laturnus Claudia; Guenther Sebastian; Shi Zhenyu; Lu Chengping; Ewers Christa

    2010-01-01

    Abstract Background Extraintestinal pathogenic E. coli (ExPEC) represent a phylogenetically diverse group of bacteria which are implicated in a large range of infections in humans and animals. Although subgroups of different ExPEC pathotypes, including uropathogenic, newborn meningitis causing, and avian pathogenic E. coli (APEC) share a number of virulence features, there still might be factors specifically contributing to the pathogenesis of a certain subset of strains or a distinct pathoty...

  20. Functional identification of galactosyltransferases (SCGs) required for species-specific modifications of the lipophosphoglycan adhesin controlling Leishmania major-sand fly interactions.

    Dobson, Deborah E; Scholtes, Luella D; Valdez, Kelli E; Sullivan, Deborah R; Mengeling, Brenda J; Cilmi, Salvatore; Turco, Salvatore J; Beverley, Stephen M

    2003-05-01

    Lipophosphoglycan (LPG) is an abundant surface molecule that plays key roles in the infectious cycle of Leishmania major. The dominant feature of LPG is a polymer of phosphoglycan (PG) (6Galbeta1,4Manalpha1-PO(4)) repeating units. In L. major these are extensively substituted with Gal(beta1,3) side chains, which are required for binding to midgut lectins and survival. We utilized evolutionary polymorphisms in LPG structure and cross-species transfections to recover genes encoding the LPG side chain beta1,3-galactosyltransferases (betaGalTs). A dispersed family of six SCG genes was recovered, whose predicted proteins exhibited characteristics of eukaryotic GalTs. At least four of these proteins showed significant LPG side chain betaGalT activity; SCG3 exhibited initiating GalT activity whereas SCG2 showed both initiating and elongating GalT activity. However, the activity of SCG2 was context-dependent, being largely silent in its normal genomic milieu, and different strains show considerable variation in the extent of LPG galactosylation. Thus the L. major genome encodes a family of SCGs with varying specificity and activity, and we propose that strain-specific LPG galactosylation patterns reflect differences in their expression. PMID:12604613

  1. Spreading of genes encoding enterotoxins, haemolysins, adhesin and biofilm among methicillin resistant Staphylococcus aureus strains with staphylococcal cassette chromosome mec type IIIA isolated from burn patients.

    Motallebi, Mitra; Jabalameli, Fereshteh; Asadollahi, Kheirollah; Taherikalani, Morovat; Emaneini, Mohammad

    2016-08-01

    The emergence of antibiotic-resistant Staphylococcus aureus in particular methicillin-resistant S. aureus (MRSA) is an important concern in burn medical centers either in Iran or worldwide. A total of 128 S. aureus isolates were collected from wound infection of burn patients during June 2013 to June 2014. Multiplex-polymerase chain reaction (MPCR) assay was performed for the characterization of the staphylococcal cassette chromosome mec (SCCmec). Genes encoding virulence factors and biofilm were targeted by PCR. Of 128 S. aureus isolates, 77 (60.1%) isolates were MRSA. Fifty four (70.1%) isolates were identified as SCCmec type IIIA. The most frequently detected toxin genes among MRSA isolates with SCCmec type IIIA were sea (64.1%) and hla (51.8%). The rate of coexistence of sea with hla and sea with hla and hlb was 37% and12.9%, respectively. The sec, eta, tst, pvl, hla and hlb genes were not detected in any of the MRSA isolates. The most prevalent genes encoding biofilm was eno, found in 61.1% of isolates, followed by fib and icaA found in 48.1% and 38.8% of the isolates, respectively. The rate of coexistence of fib + eno + icaA + icaD and fib + eno was 20.3% and 9.2%, respectively. The ebps gene was not detected in any of the isolates. In conclusion, our study indicated that the sea, hla, fib and icaA were most frequent genes encoding virulence factors among MRSA with SCCmec type IIIA isolated from burn wound infection. Moreover, the results of this study shows that the rate of coexistence of genes encoding different virulence factor were high. PMID:27238459

  2. Characterization of porcine-specific surface (S-) layer protein carrying Lactobacillus species, S-layer proteins and the adhesin of Escherichia coli F18 fimbriae

    Jakava-Viljanen, Miia

    2007-01-01

    Pigs coexist with diverse and dense commensal microbiota in their gastrointestinal tract (GIT). Lactobacilli, identified as common members of porcine intestinal microbiota, have been considered to be an important group of bacteria in maintaining the stability of GIT, in preventing intestinal infections and generally, in supporting intestinal health. Because several species of lactobacilli have GRAS (generally regarded as safe) status and some of them have an ability to interact with intestina...

  3. The PapG protein is the alpha-D-galactopyranosyl-(1----4)-beta-D-galactopyranose-binding adhesin of uropathogenic Escherichia coli.

    Lund, B; Lindberg, F; Marklund, B I; Normark, S

    1987-01-01

    Uropathogenic Escherichia coli adhere to uroepithelial cells by their digalactoside alpha-D-galactopyranosyl-(1----4)-beta-D-galactopyranose [alpha-D-Galp-(1----4)-beta-D-Galp or Gal alpha (1----4)Gal]-binding pili, which are composed of repeating identical subunits. The major subunit (PapA) of these pili is not required for binding, but the papF and papG gene products are essential for adhesion. Transcomplementation analysis between the pap gene cluster and a related gene cluster encoding a ...

  4. Characterization of porcine-specific surface (S-) layer protein carrying Lactobacillus species, S-layer proteins and the adhesin of Escherichia coli F18 fimbriae : Potential applications for veterinary medicine

    Jakava-Viljanen, Miia

    2007-01-01

    Lactobacilli, common members of porcine intestinal microbiota, have been considered to be an important group of bacteria in maintaining the stability of gastrointestinal tract (GIT), preventing intestinal infections and supporting intestinal health. Because several species of lactobacilli have GRAS (generally regarded as safe) status and some of them have an ability to interact with intestinal epithelial cells, their possible applications as mucosal vaccine vector and/or probiotics have arous...

  5. NCBI nr-aa BLAST: CBRC-DDIS-03-0094 [SEVENS

    Full Text Available CBRC-DDIS-03-0094 ref|YP_001273034.1| adhesin-like protein [Methanobrevibacter smith...ii ATCC 35061] gb|ABQ86666.1| adhesin-like protein [Methanobrevibacter smithii ATCC 35061] YP_001273034.1 3e-19 29% ...

  6. Colonization with Extraintestinal Pathogenic Escherichia coli among Nursing Home Residents and Its Relationship to Fluoroquinolone Resistance

    Maslow, Joel N.; Lautenbach, Ebbing; Glaze, Thomas; Bilker, Warren; Johnson, James R.

    2004-01-01

    In a cross-sectional fecal prevalence survey involving 49 residents of a Veterans Affairs nursing home, 59% of subjects were colonized with extraintestinal pathogenic Escherichia coli (ExPEC), 22% were colonized with adhesin-positive E. coli, and 51% were colonized with fluoroquinolone-resistant E. coli. Among 80 unique isolates, adhesins correlated negatively and aerobactin correlated positively with fluoroquinolone resistance.

  7. Expression and Identification of Recombinant A Domain of Adhesin Fnbp A from Staphylococcus aureus in Bovine Milk%重组牛乳源金黄色葡萄球菌黏附因子FnbpA A功能区的表达与鉴定

    苏艳; 王世民; 李莹; 韦海娜; 邵俊高; 张宝江; 殷涛

    2013-01-01

    黏附素分子FnbpA(纤连蛋白结合蛋白A,fibronectin binding proteinA)是金黄色葡萄球菌感染早期最重要的致病因子,也是一个重要的免疫靶标.由于不同地区流行的菌株产生的黏附素有一定的差异,将分离自新疆地区奶牛乳源金黄色葡萄球菌黏附素分子FnbpA的A功能区亚克隆至pGEX原核表达载体并转入BL21中诱导表达,SDS-PAGE分析表明,切除GST标签后在63 kD处出现特异性条带.纯化切除GST标签的蛋白经弗氏佐剂乳化免疫试验兔.ELISA方法检测免疫兔的抗体效价并评估抗体和葡萄球菌结合能力,结果表明,目的蛋白的抗体效价可达6.7×106,并可在体外识别菌体抗原.

  8. A synthetic peptide adhesion epitope as a novel antimicrobial agent.

    Kelly, C G; Younson, J S; Hikmat, B Y; Todryk, S M; Czisch, M; Haris, P I; Flindall, I R; Newby, C; Mallet, A I; Ma, J K; Lehner, T

    1999-01-01

    The earliest step in microbial infection is adherence by specific microbial adhesins to the mucosa of the oro-intestinal, nasorespiratory, or genitourinary tract. We inhibited binding of a cell surface adhesin of Streptococcus mutans to salivary receptors in vitro, as measured by surface plasmon resonance, using a synthetic peptide (p1025) corresponding to residues 1025-1044 of the adhesin. Two residues within p1025 that contribute to binding (Q1025, E1037) were identified by site-directed mutagenesis. In an in vivo human streptococcal adhesion model, direct application of p1025 to the teeth prevented recolonization of S. mutans but not Actinomyces, as compared with a control peptide or saline. This novel antimicrobial strategy, applying competitive peptide inhibitors of adhesion, may be used against other microorganisms in which adhesins mediate colonization of mucosal surfaces. PMID:9920267

  9. STRUCTURAL AND FUNCTIONAL CHARACTERISATION OF MUCUS ADHESION PROTEINS OF LACTOBACILLUS REUTERI

    Etzold, Sabrina

    2013-01-01

    Mucus is the first point of contact between the gut microbiota and the host. Mucus adhesins are thought to be key mediators in the mucus adhesion of commensal Lactobacillus species. However, knowledge on the structural or functional basis of adhesin interaction with mucin glycoproteins, the main component of mucus, is limited. This work describes the biochemical and structural properties of two cell-surface proteins from Lactobacillus reuteri, the mucus-binding protein (MUB) and the Lar0958 p...

  10. Helicobacter pylori induces β3GnT5 in human gastric cell lines, modulating expression of the SabA ligand sialyl–Lewis x

    Marcos, Nuno T; Magalhães, Ana; Ferreira, Bibiana; Maria J Oliveira; Carvalho, Ana S.; Mendes, Nuno; Gilmartin, Tim; Head, Steven R; Figueiredo, Céu; David, Leonor; Santos-Silva, Filipe; Celso A Reis

    2008-01-01

    Chronic Helicobacter pylori infection is recognized as a cause of gastric cancer. H. pylori adhesion to gastric cells is mediated by bacterial adhesins such as sialic acid–binding adhesin (SabA), which binds the carbohydrate structure sialyl–Lewis x. Sialyl–Lewis x expression in the gastric epithelium is induced during persistent H. pylori infection, suggesting that H. pylori modulates host cell glycosylation patterns for enhanced adhesion. Here, we evaluate changes in the glycosylation-relat...

  11. Type 1 pilus-mediated bacterial invasion of bladder epithelial cells

    Martinez, Juan J.; Mulvey, Matthew A.; Schilling, Joel D.; Pinkner, Jerome S.; Hultgren, Scott J.

    2000-01-01

    Most strains of uropathogenic Escherichia coli (UPEC) encode filamentous adhesive organelles called type 1 pili. We have determined that the type 1 pilus adhesin, FimH, mediates not only bacterial adherence, but also invasion of human bladder epithelial cells. In contrast, adherence mediated by another pilus adhesin, PapG, did not initiate bacterial internalization. FimH-mediated invasion required localized host actin reorganization, phosphoinositide 3-kinase (PI 3-kinase) activation and host...

  12. Fimbrial types among respiratory isolates belonging to the family Enterobacteriaceae.

    Hornick, D B; Allen, B L; Horn, M. A.; Clegg, S.

    1991-01-01

    Bacterial attachment is believed to be an early step in gram-negative nosocomial pneumonia. The frequency of fimbria-associated adhesins among respiratory pathogens has not been studied in detail. In this study isolates belonging to the family Enterobacteriaceae, prospectively obtained from intensive care unit patients who were suspected of having nosocomial pneumonia, were examined for fimbria-associated adhesins. Type 3, P, type 1, and other fimbrial phenotypes were identified by specific h...

  13. Colonization with Extraintestinal Pathogenic Escherichia coli among Nursing Home Residents and Its Relationship to Fluoroquinolone Resistance

    Maslow, Joel N.; Lautenbach, Ebbing; Glaze, Thomas; Bilker, Warren; Johnson, James R.

    2004-01-01

    In a cross-sectional fecal prevalence survey involving 49 residents of a Veterans Affairs nursing home, 59% of subjects were colonized with extraintestinal pathogenic Escherichia coli (ExPEC), 22% were colonized with adhesin-positive E. coli, and 51% were colonized with fluoroquinolone-resistant E. coli. Among 80 unique isolates, adhesins correlated negatively and aerobactin correlated positively with fluoroquinolone resistance. PMID:15328142

  14. relA Enhances the Adherence of Enteropathogenic Escherichia coli

    Beny Spira; Gerson Moura Ferreira; Luiz Gustavo de Almeida

    2014-01-01

    Enteropathogenic Escherichia coli (EPEC) is a known causative agent of diarrhea in children. In the process of colonization of the small intestine, EPEC synthesizes two types of adhesins, the bundle-forming pilus (BFP) and intimin. The BFP pilus is an adhesin associated with the initial stages of adherence of EPEC to epithelial cells, while the outer membrane protein intimin carries out the intimate adherence that takes place at the third stage of infection. BFP is encoded by the bfp operon l...

  15. AcEST: DK948418 [AcEST

    Full Text Available or domain OS=St... 46 0.002 tr|A2DMT1|A2DMT1_TRIVA A-agglutinin attachment subunit, putative.....ESD 1725 >tr|A2DMT1|A2DMT1_TRIVA A-agglutinin attachment subunit, putative OS=Trichomonas vaginalis G3 GN=TV....3 E-value 2.0e-05 Report BLASTX 2.2.19 [Nov-02-2008] Reference: Altschul, Stephe... adhesin for platelets OS=Staphy... 46 2e-04 sp|Q99QY4|SRAP_STAAM Serine-rich adhesin for platelets... OS=Staphy... 46 2e-04 sp|Q8NUJ3|SRAP_STAAW Serine-rich adhesin for platelets OS=Staphy... 45 5e-04 sp|Q

  16. Regulation of Helicobacter pylori adherence by gene conversion

    Talarico, Sarah; Whitefield, Shawn E.; Fero, Jutta; Haas, Rainer; Salama, Nina R.

    2012-01-01

    Genetic diversification of Helicobacter pylori adhesin genes may allow adaptation of adherence properties to facilitate persistence despite host defenses. The sabA gene encodes an adhesin that binds sialyl-Lewis antigens on inflamed gastric tissue. We found variability in the copy number and locus of the sabA gene and the closely related sabB and omp27 genes due to gene conversion among 51 North American pediatric H. pylori strains. We determined that sabB to sabA gene conversion is predomina...

  17. AcEST: DK960798 [AcEST

    Full Text Available TST39A01NGRL0008_G03 669 Adiantum capillus-veneris mRNA. clone: TST39A01NGRL0008_G03. 5' end seq ... . 37 1.5 tr|B7LJF8|B7LJF8_ESCFE Adhesin for cattle intestine ... colonization... 36 1.9 tr|Q8XD19|Q8XD19_ECO57 Puta ... . 35 5.5 tr|B7N941|B7N941_ECOLX Adhesin for cattle intestine ... colonization... 35 5.5 tr|B6ZPK4|B6ZPK4_ECO57 PKD ...

  18. GAA Trinucleotide Repeat Region Regulates M9/pMGA Gene Expression in Mycoplasma gallisepticum

    Liu, Li; Dybvig, Kevin; Panangala, Victor S.; van Santen, Vicky L.; French, Christopher T.

    2000-01-01

    Mycoplasma gallisepticum, the cause of chronic respiratory infections in the avian host, possesses a family of M9/pMGA genes encoding an adhesin(s) associated with hemagglutination. Nucleotide sequences of M9/pMGA gene family members indicate extensive sequence similarity in the promoter regions of both the transcribed and silent genes. The mechanism that regulates M9/pMGA gene expression is unknown, but studies have revealed an apparent correlation between gene expression and the number of t...

  19. Structure and antigenic properties of the tip-located P pilus proteins of uropathogenic Escherichia coli.

    Lund, B; Lindberg, F; Normark, S

    1988-01-01

    Pyelonephritogenic Escherichia coli frequently expresses pili which bind to Gal alpha (1-4)Gal receptors present on the uroepithelium. Binding of these pili is mediated by a pilus-associated adhesin, PapG, and not by the major subunit which constitutes the bulk of the pilus structure. The adhesin and two pilinlike proteins, PapE and PapF, are present in only a few copies each at the pilus tip. Surface exposure of both PapF and PapG is required to achieve receptor-specific binding. The nucleot...

  20. Decorin Binding by DbpA and B of Borrelia garinii, Borrelia afzelii, and Borrelia burgdorferi Sensu Stricto

    Salo, Jemiina; Loimaranta, Vuokko; Lahdenne, Pekka; Viljanen, Matti K.; Hytönen, Jukka

    2011-01-01

    Background. Decorin adherence is crucial in the pathogenesis of Lyme borreliosis. Decorin-binding proteins (Dbp) A and B are the adhesins that mediate this interaction. DbpA and B of Borrelia garinii, Borrelia afzelii, and Borrelia burgdorferi sensu stricto (ss) differ in their amino acid sequence, but little attention has been paid to the potential difference in their decorin binding.

  1. Interactions of Neuropathogenic Escherichia coli K1 (RS218) and Its Derivatives Lacking Genomic Islands with Phagocytic Acanthamoeba castellanii and Nonphagocytic Brain Endothelial Cells

    Yousuf, Farzana Abubakar; Yousuf, Zuhair; Iqbal, Junaid; Siddiqui, Ruqaiyyah; Khan, Hafsa; Khan, Naveed Ahmed

    2014-01-01

    Here we determined the role of various genomic islands in E. coli K1 interactions with phagocytic A. castellanii and nonphagocytic brain microvascular endothelial cells. The findings revealed that the genomic islands deletion mutants of RS218 related to toxins (peptide toxin, α-hemolysin), adhesins (P fimbriae, F17-like fimbriae, nonfimbrial adhesins, Hek, and hemagglutinin), protein secretion system (T1SS for hemolysin), invasins (IbeA, CNF1), metabolism (D-serine catabolism, dihydroxyacetone, glycerol, and glyoxylate metabolism) showed reduced interactions with both A. castellanii and brain microvascular endothelial cells. Interestingly, the deletion of RS218-derived genomic island 21 containing adhesins (P fimbriae, F17-like fimbriae, nonfimbrial adhesins, Hek, and hemagglutinin), protein secretion system (T1SS for hemolysin), invasins (CNF1), metabolism (D-serine catabolism) abolished E. coli K1-mediated HBMEC cytotoxicity in a CNF1-independent manner. Therefore, the characterization of these genomic islands should reveal mechanisms of evolutionary gain for E. coli K1 pathogenicity. PMID:24818136

  2. Interactions of Neuropathogenic Escherichia coli K1 (RS218 and Its Derivatives Lacking Genomic Islands with Phagocytic Acanthamoeba castellanii and Nonphagocytic Brain Endothelial Cells

    Farzana Abubakar Yousuf

    2014-01-01

    Full Text Available Here we determined the role of various genomic islands in E. coli K1 interactions with phagocytic A. castellanii and nonphagocytic brain microvascular endothelial cells. The findings revealed that the genomic islands deletion mutants of RS218 related to toxins (peptide toxin, α-hemolysin, adhesins (P fimbriae, F17-like fimbriae, nonfimbrial adhesins, Hek, and hemagglutinin, protein secretion system (T1SS for hemolysin, invasins (IbeA, CNF1, metabolism (D-serine catabolism, dihydroxyacetone, glycerol, and glyoxylate metabolism showed reduced interactions with both A. castellanii and brain microvascular endothelial cells. Interestingly, the deletion of RS218-derived genomic island 21 containing adhesins (P fimbriae, F17-like fimbriae, nonfimbrial adhesins, Hek, and hemagglutinin, protein secretion system (T1SS for hemolysin, invasins (CNF1, metabolism (D-serine catabolism abolished E. coli K1-mediated HBMEC cytotoxicity in a CNF1-independent manner. Therefore, the characterization of these genomic islands should reveal mechanisms of evolutionary gain for E. coli K1 pathogenicity.

  3. Protein (Cyanobacteria): 111836 [PGDBj - Ortholog DB

    Full Text Available YP_007088650.1 1117:2187 1150:401 1158:162 118323:2157 56110:2157 ABC-type metal io...n transport system, periplasmic component/surface adhesin Oscillatoria acuminata PCC 6304 MVISKILSRSLIPLLLLP

  4. Mediation of Staphylococcus saprophyticus adherence to uroepithelial cells by lipoteichoic acid.

    Teti, G; Chiofalo, M S; Tomasello, F.; Fava, C.; Mastroeni, P.

    1987-01-01

    Treatment of uroepithelial cells with lipoteichoic acid from Staphylococcus saprophyticus resulted in a decrease in the adherence of this organism. Similar effects were observed when bacteria were pretreated with the lipoteichoic acid ligands albumin and anti-polyglycerophosphate monoclonal antibodies. Lipoteichoic acid might behave as an adhesin of S. saprophyticus.

  5. Quantitative Analyses of Force-Induced Amyloid Formation in Candida albicans Als5p: Activation by Standard Laboratory Procedures.

    Cho X J Chan

    Full Text Available Candida albicans adhesins have amyloid-forming sequences. In Als5p, these amyloid sequences cluster cell surface adhesins to create high avidity surface adhesion nanodomains. Such nanodomains form after force is applied to the cell surface by atomic force microscopy or laminar flow. Here we report centrifuging and resuspending S. cerevisiae cells expressing Als5p led to 1.7-fold increase in initial rate of adhesion to ligand coated beads. Furthermore, mechanical stress from vortex-mixing of Als5p cells or C. albicans cells also induced additional formation of amyloid nanodomains and consequent activation of adhesion. Vortex-mixing for 60 seconds increased the initial rate of adhesion 1.6-fold. The effects of vortex-mixing were replicated in heat-killed cells as well. Activation was accompanied by increases in thioflavin T cell surface fluorescence measured by flow cytometry or by confocal microscopy. There was no adhesion activation in cells expressing amyloid-impaired Als5pV326N or in cells incubated with inhibitory concentrations of anti-amyloid dyes. Together these results demonstrated the activation of cell surface amyloid nanodomains in yeast expressing Als adhesins, and further delineate the forces that can activate adhesion in vivo. Consequently there is quantitative support for the hypothesis that amyloid forming adhesins act as both force sensors and effectors.

  6. The pavA gene of Streptococcus pneumoniae encodes a fibronectin-binding protein that is essential for virulence

    Holmes, AR; McNab, R; Millsap, KW; Rohde, M; Hammerschmidt, S; Mawdsley, JL; Jenkinson, HF

    2001-01-01

    Streptococcus pneumoniae colonizes the nasopharynx in up to 40% of healthy subjects, and is a leading cause of middle ear infections (otitis media), meningitis and pneumonia. Pneumococci adhere to glycosidic receptors on epithelial cells and to immobilized fibronectin, but the bacterial adhesins med

  7. Design and Evaluation of a Multiplex PCR Assay for the Simultaneous Identification of Genes for Nine Different Virulence Factors Associated with Escherichia coli that Cause Diarrhea and Edema Disease in Swine

    A multiplex PCR assay was developed for detection and characterization of pathogenic E. coli that cause diarrhea and Edema Disease in swine. This PCR assay was designed as a single reaction for detecting five different adhesins (K88, K99, 987P, F41 and F18), three enterotoxins (LT, STaP, STb), and ...

  8. Integrated Information and Prospects for Gliding Mechanism of the Pathogenic Bacterium Mycoplasma pneumoniae

    Miyata, Makoto; Hamaguchi, Tasuku

    2016-01-01

    Mycoplasma pneumoniae forms a membrane protrusion at a cell pole and is known to adhere to solid surfaces, including animal cells, and can glide on these surfaces with a speed up to 1 μm per second. Notably, gliding appears to be involved in the infectious process in addition to providing the bacteria with a means of escaping the host's immune systems. However, the genome of M. pneumoniae does not encode any of the known genes found in other bacterial motility systems or any conventional motor proteins that are responsible for eukaryotic motility. Thus, further analysis of the mechanism underlying M. pneumoniae gliding is warranted. The gliding machinery formed as the membrane protrusion can be divided into the surface and internal structures. On the surface, P1 adhesin, a 170 kDa transmembrane protein forms an adhesin complex with other two proteins. The internal structure features a terminal button, paired plates, and a bowl (wheel) complex. In total, the organelle is composed of more than 15 proteins. By integrating the currently available information by genetics, microscopy, and structural analyses, we have suggested a working model for the architecture of the organelle. Furthermore, in this article, we suggest and discuss a possible mechanism of gliding based on the structural model, in which the force generated around the bowl complex transmits through the paired plates, reaching the adhesin complex, resulting in the repeated catch of sialylated oligosaccharides on the host surface by the adhesin complex.

  9. Complete genome sequence of the cystic fibrosis pathogen Achromobacter xylosoxidans NH44784-1996 complies with important pathogenic phenotypes

    Jakobsen, Tim Holm; Hansen, Martin Asser; Jensen, Peter Østrup; Hansen, Lars; Riber, Leise; Cockburn, April Patricia Indera; Kolpen, Mette; Hansen, Christine Rønne; Ridderberg, Winnie; Eickhardt-Sørensen, Steffen Robert; Hansen, Marlene; Kerpedjiev, Peter; Alhede, Morten; Qvortrup, Klaus; Burmølle, Mette; Moser, Claus Ernst; Kühl, Michael; Ciofu, Oana; Givskov, Michael; Sørensen, Søren Johannes; Høiby, Niels; Bjarnsholt, Thomas

    2013-01-01

    render it an opportunistic human pathogen, We found genes involved in anaerobic growth and the pgaABCD operon encoding the biofilm adhesin poly-β-1,6-N-acetyl-D-glucosamin. Furthermore, the genome contains a range of antibiotic resistance genes coding efflux pump systems and antibiotic modifying enzymes...

  10. Dynamics of Agglutinin-Like Sequence (ALS) Protein Localization on the Surface of Candida Albicans

    Coleman, David Andrew

    2009-01-01

    The ALS gene family encodes large cell-surface glycoproteins associated with "C. albicans" pathogenesis. Als proteins are thought to act as adhesin molecules binding to host tissues. Wide variation in expression levels among the ALS genes exists and is related to cell morphology and environmental conditions. "ALS1," "ALS3," and "ALS4" are three of…

  11. Fibronectin binding proteins contribute to the adherence of Staphylococcus aureus to intact endothelium in vivo

    Kerdudou, Sylvain; Laschke, Matthias W; Sinha, Bhanu; Preissner, Klaus T; Menger, Michael D; Herrmann, Mathias

    2006-01-01

    Staphylococcal adhesins mediate attachment to matrix proteins and endothelial cells in vitro, yet, their role in primary adherence to the physiologic vessel wall has not been studied in vivo, and complex endocarditis models yielded ambiguous results. Recently, we developed a hamster model to study i

  12. Contribution of Candida albicans ALS1 to the Pathogenesis of Experimental Oropharyngeal Candidiasis

    Kamai, Yasuki; Kubota, Mikie; Kamai, Yoko; Hosokawa, Tsunemichi; Fukuoka, Takashi; Filler, Scott G.

    2002-01-01

    We investigated the contribution of Candida albicans ALS1, which encodes a candidal adhesin, to the pathogenesis of experimental murine oropharyngeal candidiasis. Our results indicate that the ALS1 gene product is important for the adherence of the organism to the oral mucosa during the early stage of the infection.

  13. Differential expression of the Escherichia coli autoaggregation factor antigen 43

    Schembri, Mark; Hjerrild, Louise; Gjermansen, Morten; Klemm, Per

    2003-01-01

    Antigen 43 (Ag43) is a self-recognizing surface adhesin found in most Escherichia coli strains. Due to its excellent cell-to-cell aggregation characteristics, Ag43 expression confers clumping and fluffing of cells and promotes biofilm formation. Ag43 expression is repressed by the cellular redox...

  14. Candidate Targets for New Anti-Virulence Drugs: Selected Cases of Bacterial Adhesion and Biofilm Formation

    Klemm, Per; Hancock, Viktoria; Kvist, Malin;

    2007-01-01

    Management of bacterial infections is becoming increasingly difficult due to the rising frequency of strains that are resistant to many current antibiotics. New types of antibiotics are, therefore, urgently needed. Virulence factors or virulence-associated phenotypes such as adhesins and biofilm...

  15. Effect of Biofilm Growth on Expression of Surface Proteins of Actinomyces naeslundii Genospecies 2

    Paddick, James S.; Brailsford, Susan R; Rao, Susmitha; Soares, Renata F.; Kidd, Edwina A. M.; Beighton, David; Homer, Karen A.

    2006-01-01

    The predominant surface proteins of biofilm and planktonic Actinomyces naeslundii, a primary colonizer of the tooth surface, were examined. Seventy-nine proteins (the products of 52 genes) were identified in biofilm cells, and 30 of these, including adhesins, chaperones, and stress-response proteins, were significantly up-regulated relative to planktonic cells.

  16. Treponema pallidum Fibronectin-Binding Proteins

    Cameron, Caroline E.; Brown, Elizabeth L.; Kuroiwa, Janelle M. Y.; Schnapp, Lynn M.; Brouwer, Nathan L.

    2004-01-01

    Putative adhesins were predicted by computer analysis of the Treponema pallidum genome. Two treponemal proteins, Tp0155 and Tp0483, demonstrated specific attachment to fibronectin, blocked bacterial adherence to fibronectin-coated slides, and supported attachment of fibronectin-producing mammalian cells. These results suggest Tp0155 and Tp0483 are fibronectin-binding proteins mediating T. pallidum-host interactions.

  17. Putative Treponema pallidum cytadhesins share a common functional domain.

    Thomas, D D; Baseman, J B; Alderete, J F

    1985-01-01

    Three putative Treponema pallidum ligands (P1, P2, and P3) that bind host fibronectin were characterized by peptide mapping. Papain digestion of each protein yielded a comigrating peptide of approximately 12,000 molecular weight. An antibody to this protein fragment inhibited T. pallidum host cytadherence, indicating that this peptide may be the functional domain of these treponemal adhesins.

  18. Characterization of starvation-induced dispersion in Pseudomonas putida biofilms: genetic elements and molecular mechanisms

    Gjermansen, M.; Nilsson, M.; Yang, Liang; Tolker-Nielsen, T.

    2010-01-01

    adhesion and were deficient in subsequent biofilm formation, suggesting that LapG affects LapA, and that the LapA protein functions both as a surface adhesin and as a biofilm matrix component. Lowering of the intracellular c-di-GMP level via induction of an EAL domain protein led to dispersal of P. putida...

  19. Increased Expression of Clumping Factor and Fibronectin-Binding Proteins by hemB Mutants of Staphylococcus aureus Expressing Small Colony Variant Phenotypes

    Vaudaux, Pierre; Francois, Patrice; Bisognano, Carmelo; Kelley, William L.; Lew, Daniel P.; Schrenzel, Jacques; Proctor, Richard A.; McNamara, Peter J.; Peters, G.; Von Eiff, Christof

    2002-01-01

    Small colony variants (SCVs) of Staphylococcus aureus are slow-growing subpopulations that cause persistent and relapsing infections. The altered phenotype of SCV can arise from defects in menadione or hemin biosynthesis, which disrupt the electron transport chain and decrease ATP concentrations. With SCVs, virulence is altered by a decrease in exotoxin production and susceptibility to various antibiotics, allowing their intracellular survival. The expression of bacterial adhesins by SCVs is poorly documented. We tested fibrinogen- and fibronectin-mediated adhesion of a hemB mutant of S. aureus 8325-4 that is defective for hemin biosynthesis and exhibits a complete SCV phenotype. In this strain, adhesion to fibrinogen and fibronectin was significantly higher than that of its isogenic, normally growing parent and correlated with the increased surface display of these adhesins as assessed by flow cytometry. Real-time quantitative reverse transcription-PCR demonstrated increased expression of clfA and fnb genes by the hemB mutant compared to its isogenic parent. The influence of the hemB mutation on altered adhesin expression was confirmed by showing complete restoration of the wild-type adhesive phenotype in the hemB mutant, either by complementing with intact hemB or by supplementing the growth medium with hemin. Increased surface display of fibrinogen and fibronectin adhesins by the hemB mutation occurred independently from agr, a major regulatory locus of virulence factors in S. aureus. Both agr-positive and agr-lacking hemB mutants were also more efficiently internalized by human embryonic kidney cells than were their isogenic controls, presumably because of increased surface display of their fibronectin adhesins. PMID:12228267

  20. Probing of microbial biofilm communities for coadhesion partners.

    Ruhl, Stefan; Eidt, Andreas; Melzl, Holger; Reischl, Udo; Cisar, John O

    2014-11-01

    Investigations of interbacterial adhesion in dental plaque development are currently limited by the lack of a convenient assay to screen the multitude of species present in oral biofilms. To overcome this limitation, we developed a solid-phase fluorescence-based screening method to detect and identify coadhesive partner organisms in mixed-species biofilms. The applicability of this method was demonstrated using coaggregating strains of type 2 fimbrial adhesin-bearing actinomyces and receptor polysaccharide (RPS)-bearing streptococci. Specific adhesin/receptor-mediated coadhesion was detected by overlaying bacterial strains immobilized to a nitrocellulose membrane with a suspended, fluorescein-labeled bacterial partner strain. Coadhesion was comparable regardless of which cell type was labeled and which was immobilized. Formaldehyde treatment of bacteria, either in suspension or immobilized on nitrocellulose, abolished actinomyces type 2 fimbrial adhesin but not streptococcal RPS function, thereby providing a simple method for assigning complementary adhesins and glycan receptors to members of a coadhering pair. The method's broader applicability was shown by overlaying colony lifts of dental plaque biofilm cultures with fluorescein-labeled strains of type 2 fimbriated Actinomyces naeslundii or RPS-bearing Streptococcus oralis. Prominent coadhesion partners included not only streptococci and actinomyces, as expected, but also other bacteria not identified in previous coaggregation studies, such as adhesin- or receptor-bearing strains of Neisseria pharyngitis, Rothia dentocariosa, and Kingella oralis. The ability to comprehensively screen complex microbial communities for coadhesion partners of specific microorganisms opens a new approach in studies of dental plaque and other mixed-species biofilms. PMID:25107971

  1. Adhesive polypeptides of Staphylococcus aureus identified using a novel secretion library technique in Escherichia coli

    Holm Liisa

    2011-05-01

    Full Text Available Abstract Background Bacterial adhesive proteins, called adhesins, are frequently the decisive factor in initiation of a bacterial infection. Characterization of such molecules is crucial for the understanding of bacterial pathogenesis, design of vaccines and development of antibacterial drugs. Because adhesins are frequently difficult to express, their characterization has often been hampered. Alternative expression methods developed for the analysis of adhesins, e.g. surface display techniques, suffer from various drawbacks and reports on high-level extracellular secretion of heterologous proteins in Gram-negative bacteria are scarce. These expression techniques are currently a field of active research. The purpose of the current study was to construct a convenient, new technique for identification of unknown bacterial adhesive polypeptides directly from the growth medium of the Escherichia coli host and to identify novel proteinaceous adhesins of the model organism Staphylococcus aureus. Results Randomly fragmented chromosomal DNA of S. aureus was cloned into a unique restriction site of our expression vector, which facilitates secretion of foreign FLAG-tagged polypeptides into the growth medium of E. coli ΔfliCΔfliD, to generate a library of 1663 clones expressing FLAG-tagged polypeptides. Sequence and bioinformatics analyses showed that in our example, the library covered approximately 32% of the S. aureus proteome. Polypeptides from the growth medium of the library clones were screened for binding to a selection of S. aureus target molecules and adhesive fragments of known staphylococcal adhesins (e.g coagulase and fibronectin-binding protein A as well as polypeptides of novel function (e.g. a universal stress protein and phosphoribosylamino-imidazole carboxylase ATPase subunit were detected. The results were further validated using purified His-tagged recombinant proteins of the corresponding fragments in enzyme-linked immunoassay and

  2. Binding of Clostridium perfringens to collagen correlates with the ability to cause necrotic enteritis in chickens.

    Wade, B; Keyburn, A L; Seemann, T; Rood, J I; Moore, R J

    2015-11-18

    This study investigated the ability of Clostridium perfringens isolates derived from chickens to bind to collagen types I-V and gelatin. In total 21 strains from three distinct backgrounds were studied: (i) virulent strains isolated from birds suffering from necrotic enteritis, (ii) avirulent strains isolated from birds suffering from necrotic enteritis and (iii) strains isolated from healthy birds. All strains isolated from diseased birds had been assessed for virulence in a disease induction model. The virulent isolates all displayed collagen binding ability. However, most strains in the other two classes showed negligible binding to collagen. The prevalence of a previously described C. perfringens putative collagen adhesin-encoding gene was investigated by PCR screening. It was found that five of the strains carried the putative collagen adhesin-encoding gene and that all of these strains were virulent isolates. Based on these studies it is postulated that collagen adhesion may play a role in the pathogenesis of necrotic enteritis. PMID:26455806

  3. Prevalence of adhesive genes among uropathogenic Escherichia coli strains isolated from patients with urinary tract infection in Mangalore

    A V Shetty

    2014-01-01

    Full Text Available The study was carried out to detect the adhesive genes pap (pyelonephritis associated pili, sfa (S fimbrial adhesin and afa (afimbrial adhesin from Escherichia coli strains isolated in patients diagnosed with urinary tract infection (UTI. A total of 23% of the isolates were positive for pap, sfa and afa genes with a prevalence of 60.87% (14/23, 39.1% (9/23 and 39.1% (9/23, respectively. Prevalence of multiple adhesive genes was 8.7% (2/23 for pap and afa, 30.43% (7/23 for pap and sfa. Significant numbers of isolates were positive for Congo red binding (80% and haemolysin production 60%. The prevalence of multiple adhesive genes indicate the potential to adhere and subsequently cause a systemic infection among UTI patients.

  4. Asymptomatic bacteriuria Escherichia coli strain 83972 carries mutations in the foc locus and is unable to express F1C fimbriae

    Hancock, Viktoria; Schembri, M.A.; Ulett, G.C.;

    2006-01-01

    adhesin. The data imply that E. coli 83972 has lost its ability to express this important colonization factor as a result of host-driven evolution. The ancestor of the strain seems to have been a pyelonephritis strain of phylogenetic group B2. Strain 83972 therefore represents an example of bacterial......Escherichia coli is the most common organism associated with asymptomatic bacteriuria (ABU). In contrast to uropathogenic E. coli (UPEC), which causes symptomatic urinary tract infection (UTI), very little is known about the mechanisms by which these strains colonize the urinary tract. Bacterial...... adhesion conferred by specific surface-associated adhesins is normally considered as a prerequisite for colonization of the urinary tract. The prototype ABU E. coli strain 83972 was originally isolated from a girl who had carried it asymptomatically for 3 years. This study characterized the molecular...

  5. Probing bacterial adhesion at the single-cell level

    Zeng, Guanghong; Müller, Torsten; Meyer, Rikke Louise

    cantilever coated with the commercial cell adhesive CellTakTM. We applied the method to study adhesion of living cells to abiotic surfaces at the single-cell level. Immobilisation of single bacterial cells to the cantilever was stable for several hours, and viability was confirmed by Live/Dead staining and......Bacteria initiate attachment to surfaces with the aid of different extracellular proteins and polymeric adhesins. To quantitatively analyse the cell-cell and cell-surface interactions provided by bacterial adhesins, it is essential to go down to single cell level where cell-to-cell variation can be...... considered. We have developed a simple and versatile method to make single-cell bacterial probes for measuring single cell adhesion by force spectroscopy using atomic force microscopy (AFM). A single-cell probe was readily made by picking up a bacterial cell from a glass surface by approaching a tipless AFM...

  6. Analysis of Escherichia coli Strains Causing Bacteriuria during Pregnancy: Selection for Strains That Do Not Express Type 1 Fimbriae

    Graham, J. C.; Leathart, J. B. S.; Keegan, S. J.; Pearson, J.; Bint, A; Gally, D.L.

    2001-01-01

    Escherichia coli isolates from patients with bacteriuria of pregnancy were compared by PCR with isolates from patients with community-acquired cystitis for the presence of established virulence determinants. The strains from patients with bacteriuria of pregnancy were less likely to carry genes for P-family, S-family, and F1C adhesins, cytotoxic necrotizing factor 1, and aerobactin, but virtually all of the strains carried the genes for type 1 fimbriae. Standard mannose-sensitive agglutinatio...

  7. The Group B Streptococcal C5a Peptidase Is Both a Specific Protease and an Invasin

    Cheng, Qi; Stafslien, Deborah; Purushothaman, Sai Sudha; Cleary, Patrick

    2002-01-01

    The group B streptococcus (GBS) is a major cause of pneumonia, sepsis, and meningitis in neonates and a serious cause of mortality or morbidity in immunocompromised adults. Although these streptococci adhere efficiently and invade a variety of tissue-specific epithelial and endothelial cells, adhesins and invasins are still unknown. All serotypes of GBS studied to date express C5a peptidase (SCPB) on their surface. This investigation addresses the possibility that this relatively large surfac...

  8. An in vitro adherence assay reveals that Helicobacter pylori exhibits cell lineage-specific tropism in the human gastric epithelium.

    Falk, P; Roth, K A; Borén, T; Westblom, T U; Gordon, J I; Normark, S

    1993-01-01

    Helicobacter pylori is a microaerophilic bacterium found in the stomach of asymptomatic humans as well as patients with acid peptic disease and gastric adenocarcinoma. We have developed an in situ adherence assay to examine the cell lineage-specific nature of binding of this organism and to characterize the nature of cell surface receptors that recognize its adhesin. Fluorescein isothiocyanate-labeled H. pylori strains were bound to surface mucous cells present in the pit region of human and ...

  9. Autotransporters and Their Role in the Virulence of Burkholderia pseudomallei and Burkholderia mallei

    Adler, Natalie R. Lazar; Stevens, Joanne M; Stevens, Mark P.; Galyov, Edouard E.

    2011-01-01

    Burkholderia pseudomallei and Burkholderia mallei are closely related Gram-negative bacteria responsible for the infectious diseases melioidosis and glanders, respectively. Autotransporters (ATs) comprise a large and diverse family of secreted and outer membrane proteins that includes virulence-associated invasins, adhesins, proteases, and actin-nucleating factors. The B. pseudomallei K96243 genome contains 11 predicted ATs, eight of which share homologs in the B. mallei ATCC 23344 genome. Th...

  10. Autotransporters and their role in the virulence of Burkholderia pseudomallei and Burkholderia mallei

    Lazar Adler, N.; Stevens, J; STEVENS, M.; Galyov, E

    2011-01-01

    Burkholderia pseudomallei and Burkholderia mallei are closely related Gram-negative bacteria responsible for the infectious diseases melioidosis and glanders, respectively. Autotransporters (ATs) comprise a large and diverse family of secreted and outer membrane proteins that includes virulence-associated invasins, adhesins, proteases and actin-nucleating factors. The B. pseudomallei K96243 genome contains eleven predicted ATs, eight of which share homologues in the B. mallei ATCC 23344 genom...

  11. Les souches pathogènes d'Escherichia coli chez les chiens et les chats : IV) Discussion générale

    Mainil, Jacques

    2002-01-01

    This manuscript reviews the current knowledge on the main classes of pathogenic Escherichia coli in dogs and cats: type 1 necrotoxigenic strains (NTEC1), adhesin-positive strains (AdEC), enteropathogenic strains (EPEC) and enterotoxigenic strains (ETEC). They represent primary or secondary (to other bacterial, parasitic and/or viral infections) infectious agents. NTEC1 and AdEC are the most frequent and are responsible for intestinal, urinary tract and invasive infections, while EPEC and ETEC...

  12. Distribution of Classical and Nonclassical Virulence Genes in Enterotoxigenic Escherichia coli Isolates from Chilean Children and tRNA Gene Screening for Putative Insertion Sites for Genomic Islands▿†

    del Canto, Felipe; Valenzuela, Patricio; Cantero, Lidia; Bronstein, Jonathan; Blanco, Jesús E; Blanco, Jorge; Prado, Valeria; Levine, Myron; Nataro, James; Sommerfelt, Halvor; Vidal, Roberto

    2011-01-01

    Enterotoxigenic Escherichia coli (ETEC) is an important cause of diarrhea. Three adhesins (Tia, TibA, EtpA), an iron acquisition system (Irp1, Irp2, and FyuA), a GTPase (LeoA), and an autotransporter (EatA) are ETEC virulence-related proteins that, in contrast to the classical virulence factors (enterotoxins and fimbrial colonization factors) have not heretofore been targets in characterizing isolates from epidemiological studies. Here, we determined the occurrence of these nonclassical virul...

  13. Yops of Yersinia enterocolitica Inhibit Receptor-Dependent Superoxide Anion Production by Human Granulocytes

    Visser, L.G.; Seijmonsbergen, E.; Nibbering, P H; van den Broek, P J; van Furth, R

    1999-01-01

    The virulence plasmid-borne genes encoding Yersinia adhesin A (YadA) and several Yersinia secreted proteins (Yops) are involved in the inhibition of phagocytosis and killing of Yersinia enterocolitica by human granulocytes. One of these Yops, YopH, dephosphorylates multiple tyrosine-phosphorylated proteins in eukaryotic cells and is involved in the inhibition of phagocytosis of Y. enterocolitica by human granulocytes. We investigated whether antibody- and complement-opsonized plasmid-bearing ...

  14. Trimeric Autotransporters of Haemophilus parasuis: Generation of an Extensive Passenger Domain Repertoire Specific for Pathogenic Strains▿ †

    Pina, Sonia; Olvera, Alex; Barceló, Anna; Bensaid, Albert

    2008-01-01

    Haemophilus parasuis is the agent responsible for causing Glässer's disease, but little is known about the pathogenic determinants of this major pig disease. Here we describe, for the pathogenic strain Nagasaki, the molecular characterization of 13 trimeric autotransporters as assessed by the presence of YadA C-terminal translocator domains which were classified into three groups. All passenger domains possess motifs and repeats characteristic of adhesins, hemagglutinins, and invasins with va...

  15. Hemagglutination and biofilm formation as virulence markers of uropathogenic Escherichia coli in acute urinary tract infections and urolithiasis

    Maheswari, Uma B.; Palvai, Sunitha; Anuradha, Pattepu Rajalingam; Kammili, Nagamani

    2013-01-01

    Introduction: Urinary tract infections (UTI) are a major public health concern in developing countries. Most UTIs are caused by E. coli, accounting for up to 90% of community-acquired UTIs (CAUTI). Recurrent UTI is considered as a major risk factor for urolithiasis. Virulence factors like adhesins and biofilm have been extensively studied by authors on UPEC isolated from recurrent UTI. The studies on isolates from infection stones in kidney are scanty. In a prospective study, we aimed to dete...

  16. Differential expression of the Escherichia coli autoaggregation factor antigen 43

    Schembri, Mark; Hjerrild, Louise; Gjermansen, Morten;

    2003-01-01

    Antigen 43 (Ag43) is a self-recognizing surface adhesin found in most Escherichia coli strains. Due to its excellent cell-to-cell aggregation characteristics, Ag43 expression confers clumping and fluffing of cells and promotes biofilm formation. Ag43 expression is repressed by the cellular redox......-forming potential of E. coli. Finally, we demonstrated that Ag43-mediated cell aggregation confers significant protection against hydrogen peroxide killing....

  17. Near Surface Swimming of Salmonella Typhimurium Explains Target-Site Selection and Cooperative Invasion

    Misselwitz, Benjamin; Barrett, Naomi; Kreibich, Saskia; Vonaesch, Pascale; Andritschke, Daniel; Rout, Samuel; Weidner, Kerstin; Sormaz, Milos; Songhet, Pascal; Horvath, Peter; Chabria, Mamta; Vogel, Viola; Spori, Doris M.; Jenny, Patrick; Hardt, Wolf-Dietrich

    2012-01-01

    Targeting of permissive entry sites is crucial for bacterial infection. The targeting mechanisms are incompletely understood. We have analyzed target-site selection by S. Typhimurium. This enteropathogenic bacterium employs adhesins (e.g. fim) and the type III secretion system 1 (TTSS-1) for host cell binding, the triggering of ruffles and invasion. Typically, S. Typhimurium invasion is focused on a subset of cells and multiple bacteria invade via the same ruffle. It has remained unclear how ...

  18. Uropathogenic E. coli Exploit CEA to Promote Colonization of the Urogenital Tract Mucosa.

    Muenzner, Petra; Kengmo Tchoupa, Arnaud; Klauser, Benedikt; Brunner, Thomas; Putze, Johannes; Dobrindt, Ulrich; Hauck, Christof R

    2016-05-01

    Attachment to the host mucosa is a key step in bacterial pathogenesis. On the apical surface of epithelial cells, members of the human carcinoembryonic antigen (CEA) family are abundant glycoproteins involved in cell-cell adhesion and modulation of cell signaling. Interestingly, several gram-negative bacterial pathogens target these receptors by specialized adhesins. The prototype of a CEACAM-binding pathogen, Neisseria gonorrhoeae, utilizes colony opacity associated (Opa) proteins to engage CEA, as well as the CEA-related cell adhesion molecules CEACAM1 and CEACAM6 on human epithelial cells. By heterologous expression of neisserial Opa proteins in non-pathogenic E. coli we find that the Opa protein-CEA interaction is sufficient to alter gene expression, to increase integrin activity and to promote matrix adhesion of infected cervical carcinoma cells and immortalized vaginal epithelial cells in vitro. These CEA-triggered events translate in suppression of exfoliation and improved colonization of the urogenital tract by Opa protein-expressing E. coli in CEA-transgenic compared to wildtype mice. Interestingly, uropathogenic E. coli expressing an unrelated CEACAM-binding protein of the Afa/Dr adhesin family recapitulate the in vitro and in vivo phenotype. In contrast, an isogenic strain lacking the CEACAM-binding adhesin shows reduced colonization and does not suppress epithelial exfoliation. These results demonstrate that engagement of human CEACAMs by distinct bacterial adhesins is sufficient to blunt exfoliation and to promote host infection. Our findings provide novel insight into mucosal colonization by a common UPEC pathotype and help to explain why human CEACAMs are a preferred epithelial target structure for diverse gram-negative bacteria to establish a foothold on the human mucosa. PMID:27171273

  19. Uropathogenic E. coli Exploit CEA to Promote Colonization of the Urogenital Tract Mucosa.

    Petra Muenzner

    2016-05-01

    Full Text Available Attachment to the host mucosa is a key step in bacterial pathogenesis. On the apical surface of epithelial cells, members of the human carcinoembryonic antigen (CEA family are abundant glycoproteins involved in cell-cell adhesion and modulation of cell signaling. Interestingly, several gram-negative bacterial pathogens target these receptors by specialized adhesins. The prototype of a CEACAM-binding pathogen, Neisseria gonorrhoeae, utilizes colony opacity associated (Opa proteins to engage CEA, as well as the CEA-related cell adhesion molecules CEACAM1 and CEACAM6 on human epithelial cells. By heterologous expression of neisserial Opa proteins in non-pathogenic E. coli we find that the Opa protein-CEA interaction is sufficient to alter gene expression, to increase integrin activity and to promote matrix adhesion of infected cervical carcinoma cells and immortalized vaginal epithelial cells in vitro. These CEA-triggered events translate in suppression of exfoliation and improved colonization of the urogenital tract by Opa protein-expressing E. coli in CEA-transgenic compared to wildtype mice. Interestingly, uropathogenic E. coli expressing an unrelated CEACAM-binding protein of the Afa/Dr adhesin family recapitulate the in vitro and in vivo phenotype. In contrast, an isogenic strain lacking the CEACAM-binding adhesin shows reduced colonization and does not suppress epithelial exfoliation. These results demonstrate that engagement of human CEACAMs by distinct bacterial adhesins is sufficient to blunt exfoliation and to promote host infection. Our findings provide novel insight into mucosal colonization by a common UPEC pathotype and help to explain why human CEACAMs are a preferred epithelial target structure for diverse gram-negative bacteria to establish a foothold on the human mucosa.

  20. Possible origin of sequence divergence in the P1 cytadhesin gene of Mycoplasma pneumoniae.

    Su, C J; Dallo, S F; Chavoya, A; Baseman, J B

    1993-01-01

    Specific regions of the P1 adhesin structural gene of Mycoplasma pneumoniae hybridize to various parts of the mycoplasma genome, indicating their multiple-copy nature. In addition, restriction fragment length polymorphisms and sequence divergence have been observed in the P1 gene, permitting the classification of clinical isolates of M. pneumoniae into two groups, I and II. These data suggest that the observed P1 gene diversity may be explained by homologous recombination between similar but ...

  1. Oral administration of protease inhibits enterotoxigenic Escherichia coli receptor activity in piglet small intestine.

    Mynott, T L; Luke, R K; Chandler, D S

    1996-01-01

    The virulence of enterotoxigenic Escherichia coli (ETEC) is attributed to their ability to adhere via fimbrial adhesins to specific receptors located on the intestinal mucosa. A novel approach to preventing ETEC induced diarrhoea would be to prevent attachment of ETEC to intestine by proteolytically modifying the receptor attachment sites. This study aimed to examine the effect of bromelain, a proteolytic extract obtained from pineapple stems, on ETEC receptor activity in porcine small intest...

  2. A structural study of the interaction between the Dr haemagglutinin DraE and derivatives of chloramphenicol

    The structures of two Dr adhesin (DraE) complexes with chloramphenicol derivatives, namely chloramphenicol succinate and bromamphenicol, have been solved. The structures reveal important functional groups for small-molecule binding and imply possible modifications to the molecule that would permit a more wide-ranging interaction without the toxic side effects associated with chloramphenicol. Dr adhesins are expressed on the surface of uropathogenic and diffusely adherent strains of Escherichia coli. The major adhesin subunit (DraE/AfaE) of these organelles mediates attachment of the bacterium to the surface of the host cell and possibly intracellular invasion through its recognition of the complement regulator decay-accelerating factor (DAF) and/or members of the carcinoembryonic antigen (CEA) family. The adhesin subunit of the Dr haemagglutinin, a Dr-family member, additionally binds type IV collagen and is inhibited in all its receptor interactions by the antibiotic chloramphenicol (CLM). In this study, previous structural work is built upon by reporting the X-ray structures of DraE bound to two chloramphenicol derivatives: chloramphenicol succinate (CLS) and bromamphenicol (BRM). The CLS structure demonstrates that acylation of the 3-hydroxyl group of CLM with succinyl does not significantly perturb the mode of binding, while the BRM structure implies that the binding pocket is able to accommodate bulkier substituents on the N-acyl group. It is concluded that modifications of the 3@@hydroxyl group would generate a potent Dr haemagglutinin inhibitor that would not cause the toxic side effects that are associated with the normal bacteriostatic activity of CLM

  3. UV- Killed Staphylococcus aureus Enhances Adhesion and Differentiation of Osteoblasts on Bone-associated Biomaterials

    Somayaji, Shankari N.; Huet, Yvette M.; Gruber, Helen E.; Hudson, Michael C

    2010-01-01

    Titanium alloys (Ti) are the preferred material for orthopaedic applications. However, very often, these metallic implants loosen over a long period and mandate revision surgery. For implant success, osteoblasts must adhere to the implant surface and deposit a mineralized extracellular matrix. Here, we utilized UV-killed Staphylococcus aureus as a novel osteoconductive coating for Ti surfaces. S. aureus expresses surface adhesins capable of binding to bone and biomaterials directly. Furthermo...

  4. Functional Mapping of YadA- and Ail-Mediated Binding of Human Factor H to Yersinia enterocolitica Serotype O:3▿

    Biedzka-Sarek, Marta; Salmenlinna, Saara; Gruber, Markus; Lupas, Andrei N.; Meri, Seppo; Skurnik, Mikael

    2008-01-01

    Yersinia enterocolitica is an enteric pathogen that exploits diverse means to survive in the human host. Upon Y. enterocolitica entry into the human host, bacteria sense and respond to variety of signals, one of which is the temperature. Temperature in particular has a profound impact on Y. enterocolitica gene expression, as most of its virulence factors are expressed exclusively at 37°C. These include two outer membrane proteins, YadA and Ail, that function as adhesins and complement resista...

  5. Identification of the autotransporter Pet toxin in Proteus mirabilis strain isolated from patients with urinary tract infections

    Luis Raúl Gutiérrez-Lucas; Guillermo Mendoza-Hernández; Bertha González-Pedrajo; Carlos Eslava-Campos; Jaime Bustos-Martínez; Teresita Sainz-Espuñes

    2012-01-01

    Proteus mirabilis, a motile Gram-negative bacterium, represents a common cause of complicated urinary tract infections. Autotransporters are a family of secreted proteins from Gram-negative bacteria that direct their own secretion across the outer membrane (type V autotransporter secretion mechanism). Serine protease autotransporters of Enterobacteriaceae (SPATEs) include adhesins, toxins, and proteases that can contribute to the virulence. Plasmid-encoded toxin (Pet) is the predominant prote...

  6. Leishmania major Survival in Selective Phlebotomus papatasi Sand Fly Vector Requires a Specific SCG-Encoded Lipophosphoglycan Galactosylation Pattern

    Deborah E Dobson; Shaden Kamhawi; Phillip Lawyer; Turco, Salvatore J.; Beverley, Stephen M.; David L Sacks

    2010-01-01

    Phlebotomine sand flies that transmit the protozoan parasite Leishmania differ greatly in their ability to support different parasite species or strains in the laboratory: while some show considerable selectivity, others are more permissive. In "selective" sand flies, Leishmania binding and survival in the fly midgut typically depends upon the abundant promastigote surface adhesin lipophosphoglycan (LPG), which exhibits species- and strain-specific modifications of the dominant phosphoglycan ...

  7. Expression of UGA-Containing Mycoplasma Genes in Bacillus subtilis

    Kannan, T. R.; Baseman, Joel B.

    2000-01-01

    We used Bacillus subtilis to express UGA-containing Mycoplasma genes encoding the P30 adhesin (one UGA) of Mycoplasma pneumoniae and methionine sulfoxide reductase (two UGAs) of Mycoplasma genitalium. Due to natural UGA suppression, these Mycoplasma genes were expressed as full-length protein products, but at relatively low efficiency, in recombinant wild-type Bacillus. The B. subtilis-expressed Mycoplasma proteins appeared as single bands and not as multiple bands compared to expression in r...

  8. Biofilm Matrix Proteins

    Fong, Jiunn N. C.; Yildiz, Fitnat H.

    2015-01-01

    Proteinaceous components of the biofilm matrix include secreted extracellular proteins, cell surface adhesins and protein subunits of cell appendages such as flagella and pili. Biofilm matrix proteins play diverse roles in biofilm formation and dissolution. They are involved in attaching cells to surfaces, stabilizing the biofilm matrix via interactions with exopolysaccharide and nucleic acid components, developing three-dimensional biofilm architectures, and dissolving biofilm matrix via enz...

  9. Does Candida albicans Als5p Amyloid Play a Role in Commensalism in Caenorhabditis elegans?

    Bois, Michael; Singh, Sean; Samlalsingh, Alyssa; Lipke, Peter N.; Garcia, Melissa C.

    2013-01-01

    Candida albicans, a dimorphic fungus and an opportunistic pathogen, possesses a myriad of adherence factors, including members of the agglutinin-like sequence (Als) family of mannoproteins. The adhesin Als5p mediates adhesion to many substrates and is upregulated during commensal interactions but is downregulated during active C. albicans infections. An amyloid-forming core sequence at residues 325 to 331 is important for Als5p function, because a single-amino-acid substitution at position 32...

  10. Bordetella pertussis filamentous hemagglutinin: evaluation as a protective antigen and colonization factor in a mouse respiratory infection model.

    Kimura, A; Mountzouros, K T; Relman, D.A.; Falkow, S; Cowell, J L

    1990-01-01

    Filamentous hemagglutinin (FHA) is a cell surface protein of Bordetella pertussis which functions as an adhesin for this organism. It is a component of many new acellular pertussis vaccines. The proposed role of FHA in immunity to pertussis is based on animal studies which have produced some conflicting results. To clarify this situation, we reexamined the protective activity of FHA in an adult mouse respiratory infection model. Four-week-old BALB/c mice were immunized with one or two doses o...

  11. Crystallization and initial crystallographic analysis of the Streptococcus parasanguinis FW213 Fap1-­NRα adhesive domain at pH 5.0

    Garnett, James A; Ramboarina, Stéphanie; Lee, Wei-chao; Tagliaferri, Camille; Wu, Wilfred; MATTHEWS, STEPHEN

    2011-01-01

    The adhesin fimbriae-associated protein 1 (Fap1) is a surface protein of Streptococcus parasanguinis FW213 and plays a major role in the formation of dental plaque in humans. Here, the adhesive domain Fap1-NRα, which is activated by acidic pH, has been crystallized at pH 5.0 and diffraction data have been collected to 3.0 Å resolution.

  12. Intravital Imaging of Vascular Transmigration by the Lyme Spirochete: Requirement for the Integrin Binding Residues of the B. burgdorferi P66 Protein.

    Devender Kumar

    2015-12-01

    Full Text Available Vascular extravasation, a key step in systemic infection by hematogenous microbial pathogens, is poorly understood, but has been postulated to encompass features similar to vascular transmigration by leukocytes. The Lyme disease spirochete can cause a variety of clinical manifestations, including arthritis, upon hematogenous dissemination. This pathogen encodes numerous surface adhesive proteins (adhesins that may promote extravasation, but none have yet been implicated in this process. In this work we report the novel use of intravital microscopy of the peripheral knee vasculature to study transmigration of the Lyme spirochete in living Cd1d-/-mice. In the absence of iNKT cells, major immune modulators in the mouse joint, spirochetes that have extravasated into joint-proximal tissue remain in the local milieu and can be enumerated accurately. We show that BBK32, a fibronectin and glycosaminoglycan adhesin of B. burgdorferi involved in early steps of endothelial adhesion, is not required for extravasation from the peripheral knee vasculature. In contrast, almost no transmigration occurs in the absence of P66, an outer membrane protein that has porin and integrin adhesin functions. Importantly, P66 mutants specifically defective in integrin binding were incapable of promoting extravasation. P66 itself does not promote detectable microvascular interactions, suggesting that vascular adhesion of B. burgdorferi mediated by other adhesins, sets the stage for P66-integrin interactions leading to transmigration. Although integrin-binding proteins with diverse functions are encoded by a variety of bacterial pathogens, P66 is the first to have a documented and direct role in vascular transmigration. The emerging picture of vascular escape by the Lyme spirochete shows similarities, but distinct differences from leukocyte transmigration.

  13. Isolation of a coaggregation-inhibiting cell wall polysaccharide from Streptococcus sanguis H1.

    Cassels, F J; London, J

    1989-01-01

    Coaggregation between Streptococcus sanguis H1 and Capnocytophaga ochracea ATCC 33596 cells is mediated by a carbohydrate receptor on the former and an adhesin on the latter. Two methods were used to release the carbohydrate receptor from the gram-positive streptococcus, autoclaving and mutanolysin treatment. The polysaccharide released from the streptococcal cell wall by either treatment was purified by ion-exchange chromatography; this polysaccharide inhibited coaggregation when preincubate...

  14. TccP2-mediated subversion of actin dynamics by EPEC 2 – a distinct evolutionary lineage of enteropathogenic Escherichia coli

    Whale, Andrew D.; Hernandes, Rodrigo T.; Ooka, Tadasuke; Beutin, Lothar; Schüller, Stephanie; Garmendia, Junkal; Crowther, Lynette; Vieira, Mônica A. M.; Ogura, Yoshitoshi; Krause, Gladys; Phillips, Alan D.; Tania A. T. Gomes; Hayashi, Tetsuya; Frankel, Gad

    2007-01-01

    Enteropathogenic Escherichia coli (EPEC) is a major cause of infantile diarrhoea in developing countries. While colonizing the gut mucosa, EPEC triggers extensive actin-polymerization activity at the site of intimate bacterial attachment, which is mediated by avid interaction between the outer-membrane adhesin intimin and the type III secretion system (T3SS) effector Tir. The prevailing dogma is that actin polymerization by EPEC is achieved following tyrosine phosphorylation of Tir, recruitme...

  15. Discovering the Secrets of the Candida albicans Agglutinin-Like Sequence (ALS) Gene Family—a Sticky Pursuit

    HOYER, LOIS L.; GREEN, CLAYTON B.; Oh, Soon-Hwan; Zhao, Xiaomin

    2008-01-01

    The Agglutinin-Like Sequence (ALS) family of Candida albicans includes eight genes that encode large cell-surface glycoproteins. The high degree of sequence relatedness between the ALS genes and the tremendous allelic variability often present in the same C. albicans strain complicated definition and characterization of the gene family. The main hypothesis driving ALS family research is that the genes encode adhesins, primarily involved in host-pathogen interactions. Although adhesive functio...

  16. Streptococcus pneumoniae Infection of Host Epithelial Cells via Polymeric Immunoglobulin Receptor Transiently Induces Calcium Release from Intracellular Stores*

    Asmat, T. M.; Agarwal, V; Rath, S.; Hildebrandt, J.-P.; Hammerschmidt, S.

    2011-01-01

    The pneumococcal surface protein C (PspC) is a major adhesin of Streptococcus pneumoniae (pneumococci) that interacts in a human-specific manner with the ectodomain of the human polymeric immunoglobulin receptor (pIgR) produced by respiratory epithelial cells. This interaction promotes bacterial colonization and bacterial internalization by initiating host signal transduction cascades. Here, we examined alterations of intracellular calcium ([Ca2+]i) levels in epithelial cells during host cell...

  17. Virulence markers of vancomycin resistant enterococci isolated from infected and colonized patients

    Priyanka Paul Biswas

    2014-01-01

    Full Text Available Background: The aim of study was to find out the potential pathogenic role of virulence factors elaborated by strains of vancomycin resistant enterococci (VRE isolated from clinical samples and VRE colonizing the gastrointestinal tract of hospitalized patients. Materials and Methods: Enterococci were isolated from various clinical samples and also from fecal specimens of colonized patients at the time of admission, after 48 h and after 5 days of admission. Various virulence determinants were detected by phenotypic tests. Vancomycin susceptibility in enterococci was detected by disc diffusion and agar screen method. Minimum inhibitory concentration was determined by agar dilution method. Results: Out of all the clinical and fecal samples processed, 12.0% isolates were either vancomycin resistant or vancomycin intermediate. Hemagglutinating activity against rabbit red blood cells was seen with 27.8% and 25.0% of clinical and fecal strains, respectively. Slime layer formation was seen with fecal VRE strains (37.5% when compared to clinical VRE (27.8%. Among the clinical VRE strains the most prolific biofilm producers were Enterococcus. fecalis (92.9% when compared to Enterococcus. faecium (52.9%. Biofilm formation/(presence of adhesions was also seen in (29.2% of the fecal VREs. In wound infection production of gelatinase, deoxyribonuclease (DNase, and caseinase (70.0% each were the major virulence factors. The predominant virulence factors seen in the blood stream infection were adhesin, and hemolysin (44.4% each and in catheter induced infection were DNase and adhesins (75.0% each. Adhesin (29.2%, slime layer (37.6%, DNAse (33.3%, gelatinase (25.0%, lipase (20.8% and caseinase (16.6% and hemolysin (8.3% were produced the fecal isolates. Conclusion: An association between adhesin (as detected by biofilm formation and urinary tract infection, adhesion and hemolysin with BSI, as also between DNase gelatinase & caseinase with wound infection was

  18. Targeting Staphylococcus aureus Toxins: A Potential form of Anti-Virulence Therapy

    Cin Kong; Hui-min Neoh; Sheila Nathan

    2016-01-01

    Staphylococcus aureus is an opportunistic pathogen and the leading cause of a wide range of severe clinical infections. The range of diseases reflects the diversity of virulence factors produced by this pathogen. To establish an infection in the host, S. aureus expresses an inclusive set of virulence factors such as toxins, enzymes, adhesins, and other surface proteins that allow the pathogen to survive under extreme conditions and are essential for the bacteria’s ability to spread through ti...

  19. Coaggregation between Aquatic Bacteria Is Mediated by Specific-Growth-Phase-Dependent Lectin-Saccharide Interactions

    Rickard, Alex H.; Leach, Stephen A.; Buswell, Clive M.; High, Nicola J.; Handley, Pauline S.

    2000-01-01

    Coaggregating strains of aquatic bacteria were identified by partial 16S rRNA gene sequencing. The coaggregation abilities of four strains of Blastomonas natatoria and one strain of Micrococcus luteus varied with culture age but were always maximum in the stationary phase of growth. Each member of a coaggregating pair carried either a heat- and protease-sensitive protein (lectin) adhesin or a saccharide receptor, as coaggregation was reversed by sugars.

  20. Amended Description of the Genes for Synthesis of Actinomyces naeslundii T14V Type 1 Fimbriae and Associated Adhesin▿ †

    CHEN, PING; Cisar, John O.; Hess, Sonja; Ho, Jenny T. C.; Leung, Kai P.

    2007-01-01

    The type 1 fimbriae of Actinomyces naeslundii T14V mediate adhesion of this gram-positive species to the tooth surface. The present findings show that the locus for type 1 fimbria production in this strain includes three genes, fimQ for a minor fimbrial subunit that appears to be an adhesin, fimP for the major structural subunit, and srtC1 for a type 1 fimbria-specific sortase involved in the assembly of these structures.

  1. Identification of Independent Streptococcus gordonii SspA and SspB Functions in Coaggregation with Actinomyces naeslundii

    Egland, Paul G.; Dû, Laurence D.; Kolenbrander, Paul E.

    2001-01-01

    The initial stages of dental plaque formation involve the adherence of early colonizing organisms such as Streptococcus gordonii and Actinomyces naeslundii to the saliva-coated tooth surface and to each other. The S. gordonii surface proteins SspA and SspB are known to play a role in adherence to salivary proteins and mediate coaggregation with other bacteria. Coaggregation is the adhesin receptor-mediated interaction between genetically distinct cell types and appears to be ubiquitous among ...

  2. Protein A-Mediated Multicellular Behavior in Staphylococcus aureus▿

    Merino, Nekane; Toledo-Arana, Alejandro; Vergara-Irigaray, Marta; Valle, Jaione; Solano, Cristina; Calvo, Enrique; Lopez, Juan Antonio; Foster, Timothy J.; Penadés, José R.; Lasa, Iñigo

    2008-01-01

    The capacity of Staphylococcus aureus to form biofilms on host tissues and implanted medical devices is one of the major virulence traits underlying persistent and chronic infections. The matrix in which S. aureus cells are encased in a biofilm often consists of the polysaccharide intercellular adhesin (PIA) or poly-N-acetyl glucosamine (PNAG). However, surface proteins capable of promoting biofilm development in the absence of PIA/PNAG exopolysaccharide have been described. Here, we used two...

  3. Comparative analysis of agr groups and virulence genes among subclinical and clinical mastitis Staphylococcus aureus isolates from sheep flocks of the Northeast of Brazil

    de Almeida, Lara M.; de Almeida, Mayra Zilta P.R.B.; Carla L. Mendonça; Mamizuka, Elsa M.

    2013-01-01

    Staphylococcus aureus is one of the most frequent mastitis causative agents in small ruminants. The expression of most virulence genes of S. aureus is controlled by an accessory gene regulator (agr) locus. This study aimed to ascertain the prevalence of the different agr groups and to evaluate the occurrence of encoding genes for cytotoxin, adhesins and toxins with superantigen activity in S. aureus isolates from milk of ewes with clinical and subclinical mastitis in sheep flocks raised for m...

  4. Initiation of assembly and association of the structural elements of a bacterial pilus depend on two specialized tip proteins.

    Jacob-Dubuisson, F; Heuser, J.; Dodson, K.; Normark, S; Hultgren, S.

    1993-01-01

    Uropathogenic Escherichia coli produce heteropolymeric surface fibers called P pili, which present an adhesin at their tip that specifically recognizes globoside receptors on the host uroepithelium. The initial attachment step is thought to be essential for pathogenesis. P pili are composite fibers consisting of a thin tip fibrillum joined end to end to a rigid helical rod. Here we show that the ordered assembly of these structures requires the activity of two proteins that are minor componen...

  5. Host cell heparan sulfate glycosaminoglycans are ligands for OspF-related proteins of the Lyme disease spirochete.

    Lin, Yi-Pin; Bhowmick, Rudra; Coburn, Jenifer; Leong, John M

    2015-10-01

    Borrelia burgdorferi, the agent of Lyme disease, spreads from the site of the tick bite to tissues such as heart, joints and the nervous tissues. Host glycosaminoglycans, highly modified repeating disaccharides that are present on cell surfaces and in extracellular matrix, are common targets of microbial pathogens during tissue colonization. While several dermatan sulfate-binding B. burgdorferi adhesins have been identified, B. burgdorferi adhesins documented to promote spirochetal binding to heparan sulfate have not yet been identified. OspEF-related proteins (Erps), a large family of plasmid-encoded surface lipoproteins that are produced in the mammalian host, can be divided into the OspF-related, OspEF-leader peptide (Elp) and OspE-related subfamilies. We show here that a member of the OspF-related subfamily, ErpG, binds to heparan sulfate and when produced on the surface of an otherwise non-adherent B. burgdorferi strain, ErpG promotes heparan sulfate-mediated bacterial attachment to the glial but not the endothelial, synovial or respiratory epithelial cells. Six other OspF-related proteins were capable of binding heparan sulfate, whereas representative OspE-related and Elp proteins lacked this activity. These results indicate that OspF-related proteins are heparan sulfate-binding adhesins, at least one of which promotes bacterial attachment to glial cells. PMID:25864455

  6. Damping properties of type 1 fimbriae

    Zakrisson, Johan; Axner, Ove; Andersson, Magnus

    2014-01-01

    Type 1 fimbriae mediate adhesion of uropathogenic Escherichia coli (UPEC) to host cells. It has been hypothesized that fimbriae can, by their ability to uncoil under exposure to force, reduce fluid shear stress on the adhesin-receptor interaction by which the bacterium adheres to the surface. In this work we develop a model that describes how the force on the adhesin-receptor interaction of a type 1 fimbriae varies as a bacterium is affected by a time dependent fluid flow mimicking in vivo conditions. The model combines in vivo hydrodynamic conditions with previously assessed biomechanical properties of the fimbriae. Numerical methods are used to solve for the motion and adhesion force under the presence of time dependent fluid profiles. It is found that a bacterium tethered with a type 1 pilus will experience significantly reduced shear stress for moderate to high flow velocities and that the maximum stress the adhesin will experience is limited to ~120 pN, which is sufficient to activate the conformational ...

  7. Mycobacterial laminin-binding histone-like protein mediates collagen-dependent cytoadherence

    André Alves Dias

    2012-12-01

    Full Text Available When grown in the presence of exogenous collagen I, Mycobacterium bovis BCG was shown to form clumps. Scanning electron microscopy examination of these clumps revealed the presence of collagen fibres cross-linking the bacilli. Since collagen is a major constituent of the eukaryotic extracellular matrices, we assayed BCG cytoadherence in the presence of exogenous collagen I. Collagen increased the interaction of the bacilli with A549 type II pneumocytes or U937 macrophages, suggesting that BCG is able to recruit collagen to facilitate its attachment to host cells. Using an affinity chromatography approach, we have isolated a BCG collagen-binding protein corresponding to the previously described mycobacterial laminin-binding histone-like protein (LBP/Hlp, a highly conserved protein associated with the mycobacterial cell wall. Moreover, Mycobacterium leprae LBP/Hlp, a well-characterized adhesin, was also able to bind collagen I. Finally, using recombinant fragments of M. leprae LBP/Hlp, we mapped the collagen-binding activity within the C-terminal domain of the adhesin. Since this protein was already shown to be involved in the recognition of laminin and heparan sulphate-containing proteoglycans, the present observations reinforce the adhesive activities of LBP/Hlp, which can be therefore considered as a multifaceted mycobacterial adhesin, playing an important role in both leprosy and tuberculosis pathogenesis.

  8. Virulence factors of Escherichia coli in relation to the importance of vaccination in pigs

    Daniele Araujo Pereira

    2016-08-01

    Full Text Available ABSTRACT: Enterotoxigenic Escherichia coli (ETEC is the major cause of diarrhea in newborn and weaned pigs. Bacteria adhesion to the host cell is considered a specific phenomenon among fimbrial and non-fimbrial adhesins with their respective receptors on enterocytes. Enteric disorders are related with the fimbriae F4 (K88, F5 (K99, F6 (987P, F41, and F18. In addition to ETEC, another category of E. coli , porcine pathogenic E. coli (PEPEC,can cause diarrhea in pigs; it produces the porcine attaching and effacing-associated (Paa adhesin in, which is capable to cause a typical lesion known as an attaching and effacing (A/E lesion. Immunization of sows with adhesin is important to stimulate the production of antibodies and their subsequent transfer to piglets through colostrum. The aim of this paper is to illustrate the main impacts of enteric diseases caused by E. coli in swine production and to highlight the importance of continuing research on this bacterium to improve disease prevention through vaccination.

  9. Adhesion and host cell modulation: critical pathogenicity determinants of Bartonella henselae

    Kempf Volkhard AJ

    2011-04-01

    Full Text Available Abstract Bartonella henselae, the agent of cat scratch disease and the vasculoproliferative disorders bacillary angiomatosis and peliosis hepatis, contains to date two groups of described pathogenicity factors: adhesins and type IV secretion systems. Bartonella adhesin A (BadA, the Trw system and possibly filamentous hemagglutinin act as promiscous or specific adhesins, whereas the virulence locus (VirB/VirD4 type IV secretion system modulates a variety of host cell functions. BadA mediates bacterial adherence to endothelial cells and extracellular matrix proteins and triggers the induction of angiogenic gene programming. The VirB/VirD4 type IV secretion system is responsible for, e.g., inhibition of host cell apoptosis, bacterial persistence in erythrocytes, and endothelial sprouting. The Trw-conjugation system of Bartonella spp. mediates host-specific adherence to erythrocytes. Filamentous hemagglutinins represent additional potential pathogenicity factors which are not yet characterized. The exact molecular functions of these pathogenicity factors and their contribution to an orchestral interplay need to be analyzed to understand B. henselae pathogenicity in detail.

  10. Adhesion and host cell modulation: critical pathogenicity determinants of Bartonella henselae.

    Franz, Bettina; Kempf, Volkhard A J

    2011-01-01

    Bartonella henselae, the agent of cat scratch disease and the vasculoproliferative disorders bacillary angiomatosis and peliosis hepatis, contains to date two groups of described pathogenicity factors: adhesins and type IV secretion systems. Bartonella adhesin A (BadA), the Trw system and possibly filamentous hemagglutinin act as promiscous or specific adhesins, whereas the virulence locus (Vir)B/VirD4 type IV secretion system modulates a variety of host cell functions. BadA mediates bacterial adherence to endothelial cells and extracellular matrix proteins and triggers the induction of angiogenic gene programming. The VirB/VirD4 type IV secretion system is responsible for, e.g., inhibition of host cell apoptosis, bacterial persistence in erythrocytes, and endothelial sprouting. The Trw-conjugation system of Bartonella spp. mediates host-specific adherence to erythrocytes. Filamentous hemagglutinins represent additional potential pathogenicity factors which are not yet characterized. The exact molecular functions of these pathogenicity factors and their contribution to an orchestral interplay need to be analyzed to understand B. henselae pathogenicity in detail. PMID:21489243

  11. A broadband capacitive sensing method for label-free bacterial LPS detection.

    Rydosz, Artur; Brzozowska, Ewa; Górska, Sabina; Wincza, Krzysztof; Gamian, Andrzej; Gruszczynski, Slawomir

    2016-01-15

    In this paper, the authors present a new type of highly sensitive label-free microwave sensor in a form of interdigital capacitor coated with T4 bacteriophage gp37 adhesin. The adhesin binds Escherichia coli B (E. coli B) by precise recognizing its bacterial host lipopolysaccharide (LPS). The C-terminal part of the adhesin consists of the receptor-binding amino acid residues which are involved in a specific interaction with two terminal glucose residues of the bacterial LPS. The change of the sensors' capacitance and conductance as a subject to LPS presence is an indicator of the detection. The measurements in the frequency range of 0-3GHz utilizing vector network analyzer have been carried out at different concentrations to verify experimentally the proposed method. The measured capacitance change between the reference and the biofunctionalized sensor equals 15% in the entire frequency range and the measured conductance change exceeds 19%. The changes of both parameters can be used as good indicators of the LPS detection. The selectivity has been confirmed by the ELISA experiments and tested by sensor measurements with lipopolysaccharide (LPS) from E. coli B, E. coli 056, E. coli 0111, Pseudomonas aeruginosa NBRC 13743 and Hafnia alvei 1185. PMID:26339930

  12. Antiadhesive Properties of Arabinogalactan Protein from Ribes nigrum Seeds against Bacterial Adhesion of Helicobacter pylori

    Jutta Messing

    2014-03-01

    Full Text Available Fruit extracts from black currants (Ribes nigrum L. are traditionally used for treatment of gastritis based on seed polysaccharides that inhibit the adhesion of Helicobacter pylori to stomach cells. For detailed investigations an arabinogalactan protein (F2 was isolated from seeds and characterized concerning molecular weight, carbohydrate, amino acid composition, linkage, configuration and reaction with β-glucosyl Yariv. Functional testing of F2 was performed by semiquantitative in situ adhesion assay on sections of human gastric mucosa and by quantitative in vitro adhesion assay with FITC-labled H. pylori strain J99 and human stomach AGS cells. Bacterial adhesins affected were identified by overlay assay with immobilized ligands. 125I-radiolabeled F2 served for binding studies to H. pylori and interaction experiments with BabA and SabA. F2 had no cytotoxic effects against H. pylori and AGS cells; but inhibited bacterial binding to human gastric cells. F2 inhibited the binding of BabA and fibronectin-binding adhesin to its specific ligands. Radiolabeled F2 bound non-specifically to different strains of H. pylori; and to BabA deficient mutant. F2 did not lead to subsequent feedback regulation or increased expression of adhesins or virulence factors. From these data the non-specific interactions between F2 and the H. pylori lead to moderate antiadhesive effects.

  13. Antiadhesive properties of arabinogalactan protein from ribes nigrum seeds against bacterial adhesion of Helicobacter pylori.

    Messing, Jutta; Niehues, Michael; Shevtsova, Anna; Borén, Thomas; Hensel, Andreas

    2014-01-01

    Fruit extracts from black currants (Ribes nigrum L.) are traditionally used for treatment of gastritis based on seed polysaccharides that inhibit the adhesion of Helicobacter pylori to stomach cells. For detailed investigations an arabinogalactan protein (F2) was isolated from seeds and characterized concerning molecular weight, carbohydrate, amino acid composition, linkage, configuration and reaction with β-glucosyl Yariv. Functional testing of F2 was performed by semiquantitative in situ adhesion assay on sections of human gastric mucosa and by quantitative in vitro adhesion assay with FITC-labled H. pylori strain J99 and human stomach AGS cells. Bacterial adhesins affected were identified by overlay assay with immobilized ligands. ¹²⁵I-radiolabeled F2 served for binding studies to H. pylori and interaction experiments with BabA and SabA. F2 had no cytotoxic effects against H. pylori and AGS cells; but inhibited bacterial binding to human gastric cells. F2 inhibited the binding of BabA and fibronectin-binding adhesin to its specific ligands. Radiolabeled F2 bound non-specifically to different strains of H. pylori; and to BabA deficient mutant. F2 did not lead to subsequent feedback regulation or increased expression of adhesins or virulence factors. From these data the non-specific interactions between F2 and the H. pylori lead to moderate antiadhesive effects. PMID:24662083

  14. Comparative proteomic analysis of pathogenic and non-pathogenic strains from the swine pathogen Mycoplasma hyopneumoniae

    Klein Cátia S

    2009-12-01

    Full Text Available Abstract Background Mycoplasma hyopneumoniae is a highly infectious swine pathogen and is the causative agent of enzootic pneumonia (EP. Following the previous report of a proteomic survey of the pathogenic 7448 strain of swine pathogen, Mycoplasma hyopneumoniae, we performed comparative protein profiling of three M. hyopneumoniae strains, namely the non-pathogenic J strain and the two pathogenic strains 7448 and 7422. Results In 2DE comparisons, we were able to identify differences in expression levels for 67 proteins, including the overexpression of some cytoadherence-related proteins only in the pathogenic strains. 2DE immunoblot analyses allowed the identification of differential proteolytic cleavage patterns of the P97 adhesin in the three strains. For more comprehensive protein profiling, an LC-MS/MS strategy was used. Overall, 35% of the M. hyopneumoniae genome coding capacity was covered. Partially overlapping profiles of identified proteins were observed in the strains with 81 proteins identified only in one strain and 54 proteins identified in two strains. Abundance analysis of proteins detected in more than one strain demonstrates the relative overexpression of 64 proteins, including the P97 adhesin in the pathogenic strains. Conclusions Our results indicate the physiological differences between the non-pathogenic strain, with its non-infective proliferate lifestyle, and the pathogenic strains, with its constitutive expression of adhesins, which would render the bacterium competent for adhesion and infection prior to host contact.

  15. The Chaotic Structure of Bacterial Virulence Protein Sequences

    Sevdanur Genc

    2015-01-01

    Full Text Available Bacterial virulence proteins, which have been class ified on structure of virulence, causes several diseases. For instance, Adhesins play an important role in th e host cells. They are inserted DNA sequences for a variety of virulence properties. Several important methods conducted for the prediction of bacterial virulence proteins for finding new drugs or vaccines. In this study, we propose a method for feature sele ction about classification of bacterial virulence protein. The features are constituted dir ectly from the amino acid sequence of a given protein. Amino acids form proteins, which are criti cal to life, and have many important functions in living cells. They occurring with diff erent physicochemical properties by a vector of 20 numerical values, and collected in AAIndex datab ases of known 544 indices. For all that, this approach have two steps. Firstly , the amino acid sequence of a given protein analysed with Lyapunov Exponents that they have a chaotic structure in accordance wi th the chaos theory. After that, if the results show chara cterization over the complete distribution in the phase space from the point of deterministic sys tem, it means related protein will show a chaotic structure. Empirical results revealed that generated feature v ectors give the best performance with chaotic structure of physicochemical features of amino acid s with Adhesins and non-Adhesins data sets.

  16. Features of two new proteins with OmpA-like domains identified in the genome sequences of Leptospira interrogans.

    Aline F Teixeira

    Full Text Available Leptospirosis is an acute febrile disease caused by pathogenic spirochetes of the genus Leptospira. It is considered an important re-emerging infectious disease that affects humans worldwide. The knowledge about the mechanisms by which pathogenic leptospires invade and colonize the host remains limited since very few virulence factors contributing to the pathogenesis of the disease have been identified. Here, we report the identification and characterization of two new leptospiral proteins with OmpA-like domains. The recombinant proteins, which exhibit extracellular matrix-binding properties, are called Lsa46 - LIC13479 and Lsa77 - LIC10050 (Leptospiral surface adhesins of 46 and 77 kDa, respectively. Attachment of Lsa46 and Lsa77 to laminin was specific, dose dependent and saturable, with KD values of 24.3 ± 17.0 and 53.0 ± 17.5 nM, respectively. Lsa46 and Lsa77 also bind plasma fibronectin, and both adhesins are plasminogen (PLG-interacting proteins, capable of generating plasmin (PLA and as such, increase the proteolytic ability of leptospires. The proteins corresponding to Lsa46 and Lsa77 are present in virulent L. interrogans L1-130 and in saprophyte L. biflexa Patoc 1 strains, as detected by immunofluorescence. The adhesins are recognized by human leptospirosis serum samples at the onset and convalescent phases of the disease, suggesting that they are expressed during infection. Taken together, our data could offer valuable information to the understanding of leptospiral pathogenesis.

  17. Molecular mechanisms of gastric epithelial cell adhesion and injection of CagA by Helicobacter pylori

    Backert Steffen

    2011-11-01

    Full Text Available Abstract Helicobacter pylori is a highly successful pathogen uniquely adapted to colonize humans. Gastric infections with this bacterium can induce pathology ranging from chronic gastritis and peptic ulcers to gastric cancer. More virulent H. pylori isolates harbour numerous well-known adhesins (BabA/B, SabA, AlpA/B, OipA and HopZ and the cag (cytotoxin-associated genes pathogenicity island encoding a type IV secretion system (T4SS. The adhesins establish tight bacterial contact with host target cells and the T4SS represents a needle-like pilus device for the delivery of effector proteins into host target cells such as CagA. BabA and SabA bind to blood group antigen and sialylated proteins respectively, and a series of T4SS components including CagI, CagL, CagY and CagA have been shown to target the integrin β1 receptor followed by injection of CagA across the host cell membrane. The interaction of CagA with membrane-anchored phosphatidylserine may also play a role in the delivery process. While substantial progress has been made in our current understanding of many of the above factors, the host cell receptors for OipA, HopZ and AlpA/B during infection are still unknown. Here we review the recent progress in characterizing the interactions of the various adhesins and structural T4SS proteins with host cell factors. The contribution of these interactions to H. pylori colonization and pathogenesis is discussed.

  18. Antiadhesive properties of Abelmoschus esculentus (Okra immature fruit extract against Helicobacter pylori adhesion.

    Jutta Messing

    Full Text Available BACKGROUND: Traditional Asian and African medicine use immature okra fruits (Abelmoschus esculentus as mucilaginous food to combat gastritis. Its effectiveness is due to polysaccharides that inhibit the adhesion of Helicobacter pylori to stomach tissue. The present study investigates the antiadhesive effect in mechanistic detail. METHODOLOGY: A standardized aqueous fresh extract (Okra FE from immature okra fruits was used for a quantitative in vitro adhesion assay with FITC-labled H. pylori J99, 2 clinical isolates, AGS cells, and fluorescence-activated cell sorting. Bacterial adhesins affected by FE were pinpointed using a dot-blot overlay assay with immobilized Lewis(b, sialyl-Lewis(a, H-1, laminin, and fibronectin. (125I-radiolabeled Okra FE polymer served for binding studies to different H. pylori strains and interaction experiments with BabA and SabA. Iron nanoparticles with different coatings were used to investigate the influence of the charge-dependence of an interaction on the H. pylori surface. PRINCIPAL FINDINGS: Okra FE dose-dependently (0.2 to 2 mg/mL inhibited H. pylori binding to AGS cells. FE inhibited the adhesive binding of membrane proteins BabA, SabA, and HpA to its specific ligands. Radiolabeled compounds from FE bound non-specifically to different strains of H. pylori, as well as to BabA/SabA deficient mutants, indicating an interaction with a still-unknown membrane structure in the vicinity of the adhesins. The binding depended on the charge of the inhibitors. Okra FE did not lead to subsequent feedback regulation or increased expression of adhesins or virulence factors. CONCLUSION: Non-specific interactions between high molecular compounds from okra fruits and the H. pylori surface lead to strong antiadhesive effects.

  19. Functional expression of adhesive peptides as fusions to Escherichia coli flagellin.

    Westerlund-Wikström, B; Tanskanen, J; Virkola, R; Hacker, J; Lindberg, M; Skurnik, M; Korhonen, T K

    1997-11-01

    An expression system for studying epitopes of adhesion proteins based on fusion of gene fragments into fliC(H7) of Escherichia coli is described. We constructed the system by an in-frame insertion of DNA fragments encoding one, two or three of the fibronectin-binding D repeats present in the fibronectin-binding protein A (FnBPA) of Staphylococcus aureus, into the fliC(H7) gene region encoding the variable domain of the H7 flagellin. The constructs were expressed by in trans complementation in the E. coli strain JT1 which harbours knock-out mutations for the expression of FliC as well as of the mannoside-binding fimbrial adhesin. The resulting chimeric flagella, which contained 39, 77 or 115 heterologous amino acid residues, efficiently bound soluble and immobilized human plasma and cellular fibronectin, and the binding was most efficient with the flagella containing the three D repeats of FnBPA. The chimeric flagella bound to frozen sections of human kidney and to cultured human cells. Antibodies raised against the chimeric flagella bound to Protein A-deficient S. aureus cells and inhibited the binding of staphylococci to immobilized fibronectin. We also expressed peptides, ranging in size between 48 and 302 amino acids, of the collagen-binding YadA adhesin of Yersinia enterocolitica. A fragment of 302 amino acids representing the middle region of YadA was needed for collagen binding. Chimeric flagellar filaments expressing hundreds of intimately associated adhesive epitopes offer versatile tools to analyze adhesin-receptor interactions and functional epitopes of adhesion proteins. PMID:9514121

  20. Molecular mechanisms of gastric epithelial cell adhesion and injection of CagA by Helicobacter pylori

    Backert, Steffen

    2011-11-01

    Abstract Helicobacter pylori is a highly successful pathogen uniquely adapted to colonize humans. Gastric infections with this bacterium can induce pathology ranging from chronic gastritis and peptic ulcers to gastric cancer. More virulent H. pylori isolates harbour numerous well-known adhesins (BabA\\/B, SabA, AlpA\\/B, OipA and HopZ) and the cag (cytotoxin-associated genes) pathogenicity island encoding a type IV secretion system (T4SS). The adhesins establish tight bacterial contact with host target cells and the T4SS represents a needle-like pilus device for the delivery of effector proteins into host target cells such as CagA. BabA and SabA bind to blood group antigen and sialylated proteins respectively, and a series of T4SS components including CagI, CagL, CagY and CagA have been shown to target the integrin β1 receptor followed by injection of CagA across the host cell membrane. The interaction of CagA with membrane-anchored phosphatidylserine may also play a role in the delivery process. While substantial progress has been made in our current understanding of many of the above factors, the host cell receptors for OipA, HopZ and AlpA\\/B during infection are still unknown. Here we review the recent progress in characterizing the interactions of the various adhesins and structural T4SS proteins with host cell factors. The contribution of these interactions to H. pylori colonization and pathogenesis is discussed.

  1. Aeromonas and Plesiomonas as food- and waterborne pathogens.

    Wadström, T; Ljungh, A

    1991-04-01

    Aeromonas and Plesiomonas have become increasingly recognized as human enteropathogens. Plesiomonas shigelloides has mainly been recovered from various sea foods, whereas Aeromonas sp. have also been cultured from pigs, broilers, eggs, milk and vegetables. Aeromonas sp. also multiply rapidly at +4 degrees C which is a significant risk in food storage. Aeromonas sp. have furthermore been recovered from fresh water sources, and some isolates are resistant to chlorination which makes it a further risk factor. No large food- or waterborne outbreaks have been reported so far with Aeromonas sp. Various virulence factors involved in intestinal infections are described such as enterotoxins, cytotoxins, and adhesins. PMID:1854599

  2. Novel Aggregative Adherence Fimbria Variant of Enteroaggregative Escherichia coli

    Jønsson, Rie; Struve, Carsten; Boisen, Nadia;

    2015-01-01

    Enteroaggregative Escherichia coli (EAEC) organisms belong to a diarrheagenic pathotype known to cause diarrhea and can be characterized by distinct aggregative adherence (AA) in a stacked-brick pattern to cultured epithelial cells. In this study, we investigated 118 EAEC strains isolated from the....... Transformation to a nonadherent E. coli HB101 and complementation of the nonadherent C338-14 mutant with the complete gene cluster restored the AA adhesion. Overall, we found the agg5A gene in 12% of the 118 strains isolated from Denmark, suggesting that this novel adhesin represents an important variant....

  3. Construction and Immunogenicity of Recombinant Adenovirus Vaccines Expressing the HMW1, HMW2, or Hia Adhesion Protein of Nontypeable Haemophilus influenzae▿

    Winter, Linda E.; Barenkamp, Stephen J.

    2010-01-01

    The objective of the present study was to construct and assess the immunogenicity of recombinant adenovirus vectors expressing the HMW1, HMW2, or Hia protein of nontypeable Haemophilus influenzae (NTHi). These proteins are critical adhesins and potential protective antigens expressed by NTHi. Segments of the hmw1A and hmw2A structural genes that encode the distal one-half of mature HMW1 or HMW2 were cloned into the T7 expression vector pGEMEX-2. These constructs encoded stable HMW1 or HMW2 re...

  4. First Analysis of a Bacterial Collagen-Binding Protein with Collagen Toolkits: Promiscuous Binding of YadA to Collagens May Explain How YadA Interferes with Host Processes▿ †

    Jack C. Leo; Elovaara, Heli; Bihan, Dominique; Pugh, Nicholas; Kilpinen, Sami K.; Raynal, Nicolas; Skurnik, Mikael; Farndale, Richard W.; Goldman, Adrian

    2010-01-01

    The Yersinia adhesin YadA mediates the adhesion of the human enteropathogen Yersinia enterocolitica to collagens and other components of the extracellular matrix. Though YadA has been proposed to bind to a specific site in collagens, the exact binding determinants for YadA in native collagen have not previously been elucidated. We investigated the binding of YadA to collagen Toolkits, which are libraries of triple-helical peptides spanning the sequences of type II and III human collagens. Yad...

  5. Functional Analysis of Lactobacillus rhamnosus GG Pili in Relation to Adhesion and Immunomodulatory Interactions with Intestinal Epithelial Cells

    Lebeer, S.; Claes, I.J.; Tytgat, H.L.P.; Verhoeven, T.L.A.; Marien, E.; Ossowski, von, I.; Reunanen, J.; Palva, A.; Vos, de, W.M.; Keersmaecker, de, S.C.; Vanderleyden, J.

    2012-01-01

    Lactobacillus rhamnosus GG, a probiotic with good survival capacity in the human gut, has well-documented adhesion properties and health effects. Recently, spaCBA-encoded pili that bind to human intestinal mucus were identified on its cell surface. Here, we report on the phenotypic analysis of a spaCBA pilus knockout mutant in comparison with the wild type and other adhesin mutants. The SpaCBA pilus of L. rhamnosus GG showed to be key for efficient adherence to the Caco-2 intestinal epithelia...

  6. LTB-R1: an alternative to swine mycoplasmal pneumoniae control LTB-R1: uma alternativa para o controle da pneumonia micoplásmica suína

    Fabrício Rochedo Conceição; André Michelon; Marcelo Michelon; Gustavo Maia de Cerqueira; Odir Antonio Dellagostin

    2003-01-01

    Mycoplasmal pneumoniae is the main respiratory disease in swine. The most efficient way to control it is through the use of vaccines (bacterins), whose production cost is high. The objective of this work was to develop a new alternative for controlling Swine Mycoplasmal Pneumoniae, based on a recombinant subunit vaccine containing the R1 region of P97 adhesin of Mycoplasma hyopneumoniae fused to the B subunit of the heat-labile enterotoxin of Escherichia coli (rLTB-R1). In this work we report...

  7. Spiroplasma citri virus SpV1-derived cloning vector: deletion formation by illegitimate and homologous recombination in a spiroplasmal host strain which probably lacks a functional recA gene.

    Marais, A.; Bové, J M; Renaudin, J

    1996-01-01

    We have previously described the use of the replicative form (RF) of Spiroplasma citri virus SpV1 as a vector for expressing an epitope of the P1 adhesin protein from Mycoplasma pneumoniae in S. citri (A. Marais, J. M. Bové, S.F. Dallo, J. B. Baseman, and J. Renaudin, J. Bacteriol. 175:2783-2787, 1993). We have now studied the structural instability of the recombinant RF leading to loss of the DNA insert. Analyses of viral clones with deletions have shown that both illegitimate and homologous...

  8. Antibody Titer Threshold Predicts Anti-Candidal Vaccine Efficacy Even though the Mechanism of Protection Is Induction of Cell-Mediated Immunity

    Spellberg, Brad; Ibrahim, Ashraf S.; Lin, Lin; Avanesian, Valentina; Fu, Yue; Lipke, Peter; Otoo, Henry; Ho, Tiffany; Edwards, John E.

    2008-01-01

    We previously reported that vaccination with Freund’s adjuvant plus the recombinant N-terminus of the candidal adhesin, Als3p (rAls3p-N), protects mice from disseminated candidiasis. Here we report that the rAls3p-N vaccine is effective when combined with aluminum hydroxide adjuvant. Antibody titers of ≥1:6400 accurately predicted protection from infection. Nevertheless, neither B lymphocytes nor serum from immunized animals transferred protection to vaccine-naive animals. In contrast, CD3+, ...

  9. Synthetic Peptide Immunogens Elicit Polyclonal and Monoclonal Antibodies Specific for Linear Epitopes in the D Motifs of Staphylococcus aureus Fibronectin-Binding Protein, Which Are Composed of Amino Acids That Are Essential for Fibronectin Binding

    Huesca, Mario; Sun, Qing; Peralta, Robert; Shivji, Gulnar M.; Sauder, Daniel N.; McGavin, Martin J.

    2000-01-01

    A fibronectin (Fn)-binding adhesin of Staphylococcus aureus contains three tandem 37- or 38-amino-acid motifs (D1, D2, and D3), which function to bind Fn. Plasma from patients with S. aureus infections contain antibodies that preferentially recognize ligand induced binding sites in the D motifs and do not inhibit Fn binding (F. Casolini, L. Visai, D. Joh, P. G. Conaldi, A. Toniolo, M. Höök, and P. Speziale, Infect. Immun. 66:5433–5442, 1998). To eliminate the influence of Fn binding on antibo...

  10. [Molecular bases of cancer immunology].

    Barrera-Rodríguez, R; Peralta-Zaragoza, O; Madrid-Marina, V

    1995-01-01

    The immune system is a tight network of different types of cells and molecules. The coordinated action of these elements mounts a precise immune response against tumor cells. However, these cells present several escape mechanisms, leading to tumor progression. This paper shows several cellular and molecular events involved in the regulation of the immune response against tumor cells. The interaction of several molecules such as MHC, TcR, adhesins, tumor antigens and cytokines are discussed, as well as the most recent knowledge about escape mechanisms and immunotherapy. PMID:7502157

  11. AcEST: DK955315 [AcEST

    Full Text Available -rich adhesin for platelets OS=Staphylococcus haemolyticus (strain JCSC1435) GN=sraP PE=3 SV=1 Length = 3608...9KX33|Q9KX33_STRCR SrpA OS=Streptococcus cristatus PE=4 SV=1 39 0.15 tr|B2ISC7|B2ISC...A ++T Sbjct: 840 GSTDVSGSTEESSLGTTDASSSDASSSTEVSGSTEISSATEVSGTTDISSSTDASSSTDV 899 Query: 378 AGMVETKSTAGLDKG...AQVSKAT 443 +G E S+ +S +T Sbjct: 900 SGSTEVSSSTDASGSTDISSST 921 >tr|A8AWU7|A8AWU7_STRGC Streptococcal hemagg... S + ++S ++ S+E + S+ + E SK ++ S Sbjct: 615 SSSEAISSSSQVTSSSTECISSSSEVISSSEVTSCSSEVVSSSETCISSKEMSSSEQIS

  12. On-Off Kinetics of Engagement of FNI Modules of Soluble Fibronectin by β-Strand Addition.

    Wenjiang Ma

    Full Text Available Intrinsically disordered sequences within bacterial adhesins bind to E-strands in the β-sheets of multiple FNI modules of fibronectin (FN by anti-parallel β-strand addition, also called tandem β-zipper formation. The FUD segment of SfbI of Streptococcus pyogenes and Bbk32 segment of BBK32 of Borrelia burgdorferi, despite being imbedded in different adhesins from different bacteria, target the same 2-5,8-9 FNI modules, 2-5,8-9 FNI, in the N-terminal 70-kDa region (FN70K of FN. To facilitate further comparisons, FUD, Bbk32, two other polypeptides based on SfbI that target 1-5 FNI (HADD and 2-5 FNI (FRD, and mutant Bbk32 (ΔBbk32 were produced with fluorochromes placed just outside of the binding sequences. Unlabeled FUD competed ~ 1000-fold better for binding of labeled Bbk32 to FN than unlabeled Bbk32 competed for binding of labeled FUD to FN. Binding kinetics were determined by fluorescence polarization in a stopped-flow apparatus. On-rates for FUD, Bbk32, HADD, and FRD were similar, and all bound more rapidly to FN70K fragment than to full length FN. In stopped-flow displacement and size exclusion chromatographic assays, however, k off for FUD or HADD to FN70K or FN was considerably lower compared to k off of FRD or Bbk32. FUD and Bbk32 differ in the spacing between sequences that interact with 3FNI and 4FNI or with 5FNI and 8FNI. ΔBbk32, in which 2 residues were removed from Bbk32 to make the spacing more like FUD, had a k off intermediate between that of Bbk32 and FUD. These results indicate a "folding-after-binding" process after initial association of certain polypeptide sequences to FN that results in formation of a stable complex and is a function of number of FNI modules engaged by the polypeptide, spacing of engagement sites, and perhaps flexibility within the polypeptide-FN complex. We suggest that contributions of SfbI and BBK32 adhesins to bacterial pathogenicity may be determined in part by stability of adhesin-FN complexes.

  13. Translational Repression of NhaR, a Novel Pathway for Multi-Tier Regulation of Biofilm Circuitry by CsrA

    Pannuri, Archana; Yakhnin, Helen; Vakulskas, Christopher A.; Edwards, Adrianne N.; Babitzke, Paul; Romeo, Tony

    2012-01-01

    The RNA binding protein CsrA (RsmA) represses biofilm formation in several proteobacterial species. In Escherichia coli, it represses the production of the polysaccharide adhesin poly-β-1,6-N-acetyl-d-glucosamine (PGA) by binding to the pgaABCD mRNA leader, inhibiting pgaA translation, and destabilizing this transcript. In addition, CsrA represses genes responsible for the synthesis of cyclic di-GMP, an activator of PGA production. Here we determined that CsrA also represses NhaR, a LysR-type...

  14. Role of type 1 and type 3 fimbriae in Klebsiella pneumoniae biofilm formation

    Schroll, C.; Barken, Kim Bundvig; Krogfelt, K.A.;

    2010-01-01

    nosocomial infections. Most clinical K. pneumoniae isolates express two types of fimbrial adhesins, type 1 fimbriae and type 3 fimbriae. In this study, we characterized the role of type 1 and type 3 fimbriae in K. pneumoniae biofilm formation. Results: Isogenic fimbriae mutants of the clinical K. pneumoniae......Background: Klebsiella pneumoniae is an important gram-negative opportunistic pathogen causing primarily urinary tract infections, respiratory infections, and bacteraemia. The ability of bacteria to form biofilms on medical devices, e. g. catheters, has a major role in development of many...... infections....

  15. Expression of Green Fluorescent Protein in Streptococcus gordonii DL1 and Its Use as a Species-Specific Marker in Coadhesion with Streptococcus oralis 34 in Saliva-Conditioned Biofilms In Vitro

    Aspiras, Marcelo B.; Kazmerzak, Karen M.; Kolenbrander, Paul E; McNab, Roderick; Hardegen, Neil; Jenkinson, Howard F.

    2000-01-01

    Streptococcus gordonii is one of the predominant streptococci in the biofilm ecology of the oral cavity. It interacts with other bacteria through receptor-adhesin complexes formed between cognate molecules on the surfaces of the partner cells. To study the spatial organization of S. gordonii DL1 in oral biofilms, we used green fluorescent protein (GFP) as a species-specific marker to identify S. gordonii in a two-species in vitro oral biofilm flowcell system. To drive expression of gfp, we is...

  16. Quantitative differences in adhesiveness of type 1 fimbriated Escherichia coli due to structural differences in fimH genes.

    Sokurenko, E V; Courtney, H S; Maslow, J; Siitonen, A.; Hasty, D L

    1995-01-01

    Type 1 fimbriae are heteropolymeric surface organelles responsible for the D-mannose-sensitive (MS) adhesion of Escherichia coli. We recently reported that variation of receptor specificity of type 1 fimbriae can result solely from minor alterations in the structure of the gene for the FimH adhesin subunit. To further study the relationship between allelic variation of the fimH gene and adhesive properties of type 1 fimbriae, the fimH genes from five additional strains were cloned and used to...

  17. Type 1 Pili Are Not Necessary for Colonization of the Streptomycin-Treated Mouse Large Intestine by Type 1-Piliated Escherichia coli F-18 and E. coli K-12

    1989-01-01

    Escherichia coli F-18, an excellent colonizer of the streptomycin-treated mouse large intestine, produces type 1 pili. E. coli F-18 FimA-, type 1 pilus negative, and E. coli F-18 FimH-, type 1 pilus positive but adhesin negative, were constructed by bacteriophage P1 transduction of defective fimA and fimH genes from the E. coli K-12 strains ORN151 and ORN133, respectively, into E. coli F-18. Adhesion of E. coli F-18 to an immobilized mannose-bovine serum albumin glycoconjugate was about sixfo...

  18. Crystal structure of the functional region of Uro-adherence factor A from Staphylococcus saprophyticus reveals participation of the B domain in ligand binding

    Matsuoka, Eriko; Tanaka, Yoshikazu; Kuroda, Makoto; Shouji, Yuko; Ohta, Toshiko; Tanaka, Isao; Yao, Min

    2010-01-01

    Staphylococci use cell wall-anchored proteins as adhesins to attach to host tissues. Staphylococcus saprophyticus, a uropathogenic species, has a unique cell wall-anchored protein, uro-adherence factor A (UafA), which shows erythrocyte binding activity. To investigate the mechanism of adhesion by UafA, we determined the crystal structure of the functional region of UafA at 1.5 Å resolution. The structure was composed of three domains, designated as the N2, N3, and B domains, arranged in a tri...

  19. Evaluation of the Role of Candida albicans Agglutinin-Like Sequence (Als) Proteins in Human Oral Epithelial Cell Interactions

    Murciano, Celia; Moyes, David L.; Runglall, Manohursingh; Tobouti, Priscila; Islam, Ayesha; HOYER, LOIS L.; Naglik, Julian R.

    2012-01-01

    The fungus C. albicans uses adhesins to interact with human epithelial surfaces in the processes of colonization and pathogenesis. The C. albicans ALS (agglutinin-like sequence) gene family encodes eight large cell-surface glycoproteins (Als1-Als7 and Als9) that have adhesive function. This study utilized C. albicans Δals mutant strains to investigate the role of the Als family in oral epithelial cell adhesion and damage, cytokine induction and activation of a MAPK-based (MKP1/c-Fos) signalin...

  20. Quorum Sensing Regulation of Adhesion in Serratia Marcescens MG1 is surface dependent

    Labbate, M.; Zhu, H.; Thung, L.;

    2007-01-01

    Serratia marcescens is an opportunistic pathogen and a major cause of ocular infections. In previous studies of S. marcescens MG1, we showed that biofilm maturation and sloughing were regulated by N-acyl homoserine lactone (AHL)-based quorum sensing (QS). Because of the importance of adhesion in ...... and the outer membrane protein OmpX. We concluded that S. marcescens MG1 utilizes different regulatory systems and adhesins in attachment to biotic and abiotic surfaces and that QS is a main regulatory pathway in adhesion to an abiotic surface but not in adhesion to a biotic surface....

  1. Up-regulation of intestinal vascular endothelial growth factor by Afa/Dr diffusely adhering Escherichia coli.

    Gaëlle Cane

    Full Text Available BACKGROUND: Angiogenesis has been recently described as a novel component of inflammatory bowel disease pathogenesis. The level of vascular endothelial growth factor (VEGF has been found increased in Crohn's disease and ulcerative colitis mucosa. To question whether a pro-inflammatory Escherichia coli could regulate the expression of VEGF in human intestinal epithelial cells, we examine the response of cultured human colonic T84 cells to infection by E. coli strain C1845 that belongs to the typical Afa/Dr diffusely adhering E. coli family (Afa/Dr DAEC. METHODOLOGY: VEGF mRNA expression was examined by Northern blotting and q-PCR. VEGF protein levels were assayed by ELISA and its bioactivity was analysed in endothelial cells. The bacterial factor involved in VEGF induction was identified using recombinant E. coli expressing Dr adhesin, purified Dr adhesin and lipopolysaccharide. The signaling pathway activated for the up-regulation of VEGF was identified using a blocking monoclonal anti-DAF antibody, Western blot analysis and specific pharmacological inhibitors. PRINCIPAL FINDINGS: C1845 bacteria induce the production of VEGF protein which is bioactive. VEGF is induced by adhering C1845 in both a time- and bacteria concentration-dependent manner. This phenomenon is not cell line dependent since we reproduced this observation in intestinal LS174, Caco2/TC7 and INT407 cells. Up-regulation of VEGF production requires: (1 the interaction of the bacterial F1845 adhesin with the brush border-associated decay accelerating factor (DAF, CD55 acting as a bacterial receptor, and (2 the activation of a Src protein kinase upstream of the activation of the Erk and Akt signaling pathways. CONCLUSIONS: Results demonstrate that a Afa/Dr DAEC strain induces an adhesin-dependent activation of DAF signaling that leads to the up-regulation of bioactive VEGF in cultured human intestinal cells. Thus, these results suggest a link between an entero-adherent, pro

  2. The Multiple Carbohydrate Binding Specificities of Helicobacter pylori

    Teneberg, Susann

    Persistent colonization of the human stomach by Helicobacter pylori is a risk factor for the development of peptic ulcer disease and gastric cancer. Adhesion of microbes to the target tissue is an important determinant for successful initiation, establishment and maintenance of infection, and a variety of different candidate carbohydrate receptors for H. pylori have been identified. Here the different the binding specifities, and their potential role in adhesion to human gastric epithelium are described. Finally, recent findings on the roles of sialic acid binding SabA adhesin in interactions with human neutrophils and erythrocytes are discussed.

  3. FimH-mediated autoaggregation of Escherichia coli

    Schembri, Mark; Christiansen, G.; Klemm, Per

    2001-01-01

    Autoaggregation is a phenomenon thought to contribute to colonization of mammalian hosts by pathogenic bacteria. Type 1 fimbriae are surface organelles of Escherichia coli that mediate D-mannose-sensitive binding to various host surfaces. This binding is conferred by the minor fimbrial component...... FimH. In this study, we have used random mutagenesis to identify variants of the FimH adhesin that confer the ability of E. coli to autoaggregate and settle from liquid cultures. Three separate autoaggregating clones were identified, all of which contained multiple amino acid changes located within...

  4. Asymptomatic bacteriuria Escherichia coli strains

    Hancock, Viktoria; Nielsen, E.M.; Klemm, Per

    2006-01-01

    Urinary tract infections (UTIs) affect millions of people each year. Escherichia coli is the most common organism associated with asymptomatic bacteriuria (ABU) in humans. Persons affected by ABU may carry a particular E. coli strain for extended periods of time without any symptoms. In contrast to...... uropathogenic E. coli (UPEC) that cause symptomatic UTI, very little is known about the mechanisms by which these strains colonize the urinary tract. Here, we have investigated the growth characteristics in human urine as well as adhesin repertoire of nine ABU strains; the ability of ABU strains to compete...

  5. Dicty_cDB: Contig-U00222-1 [Dicty_cDB

    Full Text Available -rich adhesin for platelets; AltNam... 37 1.5 CP001634_1377( CP001634 |pid:none) Kosmo...s clone CH230-9N18, *** SEQUENCIN... 46 3.4 1 ( AL844506 ) Plasmodium falciparum chromosome 7. 46 3.4 1 ( AC223206 ) Bos...TCCTCCCGTTCCACATCATCTTCCTCTTCTATTTCATATTCTT ATAATAAACAAATAAAAAACTATCACAATAAAAAAA Gap gap included Contig length 1276 Chromos...ome number (1..6, M) 1 Chromosome length 4919822 Start point 1528...um cDNA clone:dda8g07, 3' e... 333 e-128 2 ( AC116986 ) Dictyostelium discoideum chromos

  6. PapD, a periplasmic transport protein in P-pilus biogenesis.

    Lindberg, F; Tennent, J M; Hultgren, S. J.; Lund, B; Normark, S

    1989-01-01

    The product of the papD gene of uropathogenic Escherichia coli is required for the biogenesis of digalactoside-binding P pili. Mutations within papD result in complete degradation of the major pilus subunit, PapA, and of the pilinlike proteins PapE and PapF and also cause partial breakdown of the PapG adhesin. The papD gene was sequenced, and the gene product was purified from the periplasm. The deduced amino acid sequence and the N-terminal sequence obtained from the purified protein reveale...

  7. Autoregulation and multiple DNA interactions by a transcriptional regulatory protein in E. coli pili biogenesis.

    Forsman, K; M. Göransson; Uhlin, B E

    1989-01-01

    An operon mediating biogenesis of digalactoside-binding pilus-adhesin of serotype F13 in uropathogenic Escherichia coli includes the regulatory gene papB. The papB gene product was found to act as transcriptional activator of an operon which includes the papB gene and several pap cistrons encoding the proteins of the pilus polymer. Studies of how pap gene expression was affected by increasing amounts of PapB protein in the cells showed that high levels did not stimulate transcription but caus...

  8. The structure of the PapD-PapGII pilin complex reveals an open and flexible P5 pocket

    Ford, Bradley; Verger, Denis; Dodson, Karen; Volkan, Ender; Kostakioti, Maria; Elam, Jennifer; Pinkner, Jerome; Waksman, Gabriel; Hultgren, Scott

    2012-01-01

    P pili are hairlike polymeric structures that mediate binding of uropathogenic Escherichia coli to the surface of the kidney via the PapG adhesin at their tips. PapG is composed of two domains: a lectin domain at the tip of the pilus followed by a pilin domain that comprises the initial polymerizing subunit of the 1,000-plus-subunit heteropolymeric pilus fiber. Prior to assembly, periplasmic pilin domains bind to a chaperone, PapD. PapD mediates donor strand complementation, in which a beta s...

  9. Human sepsis-associated Escherichia coli (SEPEC) is able to adhere to and invade kidney epithelial cells in culture

    The adhesins of extraintestinal pathogenic Escherichia coli are essential for mediating direct interactions between the microbes and the host cell surfaces that they infect. Using fluorescence microscopy and gentamycin protection assays, we observed that 49 sepsis-associated E. coli (SEPEC) strains isolated from human adults adhered to and invaded Vero cells in the presence of D-mannose (100%). In addition, bacteria concentrations of approximately 2 × 107 CFU/mL were recovered from Vero cells following an invasion assay. Furthermore, PCR analysis of adhesin genes showed that 98.0% of these SEPEC strains tested positive for fimH, 69.4% for flu, 53.1% for csgA, 38.8% for mat, and 32.7% for iha. Analysis of the invasin genes showed that 16.3% of the SEPEC strains were positive for tia, 12.3% for gimB, and 10.2% for ibeA. Therefore, these data suggest that SEPEC adhesion to cell surfaces occurs through non-fimH mechanisms. Scanning electron microscopy showed the formation of microcolonies on the Vero cell surface. SEPEC invasiveness was also confirmed by the presence of intracellular bacteria, and ultrastructural analysis using electron transmission microscopy revealed bacteria inside the Vero cells. Taken together, these results demonstrate that these SEPEC strains had the ability to adhere to and invade Vero cells. Moreover, these data support the theory that renal cells may be the predominant pathway through which SEPEC enters human blood vessels

  10. The pancreatic zymogen granule membrane protein, GP2, binds Escherichia coli type 1 Fimbriae

    Lowe Anson W

    2009-07-01

    Full Text Available Abstract Background GP2 is the major membrane protein present in the pancreatic zymogen granule, and is cleaved and released into the pancreatic duct along with exocrine secretions. The function of GP2 is unknown. GP2's amino acid sequence is most similar to that of uromodulin, which is secreted by the kidney. Recent studies have demonstrated uromodulin binding to bacterial Type 1 fimbria. The fimbriae serve as adhesins to host receptors. The present study examines whether GP2 also shares similar binding properties to bacteria with Type 1 fimbria. Commensal and pathogenic bacteria, including E. coli and Salmonella, express type 1 fimbria. Methods An in vitro binding assay was used to assay the binding of recombinant GP2 to defined strains of E. coli that differ in their expression of Type 1 fimbria or its subunit protein, FimH. Studies were also performed to determine whether GP2 binding is dependent on the presence of mannose residues, which is a known determinant for FimH binding. Results GP2 binds E. coli that express Type 1 fimbria. Binding is dependent on GP2 glycosylation, and specifically the presence of mannose residues. Conclusion GP2 binds to Type 1 fimbria, a bacterial adhesin that is commonly expressed by members of the Enterobacteriacae family.

  11. PbsP, a cell wall-anchored protein that binds plasminogen to promote hematogenous dissemination of group B Streptococcus.

    Buscetta, Marco; Firon, Arnaud; Pietrocola, Giampiero; Biondo, Carmelo; Mancuso, Giuseppe; Midiri, Angelina; Romeo, Letizia; Galbo, Roberta; Venza, Mario; Venza, Isabella; Kaminski, Pierre-Alexandre; Gominet, Myriam; Teti, Giuseppe; Speziale, Pietro; Trieu-Cuot, Patrick; Beninati, Concetta

    2016-07-01

    Streptococcus agalactiae (Group B Streptococcus or GBS) is a leading cause of invasive infections in neonates whose virulence is dependent on its ability to interact with cells and host components. We here characterized a surface protein with a critical function in GBS pathophysiology. This adhesin, designated PbsP, possesses two Streptococcal Surface Repeat domains, a methionine and lysine-rich region, and a LPXTG cell wall-anchoring motif. PbsP mediates plasminogen (Plg) binding both in vitro and in vivo and we showed that cell surface-bound Plg can be activated into plasmin by tissue plasminogen activator to increase the bacterial extracellular proteolytic activity. Absence of PbsP results in a decreased bacterial transmigration across brain endothelial cells and impaired virulence in a murine model of infection. PbsP is conserved among the main GBS lineages and is a major plasminogen adhesin in non-CC17 GBS strains. Importantly, immunization of mice with recombinant PbsP confers protective immunity. Our results indicate that GBS have evolved different strategies to recruit Plg which indicates that the ability to acquire cell surface proteolytic activity is essential for the invasiveness of this bacterium. PMID:26888569

  12. Antigen I/II encoded by integrative and conjugative elements of Streptococcus agalactiae and role in biofilm formation.

    Chuzeville, Sarah; Dramsi, Shaynoor; Madec, Jean-Yves; Haenni, Marisa; Payot, Sophie

    2015-11-01

    Streptococcus agalactiae (i.e. Group B streptococcus, GBS) is a major human and animal pathogen. Genes encoding putative surface proteins and in particular an antigen I/II have been identified on Integrative and Conjugative Elements (ICEs) found in GBS. Antigens I/II are multimodal adhesins promoting colonization of the oral cavity by streptococci such as Streptococcus gordonii and Streptococcus mutans. The prevalence and diversity of antigens I/II in GBS were studied by a bioinformatic analysis. It revealed that antigens I/II, which are acquired by horizontal transfer via ICEs, exhibit diversity and are widespread in GBS, in particular in the serotype Ia/ST23 invasive strains. This study aimed at characterizing the impact on GBS biology of proteins encoded by a previously characterized ICE of S. agalactiae (ICE_515_tRNA(Lys)). The production and surface exposition of the antigen I/II encoded by this ICE was examined using RT-PCR and immunoblotting experiments. Surface proteins of ICE_515_tRNA(Lys) were found to contribute to GBS biofilm formation and to fibrinogen binding. Contribution of antigen I/II encoded by SAL_2056 to biofilm formation was also demonstrated. These results highlight the potential for ICEs to spread microbial adhesins between species. PMID:26232503

  13. Evaluation of two novel leptospiral proteins for their interaction with human host components.

    Silva, Lucas P; Fernandes, Luis G V; Vieira, Monica L; de Souza, Gisele O; Heinemann, Marcos B; Vasconcellos, Silvio A; Romero, Eliete C; Nascimento, Ana L T O

    2016-07-01

    Pathogenic species of the genus Leptospira are the etiological agents of leptospirosis, the most widespread zoonosis. Mechanisms involved in leptospiral pathogenesis are not well understood. By data mining the genome sequences of Leptospira interrogans we have identified two proteins predicted to be surface exposed, LIC10821 and LIC10064. Immunofluorescence and proteinase K assays confirmed that the proteins are exposed. Reactivity of the recombinant proteins with human sera has shown that rLIC10821, but not rLIC10064, is recognized by antibodies in confirmed leptospirosis serum samples, suggesting its expression during infection. The rLIC10821 was able to bind laminin, in a dose-dependent fashion, and was called Lsa37 (leptospiral surface adhesin of 37 kDa). Studies with human plasma components demonstrated that rLIC10821 interacts with plasminogen (PLG) and fibrinogen (Fg). The binding of Lsa37 with PLG generates plasmin when PLG activator was added. Fibrin clotting reduction was observed in a thrombin-catalyzed reaction, when Fg was incubated with Lsa37, suggesting that this protein may interfere in the coagulation cascade during the disease. Although LIC10064 protein is more abundant than the corresponding Lsa37, binding activity with all the components tested was not detected. Thus, Lsa37 is a novel versatile adhesin that may mediate Leptospira-host interactions. PMID:27129366

  14. Crystallization and initial crystallographic analysis of the Streptococcus parasanguinis FW213 Fap1-NRα adhesive domain at pH 5.0

    The adhesin fimbriae-associated protein 1 (Fap1) is a surface protein of Streptococcus parasanguinis FW213 and plays a major role in the formation of dental plaque in humans. Here, the adhesive domain Fap1-NRα, which is activated by acidic pH, has been crystallized at pH 5.0 and diffraction data have been collected to 3.0 Å resolution. The adhesin fimbriae-associated protein 1 (Fap1) is a surface protein of Streptococcus parasanguinis FW213 and plays a major role in the formation of dental plaque in humans. Increased adherence is highly correlated to a reduction in pH and acid activation has been mapped to a subdomain: Fap1-NRα. Here, Fap1-NRα has been crystallized at pH 5.0 and diffraction data have been collected to 3.0 Å resolution. The crystals belonged to space group P41212 or P43212, with unit-cell parameters a = b = 122.0, c = 117.8 Å. It was not possible to conclusively determine the number of molecules in the asymmetric unit and heavy-atom derivatives are now being prepared

  15. MHJ_0461 is a multifunctional leucine aminopeptidase on the surface of Mycoplasma hyopneumoniae.

    Jarocki, Veronica M; Santos, Jerran; Tacchi, Jessica L; Raymond, Benjamin B A; Deutscher, Ania T; Jenkins, Cheryl; Padula, Matthew P; Djordjevic, Steven P

    2015-01-01

    Aminopeptidases are part of the arsenal of virulence factors produced by bacterial pathogens that inactivate host immune peptides. Mycoplasma hyopneumoniae is a genome-reduced pathogen of swine that lacks the genetic repertoire to synthesize amino acids and relies on the host for availability of amino acids for growth. M. hyopneumoniae recruits plasmin(ogen) onto its cell surface via the P97 and P102 adhesins and the glutamyl aminopeptidase MHJ_0125. Plasmin plays an important role in regulating the inflammatory response in the lungs of pigs infected with M. hyopneumoniae. We show that recombinant MHJ_0461 (rMHJ_0461) functions as a leucine aminopeptidase (LAP) with broad substrate specificity for leucine, alanine, phenylalanine, methionine and arginine and that MHJ_0461 resides on the surface of M. hyopneumoniae. rMHJ_0461 also binds heparin, plasminogen and foreign DNA. Plasminogen bound to rMHJ_0461 was readily converted to plasmin in the presence of tPA. Computational modelling identified putative DNA and heparin-binding motifs on solvent-exposed sites around a large pore on the LAP hexamer. We conclude that MHJ_0461 is a LAP that moonlights as a multifunctional adhesin on the cell surface of M. hyopneumoniae. PMID:25589579

  16. Post-translational processing targets functionally diverse proteins in Mycoplasma hyopneumoniae.

    Tacchi, Jessica L; Raymond, Benjamin B A; Haynes, Paul A; Berry, Iain J; Widjaja, Michael; Bogema, Daniel R; Woolley, Lauren K; Jenkins, Cheryl; Minion, F Chris; Padula, Matthew P; Djordjevic, Steven P

    2016-02-01

    Mycoplasma hyopneumoniae is a genome-reduced, cell wall-less, bacterial pathogen with a predicted coding capacity of less than 700 proteins and is one of the smallest self-replicating pathogens. The cell surface of M. hyopneumoniae is extensively modified by processing events that target the P97 and P102 adhesin families. Here, we present analyses of the proteome of M. hyopneumoniae-type strain J using protein-centric approaches (one- and two-dimensional GeLC-MS/MS) that enabled us to focus on global processing events in this species. While these approaches only identified 52% of the predicted proteome (347 proteins), our analyses identified 35 surface-associated proteins with widely divergent functions that were targets of unusual endoproteolytic processing events, including cell adhesins, lipoproteins and proteins with canonical functions in the cytosol that moonlight on the cell surface. Affinity chromatography assays that separately used heparin, fibronectin, actin and host epithelial cell surface proteins as bait recovered cleavage products derived from these processed proteins, suggesting these fragments interact directly with the bait proteins and display previously unrecognized adhesive functions. We hypothesize that protein processing is underestimated as a post-translational modification in genome-reduced bacteria and prokaryotes more broadly, and represents an important mechanism for creating cell surface protein diversity. PMID:26865024

  17. Modulation of the NF-kappaB pathway by Bordetella pertussis filamentous hemagglutinin.

    Tzvia Abramson

    Full Text Available BACKGROUND: Filamentous hemagglutinin (FHA is a cell-associated and secreted adhesin produced by Bordetella pertussis with pro-apoptotic and pro-inflammatory activity in host cells. Given the importance of the NF-kappaB transcription factor family in these host cell responses, we examined the effect of FHA on NF-kappaB activation in macrophages and bronchial epithelial cells, both of which are relevant cell types during natural infection. METHODOLOGY/PRINCIPAL FINDINGS: Exposure to FHA of primary human monocytes and transformed U-937 macrophages, but not BEAS-2B epithelial cells, resulted in early activation of the NF-kappaB pathway, as manifested by the degradation of cytosolic IkappaB alpha, by NF-kappaB DNA binding, and by the subsequent secretion of NF-kappaB-regulated inflammatory cytokines. However, exposure of macrophages and human monocytes to FHA for two hours or more resulted in the accumulation of cytosolic IkappaB alpha, and the failure of TNF-alpha to activate NF-kappaB. Proteasome activity was attenuated following exposure of cells to FHA for 2 hours, as was the nuclear translocation of RelA in BEAS-2B cells. CONCLUSIONS: These results reveal a complex temporal dynamic, and suggest that despite short term effects to the contrary, longer exposures of host cells to this secreted adhesin may block NF-kappaB activation, and perhaps lead to a compromised immune response to this bacterial pathogen.

  18. Molecular Analysis of Asymptomatic Bacteriuria Escherichia coli Strain VR50 Reveals Adaptation to the Urinary Tract by Gene Acquisition

    Beatson, Scott A.; Ben Zakour, Nouri L.; Totsika, Makrina;

    2015-01-01

    mutant with GI-VR50-pheV deleted was attenuated in a mouse model of UTI in vivo. We established that Afa is the island-encoded factor responsible for this phenotype using two independent deletion (Afa operon and AfaE adhesin) mutants. E. coli VR50afa and VR50afaE displayed significantly decreased ability...... evolution and molecular mechanisms that underpin ABU, the genome of the ABU E. coli strain VR50 was sequenced. Analysis of the complete genome indicated that it most resembles E. coli K-12, with the addition of a 94-kb genomic island (GI-VR50-pheV), eight prophages, and multiple plasmids. GI-VR50-pheV has a...... mosaic structure and contains genes encoding a number of UTI-associated virulence factors, namely, Afa (afimbrial adhesin), two autotransporter proteins (Ag43 and Sat), and aerobactin. We demonstrated that the presence of this island in VR50 confers its ability to colonize the murine bladder, as a VR50...

  19. Effect of simulated stages of the canine oestrous cycle on Escherichia coli binding to canine endometrium.

    Krekeler, N; Lodge, K M; Anderson, G A; Browning, G F; Charles, J A; Wright, P J

    2012-12-01

    Pyometra, a prevalent infectious uterine disease that affects intact middle-aged bitches, is typically associated with Escherichia coli. Our hypotheses were (i) that bacterial adhesion to canine endometrium differs between different stages of the oestrous cycle and (ii) that the adhesin FimH facilitates this adhesion. Twelve post-pubertal, ovariectomized greyhound bitches were treated with exogenous hormones to simulate different stages of the oestrous cycle. Tissue samples from each uterus were incubated with a pathogenic E. coli strain carrying the fimH gene, but no other adhesin genes (P4-wt)--or an E. coli strain in which fimH was insertionally inactivated (P4-∆fimH::kan)--or with phosphate-buffered saline as a negative control. After washing, tissue samples were homogenized for quantification of adherent bacteria. The differences in binding to canine endometrium at different stages of the oestrous cycle were not significant. However, the mean difference in binding of the P4-wt and the P4-∆fimH::kan across all stages of the simulated oestrous cycle was significant (p < 0.001 by paired t-test on geometric means). Individual differences in numbers of P4-wt bacteria bound between dogs might suggest genetic variations or epigenetic differences in FimH receptor expression by the endometrium, unrelated to the stage of the oestrous cycle. PMID:23279531

  20. Human sepsis-associated Escherichia coli (SEPEC) is able to adhere to and invade kidney epithelial cells in culture

    Conceição, R.A. [Departamento de Genética, Evolução e Bioagentes, Universidade Estadual de Campinas, Campinas, SP (Brazil); Ludovico, M.S. [Departamento de Microbiologia, Universidade Estadual de Londrina, Londrina, PR (Brazil); Andrade, C.G.T.J. [Departamento de Biologia Geral, Universidade Estadual de Londrina, Londrina, PR (Brazil); Yano, T. [Departamento de Genética, Evolução e Bioagentes, Universidade Estadual de Campinas, Campinas, SP (Brazil)

    2012-04-13

    The adhesins of extraintestinal pathogenic Escherichia coli are essential for mediating direct interactions between the microbes and the host cell surfaces that they infect. Using fluorescence microscopy and gentamycin protection assays, we observed that 49 sepsis-associated E. coli (SEPEC) strains isolated from human adults adhered to and invaded Vero cells in the presence of D-mannose (100%). In addition, bacteria concentrations of approximately 2 × 10{sup 7} CFU/mL were recovered from Vero cells following an invasion assay. Furthermore, PCR analysis of adhesin genes showed that 98.0% of these SEPEC strains tested positive for fimH, 69.4% for flu, 53.1% for csgA, 38.8% for mat, and 32.7% for iha. Analysis of the invasin genes showed that 16.3% of the SEPEC strains were positive for tia, 12.3% for gimB, and 10.2% for ibeA. Therefore, these data suggest that SEPEC adhesion to cell surfaces occurs through non-fimH mechanisms. Scanning electron microscopy showed the formation of microcolonies on the Vero cell surface. SEPEC invasiveness was also confirmed by the presence of intracellular bacteria, and ultrastructural analysis using electron transmission microscopy revealed bacteria inside the Vero cells. Taken together, these results demonstrate that these SEPEC strains had the ability to adhere to and invade Vero cells. Moreover, these data support the theory that renal cells may be the predominant pathway through which SEPEC enters human blood vessels.

  1. Role of type 1 and type 3 fimbriae in Klebsiella pneumoniae biofilm formation

    Krogfelt Karen A

    2010-06-01

    Full Text Available Abstract Background Klebsiella pneumoniae is an important gram-negative opportunistic pathogen causing primarily urinary tract infections, respiratory infections, and bacteraemia. The ability of bacteria to form biofilms on medical devices, e.g. catheters, has a major role in development of many nosocomial infections. Most clinical K. pneumoniae isolates express two types of fimbrial adhesins, type 1 fimbriae and type 3 fimbriae. In this study, we characterized the role of type 1 and type 3 fimbriae in K. pneumoniae biofilm formation. Results Isogenic fimbriae mutants of the clinical K. pneumoniae isolate C3091 were constructed, and their ability to form biofilm was investigated in a flow cell system by confocal scanning laser microscopy. The wild type strain was found to form characteristic biofilm and development of K. pneumoniae biofilm occurred primarily by clonal growth, not by recruitment of planktonic cells. Type 1 fimbriae did not influence biofilm formation and the expression of type 1 fimbriae was found to be down-regulated in biofilm forming cells. In contrast, expression of type 3 fimbriae was found to strongly promote biofilm formation. Conclusion By use of well defined isogenic mutants we found that type 3 fimbriae, but not type 1 fimbriae, strongly promote biofilm formation in K. pneumoniae C3091. As the vast majority of clinical K. pneumoniae isolates express type 3 fimbriae, this fimbrial adhesin may play a significant role in development of catheter associated K. pneumoniae infections.

  2. Incidence of virulence determinants in clinical Enterococcus faecalis and Enterococcus faecium isolates collected in Bulgaria

    Tanya Strateva

    2016-04-01

    Full Text Available Abstract Objectives To evaluate the prevalence of some virulence genes among 510 clinical Enterococcus spp. isolates and to assess the association of those genes with the species, infection site, and patient group (inpatients/outpatients. Methods Adhesins genes (aggregation substances agg and asa1 of Enterococcus faecalis and Enterococcus faecium, respectively, enterococcal surface protein (esp, endocarditis-specific antigen A (efaA, collagen-binding proteins (ace/acm; invasins (hyaluronidase (hyl and gelatinase (gelE; cytotoxines (activation of cytolysin (cylA in E. faecalis; and modulators of the host immunity and inflammation (enhanced expression pheromone (eep in E. faecalis were detected by polymerase chain reaction. Results The overall prevalence was: esp – 44.3%, agg/asa1 – 38.4%, ace/acm – 64.3%, efaA – 85.9%, eep – 69.4%, gelE – 64.3%, hyl – 25.1%, and cylA – 47.1%. E. faecalis isolates had significantly higher frequency of adhesin genes (esp and agg/asa1 and gelatinase in comparison to E. faecium. Multiple virulence genes in E. faecalis were significantly more prevalent than in E. faecium isolates. Domination of E. faecium with or without only one gene compared to the isolates of E. faecalis were found. Enterococcus spp. isolates obtained from outpatients compared to inpatients isolates had significantly higher frequency of agg/asa1, eep, gelE and cylA. Some adhesins genes (esp, agg/asa1 and efaA had higher prevalence among the non-invasive Enterococcus spp. isolates compared to those causing invasive bacteremia, while ace/acm revealed higher dissemination in isolates causing invasive infections compared to non-invasive isolates. Conclusion Most E. faecalis attaches to abiotic surfaces in hospital environment, which correlates with higher prevalence of gene encoding for virulence factors involved in biofilm formation, such as enterococcal surface protein, aggregation substance, and gelatinase. The intestinal tract is an

  3. Identification, expression and serological evaluation of the recombinant ATP synthase beta subunit of Mycoplasma pneumoniae

    Nuyttens Hélène

    2010-08-01

    Full Text Available Abstract Background Mycoplasma pneumoniae is responsible for acute respiratory tract infections (RTIs common in children and young adults. As M. pneumoniae is innately resistant to β-lactams antibiotics usually given as the first-line treatment for RTIs, specific and early diagnosis is important in order to select the right treatment. Serology is the most used diagnostic method for M. pneumoniae infections. Results In this study, we identified the M. pneumoniae ATP synthase beta subunit (AtpD by serologic proteome analysis and evaluated its usefulness in the development of a serological assay. We successfully expressed and purified recombinant AtpD (rAtpD protein, which was recognised by serum samples from M. pneumoniae-infected patient in immunoblots. The performance of the recombinant protein rAtpD was studied using a panel of serum samples from 103 infected patients and 86 healthy blood donors in an in-house IgM, IgA and IgG enzyme-linked immunosorbent assay (ELISA. The results of this assay were then compared with those of an in-house ELISA with a recombinant C-terminal fragment of the P1 adhesin (rP1-C and of the commercial Ani Labsystems ELISA kit using an adhesin P1-enriched whole-cell extract. Performances of the rAtpD and rP1-C antigen combination were further assessed by binary logistic regression analysis. We showed that combination of rAtpD and rP1-C discriminated maximally between the patients infected with M. pneumoniae (children and adults and the healthy subjects for the IgM class, performing better than the single recombinant antigens or the commercial whole-cell extract. Conclusion These results suggest that AtpD can be used as an antigen for the immunodiagnosis of early and acute M. pneumoniae infection in association with adhesin P1, providing an excellent starting point for the development of point-of-care diagnostic assays.

  4. Expression of Helicobacter pylori AlpA protein and its immunogenicity

    Jing Xue; Yang Bai; Ye Chen; Ji-De Wang; Zhao-Shan Zhang; Ya-Li Zhang; Dian-Yuan Zhou

    2005-01-01

    AIM: To construct a recombinant strain which expresses adhesin AlpA of Helicobacter pylori(H pylori) and to study the immunogenicity of adhesin AlpA.METHODS: Gene Ab, which was amplified from H pylori chromosomal DNA by PCR technique, was sequenced and the biological information was analyzed, and inserted into the Nco Ⅰ and NotⅠ restriction fragments of the expression vector pET-22b(+) using T4 DNA ligase. The resulting plasmid pET-AlpA was transformed into competent E.coli BL21(DE3) cells using ampicillin resistance for selection.Recombinant strains were incubated in 5 mL LB with 100 μg/mL ampicillin overnight at 37 ℃. Sonication of BL21(DE3)pET-22b(+)/AlpA was analyzed by Western blot to detect AlpA immunogenicity.RESULTS: The gene encoding AlpA protein was amplified by PCR with chromosomal DNA of H pylori Sydney strain (SS1) as templates. It revealed that AlpA DNA fragment amplified by PCR had approximately 1 500 nucleotides,compatible with the previous reports. The recombinant plasmid pET-22b(+)/AB was successfully constructed. DNA sequencing showed one open reading frame with the length of 588 bp. It encoded seven conservative regions that showed good antigenicity and hydrophobicity by Parker and Welling method. Furthermore, INTERNET EXPASY,NNPREDICT and ISREC predicted that it was a porin-like structure consisting of β-pleated sheets that were embedded in the outer membrane. BLAST analyzed 836 767 protein sequences and found that the similar sequences were all belonging to H pylori OMP sequences. SDS-PAGE and scan analysis showed that the molecular weight of AB was 22.5 ku and recombinant protein amounted to 29% of the total bacterial protein, among which dissolved expression amounted to 21.9% of sonicated supernatant. The rAB purity amounted to 96% through affinity chromatography.Western blot analysis of rAB confirmed that it could be specially recognized by serum form rabbit immunized with AlpA and H pylori infected.CONCLUSION: Adhesin Alp

  5. Biofilm synthesis and its relationship with genetic characteristics in clinical methicillin-resistant staphylococci

    Nikolaos Giormezis

    2015-09-01

    Full Text Available Staphylococcus aureus can cause a broad range of infections, including skin infections, pneumonia and bacteraemia. Coagulase-negative staphylococci (CNS, mainly S. epidermidis, have also emerged as important pathogens, especially in immunocompromised patients or those with prosthetic devices, such as intravascular catheters or biomaterials. Of great importance in the initiation of these infections is the ability of staphylococci to adhere to various surfaces, such as host tissues and prosthetic devices and to form biofilm. The staphylococcal adhesins are encoded by a number of genes such as fnbA (S. aureus fibronectin binding protein A, sasG (S. aureus surface protein G, aap (S. epidermidis accumulation associated protein, bhp (Bap homologue protein and fbe (fibrinogen binding protein epidermidis. In this study, 106 methicillin-resistant S. aureus (MRSA, 145 methicillin-resistant S. epidermidis (MRSE and 70 non-epidermidis methicillin-resistant CNS (MR-CNS; 58 S. haemolyticus, 10 S. hominis and two S. lugdunensis were compared in terms of biofilm formation, antimicrobial resistance, clonal distribution and adhesin genes carriage. Isolates were classified into pulsotypes by PFGE and assigned to sequence types by MLST. In total, 121/321 isolates (37.7% produced biofilm and 219 (68.2% carried ica operon. The majority was multidrug resistant (94.7% and carried one or more adhesin genes. MRSE and all other MR-CNS prevailed in biofilm formation (P < 0.001 and antimicrobial resistance (P < 0.05 as compared to MRSA. MRSE also prevailed in ica carriage compared to the other methicillin-resistant staphylococci (P ≤ 0.007 Among MRSE, isolates from bacteraemias prevailed in biofilm formation (P = 0.031, whereas, strains from prosthetic device-associated infections carried more frequently aap (P = 0.003. Even though PFGE showed genetic diversity among MRSE, MLST revealed three major clones (ST2, ST5, ST16. MRSA isolates were less diverse, with five PFGE

  6. A c-di-GMP effector system controls cell adhesion by inside-out signaling and surface protein cleavage.

    Peter D Newell

    Full Text Available In Pseudomonas fluorescens Pf0-1 the availability of inorganic phosphate (Pi is an environmental signal that controls biofilm formation through a cyclic dimeric GMP (c-di-GMP signaling pathway. In low Pi conditions, a c-di-GMP phosphodiesterase (PDE RapA is expressed, depleting cellular c-di-GMP and causing the loss of a critical outer-membrane adhesin LapA from the cell surface. This response involves an inner membrane protein LapD, which binds c-di-GMP in the cytoplasm and exerts a periplasmic output promoting LapA maintenance on the cell surface. Here we report how LapD differentially controls maintenance and release of LapA: c-di-GMP binding to LapD promotes interaction with and inhibition of the periplasmic protease LapG, which targets the N-terminus of LapA. We identify conserved amino acids in LapA required for cleavage by LapG. Mutating these residues in chromosomal lapA inhibits LapG activity in vivo, leading to retention of the adhesin on the cell surface. Mutations with defined effects on LapD's ability to control LapA localization in vivo show concomitant effects on c-di-GMP-dependent LapG inhibition in vitro. To establish the physiological importance of the LapD-LapG effector system, we track cell attachment and LapA protein localization during Pi starvation. Under this condition, the LapA adhesin is released from the surface of cells and biofilms detach from the substratum. This response requires c-di-GMP depletion by RapA, signaling through LapD, and proteolytic cleavage of LapA by LapG. These data, in combination with the companion study by Navarro et al. presenting a structural analysis of LapD's signaling mechanism, give a detailed description of a complete c-di-GMP control circuit--from environmental signal to molecular output. They describe a novel paradigm in bacterial signal transduction: regulation of a periplasmic enzyme by an inner membrane signaling protein that binds a cytoplasmic second messenger.

  7. Molecular Basis of Ligand-Dependent Regulation of NadR, the Transcriptional Repressor of Meningococcal Virulence Factor NadA.

    Liguori, Alessia; Malito, Enrico; Lo Surdo, Paola; Fagnocchi, Luca; Cantini, Francesca; Haag, Andreas F; Brier, Sébastien; Pizza, Mariagrazia; Delany, Isabel; Bottomley, Matthew J

    2016-04-01

    Neisseria adhesin A (NadA) is present on the meningococcal surface and contributes to adhesion to and invasion of human cells. NadA is also one of three recombinant antigens in the recently-approved Bexsero vaccine, which protects against serogroup B meningococcus. The amount of NadA on the bacterial surface is of direct relevance in the constant battle of host-pathogen interactions: it influences the ability of the pathogen to engage human cell surface-exposed receptors and, conversely, the bacterial susceptibility to the antibody-mediated immune response. It is therefore important to understand the mechanisms which regulate nadA expression levels, which are predominantly controlled by the transcriptional regulator NadR (Neisseria adhesin A Regulator) both in vitro and in vivo. NadR binds the nadA promoter and represses gene transcription. In the presence of 4-hydroxyphenylacetate (4-HPA), a catabolite present in human saliva both under physiological conditions and during bacterial infection, the binding of NadR to the nadA promoter is attenuated and nadA expression is induced. NadR also mediates ligand-dependent regulation of many other meningococcal genes, for example the highly-conserved multiple adhesin family (maf) genes, which encode proteins emerging with important roles in host-pathogen interactions, immune evasion and niche adaptation. To gain insights into the regulation of NadR mediated by 4-HPA, we combined structural, biochemical, and mutagenesis studies. In particular, two new crystal structures of ligand-free and ligand-bound NadR revealed (i) the molecular basis of 'conformational selection' by which a single molecule of 4-HPA binds and stabilizes dimeric NadR in a conformation unsuitable for DNA-binding, (ii) molecular explanations for the binding specificities of different hydroxyphenylacetate ligands, including 3Cl,4-HPA which is produced during inflammation, (iii) the presence of a leucine residue essential for dimerization and conserved in

  8. AcEST: DK958484 [AcEST

    Full Text Available MYCGE Adhesin P1 OS=Mycoplasma genitalium GN=mgpA... 31 5.5 sp|Q05793|PGBM_MOUSE Basement membrane-specific hepara...0VD85|Q0VD85_MOUSE Potassium channel, subfamily K, member 4 ... 35 5.8 >tr|A2WYS3|A2WYS3_ORYSI Putative uncharac... 37 1.5 tr|Q08WD2|Q08WD2_STIAU D-isomer specific 2-hydroxyacid dehydroge... 37 1.5 tr|B2IG99|B2IG99_BEII9 Methyl-accepting chem...35 0.38 sp|O88454|KCNK4_MOUSE Potassium channel subfamily K member 4 OS=... 35 0.49 sp|Q5FM92|EFG_LACAC Elongation factor G OS=Lac...terized protein OS=Branchiostoma floridae GN=BRAFLDRAFT_63711 PE=4

  9. The main Aeromonas pathogenic factors.

    Tomás, J M

    2012-01-01

    The members of the Aeromonas genus are ubiquitous, water-borne bacteria. They have been isolated from marine waters, rivers, lakes, swamps, sediments, chlorine water, water distribution systems, drinking water and residual waters; different types of food, such as meat, fish, seafood, vegetables, and processed foods. Aeromonas strains are predominantly pathogenic to poikilothermic animals, and the mesophilic strains are emerging as important pathogens in humans, causing a variety of extraintestinal and systemic infections as well as gastrointestinal infections. The most commonly described disease caused by Aeromonas is the gastroenteritis; however, no adequate animal model is available to reproduce this illness caused by Aeromonas. The main pathogenic factors associated with Aeromonas are: surface polysaccharides (capsule, lipopolysaccharide, and glucan), S-layers, iron-binding systems, exotoxins and extracellular enzymes, secretion systems, fimbriae and other nonfilamentous adhesins, motility and flagella. PMID:23724321

  10. Glycomics for Microbes and Microbiologists.

    Lipke, Peter N

    2016-01-01

    The recent article "Lectin-Glycan Interaction Network-Based Identification of Host Receptors of Microbial Pathogenic Adhesins" by Ielasi et al. describes a new development in microbial carbohydrate analysis [Ielasi FS, Alioscha-Perez M, Donohue D, Claes S, Sahli H, Schols D, Willaert RG, mBio 7(4):e00584-16, 2016, http://dx.doi.org/10.1128/mbio.00584-16]. Specific carbohydrate ligands have been identified from the patterns of lectin binding to oligosaccharides printed on a chip. The new technique links the output to a comprehensive glycan database and offers a number of data visualization options. The graphs highlight the occurrence of potential ligands, organized by organism, tissue, and patterns of association with disease states. The analysis has successfully predicted novel glycoprotein ligands for microbial lectins, including an interaction of E. coli FimH with HIV gp120. PMID:27507827

  11. Novel Zn2+-chelating peptides selected from a fimbria-displayed random peptide library

    Kjærgaard, Kristian; Schembri, Mark; Klemm, Per

    2001-01-01

    H adhesin. FimH is a component of the fimbrial organelle that can accommodate and display a diverse range of peptide sequences on the E. coli cell surface. In this study we have constructed a random peptide library in FimH. The library, consisting of similar to 40 million individual clones, was screened for...... completely novel Zn2+-binding peptide sequences had been isolated. By changing the protein scaffold system, we demonstrated that the Zn2+-binding seems to be uniquely mediated by the peptide insert and to be independent of the sequence of the carrier protein. These findings might be applied in the design of...... biomatrices for bioremediation purposes or in the development of sensors for detection of heavy metals....

  12. Differential role of eDNA, proteins, and polysaccharides in cell-cell and cell-substrate adhesion by three Staphylococcus species

    Meyer, Rikke Louise; Okshevsky, Mira Ursula; Zeng, Guanghong

    and S. aureus to glass surfaces, while it also weakened cell-cell interactions and hampered aggregation in all species. Dispersin was most effective against S. epidermidis and S. xylosus, whereas subtilisin was most effective against S. aureus. eDNA and polysaccharides appeared to work in concert to......The diversity in mechanisms for bacterial attachment and biofilm formation is the overarching challenge for development of strategies to combat biofilms. Understanding the quantitative contribution of different types of cell surface adhesins during the initiation of biofilm formation is therefore...... valuable for designing new approaches to biofilm prevention. In this study, we combine microfluidic flow-cell studies with single-cell analyses to understand how polysaccharides, extracellular DNA (eDNA), and proteins contribute individually and in concert to mediate bacterial adhesion and aggregation on...

  13. Cytoadhesion of Plasmodium falciparum-infected erythrocytes to chondroitin-4-sulfate is cooperative and shear enhanced

    Rieger, Harden; Yoshikawa, Hiroshi Y; Quadt, Katharina;

    2015-01-01

    effect of the receptor/ligand arrangement on cytoadhesion, using artificial membranes with different CSA spacing intervals. We found that cytoadhesion is strongly dependent on the CSA distance, with half-maximal adhesion occurring at a CSA distance of 9 ± 1 nm at all hydrodynamic conditions. Moreover......, binding to CSA was cooperative and shear stress induced. These findings suggest that the CSA density, together with allosteric effects in VAR2CSA, aid in discriminating between different CSA milieus....... of the parasite-encoded adhesin VAR2CSA with chondroitin-4-sulfate (CSA) present on placental proteoglycans. CSA presented elsewhere in the microvasculature does not afford VAR2CSA-mediated cytoadhesion of parasitized erythrocytes. To address the placenta-specific binding tropism, we investigated the...

  14. Asymptomatic bacteriuria Escherichia coli strains

    Hancock, Viktoria; Nielsen, E.M.; Klemm, Per

    2006-01-01

    Urinary tract infections (UTIs) affect millions of people each year. Escherichia coli is the most common organism associated with asymptomatic bacteriuria (ABU) in humans. Persons affected by ABU may carry a particular E. coli strain for extended periods of time without any symptoms. In contrast to...... uropathogenic E. coli (UPEC) that cause symptomatic UTI, very little is known about the mechanisms by which these strains colonize the urinary tract. Here, we have investigated the growth characteristics in human urine as well as adhesin repertoire of nine ABU strains; the ability of ABU strains to compete...... against the UPEC strain CFT073 was also studied. The different ABU strains displayed a wide variety of the measured characteristics. Half of the ABU strains displayed functional type 1 fimbriae while only one expressed functional P fimbriae. A good correlation between the growth rate of a particular...

  15. Vaccines for Proteus mirabilis in urinary tract infection.

    Li, Xin; Mobley, Harry L T

    2002-06-01

    Proteus mirabilis is a documented cause of urinary tract infection (UTI) in the complicated urinary tract. Urease-mediated urea hydrolysis is responsible for both virulence of the organism and the ability to cause urolithiasis. A urease-negative mutant of P. mirabilis is unable to initiate stone formation and colonizes the kidney at a significantly lower rate. The considerable pathology caused by P. mirabilis warrants the development of a vaccine. We have initiated the advancement of vaccine studies and have determined that the MR/P fimbria, a surface adhesin of P. mirabilis, is a promising vaccine candidate. Successful vaccination would be expected both to prevent colonization by P. mirabilis and urolithiasis. PMID:12135833

  16. Antimicrobial resistance of Aeromonas hydrophila isolated from different food sources: A mini-review.

    Stratev, Deyan; Odeyemi, Olumide A

    2016-01-01

    Aeromonas hydrophila is a Gram-negative, oxidase-positive, facultative, anaerobic, opportunistic aquatic pathogen. A. hydrophila produces virulence factors, such as hemolysins, aerolysins, adhesins, enterotoxins, phospholipase and lipase. In addition to isolation from aquatic sources, A. hydrophila has been isolated from meat and meat products, milk and dairy products, and vegetables. However, various studies showed that this opportunistic pathogen is resistant to commercial antibiotics. This is attributed to factors such as the indiscriminate use of antibiotics in aquaculture, plasmids or horizontal gene transfer. In this report, we highlight the occurrence, prevalence and antimicrobial resistance of A. hydrophila isolated from different food samples. The presence of antimicrobial-resistant A. hydrophila in food poses threats to public and aquatic animal health. PMID:26588876

  17. AcEST: DK944567 [AcEST

    Full Text Available naporthe grisea ... 29 8.2 >sp|P26320|PSBO_SOLTU Oxygen-evolving...tillaria agrestis GN=PSBO PE=2 SV=1 Length = 329 Score = 108 bits (269), Expect = 1e-23 ...2 sp|Q9XD84|TIBA_ECOLX Adhesin/invasin tibA OS=Escherichia coli GN... 30 3.7 sp|A4RKC3|DCL1_MAGGR Dicer-like protein 1 OS=Mag...YMU02A01NGRL0006_H18 397 Adiantum capillus-veneris mRNA. clone: YMU02A01NGRL0006_H1...7 Definition Adiantum capillus-veneris mRNA. clone: YMU02A01NGRL0006_H18. 5' end sequence. Accession DK944567 Tis

  18. Complete genome sequence of the fish pathogen Flavobacterium psychrophilum.

    Duchaud, Eric; Boussaha, Mekki; Loux, Valentin; Bernardet, Jean-François; Michel, Christian; Kerouault, Brigitte; Mondot, Stanislas; Nicolas, Pierre; Bossy, Robert; Caron, Christophe; Bessières, Philippe; Gibrat, Jean-François; Claverol, Stéphane; Dumetz, Fabien; Le Hénaff, Michel; Benmansour, Abdenour

    2007-07-01

    We report here the complete genome sequence of the virulent strain JIP02/86 (ATCC 49511) of Flavobacterium psychrophilum, a widely distributed pathogen of wild and cultured salmonid fish. The genome consists of a 2,861,988-base pair (bp) circular chromosome with 2,432 predicted protein-coding genes. Among these predicted proteins, stress response mediators, gliding motility proteins, adhesins and many putative secreted proteases are probably involved in colonization, invasion and destruction of the host tissues. The genome sequence provides the basis for explaining the relationships of the pathogen to the host and opens new perspectives for the development of more efficient disease control strategies. It also allows for a better understanding of the physiology and evolution of a significant representative of the family Flavobacteriaceae, whose members are associated with an interesting diversity of lifestyles and habitats. PMID:17592475

  19. Asymptomatic bacteriuria Escherichia coli strain 83972 carries mutations in the foc locus and is unable to express F1C fimbriae

    Hancock, Viktoria; Schembri, M.A.; Ulett, G.C.; Klemm, Per

    2006-01-01

    Escherichia coli is the most common organism associated with asymptomatic bacteriuria (ABU). In contrast to uropathogenic E. coli (UPEC), which causes symptomatic urinary tract infection (UTI), very little is known about the mechanisms by which these strains colonize the urinary tract. Bacterial...... adhesion conferred by specific surface-associated adhesins is normally considered as a prerequisite for colonization of the urinary tract. The prototype ABU E. coli strain 83972 was originally isolated from a girl who had carried it asymptomatically for 3 years. This study characterized the molecular...... although strain 83972 contains a seemingly intact foc gene cluster, F1C fimbriae are not expressed. Sequencing and genetic complementation revealed that the focD gene, encoding a component of the F1C transport and assembly system, was non-functional, explaining the inability of strain 83972 to express this...

  20. An analysis of the sequence variability of meningococcal fHbp, NadA and NHBA over a 50-year period in the Netherlands.

    Stefania Bambini

    Full Text Available Studies of meningococcal evolution and genetic population structure, including the long-term stability of non-random associations between variants of surface proteins, are essential for vaccine development. We analyzed the sequence variability of factor H-binding protein (fHbp, Neisserial Heparin-Binding Antigen (NHBA and Neisseria adhesin A (NadA, three major antigens in the multicomponent meningococcal serogroup B vaccine 4CMenB. A panel of invasive isolates collected in the Netherlands over a period of 50 years was used. To our knowledge, this strain collection covers the longest time period of any collection available worldwide. Long-term persistence of several antigen sub/variants and of non-overlapping antigen sub/variant combinations was observed. Our data suggest that certain antigen sub/variants including those used in 4CMenB are conserved over time and promoted by selection.

  1. Dicty_cDB: Contig-U13609-1 [Dicty_cDB

    Full Text Available na T-DNA flanking sequence GK-6... 32 8.5 2 ( AY690606 ) Plum pox virus isolate Serbia-PO2...oxylas... 30 9.2 3 ( AY690608 ) Plum pox virus isolate Serbia-ST polyprotein gene... 36 9.3 2 ( AY690603... ) Plum pox virus isolate Serbia-B polyprotein gene,... 36 9.3 2 ( BX236661 ) Danio rerio genomic clone DKEY..._1( AJ580920 |pid:none) Mus musculus mRNA for tenascin-W p... 42 0.044 (Q6G620) RecName: Full=Ser...46617 |pid:none) Xenopus tropicalis odz, odd Oz/ten... 42 0.044 (Q8NUJ3) RecName: Full=Serine-rich adhesin f

  2. Promoting crystallisation of the Salmonella enteritidis fimbriae 14 pilin SefD using deuterium oxide

    Highlights: ► The benefits of D2O in screening for crystallisation was explored. ► The crystal structures of the SefD pilin in both H2O and D2O reveal differences. ► Crystallisation improvements are explained by altered interactions in D2O crystals. ► D2O is useful additive in sparse-matrix screening for crystallisation. -- Abstract: The use of heavy water (D2O) as a solvent is commonplace in many spectroscopic techniques for the study of biological macromolecules. A significant deuterium isotope effect exists where hydrogen-bonding is important, such as in protein stability, dynamics and assembly. Here we illustrate the use of D2O in additive screening for the production of reproducible diffraction-quality crystals for the Salmonella enteritidis fimbriae 14 (SEF14) putative tip adhesin, SefD.

  3. Biofilm formation in a hydrodynamic environment by novel FimH variants and ramifications for virulence

    Schembri, Mark; Klemm, Per

    2001-01-01

    Type 1 fimbriae are surface-located adhesion organelles of Escherichia coli that are directly associated with virulence of the urinary tract. They mediate D-mannose-sensitive binding to different host surfaces by way of the minor fimbrial component FimH. Naturally occurring variants of FimH that...... surfaces under static growth conditions. In this study, we used random mutagenesis combined with a novel selection-enrichment technique to specifically identify mutations in the FimH adhesin that confer on E. coli the ability to form biofilms under hydrodynamic flow (HDF) conditions. We identified three...... FimH variants demonstrated that they too could promote biofilm formation on abiotic surfaces under HDF conditions. Interestingly, the same correlation was not observed for commensal FimH variants. FimH is a multifaceted protein prone to rapid microevolution. In addition to its previously documented...

  4. Microbial interactions in building of communities

    Wright, Christopher J.; Burns, Logan H.; Jack, Alison A.; Back, Catherine R.; Dutton, Lindsay C.; Nobbs, Angela H.; Lamont, Richard J.; Jenkinson, Howard F.

    2012-01-01

    SUMMARY Establishment of a community is considered to be essential for microbial growth and survival in the human oral cavity. Biofilm communities have increased resilience to physical forces, antimicrobial agents, and nutritional variations. Specific cell-to-cell adherence processes, mediated by adhesin-receptor pairings on respective microbial surfaces, are able to direct community development. These interactions co-localize species in mutually beneficial relationships, such as streptococci, veillonellae, Porphyromonas gingivalis and Candida albicans. In transition from the planktonic mode of growth to a biofilm community, microorganisms undergo major transcriptional and proteomic changes. These occur in response to sensing of diffusible signals, such as autoinducer molecules, and to contact with host tissues or other microbial cells. Underpinning many of these processes are intracellular phosphorylation events that regulate a large number of microbial interactions relevant to community formation and development. PMID:23253299

  5. Morganella sp. rods – characteristics, infections, mechanisms of resistance to antibiotics 

    Patrycja Zalas-Więcek

    2012-04-01

    Full Text Available The Morganella genus is one member of the tribe Proteae, which also includes the genera Proteus and Providencia. These bacteria are commonly present in the environment.Morganella sp. rods are known to be a causative agent of opportunistic hospital infections, mainly urinary tract, wound and blood infections of severe and high mortality, even in cases of an appropriate antibiotic.These bacteria may produce many virulence factors, for example urease, hemolysins, LPS, adhesins and enzymes hydrolyzing and modifying antibiotics commonly used to treat infections.Understanding the diverse biological properties of these rods may be of importance in the development of effective methods of prevention and control of infections with their participation. 

  6. Influence of subinhibitory concentrations of antimicrobials on hydrophobicity, adherence and ultra-structure of Fusobacterium nucleatum

    Okamoto Ana C.

    2002-01-01

    Full Text Available Fusobacterium nucleatum is considered a bridge organism between earlier and later colonizers in dental biofilms and a putative periodontopathogen. In Dentistry, antimicrobial agents are used for treatment and control of infectious diseases associated with dental plaque. Antiseptics have been used in association with antibiotics to reduce infections after oral surgeries. In this study, the influence of subinhibitory concentrations (SC of chlorhexidine, triclosan, penicillin G and metronidazole, on hydrophobicity, adherence to oral epithelial cells, and ultra-structure of F. nucleatum was examined. All isolates were susceptible to chlorhexidine, triclosan, and metronidazole; however, most of the isolates were susceptible to penicillin G, and all of them were hydrophilic when grown with or without antimicrobials. Adherence was decreased by all antimicrobials. Results suggest that adherence of F. nucleatum was influenced by adhesins because structures such as fimbries or capsule were not observed by transmission electronic microscope.

  7. Dynamic properties of bacterial pili measured by optical tweezers

    Fallman, Erik; Schedin, Staffan; Jass, Jana; Uhlin, Bernt Eric; Axner, Ove

    2014-01-01

    The ability of uropathogenic Escherichia coli (UPEC) to cause urinary tract infections is dependent on their ability to colonize the uroepithelium. Infecting bacteria ascend the urethra to the bladder and then kidneys by attaching to the uroepithelial cells via the differential expression of adhesins. P pili are associated with pyelonephritis, the more severe infection of the kidneys. In order to find means to treat pyelonephritis, it is therefore of interest to investigate the properties P pili. The mechanical behavior of individual P pili of uropathogenic Escherichia coli has recently been investigated using optical tweezers. P pili, whose main part constitutes the PapA rod, composed of ~1000 PapA subunits in a helical arrangement, are distributed over the bacterial surface and mediate adhesion to host cells. We have earlier studied P pili regarding its stretching/elongation properties where we have found and characterized three different elongation regions, of which one constitute an unfolding of the quate...

  8. The asymptomatic bacteriuria Escherichia coli strain 83972 outcompetes uropathogenic E. coli strains in human urine

    Hancock, Viktoria; Ulett, G.C.; Schembri, M.A.;

    2006-01-01

    Escherichia coli is the most common organism associated with asymptomatic bacteriuria (ABU). In contrast to uropathogenic E. coli (UPEC), which causes symptomatic urinary tract infections (UTI), very little is known about the mechanisms by which these strains colonize the human urinary tract. The...... prototype ABU E. coli strain 83972 was originally isolated from a girl who had carried it asymptomatically for 3 years. Deliberate colonization of UTI-susceptible individuals with E. coli 83972 has been used successfully as an alternative approach for the treatment of patients who are refractory to...... conventional therapy. Colonization with strain 83972 appears to prevent infection with UPEC strains in such patients despite the fact that this strain is unable to express the primary adhesins involved in UTI, viz. P and type 1 fimbriae. Here we investigated the growth characteristics of E. coli 83972 in human...

  9. A subset of group A-like var genes encodes the malaria parasite ligands for binding to human brain endothelial cells

    Claessens, Antoine; Adams, Yvonne; Ghumra, Ashfaq;

    2012-01-01

    Cerebral malaria is the most deadly manifestation of infection with Plasmodium falciparum. The pathology of cerebral malaria is characterized by the accumulation of infected erythrocytes (IEs) in the microvasculature of the brain caused by parasite adhesins on the surface of IEs binding to human...... receptors on microvascular endothelial cells. The parasite and host molecules involved in this interaction are unknown. We selected three P. falciparum strains (HB3, 3D7, and IT/FCR3) for binding to a human brain endothelial cell line (HBEC-5i). The whole transcriptome of isogenic pairs of selected and.......029) but not by antibodies from controls with uncomplicated malaria (Mann-Whitney test, P = 0.58). This work describes a binding phenotype for virulence-associated group A P. falciparum erythrocyte membrane protein 1 variants and identifies targets for interventions to treat or prevent cerebral malaria....

  10. Effect of osteopontin on the initial adhesion of dental bacteria.

    Schlafer, Sebastian; Meyer, Rikke L; Sutherland, Duncan S; Städler, Brigitte

    2012-12-28

    Bacterial biofilms are involved in numerous infections of the human body, including dental caries. While conventional therapy of biofilm diseases aims at eradication and mechanical removal of the biofilms, recent therapeutic approaches target the mechanisms of biofilm formation and bacterial adhesion in particular. The effect of bovine milk osteopontin, a highly phosphorylated whey protein, on adhesion of Streptococcus mitis, Streptococcus sanguinis, and Actinomyces naeslundii, three prominent colonizers in dental biofilms, to saliva-coated surfaces was investigated. While adhesion of A. naeslundii was not affected by osteopontin, a strong, dose-dependent reduction in the number of adhering S. mitis was shown. No difference in bacterial adhesion was observed for caseinoglycomacropeptide, another phosphorylated milk protein. Osteopontin did not affect bacterial viability, but changed bacterial surface hydrophobicity, and may be suggested to prevent the adhesins of S. mitis from interacting with their salivary receptors. The antiadhesive effect of osteopontin may be useful for caries prevention. PMID:23167781

  11. Cellular Components Mediating Coadherence of Candida albicans and Fusobacterium nucleatum.

    Wu, T; Cen, L; Kaplan, C; Zhou, X; Lux, R; Shi, W; He, X

    2015-10-01

    Candida albicans is an opportunistic fungal pathogen found as part of the normal oral flora. It can be coisolated with Fusobacterium nucleatum, an opportunistic bacterial pathogen, from oral disease sites, such as those involved in refractory periodontitis and pulp necrosis. The physical coadherence between these 2 clinically important microbes has been well documented and suggested to play a role in facilitating their oral colonization and colocalization and contributing to polymicrobial pathogenesis. Previous studies indicated that the physical interaction between C. albicans and F. nucleatum was mediated by the carbohydrate components on the surface of C. albicans and the protein components on the Fusobaterium cell surface. However, the identities of the components involved still remain elusive. This study was aimed at identifying the genetic determinants involved in coaggregation between the 2 species. By screening a C. albicans SN152 mutant library and a panel of F. nucleatum 23726 outer membrane protein mutants, we identified FLO9, which encodes a putative adhesin-like cell wall mannoprotein of C. albicans and radD, an arginine-inhibitable adhesin-encoding gene in F. nucleatum that is involved in interspecies coadherence. Consistent with these findings, we demonstrated that the strong coaggregation between wild-type F. nucleatum 23726 and C. albicans SN152 in an in vitro assay could be greatly inhibited by arginine and mannose. Our study also suggested a complex multifaceted mechanism underlying physical interaction between C. albicans and F. nucleatum and for the first time revealed the identity of major genetic components involved in mediating the coaggregation. These observations provide useful knowledge for developing new targeted treatments for disrupting interactions between these 2 clinically relevant pathogens. PMID:26152186

  12. Effects of lng Mutations on LngA Expression, Processing, and CS21 Assembly in Enterotoxigenic Escherichia coli E9034A

    Saldaña-Ahuactzi, Zeus; Rodea, Gerardo E.; Cruz-Córdova, Ariadnna; Rodríguez-Ramírez, Viridiana; Espinosa-Mazariego, Karina; González-Montalvo, Martín A.; Ochoa, Sara A.; González-Pedrajo, Bertha; Eslava-Campos, Carlos A.; López-Villegas, Edgar O.; Hernández-Castro, Rigoberto; Arellano-Galindo, José; Patiño-López, Genaro; Xicohtencatl-Cortes, Juan

    2016-01-01

    Enterotoxigenic Escherichia coli (ETEC) is a major cause of morbidity in children under 5 years of age in low- and middle-income countries and a leading cause of traveler's diarrhea worldwide. The ability of ETEC to colonize the intestinal epithelium is mediated by fimbrial adhesins, such as CS21 (Longus). This adhesin is a type IVb pilus involved in adherence to intestinal cells in vitro and bacterial self-aggregation. Fourteen open reading frames have been proposed to be involved in CS21 assembly, hitherto only the lngA and lngB genes, coding for the major (LngA) and minor (LngB) structural subunit, have been characterized. In this study, we investigated the role of the LngA, LngB, LngC, LngD, LngH, and LngP proteins in the assembly of CS21 in ETEC strain E9034A. The deletion of the lngA, lngB, lngC, lngD, lngH, or lngP genes, abolished CS21 assembly in ETEC strain E9034A and the adherence to HT-29 cells was reduced 90%, compared to wild-type strain. Subcellular localization prediction of CS21 proteins was similar to other well-known type IV pili homologs. We showed that LngP is the prepilin peptidase of LngA, and that ETEC strain E9034A has another peptidase capable of processing LngA, although with less efficiency. Additionally, we present immuno-electron microscopy images to show that the LngB protein could be localized at the tip of CS21. In conclusion, our results demonstrate that the LngA, LngB, LngC, LngD, LngH, and LngP proteins are essential for CS21 assembly, as well as for bacterial aggregation and adherence to HT-29 cells. PMID:27536289

  13. Single-cell genomics reveals the lifestyle of Poribacteria, a candidate phylum symbiotically associated with marine sponges.

    Siegl, Alexander; Kamke, Janine; Hochmuth, Thomas; Piel, Jörn; Richter, Michael; Liang, Chunguang; Dandekar, Thomas; Hentschel, Ute

    2011-01-01

    In this study, we present a single-cell genomics approach for the functional characterization of the candidate phylum Poribacteria, members of which are nearly exclusively found in marine sponges. The microbial consortia of the Mediterranean sponge Aplysina aerophoba were singularized by fluorescence-activated cell sorting, and individual microbial cells were subjected to phi29 polymerase-mediated 'whole-genome amplification'. Pyrosequencing of a single amplified genome (SAG) derived from a member of the Poribacteria resulted in nearly 1.6 Mb of genomic information distributed among 554 contigs analyzed in this study. Approximately two-third of the poribacterial genome was sequenced. Our findings shed light on the functional properties and lifestyle of a possibly ancient bacterial symbiont of marine sponges. The Poribacteria are mixotrophic bacteria with autotrophic CO(2)-fixation capacities through the Wood-Ljungdahl pathway. The cell wall is of Gram-negative origin. The Poribacteria produce at least two polyketide synthases (PKSs), one of which is the sponge-specific Sup-type PKS. Several putative symbiosis factors such as adhesins (bacterial Ig-like domains, lamininin G domain proteins), adhesin-related proteins (ankyrin, fibronectin type III) and tetratrico peptide repeat domain-encoding proteins were identified, which might be involved in mediating sponge-microbe interactions. The discovery of genes coding for 24-isopropyl steroids implies that certain fossil biomarkers used to date the origins of metazoan life on earth may possibly be of poribacterial origin. Single-cell genomic approaches, such as those shown herein, contribute to a better understanding of beneficial microbial consortia, of which most members are, because of the lack of cultivation, inaccessible by conventional techniques. PMID:20613790

  14. Intestinal receptors for adhesive fimbriae of enterotoxigenic Escherichia coli (ETEC) K88 in swine--a review.

    Jin, L Z; Zhao, X

    2000-09-01

    Determining the structure of the intestinal receptor for enterotoxigenic Escherichia coli (ETEC) K88 fimbriae will make it possible to develop new strategies to prevent K88+ ETEC-induced disease in pigs. Putative K88 adhesin receptors have been identified in both intestinal brush border and mucus preparations as either glycoproteins or glycolipids. Proteins with sizes of 25, 35, 40-42, 60, and 80 kDa in the intestinal mucus and 16, 23, 35, 40-70, 74, 210, and 240 kDa in brush border membranes were reported to bind specifically to K88ab and K88ac fimbriae. The factors accounting for these variable results may include the variants of K88, ages, breeds, and phenotypes of pigs, and even the sampling sites in the small intestine. Of the reported K88 receptors, only three brush border receptors, i.e., a pair of mucin-type sialoglycoproteins (210 kDa or 240 kDa), an intestinal neutral glycosphingolipid (IGLad), and a 74-kDa transferrin glycoprotein (GP74), have fulfilled the criteria as phenotype-specific K88 fimbrial receptors. Inhibiting the attachment of ETEC to intestine by modifying the receptor attachment sites has been the key for developing novel approaches to preventing ETEC-induced diarrhea in pigs. These include: (1) receptor analogs from a variety of biological sources, (2) an enteric protected protease, (3) chicken egg-yolk containing anti-K88 fimbrial antibodies, and (4) some Lactobacillus isolates producing proteinaceous components or carbohydrates interacting with mucus components. Future studies should be directed to further characterize the carbohydrate and protein moieties of receptors recognized by the K88 adhesin variants and to identify the genes responsible for susceptibility to K88+ infections. PMID:11030565

  15. Binding of glycoprotein Srr1 of Streptococcus agalactiae to fibrinogen promotes attachment to brain endothelium and the development of meningitis.

    Ho Seong Seo

    Full Text Available The serine-rich repeat glycoprotein Srr1 of Streptococcus agalactiae (GBS is thought to be an important adhesin for the pathogenesis of meningitis. Although expression of Srr1 is associated with increased binding to human brain microvascular endothelial cells (hBMEC, the molecular basis for this interaction is not well defined. We now demonstrate that Srr1 contributes to GBS attachment to hBMEC via the direct interaction of its binding region (BR with human fibrinogen. When assessed by Far Western blotting, Srr1 was the only protein in GBS extracts that bound fibrinogen. Studies using recombinant Srr1-BR and purified fibrinogen in vitro confirmed a direct protein-protein interaction. Srr1-BR binding was localized to amino acids 283-410 of the fibrinogen Aα chain. Structural predictions indicated that the conformation of Srr1-BR is likely to resemble that of SdrG and other related staphylococcal proteins that bind to fibrinogen through a "dock, lock, and latch" mechanism (DLL. Deletion of the predicted latch domain of Srr1-BR abolished the interaction of the BR with fibrinogen. In addition, a mutant GBS strain lacking the latch domain exhibited reduced binding to hBMEC, and was significantly attenuated in an in vivo model of meningitis. These results indicate that Srr1 can bind fibrinogen directly likely through a DLL mechanism, which has not been described for other streptococcal adhesins. This interaction was important for the pathogenesis of GBS central nervous system invasion and subsequent disease progression.

  16. Antibiotic resistance and pathogenicity factors in Staphylococcus aureus isolated from mastitic Sahiwal cattle

    Ravinder Kumar; B R Yadav; R S Singh

    2011-03-01

    Methicillin-resistant Staphylococcus aureus (MRSA) poses a serious problem in dairy animals suffering from mastitis. In the present study, the distribution of mastitic MRSA and antibiotic resistance was studied in 107 strains of S. aureus isolated from milk samples from 195 infected udders. The characterizations pathogenic factors (adhesin and toxin genes) and antibiotic susceptibility of isolates were carried out using gene amplification and disc diffusion assays, respectively. A high prevalence of MRSA was observed in the tested isolates (13.1%). The isolates were also highly resistant to antibiotics, i.e. 36.4% were resistant to streptomycin, 33.6% to oxytetracycline, 29.9% to gentamicin and 26.2% each to chloramphenicol, pristinomycin and ciprofloxacin. A significant variation in the expression of pathogenic factors (Ig, coa and clf) was observed in these isolates. The overall distribution of adhesin genes ebp, fib, bbp, fnbB, cap5, cap8, map and cna in the isolates was found to be 69.1, 67.2, 6.5, 20.5, 60.7, 26.1, 81.3 and 8.4%, respectively. The presence of fib, fnbB, bbp and map genes was considerably greater in MRSA than in methicillin-susceptible S. aureus (MSSA) isolates. The proportions of toxin genes, namely, hlb, seb, sec, sed, seg and sei, in the isolates were found to be 94.3, 0.9, 8.4, 0.9, 10.2 and 49.5%, respectively. The proportions of agr genes I, II, III and IV were found to be 39.2, 27.1, 21.5 and 12.1%, respectively. A few isolates showed similar antibiotic-resistance patterns, which could be due to identical strains or the dissemination of the same strains among animals. These findings can be utilized in mastitis treatment programmes and antimicrobials strategies in organized herds.

  17. Identification of salivary mucin MUC7 binding proteins from Streptococcus gordonii

    Thornton David J

    2009-08-01

    Full Text Available Abstract Background The salivary mucin MUC7 (previously known as MG2 can adhere to various strains of streptococci that are primary colonizers and predominant microorganisms of the oral cavity. Although there is a growing interest in interaction between oral pathogens and salivary mucins, studies reporting the specific binding sites on the bacteria are rather limited. Identification and characterization of the specific interacting proteins on the bacterial cell surface, termed adhesins, are crucial to further understand host-pathogen interactions. Results We demonstrate here, using purified MUC7 to overlay blots of SDS-extracts of Streptococcus gordonii cell surface proteins, 4 MUC7-binding bands, with apparent molecular masses of 62, 78, 84 and 133 kDa from the Streptococcus gordonii strain, PK488. Putative adhesins were identified by in-gel digestion and subsequent nanoLC-tandem mass spectrometry analysis of resultant peptides. The 62 kDa and 84 kDa bands were identified as elongation factor (EF Tu and EF-G respectively. The 78 kDa band was a hppA gene product; the 74 kDa oligopeptide-binding lipoprotein. The 133 kDa band contained two proteins; alpha enolase and DNA-directed RNA polymerase, beta' subunit. Some of these proteins, for example alpha enolase are expected to be intracellular, however, flow cytometric analysis confirmed its location on the bacterial surface. Conclusion Our data demonstrated that S. gordonii expressed a number of putative MUC7 recognizing proteins and these contribute to MUC7 mucin binding of this streptococcal strain.

  18. A protein phosphatase 1 gamma (PP1γ) of the human protozoan parasite Trichomonas vaginalis is involved in proliferation and cell attachment to the host cell.

    Muñoz, Christian; Pérez, Mauricio; Orrego, Patricio R; Osorio, Luis; Gutiérrez, Bessy; Sagua, Hernán; Castillo, Juan L; Martínez-Oyanedel, Jose; Arroyo, Rossana; Meza-Cervantez, Patricia; da Silveira, Jose Franco; Midlej, Victor; Benchimol, Marlene; Cordero, Esteban; Morales, Patricio; Araya, Jorge E; González, Jorge

    2012-07-01

    In this work, evidence for a critical role of Trichomonas vaginalis protein phosphatase 1 gamma (TvPP1γ) in proliferation and attachment of the parasite to the mammalian cell is provided. Firstly, proliferation and attachment of T. vaginalis parasites to HeLa cells was blocked by calyculin A (CA), a potent PP1 inhibitor. Secondly, it was demonstrated that the enzyme activity of native and recombinant TvPP1γ proteins was inhibited by CA. Thirdly, reverse genetic studies confirmed that antisense oligonucleotides targeted to PP1γ but not PP1α or β inhibited proliferation and attachment of trichomonads CA-treated parasites underwent cytoskeletal modifications, including a lack of axostyle typical labelling, suggesting that cytoskeletal phosphorylation could be regulated by a CA-sensitive phosphatase where the role of PP1γ could not be ruled out. Analysis of subcellular distribution of TvPP1γ by cell fractionation and electron microscopy demonstrated the association between TvPP1γ and the cytoskeleton. The expression of adhesins, AP120 and AP65, at the cell surface was also inhibited by CA. The concomitant inhibition of expression of adhesins and changes in the cytoskeleton in CA-treated parasites suggest a specific role for PP1γ -dependent dephosphorylation in the early stages of the host-parasite interaction. Molecular modelling of TvPP1γ showed the conservation of residues critical for maintaining proper folding into the gross structure common to PP1 proteins. Taken together, these results suggest that TvPP1γ could be considered a potential novel drug target for treatment of trichomoniasis. PMID:22713760

  19. Quantitative differences in adhesiveness of type 1 fimbriated Escherichia coli due to structural differences in fimH genes.

    Sokurenko, E V; Courtney, H S; Maslow, J; Siitonen, A; Hasty, D L

    1995-01-01

    Type 1 fimbriae are heteropolymeric surface organelles responsible for the D-mannose-sensitive (MS) adhesion of Escherichia coli. We recently reported that variation of receptor specificity of type 1 fimbriae can result solely from minor alterations in the structure of the gene for the FimH adhesin subunit. To further study the relationship between allelic variation of the fimH gene and adhesive properties of type 1 fimbriae, the fimH genes from five additional strains were cloned and used to complement the FimH deletion in E. coli KB18. When the parental and recombinant strains were tested for adhesion to immobilized mannan, a wide quantitative range in the ability of bacteria to adhere was noted. The differences in adhesion do not appear to be due to differences in the levels of fimbriation or relative levels of incorporation of FimH, because these parameters were similar in low-adhesion and high-adhesion strains. The nucleotide sequence for each of the fimH genes was determined. Analysis of deduced FimH sequences allowed identification of two sequence homology groups, based on the presence of Asn-70 and Ser-78 or Ser-70 and Asn-78 residues. The consensus sequences for each group conferred very low adhesion activity, and this low-adhesion phenotype predominated among a group of 43 fecal isolates. Strains isolated from a different host niche, the urinary tract, expressed type 1 fimbriae that conferred an increased level of adhesion. The results presented here strongly suggest that the quantitative variations in MS adhesion are due primarily to structural differences in the FimH adhesin. The observed differences in MS adhesion among populations of E. coli isolated from different host niches call attention to the possibility that phenotypic variants of FimH may play a functional role in populations dynamics. PMID:7601831

  20. Survey of surface proteins from the pathogenic Mycoplasma hyopneumoniae strain 7448 using a biotin cell surface labeling approach.

    Reolon, Luciano Antonio; Martello, Carolina Lumertz; Schrank, Irene Silveira; Ferreira, Henrique Bunselmeyer

    2014-01-01

    The characterization of the repertoire of proteins exposed on the cell surface by Mycoplasma hyopneumoniae (M. hyopneumoniae), the etiological agent of enzootic pneumonia in pigs, is critical to understand physiological processes associated with bacterial infection capacity, survival and pathogenesis. Previous in silico studies predicted that about a third of the genes in the M. hyopneumoniae genome code for surface proteins, but so far, just a few of them have experimental confirmation of their expression and surface localization. In this work, M. hyopneumoniae surface proteins were labeled in intact cells with biotin, and affinity-captured biotin-labeled proteins were identified by a gel-based liquid chromatography-tandem mass spectrometry approach. A total of 20 gel slices were separately analyzed by mass spectrometry, resulting in 165 protein identifications corresponding to 59 different protein species. The identified surface exposed proteins better defined the set of M. hyopneumoniae proteins exposed to the host and added confidence to in silico predictions. Several proteins potentially related to pathogenesis, were identified, including known adhesins and also hypothetical proteins with adhesin-like topologies, consisting of a transmembrane helix and a large tail exposed at the cell surface. The results provided a better picture of the M. hyopneumoniae cell surface that will help in the understanding of processes important for bacterial pathogenesis. Considering the experimental demonstration of surface exposure, adhesion-like topology predictions and absence of orthologs in the closely related, non-pathogenic species Mycoplasma flocculare, several proteins could be proposed as potential targets for the development of drugs, vaccines and/or immunodiagnostic tests for enzootic pneumonia. PMID:25386928

  1. Survey of surface proteins from the pathogenic Mycoplasma hyopneumoniae strain 7448 using a biotin cell surface labeling approach.

    Luciano Antonio Reolon

    Full Text Available The characterization of the repertoire of proteins exposed on the cell surface by Mycoplasma hyopneumoniae (M. hyopneumoniae, the etiological agent of enzootic pneumonia in pigs, is critical to understand physiological processes associated with bacterial infection capacity, survival and pathogenesis. Previous in silico studies predicted that about a third of the genes in the M. hyopneumoniae genome code for surface proteins, but so far, just a few of them have experimental confirmation of their expression and surface localization. In this work, M. hyopneumoniae surface proteins were labeled in intact cells with biotin, and affinity-captured biotin-labeled proteins were identified by a gel-based liquid chromatography-tandem mass spectrometry approach. A total of 20 gel slices were separately analyzed by mass spectrometry, resulting in 165 protein identifications corresponding to 59 different protein species. The identified surface exposed proteins better defined the set of M. hyopneumoniae proteins exposed to the host and added confidence to in silico predictions. Several proteins potentially related to pathogenesis, were identified, including known adhesins and also hypothetical proteins with adhesin-like topologies, consisting of a transmembrane helix and a large tail exposed at the cell surface. The results provided a better picture of the M. hyopneumoniae cell surface that will help in the understanding of processes important for bacterial pathogenesis. Considering the experimental demonstration of surface exposure, adhesion-like topology predictions and absence of orthologs in the closely related, non-pathogenic species Mycoplasma flocculare, several proteins could be proposed as potential targets for the development of drugs, vaccines and/or immunodiagnostic tests for enzootic pneumonia.

  2. The study of adhesive forces between the type-3 fimbriae of Klebsiella pneumoniae and collagen-coated surfaces by using optical tweezers

    Chan, Chiahan; Fan, Chia-chieh; Huang, Ying-Jung; Peng, Hwei-Ling; Long, Hsu

    2004-10-01

    Adherence to host cells by a bacterial pathogen is a critical step for establishment of infection. It will contribute greatly to the understanding of bacterial pathogenesis by studying the biological force between a single pair of pathogen and host cell. In our experiment, we use a calibrated optical tweezers system to detach a single Klebsiella pneumoniae, the pathogen, from collagen, the host. By gradually increasing the laser power of the optical tweezers until the Klebsiella pneumoniae is detached from the collagen, we obtain the magnitude of the adhesive force between them. This happens when the adhesive force is barely equal to the trapping force provided by the optical tweezers at that specific laser power. This study is important because Klebsiella pneumoniae is an opportunistic pathogen which causes suppurative lesions, urinary and respiratory tract infections. It has been proved that type 3 fimbrial adhesin (mrkD) is strongly associated with the adherence of Klebsiella pneumoniae. Besides, four polymorphic mrkD alleles: namely, mrkDv1, v2, v3, and v4, are typed by using RFLP. In order to investigate the relationship between the structure and the function for each of these variants, DNA fragments encoding the major fimbrial proteins mrkA, mrkB, mrkC are expressed together with any of the four mrkD adhesins in E. coli JM109. Our study shows that the E. coli strain carrying the mrkDv3 fimbriae has the strongest binding activity. This suggests that mrkDv3 is a key factor that enhances the adherence of Klebsiella Pneumoniae to human body.

  3. Phase variation of poly-N-acetylglucosamine expression in Staphylococcus aureus.

    Jamie L Brooks

    2014-07-01

    Full Text Available Polysaccharide intercellular adhesin (PIA, also known as poly-N-acetyl-β-(1-6-glucosamine (PIA/PNAG is an important component of Staphylococcus aureus biofilms and also contributes to resistance to phagocytosis. The proteins IcaA, IcaD, IcaB, and IcaC are encoded within the intercellular adhesin (ica operon and synthesize PIA/PNAG. We discovered a mechanism of phase variation in PIA/PNAG expression that appears to involve slipped-strand mispairing. The process is reversible and RecA-independent, and involves the expansion and contraction of a simple tetranucleotide tandem repeat within icaC. Inactivation of IcaC results in a PIA/PNAG-negative phenotype. A PIA/PNAG-hyperproducing strain gained a fitness advantage in vitro following the icaC mutation and loss of PIA/PNAG production. The mutation was also detected in two clinical isolates, suggesting that under certain conditions, loss of PIA/PNAG production may be advantageous during infection. There was also a survival advantage for an icaC-negative strain harboring intact icaADB genes relative to an isogenic icaADBC deletion mutant. Together, these results suggest that inactivation of icaC is a mode of phase variation for PIA/PNAG expression, that high-level production of PIA/PNAG carries a fitness cost, and that icaADB may contribute to bacterial fitness, by an unknown mechanism, in the absence of an intact icaC gene and PIA/PNAG production.

  4. Glucans synthesized in situ in experimental salivary pellicle function as specific binding sites for Streptococcus mutans.

    Schilling, K M; Bowen, W H

    1992-01-01

    Many researchers have suggested that the role of glucan-mediated interactions in the adherence of Streptococcus mutans is restricted to accumulation of this cariogenic bacterium following its sucrose (i.e., glucan)-independent binding to saliva-coated tooth surfaces. However, the presence of enzymatically active glucosyltransferase in salivary pellicle suggests that glucans could also promote the initial adherence of S. mutans to the teeth. In the present study, the commonly used hydroxyapatite adherence assay was modified to include the incorporation of glucosyltransferase and the synthesis of glucans in situ on saliva-coated hydroxyapatite beads. Several laboratory strains and clinical isolates of S. mutans were examined for their ability to adhere to experimental pellicles, either with or without the prior formation of glucans in situ. Results showed that most strains of S. mutans bound stereospecifically to glucans synthesized in pellicle. Inhibition studies with various polysaccharides and fungal dextranase indicated that alpha 1,6-linked glucose residues were of primary importance in the glucan binding observed. Scanning electron microscopic analysis showed direct binding of S. mutans to hydroxyapatite surface-associated polysaccharide and revealed no evidence of trapping or cell-to-cell binding. S. mutans strains also attached to host-derived structures in experimental pellicles, and the data suggest that the bacterial adhesins which recognize salivary binding sites were distinct from glucan-binding adhesins. Furthermore, glucans formed in experimental pellicles appeared to mask the host-derived components. These results support the concept that glucans synthesized in salivary pellicle can promote the selective adherence of the cariogenic streptococci which colonize human teeth. Images PMID:1530843

  5. 变形链球菌粘附抑制多肽的研究进展%Research progress on adhesion-inhibiting peptides of Streptococcus mutans

    石佳伟(综述); 姜颖(审校)

    2016-01-01

    变形链球菌是人类龋病的主要致病菌,该菌在牙面粘附聚集并形成致龋性微生态环境-牙菌斑,进而导致龋病发生。变形链球菌粘附的表面粘附素主要有表面蛋白(PAc)、葡萄糖基转移酶(Gtf)等。针对这些粘附素设计的粘附抑制多肽为龋病的预防带来了一种全新的可能。本文就变形链球菌粘附素的特点及变形链球菌粘附抑制多肽的研究进展做一综述,有望建立一种简单、安全、有效的新型防龋方法。%Streptococcus mutans (S. mutans) is considered as a primary cariogenic bacterium. Its ability of ad-herence and further accumulation on teeth to generate dental biofilm constitutes an important condition for dental caries. Adhesins generated by S. mutans include cell surface protein antigen AgI/II (PAc) and the glucosyltransferase (Gtf) en-zyme, etc. A new possibility may be brought in to prevent dental caries with adhesion-blocking synthetic peptides de-signed specifically for such adhesions. In this paper, we summarize the characteristics of adhesins and make a survey of recent progress on adhesion-inhibiting peptides of Streptococcus mutans. We also propose a simple, safe and efficient way to prevent caries.

  6. Virulence gene profiles in Staphylococcus aureus isolated from cows with subclinical mastitis in eastern Poland.

    Kot, Barbara; Szweda, Piotr; Frankowska-Maciejewska, Aneta; Piechota, Małgorzata; Wolska, Katarzyna

    2016-05-01

    Staphylococcus aureus is arguably the most important pathogen involved in bovine mastitis. The aim of this study was to determine the virulence gene profiles of 124 Staph. aureus isolates from subclinical mastitis in cows in eastern Poland. The presence of 30 virulence genes encoding adhesins, proteases and superantigenic toxins was investigated by PCR. The 17 different combinations of adhesin genes were identified. Occurrence of eno (91·1%) and fib (82·3%) genes was found to be common. The frequency of other adhesion genes fnbA, fnbB, ebps were 14·5, 50, 25%, respectively, and for cna and bbp were 1·6%. The etA and etD genes, encoding exfoliative toxins, were present in genomes of 5·6 and 8·9% isolates, respectively. The splA and sspA, encoding serine protease, were detected in above 90% isolates. The most frequent enterotoxin genes were sei (21%), sem (19·4%), sen (19·4%), seg (18·5%) and seo (13·7%). The tst gene was harboured by 2·4% isolates. The 19 combinations of the superantigenic toxin genes were obtained and found in 35·5% of isolates. Three of them (seg, sei, sem, sen, seo; sec, seg, sei, sem, sen, seo and seg, sei, sem, sen) were the most frequent and found in 16·1% of the isolates. The most common virulotype, present in 17·7% of the isolates, was fib, eno, fnbB, splA, splE, sspA. The results indicate the variation in the presence of virulence genes in Staph. aureus isolates and considerable diversity of isolates that are able to cause mastitis in cows. PMID:27032339

  7. The HP0256 gene product is involved in motility and cell envelope architecture of Helicobacter pylori

    Douillard, Francois P

    2010-04-08

    Abstract Background Helicobacter pylori is the causative agent for gastritis, and peptic and duodenal ulcers. The bacterium displays 5-6 polar sheathed flagella that are essential for colonisation and persistence in the gastric mucosa. The biochemistry and genetics of flagellar biogenesis in H. pylori has not been fully elucidated. Bioinformatics analysis suggested that the gene HP0256, annotated as hypothetical, was a FliJ homologue. In Salmonella, FliJ is a chaperone escort protein for FlgN and FliT, two proteins that themselves display chaperone activity for components of the hook, the rod and the filament. Results Ablation of the HP0256 gene in H. pylori significantly reduced motility. However, flagellin and hook protein synthesis was not affected in the HP0256 mutant. Transmission electron transmission microscopy revealed that the HP0256 mutant cells displayed a normal flagellum configuration, suggesting that HP0256 was not essential for assembly and polar localisation of the flagella in the cell. Interestingly, whole genome microarrays of an HP0256 mutant revealed transcriptional changes in a number of genes associated with the flagellar regulon and the cell envelope, such as outer membrane proteins and adhesins. Consistent with the array data, lack of the HP0256 gene significantly reduced adhesion and the inflammatory response in host cells. Conclusions We conclude that HP0256 is not a functional counterpart of FliJ in H. pylori. However, it is required for full motility and it is involved, possibly indirectly, in expression of outer membrane proteins and adhesins involved in pathogenesis and adhesion.

  8. Adhesive properties of Enterobacter sakazakii to human epithelial and brain microvascular endothelial cells

    Pospischil Andreas

    2006-06-01

    Full Text Available Abstract Background Enterobacter sakazakii is an opportunistic pathogen that has been associated with sporadic cases and outbreaks causing meningitis, necrotizing enterocolitis and sepsis especially in neonates. However, up to now little is known about the mechanisms of pathogenicity in E. sakazakii. A necessary state in the successful colonization, establishment and ultimately production of disease by microbial pathogens is the ability to adhere to host surfaces such as mucous membranes, gastric and intestinal epithelial or endothelial tissue. This study examined for the first time the adherence ability of 50 E. sakazakii strains to the two epithelial cell lines HEp-2 and Caco-2, as well as the brain microvascular endothelial cell line HBMEC. Furthermore, the effects of bacterial culture conditions on the adherence behaviour were investigated. An attempt was made to characterize the factors involved in adherence. Results Two distinctive adherence patterns, a diffuse adhesion and the formation of localized clusters of bacteria on the cell surface could be distinguished on all three cell lines. In some strains, a mixture of both patterns was observed. Adherence was maximal during late exponential phase, and increased with higher MOI. The adhesion capacity of E. sakazakii to HBMEC cells was affected by the addition of blood to the bacteria growth medium. Mannose, hemagglutination, trypsin digestion experiments and transmission electron microscopy suggested that the adhesion of E. sakazakii to the epithelial and endothelial cells is mainly non-fimbrial based. Conclusion Adherence experiments show heterogeneity within different E. sakazakii strains. In agreement with studies on E. cloacae, we found no relationship between the adhesive capacities in E. sakazakii and the eventual production of specific fimbriae. Further studies will have to be carried out in order to determine the adhesin(s involved in the interaction of E. sakazakii with cells and to

  9. Biofilm formation and adherence characteristics of an Elizabethkingia meningoseptica isolate from Oreochromis mossambicus

    Chenia Hafizah Y

    2011-05-01

    Full Text Available Abstract Background Elizabethkingia spp. are opportunistic pathogens often found associated with intravascular device-related bacteraemias and ventilator-associated pneumonia. Their ability to exist as biofilm structures has been alluded to but not extensively investigated. Methods The ability of Elizabethkingia meningoseptica isolate CH2B from freshwater tilapia (Oreochromis mossambicus and E. meningoseptica strain NCTC 10016T to adhere to abiotic surfaces was investigated using microtiter plate adherence assays following exposure to varying physico-chemical challenges. The role of cell-surface properties was investigated using hydrophobicity (bacterial adherence to hydrocarbons, autoaggregation and coaggregation assays. The role of extracellular components in adherence was determined using reversal or inhibition of coaggregation assays in conjunction with Listeria spp. isolates, while the role of cell-free supernatants, from diverse bacteria, in inducing enhanced adherence was investigated using microtitre plate assays. Biofilm architecture of isolate CH2B alone as well as in co-culture with Listeria monocytogenes was investigated using flow cells and microscopy. Results E. meningoseptica isolates CH2B and NCTC 10016T demonstrated stronger biofilm formation in nutrient-rich medium compared to nutrient-poor medium at both 21 and 37°C, respectively. Both isolates displayed a hydrophilic cell surface following the bacterial adherence to xylene assay. Varying autoaggregation and coaggregation indices were observed for the E. meningoseptica isolates. Coaggregation by isolate CH2B appeared to be strongest with foodborne pathogens like Enterococcus, Staphylococcus and Listeria spp. Partial inhibition of coaggregation was observed when isolate CH2B was treated with heat or protease exposure, suggesting the presence of heat-sensitive adhesins, although sugar treatment resulted in increased coaggregation and may be associated with a lactose

  10. Distribution of classical and nonclassical virulence genes in enterotoxigenic Escherichia coli isolates from Chilean children and tRNA gene screening for putative insertion sites for genomic islands.

    Del Canto, Felipe; Valenzuela, Patricio; Cantero, Lidia; Bronstein, Jonathan; Blanco, Jesús E; Blanco, Jorge; Prado, Valeria; Levine, Myron; Nataro, James; Sommerfelt, Halvor; Vidal, Roberto

    2011-09-01

    Enterotoxigenic Escherichia coli (ETEC) is an important cause of diarrhea. Three adhesins (Tia, TibA, EtpA), an iron acquisition system (Irp1, Irp2, and FyuA), a GTPase (LeoA), and an autotransporter (EatA) are ETEC virulence-related proteins that, in contrast to the classical virulence factors (enterotoxins and fimbrial colonization factors) have not heretofore been targets in characterizing isolates from epidemiological studies. Here, we determined the occurrence of these nonclassical virulence genes in 103 ETEC isolates from Chilean children with diarrhea and described their association with O serogroups and classical virulence determinants. Because tia, leoA, irp2, and fyuA are harbored by pathogenicity islands inserted into the selC and asnT tRNA genes (tDNAs), we analyzed the regions flanking these loci. Ten additional tDNAs were also screened to identify hot spots for genetic insertions. Associations between the most frequent serogroups and classical colonization factor (CF)-toxin profiles included O6/LT-STh/CS1-CS3-CS21 (i.e., O6 serogroup, heat-labile [LT] and human heat-stable [STh] enterotoxins, and CFs CS1, -3 and -21), O6/LT-STh/CS2-CS3-CS21, and O104-O127/STh/CFAI-CS21. The eatA and etpA genes were detected in more than 70% of the collection, including diverse serogroups and virulence profiles. Sixteen percent of the ETEC strains were negative for classical and nonclassical adhesins, suggesting the presence of unknown determinants of adhesion. The leuX, thrW, and asnT tDNAs were disrupted in more than 65% of strains, suggesting they are hot spots for the insertion of mobile elements. Sequences similar to integrase genes were identified next to the thrW, asnT, pheV, and selC tDNAs. We propose that the eatA and etpA genes should be included in characterizations of ETEC isolates in future epidemiological studies to determine their prevalence in other geographical regions. Sequencing of tDNA-associated genetic insertions might identify new ETEC virulence

  11. Characterization of Acinetobacter baumannii biofilm associated components

    Brossard, Kari A.

    Acinetobacter baumannii is a Gram-negative aerobic coccobaccillus that is a major cause of nosocomial infections worldwide. Infected individuals may develop pneumonia, urinary tract, wound, and other infections that are associated with the use of indwelling medical devices such as catheters and mechanical ventilation. Treatment is difficult because many A. baumannii isolates have developed multi-drug resistance and the bacterium can persist on abiotic surfaces. Persistence and resistance may be due to formation of biofilms, which leads to long-term colonization, evasion of the host immune system and resistance to treatment with antibiotics and disinfectants. While biofilms are complex multifaceted structures, two bacterial components that have been shown to be important in formation and stability are exopolysaccharides (EPS) and the biofilm-associated protein (Bap). An EPS, poly-beta-1,6-N-acetylglucosamine, PNAG, has been described for E. coli and S. epidermidis. PNAG acts as an intercellular adhesin. Production of this adhesin is dependent on the pga/icaABCD locus. We have identified a homologous locus in A. baumannii 307-0294 that is involved in production of an exopolysaccharide, recognized by an anti-PNAG antibody. We hypothesized that the A. baumannii pgaABCD locus plays a role in biofilm formation, and protection against host innate defenses and disinfectants suggesting that PNAG is a possible virulence factor for the organism. The first aim of this thesis will define the pgaABCD locus. We have previously identified Bap, a protein with similarity to those described for S. aureus and we have demonstrated that this protein is involved in maintaining the stability of biofilms on glass. We hypothesized that A. baumannii Bap plays a role in persistence and pathogenesis and is regulated by quorum sensing. In our second aim we will examine the role of Bap in attachment and biofilm formation on medically relevant surfaces and also determine if Bap is involved in

  12. Biofilm formation by multidrug resistant Escherichia coli ST131 is dependent on type 1 fimbriae and assay conditions.

    Sarkar, Sohinee; Vagenas, Dimitrios; Schembri, Mark A; Totsika, Makrina

    2016-04-01

    Escherichia coli sequence type 131 (ST131) has emerged as a pandemic lineage of important multidrug resistant pathogens worldwide. Despite many studies examining the epidemiology of ST131, only a few studies to date have investigated the capacity of ST131 strains to form biofilms. Some of these studies have reported contrasting findings, with no specific ST131 biofilm-promoting factors identified. Here, we examined a diverse collection of ST131 isolates for in vitro biofilm formation in different media and assay conditions, including urine from healthy adult women. We found significant differences among strains and assay conditions, which offers an explanation for the contrasting findings reported by previous studies using a single condition. Importantly, we showed that expression of type 1 fimbriae is a critical determinant for biofilm formation by ST131 strains and that inhibition of the FimH adhesin significantly reduces biofilm formation. We also offer direct genetic evidence for the contribution of type 1 fimbriae in biofilm formation by the reference ST131 strain EC958, a representative of the clinically dominant H30-Rx ST131 subgroup. This is the first study of ST131 biofilm formation in biologically relevant conditions and paves the way for the application of FimH inhibitors in treating drug resistant ST131 biofilm infections. PMID:26940589

  13. Biofilm Formation and Detection of IcaAB Genes in Clinical Isolates of Methicillin Resistant Staphylococcus aureus

    Fereshteh Eftekhar

    2011-03-01

    Full Text Available Objective(sMethicillin-resistant Staphylococcus aureus (MRSA is an important cause of nosocomial and community infections. Biofilm formation, mediated by a polysaccharide intercellular adhesin (PIA and encoded by the ica operon, is considered to be an important virulence factor in both S. epidermidis and S. aureus. However, the clinical impact of the ica locus and PIA production is less well described in S. aureus. We studied biofilm formation in clinical isolates of MRSA in relation to the presence of the ica operon. Materials and MethodsForty five MRSA were studied for biofilm formation by colony morphology on Congo red agar (CRA and the microtitre plate assay (MtP. Presence of the ica genes was detected by PCR and specific primers. ResultsThe results showed that 53.3% of the isolates had the potential to form biofilm by colony morphology of which, 75% carried the ica operon. Weak biofilm production was observed in the MtP assay by 57.8%, of which 53.8% harbored the ica operon. However, about 70% of biofilm non-producers also carried the ica operon. ConclusionOverall, there was no agreement between the icaAB gene carriage and biofilm phenotype by either of the two phenotypic methods. However, 91% of biofilm formers on CRA also produced biofilm in the MtP assay.

  14. Pathogenesis and Antifungal Drug Resistance of the Human Fungal Pathogen Candida glabrata

    Karl Kuchler

    2011-01-01

    Full Text Available Candida glabrata is a major opportunistic human fungal pathogen causing superficial as well as systemic infections in immunocompromised individuals and several other patient cohorts. C. glabrata represents the second most prevalent cause of candidemia and a better understanding of its virulence and drug resistance mechanisms is thus of high medical relevance. In contrast to the diploid dimorphic pathogen C. albicans, whose ability to undergo filamentation is considered a major virulence trait, C. glabrata has a haploid genome and lacks the ability to switch to filamentous growth. A major impediment for the clinical therapy of C. glabrata infections is its high intrinsic resistance to several antifungal drugs, especially azoles. Further, the development of antifungal resistance, particularly during prolonged and prophylactic therapies is diminishing efficacies of therapeutic interventions. In addition, C. glabrata harbors a large repertoire of adhesins involved in the adherence to host epithelia. Interestingly, genome plasticity, phenotypic switching or the remarkable ability to persist and survive inside host immune cells further contribute to the pathogenicity of C. glabrata. In this comprehensive review, we want to emphasize and discuss the mechanisms underlying virulence and drug resistance of C. glabrata, and discuss its ability to escape from the host immune surveillance or persist inside host cells.

  15. Rapid identification of novel antigens of Salmonella Enteritidis by microarray-based immuno screening

    We report on an approach to rapidly screen thousands of Salmonella Enteritidis proteins with the goal of identifying novel immunodominant proteins. We used a microarray-based system that warrants high throughput and easy handling. Seven immunogenic candidates were selected after screening. Comparative analyses by ELISA and microarrays manifested their immunodominant character. The large repetitive protein (SEN4030) that plays a role as a putative adhesin in initial cell surface interaction and is highly specific to Salmonella is considered to be the most suitable protein for a diagnostic approach. The results further demonstrate that the strategy applied herein is convenient for specifically identifying immunogenic proteins of pathogenic microorganisms. Consequently, it enables a sound assessment of promising candidates for diagnostic applications and vaccine development. Moreover, the elucidation of immunogenic proteins may assist in unveiling unknown virulence-associated factors, thus furthering the understanding of the underlying pathogenicity of Salmonella in general, and of S. Enteritidis, one of the most frequently detected serovars of this pathogen, in particular. (author)

  16. Solid-state NMR Study of the YadA Membrane-Anchor Domain in the Bacterial Outer Membrane.

    Shahid, Shakeel A; Nagaraj, Madhu; Chauhan, Nandini; Franks, Trent W; Bardiaux, Benjamin; Habeck, Michael; Orwick-Rydmark, Marcella; Linke, Dirk; van Rossum, Barth-J

    2015-10-19

    MAS-NMR was used to study the structure and dynamics at ambient temperatures of the membrane-anchor domain of YadA (YadA-M) in a pellet of the outer membrane of E. coli in which it was expressed. YadA is an adhesin from the pathogen Yersinia enterocolitica that is involved in interactions with the host cell, and it is a model protein for studying the autotransport process. Existing assignments were sucessfully transferred to a large part of the YadA-M protein in the E. coli lipid environment by using (13) C-(13) C DARR and PDSD spectra at different mixing times. The chemical shifts in most regions of YadA-M are unchanged relative to those in microcrystalline YadA-M preparations from which a structure has previously been solved, including the ASSA region that is proposed to be involved in transition-state hairpin formation for transport of the soluble domain. Comparisons of the dynamics between the microcrystalline and membrane-embedded samples indicate greater flexibility of the ASSA region in the outer-membrane preparation at physiological temperatures. This study will pave the way towards MAS-NMR structure determination of membrane proteins, and a better understanding of functionally important dynamic residues in native membrane environments. PMID:26332158

  17. Comparative genomic analysis of coffee-infecting Xylella fastidiosa strains isolated from Brazil.

    Barbosa, Deibs; Alencar, Valquíria Campos; Santos, Daiene Souza; de Freitas Oliveira, Ana Cláudia; de Souza, Alessandra A; Coletta-Filho, Helvecio D; de Oliveira, Regina Souza; Nunes, Luiz R

    2015-05-01

    Strains of Xylella fastidiosa constitute a complex group of bacteria that develop within the xylem of many plant hosts, causing diseases of significant economic importance, such as Pierce's disease in North American grapevines and citrus variegated chlorosis in Brazil. X. fastidiosa has also been obtained from other host plants, in direct correlation with the development of diseases, as in the case of coffee leaf scorch (CLS)--a disease with potential to cause severe economic losses to the Brazilian coffee industry. This paper describes a thorough genomic characterization of coffee-infecting X. fastidiosa strains, initially performed through a microarray-based approach, which demonstrated that CLS strains could be subdivided in two phylogenetically distinct subgroups. Whole-genomic sequencing of two of these bacteria (one from each subgroup) allowed identification of ORFs and horizontally transferred elements (HTEs) that were specific to CLS-related X. fastidiosa strains. Such analyses confirmed the size and importance of HTEs as major mediators of chromosomal evolution amongst these bacteria, and allowed identification of differences in gene content, after comparisons were made with previously sequenced X. fastidiosa strains, isolated from alternative hosts. Although direct experimentation still needs to be performed to elucidate the biological consequences associated with such differences, it was interesting to verify that CLS-related bacteria display variations in genes that produce toxins, as well as surface-related factors (such as fimbrial adhesins and LPS) that have been shown to be involved with recognition of specific host factors in different pathogenic bacteria. PMID:25737482

  18. The functions of the variable lipoprotein family of Mycoplasma hyorhinis in adherence to host cells.

    Xiong, Qiyan; Wang, Jia; Ji, Yan; Ni, Bo; Zhang, Bixiong; Ma, Qinghong; Wei, Yanna; Xiao, Shaobo; Feng, Zhixin; Liu, Maojun; Shao, Guoqing

    2016-04-15

    Mycoplasma hyorhinis (M. hyorhinis) is a swine pathogen that is associated with various human cancers and contamination in cell cultures. However, no studies on the adhesion molecules of this pathogen have yet been reported. The variable lipoprotein (Vlp) family is an important surface component of M. hyorhinis. Herein, we performed several experiments to identify the function of the Vlp family in adherence to host cells. Seven recombinant Vlp (rVlp) proteins were expressed in Escherichia coli and purified by affinity chromatography. The potential role of rVlp adherence to pig kidney (PK-15) and swine tracheal epithelial (STEC) cells was then studied by indirect immunofluorescence assay and microtiter plate adherence assay. Adhesion of M. hyorhinis to PK-15 and STEC cells was specifically inhibited by the addition of a cocktail of rVlp proteins. The rVlp protein mixture was shown to bind to both PK-15 and STEC cells. The binding increased in a dose-dependent manner and could be blocked by antisera against the rVlp proteins. Most of the rVlp proteins could bind individually to both PK-15 and STEC cells except for rVlpD and rVlpF, which bound only to STEC cells. Because Vlp members vary in size among different strains and generations, they may vary in their cytoadhesion capabilities in various strains. In summary, the present results indicate that the Vlp family functions as adhesins of M. hyorhinis. PMID:27016761

  19. Presence of Pseudomonas aeruginosa influences biofilm formation and surface protein expression of Staphylococcus aureus.

    Kumar, Amit; Ting, Yen Peng

    2015-11-01

    Although Staphylococcus aureus and Pseudomonas aeruginosa can individually colonize and infect their hosts, the commensalistic effect of the two is more tenacious and lethal. In this study, it was shown that in co-culture with P. aeruginosa, a sub-population of S. aureus exhibited improved resistance to kanamycin by selection of small colony variant (SCV) phenotype. Additionally, biofilm formation by the two bacteria was denser in the co-culture, compared with biofilm formed in individual pure cultures. Using Atomic Force Microscope (AFM) force spectroscopy for single cells, it was demonstrated that S. aureus cultured in the presence of P. aeruginosa bound more tenaciously to substrates. Surface-shaved peptides were isolated and identified using ultra-performance liquid chromatography-quadrupole-time of flight and a homology search program spider. Results indicated that serine-rich adhesin, extracellular matrix binding protein and other putative adhesion proteins could be responsible for the enhanced attachment of S. aureus in the co-culture. Besides, several other proteins were differentially expressed, indicating the occurrence of a range of other interactions. Of particular interest was a multidrug resistant protein named ABC transporter permease which is known to expel xenobiotics out of the cells. Positive regulation of this protein could be involved in the SCV selection of S. aureus in the co-culture. PMID:25925222

  20. Similarities and Differences in the Glycosylation Mechanisms in Prokaryotes and Eukaryotes

    Anne Dell

    2010-01-01

    Full Text Available Recent years have witnessed a rapid growth in the number and diversity of prokaryotic proteins shown to carry N- and/or O-glycans, with protein glycosylation now considered as fundamental to the biology of these organisms as it is in eukaryotic systems. This article overviews the major glycosylation pathways that are known to exist in eukarya, bacteria and archaea. These are (i oligosaccharyltransferase (OST-mediated N-glycosylation which is abundant in eukarya and archaea, but is restricted to a limited range of bacteria; (ii stepwise cytoplasmic N-glycosylation that has so far only been confirmed in the bacterial domain; (iii OST-mediated O-glycosylation which appears to be characteristic of bacteria; and (iv stepwise O-glycosylation which is common in eukarya and bacteria. A key aim of the review is to integrate information from the three domains of life in order to highlight commonalities in glycosylation processes. We show how the OST-mediated N- and O-glycosylation pathways share cytoplasmic assembly of lipid-linked oligosaccharides, flipping across the ER/periplasmic/cytoplasmic membranes, and transferring “en bloc” to the protein acceptor. Moreover these hallmarks are mirrored in lipopolysaccharide biosynthesis. Like in eukaryotes, stepwise O-glycosylation occurs on diverse bacterial proteins including flagellins, adhesins, autotransporters and lipoproteins, with O-glycosylation chain extension often coupled with secretory mechanisms.

  1. Biochemical and functional analysis of two Plasmodium falciparum blood-stage 6-cys proteins: P12 and P41.

    Tana Taechalertpaisarn

    Full Text Available The genomes of Plasmodium parasites that cause malaria in humans, other primates, birds, and rodents all encode multiple 6-cys proteins. Distinct 6-cys protein family members reside on the surface at each extracellular life cycle stage and those on the surface of liver infective and sexual stages have been shown to play important roles in hepatocyte growth and fertilization respectively. However, 6-cys proteins associated with the blood-stage forms of the parasite have no known function. Here we investigate the biochemical nature and function of two blood-stage 6-cys proteins in Plasmodium falciparum, the most pathogenic species to afflict humans. We show that native P12 and P41 form a stable heterodimer on the infective merozoite surface and are secreted following invasion, but could find no evidence that this complex mediates erythrocyte-receptor binding. That P12 and P41 do not appear to have a major role as adhesins to erythrocyte receptors was supported by the observation that antisera to these proteins did not substantially inhibit erythrocyte invasion. To investigate other functional roles for these proteins their genes were successfully disrupted in P. falciparum, however P12 and P41 knockout parasites grew at normal rates in vitro and displayed no other obvious phenotypic changes. It now appears likely that these blood-stage 6-cys proteins operate as a pair and play redundant roles either in erythrocyte invasion or in host-immune interactions.

  2. Expression and Localization of an Hsp70 Protein in the Microsporidian Encephalitozoon cuniculi

    Carrie E. Jolly

    2010-01-01

    Full Text Available Microsporidia spore surface proteins are an important, under investigated aspect of spore/host cell attachment and infection. For comparison analysis of surface proteins, we required an antibody control specific for an intracellular protein. An endoplasmic reticulum-associated heat shock protein 70 family member (Hsp70; ECU02_0100; “C1” was chosen for further analysis. DNA encoding the C1 hsp70 was amplified, cloned and used to heterologously express the C1 Hsp70 protein, and specific antiserum was generated. Two-dimensional Western blotting analysis showed that the purified antibodies were monospecific. Immunoelectron microscopy of developing and mature E. cuniculi spores revealed that the protein localized to internal structures and not to the spore surface. In spore adherence inhibition assays, the anti-C1 antibodies did not inhibit spore adherence to host cell surfaces, whereas antibodies to a known surface adhesin (EnP1 did so. In future studies, the antibodies to the ‘C1’ Hsp70 will be used to delineate spore surface protein expression.

  3. Damping effect of helix-like pili

    Zakrisson, Johan; Axner, Ove; Andersson, Magnus

    2014-01-01

    Biopolymers are vital structures for many living organisms; for a variety of bacteria, adhesion polymers play a crucial role for the initiation of colonization. Some bacteria express, on their surface, attachment organelles (pili) that comprise subunits formed into stiff helix-like structures that possess unique biomechanical properties. These helix-like structures possess a high degree of flexibility that gives the biopolymers a unique extendibility. This has been considered beneficial for piliated bacteria adhering to host surfaces in the presence of a fluid flow. We show in this work that helix-like pili have the ability to act as efficient dampers of force that can, for a limited time, lower the load on the force-mediating adhesin-receptor bond on the tip of an individual pilus. The model presented is applied to bacteria adhering with a single pilus of either of the two most common types expressed by uropathogenic Escherichia coli, P or type 1 pili, subjected to realistic flows. The results indicate that ...

  4. The biomechanical properties of F1C pili

    Castelain, Mickaël; Klinth, Jeanna; Lindberg, Stina; Andersson, Magnus; Uhlin, Bernt Eric; Axner, Ove

    2014-01-01

    Uropathogenic Escherichia coli (UPEC) express various kinds of organelles, so-called pili or fimbriae, that mediate adhesion to host tissue in the urinary tract through specific receptor-adhesin interactions. The biomechanical properties of these pili have been considered important for the ability of bacteria to withstand shear forces from rinsing urine flows. Force measuring optical tweezers have been used to characterize individual organelles of F1C type expressed by UPEC bacteria with respect to such properties. Qualitatively, the force-vs.-elongation response was found to be similar to that of other types of helix-like pili expressed by UPEC, i.e. type 1, P, and S, with force-induced elongation in three regions of which one represents the important uncoiling mechanism of the helix-like quaternary structure. Quantitatively, the steady-state uncoiling force was assessed to 26.4(1.4) pN, which is similar to those of other pili (which range from 21 pN for SI to 30 pN for type 1). The corner velocity for dynam...

  5. Physiologic cold shock of Moraxella catarrhalis affects the expression of genes involved in the iron acquisition, serum resistance and immune evasion

    Schaller André

    2011-08-01

    Full Text Available Abstract Background Moraxella catarrhalis, a major nasopharyngeal pathogen of the human respiratory tract, is exposed to rapid downshifts of environmental temperature when humans breathe cold air. It was previously shown that the prevalence of pharyngeal colonization and respiratory tract infections caused by M. catarrhalis are greatest in winter. The aim of this study was to investigate how M. catarrhalis uses the physiologic exposure to cold air to upregulate pivotal survival systems in the pharynx that may contribute to M. catarrhalis virulence. Results A 26°C cold shock induces the expression of genes involved in transferrin and lactoferrin acquisition, and enhances binding of these proteins on the surface of M. catarrhalis. Exposure of M. catarrhalis to 26°C upregulates the expression of UspA2, a major outer membrane protein involved in serum resistance, leading to improved binding of vitronectin which neutralizes the lethal effect of human complement. In contrast, cold shock decreases the expression of Hemagglutinin, a major adhesin, which mediates B cell response, and reduces immunoglobulin D-binding on the surface of M. catarrhalis. Conclusion Cold shock of M. catarrhalis induces the expression of genes involved in iron acquisition, serum resistance and immune evasion. Thus, cold shock at a physiologically relevant temperature of 26°C induces in M. catarrhalis a complex of adaptive mechanisms that enables the bacterium to target their host cellular receptors or soluble effectors and may contribute to enhanced growth, colonization and virulence.

  6. Leptospira spp.: Novel insights into host-pathogen interactions.

    Fernandes, Luis G; Siqueira, Gabriela H; Teixeira, Aline R F; Silva, Lucas P; Figueredo, Jupciana M; Cosate, Maria R; Vieira, Monica L; Nascimento, Ana L T O

    2016-08-01

    Leptospirosis is a widespread zoonosis caused by pathogenic Leptospira spp. It is an important infectious disease that affects humans and animals. The disease causes economic losses as it affects livestock, with decreased milk production and death. Our group is investigating the genome sequences of L. interrogans targeting surface-exposed proteins because, due to their location, these proteins are capable to interact with several host components that could allow establishment of the infection. These interactions may involve adhesion of the bacteria to extracellular matrix (ECM) components and, hence, help bacterial colonization. The bacteria could also react with the host fibrinolytic system and/or with the coagulation cascade components, such as, plasminogen (PLG) and fibrinogen (Fg), respectively. The binding with the first system generates plasmin (PLA), increasing the proteolytic power of the bacteria, while the second interferes with clotting in a thrombin-catalyzed reaction, which may promote hemorrhage foci and increase bacterial dissemination. Interaction with the complement system negative regulators may help bacteria to evade the host immune system, facilitating the invasion. This work compiles the main described leptospiral proteins that could act as adhesins, as PLG and fibrinogen receptors and as complement regulator binding proteins. We present models in which we suggest possible mechanisms of how leptospires might colonize and invade host tissues, causing the disease. Understanding leptospiral pathogenesis will help to identify antigen candidates that would contribute to the development of more effective vaccines and diagnostic tests. PMID:26727033

  7. Emerging pathogens: Aeromonas spp.

    Merino, S; Rubires, X; Knochel, S; Tomas, J M

    1995-12-01

    Aeromonas spp. are Gram-negative rods of the family Vibrionaceae. They are normal water inhabitants and are part of the regular flora of poiquilotherm and homeotherm animals. They can be isolated from many foodstuffs (green vegetables, raw milk, ice cream, meat and seafood). Mesophilic Aeromonas spp. have been classified following the AeroKey II system (Altwegg et al., 1990; Carnahan et al., 1991). The major human diseases caused by Aeromonas spp. can be classified in two major groups: septicemia (mainly by strains of A. veronii subsp. sobria and A. hydrophila), and gastroenteritis (any mesophilic Aeromonas spp. but principally A. hydrophila and A. veronii). Most epidemiological studies have shown Aeromonas spp. in stools to be more often associated with diarrhea than with the carrier state; an association with the consumption of untreated water was also conspicuous. Acute self-limited diarrhea is more frequent in young children, in older patients chronic enterocolitis may also be observed. Fever, vomiting, and fecal leukocytes or erythrocytes (colitis) may be present (Janda, 1991). The main putative virulence factors are: exotoxins, endotoxin (LPS), presence of S-layers, fimbriae or adhesins and the capacity to form capsules. PMID:8750664

  8. Boosting BCG-primed responses with a subunit Apa vaccine during the waning phase improves immunity and imparts protection against Mycobacterium tuberculosis.

    Nandakumar, Subhadra; Kannanganat, Sunil; Dobos, Karen M; Lucas, Megan; Spencer, John S; Amara, Rama Rao; Plikaytis, Bonnie B; Posey, James E; Sable, Suraj B

    2016-01-01

    Heterologous prime-boosting has emerged as a powerful vaccination approach against tuberculosis. However, optimal timing to boost BCG-immunity using subunit vaccines remains unclear in clinical trials. Here, we followed the adhesin Apa-specific T-cell responses in BCG-primed mice and investigated its BCG-booster potential. The Apa-specific T-cell response peaked 32-52 weeks after parenteral or mucosal BCG-priming but waned significantly by 78 weeks. A subunit-Apa-boost during the contraction-phase of BCG-response had a greater effect on the magnitude and functional quality of specific cellular and humoral responses compared to a boost at the peak of BCG-response. The cellular response increased following mucosal BCG-prime-Apa-subunit-boost strategy compared to Apa-subunit-prime-BCG-boost approach. However, parenteral BCG-prime-Apa-subunit-boost by a homologous route was the most effective strategy in-terms of enhancing specific T-cell responses during waning in the lung and spleen. Two Apa-boosters markedly improved waning BCG-immunity and significantly reduced Mycobacterium tuberculosis burdens post-challenge. Our results highlight the challenges of optimization of prime-boost regimens in mice where BCG drives persistent immune-activation and suggest that boosting with a heterologous vaccine may be ideal once the specific persisting effector responses are contracted. Our results have important implications for design of prime-boost regimens against tuberculosis in humans. PMID:27173443

  9. Validation and utilization of PCR for differential diagnosis and prevalence determination of Entamoeba histolytica/Entamoeba dispar in Salvador City, Brazil

    Fred Luciano Neves Santos

    2011-04-01

    Full Text Available Amoebiasis is an infection caused by Entamoeba histolytica and is a potential health risk in countries in which health barriers are inappropriate. Since the discovery of Entamoeba dispar, the prevalence of amoebiasis has been modified. OBJECTIVE: This study has standardized the PCR technique applied for the diagnosis of different species of the E. histolytica/E. dispar complex and has evaluated the prevalence of infection among patients attending private and public clinical laboratories in Salvador City, Bahia State, Brazil. RESULTS: Analysis of 52,704 stool samples by microscopic examination demonstrated that 1,788 (3.4% were positive for the E. histolytica/E. dispar complex and infection occurred more often in samples originated from public clinical laboratories (5.0% than those that came from private laboratories (3.2%. PCR performed in approximately 15% (262 E. histolytica/E. dispar complex positive samples, randomly chosen, amplified 227 samples (86.6%, all of them positive for E. dispar. The non-amplified 35 samples (13.4% were also negative for E. histolytica-specific galactose adhesin. Moreover, to exclude a probable infection caused by E. hartmanni, morphometric analysis demonstrated that non-amplified samples had cyst sizes comparable to E. histolytica/E. dispar (>10 µm. CONCLUSION: The absence of amplification of these samples indicates the presence of PCR inhibitors in the stool samples or the presence of DNA from Entamoeba species other than E. dispar, E. histolytica or E. hartmanni.

  10. Biofilm characteristics of Staphylococcus epidermidis isolates associated with device-related meningitis.

    Stevens, Niall T

    2009-07-01

    Staphylococcus epidermidis biofilm causes device-related meningitis in neurosurgical patients. This study assessed the contribution of polysaccharide and protein to the development of a strong biofilm-positive phenotype in four S. epidermidis isolates associated with probable device-related meningitis, under varying environmental conditions. RT-PCR analysis of the intercellular adhesion operon (icaADBC) and assessment of polysaccharide intercellular adhesin (PIA) production indicated a correlation between increased icaA transcription and PIA production in ica(+) isolates grown in medium with 4 % ethanol and 4 % NaCl. Treatment of biofilm with sodium metaperiodate caused dispersion of adhered cells (P <0.0001), indicating involvement of PIA. Transcriptional levels of protein factors revealed that atlE transcription levels were similar in all isolates, whilst aap levels were variable, with induction being seen in two isolates following growth in the presence of alcohol or salt. Transcription of agr did not influence protein expression and RNAIII transcription varied among the strains. Although aap transcription was induced, the treatment of biofilm with proteinase K did not always disperse the biofilm. Our data suggest that, among the three ica(+) S. epidermidis isolates clinically associated with meningitis that were studied, PIA contributed to the strong biofilm-positive phenotype, whereas protein factors appeared to have a secondary role.

  11. Comparative analysis of agr groups and virulence genes among subclinical and clinical mastitis Staphylococcus aureus isolates from sheep flocks of the Northeast of Brazil

    Lara M. de Almeida

    2013-01-01

    Full Text Available Staphylococcus aureus is one of the most frequent mastitis causative agents in small ruminants. The expression of most virulence genes of S. aureus is controlled by an accessory gene regulator (agrlocus. This study aimed to ascertain the prevalence of the different agr groups and to evaluate the occurrence of encoding genes for cytotoxin, adhesins and toxins with superantigen activity in S. aureus isolates from milk of ewes with clinical and subclinical mastitis in sheep flocks raised for meat production The agr groups I and II were identified in both cases of clinical and subclinical mastitis. Neither the arg groups III and IV nor negative agr were found. The presence of cflA gene was identified in 100% of the isolates. The frequency of hla and lukE-D genes was high -77.3 and 82.8%, respectively and all isolates from clinical mastitis presented these genes. The sec gene, either associated to tst gene or not, was identified only in isolates from subclinical mastitis. None of the following genes were identified: bbp, ebpS, cna, fnbB, icaA, icaD, bap, hlg, lukM-lukF-PV and se-a-b-d-e.

  12. Comparative analysis of agr groups and virulence genes among subclinical and clinical mastitis Staphylococcus aureus isolates from sheep flocks of the Northeast of Brazil.

    de Almeida, Lara M; de Almeida, Mayra Zilta P R B; de Mendonça, Carla L; Mamizuka, Elsa M

    2013-01-01

    Staphylococcus aureus is one of the most frequent mastitis causative agents in small ruminants. The expression of most virulence genes of S. aureus is controlled by an accessory gene regulator (agr) locus. This study aimed to ascertain the prevalence of the different agr groups and to evaluate the occurrence of encoding genes for cytotoxin, adhesins and toxins with superantigen activity in S. aureus isolates from milk of ewes with clinical and subclinical mastitis in sheep flocks raised for meat production The agr groups I and II were identified in both cases of clinical and subclinical mastitis. Neither the arg groups III and IV nor negative agr were found. The presence of cflA gene was identified in 100% of the isolates. The frequency of hla and lukE-D genes was high - 77.3 and 82.8%, respectively and all isolates from clinical mastitis presented these genes. The sec gene, either associated to tst gene or not, was identified only in isolates from subclinical mastitis. None of the following genes were identified: bbp, ebpS, cna, fnbB, icaA, icaD, bap, hlg, lukM-lukF-PV and se-a-b-d-e. PMID:24294245

  13. Structural Insights into Polymorphic ABO Glycan Binding by Helicobacter pylori.

    Moonens, Kristof; Gideonsson, Pär; Subedi, Suresh; Bugaytsova, Jeanna; Romaõ, Ema; Mendez, Melissa; Nordén, Jenny; Fallah, Mahsa; Rakhimova, Lena; Shevtsova, Anna; Lahmann, Martina; Castaldo, Gaetano; Brännström, Kristoffer; Coppens, Fanny; Lo, Alvin W; Ny, Tor; Solnick, Jay V; Vandenbussche, Guy; Oscarson, Stefan; Hammarström, Lennart; Arnqvist, Anna; Berg, Douglas E; Muyldermans, Serge; Borén, Thomas; Remaut, Han

    2016-01-13

    The Helicobacter pylori adhesin BabA binds mucosal ABO/Le(b) blood group (bg) carbohydrates. BabA facilitates bacterial attachment to gastric surfaces, increasing strain virulence and forming a recognized risk factor for peptic ulcers and gastric cancer. High sequence variation causes BabA functional diversity, but the underlying structural-molecular determinants are unknown. We generated X-ray structures of representative BabA isoforms that reveal a polymorphic, three-pronged Le(b) binding site. Two diversity loops, DL1 and DL2, provide adaptive control to binding affinity, notably ABO versus O bg preference. H. pylori strains can switch bg preference with single DL1 amino acid substitutions, and can coexpress functionally divergent BabA isoforms. The anchor point for receptor binding is the embrace of an ABO fucose residue by a disulfide-clasped loop, which is inactivated by reduction. Treatment with the redox-active pharmaceutic N-acetylcysteine lowers gastric mucosal neutrophil infiltration in H. pylori-infected Le(b)-expressing mice, providing perspectives on possible H. pylori eradication therapies. PMID:26764597

  14. Streptococcus iniae SF1: complete genome sequence, proteomic profile, and immunoprotective antigens.

    Bao-cun Zhang

    Full Text Available Streptococcus iniae is a Gram-positive bacterium that is reckoned one of the most severe aquaculture pathogens. It has a broad host range among farmed marine and freshwater fish and can also cause zoonotic infection in humans. Here we report for the first time the complete genome sequence as well as the host factor-induced proteomic profile of a pathogenic S. iniae strain, SF1, a serotype I isolate from diseased fish. SF1 possesses a single chromosome of 2,149,844 base pairs, which contains 2,125 predicted protein coding sequences (CDS, 12 rRNA genes, and 45 tRNA genes. Among the protein-encoding CDS are genes involved in resource acquisition and utilization, signal sensing and transduction, carbohydrate metabolism, and defense against host immune response. Potential virulence genes include those encoding adhesins, autolysins, toxins, exoenzymes, and proteases. In addition, two putative prophages and a CRISPR-Cas system were found in the genome, the latter containing a CRISPR locus and four cas genes. Proteomic analysis detected 21 secreted proteins whose expressions were induced by host serum. Five of the serum-responsive proteins were subjected to immunoprotective analysis, which revealed that two of the proteins were highly protective against lethal S. iniae challenge when used as purified recombinant subunit vaccines. Taken together, these results provide an important molecular basis for future study of S. iniae in various aspects, in particular those related to pathogenesis and disease control.

  15. Insect-cell expression, crystallization and X-ray data collection of the bradyzoite-specific antigen BSR4 from Toxoplasma gondii

    Preliminary X-ray diffraction studies of the bradyzoite-specific surface antigen BSR4 from T. gondii are described. Toxoplasma gondii is an important global pathogen that infects nearly one third of the world’s adult population. A family of developmentally expressed structurally related surface-glycoprotein adhesins (SRSs) mediate attachment to and are utilized for entry into host cells. The latent bradyzoite form of T. gondii persists for the life of the host and expresses a distinct family of SRS proteins, of which the bradyzoite-specific antigen BSR4 is a prototypical member. Structural studies of BSR4 were initiated by first recombinantly expressing BSR4 in insect cells, which was followed by crystallization and preliminary X-ray data collection to 1.95 Å resolution. Data processing showed that BSR4 crystallized with one molecule in the asymmetric unit of the P41212 or P43212 space group, with a solvent content of 60% and a corresponding Matthews coefficient of 2.98 Å3 Da−1

  16. The Genomic Sequence of the Oral Pathobiont Strain NI1060 Reveals Unique Strategies for Bacterial Competition and Pathogenicity.

    Youssef Darzi

    Full Text Available Strain NI1060 is an oral bacterium responsible for periodontitis in a murine ligature-induced disease model. To better understand its pathogenicity, we have determined the complete sequence of its 2,553,982 bp genome. Although closely related to Pasteurella pneumotropica, a pneumonia-associated rodent commensal based on its 16S rRNA, the NI1060 genomic content suggests that they are different species thriving on different energy sources via alternative metabolic pathways. Genomic and phylogenetic analyses showed that strain NI1060 is distinct from the genera currently described in the family Pasteurellaceae, and is likely to represent a novel species. In addition, we found putative virulence genes involved in lipooligosaccharide synthesis, adhesins and bacteriotoxic proteins. These genes are potentially important for host adaption and for the induction of dysbiosis through bacterial competition and pathogenicity. Importantly, strain NI1060 strongly stimulates Nod1, an innate immune receptor, but is defective in two peptidoglycan recycling genes due to a frameshift mutation. The in-depth analysis of its genome thus provides critical insights for the development of NI1060 as a prime model system for infectious disease.

  17. Sequential unfolding of beta helical protein by single-molecule atomic force microscopy.

    David Alsteens

    Full Text Available The parallel βhelix is a common fold among extracellular proteins, however its mechanical properties remain unexplored. In Gram-negative bacteria, extracellular proteins of diverse functions of the large 'TpsA' family all fold into long βhelices. Here, single-molecule atomic force microscopy and steered molecular dynamics simulations were combined to investigate the mechanical properties of a prototypic TpsA protein, FHA, the major adhesin of Bordetella pertussis. Strong extension forces were required to fully unfold this highly repetitive protein, and unfolding occurred along a stepwise, hierarchical process. Our analyses showed that the extremities of the βhelix unfold early, while central regions of the helix are more resistant to mechanical unfolding. In particular, a mechanically resistant subdomain conserved among TpsA proteins and critical for secretion was identified. This nucleus harbors structural elements packed against the βhelix that might contribute to stabilizing the N-terminal region of FHA. Hierarchical unfolding of the βhelix in response to a mechanical stress may maintain β-helical portions that can serve as templates for regaining the native structure after stress. The mechanical properties uncovered here might apply to many proteins with β-helical or related folds, both in prokaryotes and in eukaryotes, and play key roles in their structural integrity and functions.

  18. Structural characterization of outer membrane components of the type IV pili system in pathogenic Neisseria.

    Samta Jain

    Full Text Available Structures of the type IV pili secretin complexes from Neisseria gonorrhoeae and Neisseria meningitidis, embedded in outer membranes were investigated by transmission electron microscopy. Single particle averaging revealed additional domains not observed previously. Secretin complexes of N. gonorrhoeae showed a double ring structure with a 14-15-fold symmetry in the central ring, and a 14-fold symmetry of the peripheral ring with 7 spikes protruding. In secretin complexes of N. meningitidis, the spikes were absent and the peripheral ring was partly or completely lacking. When present, it had a 19-fold symmetry. The structures of the complexes in several pil mutants were determined. Structures obtained from the pilC1/C2 adhesin and the pilW minor pilin deletion strains were similar to wild-type, whereas deletion of the homologue of N. meningitidis PilW resulted in the absence of secretin structures. Remarkably, the pilE pilin subunit and pilP lipoprotein deletion mutants showed a change in the symmetry of the peripheral ring from 14 to 19 and loss of spikes. The pilF ATPase mutant also lost the spikes, but maintained 14-fold symmetry. These results show that secretin complexes contain previously unidentified large and flexible extra domains with a probable role in stabilization or assembly of type IV pili.

  19. Decreased expression of 14-3-3 in Paracoccidioides brasiliensis confirms its involvement in fungal pathogenesis.

    Marcos, Caroline Maria; Silva, Julhiany de Fátima ds; Oliveira, Haroldo Cesar de; Assato, Patrícia Akemi; Singulani, Junya de Lacorte; Lopez, Angela Maria; Tamayo, Diana Patricia; Hernandez-Ruiz, Orville; McEwen, Juan G; Mendes-Giannini, Maria José Soares; Fusco-Almeida, Ana Marisa

    2016-01-01

    The interaction between the fungal pathogen Paracoccidioides brasiliensis and host cells is usually mediated by specific binding events between adhesins on the fungal surface and receptors on the host extracellular matrix or cell surface. One molecule implicated in the P. brasiliensis-host interaction is the 14-3-3 protein. The 14-3-3 protein belongs to a family of conserved regulatory molecules that are expressed in all eukaryotic cells and are involved in diverse cellular functions. Here, we investigated the relevance of the 14-3-3 protein to the virulence of P. brasiliensis. Using antisense RNA technology and Agrobacterium tumefaciens-mediated transformation, we generated a 14-3-3-silenced strain (expression reduced by ˜55%). This strain allowed us to investigate the interaction between 14-3-3 and the host and to correlate the functions of P. brasiliensis 14-3-3 with cellular features, such as morphological characteristics and virulence, that are important for pathogenesis. PMID:26646480

  20. Identification of conserved antigens for early serodiagnosis of relapsing fever Borrelia

    Lopez, Job E.; Porcella, Stephen F.; Schrumpf, Merry E.; Raffel, Sandra J.; Hammer, Carl H.; Zhao, Ming; Robinson, Mary Ann; Schwan, Tom G.

    2009-01-01

    Borrelia hermsii is a blood-borne pathogen transmitted by the argasid tick Ornithodoros hermsi. Since spirochaete clearance in mice is associated with an IgM-mediated response, an immunoproteomic analysis was used to identify proteins reactive with IgM. We report that IgM from both mice and human patients infected with B. hermsii not only reacted with the previously identified variable membrane proteins but also identified candidate antigens including heat-shock proteins, an adhesin protein, ABC transporter proteins, flagellar proteins, housekeeping proteins, an immune evasion protein, and proteins with unknown function. Furthermore, IgM reactivity to recombinant glycerophosphodiester phosphodiesterase was detected during early spirochaete infection and prior to a detectable IgG response. Lastly, a conserved hypothetical protein was produced in Escherichia coli and tested with immune serum against B. hermsii and Borrelia recurrentis. These results identify a much larger set of immunoreactive proteins, and could help in the early serodiagnosis of this tick-borne infection. PMID:19443544

  1. Genomic diversity of Escherichia isolates from diverse habitats.

    Seungdae Oh

    Full Text Available Our understanding of the Escherichia genus is heavily biased toward pathogenic or commensal isolates from human or animal hosts. Recent studies have recovered Escherichia isolates that persist, and even grow, outside these hosts. Although the environmental isolates are typically phylogenetically distinct, they are highly related to and phenotypically indistinguishable from their human counterparts, including for the coliform test. To gain insights into the genomic diversity of Escherichia isolates from diverse habitats, including freshwater, soil, animal, and human sources, we carried out comparative DNA-DNA hybridizations using a multi-genome E. coli DNA microarray. The microarray was validated based on hybridizations with selected strains whose genome sequences were available and used to assess the frequency of microarray false positive and negative signals. Our results showed that human fecal isolates share two sets of genes (n>90 that are rarely found among environmental isolates, including genes presumably important for evading host immune mechanisms (e.g., a multi-drug transporter for acids and antimicrobials and adhering to epithelial cells (e.g., hemolysin E and fimbrial-like adhesin protein. These results imply that environmental isolates are characterized by decreased ability to colonize host cells relative to human isolates. Our study also provides gene markers that can distinguish human isolates from those of warm-blooded animal and environmental origins, and thus can be used to more reliably assess fecal contamination in natural ecosystems.

  2. Pneumococci in biofilms are non-invasive: implications on nasopharyngeal colonization

    Ryan Paul Gilley

    2014-11-01

    Full Text Available Streptococcus pneumoniae (the pneumococcus is an opportunistic pathogen that colonizes the human nasopharynx asymptomatically. Invasive pneumococcal disease develops following bacterial aspiration into the lungs. Pneumococci within the nasopharynx exist as biofilms, a growth phenotype characterized by surface attachment, encasement within an extracellular matrix, and antimicrobial resistance. Experimental evidence indicates that biofilm pneumococci are attenuated versus their planktonic counterpart. Biofilm pneumococci failed to cause invasive disease in experimentally challenged mice and in vitro were shown to be non-invasive despite being hyper-adhesive. This attenuated phenotype corresponds with observations that biofilm pneumococci elicit significantly less cytokine and chemokine production from host cells than their planktonic counterparts. Microarray and proteomic studies show that pneumococci within biofilms have decreased metabolism, less capsular polysaccharide, and reduced production of the pore-forming toxin pneumolysin. Biofilm pneumococci are predominately in the transparent phenotype, which has elevated cell wall phosphorylcholine, an adhesin subject to C-reactive protein mediated opsonization. Herein, we review these changes in virulence, interpret their impact on colonization and transmission, and discuss the notion that non-invasive biofilms are principal lifestyle of S. pneumoniae.

  3. Bacteria hold their breath upon surface contact as shown in a strain of Escherichia coli, using dispersed surfaces and flow cytometry analysis.

    Jing Geng

    Full Text Available Bacteria are ubiquitously distributed throughout our planet, mainly in the form of adherent communities in which cells exhibit specific traits. The mechanisms underpinning the physiological shift in surface-attached bacteria are complex, multifactorial and still partially unclear. Here we address the question of the existence of early surface sensing through implementation of a functional response to initial surface contact. For this purpose, we developed a new experimental approach enabling simultaneous monitoring of free-floating, aggregated and adherent cells via the use of dispersed surfaces as adhesive substrates and flow cytometry analysis. With this system, we analyzed, in parallel, the constitutively expressed GFP content of the cells and production of a respiration probe--a fluorescent reduced tetrazolium ion. In an Escherichia coli strain constitutively expressing curli, a major E. coli adhesin, we found that single cell surface contact induced a decrease in the cell respiration level compared to free-floating single cells present in the same sample. Moreover, we show here that cell surface contact with an artificial surface and with another cell caused reduction in respiration. We confirm the existence of a bacterial cell "sense of touch" ensuring early signalling of surface contact formation through respiration down modulation.

  4. E-selectin and P-selectin expression in endothelium of leprosy skin lesions.

    Souza, Juarez de; Sousa, Jorge Rodrigues de; Hirai, Kelly Emi; Silva, Luciana Mota; Fuzii, Hellen Thais; Dias, Leonidas Braga; Carneiro, Francisca Regina Oliveira; Aarão, Tinara Leila de Souza; Quaresma, Juarez Antonio Simões

    2015-09-01

    Leprosy is an infectious-contagious disease whose clinical evolution depends on the immune response pattern of the host. Adhesion molecules and leukocyte migration from blood to tissue are of the utmost importance for the recognition and elimination of infectious pathogens. Selectins are transmembrane glycoproteins that share a similar structural organization and can be divided into three types according to their site of expression. The biopsies were cut into 5μm thick sections and submitted to immunohistochemistry using antibodies against E-selectin and P-selectin. The number of E-selectin-positive cells was significantly higher in the tuberculoid form than in the lepromatous form. The immunostaining pattern of P-selectin differed from that of E-selectin. Analysis showed a larger number of endothelial cells expressing CD62P in the lepromatous form compared to the tuberculoid form. The presence of these adhesins in the endothelium contributing to or impairing the recruitment of immune cells to inflamed tissue and consequently influences the pattern of immune response and the clinical presentation of the disease. PMID:26051909

  5. Exploring host-pathogen interactions through genome wide protein microarray analysis

    Scietti, Luigi; Sampieri, Katia; Pinzuti, Irene; Bartolini, Erika; Benucci, Barbara; Liguori, Alessia; Haag, Andreas F.; Lo Surdo, Paola; Pansegrau, Werner; Nardi-Dei, Vincenzo; Santini, Laura; Arora, Seguinde; Leber, Xavier; Rindi, Simonetta; Savino, Silvana; Costantino, Paolo; Maione, Domenico; Merola, Marcello; Speziale, Pietro; Bottomley, Matthew J.; Bagnoli, Fabio; Masignani, Vega; Pizza, Mariagrazia; Scharenberg, Meike; Schlaeppi, Jean-Marc; Nissum, Mikkel; Liberatori, Sabrina

    2016-01-01

    During bacterial pathogenesis extensive contacts between the human and the bacterial extracellular proteomes take place. The identification of novel host-pathogen interactions by standard methods using a case-by-case approach is laborious and time consuming. To overcome this limitation, we took advantage of large libraries of human and bacterial recombinant proteins. We applied a large-scale protein microarray-based screening on two important human pathogens using two different approaches: (I) 75 human extracellular proteins were tested on 159 spotted Staphylococcus aureus recombinant proteins and (II) Neisseria meningitidis adhesin (NadA), an important vaccine component against serogroup B meningococcus, was screened against ≈2300 spotted human recombinant proteins. The approach presented here allowed the identification of the interaction between the S. aureus immune evasion protein FLIPr (formyl-peptide receptor like-1 inhibitory protein) and the human complement component C1q, key players of the offense-defense fighting; and of the interaction between meningococcal NadA and human LOX-1 (low-density oxidized lipoprotein receptor), an endothelial receptor. The novel interactions between bacterial and human extracellular proteins here presented might provide a better understanding of the molecular events underlying S. aureus and N. meningitidis pathogenesis. PMID:27302108

  6. Molecular phylogenetic analysis of non-sexually transmitted strains of Haemophilus ducreyi.

    Jordan R Gaston

    Full Text Available Haemophilus ducreyi, the etiologic agent of chancroid, has been previously reported to show genetic variance in several key virulence factors, placing strains of the bacterium into two genetically distinct classes. Recent studies done in yaws-endemic areas of the South Pacific have shown that H. ducreyi is also a major cause of cutaneous limb ulcers (CLU that are not sexually transmitted. To genetically assess CLU strains relative to the previously described class I, class II phylogenetic hierarchy, we examined nucleotide sequence diversity at 11 H. ducreyi loci, including virulence and housekeeping genes, which encompass approximately 1% of the H. ducreyi genome. Sequences for all 11 loci indicated that strains collected from leg ulcers exhibit DNA sequences homologous to class I strains of H. ducreyi. However, sequences for 3 loci, including a hemoglobin receptor (hgbA, serum resistance protein (dsrA, and a collagen adhesin (ncaA contained informative amounts of variation. Phylogenetic analyses suggest that these non-sexually transmitted strains of H. ducreyi comprise a sub-clonal population within class I strains of H. ducreyi. Molecular dating suggests that CLU strains are the most recently developed, having diverged approximately 0.355 million years ago, fourteen times more recently than the class I/class II divergence. The CLU strains' divergence falls after the divergence of humans from chimpanzees, making it the first known H. ducreyi divergence event directly influenced by the selective pressures accompanying human hosts.

  7. Subcompartmentalisation of proteins in the rhoptries correlates with ordered events of erythrocyte invasion by the blood stage malaria parasite.

    Elizabeth S Zuccala

    Full Text Available Host cell infection by apicomplexan parasites plays an essential role in lifecycle progression for these obligate intracellular pathogens. For most species, including the etiological agents of malaria and toxoplasmosis, infection requires active host-cell invasion dependent on formation of a tight junction - the organising interface between parasite and host cell during entry. Formation of this structure is not, however, shared across all Apicomplexa or indeed all parasite lifecycle stages. Here, using an in silico integrative genomic search and endogenous gene-tagging strategy, we sought to characterise proteins that function specifically during junction-dependent invasion, a class of proteins we term invasins to distinguish them from adhesins that function in species specific host-cell recognition. High-definition imaging of tagged Plasmodium falciparum invasins localised proteins to multiple cellular compartments of the blood stage merozoite. This includes several that localise to distinct subcompartments within the rhoptries. While originating from the same organelle, however, each has very different dynamics during invasion. Apical Sushi Protein and Rhoptry Neck protein 2 release early, following the junction, whilst a novel rhoptry protein PFF0645c releases only after invasion is complete. This supports the idea that organisation of proteins within a secretory organelle determines the order and destination of protein secretion and provides a localisation-based classification strategy for predicting invasin function during apicomplexan parasite invasion.

  8. Insect-cell expression, crystallization and X-ray data collection of the bradyzoite-specific antigen BSR4 from Toxoplasma gondii

    Grujic, Ognjen [Biochemistry and Microbiology, University of Victoria, PO Box 3055 STN CSC, Victoria, BC, V8W 3P6 (Canada); Grigg, Michael E. [Molecular Parasitology Unit, Laboratory of Parasitic Diseases, National Institute of Allergy and Infectious Diseases, National Institutes of Health, 4 Center Drive, Bethesda, MD 20892 (United States); Boulanger, Martin J., E-mail: mboulang@uvic.ca [Biochemistry and Microbiology, University of Victoria, PO Box 3055 STN CSC, Victoria, BC, V8W 3P6 (Canada)

    2008-05-01

    Preliminary X-ray diffraction studies of the bradyzoite-specific surface antigen BSR4 from T. gondii are described. Toxoplasma gondii is an important global pathogen that infects nearly one third of the world’s adult population. A family of developmentally expressed structurally related surface-glycoprotein adhesins (SRSs) mediate attachment to and are utilized for entry into host cells. The latent bradyzoite form of T. gondii persists for the life of the host and expresses a distinct family of SRS proteins, of which the bradyzoite-specific antigen BSR4 is a prototypical member. Structural studies of BSR4 were initiated by first recombinantly expressing BSR4 in insect cells, which was followed by crystallization and preliminary X-ray data collection to 1.95 Å resolution. Data processing showed that BSR4 crystallized with one molecule in the asymmetric unit of the P4{sub 1}2{sub 1}2 or P4{sub 3}2{sub 1}2 space group, with a solvent content of 60% and a corresponding Matthews coefficient of 2.98 Å{sup 3} Da{sup −1}.

  9. Current concepts on the virulence mechanisms of meticillin-resistant Staphylococcus aureus.

    Watkins, Richard R; David, Michael Z; Salata, Robert A

    2012-09-01

    Meticillin-resistant Staphylococcus aureus (MRSA) strains are prevalent bacterial pathogens that cause both health care and community-associated infections. Increasing resistance to commonly prescribed antibiotics has made MRSA a serious threat to public health throughout the world. The USA300 strain of MRSA has been responsible for an epidemic of community-associated infections in the US, mostly involving skin and soft tissue but also more serious invasive syndromes such as pneumonia, severe sepsis and endocarditis. MRSA strains are particularly serious and potentially lethal pathogens that possess virulence mechanisms including toxins, adhesins, enzymes and immunomodulators. One of these is Panton-Valentine leukocidin (PVL), a toxin associated with abscess formation and severe necrotizing pneumonia. Earlier studies suggested that PVL was a major virulence factor in community-associated MRSA infections. However, some recent data have not supported this association while others have, leading to controversy. Therefore, investigators continue to search for additional mechanisms of pathogenesis. In this review, we summarize the current understanding of the biological basis of MRSA virulence and explore future directions for research, including potential vaccines and antivirulence therapies under development that might allow clinicians to more successfully treat and prevent MRSA infections. PMID:22745137

  10. Characterization of Enterococcus faecalis and Enterococcus faecium from wild flowers.

    Sánchez Valenzuela, Antonio; Benomar, Nabil; Abriouel, Hikmate; Pérez Pulido, Rubén; Martínez Cañamero, Magdalena; Gálvez, Antonio

    2012-05-01

    Wild flowers in the South of Spain were screened for Enterococcus faecalis and Enterococcus faecium. Enterococci were frequently associated with prickypear and fieldpoppy flowers. Forty-six isolates, from 8 different flower species, were identified as E. faecalis (28 isolates) or E. faecium (18 isolates) and clustered in well-defined groups by ERIC-PCR fingerprinting. A high incidence of antibiotic resistance was detected among the E. faecalis isolates, especially to quinupristin/dalfopristin (75%), rifampicin (68%) and ciprofloxacin (57%), and to a lesser extent to levofloxacin (35.7%), erythromycin (28.5%), tetracycline (3.5%), chloramphenicol (3.5%) and streptomycin (3.5%). Similar results were observed for E. faecium isolates, except for a higher incidence of resistance to tetracycline (17%) and lower to erythromycin (11%) or quinupristin/dalfopristin (22%). Vancomycin or teicoplanin resistances were not detected. Most isolates (especially E. faecalis) were proteolytic and carried the gelatinase gene gelE. Genes encoding other potential virulence factors (ace, efaA (fs), ccf and cpd) were frequently detected. Cytolysin genes were mainly detected in a few haemolytic E. faecium isolates, three of which also carried the collagen adhesin acm gene. Hyaluronidase gene (hyl ( Efm )) was detected in two isolates. Many isolates produced bacteriocins and carried genes for enterocins A, B, and L50 mainly. The similarities found between enterococci from wild flowers and those from animal and food sources raise new questions about the puzzling lifestyle of these commensals and opportunistic pathogens. PMID:22183298

  11. Brucella ovis PA mutants for outer membrane proteins Omp10, Omp19, SP41, and BepC are not altered in their virulence and outer membrane properties.

    Sidhu-Muñoz, Rebeca S; Sancho, Pilar; Vizcaíno, Nieves

    2016-04-15

    Mutants in several genes have been obtained on the genetic background of virulent rough (lacking O-polysaccharide) Brucella ovis PA. The target genes encode outer membrane proteins previously associated with the virulence of smooth (bearing O-polysaccharide chains in the lipopolysaccharide) Brucella strains. Multiple attempts to delete omp16, coding for a homologue to peptidoglycan-associated lipoproteins, were unsuccessful, which suggests that Omp16 is probably essential for in vitro survival of B. ovis PA. Single deletion of omp10 or omp19 - that encode two other outer membrane lipoproteins - was achieved, but the simultaneous removal of both genes failed, suggesting an essential complementary function between both proteins. Two other deletion mutants, defective in the Tol-C-homologue BepC or in the SP41 adhesin, were also obtained. Surprisingly when compared to previous results obtained with smooth Brucella, none of the B. ovis mutants showed attenuation in the virulence, either in the mouse model or in cellular models of professional and non-professional phagocytes. Additionally, and in contrast to the observations reported with smooth Brucella strains, several properties related to the outer membrane remained almost unaltered. These results evidence new distinctive traits between naturally rough B. ovis and smooth brucellae. PMID:27016758

  12. Treponema pallidum Lipoprotein TP0435 Expressed in Borrelia burgdorferi Produces Multiple Surface/Periplasmic Isoforms and mediates Adherence.

    Chan, Kamfai; Nasereddin, Thayer; Alter, Laura; Centurion-Lara, Arturo; Giacani, Lorenzo; Parveen, Nikhat

    2016-01-01

    The ability of Treponema pallidum, the syphilis spirochete to colonize various tissues requires the presence of surface-exposed adhesins that have been difficult to identify due to the inability to culture and genetically manipulate T. pallidum. Using a Borrelia burgdorferi-based heterologous system and gain-in-function approach, we show for the first time that a highly immunogenic lipoprotein TP0435 can be differentially processed into multiple isoforms with one variant stochastically displayed on the spirochete surface. TP0435 was previously believed to be exclusively located in T. pallidum periplasm. Furthermore, non-adherent B. burgdorferi strain expressing TP0435 acquires the ability to bind to a variety of host cells including placental cells and exhibits slow opsonophagocytosis in vitro similar to poor ex vivo phagocytosis of T. pallidum by host macrophages reported previously. This phenomenon of production of both surface and periplasmic immunogenic lipoprotein isoforms has possible implications in immune evasion of the obligate pathogen T. pallidum during infection. PMID:27161310

  13. The BBA33 lipoprotein binds collagen and impacts Borrelia burgdorferi pathogenesis

    Zhi, Hui; Weening, Eric H.; Barbu, Elena Magda; Hyde, Jenny A.; Höök, Magnus; Skare, Jon T.

    2016-01-01

    Summary Borrelia burgdorferi , the etiologic agent of Lyme disease, adapts to the mammalian hosts by differentially expressing several genes in the BosR and Rrp2-RpoN-RpoS dependent pathways, resulting in a distinct protein profile relative to that seen for survival in the Ixodes spp. tick. Previous studies indicate that a putative lipoprotein, BBA33, is produced in an RpoS-dependent manner under conditions that mimic the mammalian component of the borrelial lifecycle. However, the significance and function for BBA33 is not known. Given its linkage to the BosR/Rrp2-RpoN-RpoS regulatory cascade, we hypothesized that BBA33 facilitates B. burgdorferi infection in the mammalian host. The deletion of bba33 eliminated B. burgdorferi infectivity in C3H mice, which was rescued by genetic complementation with intact bba33. With regard to function, a combinatorial peptide approach, coupled with subsequent in vitro binding assays, indicated that BBA33 binds to collagen type VI and, to a lesser extent, collagen type IV. Whole cell binding assays demonstrated BBA33-dependent binding to human collagen type VI. Taken together, these results suggest that BBA33 interacts with collagenous structures and may function as an adhesin in a process that is required to prevent bacterial clearance. PMID:25560615

  14. A protein secretion system linked to bacteroidete gliding motility and pathogenesis.

    Sato, Keiko; Naito, Mariko; Yukitake, Hideharu; Hirakawa, Hideki; Shoji, Mikio; McBride, Mark J; Rhodes, Ryan G; Nakayama, Koji

    2010-01-01

    Porphyromonas gingivalis secretes strong proteases called gingipains that are implicated in periodontal pathogenesis. Protein secretion systems common to other Gram-negative bacteria are lacking in P. gingivalis, but several proteins, including PorT, have been linked to gingipain secretion. Comparative genome analysis and genetic experiments revealed 11 additional proteins involved in gingipain secretion. Six of these (PorK, PorL, PorM, PorN, PorW, and Sov) were similar in sequence to Flavobacterium johnsoniae gliding motility proteins, and two others (PorX and PorY) were putative two-component system regulatory proteins. Real-time RT-PCR analysis revealed that porK, porL, porM, porN, porP, porT, and sov were down-regulated in P. gingivalis porX and porY mutants. Disruption of the F. johnsoniae porT ortholog resulted in defects in motility, chitinase secretion, and translocation of a gliding motility protein, SprB adhesin, to the cell surface, providing a link between a unique protein translocation system and a motility apparatus in members of the Bacteroidetes phylum. PMID:19966289

  15. Discovery of new Mycoplasma pneumoniae antigens by use of a whole-genome lambda display library.

    Beghetto, Elisa; De Paolis, Francesca; Montagnani, Francesca; Cellesi, Carla; Gargano, Nicola

    2009-01-01

    Mycoplasma pneumoniae is the leading cause of atypical pneumonia in children and young adults. Bacterial colonization can occur in both the upper and the lower respiratory tracts and take place both endemically and epidemically worldwide. Characteristically, the infection is chronic in onset and recovery and both humoral and cell-mediated mechanisms are involved in the response to bacterial colonization. To identify bacterial proteins recognized by host antibody responses, a whole-genome M. pneumoniae library was created and displayed on lambda bacteriophage. The challenge of such a library with sera from individuals hospitalized for mycoplasmal pneumonia allowed the identification of a panel of recombinant bacteriophages carrying B-cell epitopes. Among the already known M. pneumoniae B-cell antigens, our results confirmed the immunogenicity of P1 and P30 adhesins. Also, the data presented in this study localized, within their sequences, the immunodominant epitopes recognized by human immunoglobulins. Furthermore, library screening allowed the identification of four novel immunogenic polypeptides, respectively, encoded by fragments of the MPN152, MPN426, MPN456 and MPN-500 open reading frames, highlighting and further confirming the potential of lambda display technology in antigen and epitope discovery. PMID:18992837

  16. Genome of Herbaspirillum seropedicae Strain SmR1, a Specialized Diazotrophic Endophyte of Tropical Grasses

    Pedrosa, Fábio O.; Monteiro, Rose Adele; Wassem, Roseli; Cruz, Leonardo M.; Ayub, Ricardo A.; Colauto, Nelson B.; Fernandez, Maria Aparecida; Fungaro, Maria Helena P.; Grisard, Edmundo C.; Hungria, Mariangela; Madeira, Humberto M. F.; Nodari, Rubens O.; Osaku, Clarice A.; Petzl-Erler, Maria Luiza; Terenzi, Hernán; Vieira, Luiz G. E.; Steffens, Maria Berenice R.; Weiss, Vinicius A.; Pereira, Luiz F. P.; Almeida, Marina I. M.; Alves, Lysangela R.; Marin, Anelis; Araujo, Luiza Maria; Balsanelli, Eduardo; Baura, Valter A.; Chubatsu, Leda S.; Faoro, Helisson; Favetti, Augusto; Friedermann, Geraldo; Glienke, Chirlei; Karp, Susan; Kava-Cordeiro, Vanessa; Raittz, Roberto T.; Ramos, Humberto J. O.; Ribeiro, Enilze Maria S. F.; Rigo, Liu Un; Rocha, Saul N.; Schwab, Stefan; Silva, Anilda G.; Souza, Eliel M.; Tadra-Sfeir, Michelle Z.; Torres, Rodrigo A.; Dabul, Audrei N. G.; Soares, Maria Albertina M.; Gasques, Luciano S.; Gimenes, Ciela C. T.; Valle, Juliana S.; Ciferri, Ricardo R.; Correa, Luiz C.; Murace, Norma K.; Pamphile, João A.; Patussi, Eliana Valéria; Prioli, Alberto J.; Prioli, Sonia Maria A.; Rocha, Carmem Lúcia M. S. C.; Arantes, Olívia Márcia N.; Furlaneto, Márcia Cristina; Godoy, Leandro P.; Oliveira, Carlos E. C.; Satori, Daniele; Vilas-Boas, Laurival A.; Watanabe, Maria Angélica E.; Dambros, Bibiana Paula; Guerra, Miguel P.; Mathioni, Sandra Marisa; Santos, Karine Louise; Steindel, Mario; Vernal, Javier; Barcellos, Fernando G.; Campo, Rubens J.; Chueire, Ligia Maria O.; Nicolás, Marisa Fabiana; Pereira-Ferrari, Lilian; da Conceição Silva, José L.; Gioppo, Nereida M. R.; Margarido, Vladimir P.; Menck-Soares, Maria Amélia; Pinto, Fabiana Gisele S.; Simão, Rita de Cássia G.; Takahashi, Elizabete K.; Yates, Marshall G.; Souza, Emanuel M.

    2011-01-01

    The molecular mechanisms of plant recognition, colonization, and nutrient exchange between diazotrophic endophytes and plants are scarcely known. Herbaspirillum seropedicae is an endophytic bacterium capable of colonizing intercellular spaces of grasses such as rice and sugar cane. The genome of H. seropedicae strain SmR1 was sequenced and annotated by The Paraná State Genome Programme—GENOPAR. The genome is composed of a circular chromosome of 5,513,887 bp and contains a total of 4,804 genes. The genome sequence revealed that H. seropedicae is a highly versatile microorganism with capacity to metabolize a wide range of carbon and nitrogen sources and with possession of four distinct terminal oxidases. The genome contains a multitude of protein secretion systems, including type I, type II, type III, type V, and type VI secretion systems, and type IV pili, suggesting a high potential to interact with host plants. H. seropedicae is able to synthesize indole acetic acid as reflected by the four IAA biosynthetic pathways present. A gene coding for ACC deaminase, which may be involved in modulating the associated plant ethylene-signaling pathway, is also present. Genes for hemagglutinins/hemolysins/adhesins were found and may play a role in plant cell surface adhesion. These features may endow H. seropedicae with the ability to establish an endophytic life-style in a large number of plant species. PMID:21589895

  17. Preliminary X-ray crystallographic studies of an N-terminal domain of unknown function from a putative glycosyltransferase from Streptococcus parasanguinis

    A streptococcal domain of unknown function 1792 has been crystallized. Serine-rich repeat glycoproteins (SRRPs) belong to a growing family of bacterial adhesins; they play important roles in bacterial virulence. Fap1, the first SRRP protein to be identified, is glycosylated; while the first two steps of its glycosylation have been determined, the remaining glycosylation steps are unknown. In a search for proteins that might be relevant to the glycosylation of Fap1, a putative glycosyltransferase (GalT1) from Streptococcus parasanguinis was identified. GalT1 possesses a domain of unknown function at the N-terminus. This domain is highly conserved in bacteria and is a member of a broad superfamily. However, the structure of this domain has not been determined. Here, the conditions used to produce a recombinant version of this protein domain and to grow protein crystals are reported. The crystals obtained belonged to space group C2, with unit-cell parameters a = 71.0, b = 45.1, c = 78.6 Å, β = 109.6°, and diffracted to 1.55 Å resolution at a synchrotron X-ray source. This domain does not share sequence identity with proteins of known structures above a level of 12%

  18. Role of polymerase chain reaction in the diagnosis of Trichomonas vaginalis infection in human immunodeficiency virus-infected individuals from India (South

    Hema Paul

    2012-01-01

    Full Text Available Background: Trichomonas vaginalis is a protozoan parasite and an etiological agent for trichomoniasis, a sexually transmitted infection (STI. Fifty to eighty percentage of women with trichomoniasis are asymptomatic and in the absence of treatment the infection persists longer. Aim: To evaluate the role of polymerase chain reaction (PCR in the diagnosis of trichomoniasis and also to look at the frequency of infection among human immunodeficiency virus (HIV infected women. Methods: A non-nested PCR was standardized to detect 102 bp size amplified product of the adhesin gene of T. vaginalis. The real time performance of this assay was performed with vaginal swab samples from 198 HIV-seropositive women who attended the infectious disease clinic and compared with wet mount and culture in Diamond′s modified media. Results: Among the prospectively studied 198 HIV-infected women, 1 (0.51% was positive by wet mount, 6 (3.03% were positive by culture and 10 (5.02% were positive by the PCR. There was a significant observed agreement between the PCR and culture (k=0.74, Z=10.7, P<0.0000. Conclusion: Our study showed that the PCR assay for the amplification of adhesion gene is a highly sensitive method to screen the high risk group individuals like HIV-positive women for Trichomonas vaginalis compared to the culture. Testing algorithm should be, wet mount and if negative, test by PCR as it is rapid compared to culture which takes 7 days.

  19. Biofilm formation by Streptococcus agalactiae: influence of environmental conditions and implicated virulence factors

    Imma eMargarit

    2015-02-01

    Full Text Available Streptococcus agalactiae (Group B Streptococcus, GBS is an important human pathogen that colonizes the urogenital and/or the lower gastro-intestinal tract of up to 40% of healthy women of reproductive age and is a leading cause of sepsis and meningitis in the neonates. GBS can also infect the elderly and immuno-compromised adults, and is responsible for mastitis in bovines. Like other Gram-positive bacteria, GBS can form biofilm-like three-dimensional structures that could enhance its ability to colonize and persist in the host. Biofilm formation by GBS has been investigated in vitro and appears tightly controlled by environmental conditions. Several adhesins have been shown to play a role in the formation of GBS biofilm-like structures, among which are the protein components of pili protruding outside the bacterial surface. Remarkably, antibodies directed against pilus proteins can prevent the formation of biofilms. The implications of biofilm formation in the context of GBS asymptomatic colonization and dissemination to cause invasive disease remain to be investigated in detail.

  20. Alkaloids: an overview of their antibacterial, antibiotic-enhancing and antivirulence activities.

    Cushnie, T P Tim; Cushnie, Benjamart; Lamb, Andrew J

    2014-11-01

    With reports of pandrug-resistant bacteria causing untreatable infections, the need for new antibacterial therapies is more pressing than ever. Alkaloids are a large and structurally diverse group of compounds that have served as scaffolds for important antibacterial drugs such as metronidazole and the quinolones. In this review, we highlight other alkaloids with development potential. Natural, semisynthetic and synthetic alkaloids of all classes are considered, looking first at those with direct antibacterial activity and those with antibiotic-enhancing activity. Potent examples include CJ-13,136, a novel actinomycete-derived quinolone alkaloid with a minimum inhibitory concentration of 0.1 ng/mL against Helicobacter pylori, and squalamine, a polyamine alkaloid from the dogfish shark that renders Gram-negative pathogens 16- to >32-fold more susceptible to ciprofloxacin. Where available, information on toxicity, structure-activity relationships, mechanisms of action and in vivo activity is presented. The effects of alkaloids on virulence gene regulatory systems such as quorum sensing and virulence factors such as sortases, adhesins and secretion systems are also described. The synthetic isoquinoline alkaloid virstatin, for example, inhibits the transcriptional regulator ToxT in Vibrio cholerae, preventing expression of cholera toxin and fimbriae and conferring in vivo protection against intestinal colonisation. The review concludes with implications and limitations of the described research and directions for future research. PMID:25130096

  1. Staphylococcus aureus dynamically adapts global regulators and virulence factor expression in the course from acute to chronic infection.

    Tuchscherr, Lorena; Löffler, Bettina

    2016-02-01

    Staphylococcus aureus is an important pathogen of severe invasive tissue infection, e.g. osteomyelitis that can develop to chronicity and become extremely difficult to treat. Recent research revealed that S. aureus can dynamically switch to small colony variants (SCVs) that are adapted bacterial phenotypes for long-term persistence. The underlying mechanisms of the bacterial switching and adaptation process are largely dependent on an intact Sigma B regulon. As SigB is known as a transcription factor that modulates the stress response of several Gram-positive bacteria, it is most likely required by the bacteria to cope with the intracellular stress conditions. Here, we demonstrate in a long-term infection model of human osteoblasts that S. aureus continuously upregulated the expression of SigB during intracellular persistence. The increased SigB expression was accompanied by upregulation of adhesins and downregulation of toxins, which are characteristics for SCV phenotypes. These data further stress the role of SigB during chronic infections that could be a novel target for preventive or therapeutic measures to avoid chronic infections. PMID:26123224

  2. Design and Characterization of a Novel p1025 Peptide-Loaded Liquid Crystalline System for the Treatment of Dental Caries

    Giovana Maria Fioramonti Calixto

    2016-01-01

    Full Text Available Dental caries, mainly caused by the adhesion of Streptococcus mutans to pellicle-coated tooth surfaces, is an important public health problem worldwide. A synthetic peptide (p1025 corresponding to residues 1025–1044 of the adhesin can inhibit this binding. Peptides are particularly susceptible to the biological environment; therefore, a p1025 peptide-loaded liquid crystalline system (LCS consisting of tea tree oil as the oil phase, polyoxypropylene-(5-polyoxyethylene-(20-cetyl alcohol as the surfactant, and water or 0.5% polycarbophil polymer dispersions as the aqueous phase was employed as a drug delivery platform. This system exhibited anticaries and bioadhesive properties and provided a protective environment to p1025 at the site of action, thereby modulating its action, prolonging its contact with the teeth, and decreasing the frequency of administration. LCSs were characterized by polarized light microscopy (PLM, small-angle X-ray scattering (SAXS, and rheological, texture, and bioadhesive tests. PLM and SAXS revealed the presence of hexagonal liquid crystalline phases and microemulsions. Rheological analyses demonstrated that the addition of polymer dispersions favored characteristics such as shear thinning and thixotropy, hence improving buccal application. Bioadhesion tests showed that polymer dispersions contributed to the adhesion onto the teeth. Taken together, LCS could provide a novel pharmaceutical nanotechnology platform for dental caries treatment.

  3. Choline Binding Proteins from Streptococcus pneumoniae: A Dual Role as Enzybiotics and Targets for the Design of New Antimicrobials.

    Maestro, Beatriz; Sanz, Jesús M

    2016-01-01

    Streptococcus pneumoniae (pneumococcus) is an important pathogen responsible for acute invasive and non-invasive infections such as meningitis, sepsis and otitis media, being the major cause of community-acquired pneumonia. The fight against pneumococcus is currently hampered both by insufficient vaccine coverage and by rising antimicrobial resistances to traditional antibiotics, making necessary the research on novel targets. Choline binding proteins (CBPs) are a family of polypeptides found in pneumococcus and related species, as well as in some of their associated bacteriophages. They are characterized by a structural organization in two modules: a functional module (FM), and a choline-binding module (CBM) that anchors the protein to the choline residues present in the cell wall through non-covalent interactions. Pneumococcal CBPs include cell wall hydrolases, adhesins and other virulence factors, all playing relevant physiological roles for bacterial viability and virulence. Moreover, many pneumococcal phages also make use of hydrolytic CBPs to fulfill their infectivity cycle. Consequently, CBPs may play a dual role for the development of novel antipneumococcal drugs, both as targets for inhibitors of their binding to the cell wall and as active cell lytic agents (enzybiotics). In this article, we review the current state of knowledge about host- and phage-encoded pneumococcal CBPs, with a special focus on structural issues, together with their perspectives for effective anti-infectious treatments. PMID:27314398

  4. Als1 and Als3 regulate the intracellular uptake of copper ions when Candida albicans biofilms are exposed to metallic copper surfaces.

    Zheng, Sha; Chang, Wenqiang; Li, Chen; Lou, Hongxiang

    2016-05-01

    Copper surfaces possess efficient antimicrobial effect. Here, we reported that copper surfaces could inactivate Candida albicans biofilms within 40 min. The intracellular reactive oxygen species in C. albicans biofilms were immediately stimulated during the contact of copper surfaces, which might be an important factor for killing the mature biofilms. Copper release assay demonstrated that the copper ions automatically released from the surface of 1 mm thick copper coupons with over 99.9% purity are not the key determinant for the copper-mediated killing action. The susceptibility test to copper surfaces by using C. albicans mutant strains, which were involved in efflux pumps, adhesins, biofilms formation or osmotic stress response showed that als1/als1 and als3/als3 displayed higher resistance to the copper surface contact than other mutants did. The intracellular concentration of copper ions was lower in als1/als1 and als3/als3 than that in wild-type strain. Transcriptional analysis revealed that the expression of copper transporter-related gene, CRP1, was significantly increased in als1/als1, als3/als3, suggesting a potential role of ALS1 and ALS3 in absorbing ions by regulating the expression of CRP1 This study provides a potential application in treating pathogenic fungi by using copper surfaces and uncovers the roles of ALS1 and ALS3 in absorbing copper ions for C. albicans. PMID:27189057

  5. Proteus mirabilis and Urinary Tract Infections.

    Schaffer, Jessica N; Pearson, Melanie M

    2015-10-01

    Proteus mirabilis is a Gram-negative bacterium and is well known for its ability to robustly swarm across surfaces in a striking bulls'-eye pattern. Clinically, this organism is most frequently a pathogen of the urinary tract, particularly in patients undergoing long-term catheterization. This review covers P. mirabilis with a focus on urinary tract infections (UTI), including disease models, vaccine development efforts, and clinical perspectives. Flagella-mediated motility, both swimming and swarming, is a central facet of this organism. The regulation of this complex process and its contribution to virulence is discussed, along with the type VI-secretion system-dependent intra-strain competition, which occurs during swarming. P. mirabilis uses a diverse set of virulence factors to access and colonize the host urinary tract, including urease and stone formation, fimbriae and other adhesins, iron and zinc acquisition, proteases and toxins, biofilm formation, and regulation of pathogenesis. While significant advances in this field have been made, challenges remain to combatting complicated UTI and deciphering P. mirabilis pathogenesis. PMID:26542036

  6. Identification of Novel Potential Vaccine Candidates against Tuberculosis Based on Reverse Vaccinology

    Gloria P. Monterrubio-López

    2015-01-01

    Full Text Available Tuberculosis (TB is a chronic infectious disease, considered as the second leading cause of death worldwide, caused by Mycobacterium tuberculosis. The limited efficacy of the bacillus Calmette-Guérin (BCG vaccine against pulmonary TB and the emergence of multidrug-resistant TB warrants the need for more efficacious vaccines. Reverse vaccinology uses the entire proteome of a pathogen to select the best vaccine antigens by in silico approaches. M. tuberculosis H37Rv proteome was analyzed with NERVE (New Enhanced Reverse Vaccinology Environment prediction software to identify potential vaccine targets; these 331 proteins were further analyzed with VaxiJen for the determination of their antigenicity value. Only candidates with values ≥0.5 of antigenicity and 50% of adhesin probability and without homology with human proteins or transmembrane regions were selected, resulting in 73 antigens. These proteins were grouped by families in seven groups and analyzed by amino acid sequence alignments, selecting 16 representative proteins. For each candidate, a search of the literature and protein analysis with different bioinformatics tools, as well as a simulation of the immune response, was conducted. Finally, we selected six novel vaccine candidates, EsxL, PE26, PPE65, PE_PGRS49, PBP1, and Erp, from M. tuberculosis that can be used to improve or design new TB vaccines.

  7. Growth of Yersinia pseudotuberculosis in human plasma: impacts on virulence and metabolic gene expression

    Rosso, Marie-Laure; Chauvaux, Sylvie; Dessein, Rodrigue; Laurans, Caroline; Frangeul, Lionel; Lacroix, Céline; Schiavo, Angèle; Dillies, Marie-Agnès; Foulon, Jeannine; Coppée, Jean-Yves; Médigue, Claudine; Carniel, Elisabeth; Simonet, Michel; Marceau, Michaël

    2008-01-01

    Background In man, infection by the Gram-negative enteropathogen Yersinia pseudotuberculosis is usually limited to the terminal ileum. However, in immunocompromised patients, the microorganism may disseminate from the digestive tract and thus cause a systemic infection with septicemia. Results To gain insight into the metabolic pathways and virulence factors expressed by the bacterium at the blood stage of pseudotuberculosis, we compared the overall gene transcription patterns (the transcriptome) of bacterial cells cultured in either human plasma or Luria-Bertani medium. The most marked plasma-triggered metabolic consequence in Y. pseudotuberculosis was the switch to high glucose consumption, which is reminiscent of the acetogenic pathway (known as "glucose overflow") in Escherichia coli. However, upregulation of the glyoxylate shunt enzymes suggests that (in contrast to E. coli) acetate may be further metabolized in Y. pseudotuberculosis. Our data also indicate that the bloodstream environment can regulate major virulence genes (positively or negatively); the yadA adhesin gene and most of the transcriptional units of the pYV-encoded type III secretion apparatus were found to be upregulated, whereas transcription of the pH6 antigen locus was strongly repressed. Conclusion Our results suggest that plasma growth of Y. pseudotuberculosis is responsible for major transcriptional regulatory events and prompts key metabolic reorientations within the bacterium, which may in turn have an impact on virulence. PMID:19055764

  8. A Molecular-Modeling Toolbox Aimed at Bridging the Gap between Medicinal Chemistry and Computational Sciences

    Sameh Eid

    2013-01-01

    Full Text Available In the current era of high-throughput drug discovery and development, molecular modeling has become an indispensable tool for identifying, optimizing and prioritizing small-molecule drug candidates. The required background in computational chemistry and the knowledge of how to handle the complex underlying protocols, however, might keep medicinal chemists from routinely using in silico technologies. Our objective is to encourage those researchers to exploit existing modeling technologies more frequently through easy-to-use graphical user interfaces. In this account, we present two innovative tools (which we are prepared to share with academic institutions facilitating computational tasks commonly utilized in drug discovery and development: (1 the VirtualDesignLab estimates the binding affinity of small molecules by simulating and quantifying their binding to the three-dimensional structure of a target protein; and (2 the MD Client launches molecular dynamics simulations aimed at exploring the time-dependent stability of ligand–protein complexes and provides residue-based interaction energies. This allows medicinal chemists to identify sites of potential improvement in their candidate molecule. As a case study, we present the application of our tools towards the design of novel antagonists for the FimH adhesin.

  9. Detection and characterization of verocytotoxin-producing Escherichia coli by automated 5 ' nuclease PCR assay

    Nielsen, Eva Møller; Andersen, Marianne Thorup

    2003-01-01

    included assays for the detection of verocytotoxin genes (vtx1, vtx2), pO157-associated genes (ehxA, katP, espP, and etpD), a recently identified adhesin (saa), intimin (eae, all variants), seven subtypes of eae, four subtypes of tir, and three subtypes of espD. A number of reference strains (VTEC and......In recent years increased attention has been focused on infections caused by isolates of verocytotoxin-producing Escherichia coli (VTEC) serotypes other than O157. These non-O157 VTEC isolates are commonly present in food and food production animals. Easy detection, isolation, and characterization...... of non-O157 VTEC isolates are essential for improving our knowledge of these organisms. In the present study, we detected VTEC isolates in bovine fecal samples by a duplex 5' nuclease PCR assay (real-time PCR) that targets vtx1 and vtx2. VTEC isolates were obtained by colony replication by use of...

  10. The link between morphotype transition and virulence in Cryptococcus neoformans.

    Linqi Wang

    Full Text Available Cryptococcus neoformans is a ubiquitous human fungal pathogen. This pathogen can undergo morphotype transition between the yeast and the filamentous form and such morphological transition has been implicated in virulence for decades. Morphotype transition is typically observed during mating, which is governed by pheromone signaling. Paradoxically, components specific to the pheromone signaling pathways play no or minimal direct roles in virulence. Thus, the link between morphotype transition and virulence and the underlying molecular mechanism remain elusive. Here, we demonstrate that filamentation can occur independent of pheromone signaling and mating, and both mating-dependent and mating-independent morphotype transition require the transcription factor Znf2. High expression of Znf2 is necessary and sufficient to initiate and maintain sex-independent filamentous growth under host-relevant conditions in vitro and during infection. Importantly, ZNF2 overexpression abolishes fungal virulence in murine models of cryptococcosis. Thus, Znf2 bridges the sex-independent morphotype transition and fungal pathogenicity. The impacts of Znf2 on morphological switch and pathogenicity are at least partly mediated through its effects on cell adhesion property. Cfl1, a Znf2 downstream factor, regulates morphogenesis, cell adhesion, biofilm formation, and virulence. Cfl1 is the first adhesin discovered in the phylum Basidiomycota of the Kingdom Fungi. Together with previous findings in other eukaryotic pathogens, our findings support a convergent evolution of plasticity in morphology and its impact on cell adhesion as a critical adaptive trait for pathogenesis.

  11. Campylobacter jejuni increases flagellar expression and adhesion of noninvasive Escherichia coli: effects on enterocytic Toll-like receptor 4 and CXCL-8 expression.

    Reti, Kristen L; Tymensen, Lisa D; Davis, Shevaun P; Amrein, Matthias W; Buret, Andre G

    2015-12-01

    Campylobacter jejuni is the most common cause of bacterium-induced gastroenteritis, and while typically self-limiting, C. jejuni infections are associated with postinfectious intestinal disorders, including flares in patients with inflammatory bowel disease and postinfectious irritable bowel syndrome (PI-IBS), via mechanisms that remain obscure. Based on the hypothesis that acute campylobacteriosis may cause pathogenic microbiota dysbiosis, we investigated whether C. jejuni may activate dormant virulence genes in noninvasive Escherichia coli and examined the epithelial pathophysiological consequences of these alterations. Microarray and quantitative real-time PCR analyses revealed that E. coli adhesin, flagellum, and hemolysin gene expression were increased when E. coli was exposed to C. jejuni-conditioned medium. Increased development of bacterial flagella upon exposure to live C. jejuni or C. jejuni-conditioned medium was observed under transmission electron microscopy. Atomic force microscopy demonstrated that the forces of bacterial adhesion to colonic T84 enterocytes, and the work required to rupture this adhesion, were significantly increased in E. coli exposed to C. jejuni-conditioned media. Finally, C. jejuni-modified E. coli disrupted TLR4 gene expression and induced proinflammatory CXCL-8 gene expression in colonic enterocytes. Together, these data suggest that exposure to live C. jejuni, and/or to its secretory-excretory products, may activate latent virulence genes in noninvasive E. coli and that these alterations may directly trigger proinflammatory signaling in intestinal epithelia. These observations shed new light on mechanisms that may contribute, at least in part, to postcampylobacteriosis inflammatory disorders. PMID:26371123

  12. The Chlamydia trachomatis Ctad1 invasin exploits the human integrin β1 receptor for host cell entry.

    Stallmann, Sonja; Hegemann, Johannes H

    2016-05-01

    Infection of human cells by the obligate intracellular bacterium Chlamydia trachomatis requires adhesion and internalization of the infectious elementary body (EB). This highly complex process is poorly understood. Here, we characterize Ctad1 (CT017) as a new adhesin and invasin from C. trachomatis serovar E. Recombinant Ctad1 (rCtad1) binds to human cells via two bacterial SH3 domains located in its N-terminal half. Pre-incubation of host cells with rCtad1 reduces subsequent adhesion and infectivity of bacteria. Interestingly, protein-coated latex beads revealed Ctad1 being an invasin. rCtad1 interacts with the integrin β1 subunit on human epithelial cells, and induces clustering of integrins at EB attachment sites. Receptor activation induces ERK1/2 phosphorylation. Accordingly, rCtad1 binding to integrin β1-negative cells is significantly impaired, as is the chlamydial infection. Thus interaction of C. trachomatis Ctad1 with integrin β1 mediates EB adhesion and induces signaling processes that promote host-cell invasion. PMID:26597572

  13. Innovative Solutions to Sticky Situations: Antiadhesive Strategies for Treating Bacterial Infections.

    Cusumano, Zachary T; Klein, Roger D; Hultgren, Scott J

    2016-04-01

    Bacterial adherence to host tissue is an essential process in pathogenesis, necessary for invasion and colonization and often required for the efficient delivery of toxins and other bacterial effectors. As existing treatment options for common bacterial infections dwindle, we find ourselves rapidly approaching a tipping point in our confrontation with antibiotic-resistant strains and in desperate need of new treatment options. Bacterial strains defective in adherence are typically avirulent and unable to cause infection in animal models. The importance of this initial binding event in the pathogenic cascade highlights its potential as a novel therapeutic target. This article seeks to highlight a variety of strategies being employed to treat and prevent infection by targeting the mechanisms of bacterial adhesion. Advancements in this area include the development of novel antivirulence therapies using small molecules, vaccines, and peptides to target a variety of bacterial infections. These therapies target bacterial adhesion through a number of mechanisms, including inhibition of pathogen receptor biogenesis, competition-based strategies with receptor and adhesin analogs, and the inhibition of binding through neutralizing antibodies. While this article is not an exhaustive description of every advancement in the field, we hope it will highlight several promising examples of the therapeutic potential of antiadhesive strategies. PMID:27227305

  14. Cloning, expression, purification, crystallization and preliminary crystallographic analysis of the N-terminal domain of serine glutamate repeat A (SgrA) protein from Enterococcus faecium

    The putative ligand-binding region of serine glutamate repeat A (SgrA) protein from E. faecium was overexpressed, purified and crystallized, and its preliminary X-ray diffraction analysis is reported at 3.3 Å resolution. Serine glutamate repeat A (SgrA) protein is an LPxTG surface adhesin of Enterococcus faecium and is the first bacterial nidogen-binding protein identified to date. It has been suggested that it binds to human nidogen, the extracellular matrix molecule of basal lamina, and plays a key role in the invasion and colonization of eukaryotic host cells. SgrA28–288, having both a putative ligand-binding A domain and repetitive B domain, was expressed in Escherichia coli and purified using Ni-affinity and hydrophobic interaction chromatography. Further, the putative ligand-binding region, rSgrA28–153, was subcloned, overexpressed and purified in both native and selenomethionine-derivative forms. The native rSgrA28–153 protein crystallized in the monoclinic space group P21 and diffracted to 3.3 Å resolution using an in-house X-ray source, with unit-cell parameters a = 35.84, b = 56.35, c = 60.20 Å, β = 106.5°

  15. Comparative proteomics of uropathogenic Escherichia coli during growth in human urine identify UCA-like (UCL) fimbriae as an adherence factor involved in biofilm formation and binding to uroepithelial cells.

    Wurpel, Daniël J; Totsika, Makrina; Allsopp, Luke P; Webb, Richard I; Moriel, Danilo G; Schembri, Mark A

    2016-01-10

    Uropathogenic Escherichia coli (UPEC) are the primary cause of urinary tract infection (UTI) in humans. For the successful colonisation of the human urinary tract, UPEC employ a diverse collection of secreted or surface-exposed virulence factors including toxins, iron acquisition systems and adhesins. In this study, a comparative proteomic approach was utilised to define the UPEC pan and core surface proteome following growth in pooled human urine. Identified proteins were investigated for subcellular origin, prevalence and homology to characterised virulence factors. Fourteen core surface proteins were identified, as well as eleven iron uptake receptor proteins and four distinct fimbrial types, including type 1, P, F1C/S and a previously uncharacterised fimbrial type, designated UCA-like (UCL) fimbriae in this study. These pathogenicity island (PAI)-associated fimbriae are related to UCA fimbriae of Proteus mirabilis, associated with UPEC and exclusively found in members of the E. coli B2 and D phylogroup. We further demonstrated that UCL fimbriae promote significant biofilm formation on abiotic surfaces and mediate specific attachment to exfoliated human uroepithelial cells. Combined, this study has defined the surface proteomic profiles and core surface proteome of UPEC during growth in human urine and identified a new type of fimbriae that may contribute to UTI. PMID:26546558

  16. The center for plant and microbial complex carbohydrates at the University of Georgia Complex Carbohydrate Research Center

    Albersheim, P.; Darvill, A.

    1991-08-01

    Research from the Complex Carbohydrates Research Center at the University of Georgia is presented. Topics include: Structural determination of soybean isoflavones which specifically induce Bradyrhizobium japonicum nodD1 but not the nodYABCSUIJ operon; structural analysis of the lipopolysaccharides (LPSs) from symbiotic mutants of Bradyrhizobium japonicum; structural characterization of lipooligosaccharides from Bradyrhizobium japonicum that are required for the specific nodulation of soybean; structural characterization of the LPSs from R. Leguminosarum biovar phaseoli, the symbiont of bean; characterization of bacteroid-specific LPS epitopes in R. leguminosarum biovar viciae; analysis of the surface polysaccharides of Rhizobium meliloti mutants whose lipopolysaccharides and extracellular polysaccharides can have the same function in symbiosis; characterization of a polysaccharide produced by certain Bradyrhizobium japonicum strains within soybean nodules; structural analysis of a streptococcal adhesin polysaccharide receptor; conformational studies of xyloglucan, the role of the fucosylated side chain in surface-specific cellulose-xyloglucan interactions; the structure of an acylated glucosamine oligosaccharide signal molecule (nod factor) involved in the symbiosis of Rhizobium leguminosarum biovar viciae with its host Vicia sativa; investigating membrane responses induced by oligogalacturonides in cultured cells; the polygalacturonase inhibitor protein; characterization of the self-incompatability glycoproteins from Petunia hybrida; investigation of the cell wall polysaccharide structures of Arabidopsis thaliana; and the glucan inhibition of virus infection of tabacco.

  17. The center for plant and microbial complex carbohydrates at the University of Georgia Complex Carbohydrate Research Center. Annual report, September 15, 1990--December 31, 1991

    Albersheim, P.; Darvill, A.

    1991-08-01

    Research from the Complex Carbohydrates Research Center at the University of Georgia is presented. Topics include: Structural determination of soybean isoflavones which specifically induce Bradyrhizobium japonicum nodD1 but not the nodYABCSUIJ operon; structural analysis of the lipopolysaccharides (LPSs) from symbiotic mutants of Bradyrhizobium japonicum; structural characterization of lipooligosaccharides from Bradyrhizobium japonicum that are required for the specific nodulation of soybean; structural characterization of the LPSs from R. Leguminosarum biovar phaseoli, the symbiont of bean; characterization of bacteroid-specific LPS epitopes in R. leguminosarum biovar viciae; analysis of the surface polysaccharides of Rhizobium meliloti mutants whose lipopolysaccharides and extracellular polysaccharides can have the same function in symbiosis; characterization of a polysaccharide produced by certain Bradyrhizobium japonicum strains within soybean nodules; structural analysis of a streptococcal adhesin polysaccharide receptor; conformational studies of xyloglucan, the role of the fucosylated side chain in surface-specific cellulose-xyloglucan interactions; the structure of an acylated glucosamine oligosaccharide signal molecule (nod factor) involved in the symbiosis of Rhizobium leguminosarum biovar viciae with its host Vicia sativa; investigating membrane responses induced by oligogalacturonides in cultured cells; the polygalacturonase inhibitor protein; characterization of the self-incompatability glycoproteins from Petunia hybrida; investigation of the cell wall polysaccharide structures of Arabidopsis thaliana; and the glucan inhibition of virus infection of tabacco.

  18. Characterization of the Mycobacterium avium subsp. paratuberculosis laminin-binding/histone-like protein (Lbp/Hlp) which reacts with sera from patients with Crohn's disease.

    Lefrançois, Louise H; Pujol, Céline; Bodier, Christelle C; Teixeira-Gomez, Ana Paula; Drobecq, Hervé; Rosso, Marie-Laure; Raze, Dominique; Dias, André Alves; Hugot, Jean-Pierre; Chacon, Ofelia; Barletta, Raul G; Locht, Camille; Vidal Pessolani, Maria Cristina; Biet, Franck

    2011-06-01

    Mycobacterium avium subsp. paratuberculosis (Map) causes a chronic enteric disease in ruminants, called paratuberculosis or Johne's disease. The current model proposes that after ingestion by the host, Map crosses the intestinal barrier via internalization by the M cells. Experimental observations suggest, however, that Map may also transcytose the intestinal wall via the enterocytes, but the mechanisms involved in this process remain poorly understood. Cytoadherence assays performed on epithelial cells with Map revealed that the addition of laminin to the cell culture increases adhesion. A Map protein was isolated by heparin-Sepharose chromatography and identified as a laminin-binding protein like. The gene encoding this protein named Lbp/Hlp was identified in the Map genome sequence at locus MAP3024 (annotated Hup B). The deduced Map Lbp/Hlp amino acid sequence reveals 80% identity with that reported for other mycobacteria. The C-terminal domain involved in adhesion is mainly composed of arginine and lysine residues modified by methylation. In vitro tests demonstrated that recombinant Lbp/Hlp binds laminin, heparin, collagen and epithelial cells. Interestingly, we found that this adhesin corresponds to the antigen described as the target of pANCA and serum antibodies of patients with Crohn's disease. PMID:21334452

  19. Directed Shotgun Proteomics Guided by Saturated RNA-seq Identifies a Complete Expressed Prokaryotic Proteome

    Omasits, U.; Quebatte, Maxime; Stekhoven, Daniel J.; Fortes, Claudia; Roschitzki, Bernd; Robinson, Mark D.; Dehio, Christoph; Ahrens, Christian H.

    2013-11-01

    Prokaryotes, due to their moderate complexity, are particularly amenable to the comprehensive identification of the protein repertoire expressed under different conditions. We applied a generic strategy to identify a complete expressed prokaryotic proteome, which is based on the analysis of RNA and proteins extracted from matched samples. Saturated transcriptome profiling by RNA-seq provided an endpoint estimate of the protein-coding genes expressed under two conditions which mimic the interaction of Bartonella henselae with its mammalian host. Directed shotgun proteomics experiments were carried out on four subcellular fractions. By specifically targeting proteins which are short, basic, low abundant, and membrane localized, we could eliminate their initial underrepresentation compared to the estimated endpoint. A total of 1250 proteins were identified with an estimated false discovery rate below 1%. This represents 85% of all distinct annotated proteins and ~90% of the expressed protein-coding genes. Genes that were detected at the transcript but not protein level, were found to be highly enriched in several genomic islands. Furthermore, genes that lacked an ortholog and a functional annotation were not detected at the protein level; these may represent examples of overprediction in genome annotations. A dramatic membrane proteome reorganization was observed, including differential regulation of autotransporters, adhesins, and hemin binding proteins. Particularly noteworthy was the complete membrane proteome coverage, which included expression of all members of the VirB/D4 type IV secretion system, a key virulence factor.

  20. Structure of Toxoplasma gondii fructose-1,6-bisphosphate aldolase

    Boucher, Lauren E.; Bosch, Jürgen, E-mail: jbosch@jhu.edu [Johns Hopkins Bloomberg School of Public Health, 615 North Wolfe Street, Baltimore, MD 21205 (United States); Johns Hopkins Bloomberg School of Public Health, 615 North Wolfe Street, Baltimore, MD 21205 (United States)

    2014-08-29

    The structure of T. gondii fructose-1,6-bisphosphate aldolase, a glycolytic enzyme and structural component of the invasion machinery, was determined to a resolution of 2.0 Å. The apicomplexan parasite Toxoplasma gondii must invade host cells to continue its lifecycle. It invades different cell types using an actomyosin motor that is connected to extracellular adhesins via the bridging protein fructose-1,6-@@bisphosphate aldolase. During invasion, aldolase serves in the role of a structural bridging protein, as opposed to its normal enzymatic role in the glycolysis pathway. Crystal structures of the homologous Plasmodium falciparum fructose-1,6-bisphosphate aldolase have been described previously. Here, T. gondii fructose-1,6-bisphosphate aldolase has been crystallized in space group P22{sub 1}2{sub 1}, with the biologically relevant tetramer in the asymmetric unit, and the structure has been determined via molecular replacement to a resolution of 2.0 Å. An analysis of the quality of the model and of the differences between the four chains in the asymmetric unit and a comparison between the T. gondii and P. falciparum aldolase structures is presented.

  1. Structural analysis of the full-length gene encoding a fibronectin-binding-like protein (CadF and its adjacent genetic loci within Campylobacter lari

    Millar B Cherie

    2009-09-01

    Full Text Available Abstract Background The combined sequences encoding a partial and putative rpsI open reading frame (ORF, non-coding (NC region, a putative ORF for the Campylobacter adhesin to fibronectin-like protein (cadF, a putative Cla_0387 ORF, NC region and a partial and putative Cla_0388 ORF, were identified in 16 Campylobacter lari isolates, using two novel degenerate primer pairs. Probable consensus sequence at the -35 and -10 regions were identified in all C. lari isolates, as a promoter. Results Thus, cadF (-like gene is highly conserved among C. lari organisms. Transcription of the cadF (-like gene in C. lari cells in vivo was also confirmed and the transcription initiation site was determined. A peptidoglycan-associating alpha-helical motif in the C-terminal regions of some bacterial cell-surface proteins was completely conserved amongst the putative cadF (-like ORFs from the C. lari isolates. Conclusion The putative cadF (-like ORFs from all C. lari isolates were nine amino acid larger than those from C. jejuni, and showed amino acid residues 137 -140 of FALG (50% identity, instead of the FRLS residues of the maximal fibronectin-binding activity site demonstrated within C. jejuni CadF. A neighbor joining tree constructed based on cadF (-like gene sequence information formed a major cluster consisting of C. lari isolates, separating from the other three thermophilic campylobacters.

  2. The exopolysaccharide of Xylella fastidiosa is essential for biofilm formation, plant virulence, and vector transmission.

    Killiny, N; Martinez, R Hernandez; Dumenyo, C Korsi; Cooksey, D A; Almeida, R P P

    2013-09-01

    Exopolysaccharides (EPS) synthesized by plant-pathogenic bacteria are generally essential for virulence. The role of EPS produced by the vector-transmitted bacterium Xylella fastidiosa was investigated by knocking out two genes implicated in the EPS biosynthesis, gumD and gumH. Mutant strains were affected in growth characteristics in vitro, including adhesion to surfaces and biofilm formation. In addition, different assays were used to demonstrate that the mutant strains produced significantly less EPS compared with the wild type. Furthermore, gas chromatography-mass spectrometry showed that both mutant strains did not produce oligosaccharides. Biologically, the mutants were deficient in movement within plants, resulting in an avirulent phenotype. Additionally, mutant strains were affected in transmission by insects: they were very poorly transmitted by and retained within vectors. The gene expression profile indicated upregulation of genes implicated in cell-to-cell signaling and adhesins while downregulation in genes was required for within-plant movement in EPS-deficient strains. These results suggest an essential role for EPS in X. fastidiosa interactions with both plants and insects. PMID:23678891

  3. Identification of a response regulator involved in surface attachment, cell-cell aggregation, exopolysaccharide production and virulence in the plant pathogen Xylella fastidiosa.

    Voegel, Tanja M; Doddapaneni, Harshavardhan; Cheng, Davis W; Lin, Hong; Stenger, Drake C; Kirkpatrick, Bruce C; Roper, M Caroline

    2013-04-01

    Xylella fastidiosa, the causal agent of Pierce's disease of grapevine, possesses several two-component signal transduction systems that allow the bacterium to sense and respond to changes in its environment. Signals are perceived by sensor kinases that autophosphorylate and transfer the phosphate to response regulators (RRs), which direct an output response, usually by acting as transcriptional regulators. In the X. fastidiosa genome, 19 RRs were found. A site-directed knockout mutant in one unusual RR, designated XhpT, composed of a receiver domain and a histidine phosphotransferase output domain, was constructed. The resulting mutant strain was analysed for changes in phenotypic traits related to biofilm formation and gene expression using microarray analysis. We found that the xhpT mutant was altered in surface attachment, cell-cell aggregation, exopolysaccharide (EPS) production and virulence in grapevine. In addition, this mutant had an altered transcriptional profile when compared with wild-type X. fastidiosa in genes for several biofilm-related traits, such as EPS production and haemagglutinin adhesins. PMID:23186359

  4. Identification of genes encoding arabinosyltransferases (SCA) mediating developmental modifications of lipophosphoglycan required for sand fly transmission of leishmania major.

    Dobson, Deborah E; Mengeling, Brenda J; Cilmi, Salvatore; Hickerson, Suzanne; Turco, Salvatore J; Beverley, Stephen M

    2003-08-01

    At key steps in the infectious cycle pathogens must adhere to target cells, but at other times detachment is required for transmission. During sand fly infections by the protozoan parasite Leishmania major, binding of replicating promastigotes is mediated by galactosyl side chain (scGal) modifications of phosphoglycan repeats of the major surface adhesin, lipophosphoglycan (LPG). Release is mediated by arabinosyl (Ara) capping of LPG scbetaGal residues upon differentiation to the infective metacyclic stage. We used intraspecific polymorphisms of LPG structure to develop a genetic strategy leading to the identification of two genes (SCA1/2) mediating scAra capping. These LPG side chain beta1,2-arabinosyltransferases (scbetaAraTs) exhibit canonical glycosyltransferase motifs, and their overexpression leads to elevated microsomal scbetaAraT activity. Although the level of scAra caps is maximal in metacyclic parasites, scbetaAraT activity is maximal in log phase cells. Because quantitative immunolocalization studies suggest this is not mediated by sequestration of SCA scbetaAraTs away from the Golgi apparatus during log phase, regulation of activated Ara precursors may control LPG arabinosylation in vivo. The SCA genes define a new family of eukaryotic betaAraTs and represent novel developmentally regulated LPG-modifying activities identified in Leishmania. PMID:12750366

  5. Escherichia coli BdcA controls biofilm dispersal in Pseudomonas aeruginosa and Rhizobium meliloti

    Wood Thomas K

    2011-10-01

    Full Text Available Abstract Background Previously we showed that BdcA controls Escherichia coli biofilm dispersal by binding the ubiquitous bacterial signal cyclic diguanylate (c-di-GMP; upon reducing the concentration of c-di-GMP, the cell shifts to the planktonic state by increasing motility, decreasing aggregation, and decreasing production of biofilm adhesins. Findings Here we report that BdcA also increases biofilm dispersal in other Gram-negative bacteria including Pseudomonas aeruginosa, Pseudomonas fluorescens, and Rhizobium meliloti. BdcA binds c-di-GMP in these strains and thereby reduces the effective c-di-GMP concentrations as demonstrated by increases in swimming motility and swarming motility as well as by a reduction in extracellular polysaccharide production. We also develop a method to displace existing biofilms by adding BdcA via conjugation from E. coli in mixed-species biofilms. Conclusion Since BdcA shows the ability to control biofilm dispersal in diverse bacteria, BdcA has the potential to be used as a tool to disperse biofilms for engineering and medical applications.

  6. Presence of Extracellular DNA during Biofilm Formation by Xanthomonas citri subsp. citri Strains with Different Host Range

    Sena-Vélez, Marta; Redondo, Cristina; Graham, James H.; Cubero, Jaime

    2016-01-01

    Xanthomonas citri subsp. citri (Xcc) A strain causes citrus bacterial canker, a serious leaf, fruit and stem spotting disease of several Citrus species. X. alfalfae subsp. citrumelonis (Xac) is the cause of citrus bacterial spot, a minor disease of citrus nursery plants and X. campestris pv. campestris (Xc) is a systemic pathogen that causes black rot of cabbage. Xanthomonas spp. form biofilms in planta that facilitate the host infection process. Herein, the role of extracellular DNA (eDNA) was evaluated in the formation and stabilization of the biofilm matrix at different stages of biofilm development. Fluorescence and light microscopy, as well as DNAse treatments, were used to determine the presence of eDNA in biofilms and bacterial cultures. DNAse treatments of Xcc strains and Xac reduced biofilm formation at the initial stage of development, as well as disrupted preformed biofilm. By comparison, no significant effect of the DNAse was detected for biofilm formation by Xc. DNAse effects on biofilm formation or disruption varied among Xcc strains and Xanthomonas species which suggest different roles for eDNA. Variation in the structure of fibers containing eDNA in biofilms, bacterial cultures, and in twitching motility was also visualized by microscopy. The proposed roles for eDNA are as an adhesin in the early stages of biofilm formation, as an structural component of mature bacterial aggregates, and twitching motility structures. PMID:27248687

  7. Biofilm formation-defective mutants in Pseudomonas putida.

    López-Sánchez, Aroa; Leal-Morales, Antonio; Jiménez-Díaz, Lorena; Platero, Ana I; Bardallo-Pérez, Juan; Díaz-Romero, Alberto; Acemel, Rafael D; Illán, Juan M; Jiménez-López, Julia; Govantes, Fernando

    2016-07-01

    Out of 8000 candidates from a genetic screening for Pseudomonas putida KT2442 mutants showing defects in biofilm formation, 40 independent mutants with diminished levels of biofilm were analyzed. Most of these mutants carried insertions in genes of the lap cluster, whose products are responsible for synthesis, export and degradation of the adhesin LapA. All mutants in this class were strongly defective in biofilm formation. Mutants in the flagellar regulatory genes fleQ and flhF showed similar defects to that of the lap mutants. On the contrary, transposon insertions in the flagellar structural genes fliP and flgG, that also impair flagellar motility, had a modest defect in biofilm formation. A mutation in gacS, encoding the sensor element of the GacS/GacA two-component system, also had a moderate effect on biofilm formation. Additional insertions targeted genes involved in cell envelope function: PP3222, encoding the permease element of an ABC-type transporter and tolB, encoding the periplasmic component of the Tol-OprL system required for outer membrane stability. Our results underscore the central role of LapA, suggest cross-regulation between motility and adhesion functions and provide insights on the role of cell envelope trafficking and maintenance for biofilm development in P. putida. PMID:27190143

  8. Inhibition of Candida albicans biofilm formation and modulation of gene expression by probiotic cells and supernatant.

    James, K M; MacDonald, K W; Chanyi, R M; Cadieux, P A; Burton, J P

    2016-04-01

    Oral candidiasis is a disease caused by opportunistic species of Candida that normally reside on human mucosal surfaces. The transition of Candida from budding yeast to filamentous hyphae allows for covalent attachment to oral epithelial cells, followed by biofilm formation, invasion and tissue damage. In this study, combinations of Lactobacillus plantarum SD5870, Lactobacillus helveticus CBS N116411 and Streptococcus salivarius DSM 14685 were assessed for their ability to inhibit the formation of and disrupt Candida albicans biofilms. Co-incubation with probiotic supernatants under hyphae-inducing conditions reduced C. albicans biofilm formation by >75 % in all treatment groups. Likewise, combinations of live probiotics reduced biofilm formation of C. albicans by >67 %. When live probiotics or their supernatants were overlaid on preformed C. albicans biofilms, biofilm size was reduced by >63 and >65 % respectively. Quantitative real-time PCR results indicated that the combined supernatants of SD5870 and CBS N116411 significantly reduced the expression of several C. albicans genes involved in the yeast-hyphae transition: ALS3 (adhesin/invasin) by 70 % (P biofilm formation) by >99 % (P removing preformed C. albicans biofilms. Our novel results point to the downregulation of several Candida genes critical to the yeast-hyphae transition, biofilm formation, tissue invasion and cellular damage. PMID:26847045

  9. Adherence and biofilm production of invasive and non-invasive isolates of Streptococcus pyogenes after hyaluronidase treatment

    Šmitran Aleksandra

    2013-01-01

    Full Text Available Biofilm represents a protected mode, which allows bacteria to survive and proliferate in a hostile environment. Little is known whether the ability to form biofilms is a characteristic of all groups of A streptococcal (GAS strains and whether there is a relationship between biofilm formation and a clinical source of isolates. A capsule physically covers superficial adhesins and other proteins, essential in bacterial attachment, as the first step in biofilm formation. It is also possible that hyaluronic acid could form part of the complex extracellular polymer matrix of biofilms and contribute to the three-dimensional architecture of the biofilm. The aim of this study was to investigate if there are differences in adherence and biofilm production between GAS strains with different pathogenic potential, and the possible role of the capsule in this process. A total of 122 isolates were divided into three groups: noninvasive (NI, low invasive (LI and highly invasive (HI. Adherence, SpeB and biofilm production were tested before and after hyaluronidase treatment. There was no difference in adherence between untreated GAS strains, but after capsule removal, NI and HI isolates adhered significantly better than the LI group. Before treatment, isolates of the HI group were the worst biofilm producers, but after capsule removal, they became the best biofilm producers. There was no difference in SpeB production among GAS isolates, regardless of the hyaluronidase treatment.

  10. Structure of human salivary alpha-amylase at 1.6 A resolution: implications for its role in the oral cavity.

    Ramasubbu, N; Paloth, V; Luo, Y; Brayer, G D; Levine, M J

    1996-05-01

    Salivary alpha-amylase, a major component of human saliva, plays a role in the initial digestion of starch and may be involved in the colonization of bacteria involved in early dental plaque formation. The three-dimensional atomic structure of salivary amylase has been determined to understand the structure-function relationships of this enzyme. This structure was refined to an R value of 18.4% with 496 amino-acid residues, one calcium ion, one chloride ion and 170 water molecules. Salivary amylase folds into a multidomain structure consisting of three domains, A, B and C. Domain A has a (beta/alpha)(8-) barrel structure, domain B has no definite topology and domain C has a Greek-key barrel structure. The Ca(2+) ion is bound to Asnl00, Arg158, Asp167, His201 and three water molecules. The Cl(-) ion is bound to Arg195, Asn298 and Arg337 and one water molecule. The highly mobile glycine-rich loop 304-310 may act as a gateway for substrate binding and be involved in a 'trap-release' mechanism in the hydrolysis of substrates. Strategic placement of calcium and chloride ions, as well as histidine and tryptophan residues may play a role in differentiating between the glycone and aglycone ends of the polysaccharide substrates. Salivary amylase also possesses a suitable site for binding to enamel surfaces and provides potential sites for the binding of bacterial adhesins. PMID:15299664

  11. Exploring host-pathogen interactions through genome wide protein microarray analysis.

    Scietti, Luigi; Sampieri, Katia; Pinzuti, Irene; Bartolini, Erika; Benucci, Barbara; Liguori, Alessia; Haag, Andreas F; Lo Surdo, Paola; Pansegrau, Werner; Nardi-Dei, Vincenzo; Santini, Laura; Arora, Seguinde; Leber, Xavier; Rindi, Simonetta; Savino, Silvana; Costantino, Paolo; Maione, Domenico; Merola, Marcello; Speziale, Pietro; Bottomley, Matthew J; Bagnoli, Fabio; Masignani, Vega; Pizza, Mariagrazia; Scharenberg, Meike; Schlaeppi, Jean-Marc; Nissum, Mikkel; Liberatori, Sabrina

    2016-01-01

    During bacterial pathogenesis extensive contacts between the human and the bacterial extracellular proteomes take place. The identification of novel host-pathogen interactions by standard methods using a case-by-case approach is laborious and time consuming. To overcome this limitation, we took advantage of large libraries of human and bacterial recombinant proteins. We applied a large-scale protein microarray-based screening on two important human pathogens using two different approaches: (I) 75 human extracellular proteins were tested on 159 spotted Staphylococcus aureus recombinant proteins and (II) Neisseria meningitidis adhesin (NadA), an important vaccine component against serogroup B meningococcus, was screened against ≈2300 spotted human recombinant proteins. The approach presented here allowed the identification of the interaction between the S. aureus immune evasion protein FLIPr (formyl-peptide receptor like-1 inhibitory protein) and the human complement component C1q, key players of the offense-defense fighting; and of the interaction between meningococcal NadA and human LOX-1 (low-density oxidized lipoprotein receptor), an endothelial receptor. The novel interactions between bacterial and human extracellular proteins here presented might provide a better understanding of the molecular events underlying S. aureus and N. meningitidis pathogenesis. PMID:27302108

  12. Helicobacter pylori infection in children: should it be carefully assessed?

    Ortiz-Princz, D; Daoud, G; Salgado-Sabel, A; Cavazza, M E

    2016-05-01

    The prevalence of H. pylori infection, mainly acquired during childhood and may be persisting throughout life, has been found high in developing countries; this high prevalence is related to low socioeconomic status. The persistence of bacterium exposure is related to gastritis and other severe complications including peptic ulcer, lymphoma MALT and gastric cancer, which are rarely present in the pediatric age due to a lower inflammatory and immunological response. Virulence factors, host gastric mucosal factors, and the natural environment of patients are associated with the clinical outcome of H. pylori infection. The main bacterial virulence factors include adhesins (BabA, SabA), vacuolating cytotoxin VacA, and the products of the cag pathogenicity island (cag PAI). There are geographic differences between cagA, vacA status and H. pylori related diseases. The main criteria to evaluate H. pylori infection in children are gastrointestinal and extra gastrointestinal manifestations related to H. pylori infection, familial history of gastric cancer, peptic ulcer, lymphoma MALT, symptomatic children living in high prevalence regions, and immigrant or adopted children in developed countries. Early detection of H. pylori and its virulence factors, in addition to effective methods of eradication associated with prevention programs, may lead to the decrease of H. pylori incidence and gastritis, especially in endemic high-risk regions. The early assessment in children may prevent further severe complications in adulthood. PMID:27212173

  13. Role for the Plasmodium sporozoite-specific transmembrane protein S6 in parasite motility and efficient malaria transmission.

    Steinbuechel, Marion; Matuschewski, Kai

    2009-02-01

    Malaria transmission occurs by intradermal deposition of Plasmodium sporozoites during the infectious bite of a female Anopheles mosquito. After formation in midgut-associated oocysts sporozoites actively enter mosquito salivary glands and subsequently invade host hepatocytes where they transform into clinically silent liver stages. To date, two sporozoite-specific transmembrane proteins have been identified that perform vital functions in natural malaria transmission. The sporozoite invasin TRAP drives sporozoite motility and target cell entry whereas the adhesin MAEBL mediates sporozoite recognition of and attachment to salivary glands. Here, we demonstrate that the sporozoite-specific transmembrane protein S6 is required for efficient malaria transmission to the vertebrate host. Targeted deletion of S6 results in severe impairment of sporozoite gliding motility and invasion of mosquito salivary glands. During sporozoite maturation S6 expression is tightly regulated by transcriptional and translational control. We propose that S6 functions together with TRAP/MIC2 family invasins to direct fast, efficient and specific cell entry and, ultimately, life cycle progression of the malaria sporozoite. PMID:19016774

  14. Genome Sequencing of a Mung Bean Plant Growth Promoting Strain of P. aeruginosa with Biocontrol Ability

    Devaraj Illakkiam

    2014-01-01

    Full Text Available Pseudomonas aeruginosa PGPR2 is a mung bean rhizosphere strain that produces secondary metabolites and hydrolytic enzymes contributing to excellent antifungal activity against Macrophomina phaseolina, one of the prevalent fungal pathogens of mung bean. Genome sequencing was performed using the Ion Torrent Personal Genome Machine generating 1,354,732 reads (6,772,433 sequenced bases achieving ~25-fold coverage of the genome. Reference genome assembly using MIRA 3.4.0 yielded 198 contigs. The draft genome of PGPR2 encoded 6803 open reading frames, of which 5314 were genes with predicted functions, 1489 were genes of known functions, and 80 were RNA-coding genes. Strain specific and core genes of P. aeruginosa PGPR2 that are relevant to rhizospheric habitat were identified by pangenome analysis. Genes involved in plant growth promoting function such as synthesis of ACC deaminase, indole-3-acetic acid, trehalose, mineral scavenging siderophores, hydrogen cyanide, chitinases, acyl homoserine lactones, acetoin, 2,3-butanediol, and phytases were identified. In addition, niche-specific genes such as phosphate solubilising 3-phytase, adhesins, pathway-specific transcriptional regulators, a diguanylate cyclase involved in cellulose synthesis, a receptor for ferrienterochelin, a DEAD/DEAH-box helicase involved in stress tolerance, chemotaxis/motility determinants, an HtpX protease, and enzymes involved in the production of a chromanone derivative with potent antifungal activity were identified.

  15. Tyrosine-phosphorylated caveolin-1 blocks bacterial uptake by inducing Vav2-RhoA-mediated cytoskeletal rearrangements.

    Jan Peter Boettcher

    Full Text Available Certain bacterial adhesins appear to promote a pathogen's extracellular lifestyle rather than its entry into host cells. However, little is known about the stimuli elicited upon such pathogen host-cell interactions. Here, we report that type IV pili (Tfp-producing Neisseria gonorrhoeae (P(+GC induces an immediate recruitment of caveolin-1 (Cav1 in the host cell, which subsequently prevents bacterial internalization by triggering cytoskeletal rearrangements via downstream phosphotyrosine signaling. A broad and unbiased analysis of potential interaction partners for tyrosine-phosphorylated Cav1 revealed a direct interaction with the Rho-family guanine nucleotide exchange factor Vav2. Both Vav2 and its substrate, the small GTPase RhoA, were found to play a direct role in the Cav1-mediated prevention of bacterial uptake. Our findings, which have been extended to enteropathogenic Escherichia coli, highlight how Tfp-producing bacteria avoid host cell uptake. Further, our data establish a mechanistic link between Cav1 phosphorylation and pathogen-induced cytoskeleton reorganization and advance our understanding of caveolin function.

  16. Immunogenicity of IMS 1113 plus soluble subunit and chimeric proteins containing Mycoplasma hyopneumoniae P97 C-terminal repeat regions.

    Barate, Abhijit K; Cho, Youngjae; Truong, Quang Lam; Hahn, Tae-Wook

    2014-03-01

    The surface adhesin P97 mediates the adherence of Mycoplasma hyopneumoniae to swine cilia. Two reiterated repeats R1 and R2 are located at the C-terminus of P97. The purpose of this study was to evaluate the immunogenicity of Montanide adjuvant IMS 1113 plus soluble subunit proteins rR1, rR1R2 and their chimeric forms coupled with B subunit of the heat-labile enterotoxin of Escherichia coli (LTB). Each recombinant protein in this study was capable of eliciting anti-R1 specific humoral antibodies (IgG), mucosal antibodies (IgG and IgA) and IFN-γ production. The chimeric protein rLTBR1R2 elicited the quickest humoral antibody response among the recombinant proteins. Serum and bronchoalveolar lavage analysis revealed that each recombinant protein was capable of inducing both Th1 and Th2 responses. Importantly, all of the proteins induced an anti-R1-specific Th2-biased response in both humoral and mucosal compartments, similar to the response observed in a natural infection or vaccination process. These observations indicate that rR1, rR1R2, rLTBR1 and rLTBR1R2 with IMS 1113 might represent a promising subunit vaccine strategy against porcine enzootic pneumonia in pigs. PMID:24461070

  17. RNA-seq transcriptional profiling of Herbaspirillum seropedicae colonizing wheat (Triticum aestivum) roots.

    Pankievicz, V C S; Camilios-Neto, D; Bonato, P; Balsanelli, E; Tadra-Sfeir, M Z; Faoro, H; Chubatsu, L S; Donatti, L; Wajnberg, G; Passetti, F; Monteiro, R A; Pedrosa, F O; Souza, E M

    2016-04-01

    Herbaspirillum seropedicae is a diazotrophic and endophytic bacterium that associates with economically important grasses promoting plant growth and increasing productivity. To identify genes related to bacterial ability to colonize plants, wheat seedlings growing hydroponically in Hoagland's medium were inoculated with H. seropedicae and incubated for 3 days. Total mRNA from the bacteria present in the root surface and in the plant medium were purified, depleted from rRNA and used for RNA-seq profiling. RT-qPCR analyses were conducted to confirm regulation of selected genes. Comparison of RNA profile of root attached and planktonic bacteria revealed extensive metabolic adaptations to the epiphytic life style. These adaptations include expression of specific adhesins and cell wall re-modeling to attach to the root. Additionally, the metabolism was adapted to the microxic environment and nitrogen-fixation genes were expressed. Polyhydroxybutyrate (PHB) synthesis was activated, and PHB granules were stored as observed by microscopy. Genes related to plant growth promotion, such as auxin production were expressed. Many ABC transporter genes were regulated in the bacteria attached to the roots. The results provide new insights into the adaptation of H. seropedicae to the interaction with the plant. PMID:26801330

  18. Role of flagella in adherence, internalization, and translocation of Campylobacter jejuni in nonpolarized and polarized epithelial cell cultures.

    Grant, C C; Konkel, M E; Cieplak, W; Tompkins, L S

    1993-01-01

    Previous studies of Campylobacter jejuni have suggested that flagellin is an adhesin for epithelial cells and that motility is a virulence factor of this bacterium. The role of flagella in the interactions of C. jejuni with nonpolarized and polarized epithelial cells was examined with flagellar mutants. Flagellated, nonmotile (flaA flaB+ Mot-) and nonflagellated, nonmotile (flaA flaB Mot-) mutants of C. jejuni were constructed by in vivo homologous recombination and gene replacement techniques. Both classes of mutants were found to adhere to cells of human epithelial origin (INT 407) equally well; however, on the basis of the percentage of the inoculum internalized, internalization of the flaA flaB Mot- mutants was decreased by factors ranging from approximately 30 to 40 compared with the parent. The flaA flaB+ Mot- mutant was internalized by the INT 407 cells at levels six- to sevenfold higher than the flaA flaB Mot- mutants. Both classes of mutants, unlike the parent, were unable to translocate across polarized Caco-2 monolayers. These results indicate that flagella are not involved in C. jejuni adherence to epithelial cells but that they do play a role in internalization. Furthermore, the results suggest that either the motility of C. jejuni or the product of flaA is essential for the bacterium to cross polarized epithelial cell monolayers. Images PMID:8478066

  19. Identification of major immunogenic proteins of Mycoplasma synoviae isolates.

    Bercic, Rebeka Lucijana; Slavec, Brigita; Lavric, Miha; Narat, Mojca; Bidovec, Andrej; Dovc, Peter; Bencina, Dusan

    2008-02-01

    Mycoplasma synoviae isolates differ in patterns of immunogenic proteins, but most of them have not been identified yet. The main aim of this study was their identification in two closely related M. synoviae isolates, ULB 02/P4 and ULB 02/OV6, recovered recently from chickens in Slovenia. N-terminal sequencing identified 17 M. synoviae proteins. Amongst them were 14 major, highly expressed but previously unidentified proteins, including enzymes, chaperones and putative lipoproteins. ULB 02/P4 proteins with increasing molecular weight (M(w)) in the region above the lipoprotein MSPB (approximately 40 kDa) were elongation factor EF-Tu, enolase, NADH oxidase, haemagglutinin MSPA, ATP synthase beta chain, trigger factor, pyruvate kinase and chaperone DnaK. Enolase (approximately 47 kDa) seemed to be immunogenic for chickens infected with M. synoviae, whereas EF-Tu, which might cross-react with antibodies to the P1 adhesin of Mycoplasma pneumoniae, was not. ULB 02/OV6 synthesized several immunogenic proteins and those with M(w) of approximately 70, 78, 82, 90, 110 and 160 kDa, cross-reacted with antibodies to Mycoplasma gallisepticum. They remain to be identified, because besides putative lipoproteins, protein bands of 78, 82, 85 and 110 kDa contained also dehydrogenase PdhD, elongation factor EF-G, enzyme PtsG and putative neuraminidase, respectively. PMID:17720337

  20. Structure of Toxoplasma gondii fructose-1,6-bisphosphate aldolase

    The structure of T. gondii fructose-1,6-bisphosphate aldolase, a glycolytic enzyme and structural component of the invasion machinery, was determined to a resolution of 2.0 Å. The apicomplexan parasite Toxoplasma gondii must invade host cells to continue its lifecycle. It invades different cell types using an actomyosin motor that is connected to extracellular adhesins via the bridging protein fructose-1,6-@@bisphosphate aldolase. During invasion, aldolase serves in the role of a structural bridging protein, as opposed to its normal enzymatic role in the glycolysis pathway. Crystal structures of the homologous Plasmodium falciparum fructose-1,6-bisphosphate aldolase have been described previously. Here, T. gondii fructose-1,6-bisphosphate aldolase has been crystallized in space group P22121, with the biologically relevant tetramer in the asymmetric unit, and the structure has been determined via molecular replacement to a resolution of 2.0 Å. An analysis of the quality of the model and of the differences between the four chains in the asymmetric unit and a comparison between the T. gondii and P. falciparum aldolase structures is presented

  1. A Toxoplasma gondii protein with homology to intracellular type Na+/H+ exchangers is important for osmoregulation and invasion

    The obligate intracellular parasite Toxoplasma gondii is exposed to a variety of physiological conditions while propagating in an infected organism. The mechanisms by which Toxoplasma overcomes these dramatic changes in its environment are not known. In yeast and plants, ion detoxification and osmotic regulation are controlled by vacuolar compartments. A novel compartment named the plant-like vacuole or vacuolar compartment (PLV/VAC) has recently been described in T.gondii, which could potentially protect extracellular tachyzoites against salt and other ionic stresses. Here, we report the molecular characterization of the vacuolar type Na+/H+ exchanger in T. gondii, TgNHE3, and its co-localization with the PLV/VAC proton-pyrophosphatase (TgVP1). We have created a TgNHE3 knockout strain, which is more sensitive to hyperosmotic shock and toxic levels of sodium, possesses a higher intracellular Ca2+ concentration [Ca2+]i, and exhibits a reduced host invasion efficiency. The defect in invasion correlates with a measurable reduction in the secretion of the adhesin TgMIC2. Overall, our results suggest that the PLV/VAC has functions analogous to those of the vacuolar compartments of plants and yeasts, providing the parasite with a mechanism to resist ionic fluctuations and, potentially, regulate protein trafficking.

  2. A Toxoplasma gondii protein with homology to intracellular type Na{sup +}/H{sup +} exchangers is important for osmoregulation and invasion

    Francia, Maria E.; Wicher, Sarah [Department of Biological Sciences, University of Idaho, Life Sciences South Room 142, Moscow, ID 83844 (United States); Pace, Douglas A. [Center for Tropical and Emerging Global Diseases and Department of Cellular Biology University of Georgia, Athens, GA 30602 (United States); Sullivan, Jack [Department of Biological Sciences, University of Idaho, Life Sciences South Room 142, Moscow, ID 83844 (United States); Moreno, Silvia N.J. [Center for Tropical and Emerging Global Diseases and Department of Cellular Biology University of Georgia, Athens, GA 30602 (United States); Arrizabalaga, Gustavo, E-mail: gustavo@uidaho.edu [Department of Biological Sciences, University of Idaho, Life Sciences South Room 142, Moscow, ID 83844 (United States)

    2011-06-10

    The obligate intracellular parasite Toxoplasma gondii is exposed to a variety of physiological conditions while propagating in an infected organism. The mechanisms by which Toxoplasma overcomes these dramatic changes in its environment are not known. In yeast and plants, ion detoxification and osmotic regulation are controlled by vacuolar compartments. A novel compartment named the plant-like vacuole or vacuolar compartment (PLV/VAC) has recently been described in T.gondii, which could potentially protect extracellular tachyzoites against salt and other ionic stresses. Here, we report the molecular characterization of the vacuolar type Na{sup +}/H{sup +} exchanger in T. gondii, TgNHE3, and its co-localization with the PLV/VAC proton-pyrophosphatase (TgVP1). We have created a TgNHE3 knockout strain, which is more sensitive to hyperosmotic shock and toxic levels of sodium, possesses a higher intracellular Ca{sup 2+} concentration [Ca{sup 2+}]{sub i}, and exhibits a reduced host invasion efficiency. The defect in invasion correlates with a measurable reduction in the secretion of the adhesin TgMIC2. Overall, our results suggest that the PLV/VAC has functions analogous to those of the vacuolar compartments of plants and yeasts, providing the parasite with a mechanism to resist ionic fluctuations and, potentially, regulate protein trafficking.

  3. The Antiadhesive Strategy in Crohn's Disease: Orally Active Mannosides to Decolonize Pathogenic Escherichia coli from the Gut.

    Alvarez Dorta, Dimitri; Sivignon, Adeline; Chalopin, Thibaut; Dumych, Tetiana I; Roos, Goedele; Bilyy, Rostyslav O; Deniaud, David; Krammer, Eva-Maria; de Ruyck, Jérome; Lensink, Marc F; Bouckaert, Julie; Barnich, Nicolas; Gouin, Sébastien G

    2016-05-17

    Blocking the adherence of bacteria to cells is an attractive complementary approach to current antibiotic treatments, which are faced with increasing resistance. This strategy has been particularly studied in the context of urinary tract infections (UTIs), in which the adhesion of pathogenic Escherichia coli strains to uroepithelial cells is prevented by blocking the FimH adhesin expressed at the tips of bacteria organelles called fimbriae. Recently, we extended the antiadhesive concept, showing that potent FimH antagonists can block the attachment of adherent-invasive E. coli (AIEC) colonizing the intestinal mucosa of patients with Crohn's disease (CD). In this work, we designed a small library of analogues of heptyl mannoside (HM), a previously identified nanomolar FimH inhibitor, but one that displays poor antiadhesive effects in vivo. The anomeric oxygen atom was replaced by a sulfur or a methylene group to prevent hydrolysis by intestinal glycosidases, and chemical groups were attached at the end of the alkyl tail. Importantly, a lead compound was shown to reduce AIEC levels in the feces and in the colonic and ileal mucosa after oral administration (10 mg kg(-1) ) in a transgenic mouse model of CD. The compound showed a low bioavailability, preferable in this instance, thus suggesting the possibility of setting up an innovative antiadhesive therapy, based on the water-soluble and non-cytotoxic FimH antagonists developed here, for the CD subpopulation in which AIEC plays a key role. PMID:26946458

  4. Differences in Extended-Spectrum Beta-Lactamase Producing Escherichia coli Virulence Factor Genes in the Baltic Sea Region

    Jana Lillo

    2014-01-01

    Full Text Available The aim of this study was to compare the prevalence of different virulence factor (VF genes in extended-spectrum beta-lactamase (ESBL producing Escherichia coli strains isolated from the Baltic Sea region. A total of 432 strains of phenotypically ESBL positive E. coli were collected from 20 institutions located in Estonia, Latvia, Lithuania, and the region of St. Petersburg in Russia from January to May 2012 and analyzed for phylogenetic group and prevalence of 23 VF genes. The strains were collected from clinical material (urine, blood, wound, and respiratory tract. Bacterial isolates were compared according to phylogenetic group, clinical material, and geographical origin. Most of the VF genes were concentrated within phylogenetic group B2 and/or D. When comparing strains isolated from different countries, it was found that strains originating from Estonia and Latvia belonged mainly to group B2 and strains from Lithuania and Russia mainly to groups B2 and D. The P-fimbrial adhesin gene papEF was more prevalent in Russian strains, colicin gene cvaC in Lithuanian strains, and capsular gene kpsMTII in Latvian strains; serum resistant gene traT was less prevalent in Estonian strains. The regional differences of VF genes remained statistically significant after taking into account the phylogenetic distribution in the countries.

  5. Differences in extended-spectrum beta-lactamase producing Escherichia coli virulence factor genes in the Baltic Sea region.

    Lillo, Jana; Pai, Kristiine; Balode, Arta; Makarova, Mariia; Huik, Kristi; Kõljalg, Siiri; Ivanova, Marina; Kaftyreva, Lidia; Miciuleviciene, Jolanta; Naaber, Paul; Parv, Kristel; Pavelkovich, Anastasia; Rööp, Tiiu; Toompere, Karolin; Suzhaeva, Ludmila; Sepp, Epp

    2014-01-01

    The aim of this study was to compare the prevalence of different virulence factor (VF) genes in extended-spectrum beta-lactamase (ESBL) producing Escherichia coli strains isolated from the Baltic Sea region. A total of 432 strains of phenotypically ESBL positive E. coli were collected from 20 institutions located in Estonia, Latvia, Lithuania, and the region of St. Petersburg in Russia from January to May 2012 and analyzed for phylogenetic group and prevalence of 23 VF genes. The strains were collected from clinical material (urine, blood, wound, and respiratory tract). Bacterial isolates were compared according to phylogenetic group, clinical material, and geographical origin. Most of the VF genes were concentrated within phylogenetic group B2 and/or D. When comparing strains isolated from different countries, it was found that strains originating from Estonia and Latvia belonged mainly to group B2 and strains from Lithuania and Russia mainly to groups B2 and D. The P-fimbrial adhesin gene papEF was more prevalent in Russian strains, colicin gene cvaC in Lithuanian strains, and capsular gene kpsMTII in Latvian strains; serum resistant gene traT was less prevalent in Estonian strains. The regional differences of VF genes remained statistically significant after taking into account the phylogenetic distribution in the countries. PMID:25250320

  6. Differences in Extended-Spectrum Beta-Lactamase Producing Escherichia coli Virulence Factor Genes in the Baltic Sea Region

    Balode, Arta; Makarova, Mariia; Huik, Kristi; Kõljalg, Siiri; Kaftyreva, Lidia; Miciuleviciene, Jolanta; Naaber, Paul; Rööp, Tiiu; Toompere, Karolin; Suzhaeva, Ludmila; Sepp, Epp

    2014-01-01

    The aim of this study was to compare the prevalence of different virulence factor (VF) genes in extended-spectrum beta-lactamase (ESBL) producing Escherichia coli strains isolated from the Baltic Sea region. A total of 432 strains of phenotypically ESBL positive E. coli were collected from 20 institutions located in Estonia, Latvia, Lithuania, and the region of St. Petersburg in Russia from January to May 2012 and analyzed for phylogenetic group and prevalence of 23 VF genes. The strains were collected from clinical material (urine, blood, wound, and respiratory tract). Bacterial isolates were compared according to phylogenetic group, clinical material, and geographical origin. Most of the VF genes were concentrated within phylogenetic group B2 and/or D. When comparing strains isolated from different countries, it was found that strains originating from Estonia and Latvia belonged mainly to group B2 and strains from Lithuania and Russia mainly to groups B2 and D. The P-fimbrial adhesin gene papEF was more prevalent in Russian strains, colicin gene cvaC in Lithuanian strains, and capsular gene kpsMTII in Latvian strains; serum resistant gene traT was less prevalent in Estonian strains. The regional differences of VF genes remained statistically significant after taking into account the phylogenetic distribution in the countries. PMID:25250320

  7. Regulation and production of Tcf, a cable-like fimbriae from Salmonella enterica serovar Typhi.

    Leclerc, Jean-Mathieu; Quevillon, Eve-Lyne; Houde, Yoan; Paranjape, Kiran; Dozois, Charles M; Daigle, France

    2016-05-01

    tcf (Typhi colonization factor) is one of the 12 putative chaperone/usher fimbrial clusters present in the Salmonella enterica serovar Typhi genome. We investigated the production, expression and regulation of tcf as well as its role during interaction with human cells. The tcf gene cluster was cloned and induced in Escherichia coli and S. Typhi, and the production of intertwined fibres similar to the Cbl (cable) pili of Burkholderia cepacia was observed on the bacterial surface by electron microscopy. In S. Typhi, tcf was expressed more after growth in M63 minimal medium than in standard Luria-Bertani medium. Analysis of the promoter region identified putative binding sites for the global regulators RcsB, ArgR and Fur. The expression of tcf was measured in isogenic strains lacking these global regulators. Under the conditions tested, the results showed that tcf expression was higher in the fur mutant and was regulated by iron concentration. Fur may regulate these fimbriae indirectly via the small RNAs RyhB1 and RyhB2. An isogenic mutant harbouring a deletion of the tcf cluster did not demonstrate any defect in adhesion or invasion of human epithelial cells, or in phagocytosis or survival in macrophages, when compared to the WT serovar Typhi strain. However, the tcf cluster contributed to adherence to human epithelial cells when introduced into E. coli. Thus, tcf genes encode functional fimbriae that can act as an adhesin and may contribute to colonization during typhoid fever. PMID:26944792

  8. Growth of Yersinia pseudotuberculosis in human plasma: impacts on virulence and metabolic gene expression

    Coppée Jean-Yves

    2008-12-01

    Full Text Available Abstract Background In man, infection by the Gram-negative enteropathogen Yersinia pseudotuberculosis is usually limited to the terminal ileum. However, in immunocompromised patients, the microorganism may disseminate from the digestive tract and thus cause a systemic infection with septicemia. Results To gain insight into the metabolic pathways and virulence factors expressed by the bacterium at the blood stage of pseudotuberculosis, we compared the overall gene transcription patterns (the transcriptome of bacterial cells cultured in either human plasma or Luria-Bertani medium. The most marked plasma-triggered metabolic consequence in Y. pseudotuberculosis was the switch to high glucose consumption, which is reminiscent of the acetogenic pathway (known as "glucose overflow" in Escherichia coli. However, upregulation of the glyoxylate shunt enzymes suggests that (in contrast to E. coli acetate may be further metabolized in Y. pseudotuberculosis. Our data also indicate that the bloodstream environment can regulate major virulence genes (positively or negatively; the yadA adhesin gene and most of the transcriptional units of the pYV-encoded type III secretion apparatus were found to be upregulated, whereas transcription of the pH6 antigen locus was strongly repressed. Conclusion Our results suggest that plasma growth of Y. pseudotuberculosis is responsible for major transcriptional regulatory events and prompts key metabolic reorientations within the bacterium, which may in turn have an impact on virulence.

  9. Effect of negative pressure on growth, secretion and biofilm formation of Staphylococcus aureus.

    Li, Tongtong; Wang, Guoqi; Yin, Peng; Li, Zhirui; Zhang, Licheng; Liu, Jianheng; Li, Ming; Zhang, Lihai; Han, Li; Tang, Peifu

    2015-10-01

    Negative pressure wound therapy (NPWT) has gained popularity in the management of contaminated wounds as an effective physical therapy, although its influence on the bacteria in the wounds remains unclear. In this study, we attempted to explore the effect of negative pressure conditions on Staphylococcus aureus, the most frequently isolated pathogen during wound infection. S. aureus was cultured in Luria-Bertani medium at subatmospheric pressure of -125 mmHg for 24 h, with the bacteria grown at ambient pressure as the control. The application of negative pressure was found to slow down the growth rate and inhibit biofilm development of S. aureus, which was confirmed by static biofilm assays. Furthermore, decreases in the total amount of virulence factors and biofilm components were observed, including α-hemolysin, extracellular adherence protein, polysaccharide intercellular adhesin and extracellular DNA. With quantitative RT-PCR analysis, we also revealed a significant inhibition in the transcription of virulence and regulatory genes related to wound infections and bacterial biofilms. Together, these findings indicated that negative pressure could inhibit the growth, virulence and biofilm formation of S. aureus. A topical subatmospheric pressure condition, such as NPWT, may be a potential antivirulence and antibiofilm strategy in the field of wound care. PMID:26272011

  10. A Serine-Threonine Kinase (StkP Regulates Expression of the Pneumococcal Pilus and Modulates Bacterial Adherence to Human Epithelial and Endothelial Cells In Vitro.

    Jenny A Herbert

    Full Text Available The pneumococcal serine threonine protein kinase (StkP acts as a global regulator in the pneumococcus. Bacterial mutants deficient in StkP are less virulent in animal models of infection. The gene for this regulator is located adjacent to the gene for its cognate phosphatase in the pneumococcal genome. The phosphatase dephosphorylates proteins phosphorylated by StkP and has been shown to regulate a number of key pneumococcal virulence factors and to modulate adherence to eukaryotic cells. The role of StkP in adherence of pneumococci to human cells has not previously been reported. In this study we show StkP represses the pneumococcal pilus, a virulence factor known to be important for bacterial adhesion. In a serotype 4 strain regulation of the pilus by StkP modulates adherence to human brain microvascular endothelial cells (HBMEC and human lung epithelial cells. This suggests that the pneumococcal pilus may play a role in adherence during infections such as meningitis and pneumonia. We show that regulation of the pilus occurs at the population level as StkP alters the number of pili-positive cells within a single culture. As far as we are aware this is the first gene identified outside of the pilus islet that regulates the biphasic expression of the pilus. These findings suggest StkPs role in cell division may be linked to regulation of expression of a cell surface adhesin.

  11. Host mucin glycosylation plays a role in bacterial adhesion in lungs of individuals with cystic fibrosis.

    Venkatakrishnan, Vignesh; Packer, Nicolle H; Thaysen-Andersen, Morten

    2013-10-01

    Malfunction of the cell surface glycoprotein, cystic fibrosis transmembrane conductance regulator, is the molecular hallmark of cystic fibrosis (CF), causing salt imbalance across the lung epithelium and biochemical and biophysical alterations of the mucous secretion and airway surfaces. Abnormal glycosylation of both secreted and membrane-tethered airway mucins in CF hosts are reported by a substantial body of literature and correlates with bacterial infection and inflammation in CF airways, features that are linked to the CF pathology. It is established that Pseudomonas aeruginosa and other CF-typic bacteria use the altered host mucin glycosylation as receptors for adhesion by dedicated lectins and adhesins recognizing an array of the aberrantly expressed glycan determinants. This review aims to describe the aberrant mucin glycosylation phenotype observed in CF airways relative to the non-CF equivalent by summarizing the wealth of literature on this topic. The possible causes and effects of altered glycosylation in the respiratory system are discussed. Specific attention is given to the adhesion mechanisms of the opportunistic P. aeruginosa, which utilizes the molecular alterations of the lung to gain access to the normally sterile airways. Finally, the emerging glycosylation-based therapeutics that show promising potential for reducing bacterial infection in individuals with CF by molecular mimicry mechanisms are discussed. PMID:24138697

  12. Genomic comparison of the endophyte Herbaspirillum seropedicae SmR1 and the phytopathogen Herbaspirillum rubrisubalbicans M1 by suppressive subtractive hybridization and partial genome sequencing.

    Monteiro, Rose A; Balsanelli, Eduardo; Tuleski, Thalita; Faoro, Helison; Cruz, Leonardo M; Wassem, Roseli; de Baura, Valter A; Tadra-Sfeir, Michelle Z; Weiss, Vinícius; DaRocha, Wanderson D; Muller-Santos, Marcelo; Chubatsu, Leda S; Huergo, Luciano F; Pedrosa, Fábio O; de Souza, Emanuel M

    2012-05-01

    Herbaspirillum rubrisubalbicans M1 causes the mottled stripe disease in sugarcane cv. B-4362. Inoculation of this cultivar with Herbaspirillum seropedicae SmR1 does not produce disease symptoms. A comparison of the genomic sequences of these closely related species may permit a better understanding of contrasting phenotype such as endophytic association and pathogenic life style. To achieve this goal, we constructed suppressive subtractive hybridization (SSH) libraries to identify DNA fragments present in one species and absent in the other. In a parallel approach, partial genomic sequence from H. rubrisubalbicans M1 was directly compared in silico with the H. seropedicae SmR1 genome. The genomic differences between the two organisms revealed by SSH suggested that lipopolysaccharide and adhesins are potential molecular factors involved in the different phenotypic behavior. The cluster wss probably involved in cellulose biosynthesis was found in H. rubrisubalbicans M1. Expression of this gene cluster was increased in H. rubrisubalbicans M1 cells attached to the surface of maize root, and knockout of wssD gene led to decrease in maize root surface attachment and endophytic colonization. The production of cellulose could be responsible for the maize attachment pattern of H. rubrisubalbicans M1 that is capable of outcompeting H. seropedicae SmR1. PMID:22268687

  13. Lactobacilli Reduce Helicobacter pylori Attachment to Host Gastric Epithelial Cells by Inhibiting Adhesion Gene Expression.

    de Klerk, Nele; Maudsdotter, Lisa; Gebreegziabher, Hanna; Saroj, Sunil D; Eriksson, Beatrice; Eriksson, Olaspers Sara; Roos, Stefan; Lindén, Sara; Sjölinder, Hong; Jonsson, Ann-Beth

    2016-05-01

    The human gastrointestinal tract, including the harsh environment of the stomach, harbors a large variety of bacteria, of which Lactobacillus species are prominent members. The molecular mechanisms by which species of lactobacilli interfere with pathogen colonization are not fully characterized. In this study, we aimed to study the effect of lactobacillus strains upon the initial attachment of Helicobacter pylori to host cells. Here we report a novel mechanism by which lactobacilli inhibit adherence of the gastric pathogen H. pylori In a screen with Lactobacillus isolates, we found that only a few could reduce adherence of H. pylori to gastric epithelial cells. Decreased attachment was not due to competition for space or to lactobacillus-mediated killing of the pathogen. Instead, we show that lactobacilli act on H. pylori directly by an effector molecule that is released into the medium. This effector molecule acts on H. pylori by inhibiting expression of the adhesin-encoding gene sabA Finally, we verified that inhibitory lactobacilli reduced H. pylori colonization in an in vivo model. In conclusion, certain Lactobacillus strains affect pathogen adherence by inhibiting sabA expression and thereby reducing H. pylori binding capacity. PMID:26930708

  14. Muc5ac gastric mucin glycosylation is shaped by FUT2 activity and functionally impacts Helicobacter pylori binding.

    Magalhães, Ana; Rossez, Yannick; Robbe-Masselot, Catherine; Maes, Emmanuel; Gomes, Joana; Shevtsova, Anna; Bugaytsova, Jeanna; Borén, Thomas; Reis, Celso A

    2016-01-01

    The gastrointestinal tract is lined by a thick and complex layer of mucus that protects the mucosal epithelium from biochemical and mechanical aggressions. This mucus barrier confers protection against pathogens but also serves as a binding site that supports a sheltered niche of microbial adherence. The carcinogenic bacteria Helicobacter pylori colonize the stomach through binding to host glycans present in the glycocalyx of epithelial cells and extracellular mucus. The secreted MUC5AC mucin is the main component of the gastric mucus layer, and BabA-mediated binding of H. pylori to MUC5AC confers increased risk for overt disease. In this study we unraveled the O-glycosylation profile of Muc5ac from glycoengineered mice models lacking the FUT2 enzyme and therefore mimicking a non-secretor human phenotype. Our results demonstrated that the FUT2 determines the O-glycosylation pattern of Muc5ac, with Fut2 knock-out leading to a marked decrease in α1,2-fucosylated structures and increased expression of the terminal type 1 glycan structure Lewis-a. Importantly, for the first time, we structurally validated the expression of Lewis-a in murine gastric mucosa. Finally, we demonstrated that loss of mucin FUT2-mediated fucosylation impairs gastric mucosal binding of H. pylori BabA adhesin, which is a recognized feature of pathogenicity. PMID:27161092

  15. Strategies for Intracellular Survival of Burkholderia pseudomallei.

    Allwood, Elizabeth M; Devenish, Rodney J; Prescott, Mark; Adler, Ben; Boyce, John D

    2011-01-01

    Burkholderia pseudomallei is the causative agent of melioidosis, a disease with high mortality that is prevalent in tropical regions of the world. A key component of the pathogenesis of melioidosis is the ability of B. pseudomallei to enter, survive, and replicate within mammalian host cells. For non-phagocytic cells, bacterial adhesins have been identified both on the bacterial surface and associated with Type 4 pili. Cell invasion involves components of one or more of the three Type 3 Secretion System clusters, which also mediate, at least in part, the escape of bacteria from the endosome into the cytoplasm, where bacteria move by actin-based motility. The mechanism of actin-based motility is not clearly understood, but appears to differ from characterized mechanisms in other bacterial species. A small proportion of intracellular bacteria is targeted by host cell autophagy, involving direct recruitment of LC3 to endosomes rather than through uptake by canonical autophagosomes. However, the majority of bacterial cells are able to circumvent autophagy and other intracellular defense mechanisms such as the induction of inducible nitric oxide synthase, and then replicate in the cytoplasm and spread to adjacent cells via membrane fusion, resulting in the formation of multi-nucleated giant cells. A potential role for host cell ubiquitin in the autophagic response to bacterial infection has recently been proposed. PMID:22007185

  16. Role of bacteria in the etiopathogenesis of inflammatory bowel disease

    2007-01-01

    Increased numbers of mucosa-associated Escherichia coli are observed in both of the major inflammatory bowel diseases, Crohn's disease (CD) and ulcerative colitis (DC). A potential pathophysiological link between the presence of pathogenic invasive bacteria and genetic host susceptibility of patients with ileal CD is suspected. In CD patients, with increased ileal expression of the CEACAM6 molecule acting as a receptor recognized by type 1 pilus bacterial adhesin, and with the identification of mutations in the NOD2-encoding gene, the presence of pathogenic invasive bacteria could be the link between abnormal ileal bacterial colonization and innate immune responses to invasive bacteria. In a susceptible host, the sequential etiological steps of the disease induced by adherent-invasive E. Coli (AIEC) are: (1) abnormal colonization via binding to the CEACAM6 receptor, which is overexpressed in the ileal mucosa of CD patients; (2) ability to adhere to and to invade intestinal epithelial cells, which allows bacteria to cross the mucosal barrier; (3) survival and replication within infected macrophages in the lamina propria; and (4) induction of tumor necrosis factor-a secretion and granuloma formation.

  17. Metarhizium anisopliae pathogenesis of mosquito larvae: a verdict of accidental death.

    Butt, Tariq M; Greenfield, Bethany P J; Greig, Carolyn; Maffeis, Thierry G G; Taylor, James W D; Piasecka, Justyna; Dudley, Ed; Abdulla, Ahmed; Dubovskiy, Ivan M; Garrido-Jurado, Inmaculada; Quesada-Moraga, Enrique; Penny, Mark W; Eastwood, Daniel C

    2013-01-01

    Metarhizium anisopliae, a fungal pathogen of terrestrial arthropods, kills the aquatic larvae of Aedes aegypti, the vector of dengue and yellow fever. The fungus kills without adhering to the host cuticle. Ingested conidia also fail to germinate and are expelled in fecal pellets. This study investigates the mechanism by which this fungus adapted to terrestrial hosts kills aquatic mosquito larvae. Genes associated with the M. anisopliae early pathogenic response (proteinases Pr1 and Pr2, and adhesins, Mad1 and Mad2) are upregulated in the presence of larvae, but the established infection process observed in terrestrial hosts does not progress and insecticidal destruxins were not detected. Protease inhibitors reduce larval mortality indicating the importance of proteases in the host interaction. The Ae. aegypti immune response to M. anisopliae appears limited, whilst the oxidative stress response gene encoding for thiol peroxidase is upregulated. Cecropin and Hsp70 genes are downregulated as larval death occurs, and insect mortality appears to be linked to autolysis through caspase activity regulated by Hsp70 and inhibited, in infected larvae, by protease inhibitors. Evidence is presented that a traditional host-pathogen response does not occur as the species have not evolved to interact. M. anisopliae retains pre-formed pathogenic determinants which mediate host mortality, but unlike true aquatic fungal pathogens, does not recognise and colonise the larval host. PMID:24349111

  18. Occurrence of genes coding for MSCRAMM and biofilm-associated protein Bap in Staphylococcus spp. isolated from bovine subclinical mastitis and relationship with somatic cell counts.

    Zuniga, Eveline; Melville, Priscilla A; Saidenberg, André B S; Laes, Marco A; Gonsales, Fernanda F; Salaberry, Sandra R S; Gregori, Fabio; Brandão, Paulo E; dos Santos, Franklin G B; Lincopan, Nilton E; Benites, Nilson R

    2015-12-01

    This study aimed to elucidate aspects of the epidemiology of bovine subclinical mastitis through the assessment of genes encoding MSCRAMM (microbial surface components recognizing adhesive matrix molecules - a group of adhesins) and protein Bap (implicated in biofilm formation), in coagulase-positive (CPS) and coagulase-negative (CNS) Staphylococcus isolated from subclinical mastitis. Milk samples were collected for microbiological exams, somatic cell count (SCC) and a survey of the genes coding for MSCRAMM (cna, eno, ebpS, fnbA, fnbB and fib) and biofilm-associated protein Bap (bap) in 106 Staphylococcus spp. isolates using PCR. The frequencies of occurrence of eno (82.1%), fnbA (72.6%), fib (71.7%) and bap (56.6%) were higher (P < 0.0001) compared with the other assessed genes (cna, ebpS and fnbB). The higher frequency of occurrence (P < 0.005) of the bap gene in CNS compared with CPS suggests that in these species biofilm formation is an important mechanism for the persistence of the infection. The medians of the SCCs in the samples where eno, fnbA, fib and bap genes were detected were higher compared with Staphylococcus without the assessed genes (P < 0.05) and negative samples (P < 0.01), which indicated that the presence of these MSCRAMM may be related to a higher intensity of the inflammatory process. PMID:26318876

  19. The role of polar pili in the adherence of Pseudomonas aeruginosa to injured canine tracheal cells: a semiquantitative morphologic study.

    Zoutman, D E; Hulbert, W C; Pasloske, B L; Joffe, A M; Volpel, K; Trebilcock, M K; Paranchych, W

    1991-03-01

    Pseudomonas aeruginosa adheres to respiratory epithelial cells in a highly specific fashion. In order to study the role of P. aeruginosa polar pili in the adherence process we conducted a quantitative morphological electron microscopic examination of P. aeruginosa adherence to SO2 injured canine tracheal cells in vitro. A pilin lacking background strain of P. aeruginosa PAK (BLP2) was constructed using a gene replacement and it in turn was engineered to express either the pilin gene of P. aeruginosa PAO, PAK, or no pilin gene. After 30 minutes incubation of these bacterial strains with injured canine tracheal rings the P. aeruginosa strains expressing pili adhered quantitatively more to the injured tracheal cells than did the pili lacking strains. PAO bearing strains adhered in greater numbers than PAK bearing strains. Healthy tracheal cells did not have any bacteria bound to their surfaces. The bacteria bound to the cilia and lateral edge of the exfoliating tracheal cells. Invasion of tracheal cells by piliated P. aeruginosa bacteria and penetration into the submucosa was also demonstrated. These data confirm the role of pili as important adhesins to injured tracheal cells. The difference in the adherence characteristics of pilin types PAK versus PAO may relate to the differences in the primary structure of these two pilin molecules. PMID:1675811

  20. BB0172, a Borrelia burgdorferi outer membrane protein that binds integrin α3β1.

    Wood, Elaine; Tamborero, Silvia; Mingarro, Ismael; Esteve-Gassent, Maria D

    2013-08-01

    Lyme disease is a multisystemic disorder caused by Borrelia burgdorferi infection. Upon infection, some B. burgdorferi genes are upregulated, including members of the microbial surface components recognizing adhesive matrix molecule (MSCRAMM) protein family, which facilitate B. burgdorferi adherence to extracellular matrix components of the host. Comparative genome analysis has revealed a new family of B. burgdorferi proteins containing the von Willebrand factor A (vWFA) domain. In the present study, we characterized the expression and membrane association of the vWFA domain-containing protein BB0172 by using in vitro transcription/translation systems in the presence of microsomal membranes and with detergent phase separation assays. Our results showed evidence of BB0172 localization in the outer membrane, the orientation of the vWFA domain to the extracellular environment, and its function as a metal ion-dependent integrin-binding protein. This is the first report of a borrelial adhesin with a metal ion-dependent adhesion site (MIDAS) motif that is similar to those observed in eukaryotic integrins and has a similar function. PMID:23687274

  1. A crystallizable form of the Streptococcus gordonii surface antigen SspB C-domain obtained by limited proteolysis

    The C-terminal domain of the S. gordonii surface protein SspB has been expressed, purified and crystallized. Diffraction data have been collected to 2.1 Å resolution. SspB is a 1500-residue adhesin expressed on the surface of the oral bacterium Streptococcus gordonii. Its interaction with other bacteria and host cells initiates the development of dental plaque. The full-length C-terminal domain of SspB was cloned, overexpressed in Escherichia coli and purified. However, the protein could not be crystallized. Limited proteolysis of the full-length C-domain identified a core fragment. The proteolysis product was cloned, expressed and purified. The protein was crystallized using the hanging-drop vapour-diffusion method. X-ray data were collected and processed to a maximum resolution of 2.1 Å with 96.4% completeness. The crystals belonged to space group P21, with one molecule in the asymmetric unit, a solvent content of 33.7% and a corresponding Matthews coefficient of 1.85 Å3 Da−1

  2. Genome of Herbaspirillum seropedicae strain SmR1, a specialized diazotrophic endophyte of tropical grasses.

    Fábio O Pedrosa

    2011-05-01

    Full Text Available The molecular mechanisms of plant recognition, colonization, and nutrient exchange between diazotrophic endophytes and plants are scarcely known. Herbaspirillum seropedicae is an endophytic bacterium capable of colonizing intercellular spaces of grasses such as rice and sugar cane. The genome of H. seropedicae strain SmR1 was sequenced and annotated by The Paraná State Genome Programme--GENOPAR. The genome is composed of a circular chromosome of 5,513,887 bp and contains a total of 4,804 genes. The genome sequence revealed that H. seropedicae is a highly versatile microorganism with capacity to metabolize a wide range of carbon and nitrogen sources and with possession of four distinct terminal oxidases. The genome contains a multitude of protein secretion systems, including type I, type II, type III, type V, and type VI secretion systems, and type IV pili, suggesting a high potential to interact with host plants. H. seropedicae is able to synthesize indole acetic acid as reflected by the four IAA biosynthetic pathways present. A gene coding for ACC deaminase, which may be involved in modulating the associated plant ethylene-signaling pathway, is also present. Genes for hemagglutinins/hemolysins/adhesins were found and may play a role in plant cell surface adhesion. These features may endow H. seropedicae with the ability to establish an endophytic life-style in a large number of plant species.

  3. Silver-doped hydroxyapatite coatings formed on Ti-6Al-4V substrates and their characterization.

    Yanovska, A A; Stanislavov, A S; Sukhodub, L B; Kuznetsov, V N; Illiashenko, V Yu; Danilchenko, S N; Sukhodub, L F

    2014-03-01

    Coatings with antibacterial components for medical implants are recommended to reduce the risk of bacterial infections. Therefore hydroxyapatite (HA) coatings with addition of chitosan (CS) and silver (Ag) are proposed in this work in an attempt to resolve this problem. Ti-6Al-4V substrates were modified by a chitosan film to study the influence of surface modification on the formation of the HA-Ag and HA-CS-Ag coatings. Using a thermal substrate method, HA and HA-CS coatings doped with Ag(+) were prepared at low substrate temperatures (90°C). Coated surfaces were examined using X-ray diffraction and scanning electron microscopy. The amount of silver in the deposited coatings was analyzed by atomic absorption spectroscopy. From this study it is concluded that the substrate surface modified by a chitosan film promotes the coating formation and increases the antibacterial activity of produced coatings against a strain of Escherichia coli. The adhesion of E. coli (ATCC 25922) to sheep erythrocytes was decreased by 14% as compared with the reference samples without Ag. It could be explained by the inhibition of bacterial adhesins by Ag(+) ions released. The combined action of silver ions and chitosan resulted in a 21% decrease in adhesive index. PMID:24433906

  4. Alteration of the Microbiota and Virulence Gene Expression in E. coli O157:H7 in Pig Ligated Intestine with and without AE Lesions.

    Bianfang Liu

    Full Text Available Previously we found that E. coli O157:H7 inoculated into ligated pig intestine formed attaching and effacing (AE lesions in some pigs but not in others. The present study evaluated changes in the microbial community and in virulence gene expression in E. coli O157:H7 in ligated pig intestine in which the bacteria formed AE lesions or failed to form AE lesions.The intestinal microbiota was assessed by RNA-based denaturing gradient gel electrophoresis (DGGE analysis. The DGGE banding patterns showed distinct differences involving two bands which had increased intensity specifically in AE-negative pigs (AE- bands and several bands which were more abundant in AE-positive pigs. Sequence analysis revealed that the two AE- bands belonged to Veillonella caviae, a species with probiotic properties, and Bacteroides sp. Concurrent with the differences in microbiota, gene expression analysis by quantitative PCR showed that, compared with AE negative pigs, E. coli O157:H7 in AE positive pigs had upregulated genes for putative adhesins, non-LEE encoded nleA and quorum sensing qseF, acid resistance gene ureD, and genes from the locus of enterocyte effacement (LEE.The present study demonstrated that AE-positive pigs had reduced activities or populations of Veillonella caviae and Bacterioides sp. compared with AE-negative pigs. Further studies are required to understand how the microbiota was changed and the role of these organisms in the control of E. coli O157:H7.

  5. Targeted gene disruption in Candida parapsilosis demonstrates a role for CPAR2_404800 in adhesion to a biotic surface and in a murine model of ascending urinary tract infection.

    Bertini, Alessia; Zoppo, Marina; Lombardi, Lisa; Rizzato, Cosmeri; De Carolis, Elena; Vella, Antonietta; Torelli, Riccardo; Sanguinetti, Maurizio; Tavanti, Arianna

    2016-02-17

    Candida parapsilosis is an emerging opportunistic pathogen, second in frequency only to C. albicans and commonly associated with both mucosal and systemic infections. Adhesion to biotic surfaces is a key step for the development of mycoses. The C. parapsilosis genome encodes 5 predicted agglutinin-like sequence proteins and their precise role in the adhesion process still remains to be elucidated. In this study, we focused on the putative adhesin Cpar2_404800, in view of its high homology to the most important adhesion molecule in C. albicans. Two independent lineages of C. parapsilosis CPAR2_404800 heterozygous and null mutants were obtained by site-specific deletion. CPAR2_404800 mutants did not differ from wild-type strain in terms of in vitro growth or in their ability to undergo morphogenesis. However, when compared for adhesion to a biotic surface, CPAR2_404800 null mutants exhibited a marked reduction in their adhesion to buccal epithelial cells (>60% reduction of adhesion index). Reintroduction of one copy of CPAR2_404800 gene in the null background restored wild type phenotype. A murine model of urinary tract infection was used to elucidate the in vivo contribution of CPAR2_404800. A 0.5 and 1 log10 reduction in colony forming unit numbers (per gram) was observed respectively in bladder and kidneys obtained from mice infected with null mutant compared to wild-type infected ones. Taken together, these findings provide the first evidence for a direct role of CPAR2_404800 in C. parapsilosis adhesion to host surfaces and demonstrate its contribution to the pathogenesis of murine urinary candidiasis. PMID:26632333

  6. Genome sequence of Helicobacter suis supports its role in gastric pathology

    Vermoote Miet

    2011-03-01

    Full Text Available Abstract Helicobacter (H. suis has been associated with chronic gastritis and ulcers of the pars oesophagea in pigs, and with gastritis, peptic ulcer disease and gastric mucosa-associated lymphoid tissue lymphoma in humans. In order to obtain better insight into the genes involved in pathogenicity and in the specific adaptation to the gastric environment of H. suis, a genome analysis was performed of two H. suis strains isolated from the gastric mucosa of swine. Homologs of the vast majority of genes shown to be important for gastric colonization of the human pathogen H. pylori were detected in the H. suis genome. H. suis encodes several putative outer membrane proteins, of which two similar to the H. pylori adhesins HpaA and HorB. H. suis harbours an almost complete comB type IV secretion system and members of the type IV secretion system 3, but lacks most of the genes present in the cag pathogenicity island of H. pylori. Homologs of genes encoding the H. pylori neutrophil-activating protein and γ-glutamyl transpeptidase were identified in H. suis. H. suis also possesses several other presumptive virulence-associated genes, including homologs for mviN, the H. pylori flavodoxin gene, and a homolog of the H. pylori vacuolating cytotoxin A gene. It was concluded that although genes coding for some important virulence factors in H. pylori, such as the cytotoxin-associated protein (CagA, are not detected in the H. suis genome, homologs of other genes associated with colonization and virulence of H. pylori and other bacteria are present.

  7. Structural insight into the role of Streptococcus parasanguinis Fap1 within oral biofilm formation

    Highlights: ► Crystal structure of Streptococcus parasanguinis Fap1-NRα at pH 5.0. ► pH-dependent conformational changes mediated through electrostatic potential of Fap1-NRα. ► Fap1 facilitates pH-dependent biofilms. ► We model inter-Fap1 biofilm interactions. -- Abstract: The fimbriae-associated protein 1 (Fap1) is a major adhesin of Streptococcus parasanguinis, a primary colonizer of the oral cavity that plays an important role in the formation of dental plaque. Fap1 is an extracellular adhesive surface fibre belonging to the serine-rich repeat protein (SRRP) family, which plays a central role in the pathogenesis of streptococci and staphylococci. The N-terminal adhesive region of Fap1 (Fap1-NR) is composed of two domains (Fap1-NRα and Fap1-NRβ) and is projected away from the bacterial surface via the extensive serine-rich repeat region, for adhesion to the salivary pellicle. The adhesive properties of Fap1 are modulated through a pH switch in which a reduction in pH results in a rearrangement between the Fap1-NRα and Fap1-NRβ domains, which assists in the survival of S. parasanguinis in acidic environments. We have solved the structure of Fap1-NRα at pH 5.0 at 3.0 A resolution and reveal how subtle rearrangements of the 3-helix bundle combined with a change in electrostatic potential mediates ‘opening’ and activation of the adhesive region. Further, we show that pH-dependent changes are critical for biofilm formation and present an atomic model for the inter-Fap1-NR interactions which have been assigned an important role in the biofilm formation.

  8. Virulence versus fitness determinants in Escherichia coli isolated from asymptomatic bacteriuria in healthy nonpregnant women

    Sugandha Srivastava

    2016-01-01

    Full Text Available Purpose: Escherichia coli isolated from asymptomatic bacteriuria (ABU correlated genotypically and phenotypically with cystitis isolates may help in distinguishing urovirulence determinants from 'fitness factors', latter necessary only for survival of E. coli in urinary tract; for gaining insight into the pathogenesis of urinary tract infection. Materials and Methods: In this cross-sectional study, we compared genotypic (phylogroups and 15 putative virulence genes, and phenotypic profiles of ABU E. coli strains with our previously genotyped collection of cystitis isolates. Virulence score was calculated for each isolate as a number of virulence genes detected. Results: Significant differences were observed in the proportion of four phylogenetic groups (P = 0.009 amongst cystitis and ABU isolates. Average virulence score was higher for ABU isolates (6.6 than cystitis strains (4.2; and hlyA (P = 0.001, cytotoxic necrotising factor 1 (P = 0.00, fyuA (P = 0.00, ibeA (P = 0.00, kpsMII (P = 0.01, and malX/pathogenicity-associated island (P = 0.01 were more frequently present in ABU strains. Conclusions: The expression of adhesins, haemolysin, aerobactin, and capsule synthesis gene were similar in two groups suggesting their role as fitness factors. ABU isolates were better biofilm producers, reflecting its importance in silent persistence. Serum resistance gene which was more expressed in cystitis isolates may represent virulence determinant. Genetic makeup of E. coli does not change much rather genes helping in survival and colonisation are expressed equally in ABU and cystitis isolates as opposed to phenotypic attenuation of those that helps in invasion or inflammation in ABU isolates.

  9. A three-way comparative genomic analysis of Mannheimia haemolytica isolates

    McDermott Jason E

    2010-10-01

    Full Text Available Abstract Background Mannhemia haemolytica is a Gram-negative bacterium and the principal etiological agent associated with bovine respiratory disease complex. They transform from a benign commensal to a deadly pathogen, during stress such as viral infection and transportation to feedlots and cause acute pleuropneumonia commonly known as shipping fever. The U.S beef industry alone loses more than one billion dollars annually due to shipping fever. Despite its enormous economic importance there are no specific and accurate genetic markers, which will aid in understanding the pathogenesis and epidemiology of M. haemolytica at molecular level and assist in devising an effective control strategy. Description During our comparative genomic sequence analysis of three Mannheimia haemolytica isolates, we identified a number of genes that are unique to each strain. These genes are "high value targets" for future studies that attempt to correlate the variable gene pool with phenotype. We also identified a number of high confidence single nucleotide polymorphisms (hcSNPs spread throughout the genome and focused on non-synonymous SNPs in known virulence genes. These SNPs will be used to design new hcSNP arrays to study variation across strains, and will potentially aid in understanding gene regulation and the mode of action of various virulence factors. Conclusions During our analysis we identified previously unknown possible type III secretion effector proteins, clustered regularly interspaced short palindromic repeats (CRISPR and CRISPR-associated sequences (Cas. The presence of CRISPR regions is indicative of likely co-evolution with an associated phage. If proven functional, the presence of a type III secretion system in M. haemolytica will help us re-evaluate our approach to study host-pathogen interactions. We also identified various adhesins containing immuno-dominant domains, which may interfere with host-innate immunity and which could potentially

  10. Characterization of Hospital-Associated Lineages of Ampicillin-Resistant Enterococcus faecium from Clinical Cases in Dogs and Humans

    MarieArchambault

    2013-08-01

    Full Text Available Ampicillin-resistant Enterococcus faecium (ARE has rapidly emerged worldwide and is one of the most important nosocomial pathogens. However, very few reports are available on ARE isolates from canine clinical cases. The objective of this study was to characterize ARE strains of canine clinical origin from a veterinary teaching hospital in Canada and to compare them with human strains. Ten ARE strains from dogs and humans were characterized by multilocus sequence typing (MLST, pulsed field gel electrophoresis (PFGE, antibiotic susceptibility and biofilm activities, presence of rep-families, CRISPR-cas and putative virulence genes. All ARE strains (n = 10 were resistant to ciprofloxacin and lincomycin. Resistances to tetracycline (n = 6, macrolides (n = 6, and to high concentrations of gentamicin, kanamycin and streptomycin (n = 5 were also observed. Canine ARE isolates were found to be susceptible to vancomycin whereas resistance to this antibiotic was observed in human strains. Ampicillin resistance was linked to PBP5 showing mutations at 25 amino acid positions. Fluoroquinolone resistance was attributable to ParC, GyrA, and GyrB mutations. Data demonstrated that all canine ARE were acm (collagen binding protein-positive and that most harbored the efaAfm gene, encoding for a cell wall adhesin. Biofilm formation was observed in two human strains but not in canine strains. Two to five rep-families were observed per strain but no CRISPR sequences were found. A total of six STs (1, 18, 65, 202, 205, and 803 were found with one belonging to a new ST (ST803. These STs were identical or closely related to human hospital-associated lineages. This report describes for the first time the characterization of canine ARE hospital-associated strains in Canada and also supports the importance of prudent antibiotic use in veterinary medicine to avoid zoonotic spread of canine ARE.

  11. What Makes a Bacterial Species Pathogenic?:Comparative Genomic Analysis of the Genus Leptospira.

    Derrick E Fouts

    2016-02-01

    Full Text Available Leptospirosis, caused by spirochetes of the genus Leptospira, is a globally widespread, neglected and emerging zoonotic disease. While whole genome analysis of individual pathogenic, intermediately pathogenic and saprophytic Leptospira species has been reported, comprehensive cross-species genomic comparison of all known species of infectious and non-infectious Leptospira, with the goal of identifying genes related to pathogenesis and mammalian host adaptation, remains a key gap in the field. Infectious Leptospira, comprised of pathogenic and intermediately pathogenic Leptospira, evolutionarily diverged from non-infectious, saprophytic Leptospira, as demonstrated by the following computational biology analyses: 1 the definitive taxonomy and evolutionary relatedness among all known Leptospira species; 2 genomically-predicted metabolic reconstructions that indicate novel adaptation of infectious Leptospira to mammals, including sialic acid biosynthesis, pathogen-specific porphyrin metabolism and the first-time demonstration of cobalamin (B12 autotrophy as a bacterial virulence factor; 3 CRISPR/Cas systems demonstrated only to be present in pathogenic Leptospira, suggesting a potential mechanism for this clade's refractoriness to gene targeting; 4 finding Leptospira pathogen-specific specialized protein secretion systems; 5 novel virulence-related genes/gene families such as the Virulence Modifying (VM (PF07598 paralogs proteins and pathogen-specific adhesins; 6 discovery of novel, pathogen-specific protein modification and secretion mechanisms including unique lipoprotein signal peptide motifs, Sec-independent twin arginine protein secretion motifs, and the absence of certain canonical signal recognition particle proteins from all Leptospira; and 7 and demonstration of infectious Leptospira-specific signal-responsive gene expression, motility and chemotaxis systems. By identifying large scale changes in infectious (pathogenic and intermediately

  12. Cloning and Expression of Helicobacter pylori HpaA Gene

    Moein Farshchian

    2009-01-01

    Full Text Available Objective: Helicobacter pylori is associated with chronic gastritis, peptic ulcers, gastric adenocarcinomaand gastric mucosa-associated lymphoid tissue (MALT lymphoma. Antibiotictherapies do not protect from potential re-infection and have a risk for development of drugresistance. Therefore, prophylactic vaccine mediated protection against H. pylori is an attractiveclinical interest. H. pylori adhesin A (HpaA is a conserved surface lipoprotein and playsimportant roles in the pathogenesis of infection. In this study the recombinant protein (rHpaAwas over-expressed in E.coli.Materials and Methods: The hpaA gene was amplified by PCR. Prokaryote expression vectorpET28a-hpaA was constructed, and used to transform E.coli BL21DE3. The expressionof recombinant protein induced by IPTG was examined by SDS-PAGE. Western blot wereused to determine immunoreactivity of rHpaA by a rabbit polyclonal antibodies against wholecell of H. pylori.Results: The hpaA gene nucleotide sequence in the recombinant plasmid vector of pET-28-a-hpaA was consistent with that of H.pylori hpaA as published in the GenBank. SDS-PAGEdemonstrated that the constructed prokaryotic expression efficiently produced rHpaA at the1.5 mmol/L of IPTG. HpaA fusion protein was able to react with the rabbit polyclonal antibodyagainst whole cells of H. pylori.Conclusion: A prokaryotic expression system pET-28a-hpaA-BL21 with high efficiency of H.pylori hpaA gene was successfully established and the HpaA fusion protein showed satisfactoryimmunoreactivity. These results indicate that production of a specific recombinant proteinis an alternative and potentially more expeditious strategy for development of H. pylori vaccine.

  13. Transformed Recombinant Enrichment Profiling Rapidly Identifies HMW1 as an Intracellular Invasion Locus in Haemophilus influenza

    Moleres, Javier; Sinha, Sunita; Fernández-Calvet, Ariadna; Porsch, Eric A.; St. Geme, Joseph W.; Nislow, Corey; Redfield, Rosemary J.; Garmendia, Junkal

    2016-01-01

    Many bacterial species actively take up and recombine homologous DNA into their genomes, called natural competence, a trait that offers a means to identify the genetic basis of naturally occurring phenotypic variation. Here, we describe “transformed recombinant enrichment profiling” (TREP), in which natural transformation is used to generate complex pools of recombinants, phenotypic selection is used to enrich for specific recombinants, and deep sequencing is used to survey for the genetic variation responsible. We applied TREP to investigate the genetic architecture of intracellular invasion by the human pathogen Haemophilus influenzae, a trait implicated in persistence during chronic infection. TREP identified the HMW1 adhesin as a crucial factor. Natural transformation of the hmw1 operon from a clinical isolate (86-028NP) into a laboratory isolate that lacks it (Rd KW20) resulted in ~1,000-fold increased invasion into airway epithelial cells. When a distinct recipient (Hi375, already possessing hmw1 and its paralog hmw2) was transformed by the same donor, allelic replacement of hmw2AHi375 by hmw1A86-028NP resulted in a ~100-fold increased intracellular invasion rate. The specific role of hmw1A86-028NP was confirmed by mutant and western blot analyses. Bacterial self-aggregation and adherence to airway cells were also increased in recombinants, suggesting that the high invasiveness induced by hmw1A86-028NP might be a consequence of these phenotypes. However, immunofluorescence results found that intracellular hmw1A86-028NP bacteria likely invaded as groups, instead of as individual bacterial cells, indicating an emergent invasion-specific consequence of hmw1A-mediated self-aggregation. PMID:27124727

  14. Structure and molecular characterization of Streptococcus pneumoniae capsular polysaccharide 10F by carbohydrate engineering in Streptococcus oralis.

    Yang, Jinghua; Shelat, Nirav Y; Bush, C Allen; Cisar, John O

    2010-07-30

    Although closely related at the molecular level, the capsular polysaccharide (CPS) of serotype 10F Streptococcus pneumoniae and coaggregation receptor polysaccharide (RPS) of Streptococcus oralis C104 have distinct ecological roles. CPS prevents phagocytosis of pathogenic S. pneumoniae, whereas RPS of commensal S. oralis functions as a receptor for lectin-like adhesins on other members of the dental plaque biofilm community. Results from high resolution NMR identified the recognition region of S. oralis RPS (i.e. Galfbeta1-6GalNAcbeta1-3Galalpha) in the hexasaccharide repeat of S. pneumoniae CPS10F. The failure of this polysaccharide to support fimbriae-mediated adhesion of Actinomyces naeslundii was explained by the position of Galf, which occurred as a branch in CPS10F rather than within the linear polysaccharide chain, as in RPS. Carbohydrate engineering of S. oralis RPS with wzy from S. pneumoniae attributed formation of the Galf branch in CPS10F to the linkage of adjacent repeating units through sub terminal GalNAc in Galfbeta1-6GalNAcbeta1-3Galalpha rather than through terminal Galf, as in RPS. A gene (wcrD) from serotype 10A S. pneumoniae was then used to engineer a linear surface polysaccharide in S. oralis that was identical to RPS except for the presence of a beta1-3 linkage between Galf and GalNAcbeta1-3Galalpha. This polysaccharide also failed to support adhesion of A. naeslundii, thereby establishing the essential role of beta1-6-linked Galf in recognition of adjacent GalNAcbeta1-3Galalpha in wild-type RPS. These findings, which illustrate a molecular approach for relating bacterial polysaccharide structure to function, provide insight into the possible evolution of S. oralis RPS from S. pneumoniae CPS. PMID:20507989

  15. Burkholderia cenocepacia BC2L-C is a super lectin with dual specificity and proinflammatory activity.

    Ondřej Sulák

    2011-09-01

    Full Text Available Lectins and adhesins are involved in bacterial adhesion to host tissues and mucus during early steps of infection. We report the characterization of BC2L-C, a soluble lectin from the opportunistic pathogen Burkholderia cenocepacia, which has two distinct domains with unique specificities and biological activities. The N-terminal domain is a novel TNF-α-like fucose-binding lectin, while the C-terminal part is similar to a superfamily of calcium-dependent bacterial lectins. The C-terminal domain displays specificity for mannose and l-glycero-d-manno-heptose. BC2L-C is therefore a superlectin that binds independently to mannose/heptose glycoconjugates and fucosylated human histo-blood group epitopes. The apo form of the C-terminal domain crystallized as a dimer, and calcium and mannose could be docked in the binding site. The whole lectin is hexameric and the overall structure, determined by electron microscopy and small angle X-ray scattering, reveals a flexible arrangement of three mannose/heptose-specific dimers flanked by two fucose-specific TNF-α-like trimers. We propose that BC2L-C binds to the bacterial surface in a mannose/heptose-dependent manner via the C-terminal domain. The TNF-α-like domain triggers IL-8 production in cultured airway epithelial cells in a carbohydrate-independent manner, and is therefore proposed to play a role in the dysregulated proinflammatory response observed in B. cenocepacia lung infections. The unique architecture of this newly recognized superlectin correlates with multiple functions including bacterial cell cross-linking, adhesion to human epithelia, and stimulation of inflammation.

  16. Enterococci from foods.

    Giraffa, Giorgio

    2002-06-01

    Enterococci have recently emerged as nosocomial pathogens. Their ubiquitous nature determines their frequent finding in foods as contaminants. In addition, the notable resistance of enterococci to adverse environmental conditions explains their ability to colonise different ecological niches and their spreading within the food chain through contaminated animals and foods. Enterococci can also contaminate finished products, such as fermented foods and, for this reason, their presence in many foods (such as cheeses and fermented sausages) can only be limited but not completely eliminated using traditional processing technologies. Enterococci are low grade pathogens but their intrinsic resistance to many antibiotics and their acquisition of resistance to the few antibiotics available for treatment in clinical therapy, such as the glycopeptides, have led to difficulties and a search for new drugs and therapeutic options. Enterococci can cause food intoxication through production of biogenic amines and can be a reservoir for worrisome opportunistic infections and for virulence traits. Clearly, there is no consensus on the acceptance of their presence in foodstuffs and their role as primary pathogens is still a question mark. In this review, the following topics will be covered: (i) emergence of the enterococci as human pathogens due to the presence of virulence factors such as the production of adhesins and aggregation substances, or the production of biogenic amines in fermented foods; (ii) their presence in foods; (iii) their involvement in food-borne illnesses; (iv) the presence, selection and spreading of antibiotic-resistant enterococci as opportunistic pathogens in foods, with particular emphasis on vancomycin-resistant enterococci. PMID:12069881

  17. Quantitative analysis of Plasmodium ookinete motion in three dimensions suggests a critical role for cell shape in the biomechanics of malaria parasite gliding motility.

    Kan, Andrey; Tan, Yan-Hong; Angrisano, Fiona; Hanssen, Eric; Rogers, Kelly L; Whitehead, Lachlan; Mollard, Vanessa P; Cozijnsen, Anton; Delves, Michael J; Crawford, Simon; Sinden, Robert E; McFadden, Geoffrey I; Leckie, Christopher; Bailey, James; Baum, Jake

    2014-05-01

    Motility is a fundamental part of cellular life and survival, including for Plasmodium parasites--single-celled protozoan pathogens responsible for human malaria. The motile life cycle forms achieve motility, called gliding, via the activity of an internal actomyosin motor. Although gliding is based on the well-studied system of actin and myosin, its core biomechanics are not completely understood. Currently accepted models suggest it results from a specifically organized cellular motor that produces a rearward directional force. When linked to surface-bound adhesins, this force is passaged to the cell posterior, propelling the parasite forwards. Gliding motility is observed in all three life cycle stages of Plasmodium: sporozoites, merozoites and ookinetes. However, it is only the ookinetes--formed inside the midgut of infected mosquitoes--that display continuous gliding without the necessity of host cell entry. This makes them ideal candidates for invasion-free biomechanical analysis. Here we apply a plate-based imaging approach to study ookinete motion in three-dimensional (3D) space to understand Plasmodium cell motility and how movement facilitates midgut colonization. Using single-cell tracking and numerical analysis of parasite motion in 3D, our analysis demonstrates that ookinetes move with a conserved left-handed helical trajectory. Investigation of cell morphology suggests this trajectory may be based on the ookinete subpellicular cytoskeleton, with complementary whole and subcellular electron microscopy showing that, like their motion paths, ookinetes share a conserved left-handed corkscrew shape and underlying twisted microtubular architecture. Through comparisons of 3D movement between wild-type ookinetes and a cytoskeleton-knockout mutant we demonstrate that perturbation of cell shape changes motion from helical to broadly linear. Therefore, while the precise linkages between cellular architecture and actomyosin motor organization remain unknown, our

  18. Silver-doped hydroxyapatite coatings formed on Ti–6Al–4V substrates and their characterization

    Yanovska, A.A., E-mail: biophy@yandex.ru [Institute of Applied Physics National Academy of Sciences of Ukraine, 58, Sumy 40000 (Ukraine); Stanislavov, A.S. [Institute of Applied Physics National Academy of Sciences of Ukraine, 58, Sumy 40000 (Ukraine); Sukhodub, L.B. [Institute of Microbiology and Immunology, National Academy of Medical Sciences of Ukraine, 14-Puschinskaya St., Kharkov 61057 (Ukraine); Kuznetsov, V.N.; Illiashenko, V.Yu.; Danilchenko, S.N. [Institute of Applied Physics National Academy of Sciences of Ukraine, 58, Sumy 40000 (Ukraine); Sukhodub, L.F. [Sumy State University, Medical Institute, Ministry of Education and Science of Ukraine, R. Korsakova Str. 2, Sumy 40007 (Ukraine)

    2014-03-01

    Coatings with antibacterial components for medical implants are recommended to reduce the risk of bacterial infections. Therefore hydroxyapatite (HA) coatings with addition of chitosan (CS) and silver (Ag) are proposed in this work in an attempt to resolve this problem. Ti–6Al–4V substrates were modified by a chitosan film to study the influence of surface modification on the formation of the HA–Ag and HA–CS–Ag coatings. Using a thermal substrate method, HA and HA–CS coatings doped with Ag{sup +} were prepared at low substrate temperatures (90 °C). Coated surfaces were examined using X-ray diffraction and scanning electron microscopy. The amount of silver in the deposited coatings was analyzed by atomic absorption spectroscopy. From this study it is concluded that the substrate surface modified by a chitosan film promotes the coating formation and increases the antibacterial activity of produced coatings against a strain of Escherichia coli. The adhesion of E. coli (ATCC 25922) to sheep erythrocytes was decreased by 14% as compared with the reference samples without Ag. It could be explained by the inhibition of bacterial adhesins by Ag{sup +} ions released. The combined action of silver ions and chitosan resulted in a 21% decrease in adhesive index. - Highlights: • Silver doped hydroxyapatite (HA) coatings are deposited by thermal substrate method. • Surface modification of Ti–6Al–4V substrates by chitosan film is proposed. • The influence of surface modification on HA–Ag coating formation is investigated. • Substrates modified by a chitosan film promote the nucleation of the HA coatings. • Antibacterial effect on the E. coli is more expressed for coatings on modified surface.

  19. Global Pattern of Gene Expression of Xanthomonas axonopodis pv. glycines Within Soybean Leaves.

    Chatnaparat, Tiyakhon; Prathuangwong, Sutruedee; Lindow, Steven E

    2016-06-01

    To better understand the behavior of Xanthomonas axonopodis pv. glycines, the causal agent of bacterial pustule of soybean within its host, its global transcriptome within soybean leaves was compared with that in a minimal medium in vitro, using deep sequencing of mRNA. Of 5,062 genes predicted from a draft genome of X. axonopodis pv. glycines, 534 were up-regulated in the plant, while 289 were down-regulated. Genes encoding YapH, a cell-surface adhesin, as well as several others encoding cell-surface proteins, were down-regulated in soybean. Many genes encoding the type III secretion system and effector proteins, cell wall-degrading enzymes and phosphate transporter proteins were strongly expressed at early stages of infection. Several genes encoding RND multidrug efflux pumps were induced in planta and by isoflavonoids in vitro and were required for full virulence of X. axonopodis pv. glycines, as well as resistance to soybean phytoalexins. Genes encoding consumption of malonate, a compound abundant in soybean, were induced in planta and by malonate in vitro. Disruption of the malonate decarboxylase operon blocked growth in minimal media with malonate as the sole carbon source but did not significantly alter growth in soybean, apparently because genes for sucrose and fructose uptake were also induced in planta. Many genes involved in phosphate metabolism and uptake were induced in planta. While disruption of genes encoding high-affinity phosphate transport did not alter growth in media varying in phosphate concentration, the mutants were severely attenuated for growth in soybean. This global transcriptional profiling has provided insight into both the intercellular environment of this soybean pathogen and traits used by X. axonopodis pv. glycines to promote disease. PMID:27003800

  20. Correlation between virulence factors and in vitro biofilm formation by Escherichia coli strains.

    Naves, Plínio; del Prado, Gema; Huelves, Lorena; Gracia, Matilde; Ruiz, Vicente; Blanco, Jorge; Dahbi, Ghizlane; Blanco, Miguel; Ponte, María del Carmen; Soriano, Francisco

    2008-08-01

    The ability of 15 Escherichia coli strains to form biofilms on polystirene plates was studied. The strains were serotyped, and their phenotypic expression of surface virulence factors (VFs), and antibiotic susceptibility was also determined. Moreover, 30 VFs-associated genes were analysed, including 15 adhesins (papC, papG and its three alleles, sfa/focDE, sfaS, focG, afa/draBC, iha, bmaE, gafD, nfaE, fimH, fimAvMT78, agn43, F9 fimbriae and type 3 fimbriae-encoding gene clusters), four toxins (hlyA, cnf1, sat and tsh), four siderophore (iron, fyuA, iutA and iucD), five proctetins/invasion-encoding genes (kpsM II, kpsMT III, K1 kps variant- neuC, traT and ibeA), and the pathogenicity island malX and cvaC. Morphological appearance and thickness of biofilms of two strong and three weak biofilm producers were also studied by confocal laser scanning microscopy (CLSM). Seven strains were classified as strong biofilm producers and the remaining eight strains were regarded as weak biofilm producers. Mannose-resistant haemagglutination was the only phenotypically expressed surface virulence factor more frequently found in the strong biofilm group. Five virulence-associated genes were more common (p<0.05) in strong biofilm producers: papC and papG alleles, sfa/focDE, focG, hlyA and cnf1. CLSM images showed irregular biofilms with projections at the top mainly in strong biofilm. PMID:18486439