WorldWideScience

Sample records for activity promotes dna

  1. Prediction of fine-tuned promoter activity from DNA sequence

    Siwo, Geoffrey; Rider, Andrew; Tan, Asako; Pinapati, Richard; Emrich, Scott; Chawla, Nitesh; Ferdig, Michael

    2016-01-01

    The quantitative prediction of transcriptional activity of genes using promoter sequence is fundamental to the engineering of biological systems for industrial purposes and understanding the natural variation in gene expression. To catalyze the development of new algorithms for this purpose, the Dialogue on Reverse Engineering Assessment and Methods (DREAM) organized a community challenge seeking predictive models of promoter activity given normalized promoter activity data for 90 ribosomal protein promoters driving expression of a fluorescent reporter gene. By developing an unbiased modeling approach that performs an iterative search for predictive DNA sequence features using the frequencies of various k-mers, inferred DNA mechanical properties and spatial positions of promoter sequences, we achieved the best performer status in this challenge. The specific predictive features used in the model included the frequency of the nucleotide G, the length of polymeric tracts of T and TA, the frequencies of 6 distinct trinucleotides and 12 tetranucleotides, and the predicted protein deformability of the DNA sequence. Our method accurately predicted the activity of 20 natural variants of ribosomal protein promoters (Spearman correlation r = 0.73) as compared to 33 laboratory-mutated variants of the promoters (r = 0.57) in a test set that was hidden from participants. Notably, our model differed substantially from the rest in 2 main ways: i) it did not explicitly utilize transcription factor binding information implying that subtle DNA sequence features are highly associated with gene expression, and ii) it was entirely based on features extracted exclusively from the 100 bp region upstream from the translational start site demonstrating that this region encodes much of the overall promoter activity. The findings from this study have important implications for the engineering of predictable gene expression systems and the evolution of gene expression in naturally occurring

  2. Regularities in the E.coli promoters composition in connection with the DNA strands interaction and promoter activity

    BEREZHNOY Andrey Yu; SHCKORBATOV Yuriy G.; HISANORI Kiryu

    2006-01-01

    The energy of interaction between DNA strands in promoters is of great functional importance. Visualization of the energy of DNA strands distribution in promoter sequences was achieved. The separation of promoters in groups by their energetic properties enables evaluation of the dependence of promoter strength on the energetic properties. The analysis of groups (clusters)of promoters distributed by the energy of DNA strands interaction in -55, -35, -10 and +6 sequences indicates their connection with the transcriptional activity.

  3. nifH Promoter Activity Is Regulated by DNA Supercoiling in Sinorhizobium meliloti

    Yan-Jie LIU; Biao HU; Jia-Bi ZHU; Shan-Jiong SHEN; Guan-Qiao YU

    2005-01-01

    In prokaryotes, DNA supercoiling regulates the expression of many genes; for example, the expression of Klebsiella pneumoniae nifLA operon depends on DNA negative supercoiling in anaerobically grown cells, which indicates that DNA supercoiling might play a role in gene regulation of the anaerobic response. Since the expression of the nifH promoter in Sinorhizobium meliloti is not repressed by oxygen, it is proposed that the status of DNA supercoiling may not affect the expression of the nifH promoter. We tested this hypothesis by analyzing nifH promoter activity in wild-type and gyr- Escherichia coli in the presence and absence of DNA gyrase inhibitors. Our results show that gene expression driven by the S.meliloti nifH promoter requires the presence of active DNA gyrase. Because DNA gyrase increases the number of negative superhelical turns in DNA in the presence of ATP, our data indicate that negative supercoiling is also important for nifH promoter activity. Our study also shows that the DNA supercoilingdependent S. meliloti nifH promoter activity is related to the trans-acting factors NtrC and NifA that activate it. DNA supercoiling appeared to have a stronger effect on NtrC-activated nifH promoter activity than on NifA-activated promoter activity. Collectively, these results from the S. meliloti nifH promoter model system seem to indicate that, in addition to regulating gene expression during anaerobic signaling, DNA supercoiling may also provide a favorable topology for trans-acting factor binding and promoter activation regardless of oxygen status.

  4. Lamin A Is an Endogenous SIRT6 Activator and Promotes SIRT6-Mediated DNA Repair

    Shrestha Ghosh

    2015-11-01

    Full Text Available The nuclear lamins are essential for various molecular events in the nucleus, such as chromatin organization, DNA replication, and provision of mechanical support. A specific point mutation in the LMNA gene creates a truncated prelamin A termed progerin, causing Hutchinson-Gilford progeria syndrome (HGPS. SIRT6 deficiency leads to defective genomic maintenance and accelerated aging similar to HGPS, suggesting a potential link between lamin A and SIRT6. Here, we report that lamin A is an endogenous activator of SIRT6 and facilitates chromatin localization of SIRT6 upon DNA damage. Lamin A promotes SIRT6-dependent DNA-PKcs (DNA-PK catalytic subunit recruitment to chromatin, CtIP deacetylation, and PARP1 mono-ADP ribosylation in response to DNA damage. The presence of progerin jeopardizes SIRT6 activation and compromises SIRT6-mediated molecular events in response to DNA damage. These data reveal a critical role for lamin A in regulating SIRT6 activities, suggesting that defects in SIRT6 functions contribute to impaired DNA repair and accelerated aging in HGPS.

  5. Architecture of the bacteriophage T4 activator MotA/promoter DNA interaction during sigma appropriation.

    Hsieh, Meng-Lun; James, Tamara D; Knipling, Leslie; Waddell, M Brett; White, Stephen; Hinton, Deborah M

    2013-09-20

    Gene expression can be regulated through factors that direct RNA polymerase to the correct promoter sequence at the correct time. Bacteriophage T4 controls its development in this way using phage proteins that interact with host RNA polymerase. Using a process called σ appropriation, the T4 co-activator AsiA structurally remodels the σ(70) subunit of host RNA polymerase, while a T4 activator, MotA, engages the C terminus of σ(70) and binds to a DNA promoter element, the MotA box. Structures for the N-terminal (NTD) and C-terminal (CTD) domains of MotA are available, but no structure exists for MotA with or without DNA. We report the first molecular map of the MotA/DNA interaction within the σ-appropriated complex, which we obtained by using the cleaving reagent, iron bromoacetamidobenzyl-EDTA (FeBABE). We conjugated surface-exposed, single cysteines in MotA with FeBABE and performed cleavage reactions in the context of stable transcription complexes. The DNA cleavage sites were analyzed using ICM Molsoft software and three-dimensional physical models of MotA(NTD), MotA(CTD), and the DNA to investigate shape complementarity between the protein and the DNA and to position MotA on the DNA. We found that the unusual "double wing" motif present within MotA(CTD) resides in the major groove of the MotA box. In addition, we have used surface plasmon resonance to show that MotA alone is in a very dynamic equilibrium with the MotA element. Our results demonstrate the utility of fine resolution FeBABE mapping to determine the architecture of protein-DNA complexes that have been recalcitrant to traditional structure analyses. PMID:23902794

  6. DNA Topoisomerases maintain promoters in a state competent for transcriptional activation in Saccharomyces cerevisiae.

    Jakob Madsen Pedersen

    Full Text Available To investigate the role of DNA topoisomerases in transcription, we have studied global gene expression in Saccharomyces cerevisiae cells deficient for topoisomerases I and II and performed single-gene analyses to support our findings. The genome-wide studies show a general transcriptional down-regulation upon lack of the enzymes, which correlates with gene activity but not gene length. Furthermore, our data reveal a distinct subclass of genes with a strong requirement for topoisomerases. These genes are characterized by high transcriptional plasticity, chromatin regulation, TATA box presence, and enrichment of a nucleosome at a critical position in the promoter region, in line with a repressible/inducible mode of regulation. Single-gene studies with a range of genes belonging to this group demonstrate that topoisomerases play an important role during activation of these genes. Subsequent in-depth analysis of the inducible PHO5 gene reveals that topoisomerases are essential for binding of the Pho4p transcription factor to the PHO5 promoter, which is required for promoter nucleosome removal during activation. In contrast, topoisomerases are dispensable for constitutive transcription initiation and elongation of PHO5, as well as the nuclear entrance of Pho4p. Finally, we provide evidence that topoisomerases are required to maintain the PHO5 promoter in a superhelical state, which is competent for proper activation. In conclusion, our results reveal a hitherto unknown function of topoisomerases during transcriptional activation of genes with a repressible/inducible mode of regulation.

  7. Use of liposome-mediated DNA transfection to determine promoter activity in smooth muscle cells.

    Fabunmi, R P

    1999-01-01

    The transfer and expression of DNA plasmids containing promoter fragments of heterologous genes linked to reporter cDNAs in mammalian cells has become an invaluable technique for studying the regulation of gene expression. Several reporter genes such as luciferase, β-galactosidase, chloramphenicol acetyl transferase, and green flourescent protein are ideal to study promoter activities as their gene products are not endogenous to smooth muscle cells (SMC) and their expression can be readily detected using convenient assays (1). Among these genes, a popular choice is the firefly luciferase, as its expression can be easily detected in cells using a highly sensitive chemiluminescent assay (2). The firefly luciferase catalyses a rapid, ATP-dependent oxidation of the substrate, luciferin, which then emits light. Reactions catalyzed by firefly luciferase are: [Formula: see text]. PMID:21341022

  8. Isolation and characterization of the hamster gadd153 gene. Activation of promoter activity by agents that damage DNA

    Luethy, J.D.; Fargnoli, J.; Park, J.S.; Fornace, A.J. Jr.; Holbrook, N.J. (National Institute on Aging, Baltimore, MD (USA))

    1990-09-25

    A group of five cDNA clones, representing the gadd genes, were recently isolated from Chinese hamster ovary (CHO) cells as genes induced upon growth arrest and after DNA damage. We have isolated and characterized one of these genes, gadd153. The gene spans five kilobases and contains four exons. The 5'-flanking region of the gene, within 420 base pairs of the transcription initiation site, contains a number of cis elements associated with transcriptional regulation in other genes. These include a Hogness box, ATAAAA, an inverted GCCAAT box; seven SP1 transcription factor binding sites, and an AP-1 site. This region is rich in G + C content (greater than 70%) and contains an unusually long stretch of alternating CpG residues. The 800-base pair region immediately upstream of the transcription start site can drive expression of the bacterial chloramphenicol acetyltransferase (CAT) gene, but only in its endogenous orientation, in three different cell lines: HeLa, CHO, and Jurkat. The gadd153 promoter is strongly activated by methyl methanesulfonate, hydrogen peroxide, and UV irradiation, but not by growth arrest signals. This suggests that separate and very different regulatory pathways are involved in the induction of the gadd153 gene by growth cessation and DNA damage.

  9. Characterization and isolation of a T-DNA tagged banana promoter active during in vitro culture and low temperature stress

    Windelinckx Saskia

    2009-06-01

    Full Text Available Abstract Background Next-generation transgenic plants will require a more precise regulation of transgene expression, preferably under the control of native promoters. A genome-wide T-DNA tagging strategy was therefore performed for the identification and characterization of novel banana promoters. Embryogenic cell suspensions of a plantain-type banana were transformed with a promoterless, codon-optimized luciferase (luc+ gene and low temperature-responsive luciferase activation was monitored in real time. Results Around 16,000 transgenic cell colonies were screened for baseline luciferase activity at room temperature 2 months after transformation. After discarding positive colonies, cultures were re-screened in real-time at 26°C followed by a gradual decrease to 8°C. The baseline activation frequency was 0.98%, while the frequency of low temperature-responsive luciferase activity was 0.61% in the same population of cell cultures. Transgenic colonies with luciferase activity responsive to low temperature were regenerated to plantlets and luciferase expression patterns monitored during different regeneration stages. Twenty four banana DNA sequences flanking the right T-DNA borders in seven independent lines were cloned via PCR walking. RT-PCR analysis in one line containing five inserts allowed the identification of the sequence that had activated luciferase expression under low temperature stress in a developmentally regulated manner. This activating sequence was fused to the uidA reporter gene and back-transformed into a commercial dessert banana cultivar, in which its original expression pattern was confirmed. Conclusion This promoter tagging and real-time screening platform proved valuable for the identification of novel promoters and genes in banana and for monitoring expression patterns throughout in vitro development and low temperature treatment. Combination of PCR walking techniques was efficient for the isolation of candidate

  10. Prophage spontaneous activation promotes DNA release enhancing biofilm formation in Streptococcus pneumoniae.

    Margarida Carrolo

    Full Text Available Streptococcus pneumoniae (pneumococcus is able to form biofilms in vivo and previous studies propose that pneumococcal biofilms play a relevant role both in colonization and infection. Additionally, pneumococci recovered from human infections are characterized by a high prevalence of lysogenic bacteriophages (phages residing quiescently in their host chromosome. We investigated a possible link between lysogeny and biofilm formation. Considering that extracellular DNA (eDNA is a key factor in the biofilm matrix, we reasoned that prophage spontaneous activation with the consequent bacterial host lysis could provide a source of eDNA, enhancing pneumococcal biofilm development. Monitoring biofilm growth of lysogenic and non-lysogenic pneumococcal strains indicated that phage-infected bacteria are more proficient at forming biofilms, that is their biofilms are characterized by a higher biomass and cell viability. The presence of phage particles throughout the lysogenic strains biofilm development implicated prophage spontaneous induction in this effect. Analysis of lysogens deficient for phage lysin and the bacterial major autolysin revealed that the absence of either lytic activity impaired biofilm development and the addition of DNA restored the ability of mutant strains to form robust biofilms. These findings establish that limited phage-mediated host lysis of a fraction of the bacterial population, due to spontaneous phage induction, constitutes an important source of eDNA for the S. pneumoniae biofilm matrix and that this localized release of eDNA favors biofilm formation by the remaining bacterial population.

  11. Construction of recombinant adenovirus with Egr-1 promoter and Smad7 cDNA and study of the Egr-1 promoter's biological activity

    Objective: To construct a recombinant replication-defective adenovirus containing Egr-1 promoter and Smad7 cDNA, then to evaluate the biological activity of Egr-1 promoter. Methods: Based on Adeno- XTM expression system, CMV promoter of the pShuttle vector was replaced by Egr-1 promoter, and the Smad7 cDNA was subcloned into the MCS(multiple cloning site) of pShuttle. The recombinant pShuttle was then sub-cloned into the Adeno-XTM genome, which was transformed into E. coli to get recombinant Adeno-XTM plasmid DNA. The recombinant adenovirus was packaged and amplified in the transfected HEK293 cells before it was purified and tested for viral titer. The fibroblasts (3T6 cells) infected by the recombinant adenovirus were irradiated , and the activity of Egr-1 promoter was quantitively determined by the amount of Smad7 protein expressed in the 3T6 cells using Western blot. Results: Identified by restriction endonuclease analysis and PCR, the recombinant adenovirus containing Egr-1 promoter and Smad7 cDNA was constructed successfully, with a viral titer of 1.0 x 1011 TCID50/ml. The expressed amount of Smad7 protein varied at different dose levels and different time points post-irradiation in the 3T6 cells infected with the recombinant adenovirus. The amount of Smad7 protein increased along with the rising of the irradiation dose, and remained at a high expression level from 8 Gy to 15 Gy. The amount of Smad7 protein started to increase at 2 hours post-irradiation, and maintained a relatively high level for the next 5 hours before it descended, which was not observed in the control 3T6 cells. Conclusions: With the aid of Adeno-XTM expression system and molecular cloning techniques, construction of recombinant adenovirus could be quick and efficient. The recombined Egr-1 promoter has the activity of regulating the expression of downstream Smad7 cDNA. The increase in Smad7 expression under control of Egr-1 promoter induced by ionizing radiation is time- and dose

  12. Activation of the Pleiotropic Drug Resistance Pathway Can Promote Mitochondrial DNA Retention by Fusion-Defective Mitochondria in Saccharomyces cerevisiae

    Dunn, Cory, D.; Mutlu, Nebibe; Garipler, Gorkem; Akdogan, Emel

    2014-01-01

    1 Activation of the pleiotropic drug resistance pathway can promote mitochondrial DNA retention by fusion-defective mitochondria in Saccharomyces cerevisiae Nebibe Mutlu1, Görkem Garipler, Emel Akdoğan and Cory D. Dunn Department of Molecular Biology and Genetics Koç University Sarıyer, İstanbul, 34450 Turkey 1 Present address: Department of Molecular, Cellular, and Developmental Biology, University of Michigan, Ann Arbor, Michigan, 48109, U.S.A. NCBI Sequence...

  13. Active DNA Demethylation Mediated by DNA Glycosylases

    Zhu, Jian-Kang

    2009-01-01

    Active DNA demethylation is involved in many vital developmental and physiological processes of plants and animals. Recent genetic and biochemical studies in Arabidopsis have demonstrated that a subfamily of DNA glycosylases function to promote DNA demethylation through a base excision-repair pathway. These specialized bifunctional DNA glycosylases remove the 5-methylcytosine base and then cleave the DNA backbone at the abasic site, resulting in a gap that is then filled with an unmethylated ...

  14. DNA signals at isoform promoters.

    Dai, Zhiming; Xiong, Yuanyan; Dai, Xianhua

    2016-01-01

    Transcriptional heterogeneity is extensive in the genome, and most genes express variable transcript isoforms. However, whether variable transcript isoforms of one gene are regulated by common promoter elements remain to be elucidated. Here, we investigated whether isoform promoters of one gene have separated DNA signals for transcription and translation initiation. We found that TATA box and nucleosome-disfavored DNA sequences are prevalent in distinct transcript isoform promoters of one gene. These DNA signals are conserved among species. Transcript isoform has a RNA-determined unstructured region around its start site. We found that these DNA/RNA features facilitate isoform transcription and translation. These results suggest a DNA-encoded mechanism by which transcript isoform is generated. PMID:27353836

  15. Sirtuin 7 promotes cellular survival following genomic stress by attenuation of DNA damage, SAPK activation and p53 response

    Maintaining the genomic integrity is a constant challenge in proliferating cells. Amongst various proteins involved in this process, Sirtuins play a key role in DNA damage repair mechanisms in yeast as well as mammals. In the present work we report the role of one of the least explored Sirtuin viz., SIRT7, under conditions of genomic stress when treated with doxorubicin. Knockdown of SIRT7 sensitized osteosarcoma (U2OS) cells to DNA damage induced cell death by doxorubicin. SIRT7 overexpression in NIH3T3 delayed cell cycle progression by causing delay in G1 to S transition. SIRT7 overexpressing cells when treated with low dose of doxorubicin (0.25 µM) showed delayed onset of senescence, lesser accumulation of DNA damage marker γH2AX and lowered levels of growth arrest markers viz., p53 and p21 when compared to doxorubicin treated control GFP expressing cells. Resistance to DNA damage following SIRT7 overexpression was also evident by EdU incorporation studies where cellular growth arrest was significantly delayed. When treated with higher dose of doxorubicin (>1 µM), SIRT7 conferred resistance to apoptosis by attenuating stress activated kinases (SAPK viz., p38 and JNK) and p53 response thereby shifting the cellular fate towards senescence. Interestingly, relocalization of SIRT7 from nucleolus to nucleoplasm together with its co-localization with SAPK was an important feature associated with DNA damage. SIRT7 mediated resistance to doxorubicin induced apoptosis and senescence was lost when p53 level was restored by nutlin treatment. Overall, we propose SIRT7 attenuates DNA damage, SAPK activation and p53 response thereby promoting cellular survival under conditions of genomic stress. - Highlights: • Knockdown of SIRT7 sensitized cells to DNA damage induced apoptosis. • SIRT7 delayed onset of premature senescence by attenuating DNA damage response. • Overexpression of SIRT7 delayed cell cycle progression by delaying G1/S transition. • Upon DNA damage SIRT

  16. Sirtuin 7 promotes cellular survival following genomic stress by attenuation of DNA damage, SAPK activation and p53 response

    Kiran, Shashi; Oddi, Vineesha [Laboratory of Cancer Biology, Centre for DNA Fingerprinting and Diagnostics, Hyderabad, Telangana, 500001 (India); Ramakrishna, Gayatri, E-mail: gayatrirama1@gmail.com [Laboratory of Cancer Biology, Centre for DNA Fingerprinting and Diagnostics, Hyderabad, Telangana, 500001 (India); Laboratory of Cancer Cell Biology, Department of Research, Institute of Liver and Biliary Sciences, Delhi 110070 (India)

    2015-02-01

    Maintaining the genomic integrity is a constant challenge in proliferating cells. Amongst various proteins involved in this process, Sirtuins play a key role in DNA damage repair mechanisms in yeast as well as mammals. In the present work we report the role of one of the least explored Sirtuin viz., SIRT7, under conditions of genomic stress when treated with doxorubicin. Knockdown of SIRT7 sensitized osteosarcoma (U2OS) cells to DNA damage induced cell death by doxorubicin. SIRT7 overexpression in NIH3T3 delayed cell cycle progression by causing delay in G1 to S transition. SIRT7 overexpressing cells when treated with low dose of doxorubicin (0.25 µM) showed delayed onset of senescence, lesser accumulation of DNA damage marker γH2AX and lowered levels of growth arrest markers viz., p53 and p21 when compared to doxorubicin treated control GFP expressing cells. Resistance to DNA damage following SIRT7 overexpression was also evident by EdU incorporation studies where cellular growth arrest was significantly delayed. When treated with higher dose of doxorubicin (>1 µM), SIRT7 conferred resistance to apoptosis by attenuating stress activated kinases (SAPK viz., p38 and JNK) and p53 response thereby shifting the cellular fate towards senescence. Interestingly, relocalization of SIRT7 from nucleolus to nucleoplasm together with its co-localization with SAPK was an important feature associated with DNA damage. SIRT7 mediated resistance to doxorubicin induced apoptosis and senescence was lost when p53 level was restored by nutlin treatment. Overall, we propose SIRT7 attenuates DNA damage, SAPK activation and p53 response thereby promoting cellular survival under conditions of genomic stress. - Highlights: • Knockdown of SIRT7 sensitized cells to DNA damage induced apoptosis. • SIRT7 delayed onset of premature senescence by attenuating DNA damage response. • Overexpression of SIRT7 delayed cell cycle progression by delaying G1/S transition. • Upon DNA damage SIRT

  17. Placental DNA methylation of peroxisome-proliferator-activated receptor-γ co-activator-1α promoter is associated with maternal gestational glucose level.

    Xie, Xuemei; Gao, Hongjie; Zeng, Wanjiang; Chen, Suhua; Feng, Ling; Deng, Dongrui; Qiao, Fu-yuan; Liao, Lihong; McCormick, Kenneth; Ning, Qin; Luo, Xiaoping

    2015-08-01

    Intrauterine exposure to hyperglycaemia may increase the risk of later-life metabolic disorders. Although the underlying mechanism is not fully understood, epigenetic dysregulation in fetal programming has been implicated. With regard to energy homoeostasis, PGC-1α (peroxisome-proliferator-activated receptor γ co-activator-1α, encoded by the PPARGC1A gene) plays a regulatory role in several biochemical processes. We hypothesized that maternal gestational glucose levels would positively correlate with DNA methylation of the PPARGC1A promoter in placental tissue. We undertook a cross-sectional study of 58 mothers who underwent uncomplicated Caesarean delivery in a university hospital. Maternal gestational glucose concentration was determined after a 75-g OGTT (oral glucose tolerance test) at 24-28 weeks of gestation. Placenta tissue and cord blood were collected immediately after delivery. Genomic DNA was extracted and thereafter bisulfite conversion was performed. After PCR amplification, the DNA methylation of the PPARGC1A promoter was quantified using a pyrosequencing technique. The protein level of PGC-1α was evaluated by Western blotting. For all participants as a whole, including the GDM (gestational diabetes mellitus) and normoglycaemia groups, the maternal gestational glucose level was positively correlated with placental DNA methylation, and negatively correlated with cord blood DNA methylation of the PPARGC1A promoter in a CpG site-specific manner. In the GDM group alone, the placental CpG site-specific methylation of the PPARGC1A promoter strongly correlated with gestational 2-h post-OGTT glycaemia. Epigenetic alteration of the PPAGRC1A promoter may be one of the potential mechanisms underlying the metabolic programming in offspring exposed to intrauterine hyperglycaemia. PMID:25875376

  18. In Vitro and In Vivo Plant Growth Promoting Activities and DNA Fingerprinting of Antagonistic Endophytic Actinomycetes Associates with Medicinal Plants.

    Ajit Kumar Passari

    Full Text Available Endophytic actinomycetes have shown unique plant growth promoting as well as antagonistic activity against fungal phytopathogens. In the present study forty-two endophytic actinomycetes recovered from medicinal plants were evaluated for their antagonistic potential and plant growth-promoting abilities. Twenty-two isolates which showed the inhibitory activity against at least one pathogen were subsequently tested for their plant-growth promoting activities and were compared genotypically using DNA based fingerprinting, including enterobacterial repetitive intergenic consensus (ERIC and BOX repetitive elements. Genetic relatedness based on both ERIC and BOX-PCR generates specific patterns corresponding to particular genotypes. Exponentially grown antagonistic isolates were used to evaluate phosphate solubilization, siderophores, HCN, ammonia, chitinase, indole-3-acetic acid production, as well as antifungal activities. Out of 22 isolates, the amount of indole-3-acetic acid (IAA ranging between 10-32 μg/ml was produced by 20 isolates and all isolates were positive for ammonia production ranging between 5.2 to 54 mg/ml. Among 22 isolates tested, the amount of hydroxamate-type siderophores were produced by 16 isolates ranging between 5.2 to 36.4 μg/ml, while catechols-type siderophores produced by 5 isolates ranging from 3.2 to 5.4 μg/ml. Fourteen isolates showed the solubilisation of inorganic phosphorous ranging from 3.2 to 32.6 mg/100ml. Chitinase and HCN production was shown by 19 and 15 different isolates, respectively. In addition, genes of indole acetic acid (iaaM and chitinase (chiC were successively amplified from 20 and 19 isolates respectively. The two potential strains Streptomyces sp. (BPSAC34 and Leifsonia xyli (BPSAC24 were tested in vivo and improved a range of growth parameters in chilli (Capsicum annuum L. under greenhouse conditions. This study is the first published report that actinomycetes can be isolated as endophytes from

  19. Computational analysis of promoters and DNA-protein interactions

    Tomovic, Andrija

    2009-01-01

    The investigation of promoter activity and DNA-protein interactions is very important for understanding many crucial cellular processes, including transcription, recombination and replication. Promoter activity and DNA-protein interactions can be studied in the lab (in vitro or in vivo) or using computational methods (in silico). Computational approaches for analysing promoters and DNA-protein interactions have become more powerful as more and more complete genome sequences, 3D...

  20. Conjugative DNA Transfer Induces the Bacterial SOS Response and Promotes Antibiotic Resistance Development through Integron Activation

    Baharoglu, Zeynep; Bikard, David; Mazel, Didier

    2010-01-01

    Conjugation is one mechanism for intra- and inter-species horizontal gene transfer among bacteria. Conjugative elements have been instrumental in many bacterial species to face the threat of antibiotics, by allowing them to evolve and adapt to these hostile conditions. Conjugative plasmids are transferred to plasmidless recipient cells as single-stranded DNA. We used lacZ and gfp fusions to address whether conjugation induces the SOS response and the integron integrase. The SOS response contr...

  1. Conjugative DNA transfer induces the bacterial SOS response and promotes antibiotic resistance development through integron activation.

    Zeynep Baharoglu

    2010-10-01

    Full Text Available Conjugation is one mechanism for intra- and inter-species horizontal gene transfer among bacteria. Conjugative elements have been instrumental in many bacterial species to face the threat of antibiotics, by allowing them to evolve and adapt to these hostile conditions. Conjugative plasmids are transferred to plasmidless recipient cells as single-stranded DNA. We used lacZ and gfp fusions to address whether conjugation induces the SOS response and the integron integrase. The SOS response controls a series of genes responsible for DNA damage repair, which can lead to recombination and mutagenesis. In this manuscript, we show that conjugative transfer of ssDNA induces the bacterial SOS stress response, unless an anti-SOS factor is present to alleviate this response. We also show that integron integrases are up-regulated during this process, resulting in increased cassette rearrangements. Moreover, the data we obtained using broad and narrow host range plasmids strongly suggests that plasmid transfer, even abortive, can trigger chromosomal gene rearrangements and transcriptional switches in the recipient cell. Our results highlight the importance of environments concentrating disparate bacterial communities as reactors for extensive genetic adaptation of bacteria.

  2. In Vitro and In Vivo Plant Growth Promoting Activities and DNA Fingerprinting of Antagonistic Endophytic Actinomycetes Associates with Medicinal Plants

    Ajit Kumar Passari; Vineet Kumar Mishra; Vijai Kumar Gupta; Mukesh Kumar Yadav; Ratul Saikia; Bhim Pratap Singh

    2015-01-01

    Endophytic actinomycetes have shown unique plant growth promoting as well as antagonistic activity against fungal phytopathogens. In the present study forty-two endophytic actinomycetes recovered from medicinal plants were evaluated for their antagonistic potential and plant growth-promoting abilities. Twenty-two isolates which showed the inhibitory activity against at least one pathogen were subsequently tested for their plant-growth promoting activities and were compared genotypically using...

  3. DNA Topoisomerases Maintain Promoters in a State Competent for Transcriptional Activation in Saccharomyces cerevisiae

    Pedersen, Jakob Madsen; Fredsøe, Jacob Christian; Rødgaard, Morten Terpager; Andreasen, Lotte; Mundbjerg, Kamilla; Kruhøffer, Mogens; Brinch, Marie; Schierup, Mikkel Heide; Bjergbæk, Lotte; Andersen, Anni Hangaard

    -depth analysis of the inducible PHO5 gene reveals that topoisomerases are essential for binding of the Pho4p transcription factor to the PHO5 promoter, which is required for promoter nucleosome removal during activation. In contrast, topoisomerases are dispensable for constitutive transcription initiation and...... elongation of PHO5, as well as the nuclear entrance of Pho4p. Finally, we provide evidence that topoisomerases are required to maintain the PHO5 promoter in a superhelical state, which is competent for proper activation. In conclusion, our results reveal a hitherto unknown function of topoisomerases during...

  4. O6-methylguanine-DNA methyltransferase activity is associated with response to alkylating agent therapy and with MGMT promoter methylation in glioblastoma and anaplastic glioma

    Bobola, Michael S.; Alnoor, Mohammad; Chen, John Y.-S.; Kolstoe, Douglas D.; Silbergeld, Daniel L.; Rostomily, Robert C.; Blank, A.; Chamberlain, Marc C.; Silber, John R.

    2014-01-01

    Background CpG methylation in the O6-methylguanine-DNA methyltransferase (MGMT) promoter is associated with better outcome following alkylating agent chemotherapy in glioblastoma (GBM) and anaplastic glioma (AG). To what extent improved response reflects low or absent MGMT activity in glioma tissue has not been unequivocally assessed. This information is central to developing anti-resistance therapies. Methods We examined the relationship of MGMT activity in 91 GBMs and 84 AGs with progression-free survival (PFS) following alkylator therapy and with promoter methylation status determined by methylation-specific PCR (MSP). Results Cox regression analysis revealed that GBMs with high activity had a significantly greater risk for progression in dichotomous (P ≤ 0.001) and continuous (P ≤ 0.003) models, an association observed for different alkylator regimens, including concurrent chemo-radiation with temozolomide. Analysis of MGMT promoter methylation status in 47 of the GBMs revealed that methylated tumors had significantly lower activity (P ≤ 0.005) and longer PFS (P ≤ 0.036) compared to unmethylated tumors, despite overlapping activities. PFS was also significantly greater in methylated vs. unmethylated GBMs with comparable activity (P ≤ 0.005), and among unmethylated tumors with less than median activity (P ≤ 0.026), suggesting that mechanisms in addition to MGMT promote alkylator resistance. Similar associations of MGMT activity with PFS and promoter methylation status were observed for AGs. Conclusions Our results provide strong support for the hypotheses that MGMT activity promotes alkylator resistance and reflects promoter methylation status in malignant gliomas. General significance MGMT activity is an attractive target for anti-resistance therapy regardless of methylation status. PMID:25558448

  5. Finding human promoter groups based on DNA physical properties

    Zeng, Jia; Cao, Xiao-Qin; Zhao, Hongya; Yan, Hong

    2009-10-01

    DNA rigidity is an important physical property originating from the DNA three-dimensional structure. Although the general DNA rigidity patterns in human promoters have been investigated, their distinct roles in transcription are largely unknown. In this paper, we discover four highly distinct human promoter groups based on similarity of their rigidity profiles. First, we find that all promoter groups conserve relatively rigid DNAs at the canonical TATA box [a consensus TATA(A/T)A(A/T) sequence] position, which are important physical signals in binding transcription factors. Second, we find that the genes activated by each group of promoters share significant biological functions based on their gene ontology annotations. Finally, we find that these human promoter groups correlate with the tissue-specific gene expression.

  6. Transcription Factor ZBED6 Mediates IGF2 Gene Expression by Regulating Promoter Activity and DNA Methylation in Myoblasts

    Huang, Yong-Zhen; Zhang, Liang-Zhi; Lai, Xin-Sheng; Li, Ming-Xun; Sun, Yu-Jia; Li, Cong-Jun; Lan, Xian-Yong; Lei, Chu-Zhao; Zhang, Chun-Lei; Zhao, Xin; Chen, Hong

    2014-04-01

    Zinc finger, BED-type containing 6 (ZBED6) is an important transcription factor in placental mammals, affecting development, cell proliferation and growth. In this study, we found that the expression of the ZBED6 and IGF2 were upregulated during C2C12 differentiation. The IGF2 expression levels were negatively associated with the methylation status in beef cattle (P assay for the IGF2 intron 3 and P3 promoter showed that the mutant-type 439 A-SNP-pGL3 in driving reporter gene transcription is significantly higher than that of the wild-type 439 G-SNP-pGL3 construct (P assay revealed that ZBED6 regulate IGF2 expression and promote myoblast differentiation. Furthermore, knockdown of ZBED6 led to IGF2 expression change in vitro. Taken together, these results suggest that ZBED6 inhibits IGF2 activity and expression via a G to A transition disrupts the interaction. Thus, we propose that ZBED6 plays a critical role in myogenic differentiation.

  7. A point mutation in the DNA-binding domain of HPV-2 E2 protein increases its DNA-binding capacity and reverses its transcriptional regulatory activity on the viral early promoter

    Gao Chen

    2012-02-01

    Full Text Available Abstract Background The human papillomavirus (HPV E2 protein is a multifunctional DNA-binding protein. The transcriptional activity of HPV E2 is mediated by binding to its specific binding sites in the upstream regulatory region of the HPV genomes. Previously we reported a HPV-2 variant from a verrucae vulgaris patient with huge extensive clustered cutaneous, which have five point mutations in its E2 ORF, L118S, S235P, Y287H, S293R and A338V. Under the control of HPV-2 LCR, co-expression of the mutated HPV E2 induced an increased activity on the viral early promoter. In the present study, a series of mammalian expression plasmids encoding E2 proteins with one to five amino acid (aa substitutions for these mutations were constructed and transfected into HeLa, C33A and SiHa cells. Results CAT expression assays indicated that the enhanced promoter activity was due to the co-expressions of the E2 constructs containing A338V mutation within the DNA-binding domain. Western blots analysis demonstrated that the transiently transfected E2 expressing plasmids, regardless of prototype or the A338V mutant, were continuously expressed in the cells. To study the effect of E2 mutations on its DNA-binding activity, a serial of recombinant E2 proteins with various lengths were expressed and purified. Electrophoresis mobility shift assays (EMSA showed that the binding affinity of E2 protein with A338V mutation to both an artificial probe with two E2 binding sites or HPV-2 and HPV-16 promoter-proximal LCR sequences were significantly stronger than that of the HPV-2 prototype E2. Furthermore, co-expression of the construct containing A338V mutant exhibited increased activities on heterologous HPV-16 early promoter P97 than that of prototype E2. Conclusions These results suggest that the mutation from Ala to Val at aa 338 is critical for E2 DNA-binding and its transcriptional regulation.

  8. A milk protein gene promoter directs the expression of human tissue plasminogen activator cDNA to the mammary gland in transgenic mice

    Whey acidic protein (WAP) is a major whey protein in mouse milk. Its gene is expressed in the lactating mammary gland and is inducible by steroid and peptide hormones. A series of transgenic mice containing a hybrid gene in which human tissue plasminogen activator (tPA) cDNA is under the control of the murine WAP gene promoter had previously been generated. In this study, 21 tissues from lactating and virgin transgenic female mice containing the WAP-tPA hybrid gene were screened for the distribution of murine WAP and human tPA transcripts. Like the endogenous WAP RNA, WAP-tPA RNA was expressed predominantly in mammary gland tissue and appeared to be inducible by lactation. Whereas WAP transcripts were not detected in 22 tissues of virgin mice, low levels of WAP-tPA RNA, which were not modulated during lactation, were found in tongue, kidney, and sublingual gland. These studies demonstrate that the WAP gene promoter can target the expression of a transgene to the mammary gland and that this expression is inducible during lactation

  9. DNA demethylation in the PTEN gene promoter induced by 5-azacytidine activates PTEN expression in the MG-63 human osteosarcoma cell line.

    Song, Deye; Ni, Jiangdong; Xie, Hongming; Ding, Muliang; Wang, Jun

    2014-05-01

    This study used the MG-63 osteosarcoma cell line to investigate the demethylation of the phosphate and tension homolog (PTEN) gene promoter and the change in PTEN gene expression levels, which are caused by the methylation inhibitor 5-azacytidine (5-Zac), and the association between the two. Different concentrations of 5-Zac (0, 5 and 10 μmol/l) were added into the MG-63 cell culture medium and the cells were cultured for 72 h. The following techniques were performed on the cells: Western blot analysis to detect the PTEN protein; reverse transcription-polymerase chain reaction (PCR) to detect the mRNA transcription levels of the PTEN gene; flow cytometry to detect the cell apoptotic rate; and sodium bisulfate to deal with the DNA of each group. The genes of the PTEN promoter and the transcription factors specificity protein 1 (Sp1) and Myc were PCR amplified and transformed into Escherichia coli, then a number of clones were selected for sequencing and the methylation status of the amplified PTEN promoter fragment was detected. Following culture of the MG-63 cells with 5-Zac at concentrations of 0, 5 and 10 μmol/l for 72 h, the expression levels of PTEN protein in each group were gradually increased, presenting a concentration-dependent effect: Group 0 μmol/l compared with groups 5 and 10 μmol/l, P<0.05; and group 5 μmol/l compared with group 10 μmol/l, P=0.007. The mRNA expression levels of the PTEN gene significantly increased. The apoptotic rates of groups 0, 5 and 10 μmol/l were 0.69±0.42, 2.50±0.30 and 6.59±0.62%, and significant differences (P<0.01) were observed between every two groups. The bisulfate DNA sequencing results of three groups showed that, following the treatment with 5-Zac, the binding of the CG site to transcription factors was affected by demethylation. The average rate of demethylation indicated a statistical difference among the three groups. In conclusion, the methylation inhibitor 5-Zac leads to a significant increase in the

  10. DNA demethylation in the PTEN gene promoter induced by 5-azacytidine activates PTEN expression in the MG-63 human osteosarcoma cell line

    SONG, DEYE; NI, JIANGDONG; XIE, HONGMING; DING, MULIANG; WANG, JUN

    2014-01-01

    This study used the MG-63 osteosarcoma cell line to investigate the demethylation of the phosphate and tension homolog (PTEN) gene promoter and the change in PTEN gene expression levels, which are caused by the methylation inhibitor 5-azacytidine (5-Zac), and the association between the two. Different concentrations of 5-Zac (0, 5 and 10 μmol/l) were added into the MG-63 cell culture medium and the cells were cultured for 72 h. The following techniques were performed on the cells: Western blot analysis to detect the PTEN protein; reverse transcription-polymerase chain reaction (PCR) to detect the mRNA transcription levels of the PTEN gene; flow cytometry to detect the cell apoptotic rate; and sodium bisulfate to deal with the DNA of each group. The genes of the PTEN promoter and the transcription factors specificity protein 1 (Sp1) and Myc were PCR amplified and transformed into Escherichia coli, then a number of clones were selected for sequencing and the methylation status of the amplified PTEN promoter fragment was detected. Following culture of the MG-63 cells with 5-Zac at concentrations of 0, 5 and 10 μmol/l for 72 h, the expression levels of PTEN protein in each group were gradually increased, presenting a concentration-dependent effect: Group 0 μmol/l compared with groups 5 and 10 μmol/l, P<0.05; and group 5 μmol/l compared with group 10 μmol/l, P=0.007. The mRNA expression levels of the PTEN gene significantly increased. The apoptotic rates of groups 0, 5 and 10 μmol/l were 0.69±0.42, 2.50±0.30 and 6.59±0.62%, and significant differences (P<0.01) were observed between every two groups. The bisulfate DNA sequencing results of three groups showed that, following the treatment with 5-Zac, the binding of the CG site to transcription factors was affected by demethylation. The average rate of demethylation indicated a statistical difference among the three groups. In conclusion, the methylation inhibitor 5-Zac leads to a significant increase in the

  11. DNA binding and antigene activity of a daunomycin-conjugated triplex-forming oligonucleotide targeting the P2 promoter of the human c-myc gene

    Giuseppina M. Carbone; McGuffie, Eileen; Napoli, Sara; Flanagan, Courtney E.; Dembech, Chiara; Negri, Umberto; Arcamone, Federico; Capobianco, Massimo L.; Catapano, Carlo V

    2004-01-01

    Triplex-forming oligonucleotides (TFO) that bind DNA in a sequence-specific manner might be used as selective repressors of gene expression and gene-targeted therapeutics. However, many factors, including instability of triple helical complexes in cells, limit the efficacy of this approach. In the present study, we tested whether covalent linkage of a TFO to daunomycin, which is a potent DNA-intercalating agent and anticancer drug, could increase stability of the triple helix and activity of ...

  12. UV Damage in DNA Promotes Nucleosome Unwrapping*

    Duan, Ming-Rui; Smerdon, Michael J.

    2010-01-01

    The association of DNA with histones in chromatin impedes DNA repair enzymes from accessing DNA lesions. Nucleosomes exist in a dynamic equilibrium in which portions of the DNA molecule spontaneously unwrap, transiently exposing buried DNA sites. Thus, nucleosome dynamics in certain regions of chromatin may provide the exposure time and space needed for efficient repair of buried DNA lesions. We have used FRET and restriction enzyme accessibility to study nucleosome dynamics following DNA dam...

  13. Recruitment of TATA-Binding Protein–TAFI Complex SL1 to the Human Ribosomal DNA Promoter Is Mediated by the Carboxy-Terminal Activation Domain of Upstream Binding Factor (UBF) and Is Regulated by UBF Phosphorylation

    Tuan, JoAnn C.; Zhai, Weiguo; Comai, Lucio

    1999-01-01

    Human rRNA synthesis by RNA polymerase I requires at least two auxiliary factors, upstream binding factor (UBF) and SL1. UBF is a DNA binding protein with multiple HMG domains that binds directly to the CORE and UCE elements of the ribosomal DNA promoter. The carboxy-terminal region of UBF is necessary for transcription activation and has been shown to be extensively phosphorylated. SL1, which consists of TATA-binding protein (TBP) and three associated factors (TAFIs), does not have any seque...

  14. Nonperiodic activity of the human anaphase-promoting complex-Cdh1 ubiquitin ligase results in continuous DNA synthesis uncoupled from mitosis

    Lukas, C; Kramer, E R; Peters, J M;

    2000-01-01

    Saccharomyces cerevisiae and Drosophila spp., triggers exit from mitosis and during G(1) prevents unscheduled DNA replication. In this study we investigated the importance of periodic oscillation of the APC-Cdh1 activity for the cell cycle progression in human cells. We show that conditional interference with...

  15. Human DNA ligase III bridges two DNA ends to promote specific intermolecular DNA end joining

    Kukshal, Vandna; Kim, In-Kwon; Gregory L. Hura; Tomkinson, Alan E.; Tainer, John A.; Ellenberger, Tom

    2015-01-01

    Mammalian DNA ligase III (LigIII) functions in both nuclear and mitochondrial DNA metabolism. In the nucleus, LigIII has functional redundancy with DNA ligase I whereas LigIII is the only mitochondrial DNA ligase and is essential for the survival of cells dependent upon oxidative respiration. The unique LigIII zinc finger (ZnF) domain is not required for catalytic activity but senses DNA strand breaks and stimulates intermolecular ligation of two DNAs by an unknown mechanism. Consistent with ...

  16. Catalytic DNA with phosphatase activity

    Chandrasekar, Jagadeeswaran; Silverman, Scott K.

    2013-01-01

    Catalytic DNA sequences (deoxyribozymes, DNA enzymes, or DNAzymes) have been identified by in vitro selection for various catalytic activities. Expanding the limits of DNA catalysis is an important fundamental objective and may facilitate practical utility of catalysts that can be obtained from entirely unbiased (random) sequence populations. In this study, we show that DNA can catalyze Zn2+-dependent phosphomonoester hydrolysis of tyrosine and serine side chains (i.e., exhibit phosphatase ac...

  17. Gene-Activated Matrix Comprised of Atelocollagen and Plasmid DNA Encoding BMP4 or Runx2 Promotes Rat Cranial Bone Augmentation.

    Umebayashi, Mayumi; Sumita, Yoshinori; Kawai, Yousuke; Watanabe, Sumiko; Asahina, Izumi

    2015-01-01

    To date, therapeutic method for in vivo gene delivery has not been established on bone engineering though its potential usefulness has been suggested. For clinical applications, an effective condition should be developed to transfer the genes in vivo without any transfection reagents or virus vectors. In this study, to facilitate the clinical setting of this strategy, particularly aimed at atrophic bone repair, we simply investigated whether manufactured gene-activated matrix (GAM) with atelocollagen containing a certain amount of plasmid (p) DNA encoding osteogenic proteins could augment the cranial bone in rat. GAMs were manufactured by mixing 0.02, 0.1, or 1 mg of AcGFP plasmid vectors harboring cDNA of BMP4 (pBMP4) or Runx2 (pRunx2) with 2% bovine atelocollagen and β-tricalcium phosphate granules. Before manufacturing GAMs, to determine the biological activity of generated pDNAs, we confirmed GFP expression and increased level of alkaline phosphatase activities in MC3T3-E1 cells transfected with pBMP4 or pRunx2 during culture. Then, GAMs were lyophilized and transplanted to onlay placement on the cranium. At 2 weeks of transplantation, GFP-expressing cells could be detectable in only GAMs containing 1 mg of AcGFP plasmid vectors. Then, at 4 weeks, significant bone formation was recognized in GAMs containing 1 mg of pDNAs encoding BMP4 or Runx2 but not in 0.02 or 0.1 mg of GAMs. These newly formed bone tissues surrounded by osteocalcin-stained area were augmented markedly until 8 weeks after transplantation. In contrast, minimal bone formation was observed in GAMs without harboring cDNA of osteogenic proteins. Meanwhile, when GAMs were transplanted to the cranial bone defect, bone formation was detectable in specimens containing 1 mg of pBMP4 or pRunx2 at 8 weeks as well. Thus, atelocollagen-based GAM reliably could form the engineered bone even for the vertical augmentation when containing a certain amount of plasmid vectors encoding osteogenic

  18. Osmotic pressure: resisting or promoting DNA ejection from phage

    Jeembaeva, Meerim; Larsson, Frida; Evilevitch, Alex

    2008-01-01

    Recent in vitro experiments have shown that DNA ejection from bacteriophage can be partially stopped by surrounding osmotic pressure when ejected DNA is digested by DNase I on the course of ejection. We argue in this work by combination of experimental techniques (osmotic suppression without DNaseI monitored by UV absorbance, pulse-field electrophoresis, and cryo-EM visualization) and simple scaling modeling that intact genome (i.e. undigested) ejection in a crowded environment is, on the contrary, enhanced or eventually complete with the help of a pulling force resulting from DNA condensation induced by the osmotic stress itself. This demonstrates that in vivo, the osmotically stressed cell cytoplasm will promote phage DNA ejection rather than resisting it. The further addition of DNA-binding proteins under crowding conditions is shown to enhance the extent of ejection. We also found some optimal crowding conditions for which DNA content remaining in the capsid upon ejection is maximum, which correlates well...

  19. Roundup® exposure promotes gills and liver impairments, DNA damage and inhibition of brain cholinergic activity in the Amazon teleost fish Colossoma macropomum.

    Braz-Mota, Susana; Sadauskas-Henrique, Helen; Duarte, Rafael M; Val, Adalberto L; Almeida-Val, Vera M F

    2015-09-01

    Roundup Original® (RD) is a glyphosate-based herbicide used to control weeds in agriculture. Contamination of Amazon waters has increased as a consequence of anthropogenic pressure, including the use of herbicides as RD. The central goal of this study was to evaluate the toxic effects of RD on juveniles of tambaqui (Colossoma macropomum). Our findings show that biomarkers in tambaqui are organ specific and dependent on RD concentration. Alterations in gills structural and respiratory epithelium were followed by changes in hematological parameters such as concentration of hemoglobin, particularly in fish exposed to the higher concentration tested (75% of RD LC50 96 h). In addition, both RD concentrations affected the biotransformation process in gills of tambaqui negatively. Instead, liver responses suggest that a production of reactive oxygen species (ROS) occurred in fish exposed to RD, particularly in the animals exposed to 75% RD, as seen by imbalances in biotransformation and antioxidant systems. The increased DNA damage observed in red blood cells of tambaqui exposed to RD is in agreement with this hypothesis. Finally, both tested sub-lethal concentrations of RD markedly inhibited the cholinesterase activity in fish brain. Thus, we can suggest that RD is potentially toxic to tambaqui and possibly to other tropical fish species. PMID:25898390

  20. Human neuronal tau promoting the melting temperature of DNA

    2000-01-01

    The hyperchromic effect of ultraviolet spectroscopy shows that adding recombinant human neuronal tau to the solution of calf thymus DNA will promote the melting temperature (Tm) from 67℃ to 81℃. Similar result has been detected when adding tau to plasmid pBluescript-Ⅱ SK, by raising Tm from 75℃ to 85℃. The kinetics of thermal denaturation of DNA with tau is much slower than that of control. It suggests that tau may stabilize the double helix conformation of DNA.

  1. Heterogeneity in the properties of burst-forming units of erythroid lineage in sickle cell anemia: DNA synthesis and burst-promoting activity production is related to peripheral hemoglobin F levels

    Circulating 14-day erythroid progenitors (BFU-E) from 28 sickle cell anemia (SS) patients with hemoglobin F (HbF) levels ranging from 2% to 16% were studied to determine their sensitivity to [3H] thymidine kill and burst-promoting activity (BPA)-like factor production. We find that the proportion of BFU-E sensitive to 3H-dT kill, and hence active in DNA synthesis, was inversely correlated with the percent of peripheral HbF when light density (LD) mononuclear cells were used for plating. Regression analysis showed that the correlation between HbF level and BFU-E kill was highly significant (r = .88; P less than .00003). We confirmed the BPA-like factor(s) production by LD mononuclear cells of SS patients, and found, in addition, that this phenomenon is restricted to the population of SS patients with HbF levels lower than 9%. Circulating BFU-E of patients with high HbF levels are not sensitive to 3H-dT, and their mononuclear cells do not release BPA-like factor. In summary, SS patients exhibit differences in the capacity of their mononuclear cells to produce BPA activity according to their peripheral HbF level, as well as to the DNA synthesis-state of their circulating BFU-E. We conclude that erythroid progenitors differ among SS patients in relation to their peripheral HbF level

  2. International energy-promotion-activities

    NONE

    1995-09-01

    Comprehensive promotion of energy and environmental measures are demanded in order to realize improvement in energy demand/supply structures in developing countries where increase in energy demand is anticipated. To achieve this goal, technical transfer related to energy saving technologies and clean coal as well as international energy promotion activities are implemented in China and Indonesia since fiscal 1993. In the field of energy saving, model operations are performed to improve efficiency in such energy consuming fields as steel making, power generation, and oil refining, in addition to cooperation in structuring databases and establishing master plans. In the clean coal field, model operations are conducted to reduce environmental load in coal utilizing areas, in addition to cooperation in establishing master plans for coal utilization. This paper describes feasibility studies on environmentally harmonious coal utilization systems in developing countries, assistance to introduction thereof, and joint verification operations. To rationalize international energy usage, basic surveys on energy utilization efficiency improvement and model operations are carried out mainly in the Asia-Pacific countries.

  3. Replication of cloned DNA containing the Alu family sequence during cell extract-promoting simian virus 40 DNA synthesis.

    Ariga, H

    1984-01-01

    The replicating activity of several cloned DNAs containing putative origin sequences was examined in a cell-free extract that absolutely depends on simian virus 40 (SV40) T antigen promoting initiation of SV40 DNA replication in vitro. Of the three DNAs containing the human Alu family sequence (BLUR8), the origin of (Saccharomyces cerevisiae plasmid 2 micron DNA (pJD29), and the yeast autonomous replicating sequence (YRp7), only BLUR8 was active as a template. Replication in a reaction mixtur...

  4. Homologous DNA strand exchange activity of the human mitochondrial DNA helicase TWINKLE.

    Sen, Doyel; Patel, Gayatri; Patel, Smita S

    2016-05-19

    A crucial component of the human mitochondrial DNA replisome is the ring-shaped helicase TWINKLE-a phage T7-gene 4-like protein expressed in the nucleus and localized in the human mitochondria. Our previous studies showed that despite being a helicase, TWINKLE has unique DNA annealing activity. At the time, the implications of DNA annealing by TWINKLE were unclear. Herein, we report that TWINKLE uses DNA annealing function to actively catalyze strand-exchange reaction between the unwinding substrate and a homologous single-stranded DNA. Using various biochemical experiments, we demonstrate that the mechanism of strand-exchange involves active coupling of unwinding and annealing reactions by the TWINKLE. Unlike strand-annealing, the strand-exchange reaction requires nucleotide hydrolysis and greatly stimulated by short region of homology between the recombining DNA strands that promote joint molecule formation to initiate strand-exchange. Furthermore, we show that TWINKLE catalyzes branch migration by resolving homologous four-way junction DNA. These four DNA modifying activities of TWINKLE: strand-separation, strand-annealing, strand-exchange and branch migration suggest a dual role of TWINKLE in mitochondrial DNA maintenance. In addition to playing a major role in fork progression during leading strand DNA synthesis, we propose that TWINKLE is involved in recombinational repair of the human mitochondrial DNA. PMID:26887820

  5. Species dependence of the major late promoter in adenovirus type 12 DNA.

    Weyer, U; Doerfler, W

    1985-01-01

    In hamster cells human adenovirus type 12 (Ad12) is deficient in DNA replication and late gene expression whereas adenovirus type 2 (Ad2) can replicate. Functions located in the E1 region of the Ad2 or adenovirus type 5 (Ad5) genome can complement the deficiencies of the Ad12 genome in hamster cells, but, infectious viral particles are not produced. We have now investigated the activity of the major late promoter of Ad2 and of Ad12 DNA in human and hamster cells. This promoter governs the exp...

  6. Impaired DNA replication within progenitor cell pools promotes leukemogenesis.

    Ganna Bilousova

    2005-12-01

    Full Text Available Impaired cell cycle progression can be paradoxically associated with increased rates of malignancies. Using retroviral transduction of bone marrow progenitors followed by transplantation into mice, we demonstrate that inhibition of hematopoietic progenitor cell proliferation impairs competition, promoting the expansion of progenitors that acquire oncogenic mutations which restore cell cycle progression. Conditions that impair DNA replication dramatically enhance the proliferative advantage provided by the expression of Bcr-Abl or mutant p53, which provide no apparent competitive advantage under conditions of healthy replication. Furthermore, for the Bcr-Abl oncogene the competitive advantage in contexts of impaired DNA replication dramatically increases leukemogenesis. Impaired replication within hematopoietic progenitor cell pools can select for oncogenic events and thereby promote leukemia, demonstrating the importance of replicative competence in the prevention of tumorigenesis. The demonstration that replication-impaired, poorly competitive progenitor cell pools can promote tumorigenesis provides a new rationale for links between tumorigenesis and common human conditions of impaired DNA replication such as dietary folate deficiency, chemotherapeutics targeting dNTP synthesis, and polymorphisms in genes important for DNA metabolism.

  7. The Bacillus subtilis DnaD and DnaB Proteins Exhibit Different DNA Remodelling Activities

    Zhang, Wenke; Carneiro, Maria J. V. M.; Turner, Ian J.; ALLEN, Stephanie; Roberts, Clive J.; Soultanas, Panos

    2005-01-01

    Primosomal protein cascades load the replicative helicase onto DNA. In Bacillus subtilis a putative primosomal cascade involving the DnaD-DnaB-DnaI proteins has been suggested to participate in both the DnaA and PriA-dependent loading of the replicative helicase DnaC onto the DNA. Recently we discovered that DnaD has a global remodelling DNA activity suggesting a more widespread role in bacterial nucleoid architecture. Here, we show that DnaB forms a “square-like” tetramer with a hole in the ...

  8. TDP1 promotes assembly of non-homologous end joining protein complexes on DNA.

    Heo, Jinho; Li, Jing; Summerlin, Matthew; Hays, Annette; Katyal, Sachin; McKinnon, Peter J; Nitiss, Karin C; Nitiss, John L; Hanakahi, Leslyn A

    2015-06-01

    The repair of DNA double-strand breaks (DSB) is central to the maintenance of genomic integrity. In tumor cells, the ability to repair DSBs predicts response to radiation and many cytotoxic anti-cancer drugs. DSB repair pathways include homologous recombination and non-homologous end joining (NHEJ). NHEJ is a template-independent mechanism, yet many NHEJ repair products carry limited genetic changes, which suggests that NHEJ includes mechanisms to minimize error. Proteins required for mammalian NHEJ include Ku70/80, the DNA-dependent protein kinase (DNA-PKcs), XLF/Cernunnos and the XRCC4:DNA ligase IV complex. NHEJ also utilizes accessory proteins that include DNA polymerases, nucleases, and other end-processing factors. In yeast, mutations of tyrosyl-DNA phosphodiesterase (TDP1) reduced NHEJ fidelity. TDP1 plays an important role in repair of topoisomerase-mediated DNA damage and 3'-blocking DNA lesions, and mutation of the human TDP1 gene results in an inherited human neuropathy termed SCAN1. We found that human TDP1 stimulated DNA binding by XLF and physically interacted with XLF to form TDP1:XLF:DNA complexes. TDP1:XLF interactions preferentially stimulated TDP1 activity on dsDNA as compared to ssDNA. TDP1 also promoted DNA binding by Ku70/80 and stimulated DNA-PK activity. Because Ku70/80 and XLF are the first factors recruited to the DSB at the onset of NHEJ, our data suggest a role for TDP1 during the early stages of mammalian NHEJ. PMID:25841101

  9. Rep provides a second motor at the replisome to promote duplication of protein-bound DNA.

    Guy, Colin P; Atkinson, John; Gupta, Milind K; Mahdi, Akeel A; Gwynn, Emma J; Rudolph, Christian J; Moon, Peter B; van Knippenberg, Ingeborg C; Cadman, Chris J; Dillingham, Mark S; Lloyd, Robert G; McGlynn, Peter

    2009-11-25

    Nucleoprotein complexes present challenges to genome stability by acting as potent blocks to replication. One attractive model of how such conflicts are resolved is direct targeting of blocked forks by helicases with the ability to displace the blocking protein-DNA complex. We show that Rep and UvrD each promote movement of E. coli replisomes blocked by nucleoprotein complexes in vitro, that such an activity is required to clear protein blocks (primarily transcription complexes) in vivo, and that a polarity of translocation opposite that of the replicative helicase is critical for this activity. However, these two helicases are not equivalent. Rep but not UvrD interacts physically and functionally with the replicative helicase. In contrast, UvrD likely provides a general means of protein-DNA complex turnover during replication, repair, and recombination. Rep and UvrD therefore provide two contrasting solutions as to how organisms may promote replication of protein-bound DNA. PMID:19941825

  10. Local chromatin microenvironment determines DNMT activity : from DNA methyltransferase to DNA demethylase or DNA dehydroxymethylase

    van der Wijst, Monique G. P.; Venkiteswaran, Muralidhar; Chen, Hui; Xu, Guo-Liang; Plosch, Torsten; Rots, Marianne G.

    2015-01-01

    Insights on active DNA demethylation disproved the original assumption that DNA methylation is a stable epigenetic modification. Interestingly, mammalian DNA methyltransferases 3A and 3B (DNMT-3A and -3B) have also been reported to induce active DNA demethylation, in addition to their well-known fun

  11. Analysis of promoter activity in transgenic plants by normalizing expression with a reference gene: anomalies due to the influence of the test promoter on the reference promoter

    Simran Bhullar; Suma Chakravarthy; Deepak Pental; Pradeep Kumar Burma

    2009-12-01

    Variations in transgene expression due to position effect and copy number are normalized when analysing and comparing the strengths of different promoters. In such experiments, the promoter to be tested is placed upstream to a reporter gene and a second expression cassette is introduced in a linked fashion in the same transfer DNA (T-DNA). Normalization in the activity of the test promoter is carried out by calculating the ratio of activities of the test and reference promoters. When an appropriate number of independent transgenic events are analysed, normalization facilitates assessment of the relative strengths of the test promoters being compared. In this study, using different modified versions of the Cauliflower Mosaic Virus (CaMV) 35S promoter expressing the reporter gene -glucuronidase (gus) (test cassette) linked to a chloramphenicol acetyl transferase (cat) gene under the wild-type 35S promoter (reference cassette) in transgenic tobacco lines, we observed that cat gene expression varied depending upon the strength of the modified 35S promoter expressing the gus gene. The 35S promoter in the reference cassette was found to have been upregulated in cases where the modified 35S promoter was weaker than the wild-type 35S promoter. Many studies have been carried out in different organisms to study the phenomenon of transcriptional interference, which refers to the reduced expression of the downstream promoter by a closely linked upstream promoter. However, we observed a positive interaction wherein the weakened activity of a promoter led to upregulation of a contiguous promoter. These observations suggest that, in situations where the promoters of the test and reference gene share the same transcription factors, the activity of the test promoter can influence the activity of the reference promoter in a way that the test promoter’s strength is underestimated when normalized by the reference promoter.

  12. APOBEC3 cytidine deaminases in double-strand DNA break repair and cancer promotion.

    Nowarski, Roni; Kotler, Moshe

    2013-06-15

    High frequency of cytidine to thymidine conversions was identified in the genome of several types of cancer cells. In breast cancer cells, these mutations are clustered in long DNA regions associated with single-strand DNA (ssDNA), double-strand DNA breaks (DSB), and genomic rearrangements. The observed mutational pattern resembles the deamination signature of cytidine to uridine carried out by members of the APOBEC3 family of cellular deaminases. Consistently, APOBEC3B (A3B) was recently identified as the mutational source in breast cancer cells. A3G is another member of the cytidine deaminases family predominantly expressed in lymphoma cells, where it is involved in mutational DSB repair following ionizing radiation treatments. This activity provides us with a new paradigm for cancer cell survival and tumor promotion and a mechanistic link between ssDNA, DSBs, and clustered mutations. Cancer Res; 73(12); 3494-8. ©2013 AACR. PMID:23598277

  13. Enhanced activity of the bacteriophage lambda PL promoter at low temperature.

    Giladi, H; Goldenberg, D; Koby, S; Oppenheim, A B

    1995-01-01

    The response of the early phage lambda PL promoter to temperature was investigated. Experiments with lacZ reporter gene fusions demonstrated that the activity of the phage lambda PL promoter is inversely dependent on temperature. The bacterial DNA-binding protein integration host factor (IHF) further enhances lambda PL promoter activity at low temperature, although no apparent changes in the cellular level of IHF protein were observed at the different temperatures. IHF protein binds DNA in vi...

  14. Promoting 21st-Century Skills in the Science Classroom by Adapting Cookbook Lab Activities: The Case of DNA Extraction of Wheat Germ

    Alozie, Nonye M.; Grueber, David J.; Dereski, Mary O.

    2012-01-01

    How can science instruction engage students in 21st-century skills and inquiry-based learning, even when doing simple labs in the classroom? We collaborated with teachers in professional development workshops to transform "cookbook" activities into engaging laboratory experiences. We show how to change the common classroom activity of DNA…

  15. XLF-Cernunnos promotes DNA ligase IV-XRCC4 re-adenylation following ligation.

    Riballo, Enriqueta; Woodbine, Lisa; Stiff, Thomas; Walker, Sarah A; Goodarzi, Aaron A; Jeggo, Penny A

    2009-02-01

    XLF-Cernunnos (XLF) is a component of the DNA ligase IV-XRCC4 (LX) complex, which functions during DNA non-homologous end joining (NHEJ). Here, we use biochemical and cellular approaches to probe the impact of XLF on LX activities. We show that XLF stimulates adenylation of LX complexes de-adenylated by pyrophosphate or following LX decharging during ligation. XLF enhances LX ligation activity in an ATP-independent and dependent manner. ATP-independent stimulation can be attributed to enhanced end-bridging. Whilst ATP alone fails to stimulate LX ligation activity, addition of XLF and ATP promotes ligation in a manner consistent with XLF-stimulated readenylation linked to ligation. We show that XLF is a weakly bound partner of the tightly associated LX complex and, unlike XRCC4, is dispensable for LX stability. 2BN cells, which have little, if any, residual XLF activity, show a 3-fold decreased ability to repair DNA double strand breaks covering a range of complexity. These findings strongly suggest that XLF is not essential for NHEJ but promotes LX adenylation and hence ligation. We propose a model in which XLF, by in situ recharging DNA ligase IV after the first ligation event, promotes double stranded ligation by a single LX complex. PMID:19056826

  16. Biological activity of SV40 DNA

    This thesis deals with a study on the biological activity of SV40 DNA. The transforming activity of SV40 DNA and DNA fragments is investigated in order to define as precisely as possible the area of the viral genome that is involved in the transformation. The infectivity of SV40 DNA is used to study the defective repair mechanisms of radiation damages of human xeroderma pigmentosum cells. (C.F.)

  17. Promoting and avoiding recombination: contrasting activities of the Escherichia coli RuvABC Holliday junction resolvase and RecG DNA translocase.

    Zhang, Jing; Mahdi, Akeel A; Briggs, Geoffrey S; Lloyd, Robert G

    2010-05-01

    RuvABC and RecG are thought to provide alternative pathways for the late stages of recombination in Escherichia coli. Inactivation of both blocks the recovery of recombinants in genetic crosses. RuvABC resolves Holliday junctions, with RuvAB driving branch migration and RuvC catalyzing junction cleavage. RecG also drives branch migration, but no nuclease has been identified that might act with RecG to cleave junctions, apart from RusA, which is not normally expressed. We searched for an alternative nuclease using a synthetic lethality assay to screen for mutations causing inviability in the absence of RuvC, on the premise that a strain without any ability to cut junctions might be inviable. All the mutations identified mapped to polA, dam, or uvrD. None of these genes encodes a nuclease that cleaves Holliday junctions. Probing the reason for the inviability using the RusA Holliday junction resolvase provided strong evidence in each case that the RecG pathway is very ineffective at removing junctions and indicated that a nuclease component most probably does not exist. It also revealed new suppressors of recG, which were located to the ssb gene. Taken together with the results from the synthetic lethality assays, the properties of the mutant SSB proteins provide evidence that, rather than promoting recombination, a major function of RecG is to curb potentially pathological replication initiated via PriA protein at sites remote from oriC. PMID:20157002

  18. Promotion marketing activities in universities

    Guseva I.B.; Ledentcova E.A.

    2014-01-01

    The article discusses the need for promotion of educational services through such means of marketing communications as advertising and personal selling , able to satisfy user requests. The results of market research - questioning school graduates of Perm, which was carried out in order to create an effective advertising campaign to attract entrants. Experience can be used in the advertising campaign universities in Russia , in particular , Perm State National Research University.

  19. FBH1 promotes DNA double-strand breakage and apoptosis in response to DNA replication stress.

    Jeong, Yeon-Tae; Rossi, Mario; Cermak, Lukas; Saraf, Anita; Florens, Laurence; Washburn, Michael P; Sung, Patrick; Schildkraut, Carl L; Schildkraut, Carl; Pagano, Michele

    2013-01-21

    Proper resolution of stalled replication forks is essential for genome stability. Purification of FBH1, a UvrD DNA helicase, identified a physical interaction with replication protein A (RPA), the major cellular single-stranded DNA (ssDNA)-binding protein complex. Compared with control cells, FBH1-depleted cells responded to replication stress with considerably fewer double-strand breaks (DSBs), a dramatic reduction in the activation of ATM and DNA-PK and phosphorylation of RPA2 and p53, and a significantly increased rate of survival. A minor decrease in ssDNA levels was also observed. All these phenotypes were rescued by wild-type FBH1, but not a FBH1 mutant lacking helicase activity. FBH1 depletion had no effect on other forms of genotoxic stress in which DSBs form by means that do not require ssDNA intermediates. In response to catastrophic genotoxic stress, apoptosis prevents the persistence and propagation of DNA lesions. Our findings show that FBH1 helicase activity is required for the efficient induction of DSBs and apoptosis specifically in response to DNA replication stress. PMID:23319600

  20. THE PROMOTIONAL ACTIVITY IN THE TOURISTIC SECTOR

    Costel Iliuta Negricea

    2008-05-01

    Full Text Available The promotion as one of the components of the marketing mix, laying stress, în this regard,on its role în the deployment of the tourism companies’ activity, the structure of the promotional activity în thetouristic sector as well as the use of the promotional strategies în the attainment of the development targets ofthe tourism companies.So, în the paper there have been mentioned the three levels at which it is made the touristic promotionîn Romania, respectively nationally, by the Ministry of the Tourism, under whose subordination it is theTourism National Authority, the second level is the regional/local one, concerning the activity carried out bythe Centers/Offices of Touristic Information from a series of localities, and the last level refers to the microone, respectively at the level of the tourism companies, which promote their offer individually (the most often.The important role of the promotion în the deployment of the activity of the tourism companies isbeing highlighted by the fact that this makes the connection between the activity of an organization and itscustomers (effective or potential, and, în the touristic field, the content of the promotional activity is stronglystressed by the features of this type of services and of the system of creation and delivery, as well as of thepurchasing behaviour.

  1. Evaluation of Results from Sales Promotion Activities

    Olimpia Ban

    2007-01-01

    An essential element of the sales promotion strategy and not only is the evaluation of the results obtained from the activities performed. Due to their nature and applicability, the evaluation of the sales promotion is much easier to be achieved, but it raises some problems. Using a hypothetical example, we have tried to develop a "classic" evaluation model of the specialty literature.

  2. Public Relations as Promotional Activity

    Almira CURRI-MEMETI

    2011-11-01

    Full Text Available Public relations give opportunity to the organization to present its image and personality to its own “public”- users, supporters, sponsors, donors, local community and other public.It is about transferring the message to the public, but that is a twoway street. You must communicate with your public, but at the same time you must give opportunity to the public to communicate easier with you. The real public relations include dialog – you should listen to the others, to see things through their perspective. This elaborate is made with the purpose to be useful for every organization, not for the sensational promotion of its achievements, but to become more critical towards its work. Seeing the organization in the way that the other see it, you can become better and sure that you are giving to your users the best service possible.

  3. Cernunnos/XLF promotes the ligation of mismatched and noncohesive DNA ends.

    Tsai, Chun J; Kim, Sunny A; Chu, Gilbert

    2007-05-01

    Nonhomologous end-joining (NHEJ) repairs DNA double-strand breaks created by ionizing radiation or V(D)J recombination of the immunoglobulin genes. The breaks often leave mismatched or nonligatable ends, and NHEJ must repair the breaks with high efficiency and minimal nucleotide loss. Here, the NHEJ proteins Ku, DNA-dependent protein kinase catalytic subunit, XRCC4/Ligase IV, and Cernunnos/XRCC4-like factor joined mismatched and noncohesive DNA ends in the absence of processing factors. Depending on the mismatch, Cernunnos stimulated joining 8- to 150-fold. For substrates with a blunt end and a 3' overhanging end, Ku, XRCC4/Ligase IV, and Cernunnos ligated the 3' overhanging hydroxyl group to the 5' phosphate of the blunt end, leaving the other strand unjoined. This activity provides a mechanism for retaining 3' overhang sequences, as observed during V(D)J recombination in vivo. Thus, Cernunnos/XRCC4-like factor promotes a mismatched end (MEnd) DNA ligase activity to facilitate joining and to preserve DNA sequence. Furthermore, MEnd ligase activity may have applications in recombinant DNA technology. PMID:17470781

  4. Rep Provides a Second Motor at the Replisome to Promote Duplication of Protein-Bound DNA

    Guy, Colin P.; Atkinson, John; Gupta, Milind K.; Mahdi, Akeel A.; Gwynn, Emma J.; Rudolph, Christian J.; Moon, Peter B.; van Knippenberg, Ingeborg C.; Cadman, Chris J.; Dillingham, Mark S.; Lloyd, Robert G.; McGlynn, Peter

    2009-01-01

    Summary Nucleoprotein complexes present challenges to genome stability by acting as potent blocks to replication. One attractive model of how such conflicts are resolved is direct targeting of blocked forks by helicases with the ability to displace the blocking protein-DNA complex. We show that Rep and UvrD each promote movement of E. coli replisomes blocked by nucleoprotein complexes in vitro, that such an activity is required to clear protein blocks (primarily transcription complexes) in vi...

  5. Promoting physical activity in socially vulnerable groups

    Herens, M.C.

    2016-01-01

    Background:  In the Netherlands, inequalities in physical activity behaviour go hand in hand with socioeconomic inequalities in health. To promote physical activity effectively and equitably, participatory community-based physical activity interventions seem promising and are s

  6. Regulation of ALF promoter activity in Xenopus oocytes.

    Dan Li

    Full Text Available BACKGROUND: In this report we evaluate the use of Xenopus laevis oocytes as a matched germ cell system for characterizing the organization and transcriptional activity of a germ cell-specific X. laevis promoter. PRINCIPAL FINDINGS: The promoter from the ALF transcription factor gene was cloned from X. laevis genomic DNA using a PCR-based genomic walking approach. The endogenous ALF gene was characterized by RACE and RT-PCR for transcription start site usage, and by sodium bisulfite sequencing to determine its methylation status in somatic and oocyte tissues. Homology between the X. laevis ALF promoter sequence and those from human, chimpanzee, macaque, mouse, rat, cow, pig, horse, dog, chicken and X. tropicalis was relatively low, making it difficult to use such comparisons to identify putative regulatory elements. However, microinjected promoter constructs were very active in oocytes and the minimal promoter could be narrowed by PCR-mediated deletion to a region as short as 63 base pairs. Additional experiments using a series of site-specific promoter mutants identified two cis-elements within the 63 base pair minimal promoter that were critical for activity. Both elements (A and B were specifically recognized by proteins present in crude oocyte extracts based on oligonucleotide competition assays. The activity of promoter constructs in oocytes and in transfected somatic Xenopus XLK-WG kidney epithelial cells was quite different, indicating that the two cell types are not functionally equivalent and are not interchangeable as assay systems. CONCLUSIONS: Overall the results provide the first detailed characterization of the organization of a germ cell-specific Xenopus promoter and demonstrate the feasibility of using immature frog oocytes as an assay system for dissecting the biochemistry of germ cell gene regulation.

  7. Promoting Physical Activity among Underserved Populations.

    Mendoza-Vasconez, Andrea S; Linke, Sarah; Muñoz, Mario; Pekmezi, Dori; Ainsworth, Cole; Cano, Mayra; Williams, Victoria; Marcus, Bess H; Larsen, Britta A

    2016-01-01

    Underserved populations, including racial/ethnic minorities, individuals with low socioeconomic status, and individuals with physical disabilities, are less likely to engage in sufficient moderate to vigorous physical activity (MVPA) and are thus at increased risk of morbidity and mortality. These populations face unique challenges to engaging in MVPA. Learning how to overcome these challenges is a necessary first step in achieving health equity through health promotion research. In this review of the literature, we discuss issues and strategies that have been used to promote MVPA among individuals from underserved populations, focusing on recruitment, intervention delivery, and the use of technology in interventions. Physical activity promotion research among these vulnerable populations is scarce. Nevertheless, there is preliminary evidence of efficacy in the use of certain recruitment and intervention strategies including tailoring, cultural adaptation, incorporation of new technologies, and multilevel and community-based approaches for physical activity promotion among different underserved populations. PMID:27399827

  8. CRP interacts with promoter-bound sigma54 RNA polymerase and blocks transcriptional activation of the dctA promoter.

    Y. P. Wang; Kolb, A; M. Buck; Wen, J.; O'Gara, F.; Buc, H

    1998-01-01

    The cAMP receptor protein (CRP) is an activator of sigma70-dependent transcription. Analysis of the sigma54-dependent dctA promoter reveals a novel negative regulatory function for CRP. CRP can bind to two distant sites of the dctA promoter, sites which overlap the upstream activator sequences for the DctD activator. CRP interacts with Esigma54 bound at the dctA promoter via DNA loop formation. When the CRP-binding sites are deleted, CRP still interacts in a cAMP-dependent manner with the sta...

  9. A 5-methylcytosine DNA glycosylase/lyase demethylates the retrotransposon Tos17 and promotes its transposition in rice

    La, Honggui

    2011-09-06

    DNA 5-methylcytosine (5-meC) is an important epigenetic mark for transcriptional gene silencing in many eukaryotes. In Arabidopsis, 5-meC DNA glycosylase/lyases actively remove 5-meC to counter-act transcriptional gene silencing in a locus-specific manner, and have been suggested to maintain the expression of transposons. However, it is unclear whether plant DNA demethylases can promote the transposition of transposons. Here we report the functional characterization of the DNA glycosylase/lyase DNG701 in rice. DNG701 encodes a large (1,812 amino acid residues) DNA glycosylase domain protein. Recombinant DNG701 protein showed 5-meC DNA glycosylase and lyase activities in vitro. Knockout or knockdown of DNG701 in rice plants led to DNA hypermethylation and reduced expression of the retrotransposon Tos17. Tos17 showed less transposition in calli derived from dng701 knockout mutant seeds compared with that in wild-type calli. Overexpression of DNG701 in both rice calli and transgenic plants substantially reduced DNA methylation levels of Tos17 and enhanced its expression. The overexpression also led to more frequent transposition of Tos17 in calli. Our results demonstrate that rice DNG701 is a 5-meC DNA glycosylase/lyase responsible for the demethylation of Tos17 and this DNA demethylase plays a critical role in promoting Tos17 transposition in rice calli.

  10. INTRANUCLEAR MATRIX METALLOPROTEINASES PROMOTE DNA DAMAGE AND APOPTOSIS INDUCED BY OXYGEN–GLUCOSE DEPRIVATION IN NEURONS

    HILL, J. W.; PODDAR, R.; THOMPSON, J. F.; ROSENBERG, G. A.; YANG, Y.

    2016-01-01

    Degradation of the extracellular matrix by elevated matrix metalloproteinase (MMP) activity following ischemia/reperfusion is implicated in blood–brain barrier disruption and neuronal death. In contrast to their characterized extracellular roles, we previously reported that elevated intranuclear MMP-2 and -9 (gelatinase) activity degrades nuclear DNA repair proteins and promotes accumulation of oxidative DNA damage in neurons in rat brain at 3-h reperfusion after ischemic stroke. Here, we report that treatment with a broad-spectrum MMP inhibitor significantly reduced neuronal apoptosis in rat ischemic hemispheres at 48-h reperfusion after a 90-min middle cerebral artery occlusion (MCAO). Since extracellular gelatinases in brain tissue are known to be neurotoxic during acute stroke, the contribution of intranuclear MMP-2 and -9 activities in neurons to neuronal apoptosis has been unclear. To confirm and extend our in vivo observations, oxygen–glucose deprivation (OGD), an in vitro model of ischemia/reperfusion, was employed. Primary cortical neurons were subjected to 2-h OGD with reoxygenation. Increased intranuclear gelatinase activity was detected immediately after reoxygenation onset and was maximal at 24 h, while extracellular gelatinase levels remained unchanged. We detected elevated levels of both MMP-2 and -9 in neuronal nuclear extracts and gelatinase activity in neurons co-localized primarily with MMP-2. We found a marked decrease in PARP1, XRCC1, and OGG1, and decreased PARP1 activity. Pretreatment of neurons with selective MMP-2/9 inhibitor II significantly decreased gelatinase activity and downregulation of DNA repair enzymes, decreased accumulation of oxidative DNA damage, and promoted neuronal survival after OGD. Our results confirm the nuclear localization of gelatinases and their nuclear substrates observed in an animal stroke model, further supporting a novel role for intranuclear gelatinase activity in an intrinsic apoptotic pathway in neurons

  11. Promoting physical activity in socially vulnerable groups

    Herens, M.C.

    2016-01-01

    Background:  In the Netherlands, inequalities in physical activity behaviour go hand in hand with socioeconomic inequalities in health. To promote physical activity effectively and equitably, participatory community-based physical activity interventions seem promising and are supported by the Dutch government’s policy. Although many strategies have been developed to increase physical activity levels in general and in socially vulnerable groups in particular, most evaluations show o...

  12. The Evolution of Physical Activity Promotion

    Richards, Elizabeth

    2015-01-01

    Overview: A physically active lifestyle has numerous physical and mental health benefits for patients of all ages. Despite these significant benefits, a majority of Americans do not meet current physical activity guidelines. Health care providers, especially nurses, play a vital role in physical activity promotion. Over the past several decades, exercise and physical activity guidelines have evolved from a focus on structured, vigorous exercise to a focus on moderate-intensity “lifestyle” phy...

  13. Characterization of a stable, major DNA polymerase alpha species devoid of DNA primase activity.

    Kaiserman, H B; Benbow, R. M.

    1987-01-01

    We have purified from Xenopus laevis ovaries a major DNA polymerase alpha species that lacked DNA primase activity. This primase-devoid DNA polymerase alpha species exhibited the same sensitivity as the DNA polymerase DNA primase alpha to BuAdATP and BuPdGTP, nucleotide analogs capable of distinguishing between DNA polymerase delta and DNA polymerase DNA primase alpha. The primase-devoid DNA polymerase alpha species also lacked significant nuclease activity indicative of the alpha-like (rathe...

  14. NLRP3 Activation Was Regulated by DNA Methylation Modification during Mycobacterium tuberculosis Infection

    Wei, Meili; Wang, Lu; Wu, Tao; Xi, Jun; Han, Yuze; Yang, Xingxiang; Zhang, Ding; Fang, Qiang

    2016-01-01

    Mycobacterium tuberculosis (Mtb) infection activates the NLRP3 inflammasome in macrophages and dendritic cells. Much attention has been paid to the mechanisms for regulation of NLRP3 against Mtb. However, whether epigenetic mechanisms participated in NLRP3 activation is still little known. Here we showed that NLRP3 activation was regulated by DNA methylation modification. Mtb infection promoted NLRP3 activation and inflammatory cytokines expression. NLRP3 promoter was cloned and subsequently identified by Dual-Luciferase Reporter System. The results showed that NLRP3 promoter activity was decreased after methylation by DNA methylase Sss I in vitro. Meanwhile, DNA methyltransferases inhibitor DAC could upregulate the expression of NLRP3. Furthermore, promoter region of NLRP3 gene was demethylated after Mtb H37Rv strain infection. These data revealed that DNA methylation was involved in NLRP3 inflammasome activation during Mtb infection and provided a new insight into the relationship between host and pathogens. PMID:27366746

  15. Evaluation of Results from Sales Promotion Activities

    Olimpia Ban

    2007-02-01

    Full Text Available An essential element of the sales promotion strategy and not only is the evaluation of the results obtained from the activities performed. Due to their nature and applicability, the evaluation of the sales promotion is much easier to be achieved, but it raises some problems. Using a hypothetical example, we have tried to develop a "classic" evaluation model of the specialty literature.

  16. TH17 cells promote microbial killing and innate immune sensing of DNA via interleukin 26

    Meller, Stephan; Domizio, Jeremy Di; Voo, Kui S; Friedrich, Heike C; Chamilos, Georgios; Ganguly, Dipyaman; Conrad, Curdin; Gregorio, Josh; Roy, Didier Le; Roger, Thierry; Ladbury, John E; Homey, Bernhard; Watowich, Stanley; Modlin, Robert L; Kontoyiannis, Dimitrios P; Liu, Yong-Jun; Arold, Stefan T; Gilliet, Michel

    2016-01-01

    Interleukin 17–producing helper T cells (TH17 cells) have a major role in protection against infections and in mediating autoimmune diseases, yet the mechanisms involved are incompletely understood. We found that interleukin 26 (IL-26), a human TH17 cell–derived cytokine, is a cationic amphipathic protein that kills extracellular bacteria via membrane-pore formation. Furthermore, TH17 cell–derived IL-26 formed complexes with bacterial DNA and self-DNA released by dying bacteria and host cells. The resulting IL-26–DNA complexes triggered the production of type I interferon by plasmacytoid dendritic cells via activation of Toll-like receptor 9, but independently of the IL-26 receptor. These findings provide insights into the potent antimicrobial and proinflammatory function of TH17 cells by showing that IL-26 is a natural human antimicrobial that promotes immune sensing of bacterial and host cell death. PMID:26168081

  17. Modulation of UvrD Helicase Activity by Covalent DNA-Protein Cross-links*

    Kumari, Anuradha; Minko, Irina G.; Smith, Rebecca L.; Lloyd, R. Stephen; McCullough, Amanda K.

    2010-01-01

    UvrD (DNA helicase II) has been implicated in DNA replication, DNA recombination, nucleotide excision repair, and methyl-directed mismatch repair. The enzymatic function of UvrD is to translocate along a DNA strand in a 3′ to 5′ direction and unwind duplex DNA utilizing a DNA-dependent ATPase activity. In addition, UvrD interacts with many other proteins involved in the above processes and is hypothesized to facilitate protein turnover, thus promoting further DNA processing. Although UvrD int...

  18. Osteoponin Promoter Controlled by DNA Methylation: Aberrant Methylation in Cloned Porcine Genome

    Chih-Jie Shen

    2014-01-01

    Full Text Available Cloned animals usually exhibited many defects in physical characteristics or aberrant epigenetic reprogramming, especially in some important organ development. Osteoponin (OPN is an extracellular-matrix protein involved in heart and bone development and diseases. In this study, we investigated the correlation between OPN mRNA and its promoter methylation changes by the 5-aza-dc treatment in fibroblast cell and promoter assay. Aberrant methylation of porcine OPN was frequently found in different tissues of somatic nuclear transferred cloning pigs, and bisulfite sequence data suggested that the OPN promoter region −2615 to −2239 nucleotides (nt may be a crucial regulation DNA element. In pig ear fibroblast cell culture study, the demethylation of OPN promoter was found in dose-dependent response of 5-aza-dc treatment and followed the OPN mRNA reexpression. In cloned pig study, discrepant expression pattern was identified in several cloned pig tissues, especially in brain, heart, and ear. Promoter assay data revealed that four methylated CpG sites presenting in the −2615 to −2239 nt region cause significant downregulation of OPN promoter activity. These data suggested that methylation in the OPN promoter plays a crucial role in the regulation of OPN expression that we found in cloned pigs genome.

  19. Vitamin and antioxidant rich diet increases MLH1 promoter DNA methylation in DMT2 subjects

    Switzeny Olivier J

    2012-10-01

    Full Text Available Abstract Background Oxidative stress may lead to an increased level of unrepaired cellular DNA damage, which is discussed as one risk for tumor initiation. Mismatch repair (MMR enzymes act as proofreading complexes that maintain the genomic integrity and MMR-deficient cells show an increased mutation rate. One important gene in the MMR complex is the MutL homolog 1 (MLH1 gene. Since a diet rich in antioxidants has the potential to counteract harmful effects by reactive oxygen species (ROS, we investigated the impact of an antioxidant, folate, and vitamin rich diet on the epigenetic pattern of MLH1. These effects were analyzed in individuals with non-insulin depended diabetes mellitus type 2 (NIDDM2 and impaired fasting glucose (IFG. Methods In this post-hoc analysis of a randomized trial we analyzed DNA methylation of MLH1, MSH2, and MGMT at baseline and after 8 weeks of intervention, consisting of 300 g vegetables and 25 ml plant oil rich in polyunsaturated fatty acids per day. DNA methylation was quantified using combined bisulfite restriction enzyme analysis (COBRA and pyrosequencing. MLH1 and DNMT1 mRNA expression were investigated by qRT-PCR. DNA damage was assessed by COMET assay. Student’s two-tailed paired t test and one-way ANOVA with Scheffé corrected Post hoc test was used to determine significant methylation and expression differences. Two-tailed Pearson test was used to determine correlations between methylation level, gene expression, and DNA strand break amount. Results The intervention resulted in significantly higher CpG methylation in two particular MLH1 promoter regions and the MGMT promoter. DNA strand breaks and methylation levels correlated significantly. The expression of MLH1, DNMT1, and the promoter methylation of MSH2 remained stable. CpG methylation levels and gene expression did not correlate. Conclusion This vitamin and antioxidant rich diet affected the CpG methylation of MLH1. The higher methylation might be a

  20. Identification of procollagen promoter DNA-binding proteins: effects of dexamethasone

    Glucocorticoids selectively decrease procollagen synthesis by decreasing procollagen mRNA transcription. Dexamethasone coordinately decreased total cellular type I and type III procollagen mRNAs in mouse embryonic skin fibroblasts. Since sequence specific DNA-binding proteins are known to modulate eukaryotic gene expression the authors identified in mouse fibroblasts nuclear proteins which bind to types I and III procollagen promoter DNAs. Nuclear proteins were electrophoresed, blotted onto nitrocellulose and probed with 32P-end-labeled type I and type III procollagen promoter DNAs in the presence of equimolar amounts of 32P-end-labeled vector DNA. Differences in total DNA binding were noted by the densitometric scans of the nuclear proteins. Dexamethasone treatment enhanced total DNA binding. Increasing the NaCl concentration decreased the number of promoter DNA-binding proteins without altering the relative specificity for the promoter DNAs. Promoter DNA binding to nuclear proteins was also inhibited by increasing concentrations of E. coli DNA. The number of DNA-binding proteins was greater for type III procollagen promoter DNA. The effect of dexamethasone treatment on promoter DNA binding to nuclear proteins was determined

  1. Effects of DNA strand breaks on transcription by RNA polymerase III: insights into the role of TFIIIB and the polarity of promoter opening

    Kassavetis, George A.; Grove, Anne; Geiduschek, E.Peter

    2002-01-01

    Certain deletion mutants of the Brf1 and Bdp1 subunits of transcription factor (TF) IIIB retain the ability to recruit RNA polymerase (pol) III to its promoters, but fail to support promoter opening: deletions within an internal Bdp1 segment interfere with initiation of DNA strand separation, and an N-terminal Brf1 deletion blocks propagation of promoter opening past the transcriptional start site. The ability of DNA strand breaks to restore pol III transcription activity to these defective T...

  2. cis Determinants of Promoter Threshold and Activation Timescale

    Anders S. Hansen

    2015-08-01

    Full Text Available Although the relationship between DNA cis-regulatory sequences and gene expression has been extensively studied at steady state, how cis-regulatory sequences affect the dynamics of gene induction is not known. The dynamics of gene induction can be described by the promoter activation timescale (AcTime and amplitude threshold (AmpThr. Combining high-throughput microfluidics with quantitative time-lapse microscopy, we control the activation dynamics of the budding yeast transcription factor, Msn2, and reveal how cis-regulatory motifs in 20 promoter variants of the Msn2-target-gene SIP18 affect AcTime and AmpThr. By modulating Msn2 binding sites, we can decouple AmpThr from AcTime and switch the SIP18 promoter class from high AmpThr and slow AcTime to low AmpThr and either fast or slow AcTime. We present a model that quantitatively explains gene-induction dynamics on the basis of the Msn2-binding-site number, TATA box location, and promoter nucleosome organization. Overall, we elucidate the cis-regulatory logic underlying promoter decoding of TF dynamics.

  3. ERK activation promotes neuronal degeneration predominantly through plasma membrane damage and independently of caspase-3

    Subramaniam, Srinivasa; Zirrgiebel, Ute; von Bohlen und Halbach, Oliver; Strelau, Jens; Laliberté, Christine; Kaplan, David R.; Unsicker, Klaus

    2004-01-01

    Our recent studies have shown that extracellular-regulated protein kinase (ERK) promotes cell death in cerebellar granule neurons (CGN) cultured in low potassium. Here we report that the “death” phenotypes of CGN after potassium withdrawal are heterogeneous, allowing the distinction between plasma membrane (PM)–, DNA-, and PM/DNA-damaged populations. These damaged neurons display nuclear condensation that precedes PM or DNA damage. Inhibition of ERK activation either by U0126 or by dominant-n...

  4. SUMO-1 possesses DNA binding activity

    Wieruszeski Jean-Michel

    2010-05-01

    Full Text Available Abstract Background Conjugation of small ubiquitin-related modifiers (SUMOs is a frequent post-translational modification of proteins. SUMOs can also temporally associate with protein-targets via SUMO binding motifs (SBMs. Protein sumoylation has been identified as an important regulatory mechanism especially in the regulation of transcription and the maintenance of genome stability. The precise molecular mechanisms by which SUMO conjugation and association act are, however, not understood. Findings Using NMR spectroscopy and protein-DNA cross-linking experiments, we demonstrate here that SUMO-1 can specifically interact with dsDNA in a sequence-independent fashion. We also show that SUMO-1 binding to DNA can compete with other protein-DNA interactions at the example of the regulatory domain of Thymine-DNA Glycosylase and, based on these competition studies, estimate the DNA binding constant of SUMO1 in the range 1 mM. Conclusion This finding provides an important insight into how SUMO-1 might exert its activity. SUMO-1 might play a general role in destabilizing DNA bound protein complexes thereby operating in a bottle-opener way of fashion, explaining its pivotal role in regulating the activity of many central transcription and DNA repair complexes.

  5. Gene activation by induced DNA rearrangements

    A murine cell line (EN/NIH) containing the retroviral vector ZIPNeoSV(x)1 that was modified by deletion of the enhancer elements in the viral long terminal repeats has been used as an assay system to detect induced DNA rearrangements that result in activation of a transcriptionally silent reporter gene encoded by the viral genome. The spontaneous frequency of G418 resistance is less than 10(-7), whereas exposure to the tumor promoter 12-O-tetradecanoylphorbol-13-acetate (TPA) or the combination of UV irradiation plus TPA resulted in the emergence of drug resistant cell lines at a frequency of 5 per 10(6) and 67 per 10(6) cells, respectively. In several of the cell lines that were analyzed a low level of amplification of one of the two parental retroviral integrants was observed, whereas in others no alteration in the region of the viral genome was detected. To determine the effect of the SV40 large T antigen on induced DNA rearrangements, EN/NIH cells were transfected with a temperature sensitive (ts) mutant of SV40 T. Transfectants were maintained at the permissive temperature (33 degrees C) for varying periods of time (1-5 days) in order to vary SV40 T antigen exposure, after which they were shifted to 39.5 degrees C for selection in G418. The frequency of emergence of drug resistant cell clones increased with duration of exposure to large T antigen (9-52 per 10(6) cells over 1-5 days, respectively), and all cell lines analyzed demonstrated DNA rearrangements in the region of the neo gene. A novel 18-kilobase pair XbaI fragment was cloned from one cell line which revealed the presence of a 2.0-kilobase pair EcoRI segment containing an inverted duplication which hybridized to neo sequences. It is likely that the observed rearrangement was initiated by the specific binding of large T antigen to the SV40 origin of replication encoded within the viral genome

  6. Alpha-Lipoic acid counteracts the promoted oxidative DNA damage in the liver of septic rats

    Viral, parasitic infections and chemical carcinogens are among the etiological factors of liver cancer. It seems important to study the initiating and promoting agents to evaluate the etiology and prevention of such life threatening disease. Intestine-derived bacteria product, lipopolysaccharide (LPS), is mainly detoxified by the liver. It has shown to induce a state of oxidative DNA damage is not fully investigated. Increased oxidative DNA damage and rate of cell proliferation may initiate or even promote cancer. In the present work, the capability of LPS to induce 8-hydroxydeoxyguanosine (8-HDG), a specific DNA adduct for oxidative DNA damage, in rat livers is tested. Furthermore, a possible protective effect of alpha lipoic acid (ALA) is also assessed. Investigated parameters are liver contents of glutathione (GSH), lipid peroxides (MDA), nitric oxide (NO) and 8-HDG in the liver-extracted DNA. Serum activities of ALT, AST and GGT as liver-function markers as well as IL2 are assessed. Moreover, liver histology is examined. LPS was given doses of 1, 3, 5, 7 and 9 mg/kg once i.p. while, the rat mortality was examined 24 hours later. ALA was given in doses of 50, 100 and 200 mg/kg once i.p. 3h before LPS is found to be 5mg/kg. LPS increased the level of 8-HDG, MDA and NO in the liver. It also induced acute liver necrosis and inflammatory cell infiltration as shown in liver-histopathology and in the significant increase in the activities of ALT, AST and GGT. LPS increased the serum level of IL2 as well. The dose 200mg/kg of ALA revealed a 100% protection against LPS-induced lethality. It also, prevented the LPS-induced increase in 8-HDG in liver extracted DNA, the liver contents of MDA and NO. ALA also rescued the LPS-induced GSH depletion. It corrected the liver function as shown by the prevention of increases in the activity of ALT, AST and GGT with a remarkable improvement in the liver histology. Moreover, it prevented the increase in serum level of IL2. These

  7. Protein found to promote DNA repair, prevent cancer

    2008-01-01

    @@ An abundant chromosomal protein that binds to damaged DNA prevents cancer development by enhancing DNA repair, researchers at University of Texas reported on-line in the Proceedings of the National Academies of Science.

  8. The murine biglycan: Complete cDNA cloning, genomic organization, promoter function, and expression

    Wegrowski, Y.; Pillarisetti, J.; Danielson, K.G.; Iozzo, R.V. [Thomas Jefferson Univ., Philadelphia, PA (United States); Suzuki, S. [Univ. of Southern California, Los Angeles, CA (United States)

    1995-11-01

    Biglycan is a ubiquitous chondroitin/dermatan sulfate proteoglycan that belongs to a growing family of proteins harboring leucine-rich repeats. We have cloned and sequenced the cDNA containing the complete murine biglycan, elucidated its genomic organization, and demonstrated functional promoter activity of its 5{prime} flanking region. The deduced biglycan protein core was highly conserved across species. However, the mouse biglycan (Bgn) gene was significantly larger than the human counterpart, primarily because of a large > 4.5-kb intron between exons 1 and 2. The mouse Bgn gene spanned over 9.5 kb of continuous DNA and comprised 8 exons, with a perfectly conserved intron/exon organization vis-a-vis the human counterpart. The promoter region was enriched in GC dinucleotide and contained numerous cis-acting elements including binding sites for SP-1, AP-1, and AP-2 factors. It lacked TATA and CAAT boxes typical of housekeeping genes. In support of this, primer extension analysis showed the existence of multiple transcription start sites. Transient cell transfection assays with a construct comprising the 548 hp upstream of the major transcription start site fused to the chloramphenicol acetyl transferase reporter gene showed functional promoter activity. Internal and 5{prime} deletion constructs showed that the distal promoter of the Bgn gene was required for full transcriptional activity. In contrast to the homologous proteoglycan decorin, the highest expression of biglycan mRNA was observed in lung, liver, and spleen of adult mouse and the lowest in skin, heart, and kidney. These results will be useful for the study of biglycan gene regulation and for the generation of mice with targeted null mutation of the Bgn gene. 56 refs., 7 figs., 1 tab.

  9. Interaction of Individual Structural Domains of hnRNP LL with the BCL2 Promoter i-Motif DNA.

    Roy, Basab; Talukder, Poulami; Kang, Hyun-Jin; Tsuen, Shujian S; Alam, Mohammad P; Hurley, Laurence H; Hecht, Sidney M

    2016-08-31

    The recently discovered role of the BCL2 (B-cell lymphoma 2 gene) promoter i-motif DNA in modulation of gene expression via interaction with the ribonucleoprotein hnRNP L-like (hnRNP LL) has prompted a more detailed study of the nature of this protein-DNA interaction. The RNA recognition motifs (RRMs) of hnRNP LL were expressed individually, and both RRM1 and RRM2 were found to bind efficiently to the BCL2 i-motif DNA, as well as being critical for transcriptional activation, whereas RRM3-4 bound only weakly to this DNA. Binding was followed by unfolding of the DNA as monitored by changes in the CD spectrum. Mutational analysis of the i-motif DNA revealed that binding involved primarily the lateral loops of the i-motif. The kinetics of binding of the DNA with RRM1 was explored by recording CD spectra at predetermined times following admixture of the protein and DNA. The change in molar ellipticity was readily apparent after 30 s and largely complete within 1 min. A more detailed view of protein-DNA interaction was obtained by introducing the fluorescence donor 6-CNTrp in RRM1 at position 137, and the acceptor 4-aminobenzo[g]quinazoline-2-one (Cf) in lieu of cytidine22 in the i-motif DNA. The course of binding of the two species was monitored by FRET, which reflected a steady increase in energy transfer over a period of several minutes. The FRET signal could be diminished by the further addition of (unlabeled) RRM2, no doubt reflecting competition for binding to the i-motif DNA. These experiments using the individual RRM domains from hnRNP LL confirm the role of this transcription factor in activation of BCL2 transcription via the i-motif in the promoter element. PMID:27483029

  10. Nuclear interferon-inducible protein 16 promotes silencing of herpesviral and transfected DNA

    Orzalli, Megan H.; Conwell, Sara E.; Berrios, Christian; DeCaprio, James A.; Knipe, David M.

    2013-01-01

    Cells have evolved mechanisms to silence foreign DNA to prevent the expression of foreign genes within them. In mammalian cells, this involves the assembly of heterochromatin on foreign DNAs such as viral or transfected DNA. Herpesviruses have evolved strategies to counteract these host mechanisms to express their own genes. Herein we demonstrate that the nuclear DNA sensor IFN-inducible protein 16 (IFI16) is involved in the host silencing response to foreign DNA. IFI16 promotes the assembly ...

  11. Tumour promoter activity in Malaysian Euphorbiaceae.

    Norhanom, A W; Yadav, M

    1995-04-01

    Herbal medication has been practised by the rural Malaysian Malays for a long time. However, the long-term side-effects have never been studied. In the present study, 48 species of Euphorbiaceae were screened for tumour-promoter activity by means of an in vitro assay using a human lymphoblastoid cell line harbouring the Epstein-Barr virus (EBV) genome. Twenty-seven per cent (13 out of 48) of the species tested were found to be positive, and in four species, namely Breynia coronata Hk.f, Codiaeum variegatum (L) Bl, Euphorbia atoto and Exocoecaria agallocha, EBV-inducing activity was observed when the plant extracts were tested at low concentrations of between 0.2 and 1.2 micrograms ml-1 in cell culture. This observation warrants attention from the regular users of these plants because regular use of plants with tumour-promoting activity could well be an aetiological factor for the promotion of tumours among rural Malaysian Malays. PMID:7710943

  12. Inhibition of SIRT1 reactivates silenced cancer genes without loss of promoter DNA hypermethylation.

    Kevin Pruitt

    2006-03-01

    Full Text Available The class III histone deactylase (HDAC, SIRT1, has cancer relevance because it regulates lifespan in multiple organisms, down-regulates p53 function through deacetylation, and is linked to polycomb gene silencing in Drosophila. However, it has not been reported to mediate heterochromatin formation or heritable silencing for endogenous mammalian genes. Herein, we show that SIRT1 localizes to promoters of several aberrantly silenced tumor suppressor genes (TSGs in which 5' CpG islands are densely hypermethylated, but not to these same promoters in cell lines in which the promoters are not hypermethylated and the genes are expressed. Heretofore, only type I and II HDACs, through deactylation of lysines 9 and 14 of histone H3 (H3-K9 and H3-K14, respectively, had been tied to the above TSG silencing. However, inhibition of these enzymes alone fails to re-activate the genes unless DNA methylation is first inhibited. In contrast, inhibition of SIRT1 by pharmacologic, dominant negative, and siRNA (small interfering RNA-mediated inhibition in breast and colon cancer cells causes increased H4-K16 and H3-K9 acetylation at endogenous promoters and gene re-expression despite full retention of promoter DNA hypermethylation. Furthermore, SIRT1 inhibition affects key phenotypic aspects of cancer cells. We thus have identified a new component of epigenetic TSG silencing that may potentially link some epigenetic changes associated with aging with those found in cancer, and provide new directions for therapeutically targeting these important genes for re-expression.

  13. Identification of Escherichia coli DNA helicase IV with the use of a DNA helicase activity gel.

    Trieu, V N; McCarthy, D

    1989-01-01

    A DNA helicase activity gel was developed based on the assumption that DNA helicases could unwind double-stranded DNA in a polyacrylamide matrix. The production of single-stranded DNA was detected by staining the activity gel with acridine orange and visualizing the gel under long-wave UV light. The products of DNA helicase activities appeared as red bands within a green fluorescent background. A novel DNA helicase, called helicase IV, was detected in crude extracts of Escherichia coli with t...

  14. Lyn tyrosine kinase promotes silencing of ATM-dependent checkpoint signaling during recovery from DNA double-strand breaks

    Highlights: • Inhibition of Src family kinases decreased γ-H2AX signal. • Inhibition of Src family increased ATM-dependent phosphorylation of Chk2 and Kap1. • shRNA-mediated knockdown of Lyn increased phosphorylation of Kap1 by ATM. • Ectopic expression of Src family kinase suppressed ATM-mediated Kap1 phosphorylation. • Src is involved in upstream signaling for inactivation of ATM signaling. - Abstract: DNA damage activates the DNA damage checkpoint and the DNA repair machinery. After initial activation of DNA damage responses, cells recover to their original states through completion of DNA repair and termination of checkpoint signaling. Currently, little is known about the process by which cells recover from the DNA damage checkpoint, a process called checkpoint recovery. Here, we show that Src family kinases promote inactivation of ataxia telangiectasia mutated (ATM)-dependent checkpoint signaling during recovery from DNA double-strand breaks. Inhibition of Src activity increased ATM-dependent phosphorylation of Chk2 and Kap1. Src inhibition increased ATM signaling both in G2 phase and during asynchronous growth. shRNA knockdown of Lyn increased ATM signaling. Src-dependent nuclear tyrosine phosphorylation suppressed ATM-mediated Kap1 phosphorylation. These results suggest that Src family kinases are involved in upstream signaling that leads to inactivation of the ATM-dependent DNA damage checkpoint

  15. Lyn tyrosine kinase promotes silencing of ATM-dependent checkpoint signaling during recovery from DNA double-strand breaks

    Fukumoto, Yasunori, E-mail: fukumoto@faculty.chiba-u.jp; Kuki, Kazumasa; Morii, Mariko; Miura, Takahito; Honda, Takuya; Ishibashi, Kenichi; Hasegawa, Hitomi; Kubota, Sho; Ide, Yudai; Yamaguchi, Noritaka; Nakayama, Yuji; Yamaguchi, Naoto, E-mail: nyama@faculty.chiba-u.jp

    2014-09-26

    Highlights: • Inhibition of Src family kinases decreased γ-H2AX signal. • Inhibition of Src family increased ATM-dependent phosphorylation of Chk2 and Kap1. • shRNA-mediated knockdown of Lyn increased phosphorylation of Kap1 by ATM. • Ectopic expression of Src family kinase suppressed ATM-mediated Kap1 phosphorylation. • Src is involved in upstream signaling for inactivation of ATM signaling. - Abstract: DNA damage activates the DNA damage checkpoint and the DNA repair machinery. After initial activation of DNA damage responses, cells recover to their original states through completion of DNA repair and termination of checkpoint signaling. Currently, little is known about the process by which cells recover from the DNA damage checkpoint, a process called checkpoint recovery. Here, we show that Src family kinases promote inactivation of ataxia telangiectasia mutated (ATM)-dependent checkpoint signaling during recovery from DNA double-strand breaks. Inhibition of Src activity increased ATM-dependent phosphorylation of Chk2 and Kap1. Src inhibition increased ATM signaling both in G2 phase and during asynchronous growth. shRNA knockdown of Lyn increased ATM signaling. Src-dependent nuclear tyrosine phosphorylation suppressed ATM-mediated Kap1 phosphorylation. These results suggest that Src family kinases are involved in upstream signaling that leads to inactivation of the ATM-dependent DNA damage checkpoint.

  16. THE CONTROL AND EVALUATION OF PROMOTIONAL ACTIVITIES

    Felicia Sabou

    2012-01-01

    Full Text Available The paper focused on importance and benefits of control and evaluation of marketing activities. The control of efficiency review the assessment of the resources for marketing activity, checking also the efficiency of the human resources, advertising, promotion activities and distribution activities. In the analyse of human resources the most important ratio are: the average of costumers visits on a day, the number of custom order received from 100 visits, the number of new customers from a period, the number of lost customers from a period, the marketing human expenditures from all the sales.The strategic control is made to check if the objectives and the company strategy are adapted to the marketing environment.

  17. Using evaluation strategically to promote active learning

    Münster, Marie

    Rationale: The challenge presented here is how to utilise evaluation to promote active learning. The method used is constructive alignment (Biggs & Tang, 2007) of learning objectives, learning and evaluation along with further considerations including which competences are promoted, the time...... for discussions and organising the course with group work allows for plenty of that. Furthermore, as group work is how many companies organise work today – the ability to cooperate well in groups is assessed to be an important competence for engineering students to achieve. The course is taught using...... the principle of inductive learning (Prince & Felder, 2006) with the students being presented with the case from the beginning and subsequently achieving the tools to perform the projects. This is both frustrating and motivating for the students as they know why they need to have the tools, but they feel...

  18. Regulation of the activity of the dual-function DnaA protein in Caulobacter crescentus.

    Carmen Fernandez-Fernandez

    Full Text Available DnaA is a conserved essential bacterial protein that acts as the initiator of chromosomal replication as well as a master transcriptional regulator in Caulobacter crescentus. Thus, the intracellular levels of active DnaA need to be tightly regulated during the cell cycle. Our previous work suggested that DnaA may be regulated at the level of its activity by the replisome-associated protein HdaA. Here, we describe the construction of a mutant DnaA protein [DnaA(R357A]. The R357 residue in the AAA+ domain of the C. crescentus DnaA protein is equivalent to the R334 residue of the E. coli DnaA protein, which is required for the Regulatory Inactivation of DnaA (RIDA. We found that the expression of the DnaA(R357A mutant protein in C. crescentus, but not the expression of the wild-type DnaA protein at similar levels, causes a severe phenotype of over-initiation of chromosomal replication and that it blocks cell division. Thus, the mutant DnaA(R357A protein is hyper-active to promote the initiation of DNA replication, compared to the wild-type DnaA protein. DnaA(R357A could not replace DnaA in vivo, indicating that the switch in DnaA activity once chromosomal replication has started may be an essential process in C. crescentus. We propose that the inactivation of DnaA is the main mechanism ensuring that chromosomal replication starts only once per cell cycle. We further observed that the R357A substitution in DnaA does not promote the activity of DnaA as a direct transcriptional activator of four important genes, encoding HdaA, the GcrA master cell cycle regulator, the FtsZ cell division protein and the MipZ spatial regulator of cell division. Thus, the AAA+ domain of DnaA may play a role in temporally regulating the bifunctionality of DnaA by reallocating DnaA molecules from initiating DNA replication to transcribing genes within the unique DnaA regulon of C. crescentus.

  19. Loyalty Card Promotional Activity in Budget Hotel

    Teng, Fei

    2010-01-01

    Loyalty card is one of the most commonly used promotional activities in business. Thus far, there are some research has been done on luxury hotel, but very few researches are on budget hotel. So, the purpose of the thesis is finding out the Swedish customers’ attitude and behavior towards budget hotel’s loyalty card; getting to know what factors influence Swedish customers’ response towards the loyalty card and budget hotels. In the thesis, the main research problem is “How do Swedish custome...

  20. Tumour promoter activity in Malaysian Euphorbiaceae.

    Norhanom, A W; Yadav, M

    1995-01-01

    Herbal medication has been practised by the rural Malaysian Malays for a long time. However, the long-term side-effects have never been studied. In the present study, 48 species of Euphorbiaceae were screened for tumour-promoter activity by means of an in vitro assay using a human lymphoblastoid cell line harbouring the Epstein-Barr virus (EBV) genome. Twenty-seven per cent (13 out of 48) of the species tested were found to be positive, and in four species, namely Breynia coronata Hk.f, Codia...

  1. DNA structure in human RNA polymerase II promoters

    Pedersen, Anders Gorm; Baldi, Pierre; Chauvin, Yves;

    1998-01-01

    in a region upstream of the transcriptional start point and significantly higher downstream. Investigation of the sequence composition in the two regions shows that the bendability profile originates from the sequential structure of the DNA, rather than the general nucleotide composition...... in sequence and bendability, which is in phase with the DNA helical pitch. The periodic bendability profile shows bending peaks roughly at every 10bp with stronger bending at 20bp intervals. These observations suggest that DNA in the region downstream of the transcriptional start point is able to...

  2. The suppression and promotion of DNA charge inversion by mixing counterions.

    Qiu, Shixue; Wang, Yanwei; Cao, Bozhi; Guo, Zilong; Chen, Yang; Yang, Guangcan

    2015-05-28

    In the preset study, we report the suppression and promotion of DNA charge inversion by mixing a quadrivalent counterion (spermine) with mono-, di- and trivalent counterions by dynamic light scattering (DLS) and single molecule electrophoresis (SME) methods. We find that the electrophoretic mobility of DNA in spermine solution decreases in the presence of monovalent sodium ions and divalent magnesium ions. It means that the charge neutralization of DNA by the quadrivalent counterion is suppressed when adding extra mono- or divalent counterions. More specifically, at a high concentration of spermine, the positive mobility can switch back to a negative value by adding mono- and divalent counterions. Thus, charge neutralization and inversion of DNA by quadrivalent counterions is suppressed in the mono- and divalent ion solution. However, the scenario changes dramatically when we add trivalent ions into the solution of DNA and spermine. In this case, the charge neutralization and inversion of DNA is promoted rather than suppressed by mixing with trivalent ions. The negative electrophoretic mobility can be promoted to a positive value, which corresponds to the charge inversion, by trivalent counterions. Thus trivalent and quadrivalent counterions work cooperatively in DNA charge neutralization and inversion. This promotion also occurs when highly positively charged chitosan is introduced into the solution. We explain the observation by the counterion complexation that is related to DNA condensation, which is supported by the images of atomic force microscopy (AFM). PMID:25913809

  3. Defective removal of ribonucleotides from DNA promotes systemic autoimmunity

    Günther, Claudia; Kind, Barbara; Reijns, Martin A.M.; Berndt, Nicole; Martinez-Bueno, Manuel; Wolf, Christine; Tüngler, Victoria; Chara, Osvaldo; Lee, Young Ae; Hübner, Norbert; Bicknell, Louise; Blum, Sophia; Krug, Claudia; Schmidt, Franziska; Kretschmer, Stefanie; Koss, Sarah; Astell, Katy R.; Ramantani, Georgia; Bauerfeind, Anja; Morris, David L.; Cunninghame Graham, Deborah S.; Bubeck, Doryen; Leitch, Andrea; Ralston, Stuart H.; Blackburn, Elizabeth A.; Gahr, Manfred; Witte, Torsten; Vyse, Timothy J.; Melchers, Inga; Mangold, Elisabeth; Nöthen, Markus M.; Aringer, Martin; Kuhn, Annegret; Lüthke, Kirsten; Unger, Leonore; Bley, Annette; Lorenzi, Alice; Isaacs, John D.; Alexopoulou, Dimitra; Conrad, Karsten; Dahl, Andreas; Roers, Axel; Alarcon-Riquelme, Marta E.; Jackson, Andrew P.; Lee-Kirsch, Min Ae

    2014-01-01

    Genome integrity is continuously challenged by the DNA damage that arises during normal cell metabolism. Biallelic mutations in the genes encoding the genome surveillance enzyme ribonuclease H2 (RNase H2) cause Aicardi-Goutières syndrome (AGS), a pediatric disorder that shares features with the autoimmune disease systemic lupus erythematosus (SLE). Here we determined that heterozygous parents of AGS patients exhibit an intermediate autoimmune phenotype and demonstrated a genetic association between rare RNASEH2 sequence variants and SLE. Evaluation of patient cells revealed that SLE- and AGS-associated mutations impair RNase H2 function and result in accumulation of ribonucleotides in genomic DNA. The ensuing chronic low level of DNA damage triggered a DNA damage response characterized by constitutive p53 phosphorylation and senescence. Patient fibroblasts exhibited constitutive upregulation of IFN-stimulated genes and an enhanced type I IFN response to the immunostimulatory nucleic acid polyinosinic:polycytidylic acid and UV light irradiation, linking RNase H2 deficiency to potentiation of innate immune signaling. Moreover, UV-induced cyclobutane pyrimidine dimer formation was markedly enhanced in ribonucleotide-containing DNA, providing a mechanism for photosensitivity in RNase H2–associated SLE. Collectively, our findings implicate RNase H2 in the pathogenesis of SLE and suggest a role of DNA damage–associated pathways in the initiation of autoimmunity. PMID:25500883

  4. DNA-based control of protein activity.

    Engelen, W; Janssen, B M G; Merkx, M

    2016-03-01

    DNA has emerged as a highly versatile construction material for nanometer-sized structures and sophisticated molecular machines and circuits. The successful application of nucleic acid based systems greatly relies on their ability to autonomously sense and act on their environment. In this feature article, the development of DNA-based strategies to dynamically control protein activity via oligonucleotide triggers is discussed. Depending on the desired application, protein activity can be controlled by directly conjugating them to an oligonucleotide handle, or expressing them as a fusion protein with DNA binding motifs. To control proteins without modifying them chemically or genetically, multivalent ligands and aptamers that reversibly inhibit their function provide valuable tools to regulate proteins in a noncovalent manner. The goal of this feature article is to give an overview of strategies developed to control protein activity via oligonucleotide-based triggers, as well as hurdles yet to be taken to obtain fully autonomous systems that interrogate, process and act on their environments by means of DNA-based protein control. PMID:26812623

  5. TH17 cells promote microbial killing and innate immune sensing of DNA via interleukin 26

    Meller, Stephan

    2015-07-13

    Interleukin 17-producing helper T cells (TH 17 cells) have a major role in protection against infections and in mediating autoimmune diseases, yet the mechanisms involved are incompletely understood. We found that interleukin 26 (IL-26), a human TH17 cell-derived cytokine, is a cationic amphipathic protein that kills extracellular bacteria via membrane-pore formation. Furthermore, TH17 cell-derived IL-26 formed complexes with bacterial DNA and self-DNA released by dying bacteria and host cells. The resulting IL-26-DNA complexes triggered the production of type I interferon by plasmacytoid dendritic cells via activation of Toll-like receptor 9, but independently of the IL-26 receptor. These findings provide insights into the potent antimicrobial and proinflammatory function of TH17 cells by showing that IL-26 is a natural human antimicrobial that promotes immune sensing of bacterial and host cell death. © 2015 Nature America, Inc.

  6. EBV-LMP1 suppresses the DNA damage response through DNA-PK/AMPK signaling to promote radioresistance in nasopharyngeal carcinoma.

    Lu, Jingchen; Tang, Min; Li, Hongde; Xu, Zhijie; Weng, Xinxian; Li, Jiangjiang; Yu, Xinfang; Zhao, Luqing; Liu, Hongwei; Hu, Yongbin; Tan, Zheqiong; Yang, Lifang; Zhong, Meizuo; Zhou, Jian; Fan, Jia; Bode, Ann M; Yi, Wei; Gao, Jinghe; Sun, Lunquan; Cao, Ya

    2016-09-28

    We conducted this research to explore the role of latent membrane protein 1 (LMP1) encoded by the Epstein-Barr virus (EBV) in modulating the DNA damage response (DDR) and its regulatory mechanisms in radioresistance. Our results revealed that LMP1 repressed the repair of DNA double strand breaks (DSBs) by inhibiting DNA-dependent protein kinase (DNA-PK) phosphorylation and activity. Moreover, LMP1 reduced the phosphorylation of AMP-activated protein kinase (AMPK) and changed its subcellular location after irradiation, which appeared to occur through a disruption of the physical interaction between AMPK and DNA-PK. The decrease in AMPK activity was associated with LMP1-mediated glycolysis and resistance to apoptosis induced by irradiation. The reactivation of AMPK significantly promoted radiosensitivity both in vivo and in vitro. The AMPKα (Thr172) reduction was associated with a poorer clinical outcome of radiation therapy in NPC patients. Our data revealed a new mechanism of LMP1-mediated radioresistance and provided a mechanistic rationale in support of the use of AMPK activators for facilitating NPC radiotherapy. PMID:27255972

  7. PROMOTION OF ACTIVE MEASURES AND EMPLOYMENT STIMULATION

    LAVINIA ELISABETA POPP

    2012-01-01

    Full Text Available Researches in the field of the labour market has allowed the identification of certain specific mechanisms for employment promotion; at present, on the Romanian labour market we find passive policies, concretised in financial aids paid to the unemployed, along with active policies, constituting the most efficient social protection activity addressed to the unemployed (they aim at counterbalancing the inefficiencies determined by the granting of financial allowances, help population to find a job by actions of information, professional training and contributing to the encouragement of the labour force mobility. The paper refers to some theoretical considerations related to the influence factors of employment stimulation, as well as to the unemployment – correlated adequate measures synapse. The applied research comprises the analysis of statistic documents; the method used is the case study, i.e. the activity of employment stimulation carried on by the County Agency for Employment Caraş-Severin, in the period 2004-2012. The conclusions highlight the impact of the activity of the institutions involved in the system of social protection and security within the labour market.

  8. Protein–DNA charge transport: Redox activation of a DNA repair protein by guanine radical

    Yavin, Eylon; Boal, Amie K.; Stemp, Eric D. A.; Boon, Elizabeth M; Livingston, Alison L.; O'Shea, Valerie L.; David, Sheila S.; Barton, Jacqueline K.

    2005-01-01

    DNA charge transport (CT) chemistry provides a route to carry out oxidative DNA damage from a distance in a reaction that is sensitive to DNA mismatches and lesions. Here, DNA-mediated CT also leads to oxidation of a DNA-bound base excision repair enzyme, MutY. DNA-bound Ru(III), generated through a flash/quench technique, is found to promote oxidation of the [4Fe-4S](2+) cluster of MutY to [4Fe-4S](3+) and its decomposition product [3Fe-4S](1+). Flash/quench experiments monitored by EPR spec...

  9. Chromium reduces the in vitro activity and fidelity of DNA replication mediated by the human cell DNA synthesome

    correlates with the genotoxic and cytotoxic effects of this metal ion; and promotes cell killing via inhibition of the DNA polymerase activity mediating the DNA replication and repair processes utilized by human cells.

  10. Mutations in BALB mitochondrial DNA induce CCL20 up-regulation promoting tumorigenic phenotypes

    Sligh, James [Department of Medicine—Dermatology Division, University of Arizona, Tucson, AZ 857 24 (United States); University of Arizona Cancer Center, Tucson, AZ 85724 (United States); Janda, Jaroslav [University of Arizona Cancer Center, Tucson, AZ 85724 (United States); Jandova, Jana, E-mail: jjandova@email.arizona.edu [Department of Medicine—Dermatology Division, University of Arizona, Tucson, AZ 857 24 (United States); University of Arizona Cancer Center, Tucson, AZ 85724 (United States)

    2014-11-15

    -κB activation inhibited CCL20 expression in mtBALB cybrids and decreased their migratory capabilities. Thus, acquired mtDNA mutations may promote tumorigenic phenotypes through up-regulation of chemokine CCL20.

  11. Mutations in BALB mitochondrial DNA induce CCL20 up-regulation promoting tumorigenic phenotypes

    -κB activation inhibited CCL20 expression in mtBALB cybrids and decreased their migratory capabilities. Thus, acquired mtDNA mutations may promote tumorigenic phenotypes through up-regulation of chemokine CCL20

  12. On the promoter complex formation rate of E. coli RNA polymerases with T7 phage DNA.

    Belintsev, B N; Zavriev, S.K.; Shemyakin, M.F.

    1980-01-01

    Influence of ionic strength on the kinetics of the promoter complex formation between E. coli RNA polymerase and T7 phage DNA was investigated using a membrane filter assay. The enzyme-promoter association rate constant was determined. It varies from 10(9) to 3 x 10(7) M-1 sec-1 when the ionic strength is changed from zero to 0.15 M NaCl. Basing on the theoretical analysis of experimental data obtained the model for the promoter site selection assuming the enzyme sliding along the DNA is disc...

  13. Novel and functional DNA sequence variants within the GATA5 gene promoter in ventricular septal defects

    Ji-Ping Shan; Xiao-Li Wang; Yuan-Gang Qiao; Hong-Xin Wan Yan; Wen-Hui Huang; Shu-Chao Pang; Bo Yan

    2014-01-01

    Background: Congenital heart disease (CHD) is the most common human birth defect. Genetic causes for CHD remain largely unknown. GATA transcription factor 5 (GATA 5) is an essential regulator for the heart development. Mutations in the GATA5 gene have been reported in patients with a variety of CHD. Since misregulation of gene expression have been associated with human diseases, we speculated that changed levels of cardiac transcription factors, GATA5, may mediate the development of CHD. Methods: In this study, GATA5 gene promoter was genetically and functionally analyzed in large cohorts of patients with ventricular septal defect (VSD) (n=343) and ethnic-matched healthy controls (n=348). Results: Two novel and heterozygous DNA sequence variants (DSVs), g.61051165A>G and g.61051463delC, were identified in three VSD patients, but not in the controls. In cultured cardiomyocytes, GATA5 gene promoter activities were significantly decreased by DSV g.61051165A>G and increased by DSV g.61051463delC. Moreover, fathers of the VSD patients carrying the same DSVs had reduced diastolic function of left ventricles. Three SNPs, g.61051279C>T (rs77067995), g.61051327A>C (rs145936691) and g.61051373G>A (rs80197101), and one novel heterozygous DSV, g.61051227C>T, were found in both VSD patients and controls with similar frequencies. Conclusion: Our data suggested that the DSVs in the GATA5 gene promoter may increase the susceptibility to the development of VSD as a risk factor.

  14. Novel and Functional DNA Sequence Variants within the GATA6 Gene Promoter in Ventricular Septal Defects

    Chunyu Li

    2014-07-01

    Full Text Available Congenital heart disease (CHD is the most common birth defect in humans. Genetic causes and underlying molecular mechanisms for isolated CHD remain largely unknown. Studies have demonstrated that GATA transcription factor 6 (GATA6 plays an essential role in the heart development. Mutations in GATA6 gene have been associated with diverse types of CHD. As GATA6 functions in a dosage-dependent manner, we speculated that changed GATA6 levels, resulting from DNA sequence variants (DSVs within the gene regulatory regions, may mediate the CHD development. In the present study, GATA6 gene promoter was genetically and functionally analyzed in large groups of patients with ventricular septal defect (VSD (n = 359 and ethnic-matched healthy controls (n = 365. In total, 11 DSVs, including four SNPs, were identified in VSD patients and controls. Two novel and heterozygous DSVs, g.22169190A>T and g.22169311C>G, were identified in two VSD patients, but in none of controls. In cultured cardiomyocytes, the activities of the GATA6 gene promoter were significantly reduced by the DSVs g.22169190A>T and g.22169311C>G. Therefore, our findings suggested that the DSVs within the GATA6 gene promoter identified in VSD patients may change GATA6 levels, contributing to the VSD development as a risk factor.

  15. Screening of promoters from rhizosphere metagenomic DNA using a promoter-trap vector and flow cytometric cell sorting.

    Lee, Se Hee; Kim, Jeong Myeong; Lee, Hyo Jung; Jeon, Che Ok

    2011-02-01

    We constructed a facilitative and efficient promoter-trap vector, pCM-EGFP, for capturing and analyzing functional promoters from environmental DNA. The pCM-EGFP vector showed good chloramphenicol sensitivity and no enhanced green fluorescent protein (EGFP) gene expression. Promoter libraries were constructed for screening promoters responding to naringenin, a key molecule released from plant roots. After electroporation, E. coli transformants were incubated in LB broth containing chloramphenicol (10 μg/ml) to select against transformants with no cloned promoter. E. coli cells were sorted using flow cytometry without naringenin, and then sorted again with high fluorescence after incubation in LB broth with naringenin (1 mM) at 28 °C for 12 h. The inducible properties of approximately 400 sorted cells were evaluated, with most cells showing only strong EGFP gene expression without inducible properties. Two clones (5-4E and 15-3D) displayed naringenin inducibility, and both contained a promoter bounded by a TetR-family regulator. The regulator knock-out mutant of the 5-4E clone lost its ability to be induced by naringenin. In conclusion, the pCM-EGFP vector may be used as an efficient promoter-trap vector and a combination of the vector with flow cytometric cell sorting was demonstrated to be an useful method for screening promoters responding to specific conditions or inducers. PMID:21259288

  16. Cell Type-Specific Activation of the Cytomegalovirus Promoter by Dimethylsulfoxide and 5-Aza-2′-deoxycytidine

    Radhakrishnan, Prakash; Basma, Hesham; Klinkebiel, David; Christman, Judith; Cheng, Pi-Wan

    2008-01-01

    The cytomegalovirus promoter is a very potent promoter commonly used for driving the expression of transgenes, though it gradually becomes silenced in stably transfected cells. We examined the methylation status of the cytomegalovirus promoter in two different cell lines and characterized its mechanisms of activation by dimethylsulfoxide and 5-Aza-2′-deoxycytidine. The cytomegalovirus promoter stably transfected into Chinese hamster ovary cells is suppressed by DNA methylation-independent mec...

  17. RNA Pol II promotes transcription of centromeric satellite DNA in beetles.

    Zeljka Pezer

    Full Text Available Transcripts of centromeric satellite DNAs are known to play a role in heterochromatin formation as well as in establishment of the kinetochore. However, little is known about basic mechanisms of satellite DNA expression within constitutive heterochromatin and its regulation. Here we present comprehensive analysis of transcription of abundant centromeric satellite DNA, PRAT from beetle Palorus ratzeburgii (Coleoptera. This satellite is characterized by preservation and extreme sequence conservation among evolutionarily distant insect species. PRAT is expressed in all three developmental stages: larvae, pupae and adults at similar level. Transcripts are abundant comprising 0.033% of total RNA and are heterogeneous in size ranging from 0.5 kb up to more than 5 kb. Transcription proceeds from both strands but with 10 fold different expression intensity and transcripts are not processed into siRNAs. Most of the transcripts (80% are not polyadenylated and remain in the nucleus while a small portion is exported to the cytoplasm. Multiple, irregularly distributed transcription initiation sites as well as termination sites have been mapped within the PRAT sequence using primer extension and RLM-RACE. The presence of cap structure as well as poly(A tails in a portion of the transcripts indicate RNA polymerase II-dependent transcription and a putative polymerase II promoter site overlaps the most conserved part of the PRAT sequence. The treatment of larvae with alpha-amanitin decreases the level of PRAT transcripts at concentrations that selectively inhibit pol II activity. In conclusion, stable, RNA polymerase II dependant transcripts of abundant centromeric satellite DNA, not regulated by RNAi, have been identified and characterized. This study offers a basic understanding of expression of highly abundant heterochromatic DNA which in beetle species constitutes up to 50% of the genome.

  18. AMP-activated protein kinase-regulated activation of the PGC-1alpha promoter in skeletal muscle cells.

    Isabella Irrcher

    Full Text Available The mechanisms by which PGC-1alpha gene expression is controlled in skeletal muscle remains largely undefined. Thus, we sought to investigate the transcriptional regulation of PGC-1alpha using AICAR, an activator of AMPK, that is known to increase PGC-1alpha expression. A 2.2 kb fragment of the human PGC-1alpha promoter was cloned and sequence analysis revealed that this TATA-less sequence houses putative consensus sites including a GC-box, a CRE, several IRSs, a SRE, binding sites for GATA, MEF2, p 53, NF-kappaB, and EBox binding proteins. AMPK activation for 24 hours increased PGC-1alpha promoter activity with concomitant increases in mRNA expression. The effect of AICAR on transcriptional activation was mediated by an overlapping GATA/EBox binding site at -495 within the PGC-1alpha promoter based on gel shift analyses that revealed increases in GATA/EBox DNA binding. Mutation of the EBox within the GATA/EBox binding site in the promoter reduced basal promoter activity and completely abolished the AICAR effect. Supershift analyses identified USF-1 as a DNA binding transcription factor potentially involved in regulating PGC-1alpha promoter activity, which was confirmed in vivo by ChIP. Overexpression of either GATA-4 or USF-1 alone increased the p851 PGC-1alpha promoter activity by 1.7- and 2.0-fold respectively, while co-expression of GATA-4 and USF-1 led to an additive increase in PGC-1alpha promoter activity. The USF-1-mediated increase in PGC-1alpha promoter activation led to similar increases at the mRNA level. Our data identify a novel AMPK-mediated regulatory pathway that regulates PGC-1alpha gene expression. This could represent a potential therapeutic target to control PGC-1alpha expression in skeletal muscle.

  19. AGU Activities to Promote Undergraduate Research

    Grove, K.; Johnson, R.; Giesler, J.

    2001-05-01

    A primary goal of the AGU Committee on Education and Human Resources (CEHR) is to significantly increase the participation of undergraduate students at AGU meetings. Involving students in scientific meetings at this level of their education helps them to better prepare for graduate school and for a career in the geophysical sciences. Ongoing CEHR activities to promote undergraduate participation include: (1) sponsoring technical sessions to showcase undergraduate research; (2) sponsoring sessions about careers and other topics of special interest to students; (3) sponsoring workshops to inform faculty about doing research with undergraduates; (4) sponsoring meeting events to partner graduate student mentors with first-time undergraduate attendees; (5) working with sections to create situations where undergraduates and section scientists can interact; (6) creating a guide for first-time meeting attendees; (7) sponsoring an Academic Recruiting Forum at meetings to connect undergraduates with geophysical graduate programs; (8) running a Career Center at meetings to connect students and employers; (9) raising funds for more travel grants to provide more student support to attend meetings; (10) developing a listserve to inform AGU members about opportunities to do research with undergraduates and to involve more members in mentoring activities; and (11) collecting data, such as career outcomes and demographic characteristics of recent Ph.D. recipients, that are of interest to students.

  20. Effect of alternative temozolomide schedules on glioblastoma O 6-methylguanine-DNA methyltransferase activity and survival

    Robinson, C G; Palomo, J M; Rahmathulla, G; McGraw, M; Donze, J; L. Liu; Vogelbaum, M A

    2010-01-01

    Background: O 6-methylguanine-DNA methyltransferase (MGMT) expression in glioblastoma correlates with temozolomide resistance. Dose-intense temozolomide schedules deplete MGMT activity in peripheral blood mononuclear cells; however, no published data exist evaluating the effect of temozolomide schedules on intracranial tumour MGMT activity. Methods: Human glioblastoma cells (GBM43) with an unmethylated MGMT promoter were implanted intracranially in immunodeficient rodents. Three weeks later, ...

  1. c-Myc activates BRCA1 gene expression through distal promoter elements in breast cancer cells

    The BRCA1 gene plays an important role in the maintenance of genomic stability. BRCA1 inactivation contributes to breast cancer tumorigenesis. An increasing number of transcription factors have been shown to regulate BRCA1 expression. c-Myc can act as a transcriptional activator, regulating up to 15% of all genes in the human genome and results from a high throughput screen suggest that BRCA1 is one of its targets. In this report, we used cultured breast cancer cells to examine the mechanisms of transcriptional activation of BRCA1 by c-Myc. c-Myc was depleted using c-Myc-specific siRNAs in cultured breast cancer cells. BRCA1 mRNA expression and BRCA1 protein expression were determined by quantitative RT-PCR and western blot, respectively and BRCA1 promoter activities were examined under these conditions. DNA sequence analysis was conducted to search for high similarity to E boxes in the BRCA1 promoter region. The association of c-Myc with the BRCA1 promoter in vivo was tested by a chromatin immunoprecipitation assay. We investigated the function of the c-Myc binding site in the BRCA1 promoter region by a promoter assay with nucleotide substitutions in the putative E boxes. BRCA1-dependent DNA repair activities were measured by a GFP-reporter assay. Depletion of c-Myc was found to be correlated with reduced expression levels of BRCA1 mRNA and BRCA1 protein. Depletion of c-Myc decreased BRCA1 promoter activity, while ectopically expressed c-Myc increased BRCA1 promoter activity. In the distal BRCA1 promoter, DNA sequence analysis revealed two tandem clusters with high similarity, and each cluster contained a possible c-Myc binding site. c-Myc bound to these regions in vivo. Nucleotide substitutions in the c-Myc binding sites in these regions abrogated c-Myc-dependent promoter activation. Furthermore, breast cancer cells with reduced BRCA1 expression due to depletion of c-Myc exhibited impaired DNA repair activity. The distal BRCA1 promoter region is associated with c

  2. Eukaryotic and archaeal TBP and TFB/TF(II)B follow different promoter DNA bending pathways.

    Gietl, Andreas; Holzmeister, Phil; Blombach, Fabian; Schulz, Sarah; von Voithenberg, Lena Voith; Lamb, Don C; Werner, Finn; Tinnefeld, Philip; Grohmann, Dina

    2014-06-01

    During transcription initiation, the promoter DNA is recognized and bent by the basal transcription factor TATA-binding protein (TBP). Subsequent association of transcription factor B (TFB) with the TBP-DNA complex is followed by the recruitment of the ribonucleic acid polymerase resulting in the formation of the pre-initiation complex. TBP and TFB/TF(II)B are highly conserved in structure and function among the eukaryotic-archaeal domain but intriguingly have to operate under vastly different conditions. Employing single-pair fluorescence resonance energy transfer, we monitored DNA bending by eukaryotic and archaeal TBPs in the absence and presence of TFB in real-time. We observed that the lifetime of the TBP-DNA interaction differs significantly between the archaeal and eukaryotic system. We show that the eukaryotic DNA-TBP interaction is characterized by a linear, stepwise bending mechanism with an intermediate state distinguished by a distinct bending angle. TF(II)B specifically stabilizes the fully bent TBP-promoter DNA complex and we identify this step as a regulatory checkpoint. In contrast, the archaeal TBP-DNA interaction is extremely dynamic and TBP from the archaeal organism Sulfolobus acidocaldarius strictly requires TFB for DNA bending. Thus, we demonstrate that transcription initiation follows diverse pathways on the way to the formation of the pre-initiation complex. PMID:24744242

  3. Effect of gamma-irradiated DNA on DNA polymerase activity: a possible mechanism for cell killing

    A cell-free assay was developed to measure the effect of γ-irradiated DNA template on the ability of DNA polymerase to copy unirradiated template. Doses as low as 1 krad were able to decrease (approx. 15%) the activity of both bacterial and mammalian DNA polymerases in the assay. The percentage of polymerase activity decreased as the dose received by the template increased. The reduction in DNA polymerase activity was shown to be due to an inhibition of the enzyme by the irradiated DNA. The mechanism for DNA polymerase inhibition was investigated. The interaction between irradiated DNA and DNA polymerase was found to be specific for the enzyme. The inhibition of DNA polymerase occurs prior to or during the initiation of DNA synthesis rather than after initiation of synthesis, i.e., during elongation. As in vitro assay for DNA polymerase α and β in irradiated HeLa cells was developed. The activities of both polymerases decreased as the dose received by the cells increased. Both DNA polymerases were found to recover by 2 hr postirradiation. Since DNA repair capability is intimately connected with cell survival, the observed diminution in DNA polymerase activity, following low doses of radiation, could be highly significant

  4. Transient gene expression control: effects of transfected DNA stability and trans-activation by viral early proteins.

    Alwine, J C

    1985-05-01

    The effects of trans-acting factors and transfected DNA stability on promoter activity were examined with chloramphenicol acetyl transferase (CAT) transient expression analysis. With cotransfection into CV-1P and HeLa cells, simian virus 40 T antigen, adenovirus E1a, and herpes-virus IE proteins were compared for their ability to trans-activate a variety of eucaryotic promoters constructed into CAT plasmids. T antigen and the IE protein were promiscuous activators of all the promoters tested [the simian virus 40 late promoter, the adenovirus E3 promoter, the alpha 2(I) collagen promoter, and the promoter of the Rous sarcoma virus long terminal repeat]. Conversely the E1a protein was specific, activating only the adenovirus E3 promoter and suppressing the basal activity of the other promoters. This specificity of activation by E1a contrasted with the high activity generated by all of the promoter-CAT plasmids when transfected into 293 cells, which endogenously produce E1a protein. Examination of transfected 293 cells determined that they stabilized much greater amounts of plasmid DNA than any other cells tested (CV-1P, COS, NIH-3T3, KB). Thus the high activity of nonadenovirus promoter-CAT plasmids in 293 cells results from the cumulative effect of basal promoter activity from a very large number of gene copies, not from E1a activation. This conclusion was supported by similar transfection analysis of KB cell lines which endogenously produce E1a protein. These cells stabilize plasmid DNA at a level comparable to that of CV-1P cells and, in agreement with the CV-1P cotransfection results, did not activate a nonadenovirus promoter-CAT plasmid. These results indicate that the stability of plasmid DNA must be considered when transient gene expression is being compared between cell lines. The use of relative plasmid copy numbers for the standardization of transient expression results is discussed. PMID:2987671

  5. Eukaryotic and archaeal TBP and TFB/TF(II)B follow different promoter DNA bending pathways

    Gietl, Andreas; Holzmeister, Phil; Blombach, Fabian; Schulz, Sarah; von Voithenberg, Lena Voith; Lamb, Don C; Werner, Finn; Tinnefeld, Philip; Grohmann, Dina

    2014-01-01

    During transcription initiation, the promoter DNA is recognized and bent by the basal transcription factor TATA-binding protein (TBP). Subsequent association of transcription factor B (TFB) with the TBP–DNA complex is followed by the recruitment of the ribonucleic acid polymerase resulting in the formation of the pre-initiation complex. TBP and TFB/TF(II)B are highly conserved in structure and function among the eukaryotic-archaeal domain but intriguingly have to operate under vastly differen...

  6. The Vibrio harveyi master quorum-sensing regulator, LuxR, a TetR-type protein is both an activator and a repressor: DNA recognition and binding specificity at target promoters

    Pompeani, Audra J; Irgon, Joseph J; Berger, Michael F; Bulyk, Martha L; Wingreen, Ned S; Bassler, Bonnie L

    2008-01-01

    Quorum sensing is the process of cell-to-cell communication by which bacteria communicate via secreted signal molecules called autoinducers. As cell population density increases, the accumulation of autoinducers leads to co-ordinated changes in gene expression across the bacterial community. The marine bacterium, Vibrio harveyi, uses three autoinducers to achieve intra-species, intra-genera and inter-species cell–cell communication. The detection of these autoinducers ultimately leads to the production of LuxR, the quorum-sensing master regulator that controls expression of the genes in the quorum-sensing regulon. LuxR is a member of the TetR protein superfamily; however, unlike other TetR repressors that typically repress their own gene expression and that of an adjacent operon, LuxR is capable of activating and repressing a large number of genes. Here, we used protein binding microarrays and a two-layered bioinformatics approach to show that LuxR binds a 21 bp consensus operator with dyad symmetry. In vitro and in vivo analyses of two promoters directly regulated by LuxR allowed us to identify those bases that are critical for LuxR binding. Together, the in silico and biochemical results enabled us to scan the genome and identify novel targets of LuxR in V. harveyi and thus expand the understanding of the quorum-sensing regulon. PMID:18681939

  7. The role of CopG mediated DNA bending on the regulation of the σ54-dependent promoters in E. coli

    2006-01-01

    In order to investigate the role of DNA bending on the regulation of σ54-dependent promoters, we introduced the CopG binding site between the enhancer-like element and the core promoter of glnAp2, nifLp and glnHp2, without changing the distance in between. The expression activities of these homologous promoters were either activated or repressed by the CopG-induced DNA bending in E. coli. In this case, similar regulatory pattern (either activated or repressed) could be observed, when the bending centers from CopG are in integral DNA helixes interval, while opposite regulatory pattern could be observed, when the bending centers from CopG are in integral plus a half DNA helixes interval. These results suggested that CopG-induced DNA bending can exert regulatory effects on the transcription of σ54-dependent promoters probably by altering the relative DNA helix phase of 54 RNA polymerase and NtrC.

  8. Genetic variation in the proximal promoter of ABC and SLC superfamilies: liver and kidney specific expression and promoter activity predict variation.

    Stephanie E Hesselson

    Full Text Available Membrane transporters play crucial roles in the cellular uptake and efflux of an array of small molecules including nutrients, environmental toxins, and many clinically used drugs. We hypothesized that common genetic variation in the proximal promoter regions of transporter genes contribute to observed variation in drug response. A total of 579 polymorphisms were identified in the proximal promoters (-250 to +50 bp and flanking 5' sequence of 107 transporters in the ATP Binding Cassette (ABC and Solute Carrier (SLC superfamilies in 272 DNA samples from ethnically diverse populations. Many transporter promoters contained multiple common polymorphisms. Using a sliding window analysis, we observed that, on average, nucleotide diversity (pi was lowest at approximately 300 bp upstream of the transcription start site, suggesting that this region may harbor important functional elements. The proximal promoters of transporters that were highly expressed in the liver had greater nucleotide diversity than those that were highly expressed in the kidney consistent with greater negative selective pressure on the promoters of kidney transporters. Twenty-one promoters were evaluated for activity using reporter assays. Greater nucleotide diversity was observed in promoters with strong activity compared to promoters with weak activity, suggesting that weak promoters are under more negative selective pressure than promoters with high activity. Collectively, these results suggest that the proximal promoter region of membrane transporters is rich in variation and that variants in these regions may play a role in interindividual variation in drug disposition and response.

  9. Promoter DNA methylation regulates progranulin expression and is altered in FTLD

    Banzhaf-Strathmann, Julia; Claus, Rainer; Mücke, Oliver; Rentzsch, Kristin; van der Zee, Julie; Engelborghs, Sebastiaan; De Deyn, Peter P.; Cruts, Marc; Van Broeckhoven, Christine; Plass, Christoph; Edbauer, Dieter

    2013-01-01

    Background Frontotemporal lobar degeneration (FTLD) is a heterogeneous group of neurodegenerative diseases associated with personality changes and progressive dementia. Loss-of-function mutations in the growth factor progranulin (GRN) cause autosomal dominant FTLD, but so far the pathomechanism of sporadic FTLD is unclear. Results We analyzed whether DNA methylation in the GRN core promoter restricts GRN expression and, thus, might promote FTLD in the absence of GRN mutations. GRN expression ...

  10. Modulation of UvrD helicase activity by covalent DNA-protein cross-links.

    Kumari, Anuradha; Minko, Irina G; Smith, Rebecca L; Lloyd, R Stephen; McCullough, Amanda K

    2010-07-01

    UvrD (DNA helicase II) has been implicated in DNA replication, DNA recombination, nucleotide excision repair, and methyl-directed mismatch repair. The enzymatic function of UvrD is to translocate along a DNA strand in a 3' to 5' direction and unwind duplex DNA utilizing a DNA-dependent ATPase activity. In addition, UvrD interacts with many other proteins involved in the above processes and is hypothesized to facilitate protein turnover, thus promoting further DNA processing. Although UvrD interactions with proteins bound to DNA have significant biological implications, the effects of covalent DNA-protein cross-links on UvrD helicase activity have not been characterized. Herein, we demonstrate that UvrD-catalyzed strand separation was inhibited on a DNA strand to which a 16-kDa protein was covalently bound. Our sequestration studies suggest that the inhibition of UvrD activity is most likely due to a translocation block and not helicase sequestration on the cross-link-containing DNA substrate. In contrast, no inhibition of UvrD-catalyzed strand separation was apparent when the protein was linked to the complementary strand. The latter result is surprising given the earlier observations that the DNA in this covalent complex is severely bent ( approximately 70 degrees ), with both DNA strands making multiple contacts with the cross-linked protein. In addition, UvrD was shown to be required for replication of plasmid DNAs containing covalent DNA-protein complexes. Combined, these data suggest a critical role for UvrD in the processing of DNA-protein cross-links. PMID:20444702

  11. RCC1-dependent activation of Ran accelerates cell cycle and DNA repair, inhibiting DNA damage-induced cell senescence.

    Cekan, Pavol; Hasegawa, Keisuke; Pan, Yu; Tubman, Emily; Odde, David; Chen, Jin-Qiu; Herrmann, Michelle A; Kumar, Sheetal; Kalab, Petr

    2016-04-15

    The coordination of cell cycle progression with the repair of DNA damage supports the genomic integrity of dividing cells. The function of many factors involved in DNA damage response (DDR) and the cell cycle depends on their Ran GTPase-regulated nuclear-cytoplasmic transport (NCT). The loading of Ran with GTP, which is mediated by RCC1, the guanine nucleotide exchange factor for Ran, is critical for NCT activity. However, the role of RCC1 or Ran⋅GTP in promoting cell proliferation or DDR is not clear. We show that RCC1 overexpression in normal cells increased cellular Ran⋅GTP levels and accelerated the cell cycle and DNA damage repair. As a result, normal cells overexpressing RCC1 evaded DNA damage-induced cell cycle arrest and senescence, mimicking colorectal carcinoma cells with high endogenous RCC1 levels. The RCC1-induced inhibition of senescence required Ran and exportin 1 and involved the activation of importin β-dependent nuclear import of 53BP1, a large NCT cargo. Our results indicate that changes in the activity of the Ran⋅GTP-regulated NCT modulate the rate of the cell cycle and the efficiency of DNA repair. Through the essential role of RCC1 in regulation of cellular Ran⋅GTP levels and NCT, RCC1 expression enables the proliferation of cells that sustain DNA damage. PMID:26864624

  12. Identification of Fic-1 as an enzyme that inhibits bacterial DNA replication by AMPylating GyrB, promoting filament formation.

    Lu, Canhua; Nakayasu, Ernesto S; Zhang, Li-Qun; Luo, Zhao-Qing

    2016-01-01

    The morphology of bacterial cells is important for virulence, evasion of the host immune system, and coping with environmental stresses. The widely distributed Fic proteins (filamentation induced by cAMP) are annotated as proteins involved in cell division because of the presence of the HPFx[D/E]GN[G/K]R motif. We showed that the presence of Fic-1 from Pseudomonas fluorescens significantly reduced the yield of plasmid DNA when expressed in Escherichia coli or P. fluorescens. Fic-1 interacted with GyrB, a subunit of DNA gyrase, which is essential for bacterial DNA replication. Fic-1 catalyzed the AMPylation of GyrB at Tyr(109), a residue critical for binding ATP, and exhibited auto-AMPylation activity. Mutation of the Fic-1 auto-AMPylated site greatly reduced AMPylation activity toward itself and toward GyrB. Fic-1-dependent AMPylation of GyrB triggered the SOS response, indicative of DNA replication stress or DNA damage. Fic-1 also promoted the formation of elongated cells when the SOS response was blocked. We identified an α-inhibitor protein that we named anti-Fic-1 (AntF), encoded by a gene immediately upstream of Fic-1. AntF interacted with Fic-1, inhibited the AMPylation activity of Fic-1 for GyrB in vitro, and blocked Fic-1-mediated inhibition of DNA replication in bacteria, suggesting that Fic-1 and AntF comprise a toxin-antitoxin module. Our work establishes Fic-1 as an AMPylating enzyme that targets GyrB to inhibit DNA replication and may target other proteins to regulate bacterial morphology. PMID:26814232

  13. Mrc1 is a replication fork component whose phosphorylation in response to DNA replication stress activates Rad53

    Osborn, Alexander J.; Elledge, Stephen J.

    2003-01-01

    When DNA replication is stalled, a signal transduction pathway is activated that promotes the stability of stalled forks and resumption of DNA synthesis. In budding yeast, this pathway includes the kinases Mec1 and Rad53. Here we report that the Mediator protein Mrc1, which is required for normal DNA replication and for activation of Rad53, is present at replication forks. Mrc1 initially binds early-replicating sequences and moves along chromatin with the replication f...

  14. Genetic dissection of independent and cooperative transcriptional activation by the LysR-type activator ThnR at close divergent promoters.

    Rivas-Marín, Elena; Floriano, Belén; Santero, Eduardo

    2016-01-01

    Regulation of tetralin biodegradation operons is one of the examples of unconventional LysR-type mediated transcriptional regulation. ThnR activates transcription from two divergent and closely located promoters PB and PC. Although ThnR activates each promoter independently, transcription from each one increases when both promoters are together. Mutational analysis of the intergenic region shows that cooperative transcription is achieved through formation of a ThnR complex when bound to its respective sites at each promoter, via formation of a DNA loop. Mutations also defined ThnR contact sites that are important for independent transcriptional activation at each promoter. A mutation at the PB promoter region, which abolishes its independent transcription, does not affect at all PB transcription in the presence of the divergent promoter PC, thus indicating that the complex formed via DNA loop can compensate for the deficiencies in the correct protein-DNA interaction at one of the promoters. Combination of mutations in both promoters identifies a region at PC that is not important for its independent transcription but it is essential for cooperative transcription from both promoters. This work provides new insights into the diversity and complexity of activation mechanisms used by the most abundant type of bacterial transcriptional regulators. PMID:27087658

  15. The isolation of transcription factors from lambda gt11 cDNA expression libraries: human steroid 5 alpha-reductase 1 has sequence-specific DNA binding activity.

    Gaston, K; Fried, M

    1992-01-01

    The Surf-1/Surf-2 bi-directional promoter contains binding sites for at least three transcription factors (Su1, Su2, and Su3). By screening a lambda gt11 HeLa cell cDNA expression library with a concatenated Su2 factor binding site, we isolated a cDNA which encodes a protein with sequence-specific DNA binding activity. Gel retardation assays showed that the cloned factor binds specifically to the Su2 factor binding site present in the human Surf-1/Surf-2 promoter but not to an Su2 site contai...

  16. Nuclear interferon-inducible protein 16 promotes silencing of herpesviral and transfected DNA

    Orzalli, Megan H.; Conwell, Sara E.; Berrios, Christian; DeCaprio, James A.; Knipe, David M.

    2013-01-01

    Mammalian cells have evolved mechanisms to silence foreign DNA introduced by viruses or by transfection. Upon herpesviral infection of cells, the viral genome is chromatinized in an attempt by the host cell to restrict expression of the viral genome. HSV ICP0 acts to counter host-intrinsic and innate responses to viral infection. We have found that nuclear interferon (IFN)-inducible protein 16 (IFI16) acts as a restriction factor against ICP0-null herpes simplex virus 1 (HSV-1) to limit viral replication and immediate–early gene expression. IFI16 promoted the addition of heterochromatin marks and the reduction of euchromatin marks on viral chromatin. IFI16 also restricted the expression of plasmid DNAs introduced by transfection but did not restrict SV40 DNA introduced into the cellular nucleus in the form of nucleosomal chromatin by viral infection. These results argue that IFI16 restricts unchromatinized DNA when it enters the cell nucleus by promoting the loading of nucleosomes and the addition of heterochromatin marks. Furthermore, these results indicate that IFI16 provides a broad surveillance role against viral and transfected DNA by promoting restriction of gene expression from the exogenous DNA and inducing innate immune responses. PMID:24198334

  17. Nuclear interferon-inducible protein 16 promotes silencing of herpesviral and transfected DNA.

    Orzalli, Megan H; Conwell, Sara E; Berrios, Christian; DeCaprio, James A; Knipe, David M

    2013-11-19

    Mammalian cells have evolved mechanisms to silence foreign DNA introduced by viruses or by transfection. Upon herpesviral infection of cells, the viral genome is chromatinized in an attempt by the host cell to restrict expression of the viral genome. HSV ICP0 acts to counter host-intrinsic and innate responses to viral infection. We have found that nuclear interferon (IFN)-inducible protein 16 (IFI16) acts as a restriction factor against ICP0-null herpes simplex virus 1 (HSV-1) to limit viral replication and immediate-early gene expression. IFI16 promoted the addition of heterochromatin marks and the reduction of euchromatin marks on viral chromatin. IFI16 also restricted the expression of plasmid DNAs introduced by transfection but did not restrict SV40 DNA introduced into the cellular nucleus in the form of nucleosomal chromatin by viral infection. These results argue that IFI16 restricts unchromatinized DNA when it enters the cell nucleus by promoting the loading of nucleosomes and the addition of heterochromatin marks. Furthermore, these results indicate that IFI16 provides a broad surveillance role against viral and transfected DNA by promoting restriction of gene expression from the exogenous DNA and inducing innate immune responses. PMID:24198334

  18. Hair Growth Promotion Activity and Its Mechanism of Polygonum multiflorum

    Yunfei Li; Mingnuan Han; Pei Lin; Yanran He; Jie Yu; Ronghua Zhao

    2015-01-01

    Polygonum multiflorum Radix (PMR) has long history in hair growth promotion and hair coloring in clinical applications. However, several crucial problems in its clinic usage and mechanisms are still unsolved or lack scientific evidences. In this research, C57BL/6J mice were used to investigate hair growth promotion activity and possible mechanism of PMR and Polygonum multiflorum Radix Preparata (PMRP). Hair growth promotion activities were investigated by hair length, hair covered skin ratio,...

  19. Microcalorimetric Studies on Gene Promoter Function of Cloned DNA Fragements from Halobacterium halobium J7 Plasmid pHH205 in Escherichia coli TG1

    LEI,Ke-Lin; HOU,Han-Na; LIU,Yi; YE,Xue-Cheng; SHEN,Ping

    2007-01-01

    Halobacterium halobium is a typical kind of extremely halophilic bacterium. Combined with the antibiotic resistance assay, the microcalorimetric method was used to study the promoter function of the cloned DNA fragments from Halobacterium halobium J7 plasmid pHH205 in Escherichia coli TG1. The promoter probe vector, plasmid pKK232-8, was used to form the recombinants. The DNA fragment, which is the promoter for the chloramphenicol acetyl transferase (CAT) gene in plasmid pKK232-8, is about 800 bp, and the chloramphenicol resistance level presented by IC50 is about 200 μg·mL-1, which suggests a high promoter activity. The conclusions show that there probably exist double-function or trinary-function gene promoters in Halobacterium halobium, and Archaea may contain rich genetic resources.

  20. The mitochondrial outer membrane protein MDI promotes local protein synthesis and mtDNA replication.

    Zhang, Yi; Chen, Yong; Gucek, Marjan; Xu, Hong

    2016-05-17

    Early embryonic development features rapid nuclear DNA replication cycles, but lacks mtDNA replication. To meet the high-energy demands of embryogenesis, mature oocytes are furnished with vast amounts of mitochondria and mtDNA However, the cellular machinery driving massive mtDNA replication in ovaries remains unknown. Here, we describe a Drosophila AKAP protein, MDI that recruits a translation stimulator, La-related protein (Larp), to the mitochondrial outer membrane in ovaries. The MDI-Larp complex promotes the synthesis of a subset of nuclear-encoded mitochondrial proteins by cytosolic ribosomes on the mitochondrial surface. MDI-Larp's targets include mtDNA replication factors, mitochondrial ribosomal proteins, and electron-transport chain subunits. Lack of MDI abolishes mtDNA replication in ovaries, which leads to mtDNA deficiency in mature eggs. Targeting Larp to the mitochondrial outer membrane independently of MDI restores local protein synthesis and rescues the phenotypes of mdi mutant flies. Our work suggests that a selective translational boost by the MDI-Larp complex on the outer mitochondrial membrane might be essential for mtDNA replication and mitochondrial biogenesis during oogenesis. PMID:27053724

  1. Epigenetic features in the oyster Crassostrea gigas suggestive of functionally relevant promoter DNA methylation in invertebrates.

    GuillaumeRiviere

    2014-04-01

    Full Text Available DNA methylation is evolutionarily conserved. Vertebrates exhibit high, widespread DNA methylation whereas invertebrate genomes are less methylated, predominantly within gene bodies. DNA methylation in invertebrates is associated with transcription level, alternative splicing and genome evolution, but functional outcomes of DNA methylation remain poorly described in lophotrochozoans. Recent genome-wide approaches improve understanding in distant taxa such as molluscs, where the phylogenetic position and life traits of Crassostrea gigas make this bivalve an ideal model to study the physiological and evolutionary implications of DNA methylation. We review the literature about DNA methylation in invertebrates and focus on DNA methylation features in the oyster. Indeed, though our MeDIP-seq results confirm predominant intragenic methylation, the profiles depend on the oyster’s developmental and reproductive stage. We discuss the perspective that oyster DNA methylation could be biased toward the 5’-end of some genes, depending on physiological status, suggesting important functional outcomes of putative promoter methylation from cell differentiation during early development to sustained adaptation of the species to the environment.

  2. Increased anticoagulant activity of thrombin-binding DNA aptamers by nanoscale organization on DNA nanostructures

    Rangnekar, Abhijit; Zhang, Alex M.; Shiyuan Li, Susan; M. Bompiani, Kristin; Hansen, Majken Nørgaard; Gothelf, Kurt Vesterager; Sullenger, Bruce A; LaBean, Thomas H.

    2012-01-01

    Control over thrombin activity is much desired to regulate blood clotting in surgical and therapeutic situations. Thrombin-binding RNA and DNA aptamers have been used to inhibit thrombin activity and thus the coagulation cascade. Soluble DNA aptamers, as well as two different aptamers tethered by a flexible single-strand linker, have been shown to possess anticoagulant activity. Here, we link multiple aptamers at programmed positions on DNA nanostructures to optimize spacing and orientation o...

  3. Promoter proximal polyadenylation sites reduce transcription activity

    Andersen, Pia Kjølhede; Lykke-Andersen, Søren; Jensen, Torben Heick

    2012-01-01

    transcription requires promoter proximity, as demonstrated using artificial constructs and supported by a genome-wide data set. Importantly, transcription down-regulation can be recapitulated in a gene context devoid of splice sites by placing a functional bona fide pA site/transcription terminator within ∼500...

  4. Gastric cancer associated variant of DNA polymerase beta (Leu22Pro) promotes DNA replication associated double strand breaks.

    Rozacky, Jenna; Nemec, Antoni A; Sweasy, Joann B; Kidane, Dawit

    2015-09-15

    DNA polymerase beta (Pol β) is a key enzyme for the protection against oxidative DNA lesions via its role in base excision repair (BER). Approximately 1/3 of tumors studied to date express Pol β variant proteins, and several tumors overexpress Pol β. Pol β possesses DNA polymerase and dRP lyase activities, both of which are known to be important for efficient BER. The dRP lyase activity resides within the 8kDa amino terminal domain of Pol β, is responsible for removal of the 5' phosphate group (5'-dRP). The DNA polymerase subsequently fills the gaps. Previously, we demonstrated that the human gastric cancer-associated variant of Pol β (Leu22Pro (L22P)) lacks dRP lyase function in vitro. Here, we report that L22P-expressing cells harbor significantly increased replication associated DNA double strand breaks (DSBs) and defective maintenance of the nascent DNA strand (NDS) during replication stress. Moreover, L22P-expressing cells are sensitive to PARP1 inhibitors, which suggests trapped PARP1 binds to the 5'-dRP group and blocks replications forks, resulting in fork collapse and DSBs. Our data suggest that the normal function of the dRP lyase is critical to maintain replication fork integrity and prevent replication fork collapse to DSBs and cellular transformation. PMID:26090616

  5. Purification of total DNA extracted from activated sludge.

    Shan, Guobin; Jin, Wenbiao; Lam, Edward K H; Xing, Xinhui

    2008-01-01

    Purification of the total DNA extracted from activated sludge samples was studied. The effects of extraction buffers and lysis treatments (lysozyme, sodium dodecyl sulfate (SDS), sonication, mechanical mill and thermal shock) on yield and purity of the total DNA extracted from activated sludge were investigated. It was found that SDS and mechanical mill were the most effective ways for cell lysis, and both gave the highest DNA yields, while by SDS and thermal shock, the purest DNA extract could be obtained. The combination of SDS with other lysis treatment, such as sonication and thermal shock, could apparently increase the DNA yields but also result in severe shearing. For the purification of the crude DNA extract, polyvinyl polypyrrolidone was used for the removal of humic contaminants. Cetyltrimethyl ammonium bromide, potassium acetate and phenol/chloroform were used to remove proteins and polysaccharides from crude DNA. Crude DNA was further purified by isopropanol precipitation. Thus, a suitable protocol was proposed for DNA extraction, yielding about 49.9 mg (total DNA)/g volatile suspended solids, and the DNA extracts were successfully used in PCR amplifications for 16S rDNA and 16S rDNA V3 region. The PCR products of 16S rDNA V3 region allowed the DGGE analysis (denatured gradient gel electrophoresis) to be possible. PMID:18572527

  6. Purification of total DNA extracted from activated sludge

    2008-01-01

    Purification of the total DNA extracted from activated sludge samples was studied. The effects of extraction buffers and lysis treatments (lysozyme, sodium dodecyl sulfate (SDS), sonication, mechanical mill and thermal shock) on yield and purity of the total DNA extracted from activated sludge were investigated. It was found that SDS and mechanical mill were the most effective ways for cell lysis, and both gave the highest DNA yields, while by SDS and thermal shock, the purest DNA extract could be obtained. The combination of SDS with other lysis treatment, such as sonication and thermal shock, could apparently increase the DNA yields but also result in severe shearing. For the purification of the crude DNA extract, polyvinyl polypyrrolidone was used for the removal of humic contaminants. Cetyltrimethyl ammonium bromide, potassium acetate and phenol/chloroform were used to remove proteins and polysaccharides from crude DNA. Crude DNA was further purified by isopropanol precipitation. Thus, a suitable protocol was proposed for DNA extraction, yielding about 49.9 mg (DNA)/g volatile suspended solids, and the DNA extracts were successfully used in PCR amplifications for 16S rDNA and 16S rDNA V3 region. The PCR products of 16S rDNA V3 region allowed the DGGE analysis (denatured gradient gel electrophoresis) to be possible.

  7. A novel DNA joining activity catalyzed by T4 DNA ligase.

    Western, L M; Rose, S. J.

    1991-01-01

    The use of T4 and E. coli DNA ligases in genetic engineering technology is usually associated with nick-closing activity in double stranded DNA or ligation of 'sticky-ends' to produce recombinant DNA molecules. We describe in this communication the ability of T4 DNA ligase to catalyze intramolecular loop formation between annealed oligodeoxyribonucleotides wherein Watson-Crick base pairing is absent on one side of the ligation site. Enzyme concentration, loop size, substrate specificity, and ...

  8. Integrity and Biological Activity of DNA after UV Exposure

    Lyon, Delina Y.; Monier, Jean-Michel; Dupraz, Sébastien; Freissinet, Caroline; Simonet, Pascal; Vogel, Timothy M.

    2010-04-01

    The field of astrobiology lacks a universal marker with which to indicate the presence of life. This study supports the proposal to use nucleic acids, specifically DNA, as a signature of life (biosignature). In addition to its specificity to living organisms, DNA is a functional molecule that can confer new activities and characteristics to other organisms, following the molecular biology dogma, that is, DNA is transcribed to RNA, which is translated into proteins. Previous criticisms of the use of DNA as a biosignature have asserted that DNA molecules would be destroyed by UV radiation in space. To address this concern, DNA in plasmid form was deposited onto different surfaces and exposed to UVC radiation. The surviving DNA was quantified via the quantitative polymerase chain reaction (qPCR). Results demonstrate increased survivability of DNA attached to surfaces versus non-adsorbed DNA. The DNA was also tested for biological activity via transformation into the bacterium Acinetobacter sp. and assaying for antibiotic resistance conferred by genes encoded by the plasmid. The success of these methods to detect DNA and its gene products after UV exposure (254 nm, 3.5 J/m2s) not only supports the use of the DNA molecule as a biosignature on mineral surfaces but also demonstrates that the DNA retained biological activity.

  9. Escherichia coli DnaE Polymerase Couples Pyrophosphatase Activity to DNA Replication.

    Fabio Lapenta

    Full Text Available DNA Polymerases generate pyrophosphate every time they catalyze a step of DNA elongation. This elongation reaction is generally believed as thermodynamically favoured by the hydrolysis of pyrophosphate, catalyzed by inorganic pyrophosphatases. However, the specific action of inorganic pyrophosphatases coupled to DNA replication in vivo was never demonstrated. Here we show that the Polymerase-Histidinol-Phosphatase (PHP domain of Escherichia coli DNA Polymerase III α subunit features pyrophosphatase activity. We also show that this activity is inhibited by fluoride, as commonly observed for inorganic pyrophosphatases, and we identified 3 amino acids of the PHP active site. Remarkably, E. coli cells expressing variants of these catalytic residues of α subunit feature aberrant phenotypes, poor viability, and are subject to high mutation frequencies. Our findings indicate that DNA Polymerases can couple DNA elongation and pyrophosphate hydrolysis, providing a mechanism for the control of DNA extension rate, and suggest a promising target for novel antibiotics.

  10. Activity-promoting gaming systems in exercise and rehabilitation

    Matthew J. D. Taylor, PhD

    2011-12-01

    Full Text Available Commercial activity-promoting gaming systems provide a potentially attractive means to facilitate exercise and rehabilitation. The Nintendo Wii, Sony EyeToy, Dance Dance Revolution, and Xbox Kinect are examples of gaming systems that use the movement of the player to control gameplay. Activity-promoting gaming systems can be used as a tool to increase activity levels in otherwise sedentary gamers and also be an effective tool to aid rehabilitation in clinical settings. Therefore, the aim of this current work is to review the growing area of activity-promoting gaming in the context of exercise, injury, and rehabilitatio

  11. Active DNA demethylation by oxidation and repair

    Zhizhong Gong; Jian-Kang Zhu

    2011-01-01

    DNA methylation and demethylation are increasingly recognized as important epigenetic factors in both plants and animals.DNA methylation,which is catalyzed by DNA methyltransferases (DNMTs),is a relatively stable and heritable modification that controls gene expression,cellular differentiation,genomic imprinting,paramutation,transposon movement,X-inactivation,and embryogenesis [1].The methylation of cytosine to 5-methylcytosine (5mC) is an important example of DNA modification in animals and plants.This highlight concerns DNA demethylation mechanisms in mammals and whether they are similar to that in plants.

  12. Invariant distribution of promoter activities in Escherichia coli.

    Alon Zaslaver

    2009-10-01

    Full Text Available Cells need to allocate their limited resources to express a wide range of genes. To understand how Escherichia coli partitions its transcriptional resources between its different promoters, we employ a robotic assay using a comprehensive reporter strain library for E. coli to measure promoter activity on a genomic scale at high-temporal resolution and accuracy. This allows continuous tracking of promoter activity as cells change their growth rate from exponential to stationary phase in different media. We find a heavy-tailed distribution of promoter activities, with promoter activities spanning several orders of magnitude. While the shape of the distribution is almost completely independent of the growth conditions, the identity of the promoters expressed at different levels does depend on them. Translation machinery genes, however, keep the same relative expression levels in the distribution across conditions, and their fractional promoter activity tracks growth rate tightly. We present a simple optimization model for resource allocation which suggests that the observed invariant distributions might maximize growth rate. These invariant features of the distribution of promoter activities may suggest design constraints that shape the allocation of transcriptional resources.

  13. Activation of the DNA Damage Response by RNA Viruses

    Ryan, Ellis L.; Robert Hollingworth; Grand, Roger J.

    2016-01-01

    RNA viruses are a genetically diverse group of pathogens that are responsible for some of the most prevalent and lethal human diseases. Numerous viruses introduce DNA damage and genetic instability in host cells during their lifecycles and some species also manipulate components of the DNA damage response (DDR), a complex and sophisticated series of cellular pathways that have evolved to detect and repair DNA lesions. Activation and manipulation of the DDR by DNA viruses has been extensively ...

  14. A mechanism for DNA-PK activation requiring unique contributions from each strand of a DNA terminus and implications for microhomology-mediated nonhomologous DNA end joining

    Pawelczak, Katherine S; Turchi, John J.

    2008-01-01

    DNA-dependent protein kinase (DNA-PK) is an essential component of the nonhomologous end joining pathway (NHEJ), responsible for the repair of DNA double-strand breaks. Ku binds a DSB and recruits the catalytic subunit, DNA-PKcs, where it is activated once the kinase is bound to the DSB. The precise mechanism by which DNA activates DNA-PK remains unknown. We have investigated the effect of DNA structure on DNA-PK activation and results demonstrate that in Ku-dependent DNA-PKcs reactions, DNA-...

  15. Condensin promotes the juxtaposition of DNA flanking its loading site in Bacillus subtilis.

    Wang, Xindan; Le, Tung B K; Lajoie, Bryan R; Dekker, Job; Laub, Michael T; Rudner, David Z

    2015-08-01

    SMC condensin complexes play a central role in compacting and resolving replicated chromosomes in virtually all organisms, yet how they accomplish this remains elusive. In Bacillus subtilis, condensin is loaded at centromeric parS sites, where it encircles DNA and individualizes newly replicated origins. Using chromosome conformation capture and cytological assays, we show that condensin recruitment to origin-proximal parS sites is required for the juxtaposition of the two chromosome arms. Recruitment to ectopic parS sites promotes alignment of large tracks of DNA flanking these sites. Importantly, insertion of parS sites on opposing arms indicates that these "zip-up" interactions only occur between adjacent DNA segments. Collectively, our data suggest that condensin resolves replicated origins by promoting the juxtaposition of DNA flanking parS sites, drawing sister origins in on themselves and away from each other. These results are consistent with a model in which condensin encircles the DNA flanking its loading site and then slides down, tethering the two arms together. Lengthwise condensation via loop extrusion could provide a generalizable mechanism by which condensin complexes act dynamically to individualize origins in B. subtilis and, when loaded along eukaryotic chromosomes, resolve them during mitosis. PMID:26253537

  16. Activity-promoting gaming systems in exercise and rehabilitation

    Matthew J. D. Taylor, PhD; Darren McCormick, BSc; Teshk Shawis, MBChB, FRCP; Rebecca Impson, MSc; Murray Griffin, PhD

    2011-01-01

    Commercial activity-promoting gaming systems provide a potentially attractive means to facilitate exercise and rehabilitation. The Nintendo Wii, Sony EyeToy, Dance Dance Revolution, and Xbox Kinect are examples of gaming systems that use the movement of the player to control gameplay. Activity-promoting gaming systems can be used as a tool to increase activity levels in otherwise sedentary gamers and also be an effective tool to aid rehabilitation in clinical settings. Therefore, the aim of t...

  17. Cooperation between core promoter elements influences transcriptional activity in vivo.

    Colgan, J.; Manley, J L

    1995-01-01

    Core promoters for RNA polymerase II frequently contain either (or both) of two consensus sequence elements, a TATA box and/or an initiator (Inr). Using test promoters consisting of prototypical TATA and/or Inr elements, together with binding sites for sequence-specific activators, we have analyzed the function of TATA and Inr elements in vivo. In the absence of activators, the TATA element was significantly more active than the Inr, and the combination of elements was only slightly more effe...

  18. Transcription from the P1 promoters of Micromonospora echinospora in the absence of native upstream DNA sequences.

    Baum, E Z; Buttner, M J; Lin, L S; Rothstein, D. M.

    1989-01-01

    We demonstrated previously that the 0.4-kilobase DNA fragment from Micromonospora echinospora contains multiple tandem promoters, P1a, P1b, P1c, and P2, which are also functional when cloned into Streptomyces lividans. We now show by in vitro transcription with Streptomyces RNA polymerase that each of these promoters is an authentic initiation site, rather than a processing site for transcripts which initiate further upstream. The DNA sequence requirements for the closely spaced promoters P1a...

  19. DNA polymerase activity and radiation-induced unscheduled synthesis of DNA at the nuclear matrix

    It is shown that both DNA polymerase α and β are involved in DNA synthesis at the nuclear matrix. DNA polymerase β is more firmly attached to the nuclear matrix of normal than of regenerating liver cells. In the nuclear matrix of UV- and gamma-irradiated cells of Zajdela hepatoma a higher level of hydroxyurea-resistant DNA synthesis has been observed in the initial 1.5-5 min of postradiation incubation if compared to that of total nuclear DNA. However 1-β-D-arabinofuranosylcytosine-resistant radiation-induced synthesis of DNA is similar in both the nuclear matrix and the whole nuclei of these cells. Poly(ADP-ribose)synthetase activity is shown to be associated with the nuclear matrix. Inhibition of this activity results in increase of the hydroxyurea-resistant synthesis of DNA at nuclear matrix. (author)

  20. Seed storage protein gene promoters contain conserved DNA motifs in Brassicaceae, Fabaceae and Poaceae

    Fauteux François

    2009-10-01

    Full Text Available Abstract Background Accurate computational identification of cis-regulatory motifs is difficult, particularly in eukaryotic promoters, which typically contain multiple short and degenerate DNA sequences bound by several interacting factors. Enrichment in combinations of rare motifs in the promoter sequence of functionally or evolutionarily related genes among several species is an indicator of conserved transcriptional regulatory mechanisms. This provides a basis for the computational identification of cis-regulatory motifs. Results We have used a discriminative seeding DNA motif discovery algorithm for an in-depth analysis of 54 seed storage protein (SSP gene promoters from three plant families, namely Brassicaceae (mustards, Fabaceae (legumes and Poaceae (grasses using backgrounds based on complete sets of promoters from a representative species in each family, namely Arabidopsis (Arabidopsis thaliana (L. Heynh., soybean (Glycine max (L. Merr. and rice (Oryza sativa L. respectively. We have identified three conserved motifs (two RY-like and one ACGT-like in Brassicaceae and Fabaceae SSP gene promoters that are similar to experimentally characterized seed-specific cis-regulatory elements. Fabaceae SSP gene promoter sequences are also enriched in a novel, seed-specific E2Fb-like motif. Conserved motifs identified in Poaceae SSP gene promoters include a GCN4-like motif, two prolamin-box-like motifs and an Skn-1-like motif. Evidence of the presence of a variant of the TATA-box is found in the SSP gene promoters from the three plant families. Motifs discovered in SSP gene promoters were used to score whole-genome sets of promoters from Arabidopsis, soybean and rice. The highest-scoring promoters are associated with genes coding for different subunits or precursors of seed storage proteins. Conclusion Seed storage protein gene promoter motifs are conserved in diverse species, and different plant families are characterized by a distinct combination

  1. Promoting Physical Activity in Primary Care: Overcoming the barriers

    Singer, Joel; Lindsay, Elizabeth A.; Wilson, Douglas M.C.

    1991-01-01

    The principle barriers preventing health care professionals from promoting physical activity include an incomplete understanding of the evidence linking physical activity and health, difficulty in translating research findings into a feasible and efficacious clinical intervention, resistance to adopting a preventive orientation, and concerns about the risks of physical activity. Low level activities likely provide benefit with little risk.

  2. PKA-mediated phosphorylation of ATR promotes recruitment of XPA to UV-induced DNA damage.

    Jarrett, Stuart G; Wolf Horrell, Erin M; Christian, Perry A; Vanover, Jillian C; Boulanger, Mary C; Zou, Yue; D'Orazio, John A

    2014-06-19

    The melanocortin 1 receptor (MC1R), which signals through cAMP, is a melanocytic transmembrane receptor involved in pigmentation, adaptive tanning, and melanoma resistance. We report MC1R-mediated or pharmacologically-induced cAMP signaling promotes nucleotide excision repair (NER) in a cAMP-dependent protein kinase A (PKA)-dependent manner. PKA directly phosphorylates ataxia telangiectasia and Rad3-related protein (ATR) at Ser435, which actively recruits the key NER protein xeroderma pigmentosum complementation group A (XPA) to sites of nuclear UV photodamage, accelerating clearance of UV-induced photolesions and reducing mutagenesis. Loss of Ser435 within ATR prevents PKA-mediated ATR phosphorylation, disrupts ATR-XPA binding, delays recruitment of XPA to UV-damaged DNA, and elevates UV-induced mutagenesis. This study mechanistically links cAMP-PKA signaling to NER and illustrates potential benefits of cAMP pharmacological rescue to reduce UV mutagenesis in MC1R-defective, melanoma-susceptible individuals. PMID:24950377

  3. Effect of γ-irradiated DNA on the activity of DNA polymerase

    A cell-free assay was developed to measure the effect of γ-irradiated DNA template on the ability of DNA polymerase to copy unirradiated template. Doses as low as 1 krad were able to decrease (approx. 15%) the activity of both bacterial and mammalian DNA polymerases in the assay. The percentage of polymerase activity decreased as the dose received by the template increased. The reduction in DNA polymerase activity was shown to be due to an inhibition of the enzyme by the irradiated DNA. Irradiated poly(dA-dT) was more effective in reducing polymerase activity than calf thymus DNA. Thus the polymerase-inhibition site(s) appears to be associated with base damage, specifically adenine or thymine. Using a free-radical scavenger, OH radicals were found to be involved in producing the damage sites. The interaction between irradiated DNA and DNA polymerase was found to be specific for the enzyme and not for other proteins present in the assay. The inhibition of DNA polymerase occurred prior to or during the initiation of DNA synthesis rather than after initiation of synthesis, i.e., during elongation

  4. Increased anticoagulant activity of thrombin-binding DNA aptamers by nanoscale organization on DNA nanostructures

    Rangnekar, Abhijit; Zhang, Alex M.; Shiyuan Li, Susan;

    2012-01-01

    Control over thrombin activity is much desired to regulate blood clotting in surgical and therapeutic situations. Thrombin-binding RNA and DNA aptamers have been used to inhibit thrombin activity and thus the coagulation cascade. Soluble DNA aptamers, as well as two different aptamers tethered by...

  5. Coevolution of teaching activity promotes cooperation

    Evolutionary games are studied where the teaching activity of players can evolve in time. Initially all players following either the cooperative or defecting strategy are distributed on a square lattice. The rate of strategy adoption is determined by the payoff difference and a teaching activity characterizing the donor's capability to enforce its strategy on the opponent. Each successful strategy adoption process is accompanied by an increase in the donor's teaching activity. By applying an optimum value of the increment, this simple mechanism spontaneously creates relevant inhomogeneities in the teaching activities that support the maintenance of cooperation for both the prisoner's dilemma and the snowdrift game

  6. Brazilian physical activity guidelines as a strategy for health promotion

    Emerson Sebastião; Andiara Schwingel; Wojtek Chodzko-Zajko

    2014-01-01

    Public health actions endorsed by the federal government, for instance, health promotion initiatives, usually have greater impact at population level compared to other types of initiatives. This commentary aims to instigate debate on the importance and necessity of producing federally endorsed brazilian physical activity guidelines as a strategy for health promotion.

  7. Physical Activity Promotion in Call Centres: Employers' Perspectives

    Renton, Sheila J.; Lightfoot, Nancy E.; Maar, Marion A.

    2011-01-01

    This study followed a predominantly qualitative approach to explore the perspectives of employers in Sudbury, Ontario, Canada, call centres (CCs) regarding physical activity (PA) promotion in workplaces, by identifying current practices and employers' motivation to promote PA, as well as perceived facilitators and barriers. In-depth interviews…

  8. Promoter and nonspecific DNA binding by the T7 RNA polymerase.

    Smeekens, S.P.; Romano, L J

    1986-01-01

    T7 RNA polymerase plays an important role in both the transcription and replication of bacteriophage T7. In this study we have used a nitrocellulose filter binding assay to examine the binding properties of the T7 RNA polymerase with T7 promoters cloned into plasmid DNAs. Promoter-specific binding was shown to be relatively insensitive to variations in the ionic strength of the incubation solution but dependent on the helical structure of the DNA. On the other hand, nonpromoter interior-site ...

  9. Inactivation of nuclear GSK3β by Ser(389) phosphorylation promotes lymphocyte fitness during DNA double-strand break response.

    Thornton, Tina M; Delgado, Pilar; Chen, Liang; Salas, Beatriz; Krementsov, Dimitry; Fernandez, Miriam; Vernia, Santiago; Davis, Roger J; Heimann, Ruth; Teuscher, Cory; Krangel, Michael S; Ramiro, Almudena R; Rincón, Mercedes

    2016-01-01

    Variable, diversity and joining (V(D)J) recombination and immunoglobulin class switch recombination (CSR) are key processes in adaptive immune responses that naturally generate DNA double-strand breaks (DSBs) and trigger a DNA repair response. It is unclear whether this response is associated with distinct survival signals that protect T and B cells. Glycogen synthase kinase 3β (GSK3β) is a constitutively active kinase known to promote cell death. Here we show that phosphorylation of GSK3β on Ser(389) by p38 MAPK (mitogen-activated protein kinase) is induced selectively by DSBs through ATM (ataxia telangiectasia mutated) as a unique mechanism to attenuate the activity of nuclear GSK3β and promote survival of cells undergoing DSBs. Inability to inactivate GSK3β through Ser(389) phosphorylation in Ser(389)Ala knockin mice causes a decrease in the fitness of cells undergoing V(D)J recombination and CSR. Preselection-Tcrβ repertoire is impaired and antigen-specific IgG antibody responses following immunization are blunted in Ser(389)GSK3β knockin mice. Thus, GSK3β emerges as an important modulator of the adaptive immune response. PMID:26822034

  10. Promoting Physical Activity during Early Childhood

    Vidoni, Carla; Ignico, Arlene

    2011-01-01

    The prevalence of obesity in children and adolescents from low-income families in the USA has become a significant concern over the last 20 years. One of the major contributors to this problem is the lack of physical activity. The purpose of this paper is to describe initiatives designed to: (1) engage young children in physical activity during…

  11. Tumor suppressor protein C53 antagonizes checkpoint kinases to promote cyclin-dependent kinase 1 activation

    Hai Jiang; Jianchun Wu; Chen He; Wending Yang; Honglin Li

    2009-01-01

    Cyclin-dependent kinase 1 (Cdk1)/cyclin B1 complex is the driving force for mitotic entry, and its activation is tightly regulated by the G2/M checkpoint. We originally reported that a novel protein C53 (also known as Cdk5rap3 and LZAP) potentiates DNA damage-induced cell death by modulating the G2/M checkpoint. More recently, Wang et al. (2007) found that C53/LZAP may function as a tumor suppressor by way of inhibiting NF-kB signaling. We report here the identification of C53 protein as a novel regulator of Cdk1 activation. We found that knockdown of C53 protein causes delayed Cdkl activation and mitotic entry. During DNA damage response, activation of checkpoint kinase 1 and 2 (Chk1 and Chk2) is partially inhibited by C53 overexpression. Intriguingly, we found that C53 interacts with Chkl and antagonizes its function. Moreover, a portion of C53 protein is localized at the centrosome, and centrosome-targeting C53 potently promotes local Cdk1 activation. Taken together, our results strongly suggest that C53 is a novel negative regulator of checkpoint response. By counteracting Chk1, C53 promotes Cdk1 activation and mitotic entry in both unperturbed cell-cycle progression and DNA damage response.

  12. miR-29 Represses the Activities of DNA Methyltransferases and DNA Demethylases

    Izuho Hatada

    2013-07-01

    Full Text Available Members of the microRNA-29 (miR-29 family directly target the DNA methyltransferases, DNMT3A and DNMT3B. Disturbances in the expression levels of miR-29 have been linked to tumorigenesis and tumor aggressiveness. Members of the miR-29 family are currently thought to repress DNA methylation and suppress tumorigenesis by protecting against de novo methylation. Here, we report that members of the miR-29 family repress the activities of DNA methyltransferases and DNA demethylases, which have opposing roles in control of DNA methylation status. Members of the miR-29 family directly inhibited DNA methyltransferases and two major factors involved in DNA demethylation, namely tet methylcytosine dioxygenase 1 (TET1 and thymine DNA glycosylase (TDG. Overexpression of miR-29 upregulated the global DNA methylation level in some cancer cells and downregulated DNA methylation in other cancer cells, suggesting that miR-29 suppresses tumorigenesis by protecting against changes in the existing DNA methylation status rather than by preventing de novo methylation of DNA.

  13. Selective DNA Methylation of BDNF Promoter in Bipolar Disorder: Differences Among Patients with BDI and BDII

    D'Addario, Claudio; Dell'Osso, Bernardo; Palazzo, Maria Carlotta; Benatti, Beatrice; Lietti, Licia; Cattaneo, Elisabetta; Galimberti, Daniela; Fenoglio, Chiara; Cortini, Francesca; Scarpini, Elio; Arosio, Beatrice; Di Francesco, Andrea; Di Benedetto, Manuela; Romualdi, Patrizia; Candeletti, Sanzio

    2012-01-01

    The etiology of bipolar disorder (BD) is still poorly understood, involving genetic and epigenetic mechanisms as well as environmental contributions. This study aimed to investigate the degree of DNA methylation at the promoter region of the brain-derived neurotrophic factor (BDNF) gene, as one of the candidate genes associated with major psychoses, in peripheral blood mononuclear cells isolated from 94 patients with BD (BD I=49, BD II=45) and 52 healthy controls. A significant BDNF gene expr...

  14. Improving health through policies that promote active travel

    de Nazelle, Audrey; Nieuwenhuijsen, Mark J; Antó, Josep M;

    2011-01-01

    Substantial policy changes to control obesity, limit chronic disease, and reduce air pollution emissions, including greenhouse gasses, have been recommended. Transportation and planning policies that promote active travel by walking and cycling can contribute to these goals, potentially yielding...

  15. Coevolution of teaching activity promotes cooperation

    Szolnoki, Attila [Research Institute for Technical Physics and Materials Science, PO Box 49, H-1525 Budapest (Hungary); Perc, Matjaz [Department of Physics, Faculty of Natural Sciences and Mathematics, University of Maribor, Koroska cesta 160, SI-2000 Maribor (Slovenia)], E-mail: szolnoki@mfa.kfki.hu, E-mail: matjaz.perc@uni-mb.si

    2008-04-15

    Evolutionary games are studied where the teaching activity of players can evolve in time. Initially all players following either the cooperative or defecting strategy are distributed on a square lattice. The rate of strategy adoption is determined by the payoff difference and a teaching activity characterizing the donor's capability to enforce its strategy on the opponent. Each successful strategy adoption process is accompanied by an increase in the donor's teaching activity. By applying an optimum value of the increment, this simple mechanism spontaneously creates relevant inhomogeneities in the teaching activities that support the maintenance of cooperation for both the prisoner's dilemma and the snowdrift game.

  16. Kinesin KIFC1 actively transports bare double-stranded DNA

    Farina, Francesca; Pierobon, Paolo; Delevoye, Cédric; Monnet, Jordan; Dingli, Florent; Loew, Damarys; Quanz, Maria; Dutreix, Marie; Cappello, Giovanni

    2013-01-01

    During the past years, exogenous DNA molecules have been used in gene and molecular therapy. At present, it is not known how these DNA molecules reach the cell nucleus. We used an in cell single-molecule approach to observe the motion of exogenous short DNA molecules in the cytoplasm of eukaryotic cells. Our observations suggest an active transport of the DNA along the cytoskeleton filaments. We used an in vitro motility assay, in which the motion of single-DNA molecules along cytoskeleton fi...

  17. DNA methylation dynamics in the rat EGF gene promoter after partial hepatectomy

    Deming Li

    2014-06-01

    Full Text Available Epidermal growth factor (EGF, a multifunctional growth factor, is a regulator in a wide variety of physiological processes. EGF plays an important role in the regulation of liver regeneration. This study was aimed at investigating the methylation level of EGF gene throughout liver regeneration. DNA of liver tissue from control rats and partial hepatectomy (PH rats at 10 time points was extracted and a 354 bp fragment including 10 CpG sites from the transcription start was amplified after DNA was modified by sodium bisulfate. The result of sequencing suggested that methylation ratio of four CpG sites was found to be significantly changed when PH group was compared to control group, in particular two of them were extremely striking. mRNA expression of EGF was down-regulated in total during liver regeneration. We think that the rat EGF promoter region is regulated by variation in DNA methylation during liver regeneration.

  18. APOBEC3G enhances lymphoma cell radioresistance by promoting cytidine deaminase-dependent DNA repair.

    Nowarski, Roni; Wilner, Ofer I; Cheshin, Ori; Shahar, Or D; Kenig, Edan; Baraz, Leah; Britan-Rosich, Elena; Nagler, Arnon; Harris, Reuben S; Goldberg, Michal; Willner, Itamar; Kotler, Moshe

    2012-07-12

    APOBEC3 proteins catalyze deamination of cytidines in single-stranded DNA (ssDNA), providing innate protection against retroviral replication by inducing deleterious dC > dU hypermutation of replication intermediates. APOBEC3G expression is induced in mitogen-activated lymphocytes; however, no physiologic role related to lymphoid cell proliferation has yet to be determined. Moreover, whether APOBEC3G cytidine deaminase activity transcends to processing cellular genomic DNA is unknown. Here we show that lymphoma cells expressing high APOBEC3G levels display efficient repair of genomic DNA double-strand breaks (DSBs) induced by ionizing radiation and enhanced survival of irradiated cells. APOBEC3G transiently accumulated in the nucleus in response to ionizing radiation and was recruited to DSB repair foci. Consistent with a direct role in DSB repair, inhibition of APOBEC3G expression or deaminase activity resulted in deficient DSB repair, whereas reconstitution of APOBEC3G expression in leukemia cells enhanced DSB repair. APOBEC3G activity involved processing of DNA flanking a DSB in an integrated reporter cassette. Atomic force microscopy indicated that APOBEC3G multimers associate with ssDNA termini, triggering multimer disassembly to multiple catalytic units. These results identify APOBEC3G as a prosurvival factor in lymphoma cells, marking APOBEC3G as a potential target for sensitizing lymphoma to radiation therapy. PMID:22645179

  19. Rescue of Newcastle disease virus from cloned cDNA using an RNA polymerase II promoter.

    Li, Bao-Yu; Li, Xue-Rui; Lan, Xi; Yin, Xiang-Pin; Li, Zhi-Yong; Yang, Bin; Liu, Ji-Xing

    2011-06-01

    A new system was developed to improve the efficiency and simplify the procedure of recovery of Newcastle disease virus (NDV) from cloned cDNA. A full-length cDNA clone of mesogenic NDV vaccine strain Mukteswar was assembled from five subgenomic cDNA fragments and cloned into a plasmid allowing transcription driven by cellular RNA polymerase II. The full-length viral cDNA was flanked by hammerhead ribozyme (HamRz) and hepatitis delta virus ribozyme (HdvRz) sequences, resulted in the synthesis of antigenomic RNA with exact termini. Without supplying T7 RNA polymerase, infectious NDV could be generated efficiently in some eukaryotic cell lines by simultaneous transcription of antigenomic RNA from the full-length plasmid and expression of NP, P and L proteins from helper plasmids introduced by cotransfection. The efficiency of recovery with the conventional T7 promoter system based on BRS-T7 cells and the cytomegalovirus (CMV) promoter system was compared, and the results demonstrate that the new system facilitates the generation of recombinant NDV and more efficient than the T7 rescue system using BRS-T7. PMID:21327786

  20. FANCD2 Maintains Fork Stability in BRCA1/2-Deficient Tumors and Promotes Alternative End-Joining DNA Repair.

    Kais, Zeina; Rondinelli, Beatrice; Holmes, Amie; O'Leary, Colin; Kozono, David; D'Andrea, Alan D; Ceccaldi, Raphael

    2016-06-14

    BRCA1/2 proteins function in homologous recombination (HR)-mediated DNA repair and cooperate with Fanconi anemia (FA) proteins to maintain genomic integrity through replication fork stabilization. Loss of BRCA1/2 proteins results in DNA repair deficiency and replicative stress, leading to genomic instability and enhanced sensitivity to DNA-damaging agents. Recent studies have shown that BRCA1/2-deficient tumors upregulate Polθ-mediated alternative end-joining (alt-EJ) repair as a survival mechanism. Whether other mechanisms maintain genomic integrity upon loss of BRCA1/2 proteins is currently unknown. Here we show that BRCA1/2-deficient tumors also upregulate FANCD2 activity. FANCD2 is required for fork protection and fork restart in BRCA1/2-deficient tumors. Moreover, FANCD2 promotes Polθ recruitment at sites of damage and alt-EJ repair. Finally, loss of FANCD2 in BRCA1/2-deficient tumors enhances cell death. These results reveal a synthetic lethal relationship between FANCD2 and BRCA1/2, and they identify FANCD2 as a central player orchestrating DNA repair pathway choice at the replication fork. PMID:27264184

  1. Promoting Physical Activity through Goal Setting Strategies

    Martinez, Ray

    2004-01-01

    Physical educators are used to setting specific goals for students within a given unit. Here, the author emphasizes that they should also encourage students to set their own goals. Goal setting engages students in the learning process and allows them to develop the skills that support an active lifestyle. The author presents goal setting…

  2. Extraction DNA from Activated Sludge-Comparing with Soil Sample

    谢冰; 奚旦立; 陈季华

    2003-01-01

    DNA directly extraction from activated sludge and soil sample with enzyme lyses methods was investigated in this paper. DNA yield from activated sludge was 3.0 mg/g. VLSS, and 28.2-43.8 μg/g soil respectively. The resulting DNA is suitable for PCR.By studied methods, higher quality and quantity of sludge DNA could be obtained rapidly and inexpensively from large number of samples, and the PCR product obtained from this protocol was not affected by contaminated higher concentration of heavy metals.

  3. RAGE is a nucleic acid receptor that promotes inflammatory responses to DNA

    Sirois, Cherilyn M.; Jin, Tengchuan; Miller, Allison L.; Bertheloot, Damien; Nakamura, Hirotaka; Horvath, Gabor L.; Mian, Abubakar; Jiang, Jiansheng; Schrum, Jacob; Bossaller, Lukas; Pelka, Karin; Garbi, Natalio; Brewah, Yambasu; Tian, Jane; Chang, ChewShun

    2013-01-01

    Recognition of DNA and RNA molecules derived from pathogens or self-antigen is one way the mammalian immune system senses infection and tissue damage. Activation of immune signaling receptors by nucleic acids is controlled by limiting the access of DNA and RNA to intracellular receptors, but the mechanisms by which endosome-resident receptors encounter nucleic acids from the extracellular space are largely undefined. In this study, we show that the receptor for advanced glycation end-products...

  4. Yeast homologous recombination-based promoter engineering for the activation of silent natural product biosynthetic gene clusters.

    Montiel, Daniel; Kang, Hahk-Soo; Chang, Fang-Yuan; Charlop-Powers, Zachary; Brady, Sean F

    2015-07-21

    Large-scale sequencing of prokaryotic (meta)genomic DNA suggests that most bacterial natural product gene clusters are not expressed under common laboratory culture conditions. Silent gene clusters represent a promising resource for natural product discovery and the development of a new generation of therapeutics. Unfortunately, the characterization of molecules encoded by these clusters is hampered owing to our inability to express these gene clusters in the laboratory. To address this bottleneck, we have developed a promoter-engineering platform to transcriptionally activate silent gene clusters in a model heterologous host. Our approach uses yeast homologous recombination, an auxotrophy complementation-based yeast selection system and sequence orthogonal promoter cassettes to exchange all native promoters in silent gene clusters with constitutively active promoters. As part of this platform, we constructed and validated a set of bidirectional promoter cassettes consisting of orthogonal promoter sequences, Streptomyces ribosome binding sites, and yeast selectable marker genes. Using these tools we demonstrate the ability to simultaneously insert multiple promoter cassettes into a gene cluster, thereby expediting the reengineering process. We apply this method to model active and silent gene clusters (rebeccamycin and tetarimycin) and to the silent, cryptic pseudogene-containing, environmental DNA-derived Lzr gene cluster. Complete promoter refactoring and targeted gene exchange in this "dead" cluster led to the discovery of potent indolotryptoline antiproliferative agents, lazarimides A and B. This potentially scalable and cost-effective promoter reengineering platform should streamline the discovery of natural products from silent natural product biosynthetic gene clusters. PMID:26150486

  5. Achaete-scute complex homolog-1 promotes DNA repair in the lung carcinogenesis through matrix metalloproteinase-7 and O(6-methylguanine-DNA methyltransferase.

    Xiao-Yang Wang

    Full Text Available Lung cancer is the leading cause of cancer-related deaths in the world. Achaete-scute complex homolog-1 (Ascl1 is a member of the basic helix-loop-helix (bHLH transcription factor family that has multiple functions in the normal and neoplastic lung such as the regulation of neuroendocrine differentiation, prevention of apoptosis and promotion of tumor-initiating cells. We now show that Ascl1 directly regulates matrix metalloproteinase-7 (MMP-7 and O(6-methylguanine-DNA methyltransferase (MGMT. Loss- and gain-of-function experiments in human bronchial epithelial and lung carcinoma cell lines revealed that Ascl1, MMP-7 and MGMT are able to protect cells from the tobacco-specific nitrosamine NNK-induced DNA damage and the alkylating agent cisplatin-induced apoptosis. We also examined the role of Ascl1 in NNK-induced lung tumorigenesis in vivo. Using transgenic mice which constitutively expressed human Ascl1 in airway lining cells, we found that there was a delay in lung tumorigenesis. We conclude that Ascl1 potentially enhances DNA repair through activation of MMP-7 and MGMT which may impact lung carcinogenesis and chemoresistance. The study has uncovered a novel and unexpected function of Ascl1 which will contribute to better understanding of lung carcinogenesis and the broad implications of transcription factors in tobacco-related carcinogenesis.

  6. Separation of DNA-dependent polymerate activities in Micrococcus radiodurans

    DNA polymerase activities in Micrococcus radiodurans were separated into two fractions after purification more than 2000 fold. They differ in pH optimum and residual activities in the absence of a full deoxyribonucleoside triphosphates complement. NAD partly inhibited one of the activities. Both activities were eluted as a single peak on gel filtration and sedimented at the same rate on glycerol gradient centrifugation. Molecular weight 140000 was calculated from Stokes radius and sedimentation constant. Deoxyribonuclease activity was detected on one of the polymerase activities which preferentially degraded double-stranded DNA. Priming activity of nicked DNA was reduced by γ-radiation. These results have been related to the possible roles in repair synthesis in vivo or DNA synthesis in permeable cells of M. radiodurans

  7. Can musical activities promote healthy ageing?

    Park, A-La

    2015-01-01

    Background: As most of the baby boomer generation have now reached retirement age, there are increasing demands for long-term care services. Depression and psychological distress can be highly prevalent at advanced ages. Regardless of chronological age, it is important to have a decent quality of life as a human being by improving resilience. The present study aims to briefly look at the current evidence on the effects of musical activities on quality of life in older adults. Methods: A liter...

  8. Purification and biochemical characterization of DnaK and its transcriptional activator RpoH from Neisseria gonorrhoeae.

    Narayanan, Shalini; Beckham, Simone A; Davies, John K; Roujeinikova, Anna

    2014-12-01

    DnaK plays a central role in stress response in the important human pathogen Neisseria gonorrhoeae. The genes encoding the DnaK chaperone machine (DnaK/DnaJ/GrpE) in N. gonorrhoeae are transcribed from RpoH (σ(32))-dependent promoters. In this study, we cloned, purified and biochemically characterised N. gonorrhoeae DnaK (NgDnaK) and RpoH. The NgDnaK and RpoH sequences are 73 and 50 % identical to the sequences of their respective E. coli counterparts. Similar to EcDnaK, nucleotide-free NgDnaK exists as a mix of monomers, dimers and higher oligomeric species in solution, and dissociates into monomers on addition of ATP. Like E. coli σ(32), RpoH of N. gonorrhoeae is monomeric in solution. Kinetic analysis of the basal ATPase activity of purified NgDnaK revealed a V max of 193 pmol phosphate released per minute per microgram DnaK (which is significantly higher than reported basal ATPase activity of EcDnaK), and the turnover number against ATP was 0.4 min(-1) under our assay conditions. Nucleotide-free NgDnaK bound a short model substrate, NR-peptide, with micromolar affinity close to that reported for EcDnaK. Our analysis showed that interaction between N. gonorrhoeae RpoH and DnaK appears to be ATP-dependent and non-specific, in stark contrast to the E. coli DnaK system where σ(32) and DnaK interact as monomers even in the absence of ATP. Sequence comparison showed that the DnaK-binding site of σ(32) is not conserved in RpoH. Our findings suggest that the mechanism of DnaK/RpoH recognition in N. gonorrhoeae is different from that in E. coli. PMID:25156536

  9. Development of transcriptional fusions to assess Leptospira interrogans promoter activity.

    Gustavo M Cerqueira

    Full Text Available BACKGROUND: Leptospirosis is a zoonotic infectious disease that affects both humans and animals. The existing genetic tools for Leptospira spp. have improved our understanding of the biology of this spirochete as well as the interaction of pathogenic leptospires with the mammalian host. However, new tools are necessary to provide novel and useful information to the field. METHODOLOGY AND PRINCIPAL FINDINGS: A series of promoter-probe vectors carrying a reporter gene encoding green fluorescent protein (GFP were constructed for use in L. biflexa. They were tested by constructing transcriptional fusions between the lipL41, Leptospiral Immunoglobulin-like A (ligA and Sphingomyelinase 2 (sph2 promoters from L. interrogans and the reporter gene. ligA and sph2 promoters were the most active, in comparison to the lipL41 promoter and the non-induced controls. The results obtained are in agreement with LigA expression from the L. interrogans Fiocruz L1-130 strain. CONCLUSIONS: The novel vectors facilitated the in vitro evaluation of L. interrogans promoter activity under defined growth conditions which simulate the mammalian host environment. The fluorescence and rt-PCR data obtained closely reflected transcriptional regulation of the promoters, thus demonstrating the suitability of these vectors for assessing promoter activity in L. biflexa.

  10. Endonuclease activity in E. coli against photoalkylated DNA

    Photoalkylation, the ultraviolet irradiation (wavelength > 305 nm) of DNA in the presence of isopropanol and the free radical photoinitiator di-tert-butylperoxide, causes a variety of base alterations. These include 8-(2-hydroxy-2-propyl)guanine, 8-(2-hydroxy-2-propyl)adenine and thymine dimers. The authors have found a endonuclease activity in E. coli directed against photoalkylated DNA. This activity converts photoalkylated superhelical PM2 phage DNA to the nicked form, as measured by a nitrocellulose filter binding assay. Enzyme activities were compared between crude extracts of mutant strain BW9051 (xth-), lacking in exonuclease III activity, and strain BW434 (xth-, nth-), deficient in both exonuclease III and endonuclease III. The endonuclease level in the double mutant against substrate photoalkylated DNA was under 20% of the activity in the E. coli strain lacking only exonuclease III. This was paralleled by a similar finding of deficient activity in the double mutant against partially depurinated PM2 DNA. Irradiation of the DNA substrate in the absence of isopropanol did not affect the activity in either strain. These studies suggest that the enzyme activity against photoalkylated DNA is endonuclease III and that the substrate photoproduct is neither a 8-(2-hydroxy-2-propyl)purine nor a thymine dimer

  11. Biological activity of cloned mammary tumor virus DNA fragments that bind purified glucocorticoid receptor protein in vitro

    To test whether high-affinity receptor:DNA interactions can be correlated with receptor effects on promoter function in vivo, we have mapped in greater detail the receptor-binding regions on murine mammary tumor virus DNA, using both nitrocellulose-filter binding and electron microscopy. Recombinant plasmids bearing these receptor-binding domains have been transfected into cultured cells, and the expression of the plasmid sequences has been monitored for hormonal regulation. The results are considered in terms of a speculative proposal that the glucocorticoid receptor may effect changes in promoter activity via specific alteration of chromatin and/or DNA structure. 37 references, 6 figures, 2 tables

  12. Synergistic transcription activation: a dual role for CRP in the activation of an Escherichia coli promoter depending on MalT and CRP

    Richet, Evelyne

    2000-01-01

    Activation of the Escherichia coli malEp promoter relies on the formation of a higher order structure involving cooperative binding of MalT to promoter-proximal and promoter-distal sites as well as CRP binding to three sites located in between. MalT is the primary activator and one function of CRP is to facilitate cooperative binding of MalT to its cognate sites by bending the intervening DNA. It is shown here that CRP also participates directly in malEp activation. This function is carried o...

  13. Honey, I Shrunk the DNA : DNA Length as a Probe for Nucleic-Acid Enzyme Activity

    Oijen, Antoine M. van

    2007-01-01

    The replication, recombination, and repair of DNA are processes essential for the maintenance of genomic information and require the activity of numerous enzymes that catalyze the polymerization or digestion of DNA. This review will discuss how differences in elastic properties between single- and d

  14. Activation and Regulation of DNA-Driven Immune Responses

    Paludan, Søren R

    2015-01-01

    The innate immune system provides early defense against infections and also plays a key role in monitoring alterations of homeostasis in the body. DNA is highly immunostimulatory, and recent advances in this field have led to the identification of the innate immune sensors responsible for the recognition of DNA as well as the downstream pathways that are activated. Moreover, information on how cells regulate DNA-driven immune responses to avoid excessive inflammation is now emerging. Finally,...

  15. Archaeal promoter architecture and mechanism of gene activation.

    Peng, Nan; Ao, Xiang; Liang, Yun Xiang; She, Qunxin

    2011-01-01

    Sulfolobus solfataricus and Sulfolobus islandicus contain several genes exhibiting D-arabinose-inducible expression and these systems are ideal for studying mechanisms of archaeal gene expression. At sequence level, only two highly conserved cis elements are present on the promoters: a regulatory element named ara box directing arabinose-inducible expression and the basal promoter element TATA, serving as the binding site for the TATA-binding protein. Strikingly, these promoters possess a modular structure that allows an essentially inactive basal promoter to be strongly activated. The invoked mechanisms include TFB (transcription factor B) recruitment by the ara-box-binding factor to activate gene expression and modulation of TFB recruitment efficiency to yield differential gene expression. PMID:21265754

  16. Deaminase Activity on Single-stranded DNA (ssDNA) Occurs in Vitro when APOBEC3G Cytidine Deaminase Forms Homotetramers and Higher-order Complexes*

    McDougall, William M.; Okany, Chinelo; Smith, Harold C.

    2011-01-01

    APOBEC3G (A3G) is a cytidine deaminase that catalyzes deamination of deoxycytidine (dC) on single-stranded DNA (ssDNA). The oligomeric state of A3G required to support deaminase activity remains unknown. We show under defined in vitro conditions that full-length and native A3G formed complexes with ssDNA in an A3G concentration-dependent but temperature-independent manner. Complexes assembled and maintained at 4 °C did not have significant deaminase activity, but their enzymatic function could be restored by subsequent incubation at 37 °C. This approach enabled complexes of a defined size range to be isolated and subsequently evaluated for their contribution to enzymatic activity. The composition of A3G bound to ssDNA was determined by protein-protein chemical cross-linking. A3G-ssDNA complexes of 16 S were necessary for deaminase activity and consisted of cross-linked A3G homotetramers and homodimers. At lower concentrations, A3G only formed 5.8 S homodimers on ssDNA with low deaminase activity. Monomeric A3G was not identified in 5.8 S or 16 S complexes. We propose that deaminase-dependent antiviral activity of A3G in vivo may require a critical concentration of A3G in viral particles that will promote oligomerization on ssDNA during reverse transcription. PMID:21737457

  17. Stimulation of DNA Glycosylase Activities by XPC Protein Complex: Roles of Protein-Protein Interactions

    Yuichiro Shimizu

    2010-01-01

    Full Text Available We showed that XPC complex, which is a DNA damage detector for nucleotide excision repair, stimulates activity of thymine DNA glycosylase (TDG that initiates base excision repair. XPC appeared to facilitate the enzymatic turnover of TDG by promoting displacement from its own product abasic site, although the precise mechanism underlying this stimulation has not been clarified. Here we show that XPC has only marginal effects on the activity of E. coli TDG homolog (EcMUG, which remains bound to the abasic site like human TDG but does not significantly interacts with XPC. On the contrary, XPC significantly stimulates the activities of sumoylated TDG and SMUG1, both of which exhibit quite different enzymatic kinetics from unmodified TDG but interact with XPC. These results point to importance of physical interactions for stimulation of DNA glycosylases by XPC and have implications in the molecular mechanisms underlying mutagenesis and carcinogenesis in XP-C patients.

  18. Different human TFIIIB activities direct RNA polymerase III transcription from TATA-containing and TATA-less promoters

    Schramm, Laura; Pendergrast, P. Shannon; Sun, Yuling; Hernandez, Nouria

    2000-01-01

    Transcription initiation at RNA polymerase III promoters requires transcription factor IIIB (TFIIIB), an activity that binds to RNA polymerase III promoters, generally through protein–protein contacts with DNA binding factors, and directly recruits RNA polymerase III. Saccharomyces cerevisiae TFIIIB is a complex of three subunits, TBP, the TFIIB-related factor BRF, and the more loosely associated polypeptide β″. Although human homologs for two of the TFIIIB subunits, the TATA box–binding prot...

  19. APLF promotes the assembly and activity of non-homologous end joining protein complexes.

    Grundy, Gabrielle J; Rulten, Stuart L; Zeng, Zhihong; Arribas-Bosacoma, Raquel; Iles, Natasha; Manley, Katie; Oliver, Antony; Caldecott, Keith W

    2013-01-01

    Non-homologous end joining (NHEJ) is critical for the maintenance of genetic integrity and DNA double-strand break (DSB) repair. NHEJ is regulated by a series of interactions between core components of the pathway, including Ku heterodimer, XLF/Cernunnos, and XRCC4/DNA Ligase 4 (Lig4). However, the mechanisms by which these proteins assemble into functional protein-DNA complexes are not fully understood. Here, we show that the von Willebrand (vWA) domain of Ku80 fulfills a critical role in this process by recruiting Aprataxin-and-PNK-Like Factor (APLF) into Ku-DNA complexes. APLF, in turn, functions as a scaffold protein and promotes the recruitment and/or retention of XRCC4-Lig4 and XLF, thereby assembling multi-protein Ku complexes capable of efficient DNA ligation in vitro and in cells. Disruption of the interactions between APLF and either Ku80 or XRCC4-Lig4 disrupts the assembly and activity of Ku complexes, and confers cellular hypersensitivity and reduced rates of chromosomal DSB repair in avian and human cells, respectively. Collectively, these data identify a role for the vWA domain of Ku80 and a molecular mechanism by which DNA ligase proficient complexes are assembled during NHEJ in mammalian cells, and reveal APLF to be a structural component of this critical DSB repair pathway. PMID:23178593

  20. Evaluation of hair growth promoting activity of Phyllanthus niruri

    Satish Patel; Vikas Sharma; Nagendra Chauhan; Mayank Thakur; Vinod Dixit

    2015-01-01

    Objective: This study was designed to investigate the potential Phyllanthus niruri (P. niruri ) extracts in promotion of hair growth. Materials and Methods: Here, we studied the hair growth promoting activity of petroleum ether extract of P. niruri following its topical administration. Alopecia was induced in albino rats by subcutaneous administration of testosterone for 21 days. Evaluation of hair loss inhibition was done by concurrent administration of extract and monitoring parameters like...

  1. Promotion as a Tool in Sustaining the Destination Marketing Activities

    Ivo Mulec

    2010-01-01

    Promoting the tourism destination in the right and best possible way is today one of vital marketing activities of all Destination Management Organizations. Only successful promotion can entice and attract potential travelers to visit the destination. The number of new destinations is increasing every year and some of them are quite similar. Market segmentation is one of the starting points for devising marketing strategy. Only by presenting the destination to the right segment of potential c...

  2. Promoting Physical Activity Among Overweight Young African American Women

    2014-01-15

    This podcast is an interview with Nefertiti Durant, MD, MPH, from the University of Alabama at Birmingham about promoting physical activity among overweight and obese young African American Women using Internet-based tools.  Created: 1/15/2014 by Preventing Chronic Disease (PCD), National Center for Chronic Disease Prevention and Health Promotion (NCCDPHP).   Date Released: 1/15/2014.

  3. Heat shock proteins DnaJ, DnaK, and GrpE stimulate P1 plasmid replication by promoting initiator binding to the origin.

    Sozhamannan, S; Chattoraj, D K

    1993-01-01

    Binding of the P1-encoded protein RepA to the origin of P1 plasmid replication is essential for initiation of DNA replication and for autoregulatory repression of the repA promoter. Previous studies have shown defects in both initiation and repression in hosts lacking heat shock proteins DnaJ, DnaK, and GrpE and have suggested that these proteins play a role in the RepA-DNA binding required for initiation and repression. In this study, using in vivo dimethyl sulfate footprinting, we have conf...

  4. O-methylguanine-DNA methyltransferase (MGMT mRNA expression predicts outcome in malignant glioma independent of MGMT promoter methylation.

    Simone Kreth

    Full Text Available BACKGROUND: We analyzed prospectively whether MGMT (O(6-methylguanine-DNA methyltransferase mRNA expression gains prognostic/predictive impact independent of MGMT promoter methylation in malignant glioma patients undergoing radiotherapy with concomitant and adjuvant temozolomide or temozolomide alone. As DNA-methyltransferases (DNMTs are the enzymes responsible for setting up and maintaining DNA methylation patterns in eukaryotic cells, we analyzed further, whether MGMT promoter methylation is associated with upregulation of DNMT expression. METHODOLOGY/PRINCIPAL FINDINGS: ADULT PATIENTS WITH A HISTOLOGICALLY PROVEN MALIGNANT ASTROCYTOMA (GLIOBLASTOMA: N = 53, anaplastic astrocytoma: N = 10 were included. MGMT promoter methylation was determined by methylation-specific PCR (MSP and sequencing analysis. Expression of MGMT and DNMTs mRNA were analysed by real-time qPCR. Prognostic factors were obtained from proportional hazards models. Correlation between MGMT mRNA expression and MGMT methylation status was validated using data from the Cancer Genome Atlas (TCGA database (N = 229 glioblastomas. Low MGMT mRNA expression was strongly predictive for prolonged time to progression, treatment response, and length of survival in univariate and multivariate models (p<0.0001; the degree of MGMT mRNA expression was highly correlated with the MGMT promoter methylation status (p<0.0001; however, discordant findings were seen in 12 glioblastoma patients: Patients with methylated tumors with high MGMT mRNA expression (N = 6 did significantly worse than those with low transcriptional activity (p<0.01. Conversely, unmethylated tumors with low MGMT mRNA expression (N = 6 did better than their counterparts. A nearly identical frequency of concordant and discordant findings was obtained by analyzing the TCGA database (p<0.0001. Expression of DNMT1 and DNMT3b was strongly upregulated in tumor tissue, but not correlated with MGMT promoter methylation and MGMT m

  5. Hair Growth Promotion Activity and Its Mechanism of Polygonum multiflorum

    Yunfei Li

    2015-01-01

    Full Text Available Polygonum multiflorum Radix (PMR has long history in hair growth promotion and hair coloring in clinical applications. However, several crucial problems in its clinic usage and mechanisms are still unsolved or lack scientific evidences. In this research, C57BL/6J mice were used to investigate hair growth promotion activity and possible mechanism of PMR and Polygonum multiflorum Radix Preparata (PMRP. Hair growth promotion activities were investigated by hair length, hair covered skin ratio, the number of follicles, and hair color. Regulation effects of several cytokines involved in the hair growth procedure were tested, such as fibroblast growth factor (FGF-7, Sonic Hedgehog (SHH, β-catenin, insulin-like growth factor-1 (IGF-1, and hepatocyte growth factor (HGF. Oral PMR groups had higher hair covered skin ratio (100 ± 0.00% than oral PMRP groups (48%~88%. However, topical usage of PMRP had about 90% hair covered skin ratio. Both oral administration of PMR and topically given PMRP showed hair growth promotion activities. PMR was considered to be more suitable for oral administration, while PMRP showed greater effects in external use. The hair growth promotion effect of oral PMR was most probably mediated by the expression of FGF-7, while topical PMRP promoted hair growth by the stimulation of SHH expression.

  6. A DNA enzyme with N-glycosylase activity

    Sheppard, Terry L.; Ordoukhanian, Phillip; Joyce, Gerald F.

    2000-01-01

    In vitro evolution was used to develop a DNA enzyme that catalyzes the site-specific depurination of DNA with a catalytic rate enhancement of about 106-fold. The reaction involves hydrolysis of the N-glycosidic bond of a particular deoxyguanosine residue, leading to DNA strand scission at the apurinic site. The DNA enzyme contains 93 nucleotides and is structurally complex. It has an absolute requirement for a divalent metal cation and exhibits optimal activity at about pH 5. The mechanism of...

  7. Cockayne syndrome group B protein promotes mitochondrial DNA stability by supporting the DNA repair association with the mitochondrial membrane

    Aamann, Maria Diget; Sorensen, Martin M; Hvitby, Christina Poulsen;

    2010-01-01

    Cockayne syndrome (CS) is a human premature aging disorder associated with severe developmental deficiencies and neurodegeneration, and phenotypically it resembles some mitochondrial DNA (mtDNA) diseases. Most patients belong to complementation group B, and the CS group B (CSB) protein plays a role...... in genomic maintenance and transcriptome regulation. By immunocytochemistry, mitochondrial fractionation, and Western blotting, we demonstrate that CSB localizes to mitochondria in different types of cells, with increased mitochondrial distribution following menadione-induced oxidative stress....... Moreover, our results suggest that CSB plays a significant role in mitochondrial base excision repair (BER) regulation. In particular, we find reduced 8-oxo-guanine, uracil, and 5-hydroxy-uracil BER incision activities in CSB-deficient cells compared to wild-type cells. This deficiency correlates with...

  8. Commercial activities and the promotion of health in schools.

    Raine, Gary

    2013-11-01

    Many companies nowadays consider schools to be an important setting for marketing to children. However, important concerns can be raised from a health promotion perspective about the potential negative impact of commercial activities on the health and well-being of pupils. As this discussion paper will demonstrate, some commercial activities raise concerns in relation to physical health and obesity, not only by potentially undermining formal curriculum messages, but also through the active promotion of specific products, particularly those high in fat, sugar or salt. Nonetheless, the issues raised by commercial activities are not solely limited to effects on physical health. By allowing commercial activities, schools risk instilling in pupils consumer-orientated values. This is significant as such values have been linked to the development of poor health and well-being. Furthermore, the presence in schools of commercial activities will also militate against informed decision-making and be disempowering. There is also evidence that business-sponsored teaching materials can contain biased and misleading information. The potential negative impacts of commercial activities are inconsistent with goals in relation to the promotion of health and the principles of health-promoting schools. PMID:23135869

  9. First functional polymorphism in CFTR promoter that results in decreased transcriptional activity and Sp1/USF binding

    Growing evidences show that functionally relevant polymorphisms in various promoters alter both transcriptional activity and affinities of existing protein-DNA interactions, and thus influence disease progression in humans. We previously reported the -94G>T CFTR promoter variant in a female CF patient in whom any known disease-causing mutation has been detected. To investigate whether the -94G>T could be a regulatory variant, we have proceeded to in silico analyses and functional studies including EMSA and reporter gene assays. Our data indicate that the promoter variant decreases basal CFTR transcriptional activity in different epithelial cells and alters binding affinities of both Sp1 and USF nuclear proteins to the CFTR promoter. The present report provides evidence for the first functional polymorphism that negatively affects the CFTR transcriptional activity and demonstrates a cooperative role of Sp1 and USF transcription factors in transactivation of the CFTR gene promoter

  10. Inactivation efficiencies of radical reactions with biologically active DNA

    Lafleur, M. V. M.; Retèl, J.; Loman, H.

    Dilute aqueous solutions of biologically active θX174 DNA may serve as a simplified model system of the cell. Damage to the DNA after irradiation with γ-rays, may be ascribed to reactions with .OH, .H and e -aq or secondary radicals, arising from reactions of water radicals with added scavengers. Conversion of primary (water) radicals into secondary (scavenger) radicals leads to a considerable protection of the DNA, which, however, would have been larger if these secondary radicals did not contribute to DNA inactivation. The inactivation yield due to isopropanol or formate (secondary) radicals depends on dose rate as well as DNA concentration. Furthermore the inactivation efficiencies of the reactions of both the primary and the secondary radicals with single-stranded DNA could be established.

  11. Inactivation efficiencies of radical reactions with biologically active DNA

    Dilute aqueous solutions of biologically active ΦX174 DNA may serve as a simplified model system of the cell. Damage to the DNA after irradiation with γ-rays, may be ascribed to reactions with radical OH, radical H and esub(aq)- or secondary radicals, arising from reactions of water radicals with added scavengers. Conversion of primary (water) radicals into secondary (scavenger) radicals leads to a considerable protection of the DNA, which however, would have been larger if these secondary radicals did not contribute to DNA inactivation. The inactivation yield due to isopropanol or formate (secondary) radicals depends on dose rate as well as DNA concentration. Furthermore the inactivation efficiencies of the reactions of both the primary and the secondary radicals with single-stranded DNA could be established. (author)

  12. hTERT promoter activity and CpG methylation in HPV-induced carcinogenesis

    Activation of telomerase resulting from deregulated hTERT expression is a key event during high-risk human papillomavirus (hrHPV)-induced cervical carcinogenesis. In the present study we examined hTERT promoter activity and its relation to DNA methylation as one of the potential mechanisms underlying deregulated hTERT transcription in hrHPV-transformed cells. Using luciferase reporter assays we analyzed hTERT promoter activity in primary keratinocytes, HPV16- and HPV18-immortalized keratinocyte cell lines and cervical cancer cell lines. In the same cells as well as cervical specimens we determined hTERT methylation by bisulfite sequencing analysis of the region spanning -442 to +566 (relative to the ATG) and quantitative methylation specific PCR (qMSP) analysis of two regions flanking the hTERT core promoter. We found that in most telomerase positive cells increased hTERT core promoter activity coincided with increased hTERT mRNA expression. On the other hand basal hTERT promoter activity was also detected in telomerase negative cells with no or strongly reduced hTERT mRNA expression levels. In both telomerase positive and negative cells regulatory sequences flanking both ends of the core promoter markedly repressed exogenous promoter activity. By extensive bisulfite sequencing a strong increase in CpG methylation was detected in hTERT positive cells compared to cells with no or strongly reduced hTERT expression. Subsequent qMSP analysis of a larger set of cervical tissue specimens revealed methylation of both regions analyzed in 100% of cervical carcinomas and 38% of the high-grade precursor lesions, compared to 9% of low grade precursor lesions and 5% of normal controls. Methylation of transcriptionally repressive sequences in the hTERT promoter and proximal exonic sequences is correlated to deregulated hTERT transcription in HPV-immortalized cells and cervical cancer cells. The detection of DNA methylation at these repressive regions may provide an attractive

  13. The Dynamic Character of the BCL2 Promoter i-Motif Provides a Mechanism for Modulation of Gene Expression by Compounds That Bind Selectively to the Alternative DNA Hairpin Structure

    Kendrick, Samantha; Kang, Hyun-Jin; Alam, Mohammad P.; Madathil, Manikandadas M.; Agrawal, Prashansa; Gokhale, Vijay; Yang, Danzhou; Hecht, Sidney M.; Hurley, Laurence H

    2014-01-01

    It is generally accepted that DNA predominantly exists in duplex form in cells. However, under torsional stress imposed by active transcription, DNA can assume nonduplex structures. The BCL2 promoter region forms two different secondary DNA structures on opposite strands called the G-quadruplex and the i-motif. The i-motif is a highly dynamic structure that exists in equilibrium with a flexible hairpin species. Here we identify a pregnanol derivative and a class of piperidine derivatives that...

  14. THE ACTIVITY OF ARABIDOSPIS DLL PROMOTER IN TRANSGENIC TOBACCO PLANTS UNDER WATER STRESS CONDITIONS

    Zuzana Polóniová

    2014-02-01

    Full Text Available In this work we used the Cre/loxP recombination system to study the activity of the Arabidopsis DLL promoter under water stress treatment. For this, the T-DNA containing the Cre/loxP self-excision recombination cassette was introduced into tobacco genome via A. tumefaciens LBA 4404. The expression of the cre gene was regulated by the DLL promoter. On activity of the DLL the Cre recombinase was expected to remove Cre/loxP cassette. Transgenic nature of regenerated transgenic T0 tobacco plantlets was proved by GUS and PCR analyses. The selected 10 transgenic T0 plants were subjected to the water stress analyses under in vitro as well as under in vivo conditions. The osmotic stress experiments were performed with 10 % PEG and 100 mmol.l-1 mannitol (individually. The activity of the DLL was evaluated after 24 hours. For drought stress experiments, the watering was withheld for 10 days. The activity of the DLL was monitored using PCR approach. Under given abiotic stress conditions, no activity of the DLL was observed. The DLL promoter remained stable. It points out the DLL as the promoter with precise control of the gene expression with wide usability in plant biotechnology.

  15. A Conserved DNA Repeat Promotes Selection of a Diverse Repertoire of Trypanosoma brucei Surface Antigens from the Genomic Archive

    Hovel-Miner, Galadriel; Mugnier, Monica R.; Goldwater, Benjamin; Cross, George A. M.; Papavasiliou, F. Nina

    2016-01-01

    African trypanosomes are mammalian pathogens that must regularly change their protein coat to survive in the host bloodstream. Chronic trypanosome infections are potentiated by their ability to access a deep genomic repertoire of Variant Surface Glycoprotein (VSG) genes and switch from the expression of one VSG to another. Switching VSG expression is largely based in DNA recombination events that result in chromosome translocations between an acceptor site, which houses the actively transcribed VSG, and a donor gene, drawn from an archive of more than 2,000 silent VSGs. One element implicated in these duplicative gene conversion events is a DNA repeat of approximately 70 bp that is found in long regions within each BES and short iterations proximal to VSGs within the silent archive. Early observations showing that 70-bp repeats can be recombination boundaries during VSG switching led to the prediction that VSG-proximal 70-bp repeats provide recombinatorial homology. Yet, this long held assumption had not been tested and no specific function for the conserved 70-bp repeats had been demonstrated. In the present study, the 70-bp repeats were genetically manipulated under conditions that induce gene conversion. In this manner, we demonstrated that 70-bp repeats promote access to archival VSGs. Synthetic repeat DNA sequences were then employed to identify the length, sequence, and directionality of repeat regions required for this activity. In addition, manipulation of the 70-bp repeats allowed us to observe a link between VSG switching and the cell cycle that had not been appreciated. Together these data provide definitive support for the long-standing hypothesis that 70-bp repeats provide recombinatorial homology during switching. Yet, the fact that silent archival VSGs are selected under these conditions suggests the 70-bp repeats also direct DNA pairing and recombination machinery away from the closest homologs (silent BESs) and toward the rest of the archive. PMID

  16. A Conserved DNA Repeat Promotes Selection of a Diverse Repertoire of Trypanosoma brucei Surface Antigens from the Genomic Archive.

    Galadriel Hovel-Miner

    2016-05-01

    Full Text Available African trypanosomes are mammalian pathogens that must regularly change their protein coat to survive in the host bloodstream. Chronic trypanosome infections are potentiated by their ability to access a deep genomic repertoire of Variant Surface Glycoprotein (VSG genes and switch from the expression of one VSG to another. Switching VSG expression is largely based in DNA recombination events that result in chromosome translocations between an acceptor site, which houses the actively transcribed VSG, and a donor gene, drawn from an archive of more than 2,000 silent VSGs. One element implicated in these duplicative gene conversion events is a DNA repeat of approximately 70 bp that is found in long regions within each BES and short iterations proximal to VSGs within the silent archive. Early observations showing that 70-bp repeats can be recombination boundaries during VSG switching led to the prediction that VSG-proximal 70-bp repeats provide recombinatorial homology. Yet, this long held assumption had not been tested and no specific function for the conserved 70-bp repeats had been demonstrated. In the present study, the 70-bp repeats were genetically manipulated under conditions that induce gene conversion. In this manner, we demonstrated that 70-bp repeats promote access to archival VSGs. Synthetic repeat DNA sequences were then employed to identify the length, sequence, and directionality of repeat regions required for this activity. In addition, manipulation of the 70-bp repeats allowed us to observe a link between VSG switching and the cell cycle that had not been appreciated. Together these data provide definitive support for the long-standing hypothesis that 70-bp repeats provide recombinatorial homology during switching. Yet, the fact that silent archival VSGs are selected under these conditions suggests the 70-bp repeats also direct DNA pairing and recombination machinery away from the closest homologs (silent BESs and toward the rest of

  17. PML induces compaction, TRF2 depletion and DNA damage signaling at telomeres and promotes their alternative lengthening.

    Osterwald, Sarah; Deeg, Katharina I; Chung, Inn; Parisotto, Daniel; Wörz, Stefan; Rohr, Karl; Erfle, Holger; Rippe, Karsten

    2015-05-15

    The alternative lengthening of telomeres (ALT) mechanism allows cancer cells to escape senescence and apoptosis in the absence of active telomerase. A characteristic feature of this pathway is the assembly of ALT-associated promyelocytic leukemia (PML) nuclear bodies (APBs) at telomeres. Here, we dissected the role of APBs in a human ALT cell line by performing an RNA interference screen using an automated 3D fluorescence microscopy platform and advanced 3D image analysis. We identified 29 proteins that affected APB formation, which included proteins involved in telomere and chromatin organization, protein sumoylation and DNA repair. By integrating and extending these findings, we found that APB formation induced clustering of telomere repeats, telomere compaction and concomitant depletion of the shelterin protein TRF2 (also known as TERF2). These APB-dependent changes correlated with the induction of a DNA damage response at telomeres in APBs as evident by a strong enrichment of the phosphorylated form of the ataxia telangiectasia mutated (ATM) kinase. Accordingly, we propose that APBs promote telomere maintenance by inducing a DNA damage response in ALT-positive tumor cells through changing the telomeric chromatin state to trigger ATM phosphorylation. PMID:25908860

  18. DNA hybridization activity of single-stranded DNA-conjugated gold nanoparticles used as probes for DNA detection

    Kira, Atsushi; Matsuo, Kosuke; Nakajima, Shin-ichiro

    2016-02-01

    Colloidal nanoparticles (NPs) have potential applications in bio-sensing technologies as labels or signal enhancers. In order to meet demands for a development of biomolecular assays by a quantitative understanding of single-molecule, it is necessary to regulate accuracy of the NPs probes modified with biomolecules to optimize the characteristics of NPs. However, to our knowledge, there is little information about the structural effect of conjugated biomolecules to the NPs. In this study, we investigated the contribution of a density of single-stranded DNA (ssDNA) conjugating gold NP to hybridization activity. Hybridization activity decreased in accordance with increases in the density of attached ssDNAs, likely due to electrostatic repulsion generated by negatively charged phosphate groups in the ssDNA backbone. These results highlight the importance of controlling the density of ssDNAs attached to the surface of NPs used as DNA detection probes.

  19. IGFBP-2 enhances VEGF gene promoter activity and consequent promotion of angiogenesis by neuroblastoma cells.

    Azar, Walid J; Azar, Sheena H X; Higgins, Sandra; Hu, Ji-Fan; Hoffman, Andrew R; Newgreen, Donald F; Werther, George A; Russo, Vincenzo C

    2011-09-01

    IGF binding protein (IGFBP)-2 is one of the most significant genes in the signature of major aggressive cancers. Previously, we have shown that IGFBP-2 enhances proliferation and invasion of neuroblastoma cells, suggesting that IGFBP-2 activates a protumorigenic gene expression program in these cells. Gene expression profiling in human neuroblastoma SK-N-SHEP (SHEP)-BP-2 cells indicated that IGFBP-2 overexpression activated a gene expression program consistent with enhancement of tumorigenesis. Regulation was significant for genes involved in proliferation/survival, migration/adhesion, and angiogenesis, including the up-regulation of vascular endothelial growth factor (VEGF) mRNA (>2-fold). Specific transcriptional activation of the VEGF gene by IGFBP-2 overexpression was demonstrated via cotransfection of a VEGF promoter Luciferase construct in SHEP-BP-2. Cotransfection of VEGF promoter Luciferase construct with IGFBP-2 protein in wild-type SHEP cells indicated that transactivation of VEGF promoter only occurs in the presence of intracellular IGFBP-2. Cell fractionation and immunofluorescence in SHEP-BP-2 cells demonstrated nuclear localization of IGFBP-2. These findings suggest that transcriptional activation of VEGF promoter is likely to be mediated by nuclear IGFBP-2. The levels of secreted VEGF (up to 400 pg/10(6) cells) suggested that VEGF might elicit angiogenic activity. Hence, SHEP-BP-2 cells and control clones cultured in collagen sponge were xenografted onto chick embryo chorioallantoic membrane. Neomicrovascularization was observed by 72 h, solely in the SHEP-BP-2 cell xenografts. In conclusion, our data indicate that IGFBP-2 is an activator of aggressive behavior in cancer cells, involving nuclear entry and activation of a protumorigenic gene expression program, including transcriptional regulation of the VEGF gene and consequent proangiogenic activity of NB cell xenografts in vivo. PMID:21750048

  20. Transcriptional activity of acetylcholinesterase gene is regulated by DNA methylation during C2C12 myogenesis.

    Lau, Kei M; Gong, Amy G W; Xu, Miranda L; Lam, Candy T W; Zhang, Laura M L; Bi, Cathy W C; Cui, D; Cheng, Anthony W M; Dong, Tina T X; Tsim, Karl W K; Lin, Huangquan

    2016-07-01

    The expression of acetylcholinesterase (AChE), an enzyme hydrolyzes neurotransmitter acetylcholine at vertebrate neuromuscular junction, is regulated during myogenesis, indicating the significance of muscle intrinsic factors in controlling the enzyme expression. DNA methylation is essential for temporal control of myogenic gene expression during myogenesis; however, its role in AChE regulation is not known. The promoter of vertebrate ACHE gene carries highly conserved CG-rich regions, implying its likeliness to be methylated for epigenetic regulation. A DNA methyltransferase inhibitor, 5-azacytidine (5-Aza), was applied onto C2C12 cells throughout the myotube formation. When DNA methylation was inhibited, the promoter activity, transcript expression and enzymatic activity of AChE were markedly increased after day 3 of differentiation, which indicated the putative role of DNA methylation. By bisulfite pyrosequencing, the overall methylation rate was found to peak at day 3 during C2C12 cell differentiation; a SP1 site located at -1826bp upstream of mouse ACHE gene was revealed to be heavily methylated. The involvement of transcriptional factor SP1 in epigenetic regulation of AChE was illustrated here: (i) the SP1-driven transcriptional activity was increased in 5-Aza-treated C2C12 culture; (ii) the binding of SP1 onto the SP1 site of ACHE gene was fully blocked by the DNA methylation; and (iii) the sequence flanking SP1 sites of ACHE gene was precipitated by chromatin immuno-precipitation assay. The findings suggested the role of DNA methylation on AChE transcriptional regulation and provided insight in elucidating the DNA methylation-mediated regulatory mechanism on AChE expression during muscle differentiation. PMID:27021952

  1. Rapid restriction enzyme free detection of DNA methyltransferase activity based on DNA-templated silver nanoclusters.

    Kermani, Hanie Ahmadzade; Hosseini, Morteza; Dadmehr, Mehdi; Ganjali, Mohammad Reza

    2016-06-01

    DNA methylation has significant roles in gene regulation. DNA methyltransferase (MTase) enzyme characterizes DNA methylation and also induces an aberrant methylation pattern that is related to many diseases, especially cancers. Thus, it is required to develop a method to detect the DNA MTase activity. In this study, we developed a new sensitive and reliable method for methyltransferase activity assay by employing DNA-templated silver nanoclusters (DNA/Ag NCs) without using restriction enzymes. The Ag NCs have been utilized for the determination of M.SssI MTase activity and its inhibition. We designed an oligonucleotide probe which contained an inserted six-cytosine loop as Ag NCs formation template. The changes in fluorescence intensity were monitored to quantify the M.SssI activity. The fluorescence spectra showed a linear decrease in the range of 0.4 to 20 U/ml with a detection limit of 0.1 U/ml, which was significant compared with previous reports. The proposed method was applied successfully for demonstrating the Gentamicin effect as MTase inhibitor. The proposed method showed convenient reproducibility and sensitivity indicating its potential for the determination of methyltransferase activity. PMID:27052776

  2. Replicase-based plasmid DNA shows anti-tumor activity

    Weiss Richard

    2011-03-01

    Full Text Available Abstract Background Double stranded RNA (dsRNA has multiple anti-tumor mechanisms. Over the past several decades, there have been numerous attempts to utilize synthetic dsRNA to control tumor growth in animal models and clinical trials. Recently, it became clear that intracellular dsRNA is more effective than extracellular dsRNA on promoting apoptosis and orchestrating adaptive immune responses. To overcome the difficulty in delivering a large dose of synthetic dsRNA into tumors, we propose to deliver a RNA replicase-based plasmid DNA, hypothesizing that the dsRNA generated by the replicase-based plasmid in tumor cells will inhibit tumor growth. Methods The anti-tumor activity of a plasmid (pSIN-β that encodes the sindbis RNA replicase genes (nsp1-4 was evaluated in mice with model tumors (TC-1 lung cancer cells or B16 melanoma cells and compared to a traditional pCMV-β plasmid. Results In cell culture, transfection of tumor cells with pSIN-β generated dsRNA. In mice with model tumors, pSIN-β more effectively delayed tumor growth than pCMV-β, and in some cases, eradicated the tumors. Conclusion RNA replicase-based plasmid may be exploited to generate intracellular dsRNA to control tumor growth.

  3. Replicase-based plasmid DNA shows anti-tumor activity

    Double stranded RNA (dsRNA) has multiple anti-tumor mechanisms. Over the past several decades, there have been numerous attempts to utilize synthetic dsRNA to control tumor growth in animal models and clinical trials. Recently, it became clear that intracellular dsRNA is more effective than extracellular dsRNA on promoting apoptosis and orchestrating adaptive immune responses. To overcome the difficulty in delivering a large dose of synthetic dsRNA into tumors, we propose to deliver a RNA replicase-based plasmid DNA, hypothesizing that the dsRNA generated by the replicase-based plasmid in tumor cells will inhibit tumor growth. The anti-tumor activity of a plasmid (pSIN-β) that encodes the sindbis RNA replicase genes (nsp1-4) was evaluated in mice with model tumors (TC-1 lung cancer cells or B16 melanoma cells) and compared to a traditional pCMV-β plasmid. In cell culture, transfection of tumor cells with pSIN-β generated dsRNA. In mice with model tumors, pSIN-β more effectively delayed tumor growth than pCMV-β, and in some cases, eradicated the tumors. RNA replicase-based plasmid may be exploited to generate intracellular dsRNA to control tumor growth

  4. Bifidobacteria DNA Induces Murine Macrophages Activation in vitro

    Yalin Li; Xun Qu; Hua Yang; Li Kang; Yingping Xu; Bo Bai; Wengang Song

    2005-01-01

    Previous studies have shown that oligodeoxynucleotides containing unmethylated CpG motifs were used as adjuvants for immunoregulation and immune response. This study was to explore the activation effects of Bifidobacteria DNA containing unmethylated CpG motifs (CpG DNA) on murine macrophage J774A.1 cells. The genomic DNA of Bifidobacteria was extracted and purified, and the methylation degree of CpG motifs was tested.The phagocytic ability of the macrophages was detected by flow cytometry. The cytokines (IL-1β, IL-6, IL-12p40 and TNF-α) levels in the culture supernatants of Bifidobacteria DNA treated J774A.1 cells were assayed by ELISA. The content of nitric oxide (NO) was detected by Griess reagent. After treated with Bifidobacteria DNA for 24h,Nile Red stain increased in J774A.1 macrophage, which suggested that the lipid metabolism increased in the macrophages. The phagocytic ability and levels of NO and cytokines of IL-1β, IL-6, IL-12p40 and TNF-α were significantly higher than PBS group and CT DNA group. The results indicated that Bifidobacteria DNA could activate murine macrophages J774A.1, which could provide scientific basis for the research and application of microorganism DNA preparation.

  5. Structure-function analysis indicates that sumoylation modulates DNA-binding activity of STAT1

    Grönholm Juha

    2012-10-01

    Full Text Available Abstract Background STAT1 is an essential transcription factor for interferon-γ-mediated gene responses. A distinct sumoylation consensus site (ψKxE 702IKTE705 is localized in the C-terminal region of STAT1, where Lys703 is a target for PIAS-induced SUMO modification. Several studies indicate that sumoylation has an inhibitory role on STAT1-mediated gene expression but the molecular mechanisms are not fully understood. Results Here, we have performed a structural and functional analysis of sumoylation in STAT1. We show that deconjugation of SUMO by SENP1 enhances the transcriptional activity of STAT1, confirming a negative regulatory effect of sumoylation on STAT1 activity. Inspection of molecular model indicated that consensus site is well exposed to SUMO-conjugation in STAT1 homodimer and that the conjugated SUMO moiety is directed towards DNA, thus able to form a sterical hindrance affecting promoter binding of dimeric STAT1. In addition, oligoprecipitation experiments indicated that sumoylation deficient STAT1 E705Q mutant has higher DNA-binding activity on STAT1 responsive gene promoters than wild-type STAT1. Furthermore, sumoylation deficient STAT1 E705Q mutant displayed enhanced histone H4 acetylation on interferon-γ-responsive promoter compared to wild-type STAT1. Conclusions Our results suggest that sumoylation participates in regulation of STAT1 responses by modulating DNA-binding properties of STAT1.

  6. TBP-TAF Complex SL1 Directs RNA Polymerase I Pre-initiation Complex Formation and Stabilizes Upstream Binding Factor at the rDNA Promoter*||

    Friedrich, J. Karsten; Panov, Kostya I.; Cabart, Pavel; Russell, Jackie; Zomerdijk, Joost C. B. M.

    2005-01-01

    Knowledge of the role of components of the RNA polymerase I transcription machinery is paramount to understanding regulation of rDNA expression. We describe key findings for the roles of essential transcription factor SL1 and activator upstream binding factor (UBF). We demonstrate that human SL1 can direct accurate Pol I transcription in the absence of UBF and can interact with the rDNA promoter independently and stably, consistent with studies of rodent SL1 but contrary to previous reports o...

  7. Conserved hypothetical BB0462 protein enhances the transcription activity of oppAV promoter

    2008-01-01

    Borrelia burgdorferi BB0462 ORF encodes an unknown functional protein with 110 amino acids.A BLAST search in protein databases and the secondary structure being predicted by the program JUFO showed that the conserved hypothetical BB0462 protein was similar to the members of the YbaB protein family in both amino acid composition and protein structure.The co-transformation of BB0462 ORF and oppA upstream regulation DNA into E.coli host cells and β-galactosidase activity assay demonstrated that the BB0462 protein enhanced the transcriptional activity of the oppAV promoter,but does not affect those of oppAⅠ,Ⅱ,Ⅲ and Ⅳ promoters.Analysis of DNA retardation and competitive repression also confirmed that the BB0462 protein bound to the 409 bp upstream regulation DNA fragment close to the initiation codon of the oppAV gene.All data in our study suggested that the BB0462 protein was involved in the transcriptional regulation of the oppAV gene

  8. Gain of DNA methylation is enhanced in the absence of CTCF at the human retinoblastoma gene promoter

    Recillas-Targa Félix

    2011-06-01

    Full Text Available Abstract Background Long-term gene silencing throughout cell division is generally achieved by DNA methylation and other epigenetic processes. Aberrant DNA methylation is now widely recognized to be associated with cancer and other human diseases. Here we addressed the contribution of the multifunctional nuclear factor CTCF to the epigenetic regulation of the human retinoblastoma (Rb gene promoter in different tumoral cell lines. Methods To assess the DNA methylation status of the Rb promoter, genomic DNA from stably transfected human erythroleukemic K562 cells expressing a GFP reporter transgene was transformed with sodium bisulfite, and then PCR-amplified with modified primers and sequenced. Single- and multi-copy integrants with the CTCF binding site mutated were isolated and characterized by Southern blotting. Silenced transgenes were reactivated using 5-aza-2'-deoxycytidine and Trichostatin-A, and their expression was monitored by fluorescent cytometry. Rb gene expression and protein abundance were assessed by RT-PCR and Western blotting in three different glioma cell lines, and DNA methylation of the promoter region was determined by sodium bisulfite sequencing, together with CTCF dissociation and methyl-CpG-binding protein incorporation by chromatin immunoprecipitation assays. Results We found that the inability of CTCF to bind to the Rb promoter causes a dramatic loss of gene expression and a progressive gain of DNA methylation. Conclusions This study indicates that CTCF plays an important role in maintaining the Rb promoter in an optimal chromatin configuration. The absence of CTCF induces a rapid epigenetic silencing through a progressive gain of DNA methylation. Consequently, CTCF can now be seen as one of the epigenetic components that allows the proper configuration of tumor suppressor gene promoters. Its aberrant dissociation can then predispose key genes in cancer cells to acquire DNA methylation and epigenetic silencing.

  9. Gain of DNA methylation is enhanced in the absence of CTCF at the human retinoblastoma gene promoter

    Long-term gene silencing throughout cell division is generally achieved by DNA methylation and other epigenetic processes. Aberrant DNA methylation is now widely recognized to be associated with cancer and other human diseases. Here we addressed the contribution of the multifunctional nuclear factor CTCF to the epigenetic regulation of the human retinoblastoma (Rb) gene promoter in different tumoral cell lines. To assess the DNA methylation status of the Rb promoter, genomic DNA from stably transfected human erythroleukemic K562 cells expressing a GFP reporter transgene was transformed with sodium bisulfite, and then PCR-amplified with modified primers and sequenced. Single- and multi-copy integrants with the CTCF binding site mutated were isolated and characterized by Southern blotting. Silenced transgenes were reactivated using 5-aza-2'-deoxycytidine and Trichostatin-A, and their expression was monitored by fluorescent cytometry. Rb gene expression and protein abundance were assessed by RT-PCR and Western blotting in three different glioma cell lines, and DNA methylation of the promoter region was determined by sodium bisulfite sequencing, together with CTCF dissociation and methyl-CpG-binding protein incorporation by chromatin immunoprecipitation assays. We found that the inability of CTCF to bind to the Rb promoter causes a dramatic loss of gene expression and a progressive gain of DNA methylation. This study indicates that CTCF plays an important role in maintaining the Rb promoter in an optimal chromatin configuration. The absence of CTCF induces a rapid epigenetic silencing through a progressive gain of DNA methylation. Consequently, CTCF can now be seen as one of the epigenetic components that allows the proper configuration of tumor suppressor gene promoters. Its aberrant dissociation can then predispose key genes in cancer cells to acquire DNA methylation and epigenetic silencing

  10. IL-2 and GM-CSF are regulated by DNA demethylation during activation of T cells, B cells and macrophages

    Highlights: ► DNA methylation is dynamic and flexible and changes rapidly upon cell activation. ► DNA methylation controls the inducible gene expression in a given cell type. ► Some enzymes are involved in maintaining the methylation profile of immune cells. -- Abstract: DNA demethylation has been found to occur at the promoters of a number of actively expressed cytokines and is believed to play a critical role in transcriptional regulation. While many DNA demethylation studies have focused on T cell activation, proliferation and differentiation, changes in DNA methylation in other types of immune cells are less well studied. We found that the expression of two cytokines (IL-2 and GM-CSF) responded differently to activation in three types of immune cells: EL4, A20 and RAW264.7 cells. Using the McrBC and MeDIP approaches, we observed decreases in DNA methylation at a genome-wide level and at the promoters of the genes of these cytokines. The expression of several potential enzymes/co-enzymes involved in the DNA demethylation pathways seemed to be associated with immune cell activation.

  11. Internet as a Medium of Pharmaceutical Companies Promotional Activities

    Darko Pantelic

    2009-01-01

    Pharmaceuticals market is highly regulated, and it can be stated that prescription (legal or ethical) drugs have a status of substances in controlled circulation. Promotional activities are also under strict legislation, further burdened with ethical consideration and public scrutiny. Internet as liberal and hard to control medium brings entirely new sets of solutions and/or problems to pharmaceuticals market(ers).

  12. Promoting Educational Equity through School Libraries: Equity Activity Book.

    Arizona State Univ., Tempe.

    The activities suggested in this workbook for participants in a continuing education program for inservice school media specialists are designed to develop the trainee's skills in identifying instances of sexism and sex stereotyping in education, and in promoting sex fairness in the library. Exercises and tests on the first module are concerned…

  13. How do general practitioners in Denmark promote physical activity?

    Jørgensen, Tanja K; Nordentoft, Merete; Krogh, Jesper

    2012-01-01

    The primary objective of this study was to quantify the frequency of advice given on type, frequency, duration, and intensity of exercise during physical activity (PA) promoting sessions by general practitioners. Second, to find GP characteristics associated with high quality of PA counselling....

  14. Health Promotion Guidance Activity of Youth Sports Clubs

    Kokko, Sami; Kannas, Lasse; Villberg, Jari; Ormshaw, Michael

    2011-01-01

    Purpose: This paper aims to clarify the extent to which youth sports clubs guide their coaches to recognise health promotion as a part of the coaching practice. The guidance activity of clubs is seen parallel to internal organisational communication. Design/methodology/approach: A survey of 93 (from 120, 78 per cent) youth sports clubs in Finland…

  15. It Takes a Virtual Community: Promoting Collaboration through Student Activities

    Battista, Ludmila; Forrey, Carol; Stevenson, Carolyn

    2008-01-01

    Distance education provides many nontraditional students with the opportunity to pursue a college education not possible through traditional brick and mortar education. Although not meeting face-to-face, student activities help promote a stronger connection between the classroom and university community. This paper will discuss strategies for…

  16. Healthy and Active Ageing: Social Capital in Health Promotion

    Koutsogeorgou, Eleni; Davies, John Kenneth; Aranda, Kay; Zissi, Anastasia; Chatzikou, Maria; Cerniauskaite, Milda; Quintas, Rui; Raggi, Alberto; Leonardi, Matilde

    2014-01-01

    Objectives: This paper examines the context of health promotion actions that are focused on/contributing to strengthening social capital by increasing community participation, reciprocal trust and support as the means to achieve better health and more active ageing. Method: The methodology employed was a literature review/research synthesis, and a…

  17. Analysis of Significance of Unite Examination of AFP and DNA Polymorphism of P3 Promoter of IGF-ⅡGene

    LUO Su; ZHANG Feng-chun; SUN Chang-jiang; LIU Cheng-bai; ZHUANG Jiang-xing; ZHANG Jin

    2004-01-01

    The DNA of P3 promoter region of IGF-Ⅱ gene was obtained by means of PCR technique. The examination of DNA polymorphism by restriction endonuclease BstE Ⅱ and the examination of AFP by bioluminescence immunoassay technique were carried out. The results have a significant difference(P<0.005). But the positive rate of AFP is higher than that of DNA polymorphism. The experimental result shows that the change of the DNA polymorphism of IGF-Ⅱis not the only carcinogenic factor. The suggested unite examination is the best method for the diagnosis of the primary hepatocellular carcinoma.

  18. In vitro incubation of human spermatozoa promotes reactive oxygen species generation and DNA fragmentation.

    Cicaré, J; Caille, A; Zumoffen, C; Ghersevich, S; Bahamondes, L; Munuce, M J

    2015-10-01

    The aim of this study was to investigate the oxidative process associated with sperm capacitation and its impact on DNA fragmentation and sperm function. Redox activity and lipid peroxidation were analysed in human spermatozoa after 3, 6 and 22 h of incubation in Ham's F10 medium plus bovine albumin at 37° and 5% CO2 for capacitation. DNA status, tyrosine phosphorylation pattern and induced acrosome reaction were evaluated after capacitating conditions. At 22 h of incubation, there was a significant (P < 0.05) increase in oxygen-free radicals and lipid peroxidation, with no effect on sperm viability. There also was a significant (P < 0.001) increase in fragmented DNA in capacitated spermatozoa compared to semen values with higher rates being found after the occurrence of the induced acrosome reaction. Protein tyrosine phosphorylation pattern confirms that capacitation took place in parallel with the occurrence of DNA fragmentation. These results indicate that when spermatozoa are incubated for several hours (22 h), a common practice in assisted reproductive techniques, an increase in oxidative sperm metabolism and in the proportion of fragmented DNA should be expected. However, there was no effect on any of the other functional parameters associated with sperm fertilising capacity. PMID:25233794

  19. Testing promoter activity in the trypanosome genome: isolation of a metacyclic-type VSG promoter, and unexpected insights into RNA polymerase II transcription.

    McAndrew, M; Graham, S; Hartmann, C; Clayton, C

    1998-09-01

    In trypanosomes, most genes are arranged in polycistronic transcription units. Individual mRNAs are generated by 5'-trans splicing and 3' polyadenylation. Remarkably, no regulation of RNA polymerase II transcription has been detected although many RNAs are differentially expressed during kinetoplastid life cycles. Demonstration of specific class II promoters is complicated by the difficulty in distinguishing between genuine promoter activity and stimulation of trans splicing. Using vectors that were designed to allow the detection of low promoter activities in a transcriptionally silent chromosomal context, we isolated a novel trypanosome RNA polymerase I promoter. We were however unable to detect class II promoter activity in any tested DNA fragment. We also integrated genes which were preceded by a T3 promoter into the genome of cells expressing bacteriophage T3 polymerase: surprisingly, transcription was alpha-amanitin sensitive. One possible interpretation of these results is that in trypanosomes, RNA polymerase II initiation is favored by genomic accessibility and double-strand melting. PMID:9709032

  20. Creative professional activity: an additional platform for promotion of faculty.

    Levinson, Wendy; Rothman, Arthur I; Phillipson, Eliot

    2006-06-01

    Academic promotion has traditionally been based on research and teaching, but faculty members' contributions to the profession may not be fully captured in those dimensions. Faculty members may influence the practice of medicine and improve the care of patients yet not obtain traditional measures of achievement through publications, grants, or teaching awards. With this problem in mind, at the University of Toronto Faculty of Medicine, the promotions committee developed and implemented a promotions criterion called Creative Professional Activity (CPA) to recognize and reward a variety of types of academic endeavors that have a demonstrable impact on medical practice and care. CPA comprises three activities: professional innovation, exemplary practice, and contributions to the development of the discipline. In this article, the authors define CPA, provide illustrative case examples, describe how faculty members document CPA, and report the use of this promotions criterion in the Department of Medicine over the last decade. The challenges of implementing CPA as a promotion criterion are described. CPA is consistent with the Department of Medicine's goal of achieving excellence through original research, education, or creative work that advances the care of patients. PMID:16728810

  1. Invariant distribution of promoter activities in Escherichia coli.

    Alon Zaslaver; Shai Kaplan; Anat Bren; Adrian Jinich; Avi Mayo; Erez Dekel; Uri Alon; Shalev Itzkovitz

    2009-01-01

    Author Summary Cells respond to a changing environment by regulating the activity of genes. Here, we sought to understand how E. coli cells distribute their limited transcriptional resources among their target genes, and how this allocation varies with growth rate and growth conditions. To achieve this, we assayed the expression of a comprehensive library of transcriptional reporter strains under different conditions. High-temporal resolution measurements of promoter activities were obtained ...

  2. Inhibition of DNA methylation promotes breast tumor sensitivity to netrin-1 interference.

    Grandin, Mélodie; Mathot, Pauline; Devailly, Guillaume; Bidet, Yannick; Ghantous, Akram; Favrot, Clementine; Gibert, Benjamin; Gadot, Nicolas; Puisieux, Isabelle; Herceg, Zdenko; Delcros, Jean-Guy; Bernet, Agnès; Mehlen, Patrick; Dante, Robert

    2016-01-01

    In a number of human cancers, NTN1 upregulation inhibits apoptosis induced by its so-called dependence receptors DCC and UNC5H, thus promoting tumor progression. In other cancers however, the selective inhibition of this dependence receptor death pathway relies on the silencing of pro-apoptotic effector proteins. We show here that a substantial fraction of human breast tumors exhibits simultaneous DNA methylation-dependent loss of expression of NTN1 and of DAPK1, a serine threonine kinase known to transduce the netrin-1 dependence receptor pro-apoptotic pathway. The inhibition of DNA methylation by drugs such as decitabine restores the expression of both NTN1 and DAPK1 in netrin-1-low cancer cells. Furthermore, a combination of decitabine with NTN1 silencing strategies or with an anti-netrin-1 neutralizing antibody potentiates tumor cell death and efficiently blocks tumor growth in different animal models. Thus, combining DNA methylation inhibitors with netrin-1 neutralizing agents may be a valuable strategy for combating cancer. PMID:27378792

  3. HyCCAPP as a tool to characterize promoter DNA-protein interactions in Saccharomyces cerevisiae.

    Guillen-Ahlers, Hector; Rao, Prahlad K; Levenstein, Mark E; Kennedy-Darling, Julia; Perumalla, Danu S; Jadhav, Avinash Y L; Glenn, Jeremy P; Ludwig-Kubinski, Amy; Drigalenko, Eugene; Montoya, Maria J; Göring, Harald H; Anderson, Corianna D; Scalf, Mark; Gildersleeve, Heidi I S; Cole, Regina; Greene, Alexandra M; Oduro, Akua K; Lazarova, Katarina; Cesnik, Anthony J; Barfknecht, Jared; Cirillo, Lisa A; Gasch, Audrey P; Shortreed, Michael R; Smith, Lloyd M; Olivier, Michael

    2016-06-01

    Currently available methods for interrogating DNA-protein interactions at individual genomic loci have significant limitations, and make it difficult to work with unmodified cells or examine single-copy regions without specific antibodies. In this study, we describe a physiological application of the Hybridization Capture of Chromatin-Associated Proteins for Proteomics (HyCCAPP) methodology we have developed. Both novel and known locus-specific DNA-protein interactions were identified at the ENO2 and GAL1 promoter regions of Saccharomyces cerevisiae, and revealed subgroups of proteins present in significantly different levels at the loci in cells grown on glucose versus galactose as the carbon source. Results were validated using chromatin immunoprecipitation. Overall, our analysis demonstrates that HyCCAPP is an effective and flexible technology that does not require specific antibodies nor prior knowledge of locally occurring DNA-protein interactions and can now be used to identify changes in protein interactions at target regions in the genome in response to physiological challenges. PMID:27184763

  4. Propionate induces the bovine cytosolic phosphoenolpyruvate carboxykinase promoter activity.

    Zhang, Qian; Koser, Stephanie L; Donkin, Shawn S

    2016-08-01

    Cytosolic phosphoenolpyruvate carboxykinase (PCK1) is a critical enzyme within the metabolic networks for gluconeogenesis, hepatic energy metabolism, and tricarboxylic acid cycle function, and is controlled by several transcription factors including hepatic nuclear factor 4α (HNF4α). The primary objective of the present study was to determine whether propionate regulates bovine PCK1 transcription. The second objective was to determine the action of cyclic AMP (cAMP), glucocorticoids, and insulin, hormonal cues known to modulate glucose metabolism, on bovine PCK1 transcriptional activity. The proximal promoter of the bovine PCK1 gene was ligated to a Firefly luciferase reporter and transfected into H4IIE hepatoma cells. Cells were exposed to treatments for 23 h and luciferase activity was determined in cell lysates. Activity of the PCK1 promoter was linearly induced by propionate, and maximally increased 7-fold with 2.5 mM propionate, which was not muted by 100 nM insulin. Activity of the PCK1 promoter was increased 1-fold by either 1.0 mM cAMP or 5.0µM dexamethasone, and 2.2-fold by their combination. Induction by cAMP and dexamethasone was repressed 50% by 100 nM insulin. Propionate, cAMP, and dexamethasone acted synergistically to induce the PCK1 promoter activity. Propionate-responsive regions, identified by 5' deletion analysis, were located between -1,238 and -409 bp and between -85 and +221 bp. Deletions of the core sequences of the 2 putative HNF4α sites decreased the responsiveness to propionate by approximately 40%. These data indicate that propionate regulates its own metabolism through transcriptional stimulation of the bovine PCK1 gene. This induction is mediated, in part, by the 2 putative HNF4α binding sites in the bovine PCK1 promoter. PMID:27289145

  5. The HMG-box mitochondrial transcription factor xl-mtTFA binds DNA as a tetramer to activate bidirectional transcription.

    Antoshechkin, I; Bogenhagen, D F; Mastrangelo, I A

    1997-01-01

    The mitochondrial HMG-box transcription factor xl-mtTFA activates bidirectional transcription by binding to a site separating two core promoters in Xenopus laevis mitochondrial DNA (mtDNA). Three independent approaches were used to study the higher order structure of xl-mtTFA binding to this site. First, co-immunoprecipitation of differentially tagged recombinant mtTFA derivatives established that the protein exists as a multimer. Second, in vitro chemical cross-linking experiments provided e...

  6. Loss of TET2 in hematopoietic cells leads to DNA hypermethylation of active enhancers and induction of leukemogenesis

    Rasmussen, Kasper D.; Jia, Guangshuai; Johansen, Jens V.; Pedersen, Marianne T.; Rapin, Nicolas; Bagger, Frederik O.; Porse, Bo T; Bernard, Olivier A; Christensen, Jesper; Helin, Kristian

    2015-01-01

    The methylcytosine dioxygenase TET2 is frequently mutated in hematological disorders, including acute myeloid leukemia (AML), and has been suggested to protect CpG islands and promoters from aberrant DNA methylation. Rasmussen et al. used a novel Tet2-dependent leukemia mouse model to show that the primary effect of Tet2 loss in preleukemic hematopoietic cells is progressive and widespread DNA hypermethylation affecting up to 25% of active enhancer elements.

  7. Amiloride inhibits rat mucosal ornithine decarboxylase activity and DNA synthesis

    Refeeding fasted rats induces a dramatic trophic response in gastrointestinal mucosa and is associated with elevations in both rate of DNA synthesis and ornithine decarboxylase (ODC) activity. The signal for these increases is unknown. Amiloride prevents cell alkalinization by blocking Na+-H+ exchange at apical epithelial cell membranes. In study 1, rats were fasted 48 h, treated with amiloride (0.5 to 500 mg/kg), and refed for 4 h. Refeeding increased ODC activities in the jejunal mucosa (X8) and liver (X19) but not in the oxyntic gland mucosa. In the jejunum, but not the liver, the activation of ODC was completely abolished by 100 mg/kg amiloride. In study 2, the rate of DNA synthesis was determine by measuring the rate of [3H]thymidine incorporation 16 h after refeeding. Refeeding resulted in significantly increased rates of DNA synthesis over fasted levels, and amiloride at 100 mg/kg significantly reduced the elevations in the jejenum and liver. In conclusion, amiloride inhibits the postprandial increases in jejunal ODC activity and DNA synthesis in the jejunum and liver. The results indicate that (1) the Na+-H+ antiport is essential to the increased ODC activity in the jejunum and liver after a meal and (2) increases in DNA synthesis and their suppression by amiloride are not necessary linked to ODC activity

  8. Synthesis, DNA interaction and antimicrobial activities of three rimantadine analogues

    The interactions of three rimantadine analogues (RAs) with calf thymus deoxyribonucleic acid (ct-DNA) in buffer solution (pH 7.4) were investigated using berberine (BR) as a probe by various methods. Fluorescence studies revealed that the RAs interacted with DNA in vitro and the quenchings were all static. Furthermore, the binding modes of these compounds to DNA were disclosed as groove binding supported by absorption spectroscopy, viscosity measurement and denatured DNA experiment. The antimicrobial activities of the RAs were also evaluated in Staphylococcus aureus and Escherichia coli, and they all exhibited good bacteriostasic effects. The results might provide an important reference for investigation of the molecular mechanism associated with the DNA binding of the RAs. - Highlights: • Three rimantadine analogues were synthesized. • The RAs effectively quenched the intrinsic fluorescence of DNA via a static combination. • These analogues can bind to DNA via groove binding mode. • The antimicrobial activities of three analogues were also evaluated by the disk diffusion method

  9. Synthesis, DNA interaction and antimicrobial activities of three rimantadine analogues

    Liu, Bing-Mi; Zhang, Jun [Department of Pharmacy, Liaoning University, Shenyang 110036 (China); Wang, Xin, E-mail: wangxinlnu@163.com [Department of Pharmacy, Liaoning University, Shenyang 110036 (China); Zhang, Li-Ping; Liu, Yang [Department of Pharmacy, Liaoning University, Shenyang 110036 (China); Niu, Hua-Ying [Jinan Dachpharm Development Co., Ltd., Jinan 250100 (China); Liu, Bin, E-mail: liubinzehao@163.com [Department of Pharmacy, Liaoning University, Shenyang 110036 (China)

    2015-03-15

    The interactions of three rimantadine analogues (RAs) with calf thymus deoxyribonucleic acid (ct-DNA) in buffer solution (pH 7.4) were investigated using berberine (BR) as a probe by various methods. Fluorescence studies revealed that the RAs interacted with DNA in vitro and the quenchings were all static. Furthermore, the binding modes of these compounds to DNA were disclosed as groove binding supported by absorption spectroscopy, viscosity measurement and denatured DNA experiment. The antimicrobial activities of the RAs were also evaluated in Staphylococcus aureus and Escherichia coli, and they all exhibited good bacteriostasic effects. The results might provide an important reference for investigation of the molecular mechanism associated with the DNA binding of the RAs. - Highlights: • Three rimantadine analogues were synthesized. • The RAs effectively quenched the intrinsic fluorescence of DNA via a static combination. • These analogues can bind to DNA via groove binding mode. • The antimicrobial activities of three analogues were also evaluated by the disk diffusion method.

  10. Chromatin inactivation precedes de novo dna methylation during the progressive epigenetic silencing of the rassf1a promoter

    Strunnikova Maria; Schagdarsurengin, Undraga; Kehlen, Astrid; Garbe, James C.; Stampfer, Martha R.; Dammann, Reinhard

    2005-02-23

    Epigenetic inactivation of the RASSF1A tumor suppressor by CpG island methylation was frequently detected in cancer. However, the mechanisms of this aberrant DNA methylation are unknown. In the RASSF1A promoter, we characterized four Sp1 sites, which are frequently methylated in cancer. We examined the functional relationship between DNA methylation, histone modification, Sp1 binding, and RASSF1A expression in proliferating human mammary epithelial cells. With increasing passages, the transcription of RASSF1A was dramatically silenced. This inactivation was associated with deacetylation and lysine 9 trimethylation of histone H3 and an impaired binding of Sp1 at the RASSF1A promoter. In mammary epithelial cells that had overcome a stress-associated senescence barrier, a spreading of DNA methylation in the CpG island promoter was observed. When the RASSF1A-silenced cells were treated with inhibitors of DNA methyltransferase and histone deacetylase, binding of Sp1 and expression of RASSF1 A reoccurred. In summary, we observed that histone H3 deacetylation and H3 lysine 9 trimethylation occur in the same time window as gene inactivation and precede DNA methylation. Our data suggest that in epithelial cells, histone inactivation may trigger de novo DNA methylation of the RASSF1A promoter and this system may serve as a model for CpG island inactivation of tumor suppressor genes.

  11. Relationship between Expression of the Human Alpha-Fetoprotein Gene and DNA Methylation Status of the Promoter Region

    Lijun Chen; Wei Wang; Qiuyue Jin; Ruimin Wang; Wenliang Hu

    2006-01-01

    OBJECTIVE DNA methylation has been regarded as an important epigenetic signature reflecting the transcription state of DNA in cells. This study was to conducted to assess the relationship between human alpha-fetoprotein (AFP) gene expression and the DNA methylation status of the promoter region in three different cells, namely two human hepatocellular carcinoma (HCC) cell lines and normal human fibroblasts.METHODS Transcription of the AFP gene was verified by RT-PCR. After bisulphate treatment of DNA, the methods of MSP and BSP were used to analyze the methylation density and status within single DNA strands of two closely spaced CpG dinucleotides of the promoter region in the different cells.RESULTS RT-PCR analysis indicated that the expression of the AFP gene in HepG2 cells was significantly higher than in SMMC-7721 cells,and that the AFP gene was not expressed in normal human fibroblasts.By MSP and BSP we observed that the promoter region was demethylated in the AFP-high-expressing cell lines, and that the sites of -2,494 bp and -2,431 bp in the AFP genomic sequence can be used as detection sites for early tumorous diagnosis.CONCLUSION These results indicate that the DNA methylation state of the promoter region has a negative correlation with AFP gene expression.

  12. H. pylori-Induced DNA Strand Breaks Are Introduced by Nucleotide Excision Repair Endonucleases and Promote NF-κB Target Gene Expression

    Mara L. Hartung

    2015-10-01

    Full Text Available The human bacterial pathogen Helicobacter pylori exhibits genotoxic properties that promote gastric carcinogenesis. H. pylori introduces DNA double strand breaks (DSBs in epithelial cells that trigger host cell DNA repair efforts. Here, we show that H. pylori-induced DSBs are repaired via error-prone, potentially mutagenic non-homologous end-joining. A genome-wide screen for factors contributing to DSB induction revealed a critical role for the H. pylori type IV secretion system (T4SS. Inhibition of transcription, as well as NF-κB/RelA-specific RNAi, abrogates DSB formation. DSB induction further requires β1-integrin signaling. DSBs are introduced by the nucleotide excision repair endonucleases XPF and XPG, which, together with RelA, are recruited to chromatin in a highly coordinated, T4SS-dependent manner. Interestingly, XPF/XPG-mediated DNA DSBs promote NF-κB target gene transactivation and host cell survival. In summary, H. pylori induces XPF/XPG-mediated DNA damage through activation of the T4SS/β1-integrin signaling axis, which promotes NF-κB target gene expression and host cell survival.

  13. Promoter Hypermethylation of DNA Repair Gene MGMT in Laryngeal Squamous Cell Carcinoma

    2006-01-01

    The relationship between hypermethylation of CpG islands in the promoter regions of O6methylguanine DNA methyltransferase (MGMT)genes and laryngeal squamous cell carcinoma was explored. Methylation-specific PCR and semi-quantitative RT-PCR were used to study the promoter methylation and mRNA expression of the MGMT gene in laryngeal carcinoma tissues, t issues adjacent to the tumor and normal laryngeal tissues. Hypermethylation of MGMT gene was detected in 16 samples of 46 (34.8 %) laryngeal squamous cell carcinoma samples. However, the MGMT hypermethylation was not detected in all tissues adjacent to the tumors and normal tissues. No significant difference in MGMT gene hypermethylation was found in samples with different histological grades (x2= 3. 130, P=0. 077) or in samples from patients with different TNM status (x2=3. 957, P=0. 138). No expression of MGMT mRNA was detected in all hypermethylated laryngeal carcinoma tissues. The expression of MGMT mRNA was detected in all unmethylated laryngeal carcinoma tissues, tissues adjacent to the tumors and normal tissues. It suggests that MGMT gene promoter hypermethylation is associated with MGMT gene transcription loss in laryngeal carcinoma tissues and possibly plays an important role in carcinogenesis of laryngeal tissues.

  14. Alterations in HIV-1 LTR promoter activity during AIDS progression

    HIV-1 variants evolving in AIDS patients frequently show increased replicative capacity compared to those present during early asymptomatic infection. It is known that late stage HIV-1 variants often show an expanded coreceptor tropism and altered Nef function. In the present study we investigated whether enhanced HIV-1 LTR promoter activity might also evolve during disease progression. Our results demonstrate increased LTR promoter activity after AIDS progression in 3 of 12 HIV-1-infected individuals studied. Further analysis revealed that multiple alterations in the U3 core-enhancer and in the transactivation-response (TAR) region seem to be responsible for the enhanced functional activity. Our findings show that in a subset of HIV-1-infected individuals enhanced LTR transcription contributes to the increased replicative potential of late stage virus isolates and might accelerate disease progression

  15. cDNA sequence of human transforming gene hst and identification of the coding sequence required for transforming activity

    The hst gene was originally identified as a transforming gene in DNAs from human stomach cancers and from a noncancerous portion of stomach mucosa by DNA-mediated transfection assay using NIH3T3 cells. cDNA clones of hst were isolated from the cDNA library constructed from poly(A)+ RNA of a secondary transformant induced by the DNA from a stomach cancer. The sequence analysis of the hst cDNA revealed the presence of two open reading frames. When this cDNA was inserted into an expression vector containing the simian virus 40 promoter, it efficiently induced the transformation of NIH3T3 cells upon transfection. It was found that one of the reading frames, which coded for 206 amino acids, was responsible for the transforming activity

  16. Synthesis, antioxidant and DNA cleavage activities of novel indole derivatives.

    Biradar, J S; Sasidhar, B S; Parveen, R

    2010-09-01

    A new series of novel indole derivatives containing barbitone moiety (5a-i) are synthesized by simple and efficient condensation of chalcones (3a-i) with barbituric acid (4). The synthesized compounds are screened for their antioxidant (free radical scavenging, total antioxidant capacity and ferric reducing antioxidant power) and DNA cleavage activities were evaluated. Among the synthesized compounds (5a), (5d) and (5g) exhibited excellent antioxidant activity and all the tested compounds in the series have exhibited promising DNA cleavage activities. The structures of the synthesized compounds are assigned on the basis of elemental analysis, IR, (1)H NMR, (13)C NMR and mass spectral data. PMID:20594623

  17. DNA ligase III promotes alternative nonhomologous end-joining during chromosomal translocation formation.

    Deniz Simsek

    2011-06-01

    Full Text Available Nonhomologous end-joining (NHEJ is the primary DNA repair pathway thought to underlie chromosomal translocations and other genomic rearrangements in somatic cells. The canonical NHEJ pathway, including DNA ligase IV (Lig4, suppresses genomic instability and chromosomal translocations, leading to the notion that a poorly defined, alternative NHEJ (alt-NHEJ pathway generates these rearrangements. Here, we investigate the DNA ligase requirement of chromosomal translocation formation in mouse cells. Mammals have two other DNA ligases, Lig1 and Lig3, in addition to Lig4. As deletion of Lig3 results in cellular lethality due to its requirement in mitochondria, we used recently developed cell lines deficient in nuclear Lig3 but rescued for mitochondrial DNA ligase activity. Further, zinc finger endonucleases were used to generate DNA breaks at endogenous loci to induce translocations. Unlike with Lig4 deficiency, which causes an increase in translocation frequency, translocations are reduced in frequency in the absence of Lig3. Residual translocations in Lig3-deficient cells do not show a bias toward use of pre-existing microhomology at the breakpoint junctions, unlike either wild-type or Lig4-deficient cells, consistent with the notion that alt-NHEJ is impaired with Lig3 loss. By contrast, Lig1 depletion in otherwise wild-type cells does not reduce translocations or affect microhomology use. However, translocations are further reduced in Lig3-deficient cells upon Lig1 knockdown, suggesting the existence of two alt-NHEJ pathways, one that is biased toward microhomology use and requires Lig3 and a back-up pathway which does not depend on microhomology and utilizes Lig1.

  18. Promotion as a Tool in Sustaining the Destination Marketing Activities

    Ivo Mulec

    2010-01-01

    Full Text Available Promoting the tourism destination in the right and best possible way is today one of vital marketing activities of all Destination Management Organizations. Only successful promotion can entice and attract potential travelers to visit the destination. The number of new destinations is increasing every year and some of them are quite similar. Market segmentation is one of the starting points for devising marketing strategy. Only by presenting the destination to the right segment of potential clients in the right way will a destination maximize the effectiveness of its marketing and promotion. Tourism destination marketers will continue to face considerable challenges in the future: they will have to take account of the needs, wants and expectations of more mature and knowledgeable customers, and the corresponding need for more up-to-date and reliable information upon which to base decision-making. In the future only marketing which includes collaborative dimensions will meet its objectives fully.

  19. Using DNA devices to track anticancer drug activity.

    Kahanda, Dimithree; Chakrabarti, Gaurab; Mcwilliams, Marc A; Boothman, David A; Slinker, Jason D

    2016-06-15

    It is beneficial to develop systems that reproduce complex reactions of biological systems while maintaining control over specific factors involved in such processes. We demonstrated a DNA device for following the repair of DNA damage produced by a redox-cycling anticancer drug, beta-lapachone (β-lap). These chips supported ß-lap-induced biological redox cycle and tracked subsequent DNA damage repair activity with redox-modified DNA monolayers on gold. We observed drug-specific changes in square wave voltammetry from these chips at therapeutic ß-lap concentrations of high statistical significance over drug-free control. We also demonstrated a high correlation of this change with the specific ß-lap-induced redox cycle using rational controls. The concentration dependence of ß-lap revealed significant signal changes at levels of high clinical significance as well as sensitivity to sub-lethal levels of ß-lap. Catalase, an enzyme decomposing peroxide, was found to suppress DNA damage at a NQO1/catalase ratio found in healthy cells, but was clearly overcome at a higher NQO1/catalase ratio consistent with cancer cells. We found that it was necessary to reproduce key features of the cellular environment to observe this activity. Thus, this chip-based platform enabled tracking of ß-lap-induced DNA damage repair when biological criteria were met, providing a unique synthetic platform for uncovering activity normally confined to inside cells. PMID:26901461

  20. DNA fragments binding CTCF in vitro and in vivo are capable of blocking enhancer activity

    Didych Dmitry A

    2012-04-01

    Full Text Available Abstract Background Earlier we identified ten 100-300-bp long CTCF-binding DNA fragments selected earlier from a 1-Mb human chromosome 19 region. Here the positive-negative selection technique was used to check the ability of CTCF-binding human genomic fragments to block enhancer-promoter interaction when inserted into the genome. Results Ten CTCF-binding DNA fragments were inserted between the CMV enhancer and CMV minimal promoter driving the herpes simplex virus thymidine kinase (HSV-tk gene in a vector expressing also the neoR gene under a separate promoter. The constructs were then integrated into the genome of CHO cells, and the cells resistant to neomycin and ganciclovir (positive-negative selection were picked up, and their DNAs were PCR analyzed to confirm the presence of the fragments between the enhancer and promoter in both orientations. Conclusions We demonstrated that all sequences identified by their CTCF binding both in vitro and in vivo had enhancer-blocking activity when inserted between the CMV minimal promoter and enhancer in stably transfected CHO cells.

  1. Promoting Moderate-Vigorous Physical Activity in Overweight Minority Girls

    Norma Olvera; Marilynn Graham; Jessica McLeod; Kellam, Stephanie F.; Butte, Nancy F

    2010-01-01

    There is limited research on the types of activities that are most effective for promoting MVPA in children. Purpose. To assess which types of activities elicit MVPA in overweight minority girls. Methods. Sample consisted of 31 overweight (BMI≥85th percentile) Latina and African-American girls (mean age 10.3±1.2 years). Participants wore an Actical accelerometer each day for 8 hours for 15 days to assess engagement in MVPA during their participation in a three-week activity inte...

  2. Promoting Moderate-Vigorous Physical Activity in Overweight Minority Girls

    Olvera, Norma; Graham, Marilynn; McLeod, Jessica; Kellam, Stephanie F.; Butte, Nancy F

    2010-01-01

    There is limited research on the types of activities that are most effective for promoting MVPA in children. Purpose. To assess which types of activities elicit MVPA in overweight minority girls. Methods. Sample consisted of 31 overweight (BMI ≥ 85th percentile) Latina and African-American girls (mean age 10.3 ± 1.2 years). Participants wore an Actical accelerometer each day for 8 hours for 15 days to assess engagement in MVPA during their participation in a three-week activity intervention t...

  3. The molecular basis of selective promoter activation by the sigmaS subunit of RNA polymerase.

    Typas, Athanasios; Becker, Gisela; Hengge, Regine

    2007-03-01

    Different environmental stimuli cause bacteria to exchange the sigma subunit in the RNA polymerase (RNAP) and, thereby, tune their gene expression according to the newly emerging needs. Sigma factors are usually thought to recognize clearly distinguishable promoter DNA determinants, and thereby activate distinct gene sets, known as their regulons. In this review, we illustrate how the principle sigma factor in stationary phase and in stressful conditions in Escherichia coli, sigmaS (RpoS), can specifically target its large regulon in vivo, although it is known to recognize the same core promoter elements in vitro as the housekeeping sigma factor, sigma70 (RpoD). Variable combinations of cis-acting promoter features and trans-acting protein factors determine whether a promoter is recognized by RNAP containing sigmaS or sigma70, or by both holoenzymes. How these promoter features impose sigmaS selectivity is further discussed. Moreover, additional pathways allow sigmaS to compete more efficiently than sigma70 for limiting amounts of core RNAP (E) and thereby enhance EsigmaS formation and effectiveness. Finally, these topics are discussed in the context of sigma factor evolution and the benefits a cell gains from retaining competing and closely related sigma factors with overlapping sets of target genes. PMID:17302812

  4. Impaired coactivator activity of the Gly482 variant of peroxisome proliferator-activated receptor γ coactivator-1α (PGC-1α) on mitochondrial transcription factor A (Tfam) promoter

    Mitochondrial dysfunction may cause diabetes or insulin resistance. Peroxisome proliferation-activated receptor-γ (PPAR-γ) coactivator-1 α (PGC-1α) increases mitochondrial transcription factor A (Tfam) resulting in mitochondrial DNA content increase. An association between a single nucleotide polymorphism (SNP), G1444A(Gly482Ser), of PGC-1α coding region and insulin resistance has been reported in some ethnic groups. In this study, we investigated whether a change of glycine to serine at codon 482 of PGC-1α affected the Tfam promoter activity. The cDNA of PGC-1α variant bearing either glycine or serine at 482 codon was transfected into Chang human hepatocyte cells. The PGC-1α protein bearing glycine had impaired coactivator activity on Tfam promoter-mediated luciferase. We analyzed the PGC-1α genotype G1444A and mitochondrial DNA (mtDNA) copy number from 229 Korean leukocyte genomic DNAs. Subjects with Gly/Gly had a 20% lower amount of peripheral blood mtDNA than did subjects with Gly/Ser and Ser/Ser (p < 0.05). No correlation was observed between diabetic parameters and PGC-1α genotypes in Koreans. These results suggest that PGC-1α variants with Gly/Gly at 482nd amino acid may impair the Tfam transcription, a regulatory function of mitochondrial biogenesis, resulting in dysfunctional mtDNA replication

  5. Ubiquitin-SUMO circuitry controls activated fanconi anemia ID complex dosage in response to DNA damage.

    Gibbs-Seymour, Ian; Oka, Yasuyoshi; Rajendra, Eeson; Weinert, Brian T; Passmore, Lori A; Patel, Ketan J; Olsen, Jesper V; Choudhary, Chunaram; Bekker-Jensen, Simon; Mailand, Niels

    2015-01-01

    We show that central components of the Fanconi anemia (FA) DNA repair pathway, the tumor suppressor proteins FANCI and FANCD2 (the ID complex), are SUMOylated in response to replication fork stalling. The ID complex is SUMOylated in a manner that depends on the ATR kinase, the FA ubiquitin ligase core complex, and the SUMO E3 ligases PIAS1/PIAS4 and is antagonized by the SUMO protease SENP6. SUMOylation of the ID complex drives substrate selectivity by triggering its polyubiquitylation by the SUMO-targeted ubiquitin ligase RNF4 to promote its removal from sites of DNA damage via the DVC1-p97 ubiquitin segregase complex. Deregulation of ID complex SUMOylation compromises cell survival following replication stress. Our results uncover a regulatory role for SUMOylation in the FA pathway, and we propose that ubiquitin-SUMO signaling circuitry is a mechanism that contributes to the balance of activated ID complex dosage at sites of DNA damage. PMID:25557546

  6. Cryptic single-stranded-DNA binding activities of the phage λ P and Escherichia coli DnaC replication initiation proteins facilitate the transfer of E. coli DnaB helicase onto DNA

    Learn, Brian A.; Um, Soo-Jong; Huang, Li; McMacken, Roger

    1997-01-01

    The bacteriophage λ P and Escherichia coli DnaC proteins are known to recruit the bacterial DnaB replicative helicase to initiator complexes assembled at the phage and bacterial origins, respectively. These specialized nucleoprotein assemblies facilitate the transfer of one or more molecules of DnaB helicase onto the chromosome; the transferred DnaB, in turn, promotes establishment of a processive replication fork apparatus. To learn more about the mechanism of the DnaB transfer reaction, we ...

  7. Gene activation regresses atherosclerosis, promotes health, and enhances longevity

    Luoma Pauli V

    2010-07-01

    Full Text Available Abstract Background Lifestyle factors and pharmacological compounds activate genetic mechanisms that influence the development of atherosclerotic and other diseases. This article reviews studies on natural and pharmacological gene activation that promotes health and enhances longevity. Results Living habits including healthy diet and regular physical activity, and pharmacotherapy, upregulate genes encoding enzymes and apolipoprotein and ATP-binding cassette transporters, acting in metabolic processes that promote health and increase survival. Cytochrome P450-enzymes, physiological factors in maintaining cholesterol homeostasis, generate oxysterols for the elimination of surplus cholesterol. Hepatic CTP:phosphocholine cytidylyltransferase-α is an important regulator of plasma HDL-C level. Gene-activators produce plasma lipoprotein profile, high HDL-C, HDL2-C and HDL-C/cholesterol ratio, which is typical of low risk of atherosclerotic disease, and also of exceptional longevity together with reduced prevalence of cardiovascular, metabolic and other diseases. High HDL contributes to protection against inflammation, oxidation and thrombosis, and associates with good cognitive function in very old people. Avoiding unhealthy stress and managing it properly promotes health and increases life expectancy. Conclusions Healthy living habits and gene-activating xenobiotics upregulate mechanisms that produce lipoprotein pattern typical of very old people and enhance longevity. Lipoprotein metabolism and large HDL2 associate with the process of living a very long life. Major future goals for health promotion are the improving of commitment to both wise lifestyle choices and drug therapy, and further the developing of new and more effective and well tolerated drugs and treatments.

  8. Targets of DNA-binding proteins in bacterial promoter regions present enhanced probabilities for spontaneous thermal openings

    We mapped promoter regions of double-stranded DNA with respect to the probabilities of appearance of relatively large bubble openings exclusively due to thermal fluctuations at physiological temperatures. We analyzed five well-studied promoter regions of procaryotic type and found a spatial correlation between the binding sites of transcription factors and the position of peaks in the probability pattern of large thermal openings. Other distinct peaks of the calculated patterns correlate with potential binding sites of DNA-binding proteins. These results suggest that a DNA molecule would more frequently expose the bases that participate in contacts with proteins, which would probably enhance the probability of the latter to reach their targets. It also stands for using this method as a means to analyze DNA sequences based on their intrinsic thermal properties

  9. Plasma-activated air mediates plasmid DNA delivery in vivo.

    Edelblute, Chelsea M; Heller, Loree C; Malik, Muhammad A; Bulysheva, Anna; Heller, Richard

    2016-01-01

    Plasma-activated air (PAA) provides a noncontact DNA transfer platform. In the current study, PAA was used for the delivery of plasmid DNA in a 3D human skin model, as well as in vivo. Delivery of plasmid DNA encoding luciferase to recellularized dermal constructs was enhanced, resulting in a fourfold increase in luciferase expression over 120 hours compared to injection only (P plasmid DNA encoding green fluorescent protein (GFP) was confirmed in the epidermal layers of the construct. In vivo experiments were performed in BALB/c mice, with skin as the delivery target. PAA exposure significantly enhanced luciferase expression levels 460-fold in exposed sites compared to levels obtained from the injection of plasmid DNA alone (P plasmid DNA encoding GFP to mouse skin was confirmed by immunostaining, where a 3-minute exposure at a 10 mm distance displayed delivery distribution deep within the dermal layers compared to an exposure at 3 mm where GFP expression was localized within the epidermis. Our findings suggest PAA-mediated delivery warrants further exploration as an alternative approach for DNA transfer for skin targets. PMID:27110584

  10. Characterization of the Lactococcus lactis lactose operon promoter: contribution of flanking sequences and LacR repressor to promoter activity.

    van Rooijen, R J; Gasson, M. J.; de Vos, W M

    1992-01-01

    We determined the location, activity, and regulation of the promoter of the Lactococcus lactis 8-kb lactose operon (lacABCDFEGX), which encodes the enzymes of the lactose phosphotransferase system and the tagatose 6-phosphate pathway. The lac promoter sequence corresponds closely to the consensus promoter described for gram-positive bacteria and is located in a back-to-back configuration with the promoter of the divergently transcribed lacR gene, which encodes the LacR repressor. The transcri...

  11. Loss of TET2 in hematopoietic cells leads to DNA hypermethylation of active enhancers and induction of leukemogenesis

    Rasmussen, Kasper D; Jia, Guangshuai; Johansen, Jens V;

    2015-01-01

    DNA methylation is tightly regulated throughout mammalian development, and altered DNA methylation patterns are a general hallmark of cancer. The methylcytosine dioxygenase TET2 is frequently mutated in hematological disorders, including acute myeloid leukemia (AML), and has been suggested to...... protect CG dinucleotide (CpG) islands and promoters from aberrant DNA methylation. In this study, we present a novel Tet2-dependent leukemia mouse model that closely recapitulates gene expression profiles and hallmarks of human AML1-ETO-induced AML. Using this model, we show that the primary effect of Tet......2 loss in preleukemic hematopoietic cells is progressive and widespread DNA hypermethylation affecting up to 25% of active enhancer elements. In contrast, CpG island and promoter methylation does not change in a Tet2-dependent manner but increases relative to population doublings. We confirmed this...

  12. Archaeal promoter architecture and mechanism of gene activation

    Peng, Nan; Ao, Xiang; Liang, Yun Xiang;

    2011-01-01

    Sulfolobus solfataricus and Sulfolobus islandicus contain several genes exhibiting D-arabinose-inducible expression and these systems are ideal for studying mechanisms of archaeal gene expression. At sequence level, only two highly conserved cis elements are present on the promoters: a regulatory...... mechanisms include TFB (transcription factor B) recruitment by the ara-box-binding factor to activate gene expression and modulation of TFB recruitment efficiency to yield differential gene expression....

  13. Physical activity and health promotion in Italian university students

    Adele Anna Teleman; Chiara de Waure; Valentina Soffiani; Andrea Poscia; Maria Luisa Di Pietro

    2015-01-01

    INTRODUCTION: Physical activity, diet plans, the mantainment of a certain Body Mass Index (BMI) and the use of various types of supplementation are common elements in the search for disease prevention, health promotion and well-being. MATERIALS AND METHODS: We analyzed the data regarding Italian university students' BMI, dieting behaviour, personal body perception, exercise habits, and use of dietary supplements and of doping substances. RESULTS: 13.7% resulted being underweight, 75.1% was in...

  14. National and international activities for the promotion of superconductivity technology

    Superconductivity has become a priority item of technology promotion schemes in many countries in the wake of the discovery of superconductivity and in response to the excellent market potentials expected. The paper summarizes the ongoing activities in this domain of R+D in Germany and in the leading, competing countries, U.S.A. and Japan, showing the various approaches and means available. (orig.)

  15. Physical activity in health promotion: a evaluation of the guidelines

    Dartel Ferrari de Lima; Olinda do Carmo Luiz

    2015-01-01

    Regular physical activity (PA) promotes health benefits over time. Numerous organizations produce guidelines to guide public administrators, health professionals and the public in general to the practice of PA. However, even though in general terms guidelines follow the same goals, nuances in guidelines communication may cause discrepancies in understanding the messages. The objective of this essay was to describe and compare PA guidelines, highlighting differences and similarities and identi...

  16. Inhibition of DNA gyrase by optically active ofloxacin.

    Imamura, M.; Shibamura, S; Hayakawa, I.; Osada, Y

    1987-01-01

    Inhibition of DNA gyrase activity by optically active ofloxacins was studied and compared with the inhibition of norfloxacin and ciprofloxacin. The (-)-isomer of ofloxacin inhibited the supercoiling activity of gyrase from Micrococcus luteus more effectively than did the (+)-isomer. The 50% inhibitory concentrations of (-)-, (+/-)-, and (+)-ofloxacin; norfloxacin; and ciprofloxacin for gyrase from Escherichia coli were 0.78, 0.98, 7.24, 0.78, and 1.15 microgram/ml, respectively. These values ...

  17. TNF-α promotes cell survival through stimulation of K+ channel and NFκB activity in corneal epithelial cells

    Tumor necrosis factor (TNF-α) in various cell types induces either cell death or mitogenesis through different signaling pathways. In the present study, we determined in human corneal epithelial cells how TNF-α also promotes cell survival. Human corneal epithelial (HCE) cells were cultured in DMEM/F-12 medium containing 10% FBS. TNF-α stimulation induced activation of a voltage-gated K+ channel detected by measuring single channel activity using patch clamp techniques. The effect of TNF-α on downstream events included NFκB nuclear translocation and increases in DNA binding activities, but did not elicit ERK, JNK, or p38 limb signaling activation. TNF-α induced increases in p21 expression resulting in partial cell cycle attenuation in the G1 phase. Cell cycle progression was also mapped by flow cytometer analysis. Blockade of TNF-α-induced K+ channel activity effectively prevented NFκB nuclear translocation and binding to DNA, diminishing the cell-survival protective effect of TNF-α. In conclusion, TNF-α promotes survival of HCE cells through sequential stimulation of K+ channel and NFκB activities. This response to TNF-α is dependent on stimulating K+ channel activity because following suppression of K+ channel activity TNF-α failed to activate NFκB nuclear translocation and binding to nuclear DNA

  18. Differentiated, Promoter-specific Response of [4Fe-4S] NsrR DNA Binding to Reaction with Nitric Oxide.

    Crack, Jason C; Svistunenko, Dimitri A; Munnoch, John; Thomson, Andrew J; Hutchings, Matthew I; Le Brun, Nick E

    2016-04-15

    NsrR is an iron-sulfur cluster protein that regulates the nitric oxide (NO) stress response of many bacteria. NsrR from Streptomyces coelicolor regulates its own expression and that of only two other genes, hmpA1 and hmpA2, which encode HmpA enzymes predicted to detoxify NO. NsrR binds promoter DNA with high affinity only when coordinating a [4Fe-4S] cluster. Here we show that reaction of [4Fe-4S] NsrR with NO affects DNA binding differently depending on the gene promoter. Binding to the hmpA2 promoter was abolished at ∼2 NO per cluster, although for the hmpA1 and nsrR promoters, ∼4 and ∼8 NO molecules, respectively, were required to abolish DNA binding. Spectroscopic and kinetic studies of the NO reaction revealed a rapid, multi-phase, non-concerted process involving up to 8-10 NO molecules per cluster, leading to the formation of several iron-nitrosyl species. A distinct intermediate was observed at ∼2 NO per cluster, along with two further intermediates at ∼4 and ∼6 NO. The NsrR nitrosylation reaction was not significantly affected by DNA binding. These results show that NsrR regulates different promoters in response to different concentrations of NO. Spectroscopic evidence indicates that this is achieved by different NO-FeS complexes. PMID:26887943

  19. Differentiated, Promoter-specific Response of [4Fe-4S] NsrR DNA Binding to Reaction with Nitric Oxide*

    Crack, Jason C.; Svistunenko, Dimitri A.; Munnoch, John; Thomson, Andrew J.; Hutchings, Matthew I.; Le Brun, Nick E.

    2016-01-01

    NsrR is an iron-sulfur cluster protein that regulates the nitric oxide (NO) stress response of many bacteria. NsrR from Streptomyces coelicolor regulates its own expression and that of only two other genes, hmpA1 and hmpA2, which encode HmpA enzymes predicted to detoxify NO. NsrR binds promoter DNA with high affinity only when coordinating a [4Fe-4S] cluster. Here we show that reaction of [4Fe-4S] NsrR with NO affects DNA binding differently depending on the gene promoter. Binding to the hmpA2 promoter was abolished at ∼2 NO per cluster, although for the hmpA1 and nsrR promoters, ∼4 and ∼8 NO molecules, respectively, were required to abolish DNA binding. Spectroscopic and kinetic studies of the NO reaction revealed a rapid, multi-phase, non-concerted process involving up to 8–10 NO molecules per cluster, leading to the formation of several iron-nitrosyl species. A distinct intermediate was observed at ∼2 NO per cluster, along with two further intermediates at ∼4 and ∼6 NO. The NsrR nitrosylation reaction was not significantly affected by DNA binding. These results show that NsrR regulates different promoters in response to different concentrations of NO. Spectroscopic evidence indicates that this is achieved by different NO-FeS complexes. PMID:26887943

  20. Isolation and characterization of active promoters from Gluconacetobacter diazotrophicus strain PAL5 using a promoter-trapping plasmid.

    Schwab, Stefan; Pessoa, Cristiane Alves; de Lima Bergami, Amanda Aparecida; de Azevedo Figueiredo, Nathália Lima; Dos Santos Teixeira, Kátia Regina; Baldani, José Ivo

    2016-07-01

    Gluconacetobacter diazotrophicus is a nitrogen-fixing, endophytic bacterium that has the potential to promote plant growth and increase yield. Genetically modified strains might get more benefits to host plants, including through expression of useful proteins, such as Cry toxins from B. thuringiensis, or enzymes involved in phytohormone production, proteins with antagonistic activity for phytopathogens, or that improve nutrient utilization by the plant. For that, expression systems for G. diazotrophicus are needed, which requires active promoters fused to foreign (or innate) genes. This article describes the construction of a G. diazotrophicus PAL5 promoter library using a promoter-less lacZ-bearing vector, and the identification of six active promoters through β-galactosidase activity assays, sequencing and localization in the bacterial genome. The characterized promoters, which are located on distinct regions of the bacterial genome and encoding either sense or antisense transcripts, present variable expression strengths and might be used in the future for expressing useful proteins. PMID:26914247

  1. The chromatin remodeling factor CSB recruits histone acetyltransferase PCAF to rRNA gene promoters in active state for transcription initiation.

    Meili Shen

    Full Text Available The promoters of poised rRNA genes (rDNA are marked by both euchromatic and heterochromatic histone modifications and are associated with two transcription factors, UBF and SL1 that nucleate transcription complex formation. Active rRNA genes contain only euchromatic histone modifications and are loaded with all components of transcriptional initiation complex including RNA polymerase I. Coupled with histone acetylation and RNA polymerase I targeting, poised promoters can be converted to active ones by ATP-dependent chromatin remodeling factor CSB for initiation of rDNA transcription. However, it is not clear how dynamic histone modifications induce the assembly of polymerase I transcription initiation complex to active promoters during such conversion. Here we show that a complex consisting of CSB, RNA polymerase I and histone acetyltransferase PCAF is present at the rDNA promoters in active state. CSB is required for the association of PCAF with rDNA, which induces acetylation of histone H4 and histone H3K9. Overexpression of CSB promotes the association of PCAF with rDNA. Knockdown of PCAF leads to decreased levels of H4ac and H3K9ac at rDNA promoters, prevents the association of RNA polymerase I and inhibits pre-rRNA synthesis. The results demonstrate that CSB recruits PCAF to rDNA, which allows histone acetylation that is required for the assembly of polymerase I transcription initiation complex during the transition from poised to active state of rRNA genes, suggesting that CSB and PCAF play cooperative roles to establish the active state of rRNA genes by histone acetylation.

  2. The DNA methylation profile of activated human natural killer cells.

    Wiencke, John K; Butler, Rondi; Hsuang, George; Eliot, Melissa; Kim, Stephanie; Sepulveda, Manuel A; Siegel, Derick; Houseman, E Andres; Kelsey, Karl T

    2016-05-01

    Natural killer (NK) cells are now recognized to exhibit characteristics akin to cells of the adaptive immune system. The generation of adaptive memory is linked to epigenetic reprogramming including alterations in DNA methylation. The study herein found reproducible genome wide DNA methylation changes associated with human NK cell activation. Activation led predominately to CpG hypomethylation (81% of significant loci). Bioinformatics analysis confirmed that non-coding and gene-associated differentially methylated sites (DMS) are enriched for immune related functions (i.e., immune cell activation). Known DNA methylation-regulated immune loci were also identified in activated NK cells (e.g., TNFA, LTA, IL13, CSF2). Twenty-one loci were designated high priority and further investigated as potential markers of NK activation. BHLHE40 was identified as a viable candidate for which a droplet digital PCR assay for demethylation was developed. The assay revealed high demethylation in activated NK cells and low demethylation in naïve NK, T- and B-cells. We conclude the NK cell methylome is plastic with potential for remodeling. The differentially methylated region signature of activated NKs revealed similarities with T cell activation, but also provided unique biomarker candidates of NK activation, which could be useful in epigenome-wide association studies to interrogate the role of NK subtypes in global methylation changes associated with exposures and/or disease states. PMID:26967308

  3. An ATF/CREB site is the major regulatory element in the human herpesvirus 6 DNA polymerase promoter.

    Agulnick, A D; Thompson, J R; Ricciardi, R P

    1994-01-01

    Human herpesvirus 6 (HHV-6) is a recently described T-cell pathogen whose medical relevance and molecular biology are just beginning to be addressed. As a first look at the regulation of viral genes, control of the HHV-6 DNA polymerase promoter was examined. Polymerase gene transcription in HHV-6-infected cells was found to initiate from a single site located 115 bases upstream of the translation start codon. A polymerase promoter-chloramphenicol acetyltransferase reporter gene construct fail...

  4. Electrostatic map of T7 DNA. Comparative analysis of functional and electrostatic properties of T7 RNA polymerase specific promoters

    Kamzolova, S. G.; Beskaravainy, P. M.; Osypov, A. A.; Dzhelyadin, T. R.; Temlyakova, E. A.; Sorokin, A. A.

    2013-01-01

    The entire T7 bacteriophage genome contains 39937 base pairs (Database NCBI RefSeq N1001604). Here, electrostatic potential distribution around double helical T7 DNA was calculated by Coulomb method using the computer program of Sorokin A.A. Electrostatic profiles of 17 promoters recognized by T7 phage specific RNA polymerase were analyzed. It was shown that electrostatic profiles of all T7 RNA polymerase specific promoters can be characterized by distinctive motifs which are specific for eac...

  5. Elevated N3-methylpurine-DNA glycosylase DNA repair activity is associated with lung cancer

    Tobacco smoke contains a range of chemical agents that can alkylate DNA. DNA repair proteins such as N3-methylpurine-DNA glycosylase (MPG) provide protection against cell killing and mutagenicity by removing lesions such as N7-methylguanine and N3-methyladenine. However, high levels of MPG activity in transfected mammalian cells in vitro have also been associated with increased genotoxicity. The aim of this study was to examine to what extent inter-individual differences in MPG activity modify susceptibility to lung cancer. Incident cases of lung cancer (n = 51) and cancer free controls (n = 88) were recruited from a hospital bronchoscopy unit. Repair activity was determined in a nuclear extract of peripheral blood mononuclear cells, using a [32P]-based oligonucleotide cleavage assay (MPG substrate 5′-CCGCTεAGCGGGTACCGAGCTCGAAT; εA = ethenoadenine). MPG activity was not related to sex or smoking status but was significantly higher in cases compared to controls (4.21 ± 1.67 fmol/μg DNA/h vs 3.47 ± 1.35 fmol/μg DNA/h, p = 0.005). After adjustment for age, sex, presence of chronic respiratory disease and smoking duration, patients in the highest tertile of MPG activity had a three fold increased probability of lung cancer (OR 3.00, 95% CI 1.16–7.75) when compared to those patients in the lowest tertile. These results suggest that elevated MPG activity is associated with lung cancer, possibly by creating an imbalance in the base excision repair pathway.

  6. Study of the activity of DNA polymerases β and λ using 5-formyluridine containing DNA substrates

    Lavrik O. I.

    2012-06-01

    Full Text Available Aim. To investigate the TLS-activity of human DNA polymerases β and λ (pols β and λ using 5-formyluridine (5-foU containing DNA duplexes which are imitating the intermediates during replication of the leading DNA strand, and to study the influence of replication factors hRPA and hPCNA on this activity. Methods. The EMSA and the methods of enzyme’s kinetics were used. Results. The capability of pols β and λ to catalyze DNA synthesis across 5-foU was investigated and the kinetic characteristics of this process in the presence and in the absence of protein factors hRPA and hPCNA were evaluated. Conclusions. It was shown that: (i both proteins are able to catalyze TLS on used DNA substrates regardless of the reaction conditions, however, pol λ was more accurate enzyme; (ii hRPA can stimulate the efficacy of the nonmutagenic TLS catalyzed by pol at the nucleotide incorporation directly opposite of 5-foU, at the same time it doesn’t influence the incorporation efficacy if the damage displaced into the duplex; (iii hPCNA doesn’t influence the efficacy of TLS catalyzed by both enzymes.

  7. Rad18 is required for functional interactions between FANCD2, BRCA2, and Rad51 to repair DNA topoisomerase 1-poisons induced lesions and promote fork recovery

    Tripathi, Kaushlendra; Mani, Chinnadurai; Clark, David W; Palle, Komaraiah

    2016-01-01

    Camptothecin (CPT) and its analogues are chemotherapeutic agents that covalently and reversibly link DNA Topoisomerase I to its nicked DNA intermediate eliciting the formation of DNA double strand breaks (DSB) during replication. The repair of these DSB involves multiple DNA damage response and repair proteins. Here we demonstrate that CPT-induced DNA damage promotes functional interactions between BRCA2, FANCD2, Rad18, and Rad51 to repair the replication-associated DSB through homologous recombination (HR). Loss of any of these proteins leads to equal disruption of HR repair, causes chromosomal aberrations and sensitizes cells to CPT. Rad18 appears to function upstream in this repair pathway as its downregulation prevents activation of FANCD2, diminishes BRCA2 and Rad51 protein levels, formation of nuclear foci of all three proteins and recovery of stalled or collapsed replication forks in response to CPT. Taken together this work further elucidates the complex interplay of DNA repair proteins in the repair of replication-associated DSB. PMID:26871286

  8. Dexamethasone down-regulates, the activity of promoter from human al (Ⅱ) procollagen gene

    2000-01-01

    Objective To investigate the effects of dexamethasone on the promoter activity of human al(1) procollagen gene.Methods Fibroblasts from human skin were primary cultured and subcultured. (1) The effects of dexamethasone on the human skin fibroblasts were determined by BrdU incorporation into DNA of fibroblasts. (2) Three plasmids containing various engths of 5' flanksequence of human al(1) procollagen gene and CAT as reporter gene were constructed, and were transfected into the human skin fi-broblasts by FuGENE Transfecfion Reagent. The effects of dexamethasone on 3 plasmids were determined by CAT - ELlSA. Results (1)After 24h of treatment on the fibroblasts with 110-9 ~110-4mol/L examethasone in DMEM containing 2% or 10% FCS, BrdU in-corporation into DNA showed no difference ( P > 0.05) . (2) the 3 plasmids were transfected into fibroblasts and then treated with 110-5mol/L and 110-6mol/L dexamethasones for 24h, relative CAT values were different belwent dexamethasone and control,higher dexamethasone(110 -5mol/L} and lower examethasone(110 -6mol/L) ( P <0. 05) . ConcluSion Dexamethasone has noeffects on the proliferation of human skin fibroblasts, and it has negative effect on the promoter activity of human al(1) procollagengene, which is dose- dependent.

  9. Checkpoint Activation of an Unconventional DNA Replication Program in Tetrahymena.

    Sandoval, Pamela Y; Lee, Po-Hsuen; Meng, Xiangzhou; Kapler, Geoffrey M

    2015-07-01

    The intra-S phase checkpoint kinase of metazoa and yeast, ATR/MEC1, protects chromosomes from DNA damage and replication stress by phosphorylating subunits of the replicative helicase, MCM2-7. Here we describe an unprecedented ATR-dependent pathway in Tetrahymena thermophila in which the essential pre-replicative complex proteins, Orc1p, Orc2p and Mcm6p are degraded in hydroxyurea-treated S phase cells. Chromosomes undergo global changes during HU-arrest, including phosphorylation of histone H2A.X, deacetylation of histone H3, and an apparent diminution in DNA content that can be blocked by the deacetylase inhibitor sodium butyrate. Most remarkably, the cell cycle rapidly resumes upon hydroxyurea removal, and the entire genome is replicated prior to replenishment of ORC and MCMs. While stalled replication forks are elongated under these conditions, DNA fiber imaging revealed that most replicating molecules are produced by new initiation events. Furthermore, the sole origin in the ribosomal DNA minichromosome is inactive and replication appears to initiate near the rRNA promoter. The collective data raise the possibility that replication initiation occurs by an ORC-independent mechanism during the recovery from HU-induced replication stress. PMID:26218270

  10. Monitoring DNA triplex formation using multicolor fluorescence and application to insulin-like growth factor I promoter downregulation.

    Hégarat, Nadia; Novopashina, Darya; Fokina, Alesya A; Boutorine, Alexandre S; Venyaminova, Alya G; Praseuth, Danièle; François, Jean-Christophe

    2014-03-01

    Inhibition of insulin-like growth factor I (IGF-I) signaling is a promising antitumor strategy and nucleic acid-based approaches have been investigated to target genes in the pathway. Here, we sought to modulate IGF-I transcriptional activity using triple helix formation. The IGF-I P1 promoter contains a purine/pyrimidine (R/Y) sequence that is pivotal for transcription as determined by deletion analysis and can be targeted with a triplex-forming oligonucleotide (TFO). We designed modified purine- and pyrimidine-rich TFOs to bind to the R/Y sequence. To monitor TFO binding, we developed a fluorescence-based gel-retardation assay that allowed independent detection of each strand in three-stranded complexes using end-labeling with Alexa 488, cyanine (Cy)3 and Cy5 fluorochromes. We characterized TFOs for their ability to inhibit restriction enzyme activity, compete with DNA-binding proteins and inhibit IGF-I transcription in reporter assays. TFOs containing modified nucleobases, 5-methyl-2'-deoxycytidine and 5-propynyl-2'-deoxyuridine, specifically inhibited restriction enzyme cleavage and formed triplexes on the P1 promoter fragment. In cells, deletion of the R/Y-rich sequence led to 48% transcriptional inhibition of a reporter gene. Transfection with TFOs inhibited reporter gene activity to a similar extent, whereas transcription from a mutant construct with an interrupted R/Y region was unaffected, strongly suggesting the involvement of triplex formation in the inhibitory mechanisms. Our results indicate that nuclease-resistant TFOs will likely inhibit endogenous IGF-I gene function in cells. PMID:24423253

  11. Viral DNA Replication-Dependent DNA Damage Response Activation during BK Polyomavirus Infection

    Verhalen, Brandy; Justice, Joshua L.; Imperiale, Michael J; Jiang, Mengxi

    2015-01-01

    BK polyomavirus (BKPyV) reactivation is associated with severe human disease in kidney and bone marrow transplant patients. The interplay between viral and host factors that regulates the productive infection process remains poorly understood. We have previously reported that the cellular DNA damage response (DDR) is activated upon lytic BKPyV infection and that its activation is required for optimal viral replication in primary kidney epithelial cells. In this report, we set out to determine...

  12. Hypothermia activates adipose tissue to promote malignant lung cancer progression.

    Gangjun Du

    Full Text Available Microenvironment has been increasingly recognized as a critical regulator of cancer progression. In this study, we identified early changes in the microenvironment that contribute to malignant progression. Exposure of human bronchial epithelial cells (BEAS-2B to methylnitrosourea (MNU caused a reduction in cell toxicity and an increase in clonogenic capacity when the temperature was lowered from 37°C to 28°C. Hypothermia-incubated adipocyte media promoted proliferation in A549 cells. Although a hypothermic environment could increase urethane-induced tumor counts and Lewis lung cancer (LLC metastasis in lungs of three breeds of mice, an increase in tumor size could be discerned only in obese mice housed in hypothermia. Similarly, coinjections using differentiated adipocytes and A549 cells promoted tumor development in athymic nude mice when adipocytes were cultured at 28°C. Conversely, fat removal suppressed tumor growth in obese C57BL/6 mice inoculated with LLC cells. Further studies show hypothermia promotes a MNU-induced epithelial-mesenchymal transition (EMT and protects the tumor cell against immune control by TGF-β1 upregulation. We also found that activated adipocytes trigger tumor cell proliferation by increasing either TNF-α or VEGF levels. These results suggest that hypothermia activates adipocytes to stimulate tumor boost and play critical determinant roles in malignant progression.

  13. DNA Recombinase Proteins, their Function and Structure in the Active Form, a Computational Study

    Carra, Claudio; Cucinotta, Francis A.

    2007-01-01

    Homologous recombination is a crucial sequence of reactions in all cells for the repair of double strand DNA (dsDNA) breaks. While it was traditionally considered as a means for generating genetic diversity, it is now known to be essential for restart of collapsed replication forks that have met a lesion on the DNA template (Cox et al., 2000). The central stage of this process requires the presence of the DNA recombinase protein, RecA in bacteria, RadA in archaea, or Rad51 in eukaryotes, which leads to an ATP-mediated DNA strand-exchange process. Despite many years of intense study, some aspects of the biochemical mechanism, and structure of the active form of recombinase proteins are not well understood. Our theoretical study is an attempt to shed light on the main structural and mechanistic issues encountered on the RecA of the e-coli, the RecA of the extremely radio resistant Deinococcus Radiodurans (promoting an inverse DNA strand-exchange repair), and the homolog human Rad51. The conformational changes are analyzed for the naked enzymes, and when they are linked to ATP and ADP. The average structures are determined over 2ns time scale of Langevian dynamics using a collision frequency of 1.0 ps(sup -1). The systems are inserted in an octahedron periodic box with a 10 Angstrom buffer of water molecules explicitly described by the TIP3P model. The corresponding binding free energies are calculated in an implicit solvent using the Poisson-Boltzmann solvent accessible surface area, MM-PBSA model. The role of the ATP is not only in stabilizing the interaction RecA-DNA, but its hydrolysis is required to allow the DNA strand-exchange to proceed. Furthermore, we extended our study, using the hybrid QM/MM method, on the mechanism of this chemical process. All the calculations were performed using the commercial code Amber 9.

  14. Regulation of Mutagenic DNA Polymerase V Activation in Space and Time

    Robinson, Andrew; McDonald, John P.; Caldas, Victor E. A.; Patel, Meghna; Wood, Elizabeth A.; Punter, Christiaan M.; Ghodke, Harshad; Cox, Michael M.; Woodgate, Roger; Goodman, Myron F.; van Oijen, Antoine M.

    2015-01-01

    Spatial regulation is often encountered as a component of multi-tiered regulatory systems in eukaryotes, where processes are readily segregated by organelle boundaries. Well-characterized examples of spatial regulation are less common in bacteria. Low-fidelity DNA polymerase V (UmuD′2C) is produced in Escherichia coli as part of the bacterial SOS response to DNA damage. Due to the mutagenic potential of this enzyme, pol V activity is controlled by means of an elaborate regulatory system at transcriptional and posttranslational levels. Using single-molecule fluorescence microscopy to visualize UmuC inside living cells in space and time, we now show that pol V is also subject to a novel form of spatial regulation. After an initial delay (~ 45 min) post UV irradiation, UmuC is synthesized, but is not immediately activated. Instead, it is sequestered at the inner cell membrane. The release of UmuC into the cytosol requires the RecA* nucleoprotein filament-mediated cleavage of UmuD→UmuD′. Classic SOS damage response mutants either block [umuD(K97A)] or constitutively stimulate [recA(E38K)] UmuC release from the membrane. Foci of mutagenically active pol V Mut (UmuD′2C-RecA-ATP) formed in the cytosol after UV irradiation do not co-localize with pol III replisomes, suggesting a capacity to promote translesion DNA synthesis at lesions skipped over by DNA polymerase III. In effect, at least three molecular mechanisms limit the amount of time that pol V has to access DNA: (1) transcriptional and posttranslational regulation that initially keep the intracellular levels of pol V to a minimum; (2) spatial regulation via transient sequestration of UmuC at the membrane, which further delays pol V activation; and (3) the hydrolytic activity of a recently discovered pol V Mut ATPase function that limits active polymerase time on the chromosomal template. PMID:26317348

  15. Regulation of Mutagenic DNA Polymerase V Activation in Space and Time.

    Andrew Robinson

    2015-08-01

    Full Text Available Spatial regulation is often encountered as a component of multi-tiered regulatory systems in eukaryotes, where processes are readily segregated by organelle boundaries. Well-characterized examples of spatial regulation are less common in bacteria. Low-fidelity DNA polymerase V (UmuD'2C is produced in Escherichia coli as part of the bacterial SOS response to DNA damage. Due to the mutagenic potential of this enzyme, pol V activity is controlled by means of an elaborate regulatory system at transcriptional and posttranslational levels. Using single-molecule fluorescence microscopy to visualize UmuC inside living cells in space and time, we now show that pol V is also subject to a novel form of spatial regulation. After an initial delay (~ 45 min post UV irradiation, UmuC is synthesized, but is not immediately activated. Instead, it is sequestered at the inner cell membrane. The release of UmuC into the cytosol requires the RecA* nucleoprotein filament-mediated cleavage of UmuD→UmuD'. Classic SOS damage response mutants either block [umuD(K97A] or constitutively stimulate [recA(E38K] UmuC release from the membrane. Foci of mutagenically active pol V Mut (UmuD'2C-RecA-ATP formed in the cytosol after UV irradiation do not co-localize with pol III replisomes, suggesting a capacity to promote translesion DNA synthesis at lesions skipped over by DNA polymerase III. In effect, at least three molecular mechanisms limit the amount of time that pol V has to access DNA: (1 transcriptional and posttranslational regulation that initially keep the intracellular levels of pol V to a minimum; (2 spatial regulation via transient sequestration of UmuC at the membrane, which further delays pol V activation; and (3 the hydrolytic activity of a recently discovered pol V Mut ATPase function that limits active polymerase time on the chromosomal template.

  16. Inflammatory cytokines promote inducible nitric oxide synthase-mediated DNA damage in hamster gallbladder epithelial cells

    2007-01-01

    AIM: To investigate the link between chronic biliary inflammation and carcinogenesis using hamster gallbladder epithelial cells.METHODS: Gallbladder epithelial cells were isolated from hamsters and cultured with a mixture of inflammatory cytokines including interleukin-1β, interferon-γ, and tumor necrosis factor-α. Inducible nitric oxide synthase (iNOS) expression, nitric oxide (NO) generation, and DNA damage were evaluated.RESULTS: NO generation was increased significantly following cytokine stimulation, and suppressed by an iNOS inhibitor. iNOS mRNA expression was demonstrated in the gallbladder epithelial cells during exposure to inflammatory cytokines. Furthermore, NO-dependent DNA damage, estimated by the comet assay, was significantly increased by cytokines, and decreased to control levels by an iNOS inhibitor.CONCLUSION: Cytokine stimulation induced iNOS expression and NO generation in normal hamster gallbladder epithelial cells, which was sufficient to cause DNA damage. These results indicate that NO-mediated genotoxicity induced by inflammatory cytokines through activation of iNOS may be involved in the process of biliary carcinogenesis in response to chronic inflammation of the biliary tree.

  17. Evaluation of hair growth promoting activity of Phyllanthus niruri

    Satish Patel

    2015-10-01

    Full Text Available Objectives: This study was designed to investigate the potential Phyllanthus niruri extracts in promotion of hair growth. Materials and Methods: Here, we studied the hair growth promoting activity of petroleum ether extract of P. niruri following its topical administration. Alopecia was induced in albino rats by subcutaneous administration of testosterone for 21 days. Evaluation of hair loss inhibition was done by concurrent administration of extract and monitoring parameters like follicular density,  anagen/telogen (A/T ratio and histological observation of animal skin sections. Finasteride solution was applied topically as standard. In vitro experiments were also performed to study the effect of extract on the activity of 5α-reductase enzyme Results: Groups treated with petroleum ether extract of plant showed hair re-growth as reflected by follicular density, A/T ratio and skin sections. Histopathology and morphologic observations of hair re-growth at shaved sites showed active follicular proliferation. In vitro experiments results showed inhibitory activity of petroleum  ether extract on type-2 5α-reductase enzyme and an increase in the amount of testosterone with increasing concentrations.  Conclusion: It could be concluded that petroleum ether extracts of P. niruri might be useful in the treatment of testosterone-induced alopecia in the experimental animal by inhibiting 5α-reductase enzyme.

  18. Presentation and exhibition activities for promoting theexportof transport services

    Darya Vladimirovna Nesterova

    2012-03-01

    Full Text Available Development of presentation and exhibition activities is considered as an important factor in providing new competitive advantages at the strategic markets for exporting of transportation services. A specific role for exhibition activities as a factor to overcome market failures arose from imperfect information and incomplete markets is displayed. Exhibitions are considered as a true reflection of most market parameters, as a means to get correct information concerning market capacity and its borders, as an instrument to access to new markets. At the firm level presentation and branding activities should be considered as a modern technology (especially it concerns Russian companies which provide to hold up already existed markets and to conquer new ones. Presentation and branding activities are an effective technology to promote company trade-mark, competitive advantages for market demand increasing. Comparative analysis of the main exhibitions on transport and logistics issues is fulfilled on the data basecollected by authors. Data observes geographical distribution of transport exhibition and exhibition facilities development at several regions for the last years. The analyses allow to revealing a geographical structure of the exhibitions and its distribution by type of transport. The most promising and economically favorable exhibition areas for the promotion of Russian transport services are shown.

  19. Promotion

    Alam, Hasan B.

    2013-01-01

    This article gives an overview of the promotion process in an academic medical center. A description of different promotional tracks, tenure and endowed chairs, and the process of submitting an application is provided. Finally, some practical advice about developing skills and attributes that can help with academic growth and promotion is dispensed.

  20. ATPase activity measurement of DNA replicative helicase from Bacillus stearothermophilus by malachite green method.

    Yang, Mu; Wang, Ganggang

    2016-09-15

    The DnaB helicase from Bacillus stearothermophilus (DnaBBst) was a model protein for studying the bacterial DNA replication. In this work, a non-radioactive method for measuring ATPase activity of DnaBBst helicase was described. The working parameters and conditions were optimized. Furthermore, this method was applied to investigate effects of DnaG primase, ssDNA and helicase loader protein (DnaI) on ATPase activity of DnaBBst. Our results showed this method was sensitive and efficient. Moreover, it is suitable for the investigation of functional interaction between DnaB and related factors. PMID:27372608

  1. DNA hairpins promote temperature controlled cargo encapsulation in a truncated octahedral nanocage structure family

    Franch, Oskar; Iacovelli, Federico; Falconi, Mattia; Juul, Sissel; Ottaviani, Alessio; Benvenuti, Claudia; Biocca, Silvia; Ho, Yi-Ping; Knudsen, Birgitta R.; Desideri, Alessandro

    2016-07-01

    In the present study we investigate the mechanism behind temperature controlled cargo uptake using a truncated octahedral DNA cage scaffold functionalized with one, two, three or four hairpin forming DNA strands inserted in one corner of the structure. This investigation was inspired by our previous demonstration of temperature controlled reversible encapsulation of the cargo enzyme, horseradish peroxidase, in the cage with four hairpin forming strands. However, in this previous study the mechanism of cargo uptake was not directly addressed (Juul, et al., Temperature-Controlled Encapsulation and Release of an Active Enzyme in the Cavity of a Self-Assembled DNA Nanocage, ACS Nano, 2013, 7, 9724-9734). In the present study we use a combination of molecular dynamics simulations and in vitro analyses to unravel the mechanism of cargo uptake in hairpin containing DNA cages. We find that two hairpin forming strands are necessary and sufficient to facilitate efficient cargo uptake, which argues against a full opening-closing of one corner of the structure being responsible for encapsulation. Molecular dynamics simulations were carried out to evaluate the atomistic motions responsible for encapsulation and showed that the two hairpin forming strands facilitated extension of at least one of the face surfaces of the cage scaffold, allowing entrance of the cargo protein into the cavity of the structure. Hence, the presented data demonstrate that cargo uptake does not involve a full opening of the structure. Rather, the uptake mechanism represents a feature of increased flexibility integrated in this nanocage structure upon the addition of at least two hairpin-forming strands.In the present study we investigate the mechanism behind temperature controlled cargo uptake using a truncated octahedral DNA cage scaffold functionalized with one, two, three or four hairpin forming DNA strands inserted in one corner of the structure. This investigation was inspired by our previous

  2. Protein-DNA interactions in the cAMP responsive promoter region of the murine ornithine decarboxylase gene.

    Palvimo, J J; Eisenberg, L M; Jänne, O A

    1991-01-01

    To evaluate the function of the murine ornithine decarboxylase (ODC) gene promoter, expression of chimeric ODC-chloramphenicol acetyltransferase (CAT) plasmids (pODCcat) containing 1,658 nt of the ODC promoter sequence and its various 5'-deletions was analyzed. In transient expression assays with NIH/3T3 mouse cells, pODCcat constructs exhibited fairly strong promoter activity yielding CAT values up to 40% of those obtained with the viral promoter RSV. Interestingly, 5'-deletions of the pODCc...

  3. Atrazine promotes biochemical changes and DNA damage in a Neotropical fish species.

    Santos, Thais G; Martinez, Cláudia B R

    2012-11-01

    The effects of Atrazine, an herbicide used worldwide and considered as a potential contaminant in aquatic environments, were assessed on the Neotropical fish Prochilodus lineatus acutely (24 and 48 h) exposed to 2 or 10 μg L(-1) of atrazine by using a set of biochemical and genetic biomarkers. The following parameters were measured in the liver: activity of the biotransformation enzymes ethoxyresorufin-O-deethylase (EROD) and glutathione S transferase (GST), antioxidant enzymes superoxide dismutase (SOD), catalase (CAT), glutathione peroxidase (GPx), glutathione reductase (GR), content of reduced glutathione (GSH), generation of reactive oxygen species (ROS) and occurrence of lipid peroxidation (LPO); in brain and muscle the activity of acetylcholinesterase (AChE) and DNA damage (comet assay) on erythrocytes, gills and liver cells. A general decreasing trend on the biotransformation and antioxidant enzymes was observed in the liver of P. lineatus exposed to atrazine; except for GR, all the other antioxidant enzymes (SOD, CAT and GPx) and biotransformation enzymes (EROD and GST) showed inhibited activity. Changes in muscle or brain AChE were not detected. DNA damage was observed in the different cell types of fish exposed to the herbicide, and it was probably not from oxidative origin, since no increase in ROS generation and LPO was detected in the liver. These results show that atrazine behaves as enzyme inhibitor, impairing hepatic metabolism, and produces genotoxic damage to different cell types of P. lineatus. PMID:22739540

  4. ESR1 gene promoter region methylation in free circulating DNA and its correlation with estrogen receptor protein expression in tumor tissue in breast cancer patients

    Tumor expression of estrogen receptor (ER) is an important marker of prognosis, and is predictive of response to endocrine therapy in breast cancer. Several studies have observed that epigenetic events, such methylation of cytosines and deacetylation of histones, are involved in the complex mechanisms that regulate promoter transcription. However, the exact interplay of these factors in transcription activity is not well understood. In this study, we explored the relationship between ER expression status in tumor tissue samples and the methylation of the 5′ CpG promoter region of the estrogen receptor gene (ESR1) isolated from free circulating DNA (fcDNA) in plasma samples from breast cancer patients. Patients (n = 110) with non-metastatic breast cancer had analyses performed of ER expression (luminal phenotype in tumor tissue, by immunohistochemistry method), and the ESR1-DNA methylation status (fcDNA in plasma, by quantitative methylation specific PCR technique). Our results showed a significant association between presence of methylated ESR1 in patients with breast cancer and ER negative status in the tumor tissue (p = 0.0179). There was a trend towards a higher probability of ESR1-methylation in those phenotypes with poor prognosis i.e. 80% of triple negative patients, 60% of HER2 patients, compared to 28% and 5.9% of patients with better prognosis such as luminal A and luminal B, respectively. Silencing, by methylation, of the promoter region of the ESR1 affects the expression of the estrogen receptor protein in tumors of breast cancer patients; high methylation of ESR1-DNA is associated with estrogen receptor negative status which, in turn, may be implicated in the patient’s resistance to hormonal treatment in breast cancer. As such, epigenetic markers in plasma may be of interest as new targets for anticancer therapy, especially with respect to endocrine treatment

  5. Human geminin promotes pre-RC formation and DNA replication by stabilizing CDT1 in mitosis

    Ballabeni, Andrea; Melixetian, Marina; Zamponi, Raffaella;

    2004-01-01

    -mediated degradation by inhibiting its ubiquitination. In particular, Geminin ensures basal levels of CDT1 during S phase and its accumulation during mitosis. Consistently, inhibition of Geminin synthesis during M phase leads to impairment of pre-RC formation and DNA replication during the following cell cycle....... Moreover, we show that inhibition of CDK1 during mitosis, and not Geminin depletion, is sufficient for premature formation of pre-RCs, indicating that CDK activity is the major mitotic inhibitor of licensing in human cells. Taken together with recent data from our laboratory, our results demonstrate that...

  6. A PHF8 homolog in C. elegans promotes DNA repair via homologous recombination.

    Changrim Lee

    Full Text Available PHF8 is a JmjC domain-containing histone demethylase, defects in which are associated with X-linked mental retardation. In this study, we examined the roles of two PHF8 homologs, JMJD-1.1 and JMJD-1.2, in the model organism C. elegans in response to DNA damage. A deletion mutation in either of the genes led to hypersensitivity to interstrand DNA crosslinks (ICLs, while only mutation of jmjd-1.1 resulted in hypersensitivity to double-strand DNA breaks (DSBs. In response to ICLs, JMJD-1.1 did not affect the focus formation of FCD-2, a homolog of FANCD2, a key protein in the Fanconi anemia pathway. However, the dynamic behavior of RPA-1 and RAD-51 was affected by the mutation: the accumulations of both proteins at ICLs appeared normal, but their subsequent disappearance was retarded, suggesting that later steps of homologous recombination were defective. Similar changes in the dynamic behavior of RPA-1 and RAD-51 were seen in response to DSBs, supporting a role of JMJD-1.1 in homologous recombination. Such a role was also supported by our finding that the hypersensitivity of jmjd-1.1 worms to ICLs was rescued by knockdown of lig-4, a homolog of Ligase 4 active in nonhomologous end-joining. The hypersensitivity of jmjd-1.1 worms to ICLs was increased by rad-54 knockdown, suggesting that JMJD-1.1 acts in parallel with RAD-54 in modulating chromatin structure. Indeed, the level of histone H3 Lys9 tri-methylation, a marker of heterochromatin, was higher in jmjd-1.1 cells than in wild-type cells. We conclude that the histone demethylase JMJD-1.1 influences homologous recombination either by relaxing heterochromatin structure or by indirectly regulating the expression of multiple genes affecting DNA repair.

  7. Structure of a topoisomerase II-DNA-nucleotide complex reveals a new control mechanism for ATPase activity.

    Schmidt, Bryan H; Osheroff, Neil; Berger, James M

    2012-11-01

    Type IIA topoisomerases control DNA supercoiling and disentangle chromosomes through a complex ATP-dependent strand-passage mechanism. Although a general framework exists for type IIA topoisomerase function, the architecture of the full-length enzyme has remained undefined. Here we present the structure of a fully catalytic Saccharomyces cerevisiae topoisomerase II homodimer complexed with DNA and a nonhydrolyzable ATP analog. The enzyme adopts a domain-swapped configuration wherein the ATPase domain of one protomer sits atop the nucleolytic region of its partner subunit. This organization produces an unexpected interaction between bound DNA and a conformational transducing element in the ATPase domain, which we show is critical for both DNA-stimulated ATP hydrolysis and global topoisomerase activity. Our data indicate that the ATPase domains pivot about each other to ensure unidirectional strand passage and that this state senses bound DNA to promote ATP turnover and enzyme reset. PMID:23022727

  8. Self DNA from lymphocytes that have undergone activation-induced cell death enhances murine B cell proliferation and antibody production.

    Qing Lu

    Full Text Available Systemic lupus erythematosus (SLE is characterized by prominent autoinflammatory tissue damage associated with impaired removal of dying cells and DNA. Self DNA-containing immune complexes are able to activate both innate and adaptive immune responses and play an important role in the maintenance and exacerbation of autoimmunity in SLE. In this study, we used DNA from lymphocytes that have undergone activation-induced cell death (ALD-DNA and analyzed its role on the activation and differentiation of B cells from normal BALB/c mice as well as lupus-prone MRL+/+ and MRL/lpr mice. We found that ALD-DNA directly increased the expression of costimulatory molecules and the survival of naïve B cells in vitro. Although ALD-DNA alone had little effect on the proliferation of naïve B cells, it enhanced LPS-activated B cell proliferation in vitro and in vivo. In addition, ALD-DNA increased plasma cell numbers and IgG production in LPS-stimulated cultures of naïve B cells, in part via enhancing IL-6 production. Importantly, B cells from lupus mice were hyperresponsive to ALD-DNA and/or LPS relative to normal control B cells in terminal plasma cell differentiation, as evidenced by increases in CD138+ cell numbers, IgM production, and mRNA levels of B lymphocyte-induced maturation protein-1 (Blimp-1 and the X-box binding protein 1 (XBP1. Furthermore, ALD-DNA enhanced CD40-activated naïve B cell proliferation. Collectively, these data indicate that self DNA can serve as a DAMP (damage-associated molecular pattern that cooperates with signals from both innate and adaptive immunity to promote polyclonal B cell activation, a common characteristic of autoimmune diseases.

  9. A novel type of DNA-binding protein interacts with a conserved sequence in an early nodulin ENOD12 promoter

    Christiansen, H; Hansen, A C; Vijn, I;

    1996-01-01

    in the nodule parenchyma and meristem. The presence of three small overlapping ORFs in the 5'-untranslated region of the ENBP1 cDNA indicates that ENBP1 expression might be regulated at the translational level. The interaction of ENBP1 with a conserved AT-rich element within the ENOD12 promoter and...

  10. Glycine Receptor α2 Subunit Activation Promotes Cortical Interneuron Migration

    Ariel Avila

    2013-08-01

    Full Text Available Glycine receptors (GlyRs are detected in the developing CNS before synaptogenesis, but their function remains elusive. This study demonstrates that functional GlyRs are expressed by embryonic cortical interneurons in vivo. Furthermore, genetic disruption of these receptors leads to interneuron migration defects. We discovered that extrasynaptic activation of GlyRs containing the α2 subunit in cortical interneurons by endogenous glycine activates voltage-gated calcium channels and promotes calcium influx, which further modulates actomyosin contractility to fine-tune nuclear translocation during migration. Taken together, our data highlight the molecular events triggered by GlyR α2 activation that control cortical tangential migration during embryogenesis.

  11. Hemi-methylated DNA regulates DNA methylation inheritance through allosteric activation of H3 ubiquitylation by UHRF1

    Harrison, Joseph S; Cornett, Evan M; Goldfarb, Dennis; DaRosa, Paul A; Li, Zimeng M; Yan, Feng; Dickson, Bradley M; Guo, Angela H; Cantu, Daniel V; Kaustov, Lilia; Brown, Peter J; Arrowsmith, Cheryl H; Erie, Dorothy A; Major, Michael B; Klevit, Rachel E; Krajewski, Krzysztof; Kuhlman, Brian; Strahl, Brian D; Rothbart, Scott B

    2016-01-01

    The epigenetic inheritance of DNA methylation requires UHRF1, a histone- and DNA-binding RING E3 ubiquitin ligase that recruits DNMT1 to sites of newly replicated DNA through ubiquitylation of histone H3. UHRF1 binds DNA with selectivity towards hemi-methylated CpGs (HeDNA); however, the contribution of HeDNA sensing to UHRF1 function remains elusive. Here, we reveal that the interaction of UHRF1 with HeDNA is required for DNA methylation but is dispensable for chromatin interaction, which is governed by reciprocal positive cooperativity between the UHRF1 histone- and DNA-binding domains. HeDNA recognition activates UHRF1 ubiquitylation towards multiple lysines on the H3 tail adjacent to the UHRF1 histone-binding site. Collectively, our studies are the first demonstrations of a DNA-protein interaction and an epigenetic modification directly regulating E3 ubiquitin ligase activity. They also define an orchestrated epigenetic control mechanism involving modifications both to histones and DNA that facilitate UHRF1 chromatin targeting, H3 ubiquitylation, and DNA methylation inheritance. DOI: http://dx.doi.org/10.7554/eLife.17101.001 PMID:27595565

  12. Hepatitis B virus basal core promoter mutations show lower replication fitness associated with cccDNA acetylation status.

    Koumbi, Lemonica; Pollicino, Teresa; Raimondo, Giovanni; Stampoulis, Dimitrios; Khakoo, Salim; Karayiannis, Peter

    2016-07-15

    In chronic hepatitis B virus (HBV) infection, variants with mutations in the basal core promoter (BCP) and precore region predominate and associate with more severe disease forms. Studies on their effect on viral replication remain controversial. Increasing evidence shows that epigenetic modifications of cccDNA regulate HBV replication and disease outcome. Here we determined the transcription and viral replication efficiency of well-defined BCP and precore mutations and their effect on cccDNA epigenetic control. HBV monomers bearing BCP mutations A1762T/G1764A and A1762T/G1764A/C1766T, and precore mutations G1896A, G1899A and G1896A/G1899A, were transfected into HepG2 cells using a plasmid-free approach. Viral RNA transcripts were detected by Northern blot hybridization and RT PCR, DNA replicative intermediates by Southern blotting and RT PCR, and viral release was measured by ELISA. Acetylation of cccDNA-bound histones was assessed by Chromatin ImmunoPrecipitation (ChIP) assay and methylation of cccDNA by bisulfite sequencing. BCP mutations resulted in low viral release, mRNA transcription and pgRNA/cccDNA ratios that paralleled the acetylation of cccDNA-bound H4 histone and inversely correlated with the HDAC1 recruitment onto cccDNA. Independently of the mutations, cccDNA was a target for methylation, accompanied by the upregulation of DNMT1 expression and DNMT1 recruitment onto cccDNA. Our results suggest that BCP mutations decrease viral replication capacity possibly by modulating the acetylation and deacetylation of cccDNA-bound histones while precore mutations do not have a significant effect on viral replication. These data provide evidence that epigenetic factors contribute to the regulation of HBV viral replication. PMID:27132039

  13. Activation of the ATM-Snail pathway promotes breast cancer metastasis

    Sun, Mianen; Guo, Xiaojing; Qian, Xiaolong; Wang, Haibo; Yang, Chunying; Brinkman, Kathryn L.; Serrano-Gonzalez, Monica; Jope, Richard S.; Zhou, Binhua; Engler, David A.; Zhan, Ming; Wong, Stephen T.C.; Fu, Li; Xu, Bo

    2012-01-01

    The DNA damage response (DDR) is critical for the maintenance of genetic stability and serves as an anti-cancer barrier during early tumorigenesis. However, the role of the DDR in tumor progression and metastasis is less known. Here, we demonstrate that the ATM kinase, one of the critical DDR elements, is hyperactive in late stage breast tumor tissues with lymph-node metastasis and this hyperactivity correlates with elevated expression of the epithelial–mesenchymal transition marker, Snail. At the molecular level, we demonstrate that ATM regulates Snail stabilization by phosphorylation on Serine-100. Using mass spectrometry, we identified HSP90 as a critical binding protein of Snail in response to DNA damage. HSP90 binds to and stabilizes phosphorylated Snail. We further provide in vitro and in vivo evidence that activation of ATM-mediated Snail phosphorylation promotes tumor invasion and metastasis. Finally, we demonstrate that Snail Serine-100 phosphorylation is elevated in breast cancer tissues with lymph-node metastasis, indicating clinical significance of the ATM-Snail pathway. Together, our findings provide strong evidence that the ATM-Snail pathway promotes tumor metastasis, highlighting a previously undescribed role of the DDR in tumor invasion and metastasis. PMID:22923499

  14. Activation of the ATM-Snail pathway promotes breast cancer metastasis

    Mianen Sun; David A. Engler; Ming Zhan; Stephen T.C. Wong; Li Fu; Bo Xu; Xiaojing Guo; Xiaolong Qian; Haibo Wang; Chunying Yang; Kathryn L. Brinkman; Monica Serrano-Gonzalez; Richard S. Jope; Binhua Zhou

    2012-01-01

    The DNA damage response (DDR) is critical for the maintenance of genetic stability and serves as an anti-cancer barrier during early tumorigenesis.However,the role of the DDR in tumor progression and metastasis is less known.Here,we demonstrate that the ATM kinase,one of the critical DDR elements,is hyperactive in late stage breast tumor tissues with lymph-node metastasis and this hyperactivity correlates with elevated expression of the epitheliai-mesenchymal transition marker,Snail.At the molecular level,we demonstrate that ATM regulates Snail stabilization by phosphorylation on Serine-100.Using mass spectrometry,we identified HSP90 as a critical binding protein of Snail in response to DNA damage.HsP9o binds to and stabilizes phosphorylated Snail.We further provide in vitro and in vivo evidence that activation of ATM-mediated Snail phosphorylation promotes tumor invasion and metastasis.Finally,we demonstrate that Snail Serine-100 phosphorylation is elevated in breast cancer tissues with lymph-node metastasis,indicating clinical significance of the ATM-Snail pathway.Together,our findings provide strong evidence that the ATM-Snail pathway promotes tumor metastasis,highlighting a previously undescribed role of the DDR in tumor invasion and metastasis.

  15. Photon-induced cell migration and integrin expression promoted by DNA integration of HPV16 genome

    Persistent human papilloma virus 16 (HPV16) infections are a major cause of cervical cancer. The integration of the viral DNA into the host genome causes E2 gene disruption which prevents apoptosis and increases host cell motility. In cervical cancer patients, survival is limited by local infiltration and systemic dissemination. Surgical control rates are poor in cases of parametrial infiltration. In these patients, radiotherapy (RT) is administered to enhance local control. However, photon irradiation itself has been reported to increase cell motility. In cases of E2-disrupted cervical cancers, this phenomenon would impose an additional risk of enhanced tumor cell motility. Here, we analyze mechanisms underlying photon-increased migration in keratinocytes with differential E2 gene status. Isogenic W12 (intact E2 gene status) and S12 (disrupted E2 gene status) keratinocytes were analyzed in fibronectin-based and serum-stimulated migration experiments following single photon doses of 0, 2, and 10 Gy. Quantitative FACS analyses of integrin expression were performed. Migration and adhesion are increased in E2 gene-disrupted keratinocytes. E2 gene disruption promotes attractability by serum components, therefore, effectuating the risk of local infiltration and systemic dissemination. In S12 cells, migration is further increased by photon RT which leads to enhanced expression of fibronectin receptor integrins. HPV16-associated E2 gene disruption is a main predictor of treatment-refractory cancer virulence. E2 gene disruption promotes cell motility. Following photon RT, E2-disrupted tumors bear the risk of integrin-related infiltration and dissemination. (orig.)

  16. Bacterial lipopolysaccharide promotes profibrotic activation of intestinal fibroblasts.

    Burke, J P

    2012-02-01

    BACKGROUND: Fibroblasts play a critical role in intestinal wound healing. Lipopolysaccharide (LPS) is a cell wall component of commensal gut bacteria. The effects of LPS on intestinal fibroblast activation were characterized. METHODS: Expression of the LPS receptor, toll-like receptor (TLR) 4, was assessed in cultured primary human intestinal fibroblasts using flow cytometry and confocal microscopy. Fibroblasts were treated with LPS and\\/or transforming growth factor (TGF) beta1. Nuclear factor kappaB (NFkappaB) pathway activation was assessed by inhibitory kappaBalpha (IkappaBalpha) degradation and NFkappaB promoter activity. Fibroblast contractility was measured using a fibroblast-populated collagen lattice. Smad-7, a negative regulator of TGF-beta1 signalling, and connective tissue growth factor (CTGF) expression were assessed using reverse transcriptase-polymerase chain reaction and western blot. The NFkappaB pathway was inhibited by IkappaBalpha transfection. RESULTS: TLR-4 was present on the surface of intestinal fibroblasts. LPS treatment of fibroblasts induced IkappaBalpha degradation, enhanced NFkappaB promoter activity and increased collagen contraction. Pretreatment with LPS (before TGF-beta1) significantly increased CTGF production relative to treatment with TGF-beta1 alone. LPS reduced whereas TGF-beta1 increased smad-7 expression. Transfection with an IkappaBalpha plasmid enhanced basal smad-7 expression. CONCLUSION: Intestinal fibroblasts express TLR-4 and respond to LPS by activating NFkappaB and inducing collagen contraction. LPS acts in concert with TGF-beta1 to induce CTGF. LPS reduces the expression of the TGF-beta1 inhibitor, smad-7.

  17. Expressing activity of promoter elements of large intergenic region from cotton leaf curl virus in host plant*

    2001-01-01

    Cotton leaf curl virus (CLCuV) is a type of single-stranded DNAvirus, belonging to geminivirus of subgroup III. In order to determine the function of CLCuV large intergenic region (LIR), total DNA of CLCuV-infected cotton leaves was used as template, and fragment of LIR was obtained by PCR and inserted into clone vector. The fragment of LIR was fused with gus reporter gene and nos terminator in the orientation of transcription of virion sense and complementary sense respectively, and the plant expression vectors were constructed. GUS activity of Agrobacterium-mediated transgenic tobacco was measured. The result indicated that LIR showed strong promoter activity in complementary sense gene orientation. Average GUS activity of the complementary sense promoter was 5-6 times that of CaMV 35S promoter, and the highest GUS activity of individual plant was ten times of that of CaMV 35S promoter. Histochemical localization confirmed its activity in both mesophyll and vascular tissues. Activity of virion sense of LIR was rather low. Thus LIR isolated from CLCuV could be used as a novel strong promoter in plant genetic manipulation.

  18. Differential effects of dimethylsulfoxide on the activities of human DNA polymerases alpha and delta.

    Lee, M Y; Toomey, N L

    1986-01-01

    The effects of dimethylsulfoxide on the activities of purified human placental DNA polymerase alpha and DNA polymerase delta were examined. DNA polymerase alpha was inhibited by dimethylsulfoxide, whereas DNA polymerase delta was significantly activated, by as much as 6-fold. Kinetic data show that the effect of dimethylsulfoxide on DNA polymerase delta activity was due to a reduction in the apparent Km for its substrate, dTTP. This novel finding of the differential effects of dimethylsulfoxi...

  19. Active Fantasy Sports: Rationale and Feasibility of Leveraging Online Fantasy Sports to Promote Physical Activity

    Majewski, Sara; Standish, Melanie; Agarwal, Pooja; Podowski, Aleksandra; Carson, Rebecca; Eyesus, Biruk; Shah, Aakash; Schneider, Kristin L

    2014-01-01

    Background The popularity of active video games (AVGs) has skyrocketed over the last decade. However, research suggests that the most popular AVGs, which rely on synchronous integration between players’ activity and game features, fail to promote physical activity outside of the game or for extended periods of engagement. This limitation has led researchers to consider AVGs that involve asynchronous integration of players’ ongoing physical activity with game features. Rather than build an AVG de novo, we selected an established sedentary video game uniquely well suited for the incorporation of asynchronous activity: online fantasy sports. Objective The primary aim of this study was to explore the feasibility of a new asynchronous AVG—active fantasy sports—designed to promote physical activity. Methods We conducted two pilot studies of an active fantasy sports game designed to promote physical activity. Participants wore a low cost triaxial accelerometer and participated in an online fantasy baseball (Study 1, n=9, 13-weeks) or fantasy basketball (Study 2, n=10, 17-weeks) league. Privileges within the game were made contingent on meeting weekly physical activity goals (eg, averaging 10,000 steps/day). Results Across the two studies, the feasibility of integrating physical activity contingent features and privileges into online fantasy sports games was supported. Participants found the active fantasy sports game enjoyable, as or more enjoyable than traditional (sedentary) online fantasy sports (Study 1: t 8=4.43, P<.01; Study 2: t 9=2.09, P=.07). Participants in Study 1 increased their average steps/day, t 8=2.63, P<.05, while participants in Study 2 maintained (ie, did not change) their activity, t 9=1.57, P=.15). In postassessment interviews, social support within the game was cited as a key motivating factor for increasing physical activity. Conclusions Preliminary evidence supports potential for the active fantasy sports system as a sustainable and

  20. Selective modulation of promoter recruitment and transcriptional activity of PPARγ

    Peroxisome proliferator-activated receptor gamma (PPARγ) is a nuclear receptor regulated by the insulin-sensitizing thiazolidinediones (TZDs). We studied selective modulation of endogenous genes by PPARγ ligands using microarray, RNA expression kinetics, and chromatin immunoprecipitation (ChIP) in 3T3-L1 adipocytes. We found over 300 genes that were significantly regulated the TZDs pioglitazone, rosiglitazone, and troglitazone. TZD-mediated expression profiles were unique but overlapping. Ninety-one genes were commonly regulated by all three ligands. TZD time course and dose-response studies revealed gene- and TZD-specific expression kinetics. PEPCK expression was induced rapidly but PDK4 expression was induced gradually. Troglitazone EC50 values for PEPCK, PDK4, and RGS2 regulation were greater than those for pioglitazone and rosiglitazone. TZDs differentially induced histone acetylation of and PPARγ recruitment to target gene promoters. Selective modulation of PPARγ by TZDs resulted in distinct expression profiles and transcription kinetics which may be due to differential promoter activation and chromatin remodeling of target genes

  1. Low LET radiation-induced telomerase catalytic subunit promoter activation is mediated by nuclear factor Kappa B

    Full text: The objective of this study is to understand whether low doses of low LET radiation induces survival advantage in normal cells. As an increase in telomerase activity is associated with longevity and cell proliferation, we examined the telomerase response following gamma-irradiation in normal aortic endothelial cells. Telomeric Repeat Amplification Protocol assay following low LET radiation showed an increase in telomerase enzyme activity as early as 8 h post irradiation and reaches its maximum at 24 h. Subsequent analysis revealed that the increased telomerse enzyme activity is due to increased synthesis resulting from an increased transcription. Examination of transcriptional activation of telomerase reverse transcriptase (TERT) promoter regulation showed an enhanced transcription of the telomerse gene following gamma-irradiation. In our previous reports we documented an increase in NF-kB DNA-binding property following low LET radiation (3). Therefore, to determine whether the activation of NF-kB-signaling is responsible for induced TERT promoter activation, cells transiently transfected with minimal promoter region of TERT containing wild type or mutant NF-kB binding site were examined following low LET radiation. TERT promoter activation was induced in wild type transfected cells whereas, in mutant kB binding site, the activation remained at the basal level similar to that of un-irradiated cells. More significantly, the gamma-ray mediated promoter activation of telomerase gene as well as induce telomerase enzyme activity was abrogated by ectopically expressing the IkBa mutant (IkBa (S32A/S36A)), which blocks NF-kB activation. The results thus suggest that exposure to low LET radiation could induce telomerase activity and the activation is at least, in part, mediated by the transcription factor NF-kB. Sustained activation of telomerase in these cells after low LET radiation may impart extended life span

  2. Active Aging Promotion: Results from the Vital Aging Program

    Mariagiovanna Caprara

    2013-01-01

    Full Text Available Active aging is one of the terms in the semantic network of aging well, together with others such as successful, productive, competent aging. All allude to the new paradigm in gerontology, whereby aging is considered from a positive perspective. Most authors in the field agree active aging is a multidimensional concept, embracing health, physical and cognitive fitness, positive affect and control, social relationships and engagement. This paper describes Vital Aging, an individual active aging promotion program implemented through three modalities: Life, Multimedia, and e-Learning. The program was developed on the basis of extensive evidence about individual determinants of active aging. The different versions of Vital Aging are described, and four evaluation studies (both formative and summative are reported. Formative evaluation reflected participants’ satisfaction and expected changes; summative evaluations yielded some quite encouraging results using quasi-experimental designs: those who took part in the programs increased their physical exercise, significantly improved their diet, reported better memory, had better emotional balance, and enjoyed more cultural, intellectual, affective, and social activities than they did before the course, thus increasing their social relationships. These results are discussed in the context of the common literature within the field and, also, taking into account the limitations of the evaluations accomplished.

  3. The nuclear protein Artemis promotes AMPK activation by stabilizing the LKB1–AMPK complex

    Highlights: ► The nuclear protein Artemis physically interacts with AMPKα2. ► Artemis co-localizes with AMPKα2 in the nucleus. ► Artemis promotes phosphorylation and activation of AMPK. ► The interaction between AMPKα2 and LKB1 is stabilized by Artemis. -- Abstract: AMP-activated protein kinase (AMPK) is a hetero-trimeric Ser/Thr kinase composed of a catalytic α subunit and regulatory β and γ subunits; it functions as an energy sensor that controls cellular energy homeostasis. In response to an increased cellular AMP/ATP ratio, AMPK is activated by phosphorylation at Thr172 in the α-subunit by upstream AMPK kinases (AMPKKs), including tumor suppressor liver kinase B1 (LKB1). To elucidate more precise molecular mechanisms of AMPK activation, we performed yeast two-hybrid screening and isolated the complementary DNA (cDNA) encoding the nuclear protein Artemis/DNA cross-link repair 1C (DCLRE1C) as an AMPKα2-binding protein. Artemis was found to co-immunoprecipitate with AMPKα2, and the co-localization of Artemis with AMPKα2 in the nucleus was confirmed by immunofluorescence staining in U2OS cells. Moreover, over-expression of Artemis enhanced the phosphorylation of AMPKα2 and the AMPK substrate acetyl-CoA carboxylase (ACC). Conversely, RNAi-mediated knockdown of Artemis reduced AMPK and ACC phosphorylation. In addition, Artemis markedly increased the physical association between AMPKα2 and LKB1. Taken together, these results suggest that Artemis functions as a positive regulator of AMPK signaling by stabilizing the LKB1–AMPK complex.

  4. The nuclear protein Artemis promotes AMPK activation by stabilizing the LKB1-AMPK complex

    Nakagawa, Koji, E-mail: k_nakagawa@pharm.hokudai.ac.jp [Department of Pathophysiology and Therapeutics, Division of Pharmascience, Faculty of Pharmaceutical Sciences, Hokkaido University, N12 W6, Kita-ku, Sapporo, Hokkaido 060-0812 (Japan); Uehata, Yasuko; Natsuizaka, Mitsuteru; Kohara, Toshihisa; Darmanin, Stephanie [Department of Gastroenterology and Hematology, Graduate School of Medicine, Hokkaido University, N15 W7, Kita-ku, Sapporo, Hokkaido 060-8638 (Japan); Asaka, Masahiro [Department of Gastroenterology and Hematology, Graduate School of Medicine, Hokkaido University, N15 W7, Kita-ku, Sapporo, Hokkaido 060-8638 (Japan); Department of Cancer Preventive Medicine, Graduate School of Medicine, Hokkaido University, N15 W7, Kita-ku, Sapporo, Hokkaido 060-8638 (Japan); Takeda, Hiroshi [Department of Pathophysiology and Therapeutics, Division of Pharmascience, Faculty of Pharmaceutical Sciences, Hokkaido University, N12 W6, Kita-ku, Sapporo, Hokkaido 060-0812 (Japan); Department of Gastroenterology and Hematology, Graduate School of Medicine, Hokkaido University, N15 W7, Kita-ku, Sapporo, Hokkaido 060-8638 (Japan); Kobayashi, Masanobu [Department of Cancer Preventive Medicine, Graduate School of Medicine, Hokkaido University, N15 W7, Kita-ku, Sapporo, Hokkaido 060-8638 (Japan); School of Nursing and Social Services, Health Sciences University of Hokkaido, Ishikari-Toubetsu, Hokkaido 061-0293 (Japan)

    2012-11-02

    Highlights: Black-Right-Pointing-Pointer The nuclear protein Artemis physically interacts with AMPK{alpha}2. Black-Right-Pointing-Pointer Artemis co-localizes with AMPK{alpha}2 in the nucleus. Black-Right-Pointing-Pointer Artemis promotes phosphorylation and activation of AMPK. Black-Right-Pointing-Pointer The interaction between AMPK{alpha}2 and LKB1 is stabilized by Artemis. -- Abstract: AMP-activated protein kinase (AMPK) is a hetero-trimeric Ser/Thr kinase composed of a catalytic {alpha} subunit and regulatory {beta} and {gamma} subunits; it functions as an energy sensor that controls cellular energy homeostasis. In response to an increased cellular AMP/ATP ratio, AMPK is activated by phosphorylation at Thr172 in the {alpha}-subunit by upstream AMPK kinases (AMPKKs), including tumor suppressor liver kinase B1 (LKB1). To elucidate more precise molecular mechanisms of AMPK activation, we performed yeast two-hybrid screening and isolated the complementary DNA (cDNA) encoding the nuclear protein Artemis/DNA cross-link repair 1C (DCLRE1C) as an AMPK{alpha}2-binding protein. Artemis was found to co-immunoprecipitate with AMPK{alpha}2, and the co-localization of Artemis with AMPK{alpha}2 in the nucleus was confirmed by immunofluorescence staining in U2OS cells. Moreover, over-expression of Artemis enhanced the phosphorylation of AMPK{alpha}2 and the AMPK substrate acetyl-CoA carboxylase (ACC). Conversely, RNAi-mediated knockdown of Artemis reduced AMPK and ACC phosphorylation. In addition, Artemis markedly increased the physical association between AMPK{alpha}2 and LKB1. Taken together, these results suggest that Artemis functions as a positive regulator of AMPK signaling by stabilizing the LKB1-AMPK complex.

  5. O6-Methylguanine-DNA Methyltransferase (MGMT) mRNA Expression Predicts Outcome in Malignant Glioma Independent of MGMT Promoter Methylation

    Simone Kreth; Niklas Thon; Sabina Eigenbrod; Juergen Lutz; Carola Ledderose; Rupert Egensperger; Tonn, Joerg C.; Kretzschmar, Hans A.; Ludwig C Hinske; Kreth, Friedrich W.

    2011-01-01

    Background: We analyzed prospectively whether MGMT (O(6)-methylguanine-DNA methyltransferase) mRNA expression gains prognostic/predictive impact independent of MGMT promoter methylation in malignant glioma patients undergoing radiotherapy with concomitant and adjuvant temozolomide or temozolomide alone. As DNA-methyltransferases (DNMTs) are the enzymes responsible for setting up and maintaining DNA methylation patterns in eukaryotic cells, we analyzed further, whether MGMT promoter methylatio...

  6. Activities of a lagging DNA strand synthesis of nucleoprotein complexes harboring an extrachromosomal DNA closely related to avian myeloblastosis virus core-bound DNA

    Nucleoprotein (NP) complexes constituting the material of the post-microsomal sediment (POMS) and its three basic components (A, B, C), harboring an extrachromosomal DNA closely related to AMV DNA were found to.possess DNA- and RNA-synthesizing activities (SAs) reflecting the ability of this material to be intensely labelled for DNA and RNA, respectively. The types of these NA-SAs were compatible with those significant for a lagging DNA strand synthesis (LSS). The use of selective inhibitors and of the proliferating cell nuclear antigen (PCNA) disclosed a successive involvement of alpha DNA polymerase (pol) and PCNA-insensitive delta DNA pol in LSS. In this respect, we show gradual changes in the representation of activities (As) of both mentioned DNA pols in the NP complexes of the individual POMS components. Those of POMS component C contained alpha DNA pol As only, while a distinct portion of DNA SAs of POMS component B was represented on expense of alpha DNA pol As by PCNA-insensitive delta DNA pol (epsilon DNA pol), As which represented practically all the DNA SAs of POMS component A. The type of RNA SAs of this material represented mostly by primase (Pr) As corresponded well with the nature of LSS. An exception was represented by a minor portion of RNA-SAs of POMS component A which was alpha amanitine-sensitive like RNA pol II. Moreover, analyzing this natural model replication system, we found that the carbonyl diphosphonate (COMDP), a selective inhibitor of the PCNA-insensitive delta DNA pol, was a strong activator of Pr-As and/or Pr-alpha DNA pol As of NP complexes of POMS component C. (authors)

  7. Identification of a Cryptic Bacterial Promoter in Mouse (mdr1a P-Glycoprotein cDNA.

    Kristen M Pluchino

    Full Text Available The efflux transporter P-glycoprotein (P-gp is an important mediator of various pharmacokinetic parameters, being expressed at numerous physiological barriers and also in multidrug-resistant cancer cells. Molecular cloning of homologous cDNAs is an important tool for the characterization of functional differences in P-gp between species. However, plasmids containing mouse mdr1a cDNA display significant genetic instability during cloning in bacteria, indicating that mdr1a cDNA may be somehow toxic to bacteria, allowing only clones containing mutations that abrogate this toxicity to survive transformation. We demonstrate here the presence of a cryptic promoter in mouse mdr1a cDNA that causes mouse P-gp expression in bacteria. This expression may account for the observed toxicity of mdr1a DNA to bacteria. Sigma 70 binding site analysis and GFP reporter plasmids were used to identify sequences in the first 321 bps of mdr1a cDNA capable of initiating bacterial protein expression. An mdr1a M107L cDNA containing a single residue mutation at the proposed translational start site was shown to allow sub-cloning of mdr1a in E. coli while retaining transport properties similar to wild-type P-gp. This mutant mdr1a cDNA may prove useful for efficient cloning of mdr1a in E. coli.

  8. Sequence-directed nucleosome-depletion is sufficient to activate transcription from a yeast core promoter in vivo.

    Ichikawa, Yuichi; Morohashi, Nobuyuki; Tomita, Nobuyuki; Mitchell, Aaron P; Kurumizaka, Hitoshi; Shimizu, Mitsuhiro

    2016-07-22

    Nucleosome-depleted regions (NDRs) (also called nucleosome-free regions or NFRs) are often found in the promoter regions of many yeast genes, and are formed by multiple mechanisms, including the binding of activators and enhancers, the actions of chromatin remodeling complexes, and the specific DNA sequences themselves. However, it remains unclear whether NDR formation per se is essential for transcriptional activation. Here, we examined the relationship between nucleosome organization and gene expression using a defined yeast reporter system, consisting of the CYC1 minimal core promoter and the lacZ gene. We introduced simple repeated sequences that should be either incorporated in nucleosomes or excluded from nucleosomes in the site upstream of the TATA boxes. The (CTG)12, (GAA)12 and (TGTAGG)6 inserts were incorporated into a positioned nucleosome in the core promoter region, and did not affect the reporter gene expression. In contrast, the insertion of (CGG)12, (TTAGGG)6, (A)34 or (CG)8 induced lacZ expression by 10-20 fold. Nucleosome mapping analyses revealed that the inserts that induced the reporter gene expression prevented nucleosome formation, and created an NDR upstream of the TATA boxes. Thus, our results demonstrated that NDR formation dictated by DNA sequences is sufficient for transcriptional activation from the core promoter in vivo. PMID:27208777

  9. A complex genetic switch involving overlapping divergent promoters and DNA looping regulates expression of conjugation genes of a gram-positive plasmid.

    Gayetri Ramachandran

    2014-10-01

    Full Text Available Plasmid conjugation plays a significant role in the dissemination of antibiotic resistance and pathogenicity determinants. Understanding how conjugation is regulated is important to gain insights into these features. Little is known about regulation of conjugation systems present on plasmids from Gram-positive bacteria. pLS20 is a native conjugative plasmid from the Gram-positive bacterium Bacillus subtilis. Recently the key players that repress and activate pLS20 conjugation have been identified. Here we studied in detail the molecular mechanism regulating the pLS20 conjugation genes using both in vivo and in vitro approaches. Our results show that conjugation is subject to the control of a complex genetic switch where at least three levels of regulation are integrated. The first of the three layers involves overlapping divergent promoters of different strengths regulating expression of the conjugation genes and the key transcriptional regulator RcoLS20. The second layer involves a triple function of RcoLS20 being a repressor of the main conjugation promoter and an activator and repressor of its own promoter at low and high concentrations, respectively. The third level of regulation concerns formation of a DNA loop mediated by simultaneous binding of tetrameric RcoLS20 to two operators, one of which overlaps with the divergent promoters. The combination of these three layers of regulation in the same switch allows the main conjugation promoter to be tightly repressed during conditions unfavorable to conjugation while maintaining the sensitivity to accurately switch on the conjugation genes when appropriate conditions occur. The implications of the regulatory switch and comparison with other genetic switches involving DNA looping are discussed.

  10. 7 CFR 981.441 - Credit for market promotion activities, including paid advertising.

    2010-01-01

    ... 7 Agriculture 8 2010-01-01 2010-01-01 false Credit for market promotion activities, including paid... promotion activities, including paid advertising. (a) In order for a handler to receive credit for his/her... each activity shall be to promote the sale, consumption or use of California almonds, and...

  11. Prognostic Significance of Promoter DNA Hypermethylation of cysteine dioxygenase 1 (CDO1 Gene in Primary Breast Cancer.

    Naoko Minatani

    Full Text Available Using pharmacological unmasking microarray, we identified promoter DNA methylation of cysteine dioxygenase 1 (CDO1 gene in human cancer. In this study, we assessed the clinicopathological significance of CDO1 methylation in primary breast cancer (BC with no prior chemotherapy. The CDO1 DNA methylation was quantified by TaqMan methylation specific PCR (Q-MSP in 7 BC cell lines and 172 primary BC patients with no prior chemotherapy. Promoter DNA of the CDO1 gene was hypermethylated in 6 BC cell lines except SK-BR3, and CDO1 gene expression was all silenced at mRNA level in the 7 BC cell lines. Quantification of CDO1 methylation was developed using Q-MSP, and assessed in primary BC. Among the clinicopathologic factors, CDO1 methylation level was not statistically significantly associated with any prognostic factors. The log-rank plot analysis elucidated that the higher methylation the tumors harbored, the poorer prognosis the patients exhibited. Using the median value of 58.0 as a cut-off one, disease specific survival in BC patients with CDO1 hypermethylation showed significantly poorer prognosis than those with hypomethylation (p = 0.004. Multivariate Cox proportional hazards model identified that CDO1 hypermethylation was prognostic factor as well as Ki-67 and hormone receptor status. The most intriguingly, CDO1 hypermethylation was of robust prognostic relevance in triple negative BC (p = 0.007. Promoter DNA methylation of CDO1 gene was robust prognostic indicator in primary BC patients with no prior chemotherapy. Prognostic relevance of the CDO1 promoter DNA methylation is worthy of being paid attention in triple negative BC cancer.

  12. Gene cloning, structural gene and promoter identification, and active assay of the phosphatidylcholine synthase of Pseudomonas sp. strain 593.

    He, Huoguang; Wu, Bin; Xiong, Min; Li, Yang; Wu, Wenhua; Wang, Xingguo

    2011-10-01

    Pseudomonas sp. strain 593, a soil bacterium, is able to use exogenous choline to synthesize phosphatidylcholine via phosphatidylcholine synthase (Pcs). A 2020 bp DNA fragment that hybridized to a Pcs probe was cloned. This fragment contained a large open reading frame (ORF) with two potential ATG start sites that would encode for 293 and 231 amino acid proteins. Fragments containing the two ORFs encoded Pcs when they were inserted into the expression vector pET23a and expressed under the control of the T7 promoter in Escherichia coli BL21(DE3) pLysS. However, when the two ORFs were inserted into the cloning vector pMD18-T and expressed without control of the plasmid promoter in E. coli DH5α, only the larger clone exhibited Pcs activity. This suggested that the larger fragment contained a native promoter driving expression of the smaller ORF. A promoter activity assay, in which DNA fragments were inserted into the promoter-probe plasmid pCB182 and β-galactosidase activity of E. coli transformants was tested, demonstrated that a promoter is indeed present in the DNA region. All results together indicate that the 696 bp ORF, not the larger 897 bp ORF, encodes the Pcs in Pseudomonas sp. strain 593 and carries a promoter in front of its 5' terminus. PMID:21939372

  13. DNA-dependent DNA polymerase from yeast mitochondria. Dependence of enzyme activity on conditions of cell growth, and properties of the highly purified polymerase.

    Wintersberger, U; Blutsch, H

    1976-09-01

    The activity of DNA polymerase was determined in gradient-purified mitochondria from yeast cells grown under a variety of conditions. The specific enzyme activity was found to be dependent on the degree of aeration of the cells, and on the carbon source used for the medium. It was sensitive to glucose repression, and was enhanced about two-fold by the growth of yeast cells in the presence of ethidium bromide. Mitochondria DNA polymerase was highly purified and several properties were determined. Sucrose density gradient centrifugation, and dodecylsulfate-polyacylamide gel electrophoresis revealed the following structure: a monomer of molecular weight around 60 000 aggregated under relatively high salt concentration (0.2 M phosphate buffer) to a dimer of about 120 000 which under low salt concentration (0.2 M Tris-HCl buffer) formed higher aggregates. For optimal activity an Mg2+ ion concentration of 50 mM was found necessary, Mn ions did not promote activity at any concentration tested (0.5--50 mM). Indeed, if added to Mg2+-containing assays, Mn2+ strongly inhibited enzyme activity at low concentrations. This might be an explanation for the inducation of mitochondrial mutants in yeast cells grown in the presence of Mn2+ ions. Mitochondrial DNA polymerase activity was strongly inhibited by low concentrations of the -SH reagent p-chloromercuribenzoate, the nucleotide analogue cytosine arabinoside triphosphate also exerted an inhibitory effect. An about 50% decrease of activity was observed in the presence of 1 mM o-phenanthroline in assay mixture containing DNA at about the Km concentration. The enzyme preferred a gapped template primer, poly(dA) - (dT)10, over nicked DNA and was unable to use a polyribonucleotide template, poly(rA) - (dT)10. In the purest preparations no exonuclease activity could be detected. PMID:786635

  14. Interaction of the Neisseria gonorrhoeae PilA protein with the pilE promoter involves multiple sites on the DNA.

    Arvidson, C G; So, M

    1995-05-01

    PilA is the putative DNA-binding component of a two-component system that regulates transcription of the pilin expression locus (pilE) of Neisseria gonorrhoeae. Here we report the purification of the PilA protein and characterization of its DNA-binding activity. PilA was overproduced in Escherichia coli with an isopropyl-beta-D-thiogalactopyranoside (IPTG)-inducible expression vector. Cell extracts were prepared by sonication and fractionated by anion-exchange chromotography, followed by dye affinity chromatography with Cibacron Blue. Proteins were eluted by using a gradient of KCl, and PilA-containing fractions were identified by immunoblot analysis with a polyclonal anti-PilA antiserum. Purified PilA was judged to be > 90% pure, as determined by Coomassie blue staining and sodium dodecyl sulfate-polyacrylamide gel electrophoresis. PilA purified in this manner was used to develop a gel retardation assay with a 301-bp fragment containing the pilE promoter (PpilE) and upstream sequences as a probe. A fragment of similar size containing the E. coli aroH promoter was used as a negative control. Competition experiments using a 100- to 1,000-fold excess of unlabelled DNA fragments confirmed the specificity of PilA binding to the pilE promoter. To localize the PilA binding site within the 301-bp PpilE fragment, stepwise deletions were generated by PCR and the fragments were examined in the gel shift assay. The results of these experiments show that there are two regions upstream of PpilE that are required for binding by PilA. Taken together, these data indicate that while PilA binds specifically to the upstream region of the pilE gene, this interaction is complex and likely involves multiple regions of this DNA sequence. PMID:7730283

  15. Promoter-distal RNA polymerase II binding discriminates active from inactive CCAAT/ enhancer-binding protein beta binding sites

    Savic, Daniel; Roberts, Brian S.; Carleton, Julia B.; Partridge, E. Christopher; White, Michael A.; Cohen, Barak A.; Cooper, Gregory M.; Gertz, Jason; Myers, Richard M.

    2015-01-01

    Transcription factors (TFs) bind to thousands of DNA sequences in mammalian genomes, but most of these binding events appear to have no direct effect on gene expression. It is unclear why only a subset of TF bound sites are actively involved in transcriptional regulation. Moreover, the key genomic features that accurately discriminate between active and inactive TF binding events remain ambiguous. Recent studies have identified promoter-distal RNA polymerase II (RNAP2) binding at enhancer elements, suggesting that these interactions may serve as a marker for active regulatory sequences. Despite these correlative analyses, a thorough functional validation of these genomic co-occupancies is still lacking. To characterize the gene regulatory activity of DNA sequences underlying promoter-distal TF binding events that co-occur with RNAP2 and TF sites devoid of RNAP2 occupancy using a functional reporter assay, we performed cis-regulatory element sequencing (CRE-seq). We tested more than 1000 promoter-distal CCAAT/enhancer-binding protein beta (CEBPB)-bound sites in HepG2 and K562 cells, and found that CEBPB-bound sites co-occurring with RNAP2 were more likely to exhibit enhancer activity. CEBPB-bound sites further maintained substantial cell-type specificity, indicating that local DNA sequence can accurately convey cell-type–specific regulatory information. By comparing our CRE-seq results to a comprehensive set of genome annotations, we identified a variety of genomic features that are strong predictors of regulatory element activity and cell-type–specific activity. Collectively, our functional assay results indicate that RNAP2 occupancy can be used as a key genomic marker that can distinguish active from inactive TF bound sites. PMID:26486725

  16. An activation domain within the walleye dermal sarcoma virus retroviral cyclin protein is essential for inhibition of the viral promoter

    Walleye dermal sarcoma virus (WDSV) is a complex retrovirus associated with seasonal dermal sarcomas. Developing tumors have low levels of accessory gene transcripts, A1 and B, and regressing tumors have high levels of full-length and spliced transcripts. Transcript A1 encodes a retroviral cyclin (rv-cyclin) with limited homology to host cyclins. The rv-cyclin is physically linked to components of the transcriptional co-activator complex, Mediator, and regulates transcription. In walleye fibroblasts, it inhibits the WDSV promoter independently of cis-acting DNA sequences. The rv-cyclin activates transcription from GAL4 promoters when fused to the GAL4 DNA binding domain. A 30 a.a. activation domain in the carboxy region can be inactivated by single point mutations, and these mutations diminish the ability of the rv-cyclin to inhibit the WDSV promoter. When fused to glutathione S-transferase, the rv-cyclin, its carboxy region, and the activation domain pull down components of transcription complexes from nuclear extracts, and pulldown is lost by mutation of the activation domain

  17. Physical activity and health promotion in Italian university students

    Adele Anna Teleman

    2015-06-01

    Full Text Available INTRODUCTION: Physical activity, diet plans, the mantainment of a certain Body Mass Index (BMI and the use of various types of supplementation are common elements in the search for disease prevention, health promotion and well-being. MATERIALS AND METHODS: We analyzed the data regarding Italian university students' BMI, dieting behaviour, personal body perception, exercise habits, and use of dietary supplements and of doping substances. RESULTS: 13.7% resulted being underweight, 75.1% was in the normal range, 9.8% was overweight, and 1.4% was obese. 11.0% were on a diet. 25.8% of the students reported never doing any type of physical activity. 0.9% admitted consuming doping substances. The percentage of overweight/obese students increases from 8.8% of the 18-21 year olds to 18.1% of the 25-30 year olds. Similarly, the prevalence of overweight/obesity was 18.5% among male population and 7.5% among the female one. DISCUSSION: The data deriving from this questionnaire showed that while the majority of university students has a BMI in the normal range, 11.2% of the study population is overweight/obese. Males present a higher risk of being overweight or obese. An important part of the population showed to be sedentary even though data coming from our study are aligned to further evidence. CONCLUSION: The most important concern arising from the questionnaire is represented by physical inactivity. Indeed, it is necessary to encourage and plan initiatives aimed at promoting physical activity in university students.

  18. DNA binding-independent transcriptional activation of the vascular endothelial growth factor gene (VEGF) by the Myb oncoprotein

    Myb is a key transcription factor that can regulate proliferation, differentiation, and apoptosis, predominantly in the haemopoietic system. Abnormal expression of Myb is associated with a number of cancers, both haemopoietic and non-haemopoietic. In order to better understand the role of Myb in normal and tumorigenic processes, we undertook a cDNA array screen to identify genes that are regulated by this factor. In this way, we identified the gene encoding vascular endothelial growth factor (VEGF) as being potentially regulated by the Myb oncoprotein in myeloid cells. To determine whether this was a direct effect on VEGF gene transcription, we examined the activity of the murine VEGF promoter in the presence of either wild-type (WT) or mutant forms of Myb. It was found that WT Myb was able to activate the VEGF promoter and that a minimal promoter region of 120 bp was sufficient to confer Myb responsiveness. Surprisingly, activation of the VEGF promoter was independent of DNA binding by Myb. This was shown by the use of DNA binding-defective Myb mutants and by mutagenesis of a potential Myb-binding site in the minimal promoter. Mutation of Sp1 sites within this region abolished Myb-mediated regulation of a reporter construct, suggesting that Myb DNA binding-independent activation of VEGF expression occurs via these Sp1 binding elements. Regulation of VEGF production by Myb has implications for the potential role of Myb in myeloid leukaemias and in solid tumours where VEGF may be functioning as an autocrine growth factor

  19. A mitigator sequence in the downstream region of the major late promoter of adenovirus type 12 DNA.

    Zock, C; Doerfler, W

    1990-01-01

    Human adenovirus type 12 (Ad12) replicates in permissive human host cells, but undergoes an abortive infection cycle in non-permissive hamster cells. Ad12 DNA cannot replicate and late viral genes are not expressed in hamster cells, whereas most of the early viral mRNAs are synthesized. We have shown previously that the major late promoter of Ad12 DNA (Ad12 MLP; nucleotides -228 to +435 relative to nucleotide +1 as the site of transcriptional initiation) does not function in uninfected or in ...

  20. Promoting Moderate-Vigorous Physical Activity in Overweight Minority Girls

    Norma Olvera

    2010-01-01

    Full Text Available There is limited research on the types of activities that are most effective for promoting MVPA in children. Purpose. To assess which types of activities elicit MVPA in overweight minority girls. Methods. Sample consisted of 31 overweight (BMI≥85th percentile Latina and African-American girls (mean age 10.3±1.2 years. Participants wore an Actical accelerometer each day for 8 hours for 15 days to assess engagement in MVPA during their participation in a three-week activity intervention that included traditional fitness, sport skills, games, dancing, and flexibility sessions. Results. On average 62% of participants met the MVPA recommended guidelines (60 min/5d/wk with an average of 68.5±14 minutes of MVPA across the three weeks. Traditional fitness sessions elicited the highest percent of MVPA (mean time spent in MVPA=32%, followed by dancing and games (mean time spent in MVPA=21%, sports skills (mean time spent in MVPA=18%, and flexibility (mean time spent in MVPA=7%. Step aerobics and rumba fitness elicited the highest proportions of MVPA. Conclusion. Traditional fitness activities were identified as the most successful in eliciting MVPA in overweight Latina and African American girls.

  1. Parp1 localizes within the Dnmt1 promoter and protects its unmethylated state by its enzymatic activity.

    Michele Zampieri

    Full Text Available BACKGROUND: Aberrant hypermethylation of CpG islands in housekeeping gene promoters and widespread genome hypomethylation are typical events occurring in cancer cells. The molecular mechanisms behind these cancer-related changes in DNA methylation patterns are not well understood. Two questions are particularly important: (i how are CpG islands protected from methylation in normal cells, and how is this protection compromised in cancer cells, and (ii how does the genome-wide demethylation in cancer cells occur. The latter question is especially intriguing since so far no DNA demethylase enzyme has been found. METHODOLOGY/PRINCIPAL FINDINGS: Our data show that the absence of ADP-ribose polymers (PARs, caused by ectopic over-expression of poly(ADP-ribose glycohydrolase (PARG in L929 mouse fibroblast cells leads to aberrant methylation of the CpG island in the promoter of the Dnmt1 gene, which in turn shuts down its transcription. The transcriptional silencing of Dnmt1 may be responsible for the widespread passive hypomethylation of genomic DNA which we detect on the example of pericentromeric repeat sequences. Chromatin immunoprecipitation results show that in normal cells the Dnmt1 promoter is occupied by poly(ADP-ribosylated Parp1, suggesting that PARylated Parp1 plays a role in protecting the promoter from methylation. CONCLUSIONS/SIGNIFICANCE: In conclusion, the genome methylation pattern following PARG over-expression mirrors the pattern characteristic of cancer cells, supporting our idea that the right balance between Parp/Parg activities maintains the DNA methylation patterns in normal cells. The finding that in normal cells Parp1 and ADP-ribose polymers localize on the Dnmt1 promoter raises the possibility that PARylated Parp1 marks those sequences in the genome that must remain unmethylated and protects them from methylation, thus playing a role in the epigenetic regulation of gene expression.

  2. Cdt2-mediated XPG degradation promotes gap-filling DNA synthesis in nucleotide excision repair

    Han, Chunhua; Wani, Gulzar; Zhao, Ran; Qian, Jiang; Sharma, Nidhi; He, Jinshan; Zhu, Qianzheng; Wang, Qi-En; Wani, Altaf A.

    2014-01-01

    Xeroderma pigmentosum group G (XPG) protein is a structure-specific repair endonuclease, which cleaves DNA strands on the 3′ side of the DNA damage during nucleotide excision repair (NER). XPG also plays a crucial role in initiating DNA repair synthesis through recruitment of PCNA to the repair sites. However, the fate of XPG protein subsequent to the excision of DNA damage has remained unresolved. Here, we show that XPG, following its action on bulky lesions resulting from exposures to UV ir...

  3. Powdered Activated Carbon: An Alternative Approach to Genomic DNA Purification.

    Barbarić, Lucija; Bačić, Ivana; Grubić, Zorana

    2015-07-01

    Forensic evidence samples are routinely found as stains on various substrates, which may contain substances known to inhibit polymerase chain reaction (PCR). The goal of this study was to evaluate post-Chelex(®) 100 purification using powdered activated carbon (PAC). Mock crime scene DNA extracts were analyzed using quantitative PCR and short tandem repeat (STR) profiling to test the DNA recovery and inhibitor removal using PAC with those of the Amicon(®) Ultra 100K. For extracted bloodstains on soil and wood substrates, PAC and Amicon(®) Ultra 100K generated similar DNA yield and quality. Moreover, the two methods significantly decreased the concentration of humic substances and tannins compared to nonpurified extracts (p < 0.001). In instances where extracts contained indigo dye (bloodstains on denim), Amicon(®) Ultra 100K performed better than PAC due to improved amplifiability. Efficient adsorption of humic substances and tannins, which are common inhibitors, indicates PAC's potential application in the purification of high-template DNA extracts. PMID:25929735

  4. 5-azacytidine promotes microspore embryogenesis initiation by decreasing global DNA methylation, but prevents subsequent embryo development in rapeseed and barley

    Solís, María-Teresa; El-Tantawy, Ahmed-Abdalla; Cano, Vanesa; Risueño, María C.; Testillano, Pilar S.

    2015-01-01

    Microspores are reprogrammed by stress in vitro toward embryogenesis. This process is an important tool in breeding to obtain double-haploid plants. DNA methylation is a major epigenetic modification that changes in differentiation and proliferation. We have shown changes in global DNA methylation during microspore reprogramming. 5-Azacytidine (AzaC) cannot be methylated and leads to DNA hypomethylation. AzaC is a useful demethylating agent to study DNA dynamics, with a potential application in microspore embryogenesis. This work analyzes the effects of short and long AzaC treatments on microspore embryogenesis initiation and progression in two species, the dicot Brassica napus and the monocot Hordeum vulgare. This involved the quantitative analyses of proembryo and embryo production, the quantification of DNA methylation, 5-methyl-deoxy-cytidine (5mdC) immunofluorescence and confocal microscopy, and the analysis of chromatin organization (condensation/decondensation) by light and electron microscopy. Four days of AzaC treatments (2.5 μM) increased embryo induction, response associated with a decrease of DNA methylation, modified 5mdC, and heterochromatin patterns compared to untreated embryos. By contrast, longer AzaC treatments diminished embryo production. Similar effects were found in both species, indicating that DNA demethylation promotes microspore reprogramming, totipotency acquisition, and embryogenesis initiation, while embryo differentiation requires de novo DNA methylation and is prevented by AzaC. This suggests a role for DNA methylation in the repression of microspore reprogramming and possibly totipotency acquisition. Results provide new insights into the role of epigenetic modifications in microspore embryogenesis and suggest a potential benefit of inhibitors, such as AzaC, to improve the process efficiency in biotechnology and breeding programs. PMID:26161085

  5. 5-azacytidine promotes microspore embryogenesis initiation by decreasing global DNA methylation, but prevents subsequent embryo development in rapeseed and barley.

    Solís, María-Teresa; El-Tantawy, Ahmed-Abdalla; Cano, Vanesa; Risueño, María C; Testillano, Pilar S

    2015-01-01

    Microspores are reprogrammed by stress in vitro toward embryogenesis. This process is an important tool in breeding to obtain double-haploid plants. DNA methylation is a major epigenetic modification that changes in differentiation and proliferation. We have shown changes in global DNA methylation during microspore reprogramming. 5-Azacytidine (AzaC) cannot be methylated and leads to DNA hypomethylation. AzaC is a useful demethylating agent to study DNA dynamics, with a potential application in microspore embryogenesis. This work analyzes the effects of short and long AzaC treatments on microspore embryogenesis initiation and progression in two species, the dicot Brassica napus and the monocot Hordeum vulgare. This involved the quantitative analyses of proembryo and embryo production, the quantification of DNA methylation, 5-methyl-deoxy-cytidine (5mdC) immunofluorescence and confocal microscopy, and the analysis of chromatin organization (condensation/decondensation) by light and electron microscopy. Four days of AzaC treatments (2.5 μM) increased embryo induction, response associated with a decrease of DNA methylation, modified 5mdC, and heterochromatin patterns compared to untreated embryos. By contrast, longer AzaC treatments diminished embryo production. Similar effects were found in both species, indicating that DNA demethylation promotes microspore reprogramming, totipotency acquisition, and embryogenesis initiation, while embryo differentiation requires de novo DNA methylation and is prevented by AzaC. This suggests a role for DNA methylation in the repression of microspore reprogramming and possibly totipotency acquisition. Results provide new insights into the role of epigenetic modifications in microspore embryogenesis and suggest a potential benefit of inhibitors, such as AzaC, to improve the process efficiency in biotechnology and breeding programs. PMID:26161085

  6. 5-azacytidine promotes microspore embryogenesis initiation by decreasing global DNA methylation, but prevents subsequent embryo development in rapeseed and barley

    María-Teresa eSolís

    2015-06-01

    Full Text Available Microspores are reprogrammed by stress in vitro towards embryogenesis. This process is an important tool in breeding to obtain double-haploid plants. DNA methylation is a major epigenetic modification that changes in differentiation and proliferation. We have shown changes in global DNA methylation during microspore reprogramming. 5-Azacytidine (AzaC cannot be methylated and leads to DNA hypomethylation. AzaC is a useful demethylating agent to study DNA dynamics, with a potential application in microspore embryogenesis. This work analyzes the effects of short and long AzaC treatments on microspore embryogenesis initiation and progression in two species, the dicot Brassica napus and the monocot Hordeum vulgare. This involved the quantitative analyses of proembryo and embryo production, the quantification of DNA methylation, 5mdC immunofluorescence and confocal microscopy, and the analysis of chromatin organization (condensation/ decondensation by light and electron microscopy. Four days of AzaC treatments (2.5 µM increased embryo induction, response associated with a decrease of DNA methylation, modified 5mdC and heterochromatin patterns compared to untreated embryos. By contrast, longer AzaC treatments diminished embryo production. Similar effects were found in both species, indicating that DNA demethylation promotes microspore reprogramming, totipotency acquisition and embryogenesis initiation, while embryo differentiation requires de novo DNA methylation and is prevented by AzaC. This suggests a role for DNA methylation in the repression of microspore reprogramming and possibly totipotency acquisition.Results provide new insights into the role of epigenetic modifications in microspore embryogenesis and suggest a potential benefit of inhibitors, such as AzaC, to improve the process efficiency in biotechnology and breeding programs.

  7. DNA replication through G-quadruplex motifs is promoted by the S. cerevisiae Pif1 DNA helicase

    Paeschke, Katrin; Capra, John A.; Zakian, Virginia A.

    2011-01-01

    G-quadruplex (G4) DNA structures are extremely stable four-stranded secondary structures held together by non-canonical G-G base pairs. Genome-wide chromatin immuno-precipitation was used to determine the in vivo binding sites of the multi-functional S. cerevisiae Pif1 DNA helicase, a potent unwinder of G4 structures in vitro. G4 motifs were a significant subset of the high confidence Pif1 binding sites. Replication slowed in the vicinity of these motifs, and they were prone to breakage in Pi...

  8. Status of O 6 -methylguanine-DNA methyltransferase [MGMT] gene promoter methylation among patients with glioblastomas from India

    Gopal Arun Nehru

    2012-01-01

    Full Text Available Background: O 6 -methylguanine DNA methyltransferase [MGMT] gene promoter methylation has emerged as a promising marker in determining resistance to temozolomide, used in the treatment of patients with glioblastomas. Aim: To determine the frequency of MGMT promoter methylation among patients with glioblastomas using methylation-specific polymerase chain reaction (MSP and compare it to the results obtained by bisulfite sequencing of a subset of samples. Materials and Methods: DNA obtained from the frozen tissue of 27 samples of glioblastomas and three other gliomas, were analyzed for MGMT promoter methylation using a nested MSP assay. Sixteen samples were also subjected to bisulfite sequencing to determine the methylation status of 27 CpG sites within the sequenced region of the MGMT promoter. Data with respect to radiation, chemotherapy and survival outcome was also collected. Results: MGMT promoter methylation was seen in 67% of the cases included in the study using frozen tissues by MSP analysis, while 62% were methylated among glioblastomas alone. There was a 100% concordance between the results obtained by MSP analysis and bisulfite sequencing. Clinical outcome was known among 67% of cases and methylation was higher among those patients who had no recurrence, though it was not statistically significant [P=0.44]. Conclusion: The frequency of methylation seen in this study concurs with that reported earlier from the country. MSP was easy to perform and interpret. However, the utility of this testing system in a routine diagnostic setting is still being debated.

  9. O 6 -methylguanine DNA methyltransferase gene promoter methylation in high-grade gliomas: A review of current status

    Vaishali Suri

    2011-01-01

    Full Text Available Assessment of promoter methylation of the O 6 -methylguanine DNA methyltransferase (MGMT gene has recently gained importance in molecular profiling of high-grade gliomas. It has emerged not only as an important prognostic marker but also as a predictive marker for response to temozolomide in patients with newly diagnosed glioblastoma. Further, recent studies indicate that MGMT promoter methylation has strong prognostic relevance even in anaplastic (grade III gliomas, irrespective of therapy (chemotherapy or radiotherapy. This article provides an overview of its use as a predictive and prognostic biomarker, as well as the methods employed for its assessment and use in therapeutic decision making.

  10. Promoting direct interspecies electron transfer with activated carbon

    Liu, Fanghua; Rotaru, Amelia-Elena; Shrestha, Pravin M.;

    2012-01-01

    Granular activated carbon (GAC) is added to methanogenic digesters to enhance conversion of wastes to methane, but the mechanism(s) for GAC’s stimulatory effect are poorly understood. GAC has high electrical conductivity and thus it was hypothesized that one mechanism for GAC stimulation of...... methanogenesis might be to facilitate direct interspecies electron transfer (DIET) between bacteria and methanogens. Metabolism was substantially accelerated when GAC was added to co-cultures of Geobacter metallireducens and Geobacter sulfurreducens grown under conditions previously shown to require DIET. Cells...... were attached to GAC, but did not aggregate as they do when making biological electrical connections between cells. Studies with a series of gene deletion mutants eliminated the possibility that GAC promoted electron exchange via interspecies hydrogen or formate transfer and demonstrated that DIET in...

  11. Activating STAT3 Alpha for Promoting Healing of Neurons

    Conway, Greg

    2008-01-01

    A method of promoting healing of injured or diseased neurons involves pharmacological activation of the STAT3 alpha protein. Usually, injured or diseased neurons heal incompletely or not at all for two reasons: (1) they are susceptible to apoptosis (cell death); and (2) they fail to engage in axogenesis that is, they fail to re-extend their axons to their original targets (e.g., muscles or other neurons) because of insufficiency of compounds, denoted neurotrophic factors, needed to stimulate such extension. The present method (see figure) of treatment takes advantage of prior research findings to the effect that the STAT3 alpha protein has anti-apoptotic and pro-axogenic properties.

  12. Detailed analysis of the promoter activity of an attenuated lentivirus.

    Blatti-Cardinaux, Laure; Sanjosé, Leticia; Zahno, Marie-Luise; Zanoni, Reto; Reina, Ramses; Bertoni, Giuseppe

    2016-07-01

    In spite of an eradication campaign that eliminated clinical cases of caprine arthritis encephalitis virus-induced arthritis in the Swiss goat population, seroconversions are still observed. In the affected flocks, viruses belonging mainly to the small ruminant lentivirus A4 subtype are regularly isolated. These viruses are considered attenuated, except in the mammary gland, where high viral loads and histopathological lesions have been observed. We previously characterized and sequenced such field isolates, detecting several potentially attenuating mutations in their LTR. Here we present a detailed analysis of the promoter activity of these genetic elements, which was comparable to those of virulent isolates. An AP-1 binding site was shown to be crucial for promoter activity in reporter gene assays and also in the context of a replicating molecular clone. Other sites, such as AML(vis) and a conserved E-box, appeared to be less crucial. Analysis of a unique AP-4 site showed a clear discrepancy between results obtained with reporter gene assays and those with mutated viruses. Within the limits of this in vitro study, we did not find evidence pointing to the LTR as the genetic correlate of attenuation for these viruses. Finally, the limited replication of SRLV A4 in mammary cell culture could not explain the suggested mammary tropism. In contrast, and in view of the abundance of macrophages in the mammary gland, it is the striking replication capacity of SRLV A4 in these cells, unaffected by all LTR mutations tested, which may explain the apparent mammary tropism of these viruses. PMID:27114068

  13. Ratite oils promote keratinocyte cell growth and inhibit leukocyte activation

    Bennett, Darin C.; Leung, Gigi; Wang, Eddy; Ma, Sam; Lo, Blanche K. K.; McElwee, Kevin J.; Cheng, Kimberly M.

    2015-01-01

    Traditionally, native Australian aborigines have used emu oil for the treatment of inflammation and to accelerate wound healing. Studies on mice suggest that topically applied emu oil may have anti-inflammatory properties and may promote wound healing. We investigated the effects of ratite oils (6 emu, 3 ostrich, 1 rhea) on immortalized human keratinocytes (HaCaT cells) in vitro by culturing the cells in media with oil concentrations of 0%, 0.5%, and 1.0%. Peking duck, tea tree, and olive oils were used as comparative controls. The same oils at 0.5% concentration were evaluated for their influence on peripheral blood mononuclear cell (PBMC) survival over 48 hr and their ability to inhibit IFNγ production in PBMCs activated by phytohemagglutinin (PHA) in ELISpot assays. Compared to no oil control, significantly shorter population doubling time durations were observed for HaCaT cells cultured in emu oil (1.51 × faster), ostrich oil (1.46 × faster), and rhea oil (1.64 × faster). Tea tree oil demonstrated significant antiproliferative activity and olive oil significantly prolonged (1.35 × slower) cell population doubling time. In contrast, almost all oils, particularly tea tree oil, significantly reduced PBMC viability. Different oils had different levels of inhibitory effect on IFNγ production with individual emu, ostrich, rhea, and duck oil samples conferring full inhibition. This preliminary investigation suggests that emu oil might promote wound healing by accelerating the growth rate of keratinocytes. Combined with anti-inflammatory properties, ratite oil may serve as a useful component in bandages and ointments for the treatment of wounds and inflammatory skin conditions. PMID:26217022

  14. Ratite oils promote keratinocyte cell growth and inhibit leukocyte activation.

    Bennett, Darin C; Leung, Gigi; Wang, Eddy; Ma, Sam; Lo, Blanche K K; McElwee, Kevin J; Cheng, Kimberly M

    2015-09-01

    Traditionally, native Australian aborigines have used emu oil for the treatment of inflammation and to accelerate wound healing. Studies on mice suggest that topically applied emu oil may have anti-inflammatory properties and may promote wound healing. We investigated the effects of ratite oils (6 emu, 3 ostrich, 1 rhea) on immortalized human keratinocytes (HaCaT cells) in vitro by culturing the cells in media with oil concentrations of 0%, 0.5%, and 1.0%. Peking duck, tea tree, and olive oils were used as comparative controls. The same oils at 0.5% concentration were evaluated for their influence on peripheral blood mononuclear cell (PBMC) survival over 48 hr and their ability to inhibit IFNγ production in PBMCs activated by phytohemagglutinin (PHA) in ELISpot assays. Compared to no oil control, significantly shorter population doubling time durations were observed for HaCaT cells cultured in emu oil (1.51×faster), ostrich oil (1.46×faster), and rhea oil (1.64×faster). Tea tree oil demonstrated significant antiproliferative activity and olive oil significantly prolonged (1.35×slower) cell population doubling time. In contrast, almost all oils, particularly tea tree oil, significantly reduced PBMC viability. Different oils had different levels of inhibitory effect on IFNγ production with individual emu, ostrich, rhea, and duck oil samples conferring full inhibition. This preliminary investigation suggests that emu oil might promote wound healing by accelerating the growth rate of keratinocytes. Combined with anti-inflammatory properties, ratite oil may serve as a useful component in bandages and ointments for the treatment of wounds and inflammatory skin conditions. PMID:26217022

  15. Physical interaction of the activator protein-1 factors c-Fos and c-Jun with Cbfa1 for collagenase-3 promoter activation

    D'Alonzo, Richard C.; Selvamurugan, Nagarajan; Karsenty, Gerard; Partridge, Nicola C.

    2002-01-01

    Previously, we determined that the activator protein-1 (AP-1)-binding site and the runt domain (RD)-binding site and their binding proteins, c-Fos.c-Jun and Cbfa, regulate the collagenase-3 promoter in parathyroid hormone-treated and differentiating osteoblasts. Here we show that Cbfa1 and c-Fos.c-Jun appear to cooperatively bind the RD- and AP-1-binding sites and form ternary structures in vitro. Both in vitro and in vivo co-immunoprecipitation and yeast two-hybrid studies further demonstrate interaction between Cbfa1 with c-Fos and c-Jun in the absence of phosphorylation and without binding to DNA. Additionally, only the runt domain of Cbfa1 was required for interaction with c-Jun and c-Fos. In mammalian cells, overexpression of Cbfa1 enhanced c-Jun activation of AP-1-binding site promoter activity, demonstrating functional interaction. Finally, insertion of base pairs that disrupted the helical phasing between the AP-1- and RD-binding sites also inhibited collagenase-3 promoter activation. Thus, we provide direct evidence that Cbfa1 and c-Fos.c-Jun physically interact and cooperatively bind the AP-1- and RD-binding sites in the collagenase-3 promoter. Moreover, the AP-1- and RD-binding sites appear to be organized in a specific required helical arrangement that facilitates transcription factor interaction and enables promoter activation.

  16. Promoting Uranium Immobilization by the Activities of Microbial Phosphatases

    The overall objective of this project is to examine the activity of nonspecific phosphohydrolases present in naturally occurring subsurface microorganisms for the purpose of promoting the immobilization of radionuclides through the production of uranium U(VI) phosphate precipitates. Specifically, we hypothesize that the precipitation of U(VI) phosphate minerals may be promoted through the microbial release and/or accumulation of PO43- as a means to detoxify radionuclides and heavy metals. An experimental approach was designed to determine the extent of phosphatase activity in bacteria previously isolated from contaminated subsurface soils collected at the ERSP Field Research Center (FRC) in Oak Ridge, TN. Screening of 135 metal resistant isolates for phosphatase activity indicated the majority (75 of 135) exhibited a phosphatase-positive phenotype. During this phase of the project, a PCR based approach has also been designed to assay FRC isolates for the presence of one or more classes of the characterized non-specific acid phophastase (NSAP) genes likely to be involved in promoting U(VI) precipitation. Testing of a subset of Pb resistant (Pbr) Arthrobacter, Bacillus and Rahnella strains indicated 4 of the 9 Pbr isolates exhibited phosphatase phenotypes suggestive of the ability to bioprecipitate U(VI). Two FRC strains, a Rahnella sp. strain Y9602 and a Bacillus sp. strain Y9-2, were further characterized. The Rahnella sp. exhibited enhanced phosphatase activity relative to the Bacillus sp. Whole-cell enzyme assays identified a pH optimum of 5.5, and inorganic phosphate accumulated in pH 5.5 synthetic groundwater (designed to mimic FRC conditions) incubations of both strains in the presence of a model organophosphorus substrate provided as the sole C and P source. Kinetic experiments showed that these two organisms can grow in the presence of 200 (micro)M dissolved uranium and that Rahnella is much more efficient in precipitating U(VI) than Bacillus sp. The

  17. Promoting Uranium Immobilization by the Activities of Microbial Phosphatases

    Robert J. Martinez; Melanie J. Beazley; Samuel M. Webb; Martial Taillefert (co-PI); and Patricia A. Sobecky

    2007-04-19

    The overall objective of this project is to examine the activity of nonspecific phosphohydrolases present in naturally occurring subsurface microorganisms for the purpose of promoting the immobilization of radionuclides through the production of uranium [U(VI)] phosphate precipitates. Specifically, we hypothesize that the precipitation of U(VI) phosphate minerals may be promoted through the microbial release and/or accumulation of PO4 3- as a means to detoxify radionuclides and heavy metals. An experimental approach was designed to determine the extent of phosphatase activity in bacteria previously isolated from contaminated subsurface soils collected at the ERSP Field Research Center (FRC) in Oak Ridge, TN. Screening of 135 metal resistant isolates for phosphatase activity indicated the majority (75 of 135) exhibited a phosphatase-positive phenotype. During this phase of the project, a PCR based approach has also been designed to assay FRC isolates for the presence of one or more classes of the characterized non-specific acid phophastase (NSAP) genes likely to be involved in promoting U(VI) precipitation. Testing of a subset of Pb resistant (Pbr) Arthrobacter, Bacillus and Rahnella strains indicated 4 of the 9 Pbr isolates exhibited phosphatase phenotypes suggestive of the ability to bioprecipitate U(VI). Two FRC strains, a Rahnella sp. strain Y9602 and a Bacillus sp. strain Y9-2, were further characterized. The Rahnella sp. exhibited enhanced phosphatase activity relative to the Bacillus sp. Whole-cell enzyme assays identified a pH optimum of 5.5, and inorganic phosphate accumulated in pH 5.5 synthetic groundwater (designed to mimic FRC conditions) incubations of both strains in the presence of a model organophosphorus substrate provided as the sole C and P source. Kinetic experiments showed that these two organisms can grow in the presence of 200 μM dissolved uranium and that Rahnella is much more efficient in precipitating U(VI) than Bacillus sp. The

  18. Putative DNA G-quadruplex formation within the promoters of Plasmodium falciparum var genes

    Rowe J

    2009-08-01

    Full Text Available Abstract Background Guanine-rich nucleic acid sequences are capable of folding into an intramolecular four-stranded structure called a G-quadruplex. When found in gene promoter regions, G-quadruplexes can downregulate gene expression, possibly by blocking the transcriptional machinery. Here we have used a genome-wide bioinformatic approach to identify Putative G-Quadruplex Sequences (PQS in the Plasmodium falciparum genome, along with biophysical techniques to examine the physiological stability of P. falciparum PQS in vitro. Results We identified 63 PQS in the non-telomeric regions of the P. falciparum clone 3D7. Interestingly, 16 of these PQS occurred in the upstream region of a subset of the P. falciparum var genes (group B var genes. The var gene family encodes PfEMP1, the parasite's major variant antigen and adhesin expressed at the surface of infected erythrocytes, that plays a key role in malaria pathogenesis and immune evasion. The ability of the PQS found in the upstream regions of group B var genes (UpsB-Q to form stable G-quadruplex structures in vitro was confirmed using 1H NMR, circular dichroism, UV spectroscopy, and thermal denaturation experiments. Moreover, the synthetic compound BOQ1 that shows a higher affinity for DNA forming quadruplex rather than duplex structures was found to bind with high affinity to the UpsB-Q. Conclusion This is the first demonstration of non-telomeric PQS in the genome of P. falciparum that form stable G-quadruplexes under physiological conditions in vitro. These results allow the generation of a novel hypothesis that the G-quadruplex sequences in the upstream regions of var genes have the potential to play a role in the transcriptional control of this major virulence-associated multi-gene family.

  19. Rev1 promotes replication through UV lesions in conjunction with DNA polymerases η, ι, and κ but not DNA polymerase ζ.

    Yoon, Jung-Hoon; Park, Jeseong; Conde, Juan; Wakamiya, Maki; Prakash, Louise; Prakash, Satya

    2015-12-15

    Translesion synthesis (TLS) DNA polymerases (Pols) promote replication through DNA lesions; however, little is known about the protein factors that affect their function in human cells. In yeast, Rev1 plays a noncatalytic role as an indispensable component of Polζ, and Polζ together with Rev1 mediates a highly mutagenic mode of TLS. However, how Rev1 functions in TLS and mutagenesis in human cells has remained unclear. Here we determined the role of Rev1 in TLS opposite UV lesions in human and mouse fibroblasts and showed that Rev1 is indispensable for TLS mediated by Polη, Polι, and Polκ but is not required for TLS by Polζ. In contrast to its role in mutagenic TLS in yeast, Rev1 promotes predominantly error-free TLS opposite UV lesions in humans. The identification of Rev1 as an indispensable scaffolding component for Polη, Polι, and Polκ, which function in TLS in highly specialized ways opposite a diverse array of DNA lesions and act in a predominantly error-free manner, implicates a crucial role for Rev1 in the maintenance of genome stability in humans. PMID:26680302

  20. Phylogenomics of caspase-activated DNA fragmentation factor

    The degradation of nuclear DNA by DNA fragmentation factor (DFF) is a key step in apoptosis of mammalian cells. Using comparative genomics, we have here determined the evolutionary history of the genes encoding the two DFF subunits, DFFA (also known as ICAD) and DFFB (CAD). Orthologs of DFFA and DFFB were identified in Nematostella vectensis, a representative of the primitive metazoan clade cnidarians, and in various vertebrates and insects, but not in representatives of urochordates, echinoderms, and nematodes. The domains mediating the interaction of DFFA and DFFB, a caspase cleavage site in DFFA, and the amino acid residues critical for endonuclease activity of DFFB were conserved in Nematostella. These findings suggest that DFF has been a part of the primordial apoptosis system of the eumetazoan common ancestor and that the ancient cell death machinery has degenerated in several evolutionary lineages, including the one leading to the prototypical apoptosis model, Caenorhabditis elegans

  1. Metabolites and DNA adduct formation from flavoenzyme-activated porfiromycin.

    Pan, S S; Iracki, T

    1988-08-01

    Porfiromycin was reductively metabolized by NADPH cytochrome P-450 reductase and xanthine oxidase under anaerobic conditions. The production of metabolites varied with the pH and the contents of the reaction buffer. In Tris buffer, two major metabolites were produced at pH 7.5 and above, whereas one major metabolite was produced at pH 6.5. The three major metabolites were separated and isolated by HPLC. Identification by californium-252 plasma desorption mass spectrometry showed that the two major metabolites from pH 7.5 were (trans) and (cis)-forms of 7-amino-1-hydroxyl-2-methylaminomitosene and the major metabolite from pH 6.5 was 7-amino-2-methylaminomitosene. All three major metabolites showed substitutions at the C-1 position. DNA was alkylated readily by enzyme-activated porfiromycin. Digestion of porfiromycin-alkylated DNA by DNase, snake venom phosphodiesterase, and alkaline phosphatase resulted in an insoluble nuclease-resistant fraction and a soluble fraction. The nuclease-resistant fraction reflected a high content of cross-linked adducts. Upon HPLC analysis, the solubilized fraction contained two monofunctionally linked porfiromycin adducts and a possibly cross-linked dinucleotide. The major adduct was isolated by HPLC and identified by NMR, as N2-(2'-deoxyguanosyl)-7-amino-2-methylaminomitosene. The N2 position of deoxyguanosine appeared as the major monofunctional alkylating site for DNA alkylation by porfiromycin. Thus, mitomycin C and porfiromycin (which differs from mitomycin C only by the addition of a methyl group to the aziridine nitrogen) share the same enzymatic activating mechanism that leads to the formation of the same types of metabolites and the same specificity of DNA alkylation. PMID:3412325

  2. Ca2+ promoted the low transformation efficiency of plasmid DNA exposed to PAH contaminants.

    Kang, Fuxing; Wang, Hong; Gao, Yanzheng; Long, Jian; Wang, Qian

    2013-01-01

    The effects of interactions between genetic materials and polycyclic aromatic hydrocarbons (PAHs) on gene expression in the extracellular environment remain to be elucidated and little information is currently available on the effect of ionic strength on the transformation of plasmid DNA exposed to PAHs. Phenanthrene and pyrene were used as representative PAHs to evaluate the transformation of plasmid DNA after PAH exposure and to determine the role of Ca(2+) during the transformation. Plasmid DNA exposed to the test PAHs demonstrated low transformation efficiency. In the absence of PAHs, the transformation efficiency was 4.7 log units; however, the efficiency decreased to 3.72-3.14 log units with phenanthrene/pyrene exposures of 50 µg · L(-1). The addition of Ca(2+) enhanced the low transformation efficiency of DNA exposed to PAHs. Based on the co-sorption of Ca(2+) and phenanthrene/pyrene by DNA, we employed Fourier-transform infrared spectroscopy (FTIR), X-ray photoelectron spectroscopy (XPS), and mass spectrometry (MS) to determine the mechanisms involved in PAH-induced DNA transformation. The observed low transformation efficiency of DNA exposed to either phenanthrene or pyrene can be attributed to a broken hydrogen bond in the double helix caused by planar PAHs. Added Ca(2+) formed strong electrovalent bonds with "-POO(-)-" groups in the DNA, weakening the interaction between PAHs and DNA based on weak molecular forces. This decreased the damage of PAHs to hydrogen bonds in double-stranded DNA by isolating DNA molecules from PAHs and consequently enhanced the transformation efficiency of DNA exposed to PAH contaminants. The findings provide insight into the effects of anthropogenic trace PAHs on DNA transfer in natural environments. PMID:23484001

  3. Ca2+ promoted the low transformation efficiency of plasmid DNA exposed to PAH contaminants.

    Fuxing Kang

    Full Text Available The effects of interactions between genetic materials and polycyclic aromatic hydrocarbons (PAHs on gene expression in the extracellular environment remain to be elucidated and little information is currently available on the effect of ionic strength on the transformation of plasmid DNA exposed to PAHs. Phenanthrene and pyrene were used as representative PAHs to evaluate the transformation of plasmid DNA after PAH exposure and to determine the role of Ca(2+ during the transformation. Plasmid DNA exposed to the test PAHs demonstrated low transformation efficiency. In the absence of PAHs, the transformation efficiency was 4.7 log units; however, the efficiency decreased to 3.72-3.14 log units with phenanthrene/pyrene exposures of 50 µg · L(-1. The addition of Ca(2+ enhanced the low transformation efficiency of DNA exposed to PAHs. Based on the co-sorption of Ca(2+ and phenanthrene/pyrene by DNA, we employed Fourier-transform infrared spectroscopy (FTIR, X-ray photoelectron spectroscopy (XPS, and mass spectrometry (MS to determine the mechanisms involved in PAH-induced DNA transformation. The observed low transformation efficiency of DNA exposed to either phenanthrene or pyrene can be attributed to a broken hydrogen bond in the double helix caused by planar PAHs. Added Ca(2+ formed strong electrovalent bonds with "-POO(--" groups in the DNA, weakening the interaction between PAHs and DNA based on weak molecular forces. This decreased the damage of PAHs to hydrogen bonds in double-stranded DNA by isolating DNA molecules from PAHs and consequently enhanced the transformation efficiency of DNA exposed to PAH contaminants. The findings provide insight into the effects of anthropogenic trace PAHs on DNA transfer in natural environments.

  4. Nuclear pore protein NUP88 activates anaphase-promoting complex to promote aneuploidy.

    Naylor, Ryan M; Jeganathan, Karthik B; Cao, Xiuqi; van Deursen, Jan M

    2016-02-01

    The nuclear pore complex protein NUP88 is frequently elevated in aggressive human cancers and correlates with reduced patient survival; however, it is unclear whether and how NUP88 overexpression drives tumorigenesis. Here, we show that mice overexpressing NUP88 are cancer prone and form intestinal tumors. To determine whether overexpression of NUP88 drives tumorigenesis, we engineered transgenic mice with doxycycline-inducible expression of Nup88. Surprisingly, NUP88 overexpression did not alter global nuclear transport, but was a potent inducer of aneuploidy and chromosomal instability. We determined that NUP88 and the nuclear transport factors NUP98 and RAE1 comprise a regulatory network that inhibits premitotic activity of the anaphase-promoting complex/cyclosome (APC/C). When overexpressed, NUP88 sequesters NUP98-RAE1 away from APC/CCDH1, triggering proteolysis of polo-like kinase 1 (PLK1), a tumor suppressor and multitasking mitotic kinase. Premitotic destruction of PLK1 disrupts centrosome separation, causing mitotic spindle asymmetry, merotelic microtubule-kinetochore attachments, lagging chromosomes, and aneuploidy. These effects were replicated by PLK1 insufficiency, indicating that PLK1 is responsible for the mitotic defects associated with NUP88 overexpression. These findings demonstrate that the NUP88-NUP98-RAE1-APC/CCDH1 axis contributes to aneuploidy and suggest that it may be deregulated in the initiating stages of a broad spectrum of human cancers. PMID:26731471

  5. In silico analysis, mapping of regulatory elements and corresponding dna-protein interaction in polyphenol oxidase gene promoter from different rice varieties

    Polyphenol oxidase (PPO) is an important enzyme that has positive impact regarding plant resistance against different biotic and abiotic stresses. In the present study PPO promoter from six different rice varieties was amplified and then analyzed for cis- and trans-acting elements. The study revealed a total of 79 different cis-acting regulatory elements including 11 elements restricted to only one or other variety. Among six varieties Pakhal-Basmati had highest number (5) of these elements, whereas C-622 and Rachna-Basmati have no such sequences. Rachna-Basmati, IR-36-Basmati and Kashmir- Basmati had 1, 2 and 3 unique elements, respectively. Different elementsrelated to pathogen, salt and water stresses were found, which may be helpful in controlling PPO activity according to changing environment. Moreover, HADDOCK was used to understand molecular mechanism of PPO regulation and it was found that DNA-protein interactions are stabilized by many potential hydrogen bonds. Adenine and arginine were the most reactive residues in DNA and proteins respectively.Structural comparison of different protein-DNA complexes show that even a highly conserved transcriptional factor can adopt different conformations when they contact a different DNA binding sequence, however their stable interactions depend on the number of hydrogen bonds formed and distance. (author)

  6. DNA methylation of specific CpG sites in the promoter region regulates the transcription of the mouse oxytocin receptor.

    Shimrat Mamrut

    Full Text Available Oxytocin is a peptide hormone, well known for its role in labor and suckling, and most recently for its involvement in mammalian social behavior. All central and peripheral actions of oxytocin are mediated through the oxytocin receptor, which is the product of a single gene. Transcription of the oxytocin receptor is subject to regulation by gonadal steroid hormones, and is profoundly elevated in the uterus and mammary glands during parturition. DNA methylation is a major epigenetic mechanism that regulates gene transcription, and has been linked to reduced expression of the oxytocin receptor in individuals with autism. Here, we hypothesized that transcription of the mouse oxytocin receptor is regulated by DNA methylation of specific sites in its promoter, in a tissue-specific manner. Hypothalamus-derived GT1-7, and mammary-derived 4T1 murine cell lines displayed negative correlations between oxytocin receptor transcription and methylation of the gene promoter, and demethylation caused a significant enhancement of oxytocin receptor transcription in 4T1 cells. Using a reporter gene assay, we showed that methylation of specific sites in the gene promoter, including an estrogen response element, significantly inhibits transcription. Furthermore, methylation of the oxytocin receptor promoter was found to be differentially correlated with oxytocin receptor expression in mammary glands and the uterus of virgin and post-partum mice, suggesting that it plays a distinct role in oxytocin receptor transcription among tissues and under different physiological conditions. Together, these results support the hypothesis that the expression of the mouse oxytocin receptor gene is epigenetically regulated by DNA methylation of its promoter.

  7. Regulation of human CYP2C9 expression by electrophilic stress involves activator protein 1 activation and DNA looping.

    Makia, Ngome L; Surapureddi, Sailesh; Monostory, Katalin; Prough, Russell A; Goldstein, Joyce A

    2014-08-01

    Cytochrome P450 (CYP)2C9 and CYP2C19 are important human enzymes that metabolize therapeutic drugs, environmental chemicals, and physiologically important endogenous compounds. Initial studies using primary human hepatocytes showed induction of both the CYP2C9 and CYP2C19 genes by tert-butylhydroquinone (tBHQ). As a pro-oxidant, tBHQ regulates the expression of cytoprotective genes by activation of redox-sensing transcription factors, such as the nuclear factor E2-related factor 2 (Nrf2) and members of the activator protein 1 (AP-1) family of proteins. The promoter region of CYP2C9 contains two putative AP-1 sites (TGAGTCA) at positions -2201 and -1930, which are also highly conserved in CYP2C19. The CYP2C9 promoter is activated by ectopic expression of cFos and JunD, whereas Nrf2 had no effect. Using specific kinase inhibitors for mitogen-activated protein kinase, we showed that extracellular signal-regulated kinase and Jun N-terminal kinase are essential for tBHQ-induced expression of CYP2C9. Electrophoretic mobility shift assays demonstrate that cFos distinctly interacts with the distal AP-1 site and JunD with the proximal site. Because cFos regulates target genes as heterodimers with Jun proteins, we hypothesized that DNA looping might be required to bring the distal and proximal AP-1 sites together to activate the CYP2C9 promoter. Chromosome conformation capture analyses confirmed the formation of a DNA loop in the CYP2C9 promoter, possibly allowing interaction between cFos at the distal site and JunD at the proximal site to activate CYP2C9 transcription in response to electrophiles. These results indicate that oxidative stress generated by exposure to electrophilic xenobiotics and metabolites induces the expression of CYP2C9 and CYP2C19 in human hepatocytes. PMID:24830941

  8. Activation of endocrine-related gene expression in placental choriocarcinoma cell lines following DNA methylation knock-down.

    Hogg, K; Robinson, W P; Beristain, A G

    2014-07-01

    Increasingly, placental DNA methylation is assessed as a factor in pregnancy-related complications, yet the transcriptional impact of such findings is not always clear. Using a proliferative in vitro placental model, the effect of DNA methylation loss on gene activation was evaluated at a number of genes selected for being differentially methylated in pre-eclampsia-associated placentae in vivo. We aimed to determine whether reduced DNA methylation at specific loci was associated with transcriptional changes at the corresponding gene, thus providing mechanistic underpinnings for previous clinical findings and to assess the degree of transcriptional response amongst our candidate genes. BeWo and JEG3 choriocarcinoma cells were exposed to 1 μM 5-Aza-2'-deoxycytidine (5-Aza-CdR) or vehicle control for 48 h, and re-plated and cultured for a further 72 h in normal media before cells were harvested for RNA and DNA. Bisulphite pyrosequencing confirmed that DNA methylation was reduced by ∼30-50% points at the selected loci studied in both cell lines. Gene activation, measured by qRT-PCR, was highly variable and transcript specific, indicating differential sensitivity to DNA methylation. Most notably, loss of DNA methylation at the leptin (LEP) promoter corresponded to a 200-fold and 40-fold increase in LEP expression in BeWo and JEG3 cells, respectively (P < 0.01). Transcripts of steroidogenic pathway enzymes CYP11A1 and HSD3B1 were up-regulated ∼40-fold in response to 5-Aza-CdR exposure in BeWo cells (P < 0.01). Other transcripts, including aromatase (CYP19), HSD11B2, inhibin (INHBA) and glucocorticoid receptor (NR3C1) were more moderately, although significantly, affected by loss of associated DNA methylation. These data present a mixed effect of DNA methylation changes at selected loci supporting cautionary interpretation of DNA methylation results in the absence of functional data. PMID:24623739

  9. International Association for Promoting Geoethics (IAPG): an update on activities

    Di Capua, Giuseppe; Bobrowsky, Peter; Kieffer, Susan; Peppoloni, Silvia; Tinti, Stefano

    2016-04-01

    The International Association for Promoting Geoethics (IAPG: http://www.geoethics.org) was founded on August 2012 to unite global geoscientists to raise the awareness of the scientific community regarding the importance of the ethical, social and cultural implications of geoscience research, education, and practice. IAPG is an international, multidisciplinary and scientific platform for discussion on ethical problems and dilemmas in Earth Sciences, promoting geoethical themes through scientific publications and conferences, strengthening the research base on geoethics, and focusing on case-studies as models for the development of effective and operative strategies. IAPG is legally recognized as a not-for-profit organization. It is a non-governmental, non-political, non-party institution, at all times free from racial, gender, religious or national prejudices. Its network continues to grow with more than 900 members in 103 countries, including 20 national sections. IAPG operates exclusively through donations and personal funds of its members. The results achieved since inception have been recognized by numerous international organizations. In particular, IAPG has obtained the status of affiliated organization by the International Union of Geological Sciences (IUGS), American Geosciences Institute (AGI), Geological Society of America (GSA), and the Geological Society of London (GSL). IAPG has enlarged its official relationships also through agreements on collaboration with other organizations, such as the American Geophysical Union (AGU), EuroGeoSurveys (EGS), European Federation of Geologists (EFG), Association of Environmental & Engineering Geologists (AEG), International Geoscience Education Organisation (IGEO), African Association of Women in Geosciences (AAWG), and others. IAPG considers publications as an indispensable activity to strengthen geoethics from a scientific point of view, so members are active in the publication of articles and editing of books on

  10. Modifications of genomic DNA by FLP site specific recombinase under the control of inducible promoters in maize and rice

    Introduction of specific mutations into genomic DNA requires elimination of any unwanted foreign DNA sequences, including selectable markers and vector DNA. Inefficient intrachromosomal homologous recombinations or DNA replacement strategies in combination with negative selection procedures have been employed to achieve this task in current gene targeting procedures. Maize protoplasts were stably co-transformed with the heat shock inducible FLP expression vector (pHsFLP) and the recombination test vector pUFNeoFmG. Eighty-four transgenic callus lines selected on medium containing kanamycin (100 μg/mL) were screened for GUS activity induced by heat shock treatment. In this experiment, 14 independently transformed lines responded to the higher temperature by activating gusA expression. 5 refs, 9 figs

  11. Cernunnos/XLF promotes the ligation of mismatched and noncohesive DNA ends

    Tsai, Chun J.; Kim, Sunny A.; Chu, Gilbert

    2007-01-01

    Nonhomologous end-joining (NHEJ) repairs DNA double-strand breaks created by ionizing radiation or V(D)J recombination of the immunoglobulin genes. The breaks often leave mismatched or nonligatable ends, and NHEJ must repair the breaks with high efficiency and minimal nucleotide loss. Here, the NHEJ proteins Ku, DNA-dependent protein kinase catalytic subunit, XRCC4/Ligase IV, and Cernunnos/XRCC4-like factor joined mismatched and noncohesive DNA ends in the absence of processing factors. Depen...

  12. Chk2-dependent phosphorylation of XRCC1 in the DNA damage response promotes base excision repair

    Chou, Wen-Cheng; Wang, Hui-Chun; Wong, Fen-Hwa; Ding, Shian-ling; Wu, Pei-Ei; Shieh, Sheau-Yann; Shen, Chen-Yang

    2008-01-01

    The DNA damage response (DDR) has an essential function in maintaining genomic stability. Ataxia telangiectasia-mutated (ATM)-checkpoint kinase 2 (Chk2) and ATM- and Rad3-related (ATR)-Chk1, triggered, respectively, by DNA double-strand breaks and blocked replication forks, are two major DDRs processing structurally complicated DNA damage. In contrast, damage repaired by base excision repair (BER) is structurally simple, but whether, and how, the DDR is involved in repairing this damage is un...

  13. DNA ligase III promotes alternative nonhomologous end-joining during chromosomal translocation formation.

    Deniz Simsek; Erika Brunet; Sunnie Yan-Wai Wong; Sachin Katyal; Yankun Gao; McKinnon, Peter J.; Jacqueline Lou; Lei Zhang; James Li; Rebar, Edward J; Gregory, Philip D.; Michael C. Holmes; Maria Jasin

    2011-01-01

    International audience Nonhomologous end-joining (NHEJ) is the primary DNA repair pathway thought to underlie chromosomal translocations and other genomic rearrangements in somatic cells. The canonical NHEJ pathway, including DNA ligase IV (Lig4), suppresses genomic instability and chromosomal translocations, leading to the notion that a poorly defined, alternative NHEJ (alt-NHEJ) pathway generates these rearrangements. Here, we investigate the DNA ligase requirement of chromosomal translo...

  14. Saccharomyces cerevisiae Rif1 cooperates with MRX-Sae2 in promoting DNA-end resection

    Martina, Marina; Bonetti, Diego; Villa, Matteo; Lucchini, Giovanna; Longhese, Maria Pia

    2014-01-01

    Diverse roles in DNA metabolism have been envisaged for budding yeast and mammalian Rif1. In particular, yeast Rif1 is involved in telomere homeostasis, while its mammalian counterpart participates in the cellular response to DNA double-strand breaks (DSBs). Here, we show that Saccharomyces cerevisiae Rif1 supports cell survival to DNA lesions in the absence of MRX or Sae2. Furthermore, it contributes to the nucleolytic processing (resection) of DSBs. This Rif1-dependent control of DSB resect...

  15. XLF interacts with the XRCC4-DNA ligase IV complex to promote DNA nonhomologous end-joining.

    Ahnesorg, Peter; Smith, Philippa; Jackson, Stephen P

    2006-01-27

    DNA nonhomologous end-joining (NHEJ) is a predominant pathway of DNA double-strand break repair in mammalian cells, and defects in it cause radiosensitivity at the cellular and whole-organism levels. Central to NHEJ is the protein complex containing DNA Ligase IV and XRCC4. By searching for additional XRCC4-interacting factors, we identified a previously uncharacterized 33 kDa protein, XRCC4-like factor (XLF, also named Cernunnos), that has weak sequence homology with XRCC4 and is predicted to display structural similarity to XRCC4. We show that XLF directly interacts with the XRCC4-Ligase IV complex in vitro and in vivo and that siRNA-mediated downregulation of XLF in human cell lines leads to radiosensitivity and impaired NHEJ. Furthermore, we establish that NHEJ-deficient 2BN cells derived from a radiosensitive and immune-deficient patient lack XLF due to an inactivating frameshift mutation in its gene, and that reintroduction of wild-type XLF into such cells corrects their radiosensitivity and NHEJ defects. XLF thus constitutes a novel core component of the mammalian NHEJ apparatus. PMID:16439205

  16. A benzoate-activated promoter from Aspergillus niger and regulation of its activity.

    Antunes, Mauricio S; Hodges, Thomas K; Carpita, Nicholas C

    2016-06-01

    The filamentous fungus Aspergillus niger is able to use benzoic acid as a sole carbon source by conversion to protocatechuic acid and subsequent metabolism. Synthesis of the first enzyme in this metabolic pathway, benzoate p-hydroxylase, is encoded by the bphA gene and positively regulated at the transcriptional level by benzoic acid. Methyl benzoate and para-aminobenzoate also act as inducers of the bphA gene. We show that bphA expression in A. niger in response to benzoate is confined to a 530-bp fragment from the bphA promoter region from -787 to -509 bp from the transcriptional start site. Electrophoretic mobility-shift assays show that a benzoate-response element, consisting of a single 6-bp sequence (5'-TAGTCA-3') within a 51-bp sequence in this region, is most likely to be involved in binding of one or more proteins that modulate the activity of the promoter in response to benzoic acid. We show through fusion of promoter fragments with the green fluorescent protein that the active sequences are located within a 200-bp sequence containing the TAGTCA benzoate-response element. Identification of the benzoate-response element in the bphA promoter region constitutes the first step in the development of a benzoate-inducible promoter system that could be used to control gene expression in fungi, and possibly in other organisms, such as plant and animal cells. PMID:26907094

  17. O6-methylguanine-DNA methyltransferase (MGMT) Promoter methylation is a rare event in soft tissue sarcoma

    Gene silencing of O6-methylguanine–DNA methyltransferase (MGMT) by promoter methylation improves the outcome of glioblastoma patients after combined therapy of alkylating chemotherapeutic agents and radiation. The purpose of this study was to assess the frequency of MGMT promoter methylation in soft tissue sarcoma to identify patients eligible for alkylating agent chemotherapy such as temozolomide. Paraffin tumor blocks of 75 patients with representative STS subtypes were evaluated. The methylation status of the MGMT promoter was assessed by methylation-specific polymerase-chain-reaction analysis (PCR). Furthermore, immunohistochemistry was applied to verify expression of MGMT. MGMT gene silencing was assumed if MGMT promoter methylation was present and the fraction of tumor cells expressing MGMT was 20% or less. Methylation specific PCR detected methylated MGMT promoter in 10/75 cases. Immunohistochemical staining of nuclear MGMT was negative in 15/75 cases. 6/75 tumor samples showed MGMT promoter methylation and negative immunohistochemical nuclear staining of MGMT. In none of the tested STS subtypes we found a fraction of tumors with MGMT silencing exceeding 22%. MGMT gene silencing is a rare event in soft tissue sarcoma and cannot be recommended as a selection criterion for the therapy of STS patients with alkylating agents such as temozolomide

  18. O6-methylguanine-DNA methyltransferase (MGMT Promoter methylation is a rare event in soft tissue sarcoma

    Jakob Jens

    2012-10-01

    Full Text Available Abstract Background Gene silencing of O6-methylguanine–DNA methyltransferase (MGMT by promoter methylation improves the outcome of glioblastoma patients after combined therapy of alkylating chemotherapeutic agents and radiation. The purpose of this study was to assess the frequency of MGMT promoter methylation in soft tissue sarcoma to identify patients eligible for alkylating agent chemotherapy such as temozolomide. Findings Paraffin tumor blocks of 75 patients with representative STS subtypes were evaluated. The methylation status of the MGMT promoter was assessed by methylation-specific polymerase-chain-reaction analysis (PCR. Furthermore, immunohistochemistry was applied to verify expression of MGMT. MGMT gene silencing was assumed if MGMT promoter methylation was present and the fraction of tumor cells expressing MGMT was 20% or less. Methylation specific PCR detected methylated MGMT promoter in 10/75 cases. Immunohistochemical staining of nuclear MGMT was negative in 15/75 cases. 6/75 tumor samples showed MGMT promoter methylation and negative immunohistochemical nuclear staining of MGMT. In none of the tested STS subtypes we found a fraction of tumors with MGMT silencing exceeding 22%. Conclusion MGMT gene silencing is a rare event in soft tissue sarcoma and cannot be recommended as a selection criterion for the therapy of STS patients with alkylating agents such as temozolomide.

  19. Molecular mechanism by which AMP-activated protein kinase activation promotes glycogen accumulation in muscle

    Hunter, Roger W; Treebak, Jonas Thue; Wojtaszewski, Jørgen;

    2011-01-01

    OBJECTIVE During energy stress, AMP-activated protein kinase (AMPK) promotes glucose transport and glycolysis for ATP production, while it is thought to inhibit anabolic glycogen synthesis by suppressing the activity of glycogen synthase (GS) to maintain the energy balance in muscle. Paradoxically...... transgenic mice overexpressing a kinase dead (KD) AMPK were incubated with glucose tracers and the AMPK-activating compound 5-aminoimidazole-4-carboxamide ribonucleoside (AICAR) ex vivo. GS activity and glucose uptake and utilization (glycolysis and glycogen synthesis) were assessed. RESULTS Even though...

  20. Synthesis, characterization and chemoprotective activity of polyoxovanadates against DNA alkylation.

    Nunes, Giovana G; Bonatto, Ana C; de Albuquerque, Carla G; Barison, Andersson; Ribeiro, Ronny R; Back, Davi F; Andrade, André Vitor C; de Sá, Eduardo L; Pedrosa, Fábio de O; Soares, Jaísa F; de Souza, Emanuel M

    2012-03-01

    The alkylation of pUC19 plasmid DNA has been employed as a model reaction for the first studies on chemoprotective action by a mixed-valence (+IV/+V) polyoxovanadate. A new, non-hydrothermal route for the high yield preparation of the test compound is described. The deep green, microcrystalline solid A was isolated after a three-day reaction in water at 80°C and 1 atm, while the reaction at 100°C gave green crystals of B. Both solids were structurally characterized by X-ray diffractometry and FTIR, EPR, NMR and Raman spectroscopies. Product A was identified as (NH(4))(2)V(3)O(8), while B corresponds to the spherical polyoxoanion [V(15)O(36)(Cl)](6-), isolated as the NMe(4)(+) salt. The lack of solubility of A in water and buffers prevented its use in DNA interaction studies, which were then carried out with B. Complex B was also tested for its ability to react with DNA alkylating agents by incubation with diethylsulphate (DES) and dimethylsulphate (DMS) in both the absence and presence of pUC19. For DMS, the best results were obtained with 10 mM of B (48% protection); with DES, this percentage increased to 70%. The direct reaction of B with increasing amounts of DMS in both buffered (PIPES 50 mM) and non-buffered aqueous solutions revealed the sequential formation of several vanadium(IV), vanadium(V) and mixed-valence aggregates of different nuclearities, whose relevance to the DNA-protecting activity is discussed. PMID:22265837

  1. Usage of Sales Promotion in the Tourism Activity

    Bunghez Corina Larisa

    2014-01-01

    The article describes marketing techniques, analyzing in detail the promotion of sales and in particular group sales, price discounts and merchandising, which have not received detailed analyses in terms of applicability and effects in the field of tourism. Due to the immateriality of tourist products, the promotion hereof is rather difficult to achieve, irrespective of the manner one may choose. Each category of promotion techniques uses specific means and methods of action. Publicity helps ...

  2. Constitutive NF-κB activation and tumor-growth promotion by Romo1-mediated reactive oxygen species production

    Highlights: • Romo1 expression is required for constitutive nuclear DNA-binding activity of NF-κB. • Romo1 depletion suppresses tumor growth in vivo. • Romo1 presents a potential therapeutic target for diseases. - Abstract: Deregulation of nuclear factor-κB (NF-κB) and related pathways contribute to tumor cell proliferation and invasion. Mechanisms for constitutive NF-κB activation are not fully explained; however, the underlying defects appear to generate and maintain pro-oxidative conditions. In hepatocellular carcinoma (HCC) tissues, up-regulation of reactive oxygen species modulator 1 (Romo1) correlates positively with tumor size. In the present study, we showed that Romo1 expression is required to maintain constitutive nuclear DNA-binding activity of NF-κB and transcriptional activity through constitutive IκBα phosphorylation. Overexpression of Romo1 promoted p65 nuclear translocation and DNA-binding activity. We also show that Romo1 depletion suppressed anchorage-independent colony formation by HCC cells and suppressed tumor growth in vivo. Based on these findings, Romo1 may be a principal regulatory factor in the maintenance of constitutive NF-κB activation in tumor cells. In the interest of anti-proliferative treatments for cancer, Romo1 may also present a productive target for drug development

  3. Interleukin-6 Promotes Tumorigenesis by Altering DNA Methylation in Oral Cancer Cells

    Gasche, Jacqueline A; Hoffmann, Jürgen; Boland, C. Richard; Goel, Ajay

    2011-01-01

    Worldwide oral squamous cell carcinoma (OSCC) accounts for more than 100,000 deaths each year. Chronic inflammation constitutes one of the key risk factors for OSCC. Accumulating evidence suggests that aberrant DNA methylation may contribute to OSCC tumorigenesis. This study investigated whether chronic inflammation alters DNA methylation and expression of cancer-associated genes in OSCC.

  4. Tousled-like kinases phosphorylate Asf1 to promote histone supply during DNA replication

    Klimovskaia, Ilnaz M; Young, Clifford; Strømme, Caroline B;

    2014-01-01

    During DNA replication, nucleosomes are rapidly assembled on newly synthesized DNA to restore chromatin organization. Asf1, a key histone H3-H4 chaperone required for this process, is phosphorylated by Tousled-like kinases (TLKs). Here, we identify TLK phosphorylation sites by mass spectrometry and...

  5. Precore/basal core promoter mutants and hepatitis B viral DNA levels as predictors for liver deaths and hepatocellular carcinoma

    Myron J Tong; Lawrence M Blatt; Jia-Horng Kao; Jason Tzuying Cheng; William G Corey

    2006-01-01

    AIM: To conduct a retrospective study in 400 chronic hepatitis B patients in order to identify hepatitis B viral factors associated with complications of liver disease or development of hepatocellular carcinoma.METHODS: The mean follow-up time was 83.6 ± 39.6mo. Alpha-fetoprotein test and abdominal ultrasound were used for cancer surveillance. Hepatitis B basal core promoter mutants, precore mutants, genotypes,hepatitis B viral DNA (HBV DNA) level and hepatitis B e antigen (HBeAg) were measured. Univariate analysis and logistic regression were used to assess odds ratios for viral factors related to liver deaths and hepatocellular carcinoma development.RESULTS: During follow-up, 38 patients had liver deaths not related to hepatocellular carcinoma. On multivariate analysis, older age [odds ratio: 95.74 (12.13-891.31);P < 0.0001], male sex [odds ratio: 7.61 (2.20-47.95);P = 0.006], and higher log10 HBV DNA [odds ratio:4.69 (1.16-20.43); P < 0.0001] were independently predictive for these liver related deaths. Also, 31 patients developed hepatocellular carcinoma. Multivariate analysis showed that older age [odds ratio: 26.51 (2.36-381.47);P = 0.007], presence of precore mutants [odds ratio:4.23 (1.53-19.58); P = 0.02] and presence of basal core promoter mutants [odds ratio: 2.93 (1.24-7.57); P =0.02] were independent predictors for progression to hepatocellular carcinoma.CONCLUSION: Our results show that high levels of baseline serum HBV DNA are associated with nonhepatocellular carcinoma-related deaths of liver failure,while genetic mutations in the basal core promoter and precore regions are predictive for development of hepatocellular carcinoma.

  6. Differential promoter methylation of kinesin family member 1a in plasma is associated with breast cancer and DNA repair capacity.

    Guerrero-Preston, Rafael; Hadar, Tal; Ostrow, Kimberly Laskie; Soudry, Ethan; Echenique, Miguel; Ili-Gangas, Carmen; Pérez, Gabriela; Perez, Jimena; Brebi-Mieville, Priscilla; Deschamps, José; Morales, Luisa; Bayona, Manuel; Sidransky, David; Matta, Jaime

    2014-08-01

    Methylation alterations of CpG islands, CpG island shores and first exons are key events in the formation and progression of human cancer, and an increasing number of differentially methylated regions and genes have been identified in breast cancer. Recent studies of the breast cancer methylome using deep sequencing and microarray platforms are providing a novel insight on the different roles aberrant methylation plays in molecular subtypes of breast cancer. Accumulating evidence from a subset of studies suggests that promoter methylation of tumor-suppressor genes associated with breast cancer can be quantified in circulating DNA. However, there is a paucity of studies that examine the combined presence of genetic and epigenetic alterations associated with breast cancer using blood-based assays. Dysregulation of DNA repair capacity (DRC) is a genetic risk factor for breast cancer that has been measured in lymphocytes. We isolated plasma DNA from 340 participants in a breast cancer case control project to study promoter methylation levels of five genes previously shown to be associated with breast cancer in frozen tissue and in cell line DNA: MAL, KIF1A, FKBP4, VGF and OGDHL. Methylation of at least one gene was found in 49% of the cases compared to 20% of the controls. Three of the four genes had receiver characteristic operator curve values of ≥ 0.50: MAL (0.64), KIF1A (0.51) and OGDHL (0.53). KIF1A promoter methylation was associated with breast cancer and inversely associated with DRC. This is the first evidence of a significant association between genetic and epigenetic alterations in breast cancer using blood-based tests. The potential diagnostic utility of these biomarkers and their relevance for breast cancer risk prediction should be examined in larger cohorts. PMID:24927296

  7. Photon-induced cell migration and integrin expression promoted by DNA integration of HPV16 genome

    Rieken, Stefan; Simon, Florian; Habermehl, Daniel; Dittmar, Jan Oliver; Combs, Stephanie E.; Weber, Klaus; Debus, Juergen; Lindel, Katja [University Hospital of Heidelberg, Department of Radiation Therapy and Radiation Oncology, Heidelberg (Germany)

    2014-10-15

    Persistent human papilloma virus 16 (HPV16) infections are a major cause of cervical cancer. The integration of the viral DNA into the host genome causes E2 gene disruption which prevents apoptosis and increases host cell motility. In cervical cancer patients, survival is limited by local infiltration and systemic dissemination. Surgical control rates are poor in cases of parametrial infiltration. In these patients, radiotherapy (RT) is administered to enhance local control. However, photon irradiation itself has been reported to increase cell motility. In cases of E2-disrupted cervical cancers, this phenomenon would impose an additional risk of enhanced tumor cell motility. Here, we analyze mechanisms underlying photon-increased migration in keratinocytes with differential E2 gene status. Isogenic W12 (intact E2 gene status) and S12 (disrupted E2 gene status) keratinocytes were analyzed in fibronectin-based and serum-stimulated migration experiments following single photon doses of 0, 2, and 10 Gy. Quantitative FACS analyses of integrin expression were performed. Migration and adhesion are increased in E2 gene-disrupted keratinocytes. E2 gene disruption promotes attractability by serum components, therefore, effectuating the risk of local infiltration and systemic dissemination. In S12 cells, migration is further increased by photon RT which leads to enhanced expression of fibronectin receptor integrins. HPV16-associated E2 gene disruption is a main predictor of treatment-refractory cancer virulence. E2 gene disruption promotes cell motility. Following photon RT, E2-disrupted tumors bear the risk of integrin-related infiltration and dissemination. (orig.) [German] Persistierende Infektionen mit humanen Papillomaviren 16 (HPV16) sind ein Hauptausloeser des Zervixkarzinoms. Die Integration der viralen DNS in das Wirtszellgenom fuehrt zum Integritaetsverlust des E2-Gens, wodurch in der Wirtszelle Apoptose verhindert und Motilitaet gesteigert werden. In

  8. Primary characterization and basal promoter activity of two hexamerin genes of Musca domestica

    C.K. Moreira

    2004-02-01

    Full Text Available Hexamerins are high molecular-weight proteins found in the hemolymph of insects and have been proposed to function as storage proteins. In previous studies, two Musca domestica hexamerins, designated Hex-L and Hex-F were characterized. Hex-L is synthesized exclusively by the larval fat bodies, is secreted into the hemolymph and likely provides a source of amino acids and energy during metamorphosis. Hex-F synthesis is induced by a proteinaceous meal and occurs only in the adult insect fat bodies. Hex-F also is secreted into the hemolymph and it has been suggested that in females it may be an amino acid reservoir to be used during the final stages of egg formation. Genomic clones containing full-length copies of the genes MdHexL1 and MdHexF1, encoding subunits of the larval and the adult female hexamerin, respectively, were isolated. Complete nucleotide sequences, including the 5'-end untranscribed regions, were determined and analyzed for each of the genes. Comparisons of the conceptual translation products of the cloned genes indicated that MdHexL1 and MdHexF1 are related to the larval serum proteins (LSP 1 and 2 of Calliphora vicina and Drosophila melanogaster. DNA fragments containing the putative promoters of the two hexamerin genes were compared and cloned into a plasmid vector so as to drive the expression of the GFP reporter gene. The constructs were assayed in vitro in transfected S2 Drosophila melanogaster cells demonstrating that the cloned M. domestica DNA fragments exhibit promoter activity.

  9. Leaf extracts from Moricandia arvensis promote antiproliferation of human cancer cells, induce apoptosis, and enhance antioxidant activity.

    Skandrani, Ines; Boubaker, Jihed; Bhouri, Wissem; Limem, Ilef; Kilani, Soumaya; Ben Sghaier, Mohamed; Neffati, Aicha; Bouhlel, Ines; Ghedira, Kamel; Chekir-Ghedira, Leila

    2010-01-01

    The in vitro antiproliferative, apoptotic, and antioxidant activities from leaf extracts of Moricandia arvensis, which are used in traditional cooking and medicines, were investigated. The MTT assay revealed that only TOF (total oligomer flavonoids), ethyl acetate (EA), chloroform (Chl), and petroleum ether (PE) extracts inhibited the proliferation of K562 cells. Apoptosis plays a very important role in the treatment of cancer by promoting the apoptosis of cancer cells and limiting the concurrent death of normal cells. Thus, the possible effects of M. arvensis extracts on the induction of apoptosis in human leukemic cells (K562 cells) were investigated. The electrophoretic analysis of DNA fragmentation confirms that TOF, Chl, PE, and EA extracts provoke DNA fragmentation. Using the lipid peroxidation inhibitory assay, the antioxidant capacity of M. arvensis extracts was evaluated by the ability of each extract to inhibit malondialdehyde formation. It was revealed that EA and TOF extracts are the most active in scavenging the hydroxyl radicals. PMID:19995267

  10. Evaluation of INK4A promoter methylation using pyrosequencing and circulating cell-free DNA from patients with hepatocellular carcinoma

    Kirk, Jason L.; Merwat, Shehzad N.; Ju, Hyunsu; Soloway, Roger D.; Wieck, Lucas R.; Li, Albert; Okorodudu, Anthony O.; Petersen, John R.; Abdulla, Nihal E.; Duchini, Andrea; Cicalese, Luca; Rastellini, Cristiana; Hu, Peter C.; Dong, Jianli

    2015-01-01

    Background Hyper-methylation of CpG dinucleotides in the promoter region of inhibitor of cyclin-dependent kinase 4A (INK4A) has been reported in 60%–80% of hepatocellular carcinoma (HCC). As INK4A promoter hypermethylation event occurs early in HCC progression, the quantification of INK4A promoter methylation in blood sample may represent a useful biomarker for non-invasive diagnosis and prediction of response to therapy. Methods We examined INK4A promoter methylation using circulating cell-free DNA (ccfDNA) in a total of 109 serum specimens, including 66 HCC and 43 benign chronic liver diseases. Methylation of the individual seven CpG sites was examined using pyrosequencing. Results Our results showed that there were significantly higher levels of methylated INK4A in HCC specimens than controls and that the seven CpG sites had different levels of methylation and might exist in different PCR amplicons. The area under receiver operating characteristic (ROC) curve was 0.82, with 65.3% sensitivity and 87.2% specificity at 5% (LOD), 39.0% sensitivity and 96.5% specificity at 7% LOD, and 20.3% sensitivity and 98.8% specificity at 10% LOD, respectively. Conclusions Our results support additional studies incorporating INK4A methylation testing of ccfDNA to further validate the diagnostic, predictive, and prognostic characteristics of this biomarker in HCC patients. The knowledge of the existence of epi-alleles should help improve assay design to maximize detection. PMID:24406287

  11. Photodynamic activation as a molecular switch to promote osteoblast cell differentiation via AP-1 activation.

    Kushibiki, Toshihiro; Tu, Yupeng; Abu-Yousif, Adnan O; Hasan, Tayyaba

    2015-01-01

    In photodynamic therapy (PDT), cells are impregnated with a photosensitizing agent that is activated by light irradiation, thereby photochemically generating reactive oxygen species (ROS). The amounts of ROS produced depends on the PDT dose and the nature of the photosensitizer. Although high levels of ROS are cytotoxic, at physiological levels they play a key role as second messengers in cellular signaling pathways, pluripotency, and differentiation of stem cells. To investigate further the use of photochemically triggered manipulation of such pathways, we exposed mouse osteoblast precursor cells and rat primary mesenchymal stromal cells to low-dose PDT. Our results demonstrate that low-dose PDT can promote osteoblast differentiation via the activation of activator protein-1 (AP-1). Although PDT has been used primarily as an anti-cancer therapy, the use of light as a photochemical "molecular switch" to promote differentiation should expand the utility of this method in basic research and clinical applications. PMID:26279470

  12. Parent participation plays an important part in promoting physical activity

    Anna-Karin Lindqvist

    2015-08-01

    Full Text Available Although physical activity (PA is an important and modifiable determinant of health, in Sweden only 15% of boys and 10% of girls aged 15 years old achieve the recommended levels of PA 7 days per week. Adolescents’ PA levels are associated with social influence exerted by parents, friends, and teachers. The purpose of this study was to describe parents’ experiences of being a part of their adolescents’ empowerment-inspired PA intervention. A qualitative interview study was performed at a school in the northern part of Sweden. A total of 10 parents were interviewed, and the collected data were analyzed with qualitative content analysis. Three subthemes were combined into one main theme, demonstrating that parents are one important part of a successful PA intervention. The life of an adolescent has many options and demands that make it difficult to prioritize PA. Although parents felt that they were important in supporting their adolescent, a successful PA intervention must have multiple components. Moreover, the parents noted that the intervention had a positive effect upon not only their adolescents’, but also their own PA. Interventions aimed at promoting PA among adolescents should include measures to stimulate parent participation, have an empowerment approach, and preferably be school-based.

  13. The enhancement effect of pp38 gene product on the activity of its upstream bi-directional promoter in Marek's disease virus

    2006-01-01

    There was a bi-directional promoter between gene 38 kd phosphorylated protein (pp38) gene and 1.8-kb mRNA transcript gene family in the genome of Marek's disease virus (MDV). In this study, enhanced green fluorescence protein (EGFP) reporter plamids, pP(pp38)-EGFP and pP(1.8- kb)-EGFP, were constructed under this bi-directional promoter in two directions. The two plasmids were transfected into uninfected chicken embryo fibroblast (CEF), MDV clone rMd5 infected CEF (rMd5-CEF) and pp38-deleted derivative rMd5Δpp38 infected CEF (rMd5Δpp38-CEF) respectively. Transfection analysis showed that EGFP was only expressed in rMd5-CEF, and no EGFP could be detected in uninfected CEF or rMd5Δpp38-CEF, implying that pp38 was a factor influencing the activity of the promoter. The pp38-expressing recombinant plasmid pcDNA-pp38 was constructed to co- transfect CEF or rMd5Δpp38-CEF with pP(pp38)-EGFP or pP(1.8-kb)-EGFP. In this case, EGFP could be detected only in rMd5Δpp38-CEF but still not in uninfected CEF, implying that pp38 needs other protein(s) to work together for the complete trans-acting activity. Another MDV gene, 24 kd phosphorylated protein pp24 gene was cloned into pcDNA3.1 as a pp24-expressing recombinant plasmid pcDNA-pp24. When uninfected CEF was co-transfected with pcDNA-pp38, pcDNA-pp24 and EGFP expressing plasmids pP(pp38)-EGFP or pP(1.8-kb)-EGFP, the EGFP could be detected. These results indicated that pp38 and pp24 could enhance the activity of the promoter when they worked together. DNA mobility shift assay showed that pp38 would bind to the bi-directional promoter with the co-existing of pp24, although neither of them alone influenced mobility of the promoter DNA. All the above suggested that MDV pp38 could transactivate the bi-directional promoter when combined with pp24. The results also indicated that the activity of the promoter in the direction of 1.8-kb mRNA was significantly stronger than that of pp38 direction.

  14. Damage-induced DNA replication stalling relies on MAPK-activated protein kinase 2 activity

    Kopper, F.; Bierwirth, C.; Schon, M.;

    2013-01-01

    DNA damage can obstruct replication forks, resulting in replicative stress. By siRNA screening, we identified kinases involved in the accumulation of phosphohistone 2AX (gamma H2AX) upon UV irradiation-induced replication stress. Surprisingly, the strongest reduction of phosphohistone 2AX followed...... replication impaired by gemcitabine or by Chk1 inhibition. This rescue strictly depended on transiesion DNA polymerases. In conclusion, instead of being an unavoidable consequence of DNA damage, alterations of replication speed and origin firing depend on MK2-mediated signaling....... knockdown of the MAP kinase-activated protein kinase 2 (MK2), a kinase currently implicated in p38 stress signaling and G2 arrest. Depletion or inhibition of MK2 also protected cells from DNA damage-induced cell death, and mice deficient for MK2 displayed decreased apoptosis in the skin upon UV irradiation...

  15. PLCz functional haplotypes modulating promoter transcriptional activity are associated with semen quality traits in Chinese Holstein bulls.

    Qing Pan

    Full Text Available The sperm-specific phospholipase C zeta (PLCz is a candidate sperm-borne oocyte-activating factor that triggers a characteristic series of physiological stimuli via cytoplasmic Ca(2+ oscillations during fertilization. The molecular mechanisms involved in the regulation of PLCz gene expression remain largely unknown. To explore the genetic variations in the 5'-flanking region of the PLCz gene and their common haplotypes in Chinese Holstein bulls, as well as to determine whether these variations affect bovine semen quality traits and transcriptional activity, DNA samples were collected from Chinese Holstein bulls and sequenced for the identification of genetic variants in the 5'-flanking region of PLCz. Two genetic variants were identified, and their haplotypic profiles were constructed. The two novel genetic variations (g. -456 G>A and g. +65 T>C were genotyped in 424 normal Chinese Holstein bulls. Bioinformatics analysis revealed that both loci are in transcription factor binding sites of the core promoter region. The association studies revealed that the two genetic variations and their haplotype combinations significantly affected semen quality traits. Using serially truncated constructs of the bovine PLCz promoters and the luciferase reporter, we found that a 726 bp (-641 nt to +112 nt fragment constitutes the core promoter region. Furthermore, four haplotypes, H1H1 (GTGT, H2H2 (GCGC, H3H3 (ATAT, and H4H4 (ACAC, were significantly associated with semen quality traits and successfully transfected into MLTC-1 cell lines. The luciferase reporter assay showed that the different haplotypes exhibited distinct promoter activities. Maximal promoter activity was demonstrated by the H2H2 haplotypes, as compared with the other haplotypes. To the best of our knowledge, this study is the first report on genetic variants and their respective haplotypes in the 5'-flanking region of PLCz gene that can influence the semen quality of Chinese Holstein bulls as

  16. Allele-specific DNA methylation reinforces PEAR1 enhancer activity.

    Izzi, Benedetta; Pistoni, Mariaelena; Cludts, Katrien; Akkor, Pinar; Lambrechts, Diether; Verfaillie, Catherine; Verhamme, Peter; Freson, Kathleen; Hoylaerts, Marc F

    2016-08-18

    Genetic variation in the PEAR1 locus is linked to platelet reactivity and cardiovascular disease. The major G allele of rs12041331, an intronic cytosine guanine dinucleotide-single-nucleotide polymorphism (CpG-SNP), is associated with higher PEAR1 expression in platelets and endothelial cells than the minor A allele. The molecular mechanism underlying this difference remains elusive. We have characterized the histone modification profiles of the intronic region surrounding rs12041331 and identified H3K4Me1 enhancer-specific enrichment for the region that covers the CpG-SNP. Interestingly, methylation studies revealed that the CpG site is fully methylated in leukocytes of GG carriers. Nuclear protein extracts from megakaryocytes, endothelial cells, vs control HEK-293 cells show a 3-fold higher affinity for the methylated G allele compared with nonmethylated G or A alleles in a gel electrophoretic mobility shift assay. To understand the positive relationship between methylation and gene expression, we studied DNA methylation at 4 different loci of PEAR1 during in vitro megakaryopoiesis. During differentiation, the CpG-SNP remained fully methylated, while we observed rapid methylation increases at the CpG-island overlapping the first 5'-untranslated region exon, paralleling the increased PEAR1 expression. In the same region, A-allele carriers of rs12041331 showed significantly lower DNA methylation at CGI1 compared with GG homozygote. This CpG-island contains binding sites for the methylation-sensitive transcription factor CTCF, whose binding is known to play a role in enhancer activation and/or repression. In conclusion, we report the molecular characterization of the first platelet function-related CpG-SNP, a genetic predisposition that reinforces PEAR1 enhancer activity through allele-specific DNA methylation. PMID:27313330

  17. DNA Fingerprinting Using PCR: A Practical Forensic Science Activity

    Choi, Hyun-Jung; Ahn, Jung Hoon; Ko, Minsu

    2008-01-01

    This paper describes a forensic science simulation programme applicable for use in colleges. Students were asked to find a putative suspect by DNA fingerprinting using a simple protocol developed in this study. DNA samples were obtained from a hair root and a drop of blood, common sources of DNA in forensic science. The DNA fingerprinting protocol…

  18. Combining Health Promotion Classroom Lessons with Health Fair Activities

    Cooper, Leslie; Eliason, Kathy; True, Alexandra

    2004-01-01

    This article focuses on the important role of the school nurse in promoting healthy lifestyle choices through networking, resource identification, and working with community partners. "Everyone Is Healthy at Northeast" was a health promotion program designed and presented in two ways: classroom lessons and a health fair. There were interactive…

  19. Loss of TET2 in hematopoietic cells leads to DNA hypermethylation of active enhancers and induction of leukemogenesis.

    Rasmussen, Kasper D; Jia, Guangshuai; Johansen, Jens V; Pedersen, Marianne T; Rapin, Nicolas; Bagger, Frederik O; Porse, Bo T; Bernard, Olivier A; Christensen, Jesper; Helin, Kristian

    2015-05-01

    DNA methylation is tightly regulated throughout mammalian development, and altered DNA methylation patterns are a general hallmark of cancer. The methylcytosine dioxygenase TET2 is frequently mutated in hematological disorders, including acute myeloid leukemia (AML), and has been suggested to protect CG dinucleotide (CpG) islands and promoters from aberrant DNA methylation. In this study, we present a novel Tet2-dependent leukemia mouse model that closely recapitulates gene expression profiles and hallmarks of human AML1-ETO-induced AML. Using this model, we show that the primary effect of Tet2 loss in preleukemic hematopoietic cells is progressive and widespread DNA hypermethylation affecting up to 25% of active enhancer elements. In contrast, CpG island and promoter methylation does not change in a Tet2-dependent manner but increases relative to population doublings. We confirmed this specific enhancer hypermethylation phenotype in human AML patients with TET2 mutations. Analysis of immediate gene expression changes reveals rapid deregulation of a large number of genes implicated in tumorigenesis, including many down-regulated tumor suppressor genes. Hence, we propose that TET2 prevents leukemic transformation by protecting enhancers from aberrant DNA methylation and that it is the combined silencing of several tumor suppressor genes in TET2 mutated hematopoietic cells that contributes to increased stem cell proliferation and leukemogenesis. PMID:25886910

  20. Identification and annotation of promoter regions in microbial genome sequences on the basis of DNA stability

    Vetriselvi Rangannan; Manju Bansal

    2007-08-01

    Analysis of various predicted structural properties of promoter regions in prokaryotic as well as eukaryotic genomes had earlier indicated that they have several common features, such as lower stability, higher curvature and less bendability, when compared with their neighboring regions. Based on the difference in stability between neighboring upstream and downstream regions in the vicinity of experimentally determined transcription start sites, a promoter prediction algorithm has been developed to identify prokaryotic promoter sequences in whole genomes. The average free energy (E) over known promoter sequences and the difference (D) between E and the average free energy over the entire genome (G) are used to search for promoters in the genomic sequences. Using these cutoff values to predict promoter regions across entire Escherichia coli genome, we achieved a reliability of 70% when the predicted promoters were cross verified against the 960 transcription start sites (TSSs) listed in the Ecocyc database. Annotation of the whole E. coli genome for promoter region could be carried out with 49% accuracy. The method is quite general and it can be used to annotate the promoter regions of other prokaryotic genomes.

  1. Cdt2-mediated XPG degradation promotes gap-filling DNA synthesis in nucleotide excision repair.

    Han, Chunhua; Wani, Gulzar; Zhao, Ran; Qian, Jiang; Sharma, Nidhi; He, Jinshan; Zhu, Qianzheng; Wang, Qi-En; Wani, Altaf A

    2015-01-01

    Xeroderma pigmentosum group G (XPG) protein is a structure-specific repair endonuclease, which cleaves DNA strands on the 3' side of the DNA damage during nucleotide excision repair (NER). XPG also plays a crucial role in initiating DNA repair synthesis through recruitment of PCNA to the repair sites. However, the fate of XPG protein subsequent to the excision of DNA damage has remained unresolved. Here, we show that XPG, following its action on bulky lesions resulting from exposures to UV irradiation and cisplatin, is subjected to proteasome-mediated proteolytic degradation. Productive NER processing is required for XPG degradation as both UV and cisplatin treatment-induced XPG degradation is compromised in NER-deficient XP-A, XP-B, XP-C, and XP-F cells. In addition, the NER-related XPG degradation requires Cdt2, a component of an E3 ubiquitin ligase, CRL4(Cdt2). Micropore local UV irradiation and in situ Proximity Ligation assays demonstrated that Cdt2 is recruited to the UV-damage sites and interacts with XPG in the presence of PCNA. Importantly, Cdt2-mediated XPG degradation is crucial to the subsequent recruitment of DNA polymerase δ and DNA repair synthesis. Collectively, our data support the idea of PCNA recruitment to damage sites which occurs in conjunction with XPG, recognition of the PCNA-bound XPG by CRL4(Cdt2) for specific ubiquitylation and finally the protein degradation. In essence, XPG elimination from DNA damage sites clears the chromatin space needed for the subsequent recruitment of DNA polymerase δ to the damage site and completion of gap-filling DNA synthesis during the final stage of NER. PMID:25483071

  2. Homocysteine Triggers Inflammatory Responses in Macrophages through Inhibiting CSE-H2S Signaling via DNA Hypermethylation of CSE Promoter

    Jiao-Jiao Li

    2015-06-01

    Full Text Available Hyperhomocysteinemia (HHcy is an independent risk factor of atherosclerosis and other cardiovascular diseases. Unfortunately, Hcy-lowering strategies were found to have limited effects in reducing cardiovascular events. The underlying mechanisms remain unclear. Increasing evidence reveals a role of inflammation in the pathogenesis of HHcy. Homocysteine (Hcy is a precursor of hydrogen sulfide (H2S, which is formed via the transsulfuration pathway catalyzed by cystathionine β-synthase and cystathionine γ-lyase (CSE and serves as a novel modulator of inflammation. In the present study, we showed that methionine supplementation induced mild HHcy in mice, associated with the elevations of TNF-α and IL-1β in the plasma and reductions of plasma H2S level and CSE expression in the peritoneal macrophages. H2S-releasing compound GYY4137 attenuated the increases of TNF-α and IL-1β in the plasma of HHcy mice and Hcy-treated raw264.7 cells while CSE inhibitor PAG exacerbated it. Moreover, the in vitro study showed that Hcy inhibited CSE expression and H2S production in macrophages, accompanied by the increases of DNA methyltransferase (DNMT expression and DNA hypermethylation in cse promoter region. DNMT inhibition or knockdown reversed the decrease of CSE transcription induced by Hcy in macrophages. In sum, our findings demonstrate that Hcy may trigger inflammation through inhibiting CSE-H2S signaling, associated with increased promoter DNA methylation and transcriptional repression of cse in macrophages.

  3. The histone demethylase LSD1/KDM1A promotes the DNA damage response

    Mosammaparast, Nima; Kim, Haeyoung; Laurent, Benoit; Zhao, Yu; Lim, Hui Jun; Majid, Mona C.; Dango, Sebastian; Luo, Yuying; Hempel, Kristina; Sowa, Mathew E.; Gygi, Steven P.; Steen, Hanno; Harper, J. Wade; Yankner, Bruce; Shi, Yang

    2013-01-01

    Histone demethylation is known to regulate transcription, but its role in other processes is largely unknown. We report a role for the histone demethylase LSD1/KDM1A in the DNA damage response (DDR). We show that LSD1 is recruited directly to sites of DNA damage. H3K4 dimethylation, a major substrate for LSD1, is reduced at sites of DNA damage in an LSD1-dependent manner. The E3 ubiquitin ligase RNF168 physically interacts with LSD1 and we find this interaction to be important for LSD1 recrui...

  4. Xeroderma Pigmentosum Group A Promotes Autophagy to Facilitate Cisplatin Resistance in Melanoma Cells through the Activation of PARP1.

    Ge, Rui; Liu, Lin; Dai, Wei; Zhang, Weigang; Yang, Yuqi; Wang, Huina; Shi, Qiong; Guo, Sen; Yi, Xiuli; Wang, Gang; Gao, Tianwen; Luan, Qi; Li, Chunying

    2016-06-01

    Xeroderma pigmentosum group A (XPA), a key protein in the nucleotide excision repair pathway, has been shown to promote the resistance of tumor cells to chemotherapeutic drugs by facilitating the DNA repair process. However, the role of XPA in the resistance of melanoma to platinum-based drugs like cisplatin is largely unknown. In this study, we initially found that XPA was expressed at higher levels in cisplatin-resistant melanoma cells than in cisplatin-sensitive ones. Furthermore, the knockdown of XPA not only increased cellular apoptosis but also inhibited cisplatin-induced autophagy, which rendered the melanoma cells more sensitive to cisplatin. Moreover, we discovered that the increased XPA in resistant melanoma cells promoted poly(adenosine diphosphate-ribose) polymerase 1 (PARP1) activation and that the inhibition of PARP1 could attenuate the cisplatin-induced autophagy. Finally, we proved that the inhibition of PARP1 and the autophagy process made resistant melanoma cells more susceptible to cisplatin treatment. Our study shows that XPA can promote cell-protective autophagy in a DNA repair-independent manner by enhancing the activation of PARP1 in melanoma cells resistant to cisplatin and that the XPA-PARP1-mediated autophagy process can be targeted to overcome cisplatin resistance in melanoma chemotherapy. PMID:26880244

  5. Determination of Free Radical Scavenging, Antioxidative DNA Damage Activities and Phytochemical Components of Active Fractions from Lansium domesticum Corr. Fruit.

    Klungsupya, Prapaipat; Suthepakul, Nava; Muangman, Thanchanok; Rerk-Am, Ubon; Thongdon-A, Jeerayu

    2015-08-01

    Lansium domesticum Corr. or "long-kong" is one of the most popular fruits in Thailand. Its peel (skin, SK) and seeds (SD) become waste unless recycled or applied for use. This study was undertaken to determine the bioactivity and phytochemical components of L. domesticum (LD) skin and seed extracts. Following various extraction and fractionation procedures, 12 fractions were obtained. All fractions were tested for antioxidant capacity against O2(-•) and OH(•). It was found that the peel of L. domesticum fruits exhibited higher O2(-•) and OH(•) scavenging activity than seeds. High potential antioxidant activity was found in two fractions of 50% ethanol extract of peel followed by ethyl acetate (EA) fractionation (LDSK50-EA) and its aqueous phase (LDSK50-H2O). Therefore, these two active fractions were selected for further studies on their antioxidative activity against DNA damage by hydrogen peroxide (H2O2) in human TK6 cells using comet assay. The comet results revealed DNA-protective activity of both LDSK50-EA and LDSK50-H2O fractions when TK6 human lymphoblast cells were pre-treated at 25, 50, 100, and 200 μg/mL for 24 h prior to H2O2 exposure. The phytochemical analysis illustrated the presence of phenolic substances, mainly scopoletin, rutin, and chlorogenic acid, in these two active fractions. This study generates new information on the biological activity of L. domesticum. It will promote and strengthen the utilization of L. domesticum by-products. PMID:26287238

  6. Determination of Free Radical Scavenging, Antioxidative DNA Damage Activities and Phytochemical Components of Active Fractions from Lansium domesticum Corr. Fruit

    Prapaipat Klungsupya

    2015-08-01

    Full Text Available Lansium domesticum Corr. or “long-kong” is one of the most popular fruits in Thailand. Its peel (skin, SK and seeds (SD become waste unless recycled or applied for use. This study was undertaken to determine the bioactivity and phytochemical components of L. domesticum (LD skin and seed extracts. Following various extraction and fractionation procedures, 12 fractions were obtained. All fractions were tested for antioxidant capacity against O2−• and OH•. It was found that the peel of L. domesticum fruits exhibited higher O2−• and OH• scavenging activity than seeds. High potential antioxidant activity was found in two fractions of 50% ethanol extract of peel followed by ethyl acetate (EA fractionation (LDSK50-EA and its aqueous phase (LDSK50-H2O. Therefore, these two active fractions were selected for further studies on their antioxidative activity against DNA damage by hydrogen peroxide (H2O2 in human TK6 cells using comet assay. The comet results revealed DNA-protective activity of both LDSK50-EA and LDSK50-H2O fractions when TK6 human lymphoblast cells were pre-treated at 25, 50, 100, and 200 μg/mL for 24 h prior to H2O2 exposure. The phytochemical analysis illustrated the presence of phenolic substances, mainly scopoletin, rutin, and chlorogenic acid, in these two active fractions. This study generates new information on the biological activity of L. domesticum. It will promote and strengthen the utilization of L. domesticum by-products.

  7. Embryonic turkey liver: activities of biotransformation enzymes and activation of DNA-reactive carcinogens

    Perrone, Carmen E.; Duan, Jian Dong; Jeffrey, Alan M.; Williams, Gary M. [New York Medical College, Department of Pathology, Valhalla (United States); Ahr, Hans-Juergen; Schmidt, Ulrich [Bayer AG, Institute of Toxicology, Wuppertal (Germany); Enzmann, Harald H. [Federal Institute for Drugs and Medical Devices, Bonn (Germany)

    2004-10-01

    Avian embryos are a potential alternative model for chemical toxicity and carcinogenicity research. Because the toxic and carcinogenic effects of some chemicals depend on bioactivation, activities of biotransformation enzymes and formation of DNA adducts in embryonic turkey liver were examined. Biochemical analyses of 22-day in ovoturkey liver post-mitochondrial fractions revealed activities of the biotransformation enzymes 7-ethoxycoumarin de-ethylase (ECOD), 7-ethoxyresorufin de-ethylase (EROD), aldrin epoxidase (ALD), epoxide hydrolase (EH), glutathione S-transferase (GST), and UDP-glucuronyltransferase (GLUT). Following the administration of phenobarbital (24 mg/egg) on day 21, enzyme activities of ECOD, EROD, ALD, EH and GLUT, but not of GST, were increased by two-fold or higher levels by day 22. In contrast, acute administration of 3-methylcholanthrene (5 mg/egg) induced only ECOD and EROD activities. Bioactivation of structurally diverse pro-carcinogens was also examined using {sup 32}P-postlabeling for DNA adducts. In ovoexposure of turkey embryos on day 20 of gestation to 2-acetylaminofluorene (AAF), 4,4'-methylenebis(2-chloroaniline) (MOCA), benzo[a]pyrene (BaP), and 2-amino-3,8-dimethylimidazo[4,5-f]quinoxaline (MeIQx) resulted in the formation of DNA adducts in livers collected by day 21. Some of the DNA adducts had {sup 32}P-postlabeling chromatographic migration patterns similar to DNA adducts found in livers from Fischer F344 rats exposed to the same pro-carcinogens. We conclude that 21-day embryonic turkey liver is capable of chemical biotransformation and activation of genotoxic carcinogens to form DNA adducts. Thus, turkey embryos could be utilized to investigate potential chemical toxicity and carcinogenicity. (orig.)

  8. Activity-based in vitro selection of T4 DNA ligase

    Recent in vitro methodologies for selection and directed evolution of proteins have concentrated not only on proteins with affinity such as single-chain antibody but also on enzymes. We developed a display technology for selection of T4 DNA ligase on ribosome because an in vitro selection method for DNA ligase had never been developed. The 3' end of mRNA encoding the gene of active or inactive T4 DNA ligase-spacer peptide fusion protein was hybridized to dsDNA fragments with cohesive ends, the substrate of T4 DNA ligase. After in vitro translation of the mRNA-dsDNA complex in a rabbit reticulocyte system, a mRNA-dsDNA-ribosome-ligase complex was produced. T4 DNA ligase enzyme displayed on a ribosome, through addition of a spacer peptide, is able to react with dsDNA in the complex. The complex expressing active ligase was biotinylated by ligation with another biotinylated dsDNA probe and selected with streptavidin-coated magnetic beads. We effectively selected active T4 DNA ligase from a small amount of protein. The gene of the active T4 DNA ligase was enriched 40 times from a mixture of active and inactive genes using this selection strategy. This ribosomal display strategy may have high potential to be useful for selection of other enzymes associated with DNA

  9. cis-active elements from mouse chromosomal DNA suppress simian virus 40 DNA replication.

    Hartl, M.; Willnow, T; Fanning, E

    1990-01-01

    Simian virus 40 (SV40)-containing DNA was rescued after the fusion of SV40-transformed VLM cells with permissive COS1 monkey cells and cloned, and prototype plasmid clones were characterized. A 2-kilobase mouse DNA fragment fused with the rescued SV40 DNA, and derived from mouse DNA flanking the single insert of SV40 DNA in VLM cells, was sequenced. Insertion of the intact rescued mouse sequence, or two nonoverlapping fragments of it, into wild-type SV40 plasmid DNA suppressed replication of ...

  10. Molecular and functional characterization of the promoter region of the mouse LDH/C gene: enhancer-assisted, Sp1-mediated transcriptional activation.

    Yang, J; THOMAS, K.

    1997-01-01

    Molecular and functional studies of the LDH/C 5' upstream promoter elements were undertaken to elucidate the molecular mechanisms involved in temporal activation of LDH/C gene expression in differentiating germ cells. Ligation mediated-PCR (LM-PCR) gene walking techniques were exploited to isolate a 2.1 kb fragment of the mouse LDH/C 5' promoter region. DNA sequence analysis of this isolated genomic fragment indicated that the mouse LDH/C promoter contained TATA and CCAT boxes as well as a GC...

  11. Human cytomegalovirus gene UL76 induces IL-8 expression through activation of the DNA damage response.

    Helena Costa

    2013-09-01

    Full Text Available Human cytomegalovirus (HCMV, a β-herpesvirus, has evolved many strategies to subvert both innate and adaptive host immunity in order to ensure its survival and propagation within the host. Induction of IL-8 is particularly important during HCMV infection as neutrophils, primarily attracted by IL-8, play a key role in virus dissemination. Moreover, IL-8 has a positive effect in the replication of HCMV. This work has identified an HCMV gene (UL76, with the relevant property of inducing IL-8 expression at both transcriptional and protein levels. Up-regulation of IL-8 by UL76 results from activation of the NF-kB pathway as inhibition of both IKK-β activity or degradation of Ikβα abolishes the IL-8 induction and, concomitantly, expression of UL76 is associated with the translocation of p65 to the nucleus where it binds to the IL-8 promoter. Furthermore, the UL76-mediated induction of IL-8 requires ATM and is correlated with the phosphorylation of NEMO on serine 85, indicating that UL76 activates NF-kB pathway by the DNA Damage response, similar to the impact of genotoxic drugs. More importantly, a UL76 deletion mutant virus was significantly less efficient in stimulating IL-8 production than the wild type virus. In addition, there was a significant reduction of IL-8 secretion when ATM -/- cells were infected with wild type HCMV, thus, indicating that ATM is also involved in the induction of IL-8 by HCMV. In conclusion, we demonstrate that expression of UL76 gene induces IL-8 expression as a result of the DNA damage response and that both UL76 and ATM have a role in the mechanism of IL-8 induction during HCMV infection. Hence, this work characterizes a new role of the activation of DNA Damage response in the context of host-pathogen interactions.

  12. Surface-promoted aggregation of amphiphilic quadruplex ligands drives their selectivity for alternative DNA structures.

    Laguerre, Aurélien; Chang, Yi; Pirrotta, Marc; Desbois, Nicolas; Gros, Claude P; Lesniewska, Eric; Monchaud, David

    2015-07-01

    Scientists are currently truly committed to enhance the specificity of chemotherapeutics that target DNA. To this end, sequence-specific drugs have progressively given way to structure-specific therapeutics. However, while numerous strategies have been implemented to design high-affinity candidates, strategies devoted to the design of high-selectivity ligands are still rare. Here we report on such an approach via the study of an amphiphilic compound, TEGPy, that self-assembles at a liquid/solid interface to provide nanosized objects that are stable in water. The resulting aggregates, identified through atomic force microscopy measurements, were found to disassemble upon interaction with DNA in a structure-specific manner (quadruplex- versus duplex-DNA). Our results provide a fertile ground for devising new strategies aiming at concomitantly enhancing DNA structural specificity and the water-solubility of aggregation-prone ligands. PMID:26040925

  13. Cyclical DNA Methylation and Histone Changes Are Induced by LPS to Activate COX-2 in Human Intestinal Epithelial Cells

    Brancaccio, Mariarita; Coretti, Lorena; Florio, Ermanno; Pezone, Antonio; Calabrò, Viola; Falco, Geppino; Keller, Simona; Lembo, Francesca; Avvedimento, Vittorio Enrico; Chiariotti, Lorenzo

    2016-01-01

    Bacterial lipopolysaccharide (LPS) induces release of inflammatory mediators both in immune and epithelial cells. We investigated whether changes of epigenetic marks, including selected histone modification and DNA methylation, may drive or accompany the activation of COX-2 gene in HT-29 human intestinal epithelial cells upon exposure to LPS. Here we describe cyclical histone acetylation (H3), methylation (H3K4, H3K9, H3K27) and DNA methylation changes occurring at COX-2 gene promoter overtime after LPS stimulation. Histone K27 methylation changes are carried out by the H3 demethylase JMJD3 and are essential for COX-2 induction by LPS. The changes of the histone code are associated with cyclical methylation signatures at the promoter and gene body of COX-2 gene. PMID:27253528

  14. DNA-guided assembly of biosynthetic pathways promotes improved catalytic efficiency

    Benčina, Mojca; Hodnik, Vesna; Mori, Jerneja; Koprivnjak, Tomaž; Gaber, Rok; Tomšič, Nejc; Turnšek, Jernej; Lebar, Tina; Conrado, Robert J.; Jerala, Roman; Glavnik, Vesna; Avbelj, Monika; Vovk, Irena; Anderluh, Gregor

    2015-01-01

    Synthetic scaffolds that permit spatial and temporal organization of enzymes in living cells are a promising post-translational strategy for controlling the flow of information in both metabolic and signaling pathways. Here, we describe the use of plasmid DNA as a stable, robust and configurable scaffold for arranging biosynthetic enzymes in the cytoplasm of Escherichia coli. This involved conversion of individual enzymes into custom DNA-binding proteins by genetic fusion to zinc-finger domai...

  15. 78 FR 24393 - Agency Information Collection Activities; Comment Request; Promoting Student Success in Algebra I...

    2013-04-25

    ... Agency Information Collection Activities; Comment Request; Promoting Student Success in Algebra I Project... notice will be considered public records. Title of Collection: Promoting Student Success in Algebra I... Estimated Number of Annual Burden Hours: 208. Abstract: The Promoting Student Success in Algebra I...

  16. Zinc promotes proliferation and activation of myogenic cells via the PI3K/Akt and ERK signaling cascade

    Skeletal muscle stem cells named muscle satellite cells are normally quiescent but are activated in response to various stimuli, such as injury and overload. Activated satellite cells enter the cell cycle and proliferate to produce a large number of myogenic progenitor cells, and these cells then differentiate and fuse to form myofibers. Zinc is one of the essential elements in the human body, and has multiple roles, including cell growth and DNA synthesis. However, the role of zinc in myogenic cells is not well understood, and is the focus of this study. We first examined the effects of zinc on differentiation of murine C2C12 myoblasts and found that zinc promoted proliferation, with an increased number of cells incorporating EdU, but inhibited differentiation with reduced myogenin expression and myotube formation. Furthermore, we used the C2C12 reserve cell model of myogenic quiescence to investigate the role of zinc on activation of myogenic cells. The number of reserve cells incorporating BrdU was increased by zinc in a dose dependent manner, with the number dramatically further increased using a combination of zinc and insulin. Akt and extracellular signal-regulated kinase (ERK) are downstream of insulin signaling, and both were phosphorylated after zinc treatment. The zinc/insulin combination-induced activation involved the phosphoinositide 3-kinase (PI3K)/Akt and ERK cascade. We conclude that zinc promotes activation and proliferation of myogenic cells, and this activation requires phosphorylation of PI3K/Akt and ERK as part of the signaling cascade. - Highlights: • Zinc has roles for promoting proliferation and inhibition differentiation of C2C12. • Zinc promotes activation of reserve cells. • Insulin and zinc synergize activation of reserve cells. • PI3K/Akt and ERK cascade affect zinc/insulin-mediated activation of reserve cells

  17. Zinc promotes proliferation and activation of myogenic cells via the PI3K/Akt and ERK signaling cascade

    Ohashi, Kazuya, E-mail: asuno10k@yahoo.co.jp [Department of Life Sciences, Graduate School of Arts and Sciences, The University of Tokyo (Japan); Nagata, Yosuke, E-mail: cynagata@mail.ecc.u-tokyo.ac.jp [Department of Life Sciences, Graduate School of Arts and Sciences, The University of Tokyo (Japan); Wada, Eiji, E-mail: gacchu1@yahoo.co.jp [Department of Life Sciences, Graduate School of Arts and Sciences, The University of Tokyo (Japan); Zammit, Peter S., E-mail: peter.zammit@kcl.ac.uk [Randall Division of Cell and Molecular Biophysics, King' s College London, London SE1 1UL (United Kingdom); Shiozuka, Masataka, E-mail: cmuscle@mail.ecc.u-tokyo.ac.jp [Department of Life Sciences, Graduate School of Arts and Sciences, The University of Tokyo (Japan); Matsuda, Ryoichi, E-mail: cmatsuda@mail.ecc.u-tokyo.ac.jp [Department of Life Sciences, Graduate School of Arts and Sciences, The University of Tokyo (Japan)

    2015-05-01

    Skeletal muscle stem cells named muscle satellite cells are normally quiescent but are activated in response to various stimuli, such as injury and overload. Activated satellite cells enter the cell cycle and proliferate to produce a large number of myogenic progenitor cells, and these cells then differentiate and fuse to form myofibers. Zinc is one of the essential elements in the human body, and has multiple roles, including cell growth and DNA synthesis. However, the role of zinc in myogenic cells is not well understood, and is the focus of this study. We first examined the effects of zinc on differentiation of murine C2C12 myoblasts and found that zinc promoted proliferation, with an increased number of cells incorporating EdU, but inhibited differentiation with reduced myogenin expression and myotube formation. Furthermore, we used the C2C12 reserve cell model of myogenic quiescence to investigate the role of zinc on activation of myogenic cells. The number of reserve cells incorporating BrdU was increased by zinc in a dose dependent manner, with the number dramatically further increased using a combination of zinc and insulin. Akt and extracellular signal-regulated kinase (ERK) are downstream of insulin signaling, and both were phosphorylated after zinc treatment. The zinc/insulin combination-induced activation involved the phosphoinositide 3-kinase (PI3K)/Akt and ERK cascade. We conclude that zinc promotes activation and proliferation of myogenic cells, and this activation requires phosphorylation of PI3K/Akt and ERK as part of the signaling cascade. - Highlights: • Zinc has roles for promoting proliferation and inhibition differentiation of C2C12. • Zinc promotes activation of reserve cells. • Insulin and zinc synergize activation of reserve cells. • PI3K/Akt and ERK cascade affect zinc/insulin-mediated activation of reserve cells.

  18. Detecting the movement and spawning activity of bigheaded carps with environmental DNA.

    Erickson, Richard A; Rees, Christopher B; Coulter, Alison A; Merkes, Christopher M; McCalla, Sunnie G; Touzinsky, Katherine F; Walleser, Liza; Goforth, Reuben R; Amberg, Jon J

    2016-07-01

    Bigheaded carps are invasive fishes threatening to invade the Great Lakes basin and establish spawning populations, and have been monitored using environmental DNA (eDNA). Not only does eDNA hold potential for detecting the presence of species, but may also allow for quantitative comparisons like relative abundance of species across time or space. We examined the relationships among bigheaded carp movement, hydrography, spawning and eDNA on the Wabash River, IN, USA. We found positive relationships between eDNA and movement and eDNA and hydrography. We did not find a relationship between eDNA and spawning activity in the form of drifting eggs. Our first finding demonstrates how eDNA may be used to monitor species abundance, whereas our second finding illustrates the need for additional research into eDNA methodologies. Current applications of eDNA are widespread, but the relatively new technology requires further refinement. PMID:27087387

  19. Length-dependent binding of human XLF to DNA and stimulation of XRCC4.DNA ligase IV activity.

    Lu, Haihui; Pannicke, Ulrich; Schwarz, Klaus; Lieber, Michael R

    2007-04-13

    An XRCC4-like factor, called XLF or Cernunnos, was recently identified as another important factor in the non-homologous DNA end joining (NHEJ) process. NHEJ is the major pathway for the repair of double-strand DNA breaks. The similarity in the putative secondary structures of XLF and XRCC4 as well as the association of XLF with XRCC4.DNA ligase IV in vivo suggested a role in the final ligation step of NHEJ. Here, we find that purified XLF directly interacts with purified XRCC4.DNA ligase IV complex and stimulates the ligase complex in a direct assay for ligation activity. Purified XLF has DNA binding activity, but this binding is dependent on DNA length in a manner most consistent with orientation of the C-terminal alpha helices parallel to the DNA helix. To better understand the function of XLF, we purified an XLF mutant (R57G), which was identified in patients with NHEJ deficiency and severe combined immunodeficiency. Surprisingly, the mutant protein retained its ability to stimulate XRCC4.DNA ligase IV but failed to translocate to the nucleus, and this appears to be the basis for the NHEJ defect in this patient. PMID:17317666

  20. Prevalence of human cell material: DNA and RNA profiling of public and private objects and after activity scenarios.

    van den Berge, M; Ozcanhan, G; Zijlstra, S; Lindenbergh, A; Sijen, T

    2016-03-01

    Especially when minute evidentiary traces are analysed, background cell material unrelated to the crime may contribute to detectable levels in the genetic analyses. To gain understanding on the composition of human cell material residing on surfaces contributing to background traces, we performed DNA and mRNA profiling on samplings of various items. Samples were selected by considering events contributing to cell material deposits in exemplary activities (e.g. dragging a person by the trouser ankles), and can be grouped as public objects, private samples, transfer-related samples and washing machine experiments. Results show that high DNA yields do not necessarily relate to an increased number of contributors or to the detection of other cell types than skin. Background cellular material may be found on any type of public or private item. When a major contributor can be deduced in DNA profiles from private items, this can be a different person than the owner of the item. Also when a specific activity is performed and the areas of physical contact are analysed, the "perpetrator" does not necessarily represent the major contributor in the STR profile. Washing machine experiments show that transfer and persistence during laundry is limited for DNA and cell type dependent for RNA. Skin conditions such as the presence of sebum or sweat can promote DNA transfer. Results of this study, which encompasses 549 samples, increase our understanding regarding the prevalence of human cell material in background and activity scenarios. PMID:26736139

  1. Determination of polyphenolic content, HPLC analyses and DNA cleavage activity of Malaysian Averrhoa carambola L. fruit extracts

    Zakia Khanam

    2015-10-01

    Full Text Available In developing countries, the increasing gap between population growth and food supply has created renewed interest in finding reliable and cheap natural resources of nutraceutical value and health promoting properties. Therefore, the present study deals with the phytochemical analyses and DNA cleavage activity of Averrhoa carambola L. fruit (starfruit extracts. The phytochemical studies involve colour tests and quantification of phenolics and flavonoids of the prepared ethanolic and aqueous extracts. Identification of phenolic acids and flavonoids present in the extracts were conducted by high performance liquid chromatography (HPLC equipped with diode array detector (DAD. DNA cleavage activity of the extracts was evaluated through gel electrophoresis against plasmid Escherichia coli DNA at different concentrations (0.125–0.60 μg/μl. The results of the study exhibited that the starfruit is a rich source of polyphenols and all the extracts exhibited a dose dependent DNA cleavage activity, whereas ethanolic extract induced more cleavage as compared to the aqueous extract. In conclusion, the present study provides preliminary evidence with regard to nutraceutical value of the fruit. So, further extensive study is a prerequisite to exploit DNA cleaving properties of the fruit extracts for therapeutic application.

  2. DNA-recognition by a σ54 transcriptional activator from Aquifex aeolicus

    Vidangos, Natasha K.; Heideker, Johanna; Lyubimov, Artem; Lamers, Meindert; Huo, Yixin; Pelton, Jeffrey G.; Ton, Jimmy; Gralla, Jay; Berger, James; Wemmer, David E.

    2014-01-01

    Transcription initiation by bacterial σ54-polymerase requires the action of a transcriptional activator protein. Activators bind sequence-specifically upstream of the transcription initiation site via a DNA-binding domain. The structurally characterized DNA-binding domains from activators all belong to the Factor for Inversion Stimulation (Fis) family of helix-turn-helix DNA-binding proteins. We report here structures of the free and DNA-bound forms of the DNA-binding domain of NtrC4 (4DBD) f...

  3. Hepatitis B virus can be inhibited by DNA methyltransferase 3a via specific zinc-finger-induced methylation of the X promoter.

    Xirong, L; Rui, L; Xiaoli, Y; Qiuyan, H; Bikui, T; Sibo, Z; Naishuo, Z

    2014-02-01

    In this work we explored whether DNA methyltransferase 3a (Dnmt3a) targeted to the HBV X promoter (XP) causes epigenetic suppression of hepatitis B virus (HBV). The C-terminus of Dnmt3a (Dnmt3aC) was fused to a six-zinc-finger peptide specific to XP to form a fused DNA methyltransferase (XPDnmt3aC). The binding and methyl-modifying specificity of XPDnmt3aC were verified with an electrophoretic mobility shift assay and methylation-specific PCR, respectively. XP activity and HBV expression were clearly downregulated in HepG2 cells transfected with plasmid pXPDnmt3aC. The injection of XPDnmt3aC into HBV transgenic (TgHBV) mice also showed significant inhibition, leading to low serum HBV surface protein (HBsAg) levels and a reduced viral load. Thus, XPDnmt3aC specifically silenced HBV via site-selective DNA methylation delivered by zinc-finger peptides. This study establishes the foundation of an epigenetic way of controlling HBV-related diseases. PMID:24794726

  4. Investigation of DNA binding, DNA photocleavage, topoisomerase I inhibition and antioxidant activities of water soluble titanium(IV) phthalocyanine compounds.

    Özel, Arzu; Barut, Burak; Demirbaş, Ümit; Biyiklioglu, Zekeriya

    2016-04-01

    The binding mode of water soluble peripherally tetra-substituted titanium(IV) phthalocyanine (Pc) compounds Pc1, Pc2 and Pc3 with calf thymus (CT) DNA was investigated by using UV-Vis spectroscopy and thermal denaturation studies in this work. The results of DNA binding constants (Kb) and the changes in the thermal denaturation profile of DNA with the addition of Pc compounds indicated that Pc1, Pc2 and Pc3 are able to bind to CT-DNA with different binding affinities. DNA photocleavage studies of Pc compounds were performed in the absence and presence of oxidizing agents such as hydrogen peroxide (H2O2), ascorbic acid (AA) and 2-mercaptoethanol (ME) using the agarose gel electrophoresis method at irradiation 650nm. According to the results of electrophoresis studies, Pc1, Pc2 and Pc3 cleaved of supercoiled pBR322 DNA via photocleavage pathway. The Pc1, Pc2 and Pc3 compounds were examined for topoisomerase I inhibition by measuring the relaxation of supercoiled pBR322 DNA. The all of Pc compounds inhibited topoisomerase I at 20μM concentration. A series of antioxidant assays, including 2,2-diphenyl-1-picrylhydrazyl (DPPH) assay, superoxide radical scavenging (SOD) assay and metal chelating effect assay were performed for Pc1, Pc2 and Pc3 compounds. The results of antioxidant assays indicated that Pc1, Pc2 and Pc3 compounds have remarkable superoxide radical scavenging activities, moderate 2,2-diphenyl-1-picrylhydrazyl activities and metal chelating effect activities. All the experimental studies showed that Pc1, Pc2 and Pc3 compounds bind to CT-DNA via minor groove binding, cleave of supercoiled pBR322 DNA via photocleavage pathway, inhibit topoisomerase I and have remarkable superoxide radical scavenging activities. Thanks to these properties the Pc1, Pc2 and Pc3 compounds are suitable agents for photo dynamic therapy. PMID:26882290

  5. Repetitive elements and enforced transcriptional repression co-operate to enhance DNA methylation spreading into a promoter CpG-island

    Repression of many tumor suppressor genes in cancer is concurrent with aberrantly increased DNA methylation levels at promoter CpG islands (CGIs). About one-fourth of empirically defined human promoters are surrounded by or contain clustered repetitive elements. It was previously observed that a sha...

  6. The Rad9 protein enhances survival and promotes DNA repair following exposure to ionizing radiation

    Following DNA damage cells initiate cell cycle checkpoints to allow time to repair sustained lesions. Rad9, Rad1, and Hus1 proteins form a toroidal complex, termed the 9-1-1 complex, that is involved in checkpoint signaling. 9-1-1 shares high structural similarity to the DNA replication protein proliferating cell nuclear antigen (PCNA) and 9-1-1 has been shown in vitro to stimulate steps of the repair process known as long patch base excision repair. Using a system that allows conditional repression of the Rad9 protein in human cell culture, we show that Rad9, and by extension, the 9-1-1 complex, enhances cell survival, is required for efficient exit from G2-phase arrest, and stimulates the repair of damaged DNA following ionizing radiation. These data provide in vivo evidence that the human 9-1-1 complex participates in DNA repair in addition to its previously described role in DNA damage sensing

  7. Properties of an endonuclease activity in Micrococcus luteus acting on γ-irradiated DNA and on apurinic DNA

    A protein fraction from Micrococcus luteus with endonuclease activity against γ-irradiated DNA was isolated and characterized. An additional activity on apurinic sites could not be separated, either by sucrose gradient sedimentation or by gel filtration through Sephadex G 100. From gel filtration, a molecular weight of about 25 000 was calculated for both endonuclease activities. The endonuclease activity against γ-irradiated DNA was stimulated five-fold with 5 mM Mg++, whereas that against apurinic sites was less dependent on the Mg++ concentration. 100 mM KCl inhibited the γ-ray endonuclease, but not the apurinic endonuclease activity. In γ-irradiated DNA the protein recognized 1.65 endonuclease sensitive sites per radiation-induced single-strand break, among which are 0.45 alkali labile lesions in the nucleotide strand. The was evaluated resulting in a Ksub(m)-value of 73 nM. (author)

  8. Delivery of a survivin promoter-driven antisense survivin-expressing plasmid DNA as a cancer therapeutic: a proof-of-concept study

    Lin KY

    2016-05-01

    Full Text Available Kun-Yuan Lin,1 Siao Muk Cheng,2 Shing-Ling Tsai,2 Ju-Ya Tsai,1 Chun-Hui Lin,1 Chun Hei Antonio Cheung1,2 1Department of Pharmacology, College of Medicine, National Cheng Kung University, Tainan, Taiwan, ROC; 2Institute of Basic Medical Sciences, College of Medicine, National Cheng Kung University, Tainan, Taiwan, ROC Abstract: Survivin is a member of the inhibitor-of-apoptosis proteins family. It is overexpressed in many different cancer types but not in the differentiated normal tissue. In addition, overexpression of survivin promotes cancer cell survival and induces chemotherapeutic drug resistance, making it an attractive target for new anticancer interventions. Despite survivin being a promising molecular target for anticancer treatment, it is widely accepted that survivin is only a “semi-druggable” target. Therefore, it is important to develop a new strategy to target survivin for anticancer treatment. In this study, we constructed a novel survivin promoter-driven full-length antisense survivin (pSur/AS-Sur expression plasmid DNA. Promoter activity assay revealed that the activity of the survivin promoter of pSur/AS-Sur correlated with the endogenous expression of survivin at the transcriptional level in the transfected A549, MDA-MB-231, and PANC-1 cancer cells. Western blot analysis showed that liposomal delivery of pSur/AS-Sur successfully downregulated the expression of survivin in A549, MBA-MB-231, and PANC-1 cells in vitro. In addition, delivery of pSur/AS-Sur induced autophagy, caspase-dependent apoptosis, and caspase-independent apoptosis as indicated by the increased LC3B-II conversion, autophagosome formation, caspase-9/-3 and poly(ADP-ribose polymerase-1 cleavage, and apoptosis-inducing factor nuclear translocation in A549, MBA-MB-231, and PANC-1 cells. Importantly, liposomal delivery of pSur/AS-Sur was also capable of decreasing the proliferation of the survivin/MDR1 coexpressing multidrug-resistant KB-TAX50 cancer cells and

  9. ATRX loss promotes tumor growth and impairs nonhomologous end joining DNA repair in glioma.

    Koschmann, Carl; Calinescu, Anda-Alexandra; Nunez, Felipe J; Mackay, Alan; Fazal-Salom, Janet; Thomas, Daniel; Mendez, Flor; Kamran, Neha; Dzaman, Marta; Mulpuri, Lakshman; Krasinkiewicz, Johnathon; Doherty, Robert; Lemons, Rosemary; Brosnan-Cashman, Jacqueline A; Li, Youping; Roh, Soyeon; Zhao, Lili; Appelman, Henry; Ferguson, David; Gorbunova, Vera; Meeker, Alan; Jones, Chris; Lowenstein, Pedro R; Castro, Maria G

    2016-03-01

    Recent work in human glioblastoma (GBM) has documented recurrent mutations in the histone chaperone protein ATRX. We developed an animal model of ATRX-deficient GBM and showed that loss of ATRX reduces median survival and increases genetic instability. Further, analysis of genome-wide data for human gliomas showed that ATRX mutation is associated with increased mutation rate at the single-nucleotide variant (SNV) level. In mouse tumors, ATRX deficiency impairs nonhomologous end joining and increases sensitivity to DNA-damaging agents that induce double-stranded DNA breaks. We propose that ATRX loss results in a genetically unstable tumor, which is more aggressive when left untreated but is more responsive to double-stranded DNA-damaging agents, resulting in improved overall survival. PMID:26936505

  10. RNF4 interacts with both SUMO and nucleosomes to promote the DNA damage response.

    Groocock, Lynda M; Nie, Minghua; Prudden, John; Moiani, Davide; Wang, Tao; Cheltsov, Anton; Rambo, Robert P; Arvai, Andrew S; Hitomi, Chiharu; Tainer, John A; Luger, Karolin; Perry, J Jefferson P; Lazzerini-Denchi, Eros; Boddy, Michael N

    2014-05-01

    The post-translational modification of DNA repair and checkpoint proteins by ubiquitin and small ubiquitin-like modifier (SUMO) critically orchestrates the DNA damage response (DDR). The ubiquitin ligase RNF4 integrates signaling by SUMO and ubiquitin, through its selective recognition and ubiquitination of SUMO-modified proteins. Here, we define a key new determinant for target discrimination by RNF4, in addition to interaction with SUMO. We identify a nucleosome-targeting motif within the RNF4 RING domain that can bind DNA and thereby enables RNF4 to selectively ubiquitinate nucleosomal histones. Furthermore, RNF4 nucleosome-targeting is crucially required for the repair of TRF2-depleted dysfunctional telomeres by 53BP1-mediated non-homologous end joining. PMID:24714598

  11. Inactivation of the WNT5A Alternative Promoter B Is Associated with DNA Methylation and Histone Modification in Osteosarcoma Cell Lines U2OS and SaOS-2.

    Himani Vaidya

    Full Text Available WNT5A is a secreted ligand involved in Wnt pathway signaling and has a role in cell movement and differentiation. Altered WNT5A expression is associated with various cancers, although in most studies the focus has been on only one of the known WNT5A isoforms. In this study, we analyzed expression from two of the major WNT5A promoters, termed promoter A and promoter B, in normal human osteoblasts, SaOS-2 and U2OS osteosarcoma cell lines, and osteosarcoma tumor tissue. We found that both promoters A and B are active in normal osteoblasts with nearly 11-fold more promoter B than A transcripts. Promoter B but not promoter A transcripts are decreased or nearly undetectable in the SaOS-2 and U2OS cell lines and osteosarcoma tumor tissues. Transient transfection of promoter A and promoter B reporter constructs confirmed that SaOS-2 cells have the necessary factors to transcribe both promoters. Bisulfite sequencing analysis revealed that three CpG enriched regions upstream of the promoter B exon 1βare highly methylated in both SaOS-2 and U2OS cells. The CpG island sub-region R6 located in promoter B exon 1β was approximately 51% methylated in SaOS-2 and 25% methylated in U2OS. Region 3 was approximately 28% methylated in normal osteoblasts, whereas the others were unmethylated. Promoter B was re-activated by treatment of SaOS-2 cells with 1 μM 5-azacytidine, which was associated with only a small insignificant change in methylation of sub-region R6. ChIP analysis of U2OS and SaOS-2 cells indicated that the promoter B region is less enriched in the active histone mark H3K4me3, in comparison to promoter A and that there is increased enrichment of the repressive mark H3K27me3 in association with the promoter B genomic region in the cell line SaOS-2. These findings show that epigenetic inactivation of the WNT5A promoter B involves both DNA methylation and histone modifications and suggest that differential expression of the WNT5A alternative promoters A

  12. Inactivation of the WNT5A Alternative Promoter B Is Associated with DNA Methylation and Histone Modification in Osteosarcoma Cell Lines U2OS and SaOS-2.

    Vaidya, Himani; Rumph, Candie; Katula, Karen S

    2016-01-01

    WNT5A is a secreted ligand involved in Wnt pathway signaling and has a role in cell movement and differentiation. Altered WNT5A expression is associated with various cancers, although in most studies the focus has been on only one of the known WNT5A isoforms. In this study, we analyzed expression from two of the major WNT5A promoters, termed promoter A and promoter B, in normal human osteoblasts, SaOS-2 and U2OS osteosarcoma cell lines, and osteosarcoma tumor tissue. We found that both promoters A and B are active in normal osteoblasts with nearly 11-fold more promoter B than A transcripts. Promoter B but not promoter A transcripts are decreased or nearly undetectable in the SaOS-2 and U2OS cell lines and osteosarcoma tumor tissues. Transient transfection of promoter A and promoter B reporter constructs confirmed that SaOS-2 cells have the necessary factors to transcribe both promoters. Bisulfite sequencing analysis revealed that three CpG enriched regions upstream of the promoter B exon 1βare highly methylated in both SaOS-2 and U2OS cells. The CpG island sub-region R6 located in promoter B exon 1β was approximately 51% methylated in SaOS-2 and 25% methylated in U2OS. Region 3 was approximately 28% methylated in normal osteoblasts, whereas the others were unmethylated. Promoter B was re-activated by treatment of SaOS-2 cells with 1 μM 5-azacytidine, which was associated with only a small insignificant change in methylation of sub-region R6. ChIP analysis of U2OS and SaOS-2 cells indicated that the promoter B region is less enriched in the active histone mark H3K4me3, in comparison to promoter A and that there is increased enrichment of the repressive mark H3K27me3 in association with the promoter B genomic region in the cell line SaOS-2. These findings show that epigenetic inactivation of the WNT5A promoter B involves both DNA methylation and histone modifications and suggest that differential expression of the WNT5A alternative promoters A and B is a

  13. A new trinuclear complex of platinum and iron efficiently promotes cleavage of plasmid DNA.

    Lempers, E L; Bashkin, J S; Kostić, N M

    1993-01-01

    The compound [[Pt(trpy)]2Arg-EDTA]+ is synthesized in five steps, purified, and characterized by 1H, 13C, and 195Pt NMR spectroscopy, mass spectrometry, UV-vis spectrophotometry, and elemental analysis. The binuclear [[(Pt(trpy)]2Arg]3+ moiety binds to double-stranded DNA, and the chelating EDTA moiety holds metal cations. In the presence of ferrous ions and the reductant dithiothreitol, the new compound cleaves DNA. It cleaves a single strand in the pBR322 plasmid nearly as efficiently as me...

  14. Metastasis suppressor NM23-H1 promotes repair of UV-induced DNA damage and suppresses UV-induced melanomagenesis

    Jarrett, Stuart G; Novak, Marian; Dabernat, Sandrine; Daniel, Jean-Yves; Mellon, Isabel; Zhang, Qingbei; Harris, Nathan; Ciesielski, Michael J.; Fenstermaker, Robert A.; Kovacic, Diane; Slominski, Andrzej; Kaetzel, David M.

    2011-01-01

    Reduced expression of the metastasis suppressor NM23-H1 is associated with aggressive forms of multiple cancers. Here, we establish that NM23-H1 (termed H1 isoform in human, M1 in mouse) and two of its attendant enzymatic activities, the 3′-5′ exonuclease and nucleoside diphosphate kinase, are novel participants in the cellular response to UV radiation (UVR)-induced DNA damage. NM23-H1 deficiency compromised the kinetics of repair for total DNA polymerase-blocking lesions and nucleotide excis...

  15. Single-molecule imaging of DNA polymerase I (Klenow fragment) activity by atomic force microscopy

    Chao, J.; Zhang, P.; Wang, Q.; Wu, N.; Zhang, F.; Hu, J.; Fan, C. H.; Li, B.

    2016-03-01

    We report a DNA origami-facilitated single-molecule platform that exploits atomic force microscopy to study DNA replication. We imaged several functional activities of the Klenow fragment of E. coli DNA polymerase I (KF) including binding, moving, and dissociation from the template DNA. Upon completion of these actions, a double-stranded DNA molecule was formed. Furthermore, the direction of KF activities was captured and then confirmed by shifting the KF binding sites on the template DNA.We report a DNA origami-facilitated single-molecule platform that exploits atomic force microscopy to study DNA replication. We imaged several functional activities of the Klenow fragment of E. coli DNA polymerase I (KF) including binding, moving, and dissociation from the template DNA. Upon completion of these actions, a double-stranded DNA molecule was formed. Furthermore, the direction of KF activities was captured and then confirmed by shifting the KF binding sites on the template DNA. Electronic supplementary information (ESI) available. See DOI: 10.1039/c5nr06544e

  16. Genetic basis of olfactory cognition: extremely high level of DNA sequence polymorphism in promoter regions of the human olfactory receptor genes revealed using the 1000 Genomes Project dataset

    ElenaV.Ignatieva

    2014-03-01

    Full Text Available The molecular mechanism of olfactory cognition is very complicated. Olfactory cognition is initiated by olfactory receptor proteins (odorant receptors, which are activated by olfactory stimuli (ligands. Olfactory receptors are the initial player in the signal transduction cascade producing a nerve impulse, which is transmitted to the brain. The sensitivity to a particular ligand depends on the expression level of multiple proteins involved in the process of olfactory cognition: olfactory receptor proteins, proteins that participate in signal transduction cascade, etc. The expression level of each gene is controlled by its regulatory regions, and especially, by the promoter (a region of DNA about 100–1000 base pairs long located upstream of the transcription start site. We analyzed single nucleotide polymorphisms using human whole-genome data from the 1000 Genomes Project and revealed an extremely high level of single nucleotide polymorphisms in promoter regions of olfactory receptor genes and HLA genes. We hypothesized that the high level of polymorphisms in olfactory receptor promoters was responsible for the diversity in regulatory mechanisms controlling the expression levels of olfactory receptor proteins. Such diversity of regulatory mechanisms may cause the great variability of olfactory cognition of numerous environmental olfactory stimuli perceived by human beings (air pollutants, human body odors, odors in culinary etc.. In turn, this variability may provide a wide range of emotional and behavioral reactions related to the vast variety of olfactory stimuli.

  17. The cauliflower mosaic virus (CaMV) 35S promoter sequence alters the level and patterns of activity of adjacent tissue- and organ-specific gene promoters.

    Zheng, Xuelian; Deng, Wei; Luo, Keming; Duan, Hui; Chen, Yongqin; McAvoy, Richard; Song, Shuiqing; Pei, Yan; Li, Yi

    2007-08-01

    Here we report the effect of the 35S promoter sequence on activities of the tissue- and organ-specific gene promoters in tobacco plants. In the absence of the 35S promoter sequence the AAP2 promoter is active only in vascular tissues as indicated by expression of the AAP2:GUS gene. With the 35S promoter sequence in the same T-plasmid, transgenic plants exhibit twofold to fivefold increase in AAP2 promoter activity and the promoter becomes active in all tissue types. Transgenic plants hosting the ovary-specific AGL5:iaaM gene (iaaM coding an auxin biosynthetic gene) showed a wild-type phenotype except production of seedless fruits, whereas plants hosting the AGL5:iaaM gene along with the 35S promoter sequence showed drastic morphological alterations. RT-PCR analysis confirms that the phenotype was caused by activation of the AGL5:iaaM gene in non-ovary organs including roots, stems and flowers. When the pollen-, ovule- and early embryo-specific PAB5:barnase gene (barnase coding a RNase gene) was transformed, the presence of 35S promoter sequence drastically reduced transformation efficiencies. However, the transformation efficiencies were restored in the absence of 35S promoter, indicating that the 35S promoter might activate the expression of PAB5:barnase in non-reproductive organs such as calli and shoot primordia. Furthermore, if the 35S promoter sequence was replaced with the NOS promoter sequence, no alteration in AAP2, AGL5 or PAB5 promoter activities was observed. Our results demonstrate that the 35S promoter sequence can convert an adjacent tissue- and organ-specific gene promoter into a globally active promoter. PMID:17340093

  18. Competition between the DNA unwinding and strand pairing activities of the Werner and Bloom syndrome proteins

    Orren David K

    2006-01-01

    Full Text Available Abstract Background The premature aging and cancer-prone Werner and Bloom syndromes are caused by defects in the RecQ helicase enzymes WRN and BLM, respectively. Recently, both WRN and BLM (as well as several other RecQ members have been shown to possess a strand annealing activity in addition to the requisite DNA unwinding activity. Since an annealing function would appear to directly oppose the action of a helicase, we have examined in this study the dynamic equilibrium between unwinding and annealing mediated by either WRN or BLM. Results Our investigation into the competition between annealing and unwinding demonstrates that, under standard reaction conditions, WRN- or BLM-mediated annealing can partially or completely mask unwinding as measured in standard helicase assays. Several strategies were employed to suppress the annealing activity so that the actual strength of WRN- or BLM-dependent unwinding could be more accurately assessed. Interestingly, if a DNA oligomer complementary to one strand of the DNA substrate to be unwound is added during the helicase reaction, both WRN and BLM unwinding is enhanced, presumably by preventing protein-mediated re-annealing. This strategy allowed measurement of WRN-catalyzed unwinding of long (80 base pair duplex regions and fully complementary, blunt-ended duplexes, both of which were otherwise quite refractory to the helicase activity of WRN. Similarly, the addition of trap strand stimulated the ability of BLM to unwind long and blunt-ended duplexes. The stimulatory effect of the human replication protein A (hRPA, the eukaryotic single-stranded DNA binding protein on both WRN- and BLM-dependent unwinding was also re-examined in light of its possible role in preventing re-annealing. Our results show that hRPA influences the outcome of WRN and BLM helicase assays by both inhibiting re-annealing and directly promoting unwinding, with the larger contribution from the latter mechanism. Conclusion These

  19. c-Jun represses the human insulin promoter activity that depends on multiple cAMP response elements

    Inagaki, Nobuya; Seino, Yutaka; Imura, Hiroo (Kyoto Univ. (Japan)); Maekawa, Toshio; Sudo, Tatsuhiko; Ishii, Shunsuke (Inst. of Physical and Chemical Research (RIKEN), Tsukuba (Japan))

    1992-02-01

    Glucose is known to increase the cAMP concentration in pancreatic {beta} cells. To determine the mechanism by which cAMP augments insulin gene expression, the authors first identified the cAMP response elements (CREs) of human insulin gene. In DNase I footprint analysis, the bacterially synthesized CRE-binding protein, CRE-BP1, protected four sites: two sites in the region upstream from the insulin core promoter, one site in the first exon, and one site in the first intron. To examine the roles of those four sites, they constructed a series of DNA plasmids in which the wild-type and mutant insulin promoters were linked to the chloramphenicol acetyltransferase gene. Studies of the transcriptional activity of these plasmids after transfection into hamster insulinoma (HIT) cells showed that these four sites contributed additively to the cAMP inducibility of the insulin promoter. Surprisingly, the c-jun protooncogene product (c-Jun) repressed the cAMP-induced activity of the insulin promoter in a cotransfection assay with the c-Jun expression plasmic. Northern blot analysis demonstrated that the level of c-jun mRNA was dramatically increased by glucose deprivation in HIT cells. These results suggest that glucose deprivation in HIT cells. These results suggest that glucose may regulate expression of the human insulin gene through multiple CREs and c-Jun.

  20. Sulfolobus Replication Factor C stimulates the activity of DNA Polymerase B1

    Xing, Xuanxuan; Zhang, Likui; Guo, Li;

    2014-01-01

    Replication factor C (RFC) is known to function in loading proliferating cell nuclear antigen (PCNA) onto primed DNA, allowing PCNA to tether DNA polymerase for highly processive DNA synthesis in eukaryotic and archaeal replication. In this report, we show that an RFC complex from the...... with the ability of RFC to facilitate DNA binding by PolB1 through protein-protein interaction. These results suggest that Sulfolobus RFC may play a role in recruiting DNA polymerase for efficient primer extension, in addition to clamp loading, during DNA replication....... hyperthermophilic archaea of the genus Sulfolobus physically interacts with DNA polymerase B1 (PolB1) and enhances both the polymerase and 3'-5' exonuclease activities of PolB1 in an ATP-independent manner. Stimulation of the PolB1 activity by RFC is independent of the ability of RFC to bind DNA but is consistent...

  1. Miz-1 activates gene expression via a novel consensus DNA binding motif.

    Bonnie L Barrilleaux

    Full Text Available The transcription factor Miz-1 can either activate or repress gene expression in concert with binding partners including the Myc oncoprotein. The genomic binding of Miz-1 includes both core promoters and more distal sites, but the preferred DNA binding motif of Miz-1 has been unclear. We used a high-throughput in vitro technique, Bind-n-Seq, to identify two Miz-1 consensus DNA binding motif sequences--ATCGGTAATC and ATCGAT (Mizm1 and Mizm2--bound by full-length Miz-1 and its zinc finger domain, respectively. We validated these sequences directly as high affinity Miz-1 binding motifs. Competition assays using mutant probes indicated that the binding affinity of Miz-1 for Mizm1 and Mizm2 is highly sequence-specific. Miz-1 strongly activates gene expression through the motifs in a Myc-independent manner. MEME-ChIP analysis of Miz-1 ChIP-seq data in two different cell types reveals a long motif with a central core sequence highly similar to the Mizm1 motif identified by Bind-n-Seq, validating the in vivo relevance of the findings. Miz-1 ChIP-seq peaks containing the long motif are predominantly located outside of proximal promoter regions, in contrast to peaks without the motif, which are highly concentrated within 1.5 kb of the nearest transcription start site. Overall, our results indicate that Miz-1 may be directed in vivo to the novel motif sequences we have identified, where it can recruit its specific binding partners to control gene expression and ultimately regulate cell fate.

  2. 78 FR 27977 - Office of Biotechnology Activities; Recombinant DNA Research: Proposed Actions Under the NIH...

    2013-05-13

    ... HUMAN SERVICES National Institutes of Health Office of Biotechnology Activities; Recombinant DNA... Acid Molecules (NIH Guidelines) SUMMARY: The NIH Office of Biotechnology Activities (NIH OBA) proposes... by mail to the NIH Office of Biotechnology Activities, National Institutes of Health, 6705...

  3. 75 FR 28811 - Office of Biotechnology Activities; Recombinant DNA Research: Proposed Actions Under the NIH...

    2010-05-24

    ... HUMAN SERVICES National Institutes of Health Office of Biotechnology Activities; Recombinant DNA... Office of Biotechnology Activities (OBA) by the Institutional Biosafety Committee at Lawrence Livermore... Biotechnology Activities, National Institutes of Health. BILLING CODE 4140-01-P...

  4. 76 FR 44339 - Office of Biotechnology Activities; Recombinant DNA Research: Action Under the NIH Guidelines for...

    2011-07-25

    ... HUMAN SERVICES National Institutes of Health Office of Biotechnology Activities; Recombinant DNA... Minor Action under the NIH Guidelines. SUMMARY: The Office of Biotechnology Activities (OBA) is updating... Biotechnology Activities, National Institutes of Health, 6705 Rockledge Drive, Suite 750, Bethesda,...

  5. Purification, crystallization and preliminary X-ray crystallographic analysis of the ETS domain of human Ergp55 in complex with the cfos promoter DNA sequence

    The ETS domain of human Ergp55 was purified and crystallized in native, complexes with E74, and cfos promoter DNA sequences. The X-ray intensity data set was collected on ETS–cfos promoter DNA complex crystal at 3.1 Å resolution to analyze the structure by molecular replacement technique. The Ergp55 protein belongs to the Ets family of transciption factors. The Ets transcription factors are involved in various developmental processes and the regulation of cancer metabolism. They contain a highly similar DNA-binding domain known as the ETS domain and have diverse functions in oncogenesis and physiology. The Ets transcription factors differ in their DNA-binding preference at the ETS site and the mechanisms by which they target genes are not clearly understood. To understand its DNA-binding mechanism, the ETS domain of Ergp55 was expressed and purified. The ETS domain was crystallized in the native form and in complex forms with DNA sequences from the E74 and cfos promoters. An X-ray diffraction data set was collected from an ETS–cfos DNA complex crystal at a wavelength of 0.9725 Å on the BM14 synchrotron beamline at the ESRF, France. The ETS–cfos DNA complex crystal belonged to space group C2221, with four molecules in the asymmetric unit. For structure analysis, initial phases for the ETS–cfos DNA complex were obtained by the molecular-replacement technique with Phaser in the CCP4 suite using the coordinates of Fli-1 protein and cfos DNA as search models. Structure analysis of the ETS–cfos DNA complex may possibly explain the DNA-binding specificity and its mechanism of interaction with the ETS domain of Ergp55

  6. The Role of Physical Educators in Helping Classroom Teachers to Promote Physical Activity

    Russ, Laura

    2015-01-01

    Elementary classroom teachers are an increasingly important constituency in school-based physical activity promotion. This article situates the need for classroom teacher physical-activity promotion at the intersection of what we know about teacher actions, what informs those actions, and what recent research has uncovered. Recommendations are…

  7. Vitamin D-mediated modifications in protein-DNA interactions at two promoter elements of the osterocalcin gene

    By the combined use of DNase I footprinting, electrophoretic mobility-shift assay, and methylation interference analysis, the authors have identified a series of sequence-specific protein-DNA interactions in the 5' flanking region of the rat osteocalcin gene. Stimulation of osteocalcin gene expression by 1,25-dihydroxyvitamin D3, a physiologic mediator of this bone-specific gene in vitro and in vivo, is associated with modifications in the binding of ROS 17/2.8 cell nuclear factors to two promoter segments that up-regulate transcription. One segment located between -462 and -437 exhibits a vitamin D-dependent increase in sequence-specific binding of nuclear factors. This element (CTGGGTGAATGAGGACATTACT-GACC), identified at single nucleotide resolution, contains a region of hyphenated dyad symmetry and shares sequence homology with consensus steroid-responsive elements and with the sequence that has been identified as the vitamin D receptor binding site in the human osteocalcin gene. They have also observed that vitamin D stimulation of osteocalcin gene expression results in a 5-fold increase in protein binding to the region of the osteocalcin box, a 24-nucleotide segment in the proximal promoter with a CCAAT motif as the central core. The results demonstrate protein-DNA interactions in a vitamin D-responsive element and in a second sequence, the osteocalcin box, both of which are involved in the physiologic regulation of the osteocalcin gene in response to 1,25-dihydroxyvitamin D3

  8. Transcriptional activities of mammalian genomes at sites of recombination with foreign DNA

    The nucleotide sequences of several sites of recombination between adenovirus DNA and hamster, mouse, or human cell DNAs were determined. These sites of recombination had been cloned from adenovirus type 2 (Ad2)- or type 12 (Ad12)-transformed cells, from Ad12-induced tumor cells, or from a symmetric recombinant between Ad12 DNA and human cell DNA. One important precondition for the generation of recombinants between host and foreign DNAs might be the establishment of a chromatin configuration that permits access of foreign DNA and of the recombination machinery to cellular DNA. Such favorable chromatin structures might arise during cellular DNA replication or transcription or both. As a first approach toward investigating these more complex problems of foreign DNA insertion. The authors determined transcriptional activities of cellular DNA sequences at viral junction sites. The results presented demonstrate that the cellular DNA sequences involved in linkage to viral DNA at five completely different sites in DNA from three different species are transcribed into RNAs even in cells which have not been transformed or infected by adenovirus. These results are consistent with the notion that at least some of the cellular DNA sequences at sites of insertion of adenovirus (foreign) DNA are transcriptionally active and thus provide an opportunity for recombination

  9. Sulforaphane inhibits CYP1A1 activity and promotes genotoxicity induced by 2,3,7,8-tetrachlorodibenzo-p-dioxin in vitro

    Yang, Fangxing, E-mail: fxyang@zju.edu.cn [MOE Key Laboratory of Environmental Remediation and Ecosystem Health, College of Environmental and Resource Sciences, Zhejiang University, Hangzhou, 310058 (China); Zhuang, Shulin [MOE Key Laboratory of Environmental Remediation and Ecosystem Health, College of Environmental and Resource Sciences, Zhejiang University, Hangzhou, 310058 (China); Zhang, Chao; Dai, Heping [State Key Laboratory of Freshwater Ecology and Biotechnology, Institute of Hydrobiology, Chinese Academy of Sciences, Wuhan, 430072 (China); Liu, Weiping, E-mail: wliu@zju.edu.cn [MOE Key Laboratory of Environmental Remediation and Ecosystem Health, College of Environmental and Resource Sciences, Zhejiang University, Hangzhou, 310058 (China)

    2013-06-15

    Increasing environmental pollution by carcinogens such as some of persistent organic pollutants (POPs) has prompted growing interest in searching for chemopreventive compounds which are readily obtainable. Sulforaphane (SFN) is isolated from cruciferous vegetables and has the potentials to reduce carcinogenesis through various pathways. In this study, we studied the effects of SFN on CYP1A1 activity and genotoxicity induced by 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). The results showed that SFN inhibited TCDD-induced CYP1A1 activity in H4IIE cells by directly inhibiting CYP1A1 activity, probably through binding to aryl hydrocarbon receptor and/or CYP1A1 revealed by molecular docking. However, SFN promoted TCDD-induced DNA damage in yeast cells and reduced the viability of initiated yeast cells. Besides, it is surprising that SFN also failed to reduce genotoxicity induced by other genotoxic reagents which possess different mechanisms to lead to DNA damage. Currently, it is difficult to predict whether SFN has the potentials to reduce the risk of TCDD based on the conflicting observations in the study. Therefore, further studies should be urgent to reveal the function and mechanism of SFN in the stress of such POPs on human health. - Highlights: • Sulforaphane inhibited TCDD-induced CYP1A1 activity in H4IIE cells. • Sulforaphane may bind to aryl hydrocarbon receptor and/or CYP1A1. • Sulforaphane promoted TCDD-induced DNA damage in yeast cells. • Sulforaphane may promote DNA damage by DNA strand breaks or DNA alkylation.

  10. Tankyrases Promote Homologous Recombination and Check Point Activation in Response to DSBs.

    Zita Nagy

    2016-02-01

    Full Text Available DNA lesions are sensed by a network of proteins that trigger the DNA damage response (DDR, a signaling cascade that acts to delay cell cycle progression and initiate DNA repair. The Mediator of DNA damage Checkpoint protein 1 (MDC1 is essential for spreading of the DDR signaling on chromatin surrounding Double Strand Breaks (DSBs by acting as a scaffold for PI3K kinases and for ubiquitin ligases. MDC1 also plays a role both in Non-Homologous End Joining (NHEJ and Homologous Recombination (HR repair pathways. Here we identify two novel binding partners of MDC1, the poly (ADP-ribose Polymerases (PARPs TNKS1 and 2. We find that TNKSs are recruited to DNA lesions by MDC1 and regulate DNA end resection and BRCA1A complex stabilization at lesions leading to efficient DSB repair by HR and proper checkpoint activation.

  11. Tankyrases Promote Homologous Recombination and Check Point Activation in Response to DSBs.

    Nagy, Zita; Kalousi, Alkmini; Furst, Audrey; Koch, Marc; Fischer, Benoit; Soutoglou, Evi

    2016-02-01

    DNA lesions are sensed by a network of proteins that trigger the DNA damage response (DDR), a signaling cascade that acts to delay cell cycle progression and initiate DNA repair. The Mediator of DNA damage Checkpoint protein 1 (MDC1) is essential for spreading of the DDR signaling on chromatin surrounding Double Strand Breaks (DSBs) by acting as a scaffold for PI3K kinases and for ubiquitin ligases. MDC1 also plays a role both in Non-Homologous End Joining (NHEJ) and Homologous Recombination (HR) repair pathways. Here we identify two novel binding partners of MDC1, the poly (ADP-ribose) Polymerases (PARPs) TNKS1 and 2. We find that TNKSs are recruited to DNA lesions by MDC1 and regulate DNA end resection and BRCA1A complex stabilization at lesions leading to efficient DSB repair by HR and proper checkpoint activation. PMID:26845027

  12. Self-Assembled Tetrahedral DNA Nanostructures Promote Adipose-Derived Stem Cell Migration via lncRNA XLOC 010623 and RHOA/ROCK2 Signal Pathway.

    Shi, Sirong; Peng, Qiang; Shao, Xiaoru; Xie, Jing; Lin, Shiyu; Zhang, Tao; Li, Qianshun; Li, Xiaolong; Lin, Yunfeng

    2016-08-01

    Self-assembled tetrahedral DNA nanostructures (TDNs) with precise sizes have been extensively applied in various fields owing to their exceptional mechanical rigidity, structural stability, and modification versatility. In addition, TDNs can be internalized by mammalian cells and remain mainly intact within the cytoplasm by escaping degradation by nucleases. Here, we studied the effects of TDNs on cell migration and the underlying molecular mechanisms. TDNs remarkably enhanced the migration of rat adipose-derived stem cells and down-regulated the long noncoding RNA (lncRNA) XLOC 010623 to activate the mRNA expression of Tiam1 and Rac1. Furthermore, TDNs highly up-regulated the mRNA and protein expression of RHOA, ROCK2, and VCL. These results indicate that TDNs suppressed the transcription of lncRNA XLOC 010623 and activated the TIAM1/RAC1 and RHOA/ROCK2 signaling pathways to promote cell migration. On the basis of these findings, TDNs show a high potential for application in tissue repair and regenerative medicine as a functional three-dimensional DNA nanomaterial. PMID:27403707

  13. Merkel cell polyomavirus large T antigen has growth-promoting and inhibitory activities.

    Cheng, Jingwei; Rozenblatt-Rosen, Orit; Paulson, Kelly G; Nghiem, Paul; DeCaprio, James A

    2013-06-01

    Merkel cell carcinoma (MCC) is a rare and aggressive form of skin cancer. In at least 80% of all MCC, Merkel cell polyomavirus (MCPyV) DNA has undergone clonal integration into the host cell genome, and most tumors express the MCPyV large and small T antigens. In all cases of MCC reported to date, the integrated MCPyV genome has undergone mutations in the large T antigen. These mutations result in expression of a truncated large T antigen that retains the Rb binding or LXCXE motif but deletes the DNA binding and helicase domains. However, the transforming functions of full-length and truncated MCPyV large T antigen are unknown. We compared the transforming activities of full-length, truncated, and alternatively spliced 57kT forms of MCPyV large T antigen. MCPyV large T antigen could bind to Rb but was unable to bind to p53. Furthermore, MCPyV-truncated large T antigen was more effective than full-length and 57kT large T antigen in promoting the growth of human and mouse fibroblasts. In contrast, expression of the MCPyV large T antigen C-terminal 100 residues could inhibit the growth of several different cell types. These data imply that the deletion of the C terminus of MCPyV large T antigen found in MCC serves not only to disrupt viral replication but also results in the loss of a distinct growth-inhibitory function intrinsic to this region. PMID:23514892

  14. The cAMP signaling system inhibits the repair of γ-ray-induced DNA damage by promoting Epac1-mediated proteasomal degradation of XRCC1 protein in human lung cancer cells

    Highlights: ► cAMP signaling system inhibits repair of γ-ray-induced DNA damage. ► cAMP signaling system inhibits DNA damage repair by decreasing XRCC1 expression. ► cAMP signaling system decreases XRCC1 expression by promoting its proteasomal degradation. ► The promotion of XRCC1 degradation by cAMP signaling system is mediated by Epac1. -- Abstract: Cyclic AMP is involved in the regulation of metabolism, gene expression, cellular growth and proliferation. Recently, the cAMP signaling system was found to modulate DNA-damaging agent-induced apoptosis by regulating the expression of Bcl-2 family proteins and inhibitors of apoptosis. Thus, we hypothesized that the cAMP signaling may modulate DNA repair activity, and we investigated the effects of the cAMP signaling system on γ-ray-induced DNA damage repair in lung cancer cells. Transient expression of a constitutively active mutant of stimulatory G protein (GαsQL) or treatment with forskolin, an adenylyl cyclase activator, augmented radiation-induced DNA damage and inhibited repair of the damage in H1299 lung cancer cells. Expression of GαsQL or treatment with forskolin or isoproterenol inhibited the radiation-induced expression of the XRCC1 protein, and exogenous expression of XRCC1 abolished the DNA repair-inhibiting effect of forskolin. Forskolin treatment promoted the ubiquitin and proteasome-dependent degradation of the XRCC1 protein, resulting in a significant decrease in the half-life of the protein after γ-ray irradiation. The effect of forskolin on XRCC1 expression was not inhibited by PKA inhibitor, but 8-pCPT-2′-O-Me-cAMP, an Epac-selective cAMP analog, increased ubiquitination of XRCC1 protein and decreased XRCC1 expression. Knockdown of Epac1 abolished the effect of 8-pCPT-2′-O-Me-cAMP and restored XRCC1 protein level following γ-ray irradiation. From these results, we conclude that the cAMP signaling system inhibits the repair of γ-ray-induced DNA damage by promoting the ubiquitin

  15. JAB1 regulates unphosphorylated STAT3 DNA-binding activity through protein–protein interaction in human colon cancer cells

    Highlights: •JAB1 interacted with unphosphorylated STAT3 in the nucleus. •JAB1 knockdown tended to increase nuclear STAT3 expression. •JAB1 knockdown significantly decreased unphosphorylated STAT3 DNA-binding activity. •JAB1 knockdown significantly decreased MDR1, NANOG, and VEGF expressions. •Nuclear JAB1, but not nuclear STAT3, correlated with STAT3 DNA-binding activity. -- Abstract: Recent studies have revealed that unphosphorylated STAT3 forms a dimer, translocates to the nucleus, binds to the STAT3 binding site, and activates the transcription of STAT3 target genes, thereby playing an important role in oncogenesis in addition to phosphorylated STAT3. Among signaling steps of unphosphorylated STAT3, nuclear translocation and target DNA-binding are the critical steps for its activation. Therefore, elucidating the regulatory mechanism of these signaling steps of unphosphorylated STAT3 is a potential step in the discovery of a novel cancer drug. However, the mechanism of unphosphorylated STAT3 binding to the promoter of target genes remains unclear. In this study, we focused on Jun activation domain-binding protein 1 (JAB1) as a candidate protein that regulates unphosphorylated STAT3 DNA-binding activity. Initially, we observed that both unphosphorylated STAT3 and JAB1 existed in the nucleus of human colon cancer cell line COLO205 at the basal state (no cytokine stimulation). On the other hand, phosphorylated STAT3 did not exist in the nucleus of COLO205 cells at the basal state. Immunoprecipitation using nuclear extract of COLO205 cells revealed that JAB1 interacted with unphosphorylated STAT3. To investigate the effect of JAB1 on unphosphorylated STAT3 activity, RNAi studies were performed. Although JAB1 knockdown tended to increase nuclear STAT3 expression, it significantly decreased unphosphorylated STAT3 DNA-binding activity. Subsequently, JAB1 knockdown significantly decreased the expression levels of MDR1, NANOG, and VEGF, which are STAT3 target

  16. An analysis of the positional distribution of DNA motifs in promoter regions and its biological relevance

    Vinga Susana; Casimiro Ana C; Freitas Ana T; Oliveira Arlindo L

    2008-01-01

    Abstract Background Motif finding algorithms have developed in their ability to use computationally efficient methods to detect patterns in biological sequences. However the posterior classification of the output still suffers from some limitations, which makes it difficult to assess the biological significance of the motifs found. Previous work has highlighted the existence of positional bias of motifs in the DNA sequences, which might indicate not only that the pattern is important, but als...

  17. METAL CONTAMINANTS PROMOTE DEGRADATION OF LIPID/DNA COMPLEXES DURING LYOPHILIZATION

    Molina, Marion d.C.; Anchordoquy, Thomas J.

    2006-01-01

    Oxidation reactions represent an important degradation pathway of nucleic acid-based pharmaceuticals. To evaluate the role of metal contamination and chelating agents in the formation of reactive oxygen species (ROS) during lyophilization, ROS generation and the stability of lipid/DNA complexes were investigated. Trehalose-containing formulations were lyophilized with different levels of transition metals. ROS generation was examined by adding proxyl fluorescamine to the formulations prior to...

  18. Pea DNA helicase 45 promotes salinity stress tolerance in IR64 rice with improved yield

    Sahoo, Ranjan Kumar; Gill, Sarvajeet Singh; Tuteja, Narendra

    2012-01-01

    The helicases provide duplex unwinding function in an ATP-dependent manner and thereby play important role in almost all the nucleic acids transaction. Since stress reduces the protein synthesis by affecting the cellular gene expression machinery, so it is evident that molecules involved in nucleic acid processing including translation factors/helicases are likely to be affected. Earlier pea DNA helicase 45 (PDH45), a homolog of translation initiation factor 4A (eIF4A) was reported to play im...

  19. The single-strand DNA binding activity of human PC4 preventsmutagenesis and killing by oxidative DNA damage

    Wang, Jen-Yeu; Sarker, Altaf Hossain; Cooper, Priscilla K.; Volkert, Michael R.

    2004-02-01

    Human positive cofactor 4 (PC4) is a transcriptional coactivator with a highly conserved single-strand DNA (ssDNA) binding domain of unknown function. We identified PC4 as a suppressor of the oxidative mutator phenotype of the Escherichia coli fpg mutY mutant and demonstrate that this suppression requires its ssDNA binding activity. Yeast mutants lacking their PC4 ortholog Sub1 are sensitive to hydrogen peroxide and exhibit spontaneous and peroxide induced hypermutability. PC4 expression suppresses the peroxide sensitivity of the yeast sub l{Delta} mutant, suggesting that the human protein has a similar function. A role for yeast and human proteins in DNA repair is suggested by the demonstration that Sub1 acts in a peroxide-resistance pathway involving Rad2 and by the physical interaction of PC4 with the human Rad2 homolog XPG. We show XPG recruits PC4 to a bubble-containing DNA substrate with resulting displacement of XPG and formation of a PC4-DNA complex. We discuss the possible requirement for PC4 in either global or transcription-coupled repair of oxidative DNA damage to mediate the release of XPG bound to its substrate.

  20. INVESTIGATION INTO CONSUMER RESPONSE TO SALES PROMOTIONAL ACTIVITIES: THE CASE OF UNILEVER GHANA LIMITED

    Martin Owusu Ansah

    2013-10-01

    Full Text Available The promotional activities have become more sophisticated and an increasing number of companies are using them to ensure their survival in today’s competitive market. Essentially, the study analyzed the nature of sales promotional activities of Unilever Ghana Limited; determined factors that influence the consumption of Unilever products in Kumasi and finally examined the relationship between sales promotions and the consumption of Unilever products. Primary and secondary data sources were used to select 220 consumers of Unilever in Kumasi and an in-depth interview with the Managers of the companies in Kumasi. Convenient sampling technique was employed in the study. Cross tabulation was done on the demographics whilst a regression model was used to establish the relationship between sales promotions and consumption of products. The findings revealed that Personalities in promotions, Prices in promotions, Messages in promotions and Promotional tools have strong influence on consumption but the Medium in promotion did not have influence on consumption during promotions. It was therefore recommended for celebrities to be used in the company’s promotions.

  1. Cyclin A2 promotes DNA repair in the brain during both development and aging.

    Gygli, Patrick E; Chang, Joshua C; Gokozan, Hamza N; Catacutan, Fay P; Schmidt, Theresa A; Kaya, Behiye; Goksel, Mustafa; Baig, Faisal S; Chen, Shannon; Griveau, Amelie; Michowski, Wojciech; Wong, Michael; Palanichamy, Kamalakannan; Sicinski, Piotr; Nelson, Randy J; Czeisler, Catherine; Otero, José J

    2016-07-01

    Various stem cell niches of the brain have differential requirements for Cyclin A2. Cyclin A2 loss results in marked cerebellar dysmorphia, whereas forebrain growth is retarded during early embryonic development yet achieves normal size at birth. To understand the differential requirements of distinct brain regions for Cyclin A2, we utilized neuroanatomical, transgenic mouse, and mathematical modeling techniques to generate testable hypotheses that provide insight into how Cyclin A2 loss results in compensatory forebrain growth during late embryonic development. Using unbiased measurements of the forebrain stem cell niche, we parameterized a mathematical model whereby logistic growth instructs progenitor cells as to the cell-types of their progeny. Our data was consistent with prior findings that progenitors proliferate along an auto-inhibitory growth curve. The growth retardation inCCNA2-null brains corresponded to cell cycle lengthening, imposing a developmental delay. We hypothesized that Cyclin A2 regulates DNA repair and that CCNA2-null progenitors thus experienced lengthened cell cycle. We demonstrate that CCNA2-null progenitors suffer abnormal DNA repair, and implicate Cyclin A2 in double-strand break repair. Cyclin A2's DNA repair functions are conserved among cell lines, neural progenitors, and hippocampal neurons. We further demonstrate that neuronal CCNA2 ablation results in learning and memory deficits in aged mice. PMID:27425845

  2. Chinese Tobacco Industry Promotional Activity on the Microblog Weibo

    Wang, Fan; Zheng, Pinpin; Yang, Dongyun; Freeman, Becky; Fu, Hua; Chapman, Simon

    2014-01-01

    Background Although China ratified the WHO Framework Convention on Tobacco Control [FCTC] in 2005, the partial ban on tobacco advertising does not cover the internet. Weibo is one of the most important social media channels in China, using a format similar to its global counterpart, Twitter. The Weibo homepage is a platform to present products, brands and corporate culture. There is great potential for the tobacco industry to exploit Weibo to promote products. Methods Seven tobacco industry W...

  3. The human DNA-activated protein kinase, DNA-PK: Substrate specificity

    Anderson, C.W.; Connelly, M.A.; Zhang, H.; Sipley, J.A. [Brookhaven National Lab., Upton, NY (United States). Biology Dept.; Lees-Miller, S.P.; Lintott, L.G. [Univ. of Calgary, Alberta (Canada). Dept. of Biological Sciences; Sakaguchi, Kazuyasu; Appella, E. [National Institutes of Health, Bethesda, MD (United States). Lab. of Cell Biology

    1994-11-05

    Although much has been learned about the structure and function of p53 and the probable sequence of subsequent events that lead to cell cycle arrest, little is known about how DNA damage is detected and the nature of the signal that is generated by DNA damage. Circumstantial evidence suggests that protein kinases may be involved. In vitro, human DNA-PK phosphorylates a variety of nuclear DNA-binding, regulatory proteins including the tumor suppressor protein p53, the single-stranded DNA binding protein RPA, the heat shock protein hsp90, the large tumor antigen (TAg) of simian virus 40, a variety of transcription factors including Fos, Jun, serum response factor (SRF), Myc, Sp1, Oct-1, TFIID, E2F, the estrogen receptor, and the large subunit of RNA polymerase II (reviewed in Anderson, 1993; Jackson et al., 1993). However, for most of these proteins, the sites that are phosphorylated by DNA-PK are not known. To determine if the sites that were phosphorylated in vitro also were phosphorylated in vivo and if DNA-PK recognized a preferred protein sequence, the authors identified the sites phosphorylated by DNA-PK in several substrates by direct protein sequence analysis. Each phosphorylated serine or threonine is followed immediately by glutamine in the polypeptide chain; at no other positions are the amino acid residues obviously constrained.

  4. Active Kids Active Minds: A Physical Activity Intervention to Promote Learning?

    lisahunter; Abbott, Rebecca; Macdonald, Doune; Ziviani, Jennifer; Cuskelly, Monica

    2014-01-01

    This study assessed the feasibility and impact of introducing a programme of an additional 30 minutes per day of moderate physical activity within curriculum time on learning and readiness to learn in a large elementary school in south-east Queensland, Australia. The programme, Active Kids Active Minds (AKAM), involved Year 5 students (n = 107),…

  5. Inactivation of biologically active DNA by isopropanol and formate radicals

    If OH and H radicals, produced by absorption of ionizing radiation in aqueous solutions, are scavenged with isopropanol or sodium formate, secondary radicals are formed which can inactivate phiX174 DNA. From experiments at various DNA concentrations and dose rates we were able to determine the rate constant and the inactivation efficiency of the reaction of these organic radicals with single stranded DNA. (author)

  6. Do Topological Charge Solitons Participate in DNA Activity?

    Hermon, Z; Ben-Jacob, E; Hermon, Ziv; Caspi, Shay; Ben-Jacob, Eshel

    1997-01-01

    We present a novel electromagnetic model of DNA molecules, in which the P-bonds act as tunnel junctions and the H-bonds as capacitors. Excess charge in the model gives rise to two coupled modified sine-Gordon equations, which admit topological solitonic excitations. We study the dynamics of the solitons, their effect on the DNA transport properties, and comment about their role in the DNA functioning. We propose specific experiments in order to test our predictions.

  7. Nuclear translocation contributes to regulation of DNA excision repair activities

    Knudsen, Nina Østergaard; Andersen, Sofie Dabros; Lützen, Anne; Nielsen, Finn Cilius; Rasmussen, Lene Juel

    2009-01-01

    DNA mutations are circumvented by dedicated specialized excision repair systems, such as the base excision repair (BER), nucleotide excision repair (NER), and mismatch repair (MMR) pathways. Although the individual repair pathways have distinct roles in suppressing changes in the nuclear DNA, it is...... co-import appears to be a mechanism employed by the composite repair systems NER and MMR to enhance and regulate nuclear accumulation of repair proteins thereby ensuring faithful DNA repair....

  8. Binding of the global response regulator protein CovR to the sag promoter of Streptococcus pyogenes reveals a new mode of CovR-DNA interaction.

    Gao, Jinxin; Gusa, Asiya A; Scott, June R; Churchward, Gordon

    2005-11-25

    CovR (CsrR) is a response regulator of gene expression in Streptococcus pyogenes. It regulates approximately 15% of the genome, including the genes encoding several streptococcal virulence factors, and acts primarily as a repressor rather than an activator of transcription. We showed that in vitro, CovR is sufficient to repress transcription from the sag promoter, which directs the expression of streptolysin S, a hemolysin that can damage the membranes of eukaryotic cells and subcellular organelles. Repression was stimulated 10-fold by phosphorylation of CovR with acetyl phosphate. In contrast to binding at the has and cov promoters, which direct the expression of genes involved in capsule biosynthesis and of CovR itself, binding of CovR to Psag was highly cooperative. CovR bound to two extended regions of Psag, an upstream region overlapping the -35 and -10 promoter elements and a downstream region overlapping the translation initiation signals of the sagA gene. Each of these regions contains only a single consensus CovR binding sequence, ATTARA, which at the has promoter defines individual sites to which CovR binds non-cooperatively. At Phas and Pcov the T residues in the sequence ATTARA are important for CovR binding. However, using uracil interference experiments we find that although the ATTARA sequence in the Psag upstream region contains thymine residues important for CovR binding, important thymine residues in the Psag downstream region are located outside this sequence. Furthermore, again in contrast to its behavior at the has and cov promoters where phosphorylation of CovR leads to a 2-3-fold increase in DNA binding affinity, binding of CovR to the sag promoter was stimulated 8-32-fold by phosphorylation. We suggest that these differences in CovR binding mean that individual promoters will be repressed at different intracellular levels of phosphorylated CovR, permitting differences in the response of members of the CovR regulon to environmental and

  9. DNA polymerase-α regulates the activation of type I interferons through cytosolic RNA:DNA synthesis.

    Starokadomskyy, Petro; Gemelli, Terry; Rios, Jonathan J; Xing, Chao; Wang, Richard C; Li, Haiying; Pokatayev, Vladislav; Dozmorov, Igor; Khan, Shaheen; Miyata, Naoteru; Fraile, Guadalupe; Raj, Prithvi; Xu, Zhe; Xu, Zigang; Ma, Lin; Lin, Zhimiao; Wang, Huijun; Yang, Yong; Ben-Amitai, Dan; Orenstein, Naama; Mussaffi, Huda; Baselga, Eulalia; Tadini, Gianluca; Grunebaum, Eyal; Sarajlija, Adrijan; Krzewski, Konrad; Wakeland, Edward K; Yan, Nan; de la Morena, Maria Teresa; Zinn, Andrew R; Burstein, Ezra

    2016-05-01

    Aberrant nucleic acids generated during viral replication are the main trigger for antiviral immunity, and mutations that disrupt nucleic acid metabolism can lead to autoinflammatory disorders. Here we investigated the etiology of X-linked reticulate pigmentary disorder (XLPDR), a primary immunodeficiency with autoinflammatory features. We discovered that XLPDR is caused by an intronic mutation that disrupts the expression of POLA1, which encodes the catalytic subunit of DNA polymerase-α. Unexpectedly, POLA1 deficiency resulted in increased production of type I interferons. This enzyme is necessary for the synthesis of RNA:DNA primers during DNA replication and, strikingly, we found that POLA1 is also required for the synthesis of cytosolic RNA:DNA, which directly modulates interferon activation. Together this work identifies POLA1 as a critical regulator of the type I interferon response. PMID:27019227

  10. Inhibition of Ape1 Redox Activity Promotes Odonto/osteogenic Differentiation of Dental Papilla Cells.

    Chen, Tian; Liu, Zhi; Sun, Wenhua; Li, Jingyu; Liang, Yan; Yang, Xianrui; Xu, Yang; Yu, Mei; Tian, Weidong; Chen, Guoqing; Bai, Ding

    2015-01-01

    Dentinogenesis is the formation of dentin, a substance that forms the majority of teeth, and this process is performed by odontoblasts. Dental papilla cells (DPCs), as the progenitor cells of odontoblasts, undergo the odontogenic differentiation regulated by multiple cytokines and paracrine signal molecules. Ape1 is a perfect paradigm of the function complexity of a biological macromolecule with two major functional regions for DNA repair and redox regulation, respectively. To date, it remains unclear whether Ape1 can regulate the dentinogenesis in DPCs. In the present study, we firstly examed the spatio-temporal expression of Ape1 during tooth germ developmental process, and found the Ape1 expression was initially high and then gradually reduced along with the tooth development. Secondly, the osteo/odontogenic differentiation capacity of DPCs was up-regulated when treated with either Ape1-shRNA or E3330 (a specific inhibitor of the Ape1 redox function), respectively. Moreover, we found that the canonical Wnt signaling pathway was activated in this process, and E3330 reinforced-osteo/odontogenic differentiation capacity was suppressed by Dickkopf1 (DKK1), a potent antagonist of canonical Wnt signaling pathway. Taken together, we for the first time showed that inhibition of Ape1 redox regulation could promote the osteo/odontogenic differentiation capacity of DPCs via canonical Wnt signaling pathway. PMID:26639148

  11. Effect of single-nucleotide polymorphisms -705T/C and -603T/A in P1 promoter region of human insulin-like growth factor-I gene on promoter activity

    Wei HUANG

    2012-01-01

    Full Text Available Objective  To investigate the effect of single-nucleotide polymorphisms (SNP -705T>C and -603T>A in the P1 promoter region of human insulin-like growth factor I (IGF-I gene on promoter activity. Methods  A total of 152 healthy volunteers were recruited for the present study. The peripheral blood samples were obtained through venipuncture. The total genomic DNA of each blood sample was extracted using the genomic DNA extraction kit. Genotyping of SNP -705T>C and -603T>A in each volunteer was performed based on restriction fragment length polymorphism (RFLP analysis, and the frequencies of each genotype were statistically analyzed. P1 promoter haplotypes and their frequencies were analyzed by PHASE v2.1 software. Luciferase reporter gene assays were adopted to determine the difference in activity between different promoter haplotypes. Results  The total genomic DNA of each volunteer was successfully extracted. Genotyping of SNP -705T>C and -603T>A was also carried out. The genotype frequencies of -705T/T, -705T/C, and -705C/C were the same as those of -603T/T, -603T/ A, and -603A/A, which were 43.4%, 45.4%, and 11.2%, respectively. The frequencies of allelic gene -705T and -705C were the same as those of -603T and -603A, which were 66.1% and 33.9%, respectively. A complete linkage disequilibrium between SNP -705T>C and -603T>A was observed. Moreover, these two SNPs only comprised two types of promoter haplotypes, including -705T/-603T (66.1% and -705C/-603A (33.9%. The results of reporter gene assays showed that the activity of -705C/-603A P1 promoter haplotype was significantly higher than that of -705T/-603T haplotype. Conclusion  SNP -705T>C and -603T>A in the P1 promoter field of human IGF-I gene can affect the activity of the P1 promoter.

  12. The physical therapist's role in physical activity promotion

    Verhagen, E.; Engbers, L.

    2009-01-01

    Clinicians are increasingly confronted with the diseases of physical inactivity. Paradoxically, a promising strategy to motivate sedentary individuals to become more active is the opportunity to encourage physical activity related behavioural change when individuals encounter health professionals. A

  13. Strategies for Physical Activity Promotion beyond the Physical Education Classroom

    Faber, Larry; Kulinna, Pamela Hodges; Darst, Paul

    2007-01-01

    The current need for physical activity has extended beyond the limited time given to students in physical education classes. In order for students to receive appropriate levels of physical activity (i.e., at least 60 minutes per day), it is necessary for physical educators to incorporate physical activity opportunities outside the traditional…

  14. Promoting Physical Activity: Addressing Barriers and Moving Forward

    Beighle, Aaron; Morrow, James R.

    2014-01-01

    The barriers that keep individuals from adopting and maintaining active lifestyles are very complex. Strategies for overcoming these barriers and to incentivize and assist inactive individuals to benefit from physical activity are necessary. In addition, it is important to examine the impact of public policy on active living. As youth physical…

  15. CRN-1, a Caenorhabditis elegans FEN-1 homologue, cooperates with CPS-6/EndoG to promote apoptotic DNA degradation

    Parrish, Jay Z.; Yang, Chonglin; Shen, Binghui; Xue, Ding

    2003-01-01

    Oligonucleosomal fragmentation of chromosomes in dying cells is a hallmark of apoptosis. Little is known about how it is executed or what cellular components are involved. We show that crn-1, a Caenorhabditis elegans homologue of human flap endonuclease-1 (FEN-1) that is normally involved in DNA replication and repair, is also important for apoptosis. Reduction of crn-1 activity by RNA interference resulted in cell death phenotypes similar to those displayed by a mutant lacking the mitochondr...

  16. Brusatol Enhances the Radiosensitivity of A549 Cells by Promoting ROS Production and Enhancing DNA Damage

    Xiaohui Sun

    2016-06-01

    Full Text Available NF-E2-related factor 2 (Nrf2 has been identified as a master regulatory factor in the protection of cells from oxidative and electrophilic stress. However, overexpression of Nrf2 in lung cancer may cause chemoresistance, as well as radioresistance. In this study, we examined the relationship between radioresistance and Nrf2 protein levels in H1299, A549, and H460 cells, and finally chose the A549 cell line to continue with due to its strong radioresistance and high Nrf2 protein levels. We found that the Nrf2 inhibitor, brusatol, could prevent the increase and accumulation of Nrf2 after exposure to irradiation. Additionally, following treatment with 80 nM brusatol, A549 cells became sensitive to irradiation, suffering severe DNA damage. Combination treatment with brusatol and ionizing radiation (IR can distinctly increase the level of reactive oxygen species in A549 cells, causing a 1.8-fold increase compared with the control, and a 1.4-fold increase compared with IR alone. In fact, in the treatment with both brusatol and IR, lung cancer cell proliferation is halted, gradually leading to cell death. Because Nrf2 is closely linked to DNA damage repair, inhibiting the function of Nrf2, as in brusatol treatment, may increase the DNA damage caused by radiotherapy or chemotherapy, possibly enhancing the efficacy of chemotherapeutic drugs. Our study is the first to demonstrate brusatol’s ability to enhance the responsiveness of lung cancer cells to irradiation, and its potential application as a natural sensitizer in radiotherapy.

  17. Brusatol Enhances the Radiosensitivity of A549 Cells by Promoting ROS Production and Enhancing DNA Damage.

    Sun, Xiaohui; Wang, Qin; Wang, Yan; Du, Liqing; Xu, Chang; Liu, Qiang

    2016-01-01

    NF-E2-related factor 2 (Nrf2) has been identified as a master regulatory factor in the protection of cells from oxidative and electrophilic stress. However, overexpression of Nrf2 in lung cancer may cause chemoresistance, as well as radioresistance. In this study, we examined the relationship between radioresistance and Nrf2 protein levels in H1299, A549, and H460 cells, and finally chose the A549 cell line to continue with due to its strong radioresistance and high Nrf2 protein levels. We found that the Nrf2 inhibitor, brusatol, could prevent the increase and accumulation of Nrf2 after exposure to irradiation. Additionally, following treatment with 80 nM brusatol, A549 cells became sensitive to irradiation, suffering severe DNA damage. Combination treatment with brusatol and ionizing radiation (IR) can distinctly increase the level of reactive oxygen species in A549 cells, causing a 1.8-fold increase compared with the control, and a 1.4-fold increase compared with IR alone. In fact, in the treatment with both brusatol and IR, lung cancer cell proliferation is halted, gradually leading to cell death. Because Nrf2 is closely linked to DNA damage repair, inhibiting the function of Nrf2, as in brusatol treatment, may increase the DNA damage caused by radiotherapy or chemotherapy, possibly enhancing the efficacy of chemotherapeutic drugs. Our study is the first to demonstrate brusatol's ability to enhance the responsiveness of lung cancer cells to irradiation, and its potential application as a natural sensitizer in radiotherapy. PMID:27347930

  18. Considerations on the promotional activity on the DIY market in Romania

    Mihai FÎNARU; Ioana Bianca CHIŢU

    2015-01-01

    Communication is a component of the marketing mix of great importance for the success of companies on the market. Currently the promotional activity of companies is experiencing a variety of manifestations, the manufacturers and the distributors are always interested in finding ways to promote themselves differently, moreover to draw the attention of consumers and to produce the desired behavior among them. DIY market is a highly competitive market and the promotional technique...

  19. An empirical analysis of the roles, activities and performance of commercial diplomats in promoting international business

    Naray, Olivier; Bezençon, Valéry; Kostecki, Michel

    2015-01-01

    Background Governments seek to promote – beyond the support for individual businesses – increased exports but also the intangible elements, such as nation branding and country positioning for inward foreign direct investment (FDI) and other economic benefits. In this context, commercial diplomats work as State representatives with diplomatic status conducting trade and business promotion activities between a home and a host country supporting directly individual business firms or promoting t...

  20. De novo DNA methylation promoted by G9a prevents reprogramming of embryonically silenced genes

    Epsztejn-Litman, Silvina; Feldman, Nirit; Abu-Remaileh, Monther; Shufaro, Yoel; Gerson, Ariela; Ueda, Jun; Deplus, Rachel; Fuks, François; Shinkai, Yoichi; Cedar, Howard; Bergman, Yehudit

    2008-01-01

    The pluripotency determining gene, Oct-3/4 (also called Pou5f1) undergoes post implantation silencing in a process mediated by the histone methyltransferase (HMT) G9a. Microarray analysis now shows that this enzyme may operate as a master regulator that inactivates multiple early embryonic genes by bringing about methylated-histone H3K9 heterochromatinization and de novo DNA methylation. Genetic studies in differentiating ES cells demonstrate that a point mutation in the G9a SET domain preven...

  1. Chinese tobacco industry promotional activity on the microblog Weibo.

    Fan Wang

    Full Text Available BACKGROUND: Although China ratified the WHO Framework Convention on Tobacco Control [FCTC] in 2005, the partial ban on tobacco advertising does not cover the internet. Weibo is one of the most important social media channels in China, using a format similar to its global counterpart, Twitter. The Weibo homepage is a platform to present products, brands and corporate culture. There is great potential for the tobacco industry to exploit Weibo to promote products. METHODS: Seven tobacco industry Weibo accounts that each had more than 5000 fans were selected to examine the content of Weibos established by tobacco companies or their advertising agents. RESULTS: Of the 12073 posts found on the seven accounts, 92.3% (11143 could be classified into six main themes: traditional culture, popular culture, social and business affairs, advertisement, public relations and tobacco culture. Posts under the theme of popular culture accounted for about half of total posts (49%, followed by 'advertisement' and 'tobacco culture' (both at 12%, 'traditional culture' and 'public relations' (both at 11%, and finally 'social and business affairs' (5%. 33% of posts included the words 'cigarette' or 'smoking' and 53% of posts included the tobacco brand name, indicating that tobacco companies carefully construct the topic and content of posts. CONCLUSIONS: Weibo is an important new online marketing tool for the Chinese tobacco industry. Tobacco industry use of Weibo to promote brands and normalize smoking subverts China's ratification of the WHO FCTC. Policy to control tobacco promotion needs reforming to address this widespread circumvention of China's tobacco advertising ban.

  2. Replication stress activates DNA repair synthesis in mitosis

    Minocherhomji, Sheroy; Ying, Songmin; Bjerregaard, Victoria A;

    2015-01-01

    mitosis serves as the trigger for completion of DNA replication at CFS loci in human cells. Given that this POLD3-dependent mitotic DNA synthesis is enhanced in aneuploid cancer cells that exhibit intrinsically high levels of chromosomal instability (CIN(+)) and replicative stress, we suggest that...

  3. Promoting Female Students' Learning Motivation towards Science by Exercising Hands-On Activities

    Wen-jin, Kuo; Chia-ju, Liu; Shi-an, Leou

    2012-01-01

    The purpose of this study is to design different hands-on science activities and investigate which activities could better promote female students' learning motivation towards science. This study conducted three types of science activities which contains nine hands-on activities, an experience scale and a learning motivation scale for data…

  4. Influence of exogenous DNA on macrophage functional activity in experimental radiotherapy

    A study was made of peritoneal macrophage functional activity in C57BL/6 mice witb transplantable Lewis carcinoma during administration of exogenous DNA and use of local radiotherapy. The results show that the use of exogenous DNA in radiotherapy incroases peritoneal macrophage functional activity in mice with transplantable tumors

  5. Structure, function, and tethering of DNA-binding domains in σ⁵⁴ transcriptional activators.

    Vidangos, Natasha; Maris, Ann E; Young, Anisa; Hong, Eunmi; Pelton, Jeffrey G; Batchelor, Joseph D; Wemmer, David E

    2013-12-01

    We compare the structure, activity, and linkage of DNA-binding domains (DBDs) from σ(54) transcriptional activators and discuss how the properties of the DBDs and the linker to the neighboring domain are affected by the overall properties and requirements of the full proteins. These transcriptional activators bind upstream of specific promoters that utilize σ(54)-polymerase. Upon receiving a signal the activators assemble into hexamers, which then, through adenosine triphosphate (ATP) hydrolysis, drive a conformational change in polymerase that enables transcription initiation. We present structures of the DBDs of activators nitrogen regulatory protein C 1 (NtrC1) and Nif-like homolog 2 (Nlh2) from the thermophile Aquifex aeolicus. The structures of these domains and their relationship to other parts of the activators are discussed. These structures are compared with previously determined structures of the DBDs of NtrC4, NtrC, ZraR, and factor for inversion stimulation. The N-terminal linkers that connect the DBDs to the central domains in NtrC1 and Nlh2 were studied and found to be unstructured. Additionally, a crystal structure of full-length NtrC1 was solved, but density of the DBDs was extremely weak, further indicating that the linker between ATPase and DBDs functions as a flexible tether. Flexible linking of ATPase and DBDs is likely necessary to allow assembly of the active hexameric ATPase ring. The comparison of this set of activators also shows clearly that strong dimerization of the DBD only occurs when other domains do not dimerize strongly. PMID:23818155

  6. Pseudomonas aeruginosa phage PaP1 DNA polymerase is an A-family DNA polymerase demonstrating ssDNA and dsDNA 3'-5' exonuclease activity.

    Liu, Binyan; Gu, Shiling; Liang, Nengsong; Xiong, Mei; Xue, Qizhen; Lu, Shuguang; Hu, Fuquan; Zhang, Huidong

    2016-08-01

    Most phages contain DNA polymerases, which are essential for DNA replication and propagation in infected host bacteria. However, our knowledge on phage-encoded DNA polymerases remains limited. This study investigated the function of a novel DNA polymerase of PaP1, which is the lytic phage of Pseudomonas aeruginosa. PaP1 encodes its sole DNA polymerase called Gp90 that was predicted as an A-family DNA polymerase with polymerase and 3'-5' exonuclease activities. The sequence of Gp90 is homologous but not identical to that of other A-family DNA polymerases, such as T7 DNA polymerases (Pol) and DNA Pol I. The purified Gp90 demonstrated a polymerase activity. The processivity of Gp90 in DNA replication and its efficiency in single-dNTP incorporation are similar to those of T7 Pol with processive thioredoxin (T7 Pol/trx). Gp90 can degrade ssDNA and dsDNA in 3'-5' direction at a similar rate, which is considerably lower than that of T7 Pol/trx. The optimized conditions for polymerization were a temperature of 37 °C and a buffer consisting of 40 mM Tris-HCl (pH 8.0), 30 mM MgCl2, and 200 mM NaCl. These studies on DNA polymerase encoded by PaP1 help advance our knowledge on phage-encoded DNA polymerases and elucidate PaP1 propagation in infected P. aeruginosa. PMID:27052734

  7. Dynamical analysis on gene activity in the presence of repressors and an interfering promoter.

    Nakanishi, Hiizu; Mitarai, Namiko; Sneppen, Kim

    2008-11-01

    Transcription is regulated through interplay among transcription factors, an RNA polymerase (RNAP), and a promoter. Even for a simple repressive transcription factor that disturbs promoter activity at initial binding of RNAP, its repression level is not determined solely by the dissociation constant of transcription factor but is sensitive to timescales of processes in RNAP. We first analyze the promoter activity under strong repression by a slow binding repressor, in which case transcription events occur in bursts, followed by long quiescent periods while a repressor binds to the operator; the number of transcription events, bursting, and quiescent times are estimated by reaction rates. We then examine interference effect from an opposing promoter, using the correlation function of initiation events for a single promoter. The interference is shown to de-repress the promoter because RNAPs from the opposing promoter most likely encounter the repressor and remove it in case of strong repression. This de-repression mechanism should be especially prominent for the promoters that facilitate fast formation of open complex with the repressor whose binding rate is slower than approximately 1/s. Finally, we discuss possibility of this mechanism for high activity of promoter PR in the hyp-mutant of lambda-phage. PMID:18658208

  8. Measuring the activity of BioBrick promoters using an in vivo reference standard

    Kelly Jason R

    2009-03-01

    Full Text Available Abstract Background The engineering of many-component, synthetic biological systems is being made easier by the development of collections of reusable, standard biological parts. However, the complexity of biology makes it difficult to predict the extent to which such efforts will succeed. As a first practical example, the Registry of Standard Biological Parts started at MIT now maintains and distributes thousands of BioBrick™ standard biological parts. However, BioBrick parts are only standardized in terms of how individual parts are physically assembled into multi-component systems, and most parts remain uncharacterized. Standardized tools, techniques, and units of measurement are needed to facilitate the characterization and reuse of parts by independent researchers across many laboratories. Results We found that the absolute activity of BioBrick promoters varies across experimental conditions and measurement instruments. We choose one promoter (BBa_J23101 to serve as an in vivo reference standard for promoter activity. We demonstrated that, by measuring the activity of promoters relative to BBa_J23101, we could reduce variation in reported promoter activity due to differences in test conditions and measurement instruments by ~50%. We defined a Relative Promoter Unit (RPU in order to report promoter characterization data in compatible units and developed a measurement kit so that researchers might more easily adopt RPU as a standard unit for reporting promoter activity. We distributed a set of test promoters to multiple labs and found good agreement in the reported relative activities of promoters so measured. We also characterized the relative activities of a reference collection of BioBrick promoters in order to further support adoption of RPU-based measurement standards. Conclusion Relative activity measurements based on an in vivoreference standard enables improved measurement of promoter activity given variation in measurement

  9. Aag DNA glycosylase promotes alkylation-induced tissue damage mediated by Parp1.

    Jennifer A Calvo

    2013-04-01

    Full Text Available Alkylating agents comprise a major class of front-line cancer chemotherapeutic compounds, and while these agents effectively kill tumor cells, they also damage healthy tissues. Although base excision repair (BER is essential in repairing DNA alkylation damage, under certain conditions, initiation of BER can be detrimental. Here we illustrate that the alkyladenine DNA glycosylase (AAG mediates alkylation-induced tissue damage and whole-animal lethality following exposure to alkylating agents. Aag-dependent tissue damage, as observed in cerebellar granule cells, splenocytes, thymocytes, bone marrow cells, pancreatic β-cells, and retinal photoreceptor cells, was detected in wild-type mice, exacerbated in Aag transgenic mice, and completely suppressed in Aag⁻/⁻ mice. Additional genetic experiments dissected the effects of modulating both BER and Parp1 on alkylation sensitivity in mice and determined that Aag acts upstream of Parp1 in alkylation-induced tissue damage; in fact, cytotoxicity in WT and Aag transgenic mice was abrogated in the absence of Parp1. These results provide in vivo evidence that Aag-initiated BER may play a critical role in determining the side-effects of alkylating agent chemotherapies and that Parp1 plays a crucial role in Aag-mediated tissue damage.

  10. Spatio-Temporal Imaging of Promoter Activity in Intact Plant Tissues.

    Xiong, Tou Cheu; Sanchez, Frédéric; Briat, Jean-François; Gaymard, Frédéric; Dubos, Christian

    2016-01-01

    Localization and quantification of expression levels of genes help to determine their function. Localization of gene expression is often achieved through the study of their promoter activity. Three main reporter genes β-glucuronidase (GUS), green fluorescent protein (GFP), and luciferase (LUC) have been intensively used to characterize promoter activities, each having its own specificities and advantages. Among them, the LUC reporter gene is best suitable for the analysis of the promoter activity of genes in intact living plants. Here, we describe a LUC-based method that allows to precisely localize and quantify promoter activity at the whole plant level, and to study the mechanisms that are involved in long-distance regulation of gene expression in Arabidopsis thaliana. Imaging LUC signals with a low-light CCD camera allows monitoring promoter activity in time and space in the transgenic plant harboring the promoter fused with the LUC gene. In addition, it allows quantifying change of promoter activities in plant during several hours. PMID:27557763

  11. The BPV-1 E2 DNA-contact helix cysteine is required for transcriptional activation but not replication in mammalian cells.

    Grossel, M J; Barsoum, J; Prakash, S S; Androphy, E J

    1996-03-01

    The papillomavirus E2 protein contains an amino-terminal region thought necessary and sufficient to support transcriptional activation and a carboxy-terminal region shown to direct sequence-specific DNA binding and dimerization. A cysteine residue in the center of the E2 DNA recognition helix is highly conserved among papillomavirus E2 proteins. Mutations of this cysteine in bovine papillomavirus type 1 E2 to serine and glycine resulted in proteins which failed to activate E2-dependent promoters in mammalian cells. These E2 mutants were DNA-binding competent, dimeric, and nuclear. When fused to the VP16 transactivation domain, C-terminal regions of E2 containing the mutations at 340 supported transcriptional activation, indicating that the heterologous trans-activation domain did not require cysteine in the DNA-binding helix as did the full-length E2 transactivating protein. Although cysteine-340 was required for transcriptional activation it was not required for DNA replication in vivo. Together, these results suggest that the E2 DNA-binding domain may directly contribute to functions of transcriptional activation previously thought limited to the N-terminal domain. PMID:8599215

  12. Linking active DNA demethylation by Thymine DNA Glycosylase with epigenetic regulation of gene expression

    Wirz, Annika

    2014-01-01

    The correct regulation of epigenetic modifications is crucial for cell plasticity and the establishment of cell identity. The underlying molecular mechanisms are not clear, but a role for DNA repair proteins has been implicated in this context, the investigation of which was the overall aim of my PhD thesis. The Thymine DNA Glycosylase (TDG) was described to excise the deamination products of cytosine (C) and 5-methylcytosine (5-mC), thereby initiating base excision repair (BER; Nedderman...

  13. Targeting and timing promotional activities : An agent-based model for the takeoff of new products

    Delre, S. A.; Jager, W.; Bijmolt, T. H. A.; Janssen, M. A.

    2007-01-01

    Many marketing efforts focus on promotional activities that support the launch of new products. Promotional strategies may play a crucial role in the early stages of the product life cycle, and determine to a large extent the diffusion of a new product. This paper proposes an agent-based model to si

  14. Investigating message-framing effects in the context of a tailored intervention promoting physical activity.

    Riet, van 't J.P.; Ruiter, R.A.C.; Werrij, M.Q.; Vries, de H.

    2010-01-01

    Health-promoting messages can be framed in terms of the gains associated with healthy behaviour or the losses associated with unhealthy behaviour. It has been argued that gain-framed messages promoting physical activity (PA) are more effective than loss-framed messages, but empirical findings are in

  15. Analysis of DNA polymerase activity in Petunia protoplasts treated with clastogenic agents

    Clastogenic agents, i.e. agents that can induce chromosome or DNA breakage, have been shown to enhance the role of direct gene transfer to protoplasts. The effect was analysed at the enzymatic level using protoplast homogenates as well as intact protoplasts. For that purpose existing procedures were modified to enable measurement of DNA polymerase in vivo. In the system used, external DNA was able to enter the cells without the addition of membrane-permeabilizing compounds. When comparing total DNA polymerase activity of protoplasts irradiated with X-rays or UV-light with that of untreated cells we did not observe significant differences. Incubation of protoplasts with high doses of bleomycin affected total DNA polymerase activity negatively. but dideoxythymidine triphosphate-sensitive activity was not influenced. We conclude that the DNA strand-breaks induced by low doses of X-rays. UV-light or bleomycin do not increase the total or the repair-DNA polymerase activity and. therefore. that the increase in the transformation rates after DNA strand-breaking is not preceded by enhanced DNA polymerase activity. (author)

  16. Altered DNA methylation patterns of the H19 differentially methylated region and the DAZL gene promoter are associated with defective human sperm.

    Bo Li

    Full Text Available DNA methylation disturbance is associated with defective human sperm. However, oligozoospermia (OZ and asthenozoospermia (AZ usually present together, and the relationship between the single-phenotype defects in human sperm and DNA methylation is poorly understood. In this study, 20 infertile OZ patients and 20 infertile AZ patients were compared with 20 fertile normozoospermic men. Bisulfate-specific PCR was used to analyze DNA methylation of the H19-DMR and the DAZL promoter in these subjects. A similar DNA methylation pattern of the H19-DMR was detected in AZ and NZ(control, with only complete methylation and mild hypomethylation(0.05. However, the methylation pattern of severe hypomethylation (>50% unmethylated CpGs and complete unmethylation was only detected in 5 OZ patients, and the occurrence of these two methylation patterns was 8.54±10.86% and 9±6.06%, respectively. Loss of DNA methylation of the H19-DMR in the OZ patients was found to mainly occur in CTCF-binding site 6, with occurrence of 18.15±14.71%, which was much higher than that in patients with NZ (0.84±2.05% and AZ (0.58±1.77% (P20% methylated clones in the DAZL promoter only in infertile patients, there was no significant difference between the AZ and OZ patients in the proportion of moderately-to-severely hypermethylated clones (p>0.05. In all cases, global sperm genome methylation analyses, using LINE1 transposon as the indicator, showed that dysregulation of DNA methylation is specifically associated with the H19-DMR and DAZL promoter. Therefore, abnormal DNA methylation status of H19-DMR, especially at the CTCF-binding site 6, is closely associated with OZ. Abnormal DNA methylation of the DAZL promoter might represent an epigenetic marker of male infertility.

  17. Construction and use of lambda PL promoter vectors for direct cloning and high level expression of PCR amplified DNA coding sequences.

    Cheng, X.; Patterson, T A

    1992-01-01

    A set of plasmid vectors which allow single-step cloning and expression of PCR-amplified DNA coding sequences has been constructed. The vectors contain the phage lambda PL promoter, a synthetic translation initiation region (TIR), and convenient cloning sites. The cloning sites provide all or part of an AUG translation initiation codon and facilitate the precise fusion of target DNA sequences to vector transcriptional and translational signals. The vectors were constructed with synthetic TIRs...

  18. Use of SPARK to Promote After-School Physical Activity

    Herrick, Heidi; Thompson, Hannah; Kinder, Jennifer; Madsen, Kristine A.

    2012-01-01

    Background: The after-school period is potentially an important venue for increasing physical activity for youth. We sought to assess the effectiveness of the Sports, Play, and Recreation for Youth (SPARK) program to increase physical activity and improve cardiorespiratory fitness and weight status among elementary students after school. Methods:…

  19. Drama Activities that Promote and Extend Your Students' Vocabulary Proficiency.

    Alber, Sheila R.; Foil, Carolyn R.

    2003-01-01

    This article suggests using drama activities to teach target vocabulary words to students with limited vocabulary development. It presents specific drama activities to implement when introducing new vocabulary, conducting guided practice, facilitating cooperative learning groups, and assigning independent practice. Suggestions are also offered for…

  20. Specific activation of 2'-5'oligoadenylate synthetase gene promoter by hepatitis C virus-core protein: A potential for developing hepatitis C virus targeting gene therapy

    Ying Wang; Shan-Shan Mao; Qiong-Qiong He; Yuan Zi; Ji-Fang Wen; De-Yun Feng

    2009-01-01

    AIM: To examine whether 2'-5'oligoadenylate synthetase (OAS) gene promoter can be specifically activated by hepatitis C virus (HCV)-core protein.METHODS: Human embryo hepatic cell line L02 was transfected with pcDNA3.1-core plasmid and selected by G418. Expression of HCV-core was detected by reverse transcription polymerase chain reaction and Western blotting. The OAS promoter sequence was amplified from the genomic DNA and inserted into pGL3-basic vector. The resultant pGL3-OAS-Luci plasmid was transiently transfected into L02/core cells and luciferase activity was assayed.RESULTS: L02/core cell line stably expressing HCV-core protein was established. The pGL3-OAS-Luci construct exhibited significant transcriptional activity in the L02/core cells but not in the L02 cells.CONCLUSION: HCV-core protein activates the OAS gene promoter specifically and effectively. Utilization of OAS gene promoter would be an ideal strategy for developing HCV-specific gene therapy.