WorldWideScience

Sample records for actinium 221

  1. Extraction of actinium with di-(2-ethylhexyl)phosphoric acid from hydrochloric and nitric acid solutions

    The extraction of actinium with HDEHP from Cl- and NO3- systems has been investigated. It was found that extraction of actinium from HCl solutions is much better than from HNO3 solutions. Stability constants of actinium complexes Ac(X-)+2 with Cl- and NO3- ligands were determined. Our results show that the actinium formed less stable complexes with Cl- than with NO3- ligands. 5 refs., 3 figs., 1 tab. (author)

  2. The sorption of polonium, actinium and protactinium onto geological materials

    This paper describes a combined experimental and modeling program of generic sorption studies to increase confidence in the performance assessment for a potential high-level radioactive waste repository in Japan. The sorption of polonium, actinium and protactinium onto geological materials has been investigated. Sorption of these radioelements onto bentonite, tuff and granodiorite from equilibrated de-ionized water was studied under reducing conditions at room temperature. In addition, the sorption of actinium and protactinium was investigated at 60 C. Thermodynamic chemical modeling was carried out to aid interpretation of the results

  3. Discovery of the actinium, thorium, protactinium, and uranium isotopes

    Fry, C; Thoennessen, M

    2012-01-01

    Currently, 31 actinium, 31 thorium, 28 protactinium, and 23 uranium isotopes have so far been observed; the discovery of these isotopes is discussed. For each isotope a brief summary of the first refereed publication, including the production and identification method, is presented.

  4. Separation of Actinium 227 from the uranium minerals

    The purpose of this work was to separate Actinium 227, whose content is 18%, from the mineral carnotite found in Gomez Chihuahua mountain range in Mexico. The mineral before processing is is pre-concentrated and passed, first through anionic exchange resins, later the eluate obtained is passed through cationic resins. The resins were 20-50 MESH QOWEX and 100-200 MESH 50 X 8-20 in some cased 200-400 MESH AG 50W-X8, 1X8 in other cases. The eluates from the ionic exchange were electrodeposited on stainless steel polished disc cathode and platinum electrode as anode; under a current ODF 10mA for 2.5 to 5 hours and of 100mA for .5 of an hour. it was possible to identify the Actinium 227 by means of its descendents, TH-227 and RA-223, through alpha spectroscopy. Due to the radiochemical purity which the electro deposits were obtained the Actinium 227 was low and was not quantitatively determined. A large majority of the members of the natural radioactive series 3 were identified and even alpha energies reported in the literature with very low percentages of non-identified emissions were observed. We conclude that a more precise study is needed concerning ionic exchange and electrodeposit to obtain an Actinium 227 of radiochemical purity. (Author)

  5. Spectroscopic and computational investigation of actinium coordination chemistry.

    Ferrier, Maryline G; Batista, Enrique R; Berg, John M; Birnbaum, Eva R; Cross, Justin N; Engle, Jonathan W; La Pierre, Henry S; Kozimor, Stosh A; Lezama Pacheco, Juan S; Stein, Benjamin W; Stieber, S Chantal E; Wilson, Justin J

    2016-01-01

    Actinium-225 is a promising isotope for targeted-α therapy. Unfortunately, progress in developing chelators for medicinal applications has been hindered by a limited understanding of actinium chemistry. This knowledge gap is primarily associated with handling actinium, as it is highly radioactive and in short supply. Hence, Ac(III) reactivity is often inferred from the lanthanides and minor actinides (that is, Am, Cm), with limited success. Here we overcome these challenges and characterize actinium in HCl solutions using X-ray absorption spectroscopy and molecular dynamics density functional theory. The Ac-Cl and Ac-OH2O distances are measured to be 2.95(3) and 2.59(3) Å, respectively. The X-ray absorption spectroscopy comparisons between Ac(III) and Am(III) in HCl solutions indicate Ac(III) coordinates more inner-sphere Cl(1-) ligands (3.2±1.1) than Am(III) (0.8±0.3). These results imply diverse reactivity for the +3 actinides and highlight the unexpected and unique Ac(III) chemical behaviour. PMID:27531582

  6. ENG 221 Uop Material-eng221dotcom

    Sandywilliam6

    2015-01-01

    ENG 221 Entire Course (UOP) For more course tutorials visit www.eng221.com   ENG 221 Week 2 Web-Conferencing Programs Research Memo ENG 221 Week 3 Request for Proposal for Trainers ENG 221 Week 4 User manual Critique ENG 221 Week 5 Learning Team Assignment: Project (Manual) ENG 221 Week 1 DQs ENG 221 Week 2 DQs ENG 221 Week 3 DQs ENG 221 Week 4 DQs ENG 221 Week 5 DQs  

  7. ENG 221 UOP Course Tutorial / eng221dotcom

    anil14

    2015-01-01

    ENG 221 Entire Course (UOP) For more course tutorials visit www.eng221.com   ENG 221 Week 2 Web-Conferencing Programs Research Memo ENG 221 Week 3 Request for Proposal for Trainers ENG 221 Week 4 User manual Critique ENG 221 Week 5 Learning Team Assignment: Project (Manual) ENG 221 Week 1 DQs ENG 221 Week 2 DQs ENG 221 Week 3 DQs ENG 221 Week 4 DQs ENG 221 Week 5 DQs  

  8. IT 221 courses / snaptutorial

    IT 210 snaptutorial

    2015-01-01

    For more classes visit www.snaptutorial.com IT 221 Week 1 DQS part 1 of 2 IT 221 Week 1 DQS part 2 of 2 IT 221 Week 1 CheckPoint: The Phases of the System Development Process IT 221 Week 2 CheckPoint: Project Management in Everyday Life (GROUP ASSIGNMENT) IT 221 Week 2 Assignment: Final Project—Project Overview- Appendix B IT 221 Week 2 CheckPoint: Project Management in Everyday Life IT 221 Week 2 CheckPoint: Final Project—Proposal IT 221 Week 3...

  9. Production of high-purity radium-223 from legacy actinium-beryllium neutron sources.

    Soderquist, Chuck Z; McNamara, Bruce K; Fisher, Darrell R

    2012-07-01

    Radium-223 is a short-lived alpha-particle-emitting radionuclide with potential applications in cancer treatment. Research to develop new radiopharmaceuticals employing (223)Ra has been hindered by poor availability due to the small quantities of parent actinium-227 available world-wide. The purpose of this study was to develop innovative and cost-effective methods to obtain high-purity (223)Ra from (227)Ac. We obtained (227)Ac from two surplus actinium-beryllium neutron generators. We retrieved the actinium/beryllium buttons from the sources and dissolved them in a sulfuric-nitric acid solution. A crude actinium solid was recovered from the solution by coprecipitation with thorium fluoride, leaving beryllium in solution. The crude actinium was purified to provide about 40 milligrams of actinium nitrate using anion exchange in methanol-water-nitric acid solution. The purified actinium was then used to generate high-purity (223)Ra. We extracted (223)Ra using anion exchange in a methanol-water-nitric acid solution. After the radium was separated, actinium and thorium were then eluted from the column and dried for interim storage. This single-pass separation produces high purity, carrier-free (223)Ra product, and does not disturb the (227)Ac/(227)Th equilibrium. A high purity, carrier-free (227)Th was also obtained from the actinium using a similar anion exchange in nitric acid. These methods enable efficient production of (223)Ra for research and new alpha-emitter radiopharmaceutical development. PMID:22697483

  10. Radium, thorium, and actinium extraction from seawater using an improved manganese-oxide-coated fiber

    Laboratory experiments were conducted to determine the efficiency with which improved manganese-oxide-coated acrylic fibers extract radium, thorium, and actinium from seawater. Tests were made using surface seawater spiked with 227Ac, 227Th and 223Ra. For sample volumes of approximately 30 liters and flow rates up to 0.5 liters per minute, radium and actinium are removed quantitatively. Approximately 80-95% of the thorium is removed under these same conditions. (Auth.)

  11. On the ^{221}Rn \\to ^{221}Fr Decay Scheme

    Gromov, K Ya; Norseev, Yu V; Samatov, Zh K; Sergienko, V A; Fominykh, V I; Chumin, V G

    2002-01-01

    The results of investigating the ^{221}Rn beta^{-}-decay and the ^{225}Ac alpha-decay are compared. It is shown that ^{221}Fr levels at 145.9 and 393.2 keV are excited at the ^{221}Rn decay. Intensities and reduced probabilities of the beta^{-}-decay to the ^{221}Fr levels are determined. A conclusion is drawn that the parity of the ^{221}Rn ground state is positive.

  12. ENG 221 UOP course tutorial/tutorialoutlet

    NARESH 1

    2015-01-01

    For more course tutorials visit www.tutorialoutlet.com   ENG 221 Week 2 Web-Conferencing Programs Research Memo   ENG 221 Week 3 Request for Proposal for Trainers   ENG 221 Week 4 User manual Critique   ENG 221 Week 5 Learning Team Assignment: Project (Manual)   ENG 221 Week 1 DQs   ENG 221 Week 2 DQs   ENG 221 Week 3 DQs   ENG 221 Week 4 DQs   ENG 221 Week 5 DQs  

  13. ENG 221 UOP COURSE Tutorial/UOPHELP

    ddfvbnm

    2015-01-01

    For more course tutorials visit www.uophelp.com   ENG 221 Week 2 Web-Conferencing Programs Research Memo ENG 221 Week 3 Request for Proposal for Trainers ENG 221 Week 4 User manual Critique ENG 221 Week 5 Learning Team Assignment: Project (Manual) ENG 221 Week 1 DQs ENG 221 Week 2 DQs ENG 221 Week 3 DQs ENG 221 Week 4 DQs ENG 221 Week 5 DQs  

  14. Production of Actinium-225 via High Energy Proton Induced Spallation of Thorium-232

    Harvey, James T.; Nolen, Jerry; Vandergrift, George; Gomes, Itacil; Kroc, Tom; Horwitz, Phil; McAlister, Dan; Bowers, Del; Sullivan, Vivian; Greene, John

    2011-12-30

    The science of cancer research is currently expanding its use of alpha particle emitting radioisotopes. Coupled with the discovery and proliferation of molecular species that seek out and attach to tumors, new therapy and diagnostics are being developed to enhance the treatment of cancer and other diseases. This latest technology is commonly referred to as Alpha Immunotherapy (AIT). Actinium-225/Bismuth-213 is a parent/daughter alpha-emitting radioisotope pair that is highly sought after because of the potential for treating numerous diseases and its ability to be chemically compatible with many known and widely used carrier molecules (such as monoclonal antibodies and proteins/peptides). Unfortunately, the worldwide supply of actinium-225 is limited to about 1,000mCi annually and most of that is currently spoken for, thus limiting the ability of this radioisotope pair to enter into research and subsequently clinical trials. The route proposed herein utilizes high energy protons to produce actinium-225 via spallation of a thorium-232 target. As part of previous R and D efforts carried out at Argonne National Laboratory recently in support of the proposed US FRIB facility, it was shown that a very effective production mechanism for actinium-225 is spallation of thorium-232 by high energy proton beams. The base-line simulation for the production rate of actinium-225 by this reaction mechanism is 8E12 atoms per second at 200 MeV proton beam energy with 50 g/cm2 thorium target and 100 kW beam power. An irradiation of one actinium-225 half-life (10 days) produces {approx}100 Ci of actinium-225. For a given beam current the reaction cross section increases slightly with energy to about 400 MeV and then decreases slightly for beam energies in the several GeV regime. The object of this effort is to refine the simulations at proton beam energies of 400 MeV and above up to about 8 GeV. Once completed, the simulations will be experimentally verified using 400 MeV and 8 Ge

  15. Production of Actinium-225 via High Energy Proton Induced Spallation of Thorium-232

    The science of cancer research is currently expanding its use of alpha particle emitting radioisotopes. Coupled with the discovery and proliferation of molecular species that seek out and attach to tumors, new therapy and diagnostics are being developed to enhance the treatment of cancer and other diseases. This latest technology is commonly referred to as Alpha Immunotherapy (AIT). Actinium-225/Bismuth-213 is a parent/daughter alpha-emitting radioisotope pair that is highly sought after because of the potential for treating numerous diseases and its ability to be chemically compatible with many known and widely used carrier molecules (such as monoclonal antibodies and proteins/peptides). Unfortunately, the worldwide supply of actinium-225 is limited to about 1,000mCi annually and most of that is currently spoken for, thus limiting the ability of this radioisotope pair to enter into research and subsequently clinical trials. The route proposed herein utilizes high energy protons to produce actinium-225 via spallation of a thorium-232 target. As part of previous R and D efforts carried out at Argonne National Laboratory recently in support of the proposed US FRIB facility, it was shown that a very effective production mechanism for actinium-225 is spallation of thorium-232 by high energy proton beams. The base-line simulation for the production rate of actinium-225 by this reaction mechanism is 8E12 atoms per second at 200 MeV proton beam energy with 50 g/cm2 thorium target and 100 kW beam power. An irradiation of one actinium-225 half-life (10 days) produces ∼100 Ci of actinium-225. For a given beam current the reaction cross section increases slightly with energy to about 400 MeV and then decreases slightly for beam energies in the several GeV regime. The object of this effort is to refine the simulations at proton beam energies of 400 MeV and above up to about 8 GeV. Once completed, the simulations will be experimentally verified using 400 MeV and 8 GeV protons

  16. MAT 221 ASH Course Tutorial / Tutorialoutlet

    mirat

    2015-01-01

    For more course tutorials visit www.tutorialoutlet.com   MAT 221 Week 1 Assignment 1 Simplifying Expressions (Ash) MAT 221 Week 1 DQ 1 Evaluating Algebraic Expressions (Ash) MAT 221 Week 2 Assignment 2 Inequalities (Ash) MAT 221 Week 2 DQ 1 Formulas (Ash) MAT 221 Week 3 Assignment 3 Two-Variable Inequality (Ash) MAT 221 Week 3 DQ 1 Parallel and Perpendicular (Ash) MAT 221 Week 4 Assignment 4 Financial Polynomials (Ash) MAT 221 Week 4 DQ 1 Initial Investme...

  17. Neutron-Induced Fission of Actinium-227, Protactinium-231 and Neptunium-237: Mass Distribution

    Results of radiochemical studies on the mass distribution in the neutron-induced fission of actinium-227, protactinium-231 and neptunium-237 have been presented. This work has been carried out as part of a programme to determine the mass distribution in the fission of heavy elements as a function of Z and A. All irradiations have been carried out in the core of the swimming-pool type reactor APSARA with cadmium shielding wherever necessary. Relative yields of several fission product nuclides have been obtained by a method involving a comparison of the fission product activities from the respective targets with those formed from uranium-235 simultaneously irradiated. Thermal-neutron fission yields of uranium-235 have been assumed. These results indicate a predominantly asymmetric mass distribution in all the three cases, and also a distinct though small symmetric peak in the case of actinium-227. (author)

  18. A new method for the determination of low-level actinium-227 in geological samples

    We developed a new method for the determination of 227Ac in geological samples. The method uses extraction chromatographic techniques and alpha-spectrometry and is applicable for a range of natural matrices. Here we report on the procedure and results of the analysis of water (fresh and seawater) and rock samples. Water samples were acidified and rock samples underwent total dissolution via acid leaching. A DGA (N,N,N',N'-tetra-n-octyldiglycolamide) extraction chromatographic column was used for the separation of actinium. The actinium fraction was prepared for alpha spectrometric measurement via cerium fluoride micro-precipitation. Recoveries of actinium in water samples were 80 ± 8 % (number of analyses n = 14) and in rock samples 70 ± 12 % (n = 30). The minimum detectable activities (MDA) were 0.017-0.5 Bq kg-1 for both matrices. Rock sample 227Ac activities ranged from 0.17 to 8.3 Bq kg-1 and water sample activities ranged from below MDA values to 14 Bq kg-1of 227Ac. From the analysis of several standard rock and water samples with the method we found very good agreement between our results and certified values. (author)

  19. IT 221 UOP COURSE TUTORIAL/UOPHELP

    nukmu

    2015-01-01

    For more course tutorials visit www.uophelp.com   IT 221 Week 1 DQS part 1 of 2 IT 221 Week 1 DQS part 2 of 2 IT 221 Week 1 CheckPoint: The Phases of the System Development Process IT 221 Week 2 CheckPoint: Project Management in Everyday Life (GROUP ASSIGNMENT) IT 221 Week 2 Assignment: Final Project—Project Overview- Appendix B IT 221 Week 2 CheckPoint: Project Management in Everyday Life IT 221 Week 2 CheckPoint: Final Project—Proposal ...

  20. IT 221 UOP COURSE TUTORIAL/ UOPHELP

    BAGIRAVI

    2015-01-01

     For more course tutorials visit www.uophelp.com   IT 221 Week 1 DQS part 1 of 2 IT 221 Week 1 DQS part 2 of 2 IT 221 Week 1 CheckPoint: The Phases of the System Development Process IT 221 Week 2 CheckPoint: Project Management in Everyday Life (GROUP ASSIGNMENT) IT 221 Week 2 Assignment: Final Project—Project Overview- Appendix B IT 221 Week 2 CheckPoint: Project Management in Everyday Life IT 221 Week 2 CheckPoint: Final Project—Propo...

  1. Analysis of the gamma spectra of the uranium, actinium, and thorium decay series

    Momeni, M.H.

    1981-09-01

    This report describes the identification of radionuclides in the uranium, actinium, and thorium series by analysis of gamma spectra in the energy range of 40 to 1400 keV. Energies and absolute efficiencies for each gamma line were measured by means of a high-resolution germanium detector and compared with those in the literature. A gamma spectroscopy method, which utilizes an on-line computer for deconvolution of spectra, search and identification of each line, and estimation of activity for each radionuclide, was used to analyze soil and uranium tailings, and ore.

  2. Analysis of the gamma spectra of the uranium, actinium, and thorium decay series

    This report describes the identification of radionuclides in the uranium, actinium, and thorium series by analysis of gamma spectra in the energy range of 40 to 1400 keV. Energies and absolute efficiencies for each gamma line were measured by means of a high-resolution germanium detector and compared with those in the literature. A gamma spectroscopy method, which utilizes an on-line computer for deconvolution of spectra, search and identification of each line, and estimation of activity for each radionuclide, was used to analyze soil and uranium tailings, and ore

  3. 39 CFR 221.5 - Headquarters organization.

    2010-07-01

    ... 39 Postal Service 1 2010-07-01 2010-07-01 false Headquarters organization. 221.5 Section 221.5 Postal Service UNITED STATES POSTAL SERVICE ORGANIZATION AND ADMINISTRATION GENERAL ORGANIZATION § 221.5 Headquarters organization. (a) Postmaster General—(1) Appointment. The postmaster general (PMG), the...

  4. 14 CFR 23.221 - Spinning.

    2010-01-01

    ... 14 Aeronautics and Space 1 2010-01-01 2010-01-01 false Spinning. 23.221 Section 23.221 Aeronautics... STANDARDS: NORMAL, UTILITY, ACROBATIC, AND COMMUTER CATEGORY AIRPLANES Flight Spinning § 23.221 Spinning. (a...-turn spin or a three-second spin, whichever takes longer, in not more than one additional turn...

  5. 24 CFR 221.775 - Option period.

    2010-04-01

    ... 24 Housing and Urban Development 2 2010-04-01 2010-04-01 false Option period. 221.775 Section 221.775 Housing and Urban Development Regulations Relating to Housing and Urban Development (Continued... § 221.775 Option period. The mortgagee may exercise its option to assign within one year following...

  6. 24 CFR 92.221 - Match credit.

    2010-04-01

    ... 24 Housing and Urban Development 1 2010-04-01 2010-04-01 false Match credit. 92.221 Section 92.221... INVESTMENT PARTNERSHIPS PROGRAM Program Requirements Matching Contribution Requirement § 92.221 Match credit. (a) When credit is given. Contributions are credited on a fiscal year basis at the time...

  7. 14 CFR 221.4 - English language.

    2010-01-01

    ... 14 Aeronautics and Space 4 2010-01-01 2010-01-01 false English language. 221.4 Section 221.4... REGULATIONS TARIFFS General § 221.4 English language. All tariffs and other documents and material filed with the Department pursuant to this part shall be in the English language....

  8. 36 CFR 2.21 - Smoking.

    2010-07-01

    ... 36 Parks, Forests, and Public Property 1 2010-07-01 2010-07-01 false Smoking. 2.21 Section 2.21... PROTECTION, PUBLIC USE AND RECREATION § 2.21 Smoking. (a) The superintendent may designate a portion of a park area, or all or a portion of a building, structure or facility as closed to smoking when...

  9. 49 CFR 221.7 - Civil penalty.

    2010-10-01

    ... 49 Transportation 4 2010-10-01 2010-10-01 false Civil penalty. 221.7 Section 221.7 Transportation... TRANSPORTATION REAR END MARKING DEVICE-PASSENGER, COMMUTER AND FREIGHT TRAINS General § 221.7 Civil penalty. Any... requirement is subject to a civil penalty of at least $650 and not more than $25,000 per violation,...

  10. 20 CFR 221.1 - Introduction.

    2010-04-01

    ... 20 Employees' Benefits 1 2010-04-01 2010-04-01 false Introduction. 221.1 Section 221.1 Employees... DETERMINATIONS § 221.1 Introduction. This part explains the factors involved in deciding whether the Social Security Administration or the Railroad Retirement Board will pay benefits to a railroad employee, and...

  11. 14 CFR 221.160 - Adoption notice.

    2010-01-01

    ... 14 Aeronautics and Space 4 2010-01-01 2010-01-01 false Adoption notice. 221.160 Section 221.160... REGULATIONS TARIFFS Adoption Publications Required To Show Change in Carrier's Name or Transfer of Operating Control § 221.160 Adoption notice. (a) When the name of a carrier is changed or when its operating...

  12. 33 CFR 117.221 - Saugatuck River.

    2010-07-01

    ... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Saugatuck River. 117.221 Section 117.221 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY BRIDGES DRAWBRIDGE OPERATION REGULATIONS Specific Requirements Connecticut § 117.221 Saugatuck River. (a)...

  13. 22 CFR 221.43 - Governing law.

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Governing law. 221.43 Section 221.43 Foreign... Administration § 221.43 Governing law. This Guarantee shall be governed by and construed in accordance with the laws of the United States of America governing contracts and commercial transactions of the...

  14. 22 CFR 221.41 - Arbitration.

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Arbitration. 221.41 Section 221.41 Foreign... Administration § 221.41 Arbitration. Any controversy or claim between A.I.D. and any noteholder arising out of this Guarantee shall be settled by arbitration to be held in Washington, DC in accordance with the...

  15. In-source laser spectroscopy developments at TRILIS—towards spectroscopy on actinium and scandium

    Resonance Ionization Laser Ion Sources (RILIS) have become a versatile tool for production and study of exotic nuclides at Isotope Separator On-Line (ISOL) facilities such as ISAC at TRIUMF. The recent development and addition of a grating tuned spectroscopy laser to the TRIUMF RILIS solid state laser system allows for wide range spectral scans to investigate atomic structures on short lived isotopes, e.g., those from the element actinium, produced in uranium targets at ISAC. In addition, development of new and improved laser ionization schemes for rare isotope production at ISAC is ongoing. Here spectroscopic studies on bound states, Rydberg states and autoionizing (AI) resonances on scandium using the existing off-line capabilities are reported. These results allowed to identify a suitable ionization scheme for scandium via excitation into an autoionizing state at 58,104 cm − 1 which has subsequently been used for ionization of on-line produced exotic scandium isotopes.

  16. Developments towards in-gas-jet laser spectroscopy studies of actinium isotopes at LISOL

    Raeder, S.; Bastin, B.; Block, M.; Creemers, P.; Delahaye, P.; Ferrer, R.; Fléchard, X.; Franchoo, S.; Ghys, L.; Gaffney, L. P.; Granados, C.; Heinke, R.; Hijazi, L.; Huyse, M.; Kron, T.; Kudryavtsev, Yu.; Laatiaoui, M.; Lecesne, N.; Luton, F.; Moore, I. D.; Martinez, Y.; Mogilevskiy, E.; Naubereit, P.; Piot, J.; Rothe, S.; Savajols, H.; Sels, S.; Sonnenschein, V.; Traykov, E.; Van Beveren, C.; Van den Bergh, P.; Van Duppen, P.; Wendt, K.; Zadvornaya, A.

    2016-06-01

    To study exotic nuclides at the borders of stability with laser ionization and spectroscopy techniques, highest efficiencies in combination with a high spectral resolution are required. These usually opposing requirements are reconciled by applying the in-gas-laser ionization and spectroscopy (IGLIS) technique in the supersonic gas jet produced by a de Laval nozzle installed at the exit of the stopping gas cell. Carrying out laser ionization in the low-temperature and low density supersonic gas jet eliminates pressure broadening, which will significantly improve the spectral resolution. This article presents the required modifications at the Leuven Isotope Separator On-Line (LISOL) facility that are needed for the first on-line studies of in-gas-jet laser spectroscopy. Different geometries for the gas outlet and extraction ion guides have been tested for their performance regarding the acceptance of laser ionized species as well as for their differential pumping capacities. The specifications and performance of the temporarily installed high repetition rate laser system, including a narrow bandwidth injection-locked Ti:sapphire laser, are discussed and first preliminary results on neutron-deficient actinium isotopes are presented indicating the high capability of this novel technique.

  17. Dicty_cDB: AFM221 [Dicty_cDB

    Full Text Available AF (Link to library) AFM221 (Link to dictyBase) - - - - AFM221P (Link to Original site) AFM221F 624 AFM...221Z 732 AFM221P 1336 - - Show AFM221 Library AF (Link to library) Clone ID AFM221 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/AF/AFM...2-A/AFM221Q.Seq.d/ Representative seq. ID AFM221P (Link to... Original site) Representative DNA sequence >AFM221 (AFM221Q) /CSM/AF/AFM2-A/AFM221Q.Seq.d/ ACACAACAATTTATAA

  18. 40 CFR 436.221 - Specialized definitions.

    2010-07-01

    ... 40 Protection of Environment 29 2010-07-01 2010-07-01 false Specialized definitions. 436.221 Section 436.221 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) EFFLUENT GUIDELINES AND STANDARDS MINERAL MINING AND PROCESSING POINT SOURCE CATEGORY Bentonite Subcategory §...

  19. 24 CFR 221.501 - Eligibility requirements.

    2010-04-01

    ... LOW COST AND MODERATE INCOME MORTGAGE INSURANCE-SAVINGS CLAUSE Eligibility Requirements-Moderate... 24 Housing and Urban Development 2 2010-04-01 2010-04-01 false Eligibility requirements. 221.501 Section 221.501 Housing and Urban Development Regulations Relating to Housing and Urban...

  20. 24 CFR 221.761 - Forbearance relief.

    2010-04-01

    ... DEVELOPMENT MORTGAGE AND LOAN INSURANCE PROGRAMS UNDER NATIONAL HOUSING ACT AND OTHER AUTHORITIES LOW COST AND... 24 Housing and Urban Development 2 2010-04-01 2010-04-01 false Forbearance relief. 221.761 Section 221.761 Housing and Urban Development Regulations Relating to Housing and Urban Development...

  1. 24 CFR 221.255 - Assignment option.

    2010-04-01

    ... DEVELOPMENT MORTGAGE AND LOAN INSURANCE PROGRAMS UNDER NATIONAL HOUSING ACT AND OTHER AUTHORITIES LOW COST AND MODERATE INCOME MORTGAGE INSURANCE-SAVINGS CLAUSE Contract Rights and Obligations-Low Cost Homes § 221.255... 24 Housing and Urban Development 2 2010-04-01 2010-04-01 false Assignment option. 221.255...

  2. 24 CFR 221.770 - Assignment option.

    2010-04-01

    ... DEVELOPMENT MORTGAGE AND LOAN INSURANCE PROGRAMS UNDER NATIONAL HOUSING ACT AND OTHER AUTHORITIES LOW COST AND... 24 Housing and Urban Development 2 2010-04-01 2010-04-01 false Assignment option. 221.770 Section 221.770 Housing and Urban Development Regulations Relating to Housing and Urban Development...

  3. 29 CFR 1952.221 - Developmental schedule.

    2010-07-01

    ... 29 Labor 9 2010-07-01 2010-07-01 false Developmental schedule. 1952.221 Section 1952.221 Labor Regulations Relating to Labor (Continued) OCCUPATIONAL SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR... schedule. The Tennessee state plan is developmental. The following is the developmental schedule...

  4. 24 CFR 221.252 - Substitute mortgagors.

    2010-04-01

    ... 24 Housing and Urban Development 2 2010-04-01 2010-04-01 false Substitute mortgagors. 221.252... Cost Homes § 221.252 Substitute mortgagors. (a) Selling mortgagor. The mortgagee may effect the release... approval of a substitute mortgagor, as provided by this section. (b) Purchasing mortgagor. The...

  5. 40 CFR 98.221 - Reporting threshold.

    2010-07-01

    ...) MANDATORY GREENHOUSE GAS REPORTING Nitric Acid Production § 98.221 Reporting threshold. You must report GHG emissions under this subpart if your facility contains a nitric acid train and the facility meets...

  6. DNA analysis of the genes encoding acidocin LF221 A and acidocin LF221 B, two bacteriocins produced by Lactobacillus gasseri LF221

    Majhenič, A.Č.; Venema, K.; Allison, G.E.; Matijašić, B.B.; Rogelj, I.; Klaenhammer, T.R.

    2004-01-01

    Lactobacillus gasseri LF221, an isolate from the feces of a child, produces two bacteriocins. Standard procedures for molecular techniques were used to locate, clone and sequence the fragments of LF221 chromosomal DNA carrying the acidocin LF221 A and B structural genes, respectively. Sequencing ana

  7. [2+2+1] cyclization of allenes.

    Kitagaki, S; Inagaki, F; Mukai, C

    2014-05-01

    The [2+2+1] cyclization of an alkyne, an alkene and carbon monoxide, i.e., the Pauson-Khand reaction, is one of the most powerful tools for constructing a five-membered ring. In place of the alkene or alkyne part, the use of an allene functionality has proven to make this reaction more valuable for organic synthesis. This review focuses on the origin and progress of the allenic [2+2+1] cyclocarbonylation, including the chirality transfer of the allene and its synthetic applications. PMID:24514744

  8. 24 CFR 221.1 - Savings clause.

    2010-04-01

    ... MORTGAGE AND LOAN INSURANCE PROGRAMS UNDER NATIONAL HOUSING ACT AND OTHER AUTHORITIES LOW COST AND MODERATE INCOME MORTGAGE INSURANCE-SAVINGS CLAUSE Eligibility Requirements-Low Cost Homes-Savings Clause § 221.1...) of the National Housing Act (12 U.S.C. 1715l(d)(2)) for low cost and moderate income...

  9. 40 CFR 86.221-94 - Hydrocarbon analyzer calibration.

    2010-07-01

    ... 40 Protection of Environment 18 2010-07-01 2010-07-01 false Hydrocarbon analyzer calibration. 86.221-94 Section 86.221-94 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR... New Medium-Duty Passenger Vehicles; Cold Temperature Test Procedures § 86.221-94 Hydrocarbon...

  10. 46 CFR 221.93 - Collection of civil penalties.

    2010-10-01

    ... 46 Shipping 8 2010-10-01 2010-10-01 false Collection of civil penalties. 221.93 Section 221.93... RELATED ACTIVITIES REGULATED TRANSACTIONS INVOLVING DOCUMENTED VESSELS AND OTHER MARITIME INTERESTS Civil Penalties § 221.93 Collection of civil penalties. Within 30 days after receipt of the Hearing...

  11. 14 CFR 221.70 - Who may amend tariffs.

    2010-01-01

    ... 14 Aeronautics and Space 4 2010-01-01 2010-01-01 false Who may amend tariffs. 221.70 Section 221...) ECONOMIC REGULATIONS TARIFFS Amendment of Tariffs § 221.70 Who may amend tariffs. A tariff shall be amended only by the carrier or agent who issued the tariff (except as otherwise authorized in subparts P and Q)....

  12. 14 CFR 221.103 - Notice of tariff terms.

    2010-01-01

    ... 14 Aeronautics and Space 4 2010-01-01 2010-01-01 false Notice of tariff terms. 221.103 Section 221...) ECONOMIC REGULATIONS TARIFFS Availability of Tariff Publications for Public Inspection § 221.103 Notice of tariff terms. Each carrier shall cause to be displayed continuously in a conspicuous public place at...

  13. 14 CFR 221.210 - Suspension of tariffs.

    2010-01-01

    ... 14 Aeronautics and Space 4 2010-01-01 2010-01-01 false Suspension of tariffs. 221.210 Section 221...) ECONOMIC REGULATIONS TARIFFS Electronically Filed Tariffs § 221.210 Suspension of tariffs. (a) A fare, charge, rule or other tariff provision that is suspended by the Department pursuant to section 41509...

  14. 14 CFR 221.5 - Unauthorized air transportation.

    2010-01-01

    ... 14 Aeronautics and Space 4 2010-01-01 2010-01-01 false Unauthorized air transportation. 221.5 Section 221.5 Aeronautics and Space OFFICE OF THE SECRETARY, DEPARTMENT OF TRANSPORTATION (AVIATION PROCEEDINGS) ECONOMIC REGULATIONS TARIFFS General § 221.5 Unauthorized air transportation. Tariff...

  15. 32 CFR 724.221 - Scheduling of discharge reviews.

    2010-07-01

    ... 32 National Defense 5 2010-07-01 2010-07-01 false Scheduling of discharge reviews. 724.221 Section 724.221 National Defense Department of Defense (Continued) DEPARTMENT OF THE NAVY PERSONNEL NAVAL DISCHARGE REVIEW BOARD Authority/Policy for Departmental Discharge Review § 724.221 Scheduling of...

  16. 49 CFR 199.221 - Use following an accident.

    2010-10-01

    ... 49 Transportation 3 2010-10-01 2010-10-01 false Use following an accident. 199.221 Section 199.221... Prevention Program § 199.221 Use following an accident. Each operator shall prohibit a covered employee who has actual knowledge of an accident in which his or her performance of covered functions has not...

  17. 10 CFR 221.11 - Natural gas and ethane.

    2010-01-01

    ... 10 Energy 3 2010-01-01 2010-01-01 false Natural gas and ethane. 221.11 Section 221.11 Energy DEPARTMENT OF ENERGY OIL PRIORITY SUPPLY OF CRUDE OIL AND PETROLEUM PRODUCTS TO THE DEPARTMENT OF DEFENSE UNDER THE DEFENSE PRODUCTION ACT Exclusions § 221.11 Natural gas and ethane. The supply of natural...

  18. 27 CFR 25.221 - Voluntary destruction of beer.

    2010-04-01

    ... beer. 25.221 Section 25.221 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT OF THE TREASURY LIQUORS BEER Voluntary Destruction § 25.221 Voluntary destruction of beer. (a) On brewery premises. (1) A brewer may destroy, at the brewery, beer on which the tax has...

  19. Ectrodactyly and 7q22.1

    Rivera, H. [Salisbury District Hospital, Odstock (United Kingdom)

    1994-10-15

    This succinct `Letter to the Editor` was written in response to a report on a family exhibiting both a t(2;7)(q21.2;q22.1) and split hand/foot anomaly by Genuardi et al. [1993]. Pertinent sections of the article are discussed, with disagreement taken with a lack of mention to work conducted in 1991 by Rivera et al. in assigning the crucial locus to band 7q22 near to the proximal interface. 3 refs.

  20. 2.2.1 Ionizing Radiation

    Kasch, K.-U.

    This document is part of Subvolume A 'Fundamentals and Data in Radiobiology, Radiation Biophysics, Dosimetry and Medical Radiological Protection' of Volume 7 'Medical Radiological Physics' of Landolt-Börnstein - Group VIII 'Advanced Materials and Technologies'. It contains the Subsection '2.2.1 Ionizing Radiation' of the Section '2.2 Kinds of Radiation' of the Chapter '2 Radiation and Biological Effects' with the contents:

  1. Groundwater seepage from the Ranger uranium mine tailings dam: radioisotopes of radium, thorium and actinium. Supervising Scientist report 106

    Monitoring of bores near the Ranger uranium mine tailings dam has revealed deterioration in water quality in several bores since 1983. In a group of bores to the north of the dam, increases have been observed of up to 500 times for sulphate concentrations and of up to 5 times for 226Ra concentrations. Results are presented here of measurements of members of the uranium, thorium and actinium decay series in borewater samples collected between 1985 and 1993. In particular, measurements of all four naturally-occurring radium isotopes have been used in an investigation of the mechanism of radium concentration changes. For the most seepage-affected bores the major findings of the study include: 228Ra/226Ra 223Ra /226Ra and 224Ra/228Ra ratios all increased over the course of the study; barium concentrations show high seasonal variability, being lower in November than May, but strontium concentrations show a steady increase with time. Calculations show that the groundwater is probably saturated with respect to barite but not with respect to celestite or anglesite; sulphide concentrations are low in comparison with sulphate, and are higher in November than in May; and 227Ac concentrations have increased with time, but do not account for the high 223Ra/226Ra ratios. It is concluded on the basis of these observations that increases in Ra isotope concentrations observed in a number of seepage-affected bores arise from increases in salinity leading to desorption of radium from adsorption sites in the vicinity of the bore rather by direct transport of radium from the tailings. Increased salinity is also causing the observed increases in 227Ac and strontium concentrations, while formation of a barite solid phase in the groundwater is causing the removal of some radium from solution. This is the cause of the increasing radium isotope ratios noted above

  2. 24 CFR 221.256 - Interest rate increase and payment of mortgage insurance premiums on mortgages under § 221.60 and...

    2010-04-01

    ... balance of the mortgage on the first day of the month following the date on which such right first accrued... of mortgage insurance premiums on mortgages under § 221.60 and § 221.65. 221.256 Section 221.256... MORTGAGE AND LOAN INSURANCE PROGRAMS UNDER NATIONAL HOUSING ACT AND OTHER AUTHORITIES LOW COST AND...

  3. 14 CFR 21.221 - Class I provisional airworthiness certificates.

    2010-01-01

    ... 14 Aeronautics and Space 1 2010-01-01 2010-01-01 false Class I provisional airworthiness certificates. 21.221 Section 21.221 Aeronautics and Space FEDERAL AVIATION ADMINISTRATION, DEPARTMENT OF... limitations established in §§ 21.81(e) and 91.317 of this subchapter. (b) The manufacturer must hold...

  4. 14 CFR 221.212 - Special tariff permission.

    2010-01-01

    ... 14 Aeronautics and Space 4 2010-01-01 2010-01-01 false Special tariff permission. 221.212 Section... PROCEEDINGS) ECONOMIC REGULATIONS TARIFFS Electronically Filed Tariffs § 221.212 Special tariff permission. (a) When a filer submits an electronic tariff or an amendment to an electronic tariff for which...

  5. 14 CFR 221.400 - Filing of paper tariffs required.

    2010-01-01

    ... 14 Aeronautics and Space 4 2010-01-01 2010-01-01 false Filing of paper tariffs required. 221.400... PROCEEDINGS) ECONOMIC REGULATIONS TARIFFS Electronically Filed Tariffs § 221.400 Filing of paper tariffs... file tariffs electronically, the filer in addition to filing electronically must continue to...

  6. 14 CFR 221.63 - Other types of governing tariffs.

    2010-01-01

    ... 14 Aeronautics and Space 4 2010-01-01 2010-01-01 false Other types of governing tariffs. 221.63... PROCEEDINGS) ECONOMIC REGULATIONS TARIFFS Governing Tariffs § 221.63 Other types of governing tariffs. Subject to approval of the Department, carriers may publish other types of governing tariffs not specified...

  7. 14 CFR 221.100 - Public notice of tariff information.

    2010-01-01

    ... 14 Aeronautics and Space 4 2010-01-01 2010-01-01 false Public notice of tariff information. 221... (AVIATION PROCEEDINGS) ECONOMIC REGULATIONS TARIFFS Availability of Tariff Publications for Public Inspection § 221.100 Public notice of tariff information. Carriers must make tariff information available...

  8. 14 CFR 221.162 - Receiver shall file adoption notices.

    2010-01-01

    ... 14 Aeronautics and Space 4 2010-01-01 2010-01-01 false Receiver shall file adoption notices. 221... (AVIATION PROCEEDINGS) ECONOMIC REGULATIONS TARIFFS Adoption Publications Required To Show Change in Carrier's Name or Transfer of Operating Control § 221.162 Receiver shall file adoption notices. A...

  9. 29 CFR 553.221 - Compensable hours of work.

    2010-07-01

    ... Compensable hours of work. (a) The general rules on compensable hours of work are set forth in 29 CFR part 785... 29 Labor 3 2010-07-01 2010-07-01 false Compensable hours of work. 553.221 Section 553.221 Labor... OF THE FAIR LABOR STANDARDS ACT TO EMPLOYEES OF STATE AND LOCAL GOVERNMENTS Fire Protection and...

  10. 14 CFR 417.221 - Time delay analysis.

    2010-01-01

    ... 14 Aeronautics and Space 4 2010-01-01 2010-01-01 false Time delay analysis. 417.221 Section 417... OF TRANSPORTATION LICENSING LAUNCH SAFETY Flight Safety Analysis § 417.221 Time delay analysis. (a) General. A flight safety analysis must include a time delay analysis that establishes the mean...

  11. 39 CFR 221.2 - Board of Governors.

    2010-07-01

    ... 39 Postal Service 1 2010-07-01 2010-07-01 false Board of Governors. 221.2 Section 221.2 Postal... Governors. (a) Composition. The Board of Governors consists of 11 members. Nine governors are appointed by... five governors may be adherents of the same political party. The governors are chosen to represent...

  12. 14 CFR 221.211 - Cancellation of suspended matter.

    2010-01-01

    ... 14 Aeronautics and Space 4 2010-01-01 2010-01-01 false Cancellation of suspended matter. 221.211 Section 221.211 Aeronautics and Space OFFICE OF THE SECRETARY, DEPARTMENT OF TRANSPORTATION (AVIATION... matter. When, pursuant to an order of the Department, the cancellation of rules, fares, charges, or...

  13. 24 CFR 221.790 - Debenture interest rate.

    2010-04-01

    ... LOW COST AND MODERATE INCOME MORTGAGE INSURANCE-SAVINGS CLAUSE Contract Rights and Obligations... 24 Housing and Urban Development 2 2010-04-01 2010-04-01 false Debenture interest rate. 221.790 Section 221.790 Housing and Urban Development Regulations Relating to Housing and Urban...

  14. 24 CFR 221.780 - Issuance of debentures.

    2010-04-01

    ... LOW COST AND MODERATE INCOME MORTGAGE INSURANCE-SAVINGS CLAUSE Contract Rights and Obligations... 24 Housing and Urban Development 2 2010-04-01 2010-04-01 false Issuance of debentures. 221.780 Section 221.780 Housing and Urban Development Regulations Relating to Housing and Urban...

  15. 24 CFR 221.275 - Method of paying insurance benefits.

    2010-04-01

    ... AUTHORITIES LOW COST AND MODERATE INCOME MORTGAGE INSURANCE-SAVINGS CLAUSE Contract Rights and Obligations-Low... 24 Housing and Urban Development 2 2010-04-01 2010-04-01 false Method of paying insurance benefits. 221.275 Section 221.275 Housing and Urban Development Regulations Relating to Housing and...

  16. 24 CFR 221.251 - Cross-reference.

    2010-04-01

    ... DEVELOPMENT MORTGAGE AND LOAN INSURANCE PROGRAMS UNDER NATIONAL HOUSING ACT AND OTHER AUTHORITIES LOW COST AND MODERATE INCOME MORTGAGE INSURANCE-SAVINGS CLAUSE Contract Rights and Obligations-Low Cost Homes § 221.251... 24 Housing and Urban Development 2 2010-04-01 2010-04-01 false Cross-reference. 221.251...

  17. 24 CFR 221.280 - Waived title objections.

    2010-04-01

    ... LOW COST AND MODERATE INCOME MORTGAGE INSURANCE-SAVINGS CLAUSE Contract Rights and Obligations-Low... 24 Housing and Urban Development 2 2010-04-01 2010-04-01 false Waived title objections. 221.280 Section 221.280 Housing and Urban Development Regulations Relating to Housing and Urban...

  18. 24 CFR 221.305 - Condition of the multifamily structure.

    2010-04-01

    ... AUTHORITIES LOW COST AND MODERATE INCOME MORTGAGE INSURANCE-SAVINGS CLAUSE Contract Rights and Obligations-Low... 24 Housing and Urban Development 2 2010-04-01 2010-04-01 false Condition of the multifamily structure. 221.305 Section 221.305 Housing and Urban Development Regulations Relating to Housing and...

  19. 24 CFR 221.751 - Cross-reference.

    2010-04-01

    ... DEVELOPMENT MORTGAGE AND LOAN INSURANCE PROGRAMS UNDER NATIONAL HOUSING ACT AND OTHER AUTHORITIES LOW COST AND... 24 Housing and Urban Development 2 2010-04-01 2010-04-01 false Cross-reference. 221.751 Section 221.751 Housing and Urban Development Regulations Relating to Housing and Urban Development...

  20. 24 CFR 221.310 - Assessment of taxes.

    2010-04-01

    ... LOW COST AND MODERATE INCOME MORTGAGE INSURANCE-SAVINGS CLAUSE Contract Rights and Obligations-Low... 24 Housing and Urban Development 2 2010-04-01 2010-04-01 false Assessment of taxes. 221.310 Section 221.310 Housing and Urban Development Regulations Relating to Housing and Urban...

  1. 24 CFR 221.800 - Cross-reference.

    2010-04-01

    ... DEVELOPMENT MORTGAGE AND LOAN INSURANCE PROGRAMS UNDER NATIONAL HOUSING ACT AND OTHER AUTHORITIES LOW COST AND MODERATE INCOME MORTGAGE INSURANCE-SAVINGS CLAUSE Servicing Responsibilities-Low Cost Homes § 221.800 Cross... 24 Housing and Urban Development 2 2010-04-01 2010-04-01 false Cross-reference. 221.800...

  2. 24 CFR 221.320 - Certificate or statement of condition.

    2010-04-01

    ... AUTHORITIES LOW COST AND MODERATE INCOME MORTGAGE INSURANCE-SAVINGS CLAUSE Contract Rights and Obligations-Low... 24 Housing and Urban Development 2 2010-04-01 2010-04-01 false Certificate or statement of condition. 221.320 Section 221.320 Housing and Urban Development Regulations Relating to Housing and...

  3. 24 CFR 221.315 - Certificate of tax assessment.

    2010-04-01

    ... AUTHORITIES LOW COST AND MODERATE INCOME MORTGAGE INSURANCE-SAVINGS CLAUSE Contract Rights and Obligations-Low... 24 Housing and Urban Development 2 2010-04-01 2010-04-01 false Certificate of tax assessment. 221.315 Section 221.315 Housing and Urban Development Regulations Relating to Housing and...

  4. 27 CFR 41.221 - Change in trade name.

    2010-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 2 2010-04-01 2010-04-01 false Change in trade name. 41.221 Section 41.221 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU... Change in trade name. Where there is a change in, or an addition or discontinuance of, a trade name...

  5. 14 CFR 221.141 - Method of revoking concurrence.

    2010-01-01

    ... 14 Aeronautics and Space 4 2010-01-01 2010-01-01 false Method of revoking concurrence. 221.141... PROCEEDINGS) ECONOMIC REGULATIONS TARIFFS Giving and Revoking Concurrences to Carriers § 221.141 Method of revoking concurrence. (a) A concurrence may be revoked by filing with the Department a Notice of...

  6. 12 CFR 221.104 - Federal credit unions.

    2010-01-01

    ... interpretation on Federal credit unions, see 12 CFR 220.110. ... 12 Banks and Banking 3 2010-01-01 2010-01-01 false Federal credit unions. 221.104 Section 221.104... CREDIT BY BANKS AND PERSONS OTHER THAN BROKERS OR DEALERS FOR THE PURPOSE OF PURCHASING OR...

  7. Sampling and Analysis Plan for the 221-U Facility

    This sampling and analysis plan (SAP) presents the rationale and strategy for the sampling and analysis activities proposed to be conducted to support the evaluation of alternatives for the final disposition of the 221-U Facility. This SAP will describe general sample locations and the minimum number of samples required. It will also identify the specific contaminants of potential concern (COPCs) and the required analysis. This SAP does not define the exact sample locations and equipment to be used in the field due to the nature of unknowns associated with the 221-U Facility

  8. 27 CFR 555.221 - Requirements for display fireworks, pyrotechnic compositions, and explosive materials used in...

    2010-04-01

    ... fireworks, pyrotechnic compositions, and explosive materials used in assembling fireworks or articles pyrotechnic. 555.221 Section 555.221 Alcohol, Tobacco Products, and Firearms BUREAU OF ALCOHOL, TOBACCO... Requirements for display fireworks, pyrotechnic compositions, and explosive materials used in...

  9. 75 FR 52591 - Seventh Meeting: RTCA Special Committee 221: Aircraft Secondary Barriers and Alternative Flight...

    2010-08-26

    ... and Alternative Flight Deck Security Procedures AGENCY: Federal Aviation Administration (FAA), DOT. ACTION: Notice of RTCA Special Committee 221 meeting: Aircraft Secondary Barriers and Alternative Flight... RTCA Special Committee 221: Aircraft Secondary Barriers and Alternative Flight Deck Security...

  10. 76 FR 38741 - Tenth Meeting: RTCA Special Committee 221: Aircraft Secondary Barriers and Alternative Flight...

    2011-07-01

    ... Alternative Flight Deck Security Procedures AGENCY: Federal Aviation Administration (FAA), DOT. ACTION: Notice of RTCA Special Committee 221 meeting: Aircraft Secondary Barriers and Alternative Flight Deck... Special Committee 221: Aircraft Secondary Barriers and Alternative Flight Deck Security Procedures....

  11. 75 FR 9016 - Fifth Meeting: RTCA Special Committee 221: Aircraft Secondary Barriers and Alternative Flight...

    2010-02-26

    ... Alternative Flight Deck Security Procedures AGENCY: Federal Aviation Administration (FAA), DOT. ACTION: Notice of RTCA Special Committee 221 meeting: Aircraft Secondary Barriers and Alternative Flight Deck... Special Committee 221: Aircraft Secondary Barriers and Alternative Flight Deck Security Procedures....

  12. Theragnosis-based combined cancer therapy using doxorubicin-conjugated microRNA-221 molecular beacon.

    Lee, Jonghwan; Choi, Kyung-Ju; Moon, Sung Ung; Kim, Soonhag

    2016-01-01

    Recently, microRNA (miRNA or miR) has emerged as a new cancer biomarker because of its high expression level in various cancer types and its role in the control of tumor suppressor genes. In cancer studies, molecular imaging and treatment based on target cancer markers have been combined to facilitate simultaneous cancer diagnosis and therapy. In this study, for combined therapy with diagnosis of cancer, we developed a doxorubicin-conjugated miR-221 molecular beacon (miR-221 DOXO MB) in a single platform composed of three different nucleotides: miR-221 binding sequence, black hole quencher 1 (BHQ1), and doxorubicin binding site. Imaging of endogenous miR-221 was achieved by specific hybridization between miR-221 and the miR-221 binding site in miR-221 DOXO MB. The presence of miR-221 triggered detachment of the quencher oligo and subsequent activation of a fluorescent signal of miR-221 DOXO MB. Simultaneous cancer therapy in C6 astrocytoma cells and nude mice was achieved by inhibition of miRNA-221 function that downregulates tumor suppressor genes. The detection of miR-221 expression and inhibition of miR-221 function by miR-221 DOXO MB provide the feasibility as a cancer theragnostic probe. Furthermore, a cytotoxic effect was induced by unloading of doxorubicin intercalated into miR-221 DOXO MB inside cells. Loss of miR-221 function and cytotoxicity induced by the miR-221 DOXO MB provides combined therapeutic efficacy against cancers. This method could be used as a new theragnostic probe with enhanced therapy to detect and inhibit many cancer-related miRNAs. PMID:26454049

  13. 24 CFR 221.254 - Mortgage insurance premiums.

    2010-04-01

    ... 24 Housing and Urban Development 2 2010-04-01 2010-04-01 false Mortgage insurance premiums. 221... HOUSING AND URBAN DEVELOPMENT MORTGAGE AND LOAN INSURANCE PROGRAMS UNDER NATIONAL HOUSING ACT AND OTHER AUTHORITIES LOW COST AND MODERATE INCOME MORTGAGE INSURANCE-SAVINGS CLAUSE Contract Rights and...

  14. 20 CFR 725.221 - Determination of dependency; child.

    2010-04-01

    ... Security Act, such disability must have begun before the child attained age 22, or in the case of a student... 20 Employees' Benefits 3 2010-04-01 2010-04-01 false Determination of dependency; child. 725.221... Determination of dependency; child. For the purposes of determining whether a child was dependent upon...

  15. 14 CFR 221.300 - Discontinuation of electronic tariff system.

    2010-01-01

    ... 14 Aeronautics and Space 4 2010-01-01 2010-01-01 false Discontinuation of electronic tariff system... (AVIATION PROCEEDINGS) ECONOMIC REGULATIONS TARIFFS Electronically Filed Tariffs § 221.300 Discontinuation of electronic tariff system. In the event that the electronic tariff system is discontinued, or...

  16. 14 CFR 221.20 - Specifications applicable to tariff publications.

    2010-01-01

    ... 14 Aeronautics and Space 4 2010-01-01 2010-01-01 false Specifications applicable to tariff... (AVIATION PROCEEDINGS) ECONOMIC REGULATIONS TARIFFS Specifications of Tariff Publications § 221.20 Specifications applicable to tariff publications. (a) Numerical order. All items in a tariff shall be arranged...

  17. Draft Genome Sequence of Avibacterium paragallinarum Strain 221

    Xu, Fuzhou; Miao, Deyuan; Du, Yu; CHEN, XIAOLING; Zhang, Peijun; Sun, Huiling

    2013-01-01

    Avibacterium paragallinarum is the causative agent of infectious coryza. Here we report the draft genome sequence of reference strain 221 of A. paragallinarum serovar A. The genome is composed of 135 contigs for 2,685,568 bp with a 41% G+C content.

  18. 14 CFR 221.202 - The filing of tariffs and amendments to tariffs.

    2010-01-01

    ... 14 Aeronautics and Space 4 2010-01-01 2010-01-01 false The filing of tariffs and amendments to tariffs. 221.202 Section 221.202 Aeronautics and Space OFFICE OF THE SECRETARY, DEPARTMENT OF TRANSPORTATION (AVIATION PROCEEDINGS) ECONOMIC REGULATIONS TARIFFS Electronically Filed Tariffs § 221.202...

  19. 14 CFR 221.180 - Requirements for electronic filing of tariffs.

    2010-01-01

    ... tariffs. 221.180 Section 221.180 Aeronautics and Space OFFICE OF THE SECRETARY, DEPARTMENT OF TRANSPORTATION (AVIATION PROCEEDINGS) ECONOMIC REGULATIONS TARIFFS Electronically Filed Tariffs § 221.180 Requirements for electronic filing of tariffs. (a) No carrier or filing agent shall file an electronic...

  20. 36 CFR 221.3 - Disposal of national forest timber according to management plans.

    2010-07-01

    ... 36 Parks, Forests, and Public Property 2 2010-07-01 2010-07-01 false Disposal of national forest timber according to management plans. 221.3 Section 221.3 Parks, Forests, and Public Property FOREST SERVICE, DEPARTMENT OF AGRICULTURE TIMBER MANAGEMENT PLANNING § 221.3 Disposal of national forest...

  1. 12 CFR 221.109 - Loan to open-end investment company.

    2010-01-01

    ... 12 Banks and Banking 3 2010-01-01 2010-01-01 false Loan to open-end investment company. 221.109 Section 221.109 Banks and Banking FEDERAL RESERVE SYSTEM (CONTINUED) BOARD OF GOVERNORS OF THE FEDERAL... CARRYING MARGIN STOCK (REGULATION U) Interpretations § 221.109 Loan to open-end investment company....

  2. Data Quality Objectives Summary Report for the 221-U Canyon Disposition Alternatives

    The 221-U Canyon Disposition Alternatives Data Quality Objective (DQO) Process identifies the sampling and analytical requirements necessary to support future detailed evaluation of alternatives via the CERCLA process, for final disposition of the 221-U Canyon Facility. Viable alternatives for the disposition of the 221-U Facility have been identified in a CERCLA Phase I Feasibility Study (FS) (DOE-RL 1997) for the Canyon Disposition Initiative (CDI). The scope of this DQO Process is limited to the 221-U Process Canyon Building and equipment contained within the facility. Associated stacks, filters, solvent handling, vaults, and storage facilities external to the 221-U Building are not addressed in this DQO. This DQO focuses on the 221-U Building because it provides the greatest potential source of contaminant volumes and concentrations and the physical structure poses the greatest challenge for disposition decisions

  3. Dicty_cDB: VFI221 [Dicty_cDB

    Full Text Available AAAACAACTTTAACAATCTTTAAAAAATTTT ATATTTTTCAACTTTATAACTTNATTATATTCAAAACCAATTTNAATAATTNAANAAAAA AATTT Length of 3' end seq. 785 Connect...ed seq. ID - Connected seq. - Length of connected seq. - Full length Seq ID - Full length Seq. - Length of full length seq. - ... ... falciparum 3D7 chromosome 10 section 2 of 7 of the complete sequence. 34 0.12 8 AX348619 |AX348619.1 Sequen...olderia sp. 383 chromosome 3... 136 9e-31 CP000633_73( CP000633 |pid:none) Agrobacterium vitis...VF (Link to library) VFI221 (Link to dictyBase) - - - Contig-U09577-1 - (Link to Or

  4. 14 CFR 221.205 - Justification and explanation for certain fares.

    2010-01-01

    ... 14 Aeronautics and Space 4 2010-01-01 2010-01-01 false Justification and explanation for certain fares. 221.205 Section 221.205 Aeronautics and Space OFFICE OF THE SECRETARY, DEPARTMENT OF... Justification and explanation for certain fares. Any carrier or its agent must provide, as to any new...

  5. Dependence of the half-life of 221Fr on the implantation environment

    Olaizola, B.; Fraile, L.M.; Riisager, Karsten; Correia, J.G.; Fynbo, Hans Otto Uldall; Jeppesen, Henrik; Johnston, K.; Kirsebom, Oliver Sølund; Skovbo, Katrine; Thomsen, Lotte Ansgaard

    The possible dependence of the half-life of 221Fr on the solid-state environment has been investigated by the simultaneous measurement of implanted 221Fr ions in an insulator (Si) and a metallic substrate (Au) at the ISOLDE facility at CERN. Our results indicate that, if existing, the difference ...

  6. 14 CFR 221.123 - Re-use of Special Tariff Permission when tariff is rejected.

    2010-01-01

    ... 14 Aeronautics and Space 4 2010-01-01 2010-01-01 false Re-use of Special Tariff Permission when tariff is rejected. 221.123 Section 221.123 Aeronautics and Space OFFICE OF THE SECRETARY, DEPARTMENT OF TRANSPORTATION (AVIATION PROCEEDINGS) ECONOMIC REGULATIONS TARIFFS Special Tariff Permission To File on Less...

  7. 14 CFR 221.102 - Accessibility of tariffs to the public.

    2010-01-01

    ... 14 Aeronautics and Space 4 2010-01-01 2010-01-01 false Accessibility of tariffs to the public. 221... (AVIATION PROCEEDINGS) ECONOMIC REGULATIONS TARIFFS Availability of Tariff Publications for Public Inspection § 221.102 Accessibility of tariffs to the public. Each file of tariffs shall be kept in...

  8. 14 CFR 221.94 - Explanation and data supporting tariff changes and new matter in tariffs.

    2010-01-01

    ... 14 Aeronautics and Space 4 2010-01-01 2010-01-01 false Explanation and data supporting tariff changes and new matter in tariffs. 221.94 Section 221.94 Aeronautics and Space OFFICE OF THE SECRETARY, DEPARTMENT OF TRANSPORTATION (AVIATION PROCEEDINGS) ECONOMIC REGULATIONS TARIFFS Filing Tariff...

  9. 24 CFR 221.300 - Changes in the plan of apartment ownership.

    2010-04-01

    ... AUTHORITIES LOW COST AND MODERATE INCOME MORTGAGE INSURANCE-SAVINGS CLAUSE Contract Rights and Obligations-Low... 24 Housing and Urban Development 2 2010-04-01 2010-04-01 false Changes in the plan of apartment ownership. 221.300 Section 221.300 Housing and Urban Development Regulations Relating to Housing and...

  10. 14 CFR 221.151 - Method of revoking power of attorney.

    2010-01-01

    ... 14 Aeronautics and Space 4 2010-01-01 2010-01-01 false Method of revoking power of attorney. 221... (AVIATION PROCEEDINGS) ECONOMIC REGULATIONS TARIFFS Giving and Revoking Powers of Attorney to Agents § 221.151 Method of revoking power of attorney. (a) A power of attorney may be revoked only by filing...

  11. Phase I feasibility study for the Canyon disposition initiative (221-U facility)

    The objective of the Phase I Feasibility Study (FS) presented in this document is to provide decision makers sufficient information on the remedial alternatives specific to the disposition of the 221-U Canyon Building (221-U Facility) located at the Hanford Site, and to determine which alternatives are viable for further detailed analysis

  12. 12 CFR 221.120 - Allocation of stock collateral to purpose and nonpurpose credits to same customer.

    2010-01-01

    ... nonpurpose credits to same customer. 221.120 Section 221.120 Banks and Banking FEDERAL RESERVE SYSTEM... § 221.120 Allocation of stock collateral to purpose and nonpurpose credits to same customer. (a) A bank proposes to extend two credits (Credits A and B) to its customer. Although the two credits are proposed...

  13. MiR-221 influences effector functions and actin cytoskeleton in mast cells.

    Ramon J Mayoral

    Full Text Available Mast cells have essential effector and immunoregulatory functions in IgE-associated allergic disorders and certain innate and adaptive immune responses, but the role of miRNAs in regulating mast cell functions is almost completely unexplored. To examine the role of the activation-induced miRNA miR-221 in mouse mast cells, we developed robust lentiviral systems for miRNA overexpression and depletion. While miR-221 favored mast cell adhesion and migration towards SCF or antigen in trans-well migration assays, as well as cytokine production and degranulation in response to IgE-antigen complexes, neither miR-221 overexpression, nor its ablation, interfered with mast cell differentiation. Transcriptional profiling of miR-221-overexpressing mast cells revealed modulation of many transcripts, including several associated with the cytoskeleton; indeed, miR-221 overexpression was associated with reproducible increases in cortical actin in mast cells, and with altered cellular shape and cell cycle in murine fibroblasts. Our bioinformatics analysis showed that this effect was likely mediated by the composite effect of miR-221 on many primary and secondary targets in resting cells. Indeed, miR-221-induced cellular alterations could not be recapitulated by knockdown of one of the major targets of miR-221. We propose a model in which miR-221 has two different roles in mast cells: in resting cells, basal levels of miR-221 contribute to the regulation of the cell cycle and cytoskeleton, a general mechanism probably common to other miR-221-expressing cell types, such as fibroblasts. Vice versa, upon induction in response to mast cell stimulation, miR-221 effects are mast cell-specific and activation-dependent, contributing to the regulation of degranulation, cytokine production and cell adherence. Our studies provide new insights into the roles of miR-221 in mast cell biology, and identify novel mechanisms that may contribute to mast cell-related pathological

  14. Level structure of 217Rn and 221Ra investigated in the alpha-decay 225Th → 221Ra → 217Rn

    The nuclei 221Ra and 217Rn have been investigated in the α-decay chain 225Th → 221Ra → 217Rn through γ-ray and conversion-electron studies. The short-lived 225Th nuclei (T1/2=8 min) were produced in the 226Ra(α, 5n) reaction, and γ-rays and conversion electrons were measured - between the irradiation periods - in coincidence with α-particles. In 221Ra the five lowest levels are interpreted as members of a K=5/2 parity-doublet with ΔEπ=104 keV. These levels, as well as a higher-lying Kπ=3/2+ band, are consistent with an octupole deformation of 221Ra, as expected from theoretical considerations. In 217Rn only three excited levels are observed, with a favoured α-decay to a 5/2+ excited level thus establishing positive parity for the ground state of 221Ra. (orig.)

  15. Fire modeling for Building 221-T - T Plant Canyon Deck and Railroad Tunnel

    This report was prepared by Hughes Associates, Inc. to document the results of fire models for building 221-T Canyon Deck and Railroad Tunnel. Backup data is contained in document No. WHC-SD-CP-ANAL-010, Rev. 0

  16. 50 CFR 221.34 - What is the law governing ex parte communications?

    2010-10-01

    ... procedural requirements, unless the inquiry involves an area of controversy in the hearing process. ... LICENSES Hearing Process General Provisions Related to Hearings § 221.34 What is the law governing ex...

  17. 14 CFR 221.204 - Adoption of provisions of one carrier by another carrier.

    2010-01-01

    ... TRANSPORTATION (AVIATION PROCEEDINGS) ECONOMIC REGULATIONS TARIFFS Electronically Filed Tariffs § 221.204... carrier, the effective and prospective fares of the adopted carrier shall be changed to reflect the...

  18. Human miR-221/222 in Physiological and Atherosclerotic Vascular Remodeling

    Dmitry A. Chistiakov

    2015-01-01

    Full Text Available A cluster of miR-221/222 is a key player in vascular biology through exhibiting its effects on vascular smooth muscle cells (VSMCs and endothelial cells (ECs. These miRNAs contribute to vascular remodeling, an adaptive process involving phenotypic and behavioral changes in vascular cells in response to vascular injury. In proliferative vascular diseases such as atherosclerosis, pathological vascular remodeling plays a prominent role. The miR-221/222 cluster controls development and differentiation of ECs but inhibits their proangiogenic activation, proliferation, and migration. miR-221/222 are primarily implicated in maintaining endothelial integrity and supporting quiescent EC phenotype. Vascular expression of miR-221/222 is upregulated in initial atherogenic stages causing inhibition of angiogenic recruitment of ECs and increasing endothelial dysfunction and EC apoptosis. In contrast, these miRNAs stimulate VSMCs and switching from the VSMC “contractile” phenotype to the “synthetic” phenotype associated with induction of proliferation and motility. In atherosclerotic vessels, miR-221/222 drive neointima formation. Both miRNAs contribute to atherogenic calcification of VSMCs. In advanced plaques, chronic inflammation downregulates miR-221/222 expression in ECs that in turn could activate intralesion neoangiogenesis. In addition, both miRNAs could contribute to cardiovascular pathology through their effects on fat and glucose metabolism in nonvascular tissues such as adipose tissue, liver, and skeletal muscles.

  19. MiR-221 Promotes Capan-2 Pancreatic Ductal Adenocarcinoma Cells Proliferation by Targeting PTEN-Akt

    Wenzhuo Yang

    2016-05-01

    Full Text Available Background/Aims: MicroRNAs (miRNAs, miRs have emerged as critical regulators of cancer cell proliferation. The effect of miR-221 on cancer cell growth could be significantly changeable in different cell lines. Although miR-221 was reported to promote the cell growth of pancreatic ductal adenocarcinoma (PDAC cells, its role in Capan-2 cell line is largely unknown. Methods: Capan-2 cells were transfected with miR-221 mimics, inhibitors, or negative controls. Cell Counting Kit-8 was used to determine cell viability. EdU staining and cell cycle analysis were used to measure cell proliferation. Western blotting was used to detect the expression levels of PTEN and phospho-Akt. The PI3K-Akt pathway activator SC-79 and inhibitor LY294002 were used to perform the rescue experiment in determining cell proliferation. Results: Overexpressing miR-221 significantly increased cell vitality and promoted cell proliferation and G1-to-S phase transition of the cell cycle in Capan-2 cells, while inhibition of miR-221 decreased that. The protein level of PTEN in Capan-2 cells was downregulated by overexpressing miR-221, while upregulated by inhibiting miR-221. Consistently, enhanced phosphorylation of AktSer473 was observed in miR-221 overexpressed Capan-2 cells, and the opposite result was found in miR-221 inhibited cells. LY294002 restored the pro-proliferation effect of miR-221 on Capan-2 cells, while SC-79 had no additional effect on cell proliferation in Capan-2 cells transfected with miR-221 mimics. Conclusion: Our study indicates that miR-221 is an oncogenic miRNA which promotes Capan-2 cells proliferation by targeting PTEN-Akt pathway.

  20. Knock-down of miR-221 and miR-222 in the radiosensitization of breast cancer cells

    Objective: To investigate the radiosensitizing effect of knock-down of miR-221 miR-222 on MCF-7 human breast cancer cells and explore the possible mechanism. Methods: Antisense oligonucleotides of miR-221 and miR-222 (AS-miR-221 and AS-miR-222), mediated by lipofectamine, were transfected to MCF-7 cells to knock down miR-221 and miR-222, Northern blotting was conducted to detect the expression of miR-221 and miR-222 in transfected cells. The cell apoptosis was detected by flow cytometry and Caspase-3 and Caspase-7 activity assay. Clonogenic assay was used to measure the sensitizing enhancement ratio. Target genes of miR-221 and miR-222 relevant to radio-sensitivity were searched using bioinformatics analysis. The targeted protein expression was determined by Western blot analysis. Results: The expression of miR-221 and miR-222 in the AS-miR-221/222 cells determined by Northern blotting was significantly reduced. Compared with the control group, the cell apoptosis and mitotic cell death after the radiation were significantly higher in AS-miR-221/222 cells. The sensitizing enhancement ratio was 1.87. Based on bioinformatics analysis, PTEN was a target gene of miR-221 and miR-222 which could enhance the radiosensitivity of MCF-7 cells. In AS-miR-221/222 cells, the expression of PTEN was up-regulated while pAkt down-regulated. Conclusions: AS-miR-221 and AS-miR-222 may enhance the radiosensitivity of MCF-7 breast cancer cells by up-regulating the expression of PTEN. (authors)

  1. MicroRNA-221 and microRNA-222 regulate gastric carcinoma cell proliferation and radioresistance by targeting PTEN

    MicroRNAs (miRNAs) can function as either oncogenes or tumor suppressor genes via regulation of cell proliferation and/or apoptosis. MiR-221 and miR-222 were discovered to induce cell growth and cell cycle progression via direct targeting of p27 and p57 in various human malignancies. However, the roles of miR-221 and miR-222 have not been reported in human gastric cancer. In this study, we examined the impact of miR-221 and miR-222 on human gastric cancer cells, and identified target genes for miR-221 and miR-222 that might mediate their biology. The human gastric cancer cell line SGC7901 was transfected with AS-miR-221/222 or transduced with pMSCV-miR-221/222 to knockdown or restore expression of miR-221 and miR-222, respectively. The effects of miR-221 and miR-222 were then assessed by cell viability, cell cycle analysis, apoptosis, transwell, and clonogenic assay. Potential target genes were identified by Western blot and luciferase reporter assay. Upregulation of miR-221 and miR-222 induced the malignant phenotype of SGC7901 cells, whereas knockdown of miR-221 and miR-222 reversed this phenotype via induction of PTEN expression. In addition, knockdonwn of miR-221 and miR-222 inhibited cell growth and invasion and increased the radiosensitivity of SGC7901 cells. Notably, the seed sequence of miR-221 and miR-222 matched the 3'UTR of PTEN, and introducing a PTEN cDNA without the 3'UTR into SGC7901 cells abrogated the miR-221 and miR-222-induced malignant phenotype. PTEN-3'UTR luciferase reporter assay confirmed PTEN as a direct target of miR-221 and miR-222. These results demonstrate that miR-221 and miR-222 regulate radiosensitivity, and cell growth and invasion of SGC7901 cells, possibly via direct modulation of PTEN expression. Our study suggests that inhibition of miR-221 and miR-222 might form a novel therapeutic strategy for human gastric cancer

  2. miR-221/222 Target the DNA Methyltransferase MGMT in Glioma Cells

    Roscigno, Giuseppina; Romano, Giulia; Diaz-Lagares, Angel; Iaboni, Margherita; Donnarumma, Elvira; Fiore, Danilo; De Marinis, Pasqualino; Soini, Ylermi; Esteller, Manel; Condorelli, Gerolama

    2013-01-01

    Glioblastoma multiforme (GBM) is one of the most deadly types of cancer. To date, the best clinical approach for treatment is based on administration of temozolomide (TMZ) in combination with radiotherapy. Much evidence suggests that the intracellular level of the alkylating enzyme O6-methylguanine–DNA methyltransferase (MGMT) impacts response to TMZ in GBM patients. MGMT expression is regulated by the methylation of its promoter. However, evidence indicates that this is not the only regulatory mechanism present. Here, we describe a hitherto unknown microRNA-mediated mechanism of MGMT expression regulation. We show that miR-221 and miR-222 are upregulated in GMB patients and that these paralogues target MGMT mRNA, inducing greater TMZ-mediated cell death. However, miR-221/miR-222 also increase DNA damage and, thus, chromosomal rearrangements. Indeed, miR-221 overexpression in glioma cells led to an increase in markers of DNA damage, an effect rescued by re-expression of MGMT. Thus, chronic miR-221/222-mediated MGMT downregulation may render cells unable to repair genetic damage. This, associated also to miR-221/222 oncogenic potential, may poor GBM prognosis. PMID:24147153

  3. MiR-221/222 target the DNA methyltransferase MGMT in glioma cells.

    Cristina Quintavalle

    Full Text Available Glioblastoma multiforme (GBM is one of the most deadly types of cancer. To date, the best clinical approach for treatment is based on administration of temozolomide (TMZ in combination with radiotherapy. Much evidence suggests that the intracellular level of the alkylating enzyme O(6-methylguanine-DNA methyltransferase (MGMT impacts response to TMZ in GBM patients. MGMT expression is regulated by the methylation of its promoter. However, evidence indicates that this is not the only regulatory mechanism present. Here, we describe a hitherto unknown microRNA-mediated mechanism of MGMT expression regulation. We show that miR-221 and miR-222 are upregulated in GMB patients and that these paralogues target MGMT mRNA, inducing greater TMZ-mediated cell death. However, miR-221/miR-222 also increase DNA damage and, thus, chromosomal rearrangements. Indeed, miR-221 overexpression in glioma cells led to an increase in markers of DNA damage, an effect rescued by re-expression of MGMT. Thus, chronic miR-221/222-mediated MGMT downregulation may render cells unable to repair genetic damage. This, associated also to miR-221/222 oncogenic potential, may poor GBM prognosis.

  4. 221-U Facility concrete and reinforcing steel evaluations specification for the canyon disposition initiative (CDI)

    This describes a test program to establish the in-situ material properties of the reinforced concrete in Building 221-U for comparison to the original design specifications. Field sampling and laboratory testing of concrete and reinforcing steel structural materials in Building 221-U for design verification will be undertaken. Forty seven samples are to be taken from radiologically clean exterior walls of the canyon. Laboratory testing program includes unconfined compressive strength of concrete cores, tensile strength of reinforcing steel, and petrographic examinations of concrete cores taken from walls below existing grade

  5. 14 CFR 221.105 - Special notice of limited liability for death or injury under the Warsaw Convention.

    2010-01-01

    ... death or injury under the Warsaw Convention. 221.105 Section 221.105 Aeronautics and Space OFFICE OF THE... injury under the Warsaw Convention. (a)(1) In addition to the other requirements of this subpart, each... to passengers provided by the Warsaw Convention, shall, at the time of delivery of the...

  6. 5 CFR 591.221 - How does OPM compute the consumer expenditure weights it uses to combine price indexes?

    2010-01-01

    ... expenditure weights it uses to combine price indexes? 591.221 Section 591.221 Administrative Personnel OFFICE... the consumer expenditure weights it uses to combine price indexes? OPM uses the following ten-step... aggregation. (f) Step 6. OPM computes a set of ratios by dividing each expenditure share of the...

  7. 12 CFR 221.116 - Bank loans to replenish working capital used to purchase mutual fund shares.

    2010-01-01

    ... purchase mutual fund shares. 221.116 Section 221.116 Banks and Banking FEDERAL RESERVE SYSTEM (CONTINUED... Bank loans to replenish working capital used to purchase mutual fund shares. (a) In a situation considered by the Board of Governors, a business concern (X) proposed to purchase mutual fund shares,...

  8. Pharmacokinetics and Pharmacodynamics of a 13-mer LNA-inhibitor-miR-221 in Mice and Non-human Primates.

    Gallo Cantafio, Maria Eugenia; Nielsen, Boye Schnack; Mignogna, Chiara; Arbitrio, Mariamena; Botta, Cirino; Frandsen, Niels M; Rolfo, Christian; Tagliaferri, Pierosandro; Tassone, Pierfrancesco; Di Martino, Maria Teresa

    2016-01-01

    Locked nucleic acid (LNA) oligonucleotides have been successfully used to efficiently inhibit endogenous small noncoding RNAs in vitro and in vivo. We previously demonstrated that the direct miR-221 inhibition by the novel 13-mer LNA-i-miR-221 induces significant antimyeloma activity and upregulates canonical miR-221 targets in vitro and in vivo. To evaluate the LNA-i-miR-221 pharmacokinetics and pharmacodynamics, novel assays for oligonucleotides quantification in NOD.SCID mice and Cynomolgus monkeys (Macaca fascicularis) plasma, urine and tissues were developed. To this aim, a liquid chromatography/mass spectrometry method, after solid-phase extraction, was used for the detection of LNA-i-miR-221 in plasma and urine, while a specific in situ hybridization assay for tissue uptake analysis was designed. Our analysis revealed short half-life, optimal tissue biovailability and minimal urine excretion of LNA-i-miR-221 in mice and monkeys. Up to 3 weeks, LNA-i-miR-221 was still detectable in mice vital organs and in xenografted tumors, together with p27 target upregulation. Importantly, no toxicity in the pilot monkey study was observed. Overall, our findings indicate the suitability of LNA-i-miR-221 for clinical use and we provide here pilot data for safety analysis and further development of LNA-miRNA-based therapeutics for human cancer. PMID:27327137

  9. 14 CFR 91.221 - Traffic alert and collision avoidance system equipment and use.

    2010-01-01

    ... 14 Aeronautics and Space 2 2010-01-01 2010-01-01 false Traffic alert and collision avoidance... RULES Equipment, Instrument, and Certificate Requirements § 91.221 Traffic alert and collision avoidance system equipment and use. (a) All airspace: U.S.-registered civil aircraft. Any traffic alert...

  10. 26 CFR 1.381(c)(22)-1 - Successor life insurance company.

    2010-04-01

    ... 26 Internal Revenue 4 2010-04-01 2010-04-01 false Successor life insurance company. 1.381(c)(22)-1... company. (a) Carryover requirement. If in a taxable year beginning after December 31, 1957, a distributor or transferor corporation which is an insurance company is acquired by a corporation which is...

  11. Tetrasomy 21 pter {yields} q22.1 and Down syndrome: Molecular definition of the region

    Daumer-Haas, C.; Schuffenhauer, S.; Walther, J.U. [Universitaet Muenchen (Germany); Portsmann, T. [Humboldt Universitaet, Berlin (Germany); Korenberg, J.R.; Schipper, R.D. [Univ. of California, Los Angeles, CA (United States)

    1994-12-01

    Down syndrome is usually caused by complete trisomy 21. Rarely, it is due to partial trisomy of the segment 21q22. We report on a 33-month-old girl with tetrasomy 21 pter {yields} q22.1 resulting from an extra chromosome idic(21)(q22.1). She has craniofacial traits typical of Down syndrome, including brachycephaly, third fontanel, upward slanting palpebral fissures, round face, and protruding tongue. Speech development is quite delayed whereas motor development is only mildly retarded. The molecular content of the extra isodicentric chromosome was defined by molecular genetic investigations using 13 single copy probes unique to chromosome 21, and SOD1 expression studies. The child was found to have 4 copies of the region defined by D21S16 (21cen) through D21S93 on 21q22.1 and two copies of the remaining region defined by SOD1 {yields} D21S55 {yields} D21S123. In view of the recent assignment of Down syndrome facial characters to the 21q22 region, defined in part by D21S55, it is significant that this child shows a subset of Down syndrome facial manifestations, without duplication of this region. These results suggest that genes contributing to the facial and some of the hand manifestations of Down syndrome also exist in the chromosomal region proximal to D21S55 in band 21q22.1. 34 refs., 6 figs., 3 tabs.

  12. 49 CFR 173.221 - Polymeric beads, expandable and Plastic molding compound.

    2010-10-01

    ... Than Class 1 and Class 7 § 173.221 Polymeric beads, expandable and Plastic molding compound. (a) Non... molding compound in dough, sheet or extruded rope form, evolving flammable vapor must be packed in: wooden... flammable vapor or Plastic molding compounds in dough, sheet or extruded rope, evolving flammable vapor...

  13. 14 CFR 221.60 - When reference to governing tariffs permitted.

    2010-01-01

    ... 14 Aeronautics and Space 4 2010-01-01 2010-01-01 false When reference to governing tariffs... (AVIATION PROCEEDINGS) ECONOMIC REGULATIONS TARIFFS Governing Tariffs § 221.60 When reference to governing tariffs permitted. (a) Reference to other tariffs prohibited except as authorized. A tariff shall...

  14. 14 CFR 221.72 - Reinstating canceled or expired tariff provisions.

    2010-01-01

    ... 14 Aeronautics and Space 4 2010-01-01 2010-01-01 false Reinstating canceled or expired tariff... (AVIATION PROCEEDINGS) ECONOMIC REGULATIONS TARIFFS Amendment of Tariffs § 221.72 Reinstating canceled or expired tariff provisions. Any fares, rules, or other tariff provisions which have been canceled or...

  15. 14 CFR 221.500 - Transmission of electronic tariffs to subscribers.

    2010-01-01

    ... 14 Aeronautics and Space 4 2010-01-01 2010-01-01 false Transmission of electronic tariffs to... TRANSPORTATION (AVIATION PROCEEDINGS) ECONOMIC REGULATIONS TARIFFS Electronically Filed Tariffs § 221.500 Transmission of electronic tariffs to subscribers. (a) Each filer that files an electronic tariff under...

  16. 14 CFR 221.130 - Applications for waiver of tariff regulations.

    2010-01-01

    ... 14 Aeronautics and Space 4 2010-01-01 2010-01-01 false Applications for waiver of tariff... TRANSPORTATION (AVIATION PROCEEDINGS) ECONOMIC REGULATIONS TARIFFS Waiver of Tariff Regulations § 221.130 Applications for waiver of tariff regulations. Applications for waiver or modification of any of...

  17. 50 CFR 221.74 - Has OMB approved the information collection provisions of this subpart?

    2010-10-01

    ... 50 Wildlife and Fisheries 7 2010-10-01 2010-10-01 false Has OMB approved the information... PRESCRIPTIONS IN FERC HYDROPOWER LICENSES Alternatives Process § 221.74 Has OMB approved the information... it displays a currently valid OMB control number that indicates OMB approval. OMB has reviewed...

  18. 42 CFR 22.1 - Duty at a station of the Service devoted to the care of Hansen's disease patients; additional pay.

    2010-10-01

    ... care of Hansen's disease patients; additional pay. 22.1 Section 22.1 Public Health PUBLIC HEALTH... Hansen's Disease Duty by Personnel Other Than Commissioned Officers § 22.1 Duty at a station of the Service devoted to the care of Hansen's disease patients; additional pay. (a) Non-commissioned...

  19. DME-221 thoria fuel: fabrication, irradiation testing, and post-irradiation examination

    Corbett, S.; Floyd, M.R.; Hamilton, H.; Livingstone, S.; Harrison, N.F. [Atomic Energy of Canada Limited, Chalk River, Ontario (Canada)

    2013-07-01

    Thoria (ThO{sub 2}) has several advantages over Urania (UO{sub 2}) as a nuclear fuel; its higher thermal conductivity results in lower operating temperatures, and its higher melting point and chemical inertness promise better stability under postulated accident conditions. Thorium is a 'fertile' material, breeding mainly fissile {sup 233}U as it is irradiated, making it more proliferation resistant. Thorium is also abundant as a natural resource, and is therefore an attractive future energy source. Past irradiation tests have shown that pellet microstructure greatly influences the irradiation performance of thoria fuels (e.g., fission-gas release is strongly influenced by the as-fabricated fuel microstructure). The “DME-221” test, conducted at AECL’s Chalk River Laboratories, was designed to demonstrate the superior irradiation performance of thoria fuels characterized by homogeneous, high-density microstructures. Eighteen DME-221 fuel elements were irradiated in the National Research Universal (NRU) loops in a 36-element demountable bundle. Six of the elements had pellets comprised of natural thoria (ThO{sub 2}), and twelve comprised of thoria blended with 1.0 wt.% or 1.5 wt% {sup 235}U in (Th, U)O{sub 2}. Various power histories were achieved as a result of the varied initial fissile concentration. To date, DME-221 thoria fuel has demonstrated excellent performance to burnups up to ∼930 MWh/kgHE (39 GWd/tHE); fission-gas release is substantially lower than that expected from UO{sub 2} fuels experiencing similar operating histories. This paper highlights the fabrication, irradiation testing and post-irradiation examination of twelve DME-221 fuel elements. The remaining six DME-221 elements are currently planned for irradiation in NRU to burnups up to 1500 MWh/kgHE (42-63 GWd/tHE). (author)

  20. Increased MiR-221 expression in hepatocellular carcinoma tissues and its role in enhancing cell growth and inhibiting apoptosis in vitro

    MiR-221 is over-expressed in human hepatocellular carcinoma (HCC), but its clinical significance and function in HCC remains uncertain. The aim of the study was to investigate the relationship between miR-221 overexpression and clinicopathological parameters in HCC formalin-fixed paraffin-embedded (FFPE) tissues, and the effect of miR-221 inhibitor and mimic on different HCC cell lines in vitro. MiR-221 expression was detected using real time RT-qPCR in FFPE HCC and the adjacent noncancerous liver tissues. The relationship between miR-221 level and clinicopathological features was also analyzed. Furthermore, miR-221 inhibitor and mimic were transfected into HCC cell lines HepB3, HepG2 and SNU449. The effects of miR-221 on cell growth, cell cycle, caspase activity and apoptosis were also investigated by spectrophotometry, fluorimetry, fluorescence microscopy and flow cytometry, respectively. The relative expression of miR-221 in clinical TNM stages III and IV was significantly higher than that in the stages I and II. The miR-221 level was also upregulated in the metastatic group compared to the nonmetastatic group. Furthermore, miR-221 over-expression was related to the status of tumor capsular infiltration in HCC clinical samples. Functionally, cell growth was inhibited, cell cycle was arrested in G1/S-phase and apoptosis was increased by miR-221 inhibitor in vitro. Likewise, miR-221 mimic accelerated the cell growth. Expression of miR-221 in FFPE tissues could provide predictive significance for prognosis of HCC patients. Moreover, miR-221 inhibitor could be useful to suppress proliferation and induce apoptosis in HCC cells. Thus miR-221 might be a critical targeted therapy strategy for HCC

  1. The Inhibition of the Highly Expressed Mir-221 and Mir-222 Impairs the Growth of Prostate Carcinoma Xenografts in Mice

    Mercatelli, Neri; Coppola, Valeria; Bonci, Desirée; Miele, Francesca; Costantini, Arianna; Guadagnoli, Marco; Bonanno, Elena; Muto, Giovanni; Frajese, Giovanni Vanni; De Maria, Ruggero; Spagnoli, Luigi Giusto; Farace, Maria Giulia; Ciafrè, Silvia Anna

    2008-01-01

    Background MiR-221 and miR-222 are two highly homologous microRNAs whose upregulation has been recently described in several types of human tumors, for some of which their oncogenic role was explained by the discovery of their target p27, a key cell cycle regulator. We previously showed this regulatory relationship in prostate carcinoma cell lines in vitro, underlying the role of miR-221/222 as inducers of proliferation and tumorigenicity. Methodology/Principal Findings Here we describe a number of in vivo approaches confirming our previous data. The ectopic overexpression of miR-221 is able, per se, to confer a high growth advantage to LNCaP-derived tumors in SCID mice. Consistently, the anti-miR-221/222 antagomir treatment of established subcutaneous tumors derived from the highly aggressive PC3 cell line, naturally expressing high levels of miR-221/222, reduces tumor growth by increasing intratumoral p27 amount; this effect is long lasting, as it is detectable as long as 25 days after the treatment. Furthermore, we provide evidence in favour of a clinical relevance of the role of miR-221/222 in prostate carcinoma, by showing their general upregulation in patient-derived primary cell lines, where we find a significant inverse correlation with p27 expression. Conclusions/Significance These findings suggest that modulating miR-221/222 levels may have a therapeutic potential in prostate carcinoma. PMID:19107213

  2. Preparation and Electrooxidative SO-Extrusion of Halogenated 7-Thiabicyclo[2.2.1]heptene 7-Oxides

    Thiemann, Thies; Melo, M. Luísa Sá e; Neves, André S. Campos; Li, Yuanqiang; Mataka, Shuntaro; Tashiro, Masashi; Geißler, Uwe; Walton, David

    1998-01-01

    Halogenated thiophenes have been cycloadded oxidatively to maleimides to give halogenated thiabicyclo[2.2.1]heptene S-oxides which have been subjected to an electrochemical extrusion of SO to give various halogeno-substituted phthalimides.

  3. The denitrification characteristics of Pseudomonas stutzeri SC221-M and its application to water quality control in grass carp aquaculture.

    Bin Deng

    Full Text Available To reduce ammonium and nitrite in aquaculture water, an isolate of the denitrifying bacterium Pseudomonas stutzeri, SC221-M, was obtained. The effects of various nitrogen and carbon sources, the ratio of carbon to nitrogen and temperature on bacterial growth, denitrification rates and the expression levels of nirS and nosZ in SC221-M were studied. The following conditions were determined to be optimal for growth and denitrification in SC221-M: NaNO2 as the nitrogen source, sodium citrate as the carbon source, a carbon to nitrogen ratio range of 4-8, and a temperature range of 20-35°C. Subsequently, SC221-M and the Bacillus cereus BSC24 strain were selected to generate microbial preparations. The results showed that addition of the microbial preparations decreased various hydrochemical parameters, including total dissolved solids, ammonium, nitrite, total nitrogen and the chemical oxygen demand. Nitrogen removal rates were highest on day 9; the removal rates of BSC24, SC221-M, a mixed preparation and a 3× mixed preparation were 24.5%, 26.6%, 53.9% and 53.4%, respectively. The mixed preparation (SC221-M+BSC24 was more effective at removing nitrogen than either the SC221-M or BSC24 preparation. Roche 454 pyrosequencing and subsequent analysis indicated that the control and other groups formed separate clusters, and the microbial community structure in the water changed significantly after the addition of microbial preparations. These results indicate that the addition of microbial preparations can improve both the water quality and microbial community structure in an experimental aquaculture system. P. stutzeri strain SC221-M and its related microbial preparations are potential candidates for the regulation of water quality in commercial aquaculture systems.

  4. 77 FR 64564 - Implementation of Regulatory Guide 1.221 on Design-Basis Hurricane and Hurricane Missiles

    2012-10-22

    ...The U.S Nuclear Regulatory Commission (NRC or the Commission) staff is soliciting public comment on its proposed Interim Staff Guidance (ISG) DC/COL-ISG-024, ``Implementation of Regulatory Guide 1.221 on Design-Basis Hurricane and Hurricane Missiles.'' The purpose of this ISG is to supplement the guidance regarding the application of Regulatory Guide 1.221, ``Design-Basis Hurricane and......

  5. A=225 implantation for $^{221}$Fr source for TRIUMF atom trap

    The FrPNC Collaboration is mounting an atom trap for parity violation experiments and precision spectroscopy on francium atoms at TRIUMF's ISAC facility. We would like to use ISOLDE's capability of simultaneously implanting A=225 (while another experiment runs online) to make a long-lived source feeding $^{221}$Fr for tests of the trap. $^{225}$Ra $\\beta$-decays to $^{225}$Ac, which then $\\alpha$-decays, producing 100 keV $^{221}$Fr t$_{1/2}$= 4.8 minute recoils. The implanted A=225 source would be shipped to TRIUMF, where it would be held for several minutes at a time a few mm from the same yttrium foil that normally receives the ISAC beam. SRIM calculations imply that 20% of the $^{221}$Fr will be implanted in a 1 cm diameter spot on the yttrium. Then the yttrium foil is moved to the trap and heated to release the Fr atoms, just as in normal ISAC online operation. A test implantation will be done at 10$^{7}$/sec production for 1 day, testing whether carbon cracking on the implantation foil in the mass separ...

  6. Targeted delivery of chemically modified anti-miR-221 to hepatocellular carcinoma with negatively charged liposomes

    Zhang W

    2015-07-01

    Full Text Available Wendian Zhang,1 Fangqi Peng,1 Taotao Zhou,1 Yifei Huang,2 Li Zhang,3 Peng Ye,4 Miao Lu,1 Guang Yang,5 Yongkang Gai,1 Tan Yang,1 Xiang Ma,1 Guangya Xiang1 1School of Pharmacy, Tongji Medical College, 2Department of Pharmacy, 3Department of Ultrasound, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, 4Department of Pharmacy, Wuhan University, Renmin Hospital, 5School of Medicine, Jianghan University, Wuhan, People’s Republic of China Abstract: Hepatocellular carcinoma (HCC is one of the leading causes of cancer-related death. Gene therapy was established as a new strategy for treating HCC. To explore the potential delivery system to support the gene therapy of HCC, negatively charged liposomal delivery system was used to deliver miR-221 antisense oligonucleotide (anti-miR-221 to the transferrin (Tf receptor over expressed HepG2 cells. The liposome exhibited a mean particle size of 122.5 nm, zeta potential of -15.74 mV, anti-miR-221 encapsulation efficiency of 70%, and excellent colloidal stability at 4°C. Anti-miR-221-encapsulated Tf-targeted liposome demonstrated a 15-fold higher delivery efficiency compared to nontargeted liposome in HepG2 cells in vitro. Anti-miR-221 Tf-targeted liposome effectively delivered anti-miR-221 to HepG2 cells, upregulated miR-221 target genes PTEN, P27kip1, and TIMP3, and exhibited greater silencing efficiency over nontargeted anti-miR-221 liposome. After intravenous injection into HepG2 tumor-bearing xenografted mice with Cy3-labeled anti-miR-221 Tf-targeted liposome, Cy3-anti-miR-221 was successfully delivered to the tumor site and increased the expressions of PTEN, P27kip1, and TIMP3. Our results demonstrate that the Tf-targeted negatively charged liposome could be a potential therapeutic modality in the gene therapy of human HCC. Keywords: transferrin, gene, HCC, target delivery system, anionic liposome 

  7. Advance research on microRNA-221,microRNA-222 and malignant tumor%microRNA-221和microRNA-222与恶性肿瘤的研究进展

    张春智; 康春生; 浦佩玉

    2009-01-01

    It has become clear that particular microRNAs(miRNAs) function either as tumor suppres-sors or oncogenes, whose loss or overexpression, respectively, has diagnostic and prognostic significance.Mi-croRNA-221 and microRNA-222 are a cluster microRNAs of oncogenes.They are overexpressed in some malig-nant tumors, including glioblstoma, prostate carcinoma, papillary thyroid carcinoma, and so on.By regulating particular target mRNAs, microRNA-221 and microRNA-222 perform pro- oneogenie role.p27kip1 and p57kip2 are target genes of microRNA-221 and mieroRNA-222.MicroRNA-221 and microRNA-222 promote oncogensis and tumor grow by down-regulating p27kip1 and p57kip2 expression.%微RNA(micmRNA)-221和microRNA-222是成簇的microRNA,在恶性肿瘤中起促癌作用,在胶质母细胞瘤、前列腺癌、乳头状甲状腺癌等恶性肿瘤中高表达.microRNA-221和microRNA-222通过调控其特定的靶基因行使促癌作用.在所有预测的靶基因中,p27kip1和p57kip2是已被验证的靶基因,microRNA-221和microRNA-222通过下调p27kip1和p57kip2的表达来促进肿瘤的形成和生长.

  8. Slug-upregulated miR-221 promotes breast cancer progression through suppressing E-cadherin expression.

    Pan, Yi; Li, Jing; Zhang, Yaqin; Wang, Nan; Liang, Hongwei; Liu, Yuan; Zhang, Chen-Yu; Zen, Ke; Gu, Hongwei

    2016-01-01

    It is generally regarded that E-cadherin is downregulated during tumorigenesis via Snail/Slug-mediated E-cadherin transcriptional reduction. However, this transcriptional suppressive mechanism cannot explain the failure of producing E-cadherin protein in metastatic breast cancer cells after overexpressing E-cadherin mRNA. Here we reveal a novel mechanism that E-cadherin is post-transcriptionally regulated by Slug-promoted miR-221, which serves as an additional blocker for E-cadherin expression in metastatic tumor cells. Profiling the predicted E-cadherin-targeting miRNAs in breast cancer tissues and cells showed that miR-221 was abundantly expressed in breast tumor and metastatic MDA-MB-231 cells and its level was significantly higher in breast tumor or MDA-MB-231 cells than in distal non-tumor tissue and low-metastatic MCF-7 cells, respectively. MiR-221, which level inversely correlated with E-cadherin level in breast cancer cells, targeted E-cadherin mRNA open reading frame (ORF) and suppressed E-cadherin protein expression. Depleting or increasing miR-221 level in breast cancer cells induced or decreased E-cadherin protein level, leading to suppressing or promoting tumor cell progression, respectively. Moreover, miR-221 was specifically upregulated by Slug but not Snail. TGF-β treatment enhanced Slug activity and thus increased miR-221 level in MCF-7 cells. In summary, our results provide the first evidence that Slug-upregulated miR-221 promotes breast cancer progression via reducing E-cadherin expression. PMID:27174021

  9. In vitro and in vivo activity of a novel locked nucleic acid (LNA-inhibitor-miR-221 against multiple myeloma cells.

    Maria Teresa Di Martino

    Full Text Available BACKGROUND & AIM: The miR-221/222 cluster is upregulated in malignant plasma cells from multiple myeloma (MM patients harboring the t(4;14 translocation. We previously reported that silencing of miR-221/222 by an antisense oligonucleotide induces anti-MM activity and upregulates canonical miR-221/222 targets. The in vivo anti-tumor activity occurred when miR-221/222 inhibitors were delivered directly into MM xenografts. The aim of the present study was to evaluate the anti-MM activity of a novel phosphorothioate modified backbone 13-mer locked nucleic acid (LNA-Inhibitor-miR-221 (LNA-i-miR-221 specifically designed for systemic delivery. METHODS: In vitro anti-MM activity of LNA-i-miR-221 was evaluated by cell proliferation and BrdU uptake assays. In vivo studies were performed with non-obese diabetic/severe combined immunodeficient (NOD.SCID mice bearing t(4;14 MM xenografts, which were intraperitoneally or intravenously treated with naked LNA-i-miR-221. RNA extracts from retrieved tumors were analyzed for miR-221 levels and modulation of canonical targets expression. H&E staining and immunohistochemistry were performed on retrieved tumors and mouse vital organs. RESULTS: In vitro, LNA-i-miR-221 exerted strong antagonistic activity against miR-221 and induced upregulation of the endogenous target p27Kip1. It had a marked anti-proliferative effect on t(4;14-translocated MM cells but not on MM cells not carrying the translocation and not overexpressing miR-221. In vivo, systemic treatment with LNA-i-miR-221 triggered significant anti-tumor activity against t(4;14 MM xenografts; it also induced miR-221 downregulation, upregulated p27Kip1 and reduced Ki-67. No behavioral changes or organ-related toxicity were observed in mice as a consequence of treatments. CONCLUSIONS: LNA-i-miR-221 is a highly stable, effective agent against t(4;14 MM cells, and is suitable for systemic use. These data provide the rationale for the clinical development of LNA

  10. Increased expression of microRNA-221 inhibits PAK1 in endothelial progenitor cells and impairs its function via c-Raf/MEK/ERK pathway

    Highlights: ► MicroRNA-221 is upregulated in the endothelial progenitor cells of atherosclerosis patients. ► PAK1 is a direct target of microRNA-221. ► MicroRNA-221 inhibits EPCs proliferation through c-Raf/MEK/ERK pathway. -- Abstract: Coronary artery disease (CAD) is associated with high mortality and occurs via endothelial injury. Endothelial progenitor cells (EPCs) restore the integrity of the endothelium and protect it from atherosclerosis. In this study, we compared the expression of microRNAs (miRNAs) in EPCs in atherosclerosis patients and normal controls. We found that miR-221 expression was significantly up-regulated in patients compared with controls. We predicted and identified p21/Cdc42/Rac1-activated kinase 1 (PAK1) as a novel target of miR-221 in EPCs. We also demonstrated that miR-221 targeted a putative binding site in the 3′UTR of PAK1, and absence of this site was inversely associated with miR-221 expression in EPCs. We confirmed this relationship using a luciferase reporter assay. Furthermore, overexpression of miR-221 in EPCs significantly decreased EPC proliferation, in accordance with the inhibitory effects induced by decreased PAK1. Overall, these findings demonstrate that miR-221 affects the MEK/ERK pathway by targeting PAK1 to inhibit the proliferation of EPCs

  11. Functional synergy of anti-mir221 and nanohydroxyapatite scaffold in bone tissue engineering of rat skull.

    Sadeghi, Mahya; Bakhshandeh, Behnaz; Dehghan, Mohammad Mehdi; Mehrnia, Mohammad Reza; Khojasteh, Arash

    2016-08-01

    An appropriate cell source, effective cell modification, and proper supportive matrices are the main bases of tissue engineering. The effectiveness of anti-mir221 or hydroxyapatite (HA) in improving the osteogenic differentiation of mesenchymal stem cells (MSCs) has been reported previously. Herein, simultaneous application of these osteogenic inducers was investigated in vivo. The Poly-caprolactone (PCL)/HA nanofibers were characterized using contact angle measurement, tensile test, Fourier transform infrared spectroscopy, and electron microscopy. Rat MSCs were isolated, characterized and transfected with anti-mir221. The rats were divided into 4 groups and an 8 mm defect were created in the mid-calvaria of each rat by trephine bur. Group 1 received (PCL)/HA nanofibers, group 2 received (PCL)/HA nanofibers plus autologous MSCs, group 3 received (PCL)/HA nanofibers plus MSCs transfected with anti-mir221, and group 4 rats were left empty as an additional control group. Histomorphometric and radiomorphometric evaluation after 4 and 8 weeks revealed more new bone formation in the cell-treated groups compared to the scaffold alone group. There was evidence for a combination of increased osteoclasts and osteoblast vascular lake containing red blood cells in the anti-mir221 transfected group. New bone penetration into the scaffolds empirically demonstrated the capability of this combination for efficient osteointegration. Altogether, the co-application of HA and anti-mir221 transfected cells can enhance bone healing of the rat skull. PMID:27412651

  12. Report on sampling and analysis of exhaust air at the 221-T and 2706-T buildings

    Stauffer, M.

    1997-09-22

    This report presents analytical results from exhaust air samples collected at stacks 221-T and 2706-T of the T-Plant. The samples were collected with SUMMA canisters over a 24 hour interval and were analyzed by gas chromatography-mass spectrometry using a modified EPA TO-14 procedure. The data suggest that the buildings had generally low concentrations of volatile organic compounds (< 40 ppbv). However, samples from building 2706-T did have significant amounts of non-target higher-boiling hydrocarbons, probably from a petroleum destination fraction.

  13. Attachments for fire modeling for Building 221-T, T Plant canyon deck and railroad tunnel

    Oar, D.L. [Westinghouse Hanford Co., Richland, WA (United States)

    1995-01-23

    The purpose of this attachment is to provide historical information and documentation for Document No. WHC-SD-CP-ANAL-008 Rev 0, ``Fire Modeling for Building 221-T--T Plant Canyon Deck and Railroad Tunnel``, dated September 29, 1994. This data compilation contains the following: Resumes of the Technical Director, Senior Engineer and Junior Engineer; Review and Comment Record; Software Files; CFAST Input and Output Files; Calculation Control Sheets; and Estimating Sprinkler Actuation Time in the Canyon and Railroad Tunnel. The T Plant was originally a fuel reprocessing facility. It was modified later to decontaminate and repair PuRex process equipment.

  14. Dual Selectivity Expressed in [2+2+1] Dynamic Clipping of Unsymmetrical [2]Catenanes

    Liu, Yi

    2010-06-11

    A {pi}-templated dynamic [2+2+1] clipping protocol is established for the synthesis of [2]catenanes from two parts dialdehyde, two parts diamine and one part tetracationic cyclophane. It is further diversified for the selective formation of an unsymmetrical [2]catenane showing great translational selectivity by employing two different dialdehydes in a one-pot reaction. The dual selectivity and the dynamic nature are verified by {sup 1}H NMR spectroscopy, X-ray single crystal structural studies and exchange experiments.

  15. Attachments for fire modeling for Building 221-T, T Plant canyon deck and railroad tunnel

    The purpose of this attachment is to provide historical information and documentation for Document No. WHC-SD-CP-ANAL-008 Rev 0, ''Fire Modeling for Building 221-T--T Plant Canyon Deck and Railroad Tunnel'', dated September 29, 1994. This data compilation contains the following: Resumes of the Technical Director, Senior Engineer and Junior Engineer; Review and Comment Record; Software Files; CFAST Input and Output Files; Calculation Control Sheets; and Estimating Sprinkler Actuation Time in the Canyon and Railroad Tunnel. The T Plant was originally a fuel reprocessing facility. It was modified later to decontaminate and repair PuRex process equipment

  16. New Short-Lived Isotope ^{221}U and the Mass Surface Near N=126.

    Khuyagbaatar, J; Yakushev, A; Düllmann, Ch E; Ackermann, D; Andersson, L-L; Block, M; Brand, H; Cox, D M; Even, J; Forsberg, U; Golubev, P; Hartmann, W; Herzberg, R-D; Heßberger, F P; Hoffmann, J; Hübner, A; Jäger, E; Jeppsson, J; Kindler, B; Kratz, J V; Krier, J; Kurz, N; Lommel, B; Maiti, M; Minami, S; Mistry, A K; Mrosek, Ch M; Pysmenetska, I; Rudolph, D; Sarmiento, L G; Schaffner, H; Schädel, M; Schausten, B; Steiner, J; De Heidenreich, T Torres; Uusitalo, J; Wegrzecki, M; Wiehl, N; Yakusheva, V

    2015-12-11

    Two short-lived isotopes ^{221}U and ^{222}U were produced as evaporation residues in the fusion reaction ^{50}Ti+^{176}Yb at the gas-filled recoil separator TASCA. An α decay with an energy of E_{α}=9.31(5)  MeV and half-life T_{1/2}=4.7(7)  μs was attributed to ^{222}U. The new isotope ^{221}U was identified in α-decay chains starting with E_{α}=9.71(5)  MeV and T_{1/2}=0.66(14)  μs leading to known daughters. Synthesis and detection of these unstable heavy nuclei and their descendants were achieved thanks to a fast data readout system. The evolution of the N=126 shell closure and its influence on the stability of uranium isotopes are discussed within the framework of α-decay reduced width. PMID:26705628

  17. A family with an inverted tandem duplication 5q22.1q23.2.

    Schmidt, T; Bartels, I; Liehr, T; Burfeind, P; Zoll, B; Shoukier, M

    2013-01-01

    Here, we report a 3-year-old boy with short stature, developmental delay and mild facial dysmorphic signs. Karyotype analysis and array-CGH revealed a pure duplication 5q22.1q23.2 with a length of 14.25 Mb. As demonstrated by multicolor-fluorescence in situ hybridization, the duplicated segment was orientated in an inverted tandem manner. One of the 2 older half-brothers of the index patient was intellectually disabled and showed short stature as well. The mother of the siblings was only 149 cm in height. The affected half-brother as well as the mother of the siblings were tested positive for the same duplication. Duplications of the long arm of chromosome 5 are rare. There are 16 reported cases of different 5q segments with a pure duplication and no additional chromosomal imbalance. In order to refine the 5q-duplication phenotype, reported cases were recently classified in 3 groups on the basis of clinical findings and the involved chromosome segments. However, our case does not fit in any of these groups but is placed in the interjacent chromosomal area between 2 of these groups. Overall, this is the second reported family with a duplication of 5q22.1q23.2 and both families share phenotypic features like short stature, facial dysmorphic signs and speech delay. The reported family provides further information for delineating phenotype-genotype correlations of pure duplications of the 5q region. PMID:23051634

  18. Preparation and Photo-thermal Isomerization of Azo [2.2.1]-and Azo[2.2.3]metacyclophane Tweezers

    Sawada, Tsuyoshi; Thiemann, Thies; Mataka, Shuntaro

    1999-01-01

    Azo[2.2.1]metacyclophane (MCP) tweezer 11 and azo[2.2.3]MCP tweezer 12 were prepared from [2.2.1]MCP 1a and [2.2.3]MCP 8, respectively, by ipso-nitration followed by reductive coupling using LiAlH_4. The photochemical and thermal isomerization of azo[2.2.n]MCP tweezers were studied by UV spectroscopy. The activation parameter (E_a) of the thermal cis-trans isomerization of 11 and 12 was determined as 81.7 kJmol^ and 90.9 kJmol^, respectively.

  19. The Inhibition of the Highly Expressed Mir-221 and Mir-222 Impairs the Growth of Prostate Carcinoma Xenografts in Mice

    Neri Mercatelli; Valeria Coppola; Desirée Bonci; Francesca Miele; Arianna Costantini; Marco Guadagnoli; Elena Bonanno; Giovanni Muto; Giovanni Vanni Frajese; Ruggero De Maria; Luigi Giusto Spagnoli; Maria Giulia Farace; Silvia Anna Ciafrè

    2008-01-01

    BACKGROUND: MiR-221 and miR-222 are two highly homologous microRNAs whose upregulation has been recently described in several types of human tumors, for some of which their oncogenic role was explained by the discovery of their target p27, a key cell cycle regulator. We previously showed this regulatory relationship in prostate carcinoma cell lines in vitro, underlying the role of miR-221/222 as inducers of proliferation and tumorigenicity. METHODOLOGY/PRINCIPAL FINDINGS: Here we describe a n...

  20. 12 CFR 221.114 - Bank loans to purchase stock of American Telephone and Telegraph Company under Employees' Stock...

    2010-01-01

    ... proposed to receive such stock as collateral for a “living expenses” loan that will be advanced to the... period would be substantially greater than the maximum loan value of the collateral as prescribed in § 221.7 (the Supplement). (d) In the opinion of the Board of Governors, a loan of the kind...

  1. A novel Xq22.1 deletion in a male with multiple congenital abnormalities and respiratory failure.

    Cao, Yang; Aypar, Umut

    2016-05-01

    Here we report the first male case of a novel Xq22.1 deletion. An 8-week-old boy with multiple congenital abnormalities and respiratory failure was referred to the Mayo Clinic Cytogenetics laboratory for testing. Chromosomal microarray analysis identified a novel 1.1 Mb deletion at Xq22.1. A similar deletion has only been described once in the literature in a female patient and her mother; both have intellectual disability and dysmorphic facial features. In addition, the mother had a son who died at 15 days due to breathing failure. Recently, a mouse model revealed that a 0.35 Mb sub-region, containing 4 genes, is sufficient to cause majority of the Xq22.1 deletion phenotypes. The deleted intervals in our male patient and the female patients contain 15 common genes, including the four described in the 0.35 Mb sub-region. Male mice with deletion of the 0.35 Mb sub-region died perinatally from respiratory failure due to pulmonary hypoplasia, consistent with the breathing problem and potential neonatal fatality in male patients. The phenotypes of the mouse models and the patients are strikingly similar; therefore, the deletion of these five genes (ARMCX5, ARMCX5-GPRASP2, GPRASP1, GPRASP2, and BHLHB9) is likely responsible for the novel Xq22.1 deletion syndrome. PMID:26995686

  2. Elevation of miR-221 and -222 in the internal mammary arteries of diabetic subjects and normalization with metformin.

    Coleman, Chasity B; Lightell, Daniel J; Moss, Stephanie C; Bates, Michael; Parrino, Patrick E; Woods, T Cooper

    2013-07-15

    Diabetes is a major risk factor for cardiovascular disease and is associated with increased intimal thickening and accelerated vascular smooth muscle cell (VSMC) proliferation. We measured the expression of two microRNAs that promote intimal thickening, miR-221/222, and mRNA encoding a downstream target, p27(Kip1), in internal mammary artery (IMA) segments collected from 37 subjects undergoing coronary artery bypass grafting. The segments were stratified into three groups: non-diabetic subjects (ND), diabetic subjects not on metformin (DMMet-), and diabetic subjects on metformin (DMMet+). The DMMet- group exhibited a significant increase in miR-221/222 and decrease in p27(Kip1) mRNA compared to both the ND and DMMet+ groups. miR-221/222 levels inversely correlated with metformin dose. VSMCs isolated from the IMAs of the DMMet- group proliferate at a faster rate than those of the ND and DMMet+ groups. Further studies into the importance of miR-221/222 in the increased intimal thickening observed in diabetic subjects is warranted. PMID:23648338

  3. Deliverable 2.2.1 Use Scenarios in the Pilot Services

    Peterson, Carrie Beth

    2010-01-01

    Deliverable 2.2.1 - Use scenarios in the pilot services During the first phase of ISISEMD project (WP1) the user requirements analysis phase, mainly D1.1.1, has proposed a list of services organized in three groups (bundles as in Dow) and classified as mandatory or not mandatory and leading to di...... how the services look like and shall work at runtime. The integration work is now in progress and during the next months the design, workflow, GUI etc. for each service will be fully integrated, tested and evaluated in cooperation with the regions according to the project plan...... and usage scenarios of service bundles to be implemented in the ISISEMD Pilot platform in each of the four regions during the pilot. The services/sub functions are presented as workflows and also described by presenting how the Graphical User Interface will be organized and designed thus reflecting...

  4. Development of Waste Acceptance Criteria at 221-U Building: Initial Flow and Transport Scoping Calculations

    Freedman, Vicky L.; Zhang, Z. F.; Keller, Jason M.; Chen, Yousu

    2007-05-30

    This report documents numerical flow and transport simulations performed that establish initial waste acceptance criteria for the potential waste streams that may be safely sequestered in the 221-U Building and similar canyon structures. Specifically, simulations were executed to identify the maximum loading of contaminant mass (without respect to volume) that can be emplaced within the 221-U Building with no more than 1 pCi/m2 of contaminant migrating outside the structure within a 1,000 year time period. The initial scoping simulations were executed in one dimension to assess important processes, and then two dimensions to establish waste acceptance criteria. Two monolithic conditions were assessed: (1) a grouted canyon monolith; and (2) a canyon monolith filled with sand, both assuming no cracks or fissures were present to cause preferential transport. A three-staged approach was taken to account for different processes that may impact the amount of contaminant that can be safely sequestered in canyon structure. In the first stage, flow and transport simulations established waste acceptance criteria based on a linear (Kd) isotherm approach. In the second stage, impacts on thermal loading were examined and the differences in waste acceptance criteria quantified. In the third stage of modeling, precipitation/dissolution reactions were considered on the release and transport of the contaminants, and the subsequent impact on the maximum contaminant loading. The reactive transport modeling is considered a demonstration of the reactive transport capability, and shows the importance of its use for future performance predictions once site-specific data have been obtained.

  5. Circulating miR-221-3p as a novel marker for early prediction of acute myocardial infarction.

    Coskunpinar, Ender; Cakmak, Huseyin Altug; Kalkan, Ali Kemal; Tiryakioglu, Necip Ozan; Erturk, Mehmet; Ongen, Zeki

    2016-10-10

    Recent studies have reported circulating microRNAs (miRNAs) as novel biomarkers for cardiovascular diseases including acute myocardial infarction, heart failure, diabetes mellitus, stroke, and acute pulmonary embolism. The aims of this study were 1) to compare the plasma expression levels of miRNAs in patients with acute coronary syndrome (ACS) and control subjects and in ST-elevation myocardial infarction (STEMI) and non-STEMI 2) to evaluate miRNAs potential to be used as novel diagnostic biomarkers for ACS. Twenty seven consecutive patients, admitted to emergency department of a training and research hospital between January-December 2013 with acute chest pain and/or dyspnea and diagnosed with ACS, and 16 non-ACS control subjects were included in this study. miRNA profiling was performed by using real time polymerase chain reaction. Functions of dysregulated miRNAs were evaluated by computerized-pathways analysis. miR-221-3p was one of the two most dysregulated miRNAs with a fold regulation of 3.89. It was significantly positively correlated with both Troponin and GRACE and Synthax Score. Moreover, miR221-3p was found to be significantly inversely correlated with left ventricular ejection fraction. miR-221-3p was the most prominent biomarker candidate with an area under curve (AUC) level of 0.881 (95% confidence interval: 0.774-0.987; p=0.002). The present study is the first to report an increased expression levels of miR-221-3p in AMI. Since miR-221-3p has a high discriminative value and significant relations with Troponin, GRACE and Synthax score and left ventricular systolic function, it may be a potential biomarker for early prediction of AMI. PMID:27374153

  6. Down-regulation of MicroRNAs 222/221 in Acute Myelogenous Leukemia with Deranged Core-Binding Factor Subunits

    Matteo Brioschi

    2010-11-01

    Full Text Available Core-binding factor leukemia (CBFL is a subgroup of acutemyeloid leukemia (AML characterized by genetic mutations involving the subunits of the core-binding factor (CBF. The leukemogenesis model for CBFL posits that one, or more, gene mutations inducing increased cell proliferation and/or inhibition of apoptosis cooperate with CBF mutations for leukemia development. One of the most commonmutations associated with CBF mutations involves the KIT receptor. A high expression of KIT is a hallmark of a high proportion of CBFL. Previous studies indicate that microRNA (MIR 222/221 targets the 3′ untranslated region of the KIT messenger RNA and our observation that AML1 can bind the MIR-222/221 promoter, we hypothesized that MIR-222/221 represents the link between CBF and KIT. Here, we show that MIR-222/221 expression is upregulated after myeloid differentiation of normal bone marrow AC133+ stem progenitor cells. CBFL blasts with either t(8;21 or inv(16 CBF rearrangements with high expression levels of KIT (CD117 display a significantly lower level of MIR-222/221 expression than non-CBFL blasts. Consistently, we found that the t(8;21 AML1-MTG8 fusion protein binds the MIR-222/221 promoter and induces transcriptional repression of a MIR-222/221-LUC reporter. Because of the highly conserved sequence homology, we demonstrated concomitant MIR-222/221 down-regulation and KIT up-regulation in the 32D/WT1 mouse cell model carrying the AML1-MTG16 fusion protein. This study provides the first hint that CBFL-associated fusion proteins may lead to up-regulation of the KIT receptor by down-regulating MIR-222/221, thus explaining the concomitant occurrence of CBF genetic rearrangements and overexpression of wild type or mutant KIT in AML.

  7. Simultaneous detection and differentiation by multiplex real time RT-PCR of highly pathogenic avian influenza subtype H5N1 classic (clade 2.2.1 proper and escape mutant (clade 2.2.1 variant lineages in Egypt

    Arafa Abdel-Satar

    2010-10-01

    Full Text Available Abstract Background The endemic status of highly pathogenic avian influenza virus (HPAIV of subtype H5N1 in Egypt continues to devastate the local poultry industry and poses a permanent threat for human health. Several genetically and antigenically distinct H5N1 lineages co-circulate in Egypt: Strains of clade 2.2.1 proper replicate mainly in backyard birds causing the bulk of human infections, while a variant lineage within 2.2.1 (2.2.1v appears to be perpetuated mainly in commercial poultry farms in Egypt. Viruses of the 2.2.1v lineage represent drift variants escaping from conventional vaccine-induced immunity and some of these strains also escaped detection by commercial real time reverse transcriptase PCR (RT-qPCR protocols due to mismatches in the primers/probe binding sites. Results We developed therefore a versatile, sensitive and lineage-specific multiplex RT-qPCR for detection and typing of H5N1 viruses in Egypt. Analytical characterization was carried out using 50 Egyptian HPAIV H5N1 strains isolated since 2006 and 45 other avian influenza viruses (AIV. A detection limit of 400 cRNA copies per ml sample matrix was found. Higher diagnostic sensitivity of the multiplex assay in comparison to other generic H5 or M-gene based RT-qPCR assays were found by examination of 63 swab samples from experimentally infected chickens and 50 AIV-positive swab samples from different host species in the field in Egypt. Conclusions The new multiplex RT-qPCR assay could be useful for rapid high-throughput monitoring for the presence of HPAIV H5N1 in commercial poultry in Egypt. It may also aid in prospective epidemiological studies to further delineate and better control spread of HPAIV H5N1 in Egypt.

  8. De Novo Balanced Translocation t (7;16 (p22.1; p11.2 Associated with Autistic Disorder

    Nadia Bayou

    2008-01-01

    Full Text Available The high incidence of de novo chromosomal aberrations in a population of persons with autism suggests a causal relationship between certain chromosomal aberrations and the occurrence of isolated idiopathic autism. We report on the clinical and cytogenetic findings in a male patient with autism, no physical abnormalities and a de novo balanced (7;16(p22.1;p16.2 translocation. G-banded chromosomes and fluorescent in situ hybridization (FISH were used to examine the patient's karyotype as well as his parents'. FISH with specific RP11-BAC clones mapping near 7p22.1 and 16p11.2 was used to refine the location of the breakpoints. This is, in the best of our knowledge, the first report of an individual with autism and this specific chromosomal aberration.

  9. De Novo Balanced Translocation t (7;16) (p22.1; p11.2) Associated with Autistic Disorder

    Nadia Bayou; Ridha M'rad; Ahlem Belhaj; Hussein Daoud; Lamia Ben Jemaa; Ramzi Zemni; Sylvain Briault; M. Bechir Helayem; Habiba Chaabouni

    2008-01-01

    The high incidence of de novo chromosomal aberrations in a population of persons with autism suggests a causal relationship between certain chromosomal aberrations and the occurrence of isolated idiopathic autism. We report on the clinical and cytogenetic findings in a male patient with autism, no physical abnormalities and a de novo balanced (7;16)(p22.1;p16.2) translocation. G-banded chromosomes and fluorescent in situ hybridization (FISH) were used to examine the patient's karyotype as wel...

  10. NIEZAWIADOMIENIE O WYPADKU PRZY PRACY LUB CHOROBIE ZAWODOWEJ (PRZESTĘPSTWO Z ART. 221 K.K.)

    Jachimowicz, Marcin

    2003-01-01

    The crime described under Article 221 of the Criminal Code has been introduced to the Polish Criminal Law for the first time by the Criminal Code of 1997. Before that, this act was prosecuted under Article 283 § 6 section 6 of the Labor Code. This crime primarily covers failure to notify the relevant institution of a mishap at workplace or professional illness, or failure to submit appropriate documentation of such event. The paper begins with the analysis of the rights protect...

  11. Investigation of $\\alpha$-decay rates of $^{221}$Fr, $^{224}$Ra and $^{226}$Ra in different environments

    2007-01-01

    It has recently been suggested, and indicated experimentally, that $\\alpha$- decay half-lives are modified by solid state effects in the surrounding environment. We propose here to measure with high accuracy the $\\alpha$-decay half-life of $^{221}$Fr, $^{224}$Ra and $^{226}$Ra in insulators and metals. Furthermore we plan to investigate the temperature dependency of the half-life in these materials (room temperature, 4 K and 10 mK).

  12. Overexpression of miR-221 in peripheral blood lymphocytes in petrol station attendants: A population based cross-sectional study in southern China.

    Hu, Dalin; Peng, Xiaowu; Liu, Yungang; Zhang, Wenjuan; Peng, Xiaochun; Tang, Huanwen; Yuan, Jianhui; Zhu, Zhiliang; Yang, Jianping

    2016-04-01

    Benzene is a recognized environmental leukemogen, however, the mechanisms for its carcinogenesis have not been fully elucidated. Recently, miR-221, a suggested oncogene involved in a number of malignancies, has been detected with elevated expression levels in blood cells of patients with leukemia. To explore whether benzene exposure has an effect on the expression of miR-221, a population based cross-sectional study was conducted in southern China, with 97 petrol station attendants as the exposure group and 103 general residents as the control group. Plasma benzene was analyzed by using GC∖MS. miR-221 in peripheral blood lymphocytes were measured by qRT-PCR and the ΔCt value for each sample was calculated by normalizing the Ct value for miR-221 with U6 RNA (i.e., ΔCt = CtmiR-221 - CtU6). Potential confounding factors were taken into account. Pearson correlation, univariate and multivariate logistic regression were performed in statistical analysis. The results showed that the air concentrations of benzene were significantly higher in petrol stations than in control sites (P < 0.05); The levels of benzene and miR-221 in exposure group were both significantly higher than in control group (P < 0.05) and there was a significant positive correlation between the two indexes (r = 0.851, P < 0.05); An association between benzene levels and the ΔCt values for miR-221 was identified by univariate and multivariate logistic analysis (OR 0.274; 95%CI 0.117, 0.396). Our investigation indicates that benzene exposure may be related to elevated miR-221 expression in human lymphocytes. PMID:26841344

  13. INSULIN RESISTANCE AND CAROTID ATHEROSCLEROSIS IN 221 PATIENTS WITH POTENTIAL HYPERGLYCEMIA

    Bo Yang; Tian-de Li; Jin-song Wang; Guang Zhi; Wen-sheng Jin; Yong Xu

    2005-01-01

    Objective To investigate the relationship between insulin resistance and carotid atherosclerosis in patients with potential hyperglycemia.Methods A total of 221 patients were recruited among those with potential hyperglycemia. All participants underwent physical examination, medical history interview, and 75 g oral glucose tolerance test. Venous blood was sampled for measurement of insulin and cholesterol levels. The intima-media thickness (IMT) in bilateral common carotid arteries was observed by B-mode ultrasound. Insulin resistance index was calculated by homeostasis model assessment (HOMA-IR).Subjects were stratified in quintiles according to HOMA-IR values. Risk factors and atherosclerotic parameters were analyzed.Results With HOMA-IR value increase, incidence of impaired glucose tolerance, diabetes mellitus, hypertension, and coronary artery disease increased, the levels of triglyceride (TG), low density lipoprotein cholesterol (LDL-C), fasting plasma glucose, 2 hour plasma glucose, and fasting insulin increased as well, while the level of high density lipoprotein cholesterol (HDL-C) decreased. Meanwhile, all atherosclerotic parameters increased. Multivariate regression analysis showed that TG, total cholesterol, HDL-C, LDL-C levels, and In(HOMA-IR) were related to IMT, hence were risk factors for IMT increase.Conchsion Insulin resistance is implicated in atherogenesis.

  14. MiR-221-inhibited adipose tissue-derived mesenchymal stem cells bioengineered in a nano-hydroxy apatite scaffold.

    Hoseinzadeh, Saghar; Atashi, Amir; Soleimani, Masoud; Alizadeh, Effat; Zarghami, Nosratollah

    2016-04-01

    The repair of skeletal defects is the main goal of bone tissue engineering. Recent literature highlighted various regulatory roles of microRNAs in stem cell fate determination. In addition, the role of porous hydroxyapatite/polycaprolacton (nHA/PCL) as a bioactive scaffold which enhances adipose tissue-derived mesenchymal stem cells (AT-MSCs) growth and osteogenic differentiation has been proved. The aim of the present study was to investigate the synergistic potential of both down-regulating miR-221 and nHA/PCL scaffold seeding in osteogenic potential of AT-MSCs. After isolation and characterization of AT-MSCs, the transfection of anti-miR-221 was performed into the cells using lipofectamine 2000 and the transfected cells were seeded into a synthesized nHA/PCL scaffold. The DAPI staining confirmed the presence of AT-MSCs on nHA/PCL scaffold. Quantitative expression of osteoblast marker genes, Runx2, and osteocalcin of the transfected cells in the scaffold were evaluated. Interestingly, significant upregulation of transcribed Runx2 and osteocalcin genes (P PCL seeded cells. Also, alkaline phosphatase activity (ALP) was significantly higher (P PCL than those seeded on nHA/PCL or transfected with anti-miR-221, individually. The results of this combination suggest a valuable method for enhancing osteogenesis in AT-MSCs. This method could be applicable for gene-cell therapy of bone defects. PMID:26822432

  15. Establishment and characterization of a new human myxoid liposarcoma cell line (DL-221) with the FUS-DDIT3 translocation.

    de Graaff, Marieke A; Yu, Jamie S E; Beird, Hannah C; Ingram, Davis R; Nguyen, Theresa; Juehui Liu, Jeffrey; Bolshakov, Svetlana; Szuhai, Károly; Åman, Pierre; Torres, Keila E; Lev, Dina; Nielsen, Torsten O; Bovée, Judith V M G; Lazar, Alexander J; Somaiah, Neeta

    2016-08-01

    Myxoid liposarcoma has the pathognomonic fusion oncogene FUS-DDIT3 encoding a chimeric transcription factor. Metastatic risk is higher with an increased round cell component and has been linked to aberrations involving the IGFR/PI3K/AKT pathway. These molecular insights have yet to translate to targeted therapies, and the lack of experimental models is a major hindrance. We describe the initial in-depth characterization of a new cell line (DL-221) and establishment of a mouse xenograft model. The cell line DL-221 was derived from a metastatic pleural lesion showing myxoid and round cell histology. This newly established cell line was characterized for phenotypic properties and molecular cytogenetic profile, using PCR, COBRA-FISH, and western blot. Next-generation whole-exome sequencing was performed to further characterize the cell line and the parent tumor. NOD-SCID-IL2R gamma knockout mice were xenograft hosts. DL-221 cells grew an adhering monolayer and COBRA-FISH showed an aneuploid karyotype with t(12;16)(q13;p11) and several other rearrangements; RT-PCR demonstrated a FUS-DDIT3 fusion transcript type 1. Both the cell line and the original tumor harbored a TP53 compound heterozygous mutation in exon 4 and 7, and were wild-type for PIK3CA. Moreover, among the 1254 variants called by whole-exome sequencing, there was 77% concordance between the cell line and parent tumor. The recently described hotspot mutation in the TERT promoter region in myxoid liposarcomas was also found at C228T in DL-221. Xenografts suitable for additional preclinical studies were successfully established in mice after subcutaneous injection. The established DL-221 cell line is the only published available myxoid liposarcoma cell line that underwent spontaneous immortalization, without requiring SV40 transformation. The cell line and its xenograft model are unique and helpful tools to study the biology and novel potential-targeted treatment approaches for myxoid liposarcoma. PMID:27270875

  16. The inhibition of the highly expressed miR-221 and miR-222 impairs the growth of prostate carcinoma xenografts in mice.

    Neri Mercatelli

    Full Text Available BACKGROUND: MiR-221 and miR-222 are two highly homologous microRNAs whose upregulation has been recently described in several types of human tumors, for some of which their oncogenic role was explained by the discovery of their target p27, a key cell cycle regulator. We previously showed this regulatory relationship in prostate carcinoma cell lines in vitro, underlying the role of miR-221/222 as inducers of proliferation and tumorigenicity. METHODOLOGY/PRINCIPAL FINDINGS: Here we describe a number of in vivo approaches confirming our previous data. The ectopic overexpression of miR-221 is able, per se, to confer a high growth advantage to LNCaP-derived tumors in SCID mice. Consistently, the anti-miR-221/222 antagomir treatment of established subcutaneous tumors derived from the highly aggressive PC3 cell line, naturally expressing high levels of miR-221/222, reduces tumor growth by increasing intratumoral p27 amount; this effect is long lasting, as it is detectable as long as 25 days after the treatment. Furthermore, we provide evidence in favour of a clinical relevance of the role of miR-221/222 in prostate carcinoma, by showing their general upregulation in patient-derived primary cell lines, where we find a significant inverse correlation with p27 expression. CONCLUSIONS/SIGNIFICANCE: These findings suggest that modulating miR-221/222 levels may have a therapeutic potential in prostate carcinoma.

  17. Synthesis, crystal structure and reactivity of (μ3-η2-7-oxabicyclo[2.2.1]hept-5-yn-2-one) nonacarbonyldihydridotriruthenium and (μ3-η2-7-oxabicyclo[2.2.1]hept-5-yn-2-one) hexacarbonyldihydridotris(triphenylphosphine)triruthenium

    The thermal reaction of Ru3(CO)12 with 7-oxabicyclo[2.2.1]hept-2-ene systems give ruthenium complexes. Single crystal diffraction studies are reported. Preliminary studies on the reactivity of these new clusters are described

  18. Regulation of the p27Kip1 tumor suppressor by miR-221 and miR-222 promotes cancer cell proliferation

    le Sage, Carlos; Nagel, Remco; Egan, David A; Schrier, Mariette; Mesman, Elly; Mangiola, Annunziato; Anile, Corrado; Maira, Giulio; Mercatelli, Neri; Ciafrè, Silvia Anna; Farace, Maria Giulia; Agami, Reuven

    2007-01-01

    MicroRNAs (miRNAs) are potent post-transcriptional regulators of protein coding genes. Patterns of misexpression of miRNAs in cancer suggest key functions of miRNAs in tumorigenesis. However, current bioinformatics tools do not entirely support the identification and characterization of the mode of action of such miRNAs. Here, we used a novel functional genetic approach and identified miR-221 and miR-222 (miR-221&222) as potent regulators of p27Kip1, a cell cycle inhibitor and tumor suppressor. Using miRNA inhibitors, we demonstrate that certain cancer cell lines require high activity of miR-221&222 to maintain low p27Kip1 levels and continuous proliferation. Interestingly, high levels of miR-221&222 appear in glioblastomas and correlate with low levels of p27Kip1 protein. Thus, deregulated expression of miR-221&222 promotes cancerous growth by inhibiting the expression of p27Kip1. PMID:17627278

  19. Knockdown of miR-221 promotes the cisplatin-inducing apoptosis by targeting the BIM-Bax/Bak axis in breast cancer.

    Ye, Zhiqiang; Hao, Rutian; Cai, Yefeng; Wang, Xiaobo; Huang, Guanli

    2016-04-01

    Accumulating evidence shows that microRNAs (miRNAs) have a critical role in the initiation and progression of types of human cancer, including breast cancer. Recent research indicated that miRNAs are also related with the chemotherapy on cancers. In this study, the expression of miR-221 in breast cancer (BC) patients' serum and cancer tissues was found to be significantly up-regulated. The results of in vitro MTT assay indicated that although the anti-miR-221 oligonucleotide alone did not influence the viability of BC cell lines markedly, it significantly promoted the cytotoxicity of cisplatin (DDP) to BC cells. Mechanistic studies demonstrated that the gene of BIM (Bcl-2 interacting mediator of cell death), a pro-apoptotic Bcl-2 family protein, was up-regulated by the knockdown of miR-221. We found that the synergetic effect of anti-miR-221 on increasing the sensitivity of MDA-MB-231 was BIM dependant. Furthermore, results of immunoprecipitation showed the up-regulated BIM directly combined with the Bax and Bak, leading to mitochondrial dysfunction. Our results suggest the anti-miR-221 could promote the cisplatin-inducing apoptosis by targeting the Bim-Bax/Bak axis in breast cancer. PMID:26503209

  20. Towards the Secrecy Capacity of the Gaussian MIMO Wire-tap Channel: The 2-2-1 Channel

    Shafiee, Shabnam; Ulukus, Sennur

    2007-01-01

    We find the secrecy capacity of the 2-2-1 Gaussian MIMO wire-tap channel, which consists of a transmitter and a receiver with two antennas each, and an eavesdropper with a single antenna. We determine the secrecy capacity of this channel by proposing an achievable scheme and then developing a tight upper bound that meets the proposed achievable secrecy rate. We show that, for this channel, Gaussian signalling in the form of beam-forming is optimal, and no pre-processing of information is necessary.

  1. Immunomodulatory effect of halophilic lactic acid bacterium Tetragenococcus halophilus Th221 from soy sauce moromi grown in high-salt medium.

    Masuda, Susumu; Yamaguchi, Hitomi; Kurokawa, Toshiko; Shirakami, Tomoyuki; Tsuji, Ryohei F; Nishimura, Ikuko

    2008-02-10

    A halophilic lactic acid bacterium, Tetragenococcus halophilus, was found to possess an immunomodulatory activity that promotes T helper type 1 (Th1) immunity in addition to its important roles in soy sauce brewing. Strain Th221 was selected from 151 strains isolated from soy sauce (shoyu) moromi, since it induced strong interleukin (IL)-12 production by mouse peritoneal macrophages in vitro. The relationship between the salt concentration in the medium and the IL-12 production-inducing activity of this strain was investigated, and the activity was found to be strong when the bacteria were grown in medium containing > or =10% (w/v) salt. The Th1-promoting activity was also manifested in an in vivo mouse study, since Th1-dependant contact sensitivity was augmented and Th2 immunity, as evaluated by specific immunoglobulin E production, was suppressed following oral ingestion of Th221. Based on these findings, Th221 administration may be useful for improving allergic symptoms. PMID:18061297

  2. MiR-221 promotes the development of androgen independence in prostate cancer cells via downregulation of HECTD2 and RAB1A

    Sun, T; Wang, X; He, HH; Sweeney, CJ; Liu, SX; Brown, M.; Balk, S.; Lee, G-SM; Kantoff, PW

    2013-01-01

    Hormone-sensitive prostate cancer typically progresses to castration resistant prostate cancer (CRPC) after the androgen deprivation therapy. We investigated the impact of microRNAs (miRs) in the transition of prostate cancer to CRPC. MiR-221/-222 was highly expressed in bone metastatic CRPC tumor specimens. We previously demonstrated that transient overexpression of miR-221/-222 in LNCaP promoted the development of the CRPC phenotype. In current study, we show that stably overexpressing miR-...

  3. miR-221/222 targets adiponectin receptor 1 to promote the epithelial-to-mesenchymal transition in breast cancer.

    Michael S Hwang

    Full Text Available The epithelial-to-mesenchymal transition (EMT is a highly conserved physiological program involved in development and tissue repair; however, its aberrant activation has been implicated in accelerating the progression of a variety of cancers. In breast cancer, the microRNAs (miRNAs miR-221 and miR-222 (miR-221/222 are differentially expressed in the clinically more aggressive basal-like subtype compared to luminal subtype of breast cancer and upregulation of miR-221/222 induces the EMT by targeting the 3' untranslated region (3'UTR of the GATA family transcriptional repressor TRPS1 (tricho-rhino-phalangeal syndrome type 1. The complete mechanism through which miR-221/222 promotes the EMT, however, is not fully understood. We identified adiponectin receptor 1 (ADIPOR1, a receptor for the adipocytokine adiponectin, as a direct target of miR-221/222. ADIPOR1 is expressed at higher levels in the luminal compared to the basal-like subtype of breast cancer cell lines, which can be reduced by miR-221/222 targeting of its 3'UTR. In addition, miR-221/222 were negatively correlated with ADIPOR1 expression across breast cancer cell lines and tumors. ADIPOR1 depletion by siRNA in MCF10A cells induced the EMT and increased cell invasion. Depletion of ADIPOR1 by siRNA induced activation of the canonical nuclear factor-kappaB (NF-κB and subsequent phosphorylation of signal transducer and activator of transcription 3 (STAT3 in an interleukin 6 (IL6-dependent manner. Finally, overexpression of ADIPOR1 in the basal-like cell line, MDA-MB-231, attenuated cell invasion and promoted the mesenchymal-to-epithelial transition (MET. We conclude that ADIPOR1 negatively regulates EMT in breast cancer and provides an additional node by which miR-221/222 induces the EMT. These results suggest that ADIPOR1 may play an important role in breast cancer progression and metastasis, and could potentially offer an alternative therapeutic strategy for basal-like breast cancer

  4. Regulation of the p27Kip1 tumor suppressor by miR-221 and miR-222 promotes cancer cell proliferation

    le Sage, Carlos; Nagel, Remco; Egan, David A.; Schrier, Mariette; Mesman, Elly; Mangiola, Annunziato; Anile, Corrado; Maira, Giulio; Mercatelli, Neri; Ciafrè, Silvia Anna; Farace, Maria Giulia; Agami, Reuven

    2007-01-01

    MicroRNAs (miRNAs) are potent post-transcriptional regulators of protein coding genes. Patterns of misexpression of miRNAs in cancer suggest key functions of miRNAs in tumorigenesis. However, current bioinformatics tools do not entirely support the identification and characterization of the mode of action of such miRNAs. Here, we used a novel functional genetic approach and identified miR-221 and miR-222 (miR-221&222) as potent regulators of p27Kip1, a cell cycle inhibitor and tumor suppresso...

  5. Up-regulation of miRNA-221 inhibits hypoxia/reoxygenation-induced autophagy through the DDIT4/mTORC1 and Tp53inp1/p62 pathways.

    Chen, Qiying; Zhou, Yue; Richards, A Mark; Wang, Peipei

    2016-05-20

    Timely reperfusion in acute myocardial infarction has improved clinical outcomes but the benefits are partially offset by ischemia-reperfusion injury (I/R). MiRNA regulates mRNA of multiple effectors within injury and survival cell signaling pathways. We have previously reported the protective effects of miRNA-221 in I/R injury. The purpose of this study was to explore the mechanisms underlying cardioprotection of miR-221. Myoblast H9c2 and neonatal rat ventricular myocytes (NRVM) were subjected to 0.2% O2 hypoxia followed by 2 h of re-oxygenation (H/R). In gain-and-loss function studies through transfections of miR-221 mimic (miR-221) and inhibitor (miR-221-i), the protective effects of miR-221 were confirmed as assessed by increased cell metabolic activity (WST-1) and decreased LDH release. Autophagy was assessed by GFP-LC3 labeling of autophagosome formation, LC3 and p62 measurements. Co-immuno-precipitation and specific gene cloning and function were used to identify the pathways underpinning miR-221 effects. MiR-221 significantly reduced H/R injury in association with inhibition of autophagy. Underlying mechanisms include (1) down-regulation of Ddit4 (disinhibiting the mTORC1/p-4EBP1 pathway) which inhibits autophagosome formation (2) down-regulation of Tp53inp1 (with reduced Tp53inp1/p62 complex formation) which inhibits autophagosome degradation. In conclusion, miRNA-221 exerts cytoprotective effects in hypoxia-reoxygenation injury in association with alterations in autophagic cell injury. Mir-221 may constitute is a novel therapeutic target in the treatment of cardiac I/R injury. PMID:27105917

  6. MiR-221 and -222-based therapeutic approach in melanoma and GIST (Gastrointestinal Stromal Tumor): in vitro and in vivo preclinical studies

    Micro RNAs (miRs) are small (∼22 nucleotides) non coding RNAs involved in gene expression, as negative regulators of specific mRNA targets. Growing evidences indicated miR functional roles in all the main biological processes, including cancer where they can act as oncogenes as well as tumor suppressor genes. Several studies reported the involvement of miR- 221 and -222 in the induction and/or progression of different neoplasias. We have analyzed miR-221/-222 functional role in a panel of differently staged melanoma cell lines and primary bioptic samples, showing their capabilities to regulate two distinct, but functionally convergent pathways of melanocyte transformation through the cell cycle inhibitor p27Kip and c-kit receptor. We also demonstrated the lack of the tumor suppressor gene PLZF as a direct cause of miR-221/-222 up regulation in melanoma cells. In vitro and, more important, in vivo studies confirmed that suppression of miR-221/-222 strongly reduced melanoma growth and dissemination

  7. A map of nuclear matrix attachment regions within the breast cancer loss-of-heterozygosity region on human chromosome 16q22.1

    Shaposhnikov, Sergey A.; Akopov, Sergey B.; Chernov, Igor P.;

    2007-01-01

    There is abundant evidence that the DNA in eukaryotic cells is organized into loop domains that represent basic structural and functional units of chromatin packaging. To explore the DNA domain organization of the breast cancer loss-of-heterozygosity region on human chromosome 16q22.1, we have id...

  8. Role of gga-miR-221 and gga-miR-222 during Tumour Formation in Chickens Infected by Subgroup J Avian Leukosis Virus

    Zhenkai Dai

    2015-12-01

    Full Text Available Subgroup J avian leukosis virus (ALV-J causes a neoplastic disease in infected chickens. Differential expression patterns of microRNAs (miRNAs are closely related to the formation and growth of tumors. (1 Background: This study was undertaken to understand how miRNAs might be related to tumor growth during ALV-J infection. We chose to characterize the effects of miR-221 and miR-222 on cell proliferation, migration, and apoptosis based on previous microarray data. (2 Methods: In vivo, the expression levels of miR-221 and miR-222 were significantly increased in the liver of ALV-J infected chickens (p < 0.01. Over-expression of gga-miR-221 and gga-miR-222 promoted the proliferation, migration, and growth of DF-1 cells, and decreased the expression of BCL-2 modifying factor (BMF making cells more resistant to apoptosis. (3 Results: Our results suggest that gga-miR-221 and gga-miR-222 may be tumour formation relevant gene in chicken that promote proliferation, migration, and growth of cancer cells, and inhibit apoptosis. BMF expression was significantly reduced in vivo 70 days after ALV-J infection. They may also play a pivotal role in tumorigenesis during ALV-J infection.

  9. Role of gga-miR-221 and gga-miR-222 during Tumour Formation in Chickens Infected by Subgroup J Avian Leukosis Virus.

    Dai, Zhenkai; Ji, Jun; Yan, Yiming; Lin, Wencheng; Li, Hongxin; Chen, Feng; Liu, Yang; Chen, Weiguo; Bi, Yingzuo; Xie, Qingmei

    2015-12-01

    Subgroup J avian leukosis virus (ALV-J) causes a neoplastic disease in infected chickens. Differential expression patterns of microRNAs (miRNAs) are closely related to the formation and growth of tumors. (1) BACKGROUND: This study was undertaken to understand how miRNAs might be related to tumor growth during ALV-J infection. We chose to characterize the effects of miR-221 and miR-222 on cell proliferation, migration, and apoptosis based on previous microarray data. (2) METHODS: In vivo, the expression levels of miR-221 and miR-222 were significantly increased in the liver of ALV-J infected chickens (p < 0.01). Over-expression of gga-miR-221 and gga-miR-222 promoted the proliferation, migration, and growth of DF-1 cells, and decreased the expression of BCL-2 modifying factor (BMF) making cells more resistant to apoptosis. (3) RESULTS: Our results suggest that gga-miR-221 and gga-miR-222 may be tumour formation relevant gene in chicken that promote proliferation, migration, and growth of cancer cells, and inhibit apoptosis. BMF expression was significantly reduced in vivo 70 days after ALV-J infection. They may also play a pivotal role in tumorigenesis during ALV-J infection. PMID:26690468

  10. Simulation of Microstructure Evolution of Ni75A12.9V22.1 Alloy with Progressive Aging Mechanisms

    Yongsheng LI; Zheng CHEN; Qingbo LAI; Yongxin WANG

    2008-01-01

    The interrupted aging mechanisms were applied to Ni75Al2.9V22.1 alloy by using the microscopic phase-field simulation method. For the single phase region existing at high temperature, the low content alloy was used as the study object. With the progressive aging mechanisms, the metastable phase γ' of high temperature can be obtained from the low temperature two phase regions, and the quantity of γ' phase reduces with increasing temperature. The θ single phase morphology at high temperature regions will turn to be the γ'+θ two phase morphology at low temperature with the interrupted aging method. Despite of the different precipitation paths of γ' phase, the precipitation mechanisms are the same for the low temperature aging and high temperature interrupted aging.

  11. Optimisation of cheese whey enzymatic hydrolysis and further continuous production of antimicrobial extracts by Lactobacillus plantarum CECT-221.

    Rodríguez-Pazo, Noelia; da Silva Sabo, Sabrina; Salgado-Seara, José Manuel; Arni, Saleh Al; de Souza Oliveira, Ricardo Pinheiro; Domínguez, José Manuel

    2016-08-01

    The enzymatic hydrolysis of cheese whey was optimised using the enzymes iZyme, Alcalase or Flavourzyme under different conditions. Hydrolysates supplemented with commercial nutrients were evaluated as fermentation broths to produce DL-3-Phenyllactic acid (PLA) from phenylalanine (Phe) by Lactobacillus plantarum CECT-221. Optimised hydrolysates were obtained using Flavourzyme at 50 °C and 100 rpm during 12 h, and assayed in 250 ml Erlenemyer flasks using different proportions of vinasses as economic nutrient. The process was then scaled up using a 2 litres Bioreactor working under the continuous modality. Under the intermediate dilution rate of 0·0207 h-1 0·81 ± 0·026 mM of PLA and 38·8 ± 3·253 g/l of lactic acid were produced. A final evaluation revealed that lactic acid, and bacteriocins exerted the highest inhibitory effect among the extracted components of cell-free supernatants. PMID:27600978

  12. Cardiomyocyte protection by GATA-4 gene engineered mesenchymal stem cells is partially mediated by translocation of miR-221 in microvesicles.

    Bin Yu

    Full Text Available INTRODUCTION: microRNAs (miRs, a novel class of small non-coding RNAs, are involved in cell proliferation, differentiation, development, and death. In this study, we found that miR-221 translocation by microvesicles (MVs plays an important role in cardioprotection mediated by GATA-4 overexpressed mesenchymal stem cells (MSC. METHODS AND RESULTS: Adult rat bone marrow MSC and neonatal rat ventricle cardiomyocytes (CM were harvested as primary cultures. MSC were transduced with GATA-4 (MSC(GATA-4 using the murine stem cell virus (pMSCV retroviral expression system. Empty vector transfection was used as a control (MSC(Null. The expression of miRs was assessed by real-time PCR and localized using in situ hybridization (ISH. MVs collected from MSC cultures were characterized by expression of CD9, CD63, and HSP70, and photographed with electron microscopy. Cardioprotection during hypoxia afforded by conditioned medium (CdM from MSC cultures was evaluated by lactate dehydrogenase (LDH release, MTS uptake by CM, and caspase 3/7 activity. Expression of miR-221/222 was significantly higher in MSC than in CM and miR-221 was upregulated in MSC(GATA-4. MSC overexpression of miR-221 significantly enhanced cardioprotection by reducing the expression of p53 upregulated modulator of apoptosis (PUMA. Moreover, expression of PUMA was significantly decreased in CM co-cultured with MSC. MVs derived from MSC expressed high levels of miR-221, and were internalized quickly by CM as documented in images obtained from a Time-Lapse Imaging System. CONCLUSIONS: Our results demonstrate that cardioprotection by MSC(GATA-4 may be regulated in part by a transfer of anti-apoptotic miRs contained within MVs.

  13. HIV-1逆转录酶H221Y突变对Y181C突变株复制能力影响研究%Impact of HIV-1 reverse transcriptase H221Y mutation on replication capacity of Y181C mutant viral strain

    殷丽丽; 韩晓旭; 赵彬; 张旻; 安明晖; 吉阳涛; 欧阳金鸣; 尚红

    2013-01-01

    Objective To explore the development of Y181C and H221Y mutations among HIV-1 infected patients upon antiretroviral therapy in China and to investigate the impact of H221Y mutation on replication capacity of Y181C mutant.Methods Three HIV-1 subtype B' infected patients with Y181C and H221Y mutations upon highly active antiretroviral therapy from Henan province were enrolled in this study.Follow-up blood samples collected every six months from the patients after therapy between 2004 to 2006 were detected for viral load evaluation.Fragments of pol gene were amplified by nested PCR.The purified PCR products were ligated into pMD18-T vector to construct recombinant plasmids,which were further sequenced and compared with the HIV reference strain from Stanford HIVDB for analyzing the development of Y181C and H221Y mutations.Plasmids containing Y181C mutation alone and plasmids containing Y181C and H221Y double mutations were constructed and cotransfected respectively with envelope-expression plasmid pVSV-G into HEK 293T cells to obtain HIV-1 pseudotyped viruses.Replication capacity of each pseudotyped virus was analyzed after a single-cycle infection in TZM-bl cells.Results A total of 57 TA cloned sequences from six follow-up blood samples of three patients were obtained.Y181C mutation alone was found in 46 clones and Y181C and H221Y mutations were found in 35 clones.Moreover,H221Y mutation was only found in clones in which Y181C mutation had already developed.Between two pairs of pseudotyped virus from two patients,replication capacity of those viruses containing Y181C and H221Y mutations were 1.42 and 1.62 fold higher than the viruses containing Y181C mutation alone,respectively.Conclusion H221Y mutation might be a compensatory mutation of Y181C mutation occurred to improve the replication capacity of viral strains with Y181C mutant in HIV-1 subtype B' infected patients upon antiretroviral therapy.The finding suggests that it's significantly important to further

  14. AP2α controls the dynamic balance between miR-126&126* and miR-221&222 during melanoma progression

    Felli, N; Errico, M C; Pedini, F; Petrini, M; Puglisi, R; Bellenghi, M; Boe, A; Felicetti, F; Mattia, G; De Feo, A; Bottero, L; Tripodo, C; Carè, A

    2016-01-01

    Accumulating evidences have shown the association between aberrantly expressed microRNAs (miRs) and cancer, where these small regulatory RNAs appear to dictate the cell fate by regulating all the main biological processes. We demonstrated the responsibility of the circuitry connecting the oncomiR-221&222 with the tumor suppressors miR-126&126* in melanoma development and progression. According to the inverse correlation between endogenous miR-221&222 and miR-126&126*, respectively increasing or decreasing with malignancy, their enforced expression or silencing was sufficient for a reciprocal regulation. In line with the opposite roles of these miRs, protein analyses confirmed the reverse expression pattern of miR-126&126*-targeted genes that were induced by miR-221&222. Looking for a central player in this complex network, we revealed the dual regulation of AP2α, on one side directly targeted by miR-221&222 and on the other a transcriptional activator of miR-126&126*. We showed the chance of restoring miR-126&126* expression in metastatic melanoma to reduce the amount of mature intracellular heparin-binding EGF like growth factor, thus preventing promyelocytic leukemia zinc finger delocalization and maintaining its repression on miR-221&222 promoter. Thus, the low-residual quantity of these two miRs assures the release of AP2α expression, which in turn binds to and induces miR-126&126* transcription. All together these results point to an unbalanced ratio functional to melanoma malignancy between these two couples of miRs. During progression this balance gradually moves from miR-126&126* toward miR-221&222. This circuitry, besides confirming the central role of AP2α in orchestrating melanoma development and/or progression, further displays the significance of these miRs in cancer and the option of utilizing them for novel therapeutics. PMID:26434590

  15. Acceptable Knowledge Summary Report for Waste Stream: SR-T001-221F-HET/Drums

    Lunsford, G.F.

    1998-10-26

    Since beginning operations in 1954, the Savannah River Site FB-Line produced Weapons Grade Plutonium for the United States National Defense Program. The facility mission was mainly to process dilute plutonium solution received from the 221-F Canyon into highly purified plutonium metal. As a result of various activities (maintenance, repair, clean up, etc.) in support of the mission, the facility generated a transuranic heterogeneous debris waste stream. Prior to January 25, 1990, the waste stream was considered suspect mixed transuranic waste (based on potential for inclusion of F-Listed solvent rags/wipes) and is not included in this characterization. Beginning January 25, 1990, Savannah River Site began segregation of rags and wipes containing F-Listed solvents thus creating a mixed transuranic waste stream and a non-mixed transuranic waste stream. This characterization addresses the non-mixed transuranic waste stream packaged in 55-gallon drums after January 25, 1990.Characterization of the waste stream was achieved using knowledge of process operations, facility safety basis documentation, facility specific waste management procedures and storage / disposal records. The report is fully responsive to the requirements of Section 4.0 "Acceptable Knowledge" from the WIPP Transuranic Waste Characterization Quality Assurance Plan, CAO-94-1010, and provides a sound, (and auditable) characterization that satisfies the WIPP criteria for Acceptable Knowledge.

  16. Localization of a human homolog of the mouse Tiam-1 gene to chromosome 21q22.1

    Haiming Chen; Antonarakis, S.E. [Univ. of Geneva Medical School (Switzerland)

    1995-11-01

    Exon trapping was applied to genomic DNA from a chromosome 21-specific cosmid library (LL21NC02-Q) to clone portions of genes from this chromosome. Among a large number of trapped exons, three showed striking homology to different regions of the cDNA for the mouse T-lymphoma invasion and metastasis gene (Tiam-1) at both nucleotide and predicted amino acid sequence levels, suggesting that these three exons are part of a human homolog of the mouse Tiam-1 gene. We mapped this presumed human TIAM1 gene to chromosome 21 by using appropriate somatic cell hybrids, YACs, and cosmids. The TIAM1 gene localizes to YAC 760H5 of the I. Chumakov et al. YAC contig between markers D21S298 and D21S404 in band 21q22.1. This human gene (which is a member of the group of guanine nucleotide-dissociation stimulators that modulate the activity of Rho-like proteins) may be important in the development or metastasis of malignancies that are associated with abnormalities on chromosome 21, including the various forms of leukemia frequent in trisomy 21. 25 refs., 2 figs.

  17. Induction of resistance to rice tungro virus disease in rice cultivar Pusa 2-21 through irradiation

    The dry seeds of Pusa 2-21, a moderately resistant rice cultivar, were subjected to 10, 15 and 20 Krad (dose rate 12.3 Krad/min) radiation dosages of gamma rays to induce resistance against rice tungro virus disease. The height of M1 seedling was significantly reduced in 15 and 20 Krad treatments. However, there was no effect of gamma irradiation on seed germination. A limited population of M2 and M3 generation was screened at the rate of 3 viruliferous leafhoppers/seedling using single plant caging technique. In M2 generation 22.0, 17.6 and 25.0 percent seedlings exhibited green colour (symptomless) representing resistant reaction to the disease in 10, 15 and 20 Krad treatments, respectively. Out of 1470 seedlings in M3 generation, 2.7 percent seedlings showing no symptoms of tungro could be isolated indicating the possibility of inducing higher degree of resistance than that of the parent to RTV through irradiation for the first time. (auth.)

  18. The effects of CO2 and O3 singly and in-combination on Malaysia rice cultivar (MR 221)

    The continuous burning of fossil fuel and rapid development of industrialization have increase the atmospheric Carbon dioxide (CO2) and tropospheric Ozone (03). The profound effects of the rising CO, and 03 in the tropospheric environment on the plants have been acknowledged due to the combination effects of CO, and 03 on plants. The seedling rice (Oryza sativa) of Malaysian cultivar (MR221) were exposed to four types of treatments namely 350 ppm C02 and 10 ppb 03 conditions, 660 ppm C02 and 10 ppb 03, and 350 ppm CO, and 33 ppb 03. The seedlings were exposed to these conditions 6 hours per day from 0900 to 1500 hours for 5 days per week for more than three months. The objectives of this study was to determine the direct effects of elevated CO, and 03 enhancement on physiological aspects and growth performances of rice. The results indicated that there was a progressive stimulation in photosynthesis of seedlings exposed to elevated C02 indicates by doubling of Pmax. Results of the growth performances showed that there were no consistent effects of ozone on plant height and tillering which differ from other related studies. (Author)

  19. The investigation of the decay of the deformed 167Yb, 164Tm, 225Ac, 221Fr nuclei. Beta-spectrograph with positional-sensitive detector

    The decay of the deformed 167Yb, 164Tm, 225Ac,221Fr nuclei is investigated in this work. For 167Yb and 164Tm decays the specters of the conversion electrons were measured. 32 γ-transitions were found for 167 Yb decay, 6 of which were found for the first time. The multipolarities for 9 γ-transitions were found. For 164Tm decay 23 new γ-transitions were found. The theoretical investigations of the collective states in the nucleus were carried out. Octupole-rotatory line with k=1- was found in the measurement of conversion electrons specters of the short-life nuclei. Device' nonlinearity was 0,04%. Resolution was Δβρ/βρ 0,11%. Effective light yield was 1-2 %. The decay of 225Ac and 221Fr nuclei were investigated. The investigations of α-γ -coincidence, α-γ - rays were carried out. 24 new γ -transitions for 225Ac and 13 ones for 221Fr were found. The new levels and their intensities were defined more precisely. Intensity balance calculations were carried out and the full populations of the nuclear levels were calculated. (author). 3 tabs.; 10 figs

  20. A Pumilio-induced RNA structure switch in p27-3' UTR controls miR-221 and miR-222 accessibility.

    Kedde, Martijn; van Kouwenhove, Marieke; Zwart, Wilbert; Oude Vrielink, Joachim A F; Elkon, Ran; Agami, Reuven

    2010-10-01

    Key regulators of 3' untranslated regions (3' UTRs) are microRNAs and RNA-binding proteins (RBPs). The p27 tumour suppressor is highly expressed in quiescent cells, and its downregulation is required for cell cycle entry after growth factor stimulation. Intriguingly, p27 accumulates in quiescent cells despite high levels of its inhibitors miR-221 and miR-222 (Refs 5, 6). Here we show that miR-221 and miR-222 are underactive towards p27-3' UTR in quiescent cells, as a result of target site hindrance. Pumilio-1 (PUM1) is a ubiquitously expressed RBP that was shown to interact with p27-3' UTR. In response to growth factor stimulation, PUM1 is upregulated and phosphorylated for optimal induction of its RNA-binding activity towards the p27-3' UTR. PUM1 binding induces a local change in RNA structure that favours association with miR-221 and miR-222, efficient suppression of p27 expression, and rapid entry to the cell cycle. We have therefore uncovered a novel RBP-induced structural switch modulating microRNA-mediated gene expression regulation. PMID:20818387

  1. 南宁地区221株淋球菌对青霉素、壮观霉素的敏感性测定%Sensitivity test of 221 Neisseria gonorrhoeae strains in Nanning to penicillin and spectinomycin

    李伟; 赵秀梅; 覃善列; 唐桂林

    2001-01-01

    目的:了解南宁地区淋球菌对青霉素、壮观霉素的敏感性。方法:我们于1996年至1999年对221株淋球菌临床分离株以琼脂稀释法测定青霉素、壮观霉素的最小抑菌浓度(MIC)。结果:7株(3.17%)为产青霉素酶淋球菌(PPNG)。青霉素MIC范围为0.008~16mg/L;2.71%菌株对青霉素敏感,36.20%为低敏,61.09%为耐药。其中1996至1999年各年耐药率分别为23.92%、37.10%、89.16%、90.00%。壮观霉素MIC范围2~>128mg/L;92.76%菌株对壮观霉素敏感,7.24%菌株为耐药;1999年未发现耐壮观霉素菌株。结论:南宁地区淋球菌对青霉素耐药比率较高,且呈逐年上升趋势。出现了耐壮观霉素的菌株。持续性监测青霉素、壮观霉素对临床合理用药十分重要。%Objective: To measure the susceptibility of Neisseria gonorrhoeae to penicillin and spetinomycin in Nan ning. Methods:221 clinical isolates of Neisseria gonokrrhoeae abtained from patients with gonorrhea in Nanning were tesed for their susceptiblities to penicillin and spectinomycin in vitro. The mininum inhibitory concentrations (MIC) of penicillin and spectinomycin were determined by agar dilution method. Rusults: 7 strains (3.17%) were penicilinase producers (PPNG). The MIC ranges were from 0.008mg/L to 16mg/L for Penicillin. 2.71% of the isolates were susceptible to penicillin,36.20% were less sensitive; 61.09% exhibited resistance to penicillin. The prevalence of resistant gonococci every year was 23.92%, 37.1%, 89.16%, 90% respectively in 1996~1999. The MIC ranges were from 2mg/L to>128mg/L for spectinomycin.92.76% of the isolates were susceptible to spectinomycin, 7.24% exhibited resistance to spectinomycin. None of the isolates were detected to be resistant of spectinomycin in 1999. Conclusion: A high proportion of goncoccal isolates remain resistant to penicillin, with the emergence of spectinomycin resistance strains in Nanning. For the

  2. Early-Onset Multiple Sclerosis in Isfahan, Iran: Report of the Demographic and Clinical Features of 221 Patients.

    Etemadifar, Masoud; Nourian, Sayed-Mohammadamin; Nourian, Niloofaralsadat; Abtahi, Seyed-Hossein; Sayahi, Farnaz; Saraf, Zahra; Fereidan-Esfahani, Mahboobeh

    2016-06-01

    It is estimated that early-onset multiple sclerosis multiple sclerosis (early-onset multiple sclerosis) approximately incorporates 3-5% of the multiple sclerosis population. In this report on early-onset multiple sclerosis, the authors aimed to define demographic, clinical and imaging features in a case-series of true-childhood multiple sclerosis and to compare its characteristics with juvenile multiple sclerosis. The authors inspected the records of multiple sclerosis patients who were registered by Isfahan MS Society. Clinical and demographic data of children with less than 16 years of age were reviewed retrospectively. Out of 4536 multiple sclerosis patients referred to the authors' center, 221 patients (4.8%) had multiple sclerosis starting at the age of 16 or less (11 true-childhood multiple sclerosis vs 210 juvenile-onset multiple sclerosis); the female to male ratio was 4.81:1. In the mean follow-up period of 6.2 years, 22 patients (10.5%) had positive family history of multiple sclerosis, 196 (88.6%) patients were classified as relapsing-remitting multiple sclerosis, the mean (± SD Expanded Disability Status Scale) was 1.5 ± 1.1 at the last evaluation. The most common initial presentation was optic nerve involvement (36.1%) and cerebellar sign and symptoms (14.6%). In all, 13 patients (5.8%) had experienced seizure in the course of multiple sclerosis. This study indicated that early-onset multiple sclerosis is not rare condition and overwhelmingly affects girls even at prepubertal onset. Physicians should consider multiple sclerosis in suspicious pediatric cases. PMID:26979097

  3. Influence on the interaction by functional groups in some series of bicyclo (2,2,1) heptane derivatives

    In connection with investigations involving the interactions of substituted groups in the bicyclo (2,2,1) heptane molecules, the chemical reactivity and some physical properties of polyfunctional compounds have been studied. A new method for preparation of β-fenchylic derivatives is presented, the first described terpenic nitroxide radical have been prepared from oxazolidinic compounds. The stereochemistry of the base induced elimination reaction of 6-exo tosyl and 6-endo tosyl oxy epi-camphor is dependent of the geometry of these compounds. On the other hand, the results indicate that the most important part of the structure is the position of the carbonyl group. Tricyclenic and camphenic derivatives are obtained with different rates. An explanation for these results involve several possible basic abstractions of acid protons, and the competition between these different reactions. The oxazolidinic compounds are obtained by reacting 2-amino 2-methyl 1-propanol with norcamphor and norbornane-2,5 dione. The geometrical configuration of the different stereoisomers is deduced from the measured dipolar interaction parameter D. The cotton effects of the γ-diketones do not show any interaction between the two carbonyl groups, in the fenchylic and bornylic series. The two carbonyl bond angles of the substituted α-diketones do not seem to be sensitive to any substitution of an alkoxy group. So, a new quadrant rule is proposed; compatible results are obtained, except for a methyl group in the α position. At least, PMR studies of terpenic polyfunctional compounds demonstrate the influence of the substitution on the geometry of the carbon skeleton. A new coupling constant 4JHH is examined. (author)

  4. Isolation and characterization of a novel cold-adapted esterase, MtEst45, from Microbulbifer thermotolerans DAU221

    Yong-Suk eLee

    2016-03-01

    Full Text Available A novel esterase, MtEst45, was isolated from a fosmid genomic library of Microbulbifer thermotolerans DAU221. The encoding gene is predicted to have a mass of 45,564 Da and encodes 495 amino acids, excluding a 21 amino acid signal peptide. MtEst45 showed a low amino acid identity (approximately 23–24% compared with other lipolytic enzymes belonging to Family III, a closely related bacterial lipolytic enzyme family. MtEst45 also showed a conserved GXSXG motif, G131IS133YG135, which was reported as active site of known lipolytic enzymes, and the putative catalytic triad composed of D237 and H265. Because these mutants of MtEst45, which was S133A, D237N, and H265L, had no activity, these catalytic triad essential for the enzyme catalysis. MtEst45 was overexpressed in Escherichia coli BL21 (DE3 and purified via His-tag affinity chromatography. The optimal pH and temperature of MtEst45 were estimated to be 8.17 and 46.27°C by response surface methodology, respectively. Additionally, MtEst45 was also active between 1–15°C. The optimal hydrolysis substrate for MtEst45 among p-nitrophenyl esters (C2–C18 was p-nitrophenyl butyrate, and the Km and Vmax values were 0.0998 mM and 550 μmol/min/mg of protein, respectively. MtEst45 was strongly inhibited by Hg2+, Zn2+, and Cu2+ ions; by phenylmethanesulfonyl fluoride; and by β-mercaptoethanol. Ca2+ did not affect the enzyme’s activity. These biochemical properties, sequence identity, and phylogenetic analysis suggest that MtEst45 represents a novel and valuable bacterial lipolytic enzyme family and is useful for biotechnological applications.

  5. Rocky or Not, Here We Come: Further Revealing the Internal Structures of K2-21b+c Through Transit Timing

    Stevenson, Kevin; Bean, Jacob; Dragomir, Diana; Fabrycky, Daniel; Kreidberg, Laura; Mills, Sean; Petigura, Erik

    2016-08-01

    The provenance of planets 1.5 - 2 times the size of the Earth is one of the biggest unresolved mysteries from the Kepler mission. Determining the nature and origins of these exoplanets relies not only on measuring their radii, but also requires knowledge about their masses, atmospheric compositions, and interior structures. With this information, we can more confidently estimate planet mass distributions from measured radii, distinguish between rocky and non-rocky compositions, and better constrain the occurrence rate of Earth-like planets. Last year, Co-I Petigura announced the discovery of a two-transiting-planet system, K2-21, with bodies of 1.6 and 1.9 Earth-radii. The latter is expected to have a volatile-rich atmosphere, but the former lies squarely on the rocky/non-rocky composition boundary. These exoplanets orbit their relatively bright, nearby M dwarf parent star in a near 5:3 resonance and, based on our successful Spitzer observations, exhibit measurable transit timing variations (TTVs). Complete knowledge about their interactions will reveal constraints on the planets' masses, which is important because significant stellar activity makes RV mass measurements impractical. We propose to continue measuring precise transit times of K2-21b and K2-21c with Spitzer and combine that information with existing K2 timing constraints to determine their masses. Understanding the planets' masses is a critical, first step to ultimately determining their atmospheric compositions and internal structures. These planets will provide an excellent test to current statistical arguments that suggest there is a turning point in composition from rocky, true-to-name super-Earths to volatile-rich sub-Neptunes in the range of 1.5 - 2 Earth-radii.

  6. Rocky or Not, Here We Come: Revealing the Internal Structures of K2-21b+c Through Transit Timing

    Stevenson, Kevin; Bean, Jacob; Dragomir, Diana; Fabrycky, Daniel; Kreidberg, Laura; Mills, Sean; Petigura, Erik

    2015-10-01

    The provenance of planets 1.5 -- 2 times the size of the Earth is one of the biggest unresolved mysteries from the Kepler mission. Determining the nature and origins of these exoplanets relies not only on measuring their radii, but also requires knowledge about their masses, atmospheric compositions, and interior structures. With this information, we can more confidently estimate planet mass distributions from measured radii, distinguish between rocky and non-rocky compositions, and better constrain the occurrence rate of Earth-like planets. Co-I Petigura recently announced the discovery of a two-transiting-planet system, K2-21, with bodies of 1.6 and 1.9 Earth-radii. The latter is expected to have a volatile-rich atmosphere, but the former lies squarely on the rocky/non-rocky composition boundary. These exoplanets orbit their relatively bright, nearby M dwarf parent star in a near 5:3 resonance and likely exhibit transit timing variations (TTVs) that can be resolved by Spitzer. Knowledge about their TTVs, in turn, will reveal constraints on the planets' masses, which is important because significant stellar activity makes RV mass measurements impractical. We propose to measure precise transit times of K2-21b and K2-21c with Spitzer and combine that information with existing K2 timing constraints to determine their masses. Understanding the planets' masses is a critical, first step to ultimately determining their atmospheric compositions and internal structures. These planets will provide an excellent test to current statistical arguments that suggest there is a turning point in composition from rocky, true-to-name super-Earths to volatile-rich sub-Neptunes in the range of 1.5 -- 2 Earth-radii.

  7. NF-kB and c-Jun induce the expression of the oncogenic miR-221 and miR-222 in prostate carcinoma and glioblastoma cells

    Galardi, Silvia; Mercatelli, Neri; Farace, Maria G.; Ciafrè, Silvia A.

    2011-01-01

    MicroRNAs (miRNAs) are potent negative regulators of gene expression involved in all aspects of cell biology. They finely modulate virtually all physiological pathways in metazoans, and are deeply implicated in all main pathologies, among which cancer. Mir-221 and miR-222, two closely related miRNAs encoded in cluster from a genomic region on chromosome X, are strongly upregulated in several forms of human tumours. In this work, we report that the ectopic modulation of NF-kB modifies miR-221/222 expression in prostate carcinoma and glioblastoma cell lines, where we had previously shown their oncogenic activity. We identify two separate distal regions upstream of miR-221/222 promoter which are bound by the NF-kB subunit p65 and drive efficient transcription in luciferase reporter assays; consistently, the site-directed mutagenesis disrupting p65 binding sites or the ectopical inhibition of NF-kB activity significantly reduce luciferase activity. In the most distal enhancer region, we also define a binding site for c-Jun, and we show that the binding of this factor cooperates with that of p65, fully accounting for the observed upregulation of miR-221/222. Thus our work uncovers an additional mechanism through which NF-kB and c-Jun, two transcription factors deeply involved in cancer onset and progression, contribute to oncogenesis, by inducing miR-221/222 transcription. PMID:21245048

  8. NF-kB and c-Jun induce the expression of the oncogenic miR-221 and miR-222 in prostate carcinoma and glioblastoma cells.

    Galardi, Silvia; Mercatelli, Neri; Farace, Maria G; Ciafrè, Silvia A

    2011-05-01

    MicroRNAs (miRNAs) are potent negative regulators of gene expression involved in all aspects of cell biology. They finely modulate virtually all physiological pathways in metazoans, and are deeply implicated in all main pathologies, among which cancer. Mir-221 and miR-222, two closely related miRNAs encoded in cluster from a genomic region on chromosome X, are strongly upregulated in several forms of human tumours. In this work, we report that the ectopic modulation of NF-kB modifies miR-221/222 expression in prostate carcinoma and glioblastoma cell lines, where we had previously shown their oncogenic activity. We identify two separate distal regions upstream of miR-221/222 promoter which are bound by the NF-kB subunit p65 and drive efficient transcription in luciferase reporter assays; consistently, the site-directed mutagenesis disrupting p65 binding sites or the ectopical inhibition of NF-kB activity significantly reduce luciferase activity. In the most distal enhancer region, we also define a binding site for c-Jun, and we show that the binding of this factor cooperates with that of p65, fully accounting for the observed upregulation of miR-221/222. Thus our work uncovers an additional mechanism through which NF-kB and c-Jun, two transcription factors deeply involved in cancer onset and progression, contribute to oncogenesis, by inducing miR-221/222 transcription. PMID:21245048

  9. A ±6 ms-Accuracy, 0.68 mm2, and 2.21 μW QRS Detection ASIC

    Sheng-Chieh Huang; Hui-Min Wang; Wei-Yu Chen

    2012-01-01

    Healthcare issues arose from population aging. Meanwhile, electrocardiogram (ECG) is a powerful measurement tool. The first step of ECG is to detect QRS complexes. A state-of-the-art QRS detection algorithm was modified and implemented to an application-specific integrated circuit (ASIC). By the dedicated architecture design, the novel ASIC is proposed with 0.68 mm2 core area and 2.21 μW power consumption. It is the smallest QRS detection ASIC based on 0.18 μm technology. In addition, the sen...

  10. Role of gga-miR-221 and gga-miR-222 during Tumour Formation in Chickens Infected by Subgroup J Avian Leukosis Virus

    Zhenkai Dai; Jun Ji; Yiming Yan; Wencheng Lin; Hongxin Li; Feng Chen; Yang Liu; Weiguo Chen; Yingzuo Bi; Qingmei Xie

    2015-01-01

    Subgroup J avian leukosis virus (ALV-J) causes a neoplastic disease in infected chickens. Differential expression patterns of microRNAs (miRNAs) are closely related to the formation and growth of tumors. (1) Background: This study was undertaken to understand how miRNAs might be related to tumor growth during ALV-J infection. We chose to characterize the effects of miR-221 and miR-222 on cell proliferation, migration, and apoptosis based on previous microarray data. (2) Methods: In vivo, the ...

  11. Down regulation of NLK by MIR-221/222 modulates chemosensitivity to glucocorticoids in pediatric normal karyotype b-cell precursor acute lymphoblastic leukemia. La downregolazione di nemo-like kinase indotta dai MIR-221/222 modula chemiosensibilità ai glucocorticoidi nella pediatrico b-cell precursor leucemia linfattica acuta

    Koh,

    2012-01-01

    Normal karyotype pediatric B-cell precursor ALL patients are heterogeneous with respect to chemotherapy response, relapse rates and prognosis and the reason is unknown. These patients are treated with a standard protocol, and stratified using MRD methodology that shows they have variable responses and predicted outcomes. This study aims to determine the reasons behind such heterogeneity. This study shows that through miRNA profiling, miR-221/222 are differentially expressed in normal karyotyp...

  12. A map of nuclear matrix attachment regions within the breast cancer loss-of-heterozygosity region on human chromosome 16q22.1.

    Shaposhnikov, Sergey A; Akopov, Sergey B; Chernov, Igor P; Thomsen, Preben D; Joergensen, Claus; Collins, Andrew R; Frengen, Eirik; Nikolaev, Lev G

    2007-03-01

    There is abundant evidence that the DNA in eukaryotic cells is organized into loop domains that represent basic structural and functional units of chromatin packaging. To explore the DNA domain organization of the breast cancer loss-of-heterozygosity region on human chromosome 16q22.1, we have identified a significant portion of the scaffold/matrix attachment regions (S/MARs) within this region. Forty independent putative S/MAR elements were assigned within the 16q22.1 locus. More than 90% of these S/MARs are AT rich, with GC contents as low as 27% in 2 cases. Thirty-nine (98%) of the S/MARs are located within genes and 36 (90%) in gene introns, of which 15 are in first introns of different genes. The clear tendency of S/MARs from this region to be located within the introns suggests their regulatory role. The S/MAR resource constructed may contribute to an understanding of how the genes in the region are regulated and of how the structural architecture and functional organization of the DNA are related. PMID:17188460

  13. NF-kB and c-Jun induce the expression of the oncogenic miR-221 and miR-222 in prostate carcinoma and glioblastoma cells

    Galardi, Silvia; Mercatelli, Neri; Farace, Maria G.; Ciafrè, Silvia A.

    2011-01-01

    MicroRNAs (miRNAs) are potent negative regulators of gene expression involved in all aspects of cell biology. They finely modulate virtually all physiological pathways in metazoans, and are deeply implicated in all main pathologies, among which cancer. Mir-221 and miR-222, two closely related miRNAs encoded in cluster from a genomic region on chromosome X, are strongly upregulated in several forms of human tumours. In this work, we report that the ectopic modulation of NF-kB modifies miR-221/...

  14. A new hemoglobin variant: Hb Meylan [β73(E17)Asp → Phe; HBB: c.220G>T; c.221A>T] with a double base mutation at the same codon.

    Renoux, Céline; Feray, Cécile; Joly, Philippe; Zanella-Cleon, Isabelle; Garcia, Caroline; Lacan, Philippe; Couprie, Nicole; Francina, Alain

    2015-01-01

    We report a new β-globin chain variant: Hb Meylan [β73(E17)Asp → Phe; HBB: c.220G>T; c.221A>T]. The new variant results from a double nucleotide mutation at the same codon. The possible molecular mechanisms are discussed. PMID:25476778

  15. Catalytic formal [2+2+1] synthesis of pyrroles from alkynes and diazenes via TiII/TiIV redox catalysis

    Gilbert, Zachary W.; Hue, Ryan J.; Tonks, Ian A.

    2016-01-01

    Pyrroles are structurally important heterocycles. However, the synthesis of polysubstituted pyrroles is often challenging. Here, we report a multicomponent, Ti-catalysed formal [2+2+1] reaction of alkynes and diazenes for the oxidative synthesis of penta- and trisubstituted pyrroles: a nitrenoid analogue to classical Pauson-Khand-type syntheses of cyclopentenones. Given the scarcity of early transition-metal redox catalysis, preliminary mechanistic studies are presented. Initial stoichiometric and kinetic studies indicate that the mechanism of this reaction proceeds through a formally TiII/TiIV redox catalytic cycle, in which an azatitanacyclobutene intermediate, resulting from [2+2] alkyne + Ti imido coupling, undergoes a second alkyne insertion followed by reductive elimination to yield pyrrole and a TiII species. The key component for catalytic turnover is the reoxidation of the TiII species to a TiIV imido via the disproportionation of an η2-diazene-TiII complex.

  16. Synthesis, crystal structures, and properties of lanthanoid(III) complexes with 7-oxa-bicyclo[2.2.1]heptane-2,3-dicarboxylic acid

    The synthesis of coordination compounds [ML(HL)(H2O)] with M=La3+, Ce3+, Pr3+, Nd3+ and H2L=7-Oxa-bicyclo[2.2.1]heptane-2-exo,3-cis-dicarboxylic acid (1) has been described. Results of IR spectroscopy and thermal decomposition are given. As a result of X-ray analyses, the four investigated lanthanoid(III) complexes are isotypic. Their stereochemistry approximates to the tri-capped trigonal prism with nine O atoms coordinating the metal atom. The bicyclic ligand acts as a tridentate chelating monoanion HL- as well as a pentadentate dianion L2-with both chelating and bridging function. One coordination place at the metal atom is occupied by a water molecule. (orig.)

  17. Pressure dependence of the stereoselectivity in the photodenitrogenation of diazabicyclo[2.2.1]hept-2-ene in supercritical fluids: evidence for the diazenyl diradical

    Adam, Waldemar; Diedering, Manfred; Trofimov, Alexei V.

    2001-12-01

    The present study shows that the preference for the stereoselective inversion upon the photolytic nitrogen extrusion from the stereolabeled DBH derivative exo-d 2-diazabicyclo[2.2.1]heptene ( 1) in supercritical media (sc-CO 2, sc-C 2H 6) depends on pressure. The increase of pressure up to 200 bar leads to ca. 2.3-fold decrease of the stereoselectivity ( kinv/ kret ratio) in sc-CO 2 and sc-C 2H 6. Analysis of the observed pressure dependence in terms of collisional (self-diffusion coefficient) and frictional (viscosity) effects discloses that frictional impositions by the fluid media account best for the experimental observations reported herein. This pressure-dependent viscosity effect is consistent with a stepwise denitrogenation mechanism for the photolysis of DBH in the supercritical phase, which proceeds through an unsymmetrical, nitrogen-containing transient, namely the singlet diazenyl diradical.

  18. A Rare Interstitial Duplication of 8q22.1–8q24.3 Associated with Syndromic Bilateral Cleft Lip/Palate

    Regina Ferreira Rezek

    2014-01-01

    Full Text Available We present a rare case of 8q interstitial duplication derived from maternal balanced translocations in a patient with bilateral cleft lip and palate in syndromic form associated with other congenital malformations. G-banding cytogenetic analysis revealed a chromosomal abnormality in the form of the karyotype 46,XX der(22t(8;22(q22.1;p11.1mat. Chromosome microarray analysis evidenced a 49 Mb duplicated segment of chromosome 8q with no pathogenic imbalances on chromosome 22. Two siblings also carry the balanced translocation. We have compared this case with other “pure” trisomies of 8q patients reported in the literature and with genome wide association studies recently published. This work highlights the involvement of chromosome 8q in orofacial clefts.

  19. A ±6 ms-Accuracy, 0.68 mm2, and 2.21 μW QRS Detection ASIC

    Sheng-Chieh Huang

    2012-01-01

    Full Text Available Healthcare issues arose from population aging. Meanwhile, electrocardiogram (ECG is a powerful measurement tool. The first step of ECG is to detect QRS complexes. A state-of-the-art QRS detection algorithm was modified and implemented to an application-specific integrated circuit (ASIC. By the dedicated architecture design, the novel ASIC is proposed with 0.68 mm2 core area and 2.21 μW power consumption. It is the smallest QRS detection ASIC based on 0.18 μm technology. In addition, the sensitivity is 95.65% and the positive prediction of the ASIC is 99.36% based on the MIT/BIH arrhythmia database certification.

  20. Isolation of the human MOX2 homeobox gene and localization to chromosome 7p22.1-p21.3.

    Grigoriou, M; Kastrinaki, M C; Modi, W S; Theodorakis, K; Mankoo, B; Pachnis, V; Karagogeos, D

    1995-04-10

    We have isolated and characterized cDNA clones encoding a novel human homeobox gene, MOX2, the homologue of the murine mox-2 gene. The MOX2 protein contains all of the characteristic features of Mox-2 proteins of other vertebrate species, namely the homeobox, the polyhistidine stretch, and a number of potential serine/threonine phosphorylation sites. The homeodomain of MOX2 protein is identical to all other vertebrate species reported so far (rodents and amphibians). Outside the homeodomain, Mox-2 proteins share a high degree of identity, except for a few amino acid differences encountered between the human and the rodent polypeptides. A polyhistidine stretch of 12 amino acids in the N terminal region of the protein is also conserved among humans, rodents, and (only partly) amphibians. The chromosomal position of MOX2 was assigned to 7p22.1-p21.3. PMID:7607679

  1. Isolation of the human MOX2 homeobox gene and localization to chromosome 7p22.1-p21.3

    Grigoriou, M.; Theodorakis, K. [Institute of Molecular Biology and Biotechnology, Crete (Greece); Mankoo, B. [National Institute for Medical Research, London (United Kingdom)] [and others

    1995-04-10

    We have isolated and characterized cDNA clones encoding a novel human homeobox gene, MOX2, the homologue of the murine mox-2 gene. The MOX2 protein contains all of the characteristic features of Mox-2 proteins of other vertebrate species, namely the homeobox, the polyhistidine stretch, and a number of potential serine/threonine phosphorylation sites. The homeodomain of MOX2 protein is identical to all other vertebrate species reported so far (rodents and amphibians). Outside the homeodomain, Mox-2 proteins share a high degree of identity, except for a few amino acid differences encountered between the human and the rodent polypeptides. A polyhistidine stretch of 12 amino acids in the N terminal region of the protein is also conserved among humans, rodents, and (only partly) amphibians. The chromosomal position of MOX2 was assigned to 7p22.1-p21.3. 31 refs., 3 figs.

  2. miR-21, miR-221 and miR-222 expression and prostate cancer recurrence among obese and non-obese cases

    Ernest K Amankwah; Evelyn Anegbe; Hyun Park; Julio Pow-Sang; Ardeshir Hakam; Jong Y Park

    2013-01-01

    Recent evidence shows that certain microRNAs (miRNAs) play a role in both obesity and prostate cancer recurrence,but the association between the expression of these miRNAs and obesity in prostate cancer recurrence is unknown.In this study,we examined the effect of the interaction between obesity and miR-21,miR-221 or miR-222 expression on prostate cancer recurrence among 28 recurrent and 37 non-recurrent prostate cancer cases,miRNA expression was determined using quantitative real-time polymerase chain reaction.Cox proportional hazard models adjusting for age at diagnosis,clinical stage and Gleason score were used to estimate hazard ratios (HR) and 95% confidence intervals (95% CI) for recurrence free survival.A significantly (P=0.014) higher proportion of recurrent cases (78.6%) than non-recurrent cases (48.6%) had a low expression of miR-21 and the difference was more prominent in obese than non-obese patients.Multivariate analysis showed that the expression of miR-21 was an independent risk factor for recurrence in obese (HR=6.15,95% CI=1.04-36.48,P=0.045),but not in non-obese (HR=1.28,95% CI=0.30-5.49,P=0.74) cases.A significant association with recurrence was not observed for the expression of miR-221 and miR-222.In summary,our findings show that miR-21 is associated with prostate cancer recurrence after radical prostatectomy and suggest that the differential expression of miR-21 is more prominent in obese than in non-obese cases.Future larger studies are warranted to confirm these initial findings and to elucidate the mechanisms involved.

  3. Enantioselective Resolution of N-(tert-Butoxycarbonyl)- 2-azabicyclo[2.2.1]hept-5-en-3-one%N-(叔丁氧羰基)-2-氮杂双环[2.2.1]庚-5-烯-3-酮的手性拆分

    李普瑞; 胡建建; 王晓川; 张玲玲; 王晓钟

    2015-01-01

    (-)-(1R,4S)-N-(叔丁氧羰基)-2-氮杂双环[2.2.1]庚-5-烯-3-酮是抗艾滋病药物阿巴卡韦的重要中间体。今以2-氮杂双环[2.2.1]庚-5-烯-3-酮为原料,先与(Boc)2O反应生成外消旋体(±)-N-(叔丁氧羰基)-2-氮杂双环[2.2.1]庚-5-烯-3-酮,再以固定化脂肪酶作为拆分试剂选择性拆分制得。试验中分别使用了三种酶,三种酶均表现出较好的反应活性和较高的反应收率,其中固定化酶Lipozyme RM IM的反应活性最高,对其催化的酶促反应进行了优化,得到最佳的反应条件:以异丙醚为反应溶剂,酶与底物质量投料比为1.5/2.0,反应温度为30℃,收率46.5%,对映体过量大于99%。结构经1H-NMR确证。该方法成本低,酶的选择性、催化活性和反应收率高。%(−)-(1R,4S)-N-(tert-Butoxycarbonyl)-2-azabicyclo[2.2.1]hept-5-en-3-one is an important intermediate of abacavir which is widely used in AIDS treatment. This chemical was prepared with 2-azabicyclo-[2.2.1]hept-5-en-3-one(2) as the starting material in this study. The starting material(2) was first reacted with (Boc)2O to give the raceme (±)-N-(tert-Butoxycarbonyl)-2-azabicyclo[2.2.1]hept-5-en-3-one(3) via amidation. The key intermediate was preparedvia a prominent turnover from the raceme(3) with immobilized lipases, and its structure was identified by1H-NMR. The optimum conditions of the enzymatic reaction were as follows: Lipozyme RM IM andisopropyl elther were used as the enzyme reaction catalyst, and reaction solvent separatively, the mass ratio of enzyme: substrate 1.5/2.0 and the reaction temperature of 30℃. The yield can reach to 46.5% under these optimal conditions with enantiomeric excess up to 99%. This synthetic process is suitable for large-scale manufacture due to the cheap available material and higher catalytic activity and selectivity of the lipase.

  4. Principy a ekonomické vyčíslení škod z porušování průmyslových práv dle zákona č. 221/2006 Sb.

    Holub, Michal

    2008-01-01

    This diploma thesis examines evaluation of damages according to the law Nr. 221/2006. Industrial rights, whose damages are enforced according to the law Nr. 221/2006, are described. Analysis of laws and judicial decisions in relation to the enforcement of damages and analysis of the law Nr. 221/2006 are made. The thesis examines sequences, important problems and aspects in relation to each method of the evaluation of damages. At the end of the thesis a study of a hypotetical case is carried o...

  5. miR-29b, miR-205 and miR-221 enhance chemosensitivity to gemcitabine in HuH28 human cholangiocarcinoma cells.

    Kinya Okamoto

    Full Text Available BACKGROUND AND AIMS: Cholangiocarcinoma (CCA is highly resistant to chemotherapy, including gemcitabine (Gem treatment. MicroRNAs (miRNAs are endogenous, non-coding, short RNAs that can regulate multiple genes expression. Some miRNAs play important roles in the chemosensitivity of tumors. Here, we examined the relationship between miRNA expression and the sensitivity of CCA cells to Gem. METHODS: Microarray analysis was used to determine the miRNA expression profiles of two CCA cell lines, HuH28 and HuCCT1. To determine the effect of candidate miRNAs on Gem sensitivity, expression of each candidate miRNA was modified via either transfection of a miRNA mimic or transfection of an anti-oligonucleotide. Ontology-based programs were used to identify potential target genes of candidate miRNAs that were confirmed to affect the Gem sensitivity of CCA cells. RESULTS: HuCCT1 cells were more sensitive to Gem than were HuH28 cells, and 18 miRNAs were differentially expressed whose ratios over ± 2log2 between HuH28 and HuCCT1. Among these 18 miRNAs, ectopic overexpression of each of three downregulated miRNAs in HuH28 (miR-29b, miR-205, miR-221 restored Gem sensitivity to HuH28. Suppression of one upregulated miRNA in HuH28, miR-125a-5p, inhibited HuH28 cell proliferation independently to Gem treatment. Selective siRNA-mediated downregulation of either of two software-predicted targets, PIK3R1 (target of miR-29b and miR-221 or MMP-2 (target of miR-29b, also conferred Gem sensitivity to HuH28. CONCLUSIONS: miRNA expression profiling was used to identify key miRNAs that regulate Gem sensitivity in CCA cells, and software that predicts miRNA targets was used to identify promising target genes for anti-tumor therapies.

  6. CHARACTERIZATION AND THERMAL STABILITY OF PMR POLYIMIDES USING 7-OXA-BICYCLO[2,2,1]HEPT-5-ENE-2, 3-DICARBOXYLIC ANHYDRIDE AS END CAPS

    Chen-liang Gong; Yan-feng Li; Hai-xia Yang; Xiao-long Wang; Shu-jiang Zhang; Shi-yong Yanga

    2011-01-01

    An anhydride monomer containing ether oxide bridge,7-oxa-bicyclo[2,2,1]hept-5-ene-2,3-dicarboxylic anhydride (ONA),was successfully synthesized by Diels-Alder reaction of furan and maleic anhydride.The ONA was also studied as an end-cap for the polymerization of monomer reactant (PMR) type polyimides.Three molecular weight levels of the ONA end-capped PMR resins were evaluated.The effects of process conditions of these novel PMR resins on thermal and mechanical properties were investigated.It was demonstrated that the imidized prepolymers using the end-cap have good processability,and the cured polyimide specimens exhibited good thermal stability.The initial decomposition temperature,Td (ca.580℃) and glass transition temperature,Tg (330℃) of the novel resin (PI-20),prepared under optimum process conditions,compare favorably with the Td (ca.620℃) and Tg (ca.348℃) of the state-of-the-art resin (PI'-20),respectively.

  7. Potentiometric stripping analysis of bismuth based on carbon paste electrode modified with cryptand [2.2.1] and multiwalled carbon nanotubes

    An electrochemical method based on potentiometric stripping analysis (PSA) employing a cryptand [2.2.1] (CRY) and carbon nanotube (CNT) modified paste electrode (CRY-CNT-PE) has been proposed for the subnanomolar determination of bismuth. The characterization of the electrode surface has been carried out by means of scanning electron microscopy (SEM), cyclic voltammetry (CV), electrochemical impedance spectroscopy (EIS) and chronocoulometry (CC). It was observed that by employing CRY-CNT-PE, a 9-fold enhancement in the PSA signal (dt/dE) was observed as compared to plain carbon paste electrode (PCPE). Under the optimized conditions, dt/dE (s/V) was proportional to the Bi(III) concentration in the range of 5.55 x 10-8 to 9.79 x 10-11 M (r = 0.9990) with the detection limit (S/N = 3) of 3.17 x 10-11 M. The practical analytical utilities of the modified electrode were demonstrated by the determination of bismuth in pharmaceutical formulations, human hair, sea water, urine and blood serum samples. The prepared modified electrode showed several advantages, such as a simple preparation method, high sensitivity, very low detection limits and excellent reproducibility. Moreover, the results obtained for bismuth analysis in commercial and real samples using CRY-CNT-PE and those obtained by atomic absorption spectroscopy (AAS) are in agreement at the 95% confidence level.

  8. Differential cross-section measurements for inelastic scattering of 22.1 keV photons by elements with 4<=Z<=69

    Kumar, A; Puri, S; Mehta, D; Singh, N

    2002-01-01

    Inelastic scattering differential cross-sections for the 22.1 keV photons have been measured in Be, C, Mg, Al, S, Ti, Fe, Cu, Zn, As, Se, Y, Zr, Ag, In, Sn, Te, Gd, Dy, Ho and Tm elements at an angle of 133 deg. . The measurements were performed under vacuum using an annular source of sup 1 sup 0 sup 9 Cd radioisotope as photon source and a planar HPGe detector. The measured inelastic scattering cross-sections are compared with those calculated using the Klein-Nishina cross-section for Compton scattering by stationary free electrons and the non-relativistic Hartree-Fock incoherent-scattering function. A good agreement is found for all the elements under investigation except for sub 3 sub 9 Y (B sub K =17.038 keV) and sub 4 sub 0 Zr (B sub K =17.998 keV) elements, where the measured cross-sections are approx 25% lower than the calculated ones; B sub K is the K-shell binding energy of the element.

  9. Stereochemistry and mechanism of the reduction of some bicyclo (2-2-1-) heptane-2-ones by metals dissolved in liquid ammonia

    A systematic experimental study of the reduction of four bicyclo(2-2-1)hepta n-2-ones by dissolved alkaline and alkaline-earth metals in liquid ammonia is reported. Chapter one: models of metal-ammonia solutions and mechanisms of the reduction of ketones by these solutions are rapidly recalled. Chapter two: results obtained in the thermodynamic equilibration of three pairs of epimeric alcohols which formally derive from three of the starting ketones are presented. Chapter three: deals with the results obtained in the reduction of the ketones in the absence or the presence of a proton source. A new interpretation of these results is given and is based upon two different effects: - the torsional interaction created by the bridgehead substituent on the C-O bond which favours the formation of the endo alcohol; - the difference of steric hindrance between the two sides (exo and endo) defined by the plane of the carbonyl group of the starting molecule, which favours the attack of the metal cation from one side or the other, and therefore the formation of the exo or the endo epimer. This mechanism is generalised in a model which is tested by means of some examples published in the literature. It then appears able to construe correctly the obtained results. (author)

  10. Synthesis and spectroscopic characterization of some lanthanide(III nitrate complexes of ethyl 2-[2-(1-acetyl-2-oxopropylazo]-4,5-dimethyl-3-thiophenecarboxyate

    CHEMPAKAM JANARDHANAN ATHIRA

    2011-02-01

    Full Text Available Ethyl 2-[2-(1-acetyl-2-oxopropylazo]-4,5-dimethyl-3-thiophenecarboxyate was synthesized by coupling diazotized ethyl 2-amino-4,5-dimethylthiophene-3-carboxylate with acetylacetone. Based on various spectral studies and elemental analysis, an intramolecularly hydrogen-bonded azo-enol structural form was assigned for the ligand. This ligand is versatile in forming a series of lanthanide(III complexes, viz., lanthanum(III, cerium(III, praseodymium(III, neodymium(III, samarium(III and gadolinium(III, which were characterized through various spectral studies, elemental analysis, magnetic susceptibility measurements, molar conductance and thermal analysis. The spectral data revealed that the ligand acted as a neutral tridentate, coordinating to the metal ion through one of the azo nitrogen atoms, the ester carbonyl and the enolic oxygen of the acetylacetone moiety, without deprotonation. Molar conductance values adequately supported their non-electrolytic nature. The ligand and lanthanum(III complex were subjected to X-ray diffraction studies. In addition, the lanthanum(III complex underwent a facile transesterification reaction on refluxing with methanol for a long period. The thermal behaviour of the lanthanum(III complex was also examined

  11. Synthesis, crystal structures, and properties of lanthanoid(III) complexes with 7-oxa-bicyclo[2.2.1]heptane-2,3-dicarboxylic acid; Synthese, Kristallstrukturen und Eigenschaften von Lanthanoid(III)-Komplexen mit 7-Oxa-bicyclo[2.2.1]heptan-2,3-dicarbonsaeure

    Schuechner, G. [Halle-Wittenberg Univ., Halle (Germany). Inst. fuer Anorganische Chemie und Allgemeine Chemie; Fechtel, G. [Halle-Wittenberg Univ., Halle (Germany). Inst. fuer Anorganische Chemie und Allgemeine Chemie; Baumeister, U. [Halle-Wittenberg Univ., Halle (Germany). Inst. fuer Physikalische Chemie; Hartung, H. [Halle-Wittenberg Univ., Halle (Germany). Inst. fuer Physikalische Chemie

    1996-08-01

    The synthesis of coordination compounds [ML(HL)(H{sub 2}O)] with M=La{sup 3+}, Ce{sup 3+}, Pr{sup 3+}, Nd{sup 3+} and H{sub 2}L=7-Oxa-bicyclo[2.2.1]heptane-2-exo,3-cis-dicarboxylic acid (1) has been described. Results of IR spectroscopy and thermal decomposition are given. As a result of X-ray analyses, the four investigated lanthanoid(III) complexes are isotypic. Their stereochemistry approximates to the tri-capped trigonal prism with nine O atoms coordinating the metal atom. The bicyclic ligand acts as a tridentate chelating monoanion HL{sup -} as well as a pentadentate dianion L{sup 2-} with both chelating and bridging function. One coordination place at the metal atom is occupied by a water molecule. (orig.)

  12. Synthesis of 2-Azabicyclo[2,2,1]hept-5-en-3-one as an Intermediate for Abacavir%阿巴卡韦中间体2-杂氮双环[2,2,1]庚-5-烯-3-酮的合成

    陈灿; 郭莉娜; 李宏伟; 侯仲轲

    2006-01-01

    采用一步法由对甲基苯亚磺酸钠与氯化氰及1,3-环戊二烯合成目标物2-杂氮双环[2,2,1]庚-5-烯-3-酮.反应条件为:n(对甲基苯亚磺酸钠):n(氯化氰):n(1,3-环戊二烯)=0.48:1.05:1,反应温度控制在15℃,反应7h,反应中控制pH=5,可得纯度为95%的产品,收率由文献报道的64%提高到78%.

  13. Metformin Causes G1-Phase Arrest via Down-Regulation of MiR-221 and Enhances TRAIL Sensitivity through DR5 Up-Regulation in Pancreatic Cancer Cells.

    Tanaka, Ryoichi; Tomosugi, Mitsuhiro; Horinaka, Mano; Sowa, Yoshihiro; Sakai, Toshiyuki

    2015-01-01

    Although many chemotherapeutic strategies against cancer have been developed, pancreatic cancer is one of the most aggressive and intractable types of malignancies. Therefore, new strategies and anti-cancer agents are necessary to treat this disease. Metformin is a widely used drug for type-2 diabetes, and is also known as a promising candidate anti-cancer agent from recent studies in vitro and in vivo. However, the mechanisms of metformin's anti-cancer effects have not been elucidated. We demonstrated that metformin suppressed the expression of miR-221, one of the most well-known oncogenic microRNAs, in human pancreatic cancer PANC-1 cells. Moreover, we showed that the down-regulation of miR-221 by metformin caused G1-phase arrest via the up-regulation of p27, one of the direct targets of miR-221. Tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) is also a promising agent for cancer treatment. While recent studies showed that treatment with only TRAIL was not effective against pancreatic cancer cells, the present data showed that metformin sensitized p53-mutated pancreatic cancer cells to TRAIL. Metformin induced the expressions of death receptor 5 (DR5), a receptor for TRAIL, and Bim with a pro-apoptotic function in the downstream of TRAIL-DR5 pathway. We suggest that the up-regulation of these proteins may contribute to sensitization of TRAIL-induced apoptosis. The combination therapy of metformin and TRAIL could therefore be effective in the treatment of pancreatic cancer. PMID:25955843

  14. Cytogenetic and clinical studies in gonadal dysgenesis with 46,X,Xt(qter leads to p221::p223 leads to qter) karyotype: review and phenotype/karyotype correlations.

    M. Ferraro; de Capoa, A.; Mostacci, C; Pelliccia, F; Zulli, P; Baldini, M A; Di Nisio, Q

    1980-01-01

    Chromosome analysis by Q, R, and C banding was performed in a case diagnosed clinically as gonadal dysgenesis and the karyotype was shown to be 46,X,Xt(qter leads to p221::p223 leads to qter). Localisation of the breakpoints in the fused X chromosomes and replication studies have led to a hypothesis on the origin of the translocation. A comparison of clinical and cytogenetical findings in this and other published cases has also been made in an attempt to detect some phenotype/karyotype correl...

  15. A genome-wide association study identifies pancreatic cancer susceptibility loci on chromosomes 13q22.1, 1q32.1 and 5p15.33

    Petersen, Gloria M.; Amundadottir, Laufey; Fuchs, Charles S; Kraft, Peter; Stolzenberg-Solomon, Rachael Z; Jacobs, Kevin B.; Arslan, Alan A.; Bueno-de-Mesquita, H Bas; Gallinger, Steven; Gross, Myron; Helzlsouer, Kathy; Holly, Elizabeth A.; Jacobs, Eric J.; Klein, Alison P; LaCroix, Andrea

    2010-01-01

    We conducted a genome-wide association study (GWAS) of pancreatic cancer in 3,851 cases and 3,934 controls drawn from twelve prospective cohort studies and eight case-control studies. Based on a logistic regression model for genotype trend effect that was adjusted for study, age, sex, self-described ancestry and five principal components, we identified eight SNPs that map to three loci on chromosomes 13q22.1, 1q32.1 and 5p15.33. Two correlated SNPs, rs9543325 (P=3.27×10−11; per allele odds ra...

  16. Synthesis, structure, photoluminescence and antitumour activity of zinc complex based on 2-(2-(1H-benzo-[d]imidazol-2-yl)benzyl)-1H-benzo-[d]imidazole

    Che, Zhijian; Wang, Shaoxiang; Liu, Shenggui; Li, Guobi; Wu, Qiting; Lin, Chunyu; Kong, Linglang; Wang, Sheng

    2015-01-01

    A new complex [Zn(bbb)Cl2]·DMF, where bbb is 2-(2-(1H-benzo[d]imidazol-2-yl)benzyl)-1H-benzo[d]imidazole, was synthesized and characterized by element analysis, 1H NMR and X-ray single crystal structure analyses. For complex: crystal system, triclinic, space group, P-1, a = 9.4661(13), b = 10.3534(14), c = 13.0025(18) Å, α = 73.477(2), β = 80.743(2), γ = 88.658(2)°, V = 1205.5(3) Å3, Z = 2. In this complex, the Zn2+ distorted tetrahedron geometry is coordinated by two nitrogen atoms from 2-(2-(1H-benzo[d]imidazol-2-yl)benzyl)-1H-benzo[d]imidazole and two Cl-. The complex emits yellow green luminescence with the maximal emission peak at 550 nm in DMF solution. The complex exhibits inhibition on the growth of Eca109 cancer cell with IC50 value of 8.9 ± 1.1 μM, which was lower than that of cisplatin (14.3 ± 1.4 μM). This complex has potential application in treatment of esophageal cancer.

  17. Crystal structures of nitrato-(2-[2-(1-pyridine-2-ylethylidene)hydrazine]-1,3-benzothiazolo) aquacopper and chloro-(2-[2-phenyl(pyridine-2-ylethylidene)hydrazine]-1,3-benzothiazolo) copper

    Chumakov, Yu. M. [Academy of Sciences of Moldova, Institute of Applied Physics (Moldova, Republic of); Paholnitcaia, A. Yu. [State University of Moldova (Moldova, Republic of); Petrenko, P. A. [Academy of Sciences of Moldova, Institute of Applied Physics (Moldova, Republic of); Tsapkov, V. I., E-mail: vtsapkov@gmail.com [State University of Moldova (Moldova, Republic of); Poirier, D. [Centre Hospitalier Universitaire de Quebec (Canada); Gulea, A. P. [State University of Moldova (Moldova, Republic of)

    2015-01-15

    Two crystal modifications of nitrato-(2-[2-(1-pyridine-2-ylethylidene)hydrazine]-1,3-benzothiazolo) aquacopper (I and II) and two modifications of chloro-(2-[2-phenyl(pyridine-2-ylethylidene)hydrazine]-1,3-benzothiazolo) copper (III and IV) have been synthesized and studied by X-ray diffraction. In structures I and II, the copper atoms coordinate a monodeprotonated molecule of the organic ligand, nitrate ions, and a water molecule. In crystals of I, the complexes are monomeric, whereas complexes II are linked via nitrate ions to form polymeric chains. In both structures the coordination polyhedron of the copper atom can be described as a distorted tetragonal bipyramid—(4 + 1 + 1) in I and (4 + 2) in II. These coordination polyherdra have different compositions. In structures III and IV, the metal atoms coordinate a monodeprotonated (2-[2-phenyl(pyridine-2-ylethylidene)hydrazine]-1,3-benzothiazole molecule and chloride ions. In III the complex-forming ion has square-planar coordination geometry, whereas structure IV consists of centrosymmetric dimers with two bridging chlorine atoms. It was found that nitrato-(2-[2-(1-pyridine-2-ylethylidene)hydrazine]-1,3-benzothiazolo) aquacopper possesses antitumor activity.

  18. A genome-wide association study identifies pancreatic cancer susceptibility loci on chromosomes 13q22.1, 1q32.1 and 5p15.33

    Petersen, Gloria M.; Amundadottir, Laufey; Fuchs, Charles S.; Kraft, Peter; Stolzenberg-Solomon, Rachael Z.; Jacobs, Kevin B.; Arslan, Alan A.; Bueno-de-Mesquita, H. Bas; Gallinger, Steven; Gross, Myron; Helzlsouer, Kathy; Holly, Elizabeth A.; Jacobs, Eric J.; Klein, Alison P.; LaCroix, Andrea; Li, Donghui; Mandelson, Margaret T.; Olson, Sara H.; Risch, Harvey A.; Zheng, Wei; Albanes, Demetrius; Bamlet, William R.; Berg, Christine D.; Boutron-Ruault, Marie-Christine; Buring, Julie E.; Bracci, Paige M.; Canzian, Federico; Clipp, Sandra; Cotterchio, Michelle; de Andrade, Mariza; Duell, Eric J.; Gaziano, J. Michael; Giovannucci, Edward L.; Goggins, Michael; Hallmans, Göran; Hankinson, Susan E.; Hassan, Manal; Howard, Barbara; Hunter, David J.; Hutchinson, Amy; Jenab, Mazda; Kaaks, Rudolf; Kooperberg, Charles; Krogh, Vittorio; Kurtz, Robert C.; Lynch, Shannon M.; McWilliams, Robert R.; Mendelsohn, Julie B.; Michaud, Dominique S.; Parikh, Hemang; Patel, Alpa V.; Peeters, Petra H.M.; Rajkovic, Aleksandar; Riboli, Elio; Rodriguez, Laudina; Seminara, Daniela; Shu, Xiao-Ou; Thomas, Gilles; Tjønneland, Anne; Tobias, Geoffrey S.; Trichopoulos, Dimitrios; Van Den Eeden, Stephen K.; Virtamo, Jarmo; Wactawski-Wende, Jean; Wang, Zhaoming; Wolpin, Brian M.; Yu, Herbert; Yu, Kai; Zeleniuch-Jacquotte, Anne; Fraumeni, Joseph F.; Hoover, Robert N.; Hartge, Patricia; Chanock, Stephen J.

    2010-01-01

    We conducted a genome-wide association study (GWAS) of pancreatic cancer in 3,851 cases and 3,934 controls drawn from twelve prospective cohort studies and eight case-control studies. Based on a logistic regression model for genotype trend effect that was adjusted for study, age, sex, self-described ancestry and five principal components, we identified eight SNPs that map to three loci on chromosomes 13q22.1, 1q32.1 and 5p15.33. Two correlated SNPs, rs9543325 (P=3.27×10−11; per allele odds ratio, OR 1.26, 95% CI=1.18-1.35) and rs9564966 (P=5.86×10−8; per allele OR 1.21, 95% CI=1.13-1.30) map to a non-genic region on chromosome 13q22.1. Five SNPs on 1q32.1 map to NR5A2; the strongest signal was rs3790844 (P=2.45×10−10; per allele OR 0.77, 95% CI=0.71-0.84). A single SNP, rs401681 (P=3.66×10−7; per allele OR 1.19, 95% CI=1.11-1.27) maps to the CLPTM1L-TERT locus on 5p15.33, associated with multiple cancers. Our study has identified common susceptibility loci for pancreatic cancer that warrant follow-up studies. PMID:20101243

  19. 北京市东城区221名1~12岁健康儿童肺炎链球菌携带状况研究%Carriage of Streptococcus pneumoniae in 221 healthy children aged 1 - 12 years in Dongcheng district, Beijing

    邸明芝; 吴疆; 黄辉; 吕敏; 张玉萍; 周云; 李侠; 闫威; 翟力军; 孙宏莉

    2012-01-01

    Objective To investigate the nasopharyngeal carriage status of Streptococcus pneumoniae in healthy children aged 1-12 years and the serotype and the antibiotic resistance of the isolated strains. Methods From October 2010 to June 2011 ,nasopharyngeal swabs were collected every two months from randomly selected 221 healthy children aged 1-12 years in Dongcheng district to isolate Streptococcus pneumoniae and identify the serotypes and test antibiotic resistance of the isolates. Results A total of 220 strains of Streptococcus pneumoniae in 32 serotypes were isolated, the cumulative carriage rate of Streptococcus pneumoniae in the healthy children was 57. 47% . The serotype coverage rate of pneumococcal 7-valent conjugate vaccine was 36. 82% and the serotype coverage rate of polysaccharide polyvalent pneumococcal vaccine was 64.55%. The antibiotic resistant strains accounted for 3.64%. Conclusion Healthy children aged 1-12 years are at high risk of Streptococcus pneumoniae infection. It is necessary to establish effective surveillance system and develop Streptococcus pneumoniae vaccine which is suitable to use in China.%目的 了解1 ~12岁健康儿童鼻咽部肺炎链球菌携带情况,及该菌血清型、耐药情况,为制定防治策略提供参考依据.方法 2010年10月至2011年6月,选取北京市东城区221名1~12岁健康儿童,每2个月采集鼻咽拭子标本1次,进行肺炎链球菌培养、血清分型及耐药性检测.结果 1 ~12岁健康儿童肺炎链球菌累计携带率为57.47%;分离到32个血清型共220株肺炎链球菌,7价肺炎球菌结合疫苗的血清型覆盖率为36.82%,23价肺炎链球菌荚膜多糖疫苗的血清型覆盖率为64.55%;耐药菌株占3.64%.结论 1~ 12岁健康儿童存在着较高肺炎链球菌疾病的风险,有必要建立科学的监测体系,研制出适合国情的肺炎链球菌疫苗.

  20. New ab initio adiabatic potential energy surfaces and bound state calculations for the singlet ground X˜ 1A1 and excited C˜ 1B2(21A') states of SO2

    Kłos, Jacek; Alexander, Millard H.; Kumar, Praveen; Poirier, Bill; Jiang, Bin; Guo, Hua

    2016-05-01

    We report new and more accurate adiabatic potential energy surfaces (PESs) for the ground X˜ 1A1 and electronically excited C˜ 1B2(21A') states of the SO2 molecule. Ab initio points are calculated using the explicitly correlated internally contracted multi-reference configuration interaction (icMRCI-F12) method. A second less accurate PES for the ground X ˜ state is also calculated using an explicitly correlated single-reference coupled-cluster method with single, double, and non-iterative triple excitations [CCSD(T)-F12]. With these new three-dimensional PESs, we determine energies of the vibrational bound states and compare these values to existing literature data and experiment.

  1. Molecular and cytogenetic characterization of a recurrent unbalanced translocation (4;21) (p16.3;q22.1): Relevance to the Wolf-Hirschhorn and Down syndrome critical regions

    Sebastio, G.; Perone, L.; Guzzetta, V. [Universita Federico II, Naples (Italy)] [and others

    1996-05-17

    We report on an aneuploidy syndrome due to the unbalanced segregation of a familial translocation (4;21)(p16.3;q22.1) causing a partial 4p monosomy and a partial 21q trisomy. The three affected children presented with severe failure to thrive, short stature, microcephaly, profound hypotonia, and mental retardation. The face, very similar in the three children, is characterized by frontal bossing, upslanting of the palpebral fissures, short nose, and deep set ears, giving the overall appearance of the Down syndrome. The molecular study has defined the aneuploid segment on both 4p and 21q. Most of the Down syndrome critical region was found to be trisomic, while only part of the candidate Wolf-Hirschhorn syndrome critical region was deleted, suggesting that this region is not critical for the major malformations characteristic for WHS. 15 refs., 5 figs., 1 tab.

  2. Radium-228 analysis of natural waters by Cherenkov counting of Actinium-228

    The activities of 228Ra in natural waters were determined by the Cherenkov counting of the daughter nuclide 228Ac. The radium was pre-concentrated on MnO2 and the radium purified via ion exchange and, after a 2-day period of incubation to allow for secular equilibrium between the parent-daughter 228Ra(228Ac), the daughter nuclide 228Ac was isolated by ion exchange according to the method of Nour et al. [2004. Radium-228 determination of natural waters via concentration on manganese dioxide and separation using Diphonix ion exchange resin. Appl. Radiat. Isot. 61, 1173-1178]. The Cherenkov photons produced by 228Ac were counted directly without the addition of any scintillation reagents. The optimum Cherenkov counting window, sample volume, and vial type were determined experimentally to achieve optimum Cherenkov photon detection efficiency and lowest background count rates. An optimum detection efficiency of 10.9±0.1% was measured for 228Ac by Cherenkov counting with a very low Cherenkov photon background of 0.317±0.013 cpm. The addition of sodium salicylate into the sample counting vial at a concentration of 0.1 g/mL yielded a more than 3-fold increase in the Cherenkov detection efficiency of 228Ac to 38%. Tests of the Cherenkov counting technique were conducted with several water standards of known activity and the results obtained compared closely with a conventional liquid scintillation counting technique. The advantages and disadvantages of Cherenkov counting compared to liquid scintillation counting methods are discussed. Advantages include much lower Cherenkov background count rates and consequently lower minimal detectable activities for 228Ra and no need for expensive environmentally unfriendly liquid scintillation cocktails. The disadvantages of the Cherenkov counting method include the need to measure 228Ac Cherenkov photon detection efficiency and optimum Cherenkov counting volume, which are not at all required when liquid scintillation analysis is used

  3. Linear free energy relationship applied to trivalent cations with lanthanum and actinium oxide and hydroxide structure

    Linear free energy relationships for trivalent cations with crystalline M2O3 and, M(OH)3 phases of lanthanides and actinides were developed from known thermodynamic properties of the aqueous trivalent cations, modifying the Sverjensky and Molling equation. The linear free energy relationship for trivalent cations is as ΔGf,MvX0=aMvXΔGn,M3+0+bMvX+βMvXrM3+, where the coefficients aMvX, bMvX, and βMvX characterize a particular structural family of MvX, rM3+ is the ionic radius of M3+ cation, ΔGf,MvX0 is the standard Gibbs free energy of formation of MvX and ΔGn,M3+0 is the standard non-solvation free energy of the cation. The coefficients for the oxide family are: aMvX=0.2705, bMvX=-1984.75 (kJ/mol), and βMvX=197.24 (kJ/molnm). The coefficients for the hydroxide family are: aMvX=0.1587, bMvX=-1474.09 (kJ/mol), and βMvX=791.70 (kJ/molnm).

  4. Actinium: A RESTful Runtime Container for Scriptable Internet of Things Applications

    Kovatsch, Matthias; Lanter, Martin; Duquennoy, Simon

    2012-01-01

    Programming Internet of Things (IoT) applications is challenging because developers have to be knowledgeable in various technical domains, from low-power networking, over embedded operating systems, to distributed algorithms. Hence, it will be challenging to find enough experts to provide software for the vast number of expected devices, which must also be scalable and particularly safe due to the connection to the physical world. To remedy this situation, we propose an architecture that pr...

  5. Reflection asymmetry in odd-A and odd-odd actinium nuclei

    Theoretical calculations and measurements indicate that octupole correlations are at a maximum in the ground states of the odd-proton nuclei Ac and Pa. It has been expected that odd-odd nuclei should have even larger amount of octupole-octupole correlations. We have recently made measurements on the structure of 224Ac. Although spin and parity assignments could not be made, two bands starting at 354.1 and 360.0 keV have properties characteristic of reflection asymmetric shape. These two bands have very similar rotational constants and also similar alpha decay rates, which suggest similarity between the wavefunctions of these bands. These signatures provide evidence for octupole correlations in these nuclides

  6. Bestimmung der Ionisationsenergie von Actinium und Ultraspurenanalyse von Plutonium mit resonanter Ionisationsmassenspektrometrie (RIMS)

    Waldek, Achim Marcus

    2001-01-01

    ZusammenfassungDie Resonanzionisationsmassenspektrometrie (RIMS) verbindet hohe Elementselektivität mit guter Nachweiseffizienz. Aufgrund dieser Eigenschaften ist die Methode für Ultraspurenanalyse und Untersuchungen an seltenen oder schwer handhabbaren Elementen gut geeignet. Für RIMS werden neutrale Atome mit monochromatischem Laserlicht ein- oder mehrfach resonant auf energetisch hoch liegende Niveaus angeregt und anschließend durch einen weiteren Laserstrahl oder durch ein elektrisches Fe...

  7. Synthesis of chelating agents for actinium 225 complexation and its application in radioimmunotherapy

    Immunotherapy with radiolabeled antibodies should allow fairly specific targeting of certain cancers. However, iodine 131 may not be the best isotope for tumor therapy because of its limited specific activity, low beta-energy, relatively long half life and strong gamma emission. Another approach to improve therapeutic efficacy is the use of replacement isotopes with better physical properties. Chelator that can hold radio-metals with high stability under physiological conditions are essential to avoid excessive damage to non-target cells; Moreover, the development of new bifunctional chelating agents is essential for this purpose. Accordingly, our efforts have been directed, for several years, to the synthesis of original chelating agents likely to form stable complexes in vivo with the numerous potential candidates for such applications. Therefore, we have developed a new simple and efficient synthesis pathway of 2-(4-iso-thio-cyanate-benzyl)-1,4,7,10,13,16- hexa-aza-cyclo-hexadecane- 1,4,7,10,13,16-hexa-acetic acid, though functionalized on the cycle by a termination allowed coupling to an antibody or any other biological substance such as a hapten. (author)

  8. Purification of selenium from thorium, uranium, radium, actinium and potassium impurities for low background measurements

    A technique of selenium purification from 232Th, 238U, 226,228Ra, 227Ac and 40K was developed. This technique is simple to perform and employs a minimum number of highly pure reagents (bidistilled water, nitric acid). Operations carried out during purification (elution, evaporation) practically exclude losses of the target product (chemical yields of Se > 99%). A test purification of 100 g of selenium was carried out using this technique. The efficiency of this technique was confirmed by low background gamma spectrometry of the purified selenium sample. Distribution coefficients of Th, U, Ra and Ac on DOWEX 50W- x 8 cation-exchange resin at different concentrations of selenium and nitric acid were experimentally determinated. Instrumental neutron activation analysis of bidistilled water, deionized water and nitric acid was performed. (orig.)

  9. Purification of selenium from thorium, uranium, radium, actinium and potassium impurities for low background measurements

    Rakhimov, A.V. [Joint Institute for Nuclear Research (JINR), Dubna (Russian Federation); Uzbek Academy of Sciences, Tashkent (Uzbekistan). Inst. of Nuclear Physics (INP AS RUz); Warot, G. [CEA-CNRS, Modane (France). Laboratoire Souterrain de Modane (LSM); Karaivanov, D.V. [Joint Institute for Nuclear Research (JINR), Dubna (Russian Federation); Institute for Nuclear Research and Nuclear Energy (INRNE), Sofia (Bulgaria); Kochetov, O.I.; Lebedev, N.A.; Filosofov, D.V. [Joint Institute for Nuclear Research (JINR), Dubna (Russian Federation); Mukhamedshina, N.M.; Sadikov, I.I. [Uzbek Academy of Sciences, Tashkent (Uzbekistan). Inst. of Nuclear Physics (INP AS RUz)

    2013-07-01

    A technique of selenium purification from {sup 232}Th, {sup 238}U, {sup 226,228}Ra, {sup 227}Ac and {sup 40}K was developed. This technique is simple to perform and employs a minimum number of highly pure reagents (bidistilled water, nitric acid). Operations carried out during purification (elution, evaporation) practically exclude losses of the target product (chemical yields of Se > 99%). A test purification of 100 g of selenium was carried out using this technique. The efficiency of this technique was confirmed by low background gamma spectrometry of the purified selenium sample. Distribution coefficients of Th, U, Ra and Ac on DOWEX 50W- x 8 cation-exchange resin at different concentrations of selenium and nitric acid were experimentally determinated. Instrumental neutron activation analysis of bidistilled water, deionized water and nitric acid was performed. (orig.)

  10. New method for large scale production of medically applicable Actinium-225 and Radium-223

    Alpha-emitters (211At, 212Bi, 213Bi, 223Ra, 225Ac) are promising for targeted radiotherapy of cancer. Only two alpha decays near a cell membrane result in 50% death of cancer cell and only a single decay inside the cell is required for this. 225Ac may be used either directly or as a mother radionuclide in 213Bi isotope generator. Production of 225Ac is provided by three main suppliers - Institute for Transuranium Elements in Germany, Oak Ridge National Laboratory in USA and Institute of Physics and Power Engineering in Obninsk, Russia. The current worldwide production of 225Ac is approximately 1.7 Ci per year that corresponds to only 100-200 patients that could be treated annually. The common approach for 225Ac production is separation from mother 229Th or irradiation of 226Ra with protons in a cyclotron. Both the methods have some practical limitations to be applied routinely. 225Ac can be also produced by irradiation of natural thorium with medium energy protons . Cumulative cross sections of 225Ac, 227Ac, 227Th, 228Th formations have been obtained recently. Thorium targets (1-9 g) were irradiated by 114-91 MeV proton beam (1-50 μA) at INR linear accelerator. After dissolution in 8 M HNO3 + 0.004 M HF thorium was removed by double LLX by HDEHP in toluene (1:1). Ac and REE were pre-concentrated and separated from Ra and most fission products by DGA-Resin (Triskem). After washing out by 0.01 M HNO3 Ac was separated from REE by TRU Resin (Triskem) in 3 M HNO3 media. About 6 mCi 225Ac were separated in hot cell with chemical yield 85%. The method may be upscaled for production of Ci amounts of the radionuclide. The main impurity is 227Ac (0.1% at the EOB) but it does not hinder 225Ac from being used for medical 225Ac/213Bi generators. (author)