WorldWideScience

Sample records for actinium 216

  1. Extraction of actinium with di-(2-ethylhexyl)phosphoric acid from hydrochloric and nitric acid solutions

    The extraction of actinium with HDEHP from Cl- and NO3- systems has been investigated. It was found that extraction of actinium from HCl solutions is much better than from HNO3 solutions. Stability constants of actinium complexes Ac(X-)+2 with Cl- and NO3- ligands were determined. Our results show that the actinium formed less stable complexes with Cl- than with NO3- ligands. 5 refs., 3 figs., 1 tab. (author)

  2. The sorption of polonium, actinium and protactinium onto geological materials

    This paper describes a combined experimental and modeling program of generic sorption studies to increase confidence in the performance assessment for a potential high-level radioactive waste repository in Japan. The sorption of polonium, actinium and protactinium onto geological materials has been investigated. Sorption of these radioelements onto bentonite, tuff and granodiorite from equilibrated de-ionized water was studied under reducing conditions at room temperature. In addition, the sorption of actinium and protactinium was investigated at 60 C. Thermodynamic chemical modeling was carried out to aid interpretation of the results

  3. Discovery of the actinium, thorium, protactinium, and uranium isotopes

    Fry, C; Thoennessen, M

    2012-01-01

    Currently, 31 actinium, 31 thorium, 28 protactinium, and 23 uranium isotopes have so far been observed; the discovery of these isotopes is discussed. For each isotope a brief summary of the first refereed publication, including the production and identification method, is presented.

  4. Separation of Actinium 227 from the uranium minerals

    The purpose of this work was to separate Actinium 227, whose content is 18%, from the mineral carnotite found in Gomez Chihuahua mountain range in Mexico. The mineral before processing is is pre-concentrated and passed, first through anionic exchange resins, later the eluate obtained is passed through cationic resins. The resins were 20-50 MESH QOWEX and 100-200 MESH 50 X 8-20 in some cased 200-400 MESH AG 50W-X8, 1X8 in other cases. The eluates from the ionic exchange were electrodeposited on stainless steel polished disc cathode and platinum electrode as anode; under a current ODF 10mA for 2.5 to 5 hours and of 100mA for .5 of an hour. it was possible to identify the Actinium 227 by means of its descendents, TH-227 and RA-223, through alpha spectroscopy. Due to the radiochemical purity which the electro deposits were obtained the Actinium 227 was low and was not quantitatively determined. A large majority of the members of the natural radioactive series 3 were identified and even alpha energies reported in the literature with very low percentages of non-identified emissions were observed. We conclude that a more precise study is needed concerning ionic exchange and electrodeposit to obtain an Actinium 227 of radiochemical purity. (Author)

  5. Spectroscopic and computational investigation of actinium coordination chemistry.

    Ferrier, Maryline G; Batista, Enrique R; Berg, John M; Birnbaum, Eva R; Cross, Justin N; Engle, Jonathan W; La Pierre, Henry S; Kozimor, Stosh A; Lezama Pacheco, Juan S; Stein, Benjamin W; Stieber, S Chantal E; Wilson, Justin J

    2016-01-01

    Actinium-225 is a promising isotope for targeted-α therapy. Unfortunately, progress in developing chelators for medicinal applications has been hindered by a limited understanding of actinium chemistry. This knowledge gap is primarily associated with handling actinium, as it is highly radioactive and in short supply. Hence, Ac(III) reactivity is often inferred from the lanthanides and minor actinides (that is, Am, Cm), with limited success. Here we overcome these challenges and characterize actinium in HCl solutions using X-ray absorption spectroscopy and molecular dynamics density functional theory. The Ac-Cl and Ac-OH2O distances are measured to be 2.95(3) and 2.59(3) Å, respectively. The X-ray absorption spectroscopy comparisons between Ac(III) and Am(III) in HCl solutions indicate Ac(III) coordinates more inner-sphere Cl(1-) ligands (3.2±1.1) than Am(III) (0.8±0.3). These results imply diverse reactivity for the +3 actinides and highlight the unexpected and unique Ac(III) chemical behaviour. PMID:27531582

  6. Production of high-purity radium-223 from legacy actinium-beryllium neutron sources.

    Soderquist, Chuck Z; McNamara, Bruce K; Fisher, Darrell R

    2012-07-01

    Radium-223 is a short-lived alpha-particle-emitting radionuclide with potential applications in cancer treatment. Research to develop new radiopharmaceuticals employing (223)Ra has been hindered by poor availability due to the small quantities of parent actinium-227 available world-wide. The purpose of this study was to develop innovative and cost-effective methods to obtain high-purity (223)Ra from (227)Ac. We obtained (227)Ac from two surplus actinium-beryllium neutron generators. We retrieved the actinium/beryllium buttons from the sources and dissolved them in a sulfuric-nitric acid solution. A crude actinium solid was recovered from the solution by coprecipitation with thorium fluoride, leaving beryllium in solution. The crude actinium was purified to provide about 40 milligrams of actinium nitrate using anion exchange in methanol-water-nitric acid solution. The purified actinium was then used to generate high-purity (223)Ra. We extracted (223)Ra using anion exchange in a methanol-water-nitric acid solution. After the radium was separated, actinium and thorium were then eluted from the column and dried for interim storage. This single-pass separation produces high purity, carrier-free (223)Ra product, and does not disturb the (227)Ac/(227)Th equilibrium. A high purity, carrier-free (227)Th was also obtained from the actinium using a similar anion exchange in nitric acid. These methods enable efficient production of (223)Ra for research and new alpha-emitter radiopharmaceutical development. PMID:22697483

  7. MGT 216 uop Courses/ uophelp

    Uophelp

    2015-01-01

    For more course tutorials visit www.uophelp.com   MGT 216 FINAL EXAM / TEST (use to study) MGT 216 Week 1 Business Ethics Perspective MGT 216 Week 2 Ethical Theories Chart MGT 216 Week 3 Case Study MGT 216 Week 3 Ethical Game Simulation MGT 216 Week 3 Learning Team Assignment Ford Pinto Case Study Review MGT 216 Week 4 Ethical Issues MGT 216 Week 5 Ethical Organization Profile MGT 216 Week 5 Global Business and Ethics MGT 216 Week 1 DQS ...

  8. MGT 216 Courses/Indigohelp

    charles

    2015-01-01

    For more classes visits www.indigohelp.com   MGT 216 FINAL EXAM / TEST (use to study) MGT 216 Week 1 Business Ethics Perspective MGT 216 Week 2 Ethical Theories Chart MGT 216 Week 3 Case Study MGT 216 Week 3 Ethical Game Simulation MGT 216 Week 3 Learning Team Assignment Ford Pinto Case Study Review MGT 216 Week 4 Ethical Issues MGT 216 Week 5 Ethical Organization Profile MGT 216 Week 5 Global Business and Ethics MGT 216 Week 1 DQS MGT ...

  9. XMGT 216 courses/snaptutorial

    Paul Marlowe

    2015-01-01

    For more classes visit www.snaptutorial.com   XMGT 216 Week 1 CheckPoint Ethical Theories Chart XMGT 216 Week 1 Discussion Question 1 & 2 XMGT 216 Week 2 CheckPoint Clarifying Personal Values XMGT 216 Week 2 Assignment Business Ethics Reflection XMGT 216 Week 3 CheckPoint Ethics Awareness Inventory XMGT 216 Week 3 Discussion Question 1 & 2 XMGT 216 Week 4 Assignment Ethical Issues and Management Paper XMGT 216 Week 4 CheckPoint Short Case M...

  10. Radium, thorium, and actinium extraction from seawater using an improved manganese-oxide-coated fiber

    Laboratory experiments were conducted to determine the efficiency with which improved manganese-oxide-coated acrylic fibers extract radium, thorium, and actinium from seawater. Tests were made using surface seawater spiked with 227Ac, 227Th and 223Ra. For sample volumes of approximately 30 liters and flow rates up to 0.5 liters per minute, radium and actinium are removed quantitatively. Approximately 80-95% of the thorium is removed under these same conditions. (Auth.)

  11. XMGT 216 Courses Tutorial / indigohelp

    XMISSION

    2015-01-01

    XMGT 216 Week 1 CheckPoint Ethical Theories Chart XMGT 216 Week 1 Discussion Question 1 & 2 XMGT 216 Week 2 CheckPoint Clarifying Personal Values XMGT 216 Week 2 Assignment Business Ethics Reflection XMGT 216 Week 3 CheckPoint Ethics Awareness Inventory XMGT 216 Week 3 Discussion Question 1 & 2 XMGT 216 Week 4 Assignment Ethical Issues and Management Paper XMGT 216 Week 4 CheckPoint Short Case Management XMGT 216 Week 5 CheckPoint Management Case Study ...

  12. MGT 216 UOP Course Tutorial / Tutorialoutlet

    karthi

    2015-01-01

    For more course tutorials visit www.tutorialoutlet.com   MGT 216 FINAL EXAM / TEST (use to study) MGT 216 Week 1 Business Ethics Perspective MGT 216 Week 2 Ethical Theories Chart MGT 216 Week 3 Case Study MGT 216 Week 3 Ethical Game Simulation MGT 216 Week 3 Learning Team Assignment Ford Pinto Case Study Review MGT 216 Week 4 Ethical Issues MGT 216 Week 5 Ethical Organization Profile MGT 216 Week 5 Global Business and Ethics MGT 216 Week 1 ...

  13. MGT 216 Course Tutorial/snaptutorial

    roman8006

    2015-01-01

    MGT 216 Entire Course For more classes visit www.snaptutorial.com   MGT 216 FINAL EXAM / TEST (use to study) MGT 216 Week 1 Business Ethics Perspective MGT 216 Week 2 Ethical Theories Chart MGT 216 Week 3 Case Study MGT 216 Week 3 Ethical Game Simulation MGT 216 Week 3 Learning Team Assignment Ford Pinto Case Study Review MGT 216 Week 4 Ethical Issues MGT 216 Week 5 Ethical Organization Profile MGT 216 Week 5 Global Business and Ethics ...

  14. Production of Actinium-225 via High Energy Proton Induced Spallation of Thorium-232

    Harvey, James T.; Nolen, Jerry; Vandergrift, George; Gomes, Itacil; Kroc, Tom; Horwitz, Phil; McAlister, Dan; Bowers, Del; Sullivan, Vivian; Greene, John

    2011-12-30

    The science of cancer research is currently expanding its use of alpha particle emitting radioisotopes. Coupled with the discovery and proliferation of molecular species that seek out and attach to tumors, new therapy and diagnostics are being developed to enhance the treatment of cancer and other diseases. This latest technology is commonly referred to as Alpha Immunotherapy (AIT). Actinium-225/Bismuth-213 is a parent/daughter alpha-emitting radioisotope pair that is highly sought after because of the potential for treating numerous diseases and its ability to be chemically compatible with many known and widely used carrier molecules (such as monoclonal antibodies and proteins/peptides). Unfortunately, the worldwide supply of actinium-225 is limited to about 1,000mCi annually and most of that is currently spoken for, thus limiting the ability of this radioisotope pair to enter into research and subsequently clinical trials. The route proposed herein utilizes high energy protons to produce actinium-225 via spallation of a thorium-232 target. As part of previous R and D efforts carried out at Argonne National Laboratory recently in support of the proposed US FRIB facility, it was shown that a very effective production mechanism for actinium-225 is spallation of thorium-232 by high energy proton beams. The base-line simulation for the production rate of actinium-225 by this reaction mechanism is 8E12 atoms per second at 200 MeV proton beam energy with 50 g/cm2 thorium target and 100 kW beam power. An irradiation of one actinium-225 half-life (10 days) produces {approx}100 Ci of actinium-225. For a given beam current the reaction cross section increases slightly with energy to about 400 MeV and then decreases slightly for beam energies in the several GeV regime. The object of this effort is to refine the simulations at proton beam energies of 400 MeV and above up to about 8 GeV. Once completed, the simulations will be experimentally verified using 400 MeV and 8 Ge

  15. Production of Actinium-225 via High Energy Proton Induced Spallation of Thorium-232

    The science of cancer research is currently expanding its use of alpha particle emitting radioisotopes. Coupled with the discovery and proliferation of molecular species that seek out and attach to tumors, new therapy and diagnostics are being developed to enhance the treatment of cancer and other diseases. This latest technology is commonly referred to as Alpha Immunotherapy (AIT). Actinium-225/Bismuth-213 is a parent/daughter alpha-emitting radioisotope pair that is highly sought after because of the potential for treating numerous diseases and its ability to be chemically compatible with many known and widely used carrier molecules (such as monoclonal antibodies and proteins/peptides). Unfortunately, the worldwide supply of actinium-225 is limited to about 1,000mCi annually and most of that is currently spoken for, thus limiting the ability of this radioisotope pair to enter into research and subsequently clinical trials. The route proposed herein utilizes high energy protons to produce actinium-225 via spallation of a thorium-232 target. As part of previous R and D efforts carried out at Argonne National Laboratory recently in support of the proposed US FRIB facility, it was shown that a very effective production mechanism for actinium-225 is spallation of thorium-232 by high energy proton beams. The base-line simulation for the production rate of actinium-225 by this reaction mechanism is 8E12 atoms per second at 200 MeV proton beam energy with 50 g/cm2 thorium target and 100 kW beam power. An irradiation of one actinium-225 half-life (10 days) produces ∼100 Ci of actinium-225. For a given beam current the reaction cross section increases slightly with energy to about 400 MeV and then decreases slightly for beam energies in the several GeV regime. The object of this effort is to refine the simulations at proton beam energies of 400 MeV and above up to about 8 GeV. Once completed, the simulations will be experimentally verified using 400 MeV and 8 GeV protons

  16. XMGT 216 UOP Tutorial/Uoptutorial

    David Lawrence

    2015-01-01

    For more course tutorials visit www.uoptutorial.com     XMGT 216 week 1 CheckPoint Ethical Theories Chart XMGT 216 week 1 Discussion Question 1 & 2 XMGT 216 week 2 CheckPoint Clarifying Personal Values XMGT 216 week 2 Assignment Business Ethics Reflection XMGT 216 week 3 CheckPoint Ethics Awareness Inventory XMGT 216 week 3 Discussion Question 1 & 2 XMGT 216 week 4 Assignment Ethical Issues and Management Paper XMGT 216 week 4 Chec...

  17. XMGT 216 Course tutorial/uophelp

    SXZX

    2015-01-01

    XMGT 216 Entire Course For more course tutorials visit www.uophelp.com     XMGT 216 Week 1 CheckPoint Ethical Theories Chart XMGT 216 Week 1 Discussion Question 1 & 2 XMGT 216 Week 2 CheckPoint Clarifying Personal Values XMGT 216 Week 2 Assignment Business Ethics Reflection XMGT 216 Week 3 CheckPoint Ethics Awareness Inventory XMGT 216 Week 3 Discussion Question 1 & 2 XMGT 216 Week 4 Assignment Ethical Issues and Management Paper ...

  18. XMGT 216 UOP Tutorial Course/Uoptutorial

    anemone221

    2015-01-01

    For More Course Tutorials Visit www.uoptutorial.com     XMGT 216 week 1 CheckPoint Ethical Theories Chart XMGT 216 week 1 Discussion Question 1 & 2 XMGT 216 week 2 CheckPoint Clarifying Personal Values XMGT 216 week 2 Assignment Business Ethics Reflection XMGT 216 week 3 CheckPoint Ethics Awareness Inventory XMGT 216 week 3 Discussion Question 1 & 2 XMGT 216 week 4 Assignment Ethical Issues and Management Paper XMGT 216 week 4 Chec...

  19. Neutron-Induced Fission of Actinium-227, Protactinium-231 and Neptunium-237: Mass Distribution

    Results of radiochemical studies on the mass distribution in the neutron-induced fission of actinium-227, protactinium-231 and neptunium-237 have been presented. This work has been carried out as part of a programme to determine the mass distribution in the fission of heavy elements as a function of Z and A. All irradiations have been carried out in the core of the swimming-pool type reactor APSARA with cadmium shielding wherever necessary. Relative yields of several fission product nuclides have been obtained by a method involving a comparison of the fission product activities from the respective targets with those formed from uranium-235 simultaneously irradiated. Thermal-neutron fission yields of uranium-235 have been assumed. These results indicate a predominantly asymmetric mass distribution in all the three cases, and also a distinct though small symmetric peak in the case of actinium-227. (author)

  20. A new method for the determination of low-level actinium-227 in geological samples

    We developed a new method for the determination of 227Ac in geological samples. The method uses extraction chromatographic techniques and alpha-spectrometry and is applicable for a range of natural matrices. Here we report on the procedure and results of the analysis of water (fresh and seawater) and rock samples. Water samples were acidified and rock samples underwent total dissolution via acid leaching. A DGA (N,N,N',N'-tetra-n-octyldiglycolamide) extraction chromatographic column was used for the separation of actinium. The actinium fraction was prepared for alpha spectrometric measurement via cerium fluoride micro-precipitation. Recoveries of actinium in water samples were 80 ± 8 % (number of analyses n = 14) and in rock samples 70 ± 12 % (n = 30). The minimum detectable activities (MDA) were 0.017-0.5 Bq kg-1 for both matrices. Rock sample 227Ac activities ranged from 0.17 to 8.3 Bq kg-1 and water sample activities ranged from below MDA values to 14 Bq kg-1of 227Ac. From the analysis of several standard rock and water samples with the method we found very good agreement between our results and certified values. (author)

  1. Analysis of the gamma spectra of the uranium, actinium, and thorium decay series

    Momeni, M.H.

    1981-09-01

    This report describes the identification of radionuclides in the uranium, actinium, and thorium series by analysis of gamma spectra in the energy range of 40 to 1400 keV. Energies and absolute efficiencies for each gamma line were measured by means of a high-resolution germanium detector and compared with those in the literature. A gamma spectroscopy method, which utilizes an on-line computer for deconvolution of spectra, search and identification of each line, and estimation of activity for each radionuclide, was used to analyze soil and uranium tailings, and ore.

  2. Analysis of the gamma spectra of the uranium, actinium, and thorium decay series

    This report describes the identification of radionuclides in the uranium, actinium, and thorium series by analysis of gamma spectra in the energy range of 40 to 1400 keV. Energies and absolute efficiencies for each gamma line were measured by means of a high-resolution germanium detector and compared with those in the literature. A gamma spectroscopy method, which utilizes an on-line computer for deconvolution of spectra, search and identification of each line, and estimation of activity for each radionuclide, was used to analyze soil and uranium tailings, and ore

  3. In-source laser spectroscopy developments at TRILIS—towards spectroscopy on actinium and scandium

    Resonance Ionization Laser Ion Sources (RILIS) have become a versatile tool for production and study of exotic nuclides at Isotope Separator On-Line (ISOL) facilities such as ISAC at TRIUMF. The recent development and addition of a grating tuned spectroscopy laser to the TRIUMF RILIS solid state laser system allows for wide range spectral scans to investigate atomic structures on short lived isotopes, e.g., those from the element actinium, produced in uranium targets at ISAC. In addition, development of new and improved laser ionization schemes for rare isotope production at ISAC is ongoing. Here spectroscopic studies on bound states, Rydberg states and autoionizing (AI) resonances on scandium using the existing off-line capabilities are reported. These results allowed to identify a suitable ionization scheme for scandium via excitation into an autoionizing state at 58,104 cm − 1 which has subsequently been used for ionization of on-line produced exotic scandium isotopes.

  4. 22 CFR 216.8 - Public hearings.

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Public hearings. 216.8 Section 216.8 Foreign Relations AGENCY FOR INTERNATIONAL DEVELOPMENT ENVIRONMENTAL PROCEDURES § 216.8 Public hearings. (a) In most instances AID will be able to gain the benefit of public participation in the impact statement...

  5. 12 CFR 741.216 - Flood insurance.

    2010-01-01

    ... 12 Banks and Banking 6 2010-01-01 2010-01-01 false Flood insurance. 741.216 Section 741.216 Banks... INSURANCE Regulations Codified Elsewhere in NCUA's Regulations as Applying to Federal Credit Unions That Also Apply to Federally Insured State-Chartered Credit Unions § 741.216 Flood insurance. Any...

  6. 32 CFR 216.5 - Responsibilities.

    2010-07-01

    ... 32 National Defense 2 2010-07-01 2010-07-01 false Responsibilities. 216.5 Section 216.5 National... § 216.5 Responsibilities. (a) The PDUSD(P&R), under the Under Secretary of Defense for Personnel and... appropriate preparations to carry out their responsibilities should a covered school be determined...

  7. 50 CFR 216.87 - Wildlife research.

    2010-10-01

    ... 50 Wildlife and Fisheries 7 2010-10-01 2010-10-01 false Wildlife research. 216.87 Section 216.87... Pribilof Islands Administration § 216.87 Wildlife research. (a) Wildlife research, other than research on... to the following conditions: (1) Any person or agency, seeking to conduct such research shall...

  8. 50 CFR 216.42 - Photography. [Reserved

    2010-10-01

    ... 50 Wildlife and Fisheries 7 2010-10-01 2010-10-01 false Photography. 216.42 Section 216.42 Wildlife and Fisheries NATIONAL MARINE FISHERIES SERVICE, NATIONAL OCEANIC AND ATMOSPHERIC ADMINISTRATION, DEPARTMENT OF COMMERCE MARINE MAMMALS REGULATIONS GOVERNING THE TAKING AND IMPORTING OF MARINE MAMMALS Special Exceptions § 216.42...

  9. 25 CFR 216.8 - Performance bond.

    2010-04-01

    ... 25 Indians 1 2010-04-01 2010-04-01 false Performance bond. 216.8 Section 216.8 Indians BUREAU OF... RECLAMATION OF LANDS General Provisions § 216.8 Performance bond. (a) Upon approval of an exploration plan or mining plan, the operator shall be required to file a suitable performance bond of not less than...

  10. 29 CFR 500.216 - Substituted service.

    2010-07-01

    ... 29 Labor 3 2010-07-01 2010-07-01 false Substituted service. 500.216 Section 500.216 Labor... Service § 500.216 Substituted service. (a) Pursuant to section 102(5) of the Act, the Secretary, when so designated by a court, shall accept service of summons in any action arising under the Act or...

  11. Developments towards in-gas-jet laser spectroscopy studies of actinium isotopes at LISOL

    Raeder, S.; Bastin, B.; Block, M.; Creemers, P.; Delahaye, P.; Ferrer, R.; Fléchard, X.; Franchoo, S.; Ghys, L.; Gaffney, L. P.; Granados, C.; Heinke, R.; Hijazi, L.; Huyse, M.; Kron, T.; Kudryavtsev, Yu.; Laatiaoui, M.; Lecesne, N.; Luton, F.; Moore, I. D.; Martinez, Y.; Mogilevskiy, E.; Naubereit, P.; Piot, J.; Rothe, S.; Savajols, H.; Sels, S.; Sonnenschein, V.; Traykov, E.; Van Beveren, C.; Van den Bergh, P.; Van Duppen, P.; Wendt, K.; Zadvornaya, A.

    2016-06-01

    To study exotic nuclides at the borders of stability with laser ionization and spectroscopy techniques, highest efficiencies in combination with a high spectral resolution are required. These usually opposing requirements are reconciled by applying the in-gas-laser ionization and spectroscopy (IGLIS) technique in the supersonic gas jet produced by a de Laval nozzle installed at the exit of the stopping gas cell. Carrying out laser ionization in the low-temperature and low density supersonic gas jet eliminates pressure broadening, which will significantly improve the spectral resolution. This article presents the required modifications at the Leuven Isotope Separator On-Line (LISOL) facility that are needed for the first on-line studies of in-gas-jet laser spectroscopy. Different geometries for the gas outlet and extraction ion guides have been tested for their performance regarding the acceptance of laser ionized species as well as for their differential pumping capacities. The specifications and performance of the temporarily installed high repetition rate laser system, including a narrow bandwidth injection-locked Ti:sapphire laser, are discussed and first preliminary results on neutron-deficient actinium isotopes are presented indicating the high capability of this novel technique.

  12. 48 CFR 216.405 - Cost-reimbursement incentive contracts.

    2010-10-01

    ... incentive contracts. 216.405 Section 216.405 Federal Acquisition Regulations System DEFENSE ACQUISITION REGULATIONS SYSTEM, DEPARTMENT OF DEFENSE CONTRACTING METHODS AND CONTRACT TYPES TYPES OF CONTRACTS Incentive Contracts 216.405 Cost-reimbursement incentive contracts....

  13. 43 CFR 17.216 - Accessibility.

    2010-10-01

    ... 43 Public Lands: Interior 1 2010-10-01 2010-10-01 false Accessibility. 17.216 Section 17.216 Public Lands: Interior Office of the Secretary of the Interior NONDISCRIMINATION IN FEDERALLY ASSISTED... Accessibility. No handicapped person shall, because a recipient's facilities are inaccessible to or unusable...

  14. 32 CFR 216.4 - Policy.

    2010-07-01

    ... 32 National Defense 2 2010-07-01 2010-07-01 false Policy. 216.4 Section 216.4 National Defense... Policy. It is DoD policy that: (a) Under 10 U.S.C. 983, no covered funds may be provided by contract or... Secretary of Defense determines that the covered school: (1) Has a policy or practice (regardless of...

  15. 36 CFR 216.5 - Documentation.

    2010-07-01

    ... 36 Parks, Forests, and Public Property 2 2010-07-01 2010-07-01 false Documentation. 216.5 Section... PUBLIC IN THE FORMULATION OF FOREST SERVICE DIRECTIVES § 216.5 Documentation. The responsible Forest... reasons therefor, in a concise written summary. The summary may be combined with documentation required...

  16. 31 CFR 800.216 - Foreign person.

    2010-07-01

    ... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false Foreign person. 800.216 Section 800... TAKEOVERS BY FOREIGN PERSONS Definitions § 800.216 Foreign person. The term foreign person means: (a) Any foreign national, foreign government, or foreign entity; or (b) Any entity over which control is...

  17. 18 CFR 157.216 - Abandonment.

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Abandonment. 157.216 Section 157.216 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION, DEPARTMENT... firm contract; or (2) A facility that did or could now qualify for automatic authorization as...

  18. 50 CFR 216.101 - Purpose.

    2010-10-01

    ... General Regulations Governing Small Takes of Marine Mammals Incidental to Specified Activities § 216.101... request, the incidental, but not intentional, taking of small numbers of marine mammals by U.S....

  19. 50 CFR 216.102 - Scope.

    2010-10-01

    ... General Regulations Governing Small Takes of Marine Mammals Incidental to Specified Activities § 216.102 Scope. The taking of small numbers of marine mammals under section 101(a)(5) (A) through (D) of...

  20. Atmospheric Abundances, Trends and Emissions of CFC-216ba, CFC-216ca and HCFC-225ca

    Corinna Kloss

    2014-06-01

    Full Text Available The first observations of the feedstocks, CFC-216ba (1,2-dichlorohexafluoropropane and CFC-216ca (1,3-dichlorohexafluoropropane, as well as the CFC substitute HCFC-225ca (3,3-dichloro-1,1,1,2,2-pentafluoropropane, are reported in air samples collected between 1978 and 2012 at Cape Grim, Tasmania. Present day (2012 mixing ratios are 37.8 ± 0.08 ppq (parts per quadrillion; 1015 and 20.2 ± 0.3 ppq for CFC-216ba and CFC-216ca, respectively. The abundance of CFC-216ba has been approximately constant for the past 20 years, whilst that of CFC-216ca is increasing, at a current rate of 0.2 ppq/year. Upper tropospheric air samples collected in 2013 suggest a further continuation of this trend. Inferred annual emissions peaked 421 at 0.18 Gg/year (CFC-216ba and 0.05 Gg/year (CFC-216ca in the mid-1980s and then decreased sharply as expected from the Montreal Protocol phase-out schedule for CFCs. The atmospheric trend of CFC-216ca and CFC-216ba translates into continuing emissions of around 0.01 Gg/year in 2011, indicating that significant banks still exist or that they are still being used. HCFC-225ca was not detected in air samples collected before 1992. The highest mixing ratio of 52 ± 1 ppq was observed in 2001. Increasing annual emissions were found in the 1990s (i.e., when HCFC-225ca was being introduced as a replacement for CFCs. Emissions peaked around 1999 at about 1.51 Gg/year. In accordance with the Montreal Protocol, restrictions on HCFC consumption and the short lifetime of HCFC-225ca, mixing ratios declined after 2001 to 23.3 ± 0.7 ppq by 2012.

  1. 50 CFR 216.103 - Definitions.

    2010-10-01

    ... General Regulations Governing Small Takes of Marine Mammals Incidental to Specified Activities § 216.103..., adversely affect the species or stock through effects on annual rates of recruitment or survival. Small... place in a specified geographical region and potentially involves the taking of small numbers of...

  2. 22 CFR 216.6 - Environmental assessments.

    2010-04-01

    ... Foreign Relations AGENCY FOR INTERNATIONAL DEVELOPMENT ENVIRONMENTAL PROCEDURES § 216.6 Environmental... environment so that the expected benefits of development objectives can be weighed against any adverse impacts upon the human environment or any irreversible or irretrievable commitment of resources....

  3. 20 CFR 498.216 - Witnesses.

    2010-04-01

    ... § 498.216 Witnesses. (a) Except as provided in paragraph (b) of this section, testimony at the hearing..., testimony (other than expert testimony) may be admitted in the form of a written statement. Any such written statement must be provided to all other parties along with the last known address of such witness, in...

  4. 27 CFR 24.216 - Distilling material.

    2010-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Distilling material. 24..., DEPARTMENT OF THE TREASURY LIQUORS WINE Production of Other Than Standard Wine § 24.216 Distilling material... fruit residues, for use as distilling material, using any quantity of water desired to...

  5. 40 CFR 2.216-2.300 - [Reserved

    2010-07-01

    ... 40 Protection of Environment 1 2010-07-01 2010-07-01 false 2.216-2.300 Section 2.216-2.300 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY GENERAL PUBLIC INFORMATION Confidentiality of Business Information §§ 2.216-2.300...

  6. 42 CFR 57.216a - Performance standard.

    2010-10-01

    ... 42 Public Health 1 2010-10-01 2010-10-01 false Performance standard. 57.216a Section 57.216a... Professions Student Loans § 57.216a Performance standard. On June 30, 1984, and on each June 30 thereafter, except as provided in paragraph (b) of this section, each school must have a default rate (as...

  7. 9 CFR 113.216 - Bovine Rhinotracheitis Vaccine, Killed Virus.

    2010-01-01

    ... Virus. 113.216 Section 113.216 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE VIRUSES, SERUMS, TOXINS, AND ANALOGOUS PRODUCTS; ORGANISMS AND VECTORS STANDARD REQUIREMENTS Killed Virus Vaccines § 113.216 Bovine Rhinotracheitis Vaccine, Killed Virus. Infectious...

  8. 50 CFR 216.83 - Importation of birds or mammals.

    2010-10-01

    ... 50 Wildlife and Fisheries 7 2010-10-01 2010-10-01 false Importation of birds or mammals. 216.83 Section 216.83 Wildlife and Fisheries NATIONAL MARINE FISHERIES SERVICE, NATIONAL OCEANIC AND ATMOSPHERIC... MAMMALS Pribilof Islands Administration § 216.83 Importation of birds or mammals. No mammals or...

  9. 25 CFR 216.7 - Approval of mining plan.

    2010-04-01

    ... 25 Indians 1 2010-04-01 2010-04-01 false Approval of mining plan. 216.7 Section 216.7 Indians BUREAU OF INDIAN AFFAIRS, DEPARTMENT OF THE INTERIOR ENERGY AND MINERALS SURFACE EXPLORATION, MINING, AND RECLAMATION OF LANDS General Provisions § 216.7 Approval of mining plan. (a) Before surface mining...

  10. 49 CFR 216.27 - Reservation of authority and discretion.

    2010-10-01

    ... 49 Transportation 4 2010-10-01 2010-10-01 false Reservation of authority and discretion. 216.27 Section 216.27 Transportation Other Regulations Relating to Transportation (Continued) FEDERAL RAILROAD..., LOCOMOTIVE AND EQUIPMENT Emergency Order-Track § 216.27 Reservation of authority and discretion. The FRA...

  11. 10 CFR 216.7 - Conflict in priority orders.

    2010-01-01

    ... 10 Energy 3 2010-01-01 2010-01-01 false Conflict in priority orders. 216.7 Section 216.7 Energy... DOMESTIC ENERGY SUPPLIES § 216.7 Conflict in priority orders. If it appears that the use of assistance pursuant to DPA section 101(c) creates or threatens to create a conflict with priorities and...

  12. 216-B-3 expansion ponds closure plan

    1994-10-01

    This document describes the activities for clean closure under the Resource Conservation and Recovery Act of 1976 (RCRA) of the 216-B-3 Expansion Ponds. The 216-B-3 Expansion Ponds are operated by the US Department of Energy, Richland Operations Office (DOE-RL) and co-operated by Westinghouse Hanford Company (Westinghouse Hanford). The 216-B-3 Expansion Ponds consists of a series of three earthen, unlined, interconnected ponds that receive waste water from various 200 East Area operating facilities. The 3A, 3B, and 3C ponds are referred to as Expansion Ponds because they expanded the capability of the B Pond System. Waste water (primarily cooling water, steam condensate, and sanitary water) from various 200 East Area facilities is discharged to the Bypass pipe (Project X-009). Water discharged to the Bypass pipe flows directly into the 216-B-3C Pond. The ponds were operated in a cascade mode, where the Main Pond overflowed into the 3A Pond and the 3A Pond overflowed into the 3C Pond. The 3B Pond has not received waste water since May 1985; however, when in operation, the 3B Pond received overflow from the 3A Pond. In the past, waste water discharges to the Expansion Ponds had the potential to have contained mixed waste (radioactive waste and dangerous waste). The radioactive portion of mixed waste has been interpreted by the US Department of Energy (DOE) to be regulated under the Atomic Energy Act of 1954; the dangerous waste portion of mixed waste is regulated under RCRA.

  13. 216-B-3 expansion ponds closure plan

    This document describes the activities for clean closure under the Resource Conservation and Recovery Act of 1976 (RCRA) of the 216-B-3 Expansion Ponds. The 216-B-3 Expansion Ponds are operated by the US Department of Energy, Richland Operations Office (DOE-RL) and co-operated by Westinghouse Hanford Company (Westinghouse Hanford). The 216-B-3 Expansion Ponds consists of a series of three earthen, unlined, interconnected ponds that receive waste water from various 200 East Area operating facilities. The 3A, 3B, and 3C ponds are referred to as Expansion Ponds because they expanded the capability of the B Pond System. Waste water (primarily cooling water, steam condensate, and sanitary water) from various 200 East Area facilities is discharged to the Bypass pipe (Project X-009). Water discharged to the Bypass pipe flows directly into the 216-B-3C Pond. The ponds were operated in a cascade mode, where the Main Pond overflowed into the 3A Pond and the 3A Pond overflowed into the 3C Pond. The 3B Pond has not received waste water since May 1985; however, when in operation, the 3B Pond received overflow from the 3A Pond. In the past, waste water discharges to the Expansion Ponds had the potential to have contained mixed waste (radioactive waste and dangerous waste). The radioactive portion of mixed waste has been interpreted by the US Department of Energy (DOE) to be regulated under the Atomic Energy Act of 1954; the dangerous waste portion of mixed waste is regulated under RCRA

  14. Groundwater seepage from the Ranger uranium mine tailings dam: radioisotopes of radium, thorium and actinium. Supervising Scientist report 106

    Monitoring of bores near the Ranger uranium mine tailings dam has revealed deterioration in water quality in several bores since 1983. In a group of bores to the north of the dam, increases have been observed of up to 500 times for sulphate concentrations and of up to 5 times for 226Ra concentrations. Results are presented here of measurements of members of the uranium, thorium and actinium decay series in borewater samples collected between 1985 and 1993. In particular, measurements of all four naturally-occurring radium isotopes have been used in an investigation of the mechanism of radium concentration changes. For the most seepage-affected bores the major findings of the study include: 228Ra/226Ra 223Ra /226Ra and 224Ra/228Ra ratios all increased over the course of the study; barium concentrations show high seasonal variability, being lower in November than May, but strontium concentrations show a steady increase with time. Calculations show that the groundwater is probably saturated with respect to barite but not with respect to celestite or anglesite; sulphide concentrations are low in comparison with sulphate, and are higher in November than in May; and 227Ac concentrations have increased with time, but do not account for the high 223Ra/226Ra ratios. It is concluded on the basis of these observations that increases in Ra isotope concentrations observed in a number of seepage-affected bores arise from increases in salinity leading to desorption of radium from adsorption sites in the vicinity of the bore rather by direct transport of radium from the tailings. Increased salinity is also causing the observed increases in 227Ac and strontium concentrations, while formation of a barite solid phase in the groundwater is causing the removal of some radium from solution. This is the cause of the increasing radium isotope ratios noted above

  15. 48 CFR 52.216-5 - Price Redetermination-Prospective.

    2010-10-01

    ... 48 Federal Acquisition Regulations System 2 2010-10-01 2010-10-01 false Price Redetermination-Prospective. 52.216-5 Section 52.216-5 Federal Acquisition Regulations System FEDERAL ACQUISITION REGULATION... of the excess has been applied to the liquidation of progress payments, then that portion...

  16. 48 CFR 52.216-6 - Price Redetermination-Retroactive.

    2010-10-01

    ... 48 Federal Acquisition Regulations System 2 2010-10-01 2010-10-01 false Price Redetermination-Retroactive. 52.216-6 Section 52.216-6 Federal Acquisition Regulations System FEDERAL ACQUISITION REGULATION... of the excess has been applied to the liquidation of progress payments, then that portion...

  17. 36 CFR 2.16 - Horses and pack animals.

    2010-07-01

    ... 36 Parks, Forests, and Public Property 1 2010-07-01 2010-07-01 false Horses and pack animals. 2.16... RESOURCE PROTECTION, PUBLIC USE AND RECREATION § 2.16 Horses and pack animals. The following are prohibited... equipment. (b) The use of horses or pack animals outside of trails, routes or areas designated for their...

  18. 47 CFR 36.216 - Uncollectible revenue-Account 5300.

    2010-10-01

    ... 47 Telecommunication 2 2010-10-01 2010-10-01 false Uncollectible revenue-Account 5300. 36.216..., REVENUES, EXPENSES, TAXES AND RESERVES FOR TELECOMMUNICATIONS COMPANIES 1 Operating Revenues and Certain Income Accounts Operating Revenues § 36.216 Uncollectible revenue—Account 5300. The amounts in...

  19. 50 CFR 216.74 - Cooperation with Federal officials.

    2010-10-01

    ... 50 Wildlife and Fisheries 7 2010-10-01 2010-10-01 false Cooperation with Federal officials. 216.74... MAMMALS Pribilof Islands, Taking for Subsistence Purposes § 216.74 Cooperation with Federal officials... subsistence uses must, consistent with 5 CFR 1320.7(k)(3), cooperate with the NMFS representatives on...

  20. 48 CFR 216.104-70 - Research and development.

    2010-10-01

    ... Contract Types § 216.104-70 Research and development. Follow the procedures at PGI 216.104-70 for selecting the appropriate research and development contract type. ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Research and...

  1. 28 CFR 2.216 - Revocation hearing procedure.

    2010-07-01

    ... 28 Judicial Administration 1 2010-07-01 2010-07-01 false Revocation hearing procedure. 2.216 Section 2.216 Judicial Administration DEPARTMENT OF JUSTICE PAROLE, RELEASE, SUPERVISION AND RECOMMITMENT... identity of a confidential informant or result in harm to any person, that information may be withheld...

  2. 50 CFR 216.85 - Walrus and Otter Islands.

    2010-10-01

    ... 50 Wildlife and Fisheries 7 2010-10-01 2010-10-01 false Walrus and Otter Islands. 216.85 Section... MAMMALS Pribilof Islands Administration § 216.85 Walrus and Otter Islands. By Executive Order 1044, dated February 27, 1909, Walrus and Otter Islands were set aside as bird reservations. All persons are...

  3. 48 CFR 1852.216-81 - Estimated cost.

    2010-10-01

    ... 48 Federal Acquisition Regulations System 6 2010-10-01 2010-10-01 true Estimated cost. 1852.216-81... Estimated cost. As prescribed in 1816.307-70(d), insert the following clause: Estimated cost (DEC 1988) The total estimated cost for complete performance of this contract is $ . See FAR clause 52.216-11,...

  4. 48 CFR 3052.216-73 - Distribution of award fee.

    2010-10-01

    ... of 85 percent of the base fee and potential award fee, the Government may withhold further payment of... 48 Federal Acquisition Regulations System 7 2010-10-01 2010-10-01 false Distribution of award fee. 3052.216-73 Section 3052.216-73 Federal Acquisition Regulations System DEPARTMENT OF HOMELAND...

  5. 50 CFR 216.91 - Dolphin-safe labeling standards.

    2010-10-01

    ... 50 Wildlife and Fisheries 7 2010-10-01 2010-10-01 false Dolphin-safe labeling standards. 216.91... MAMMALS Dolphin Safe Tuna Labeling § 216.91 Dolphin-safe labeling standards. (a) It is a violation of... include on the label of those products the term “dolphin-safe” or any other term or symbol that claims...

  6. 46 CFR 153.216 - Shower and eyewash fountains.

    2010-10-01

    ... Vessel Requirements § 153.216 Shower and eyewash fountains. (a) Each non-self-propelled ship must have a fixed or portable shower and eyewash fountain that operates during cargo transfer and meets paragraph (c... 46 Shipping 5 2010-10-01 2010-10-01 false Shower and eyewash fountains. 153.216 Section...

  7. 50 CFR 216.81 - Visits to fur seal rookeries.

    2010-10-01

    ... 50 Wildlife and Fisheries 7 2010-10-01 2010-10-01 false Visits to fur seal rookeries. 216.81... MAMMALS Pribilof Islands Administration § 216.81 Visits to fur seal rookeries. From June 1 to October 15... any fur seal rookery or hauling grounds nor pass beyond any posted sign forbidding passage....

  8. 50 CFR 216.73 - Disposition of fur seal parts.

    2010-10-01

    ... 50 CFR 216.23(c) for the purpose of processing, and will be returned directly to the Alaskan Native..., or to an agent registered under 50 CFR 216.23(c) for resale or transfer to an Alaskan Native, who... 50 Wildlife and Fisheries 7 2010-10-01 2010-10-01 false Disposition of fur seal parts....

  9. 48 CFR 1652.216-71 - Accounting and Allowable Cost.

    2010-10-01

    ... of FEHBP Clauses 1652.216-71 Accounting and Allowable Cost. As prescribed in section 1616.7002, the...). Accounting and Allowable Cost (FEHBAR 1652.216-71) (JAN 2003) (a) Annual Accounting Statements. (1) The... addition, the Carrier must: (i) on request, document and make available accounting support for the cost...

  10. 27 CFR 40.216 - Notice for smokeless tobacco.

    2010-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 2 2010-04-01 2010-04-01 false Notice for smokeless tobacco. 40.216 Section 40.216 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT OF THE TREASURY (CONTINUED) TOBACCO MANUFACTURE OF TOBACCO PRODUCTS, CIGARETTE...

  11. Monitoring plan for borehole logging at 216-Z-1A Tile Field, 216-Z-9 Trench, and 216-Z-12 Crib

    This plan describes the fiscal year 1998 vadose monitoring of three inactive, liquid waste disposal facilities associated with the Plutonium Finishing Plant (Z-Plant): the 216-Z-1A Tile Field, the 216-Z-9 Trench, and the 216-Z-12 Crib. Monitoring will consist of spectral gamma ray logging of 21 boreholes. This plan describes the physical characteristics of the facilities, their operational histories, the subsurface geology and known contamination distribution at each facility. The plan then describes the specific monitoring to be done including the boreholes to be logged, the methods of data acquisition, data reduction, and data evaluation, and finally, the quality control, data management and data reporting for this effort. The three liquid waste disposal facilities at the Z Plant were chosen to be monitored because they were identified as containing some of the most significant sources of radioactive contamination in the Hanford vadose zone. Johnson's analysis was based on the relative hazard obtained by combining curie quantities disposed to the facilities with appropriate health risk standards. The basic question to be addressed by this logging activity addresses the configuration of subsurface contamination since it was last measured. Historical data from the 216-Z-1A Tile Field, the 216-Z-9 Trench, and the 216-Z-12 Crib form the baseline for comparisons to answer this question

  12. Dicty_cDB: CFI216 [Dicty_cDB

    Full Text Available TGTACCAATTCATAAT CTTATGGAAGATGCTGCTACCGCTGAAATTTCAAGATCTCAAATTTGGCAATGGATTAAA CATAAAGCACCATT Length of 3' end seq. 494 Connect...ed seq. ID CFI216P Connected seq. >CFI216P.Seq ATTTATTTTATTTTAT...ATGGATTAAACATAAAGCACCATT Length of connected seq. 614 Full length Seq ID - Full length Seq. - Length of full length seq. - ... ...ksnfihsiincskf*rdc*iivisrpc*tr*yh*gwl*k*yrc wysis*slvkw*wlctns*sygrccyr*nfkisnlamd*t*sti... 8.0 %: endoplasmic reticulum 4.0 %: vesicles of secretory system 4.0 %: peroxisomal >> prediction for CFI216 is

  13. The decay of the neutron-rich nucleus 216Bi

    The decay of the neutron-rich isotope 216Bi, produced by proton-induced spallation at the PS Booster-ISOLDE facility, was investigated by β-γγ, αγ coincidence and spectrum-multiscaling measurements. A new method for reducing isobaric contamination enabled to cover the unknown region ''east'' of 208Pb for the isobaric chain A=216. The half-life of the β decay of 216Bi was found as T1/2=135±5 s. Its decay scheme was extended and the possible shell model configurations are proposed. (orig.)

  14. 48 CFR 252.216-7001 - Economic price adjustment-nonstandard steel items.

    2010-10-01

    ...-nonstandard steel items. 252.216-7001 Section 252.216-7001 Federal Acquisition Regulations System DEFENSE... CLAUSES Text of Provisions And Clauses 252.216-7001 Economic price adjustment—nonstandard steel items. As prescribed in 216.203-4-70(b), use the following clause: Economic Price Adjustment—Nonstandard Steel...

  15. Soil/sediment characterization for 216-A-29 ditch

    Mitchell, R.M.

    1997-03-01

    This document provides a detailed description of the environmental samples collected from the 216-A-29 Ditch in 1988. Tables summarizing the laboratory data for radionuclides, metals, and soil chemistry are included.

  16. 12 CFR 216.1 - Purpose and scope.

    2010-01-01

    ... CONSUMER FINANCIAL INFORMATION (REGULATION P) § 216.1 Purpose and scope. (a) Purpose. This part governs the... who obtain financial products or services primarily for personal, family, or household purposes...

  17. 18 CFR 367.2160 - Account 216, Unappropriated retained earnings.

    2010-04-01

    ... NATURAL GAS ACT Balance Sheet Chart of Accounts Proprietary Capital § 367.2160 Account 216, Unappropriated... ACT OF 2005, FEDERAL POWER ACT AND NATURAL GAS ACT UNIFORM SYSTEM OF ACCOUNTS FOR CENTRALIZED...

  18. Dicty_cDB: SLE216 [Dicty_cDB

    Full Text Available SL (Link to library) SLE216 (Link to dictyBase) - - - Contig-U13024-1 SLE216Z (Link to Original ... 48 AY530539_1( AY530539 |pid:none) Mimulus ringens def iciens (DEF ) mR... 34 4.4 AY524011_1( AY524011 |pid ... :none) Paulownia tomentosa def iciens (DEF ... 33 5.8 protein update 2009. 1.22 PSO ...

  19. Results of 1998 spectral gamma-ray monitoring of boreholes at the 216-Z-1A tile field, 216-Z-9 trench, and 216-Z-12 crib

    Horton, D.G. [Pacific Northwest National Lab., Richland, WA (United States); Randall, R.R. [Three Rivers Scientific, West Richland, WA (United States)

    1998-09-01

    This document describes the results of fiscal year 1998 vadose zone monitoring of three inactive liquid waste disposal facilities associated with the Plutonium Finishing Plant: the 216-Z-1A tile field, the 216-Z-9 trench, and the 216-Z-12 crib. Monitoring consisted of spectral gamma-ray logging of 21 boreholes. This work was performed by Pacific Northwest National Laboratory in conjunction with Three Rivers Scientific and Waste management Federal Services, inc. Northwest Operations. These three liquid waste disposal facilities were chosen for monitoring because they were identified as containing some of the most significant sources of radioactive contamination in the Hanford Site vadose zone. The basic question addressed by this logging activity is ``Has the configuration of subsurface contamination changed since it was last measured?`` Previous borehole logging and laboratory analyses provide the baseline data to help answer this question.

  20. Results of 1998 spectral gamma-ray monitoring of boreholes at the 216-Z-1A tile field, 216-Z-9 trench, and 216-Z-12 crib

    This document describes the results of fiscal year 1998 vadose zone monitoring of three inactive liquid waste disposal facilities associated with the Plutonium Finishing Plant: the 216-Z-1A tile field, the 216-Z-9 trench, and the 216-Z-12 crib. Monitoring consisted of spectral gamma-ray logging of 21 boreholes. This work was performed by Pacific Northwest National Laboratory in conjunction with Three Rivers Scientific and Waste management Federal Services, inc. Northwest Operations. These three liquid waste disposal facilities were chosen for monitoring because they were identified as containing some of the most significant sources of radioactive contamination in the Hanford Site vadose zone. The basic question addressed by this logging activity is ''Has the configuration of subsurface contamination changed since it was last measured?'' Previous borehole logging and laboratory analyses provide the baseline data to help answer this question

  1. 216-U-10 Pond and 216-Z-19 Ditch characterization studies

    Last, G.V.; Duncan, D.W.; Graham, M.J.; Hall, M.D.; Hall, V.W.; Landeen, D.S.; Leitz, J.G.; Mitchell, R.M.

    1994-02-01

    The chemical, reprocessing of spent nuclear fuels at the US Department of Energy`s Hanford Site has generated large volumes of radioactive liquid effluents. The majority of these effluents have been used strictly for cooling or other supportive functions and have been discharged to ditches and ponds. The 216-U-10 Pond and 216-Z-19 Ditch are two such disposal facilities. These facilities are components of an integrated system of ditches, ponds, and overflow facilities collectively referred to as the U-Pond disposal system. The U-Pond system has been used since 1943 and has received a large variety of radioisotopes from several sources. This study covered tho major aspects of the environment, including wind resuspension, biological uptake and transport, geologic distribution in surface and subsurface sediments, and ground-water impacts. The long-term use of U-Pond and the Z-19 Ditch has resulted in the localized accumulation of transuranic and fission product inventories as a result of sorption and filtration of particulates onto the uppermost sediments.

  2. 216-U-10 Pond and 216-Z-19 Ditch characterization studies

    The chemical, reprocessing of spent nuclear fuels at the US Department of Energy's Hanford Site has generated large volumes of radioactive liquid effluents. The majority of these effluents have been used strictly for cooling or other supportive functions and have been discharged to ditches and ponds. The 216-U-10 Pond and 216-Z-19 Ditch are two such disposal facilities. These facilities are components of an integrated system of ditches, ponds, and overflow facilities collectively referred to as the U-Pond disposal system. The U-Pond system has been used since 1943 and has received a large variety of radioisotopes from several sources. This study covered tho major aspects of the environment, including wind resuspension, biological uptake and transport, geologic distribution in surface and subsurface sediments, and ground-water impacts. The long-term use of U-Pond and the Z-19 Ditch has resulted in the localized accumulation of transuranic and fission product inventories as a result of sorption and filtration of particulates onto the uppermost sediments

  3. Combination RCRA groundwater monitoring plan for the 216-A-10, 216-A-36B, and 216-A-37-1 PUREX cribs

    Lindberg, J.W.

    1997-06-01

    This document presents a groundwater quality assessment monitoring plan, under Resource Conservation and Recovery Act of 1976 (RCRA) regulatory requirements for three RCRA sites in the Hanford Site`s 200 East Area: 216-A-10, 216-A-36B, and 216-A-37-1 cribs (PUREX cribs). The objectives of this monitoring plan are to combine the three facilities into one groundwater quality assessment program and to assess the nature, extent, and rate of contaminant migration from these facilities. A groundwater quality assessment plan is proposed because at least one downgradient well in the existing monitoring well networks has concentrations of groundwater constituents indicating that the facilities have contributed to groundwater contamination. The proposed combined groundwater monitoring well network includes 11 existing near-field wells to monitor contamination in the aquifer in the immediate vicinity of the PUREX cribs. Because groundwater contamination from these cribs is known to have migrated as far away as the 300 Area (more than 25 km from the PUREX cribs), the plan proposes to use results of groundwater analyses from 57 additional wells monitored to meet environmental monitoring requirements of US Department of Energy Order 5400.1 to supplement the near-field data. Assessments of data collected from these wells will help with a future decision of whether additional wells are needed.

  4. Combination RCRA groundwater monitoring plan for the 216-A-10, 216-A-36B, and 216-A-37-1 PUREX cribs

    This document presents a groundwater quality assessment monitoring plan, under Resource Conservation and Recovery Act of 1976 (RCRA) regulatory requirements for three RCRA sites in the Hanford Site's 200 East Area: 216-A-10, 216-A-36B, and 216-A-37-1 cribs (PUREX cribs). The objectives of this monitoring plan are to combine the three facilities into one groundwater quality assessment program and to assess the nature, extent, and rate of contaminant migration from these facilities. A groundwater quality assessment plan is proposed because at least one downgradient well in the existing monitoring well networks has concentrations of groundwater constituents indicating that the facilities have contributed to groundwater contamination. The proposed combined groundwater monitoring well network includes 11 existing near-field wells to monitor contamination in the aquifer in the immediate vicinity of the PUREX cribs. Because groundwater contamination from these cribs is known to have migrated as far away as the 300 Area (more than 25 km from the PUREX cribs), the plan proposes to use results of groundwater analyses from 57 additional wells monitored to meet environmental monitoring requirements of US Department of Energy Order 5400.1 to supplement the near-field data. Assessments of data collected from these wells will help with a future decision of whether additional wells are needed

  5. 48 CFR 1852.216-88 - Performance incentive.

    2010-10-01

    ... 48 Federal Acquisition Regulations System 6 2010-10-01 2010-10-01 true Performance incentive. 1852... 1852.216-88 Performance incentive. As prescribed in 1816.406-70(f), insert the following clause: Performance Incentive (JAN 1997) (a) A performance incentive applies to the following hardware...

  6. 48 CFR 52.216-10 - Incentive Fee.

    2010-10-01

    ... 48 Federal Acquisition Regulations System 2 2010-10-01 2010-10-01 false Incentive Fee. 52.216-10... Incentive Fee. As prescribed in 16.307(d), insert the following clause in solicitations and contracts when a cost-plus-incentive-fee contract (other than a facilities contract) is contemplated: Incentive Fee...

  7. 48 CFR 216.403 - Fixed-price incentive contracts.

    2010-10-01

    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Fixed-price incentive... SYSTEM, DEPARTMENT OF DEFENSE CONTRACTING METHODS AND CONTRACT TYPES TYPES OF CONTRACTS Incentive Contracts 216.403 Fixed-price incentive contracts....

  8. 48 CFR 1852.216-83 - Fixed price incentive.

    2010-10-01

    ... 48 Federal Acquisition Regulations System 6 2010-10-01 2010-10-01 true Fixed price incentive. 1852... 1852.216-83 Fixed price incentive. As prescribed in 1816.406-70(c), insert the following clause: Fixed Price Incentive (OCT 1996) The target cost of this contract is $___. The Target profit of this...

  9. Dicty_cDB: CHB216 [Dicty_cDB

    Full Text Available CH (Link to library) CHB216 (Link to dictyBase) - - - Contig-U16381-1 - (Link to Original site) ... stsl*n*msrrs*m*s**mg*rmlrkdqm**yl*lalskgs*mqdqt*w**mlc ... pfmetktt*ttststnlqikmstrs*mqt**tw*rmlr*ktss**m*pqm ... *erl*m*nqt *wlqmlc qensketml*tkfmcqr*kmcchqrqnhlcktnl**yslssklplhmw**n ...

  10. 13 CFR 134.216 - Alternative dispute resolution procedures.

    2010-01-01

    ... 13 Business Credit and Assistance 1 2010-01-01 2010-01-01 false Alternative dispute resolution....216 Alternative dispute resolution procedures. At any time during the pendency of a case, the parties may submit a joint motion requesting that the Judge permit the use of alternative dispute...

  11. 48 CFR 2452.216-73 - Performance evaluation plan.

    2010-10-01

    ... 48 Federal Acquisition Regulations System 6 2010-10-01 2010-10-01 true Performance evaluation plan... 2452.216-73 Performance evaluation plan. As prescribed in 2416.406(e)(3), insert the following clause in all award fee contracts: Performance Evaluation Plan (AUG 1987) (a) The Government...

  12. 48 CFR 3052.216-72 - Performance evaluation plan.

    2010-10-01

    ... CONTRACT CLAUSES Text of Provisions and Clauses 3052.216-72 Performance evaluation plan. As prescribed in (HSAR) 48 CFR 3016.406(e)(i)(ii), insert a clause substantially the same as the following: Performance... 48 Federal Acquisition Regulations System 7 2010-10-01 2010-10-01 false Performance...

  13. 48 CFR 1252.216-72 - Performance evaluation plan.

    2010-10-01

    ....216-72 Performance evaluation plan. As prescribed in (TAR) 48 CFR 1216.406(b), insert the following clause: Performance Evaluation Plan (OCT 1994) (a) A Performance Evaluation Plan shall be unilaterally... 48 Federal Acquisition Regulations System 5 2010-10-01 2010-10-01 false Performance...

  14. Adsorption gas chromatography with 150-ms 216Po

    A gas chromatography apparatus was developed, which allows experiments with volatile radionuclides having shorter half-lives than one second. This apparatus was tested with the 150-ms isotope 216Po. Experimental data were compared with a Monte Carlo model to determine the adsorption enthalpy ΔHa. (author) 2 figs., 2 refs

  15. 31 CFR 31.216 - Communications with Treasury employees.

    2010-07-01

    ... employee, except as permitted by Government-Wide Ethics Rules, 5 CFR part 2635. (3) Solicit or obtain from... TROUBLED ASSET RELIEF PROGRAM Conflicts of Interest § 31.216 Communications with Treasury employees. (a... employee with personal or direct responsibility for that procurement. (2) Offer, give, or promise to...

  16. 12 CFR 216.12 - Limits on sharing account number information for marketing purposes.

    2010-01-01

    ... third party for use in telemarketing, direct mail marketing, or other marketing through electronic mail... for marketing purposes. 216.12 Section 216.12 Banks and Banking FEDERAL RESERVE SYSTEM BOARD OF... Disclosures § 216.12 Limits on sharing account number information for marketing purposes. (a)...

  17. 29 CFR 1910.216 - Mills and calenders in the rubber and plastics industries.

    2010-07-01

    ... 29 Labor 5 2010-07-01 2010-07-01 false Mills and calenders in the rubber and plastics industries. 1910.216 Section 1910.216 Labor Regulations Relating to Labor (Continued) OCCUPATIONAL SAFETY AND... Guarding § 1910.216 Mills and calenders in the rubber and plastics industries. (a) General requirements—...

  18. 50 CFR 660.216 - Fixed gear fishery-observer requirements.

    2010-10-01

    ... 50 Wildlife and Fisheries 9 2010-10-01 2010-10-01 false Fixed gear fishery-observer requirements. 660.216 Section 660.216 Wildlife and Fisheries FISHERY CONSERVATION AND MANAGEMENT, NATIONAL OCEANIC... West Coast Groundfish-Limited Entry Fixed Gear Fisheries § 660.216 Fixed gear...

  19. 48 CFR 2452.216-70 - Estimated cost, base fee and award fee.

    2010-10-01

    ... 48 Federal Acquisition Regulations System 6 2010-10-01 2010-10-01 true Estimated cost, base fee and award fee. 2452.216-70 Section 2452.216-70 Federal Acquisition Regulations System DEPARTMENT OF HOUSING AND URBAN DEVELOPMENT CLAUSES AND FORMS SOLICITATION PROVISIONS AND CONTRACT CLAUSES Texts of Provisions and Clauses 2452.216-70 Estimated...

  20. 10 CFR 1021.216 - Procurement, financial assistance, and joint ventures.

    2010-01-01

    ... 10 Energy 4 2010-01-01 2010-01-01 false Procurement, financial assistance, and joint ventures. 1021.216 Section 1021.216 Energy DEPARTMENT OF ENERGY (GENERAL PROVISIONS) NATIONAL ENVIRONMENTAL POLICY ACT IMPLEMENTING PROCEDURES DOE Decisionmaking § 1021.216 Procurement, financial assistance, and joint ventures. (a) This section applies to...

  1. Satraplatin: BMS 182751, BMY 45594, JM 216.

    2007-01-01

    Satraplatin [BMS 182751, BMY 45594, JM 216] belongs to a series of orally-active platinum compounds with anticancer activity. It was jointly originated by Bristol-Myers Squibb, Johnson Matthey and the Institute of Cancer Research in the UK; however, Johnson Matthey has since ceased involvement with drug development. Subsequently, the agent has been licensed to and is under development with GPC Biotech, Pharmion and Spectrum Pharmaceuticals. Clinical trials are underway to evaluate satraplatin among patients with different tumour types, including prostate, breast, cervical and lung cancers. The compound is under regulatory review with the US FDA for the treatment of hormone-refractory prostate cancer. NeoTherapeutics (now Spectrum Pharmaceuticals) granted GPC Biotech an exclusive worldwide licence to develop and market satraplatin in October 2002. Under the terms of the agreement, GPC Biotech is fully funding development costs and commercialisation requirements for the drug. The deal also involves GPC Biotech paying a signing fee, milestone and royalty payments. Spectrum is a member of a joint development committee headed by GPC Biotech to govern development of satraplatin. Previously in October 2001, NeoOncoRx (Spectrum Pharmaceuticals) gained the rights to develop and market the compound worldwide. In December 2005, GPC Biotech and Pharmion Corporation entered into a co-development and license agreement for satraplatin. Under the agreement terms, Pharmion has exclusive commercialisation rights for Europe, Turkey, the Middle East, Australia and New Zealand, while GPC Biotech retains rights to North America and all other territories. Pharmion made an upfront payment of $US37.1 million to GPC Biotech, which included reimbursement for past clinical development costs plus funding for ongoing and certain clinical development activities to be jointly conducted by the companies. In addition, both parties will pursue a joint development plan for satraplatin in a variety of

  2. Nuclear structure of 216Ra at high spin

    S Muralithar; G Rodrigues; R P Singh; R K Bhowmik; P Mukherjee; B Sethi; I Mukherjee

    2012-09-01

    High-spin states of 216Ra ( = 88, = 128) have been investigated through 209Bi(10B, 3n) reaction at an incident beam energy of 55 MeV and 209Bi(11B, 4n) reaction at incident beam energies ranging from 65 to 78 MeV. Based on coincidence data, the level scheme for 216Ra has been considerably extended up to $∼ 33\\hbar$ spin and 7.2 MeV excitation energy in the present experiment with placement of 28 new -transitions over what has been reported earlier. Tentative spin-parity assignments are done for the newly proposed levels on the basis of the DCO ratios corresponding to strong gates. Empirical shell model calculations were carried out to provide an understanding of the underlying nuclear structure.

  3. Nuclear structure of 216Ra at high spin

    High-spin states of 216Ra (Z = 88, N = 128) have been investigated through 209Bi(10B, 3n) reaction at an incident beam energy of 55 MeV and 209Bi(11B, 4n) reaction at incident beam energies ranging from 65 to 78 MeV. Based on γγ coincidence data, the level scheme for 216Ra has been considerably extended up to ∼ 33 h spin and 7.2 MeV excitation energy in the present experiment with placement of 28 new γ-transitions over what has been reported earlier. Tentative spin-parity assignments are done for the newly proposed levels on the basis of the DCa ratios corresponding to strong gates. Empirical shell model calculations were carried out to provide an understanding of the underlying nuclear structure. (author)

  4. Existing data on the 216-Z liquid waste sites

    During 36 years of operation at the Hanford Site, the ground has been used for disposal of liquid and solid transuranic and/or low-level wastes. Liquid waste was disposed in surface and subsurface cribs, trenches, French drains, reverse wells, ditches and ponds. Disposal structures associated with Z Plant received liquid waste from plutonium finishing and reclamation, waste treatment and laboratory operations. The nineteen 216-Z sites have received 83% of the plutonium discharged to 325 liquid waste facilities at the Hanford Site. The purpose of this document is to support the Hanford Defense Waste Environmental Impact Statement by drawing the existing data together for the 216-Z liquid waste disposal sites. This document provides an interim reference while a sitewide Waste Information Data System (WIDS) is developed and put on line. Eventually these and additional site data for all Hanford waste disposal sites will be available on WIDS. Compilation of existing data is the first step in evaluating the need and developing the technology for long-term management of these waste sites. The scope of this document is confined to data describing the status of the 216-Z waste sites as of December 31, 1979. Information and sketches are taken from existing documents and drawings

  5. Variable stars in the Pegasus dwarf galaxy (DDO 216)

    Observations obtained over a period of five years of the resolved stars in the Pegasus dwarf irregular galaxy (DDO 216) have been searched for variable stars. Thirty-one variables were found, and periods established for 12. Two of these variable stars are clearly eclipsing variables, seven are very likely Cepheid variables, and the remaining three are probable Cepheids. The period-luminosity relation for the Cepheids indicates a distance modulus for Pegasus of m - M = 26.22 + or - 0.20. This places Pegasus very near the zero-velocity surface of the Local Group. 25 refs

  6. 1 CFR 21.6 - Notice of expiration of codified material.

    2010-01-01

    ... 1 General Provisions 1 2010-01-01 2010-01-01 false Notice of expiration of codified material. 21.6 Section 21.6 General Provisions ADMINISTRATIVE COMMITTEE OF THE FEDERAL REGISTER PREPARATION, TRANSMITTAL... expiration of codified material. Whenever a codified regulation expires after a specified period by its...

  7. Addiction-Related Effects of DOV 216,303 and Cocaine

    Sørensen, Gunnar; Husum, Henriette; Brennum, Lise T;

    2014-01-01

    of DOV 216,303, we conducted a comparative study of addiction-related effects of DOV 216,303 and cocaine in mice using acute self-administration, conditioned place preference (CPP) and drug-induced hyperlocomotion. Effects on accumbal extracellular dopamine levels were determined using microdialysis...

  8. 48 CFR 52.216-16 - Incentive Price Revision-Firm Target.

    2010-10-01

    ... 48 Federal Acquisition Regulations System 2 2010-10-01 2010-10-01 false Incentive Price Revision-Firm Target. 52.216-16 Section 52.216-16 Federal Acquisition Regulations System FEDERAL ACQUISITION... liquidation of progress payments, then that portion may, instead of being refunded, be added to...

  9. 48 CFR 52.216-17 - Incentive Price Revision-Successive Targets.

    2010-10-01

    ... 48 Federal Acquisition Regulations System 2 2010-10-01 2010-10-01 false Incentive Price Revision-Successive Targets. 52.216-17 Section 52.216-17 Federal Acquisition Regulations System FEDERAL ACQUISITION... liquidation of progress payments, then that portion may, instead of being refunded, be added to...

  10. 20 CFR 408.216 - Are you a World War II veteran?

    2010-04-01

    ... 20 Employees' Benefits 2 2010-04-01 2010-04-01 false Are you a World War II veteran? 408.216 Section 408.216 Employees' Benefits SOCIAL SECURITY ADMINISTRATION SPECIAL BENEFITS FOR CERTAIN WORLD WAR... line of active duty. SSI Eligibility...

  11. 48 CFR 216.405-1 - Cost-plus-incentive-fee contracts.

    2010-10-01

    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Cost-plus-incentive-fee... REGULATIONS SYSTEM, DEPARTMENT OF DEFENSE CONTRACTING METHODS AND CONTRACT TYPES TYPES OF CONTRACTS Incentive Contracts 216.405-1 Cost-plus-incentive-fee contracts. See PGI 216.405-1 for guidance on the use of...

  12. 20 CFR 216.32 - Who is eligible for a disability annuity.

    2010-04-01

    ... retirement age; and (2) Has a current connection with the railroad industry; and has either: (3) Completed 20....32 Section 216.32 Employees' Benefits RAILROAD RETIREMENT BOARD REGULATIONS UNDER THE RAILROAD RETIREMENT ACT ELIGIBILITY FOR AN ANNUITY Employee Annuity § 216.32 Who is eligible for a disability...

  13. 20 CFR 216.52 - Who is eligible for an annuity as a divorced spouse.

    2010-04-01

    ...) Have attained retirement age; or (e) Have attained age 62 but be under retirement age. The annuity is reduced for each month the spouse is under retirement age at the time the annuity begins. ... spouse. 216.52 Section 216.52 Employees' Benefits RAILROAD RETIREMENT BOARD REGULATIONS UNDER...

  14. 50 CFR 216.21 - Actions permitted by international treaty, convention, or agreement.

    2010-10-01

    ..., convention, or agreement. 216.21 Section 216.21 Wildlife and Fisheries NATIONAL MARINE FISHERIES SERVICE... international treaty, convention, or agreement. The MMPA and these regulations shall not apply to the extent that they are inconsistent with the provisions of any international treaty, convention or agreement,...

  15. 50 CFR 216.14 - Marine mammals taken before the MMPA.

    2010-10-01

    ... 50 Wildlife and Fisheries 7 2010-10-01 2010-10-01 false Marine mammals taken before the MMPA. 216... ATMOSPHERIC ADMINISTRATION, DEPARTMENT OF COMMERCE MARINE MAMMALS REGULATIONS GOVERNING THE TAKING AND IMPORTING OF MARINE MAMMALS Prohibitions § 216.14 Marine mammals taken before the MMPA. (a) Section...

  16. 22 CFR 216.9 - Bilateral and multilateral studies and concise reviews of environmental issues.

    2010-04-01

    ... reviews of environmental issues. 216.9 Section 216.9 Foreign Relations AGENCY FOR INTERNATIONAL... environmental issues. Notwithstanding anything to the contrary in these procedures, the Administrator may... United States is a member or participant; or (b) Concise reviews of the environmental issues...

  17. 50 CFR 216.191 - Designation of Offshore Biologically Important Marine Mammal Areas.

    2010-10-01

    ...) Detailed information on the biology of marine mammals within the area, including estimated population size... Important Marine Mammal Areas. 216.191 Section 216.191 Wildlife and Fisheries NATIONAL MARINE FISHERIES SERVICE, NATIONAL OCEANIC AND ATMOSPHERIC ADMINISTRATION, DEPARTMENT OF COMMERCE MARINE...

  18. 20 CFR 216.23 - Work which does not affect eligibility.

    2010-04-01

    ... RETIREMENT ACT ELIGIBILITY FOR AN ANNUITY Railroad and Last Non-Railroad Employment § 216.23 Work which does... 20 Employees' Benefits 1 2010-04-01 2010-04-01 false Work which does not affect eligibility. 216... his or her annuity: (a) Work for a railway labor organization. An individual may work for a...

  19. 30 CFR 77.216-5 - Water, sediment or slurry impoundments and impounding structures; abandonment.

    2010-07-01

    ..., sediment, or slurry impoundment and impounding structure which meets the requirements of 30 CFR 77.216(a... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Water, sediment or slurry impoundments and... AND SURFACE WORK AREAS OF UNDERGROUND COAL MINES Surface Installations § 77.216-5 Water, sediment...

  20. 12 CFR 216.15 - Other exceptions to notice and opt out requirements.

    2010-01-01

    ... 12 Banks and Banking 2 2010-01-01 2010-01-01 false Other exceptions to notice and opt out requirements. 216.15 Section 216.15 Banks and Banking FEDERAL RESERVE SYSTEM BOARD OF GOVERNORS OF THE FEDERAL..., agencies that are rating you, persons that are assessing your compliance with industry standards, and...

  1. 50 CFR 216.107 - Incidental harassment authorization for Arctic waters.

    2010-10-01

    ... 50 Wildlife and Fisheries 7 2010-10-01 2010-10-01 false Incidental harassment authorization for... Incidental to Specified Activities § 216.107 Incidental harassment authorization for Arctic waters. (a... authorized under § 216.105, incidental harassment authorizations may be issued, following a 30-day...

  2. 50 CFR 216.108 - Requirements for monitoring and reporting under incidental harassment authorizations for Arctic...

    2010-10-01

    ... under incidental harassment authorizations for Arctic waters. 216.108 Section 216.108 Wildlife and... for monitoring and reporting under incidental harassment authorizations for Arctic waters. (a) Holders of an incidental harassment authorization in Arctic waters and their employees, agents, and...

  3. 50 CFR 216.41 - Permits for scientific research and enhancement.

    2010-10-01

    ... under section 117 of the MMPA; (B) Contribute significantly to understanding the basic biology or... enhancement. 216.41 Section 216.41 Wildlife and Fisheries NATIONAL MARINE FISHERIES SERVICE, NATIONAL OCEANIC AND ATMOSPHERIC ADMINISTRATION, DEPARTMENT OF COMMERCE MARINE MAMMALS REGULATIONS GOVERNING THE...

  4. 27 CFR 40.216b - Notice for roll-your-own tobacco.

    2010-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 2 2010-04-01 2010-04-01 false Notice for roll-your-own tobacco. 40.216b Section 40.216b Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT OF THE TREASURY (CONTINUED) TOBACCO MANUFACTURE OF TOBACCO PRODUCTS, CIGARETTE...

  5. Ataxia and Hypogonadotropic Hypogonadism with Intrafamilial Variability Caused by RNF216 Mutation.

    Alqwaifly, Mohammed; Bohlega, Saeed

    2016-06-15

    Gordon Holmes syndrome (GHS) is a distinct phenotype of autosomal recessive cerebellar ataxia, characterized by ataxia, dementia, reproductive defects and hypogonadism; it has been recently found to be associated with RNF216 mutation. We performed whole-exome sequencing and filtered the resulting novel variants by the coordinates of the shared autozygome. We identified a novel splicing variant in RNF216 that is likely to abolish the canonical splice site at the junction of exon/intron 13 (NM_207111.3:c.2061G>A). We herein report two patients with GHS caused by a novel RNF216 mutation as the first follow up report on RNF216-related GHS, and show interfamilial variability of phenotype supporting the previously reported RNF216-related cases. PMID:27441066

  6. Groundwater impact assessment report for the 216-U-14 Ditch

    Singleton, K.M.; Lindsey, K.A.

    1994-01-01

    Groundwater impact assessments are conducted at liquid effluent receiving sites on the Hanford Site to determine hydrologic and contaminant impacts caused by discharging wastewater to the soil column. The assessments conducted are pursuant to the Hanford Federal Facility Agreement and Consent Order (Tri-Party Agreement) Milestone M-17-00A and M-17-00B, as agreed by the US Department of Energy (DOE), Washington State Department of Ecology (Ecology), and the US Environmental Protection Agency (EPA) (Ecology et al. 1992). This report assesses impacts on the groundwater and vadose zone from wastewater discharged to the 216-U-14 Ditch. Contemporary effluent waste streams of interest are 242-S Evaporator Steam Condensate and UO{sub 3}/U Plant wastewater.

  7. Mani (216–276 CE and Ethiopian Enoch

    Pieter M. Venter

    2014-02-01

    Full Text Available Mani (216–276 CE lived in a world where many ideas contributed to his unique theology. In the scriptural legacy of Mani seven of his books show influence of Ethiopian Enoch. These books are identified in this article and the use of Enochic material in those books is discussed. The Manichaean myth is briefly discussed and used to propose that Enochic influence can mainly be found in the way First Enoch depicted characters and presented the cosmos. Mani adopted his ideas mainly from the Book of the Watchers (1 En 1–36, the Book of Parables (1 En 37–71 and the Astronomical Book of Enoch (72–82 where evil beings and cursed places are depicted.

  8. 32 CFR 724.216 - Failure to appear at a hearing or respond to a scheduling notice.

    2010-07-01

    ... 32 National Defense 5 2010-07-01 2010-07-01 false Failure to appear at a hearing or respond to a scheduling notice. 724.216 Section 724.216 National Defense Department of Defense (Continued) DEPARTMENT OF... § 724.216 Failure to appear at a hearing or respond to a scheduling notice. (a) Except as...

  9. 40 CFR 80.216 - What standards apply to gasoline produced or imported for use in the GPA?

    2010-07-01

    ... produced or imported for use in the GPA? 80.216 Section 80.216 Protection of Environment ENVIRONMENTAL... Geographic Phase-in Program § 80.216 What standards apply to gasoline produced or imported for use in the GPA... in the geographic phase-in area under § 80.215, and designated as GPA gasoline under §...

  10. State Environmental Policy Act (SEPA) Environmental Checklist Form 216-B-3 Expansion Ponds Closure Plan

    The 216-B-3 Expansion Ponds Closure Plan (Revision 1) consists of a Part A Dangerous Waste Permit Application and a Resource Conservation and Recovery Act Closure Plan. An explanation of the Part A submitted with this document is provided at the beginning of the Part A Section. The closure plan consists of nine chapters and five appendices. The 216-B-3 Pond System consists of a series of four earthen, unlined, interconnected ponds and the 216-B-3-3 Ditch that receive waste water from various 200 East Area operating facilities. These four ponds, collectively. Waste water (primarily cooling water, steam condensate, and sanitary water) from various 200 East Area facilities is discharged to the 216-B-3-3 Ditch. Water discharged to the 216-8-3-3 Ditch flows directly into the 216-B-3 Pond. In the past, waste water discharges to B Pond and the 216-B-3-3 Ditch contained mixed waste (radioactive waste and dangerous waste). The radioactive portion of mixed waste has been interpreted by the US Department of Energy (DOE) to be regulated under the Atomic Energy Act of 1954; the nonradioactive dangerous portion of mixed waste is regulated under RCRA. Mixed waste also may be considered a hazardous substance under the Comprehensive Environmental Response, Compensation, and Liability Act of 1980 (CERCLA) when considering remediation of waste sites

  11. 40 CFR 90.903 - Exclusions, application of section 216 (10) and (11) of the Act.

    2010-07-01

    ... section 216(10) of the Act, an internal combustion engine (including the fuel system) that is not used in a motor vehicle is deemed a nonroad engine, if it meets the definition in subpart A of this...

  12. 40 CFR 89.903 - Application of section 216(10) of the Act.

    2010-07-01

    ... the applicability of section 216(10) of the Act, an internal combustion engine (including the fuel system) that is not used in a motor vehicle is deemed a nonroad engine if it meets the definition...

  13. Decay of high angular momentum isomers: 149Dy and 216Ra nuclei

    Some general considerations on the forming and de-excitation of high angular momentum nuclei are given. The experimental equipment employed is then described and analyzed. Discrete high angular momentum states of 149Dy83 and 216Ra128 were investigated. Measurements of excitation functions induced by 9Be beams enable the order of the levels beneath the isomer to be determined. Isomeric states were studied using a pulsed 32S beam. Discrete 216Ra transitions above the isomeric state were also studied

  14. Detection and Functional Analysis of Estrogen Receptor α Phosphorylated at Serine 216 in Mouse Neutrophils.

    Shindo, Sawako; Moore, Rick; Negishi, Masahiko

    2016-01-01

    Serine 216 constitutes a protein kinase C phosphorylation motif located within the DNA binding domain of estrogen receptor α (ERα). In this chapter we present experimental procedures confirming that mouse ERα is phosphorylated at serine 216 in peripheral blood neutrophils and in neutrophils that infiltrate the uterus, as well as the role of phosphoserine 216 in neutrophil migration. A phospho-peptide antibody (αP-S216) was utilized in Western blot, immunohistochemistry, and double immunofluorescence staining to detect this phosphorylation of an endogenous ERα. Both immunohistochemistry (with αP-S216 or neutrophil marker Ly6G antibody) and double immunofluorescence staining of mouse uterine sections prepared from C3H/HeNCrIBR females revealed that phosphorylated ERα was expressed in all infiltrating neutrophils during hormonal cycles but not in any other of the other uterine cells. Neutrophils infiltrate the uterus from the blood stream. White blood cells (WBC) were prepared from peripheral blood of C3H/HeNCrIBR females or males and double immunostained. Blood neutrophils also expressed phosphorylated ERα but in only about 20 % of cells in both sexes. Only the neutrophils expressing phosphorylated ERα spontaneously migrated in in vitro Transwell migration assays and infiltrated the uterus in mice. PMID:26585153

  15. Plutonium Mobility Studies: 216-Z-9 Trench Sample Analysis Results

    Cantrell, Kirk J.; Geiszler, Keith N.; Arey, Bruce W.

    2008-09-05

    A variety of analyses were conducted on selected sediment samples collected from two wells (299 W15-46 and 299-W15-48) drilled near the 216-Z-9 Trench to elucidate the form and potential for Pu and Am to be mobilized under present conditions and those that could be expected in future remediation scenarios. Analyses included moisture content, determination of the less than sand size fraction (silt plus clay), carbon analysis, SEM/EDS analysis, microwave-assisted acid digestions for total element analysis, and extraction tests using Hanford groundwater as the leachate. Results of the extraction tests were used as input to conduct equilibrium geochemical modeling of the solutions with Geochemist’s Workbench®. Geochemical modeling results for Pu were evaluated in terms of recent conclusions regarding the solubility and redox reactions of Pu by Neck et al. (2007a, 2007b). It was found that the highest concentrations of Pu and Am were associated with sediments of low silt/clay content and occur above silt/clay rich layers within the sediment profile. It was also found that the Pu and Am were relatively enriched in the silt/clay portion of these samples. The fact that the highest concentrations of Pu and Am occurred in sediments with low silt/clay contents suggests that waste solutions had perched on top of the low permeability silt/clay rich layers and interactions with the high silt/clay layers was minimal. SEM/EDS analysis indicated that the Pu and Am in these sediments does not occur as discrete micron size particles, and therefore must occur as mononuclear or polynuclear/ nanoclusters size particles adsorbed throughout the sediment samples. Leaching of these samples with Hanford groundwater indicates that release of Pu and Am from the sediments is correlated most significantly with the acidity of the water and not the initial concentrations of Pu and Am in the sediments. Only extracts that were acidic after contact with the sediments (pH 4.3 to 5.4) contained

  16. Groundwater impact assessment report for the 216-S-26 Crib, 200 West Area

    Lindberg, J.W.; Evelo, S.D.; Alexander, D.J.

    1993-11-01

    This report assesses the impact of wastewater discharged to the 216-S-26 Crib on groundwater quality. The 216-S-26 Crib, located in the southern 200 West Area, has been in use since 1984 to dispose of liquid effluents from the 222-S Laboratory Complex. The 222-S Laboratory Complex effluent stream includes wastewater from four sources: the 222-S Laboratory, the 219-S Waste Storage Facility, the 222-SA Chemical Standards Laboratory, and the 291-S Exhaust Fan Control House and Stack. Based on assessment of groundwater chemistry and flow data, contaminant transport predictions, and groundwater chemistry data, the 216-S-26 Crib has minimal influence on groundwater contamination in the southern 200 West Area.

  17. Groundwater impact assessment report for the 216-S-26 Crib, 200 West Area

    This report assesses the impact of wastewater discharged to the 216-S-26 Crib on groundwater quality. The 216-S-26 Crib, located in the southern 200 West Area, has been in use since 1984 to dispose of liquid effluents from the 222-S Laboratory Complex. The 222-S Laboratory Complex effluent stream includes wastewater from four sources: the 222-S Laboratory, the 219-S Waste Storage Facility, the 222-SA Chemical Standards Laboratory, and the 291-S Exhaust Fan Control House and Stack. Based on assessment of groundwater chemistry and flow data, contaminant transport predictions, and groundwater chemistry data, the 216-S-26 Crib has minimal influence on groundwater contamination in the southern 200 West Area

  18. Interim-status groundwater monitoring plan for the 216-B-63 trench. Revision 1

    This document outlines the groundwater monitoring plan for interim-status detection-level monitoring of the 216-B-63 Trench. This is a revision of the initial groundwater monitoring plan prepared for Westinghouse Hanford Company (WHC) by Bjornstad and Dudziak (1989). The 216-B-63 Trench, located at the Hanford Site in south-central Washington State, is an open, unlined, earthern trench approximately 1.2 m (4 ft) wide at the bottom, 427 m (1400 ft) long, and 3 m (10 ft) deep that received wastewater containing hazardous waste and radioactive materials from B Plant, located in the 200 East Area. Liquid effluent discharge to the 216-B-63 Trench began in March 1970 and ceased in February 1992. The trench is now managed by Waste Tank Operations

  19. 50 CFR 216.16 - Prohibitions under the General Authorization for Level B harassment for scientific research.

    2010-10-01

    ... 50 Wildlife and Fisheries 7 2010-10-01 2010-10-01 false Prohibitions under the General Authorization for Level B harassment for scientific research. 216.16 Section 216.16 Wildlife and Fisheries... Prohibitions under the General Authorization for Level B harassment for scientific research. It shall...

  20. 50 CFR 216.46 - U.S. citizens on foreign flag vessels operating under the International Dolphin Conservation...

    2010-10-01

    ... 50 Wildlife and Fisheries 7 2010-10-01 2010-10-01 false U.S. citizens on foreign flag vessels operating under the International Dolphin Conservation Program. 216.46 Section 216.46 Wildlife and Fisheries....46 U.S. citizens on foreign flag vessels operating under the International Dolphin...

  1. Addiction-related effects of DOV 216,303 and cocaine: A comparative study in the mouse.

    Sørensen, Gunnar; Husum, Henriette; Brennum, Lise T; Bundgaard, Christoffer; Montezinho, Liliana C P; Mørk, Arne; Wörtwein, Gitta; Woldbye, David P D

    2014-06-01

    DOV 216,303, an inhibitor of serotonin, noradrenaline and dopamine reuptake, belongs to a new line of drugs called 'triple reuptake inhibitors' that have been proposed for treatment of depression. The addictive drug cocaine has similar mechanism of action and exerts rewarding effects by blocking reuptake of dopamine, leading to increased extracellular concentrations of dopamine in the nucleus accumbens. Thus, DOV 216,303 and other triple reuptake inhibitors might be speculated to exhibit abuse potential, limiting their future therapeutic use. To further elucidate potential addictive properties of DOV 216,303, we conducted a comparative study of addiction-related effects of DOV 216,303 and cocaine in mice using acute self-administration, conditioned place preference (CPP) and drug-induced hyperlocomotion. Effects on accumbal extracellular dopamine levels were determined using microdialysis, and we measured monoamine receptor occupancy as well as brain and plasma exposure. DOV 216,303 was self-administered acutely in the same dose range as cocaine. However, in the CPP model, DOV 216,303 did not induce place preference at doses where cocaine caused place preference. Higher doses of DOV 216,303 than cocaine were needed to induce hyperlocomotion and increase extracellular accumbal dopamine with effective doses being higher than effective doses used in depression models. Moreover, DOV 216,303 displayed a pharmacokinetic profile with lower potential for addiction than cocaine. Thus, high levels of DAT occupancy were reached slower and decayed more slowly after DOV 216,303 than cocaine administration. The present study shows that acute administration of DOV 216,303 displays some addictive-like properties in mice, but these were less pronounced than cocaine, most likely due to different pharmacokinetic profiles. PMID:24314270

  2. Groundwater impact assessment for the 216-U-17 Crib, 200 West Area

    As required by the Hanford Federal Facility Agreement and Consent Order (Tri-Party Agreement milestone M-17-00A), this report assesses the impact to groundwater from discharge of process condensate to the ground at the 216-U-17 Crib. The assessment considers impacts associated with moisture movement through soil beneath the crib and the potential transport of contaminants to the groundwater

  3. 50 CFR 216.200 - Specified activity and specified geographical region.

    2010-10-01

    ... of Offshore Oil and Gas Facilities in the U.S. Beaufort Sea § 216.200 Specified activity and... and pipeline construction, vessel and helicopter activity; and oil production activities, including ice road construction, and vessel and helicopter activity, but excluding seismic operations....

  4. Yeast Interacting Proteins Database: YBR216C, YML007W [Yeast Interacting Proteins Database

    Full Text Available YBR216C YBP1 Protein required for oxidation of specific cysteine residues of the transcription f ... n the nuclear localization of Yap1p in response to stress ... Rows with this bait as bait (1) Rows with this bai ... (bZIP) transcription factor required for oxidative stress ... tolerance; activated by H2O2 through the multistep ...

  5. 12 CFR 216.4 - Initial privacy notice to consumers required.

    2010-01-01

    ... consumer's loan. (d) Existing customers. When an existing customer obtains a new financial product or... SYSTEM PRIVACY OF CONSUMER FINANCIAL INFORMATION (REGULATION P) Privacy and Opt Out Notices § 216.4... provided in paragraph (e) of this section; and (2) Consumer. A consumer, before you disclose any...

  6. 50 CFR 216.25 - Exempted marine mammals and marine mammal products.

    2010-10-01

    ... 50 Wildlife and Fisheries 7 2010-10-01 2010-10-01 false Exempted marine mammals and marine mammal... AND ATMOSPHERIC ADMINISTRATION, DEPARTMENT OF COMMERCE MARINE MAMMALS REGULATIONS GOVERNING THE TAKING AND IMPORTING OF MARINE MAMMALS General Exceptions § 216.25 Exempted marine mammals and marine...

  7. 20 CFR 216.22 - Work as an employee which affects payment.

    2010-04-01

    ... RETIREMENT ACT ELIGIBILITY FOR AN ANNUITY Railroad and Last Non-Railroad Employment § 216.22 Work as an employee which affects payment. (a) Work for a railroad employer. Work for pay as an employee of a railroad... 20 Employees' Benefits 1 2010-04-01 2010-04-01 false Work as an employee which affects...

  8. 20 CFR 216.24 - Relinquishment of rights to return to work.

    2010-04-01

    ... 20 Employees' Benefits 1 2010-04-01 2010-04-01 false Relinquishment of rights to return to work... RETIREMENT ACT ELIGIBILITY FOR AN ANNUITY Railroad and Last Non-Railroad Employment § 216.24 Relinquishment of rights to return to work. (a) What return to work rights must be given up. Before an...

  9. 30 CFR 77.216-4 - Water, sediment or slurry impoundments and impounding structures; reporting requirements...

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Water, sediment or slurry impoundments and....216-4 Water, sediment or slurry impoundments and impounding structures; reporting requirements... of the initial plan approval, the person owning, operating, or controlling a water, sediment,...

  10. 30 CFR 77.216-1 - Water, sediment or slurry impoundments and impounding structures; identification.

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Water, sediment or slurry impoundments and... AND SURFACE WORK AREAS OF UNDERGROUND COAL MINES Surface Installations § 77.216-1 Water, sediment or..., operating, or controlling the structure, shall be located on or immediately adjacent to each water,...

  11. 30 CFR 77.216-3 - Water, sediment, or slurry impoundments and impounding structures; inspection requirements...

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Water, sediment, or slurry impoundments and... COAL MINES Surface Installations § 77.216-3 Water, sediment, or slurry impoundments and impounding structures; inspection requirements; correction of hazards; program requirements. (a) All water, sediment,...

  12. 30 CFR 77.216 - Water, sediment, or slurry impoundments and impounding structures; general.

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Water, sediment, or slurry impoundments and... WORK AREAS OF UNDERGROUND COAL MINES Surface Installations § 77.216 Water, sediment, or slurry... structures which impound water, sediment, or slurry shall be required if such an existing or...

  13. 50 CFR 216.45 - General Authorization for Level B harassment for scientific research.

    2010-10-01

    ...) of the ESA and implementing regulations at 50 CFR parts 217-227, particularly at § 222.23 through... et seq.) and implementing regulations (50 CFR part 216), I hereby notify the National Marine... is subject to the requirements of 15 CFR part 904....

  14. Interim-status groundwater monitoring plan for the 216-B-63 trench

    Sweeney, M.D.

    1995-02-09

    This document outlines the groundwater monitoring plan, under RCRA regulations in 40 CFR 265 Subpart F and WAC173-300-400, for the 216-B-63 Trench. This interim status facility is being sampled under detection monitoring criteria and this plan provides current program conditions and requirements.

  15. 76 FR 27987 - Foreign-Trade Zone 216-Olympia, Washington; Application for Reorganization Under Alternative Site...

    2011-05-13

    ... zone under the alternative site framework (ASF) adopted by the Board (74 FR 1170, 1/12/09 (correction 74 FR 3987, 1/22/09); 75 FR 71069-71070, 11/22/10). The ASF is an option for grantees for the..., 2011. FTZ 216 was approved by the Board on August 16, 1996 (Board Order 836, 61 FR 45408,...

  16. 48 CFR 1852.216-84 - Estimated cost and incentive fee.

    2010-10-01

    ... 48 Federal Acquisition Regulations System 6 2010-10-01 2010-10-01 true Estimated cost and... Provisions and Clauses 1852.216-84 Estimated cost and incentive fee. As prescribed in 1816.406-70(d), insert the following clause: Estimated Cost and Incentive Fee (OCT 1996) The target cost of this contract...

  17. 48 CFR 2452.216-77 - Estimated quantities-requirements contract.

    2010-10-01

    ... 48 Federal Acquisition Regulations System 6 2010-10-01 2010-10-01 true Estimated quantities... Provisions and Clauses 2452.216-77 Estimated quantities—requirements contract. As prescribed in 2416.506-70(c), insert the following provision: Estimated Quantities—Requirements Contract (FEB 2006) In accordance...

  18. 48 CFR 1552.216-76 - Estimated cost and cost-sharing.

    2010-10-01

    ... 48 Federal Acquisition Regulations System 6 2010-10-01 2010-10-01 true Estimated cost and cost... 1552.216-76 Estimated cost and cost-sharing. As prescribed in 1516.307(c), insert the following clause: Estimated Cost and Cost-Sharing (APR 1996) (a) The total estimated cost of performing the work under...

  19. 48 CFR 1852.216-85 - Estimated cost and award fee.

    2010-10-01

    ... 48 Federal Acquisition Regulations System 6 2010-10-01 2010-10-01 true Estimated cost and award... and Clauses 1852.216-85 Estimated cost and award fee. As prescribed in 1816.406-70(e), insert the following clause: Estimated Cost and Award Fee (SEP 1993) The estimated cost of this contract is $___....

  20. 48 CFR 1852.216-73 - Estimated cost and cost sharing.

    2010-10-01

    ... 48 Federal Acquisition Regulations System 6 2010-10-01 2010-10-01 true Estimated cost and cost... and Clauses 1852.216-73 Estimated cost and cost sharing. As prescribed in 1816.307-70(a), insert the following clause: Estimated Cost and Cost Sharing (DEC 1991) (a) It is estimated that the total cost...

  1. 48 CFR 1852.216-74 - Estimated cost and fixed fee.

    2010-10-01

    ... 48 Federal Acquisition Regulations System 6 2010-10-01 2010-10-01 true Estimated cost and fixed... and Clauses 1852.216-74 Estimated cost and fixed fee. As prescribed in 1816.307-70(b), insert the following clause: Estimated Cost and Fixed Fee (DEC 1991) The estimated cost of this contract...

  2. 50 CFR 216.95 - Official mark for “Dolphin-safe” tuna products.

    2010-10-01

    ... 50 Wildlife and Fisheries 7 2010-10-01 2010-10-01 false Official mark for âDolphin-safeâ tuna... AND IMPORTING OF MARINE MAMMALS Dolphin Safe Tuna Labeling § 216.95 Official mark for “Dolphin-safe... Department of Commerce that may be used to label tuna products that meet the “dolphin-safe” standards...

  3. 48 CFR 1352.216-71 - Level of effort (cost-plus-fixed-fee, term contract).

    2010-10-01

    ... Clauses 1352.216-71 Level of effort (cost-plus-fixed-fee, term contract). As prescribed in 48 CFR 1316.307... Optionperiod II Optionperiod III xxxxxxxxxx xxxx xxxx xxxx xxxx xxxxxxxxxx xxxx xxxx xxxx xxxx Total Direct Labor xxxx xxxx xxxx xxxx (c) The hours specified above are provided as estimates......

  4. Regulation of the P2X7R by microRNA-216b in human breast cancer

    Highlights: • We suggest the expression level of miR-216b and P2X7R in breast cancer tissues and cell lines. • We demonstrated that miR-216b directly targets and inhibits P2X7R. • We suggested miR-216b can attenuate ATP/P2X7R signaling pathways and induced Bcl-2/caspase-3 pathway. - Abstract: Breast cancer is the most common cancer in women around the world. However, the molecular mechanisms underlying breast cancer pathogenesis are only partially understood. Here, in this study, we found that P2X7R was up-regulated and miR-216b was down-regulated in breast cancer cell lines and tissues. Using bioinformatic analysis and 3′UTR luciferase reporter assay, we determined P2X7R can be directly targeted by miR-216b, which can down-regulate endogenous P2X7R mRNA and protein levels. Ectopic expression of miR-216b mimics leads to inhibited cell growth and apoptosis, while blocking expression of the miR-216b results in increased cell proliferation. Furthermore, our findings demonstrate that knockdown of P2X7R promotes apoptosis in breast cancer cells through down-regulating Bcl-2 and increasing the cleavage caspase-3 protein level. Finally, we confirmed that down-regulation of miR-216b in breast cancer is inversely associated with P2X7R expression level. Together, these findings establish miR-216b as a novel regulator of P2X7R and a potential therapeutic target for breast cancer

  5. 216例合并HIV/AIDS患者围手术期的心理护理

    韦庆旭

    2014-01-01

    目的:通过对216例合并HIV/AIDS患者围手术期的心理护理,探讨合并HIV/AIDS患者围手术期的心理护理方法。方法:对216例合并HIV/AIDS患者进行术前、术中、术后心理护理和随访。结果通过对216例合并HIV/AIDS患者的心理护理,减轻了心理负担疗效果好,达满意。

  6. Borehole Summary Report for the 216-B-2-2 Ditch

    The purpose of this borehole summary report is to provide the results of the drilling and sampling as a data package. The 216-B-2-2 Ditch borehole data will be evaluated with other existing data during remedial investigation/feasibility study (RI/FS) work plan development for the Gable Mountain Pond/B-Pond and Ditches Cooling Water Group (200-CW-1 ). Additional characterization needs for the ditch, as well as for the 200-CW-1 Waste Group in general, will be defined in an RI/FS work plan for the 200-CW-1 Waste Group planned for preparation in fiscal year 1999. After characterization activities have been completed for the waste group, the information (including the 216-B-2-2 borehole data) will be collectively evaluated and documented in a remedial investigation report

  7. Features of thin spatial structure of the quasar 3C216 at decameter lengths of waves

    Megn, A. V.; Rashkovskiy, S. L.; Shepelev, V. A.; Inytin, G. A.; Vashchishin, R. V.; Brazhenko, A. I.; Koshoviy, V. V.; Lozinskiy, A. B.

    2010-01-01

    The results of interferometric researches of the quasar 3C216 have been presented. The model of brightness distribution of the quasar at frequencies of 20 and 25 MHz and spectra of its details at frequencies below 1 GHz have been refined. It was found out, that at decameter lengths the radio image of 3C216 has three components. It consists of a compact component having the size limited by scattering, an extended component with the size of 4.5'' and a halo with the size about 23''. The northeast hot spot (instead of the core, as it was supposed earlier) is the dominating compact component at decameter waves. The self-absorption effect in the northeast hot spot has been detected.

  8. H_2^{16}O and H_2^{18}O Maser Emission from Gas-Dust Clouds

    Nesterenok, Aleksandr; 10.1134/S1063773711070036

    2011-01-01

    The collisional pumping of H_2^{16}O and H_2^{18}O masers in hot dense gas-dust clouds has been simulated numerically. New data on the rate coefficients for collisional transitions from Faure et al. (2007) were used in the calculations. The possibility of detecting H_2^{18}O emission in 22.2-GHz H_2^{16}O maser sources is investigated. The medium is shown to become optically thick in the H_2^{16}O lines for which an inverted level population is observed at H_2O column densities of ~10^{19}-10^{20} cm^{-2}. A simultaneous observation of H_2^{18}O emission and H_2^{16}O maser emission in the same source will allow the physical conditions in the gas-dust cloud to be refined.

  9. 77 FR 29682 - Gulf of Mexico, Outer Continental Shelf, Central Planning Area, Oil and Gas Lease Sale 216/222

    2012-05-18

    ... Availability (NOA) of a Record of Decision (ROD) on a Final Supplemental Environmental Impact Statement (SEIS... Area (CPA) Lease Sale 216/222 Authority: This NOA is published pursuant to the regulations (40 CFR...

  10. The synthesis of 191Pt labelled JM216, an orally active platinum anti-tumour agent

    The orally active platinum anti-tumour complex JM 216 [bis-acetatoamminedichloro cyclohexylamineplatinum (IV)] is at present in stage II clinical trials. A procedure for synthesising the complex labelled with 191Pt or 188Pt at the platinum centre has been developed. The purity (shown by HPLC) is 98% and the specific activity (0.3-0.4 Ci/kg) is enough for in vivo and in vitro studies. (author)

  11. Borehole Data Package for 216-U-12 Crib Well 299-W22-79

    One new Resource Conservation and Recovery Act (RCRA) groundwater monitoring well was installed at the 216-U-12 crib in September 1998 in support of Tri-Parly Agreement (Ecology 1996) milestone M-24-36. The new well is 299-W22-79 and is a downgradient well in the groundwater monitoring network. There are a total of six wells in the groundwater monitoring network for the 216-U-12 crib and their locations are shown on Figure 1. The groundwater assessment monitoring plan for the 216-U-12 crib (Chou and Williams 1993) describes the hydrogeology of the 200 West Area and the 216-U-12 crib area. An Interim Change Notice to the assessment plan provides justification for the well (Chou and Williams 1997). The new well was constructed to the specifications and requirements described in Washington Administrative Code (WAC) 173-160, and WAC-173-303, and in Chou and Williams (1997). This document compiles information on the drilling and construction, well development and permanent pump installation applicable to well 299-W22-79. Appendix A contains the geologist's log, the Well Construction Summary Report, and Well Summary Sheet (as-built diagram). Additional documentation concerning well construction is on file with Bechtel Hanford, Inc., Richland, Washington. English units are used in this report because they are used by drillers to measure and report depths and well construction details. The conversion is made by multiplying feet by 0.3048 to obtain meters; or multiplying inches by 2.54 to obtain centimeters

  12. DDO216-A1: a central globular cluster in a low-luminosity transition type galaxy

    Cole, Andrew A; Skillman, Evan D; Williams, Benjamin F; Dolphin, Andrew E; Johnson, L Clifton; McConnachie, Alan W; Boylan-Kolchin, Michael; Dalcanton, Julianne; Governato, Fabio; Madau, Piero; Shen, Sijing; Vogelsberger, Mark

    2016-01-01

    We confirm that the object DDO216-A1 is a substantial globular cluster at the center of Local Group galaxy DDO216 (the Pegasus dwarf irregular), using Hubble Space Telescope ACS imaging. By fitting isochrones, we find the cluster metallicity to be -1.6 +/-0.2, for reddening E(B-V) = 0.16 +/-0.02; the best-fit age is 12.3 +/-0.8 Gyr. There are ~30 RR Lyrae variables in the cluster; the magnitude of the fundamental mode pulsators gives a distance modulus of 24.77 +/-0.08 - identical to the host galaxy. The ratio of overtone to fundamental mode variables and their mean periods make DDO216-A1 an Oosterhoff Type I cluster. We find an I-band central surface brightness 20.85 +/-0.17 F814W mag per square arcsecond, half-light radius of 3.1 arcsec (13.4 pc), and absolute magnitude M814 = -7.90 +/-0.16 (approximately 10^5 solar masses). King models fit to the cluster give the core radius and concentration index, r_c = 2.1" +/-0.9" and c = 1.24 +/-0.39. The cluster is an "extended" cluster somewhat typical of some dwarf...

  13. φX216, a P2-like bacteriophage with broad Burkholderia pseudomallei and B. mallei strain infectivity

    Kvitko Brian H

    2012-12-01

    Full Text Available Abstract Background Burkholderia pseudomallei and B. mallei are closely related Category B Select Agents of bioterrorism and the causative agents of the diseases melioidosis and glanders, respectively. Rapid phage-based diagnostic tools would greatly benefit early recognition and treatment of these diseases. There is extensive strain-to-strain variation in B. pseudomallei genome content due in part to the presence or absence of integrated prophages. Several phages have previously been isolated from B. pseudomallei lysogens, for example φK96243, φ1026b and φ52237. Results We have isolated a P2-like bacteriophage, φX216, which infects 78% of all B. pseudomallei strains tested. φX216 also infects B. mallei, but not other Burkholderia species, including the closely related B. thailandensis and B. oklahomensis. The nature of the φX216 host receptor remains unclear but evidence indicates that in B. mallei φX216 uses lipopolysaccharide O-antigen but a different receptor in B. pseudomallei. The 37,637 bp genome of φX216 encodes 47 predicted open reading frames and shares 99.8% pairwise identity and an identical strain host range with bacteriophage φ52237. Closely related P2-like prophages appear to be widely distributed among B. pseudomallei strains but both φX216 and φ52237 readily infect prophage carrying strains. Conclusions The broad strain infectivity and high specificity for B. pseudomallei and B. mallei indicate that φX216 will provide a good platform for the development of phage-based diagnostics for these bacteria.

  14. Global modeling of the 15N216O line positions within the framework of the polyad model of effective Hamiltonian and a room temperature 15N216O line list

    Tashkun, S. A.; Perevalov, V. I.; Liu, A.-W.; Hu, S.-M.

    2016-05-01

    The global modeling of 15N216O line positions in the 4-12,516 cm-1 region has been performed using the polyad model of effective Hamiltonian. The effective Hamiltonian parameters were fitted to the line positions collected from an exhaustive review of the literature. The dimensionless weighted standard deviation of the fit is 1.31. The fitted set of 109 parameters allowed reproducing more than 18,000 measured line positions with an RMS value of 0.001 cm-1. A line list was calculated for a reference temperature 296 K, natural abundance (1.32×10-5), and an intensity cutoff 10-30 cm/molecule. The line list is based on the fitted set of the effective Hamiltonian parameters for 15N216O obtained in this work and the effective dipole moment parameters of the 15N216O and 14N216O isotopologues. Accurate values of the 15N216O total partition function are also given.

  15. Post-Closure RCRA Groundwater Monitoring Plan for the 216-S-10 Pond and Ditch

    The purpose of this plan is to provide a post-closure groundwater monitoring program for the 216-S-10 Pond and Ditch (S-10) treatment, storage, and/or disposal (TSD) unit. The plan incorporates the sum of knowledge about the potential for groundwater contamination to originate from the S-10, including groundwater monitoring results, hydrogeology, and operational history. The S-10 has not received liquid waste since October 1991. The closure of S-10 has been coordinated with the 200-CS-1 source operable unit in accordance with the Tri-Party Agreement interim milestones M-20-39 and M-15-39C. The S-10 is closely situated among other waste sites of very similar operational histories. The proximity of the S-10 to the other facilities (216-S-17 pond, 216-S-11 Pond, 216-S-5,6 cribs, 216-S-16 ditch and pond, and 216-U-9 ditch) indicate that at least some observed groundwater contamination beneath and downgradient of S-10 could have originated from waste sites other than S-10. Hence, it may not be feasible to strictly discriminate between the contributions of each waste site to groundwater contamination beneath the S-10. A post-closure groundwater monitoring network is proposed that will include the drilling of three new wells to replace wells that have gone dry. When completed, the revised network will meet the intent for groundwater monitoring network under WAC 173-303-645, and enable an improved understanding of groundwater contamination at the S-10. Site-specific sampling constituents are based on the dangerous waste constituents of concern relating to RCRA TSD unit operations (TSD unit constituents) identified in the Part A Permit Application. Thus, a constituent is selected for monitoring if it is: A dangerous waste constituent identified in the Part A Permit Application, or A mobile decomposition product (i.e., nitrate from nitrite) of a Part A constituent, or A reliable indicator of the site-specific contaminants (i.e., specific conductance). Using these criteria

  16. Asteroid 2015 DB216: a recurring co-orbital companion to Uranus

    de la Fuente Marcos, C.; de la Fuente Marcos, R.

    2015-10-01

    Minor bodies trapped in 1:1 co-orbital resonances with a host planet could be relevant to explain the origin of captured satellites. Among the giant planets, Uranus has one of the smallest known populations of co-orbitals, three objects, and all of them are short-lived. Asteroid 2015 DB216 has an orbital period that matches well that of Uranus, and here we investigate its dynamical state. Direct N-body calculations are used to assess the current status of this object, reconstruct its immediate dynamical past, and explore its future orbital evolution. A covariance matrix-based Monte Carlo scheme is presented and applied to study its short-term stability. We find that 2015 DB216 is trapped in a temporary co-orbital resonance with Uranus, the fourth known minor body to do so. A detailed analysis of its dynamical evolution shows that it is an unstable but recurring co-orbital companion to Uranus. It currently follows an asymmetric horseshoe trajectory that will last for at least 10 kyr, but it may remain inside Uranus' co-orbital zone for millions of years. As in the case of other transient Uranian co-orbitals, complex multibody ephemeral mean motion resonances trigger the switching between the various resonant co-orbital states. The new Uranian co-orbital exhibits a secular behaviour markedly different from that of the other known Uranian co-orbitals because of its higher inclination, nearly 38°. Given its rather unusual discovery circumstances, the presence of 2015 DB216 hints at the existence of a relatively large population of objects moving in similar orbits.

  17. Actinide occurrences in sediments following ground disposal of acid wastes at 216-Z-9

    Liquid acid wastes from a Pu recovery facility at Hanford were released to the ground via structures collectively termed trenches from 1955 through 1962. Data are presented from a study of the microdistribution of Am and Pu in samples from the 216-Z-9 trench. Solution sediment relationships and associated actinide removal mechanisms under acid conditions were studied. Core wells were drilled into the sediments in which this covered trench is located and in the immediate vicinity to obtain samples for quantitative mineralogical analysis and comparison of sediments from various depths of contaminated and noncontaminated areas. Analytical techniques are described and results are reported

  18. Drift-tube linac geometry optimization at 108 and 216 MHz

    Ungrin, James; Michel, Walter L.

    1985-10-01

    Drift-tube linear accelerator geometries at 108 and 216 MHz have been studied using the computer code SUPERFISH with the aim of optimizing the effective shunt impedance, ZT2. Optimum ZT2 curves for particle velocities, β = v/ c, ranging from 0.061 (1.75 MeV/amu) to 0.567 (200 MeV/amu) have been generated from over 2500 computer runs with SUPERFISH. These curves, although derived primarily for a high current electronuclear breeder accelerator, have general application for other proton or heavy ion linear accelerators.

  19. Drift-tube linac geometry optimization at 108 and 216 MHz

    Drift-tube linear accelerator geometries at 108 and 216 MHz have been studied using the computer code SUPERFISH with the aim of optimizing the effective shunt impedance, ZT2. Optimum ZT2 curves for particle velocities, β=v/c, ranging from 0.061 (1.75 MeV/amu) to 0.567 (200 MeV/amu) have been generated from over 2500 computer runs with SUPERFISH. These curves, although derived primarily for a high current electronuclear breeder accelerator, have general application for other proton or heavy ion linear accelerators. (orig.)

  20. Radionuclide logging of Tank 216-T-106, borehole 299-W10-196

    Geophysical surveys were conducted in borehole 299-W10-196 during construction to profile the radionuclide contaminants in the vadose zone that leaked from single-shell Tank 216-T-106. Contaminants from the tank leak were detected to 120 feet below the ground surface. A second complete geophysical survey was conducted about one year after drilling was completed to evaluate contaminant movement that may have been caused by the presence of the cased borehole. Contaminant movement would warrant plugging and abandoning the borehole. Comparison of the two surveys indicate that no contamination movement to greater depths can be identified

  1. Asteroid 2015 DB216: a recurring co-orbital companion to Uranus

    Marcos, C. de la Fuente; Marcos, R. de la Fuente

    2015-01-01

    Minor bodies trapped in 1:1 co-orbital resonances with a host planet could be relevant to explain the origin of captured satellites. Among the giant planets, Uranus has one of the smallest known populations of co-orbitals, three objects, and all of them are short-lived. Asteroid 2015 DB216 has an orbital period that matches well that of Uranus, and here we investigate its dynamical state. Direct N-body calculations are used to assess the current status of this object, reconstruct its immediat...

  2. Groundwater impact assessment report for the 216-Z-20 Crib, 200 West Area

    As required by the Hanford Federal Facility Agreement and Consent Order ([Tri-Party Agreement] Milestone M-17-00A), this report assesses the impact of wastewater discharges to the 216-Z-20 Crib on groundwater quality. The assessment reported herein extends the initial analysis conducted from 1989 through 1990 for the Liquid Effluent Study Final Project Report. Three primary issues are addressed in response to regulator concerns with the initial analysis: The magnitude and status of the soil column transuranic inventory. Potential interactions of wastewater with carbon tetrachloride from adjacent facilities. Preferential pathways created by unsealed monitoring wells

  3. Groundwater impact assessment report for the 216-Z-20 Crib, 200 West Area

    Johnson, V.G.

    1993-10-01

    As required by the Hanford Federal Facility Agreement and Consent Order ([Tri-Party Agreement] Milestone M-17-00A), this report assesses the impact of wastewater discharges to the 216-Z-20 Crib on groundwater quality. The assessment reported herein extends the initial analysis conducted from 1989 through 1990 for the Liquid Effluent Study Final Project Report. Three primary issues are addressed in response to regulator concerns with the initial analysis: The magnitude and status of the soil column transuranic inventory. Potential interactions of wastewater with carbon tetrachloride from adjacent facilities. Preferential pathways created by unsealed monitoring wells.

  4. Results of RCRA groundwater quality assessment program at the 216-U-12 crib

    The 216-U-12 crib has been in a Resource Conservation and Recovery Act of 1976 (RCRA) interim-status groundwater quality assessment program since the first quarter of 1993. Specific conductance measured in downgradient wells 299-W22-41 and 299-W22-42 exceeds its critical mean. This report presents the results and findings of Phases I and II of the assessment monitoring program, as required by 40 CFR 265.93. The elevated levels of specific conductance in the downgradient open-quotes triggeringclose quotes wells are attributed to nitrate, the mobile anion released when nitric acid is diluted in water, and calcium which is released from the sediments as acid is neutralized. Technetium-99 levels have been elevated in these same downgradient wells since 1991. The source of these constituents is the 216-U-12 crib. Downward migration of nitrate and technetium-99 from the vadose zone (and continued elevated specific conductance in the two downgradient wells) is still occurring because the driving force is still present

  5. The Xinglong 2.16-m Telescope: Current Instruments and Scientific Projects

    Fan, Zhou; Jiang, Xiaojun; Wu, Hong; Li, Hongbin; Huang, Yang; Xu, Dawei; Hu, Zhongwen; Zhu, Yinan; Wang, Jianfeng; Komossa, Stefanie; Zhang, Xiaoming

    2016-01-01

    The Xinglong 2.16-m reflector is the first 2-meter class astronomical telescope in China. It was jointly designed and built by the Nanjing Astronomical Instruments Factory (NAIF), Beijing Astronomical Observatory (now National Astronomical Observatories, Chinese Academy of Sciences, NAOC) and Institute of Automation, Chinese Academy of Sciences in 1989. It is Ritchey-Chr\\'{e}tien (R-C) reflector on an English equatorial mount and the effective aperture is 2.16 meters. It had been the largest optical telescope in China for $\\sim18$ years until the Guoshoujing Telescope (also called Large Sky Area Multi-Object Fiber Spectroscopic Telescope, LAMOST) and the Lijiang 2.4-m telescope were built. At present, there are three main instruments on the Cassegrain focus available: the Beijing Faint Object Spectrograph and Camera (BFOSC) for direct imaging and low resolution ($R\\sim500-2000$) spectroscopy, the spectrograph made by Optomechanics Research Inc. (OMR) for low resolution spectroscopy (the spectral resolutions a...

  6. Hirschsprung′s disease: Role of rectal suction biopsy - data on 216 specimens

    Rahman Zillur

    2010-01-01

    Full Text Available Background: The diagnosis of Hirschsprung′s disease (HD is dependent on the histological study of rectal ganglion cells, and an open rectal biopsy was the mainstay that required general anaesthesia (GA and carried risk of postoperative rectal bleeding. Suction rectal biopsy later gained wide acceptance and became the choice as there is no requirement of GA and virtual absence of any complications. Materials and Methods: A retrospective review of the histological findings of 216 rectal suction biopsies studied from 2005 to 2009. Results: There were 143 male and 73 female children. 196 (90.7% children were within 1 year of age. Among 216 rectal suction biopsies 181 (83.80% were aganglionic, 27 (12.5% were ganglionic and 8 (3.7% were inadequate. Majority of patients were of less than 1 year of age (94.47%. Conclusions : The rectal suction biopsy is a bed side procedure, safe, cheap and time saving. There is high degree of accuracy, simplicity and absence of complications.

  7. Summary and analysis of 216 GHz polarimetric measurements of in-situ rain

    Hedden, Abigail S.; Wikner, David A.; Bradley, Russell W.

    2015-05-01

    The Army Research Laboratory (ARL) has developed a polarimetric frequency-modulated continuous-wave (FMCW) instrumentation radar that has been used to study the polarization and backscatter properties of in-situ rain in the 220 GHz atmospheric window. A summary of the preliminary measurements is presented in this work including an analysis of the co-polarization backscatter and attenuation characteristics measured at 216 GHz. A marginal detection of the copolarization backscatter signature of rain was made during a series of fast-moving, heavy downpour thunderstorm events. A detection limit of -40±3 dB[m2/m3] was found for the VV-polarization cross section per unit volume for rain rates up to 150 mm/hr. Co-polarization (VV- and HH-polarization) attenuation characteristics measured at high rain rates (< 20 mm/hr) were well described by a Joss thunderstorm drop distribution in the high frequency limit, where drop size is much greater than the observation wavelength. Observations at 216 GHz suggest attenuation levels of 8-10 dB/km at rain rates above 20 mm/hr, strengthening previous evidence that attenuation through rain is independent of frequency under high rain rate conditions. Attenuation measurements at lower rain rates (< 20 mm/hr) were qualitatively consistent with both Laws and Parsons and Joss thunderstorm distributions.

  8. Asteroid 2015 DB216: a recurring co-orbital companion to Uranus

    Marcos, C de la Fuente

    2015-01-01

    Minor bodies trapped in 1:1 co-orbital resonances with a host planet could be relevant to explain the origin of captured satellites. Among the giant planets, Uranus has one of the smallest known populations of co-orbitals, three objects, and all of them are short-lived. Asteroid 2015 DB216 has an orbital period that matches well that of Uranus, and here we investigate its dynamical state. Direct N-body calculations are used to assess the current status of this object, reconstruct its immediate dynamical past, and explore its future orbital evolution. A covariance matrix-based Monte Carlo scheme is presented and applied to study its short-term stability. We find that 2015 DB216 is trapped in a temporary co-orbital resonance with Uranus, the fourth known minor body to do so. A detailed analysis of its dynamical evolution shows that it is an unstable but recurring co-orbital companion to Uranus. It currently follows an asymmetric horseshoe trajectory that will last for at least 10 kyr, but it may remain inside U...

  9. 20 CFR 652.216 - May the One-Stop operator provide guidance to State merit-staff employees in accordance with the...

    2010-04-01

    ... State merit-staff employees in accordance with the Act? 652.216 Section 652.216 Employees' Benefits... operator provide guidance to State merit-staff employees in accordance with the Act? Yes, the One-Stop... accountability of State merit-staff employees funded under the Act, remain under the authority of the...

  10. Separation and Biochemical Properties of Protein Mp-21.6 from Momordica charantia%苦瓜Mp-21.6蛋白的分离及生化特性

    蔡马; 于群; 朱新产

    2011-01-01

    为研究苦瓜蛋白的有效分离技术与抑菌活性,本实验采用(NH4)2SO4分级分离油苦瓜(Momordica charantia L.)蛋白质,将SephadexG-100凝胶柱在DEAE-52阴离子交换柱色谱上作站上串联,分步聚集纯化出苦瓜蛋白Mp-21.6.SDS-PAGE凝胶电泳显示单一蛋白条带;经生化分析鉴定,Mp-21.6 (Momordica protein of 21.6 kD)蛋白的分子量为21.6 kD,等电点pI=9.6;双向还原SDS-PAGE确定苦瓜蛋白Mp-21.6仅存在链内二硫健;Aacomplement软件的基于氨基酸组成比较发现,Mp-21.6类似于RNMC_MOMCH [Ribonuclease MC (RNase MC,EC=3.1.27.1)].抑菌试验显示Mp-21.6对大肠杆菌(Escherichia coli)、金黄色葡萄球菌(Staphylococcus aure us)、沙门氏菌(Salmonellab sp)、枯草芽胞杆菌(Bacillus sabtilis)、啤酒酵母(Saccharomyces cerevisiae)和黄曲霉(Aspergillus flavus)产生明显的抑菌活性,其最小抑菌浓度(MIC)远低于苯甲酸钠.随着苦瓜蛋白的逐级分离纯化,其清除羟自由基和总抗氧化能力均有上升的趋势.研究结果提示,苦瓜Mp-21.6蛋白具有广谱抗菌活性及显著的抗氧化能力,利用区隔性分离方式,分级提纯苦瓜的生物活性蛋白,将能开发出有发展潜力的新型抗菌药物.%In order to investigate technology of isolation and purification, and antimicrobial activity of pulp protein, in this paper, protein Mp-21.6 was isolated and purified from the pulp (Momordica charantia L.) by ammonium sulphate fractionation chromatographies on Sephadex G -100 and DEAE-52. And the protein was analyzed via SDS-PAGE and biochemical determination. The results showed that Mp-21.6 was homogeneous single band with molecular weight of 21.6 kD and pi 9.6. Mp-21.6 protein had intrachain disulfide bond by reductive two-dimensional electrophoresis. And Mp-21.6 was similar to RNMCMOMCH [Ribonuclease MC (Rnase MC, EC=3.1.27.1)] compared with amino acids by Aacomplement software. Antimicrobial activities of the protein were detected by

  11. Clinicopathological features and prognostic factors of 216 cases with primary gastrointestinal tract non-Hodgkin’s lymphoma

    尹文娟

    2013-01-01

    Objective To investigate the clinicopathological features of primary gastrointestinal non-Hodgkin’s lymphomas (PGI-NHL) and their prognostic values.Methods The clinical and pathological data of 216 patients diagnosed as PGI-NHL from Zhejiang Cancer Hospital were

  12. Decree of 19 November 1981 listing the insanitary industries in accordance with Section 216 of the health Code

    This Decree issued by the Minister of Health approves an amended list of insanitary industries which are subject to certain obligations under Section 216 of the Health Code of 1934. The amendments concern certain nuclear plants and laboratories. The 1981 Decree modifies a previous Decree of 1976. (NEA)

  13. 48 CFR 252.216-7000 - Economic price adjustment-basic steel, aluminum, brass, bronze, or copper mill products.

    2010-10-01

    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Economic price adjustment... SOLICITATION PROVISIONS AND CONTRACT CLAUSES Text of Provisions And Clauses 252.216-7000 Economic price...), use the following clause: Economic Price Adjustment—Basic Steel, Aluminum, Brass, Bronze, or...

  14. 30 CFR 77.216-2 - Water, sediment, or slurry impoundments and impounding structures; minimum plan requirements...

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Water, sediment, or slurry impoundments and... COAL MINES Surface Installations § 77.216-2 Water, sediment, or slurry impoundments and impounding... under design storm conditions, sediment or slurry level, water level and other information pertinent...

  15. 77 FR 28568 - Foreign-Trade Zone 216-Olympia, WA; Notification of Proposed Production Activity; Callisons, Inc...

    2012-05-15

    ... From the Federal Register Online via the Government Publishing Office DEPARTMENT OF COMMERCE Foreign-Trade Zones Board Foreign-Trade Zone 216--Olympia, WA; Notification of Proposed Production Activity; Callisons, Inc., (Mint Products), Lacey and Chehalis, WA The Port of Olympia, grantee of FTZ...

  16. 50 CFR 216.92 - Dolphin-safe requirements for tuna harvested in the ETP by large purse seine vessels.

    2010-10-01

    ... 50 Wildlife and Fisheries 7 2010-10-01 2010-10-01 false Dolphin-safe requirements for tuna... MAMMALS REGULATIONS GOVERNING THE TAKING AND IMPORTING OF MARINE MAMMALS Dolphin Safe Tuna Labeling § 216.92 Dolphin-safe requirements for tuna harvested in the ETP by large purse seine vessels. (a)...

  17. Treatability Test Report: Characterization of Vadose Zone Carbon Tetrachloride Source Strength Using Tomographic Methods at the 216-Z-9 Site

    Truex, Michael J.; Carroll, Kenneth C.; Rohay, Virginia J.; Mackley, Rob D.; Parker, Kyle R.

    2012-09-28

    A treatability test was conducted in 2011 at the 216-Z-9 Trench to evaluate methods for collecting characterization information that supports refined assessment of SVE performance goals based on impact to groundwater. The characterization information can also provide input to operational strategies for continued SVE operation and decisions regarding closure of the SVE system or transition to other remedies, if necessary.

  18. NCDC216: A New Multistate Group for Water Management and Quality for Ornamental Crop Production and Health

    We have established a USDA multistate development committee (NCDC216) to create a project focused on water management and quality for ornamental crop production and health. The nursery and greenhouse industry ranks 5th (>$14.6 billion) among all US agriculture commodities and within the top 5 commod...

  19. Corrosion studies of A216 grade WCA steel in hydrothermal magnesium-containing brines

    The US Department of Energy's Salt Repository Project (SRP) is investigating the general corrosion resistance of cast mild steel as a candidate material for waste package containers. Evaluation of this material is being performed at the Pacific Northwest Laboratory in environments simulating expected repository conditions. General corrosion studies of mild steel (ASTM A216 grade WCA) in the as-cast and normalized conditions were conducted in hydrothermal halite-saturated (saturated at ambient temperature) brine environments simulating a ''dissolution'' and an ''inclusion'' brine. Corrosion tests were also performed in brines similar to the inclusion brine but containing magnesium concentrations ranging from 1000 to 30,000 ppM to investigate the effect of magnesium on the corrosion behavior. Corrosion rates of the cast mild steel were found to increase with increasing temperature and with increasing magnesium concentration. Some possible mechanisms that explain the observed behavior are presented. 8 refs., 7 figs., 2 tabs

  20. Ground water impact assessment report for the 216-B-3 Pond system

    Ground water impact assessments were required for a number of liquid effluent receiving sites according to the Hanford Federal Facility Agreement and Consent Order Milestones M-17-00A and M-17-00B, as agreed upon by the US Department of Energy. This report is one of the last three assessments required and addresses the impact of continued discharge of uncontaminated wastewater to the 216-B-3C expansion lobe of the B Pond system in the 200 East Area until June 1997. Evaluation of past and projected effluent volumes and composition, geohydrology of the receiving site, and contaminant plume distribution patterns, combined with ground water modeling, were used to assess both changes in ground water flow regime and contaminant-related impacts

  1. Fission characteristics of 216Ra formed in heavy-ion induced reactions

    Hadi Eslamizadeh

    2013-11-01

    A Kramers-modified statistical model is used to calculate the cross-section of the evaporation residue, fission cross-section, average pre-fission multiplicities of protons and -particles for 216Ra formed in 19F + 197Au reactions and results are compared with the experimental data. To calculate these quantities, the effects of temperature and spin K about the symmetry axis have been considered in the calculations of the potential energy surfaces and the fission widths. It is shown that the results of the calculations using values of the temperature coefficient of the effective potential = 0.008 ± 0.003 MeV−2 and scaling factor of the fission-barrier height $r_{s} = 1.004 ± 0.002$ are in good agreement with the experimental data.

  2. Ground water impact assessment report for the 216-B-3 Pond system

    Johnson, V.G.; Law, A.G.; Reidel, S.P.; Evelo, S.D.; Barnett, D.B.; Sweeney, M.D.

    1995-01-01

    Ground water impact assessments were required for a number of liquid effluent receiving sites according to the Hanford Federal Facility Agreement and Consent Order Milestones M-17-00A and M-17-00B, as agreed upon by the US Department of Energy. This report is one of the last three assessments required and addresses the impact of continued discharge of uncontaminated wastewater to the 216-B-3C expansion lobe of the B Pond system in the 200 East Area until June 1997. Evaluation of past and projected effluent volumes and composition, geohydrology of the receiving site, and contaminant plume distribution patterns, combined with ground water modeling, were used to assess both changes in ground water flow regime and contaminant-related impacts.

  3. Groundwater monitoring plan for the Hanford Site 216-B-3 pond RCRA facility

    The 216-B-3 pond system was a series of ponds for disposal of liquid effluent from past Hanford production facilities. In operation since 1945, the B Pond system has been a RCRA facility since 1986, with Resource Conservation and Recovery Act (RCRA) interim-status groundwater monitoring in place since 1988. In 1994, discharges were diverted from the main pond, where the greatest potential for contamination was thought to reside, to the 3C expansion pond. In 1997, all discharges to the pond system were discontinued. In 1990, the B Pond system was elevated from detection groundwater monitoring to an assessment-level status because total organic halogens and total organic carbon were found to exceed critical means in two wells. Subsequent groundwater quality assessment failed to find any specific hazardous waste contaminant that could have accounted for the exceedances, which were largely isolated in occurrence. Thus, it was recommended that the facility be returned to detection-level monitoring

  4. Groundwater monitoring plan for the Hanford Site 216-B-3 pond RCRA facility

    Barnett, D.B.; Chou, C.J.

    1998-06-01

    The 216-B-3 pond system was a series of ponds for disposal of liquid effluent from past Hanford production facilities. In operation since 1945, the B Pond system has been a RCRA facility since 1986, with Resource Conservation and Recovery Act (RCRA) interim-status groundwater monitoring in place since 1988. In 1994, discharges were diverted from the main pond, where the greatest potential for contamination was thought to reside, to the 3C expansion pond. In 1997, all discharges to the pond system were discontinued. In 1990, the B Pond system was elevated from detection groundwater monitoring to an assessment-level status because total organic halogens and total organic carbon were found to exceed critical means in two wells. Subsequent groundwater quality assessment failed to find any specific hazardous waste contaminant that could have accounted for the exceedances, which were largely isolated in occurrence. Thus, it was recommended that the facility be returned to detection-level monitoring.

  5. Ultraviolet (193, 216 and 254 nm) photoinactivation of Escherichia coli strains with different repair deficiencies

    Escherichia coli K12 bacteria strains AB1157 (repair-deficient wild-type, uvrA+ recA+), AB1886 (uvrA-), AB2463 (recA-) and AB2480 (uvrA- recA-) were exposed to 254 nm germicidal UV and 216 or 193 nm laser radiation. The mean lethal incident dose (D37) for AB1157 does not change significantly with wavelength, whereas it increases for the other strains on going from λirr = 254 to 193 nm, e.g., eightfold for AB2480. Quantum yields for inactivation, due to light absorbed by the chromosomal DNA, have been estimated from the D37 values. The large differences in D37 between uvrA+ and uvrA- strains indicate a significant contribution of pyrimidine dimers and (6-4) photoproducts to photodamage of DNA in the cells. The formation of dimers even with λirr = 193 nm is supported by the result that the photoreactivable sector is larger than 63%. Inactivation of E. coli upon irradiation at 193 and 216 nm is therefore due to damage to intracellular DNA rather than to membrane or protein damage as is the case for mammalian cells. The ratio of the lethal doses for AB1157 vs AB2480 is ∼900 with λirr = 254 nm, but only 160 with λirr = 193 nm. We propose that this is due to the better repair of photodimers and (6-4) photoproducts than of damage induced by photoionization via upper excited states. Irradiation at 193 nm inactivates AB1157 mainly by damage due to photoionization and AB2480 by damage due to photodimers in the chromosomal DNA. 51 refs., 3 figs., 5 tabs

  6. Ultraviolet (193, 216 and 254 nm) photoinactivation of Escherichia coli strains with different repair deficiencies

    Gurzadyan, G.G.; Goerner, H.; Schulte-Frohlinde, D. [Max-Planck-Institut fuer Strahlenchemie, Muelheim an der Ruhr (Germany)

    1995-03-01

    Escherichia coli K12 bacteria strains AB1157 (repair-deficient wild-type, uvrA{sup +} recA{sup +}), AB1886 (uvrA{sup {minus}}), AB2463 (recA{sup {minus}}) and AB2480 (uvrA{sup {minus}} recA{sup {minus}}) were exposed to 254 nm germicidal UV and 216 or 193 nm laser radiation. The mean lethal incident dose (D{sub 37}) for AB1157 does not change significantly with wavelength, whereas it increases for the other strains on going from {lambda}{sub irr} = 254 to 193 nm, e.g., eightfold for AB2480. Quantum yields for inactivation, due to light absorbed by the chromosomal DNA, have been estimated from the D{sub 37} values. The large differences in D{sub 37} between uvrA{sup +} and uvrA{sup {minus}} strains indicate a significant contribution of pyrimidine dimers and (6-4) photoproducts to photodamage of DNA in the cells. The formation of dimers even with {lambda}{sub irr} = 193 nm is supported by the result that the photoreactivable sector is larger than 63%. Inactivation of E. coli upon irradiation at 193 and 216 nm is therefore due to damage to intracellular DNA rather than to membrane or protein damage as is the case for mammalian cells. The ratio of the lethal doses for AB1157 vs AB2480 is {approx}900 with {lambda}{sub irr} = 254 nm, but only 160 with {lambda}{sub irr} = 193 nm. We propose that this is due to the better repair of photodimers and (6-4) photoproducts than of damage induced by photoionization via upper excited states. Irradiation at 193 nm inactivates AB1157 mainly by damage due to photoionization and AB2480 by damage due to photodimers in the chromosomal DNA. 51 refs., 3 figs., 5 tabs.

  7. Constraints on the size of Asteroid (216) Kleopatra using stress analysis

    Hirabayashi, M.; Scheeres, D. J.

    2013-12-01

    We investigate the stable size of Asteroid (216) Kleopatra by considering structural constraints on this body. Comprehensive radar observations (Ostro et al. 2000, Science) were used to estimate a shape model for this asteroid. Their estimation revealed that the shape looks like a dog-bone, the mean radius is 54.3 km (with uncertainty as large as 25%), and the surface seems similar to lunar surface regolith. However, 10 years later, Descamps et al. (2011, Icarus) performed near-infrared adaptive optics (AO) imaging with the W.M. Keck II telescope and found that although the shape may be consistent with their observation result, their size appeared to be larger than the Ostro size (by a factor of about 1.24). Our motivation in this study is to investigate structural stability constraints on the size of this asteroid. Across the stated range of uncertainty we find significant differences in the necessary angle of friction and cohesion for the body to avoid plastic deformation. We use the following physical parameters as fixed: a mass of 4.64e18 kg (Descamps et al. 2011, Icarus), a rotation period of 5.385 hr (Magnusson 1990, Icarus), and the Ostro et al. shape. We use the Drucker-Prager criterion to describe the rheology of the asteroid's material. Furthermore, we determine the friction angle from the fact that the surface of this asteroid is similar to lunar surface regolith, whose porosity ranges from 33% to 55%. According to Scott (1963), a soil with porosity of 44% (the mean value of the lunar surface porosity) has a friction angle of 32 degrees (which we use as our nominal value). Since the interior structure is unknown, we assume that the body is homogeneous. We first analyze the stable size by using the upper bound theorem from limit analysis on the assumption that this asteroid's materials are cohesionless. Based on this theorem, for any static surface traction and body force, the yield due to a smooth and convex yield envelope associated with the volume

  8. Milestones in the testing of surface disinfectants: from Robert Koch to CEN TC 216

    Reybrouck, Gerald

    2007-09-01

    Full Text Available The first publication on testing disinfection procedures dates back to 1881 and was compiled by Robert Koch. Although his conclusions were erroneous, we continue to use the “germ carrier test” right up to the present day even if preference is now given to the suspension test first devised by Geppert. Over the years many conceptual milestones had to be reached, and much knowledge and many insights were needed to develop this procedure further to ensure reproducible results. Today, the disinfectant effect is calculated in terms of logarithmic reduction factors for the microbial count: a reduction of 5 log levels has been agreed, i.e. an inactivation kinetics of 99.999%. Of paramount importance was, in particular, the insight that different methods had to be employed to test disinfectants, while doing so not only in the laboratory but also under everyday working conditions. This gave rise to a situation whereby each country developed its own test methods, producing significantly different results. It was only in 1970 that the parties concerned came together so as to reach a uniform solution in Europe. The achievements of the “International Colloquium” were later adopted and continued by the European Standardization Committee (CEN in a special working group (TS 216. The most important accomplishment of this working group is, no doubt, the insight that it is not a test result but rather a test system that will reveal the truth. The tests carried out in Phase 1 are quantitative suspension tests to elucidate the bactericidal, virucidal, tuberculocidal, fungicidal and sporicidal efficacy. Phase 2 defines the requisite concentration per exposure time.CEN was founded and is sponsored by industry, since the latter needs reliable standards. Time will tell whether this was not perhaps the greatest milestone in the development of test methods. However, the successes scored by CEN are ultimately only the logical consequence of the accomplishments

  9. Groundwater Monitoring Plan for the Hanford Site 216-B-3 Pond RCRA Facility

    Barnett, D BRENT.; Smith, Ronald M.; Chou, Charissa J.; McDonald, John P.

    2005-11-01

    The 216-B-3 Pond system was a series of ponds used for disposal of liquid effluent from past Hanford production facilities. In operation from 1945 to 1997, the B Pond System has been a Resource Conservation and Recovery Act (RCRA) facility since 1986, with RCRA interim-status groundwater monitoring in place since 1988. In 1994 the expansion ponds of the facility were clean closed, leaving only the main pond and a portion of the 216-B-3-3 ditch as the currently regulated facility. In 2001, the Washington State Department of Ecology (Ecology) issued a letter providing guidance for a two-year, trial evaluation of an alternate, intrawell statistical approach to contaminant detection monitoring at the B Pond system. This temporary variance was allowed because the standard indicator-parameters evaluation (pH, specific conductance, total organic carbon, and total organic halides) and accompanying interim status statistical approach is ineffective for detecting potential B-Pond-derived contaminants in groundwater, primarily because this method fails to account for variability in the background data and because B Pond leachate is not expected to affect the indicator parameters. In July 2003, the final samples were collected for the two-year variance period. An evaluation of the results of the alternate statistical approach is currently in progress. While Ecology evaluates the efficacy of the alternate approach (and/or until B Pond is incorporated into the Hanford Facility RCRA Permit), the B Pond system will return to contamination-indicator detection monitoring. Total organic carbon and total organic halides were added to the constituent list beginning with the January 2004 samples. Under this plan, the following wells will be monitored for B Pond: 699-42-42B, 699-43-44, 699-43-45, and 699-44-39B. The wells will be sampled semi-annually for the contamination indicator parameters (pH, specific conductance, total organic carbon, and total organic halides) and annually for

  10. 4$\\pi$ detector for study of Zeno effect using 220Rn -> 216Po alpha->alpha correlated chains

    Nadderd, L; Subotic, K; Polyakov, A N; Lobanov, Y V; Rykhlyuk, A V

    2015-01-01

    First test of the 4pi detector for study of exponential law of radioactive decay and possibility of observation of Zeno effect [1-3], measuring the mean life of 216Po is presented. This detector consists of two surface-barrier n-Si(Au) detectors placed in the close contact ( 4T1/2. Both, the data acquisition system and the vacuum chamber design are presented in brief.

  11. Borehole data package for the 216-S-10 pond and ditch well 299-W26-13

    One new Resource Conservation and Recovery Act (RCRA) groundwater monitoring well was installed at the 216-S-10 pond and ditch during November and December 1999 in fulfillment of Tri-Party Agreement (Ecology 1996) milestone M-24-42. The well is 299-W26-13 and is located at the northeast comer to the 216-S-10 pond, southwest of 200 West Area. The well is a new downgradient well in the monitoring network. A figure shows the locations of all wells in the 216-S-10 pond and ditch monitoring network. The new well was constructed to the specifications and requirements described in Washington Administrative Code (WAC) 173-160 and WAC 173-303, the groundwater monitoring plan for the 216-S-10 pond and ditch (Airhart et al. 1990), and the description of work for well drilling and installation. During drilling and construction of well 299-W26-13, sampling and analysis activities were done to support remedial action, closure decisions at treatment, storage and disposal facilities, and to confirm preliminary site conceptual models developed in the 200-CS-1 Work Plan (DOE/RL 1999). This document compiles information on the drilling and construction, well development, pump installation, and sediment and groundwater testing applicable to well 299-W26-13. Appendix A contains the Well Summary Sheet (as-built diagram), the Well Construction Summary Report, and the geologist's log. Appendix B contains results of field and laboratory determinations of physical and chemical properties of sediment samples. Appendix C contains borehole geophysical logs. Additional documentation concerning well construction is on file with Bechtel Hanford, Inc., Richland, Washington

  12. Evidence for deuterium astration in the planetary nebula Sh2-216?

    Oliveira, C M; Moos, H W; Kruk, J W; Rauch, T; Oliveira, Cristina M; Chayer, Pierre; Kruk, Jeffrey W.; Rauch, Thomas

    2007-01-01

    We present FUSE observations of the line of sight to WD0439+466 (LS V +46 21), the central star of the old planetary nebula Sh2-216. The FUSE data shows absorption by many interstellar and stellar lines, in particular D I, H2 (J = 0 - 9), HD (J = 0 - 1), and CO. Many other stellar and ISM lines are detected in the STIS E140M HST spectra of this sightline, which we use to determine N(HI). We derive, for the neutral gas, D/H=(0.76 +0.12 -0.11)E-5, O/H = (0.89 +0.15 -0.11)E-4 and N/H = (3.24 +0.61-0.55)E-5. We argue that most of the gas along this sightline is associated with the planetary nebula. The low D/H ratio is likely the result of this gas being processed through the star (astrated) but not mixed with the ISM. This would be the first time that the D/H ratio has been measured in predominantly astrated gas. The O/H and N/H ratios derived here are lower than typical values measured in other planetary nebulae likely due to unaccounted for ionization corrections.

  13. Evaluation report on CCTF Core-II reflood test C2-16 (Run 76)

    This report presents the result of the upper plenum injection (UPI) test C2-16 (Run 76), which was conducted on October 23, 1984, with the Cylindrical Core Test Facility (CCTF) at Japan Atomic Energy Research Institute (JAERI). The CCTF is a 1/21.4 scale model of a 1,100 MWe PWR with four loop active components to provide information on the system and core thermo-hydrodynamics during reflood. The objectives of the test are to investigate the reflood phenomena with single failure UPI condition and to investigate the effect of the asymmetry of UPI on the reflood phenomena. The test was performed with an asymmetric UPI condition at the injection rate simulating single failure of LPCI pumps. It was observed that, (1) a UPI test simulating no LPCI pump failure gave the slightly lower peak clad temperature than a UPI test simulating single LPCI pump failure, indicating that single LPCI pump failure assumption is conserrative for UPI condition, and (2) an asymmetric UPI lead to a higher core water accumulation and then a higher heat transfer coefficient, resultantly a lower peak clad temperature than a symmetric UPI, indicating that asymmetric UPI does not lead to a poorer core cooling than symmetric UPI. (author)

  14. Crash testing hydrological models in contrasted climate conditions: An experiment on 216 Australian catchments

    Coron, L.; AndréAssian, V.; Perrin, C.; Lerat, J.; Vaze, J.; Bourqui, M.; Hendrickx, F.

    2012-05-01

    This paper investigates the actual extrapolation capacity of three hydrological models in differing climate conditions. We propose a general testing framework, in which we perform series of split-sample tests, testing all possible combinations of calibration-validation periods using a 10 year sliding window. This methodology, which we have called the generalized split-sample test (GSST), provides insights into the model's transposability over time under various climatic conditions. The three conceptual rainfall-runoff models yielded similar results over a set of 216 catchments in southeast Australia. First, we assessed the model's efficiency in validation using a criterion combining the root-mean-square error and bias. A relation was found between this efficiency and the changes in mean rainfall (P) but not with changes in mean potential evapotranspiration (PE) or air temperature (T). Second, we focused on average runoff volumes and found that simulation biases are greatly affected by changes in P. Calibration over a wetter (drier) climate than the validation climate leads to an overestimation (underestimation) of the mean simulated runoff. We observed different magnitudes of these models deficiencies depending on the catchment considered. Results indicate that the transfer of model parameters in time may introduce a significant level of errors in simulations, meaning increased uncertainty in the various practical applications of these models (flow simulation, forecasting, design, reservoir management, climate change impact assessments, etc.). Testing model robustness with respect to this issue should help better quantify these uncertainties.

  15. Description of work for 216-U-Pond cone penetrometer demonstration

    This description of work details the Proposed field activities associated with Cone Penetrometer (CPT) work at the 216-U-10 Pond (U-10 Pond) in the 200 West Area and will serve as a field guide for those performing the work. The U-10 Pond was constructed in 1944 to receive low-level liquid effluent from the various chemical reprocessing facilities within the 200 West Area. The U-10 Pond covered 30 acres and received approximately 4.3 x 1010 gal of contaminated liquid. Sampling conducted in 1980 indicated that the most significant radionuclides were 90Sr, 137Cs, plutonium, and uranium (DOE-RL 1993). The pond was deactivated and stabilized in 1985 with clean fill dirt. The thickness of the stabilization cover is variable across the former pond and ranges between 2 ft near the pond margins and delta area to 8 feet in the deepest section of the pond. The purpose of this work is to establish the extent of contamination beneath the U-10 pond

  16. ASASSN-15oi: A Rapidly Evolving, Luminous Tidal Disruption Event at 216 Mpc

    Holoien, T W -S; Prieto, J L; Grupe, D; Chen, Ping; Godoy-Rivera, D; Stanek, K Z; Shappee, B J; Dong, Subo; Brown, J S; Basu, U; Beacom, J F; Bersier, D; Brimacombe, J; Carlson, E K; Falco, E; Johnston, E; Madore, B F; Pojmanski, G; Seibert, M

    2016-01-01

    We present ground-based and Swift photometric and spectroscopic observations of the tidal disruption event (TDE) ASASSN-15oi, discovered at the center of 2MASX J20390918-3045201 ($d\\simeq216$ Mpc) by the All-Sky Automated Survey for SuperNovae (ASAS-SN). The source peaked at a bolometric luminosity of $L\\simeq1.9\\times10^{44}$ ergs s$^{-1}$ and radiated a total energy of $E\\simeq5.0\\times10^{50}$ ergs over the $\\sim3.5$ months of observations. The early optical/UV emission of the source can be fit by a blackbody with temperature increasing from $T\\sim2\\times10^4$ K to $T\\sim6\\times10^4$ K while the luminosity declines from $L\\simeq1.9\\times10^{44}$ ergs s$^{-1}$ to $L\\simeq2.8\\times10^{43}$ ergs s$^{-1}$, requiring the photosphere to be shrinking rapidly. The optical/UV luminosity decline is broadly consistent with an exponential decline, $L\\propto e^{-t/t_0}$, with $t_0\\simeq35$ days. ASASSN-15oi also exhibits roughly constant soft X-ray emission that is significantly weaker than the optical/UV emission. Spe...

  17. Discovery of a possible X-ray counterpart to HESS J1804-216

    Bamba, A; Hiraga, J S; Hughes, J P; Kohmura, T; Kokubun, M; Maeda, Y; Matsumoto, H; Senda, A; Takahashi, T; Tsuboi, Y; Yamauchi, S; Yuasa, T; Bamba, Aya; Koyama, Katsuji; Hiraga, Junko S.; Hughes, John P.; Kohmura, Takayoshi; Kokubun, Motohide; Maeda, Yoshitomo; Matsumoto, Hironori; Senda, Atsushi; Takahashi, Tadayuki; Tsuboi, Yohko; Yamauchi, Shigeo; Yuasa, Takayuki

    2006-01-01

    Suzaku deep observations have discovered two highly significant nonthermal X-ray sources, Suzaku J1804$-$2142 (Src 1) and Suzaku J1804$-$2140 (Src 2), positionally coincident with the unidentified TeV $\\gamma$-ray source, HESS J1804$-$216. The X-ray sources are not time variable and show no counterpart in other wavebands, except for the TeV source. Src 1 is unresolved at Suzaku spatial resolution, whereas Src 2 is extended or composed of multiple sources. The X-ray spectra are highly absorbed, hard, and featureless, and are well fitted by absorbed power-law models with best-fit photon indices and absorption columns of $-0.3_{-0.5}^{+0.5}$ and $0.2_{-0.2}^{+2.0}\\times 10^{22}$ cm$^{-2}$ for Src 1, and $1.7_{-1.0}^{+1.4}$ and $1.1_{-0.6}^{+1.0}\\times 10^{23}$ cm$^{-2}$ for Src 2. The measured X-ray absorption to the latter source is significantly larger than the total Galactic neutral hydrogen column in that direction. The unabsorbed 2--10 keV band luminosities are $7.5\\times 10^{32}(d/{\\rm 5 kpc})^2$ ergs s$^{...

  18. Results of RCRA groundwater quality assessment at the 216-B-3 Pond Facility

    This document describes a groundwater quality assessment of the 216-B-3 pond system, a Resources Conservation and Recovery act of 1976 (RCRA) waste facility. In 1990, sampling and chemical analysis of groundwater underlying the facility indicated that the contamination indicator parameters, total organic halogens (TOX), and total organic carbon (TOC) had exceeded established limits in two wells. This discovery placed the facility into RCRA groundwater assessment status and subsequently led to a more detailed hydrochemical analysis of groundwater underlying the facility. Comprehensive chemical analyses of groundwater samples from 1994 through 1996 revealed one compound, tris (2-chloroethyl) phosphate (TRIS2CH), that may have contributed to elevated TOX concentrations. No compound was identified as a contributor to TOC. Detailed evaluations of TOX, TOC, and TRIS2CH and comparison of occurrences of these parameters led to conclusions that (1) with few exceptions, these constituents occur at low concentrations below or near limits of quantitation; (2) it is problematic whether the low concentrations of TRIS2CH represent a contaminant originating from the facility or if it is a product of well construction; and (3) given the low and diminishing concentration of TOX, TOC, and TRIS2CH, no further investigation into the occurrent of these constituents is justified. Continued groundwater monitoring should include an immediate recalculation of background critical means of upgradient/downgradient comparisons and a return to seminannual groundwater monitoring under a RCRA indicator parameter evaluation program

  19. Three Alginate Lyases from Marine Bacterium Pseudomonas fluorescens HZJ216: Purification and Characterization

    Liyan, Li [Ocean University of China, Qingdao, PRC; Jiang, Xiaolu [Ocean University of China, Qingdao, PRC; Wang, Peng [Ocean University of China, Qingdao, PRC; Guan, Huashi [Ocean University of China, Qingdao, PRC; Guo, Hong [ORNL

    2010-01-01

    Three alginate lyases (A, B, and C) from an alginate-degrading marine bacterium strain HZJ216 isolated from brown seaweed in the Yellow Sea of China and identified preliminarily as Pseudomonas fluorescens are purified, and their biochemical properties are described. Molecular masses of the three enzymes are determined by SDS-PAGE to be 60.25, 36, and 23 kDa with isoelectric points of 4, 4.36, and 4.59, respectively. Investigations of these enzymes at different pH and temperatures show that they are most active at pH 7.0 and 35 C. Alginate lyases A and B are stable in the pH range of 5.0 9.0, while alginate lyase C is stable in the pH range of 5.0 7.0. Among the metal ions tested, additions of Na+, K+, and Mg2+ ions can enhance the enzyme activities while Fe2+, Fe3+, Ba2+, and Zn2+ ions show inhibitory effects. The substrate specificity results demonstrate that alginate lyase C has the specificity for G block while alginate lyases A and B have the activities for both M and G blocks. It is the first report about extracellular alginate lyases with high alginate-degrading activity from P. fluorescens.

  20. The predicted impacts to the groundwater and Columbia River from ammoniated water discharges to the 216-A-36B crib

    Impact from past and potential future discharges of ammoniated water to the 216-A-36B crib have on groundwater and river concentrations of hazardous chemical constitutents are studied. Until August 1987, the 216-A-36B crib, located in the 200-East Area of the Hanford Site, accepted ammoniated water discharges. Although this study addresses known hazardous chemical constituents associated with such discharges, the primary concern is the discharge of NH4OH because of its microbiological conversion to NO2/sup /minus// and NO3/sup /minus//. As a result of fuel decladding operations, material balance calculations indicate that NH4OH has been discharged to the 216-A-36B crib in amounts that exceed reportable quantities under the Comprehensive Environmental Response, Compensation and Liability Act of 1980. Although flow to the crib is relatively constant, the estimated NH4OH discharge varies from negligible to a maximum of 10,000 g-molesh. Because these discharges are intermittent, the concentration delivered to the groundwater is a function of soil sorption, microbiological conversion rates of NH4+ to NO2/sup /minus// and NO3/sup /minus//, and groundwater dispersion. This report provides results based on the assumptions of maximum, nominal, and discountinued NH4OH discharges to the crib. Consequently, the results show maximum and realistic estimates of NH4+, NO2/sup /minus// and NO3/sup /minus// concentrations in the groundwater

  1. Corrosion and hydrogen permeation of A216 grade WCA steel in hydrothermal magnesium-containing brines

    The US Department of Energy's Salt Repository Project (SRP) is investigating the general corrosion resistance of cast mild steel as a candidate material for waste package containers. Evaluation of this material is being performed at the Pacific Northwest Laboratory in environments simulating expected repository conditions. The present work addresses two potential failure modes of the reference waste package container: failure by general corrosion processes, and failure by internal hydrogen pressurization by permeation of corrosion product hydrogen. General corrosion studies of mild steel (ASTM A216 grade WCA) in the as-cast and normalized conditions were conducted in hydrothermal halite-saturated (saturated at ambient temperature) brine environments simulating a dissolution and an inclusion brine. Corrosion tests were also performed in brines similar to the inclusion brine but containing magnesium concentrations ranging from 1,000 to 30,000 ppm to investigate the effect of magnesium on the corrosion behavior. In addition, long-term (to 18 months) corrosion tests have been carried out using two-phase salt/brine environments (excess salt tests). Corrosion rates of the cast mild steel in brine were found to increase with increasing temperature and with increasing magnesium concentration. Some possible mechanisms that explain the observed behavior are presented. The corrosion rates observed in the excess-salt tests tend to decrease with time, at 200 degree and 150 degree C; and as-cast material corrodes more slowly than does normalized material. Corrosion-product hydrogen rapidly permeated a mild steel tubing corrosion/permeation specimen immersed in brine. The rate of permeation at 150 degree C was high enough to cause concern regarding potential container overpressurization

  2. Brightest Fermi-LAT flares of PKS 1222+216: implications on emission and acceleration processes

    Kushwaha, Pankaj; Singh, K. P. [Department of Astronomy and Astrophysics, Tata Institute of Fundamental Research, Mumbai (India); Sahayanathan, Sunder, E-mail: pankaj563@tifr.res.in [Astrophysical Sciences Division, Bhabha Atomic Research Centre, Mumbai (India)

    2014-11-20

    We present a high time resolution study of the two brightest γ-ray outbursts from a blazar PKS 1222+216 observed by the Fermi Large Area Telescope (LAT) in 2010. The γ-ray light curves obtained in four different energy bands, 0.1-3, 0.1-0.3, 0.3-1, and 1-3 GeV, with time bins of six hours, show asymmetric profiles with similar rise times in all the bands but a rapid decline during the April flare and a gradual one during the June flare. The light curves during the April flare show an ∼2 day long plateau in 0.1-0.3 GeV emission, erratic variations in 0.3-1 GeV emission, and a daily recurring feature in 1-3 GeV emission until the rapid rise and decline within a day. The June flare shows a monotonic rise until the peak, followed by a gradual decline powered mainly by the multi-peak 0.1-0.3 GeV emission. The peak fluxes during both the flares are similar except in the 1-3 GeV band in April, which is twice the corresponding flux during the June flare. Hardness ratios during the April flare indicate spectral hardening in the rising phase followed by softening during the decay. We attribute this behavior to the development of a shock associated with an increase in acceleration efficiency followed by its decay leading to spectral softening. The June flare suggests hardening during the rise followed by a complicated energy dependent behavior during the decay. Observed features during the June flare favor multiple emission regions while the overall flaring episode can be related to jet dynamics.

  3. Influence of Neutron Shell Closure (Nc=126) on Prescission Particle Emission of Fissioning Systems 216,224Th

    叶巍

    2003-01-01

    The effect of neutron shell closure Nc = 126 on the prescission-particle emission of 216Th and 224Th nuclei is investigated within the framework of an extensive Smoluchowski equation. It is found that there is a large difference in the prescission neutron multiplicity for the two Th nuclei, indicating a strong shell effect in neutron emission. Moreover, shell effects on particle emission are also investigated as functions of excitation energy,angular momentum and nuclear viscosity. The results show that with increasing excitation energy shell effects in prefission neutron evolve from continual strength to gradual weakness. Both high angular momenta and low viscosity weaken the shell effects on the particle emission.

  4. A Retrospective Clinical Analysis of 216 Patients With Non-ST Segment Elevation Myocardial Infarction

    Manish Pradhan; Shuxian Zhou; Juan Lei; Zesheng Liu

    2008-01-01

    Objectives To analyze the clinical characteristics of 216 patients with non-ST segment elevation myocardial infarc-tion (NSTEMI). Methods A retrospective analysis was used. Two hundred and sixteen NSTEMI patients were divid-ed into two groups: ①according to the age: age 178 μmol. L-1 group. Seven hundred and eighty six acute myocardial infarction (AMI) patients during the same period were divided into ST seg-ment elevation myocardial infarction (STEMI) group and NSTEMI group. Clinical characteristics of the patients in th e two groups were compared. Results ① The number of NSTEMI patients in age ≥65 years group is significantly grea-ter than that in age 178 μmol· L-1) and triple ves-sel disease. Fewer patients in this group received coronary artery angiography (CAG), percutaneous coronary interven-tion (PCI) and coronary artery bypass graft (CABG). More number of deaths in this group compared with the age 4 group is significantly greater than that in TIMI score 4 group comparing with TIMI score ≤4 group. ③ Obviously, more number of elderly patients, non-insulin dependant diabetes mellitus (NIDDM), patients with cardiac troponin T (CTnT) >3.0 ng · L-1 and deaths occurred in sCr > 178 μmol · L-1 group. @ STEMI and NSTEMI patients were compared in same time frame as follows: fewer NSTEMI patients and more elderly patients had no chest pain, NID-DM, hypertension, dyslipidemia, left main coronary artery (LMCA) disease while CTnT ≥3.0 ng· ml-1; fewer pa- tients with aneurysm (30 days) underwent CAG, PCI and CABG treatment. However, there were no significant differ-ences in smokers, patients with less than 50% stenosis in any vessel, 1 -3 vessel disease, acute left ventricle heart fail-ure, cardiogenic shock, serious arrhythmia and deaths. ⑤ The multivariate logistic regression analysis showed that death in NSTEMI was directly influenced by malignant arrhythmias with age ≥ 70 years. Conclusions Patients with NSTEMI were older, had more risk factors

  5. EFSA CEF Panel (EFSA Panel on Food Contact Materials, Enzymes, Flavourings and Processing Aids), 2013. Scientific Opinion on Flavouring Group Evaluation 216, Revision 1 (FGE.216Rev1). Consideration of genotoxic potential for α,β-unsaturated 2-Phenyl -2-Alkenals from Subgroup 3.3 of FGE.19

    Beltoft, Vibe Meister; Binderup, Mona-Lise; Lund, Pia;

    The Panel on Food Contact Materials, Enzymes, Flavourings and Processing Aids of the European Food Safety Authority was requested to evaluate the genotoxic potential of five flavouring substances from subgroup 3.3 of FGE.19. In the Flavouring Group Evaluation 216 (FGE.216) additional genotoxicity...... of animals treated with 2-phenylcrotonaldehyde. Moreover, since the substance was genotoxic only without metabolic activation, it appears necessary to prove the absence of genotoxic effect locally in the gastro intestinal system using the Comet assay....

  6. 中西结合治疗216例犬细小病毒病疗效观察%Clinical Observation of 216 Cases of Canine Parvovirus Disease by Treatment of Combining TCM and WM

    宋洋铭; 叶得河

    2012-01-01

    通过临床症状、流行病学特点和犬细小病毒抗原试剂盒对疑似细小病毒感染的216例病犬进行确诊,并对确诊为细小病毒感染的部分病例进行抗体水平检测,以判断其预后,采用中西结合的综合措施治疗发病犬,治愈率达到70%,提出了有效的预防措施.%Author confirmed 216 cases of suspected canine parvovirus disease through the clinical signs, epidemiological characteristics and antigen rapid canine parvovirus test kit, to determine its prognosis, author detected antibody level of some cases of confirmed canine parvovirus disease, in addition, author achieved cure rate of 70% by comprehensive measures of treatment of combining TCM and WM, at last author propose effective prevention measures for canine parvovirus disease.

  7. Breast-conserving surgery and combined therapy for women breast cancer:a report of 216 cases%216例女性乳腺癌保乳手术及综合治疗的临床分析

    Xianju Qin; Junxue Chen; Hongwei Zhang; Dafang Zhao; Hua Zhang; Wenjie Luo; Qian Huang; Shixian Lian; Hanxing Tong

    2007-01-01

    Objective:To explore the therapeutic effect and associated techniques of breast-conserving therapy on patients with clinical stage Ⅰand stage Ⅱ breasl cancer.Methods:216 female patients with breast cancer underwent breast-conserving therapy from December 1993 to October 2004.Their data were analyzed retrospectively.The breast-conserving therapy consisted of lumpectomy or quadrant removal of the breast,postoperative radiotherapy.chemotherapy and endocrine therapy.of them.209 patients underwent axillary lymph node dissection.Results:There were no operative complications.216patients were followed-up 3 to 147 months.the medial follow-up time was 78 months.The local recurrence rate was 1.85%.Two patients died and one of them was not related with breast cancer.Presence or absence of fibrosis,shape of breast,asymmetry,pigmentation and handle were taken into consideration for cosmetic evaluation by the patients and experienced breast surgeon.Breasts were scored cosmetically asexcellent and good in 199 patients.the rate of satisfactory was92.13%.Conclusion:Breast-conserving therapy for early breast cancer is a safe and effective therapy.It has less trauma and less complications and can also raise the quality of life in the patients.But we must obey the strict indications and reasonable techniques.

  8. Observation of Very High Energy Gamma Rays from HESS J1804-216 with CANGAROO-III Telescopes

    Higashi, Y; Yoshida, T; Enomoto, R; Tanimori, T; Edwards, P G; Naito, T; Bicknell, G V; Clay, R W; Gunji, S; Hara, S; Hara, T; Hattori, T; Hayashi, S; Hirai, Y; Inoue, K; Kabuki, S; Kajino, F; Katagiri, H; Kawachi, A; Kifune, T; Kiuchi, R; Kushida, J; Matsubara, Y; Mizukami, T; Mizumoto, Y; Mizuniwa, R; Mori, M; Muraishi, H; Muraki, Y; Nakamori, T; Nakano, S; Nishida, D; Nishijima, K; Ohishi, M; Sakamoto, Y; Seki, A; Stamatescu, V; Suzuki, T; Swaby, D L; Thornton, G; Tokanai, F; Tsuchiya, K; Watanabe, S; Yamada, Y; Yamazaki, E; Yanagita, S; Yoshikoshi, T; Yukawa, Y

    2008-01-01

    We observed the unidentified TeV gamma-ray source HESS J1804-216 with the CANGAROO-III atmospheric Cerenkov telescopes from May to July in 2006. We detected very high energy gamma rays above 600 GeV at the 10 sigma level in an effective exposure of 76 hr. We obtained a differential flux of (5.0+/-1.5_{stat}+/-1.6_{sys})\\times 10^{-12}(E/1 TeV)^{-\\alpha} cm^{-2}s^{-1}TeV^{-1} with a photon index \\alpha of 2.69 +/- 0.30_{stat} +/- 0.34_{sys}, which is consistent with that of the H.E.S.S. observation in 2004. We also confirm the extended morphology of the source. By combining our result with multi-wavelength observations, we discuss the possible counterparts of HESS J1804-216 and the radiation mechanism based on leptonic and hadronic processes for a supernova remnant and a pulsar wind nebula.

  9. 40 CFR 265 interim status indicator-evaluation ground-water monitoring plan for the 216-B-63 trench

    This document outlines a ground-water monitoring plan for the 216-B-63 trench located in the northeast corner of the 200-East Area on the Hanford Site in southeastern Washington State. It has been determined that hazardous materials (corrosives) were disposed of to the trench during past operations. Installation of an interim-status ground-water monitoring system is required to determine whether hazardous chemicals are leaching to the ground water from beneath the trench. This document summarizes the existing data that are available from near the 216-B-63 trench and presents a plan to determine the extent of ground-water contamination, if any, derived from the trench. The plan calls for the installation of four new monitoring wells located near the west end of the trench. These wells will be used to monitor ground-water levels and water quality immediately adjacent to the trench. Two existing RCRA monitoring wells, which are located near the trench and hydraulically upgradient of it, will be used as background wells. 46 refs., 15 figs., 12 tabs

  10. 宫腔内人工授精治疗不育症216例疗效观察

    贾韶彤; 席向红; 刘鑫

    2006-01-01

    为观察男性不育症患者宫腔内人工授精(IUI)临床疗效,回顾性分析行IUI的216例患者的临床资料.患者4组:A组正常精液自然周期的卵泡成熟后采用IUI;B组正常精液采用促排卵后行IUI治疗;C组精液分析异常(精液不液化、少精症、弱精子症等)自然周期的卵泡成熟后采用IUI;D组免疫性不育(男性血清抗精了抗体阳性)自然周期的卵泡成熟后采用IUI.结果,216例男性不育患者进行245个周期的IUI,妊娠33例,妊娠率15.28%;正常精液促排卵进行IUI治疗的B组妊娠率最高,为19.04%.表明IUI适用于男方因素引起的不孕.

  11. Cilium adhesin P216 (MHJ_0493) is a target of ectodomain shedding and aminopeptidase activity on the surface of Mycoplasma hyopneumoniae.

    Tacchi, Jessica L; Raymond, Benjamin B A; Jarocki, Veronica M; Berry, Iain J; Padula, Matthew P; Djordjevic, Steven P

    2014-06-01

    MHJ_0493 (P216) is a highly expressed cilium adhesin in Mycoplasma hyopneumoniae. P216 undergoes cleavage at position 1074 in the S/T-X-F↓-X-D/E-like motif (1072)T-N-F↓Q-E(1076) generating N-terminal and C-terminal fragments of 120 kDa (P120) and 85 kDa (P85) on the surface of M. hyopneumoniae. Here we show that several S/T-X-F↓X-D/E-like motifs exist in P216 but only (1072)T-N-F↓Q-E(1076) and (1344)I-T-F↓A-D-Y(1349) were determined to be bona fide processing sites by identifying semitryptic peptides consistent with cleavage at the phenylalanine residue. The location of S/T-X-F↓-X-D/E-like motifs within or abutting regions of protein disorder greater than 40 consecutive amino acids is consistent with our hypothesis that site access influences the cleavage efficiency. Approximately 20 cleavage fragments of P216 were identified on the surface of M. hyopneumoniae by LC-MS/MS analysis of biotinylated proteins and 2D SDS-PAGE. LC-MS/MS analysis of semitryptic peptides within P216 identified novel cleavage sites. Moreover, detection of a series of overlapping semitryptic peptides that differed by the loss a single amino acid at their N-terminus is consistent with aminopeptidase activity on the surface of M. hyopneumoniae. P120 and P85 and their cleavage fragments bind heparin and cell-surface proteins derived from porcine epithelial-like cells, indicating that P216 cleavage fragments retain the ability to bind glycosaminoglycans. PMID:24804907

  12. A program to compute three-dimensional subsonic unsteady aerodynamic characteristics using the doublet lattice method, L216 (DUBFLEX). Volume 2: Supplemental system design and maintenance document

    Harrison, B. A.; Richard, M.

    1979-01-01

    The information necessary for execution of the digital computer program L216 on the CDC 6600 is described. L216 characteristics are based on the doublet lattice method. Arbitrary aerodynamic configurations may be represented with combinations of nonplanar lifting surfaces composed of finite constant pressure panel elements, and axially summetric slender bodies composed of constant pressure line elements. Program input consists of configuration geometry, aerodynamic parameters, and modal data; output includes element geometry, pressure difference distributions, integrated aerodynamic coefficients, stability derivatives, generalized aerodynamic forces, and aerodynamic influence coefficient matrices. Optionally, modal data may be input on magnetic field (tape or disk), and certain geometric and aerodynamic output may be saved for subsequent use.

  13. Pilot Source Study 2015: US Regional Airline Pilot Hiring Background Characteristic Changes Consequent to Public Law 111-216 and the FAA First Officer Qualifications Rule

    Bjerke, Elizabeth; Smith, Guy; Smith, MaryJo; Christensen, Cody; Carney, Thomas; Craig, Paul; Niemczyk, Mary

    2016-01-01

    This report is the first article in a series called Pilot Source Study 2015. Public Law (PL) 111-216, passed by the US Congress in 2010, and the subsequent FAA Regulation, Pilot Certification and Qualification Requirements for Air Carrier Operations Rule, abruptly changed the pilot hiring situation for US air carriers operating under 14 CFR Part 121. PL 111-216 became effective on August 1, 2013; thereafter, pilots were not eligible to be first officers in Part 121 air carriers unless they we...

  14. Vadose Zone Contaminant Fate and Transport Analysis for the 216-B-26 Trench

    The BC Cribs and Trenches, part of the 200 TW 1 OU waste sites, received about 30 Mgal of scavenged tank waste, with possibly the largest inventory of 99Tc ever disposed to the soil at Hanford and site remediation is being accelerated. The purpose of this work was to develop a conceptual model for contaminant fate and transport at the 216-B-26 Trench site to support identification and development and evaluation of remediation alternatives. Large concentrations of 99Tc high above the water table implicated stratigraphy in the control of the downward migration. The current conceptual model accounts for small-scale stratigraphy; site-specific changes soil properties; tilted layers; and lateral spreading. It assumes the layers are spatially continuous causing water and solutes to move laterally across the boundary if conditions permit. Water influx at the surface is assumed to be steady. Model parameters were generated with pedotransfer functions; these were coupled high resolution neutron moisture logs that provided information on the underlying heterogeneity on a scale of 3 inches. Two approaches were used to evaluate the impact of remedial options on transport. In the first, a 1-D convolution solution to the convective-dispersive equation was used, assuming steady flow. This model was used to predict future movement of the existing plume using the mean and depth dependent moisture content. In the second approach, the STOMP model was used to first predict the current plume distribution followed by its future migration. Redistribution of the 99Tc plume was simulated for the no-action alternative and on-site capping. Hypothetical caps limiting recharge to 1.0, 0.5, and 0.1 mm yr-1 were considered and assumed not to degrade in the long term. Results show that arrival time of the MCLs, the peak arrival time, and the arrival time of the center of mass increased with decreasing recharge rate. The 1-D convolution model is easy to apply and can easily accommodate initial

  15. Vadose Zone Contaminant Fate and Transport Analysis for the 216-B-26 Trench

    Ward, Andy L.; Gee, Glendon W.; Zhang, Z. F.; Keller, Jason M.

    2004-10-14

    The BC Cribs and Trenches, part of the 200 TW 1 OU waste sites, received about 30 Mgal of scavenged tank waste, with possibly the largest inventory of 99Tc ever disposed to the soil at Hanford and site remediation is being accelerated. The purpose of this work was to develop a conceptual model for contaminant fate and transport at the 216-B-26 Trench site to support identification and development and evaluation of remediation alternatives. Large concentrations of 99Tc high above the water table implicated stratigraphy in the control of the downward migration. The current conceptual model accounts for small-scale stratigraphy; site-specific changes soil properties; tilted layers; and lateral spreading. It assumes the layers are spatially continuous causing water and solutes to move laterally across the boundary if conditions permit. Water influx at the surface is assumed to be steady. Model parameters were generated with pedotransfer functions; these were coupled high resolution neutron moisture logs that provided information on the underlying heterogeneity on a scale of 3 inches. Two approaches were used to evaluate the impact of remedial options on transport. In the first, a 1-D convolution solution to the convective-dispersive equation was used, assuming steady flow. This model was used to predict future movement of the existing plume using the mean and depth dependent moisture content. In the second approach, the STOMP model was used to first predict the current plume distribution followed by its future migration. Redistribution of the 99Tc plume was simulated for the no-action alternative and on-site capping. Hypothetical caps limiting recharge to 1.0, 0.5, and 0.1 mm yr-1 were considered and assumed not to degrade in the long term. Results show that arrival time of the MCLs, the peak arrival time, and the arrival time of the center of mass increased with decreasing recharge rate. The 1-D convolution model is easy to apply and can easily accommodate initial

  16. Carbon Tetrachloride Flow and Transport in the Subsurface of the 216-Z-18 Crib and 216-Z-1A Tile Field at the Hanford Site: Multifluid Flow Simulations and Conceptual Model Update

    Oostrom, Mart; Rockhold, Mark L.; Thorne, Paul D.; Last, George V.; Truex, Michael J.

    2006-10-31

    Carbon tetrachloride (CT) was discharged to the 216-Z-9, Z-1A, and Z-18 waste sites that are included in the 200-PW-1 Operable Unit in Hanford 200 West Area. Fluor Hanford, Inc. is conducting a Comprehensive Environmental Response, Compensation, and Liability Act (CERCLA) remedial investigation/feasibility study (RI/FS) for the 200-PW-1 Operable Unit. As part of this overall effort, Pacific Northwest National Laboratory (PNNL) was contracted to improve the conceptual model of how CT is distributed in the Hanford 200 West Area subsurface through use of numerical flow and transport modeling. This work supports the U.S. Department of Energy's (DOE's) efforts to characterize the nature and distribution of CT in the 200 West Area and subsequently select an appropriate final remedy.

  17. One Day Every 216 Years, Three Days Each Decan. Rebirth Cycle of Pythagoras, Phoenix, Hazon Gabriel, and Christian Dogma of Resurrection Can Be Explained by the Metonic Cycle

    Rothwangl, S.

    2009-08-01

    This article explains how the Metonic cycle is at the base of the period of 216 years Pythagoras believed in being reborn after that period. It shows how this period calendrically is related to other mythological worldviews such as the Phoenix myth, the Hebrean Hazon Gabriel, and the Christian dogma of resurrection on the third day.

  18. Carbon Tetrachloride Flow and Transport in the Subsurface of the 216-Z-9 Trench at the Hanford Site

    Oostrom, M.; Rockhold, M.; Truex, M.; Thorne, P.; Last, G.; Rohay, V.

    2006-12-01

    Three-dimensional modeling was conducted with layered and heterogeneous models to enhance the conceptual model of CT distribution in the vertical and lateral direction beneath the 216-Z-9 trench and to investigate the effects of soil vapor extraction (SVE). This work supports the U.S. Department of Energy's (DOE's) efforts to characterize the nature and distribution of CT in the 200 West Area and subsequently select an appropriate final remedy. Simulations targeted migration of dense, nonaqueous phase liquid (DNAPL) consisting of CT and co-disposed organics in the subsurface beneath the 216-Z-9 trench as a function of the properties and distribution of subsurface sediments and of the properties and disposal history of the waste. Simulations of CT migration were conducted using the Subsurface Transport Over Multiple Phases (STOMP) simulator. Simulation results support a conceptual model for CT distribution where CT in the DNAPL phase is expected to have migrated primarily in a vertical direction below the disposal trench. Presence of small-scale heterogeneities tends to limit the extent of vertical migration of CT DNAPL due to enhanced retention of DNAPL compared to more homogeneous conditions, but migration is still predominantly in the vertical direction. Results also show that the Cold Creek units retain more CT DNAPL within the vadose zone than other hydrologic unit during SVE. A considerable amount of the disposed CT DNAPL may have partitioned to the vapor and subsequently water and sorbed phases. Presence of small-scale heterogeneities tends to increase the amount of volatilization. Any continued migration of CT from the vadose zone to the groundwater is likely through interaction of vapor phase CT with the groundwater and not through continued DNAPL migration. The results indicated that SVE appears to be an effective technology for vadose zone remediation, but additional effort is needed to improve simulation of the SVE process.

  19. Percutaneous Laser Disc Decompression for Lumbar Disc Retrospective Analysis: Report of 216 Cases%经皮激光减压术治疗腰椎间盘突出症216

    赵继荣; 朱换平; 陈文

    2011-01-01

    Objective To observe the therapeutic effect of percutaneous laser disc decompression on lumbar disc herniation.Methods 216 cases of lumbar discherniation were treated by percutaneous laser disc decompression therapy, and were followed up for 1 week, three months, one year and three years respectirely to assess the efficacy.Results The efficient and excellent rates were 56.9% and 93.1%, 80.8% and 95.3%, 83.4% and 94.5%, 82.8% and 93.8%.7 days, 3 months, 1 year and 3 years after operation, respectively.The disease was in a recovery stage within the first year after operation and become stable then.Conclusions Percutaneous laser disc decompression in effective for treatment of disc herniation with less complications and its longterm effects is better the short-term effect.%目的 观察经皮激光减压术治疗腰椎间盘突出症的疗效.方法 对符合纳入标准的216例腰椎间盘突出症患者应用经皮激光间盘气化减压术治疗,分别于术后1周、3个月、1和3年进行随访,评定疗效.结果 有效率、优良率术后3d分别为56.9%、93.1%;术后3个月分别为80.8%、95.3%;术后1年分别为83.4%、94.5%;术后3年分别为82.8%、93.8%.术后1年内处于病情恢复阶段,1年后疗效稳定.结论 经皮激光气化减压术治疗椎间盘突出症疗效确切、并发症少,远期效果好于近期效果.

  20. Structural Characterization of the 216-Z-9 Crib Prior to Decontamination and Demolition Using Robot Crawler and High Resolution Photography

    The Department of Energy, Richland Operations Office is preparing to conduct a Comprehensive Environmental Response, Compensation, and Liability Act (CERCLA) removal action for the decontamination and demolition of the above-grade mining structures and equipment at the 216-Z-9 Crib. An investigation of the condition of the mining complex was initiated to determine constraints necessary for safely conducting the removal of the buildings. While crib headspace chemical analysis and nondestructive analysis of the interior of the buildings was completed to address radiological contamination concerns, the primary concern regarding the removal of the above-grade structures located on the crib cover involves determining the loading capacity and structural integrity of the crib cover slab. Additional concerns included headspace gases and radionuclide contamination. Until the structural analysis was completed, loading limits on the crib cover had been restricted. Photographic documentation revealed the loss of protective tiles and acid resistant coating from the underside of the cover raising a question of concrete stability. The investigation relied heavily on the use of high resolution photography with high intensity lighting for photographic documentation of the underside of the crib cover, followed by structural analysis of the documentation by a team of qualified engineers. Deployment of a robot crawler with attached camera and positioning of a fixed camera were integral to this structural characterization effort. Results of the photographic documentation were of sufficient quality to allow for bounding decisions to be made regarding the loading of the crib cover while performing the demolition of the mining structures (glovebox, excavator, bucket) and the associated buildings. The 216-Z-9 Crib, also known as the 216 Z-9 Recuplex CAW (CA column waste) Waste Disposal Cavern, the Z-9 Trench and the Z-9 Crib was constructed as an engineered trench with an open area beneath

  1. AB088. The application of vesiculoscopy in the patients of hematospermia and ejaculatory duct obstruction (216 cases report)

    Li, Yan-Feng; Liao, Liang-Gong

    2016-01-01

    Objective To evaluate the clinical effects of the vesiculoscopy and related endoscopic technique on the treatment of ejaculatory duct obstruction (EDO) and severe, persistent hematospermia in cases that were refractory to conservative treatments by retrospectively analyzing the clinical data of the patients treated in our hospital. Methods Clinical data from 216 patients with persistent and refractory hematospermia or EDO in our hospital since Jan. 2009 to May. 2015 was retrospectively analyzed. Data collected included history, symptoms, as well as ultrasound and MRI of the morphological features of the bilateral seminal vesicles (SV) and ejaculatory duct (ED) areas. Seminal vesiculoscopy and /or transurethral resection of the ejaculatory duct (TURED) or other related procedure were performed according to individual situation. The effects of endoscopic treatment on the refractory haematospermia and EDO were followed up. Results The age range of the patients was 21–80 years (mean, 43.2 years). The history of hematospermia lasted for 6 to 120 months (mean, 35.2 months). The operations include: (I) seminal vesiculoscopy + seminal vesicle irrigation; (II) transurethral resection of the cysts in ED area and fulguration of the cyst wall; (III) lithotripsy and/or removing stones of seminal duct; (IV) fulguration of the abnormal blood vessels at posterior urethra; (V) TURED. The operation time ranged from 20 to 65 min (mean, 33 min). The seminal vesiculoscopy and related procedure were successfully performed in 211 patients, and were failed to perform in 5 patients because of the atrophy or abnormal anatomy of the seminal vesicles. 27.3% (59/216) of the patients had cysts in the ED area and 12.5% (27/216) had stone or calcification in the SV, ED or utricular cyst. 204 patients were followed up for 3–72 months (mean, 35 months). The hematospermia of all the patients were disappeared within 2–6 weeks and 94.6% (193/204) of the patients did not appear the haematospermia

  2. Conformational alterations induced by novel green 16-E2-16 gemini surfactant in xanthine oxidase: Biophysical insights from tensiometry, spectroscopy, microscopy and molecular modeling.

    Akram, Mohd; Bhat, Imtiyaz Ahmad; Bhat, Waseem Feeroze; Kabir-ud-Din

    2015-11-01

    Herein we report the interaction of a biodegradable gemini surfactant, ethane-1,2-diyl bis(N,N-dimethyl-N-hexadecylammoniumacetoxy) dichloride (16-E2-16) with bovine milk xanthine oxidase (XO), employing tensiometry, fluorescence spectroscopy, UV spectroscopy, far-UV circular dichroism spectroscopy (CD), Fourier transform infrared (FT-IR) spectroscopy, scanning electron microscopy (SEM), transmission electron microscopy (TEM), and computational molecular modeling. Surface tension results depict substantial changes in the micellar as well as interfacial parameters (CMC, ΠCMC, γCMC, Γmax, Amin, ΔGmic° and ΔGads°) of 16-E2-16 gemini surfactant upon XO combination, deciphering the interaction of XO with the gemini surfactant. Fluorescence measurements reveal that 16-E2-16 gemini surfactant causes quenching in the xanthine oxidase (XO) fluorescence spectra via static procedure and the values of various evaluated binding parameters (KSV, Kb, kq, ΔGb° and n) describe that 16-E2-16 effectively binds to XO. Three dimensional fluorescence, 8-anilino-1-naphthalene sulfonic acid (ANS) binding, F1F3 ratio, UV, CD, FTIR, SEM and TEM results delineate changes in the secondary structure of xanthine oxidase. Molecular docking results provide complement to the steady-state fluorescence findings and support the view that quenching occurs due to non-polar environment experienced by aromatic residues of the enzyme. The results of this study can help scientists to tune the conformation of an enzyme (XO) with biocompatible amphiphilic microstructures, which will help to unfold further understanding in the treatment modes of various diseases like gout, hyperuricemia, liver and brain necrosis. PMID:26057098

  3. Expand MILES spectral library for LAMOST stellar parameter determination using Chinese 2.4 and 2.16 metereter telescopes

    Wang, Chun; Liu, Xiaowei; Huang, Yang; Zuo, Fang; Yuan, Haibo; Ren, Juanjuan; Chen, Bingqiu; Xiang, Maosheng; Zhang, Huawei; Luo, Ali; Shi, Jianrong

    2015-08-01

    We present a new medium resolution (full width at half-maximum FWHM ~ 2.4 Å) spectral library containing 1903 stellar spectra with a wavelength coverage of 3800-9000 Å based on MILES spectral library which contains 985 blue arm spectra with wavelength coverage of 3500-7500 Å at a spectral resolution of 2.5 Å (FWHM). The spectra are observed with Chinese Xinglong 2.16 meter telescope of blue arm spectra (with wavelength coverage 3800-5180 Å ) and Gaomeigu 2.4 meter telescope of red arm spectra (with wavelength coverage 5150-9000 Å ), respectively. This new library aims to improve the stellar atmospheric parameters determination accuracy of LAMOST Stellar Parameter Pipeline at Peking University (LSP3) and minimize the limitation of LSP3 . It also could be used in the spectral synthesis of stellar populations of galaxies and many other astronomical fields. Now 560 blue arm and 496 red arm spectra have been observed and reduced. The accuracy of wavelength-calibration and flux-calibration are better than ~ 0.3 Å and ~ 5 per cent, respectively. The mean signal to noise ratios of all spectra are almost larger than 100 per Å.

  4. High-resolution FUSE and HST ultraviolet spectroscopy of the white dwarf central star of Sh 2-216

    Rauch, T; Werner, K; Kruk, J W; Oliveira, C M; Putte, D Vande; Mignani, R P; Kerber, F

    2007-01-01

    LS V +4621 is the DAO-type central star of the planetary nebula Sh 2-216. We perform a comprehensive spectral analysis of high-resolution, high-S/N ultraviolet observations obtained with FUSE and STIS aboard the HST as well as the optical spectrum of LS V +4621 by means of state-of-the-art NLTE model-atmosphere techniques in order to compare its photospheric properties to theoretical predictions from stellar evolution theory as well as from diffusion calculations. From the N IV - NV, O IV - O VI, Si IV - Si V, and Fe V - Fe VII ionization equilibria, we determined an effective temperature of 95 +/- 2 kK with high precision. The surface gravity is log g = 6.9 +/- 0.2. An unexplained discrepancy appears between the spectroscopic distance d = 224 +46/-58 pc and the parallax distance d = 129 +6/-5 pc of LS V +4621. For the first time, we have identified Mg IV and Ar VI absorption lines in the spectrum of a hydrogen-rich central star and determined the Mg and Ar abundances as well as the individual abundances of i...

  5. A simulation study of the performance of the NASA (2,1,6) convolutional code on RFI/burst channels

    Perez, Lance C.; Costello, Daniel J., Jr.

    1993-01-01

    In an earlier report, the LINKABIT Corporation studied the performance of the (2,1,6) convolutional code on the radio frequency interference (RFI)/burst channel using analytical methods. Using an R(sub 0) analysis, the report concluded that channel interleaving was essential to achieving reliable performance. In this report, Monte Carlo simulation techniques are used to study the performance of the convolutional code on the RFI/burst channel in more depth. The basic system model under consideration is shown. The convolutional code is the NASA standard code with generators g(exp 1) = 1+D(exp 2)+D(exp 3)+D(exp 5)+D(exp 6) and g(exp 2) = 1+D+D(exp 2)+D(exp 3)+D(exp 6) and d(sub free) = 10. The channel interleaver is of the convolutional or periodic type. The binary output of the channel interleaver is transmitted across the channel using binary phase shift keying (BPSK) modulation. The transmitted symbols are corrupted by an RFI/burst channel consisting of a combination of additive white Gaussian noise (AWGN) and RFI pulses. At the receiver, a soft-decision Viterbi decoder with no quantization and variable truncation length is used to decode the deinterleaved sequence.

  6. Influence of intermartensitic transitions on transport properties of Ni$_{2.16}Mn_{0.84}$Ga alloy

    Khovailo, V V; Wedel, C; Takagi, T; Abe, T; Sugiyama, K

    2004-01-01

    Magnetic, transport, and x-ray diffraction measurements of ferromagnetic shape memory alloy Ni$_{2.16}$Mn$_{0.84}$Ga revealed that this alloy undergoes an intermartensitic transition upon cooling, whereas no such a transition is observed upon subsequent heating. The difference in the modulation of the martensite forming upon cooling from the high-temperature austenitic state [5-layered (5M) martensite], and the martensite forming upon the intermartensitic transition [7-layered (7M) martensite] strongly affects the magnetic and transport properties of the alloy and results in a large thermal hysteresis of the resistivity $\\rho$ and magnetization $M$. The intermartensitic transition has an especially marked influence on the transport properties, as is evident from a large difference in the resistivity of the 5M and 7M martensite, $(\\rho_{\\mathrm{5M}} - \\rho_{\\mathrm{7M}})/\\rho _{\\mathrm{5M}} \\approx 15%$, which is larger than the jump of resistivity at the martensitic transition from the cubic austenitic phase ...

  7. Kinetics of radiolabelled (99mTc) heparin and low molecular weight heparin fractions CY 216, CY 222 in patients with uncomplicated myocardial infarction

    Kinetics of plasmatic disappearance of 99mTc-heparin and low molecular weight heparin (LMWH) fractions CY 216 and CY 222 were compared in 2 women and 8 men (aged 50-71) with uncomplicated myocardial infarction. The three technetiated heparins were consecutively injected intravenously (67 nanomoles) to each of 10 patients, at intervals of 3-5 days, 14-28 days after acute cardiac onset. The plasma radioactivity was counted in blood samples collected within a period of 5 h. 99mTc-heparin and LMWH fractions CY 216, CY 222 disappeared from plasma following a biexponential clearance curve with a fast and slow component reflecting the biodistribution (α) and elimination (β) phase. The bioavailability values as well as distribution and elimination rates were similar for all three technetiated heparins. The bulk of injected 99mTc-heparin or LMWH fraction was rapidly distributed to the tissue compartment, whereas the radiocomplex remaining in the circulation was slowly eliminated with a half-time of an average 320 min. Radioactivity eliminated from plasma was only partially (30-50%) excreted in the urine. The results indicate that after a low-dose intravenous administration LMWH fractions CY 216 and CY 222 maintain the pharmacokinetic properties of standard heparin, especially the rapid distribution to the tissue compartment. (author)

  8. Regular in situ measurements of HDO/H216O in the northern and southern hemispherical upper troposphere reveal tropospheric transport processes.

    Christner, Emanuel; Dyroff, Christoph; Sanati, Shahrokh; Brenninkmeijer, Carl; Zahn, Andreas

    2013-04-01

    Atmospheric water in form of water vapor and clouds is an enormously crucial trace species. It is responsible for ~70 % of the natural greenhouse effect (Schmidt et al., JGR, 2010), carries huge amounts of latent heat, and is the major source of OH in the troposphere. The isotopic composition of water vapor is an elegant tracer for a better understanding and quantification of the extremely complex and variable hydrological cycle in Earth's atmosphere (evaporation, cloud condensation, rainout, re-evaporation, snow), which in turn is a prerequisite to improve climate modeling and predictions. In this context, water-isotopologues (here the isotope ratio HDO/H216O) can be used to study the atmospheric transport of water and in-cloud processes. As H216O and HDO differ in vapor pressure and molecular diffusion, fractionation occurs during condensation and rainout events. For that reason the ratio HDO/H216O preserves information about the transport and condensation history of an air mass. The tunable diode-laser absorption spectrometer ISOWAT was developed for airborne measurements of the water-isotopologue concentrations of H216O and HDO, probing fundamental rovibrational water-absorption lines at around 2.66 μm. Since April 2010 the spectrometer is regularly operated aboard the CARIBIC passenger aircraft (Civil Aircraft for the Regular Investigation of the atmosphere Based on an Instrument Container - Lufthansa, Airbus 340-600), which measures ~100 trace gases and aerosol components in the UTLS (9-12 km altitude) on four long-distance flights per month. During several flights across the equator (Africa) or close to the equator (Venezuela and Malaysia) an increase of HDO/H216O from the subtropics towards the tropics was measured (by more than 100 permil) at an altitude of ~12 km. This isotopic gradient can partly be attributed to differences in humidity. In addition there is a humidity independent latitudinal gradient (by more than 50 permil), revealing the strong

  9. Advanced Hodgkin's lymphoma: results in 216 patients treated with ABVD in Brazil Linfoma de Hodgkin em estádio avançado: resultados do tratamento em 216 pacientes tratados com ABVD no Brasil

    Luciana Britto

    2010-01-01

    Full Text Available The outcome of Hodgkin's lymphoma (HL has markedly improved over the last few decades, placing HL among the human cancers with highest cure rates. However, data about treatment outcomes in developing countries are scarce. From 1996 to 2005, 370 consecutive patients with HL treated in three public institutions in Rio de Janeiro were identified. A total of 216 patients who presented with advanced stage (IIB-IV HL were selected for the present analysis. Patients with advanced disease were treated with ABVD, complemented or not by radiation therapy. The median follow-up time of survivors was 6.3 years (1-11.8. Fifteen patients died during first-line treatment. The complete remission rate was 80%. The 5-year progression-free survival (PFS and the 5-year overall survival (OS probabilities were 69% and 83%, respectively. The 5-year PFS in low-risk and high-risk patients were 81% and 62% (p=0.003, respectively. The 5-year OS in low-risk and high-risk International Prognostic Score patients were 89% and 78% (p=0.02, respectively. The present study provides a representative estimate of current treatment results for advanced HL in public institutions in an urban area in Brazil. It is clear that full treatment can be given to most patients, although those with very low socio-economic status might require special attention and support. Since Brazil is a large country, with substantial interregional heterogeneity, a nationwide registry of HL patients is currently being implemented.Os resultados do tratamento do linfoma de Hodgkin (LH melhoraram substancialmente ao longo das últimas décadas e tornaram o LH uma das neoplasias humanas com maior chance de cura. Entretanto, os dados sobre tratamento em países em desenvolvimento são escassos. Entre 1996 e 2005, 370 pacientes consecutivos com LH tratados em três instituições públicas no Rio de Janeiro foram identificados. Destes, 216 em estádio avançado (IIB-IV foram selecionados para esta análise. Os

  10. XMM-NEWTON OBSERVATIONS OF THE TeV γ-RAY SOURCE HESS J1804-216

    We have analyzed three XMM-Newton observations of the central part of the unidentified TeV γ-ray source HESS J1804-216. We focus on two X-ray sources, 2XMMi J180442.0-214221 (Src 1) and 2XMMi J180432.5-214009 (Src 2), which were suggested to be the possible X-ray counterparts to the TeV source. We discover a 2.93 hr X-ray periodicity from Src 1, with the pulse profile explained with a self-eclipsing pole in an eclipsing polar. Src 2 exhibits a strong Fe emission line (FWHM ∼ 0.3 keV and equivalent width ∼0.8 keV) and large X-ray variability on timescales of hours and is probably an intermediate polar. Thus Src 1 and Src 2 are probably two field sources not responsible for the TeV emission. The observations were contaminated by strong stray light from a nearby bright source, and we see no clear extended X-ray emission that can be attributed to the supernova remnant G8.7-0.1, a popular possible association with the TeV source. The other possible association, the pulsar wind nebula candidate PSR J1803-2137, shows little long-term variability compared with a previous Chandra observation. Many point sources were serendipitously detected, but most of them are probably normal stars. Three new candidate compact object systems (other than Src 1, Src 2, and PSR J1803-2137) are also found. They are far away from the TeV source and are probably also magnetic cataclysmic variables, thus unlikely to be responsible for the TeV emission.