WorldWideScience

Sample records for acid sequences visualized

  1. ANTICALIgN: visualizing, editing and analyzing combined nucleotide and amino acid sequence alignments for combinatorial protein engineering.

    Jarasch, Alexander; Kopp, Melanie; Eggenstein, Evelyn; Richter, Antonia; Gebauer, Michaela; Skerra, Arne

    2016-07-01

    ANTIC ALIGN: is an interactive software developed to simultaneously visualize, analyze and modify alignments of DNA and/or protein sequences that arise during combinatorial protein engineering, design and selection. ANTIC ALIGN: combines powerful functions known from currently available sequence analysis tools with unique features for protein engineering, in particular the possibility to display and manipulate nucleotide sequences and their translated amino acid sequences at the same time. ANTIC ALIGN: offers both template-based multiple sequence alignment (MSA), using the unmutated protein as reference, and conventional global alignment, to compare sequences that share an evolutionary relationship. The application of similarity-based clustering algorithms facilitates the identification of duplicates or of conserved sequence features among a set of selected clones. Imported nucleotide sequences from DNA sequence analysis are automatically translated into the corresponding amino acid sequences and displayed, offering numerous options for selecting reading frames, highlighting of sequence features and graphical layout of the MSA. The MSA complexity can be reduced by hiding the conserved nucleotide and/or amino acid residues, thus putting emphasis on the relevant mutated positions. ANTIC ALIGN: is also able to handle suppressed stop codons or even to incorporate non-natural amino acids into a coding sequence. We demonstrate crucial functions of ANTIC ALIGN: in an example of Anticalins selected from a lipocalin random library against the fibronectin extradomain B (ED-B), an established marker of tumor vasculature. Apart from engineered protein scaffolds, ANTIC ALIGN: provides a powerful tool in the area of antibody engineering and for directed enzyme evolution. PMID:27261456

  2. Seq2Logo: a method for construction and visualization of amino acid binding motifs and sequence profiles including sequence weighting, pseudo counts and two-sided representation of amino acid enrichment and depletion

    Thomsen, Martin Christen Frølund; Nielsen, Morten

    2012-01-01

    Seq2Logo is a web-based sequence logo generator. Sequence logos are a graphical representation of the information content stored in a multiple sequence alignment (MSA) and provide a compact and highly intuitive representation of the position-specific amino acid composition of binding motifs, active...... sites, etc. in biological sequences. Accurate generation of sequence logos is often compromised by sequence redundancy and low number of observations. Moreover, most methods available for sequence logo generation focus on displaying the position-specific enrichment of amino acids, discarding the equally...... valuable information related to amino acid depletion. Seq2logo aims at resolving these issues allowing the user to include sequence weighting to correct for data redundancy, pseudo counts to correct for low number of observations and different logotype representations each capturing different aspects...

  3. Locomotor sequence learning in visually guided walking

    Choi, Julia T; Jensen, Peter; Nielsen, Jens Bo

    2016-01-01

    Voluntary limb modifications must be integrated with basic walking patterns during visually guided walking. Here we tested whether voluntary gait modifications can become more automatic with practice. We challenged walking control by presenting visual stepping targets that instructed subjects to...... modify step length from one trial to the next. Our sequence learning paradigm is derived from the serial reaction-time (SRT) task that has been used in upper limb studies. Both random and ordered sequences of step lengths were used to measure sequence-specific and sequence non-specific learning during...... walking. In addition, we determined how age (i.e., healthy young adults vs. children) and biomechanical factors (i.e., walking speed) affected the rate and magnitude of locomotor sequence learning. The results showed that healthy young adults (age 24 ± 5 years, N = 20) could learn a specific sequence of...

  4. MatrixPlot: visualizing sequence constraints

    Gorodkin, Jan; Stærfeldt, Hans Henrik; Lund, Ole;

    1999-01-01

    MatrixPlot: visualizing sequence constraints. Sub-title Abstract Summary : MatrixPlot is a program for making high-quality matrix plots, such as mutual information plots of sequence alignments and distance matrices of sequences with known three-dimensional coordinates. The user can add information...... about the sequences (e.g. a sequence logo profile) along the edges of the plot, as well as zoom in on any region in the plot. Availability : MatrixPlot can be obtained on request, and can also be accessed online at http://www. cbs.dtu.dk/services/MatrixPlot. Contact : gorodkin@cbs.dtu.dk...

  5. Robot Sequencing and Visualization Program (RSVP)

    Cooper, Brian K.; Maxwell,Scott A.; Hartman, Frank R.; Wright, John R.; Yen, Jeng; Toole, Nicholas T.; Gorjian, Zareh; Morrison, Jack C

    2013-01-01

    The Robot Sequencing and Visualization Program (RSVP) is being used in the Mars Science Laboratory (MSL) mission for downlink data visualization and command sequence generation. RSVP reads and writes downlink data products from the operations data server (ODS) and writes uplink data products to the ODS. The primary users of RSVP are members of the Rover Planner team (part of the Integrated Planning and Execution Team (IPE)), who use it to perform traversability/articulation analyses, take activity plan input from the Science and Mission Planning teams, and create a set of rover sequences to be sent to the rover every sol. The primary inputs to RSVP are downlink data products and activity plans in the ODS database. The primary outputs are command sequences to be placed in the ODS for further processing prior to uplink to each rover. RSVP is composed of two main subsystems. The first, called the Robot Sequence Editor (RoSE), understands the MSL activity and command dictionaries and takes care of converting incoming activity level inputs into command sequences. The Rover Planners use the RoSE component of RSVP to put together command sequences and to view and manage command level resources like time, power, temperature, etc. (via a transparent realtime connection to SEQGEN). The second component of RSVP is called HyperDrive, a set of high-fidelity computer graphics displays of the Martian surface in 3D and in stereo. The Rover Planners can explore the environment around the rover, create commands related to motion of all kinds, and see the simulated result of those commands via its underlying tight coupling with flight navigation, motor, and arm software. This software is the evolutionary replacement for the Rover Sequencing and Visualization software used to create command sequences (and visualize the Martian surface) for the Mars Exploration Rover mission.

  6. Coding visual features extracted from video sequences.

    Baroffio, Luca; Cesana, Matteo; Redondi, Alessandro; Tagliasacchi, Marco; Tubaro, Stefano

    2014-05-01

    Visual features are successfully exploited in several applications (e.g., visual search, object recognition and tracking, etc.) due to their ability to efficiently represent image content. Several visual analysis tasks require features to be transmitted over a bandwidth-limited network, thus calling for coding techniques to reduce the required bit budget, while attaining a target level of efficiency. In this paper, we propose, for the first time, a coding architecture designed for local features (e.g., SIFT, SURF) extracted from video sequences. To achieve high coding efficiency, we exploit both spatial and temporal redundancy by means of intraframe and interframe coding modes. In addition, we propose a coding mode decision based on rate-distortion optimization. The proposed coding scheme can be conveniently adopted to implement the analyze-then-compress (ATC) paradigm in the context of visual sensor networks. That is, sets of visual features are extracted from video frames, encoded at remote nodes, and finally transmitted to a central controller that performs visual analysis. This is in contrast to the traditional compress-then-analyze (CTA) paradigm, in which video sequences acquired at a node are compressed and then sent to a central unit for further processing. In this paper, we compare these coding paradigms using metrics that are routinely adopted to evaluate the suitability of visual features in the context of content-based retrieval, object recognition, and tracking. Experimental results demonstrate that, thanks to the significant coding gains achieved by the proposed coding scheme, ATC outperforms CTA with respect to all evaluation metrics. PMID:24818244

  7. Temporal integration windows for naturalistic visual sequences.

    Scott L Fairhall

    Full Text Available There is increasing evidence that the brain possesses mechanisms to integrate incoming sensory information as it unfolds over time-periods of 2-3 seconds. The ubiquity of this mechanism across modalities, tasks, perception and production has led to the proposal that it may underlie our experience of the subjective present. A critical test of this claim is that this phenomenon should be apparent in naturalistic visual experiences. We tested this using movie-clips as a surrogate for our day-to-day experience, temporally scrambling them to require (re- integration within and beyond the hypothesized 2-3 second interval. Two independent experiments demonstrate a step-wise increase in the difficulty to follow stimuli at the hypothesized 2-3 second scrambling condition. Moreover, only this difference could not be accounted for by low-level visual properties. This provides the first evidence that this 2-3 second integration window extends to complex, naturalistic visual sequences more consistent with our experience of the subjective present.

  8. Visualization of the sequence of a couple splitting outside shop

    2015-01-01

    Visualization of tracks of couple walking together before splitting and one goes into shop the other waits outside. The visualization represents the sequence described in figure 7 in the publication 'Taking the temperature of pedestrian movement in public spaces'...

  9. Nucleic acid visualization with UCSF Chimera

    Couch, Gregory S.; Hendrix, Donna K.; Ferrin, Thomas E.

    2006-01-01

    With the increase in the number of large, 3D, high-resolution nucleic acid structures, particularly of the 30S and 50S ribosomal subunits and the intact bacterial ribosome, advancements in the visualization of nucleic acid structural features are essential. Large molecular structures are complicated and detailed, and one goal of visualization software is to allow the user to simplify the display of some features and accent others. We describe an extension to the UCSF Chimera molecular visuali...

  10. Chip-based sequencing nucleic acids

    Beer, Neil Reginald

    2014-08-26

    A system for fast DNA sequencing by amplification of genetic material within microreactors, denaturing, demulsifying, and then sequencing the material, while retaining it in a PCR/sequencing zone by a magnetic field. One embodiment includes sequencing nucleic acids on a microchip that includes a microchannel flow channel in the microchip. The nucleic acids are isolated and hybridized to magnetic nanoparticles or to magnetic polystyrene-coated beads. Microreactor droplets are formed in the microchannel flow channel. The microreactor droplets containing the nucleic acids and the magnetic nanoparticles are retained in a magnetic trap in the microchannel flow channel and sequenced.

  11. Enhanced learning of natural visual sequences in newborn chicks.

    Wood, Justin N; Prasad, Aditya; Goldman, Jason G; Wood, Samantha M W

    2016-07-01

    To what extent are newborn brains designed to operate over natural visual input? To address this question, we used a high-throughput controlled-rearing method to examine whether newborn chicks (Gallus gallus) show enhanced learning of natural visual sequences at the onset of vision. We took the same set of images and grouped them into either natural sequences (i.e., sequences showing different viewpoints of the same real-world object) or unnatural sequences (i.e., sequences showing different images of different real-world objects). When raised in virtual worlds containing natural sequences, newborn chicks developed the ability to recognize familiar images of objects. Conversely, when raised in virtual worlds containing unnatural sequences, newborn chicks' object recognition abilities were severely impaired. In fact, the majority of the chicks raised with the unnatural sequences failed to recognize familiar images of objects despite acquiring over 100 h of visual experience with those images. Thus, newborn chicks show enhanced learning of natural visual sequences at the onset of vision. These results indicate that newborn brains are designed to operate over natural visual input. PMID:27079969

  12. BlockLogo: visualization of peptide and sequence motif conservation.

    Olsen, Lars Rønn; Kudahl, Ulrich Johan; Simon, Christian; Sun, Jing; Schönbach, Christian; Reinherz, Ellis L; Zhang, Guang Lan; Brusic, Vladimir

    2013-12-31

    BlockLogo is a web-server application for the visualization of protein and nucleotide fragments, continuous protein sequence motifs, and discontinuous sequence motifs using calculation of block entropy from multiple sequence alignments. The user input consists of a multiple sequence alignment, selection of motif positions, type of sequence, and output format definition. The output has BlockLogo along with the sequence logo, and a table of motif frequencies. We deployed BlockLogo as an online application and have demonstrated its utility through examples that show visualization of T-cell epitopes and B-cell epitopes (both continuous and discontinuous). Our additional example shows a visualization and analysis of structural motifs that determine the specificity of peptide binding to HLA-DR molecules. The BlockLogo server also employs selected experimentally validated prediction algorithms to enable on-the-fly prediction of MHC binding affinity to 15 common HLA class I and class II alleles as well as visual analysis of discontinuous epitopes from multiple sequence alignments. It enables the visualization and analysis of structural and functional motifs that are usually described as regular expressions. It provides a compact view of discontinuous motifs composed of distant positions within biological sequences. BlockLogo is available at: http://research4.dfci.harvard.edu/cvc/blocklogo/ and http://met-hilab.bu.edu/blocklogo/. PMID:24001880

  13. Visually lossless compression of digital hologram sequences

    Darakis E.; Kowiel M.; Nasanen R.; Naughton T.J.

    2010-01-01

    Digital hologram sequences have great potential for the recording of 3D scenes of moving macroscopic objects as their numerical reconstruction can yield a range of perspective views of the scene. Digital holograms inherently have large information content and lossless coding of holographic data is rather inefficient due to the speckled nature of the interference fringes they contain. Lossy coding of still holograms and hologram sequences has shown promising results. By definition,...

  14. Programming Using Visual Basic for Nucleic Acid Sequences Analysis%Visual BASIC编程在核酸序列分析中的应用研究初探

    葛威; 鲍大鹏; 董战峰; 施铮

    2004-01-01

    利用可视化的编程语言Visual BASIC编写了一个简易实用的核酸序列分析程序,能够自动实现对已知核酸序列的分子质量、Tm值、碱基组成的测定、各种核酸序列的转换和氨基酸序列的推导.同时也详细描述了核酸序列自动分析各功能实现的Visual BASIC语言编程过程.

  15. BlockLogo: Visualization of peptide and sequence motif conservation

    Olsen, Lars Rønn; Kudahl, Ulrich Johan; Simon, Christian;

    2013-01-01

    , selection of motif positions, type of sequence, and output format definition. The output has BlockLogo along with the sequence logo, and a table of motif frequencies. We deployed BlockLogo as an online application and have demonstrated its utility through examples that show visualization of T-cell epitopes...... and B-cell epitopes (both continuous and discontinuous). Our additional example shows a visualization and analysis of structural motifs that determine the specificity of peptide binding to HLA-DR molecules. The BlockLogo server also employs selected experimentally validated prediction algorithms to...... enable on-the-fly prediction of MHC binding affinity to 15 common HLA class I and class II alleles as well as visual analysis of discontinuous epitopes from multiple sequence alignments. It enables the visualization and analysis of structural and functional motifs that are usually described as regular...

  16. Visualizing and Clustering Protein Similarity Networks: Sequences, Structures, and Functions.

    Mai, Te-Lun; Hu, Geng-Ming; Chen, Chi-Ming

    2016-07-01

    Research in the recent decade has demonstrated the usefulness of protein network knowledge in furthering the study of molecular evolution of proteins, understanding the robustness of cells to perturbation, and annotating new protein functions. In this study, we aimed to provide a general clustering approach to visualize the sequence-structure-function relationship of protein networks, and investigate possible causes for inconsistency in the protein classifications based on sequences, structures, and functions. Such visualization of protein networks could facilitate our understanding of the overall relationship among proteins and help researchers comprehend various protein databases. As a demonstration, we clustered 1437 enzymes by their sequences and structures using the minimum span clustering (MSC) method. The general structure of this protein network was delineated at two clustering resolutions, and the second level MSC clustering was found to be highly similar to existing enzyme classifications. The clustering of these enzymes based on sequence, structure, and function information is consistent with each other. For proteases, the Jaccard's similarity coefficient is 0.86 between sequence and function classifications, 0.82 between sequence and structure classifications, and 0.78 between structure and function classifications. From our clustering results, we discussed possible examples of divergent evolution and convergent evolution of enzymes. Our clustering approach provides a panoramic view of the sequence-structure-function network of proteins, helps visualize the relation between related proteins intuitively, and is useful in predicting the structure and function of newly determined protein sequences. PMID:27267620

  17. ProSAT+: visualizing sequence annotations on 3D structure.

    Stank, Antonia; Richter, Stefan; Wade, Rebecca C

    2016-08-01

    PRO: tein S: tructure A: nnotation T: ool-plus (ProSAT(+)) is a new web server for mapping protein sequence annotations onto a protein structure and visualizing them simultaneously with the structure. ProSAT(+) incorporates many of the features of the preceding ProSAT and ProSAT2 tools but also provides new options for the visualization and sharing of protein annotations. Data are extracted from the UniProt KnowledgeBase, the RCSB PDB and the PDBe SIFTS resource, and visualization is performed using JSmol. User-defined sequence annotations can be added directly to the URL, thus enabling visualization and easy data sharing. ProSAT(+) is available at http://prosat.h-its.org. PMID:27284084

  18. Comparative Amino Acid Sequences of Dengue Viruses

    Haishi, Shozo; TANAKA Mariko; Igarashi, Akira

    1990-01-01

    Amino acid (AA) sequences of 4 serotype of dengue viruses deduced from their nucleotide (nt) sequences of genomic RNA were analyzed for each genome segment and each stretch of 10 AA residues. Precursor of membrane protein (pM), and 4 nonstructural proteins (NS1, NS3, NS4B, NS5) were highly conserved, while another nonstructural protein (NS2A) was least conserved among 5 strains of dengue viruses. When homology was compared among heterotypic viruses, type 1 and type 3 dengue viruses showed clo...

  19. Phylo-mLogo: an interactive and hierarchical multiple-logo visualization tool for alignment of many sequences

    Lee DT

    2007-02-01

    Full Text Available Abstract Background When aligning several hundreds or thousands of sequences, such as epidemic virus sequences or homologous/orthologous sequences of some big gene families, to reconstruct the epidemiological history or their phylogenies, how to analyze and visualize the alignment results of many sequences has become a new challenge for computational biologists. Although there are several tools available for visualization of very long sequence alignments, few of them are applicable to the alignments of many sequences. Results A multiple-logo alignment visualization tool, called Phylo-mLogo, is presented in this paper. Phylo-mLogo calculates the variabilities and homogeneities of alignment sequences by base frequencies or entropies. Different from the traditional representations of sequence logos, Phylo-mLogo not only displays the global logo patterns of the whole alignment of multiple sequences, but also demonstrates their local homologous logos for each clade hierarchically. In addition, Phylo-mLogo also allows the user to focus only on the analysis of some important, structurally or functionally constrained sites in the alignment selected by the user or by built-in automatic calculation. Conclusion With Phylo-mLogo, the user can symbolically and hierarchically visualize hundreds of aligned sequences simultaneously and easily check the changes of their amino acid sites when analyzing many homologous/orthologous or influenza virus sequences. More information of Phylo-mLogo can be found at URL http://biocomp.iis.sinica.edu.tw/phylomlogo.

  20. SVA: software for annotating and visualizing sequenced human genomes

    Ge, Dongliang; Ruzzo, Elizabeth K.; Shianna, Kevin V.; He, Min; Pelak, Kimberly; Heinzen, Erin L.; Need, Anna C.; Cirulli, Elizabeth T.; Maia, Jessica M.; Dickson, Samuel P.; Zhu, Mingfu; Singh, Abanish; Allen, Andrew S.; Goldstein, David B.

    2011-01-01

    Summary: Here we present Sequence Variant Analyzer (SVA), a software tool that assigns a predicted biological function to variants identified in next-generation sequencing studies and provides a browser to visualize the variants in their genomic contexts. SVA also provides for flexible interaction with software implementing variant association tests allowing users to consider both the bioinformatic annotation of identified variants and the strength of their associations with studied traits. We illustrate the annotation features of SVA using two simple examples of sequenced genomes that harbor Mendelian mutations. Availability and implementation: Freely available on the web at http://www.svaproject.org. Contact: d.ge@duke.edu Supplementary information: Supplementary data are available at Bioinformatics online. PMID:21624899

  1. 77 FR 65537 - Requirements for Patent Applications Containing Nucleotide Sequence and/or Amino Acid Sequence...

    2012-10-29

    ... Amino Acid Sequence Disclosures ACTION: Proposed collection; comment request. SUMMARY: The United States....'' SUPPLEMENTARY INFORMATION: I. Abstract Patent applications that contain nucleotide and/or amino acid...

  2. IVisTMSA: Interactive Visual Tools for Multiple Sequence Alignments

    Muhammad Tariq Pervez; Masroor Ellahi Babar; Asif Nadeem; Naeem Aslam; Nasir Naveed; Sarfraz Ahmad; Shah Muhammad; Salman Qadri; Muhammad Shahid; Tanveer Hussain; Maryam Javed

    2015-01-01

    IVisTMSA is a software package of seven graphical tools for multiple sequence alignments. MSApad is an editing and analysis tool. It can load 409% more data than Jalview, STRAP, CINEMA, and Base-by-Base. MSA comparator allows the user to visualize consistent and inconsistent regions of reference and test alignments of more than 21-MB size in less than 12 seconds. MSA comparator is 5,200% efficient and more than 40% efficient as compared to BALiBASE c program and FastSP, respectively. MSA reco...

  3. Detection of nucleic acid sequences by invader-directed cleavage

    Brow, Mary Ann D. (Madison, WI); Hall, Jeff Steven Grotelueschen (Madison, WI); Lyamichev, Victor (Madison, WI); Olive, David Michael (Madison, WI); Prudent, James Robert (Madison, WI)

    1999-01-01

    The present invention relates to means for the detection and characterization of nucleic acid sequences, as well as variations in nucleic acid sequences. The present invention also relates to methods for forming a nucleic acid cleavage structure on a target sequence and cleaving the nucleic acid cleavage structure in a site-specific manner. The 5' nuclease activity of a variety of enzymes is used to cleave the target-dependent cleavage structure, thereby indicating the presence of specific nucleic acid sequences or specific variations thereof. The present invention further relates to methods and devices for the separation of nucleic acid molecules based by charge.

  4. Detection of nucleic acid sequences by invader-directed cleavage

    Brow, Mary Ann D.; Hall, Jeff Steven Grotelueschen; Lyamichev, Victor; Olive, David Michael; Prudent, James Robert

    1999-01-01

    The present invention relates to means for the detection and characterization of nucleic acid sequences, as well as variations in nucleic acid sequences. The present invention also relates to methods for forming a nucleic acid cleavage structure on a target sequence and cleaving the nucleic acid cleavage structure in a site-specific manner. The 5' nuclease activity of a variety of enzymes is used to cleave the target-dependent cleavage structure, thereby indicating the presence of specific nucleic acid sequences or specific variations thereof. The present invention further relates to methods and devices for the separation of nucleic acid molecules based by charge.

  5. IVisTMSA: Interactive Visual Tools for Multiple Sequence Alignments.

    Pervez, Muhammad Tariq; Babar, Masroor Ellahi; Nadeem, Asif; Aslam, Naeem; Naveed, Nasir; Ahmad, Sarfraz; Muhammad, Shah; Qadri, Salman; Shahid, Muhammad; Hussain, Tanveer; Javed, Maryam

    2015-01-01

    IVisTMSA is a software package of seven graphical tools for multiple sequence alignments. MSApad is an editing and analysis tool. It can load 409% more data than Jalview, STRAP, CINEMA, and Base-by-Base. MSA comparator allows the user to visualize consistent and inconsistent regions of reference and test alignments of more than 21-MB size in less than 12 seconds. MSA comparator is 5,200% efficient and more than 40% efficient as compared to BALiBASE c program and FastSP, respectively. MSA reconstruction tool provides graphical user interfaces for four popular aligners and allows the user to load several sequence files at a time. FASTA generator converts seven formats of alignments of unlimited size into FASTA format in a few seconds. MSA ID calculator calculates identity matrix of more than 11,000 sequences with a sequence length of 2,696 base pairs in less than 100 seconds. Tree and Distance Matrix calculation tools generate phylogenetic tree and distance matrix, respectively, using neighbor joining% identity and BLOSUM 62 matrix. PMID:25861209

  6. Sensory information in perceptual-motor sequence learning: visual and/or tactile stimuli

    Abrahamse, Elger L.; Lubbe, van der, S.; Verwey, Willem B.

    2009-01-01

    Sequence learning in serial reaction time (SRT) tasks has been investigated mostly with unimodal stimulus presentation. This approach disregards the possibility that sequence acquisition may be guided by multiple sources of sensory information simultaneously. In the current study we trained participants in a SRT task with visual only, tactile only, or bimodal (visual and tactile) stimulus presentation. Sequence performance for the bimodal and visual only training groups was similar, while bot...

  7. Sequence specific visual detection of LAMP reactions by addition of cationic polymers

    Hirano Tsuyoshi

    2006-01-01

    Full Text Available Abstract Background Development of a practical gene point-of-care testing device (g-POCT device requires innovative detection methods for demonstrating the results of the gene amplification reaction without the use of expensive equipment. We have studied a new method for the sequence-specific visual detection of minute amounts of nucleic acids using precipitation reaction by addition of cationic polymers to amplicons of Loop mediated isothermal Amplification (LAMP. Results Oligo DNA probes labeled with different fluorescent dyes were prepared for multiple nucleic acid templates, and the templates were amplified by the LAMP reactions under the existence of the probes. At completion of the LAMP reaction, an optimal amount of low molecular weight polyethylenimine (PEI was added, resulting in the precipitation of the insoluble LAMP amplicon-PEI complex. The fluorescently labeled Oligo DNA probes hybridized to the LAMP product were incorporated into the precipitation, and the precipitate emitted fluorescence corresponding to the amplified nucleic acid templates. The color of emitted fluorescence can be detected easily by naked eye on a conventional UV illuminator. Conclusion The presence or absence of minute amount of nucleic acid templates could be detected in a simple manner through visual assessment for the color of the LAMP amplicon-PEI complex precipitate. We conclude that this detection method may facilitate development of small and simple g-POCT device.

  8. SSE: a nucleotide and amino acid sequence analysis platform

    Simmonds Peter

    2012-01-01

    Abstract Background There is an increasing need to develop bioinformatic tools to organise and analyse the rapidly growing amount of nucleotide and amino acid sequence data in organisms ranging from viruses to eukaryotes. Finding A simple sequence editor (SSE) was developed to create an integrated environment where sequences can be aligned, annotated, classified and directly analysed by a number of built-in bioinformatic programs. SSE incorporates a sequence editor for the creation of sequenc...

  9. Analysis and Visualization Tool for Targeted Amplicon Bisulfite Sequencing on Ion Torrent Sequencers.

    Pabinger, Stephan; Ernst, Karina; Pulverer, Walter; Kallmeyer, Rainer; Valdes, Ana M; Metrustry, Sarah; Katic, Denis; Nuzzo, Angelo; Kriegner, Albert; Vierlinger, Klemens; Weinhaeusel, Andreas

    2016-01-01

    Targeted sequencing of PCR amplicons generated from bisulfite deaminated DNA is a flexible, cost-effective way to study methylation of a sample at single CpG resolution and perform subsequent multi-target, multi-sample comparisons. Currently, no platform specific protocol, support, or analysis solution is provided to perform targeted bisulfite sequencing on a Personal Genome Machine (PGM). Here, we present a novel tool, called TABSAT, for analyzing targeted bisulfite sequencing data generated on Ion Torrent sequencers. The workflow starts with raw sequencing data, performs quality assessment, and uses a tailored version of Bismark to map the reads to a reference genome. The pipeline visualizes results as lollipop plots and is able to deduce specific methylation-patterns present in a sample. The obtained profiles are then summarized and compared between samples. In order to assess the performance of the targeted bisulfite sequencing workflow, 48 samples were used to generate 53 different Bisulfite-Sequencing PCR amplicons from each sample, resulting in 2,544 amplicon targets. We obtained a mean coverage of 282X using 1,196,822 aligned reads. Next, we compared the sequencing results of these targets to the methylation level of the corresponding sites on an Illumina 450k methylation chip. The calculated average Pearson correlation coefficient of 0.91 confirms the sequencing results with one of the industry-leading CpG methylation platforms and shows that targeted amplicon bisulfite sequencing provides an accurate and cost-efficient method for DNA methylation studies, e.g., to provide platform-independent confirmation of Illumina Infinium 450k methylation data. TABSAT offers a novel way to analyze data generated by Ion Torrent instruments and can also be used with data from the Illumina MiSeq platform. It can be easily accessed via the Platomics platform, which offers a web-based graphical user interface along with sample and parameter storage. TABSAT is freely

  10. Los Alamos sequence analysis package for nucleic acids and proteins.

    Kanehisa, M I

    1982-01-01

    An interactive system for computer analysis of nucleic acid and protein sequences has been developed for the Los Alamos DNA Sequence Database. It provides a convenient way to search or verify various sequence features, e.g., restriction enzyme sites, protein coding frames, and properties of coded proteins. Further, the comprehensive analysis package on a large-scale database can be used for comparative studies on sequence and structural homologies in order to find unnoted information stored i...

  11. MEANS AND METHODS FOR CLONING NUCLEIC ACID SEQUENCES

    Geertsma, Eric Robin; Poolman, Berend

    2008-01-01

    The invention provides means and methods for efficiently cloning nucleic acid sequences of interest in micro-organisms that are less amenable to conventional nucleic acid manipulations, as compared to, for instance, E.coli. The present invention enables high-throughput cloning (and, preferably, expr

  12. An Integrated Sequence-Structure Database incorporating matching mRNA sequence, amino acid sequence and protein three-dimensional structure data.

    Adzhubei, I A; Adzhubei, A. A.; Neidle, S.

    1998-01-01

    We have constructed a non-homologous database, termed the Integrated Sequence-Structure Database (ISSD) which comprises the coding sequences of genes, amino acid sequences of the corresponding proteins, their secondary structure and straight phi,psi angles assignments, and polypeptide backbone coordinates. Each protein entry in the database holds the alignment of nucleotide sequence, amino acid sequence and the PDB three-dimensional structure data. The nucleotide and amino acid sequences for ...

  13. Amino acid sequences of proteins from Leptospira serovar pomona

    Alves Selmo F

    2000-01-01

    Full Text Available This report describes a partial amino acid sequences from three putative outer envelope proteins from Leptospira serovar pomona. In order to obtain internal fragments for protein sequencing, enzymatic and chemical digestion was performed. The enzyme clostripain was used to digest the proteins 32 and 45 kDa. In situ digestion of 40 kDa molecular weight protein was accomplished using cyanogen bromide. The 32 kDa protein generated two fragments, one of 21 kDa and another of 10 kDa that yielded five residues. A fragment of 24 kDa that yielded nineteen residues of amino acids was obtained from 45 kDa protein. A fragment with a molecular weight of 20 kDa, yielding a twenty amino acids sequence from the 40 kDa protein.

  14. Visual Sequence Learning in Infancy: Domain-General and Domain-Specific Associations with Language

    Shafto, Carissa L.; Conway, Christopher M.; Field, Suzanne L.; Houston, Derek M.

    2012-01-01

    Research suggests that nonlinguistic sequence learning abilities are an important contributor to language development (Conway, Bauernschmidt, Huang, & Pisoni, 2010). The current study investigated visual sequence learning (VSL) as a possible predictor of vocabulary development in infants. Fifty-eight 8.5-month-old infants were presented with a…

  15. Visual Analytics of Temporal Event Sequences in News Streams

    Krstajic, Milos

    2014-01-01

    Finding new ways of extracting and analyzing useful information from exploding volumes of unstructured and semi-structured text sources has become one of the greatest challenges in the era of big data. After new technologies have enabled efficient solutions for collecting and storing these data, the next step in computer science research is to develop scalable approaches for efficient analysis of dynamics in text streams. This dissertation addresses this challenge by examining how visual anal...

  16. Visual Sequence Learning in Infancy: Domain-General and Domain-Specific Associations with Language

    2011-01-01

    Research suggests that non-linguistic sequence learning abilities are an important contributor to language development (Conway, Bauernschmidt, Huang, & Pisoni, 2010). The current study investigated visual sequence learning as a possible predictor of vocabulary development in infants. Fifty-eight 8.5-month-old infants were presented with a three-location spatiotemporal sequence of multi-colored geometric shapes. Early language skills were assessed using the MacArthur-Bates CDI. Analyses of chi...

  17. Visual analysis of next-generation sequencing data to detect overlapping genes in bacterial genomes

    Simon, Svenja; Oelke, Daniela; Landstorfer, Richard; Neuhaus, Klaus; Keim, Daniel

    2011-01-01

    Next generation sequencing (NGS) technologies are about to revolutionize biological research. Being able to sequence large amounts of DNA or, indirectly, RNA sequences in a short time period opens numerous new possibilities. However, analyzing the large amounts of data generated in NGS is a serious challenge, which requires novel data analysis and visualization methods to allow the biological experimenter to understand the results. In this paper, we describe a novel system to deal with the fl...

  18. Representation of protein-sequence information by amino acid subalphabets

    Andersen, C.A.F.; Brunak, Søren

    2004-01-01

    -sequence information, using machine learning strategies, where the primary goal is the discovery of novel powerful representations for use in AI techniques. In the case of proteins and the 20 different amino acids they typically contain, it is also a secondary goal to discover how the current selection of amino acids......-which now are common in proteins-might have emerged from simpler selections, or alphabets, in use earlier during the evolution of living organisms....

  19. On Quantum Algorithm for Multiple Alignment of Amino Acid Sequences

    Iriyama, Satoshi; Ohya, Masanori

    2009-02-01

    The alignment of genome sequences or amino acid sequences is one of fundamental operations for the study of life. Usual computational complexity for the multiple alignment of N sequences with common length L by dynamic programming is O(LN). This alignment is considered as one of the NP problems, so that it is desirable to find a nice algorithm of the multiple alignment. Thus in this paper we propose the quantum algorithm for the multiple alignment based on the works12,1,2 in which the NP complete problem was shown to be the P problem by means of quantum algorithm and chaos information dynamics.

  20. The amino-acid sequence of kangaroo pancreatic ribonuclease.

    Gaastra, W; Welling, G W; Beintema, J J

    1978-05-01

    Red kangaroo (Macropus rufus) ribonuclease was isolated from pancreatic tissue by affinity chromatography. The amino acid sequence was determined by automatic sequencing of overlapping large fragments and by analysis of shorter peptides obtained by digestion with a number of proteolytic enzymes. The polypeptide chain consists of 122 amino acid residues. Compared to other ribonucleases, the N-terminal residue and residue 114 are deleted. In other pancreatic ribonucleases position 114 is occupied by a cis proline residue in an external loop at the surface of the molecule. Other remarkable substitutions are the presence of a tyrosine residue at position 123 instead of a serine which forms a hydrogen bond with the pyrimidine ring of a nucleotide substrate, and a number of hydrophobichydrophilic interchanges in the sequence 51-55, which forms part of an alpha-helix in bovine ribonuclease and exhibits few substitutions in the placental mammals. Kangaroo ribonuclease contains no carbohydrate, although the enzyme possesses a recognition site for carbohydrate attachment in the sequence Asn-Val-Thr (62-64). The enzyme differs at about 35-40% of the positions from all other mammalian pancreatic ribonucleases sequenced to date, which is in agreement with the early divergence between the marsupials and the placental mammals. From fragmentary data a tentative sequence of red-necked wallaby (Macropus rufogriseus) pancreatic ribonuclease has been derived. Eight differences with the kangaroo sequence were found. PMID:658039

  1. Visual programming for next-generation sequencing data analytics

    Milicchio, Franco; Rose, Rebecca; Bian, Jiang; Min, Jae; Prosperi, Mattia

    2016-01-01

    Background High-throughput or next-generation sequencing (NGS) technologies have become an established and affordable experimental framework in biological and medical sciences for all basic and translational research. Processing and analyzing NGS data is challenging. NGS data are big, heterogeneous, sparse, and error prone. Although a plethora of tools for NGS data analysis has emerged in the past decade, (i) software development is still lagging behind data generation capabilities, and (ii) ...

  2. Age-Related Declines in Early Sensory Memory: Identification of Rapid Auditory and Visual Stimulus Sequences

    Fogerty, Daniel; Humes, Larry E.; Busey, Thomas A.

    2016-01-01

    Age-related temporal-processing declines of rapidly presented sequences may involve contributions of sensory memory. This study investigated recall for rapidly presented auditory (vowel) and visual (letter) sequences presented at six different stimulus onset asynchronies (SOA) that spanned threshold SOAs for sequence identification. Younger, middle-aged, and older adults participated in all tasks. Results were investigated at both equivalent performance levels (i.e., SOA threshold) and at identical physical stimulus values (i.e., SOAs). For four-item sequences, results demonstrated best performance for the first and last items in the auditory sequences, but only the first item for visual sequences. For two-item sequences, adults identified the second vowel or letter significantly better than the first. Overall, when temporal-order performance was equated for each individual by testing at SOA thresholds, recall accuracy for each position across the age groups was highly similar. These results suggest that modality-specific processing declines of older adults primarily determine temporal-order performance for rapid sequences. However, there is some evidence for a second amodal processing decline in older adults related to early sensory memory for final items in a sequence. This selective deficit was observed particularly for longer sequence lengths and was not accounted for by temporal masking. PMID:27199737

  3. Phylo-mLogo: an interactive and hierarchical multiple-logo visualization tool for alignment of many sequences

    Lee DT; Shih Arthur; Peng Chin-Lin; Wu Yu-Wei

    2007-01-01

    Abstract Background When aligning several hundreds or thousands of sequences, such as epidemic virus sequences or homologous/orthologous sequences of some big gene families, to reconstruct the epidemiological history or their phylogenies, how to analyze and visualize the alignment results of many sequences has become a new challenge for computational biologists. Although there are several tools available for visualization of very long sequence alignments, few of them are applicable to the ali...

  4. PyVDT: A PsychoPy-Based Visual Sequence Detection Task

    Hansen, Mads

    2016-01-01

    PyVDT is a computerized test consisting of two brief visual sequence detection tasks in which participants watch single digits displayed on screen and respond whenever target digit sequences (even – odd – even) are displayed. The total duration of the test is around five minutes. PyVDT is a reimplementation of the Visual Monitoring Task (VMT), a task thought to measure working memory.PyVDT uses the PsychoPy API to display digits, to plot diagnostic information, and to output log files and res...

  5. VarSifter: Visualizing and analyzing exome-scale sequence variation data on a desktop computer

    Teer, Jamie K.; Green, Eric D.; Mullikin, James C.; Biesecker, Leslie G.

    2011-01-01

    Summary: VarSifter is a graphical software tool for desktop computers that allows investigators of varying computational skills to easily and quickly sort, filter, and sift through sequence variation data. A variety of filters and a custom query framework allow filtering based on any combination of sample and annotation information. By simplifying visualization and analyses of exome-scale sequence variation data, this program will help bring the power and promise of massively-parallel DNA seq...

  6. Subfamily logos: visualization of sequence deviations at alignment positions with high information content

    Beitz Eric

    2006-06-01

    Full Text Available Abstract Background Recognition of relevant sequence deviations can be valuable for elucidating functional differences between protein subfamilies. Interesting residues at highly conserved positions can then be mutated and experimentally analyzed. However, identification of such sites is tedious because automated approaches are scarce. Results Subfamily logos visualize subfamily-specific sequence deviations. The display is similar to classical sequence logos but extends into the negative range. Positive, upright characters correspond to residues which are characteristic for the subfamily, negative, upside-down characters to residues typical for the remaining sequences. The symbol height is adjusted to the information content of the alignment position. Residues which are conserved throughout do not appear. Conclusion Subfamily logos provide an intuitive display of relevant sequence deviations. The method has proven to be valid using a set of 135 aligned aquaporin sequences in which established subfamily-specific positions were readily identified by the algorithm.

  7. Deoxyribonucleic acid sequence mapping on metaphase chromosomes by immunoelectron microscopy

    Nucleic acid sequences can be localized on chromosomes in the electron microscope after hybridization with a biotinylated DNA probe followed by detection with a primary antibiotin antibody and a secondary antibody coupled to colloidal gold. Hybridization probes can also be labelled with alternative ligands such as N-acetoxy-2-acetylaminofluorene (AAF), Dinitrophenyl-dUTP and Digoxigenin-dUTP. Multiple labelling is possible if these differently modified DNA probes are used in conjunction with colloidal gold preparations of varying particle sizes. A substantial signal amplification can be achieved by incubating preparations with successive cycles of primary antibiotin antibody followed by a biotinylated secondary antibody. Detection is with Streptavidin-gold, and in the case of highly and moderately repeated sequences, the signal is visible in the light microscope. Detailed protocols are given for EM in-situ hybridization to whole mount metaphase chromosomes and include instructions necessary to perform multiple sequence localization and signal amplification

  8. Learning of Grammar-Like Visual Sequences by Adults with and without Language-Learning Disabilities

    Aguilar, Jessica M.; Plante, Elena

    2014-01-01

    Purpose: Two studies examined learning of grammar-like visual sequences to determine whether a general deficit in statistical learning characterizes this population. Furthermore, we tested the hypothesis that difficulty in sustaining attention during the learning task might account for differences in statistical learning. Method: In Study 1,…

  9. PyVDT: A PsychoPy-Based Visual Sequence Detection Task

    Mads Hansen

    2016-06-01

    Full Text Available PyVDT is a computerized test consisting of two brief visual sequence detection tasks in which participants watch single digits displayed on screen and respond whenever target digit sequences (even – odd – even are displayed. The total duration of the test is around five minutes. PyVDT is a reimplementation of the Visual Monitoring Task (VMT, a task thought to measure working memory. PyVDT uses the PsychoPy API to display digits, to plot diagnostic information, and to output log files and results. It is available for download on Figshare and GitHub. PyVDT is free software and has minimal software and hardware requirements. Thus, PyVDT provides a readily available visual monitoring task for use in experiments within cognitive science and related fields.

  10. Quantum-Sequencing: Biophysics of quantum tunneling through nucleic acids

    Casamada Ribot, Josep; Chatterjee, Anushree; Nagpal, Prashant

    2014-03-01

    Tunneling microscopy and spectroscopy has extensively been used in physical surface sciences to study quantum tunneling to measure electronic local density of states of nanomaterials and to characterize adsorbed species. Quantum-Sequencing (Q-Seq) is a new method based on tunneling microscopy for electronic sequencing of single molecule of nucleic acids. A major goal of third-generation sequencing technologies is to develop a fast, reliable, enzyme-free single-molecule sequencing method. Here, we present the unique ``electronic fingerprints'' for all nucleotides on DNA and RNA using Q-Seq along their intrinsic biophysical parameters. We have analyzed tunneling spectra for the nucleotides at different pH conditions and analyzed the HOMO, LUMO and energy gap for all of them. In addition we show a number of biophysical parameters to further characterize all nucleobases (electron and hole transition voltage and energy barriers). These results highlight the robustness of Q-Seq as a technique for next-generation sequencing.

  11. Nucleotide sequence and corresponding amino acid sequence of the gene for the major antigen of foot and mouth disease virus.

    Kurz, C; Forss, S; Küpper, H; K Strohmaier; Schaller, H

    1981-01-01

    A segment of 1160 nucleotides of the FMDV genome has been sequenced using three overlapping fragments of cloned cDNA from FMDV strain O1K. This sequence contains the coding sequence for the viral capsid protein VP1 as shown by its homology to known and newly determined amino acid sequences from this man antigenic polypeptide of the FMDV virion. The structural gene for VP1 comprises 639 nucleotides which specify a sequence of 213 amino acids for the VP1 protein. The coding sequence is not flan...

  12. Correlation between fibroin amino acid sequence and physical silk properties.

    Fedic, Robert; Zurovec, Michal; Sehnal, Frantisek

    2003-09-12

    The fiber properties of lepidopteran silk depend on the amino acid repeats that interact during H-fibroin polymerization. The aim of our research was to relate repeat composition to insect biology and fiber strength. Representative regions of the H-fibroin genes were sequenced and analyzed in three pyralid species: wax moth (Galleria mellonella), European flour moth (Ephestia kuehniella), and Indian meal moth (Plodia interpunctella). The amino acid repeats are species-specific, evidently a diversification of an ancestral region of 43 residues, and include three types of regularly dispersed motifs: modifications of GSSAASAA sequence, stretches of tripeptides GXZ where X and Z represent bulky residues, and sequences similar to PVIVIEE. No concatenations of GX dipeptide or alanine, which are typical for Bombyx silkworms and Antheraea silk moths, respectively, were found. Despite different repeat structure, the silks of G. mellonella and E. kuehniella exhibit similar tensile strength as the Bombyx and Antheraea silks. We suggest that in these latter two species, variations in the repeat length obstruct repeat alignment, but sufficiently long stretches of iterated residues get superposed to interact. In the pyralid H-fibroins, interactions of the widely separated and diverse motifs depend on the precision of repeat matching; silk is strong in G. mellonella and E. kuehniella, with 2-3 types of long homogeneous repeats, and nearly 10 times weaker in P. interpunctella, with seven types of shorter erratic repeats. The high proportion of large amino acids in the H-fibroin of pyralids has probably evolved in connection with the spinning habit of caterpillars that live in protective silk tubes and spin continuously, enlarging the tubes on one end and partly devouring the other one. The silk serves as a depot of energetically rich and essential amino acids that may be scarce in the diet. PMID:12816957

  13. Cervical cancer risk factors and feasibility of visual inspection with acetic acid screening in Sudan

    Ibrahim, Ahmed; Rasch, Vibeke; Pukkala, Eero;

    2011-01-01

    To assess the risk factors of cervical cancer and the feasibility and acceptability of a visual inspection with acetic acid (VIA) screening method in a primary health center in Khartoum, Sudan.......To assess the risk factors of cervical cancer and the feasibility and acceptability of a visual inspection with acetic acid (VIA) screening method in a primary health center in Khartoum, Sudan....

  14. Nucleic acid sequence detection using multiplexed oligonucleotide PCR

    Nolan, John P.; White, P. Scott

    2006-12-26

    Methods for rapidly detecting single or multiple sequence alleles in a sample nucleic acid are described. Provided are all of the oligonucleotide pairs capable of annealing specifically to a target allele and discriminating among possible sequences thereof, and ligating to each other to form an oligonucleotide complex when a particular sequence feature is present (or, alternatively, absent) in the sample nucleic acid. The design of each oligonucleotide pair permits the subsequent high-level PCR amplification of a specific amplicon when the oligonucleotide complex is formed, but not when the oligonucleotide complex is not formed. The presence or absence of the specific amplicon is used to detect the allele. Detection of the specific amplicon may be achieved using a variety of methods well known in the art, including without limitation, oligonucleotide capture onto DNA chips or microarrays, oligonucleotide capture onto beads or microspheres, electrophoresis, and mass spectrometry. Various labels and address-capture tags may be employed in the amplicon detection step of multiplexed assays, as further described herein.

  15. Isolating Visual and Proprioceptive Components of Motor Sequence Learning in ASD.

    Sharer, Elizabeth A; Mostofsky, Stewart H; Pascual-Leone, Alvaro; Oberman, Lindsay M

    2016-05-01

    In addition to defining impairments in social communication skills, individuals with autism spectrum disorder (ASD) also show impairments in more basic sensory and motor skills. Development of new skills involves integrating information from multiple sensory modalities. This input is then used to form internal models of action that can be accessed when both performing skilled movements, as well as understanding those actions performed by others. Learning skilled gestures is particularly reliant on integration of visual and proprioceptive input. We used a modified serial reaction time task (SRTT) to decompose proprioceptive and visual components and examine whether patterns of implicit motor skill learning differ in ASD participants as compared with healthy controls. While both groups learned the implicit motor sequence during training, healthy controls showed robust generalization whereas ASD participants demonstrated little generalization when visual input was constant. In contrast, no group differences in generalization were observed when proprioceptive input was constant, with both groups showing limited degrees of generalization. The findings suggest, when learning a motor sequence, individuals with ASD tend to rely less on visual feedback than do healthy controls. Visuomotor representations are considered to underlie imitative learning and action understanding and are thereby crucial to social skill and cognitive development. Thus, anomalous patterns of implicit motor learning, with a tendency to discount visual feedback, may be an important contributor in core social communication deficits that characterize ASD. Autism Res 2016, 9: 563-569. © 2015 International Society for Autism Research, Wiley Periodicals, Inc. PMID:26442448

  16. Amino acid sequences used for clusterintg (Multi FASTA format) - Gclust Server | LSDB Archive [Life Science Database Archive metadata

    Full Text Available Gclust Server Amino acid sequences used for clusterintg (Multi FASTA format) Data detail Data name Amino acid sequences use... Site Policy | Contact Us Amino acid sequences used for clusterintg (Multi FASTA format) - Gclust Server | LSDB Archive ...

  17. fluff: exploratory analysis and visualization of high-throughput sequencing data.

    Georgiou, Georgios; van Heeringen, Simon J

    2016-01-01

    In this article we describe fluff, a software package that allows for simple exploration, clustering and visualization of high-throughput sequencing data mapped to a reference genome. The package contains three command-line tools to generate publication-quality figures in an uncomplicated manner using sensible defaults. Genome-wide data can be aggregated, clustered and visualized in a heatmap, according to different clustering methods. This includes a predefined setting to identify dynamic clusters between different conditions or developmental stages. Alternatively, clustered data can be visualized in a bandplot. Finally, fluff includes a tool to generate genomic profiles. As command-line tools, the fluff programs can easily be integrated into standard analysis pipelines. The installation is straightforward and documentation is available at http://fluff.readthedocs.org. Availability. fluff is implemented in Python and runs on Linux. The source code is freely available for download at https://github.com/simonvh/fluff. PMID:27547532

  18. Timing and sequence of brain activity in top-down control of visual-spatial attention.

    Tineke Grent-'t-Jong; Woldorff, Marty G.

    2007-01-01

    Recent brain imaging studies using functional magnetic resonance imaging (fMRI) have implicated a frontal-parietal network in the top-down control of attention. However, little is known about the timing and sequence of activations within this network. To investigate these timing questions, we used event-related electrical brain potentials (ERPs) and a specially designed visual-spatial attentional-cueing paradigm, which were applied as part of a multi-methodological approach that included a cl...

  19. HYBRIDCHECK: software for the rapid detection, visualization and dating of recombinant regions in genome sequence data.

    Ward, Ben J; van Oosterhout, Cock

    2016-03-01

    HYBRIDCHECK is a software package to visualize the recombination signal in large DNA sequence data set, and it can be used to analyse recombination, genetic introgression, hybridization and horizontal gene transfer. It can scan large (multiple kb) contigs and whole-genome sequences of three or more individuals. HYBRIDCHECK is written in the r software for OS X, Linux and Windows operating systems, and it has a simple graphical user interface. In addition, the r code can be readily incorporated in scripts and analysis pipelines. HYBRIDCHECK implements several ABBA-BABA tests and visualizes the effects of hybridization and the resulting mosaic-like genome structure in high-density graphics. The package also reports the following: (i) the breakpoint positions, (ii) the number of mutations in each introgressed block, (iii) the probability that the identified region is not caused by recombination and (iv) the estimated age of each recombination event. The divergence times between the donor and recombinant sequence are calculated using a JC, K80, F81, HKY or GTR correction, and the dating algorithm is exceedingly fast. By estimating the coalescence time of introgressed blocks, it is possible to distinguish between hybridization and incomplete lineage sorting. HYBRIDCHECK is libré software and it and its manual are free to download from http://ward9250.github.io/HybridCheck/. PMID:26394708

  20. Carbon nanotube-based labels for highly sensitive colorimetric and aggregation-based visual detection of nucleic acids

    A novel carbon nanotube (CNT) derived label capable of dramatic signal amplification of nucleic acid detection and direct visual detection of target hybridization has been developed. Highly sensitive colorimetric detection of human acute lymphocytic leukemia (ALL) related oncogene sequences amplified by the novel CNT-based label was demonstrated. Atomic force microscope (AFM) images confirmed that a monolayer of horseradish peroxidase and detection probe molecules was immobilized along the carboxylated CNT carrier. The resulting CNT labels significantly enhanced the nucleic acid assay sensitivity by at least 1000 times compared to that of conventional labels used in enzyme-linked oligosorbent assay (ELOSA). An excellent detection limit of 1 x 10-12 M (60 x 10-18 mol in 60 μl) and a four-order wide dynamic range of target concentration were achieved. Hybridizations using these labels were coupled to a concentration-dependent formation of visible dark aggregates. Targets can thus be detected simply with visual inspection, eliminating the need for expensive and sophisticated detection systems. The approach holds promise for ultrasensitive and low cost visual inspection and colorimetric nucleic acid detection in point-of-care and early disease diagnostic application

  1. 37 CFR 1.822 - Symbols and format to be used for nucleotide and/or amino acid sequence data.

    2010-07-01

    ... for nucleotide and/or amino acid sequence data. 1.822 Section 1.822 Patents, Trademarks, and... Amino Acid Sequences § 1.822 Symbols and format to be used for nucleotide and/or amino acid sequence data. (a) The symbols and format to be used for nucleotide and/or amino acid sequence data...

  2. The learning of a sequence of visual patterns by the ant Cataglyphis cursor

    Chameron, S.; Schatz, B.; Pastergue-Ruiz, I.; Beugnon, G.; Collett, T S

    1998-01-01

    We used a maze to explore the ability of Cataglyphis cursor to store multiple visual patterns presented in a fixed sequence. Ants were trained individually to negotiate a linear maze that consisted of four boxes connected by tunnels and through which an ant travelled from a sucrose feeder back to its nest. Each box had one entrance and two possible exits. One exit led to a blocked tunnel and the other to an open tunnel leading to the entrance of the next box. The open and closed exits in each...

  3. GeneWiz browser: An Interactive Tool for Visualizing Sequenced Chromosomes

    Hallin, Peter Fischer; Stærfeldt, Hans Henrik; Rotenberg, Eva;

    2009-01-01

    readability and increased functionality compared to other browsers. The tool allows the user to select the display of various genomic features, color setting and data ranges. Custom numerical data can be added to the plot, allowing for example visualization of gene expression and regulation data. Further......, standard atlases are pre-generated for all prokaryotic genomes available in GenBank, providing a fast overview of all available genomes, including recently deposited genome sequences. The tool is available online from http://www.cbs.dtu.dk/services/gwBrowser. [Supplemental material including interactive...

  4. Contig sequences and their annotation (amino acid sequence and results of homology search), and expression profile - Dicty_cDB | LSDB Archive [Life Science Database Archive metadata

    Full Text Available Dicty_cDB Contig sequences and their annotation (amino acid sequence and results of homology search), and ex...pression profile Data detail Data name Contig sequences and their annotation (amino acid sequence and result... sequences of cDNA sequences of Dictyostelium discoideum and their annotation (amino acid sequence and resul...ence and full-length cDNA sequence by the assembly program Phrap ( http://www.phrap.org/index.html ). Link to the... list of clones constituting the contig, the information on its mapping to the genome mapped to genome sequence and the

  5. Dietary Omega-3 Fatty Acid Deficiency and Visual Loss in Infant Rhesus Monkeys

    Neuringer, M.; Connor, W.E.; Van Petten, C; Barstad, L

    1984-01-01

    Linolenic acid (18:3 omega 3) is a dietary precursor of docosahexaenoic acid (22:6 omega 3), the major fatty acid in the photoreceptor membranes of the retina. We hypothesized that rhesus monkeys deprived of dietary omega-3 fatty acids during prenatal and postnatal development would show plasma depletion of these fatty acids and visual impairment. Semipurified diets low in omega-3 fatty acids were fed to one group of adult female rhesus monkeys throughout pregnancy and to their infants from b...

  6. Visualization of sialoglycoproteins in polyacrylamide gels by acidic ninhydrin reaction.

    Yao,Kenzabroh; Ubuka,Toshihiko; Masuoka,Noriyoshi; Kinuta, Masahiro; Ohta, Jun; Ishino,Kazushi

    1990-01-01

    A new method for staining sialoglycoproteins in polyacrylamide gel after disc electrophoresis is described. The method utilizes the reaction of sialic acids with an acidic ninhydrin reagent which yields a stable color with an absorption maximum at 470 nm. After electrophoresis, the polyacrylamide gel is placed in a test tube and heated with 5 ml of the acidic ninhydrin reagent for 10 min in a boiling water bath. Sialoglycoproteins are detected as brown bands. No additional procedure such as d...

  7. Human retroviruses and AIDS 1996. A compilation and analysis of nucleic acid and amino acid sequences

    Myers, G.; Foley, B.; Korber, B. [eds.] [Los Alamos National Lab., NM (United States). Theoretical Div.; Mellors, J.W. [ed.] [Univ. of Pittsburgh, PA (United States); Jeang, K.T. [ed.] [National Institutes of Health, Bethesda, MD (United States). Molecular Virology Section; Wain-Hobson, S. [Pasteur Inst., Paris (France)] [ed.

    1997-04-01

    This compendium and the accompanying floppy diskettes are the result of an effort to compile and rapidly publish all relevant molecular data concerning the human immunodeficiency viruses (HIV) and related retroviruses. The scope of the compendium and database is best summarized by the five parts that it comprises: (1) Nuclear Acid Alignments and Sequences; (2) Amino Acid Alignments; (3) Analysis; (4) Related Sequences; and (5) Database Communications. Information within all the parts is updated throughout the year on the Web site, http://hiv-web.lanl.gov. While this publication could take the form of a review or sequence monograph, it is not so conceived. Instead, the literature from which the database is derived has simply been summarized and some elementary computational analyses have been performed upon the data. Interpretation and commentary have been avoided insofar as possible so that the reader can form his or her own judgments concerning the complex information. In addition to the general descriptions of the parts of the compendium, the user should read the individual introductions for each part.

  8. PHYLOViZ: phylogenetic inference and data visualization for sequence based typing methods

    Francisco Alexandre P

    2012-05-01

    Full Text Available Abstract Background With the decrease of DNA sequencing costs, sequence-based typing methods are rapidly becoming the gold standard for epidemiological surveillance. These methods provide reproducible and comparable results needed for a global scale bacterial population analysis, while retaining their usefulness for local epidemiological surveys. Online databases that collect the generated allelic profiles and associated epidemiological data are available but this wealth of data remains underused and are frequently poorly annotated since no user-friendly tool exists to analyze and explore it. Results PHYLOViZ is platform independent Java software that allows the integrated analysis of sequence-based typing methods, including SNP data generated from whole genome sequence approaches, and associated epidemiological data. goeBURST and its Minimum Spanning Tree expansion are used for visualizing the possible evolutionary relationships between isolates. The results can be displayed as an annotated graph overlaying the query results of any other epidemiological data available. Conclusions PHYLOViZ is a user-friendly software that allows the combined analysis of multiple data sources for microbial epidemiological and population studies. It is freely available at http://www.phyloviz.net.

  9. Natural vs. random protein sequences: Discovering combinatorics properties on amino acid words.

    Santoni, Daniele; Felici, Giovanni; Vergni, Davide

    2016-02-21

    Casual mutations and natural selection have driven the evolution of protein amino acid sequences that we observe at present in nature. The question about which is the dominant force of proteins evolution is still lacking of an unambiguous answer. Casual mutations tend to randomize protein sequences while, in order to have the correct functionality, one expects that selection mechanisms impose rigid constraints on amino acid sequences. Moreover, one also has to consider that the space of all possible amino acid sequences is so astonishingly large that it could be reasonable to have a well tuned amino acid sequence indistinguishable from a random one. In order to study the possibility to discriminate between random and natural amino acid sequences, we introduce different measures of association between pairs of amino acids in a sequence, and apply them to a dataset of 1047 natural protein sequences and 10,470 random sequences, carefully generated in order to preserve the relative length and amino acid distribution of the natural proteins. We analyze the multidimensional measures with machine learning techniques and show that, to a reasonable extent, natural protein sequences can be differentiated from random ones. PMID:26656109

  10. Transcriptome Sequencing in Response to Salicylic Acid in Salvia miltiorrhiza.

    Zhang, Xiaoru; Dong, Juane; Liu, Hailong; Wang, Jiao; Qi, Yuexin; Liang, Zongsuo

    2016-01-01

    Salvia miltiorrhiza is a traditional Chinese herbal medicine, whose quality and yield are often affected by diseases and environmental stresses during its growing season. Salicylic acid (SA) plays a significant role in plants responding to biotic and abiotic stresses, but the involved regulatory factors and their signaling mechanisms are largely unknown. In order to identify the genes involved in SA signaling, the RNA sequencing (RNA-seq) strategy was employed to evaluate the transcriptional profiles in S. miltiorrhiza cell cultures. A total of 50,778 unigenes were assembled, in which 5,316 unigenes were differentially expressed among 0-, 2-, and 8-h SA induction. The up-regulated genes were mainly involved in stimulus response and multi-organism process. A core set of candidate novel genes coding SA signaling component proteins was identified. Many transcription factors (e.g., WRKY, bHLH and GRAS) and genes involved in hormone signal transduction were differentially expressed in response to SA induction. Detailed analysis revealed that genes associated with defense signaling, such as antioxidant system genes, cytochrome P450s and ATP-binding cassette transporters, were significantly overexpressed, which can be used as genetic tools to investigate disease resistance. Our transcriptome analysis will help understand SA signaling and its mechanism of defense systems in S. miltiorrhiza. PMID:26808150

  11. AllelicImbalance: An R/ bioconductor package for detecting, managing, and visualizing allele expression imbalance data from RNA sequencing

    Gådin, Jesper R.; van't Hooft, Ferdinand M.; Eriksson, Per;

    2015-01-01

    Background: One aspect in which RNA sequencing is more valuable than microarray-based methods is the ability to examine the allelic imbalance of the expression of a gene. This process is often a complex task that entails quality control, alignment, and the counting of reads over heterozygous single...... possible biases. Results: We present AllelicImblance, a software program that is designed to detect, manage, and visualize allelic imbalances comprehensively. The purpose of this software is to allow users to pose genetic questions in any RNA sequencing experiment quickly, enhancing the general utility of...... RNA sequencing. The visualization features can reveal notable, non-trivial allelic imbalance behavior over specific regions, such as exons. Conclusions: The software provides a complete framework to perform allelic imbalance analyses of aligned RNA sequencing data, from detection to visualization...

  12. Detection of CIN by naked eye visualization after application of acetic acid.

    Londhe M; George S; Seshadri L

    1997-01-01

    A prospective study was undertaken to determine the sensitivity and specificity of acetic application to the cervix followed by naked eye visualization as a screening test for detection of cervical intraepithelial neoplasia. Three hundred and seventy two sexually active woman in the reproductive age group were studied. All the women underwent Papanicolaou test, acetic acid test and colposcopy. One hundred and seventy five woman were acetic acid test negative, 197 women were acetic acid test p...

  13. A noncontrast-enhanced pulse sequence optimized to visualize human peripheral vessels

    Gjesdal, Kjell-Inge [Sunnmoere MR-Klinikk, Aalesund (Norway); Storaas, Tryggve [Ullevaal University Hospital, Section for Diagnostic Physics, Department of Radiology, Oslo (Norway); Geitung, Jonn-Terje [Haraldsplass University Hospital, Department of Radiology, Bergen (Norway)

    2009-01-15

    The purpose of this paper is to present a pulse sequence optimized to visualize human peripheral vessels. The optimized MR technique is a 3D multi-shot balanced non-SSFP gradient echo pulse sequence with fat suppression. Several imaging parameters were adjusted to find the best compromise between the contrast of vascular structures and muscle, fat, and bone. Most of the optimization was performed in the knee and calf regions using multi-channel SENSE coils. To verify potential clinical use, images of both healthy volunteers and volunteers with varicose veins were produced. The balanced non-SSFP sequence can produce high-spatial-resolution images of the human peripheral vessels without the need for an intravenous contrast agent. Both arteries and veins are displayed along with other body fluids. Due to the high spatial resolution of the axial plane source or reconstructed images, the need for procedures to separate arteries from veins is limited. We demonstrate that high signals from synovial joint fluid and cystic structures can be suppressed by applying an inversion prepulse but at the expense of reduced image signal-to-noise and overall image quality. (orig.)

  14. A noncontrast-enhanced pulse sequence optimized to visualize human peripheral vessels

    The purpose of this paper is to present a pulse sequence optimized to visualize human peripheral vessels. The optimized MR technique is a 3D multi-shot balanced non-SSFP gradient echo pulse sequence with fat suppression. Several imaging parameters were adjusted to find the best compromise between the contrast of vascular structures and muscle, fat, and bone. Most of the optimization was performed in the knee and calf regions using multi-channel SENSE coils. To verify potential clinical use, images of both healthy volunteers and volunteers with varicose veins were produced. The balanced non-SSFP sequence can produce high-spatial-resolution images of the human peripheral vessels without the need for an intravenous contrast agent. Both arteries and veins are displayed along with other body fluids. Due to the high spatial resolution of the axial plane source or reconstructed images, the need for procedures to separate arteries from veins is limited. We demonstrate that high signals from synovial joint fluid and cystic structures can be suppressed by applying an inversion prepulse but at the expense of reduced image signal-to-noise and overall image quality. (orig.)

  15. Nucleotide sequence of Crithidia fasciculata cytosol 5S ribosomal ribonucleic acid.

    MacKay, R M; Gray, M W; Doolittle, W F

    1980-01-01

    The complete nucleotide sequence of the cytosol 5S ribosomal ribonucleic acid of the trypanosomatid protozoan Crithidia fasciculata has been determined by a combination of T1-oligonucleotide catalog and gel sequencing techniques. The sequence is: GAGUACGACCAUACUUGAGUGAAAACACCAUAUCCCGUCCGAUUUGUGAAGUUAAGCACC CACAGGCUUAGUUAGUACUGAGGUCAGUGAUGACUCGGGAACCCUGAGUGCCGUACUCCCOH. This 5S ribosomal RNA is unique in having GAUU in place of the GAAC or GAUC found in all other prokaryotic and eukaryotic 5S ...

  16. GENAS: a database system for nucleic acid sequence analysis.

    Kuhara, S; Matsuo, F; Futamura, S; A. Fujita; Shinohara, T.; Takagi, T.; Sakaki, Y

    1984-01-01

    A database system, named GENAS (GENe Analyzing System), for computer analysis of sequence was constructed using Adbis which is a relational database management system (1). GENAS enables us to retrieve any sequence data from EMBL nucleotide sequence data library (2) and readily to analyze them (if necessary, together with private data) by various application programs in a interactive manner. Analysis of structure of replication origin of replicons was demonstrated using this system.

  17. eQTL Viewer: visualizing how sequence variation affects genome-wide transcription

    Zeng Zhao-Bang

    2007-01-01

    Full Text Available Abstract Background Expression Quantitative Trait Locus (eQTL mapping methods have been used to identify the genetic basis of gene expression variations. To map eQTL, thousands of expression profiles are related with sequence polymorphisms across the genome through their correlated variations. These eQTL distribute in many chromosomal regions, each of which can include many genes. The large number of mapping results produced makes it difficult to consider simultaneously the relationships between multiple genomic regions and multiple expressional profiles. There is a need for informative bioinformatics tools to assist the visualization and interpretation of these mapping results. Results We have developed a web-based tool, called eQTL Viewer, to visualize the relationships between the expression trait genes and the candidate genes in the eQTL regions using Scalable Vector Graphics. The plot generated by eQTL Viewer has the capacity to display mapping results with high resolutions at a variety of scales, and superimpose biological annotations onto the mapping results dynamically. Conclusion Our tool provides an efficient and intuitive way for biologists to explore transcriptional regulation patterns, and to generate hypotheses on the genetic basis of transcriptional regulations.

  18. Homology between the invertible deoxyribonucleic acid sequence that controls flagellar-phase variation in Salmonella sp. and deoxyribonucleic acid sequences in other organisms.

    Szekely, E; Simon, M.

    1981-01-01

    The invertible deoxyribonucleic acid (DNA) segment cloned from Salmonella sp. was radioactively labeled and used as a probe to search for homologous sequences by Southern hybridization. Only one copy of the invertible segment could be found on the Salmonella sp. genome. Partial sequence homology with the invertible region was detected in bacteriophage Mu and P1 DNA by low-stringency hybridization. Under these conditions, no homology was detected with Escherichia coli DNA. A strain of Salmonel...

  19. Nucleotide Sequence of a Chicken Vitellogenin Gene and Derived Amino Acid Sequence of the Encoded Yolk Precursor Protein

    Schip, Fred D. van het; Samallo, John; Broos, Jaap; Ophuis, Jan; Mojet, Mart; Gruber, Max; AB, Geert

    1987-01-01

    The gene encoding the major vitellogenin from chicken has been completely sequenced and its exon-intron organization has been established. The gene is 20,342 base-pairs long and contains 35 exons with a combined length of 5787 base-pairs. They encode the 1850-amino acid pre-peptide of vitellogenin,

  20. Characterization of mouse cellular deoxyribonucleic acid homologous to Abelson murine leukemia virus-specific sequences.

    Dale, B.; Ozanne, B.

    1981-01-01

    The genome of Abelson murine leukemia virus (A-MuLV) consists of sequences derived from both BALB/c mouse deoxyribonucleic acid and the genome of Moloney murine leukemia virus. Using deoxyribonucleic acid linear intermediates as a source of retroviral deoxyribonucleic acid, we isolated a recombinant plasmid which contained 1.9 kilobases of the 3.5-kilobase mouse-derived sequences found in A-MuLV (A-MuLV-specific sequences). We used this clone, designated pSA-17, as a probe restriction enzyme ...

  1. Representation of Protein-Sequence Information by Amino Acid Subalphabets

    Andersen, Claus A. F.; Brunak, Soren

    2004-01-01

    Within computational biology, algorithms are constructed with the aim of extracting knowledge from biological data, in particular, data generated by the large genome projects, where gene and protein sequences are produced in high volume. In this article, we explore new ways of representing protein-sequence information, using machine learning strategies, where the primary goal is the discovery of novel powerful representations for use in AI techniques. In the case of proteins and the 20 differ...

  2. A conversational system for the computer analysis of nucleic acid sequences.

    Sege, R; Söll, D.; Ruddle, F H; Queen, C

    1981-01-01

    We present a conversational system for the computer analysis of nucleic acid and protein sequences based on the well-known Queen and Korn program (1). The system can be used by persons with only minimal knowledge of computers.

  3. Amino Acid Sequence - KOME | LSDB Archive [Life Science Database Archive metadata

    Full Text Available [ Credits ] BLAST Search Image Search Home About Archive Update History Contact us ...CE Amino acid sequence Joomla SEF URLs by Artio About This Database Database Description Download License Update History

  4. Accuracy of sequence alignment and fold assessment using reduced amino acid alphabets.

    Melo, Francisco; Marti-Renom, Marc A

    2006-06-01

    Reduced or simplified amino acid alphabets group the 20 naturally occurring amino acids into a smaller number of representative protein residues. To date, several reduced amino acid alphabets have been proposed, which have been derived and optimized by a variety of methods. The resulting reduced amino acid alphabets have been applied to pattern recognition, generation of consensus sequences from multiple alignments, protein folding, and protein structure prediction. In this work, amino acid substitution matrices and statistical potentials were derived based on several reduced amino acid alphabets and their performance assessed in a large benchmark for the tasks of sequence alignment and fold assessment of protein structure models, using as a reference frame the standard alphabet of 20 amino acids. The results showed that a large reduction in the total number of residue types does not necessarily translate into a significant loss of discriminative power for sequence alignment and fold assessment. Therefore, some definitions of a few residue types are able to encode most of the relevant sequence/structure information that is present in the 20 standard amino acids. Based on these results, we suggest that the use of reduced amino acid alphabets may allow to increasing the accuracy of current substitution matrices and statistical potentials for the prediction of protein structure of remote homologs. PMID:16506243

  5. cDNA-derived amino acid sequences of myoglobins from nine species of whales and dolphins.

    Iwanami, Kentaro; Mita, Hajime; Yamamoto, Yasuhiko; Fujise, Yoshihiro; Yamada, Tadasu; Suzuki, Tomohiko

    2006-10-01

    We determined the myoglobin (Mb) cDNA sequences of nine cetaceans, of which six are the first reports of Mb sequences: sei whale (Balaenoptera borealis), Bryde's whale (Balaenoptera edeni), pygmy sperm whale (Kogia breviceps), Stejneger's beaked whale (Mesoplodon stejnegeri), Longman's beaked whale (Indopacetus pacificus), and melon-headed whale (Peponocephala electra), and three confirm the previously determined chemical amino acid sequences: sperm whale (Physeter macrocephalus), common minke whale (Balaenoptera acutorostrata) and pantropical spotted dolphin (Stenella attenuata). We found two types of Mb in the skeletal muscle of pantropical spotted dolphin: Mb I with the same amino acid sequence as that deposited in the protein database, and Mb II, which differs at two amino acid residues compared with Mb I. Using an alignment of the amino acid or cDNA sequences of cetacean Mb, we constructed a phylogenetic tree by the NJ method. Clustering of cetacean Mb amino acid and cDNA sequences essentially follows the classical taxonomy of cetaceans, suggesting that Mb sequence data is valid for classification of cetaceans at least to the family level. PMID:16962803

  6. Kohonen map as a visualization tool for the analysis of protein sequences: multiple alignments, domains and segments of secondary structures.

    Hanke, J; Reich, J G

    1996-12-01

    The method of Kohonen maps, a special form of neural networks, was applied as a visualization tool for the analysis of protein sequence similarity. The procedure converts sequence (domains, aligned sequences, segments of secondary structure) into a characteristic signal matrix. This conversion depends on the property or replacement score vector selected by the user. Similar sequences have small distance in the signal space. The trained Kohonen network is functionally equivalent to an unsupervised non-linear cluster analyzer. Protein families, or aligned sequences, or segments of similar secondary structure, aggregate as clusters, and their proximity may be inspected on a color screen or on paper. Pull-down menus permit access to background information in the established text-oriented way. PMID:9021261

  7. Detection of CIN by naked eye visualization after application of acetic acid.

    Londhe, M; George, S S; Seshadri, L

    1997-06-01

    A prospective study was undertaken to determine the sensitivity and specificity of acetic application to the cervix followed by naked eye visualization as a screening test for detection of cervical intraepithelial neoplasia. Three hundred and seventy two sexually active woman in the reproductive age group were studied. All the women underwent Papanicolaou test, acetic acid test and colposcopy. One hundred and seventy five woman were acetic acid test negative, 197 women were acetic acid test positive. The sensitivity of acetic acid test was 72.4%, specificity 54% and false negative rate 15.2%, as compared to papanicolaou test which had a sensitivity of 13.2%, specificity of 96.3% and false negative rate of 24.4%. The advantage of the acetic acid test lies in its easy technique, low cost and high sensitivity which are important factors for determining the efficacy of any screening programme in developing countries. PMID:9491668

  8. Homology of amino acid sequences of rat liver cathepsins B and H with that of papain.

    Takio, K; Towatari, T; Katunuma, N.; Teller, D C; Titani, K

    1983-01-01

    The amino acid sequences of rat liver lysosomal thiol endopeptidases, cathepsins B and H, are presented and compared with that of the plant thiol protease papain. The 252-residue sequence of cathepsin B and the 220-residue sequence of cathepsin H were determined largely by automated Edman degradation of their intact polypeptide chains and of the two chains of each enzyme generated by limited proteolysis. Subfragments of the chains were produced by enzymatic digestion and by chemical cleavage ...

  9. Complete amino acid sequence of human intestinal aminopeptidase N as deduced from cloned cDNA

    Cowell, G M; Kønigshøfer, E; Danielsen, E M;

    1988-01-01

    The complete primary structure (967 amino acids) of an intestinal human aminopeptidase N (EC 3.4.11.2) was deduced from the sequence of a cDNA clone. Aminopeptidase N is anchored to the microvillar membrane via an uncleaved signal for membrane insertion. A domain constituting amino acid 250...

  10. Representation of protein-sequence information by amino acid subalphabets

    Andersen, C.A.F.; Brunak, Søren

    2004-01-01

    Within computational biology, algorithms are constructed with the aim of extracting knowledge from biological data, in particular, data generated by the large genome projects, where gene and protein sequences are produced in high volume. In this article, we explore new ways of representing protei......-which now are common in proteins-might have emerged from simpler selections, or alphabets, in use earlier during the evolution of living organisms....

  11. Two distinct ferredoxins from Rhodobacter capsulatus: complete amino acid sequences and molecular evolution.

    Saeki, K; Suetsugu, Y; Yao, Y; Horio, T; Marrs, B L; Matsubara, H

    1990-09-01

    Two distinct ferredoxins were purified from Rhodobacter capsulatus SB1003. Their complete amino acid sequences were determined by a combination of protease digestion, BrCN cleavage and Edman degradation. Ferredoxins I and II were composed of 64 and 111 amino acids, respectively, with molecular weights of 6,728 and 12,549 excluding iron and sulfur atoms. Both contained two Cys clusters in their amino acid sequences. The first cluster of ferredoxin I and the second cluster of ferredoxin II had a sequence, CxxCxxCxxxCP, in common with the ferredoxins found in Clostridia. The second cluster of ferredoxin I had a sequence, CxxCxxxxxxxxCxxxCM, with extra amino acids between the second and third Cys, which has been reported for other photosynthetic bacterial ferredoxins and putative ferredoxins (nif-gene products) from nitrogen-fixing bacteria, and with a unique occurrence of Met. The first cluster of ferredoxin II had a CxxCxxxxCxxxCP sequence, with two additional amino acids between the second and third Cys, a characteristics feature of Azotobacter-[3Fe-4S] [4Fe-4S]-ferredoxin. Ferredoxin II was also similar to Azotobacter-type ferredoxins with an extended carboxyl (C-) terminal sequence compared to the common Clostridium-type. The evolutionary relationship of the two together with a putative one recently found to be encoded in nifENXQ region in this bacterium [Moreno-Vivian et al. (1989) J. Bacteriol. 171, 2591-2598] is discussed. PMID:2277040

  12. Complete nucleotide sequence of cDNA and deduced amino acid sequence of rat liver catalase.

    Furuta, S.; Hayashi, H; Hijikata, M; Miyazawa, S.; Osumi, T; Hashimoto, T.

    1986-01-01

    We have isolated five cDNA clones for rat liver catalase (hydrogen peroxide:hydrogen peroxide oxidoreductase, EC 1.11.1.6). These clones overlapped with each other and covered the entire length of the mRNA, which had been estimated to be 2.4 kilobases long by blot hybridization analysis of electrophoretically fractionated RNA. Nucleotide sequencing was carried out on these five clones and the composite nucleotide sequence of catalase cDNA was determined. The 5' noncoding region contained 83 b...

  13. CpGAVAS, an integrated web server for the annotation, visualization, analysis, and GenBank submission of completely sequenced chloroplast genome sequences

    Liu Chang

    2012-12-01

    Full Text Available Abstract Background The complete sequences of chloroplast genomes provide wealthy information regarding the evolutionary history of species. With the advance of next-generation sequencing technology, the number of completely sequenced chloroplast genomes is expected to increase exponentially, powerful computational tools annotating the genome sequences are in urgent need. Results We have developed a web server CPGAVAS. The server accepts a complete chloroplast genome sequence as input. First, it predicts protein-coding and rRNA genes based on the identification and mapping of the most similar, full-length protein, cDNA and rRNA sequences by integrating results from Blastx, Blastn, protein2genome and est2genome programs. Second, tRNA genes and inverted repeats (IR are identified using tRNAscan, ARAGORN and vmatch respectively. Third, it calculates the summary statistics for the annotated genome. Fourth, it generates a circular map ready for publication. Fifth, it can create a Sequin file for GenBank submission. Last, it allows the extractions of protein and mRNA sequences for given list of genes and species. The annotation results in GFF3 format can be edited using any compatible annotation editing tools. The edited annotations can then be uploaded to CPGAVAS for update and re-analyses repeatedly. Using known chloroplast genome sequences as test set, we show that CPGAVAS performs comparably to another application DOGMA, while having several superior functionalities. Conclusions CPGAVAS allows the semi-automatic and complete annotation of a chloroplast genome sequence, and the visualization, editing and analysis of the annotation results. It will become an indispensible tool for researchers studying chloroplast genomes. The software is freely accessible from http://www.herbalgenomics.org/cpgavas.

  14. Protein chemotaxonomy. XIII. Amino acid sequence of ferredoxin from Panax ginseng.

    Mino, Yoshiki

    2006-08-01

    The complete amino acid sequence of [2Fe-2S] ferredoxin from Panax ginseng (Araliaceae) has been determined by automated Edman degradation of the entire S-carboxymethylcysteinyl protein and of the peptides obtained by enzymatic digestion. This ferredoxin has a unique amino acid sequence, which includes an insertion of Tyr at the 3rd position from the amino-terminus and a deletion of two amino acid residues at the carboxyl terminus. This ferredoxin had 18 differences in its amino acid sequence compared to that of Petroselinum sativum (Umbelliferae). In contrast, 23-33 differences were observed compared to other dicotyledonous plants. This suggests that Panax ginseng is related taxonomically to umbelliferous plants. PMID:16880642

  15. Visualization of Early Events in Acetic Acid Denaturation of HIV-1 Protease: A Molecular Dynamics Study

    Borkar, Aditi Narendra; Rout, Manoj Kumar; Hosur, Ramakrishna V.

    2011-01-01

    Protein denaturation plays a crucial role in cellular processes. In this study, denaturation of HIV-1 Protease (PR) was investigated by all-atom MD simulations in explicit solvent. The PR dimer and monomer were simulated separately in 9 M acetic acid (9 M AcOH) solution and water to study the denaturation process of PR in acetic acid environment. Direct visualization of the denaturation dynamics that is readily available from such simulations has been presented. Our simulations in 9 M AcOH re...

  16. Visualizing digestive organ morphology and function using differential fatty acid metabolism in live zebrafish

    Carten, Juliana Debrito; Bradford, Mary Katherine; Farber, Steven Arthur

    2011-01-01

    Lipids are essential for cellular function as sources of fuel, critical signaling molecules and membrane components. Deficiencies in lipid processing and transport underlie many metabolic diseases. To better understand metabolic function as it relates to disease etiology, a whole animal approach is advantageous, one in which multiple organs and cell types can be assessed simultaneously in vivo. Towards this end, we have developed an assay to visualize fatty acid (FA) metabolism in larval zebr...

  17. Visualization of Iron-Binding Micelles in Acidic Recombinant Biomineralization Protein, MamC

    Sanjay Kashyap; Taylor Woehl; Carmen Valverde-Tercedor; Miguel Sánchez-Quesada; Concepción Jiménez López; Tanya Prozorov

    2014-01-01

    Biological macromolecules are utilized in low-temperature synthetic methods to exert precise control over nanoparticle nucleation and placement. They enable low-temperature formation of a variety of functional nanostructured materials with properties often not achieved via conventional synthetic techniques. Here we report on the in situ visualization of a novel acidic bacterial recombinant protein, MamC, commonly present in the magnetosome membrane of several magnetotactic bacteria, including...

  18. Visualization of cranial nerves I-XII: value of 3D CISS and T2-weighted FSE sequences

    Yousry, I.; Camelio, S.; Wiesmann, M.; Brueckmann, H.; Yousry, T.A. [Department of Neuroradiology, Klinikum Grosshadern, Ludwig-Maximilians University, Marchioninistrasse 15, D-81377 Munich (Germany); Schmid, U.D. [Neurosurgical Unit, Klinik im Park, 8000 Zurich (Switzerland); Horsfield, M.A. [Department of Medical Physics, University of Leicester, Leicester LE1 5WW (United Kingdom)

    2000-07-01

    The aim of this study was to evaluate the sensitivity of the three-dimensional constructive interference of steady state (3D CISS) sequence (slice thickness 0.7 mm) and that of the T2-weighted fast spin echo (T2-weighted FSE) sequence (slice thickness 3 mm) for the visualization of all cranial nerves in their cisternal course. Twenty healthy volunteers were examined using the T2-weighted FSE and the 3D CISS sequences. Three observers evaluated independently the cranial nerves NI-NXII in their cisternal course. The rates for successful visualization of each nerve for 3D CISS (and for T2-weighted FSE in parentheses) were as follows: NI, NII, NV, NVII, NVIII 40 of 40 (40 of 40), NIII 40 of 40 (18 of 40), NIV 19 of 40 (3 of 40), NVI 39 of 40 (5 of 40), NIX, X, XI 40 of 40 (29 of 40), and NXII 40 of 40 (4 of 40). Most of the cranial nerves can be reliably assessed when using the 3D CISS and the T2-weighted FSE sequences. Increasing the spatial resolution when using the 3D CISS sequence increases the reliability of the identification of the cranial nerves NIII-NXII. (orig.)

  19. Visualization of cranial nerves I-XII: value of 3D CISS and T2-weighted FSE sequences

    The aim of this study was to evaluate the sensitivity of the three-dimensional constructive interference of steady state (3D CISS) sequence (slice thickness 0.7 mm) and that of the T2-weighted fast spin echo (T2-weighted FSE) sequence (slice thickness 3 mm) for the visualization of all cranial nerves in their cisternal course. Twenty healthy volunteers were examined using the T2-weighted FSE and the 3D CISS sequences. Three observers evaluated independently the cranial nerves NI-NXII in their cisternal course. The rates for successful visualization of each nerve for 3D CISS (and for T2-weighted FSE in parentheses) were as follows: NI, NII, NV, NVII, NVIII 40 of 40 (40 of 40), NIII 40 of 40 (18 of 40), NIV 19 of 40 (3 of 40), NVI 39 of 40 (5 of 40), NIX, X, XI 40 of 40 (29 of 40), and NXII 40 of 40 (4 of 40). Most of the cranial nerves can be reliably assessed when using the 3D CISS and the T2-weighted FSE sequences. Increasing the spatial resolution when using the 3D CISS sequence increases the reliability of the identification of the cranial nerves NIII-NXII. (orig.)

  20. FeatureViewer, a BioJS component for visualization of position-based annotations in protein sequences

    Leyla Garcia; Guy Yachdav; Maria-Jesus Martin

    2014-01-01

    Summary: FeatureViewer is a BioJS component that lays out, maps, orients, and renders position-based annotations for protein sequences. This component is highly flexible and customizable, allowing the presentation of annotations by rows, all centered, or distributed in non-overlapping tracks. It uses either lines or shapes for sites and rectangles for regions. The result is a powerful visualization tool that can be easily integrated into web applications as well as documents as it provides an...

  1. Nucleotide sequence of the beta-cyclodextrin glucanotransferase gene of alkalophilic Bacillus sp. strain 1011 and similarity of its amino acid sequence to those of alpha-amylases.

    Kimura, K.; Kataoka, S; Ishii, Y; Takano, T.; Yamane, K

    1987-01-01

    The nucleotide sequence of the gene for cyclodextrin glucanotransferase of alkalophilic Bacillus sp. strain 1011 was determined. The deduced amino acid sequence at the NH2-terminal side of the enzyme showed a high homology with the sequences of alpha-amylase in the three regions which constitutes the active centers of alpha-amylases.

  2. EST sequences and their annotation (amino acid sequence and results of homology search) - Dicty_cDB | LSDB Archive [Life Science Database Archive metadata

    Full Text Available lone covering full-length ORF provided by the National BioResource Project ( http://www.nbrp.jp/ ). The...ein Coding Gene in dictyBase ( http://dictybase.org/ ). The link to dictyBase is provided in the...Dicty_cDB EST sequences and their annotation (amino acid sequence and results of homology search) Data detai...l Data name EST sequences and their annotation (amino acid sequence and results of homology search) Descript...ion of data contents Sequences of cDNA clones of Dictyostelium discoideum and the

  3. Introduction of restriction enzyme sites in protein-coding DNA sequences by site-specific mutagenesis not affecting the amino acid sequence: a computer program.

    Arentzen, R; Ripka, W. C.

    1984-01-01

    Structure/function relationship studies of proteins are greatly facilitated by recombinant DNA technology which allows specific amino acid mutations to be made at the DNA sequence level by site-specific mutagenesis employing synthetic oligonucleotides. This technique has been successfully used to alter one or two amino acids in a protein. Replacement of existing DNA sequence coding for several amino acids with new synthetic DNA fragments would be facilitated by the presence of unique restrict...

  4. Nucleic-acid-programmed Ag-nanoclusters as a generic platform for visualization of latent fingerprints and exogenous substances.

    Ran, Xiang; Wang, Zhenzhen; Zhang, Zhijun; Pu, Fang; Ren, Jinsong; Qu, Xiaogang

    2016-01-11

    We display a nucleic acid controlled AgNC platform for latent fingerprint visualization. The versatile emission of aptamer-modified AgNCs was regulated by the nearby DNA regions. Multi-color images for simultaneous visualization of fingerprints and exogenous components were successfully obtained. A quantitative detection strategy for exogenous substances in fingerprints was also established. PMID:26537157

  5. 37 CFR 1.824 - Form and format for nucleotide and/or amino acid sequence submissions in computer readable form.

    2010-07-01

    ... nucleotide and/or amino acid sequence submissions in computer readable form. 1.824 Section 1.824 Patents... And/or Amino Acid Sequences § 1.824 Form and format for nucleotide and/or amino acid sequence... readable form may be created by any means, such as word processors, nucleotide/amino acid sequence...

  6. Draft genome sequence of the docosahexaenoic acid producing thraustochytrid Aurantiochytrium sp. T66.

    Liu, Bin; Ertesvåg, Helga; Aasen, Inga Marie; Vadstein, Olav; Brautaset, Trygve; Heggeset, Tonje Marita Bjerkan

    2016-06-01

    Thraustochytrids are unicellular, marine protists, and there is a growing industrial interest in these organisms, particularly because some species, including strains belonging to the genus Aurantiochytrium, accumulate high levels of docosahexaenoic acid (DHA). Here, we report the draft genome sequence of Aurantiochytrium sp. T66 (ATCC PRA-276), with a size of 43 Mbp, and 11,683 predicted protein-coding sequences. The data has been deposited at DDBJ/EMBL/Genbank under the accession LNGJ00000000. The genome sequence will contribute new insight into DHA biosynthesis and regulation, providing a basis for metabolic engineering of thraustochytrids. PMID:27222814

  7. DNA Data Visualization (DDV: Software for Generating Web-Based Interfaces Supporting Navigation and Analysis of DNA Sequence Data of Entire Genomes.

    Tomasz Neugebauer

    Full Text Available Data visualization methods are necessary during the exploration and analysis activities of an increasingly data-intensive scientific process. There are few existing visualization methods for raw nucleotide sequences of a whole genome or chromosome. Software for data visualization should allow the researchers to create accessible data visualization interfaces that can be exported and shared with others on the web. Herein, novel software developed for generating DNA data visualization interfaces is described. The software converts DNA data sets into images that are further processed as multi-scale images to be accessed through a web-based interface that supports zooming, panning and sequence fragment selection. Nucleotide composition frequencies and GC skew of a selected sequence segment can be obtained through the interface. The software was used to generate DNA data visualization of human and bacterial chromosomes. Examples of visually detectable features such as short and long direct repeats, long terminal repeats, mobile genetic elements, heterochromatic segments in microbial and human chromosomes, are presented. The software and its source code are available for download and further development. The visualization interfaces generated with the software allow for the immediate identification and observation of several types of sequence patterns in genomes of various sizes and origins. The visualization interfaces generated with the software are readily accessible through a web browser. This software is a useful research and teaching tool for genetics and structural genomics.

  8. New families in the classification of glycosyl hydrolases based on amino acid sequence similarities.

    Henrissat, B; Bairoch, A

    1993-01-01

    301 glycosyl hydrolases and related enzymes corresponding to 39 EC entries of the I.U.B. classification system have been classified into 35 families on the basis of amino-acid-sequence similarities [Henrissat (1991) Biochem. J. 280, 309-316]. Approximately half of the families were found to be monospecific (containing only one EC number), whereas the other half were found to be polyspecific (containing at least two EC numbers). A > 60% increase in sequence data for glycosyl hydrolases (181 additional enzymes or enzyme domains sequences have since become available) allowed us to update the classification not only by the addition of more members to already identified families, but also by the finding of ten new families. On the basis of a comparison of 482 sequences corresponding to 52 EC entries, 45 families, out of which 22 are polyspecific, can now be defined. This classification has been implemented in the SWISS-PROT protein sequence data bank. PMID:8352747

  9. Coding Local and Global Binary Visual Features Extracted From Video Sequences.

    Baroffio, Luca; Canclini, Antonio; Cesana, Matteo; Redondi, Alessandro; Tagliasacchi, Marco; Tubaro, Stefano

    2015-11-01

    Binary local features represent an effective alternative to real-valued descriptors, leading to comparable results for many visual analysis tasks while being characterized by significantly lower computational complexity and memory requirements. When dealing with large collections, a more compact representation based on global features is often preferred, which can be obtained from local features by means of, e.g., the bag-of-visual word model. Several applications, including, for example, visual sensor networks and mobile augmented reality, require visual features to be transmitted over a bandwidth-limited network, thus calling for coding techniques that aim at reducing the required bit budget while attaining a target level of efficiency. In this paper, we investigate a coding scheme tailored to both local and global binary features, which aims at exploiting both spatial and temporal redundancy by means of intra- and inter-frame coding. In this respect, the proposed coding scheme can conveniently be adopted to support the analyze-then-compress (ATC) paradigm. That is, visual features are extracted from the acquired content, encoded at remote nodes, and finally transmitted to a central controller that performs the visual analysis. This is in contrast with the traditional approach, in which visual content is acquired at a node, compressed and then sent to a central unit for further processing, according to the compress-then-analyze (CTA) paradigm. In this paper, we experimentally compare the ATC and the CTA by means of rate-efficiency curves in the context of two different visual analysis tasks: 1) homography estimation and 2) content-based retrieval. Our results show that the novel ATC paradigm based on the proposed coding primitives can be competitive with the CTA, especially in bandwidth limited scenarios. PMID:26080384

  10. ProViz-a web-based visualization tool to investigate the functional and evolutionary features of protein sequences.

    Jehl, Peter; Manguy, Jean; Shields, Denis C; Higgins, Desmond G; Davey, Norman E

    2016-07-01

    Low-throughput experiments and high-throughput proteomic and genomic analyses have created enormous quantities of data that can be used to explore protein function and evolution. The ability to consolidate these data into an informative and intuitive format is vital to our capacity to comprehend these distinct but complementary sources of information. However, existing tools to visualize protein-related data are restricted by their presentation, sources of information, functionality or accessibility. We introduce ProViz, a powerful browser-based tool to aid biologists in building hypotheses and designing experiments by simplifying the analysis of functional and evolutionary features of proteins. Feature information is retrieved in an automated manner from resources describing protein modular architecture, post-translational modification, structure, sequence variation and experimental characterization of functional regions. These features are mapped to evolutionary information from precomputed multiple sequence alignments. Data are displayed in an interactive and information-rich yet intuitive visualization, accessible through a simple protein search interface. This allows users with limited bioinformatic skills to rapidly access data pertinent to their research. Visualizations can be further customized with user-defined data either manually or using a REST API. ProViz is available at http://proviz.ucd.ie/. PMID:27085803

  11. Better prediction of protein contact number using a support vector regression analysis of amino acid sequence

    Yuan Zheng

    2005-10-01

    Full Text Available Abstract Background Protein tertiary structure can be partly characterized via each amino acid's contact number measuring how residues are spatially arranged. The contact number of a residue in a folded protein is a measure of its exposure to the local environment, and is defined as the number of Cβ atoms in other residues within a sphere around the Cβ atom of the residue of interest. Contact number is partly conserved between protein folds and thus is useful for protein fold and structure prediction. In turn, each residue's contact number can be partially predicted from primary amino acid sequence, assisting tertiary fold analysis from sequence data. In this study, we provide a more accurate contact number prediction method from protein primary sequence. Results We predict contact number from protein sequence using a novel support vector regression algorithm. Using protein local sequences with multiple sequence alignments (PSI-BLAST profiles, we demonstrate a correlation coefficient between predicted and observed contact numbers of 0.70, which outperforms previously achieved accuracies. Including additional information about sequence weight and amino acid composition further improves prediction accuracies significantly with the correlation coefficient reaching 0.73. If residues are classified as being either "contacted" or "non-contacted", the prediction accuracies are all greater than 77%, regardless of the choice of classification thresholds. Conclusion The successful application of support vector regression to the prediction of protein contact number reported here, together with previous applications of this approach to the prediction of protein accessible surface area and B-factor profile, suggests that a support vector regression approach may be very useful for determining the structure-function relation between primary protein sequence and higher order consecutive protein structural and functional properties.

  12. Complete amino acid sequence of branched-chain amino acid aminotransferase (transaminase B) of Salmonella typhimurium, identification of the coenzyme-binding site and sequence comparison analysis

    The complete amino acid sequence of the subunit of branched-chain amino acid aminotransferase of Salmonella typhimurium was determined by automated Edman degradation of peptide fragments generated by chemical and enzymatic digestion of S-carboxymethylated and S-pyridylethylated transaminase B. Peptide fragments of transaminase B were generated by treatment of the enzyme with trypsin, Staphylococcus aureus V8 protease, endoproteinase Lys-C, and cyanogen bromide. Protocols were developed for separation of the peptide fragments by reverse-phase high performance liquid chromatography (HPLC), ion-exchange HPLC, and SDS-urea gel electrophoresis. The enzyme subunit contains 308 amino acid residues and has a molecular weight of 33,920 daltons. The coenzyme-binding site was determined by treatment of the enzyme, containing bound pyridoxal 5-phosphate, with tritiated sodium borohydride prior to trypsin digestion. Monitoring radioactivity incorporation and peptide map comparisons with an apoenzyme tryptic digest, allowed identification of the pyridoxylated-peptide which was isolated by reverse-phase HPLC and sequenced. The coenzyme-binding site is a lysyl residue at position 159. Some peptides were further characterized by fast atom bombardment mass spectrometry

  13. Sequence divergence, polymorphism and evolution of the middle-wave and long-wave visual pigment genes of great apes and Old World monkeys.

    Dulai, K S; Bowmaker, J K; Mollon, J D; Hunt, D M

    1994-10-01

    In man, the spectral shift between the middle-wave (MW) and long-wave (LW) visual pigments is largely achieved by amino acid substitution at two codons, both located in exon 5. A third amino acid site coded by exon 3 is polymorphic between pigments. We have studied the equivalent regions of the cone opsin genes in two members of the Hominidea (the gorilla, Gorilla gorilla and the chimpanzee, Pan troglodytes) and in three members of the Cercopithecoidea family of Old World primates (the diana monkey, Cercopithecus diana, the talapoin monkey, Miopithecus talapoin, and the crab-eating macaque, Macaca fascicularis). No variation in the codons that specify the amino acids involved in spectral tuning were found. We predict therefore that the MW and LW pigments of gorilla and chimpanzee have similar spectral characteristics to those of man. Multiple copies of the same opsin gene sequence were identified in the chimpanzee, talapoin and macaque and we also show that non-human Old World primates are similar to man in showing a bunching of polymorphic sites in exon 3. We discuss the ancestry of the separate MW and LW genes of Old World primates and the equivalent polymorphic gene of the marmoset, a New World primate. PMID:7975287

  14. The human receptor for urokinase plasminogen activator. NH2-terminal amino acid sequence and glycosylation variants

    Behrendt, N; Rønne, E; Ploug, M; Petri, T; Løber, D; Nielsen, L S; Schleuning, W D; Blasi, F; Appella, E; Danø, K

    1990-01-01

    -PA. The purified protein shows a single 55-60 kDa band after sodium dodecyl sulfate-polyacrylamide gel electrophoresis and silver staining. It is a heavily glycosylated protein, the deglycosylated polypeptide chain comprising only 35 kDa. The glycosylated protein contains N-acetyl-D-glucosamine and sialic...... acid, but no N-acetyl-D-galactosamine. Glycosylation is responsible for substantial heterogeneity in the receptor on phorbol ester-stimulated U937 cells, and also for molecular weight variations among various cell lines. The amino acid composition and the NH2-terminal amino acid sequence are reported...

  15. Molecular cloning and sequence analysis of cDNA encoding human prostatic acid phosphatase.

    Vihko, P; Virkkunen, P; Henttu, P; Roiko, K; Solin, T; Huhtala, M L

    1988-08-29

    lambda gt11 clones encoding human prostatic acid phosphatase (PAP) (EC 3.1.3.2) were isolated from human prostatic cDNA libraries by immunoscreening with polyclonal antisera. Sequence data obtained from several overlapping clones indicated that the composite cDNAs contained the complete coding region for PAP, which encodes a 354-residue protein with a calculated molecular mass of 41,126 Da. In the 5'-end, the cDNA codes for a signal peptide of 32 amino acids. Direct protein sequencing of the amino-terminus of the mature protein and its proteolytic fragments confirmed the identity of the predicted protein sequence. PAP has no apparent sequence homology to other known proteins. However, both the cDNA clones coding for human placental alkaline phosphatase and PAP have an alu-type repetitive sequence about 900 nucleotides downstream from the coding region in the 3'-untranslated region. Two of our cDNA clones differed from others at the 5'-ends. RNA blot analysis indicated mRNA of 3.3 kb. We are continuing to study whether acid phosphatases form a gene family as do alkaline phosphatases. PMID:2842184

  16. Draft Genome Sequence of Perfluorooctane Acid-Degrading Bacterium Pseudomonas parafulva YAB-1

    Yi, Langbo; Tang, Chongjian; Peng, Qingjing; Peng, Qingzhong; Chai, Liyuan

    2015-01-01

    Pseudomonas parafulva YAB-1, isolated from perfluorinated compound-contaminated soil, has the ability to degrade perfluorooctane acid (PFOA) compound. Here, we report the draft genome sequence and annotation of the PFOA-degrading bacterium P. parafulva YAB-1. The data provide the basis to investigate the molecular mechanism of PFOA metabolism.

  17. Draft Genome Sequence of Perfluorooctane Acid-Degrading Bacterium Pseudomonas parafulva YAB-1

    Tang, Chongjian; Peng, Qingjing; Peng, Qingzhong

    2015-01-01

    Pseudomonas parafulva YAB-1, isolated from perfluorinated compound-contaminated soil, has the ability to degrade perfluorooctane acid (PFOA) compound. Here, we report the draft genome sequence and annotation of the PFOA-degrading bacterium P. parafulva YAB-1. The data provide the basis to investigate the molecular mechanism of PFOA metabolism. PMID:26337877

  18. Visualization of Iron-Binding Micelles in Acidic Recombinant Biomineralization Protein, MamC

    Kashyap, Sanjay [Ames Laboratory; Woehl, Taylor [Ames Laboratory; Valverde-Tercedor, Carmen [University of Granada; Sanchez-Quesada, Miguel [University of Granada; Lopez, Concepcion Jimenez [University of Granada; Prozorov, Tanya [Ames Laboratory

    2014-03-07

    Biological macromolecules are utilized in low-temperature synthetic methods to exert precise control over nanoparticle nucleation and placement. They enable low-temperature formation of a variety of functional nanostructured materials with properties often not achieved via conventional synthetic techniques. Here we report on the in situ visualization of a novel acidic bacterial recombinant protein, MamC, commonly present in the magnetosome membrane of several magnetotactic bacteria, including Magnetococcus marinus, strain MC-1. Our findings provide an insight into the self-assembly of MamC and point to formation of the extended protein surface, which is assumed to play an important role in the formation of biotemplated inorganic nanoparticles. The self-organization of MamC is compared to the behavior of another acidic recombinant iron-binding protein, Mms6.

  19. Fetal magnetic resonance imaging of normal spinal cord: Evaluating cord visualization and conus medullaris position by T2-weighted sequences

    Yen-Ling Huang

    2014-08-01

    Full Text Available Background: Prenatal magnetic resonance (MR imaging demonstration of the normal spinal cord and the conus medullaris location has not been well studied. We compared balanced fast field echo (bFFE with single-shot turbo spin-echo (SSh-TSE MR sequences for visualizing the normal spinal cord and position of conus medullaris in fetuses. Methods: This retrospective study was approved by the Institutional Review Board of Chang Gung Medical Foundation. We reviewed the MR images of 141 fetuses aged between 16 and 39 gestational weeks, to determine the position of the conus and visualize the spinal cord by using a signal intensity ratio of cerebral spinal fluid (CSF to the spinal cord. Results: Of the 75 subjects having normal spinal cord and being examined by both bFFE and SSh-TSE studies, the signal intensity ratio of CSF/cord was greater on bFFE images (2.18 ± 0.53 than that on SSh-TSE images (1.21 ± 0.13 (p < 0.05. The conus level identified in the 50 subjects, in whom the lumbosacral spine was appropriately imaged, was located from L1 to L5 levels. The ascendance of the conus correlated moderately with gestational age. Conclusions: With greater signal contrast ratio of CSF to spinal cord, bFFE sequence, when compared with SSh-TSE sequence, provides better visualization of normal spinal cord. The fetal conus medullaris ascends from L5 to L1 levels as the gestational age increases.

  20. Use of a structural alphabet to find compatible folds for amino acid sequences.

    Mahajan, Swapnil; de Brevern, Alexandre G; Sanejouand, Yves-Henri; Srinivasan, Narayanaswamy; Offmann, Bernard

    2015-01-01

    The structural annotation of proteins with no detectable homologs of known 3D structure identified using sequence-search methods is a major challenge today. We propose an original method that computes the conditional probabilities for the amino-acid sequence of a protein to fit to known protein 3D structures using a structural alphabet, known as "Protein Blocks" (PBs). PBs constitute a library of 16 local structural prototypes that approximate every part of protein backbone structures. It is used to encode 3D protein structures into 1D PB sequences and to capture sequence to structure relationships. Our method relies on amino acid occurrence matrices, one for each PB, to score global and local threading of query amino acid sequences to protein folds encoded into PB sequences. It does not use any information from residue contacts or sequence-search methods or explicit incorporation of hydrophobic effect. The performance of the method was assessed with independent test datasets derived from SCOP 1.75A. With a Z-score cutoff that achieved 95% specificity (i.e., less than 5% false positives), global and local threading showed sensitivity of 64.1% and 34.2%, respectively. We further tested its performance on 57 difficult CASP10 targets that had no known homologs in PDB: 38 compatible templates were identified by our approach and 66% of these hits yielded correctly predicted structures. This method scales-up well and offers promising perspectives for structural annotations at genomic level. It has been implemented in the form of a web-server that is freely available at http://www.bo-protscience.fr/forsa. PMID:25297700

  1. SeqVISTA: a graphical tool for sequence feature visualization and comparison

    Niu Tianhua

    2003-01-01

    Full Text Available Abstract Background Many readers will sympathize with the following story. You are viewing a gene sequence in Entrez, and you want to find whether it contains a particular sequence motif. You reach for the browser's "find in page" button, but those darn spaces every 10 bp get in the way. And what if the motif is on the opposite strand? Subsequently, your favorite sequence analysis software informs you that there is an interesting feature at position 13982–14013. By painstakingly counting the 10 bp blocks, you are able to examine the sequence at this location. But now you want to see what other features have been annotated close by, and this information is buried several screenfuls higher up the web page. Results SeqVISTA presents a holistic, graphical view of features annotated on nucleotide or protein sequences. This interactive tool highlights the residues in the sequence that correspond to features chosen by the user, and allows easy searching for sequence motifs or extraction of particular subsequences. SeqVISTA is able to display results from diverse sequence analysis tools in an integrated fashion, and aims to provide much-needed unity to the bioinformatics resources scattered around the Internet. Our viewer may be launched on a GenBank record by a single click of a button installed in the web browser. Conclusion SeqVISTA allows insights to be gained by viewing the totality of sequence annotations and predictions, which may be more revealing than the sum of their parts. SeqVISTA runs on any operating system with a Java 1.4 virtual machine. It is freely available to academic users at http://zlab.bu.edu/SeqVISTA.

  2. Software scripts for quality checking of high-throughput nucleic acid sequencers.

    Lazo, G R; Tong, J; Miller, R; Hsia, C; Rausch, C; Kang, Y; Anderson, O D

    2001-06-01

    We have developed a graphical interface to allow the researcher to view and assess the quality of sequencing results using a series of program scripts developed to process data generated by automated sequencers. The scripts are written in Perl programming language and are executable under the cgibin directory of a Web server environment. The scripts direct nucleic acid sequencing trace file data output from automated sequencers to be analyzed by the phred molecular biology program and are displayed as graphical hypertext mark-up language (HTML) pages. The scripts are mainly designed to handle 96-well microtiter dish samples, but the scripts are also able to read data from 384-well microtiter dishes 96 samples at a time. The scripts may be customized for different laboratory environments and computer configurations. Web links to the sources and discussion page are provided. PMID:11414222

  3. Amino acid sequences and structures of chicken and turkey beta 2-microglobulin

    Welinder, K G; Jespersen, H M; Walther-Rasmussen, J; Skjødt, K

    The complete amino acid sequences of chicken and turkey beta 2-microglobulins have been determined by analyses of tryptic, V8-proteolytic and cyanogen bromide fragments, and by N-terminal sequencing. Mass spectrometric analysis of chicken beta 2-microglobulin supports the sequence-derived Mr of 11......,048. The higher apparent Mr obtained for the avian beta 2-microglobulins as compared to human beta 2-microglobulin by SDS-PAGE is not understood. Chicken and turkey beta 2-microglobulin consist of 98 residues and deviate at seven positions: 60, 66, 74-76, 78 and 82. The chicken and turkey sequences are...... complex suggest that the seven chicken to turkey differences are exposed to solvent in the avian MHC class I complex. The key residues of beta 2-microglobulin involved in alpha chain contacts within the MHC class I molecule are highly conserved between chicken and man. This explains that heterologous...

  4. Agreement Between Visual Inspection with Acetic Acid and Papanicolaous Smear as Screening Methods for Cervical Cancer

    Objective: To determine degree of agreement between visual inspection with acetic acid (VIA) and Papanicolaous (Pap) smear as screening methods for cervical cancer. Study Design: A cross-sectional study. Place and Duration of Study: Department of Obstetrics and Gynaecology, Sir Ganga Ram Hospital, Lahore, from July to December 2012. Methodology: Two hundred and fifty women in reproductive age group presenting with various gynaecological complaints were included in the study. A Papanicolaous smear was taken and visual inspection with 5% acetic acid was done. VIA was reported as positive or negative according to acetowhite changes and cytology result was graded as CIN 1, 2, 3 and squamous carcinoma. Those women who showed positive result with either VIA or Pap smear or both were further subjected to colposcopic directed biopsy which was taken as gold standard. Results were computed using Statistical Package for Social Sciences (SPSS) version 16 and statistical test used was kappa. Results: Out of 250 women, VIA was positive in 55 (22%) patients and Pap smear was abnormal in 27 (10.8%). Histological diagnosis of CIN/cancer was made in 36 out of a total 62 patients who underwent biopsy. Conclusion: There was a fair agreement between VIA and Pap smear, with VIA detecting more abnormalities than cytology. In the absence of Pap smear availability, VIA may be a reasonable cervical cancer screening method, especially in low resource settings. (author)

  5. Visualization of early events in acetic acid denaturation of HIV-1 protease: a molecular dynamics study.

    Aditi Narendra Borkar

    Full Text Available Protein denaturation plays a crucial role in cellular processes. In this study, denaturation of HIV-1 Protease (PR was investigated by all-atom MD simulations in explicit solvent. The PR dimer and monomer were simulated separately in 9 M acetic acid (9 M AcOH solution and water to study the denaturation process of PR in acetic acid environment. Direct visualization of the denaturation dynamics that is readily available from such simulations has been presented. Our simulations in 9 M AcOH reveal that the PR denaturation begins by separation of dimer into intact monomers and it is only after this separation that the monomer units start denaturing. The denaturation of the monomers is flagged off by the loss of crucial interactions between the α-helix at C-terminal and surrounding β-strands. This causes the structure to transit from the equilibrium dynamics to random non-equilibrating dynamics. Residence time calculations indicate that denaturation occurs via direct interaction of the acetic acid molecules with certain regions of the protein in 9 M AcOH. All these observations have helped to decipher a picture of the early events in acetic acid denaturation of PR and have illustrated that the α-helix and the β-sheet at the C-terminus of a native and functional PR dimer should maintain both the stability and the function of the enzyme and thus present newer targets for blocking PR function.

  6. PHYLOViZ: phylogenetic inference and data visualization for sequence based typing methods

    Francisco Alexandre P; Vaz Ctia; Monteiro Pedro T; Melo-Cristino José; Ramirez Mário; Carrio Joo A

    2012-01-01

    Abstract Background With the decrease of DNA sequencing costs, sequence-based typing methods are rapidly becoming the gold standard for epidemiological surveillance. These methods provide reproducible and comparable results needed for a global scale bacterial population analysis, while retaining their usefulness for local epidemiological surveys. Online databases that collect the generated allelic profiles and associated epidemiological data are available but this wealth of data remains under...

  7. Nucleotide sequence analysis of the gene encoding the Deinococcus radiodurans surface protein, derived amino acid sequence, and complementary protein chemical studies

    Peters, J.; Peters, M.; Lottspeich, F.; Schaefer, W.; Baumeister, W.

    1987-11-01

    The complete nucleotide sequence of the gene encoding the surface (hexagonally packed intermediate (HPI))-layer polypeptide of Deinococcus radiodurans Sark was determined and found to encode a polypeptide of 1036 amino acids. Amino acid sequence analysis of about 30% of the residues revealed that the mature polypeptide consists of at least 978 amino acids. The N terminus was blocked to Edman degradation. The results of proteolytic modification of the HPI layer in situ and M/sub r/ estimations of the HPI polypeptide expressed in Escherichia coli indicated that there is a leader sequence. The N-terminal region contained a very high percentage (29%) of threonine and serine, including a cluster of nine consecutive serine or threonine residues, whereas a stretch near the C terminus was extremely rich in aromatic amino acids (29%). The protein contained at least two disulfide bridges, as well as tightly bound reducing sugars and fatty acids.

  8. Nucleotide sequence analysis of the gene encoding the Deinococcus radiodurans surface protein, derived amino acid sequence, and complementary protein chemical studies

    The complete nucleotide sequence of the gene encoding the surface (hexagonally packed intermediate [HPI])-layer polypeptide of Deinococcus radiodurans Sark was determined and found to encode a polypeptide of 1036 amino acids. Amino acid sequence analysis of about 30% of the residues revealed that the mature polypeptide consists of at least 978 amino acids. The N terminus was blocked to Edman degradation. The results of proteolytic modification of the HPI layer in situ and M/sub r/ estimations of the HPI polypeptide expressed in Escherichia coli indicated that there is a leader sequence. The N-terminal region contained a very high percentage (29%) of threonine and serine, including a cluster of nine consecutive serine or threonine residues, whereas a stretch near the C terminus was extremely rich in aromatic amino acids (29%). The protein contained at least two disulfide bridges, as well as tightly bound reducing sugars and fatty acids

  9. Efficient Nucleic Acid Extraction and 16S rRNA Gene Sequencing for Bacterial Community Characterization.

    Anahtar, Melis N; Bowman, Brittany A; Kwon, Douglas S

    2016-01-01

    There is a growing appreciation for the role of microbial communities as critical modulators of human health and disease. High throughput sequencing technologies have allowed for the rapid and efficient characterization of bacterial communities using 16S rRNA gene sequencing from a variety of sources. Although readily available tools for 16S rRNA sequence analysis have standardized computational workflows, sample processing for DNA extraction remains a continued source of variability across studies. Here we describe an efficient, robust, and cost effective method for extracting nucleic acid from swabs. We also delineate downstream methods for 16S rRNA gene sequencing, including generation of sequencing libraries, data quality control, and sequence analysis. The workflow can accommodate multiple samples types, including stool and swabs collected from a variety of anatomical locations and host species. Additionally, recovered DNA and RNA can be separated and used for other applications, including whole genome sequencing or RNA-seq. The method described allows for a common processing approach for multiple sample types and accommodates downstream analysis of genomic, metagenomic and transcriptional information. PMID:27168460

  10. Preparation of Nucleic Acid Libraries for Personalized Sequencing Systems Using an Integrated Microfluidic Hub Technology (Seventh Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting 2012)

    Patel, Kamlesh D [Ken; SNL,

    2012-06-01

    Kamlesh (Ken) Patel from Sandia National Laboratories (Livermore, California) presents "Preparation of Nucleic Acid Libraries for Personalized Sequencing Systems Using an Integrated Microfluidic Hub Technology " at the 7th Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting held in June, 2012 in Santa Fe, NM.

  11. Human liver type pyruvate kinase: Complete amino acid sequence and the expression in mammalian cells

    Pyruvate kinase (PK) has four isozymes (L, R, M1, M2) that are encoded by two different genes. Among these isozymes, abnormalities of liver (L)-type PK is considered to be associated with hereditary nonspherocytic hemolytic anemia in humans. The authors isolated and determined the full-length sequence of human L-type PK cDNA. The cDNA contains 1,629 base pairs encoding 543 amino acids, 68 base pairs of 5'-noncoding sequence, and 734 base pairs of 3'-noncoding sequence. The similarity between human and rat L-type PK was 86.9% at the nucleotide sequence level and 92.4% at the amino acid sequence level. The full-length L-type PK cDNA was placed under the promoter of simian virus 40 and introduced into monkey COS cells. Human L-type PK activity was detected in the extract of COS cells by the classical PK electrophoresis method

  12. Complete nucleic acid sequence of Penaeus stylirostris densovirus (PstDNV) from India.

    Rai, Praveen; Safeena, Muhammed P; Karunasagar, Iddya; Karunasagar, Indrani

    2011-06-01

    Infectious hypodermal and hematopoietic necrosis virus (IHHNV) of shrimp, recently been classified as Penaeus stylirostris densovirus (PstDNV). The complete nucleic acid sequence of PstDNV from India was obtained by cloning and sequencing of different DNA fragment of the virus. The genome organisation of PstDNV revealed that there were three major coding domains: a left ORF (NS1) of 2001 bp, a mid ORF (NS2) of 1092 bp and a right ORF (VP) of 990 bp. The complete genome and amino acid sequences of three proteins viz., NS1, NS2 and VP were compared with the genomes of the virus reported from Hawaii, China and Mexico and with partial sequence available from isolates from different regions. The phylogenetic analysis of shrimp, insect and vertebrate parvovirus sequences showed that the Indian PstDNV isolate is phylogenetically more closely related to one of the three isolates from Taiwan (AY355307), and two isolates (AY362547 and AY102034) from Thailand. PMID:21402111

  13. Fluorescent Probes for Nucleic Acid Visualization in Fixed and Live Cells

    Alexandre S. Boutorine

    2013-12-01

    Full Text Available This review analyses the literature concerning non-fluorescent and fluorescent probes for nucleic acid imaging in fixed and living cells from the point of view of their suitability for imaging intracellular native RNA and DNA. Attention is mainly paid to fluorescent probes for fluorescence microscopy imaging. Requirements for the target-binding part and the fluorophore making up the probe are formulated. In the case of native double-stranded DNA, structure-specific and sequence-specific probes are discussed. Among the latest, three classes of dsDNA-targeting molecules are described: (i sequence-specific peptides and proteins; (ii triplex-forming oligonucleotides and (iii polyamide oligo(N-methylpyrrole/N-methylimidazole minor groove binders. Polyamides seem to be the most promising targeting agents for fluorescent probe design, however, some technical problems remain to be solved, such as the relatively low sequence specificity and the high background fluorescence inside the cells. Several examples of fluorescent probe applications for DNA imaging in fixed and living cells are cited. In the case of intracellular RNA, only modified oligonucleotides can provide such sequence-specific imaging. Several approaches for designing fluorescent probes are considered: linear fluorescent probes based on modified oligonucleotide analogs, molecular beacons, binary fluorescent probes and template-directed reactions with fluorescence probe formation, FRET donor-acceptor pairs, pyrene excimers, aptamers and others. The suitability of all these methods for living cell applications is discussed.

  14. Nucleotide and amino acid sequences of human intestinal alkaline phosphatase: close homology to placental alkaline phosphatase

    A cDNA clone for human adult intestinal alkaline phosphatase (ALP) [orthophosphoric-monoester phosphohydrolase (alkaline optimum); EC 3.1.3.1] was isolated from a λgt11 expression library. The cDNA insert of this clone is 2513 base pairs in length and contains an open reading frame that encodes a 528-amino acid polypeptide. This deduced polypeptide contains the first 40 amino acids of human intestinal ALP, as determined by direct protein sequencing. Intestinal ALP shows 86.5% amino acid identity to placental (type 1) ALP and 56.6% amino acid identity to liver/bone/kidney ALP. In the 3'-untranslated regions, intestinal and placental ALP cDNAs are 73.5% identical (excluding gaps). The evolution of this multigene enzyme family is discussed

  15. Human apolipoprotein C-II: complete nucleic acid sequence of preapolipoprotein C-II.

    Fojo, S S; Law, S W; Brewer, H B

    1984-01-01

    Apolipoprotein (apo) C-II is a cofactor for lipoprotein lipase, the enzyme that catalyzes the hydrolysis of triglycerides on plasma triglyceride-rich lipoproteins. The complete coding sequence of apoC-II mRNA has been determined from an apoC-II clone isolated from a human liver cDNA library. A 17-base-long synthetic oligonucleotide based on amino acid residues 5-10 of apoC-II was utilized as a hybridization probe to select recombinant plasmids containing the apoC-II sequence. Two thousand fou...

  16. Amino acid sequence of the beta subunit of bovine lung casein kinase II.

    Takio, K.; Kuenzel, E A; Walsh, K. A.; Krebs, E G

    1987-01-01

    The amino acid sequence of the 209-residue beta subunit of bovine lung casein kinase II has been determined. Excluding the amino-terminal blocking group, which was not identified, the molecular weight of the polypeptide chain is 24,239. A marked polarity of the beta subunit is indicated by clusters of negative charges in the amino-terminal region and of positive charges in the carboxyl-terminal region. Whereas the beta subunit shows no homology with any known protein, a segment of the sequenc...

  17. Visualization of the 12th Cranial Nerve with MRI: Value of Balanced Fast-Field Echo and 3D-Drive Sequences Among the T2 TSE Post-Contrast T1 Sequences

    Aydin, H.; N Aydin Oktay; B Hekimoglu

    2010-01-01

    Background/Objective: Our aim was to optimize the most effective MR imaging sequence for visualization of the 12th cranial nerve (hypoglossal nerve) through its cisternal course."nPatients and Methods: We applied balanced fast-field echo (B-FFE), 3D-T2 weighted Driven Equilibrium RF Reset Pulse (DRIVE), T2 weighted 2D TSE and post-contrast T1 weighted sequences and tried to find out the best sequence for the perfect visualization of the 12th cranial nerve. One-hundred patients without an...

  18. Automatic classification of lung tumour heterogeneity according to a visual-based score system in dynamic contrast enhanced CT sequences

    Bevilacqua, Alessandro; Baiocco, Serena

    2016-03-01

    Computed tomography (CT) technologies have been considered for a long time as one of the most effective medical imaging tools for morphological analysis of body parts. Contrast Enhanced CT (CE-CT) also allows emphasising details of tissue structures whose heterogeneity, inspected through visual analysis, conveys crucial information regarding diagnosis and prognosis in several clinical pathologies. Recently, Dynamic CE-CT (DCE-CT) has emerged as a promising technique to perform also functional hemodynamic studies, with wide applications in the oncologic field. DCE-CT is based on repeated scans over time performed after intravenous administration of contrast agent, in order to study the temporal evolution of the tracer in 3D tumour tissue. DCE-CT pushes towards an intensive use of computers to provide automatically quantitative information to be used directly in clinical practice. This requires that visual analysis, representing the gold-standard for CT image interpretation, gains objectivity. This work presents the first automatic approach to quantify and classify the lung tumour heterogeneities based on DCE-CT image sequences, so as it is performed through visual analysis by experts. The approach developed relies on the spatio-temporal indices we devised, which also allow exploiting temporal data that enrich the knowledge of the tissue heterogeneity by providing information regarding the lesion status.

  19. HBVRegDB: Annotation, comparison, detection and visualization of regulatory elements in hepatitis B virus sequences

    Firth Andrew E

    2007-12-01

    Full Text Available Abstract Background The many Hepadnaviridae sequences available have widely varied functional annotation. The genomes are very compact (~3.2 kb but contain multiple layers of functional regulatory elements in addition to coding regions. Key regions are subject to purifying selection, as mutations in these regions will produce non-functional viruses. Results These genomic sequences have been organized into a structured database to facilitate research at the molecular level. HBVRegDB is a comparative genomic analysis tool with an integrated underlying sequence database. The database contains genomic sequence data from representative viruses. In addition to INSDC and RefSeq annotation, HBVRegDB also contains expert and systematically calculated annotations (e.g. promoters and comparative genome analysis results (e.g. blastn, tblastx. It also contains analyses based on curated HBV alignments. Information about conserved regions – including primary conservation (e.g. CDS-Plotcon and RNA secondary structure predictions (e.g. Alidot – is integrated into the database. A large amount of data is graphically presented using the GBrowse (Generic Genome Browser adapted for analysis of viral genomes. Flexible query access is provided based on any annotated genomic feature. Novel regulatory motifs can be found by analysing the annotated sequences. Conclusion HBVRegDB serves as a knowledge database and as a comparative genomic analysis tool for molecular biologists investigating HBV. It is publicly available and complementary to other viral and HBV focused datasets and tools http://hbvregdb.otago.ac.nz. The availability of multiple and highly annotated sequences of viral genomes in one database combined with comparative analysis tools facilitates detection of novel genomic elements.

  20. Sequence-specific nucleic acid detection from binary pore conductance measurement

    Esfandiari, Leyla; Monbouquette, Harold G.; Jacob J. Schmidt

    2012-01-01

    We describe a platform for sequence-specific nucleic acid (NA) detection utilizing a micropipette tapered to a 2 μm diameter pore and 3 μm diameter polystyrene beads to which uncharged peptide nucleic acid (PNA) probe molecules have been conjugated. As the target NAs hybridize to the complementary PNA-beads, the beads acquire negative charge and become electrophoretically mobile. An applied electric field guides these NA-PNA-beads toward the pipette tip, which they obstruct, leading to an ind...

  1. Nucleotide sequence homology between the heat-labile enterotoxin gene of Escherichia coli and Vibrio cholerae deoxyribonucleic acid.

    Moseley, S L; Falkow, S

    1980-01-01

    Isolated deoxyribonucleic acid fragments encoding the heat-labile enterotoxin of Escherichia coli were used to probe for homologous sequences in restricted whole-cell deoxyribonucleic acid from Vibrio cholerae. Significant sequence homology between the heat-labile enterotoxin gene and V. cholerae deoxyribonucleic acid was demonstrated, and apparent differences were observed in the organization of the cholera toxin gene among different strains of V. cholerae.

  2. Visualization of the mycelia of wood-rotting fungi by fluorescence in situ hybridization using a peptide nucleic acid probe.

    Nakada, Yuji; Nakaba, Satoshi; Matsunaga, Hiroshi; Funada, Ryo; Yoshida, Makoto

    2013-01-01

    White rot fungus, Phanerochaete chrysosporium, and brown rot fungus, Postia placenta, grown on agar plates, were visualized by fluorescence in situ hybridization (FISH) using a peptide nucleic acid (PNA) probe. Mycelia grown on wood chips were also clearly detected by PNA-FISH following blocking treatment. To the best of our knowledge, this is the first report on the visualization of fungi in wood by FISH. PMID:23391931

  3. Self-Sequencing of Amino Acids and Origins of Polyfunctional Protocells

    Fox, Sidney W.

    1984-12-01

    The primal role of the origins of proteins in molecular evolution is discussed. On the basis of this premise, the significance of the experimentally established self-sequencing of amino acids under simulated geological conditions is explained as due to the fact that the products are highly nonrandom and accordingly contain many kinds of information. When such thermal proteins are aggregated into laboratory protocells, an action that occurs readily, the resultant protocells also contain many kinds of information. Residue-by-residue order, enzymic activities, and lipid quality accordingly occur within each preparation of proteinoid (thermal protein). In this paper are reviewed briefly the phenomenon of self-sequencing of amino acids, its relationship to evolutionary processes, other significance of such self-ordering, and the experimental evidence for original polyfunctional protocells.

  4. Anti-peptide aptamers recognize amino acid sequence and bind a protein epitope.

    Xu, W; Ellington, A. D.

    1996-01-01

    In vitro selection of nucleic acid binding species (aptamers) is superficially similar to the immune response. Both processes produce biopolymers that can recognize targets with high affinity and specificity. While antibodies are known to recognize the sequence and conformation of protein surface features (epitopes), very little is known about the precise interactions between aptamers and their epitopes. Therefore, aptamers that could recognize a particular epitope, a peptide fragment of huma...

  5. Sequence-selective targeting of duplex DNA by peptide nucleic acids

    Nielsen, Peter E

    2010-01-01

    nucleic acid (PNA) can recognize duplex DNA with high sequence specificity and affinity in triplex, duplex and double-duplex invasive modes or non-invasive triplex modes. Novel PNA modification has improved the affinity for DNA recognition via duplex invasion, double-duplex invasion and triplex......Sequence-selective gene targeting constitutes an attractive drug-discovery approach for genetic therapy, with the aim of reducing or enhancing the activity of specific genes at the transcriptional level, or as part of a methodology for targeted gene repair. The pseudopeptide DNA mimic peptide...... recognition considerably. Such modifications have also resulted in new approaches to targeted gene repair and sequence-selective double-strand cleavage of genomic DNA....

  6. Amino acid sequences mediating vascular cell adhesion molecule 1 binding to integrin alpha 4: homologous DSP sequence found for JC polyoma VP1 coat protein

    Michael Andrew Meyer

    2013-07-01

    Full Text Available The JC polyoma viral coat protein VP1 was analyzed for amino acid sequences homologies to the IDSP sequence which mediates binding of VLA-4 (integrin alpha 4 to vascular cell adhesion molecule 1. Although the full sequence was not found, a DSP sequence was located near the critical arginine residue linked to infectivity of the virus and binding to sialic acid containing molecules such as integrins (3. For the JC polyoma virus, a DSP sequence was found at residues 70, 71 and 72 with homology also noted for the mouse polyoma virus and SV40 virus. Three dimensional modeling of the VP1 molecule suggests that the DSP loop has an accessible site for interaction from the external side of the assembled viral capsid pentamer.

  7. Random amino acid mutations and protein misfolding lead to Shannon limit in sequence-structure communication.

    Andreas Martin Lisewski

    Full Text Available The transmission of genomic information from coding sequence to protein structure during protein synthesis is subject to stochastic errors. To analyze transmission limits in the presence of spurious errors, Shannon's noisy channel theorem is applied to a communication channel between amino acid sequences and their structures established from a large-scale statistical analysis of protein atomic coordinates. While Shannon's theorem confirms that in close to native conformations information is transmitted with limited error probability, additional random errors in sequence (amino acid substitutions and in structure (structural defects trigger a decrease in communication capacity toward a Shannon limit at 0.010 bits per amino acid symbol at which communication breaks down. In several controls, simulated error rates above a critical threshold and models of unfolded structures always produce capacities below this limiting value. Thus an essential biological system can be realistically modeled as a digital communication channel that is (a sensitive to random errors and (b restricted by a Shannon error limit. This forms a novel basis for predictions consistent with observed rates of defective ribosomal products during protein synthesis, and with the estimated excess of mutual information in protein contact potentials.

  8. Characterization of the microbial acid mine drainage microbial community using culturing and direct sequencing techniques.

    Auld, Ryan R; Myre, Maxine; Mykytczuk, Nadia C S; Leduc, Leo G; Merritt, Thomas J S

    2013-05-01

    We characterized the bacterial community from an AMD tailings pond using both classical culturing and modern direct sequencing techniques and compared the two methods. Acid mine drainage (AMD) is produced by the environmental and microbial oxidation of minerals dissolved from mining waste. Surprisingly, we know little about the microbial communities associated with AMD, despite the fundamental ecological roles of these organisms and large-scale economic impact of these waste sites. AMD microbial communities have classically been characterized by laboratory culturing-based techniques and more recently by direct sequencing of marker gene sequences, primarily the 16S rRNA gene. In our comparison of the techniques, we find that their results are complementary, overall indicating very similar community structure with similar dominant species, but with each method identifying some species that were missed by the other. We were able to culture the majority of species that our direct sequencing results indicated were present, primarily species within the Acidithiobacillus and Acidiphilium genera, although estimates of relative species abundance were only obtained from direct sequencing. Interestingly, our culture-based methods recovered four species that had been overlooked from our sequencing results because of the rarity of the marker gene sequences, likely members of the rare biosphere. Further, direct sequencing indicated that a single genus, completely missed in our culture-based study, Legionella, was a dominant member of the microbial community. Our results suggest that while either method does a reasonable job of identifying the dominant members of the AMD microbial community, together the methods combine to give a more complete picture of the true diversity of this environment. PMID:23485423

  9. Metazoan Remaining Genes for Essential Amino Acid Biosynthesis: Sequence Conservation and Evolutionary Analyses

    Igor R. Costa

    2014-12-01

    Full Text Available Essential amino acids (EAA consist of a group of nine amino acids that animals are unable to synthesize via de novo pathways. Recently, it has been found that most metazoans lack the same set of enzymes responsible for the de novo EAA biosynthesis. Here we investigate the sequence conservation and evolution of all the metazoan remaining genes for EAA pathways. Initially, the set of all 49 enzymes responsible for the EAA de novo biosynthesis in yeast was retrieved. These enzymes were used as BLAST queries to search for similar sequences in a database containing 10 complete metazoan genomes. Eight enzymes typically attributed to EAA pathways were found to be ubiquitous in metazoan genomes, suggesting a conserved functional role. In this study, we address the question of how these genes evolved after losing their pathway partners. To do this, we compared metazoan genes with their fungal and plant orthologs. Using phylogenetic analysis with maximum likelihood, we found that acetolactate synthase (ALS and betaine-homocysteine S-methyltransferase (BHMT diverged from the expected Tree of Life (ToL relationships. High sequence conservation in the paraphyletic group Plant-Fungi was identified for these two genes using a newly developed Python algorithm. Selective pressure analysis of ALS and BHMT protein sequences showed higher non-synonymous mutation ratios in comparisons between metazoans/fungi and metazoans/plants, supporting the hypothesis that these two genes have undergone non-ToL evolution in animals.

  10. Complete Genome Sequence of the Probiotic Lactic Acid Bacterium Lactobacillus Rhamnosus

    Samat Kozhakhmetov

    2014-01-01

    Full Text Available Introduction: Lactobacilli are a bacteria commonly found in the gastrointestinal tract. Some species of this genus have probiotic properties. The most common of these is Lactobacillus rhamnosus, a microoganism, generally regarded as safe (GRAS. It is also a homofermentative L-(+-lactic acid producer. The genus Lactobacillus is characterized by an extraordinary degree of the phenotypic and genotypic diversity. However, the studies of the genus were conducted mostly with the unequally distributed, non-random choice of species for sequencing; thus, there is only one representative genome from the Lactobacillus rhamnosus clade available to date. The aim of this study was to characterize the genome sequencing of selected strains of Lactobacilli. Methods: 109 samples were isolated from national domestic dairy products in the laboratory of Center for life sciences. After screaning isolates for probiotic properties, a highly active Lactobacillus spp strain was chosen. Genomic DNA was extracted according to the manufacturing protocol (Wizard® Genomic DNA Purification Kit. The Lactobacillus rhamnosus strain was identified as the highly active Lactobacillus strain accoridng to its morphological, cultural, physiological, and biochemical properties, and a genotypic analysis. Results: The genome of Lactobacillus rhamnosus was sequenced using the Roche 454 GS FLX (454 GS FLX platforms. The initial draft assembly was prepared from 14 large contigs (20 all contigs by the Newbler gsAssembler 2.3 (454 Life Sciences, Branford, CT. Conclusion: A full genome-sequencing of selected strains of lactic acid bacteria was made during the study.

  11. Draft Genome Sequence of Acid-Tolerant Clostridium drakei SL1T, a Potential Chemical Producer through Syngas Fermentation

    Jeong, Yujin; Song, Yoseb; Shin, Hyeon Seok; Cho, Byung-Kwan

    2014-01-01

    Clostridium drakei SL1T is a strictly anaerobic, H2-utilizing, and acid-tolerant acetogen isolated from an acidic sediment that is a potential platform for commodity chemical production from syngas fermentation. The draft genome sequence of this strain will enable determination of the acid resistance and autotrophic pathway of the acetogen.

  12. Nanopore Analysis of Nucleic Acids: Single-Molecule Studies of Molecular Dynamics, Structure, and Base Sequence

    Olasagasti, Felix; Deamer, David W.

    Nucleic acids are linear polynucleotides in which each base is covalently linked to a pentose sugar and a phosphate group carrying a negative charge. If a pore having roughly the crosssectional diameter of a single-stranded nucleic acid is embedded in a thin membrane and a voltage of 100 mV or more is applied, individual nucleic acids in solution can be captured by the electrical field in the pore and translocated through by single-molecule electrophoresis. The dimensions of the pore cannot accommodate anything larger than a single strand, so each base in the molecule passes through the pore in strict linear sequence. The nucleic acid strand occupies a large fraction of the pore's volume during translocation and therefore produces a transient blockade of the ionic current created by the applied voltage. If it could be demonstrated that each nucleotide in the polymer produced a characteristic modulation of the ionic current during its passage through the nanopore, the sequence of current modulations would reflect the sequence of bases in the polymer. According to this basic concept, nanopores are analogous to a Coulter counter that detects nanoscopic molecules rather than microscopic [1,2]. However, the advantage of nanopores is that individual macromolecules can be characterized because different chemical and physical properties affect their passage through the pore. Because macromolecules can be captured in the pore as well as translocated, the nanopore can be used to detect individual functional complexes that form between a nucleic acid and an enzyme. No other technique has this capability.

  13. Prediction of protein motions from amino acid sequence and its application to protein-protein interaction

    Wako Hiroshi

    2010-07-01

    Full Text Available Abstract Background Structural flexibility is an important characteristic of proteins because it is often associated with their function. The movement of a polypeptide segment in a protein can be broken down into two types of motions: internal and external ones. The former is deformation of the segment itself, but the latter involves only rotational and translational motions as a rigid body. Normal Model Analysis (NMA can derive these two motions, but its application remains limited because it necessitates the gathering of complete structural information. Results In this work, we present a novel method for predicting two kinds of protein motions in ordered structures. The prediction uses only information from the amino acid sequence. We prepared a dataset of the internal and external motions of segments in many proteins by application of NMA. Subsequently, we analyzed the relation between thermal motion assessed from X-ray crystallographic B-factor and internal/external motions calculated by NMA. Results show that attributes of amino acids related to the internal motion have different features from those related to the B-factors, although those related to the external motion are correlated strongly with the B-factors. Next, we developed a method to predict internal and external motions from amino acid sequences based on the Random Forest algorithm. The proposed method uses information associated with adjacent amino acid residues and secondary structures predicted from the amino acid sequence. The proposed method exhibited moderate correlation between predicted internal and external motions with those calculated by NMA. It has the highest prediction accuracy compared to a naïve model and three published predictors. Conclusions Finally, we applied the proposed method predicting the internal motion to a set of 20 proteins that undergo large conformational change upon protein-protein interaction. Results show significant overlaps between the

  14. Colorimetric and visual determination of dicyandiamide using gallic acid-capped gold nanoparticles

    A new method is presented for the visual detection of dicyandiamide (DCD). Gold nanoparticles (AuNPs) capped with gallic acid (GA) were synthesized in a single step at room temperature, using GA as both the reducing agent and stabilizer. In the presence of DCD, the hydrogen-bonding interaction between GA and DCD induces the aggregation of AuNPs, associated with a color change from red to gray that can be observed with bare eye. DCD could be quantified by photometry as the red shift of the maximal absorption band is linearly related to the logarithm of concentration of DCD in the 0.1 to 500 μM concentration range, with a regression coefficient of 0.9987 and a 80 nM detection limit (at an SNR of 3). The proposed method was successfully applied to the detection of DCD in spiked dairy samples. (author)

  15. Quantification of read species behavior within whole genome sequencing of cancer genomes for the stratification and visualization of genomic variation.

    Hibsh, Dror; Buetow, Kenneth H; Yaari, Gur; Efroni, Sol

    2016-05-19

    The cancer genome is abnormal genome, and the ability to monitor its sequence had undergone a technological revolution. Yet prognosis and diagnosis remain an expert-based decision, with only limited abilities to provide machine-based decisions. We introduce a heterogeneity-based method for stratifying and visualizing whole-genome sequencing (WGS) reads. This method uses the heterogeneity within WGS reads to markedly reduce the dimensionality of next-generation sequencing data; it is available through the tool HiBS (Heterogeneity-Based Subclassification) that allows cancer sample classification. We validated HiBS using >200 WGS samples from nine different cancer types from The Cancer Genome Atlas (TCGA). With HiBS, we show progress with two WGS related issues: (i) differentiation between normal (NB) and tumor (TP) samples based solely on the information structure of their WGS data, and (ii) identification of specific regions of chromosomal amplification/deletion and their association with tumor stage. By comparing results to those obtained through available WGS analyses tools, we demonstrate some of the novelties obtained by the approach implemented in HiBS and also show nearly perfect normal/tumor classification, used to identify known and unknown chromosomal aberrations. Finally, the HiBS index has been associated with breast cancer tumor stage. PMID:26809676

  16. Mulan: Multiple-Sequence Local Alignment and Visualization for Studying Function and Evolution

    Ovcharenko, I; Loots, G; Giardine, B; Hou, M; Ma, J; Hardison, R; Stubbs, L; Miller, W

    2004-07-14

    Multiple sequence alignment analysis is a powerful approach for understanding phylogenetic relationships, annotating genes and detecting functional regulatory elements. With a growing number of partly or fully sequenced vertebrate genomes, effective tools for performing multiple comparisons are required to accurately and efficiently assist biological discoveries. Here we introduce Mulan (http://mulan.dcode.org/), a novel method and a network server for comparing multiple draft and finished-quality sequences to identify functional elements conserved over evolutionary time. Mulan brings together several novel algorithms: the tba multi-aligner program for rapid identification of local sequence conservation and the multiTF program for detecting evolutionarily conserved transcription factor binding sites in multiple alignments. In addition, Mulan supports two-way communication with the GALA database; alignments of multiple species dynamically generated in GALA can be viewed in Mulan, and conserved transcription factor binding sites identified with Mulan/multiTF can be integrated and overlaid with extensive genome annotation data using GALA. Local multiple alignments computed by Mulan ensure reliable representation of short-and large-scale genomic rearrangements in distant organisms. Mulan allows for interactive modification of critical conservation parameters to differentially predict conserved regions in comparisons of both closely and distantly related species. We illustrate the uses and applications of the Mulan tool through multi-species comparisons of the GATA3 gene locus and the identification of elements that are conserved differently in avians than in other genomes allowing speculation on the evolution of birds. Source code for the aligners and the aligner-evaluation software can be freely downloaded from http://bio.cse.psu.edu/.

  17. eQTL Viewer: visualizing how sequence variation affects genome-wide transcription

    Zeng Zhao-Bang; Aylor David L; Zou Wei

    2007-01-01

    Abstract Background Expression Quantitative Trait Locus (eQTL) mapping methods have been used to identify the genetic basis of gene expression variations. To map eQTL, thousands of expression profiles are related with sequence polymorphisms across the genome through their correlated variations. These eQTL distribute in many chromosomal regions, each of which can include many genes. The large number of mapping results produced makes it difficult to consider simultaneously the relationships bet...

  18. Predicting DNA-binding sites of proteins from amino acid sequence

    Wu Feihong

    2006-05-01

    Full Text Available Abstract Background Understanding the molecular details of protein-DNA interactions is critical for deciphering the mechanisms of gene regulation. We present a machine learning approach for the identification of amino acid residues involved in protein-DNA interactions. Results We start with a Naïve Bayes classifier trained to predict whether a given amino acid residue is a DNA-binding residue based on its identity and the identities of its sequence neighbors. The input to the classifier consists of the identities of the target residue and 4 sequence neighbors on each side of the target residue. The classifier is trained and evaluated (using leave-one-out cross-validation on a non-redundant set of 171 proteins. Our results indicate the feasibility of identifying interface residues based on local sequence information. The classifier achieves 71% overall accuracy with a correlation coefficient of 0.24, 35% specificity and 53% sensitivity in identifying interface residues as evaluated by leave-one-out cross-validation. We show that the performance of the classifier is improved by using sequence entropy of the target residue (the entropy of the corresponding column in multiple alignment obtained by aligning the target sequence with its sequence homologs as additional input. The classifier achieves 78% overall accuracy with a correlation coefficient of 0.28, 44% specificity and 41% sensitivity in identifying interface residues. Examination of the predictions in the context of 3-dimensional structures of proteins demonstrates the effectiveness of this method in identifying DNA-binding sites from sequence information. In 33% (56 out of 171 of the proteins, the classifier identifies the interaction sites by correctly recognizing at least half of the interface residues. In 87% (149 out of 171 of the proteins, the classifier correctly identifies at least 20% of the interface residues. This suggests the possibility of using such classifiers to identify

  19. Complete amino acid sequence of globin chains and biological activity of fragmented crocodile hemoglobin (Crocodylus siamensis).

    Srihongthong, Saowaluck; Pakdeesuwan, Anawat; Daduang, Sakda; Araki, Tomohiro; Dhiravisit, Apisak; Thammasirirak, Sompong

    2012-08-01

    Hemoglobin, α-chain, β-chain and fragmented hemoglobin of Crocodylus siamensis demonstrated both antibacterial and antioxidant activities. Antibacterial and antioxidant properties of the hemoglobin did not depend on the heme structure but could result from the compositions of amino acid residues and structures present in their primary structure. Furthermore, thirteen purified active peptides were obtained by RP-HPLC analyses, corresponding to fragments in the α-globin chain and the β-globin chain which are mostly located at the N-terminal and C-terminal parts. These active peptides operate on the bacterial cell membrane. The globin chains of Crocodylus siamensis showed similar amino acids to the sequences of Crocodylus niloticus. The novel amino acid substitutions of α-chain and β-chain are not associated with the heme binding site or the bicarbonate ion binding site, but could be important through their interactions with membranes of bacteria. PMID:22648692

  20. Amino acid selective unlabeling for sequence specific resonance assignments in proteins

    Krishnarjuna, B.; Jaipuria, Garima; Thakur, Anushikha [Indian Institute of Science, NMR Research Centre (India); D' Silva, Patrick, E-mail: patrick@biochem.iisc.ernet.in [Indian Institute of Science, Department of Biochemistry (India); Atreya, Hanudatta S., E-mail: hsatreya@sif.iisc.ernet.in [Indian Institute of Science, NMR Research Centre (India)

    2011-01-15

    Sequence specific resonance assignment constitutes an important step towards high-resolution structure determination of proteins by NMR and is aided by selective identification and assignment of amino acid types. The traditional approach to selective labeling yields only the chemical shifts of the particular amino acid being selected and does not help in establishing a link between adjacent residues along the polypeptide chain, which is important for sequential assignments. An alternative approach is the method of amino acid selective 'unlabeling' or reverse labeling, which involves selective unlabeling of specific amino acid types against a uniformly {sup 13}C/{sup 15}N labeled background. Based on this method, we present a novel approach for sequential assignments in proteins. The method involves a new NMR experiment named, {l_brace}{sup 12}CO{sub i}-{sup 15}N{sub i+1}{r_brace}-filtered HSQC, which aids in linking the {sup 1}H{sup N}/{sup 15}N resonances of the selectively unlabeled residue, i, and its C-terminal neighbor, i + 1, in HN-detected double and triple resonance spectra. This leads to the assignment of a tri-peptide segment from the knowledge of the amino acid types of residues: i - 1, i and i + 1, thereby speeding up the sequential assignment process. The method has the advantage of being relatively inexpensive, applicable to {sup 2}H labeled protein and can be coupled with cell-free synthesis and/or automated assignment approaches. A detailed survey involving unlabeling of different amino acid types individually or in pairs reveals that the proposed approach is also robust to misincorporation of {sup 14}N at undesired sites. Taken together, this study represents the first application of selective unlabeling for sequence specific resonance assignments and opens up new avenues to using this methodology in protein structural studies.

  1. Comparative characterization of random-sequence proteins consisting of 5, 12, and 20 kinds of amino acids.

    Tanaka, Junko; Doi, Nobuhide; Takashima, Hideaki; Yanagawa, Hiroshi

    2010-04-01

    Screening of functional proteins from a random-sequence library has been used to evolve novel proteins in the field of evolutionary protein engineering. However, random-sequence proteins consisting of the 20 natural amino acids tend to aggregate, and the occurrence rate of functional proteins in a random-sequence library is low. From the viewpoint of the origin of life, it has been proposed that primordial proteins consisted of a limited set of amino acids that could have been abundantly formed early during chemical evolution. We have previously found that members of a random-sequence protein library constructed with five primitive amino acids show high solubility (Doi et al., Protein Eng Des Sel 2005;18:279-284). Although such a library is expected to be appropriate for finding functional proteins, the functionality may be limited, because they have no positively charged amino acid. Here, we constructed three libraries of 120-amino acid, random-sequence proteins using alphabets of 5, 12, and 20 amino acids by preselection using mRNA display (to eliminate sequences containing stop codons and frameshifts) and characterized and compared the structural properties of random-sequence proteins arbitrarily chosen from these libraries. We found that random-sequence proteins constructed with the 12-member alphabet (including five primitive amino acids and positively charged amino acids) have higher solubility than those constructed with the 20-member alphabet, though other biophysical properties are very similar in the two libraries. Thus, a library of moderate complexity constructed from 12 amino acids may be a more appropriate resource for functional screening than one constructed from 20 amino acids. PMID:20162614

  2. Partial amino acid sequence of fructose-1,6-bisphosphatase from the blue-green algae Synechococcus leopoliensis.

    Marcus, F; Latshaw, S P; Steup, M; Gerbling, K P

    1989-08-01

    Purified fructose-1,6-bisphosphatase from the cyanobacterium Synechococcus leopoliensis was S-carboxymethylated and cleaved with trypsin. The resulting peptides were purified by reversed-phase high performance liquid chromatography and the amino acid sequence of six of the purified peptides was determined by gas-phase microsequencing. The results revealed sequence homology with other fructose-1,6-bisphosphatases. The obtained sequence data provides information required for the design of oligonucleotide hybridization probes to screen existing libraries of cyanobacterial DNA. The determination of the amino acid sequence of cyanobacterial proteins may yield important information with respect to the endosymbiotic theory of evolution. PMID:2550924

  3. Visualization of 4th Cranial Nerve With MRI: Value of Balanced Fast-Field Echo and 3d-Drive Sequences Against The T2-TSE and Post-Contrast T1w Sequences

    Hasan AYDIN; Ç?FTÇ?, Egemen; HEK?MO?LU, Baki

    2009-01-01

    The aim of this study is to assess the best effective MRI sequence for the visualization of the 4th cranial nerve (Trochlear nerve) in its cisternal course. Balanced fast-field echo (B-FFE), 3D-T2W DRIVE Sense, T2W 2D TSE and Post-contrast T1W sequences were all applied and we tried to get the best sequence for the exact assessment of the 4th cranial nerve. 100 patients without the symptoms of trochlear nerve palsy were examined using the above sequences. Imaging analysis is graded as; nerve ...

  4. Method and software for using m-sequences to characterize parallel components of higher-order visual tracking behavior in Drosophila

    Mark A Frye

    2014-10-01

    Full Text Available A moving visual figure may contain first-order signals defined by variation in mean luminance, as well as second-order signals defined by constant mean luminance and variation in luminance envelope, or higher-order signals that cannot be estimated by taking higher moments of the luminance distribution. Separating these properties of a moving figure to experimentally probe the visual subsystems that encode them is technically challenging and has resulted in debated mechanisms of visual object detection by flies. Our prior work took a white noise systems identification approach using a commercially available electronic display system to characterize the spatial variation in the temporal dynamics of two distinct subsystems for first- and higher-order components of visual figure tracking. The method relied on the use of single pixel displacements of two visual stimuli according to two binary maximum length shift register sequences (m-sequences and cross-correlation of each m-sequence with time-varying flight steering measurements. The resultant spatio-temporal action fields represent temporal impulse responses parameterized by the azimuthal location of the visual figure, one STAF for first-order and another for higher-order components of compound stimuli. Here we review m-sequence and reverse correlation procedures, then describe our application in detail, provide Matlab code, validate the STAFs, and demonstrate the utility and robustness of STAFs by predicting the results of other published experimental procedures. This method has demonstrated how two relatively modest innovations on classical white noise analysis—the inclusion of space as a way to organize response kernels and the use of linear decoupling to measure the response to two channels of visual information simultaneously—could substantially improve our basic understanding of visual processing in the fly.

  5. alpha-Amylase gene of Streptomyces limosus: nucleotide sequence, expression motifs, and amino acid sequence homology to mammalian and invertebrate alpha-amylases.

    Long, C M; Virolle, M J; Chang, S Y; Chang, S.; Bibb, M.J.

    1987-01-01

    The nucleotide sequence of the coding and regulatory regions of the alpha-amylase gene (aml) of Streptomyces limosus was determined. High-resolution S1 mapping was used to locate the 5' end of the transcript and demonstrated that the gene is transcribed from a unique promoter. The predicted amino acid sequence has considerable identity to mammalian and invertebrate alpha-amylases, but not to those of plant, fungal, or eubacterial origin. Consistent with this is the susceptibility of the enzym...

  6. Comparison of Visual Inspection with acetic acid and Pap smear in cervical cancer screening at a tertiary care hospital

    Objective: To determine the accuracy of visual inspection with acetic acid in comparison with Pap smear against colposcopic directed biopsy, for detection of pre-cancerous lesion. Methods: The comparative cross-sectional study was conducted at the Maternal and Child Health Centre (MCHC), Pakistan Institute of Medical Sciences (PIMS), Islamabad, from January to December 2010. Every married women with age range 19 to 51 years underwent conventional cytology and visual inspection with 5% acetic acid. Distinct acetowhite areas were taken as positive, while cervical intra-epithelial neoplasia on cytology was labelled as Pap smear positive. Colposcopic directed biopsy was taken as the gold standard. SPSS 13 was used for statistical analysis. Results: Of 519 subjects, 70(13.4%) were screened positive and 29(5.6%) were biopsy positive for cervical intra-epithelial neoplasia. Of these, 26(37.1 %) were positive on visual inspection; 14 (20 %) on cytology; and 30 (42.8%) on combined test. The sensitivity of visual inspection was 78.5% vs 61.1% for Pap smear (p<0.001). The specificity of visual inspection was 99.3% vs 99.4% for cytology (p<0.1). Significantly higher sensitivity and specificity was found for the combined test than either of the two alone; 93.1% and 99.1% respectively (p<0.001). The positive predictive value of visual inspection vs pap was 84.6% vs 78.5% (p<0.001) and negative predictive value was 98.6% vs 96.5% (p<0.1). Both values of combined test were significantly higher than either of the two tests alone (p<0.01). Conclusion: Visual inspection with acetic acid has significantly higher sensitivity than Pap smear and may replace pap smear as a primary screening tool for universal screening. Combined test with higher predictive accuracy may be used for opportunistic screening. (author)

  7. Prediction of flexible/rigid regions from protein sequences using k-spaced amino acid pairs

    Ruan Jishou

    2007-04-01

    Full Text Available Abstract Background Traditionally, it is believed that the native structure of a protein corresponds to a global minimum of its free energy. However, with the growing number of known tertiary (3D protein structures, researchers have discovered that some proteins can alter their structures in response to a change in their surroundings or with the help of other proteins or ligands. Such structural shifts play a crucial role with respect to the protein function. To this end, we propose a machine learning method for the prediction of the flexible/rigid regions of proteins (referred to as FlexRP; the method is based on a novel sequence representation and feature selection. Knowledge of the flexible/rigid regions may provide insights into the protein folding process and the 3D structure prediction. Results The flexible/rigid regions were defined based on a dataset, which includes protein sequences that have multiple experimental structures, and which was previously used to study the structural conservation of proteins. Sequences drawn from this dataset were represented based on feature sets that were proposed in prior research, such as PSI-BLAST profiles, composition vector and binary sequence encoding, and a newly proposed representation based on frequencies of k-spaced amino acid pairs. These representations were processed by feature selection to reduce the dimensionality. Several machine learning methods for the prediction of flexible/rigid regions and two recently proposed methods for the prediction of conformational changes and unstructured regions were compared with the proposed method. The FlexRP method, which applies Logistic Regression and collocation-based representation with 95 features, obtained 79.5% accuracy. The two runner-up methods, which apply the same sequence representation and Support Vector Machines (SVM and Naïve Bayes classifiers, obtained 79.2% and 78.4% accuracy, respectively. The remaining considered methods are

  8. Nucleic and amino acid sequences relating to a novel transketolase, and methods for the expression thereof

    Croteau, Rodney Bruce (Pullman, WA); Wildung, Mark Raymond (Colfax, WA); Lange, Bernd Markus (Pullman, WA); McCaskill, David G. (Pullman, WA)

    2001-01-01

    cDNAs encoding 1-deoxyxylulose-5-phosphate synthase from peppermint (Mentha piperita) have been isolated and sequenced, and the corresponding amino acid sequences have been determined. Accordingly, isolated DNA sequences (SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7) are provided which code for the expression of 1-deoxyxylulose-5-phosphate synthase from plants. In another aspect the present invention provides for isolated, recombinant DXPS proteins, such as the proteins having the sequences set forth in SEQ ID NO:4, SEQ ID NO:6 and SEQ ID NO:8. In other aspects, replicable recombinant cloning vehicles are provided which code for plant 1-deoxyxylulose-5-phosphate synthases, or for a base sequence sufficiently complementary to at least a portion of 1-deoxyxylulose-5-phosphate synthase DNA or RNA to enable hybridization therewith. In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding a plant 1-deoxyxylulose-5-phosphate synthase. Thus, systems and methods are provided for the recombinant expression of the aforementioned recombinant 1-deoxyxylulose-5-phosphate synthase that may be used to facilitate its production, isolation and purification in significant amounts. Recombinant 1-deoxyxylulose-5-phosphate synthase may be used to obtain expression or enhanced expression of 1-deoxyxylulose-5-phosphate synthase in plants in order to enhance the production of 1-deoxyxylulose-5-phosphate, or its derivatives such as isopentenyl diphosphate (BP), or may be otherwise employed for the regulation or expression of 1-deoxyxylulose-5-phosphate synthase, or the production of its products.

  9. Genome Sequence Analysis of the Naphthenic Acid Degrading and Metal Resistant Bacterium Cupriavidus gilardii CR3.

    Xiaoyu Wang

    Full Text Available Cupriavidus sp. are generally heavy metal tolerant bacteria with the ability to degrade a variety of aromatic hydrocarbon compounds, although the degradation pathways and substrate versatilities remain largely unknown. Here we studied the bacterium Cupriavidus gilardii strain CR3, which was isolated from a natural asphalt deposit, and which was shown to utilize naphthenic acids as a sole carbon source. Genome sequencing of C. gilardii CR3 was carried out to elucidate possible mechanisms for the naphthenic acid biodegradation. The genome of C. gilardii CR3 was composed of two circular chromosomes chr1 and chr2 of respectively 3,539,530 bp and 2,039,213 bp in size. The genome for strain CR3 encoded 4,502 putative protein-coding genes, 59 tRNA genes, and many other non-coding genes. Many genes were associated with xenobiotic biodegradation and metal resistance functions. Pathway prediction for degradation of cyclohexanecarboxylic acid, a representative naphthenic acid, suggested that naphthenic acid undergoes initial ring-cleavage, after which the ring fission products can be degraded via several plausible degradation pathways including a mechanism similar to that used for fatty acid oxidation. The final metabolic products of these pathways are unstable or volatile compounds that were not toxic to CR3. Strain CR3 was also shown to have tolerance to at least 10 heavy metals, which was mainly achieved by self-detoxification through ion efflux, metal-complexation and metal-reduction, and a powerful DNA self-repair mechanism. Our genomic analysis suggests that CR3 is well adapted to survive the harsh environment in natural asphalts containing naphthenic acids and high concentrations of heavy metals.

  10. Heterodimeric l-amino acid oxidase enzymes from Egyptian Cerastes cerastes venom: Purification, biochemical characterization and partial amino acid sequencing

    A.E. El Hakim

    2015-12-01

    Full Text Available Two l-amino acid oxidase enzyme isoforms, Cc-LAAOI and Cc-LAAOII were purified to apparent homogeneity from Cerastes cerastes venom in a sequential two-step chromatographic protocol including; gel filtration and anion exchange chromatography. The native molecular weights of the isoforms were 115 kDa as determined by gel filtration on calibrated Sephacryl S-200 column, while the monomeric molecular weights of the enzymes were, 60, 56 kDa and 60, 53 kDa for LAAOI and LAAOII, respectively. The tryptic peptides of the two isoforms share high sequence homology with other snake venom l-amino acid oxidases. The optimal pH and temperature values of Cc-LAAOI and Cc-LAAOII were 7.8, 50 °C and 7, 60 °C, respectively. The two isoenzymes were thermally stable up to 70 °C. The Km and Vmax values were 0.67 mM, 0.135 μmol/min for LAAOI and 0.82 mM, 0.087 μmol/min for LAAOII. Both isoenzymes displayed high catalytic preference to long-chain, hydrophobic and aromatic amino acids. The Mn2+ ion markedly increased the LAAO activity for both purified isoforms, while Na+, K+, Ca2+, Mg2+ and Ba2+ ions showed a non-significant increase in the enzymatic activity of both isoforms. Furthermore, Zn2+, Ni2+, Co2+, Cu2+ and AL3+ ions markedly inhibited the LAAOI and LAAOII activities. l-Cysteine and reduced glutathione completely inhibited the LAAO activity of both isoenzymes, whereas, β-mercaptoethanol, O-phenanthroline and PMSF completely inhibited the enzymatic activity of LAAOII. Furthermore, iodoacitic acid inhibited the enzymatic activity of LAAOII by 46% and had no effect on the LAAOI activity.

  11. Sequence-defined bioactive macrocycles via an acid-catalysed cascade reaction

    Porel, Mintu; Thornlow, Dana N.; Phan, Ngoc N.; Alabi, Christopher A.

    2016-06-01

    Synthetic macrocycles derived from sequence-defined oligomers are a unique structural class whose ring size, sequence and structure can be tuned via precise organization of the primary sequence. Similar to peptides and other peptidomimetics, these well-defined synthetic macromolecules become pharmacologically relevant when bioactive side chains are incorporated into their primary sequence. In this article, we report the synthesis of oligothioetheramide (oligoTEA) macrocycles via a one-pot acid-catalysed cascade reaction. The versatility of the cyclization chemistry and modularity of the assembly process was demonstrated via the synthesis of >20 diverse oligoTEA macrocycles. Structural characterization via NMR spectroscopy revealed the presence of conformational isomers, which enabled the determination of local chain dynamics within the macromolecular structure. Finally, we demonstrate the biological activity of oligoTEA macrocycles designed to mimic facially amphiphilic antimicrobial peptides. The preliminary results indicate that macrocyclic oligoTEAs with just two-to-three cationic charge centres can elicit potent antibacterial activity against Gram-positive and Gram-negative bacteria.

  12. Complete Genome Sequence of Lactococcus lactis IO-1, a Lactic Acid Bacterium That Utilizes Xylose and Produces High Levels of l-Lactic Acid

    Kato, Hiroaki; Shiwa, Yuh; Oshima, Kenshiro; Machii, Miki; Araya-Kojima, Tomoko; Zendo, Takeshi; Shimizu-Kadota, Mariko; Hattori, Masahira; Sonomoto, Kenji; Yoshikawa, Hirofumi

    2012-01-01

    We report the complete genome sequence of Lactococcus lactis IO-1 (= JCM7638). It is a nondairy lactic acid bacterium, produces nisin Z, ferments xylose, and produces predominantly l-lactic acid at high xylose concentrations. From ortholog analysis with other five L. lactis strains, IO-1 was identified as L. lactis subsp. lactis.

  13. Morphological tranformation of calcite crystal growth by prismatic "acidic" polypeptide sequences.

    Kim, I; Giocondi, J L; Orme, C A; Collino, J; Evans, J S

    2007-02-13

    Many of the interesting mechanical and materials properties of the mollusk shell are thought to stem from the prismatic calcite crystal assemblies within this composite structure. It is now evident that proteins play a major role in the formation of these assemblies. Recently, a superfamily of 7 conserved prismatic layer-specific mollusk shell proteins, Asprich, were sequenced, and the 42 AA C-terminal sequence region of this protein superfamily was found to introduce surface voids or porosities on calcite crystals in vitro. Using AFM imaging techniques, we further investigate the effect that this 42 AA domain (Fragment-2) and its constituent subdomains, DEAD-17 and Acidic-2, have on the morphology and growth kinetics of calcite dislocation hillocks. We find that Fragment-2 adsorbs on terrace surfaces and pins acute steps, accelerates then decelerates the growth of obtuse steps, forms clusters and voids on terrace surfaces, and transforms calcite hillock morphology from a rhombohedral form to a rounded one. These results mirror yet are distinct from some of the earlier findings obtained for nacreous polypeptides. The subdomains Acidic-2 and DEAD-17 were found to accelerate then decelerate obtuse steps and induce oval rather than rounded hillock morphologies. Unlike DEAD-17, Acidic-2 does form clusters on terrace surfaces and exhibits stronger obtuse velocity inhibition effects than either DEAD-17 or Fragment-2. Interestingly, a 1:1 mixture of both subdomains induces an irregular polygonal morphology to hillocks, and exhibits the highest degree of acute step pinning and obtuse step velocity inhibition. This suggests that there is some interplay between subdomains within an intra (Fragment-2) or intermolecular (1:1 mixture) context, and sequence interplay phenomena may be employed by biomineralization proteins to exert net effects on crystal growth and morphology.

  14. Intra-operative visualization of brain tumors with 5-aminolevulinic acid-induced fluorescence.

    Widhalm, Georg

    2014-01-01

    Precise histopathological diagnosis of brain tumors is essential for the correct patient management. Furthermore, complete resection of brain tumors is associated with an improved patient prognosis. However, histopathological undergrading and incomplete tumor removal are not uncommon, especially due to insufficient intra-operative visualization of brain tumor tissue. The fluorescent dye 5-aminolevulinic acid (5-ALA) is currently applied for fluorescence-guided resections of high-grade gliomas. The value of 5-ALA-induced protoporphyrin (PpIX) fluorescence for intra-operative visualization of other tumors than high-grade gliomas remains unclear. Within the frame of this thesis, we found a significantly higher rate of complete resections of our high-grade gliomas as compared to control cases by using the newly established 5-ALA fluorescence technology at our department. Additionally, we showed that MRI spectroscopy-based chemical shift imaging (CSI) is capable to identify intratumoral high-grade glioma areas (= anaplastic foci) during navigation guided resections to avoid histopathological undergrading. However, the accuracy of navigation systems with integrated pre-operative imaging data such as CSI declines during resections due to intra-operative brainshift. In two further studies, we found that 5-ALA induced PpIX fluorescence is capable as a novel intra-operative marker to detect anaplastic foci within initially suspected low-grade gliomas independent of brainshift. Finally, we showed that the application of 5-ALA is also of relevance in needle biopsies for intra-operative identification of representative brain tumor tissue. These data indicate that 5-ALA is not only of major importance for resection of high-grade gliomas, but also for intra-operative visualization of anaplastic foci as well as representative brain tumor tissue in needle biopsies unaffected by brainshift. Consequently, this new technique might become a novel standard in brain tumor surgery that

  15. Cervical cancer risk factors and feasibility of visual inspection with acetic acid screening in Sudan

    Ibrahim A

    2011-04-01

    Full Text Available Ahmed Ibrahim1, Vibeke Rasch2, Eero Pukkala3, Arja R Aro11Unit for Health Promotion Research, University of Southern Denmark, Esbjerg, Denmark; 2Department of Obstetrics and Gynecology, Odense University Hospital, Odense, Denmark; 3Institute for Statistical and Epidemiological Cancer Research, Finnish Cancer Registry, Helsinki, FinlandObjectives: To assess the risk factors of cervical cancer and the feasibility and acceptability of a visual inspection with acetic acid (VIA screening method in a primary health center in Khartoum, Sudan.Methods: A cross-sectional prospective pilot study of 100 asymptomatic women living in Khartoum State in Sudan was carried out from December 2008 to January 2009. The study was performed at the screening center in Khartoum. Six nurses and two physicians were trained by a gynecologic oncologist. The patients underwent a complete gynecological examination and filled in a questionnaire on risk factors and feasibility and acceptability. They were screened for cervical cancer by application of 3%–5% VIA. Women with a positive test were referred for colposcopy and treatment.Results: Sixteen percent of screened women were tested positive. Statistically significant associations were observed between being positive with VIA test and the following variables: uterine cervix laceration (odds ratio [OR] 18.6; 95% confidence interval [CI]: 4.64–74.8, assisted vaginal delivery (OR 13.2; 95% CI: 2.95–54.9, parity (OR 5.78; 95% CI: 1.41–23.7, female genital mutilation (OR 4.78; 95% CI: 1.13–20.1, and episiotomy (OR 5.25; 95% CI: 1.15–23.8. All these associations remained statistically significant after adjusting for age, educational level, employment, and potential confounding factors such as smoking, number of sexual partners, and use of contraceptive method. Furthermore, the VIA screening method was found to be feasible and acceptable to participants.Conclusion: This pilot study showed that women who have uterine

  16. Sparse Representations-Based Super-Resolution of Key-Frames Extracted from Frames-Sequences Generated by a Visual Sensor Network

    Muhammad Sajjad; Irfan Mehmood; Sung Wook Baik

    2014-01-01

    Visual sensor networks (VSNs) usually generate a low-resolution (LR) frame-sequence due to energy and processing constraints. These LR-frames are not very appropriate for use in certain surveillance applications. It is very important to enhance the resolution of the captured LR-frames using resolution enhancement schemes. In this paper, an effective framework for a super-resolution (SR) scheme is proposed that enhances the resolution of LR key-frames extracted from frame-sequences captured b...

  17. Amino acid sequence of the cold-active alkaline phosphatase from Atlantic cod (Gadus morhua)

    Asgeirsson, Bjarni; Nielsen, Berit Noesgaard; Højrup, Peter

    2003-01-01

    Atlantic cod is a marine fish that lives at low temperatures of 0-10 degrees C and contains a cold-adapted alkaline phosphatase (AP). Preparations of AP from either the lower part of the intestines or the pyloric caeca area were subjected to proteolytic digestion, mass spectrometry and amino acid...... sequencing by Edman degradation. The primary structure exhibits greatest similarity to human tissue non-specific AP (80%), and approximately 30% similarity to AP from Escherichia coli. The key residues required for catalysis are conserved in the cod AP, except for the third metal binding site, where cod AP...

  18. Frequencies of amino acid strings in globular protein sequences indicate suppression of blocks of consecutive hydrophobic residues

    Schwartz, Russell; Istrail, Sorin; King, Jonathan

    2001-01-01

    Patterns of hydrophobic and hydrophilic residues play a major role in protein folding and function. Long, predominantly hydrophobic strings of 20–22 amino acids each are associated with transmembrane helices and have been used to identify such sequences. Much less attention has been paid to hydrophobic sequences within globular proteins. In prior work on computer simulations of the competition between on-pathway folding and off-pathway aggregate formation, we found that long sequences of cons...

  19. 3-d structure-based amino acid sequence alignment of esterases, lipases and related proteins

    Gentry, M.K.; Doctor, B.P.; Cygler, M.; Schrag, J.D.; Sussman, J.L.

    1993-05-13

    Acetylcholinesterase and butyrylcholinesterase, enzymes with potential as pretreatment drugs for organophosphate toxicity, are members of a larger family of homologous proteins that includes carboxylesterases, cholesterol esterases, lipases, and several nonhydrolytic proteins. A computer-generated alignment of 18 of the proteins, the acetylcholinesases, butyrylcholinesterases, carboxylesterases, some esterases, and the nonenzymatic proteins has been previously presented. More recently, the three-dimensional structures of two enzymes enzymes in this group, acetylcholinesterase from Torpedo californica and lipase from Geotrichum candidum, have been determined. Based on the x-ray structures and the superposition of these two enzymes, it was possible to obtain an improved amino acid sequence alignment of 32 members of this family of proteins. Examination of this alignment reveals that 24 amino acids are invariant in all of the hydrolytic proteins, and an additional 49 are well conserved. Conserved amino acids include those of the active site, the disulfide bridges, the salt bridges, in the core of the proteins, and at the edges of secondary structural elements. Comparison of the three-dimensional structures makes it possible to find a well-defined structural basis for the conservation of many of these amino acids.

  20. Nanostructure of native pectin sugar acid gels visualized by atomic force microscopy.

    Fishman, Marshall L; Cooke, Peter H; Coffin, David R

    2004-01-01

    Height and phase shift images of high methoxyl sugar acid gels (HMSAG) of pectin were obtained by atomic force microscopy in the tapping mode. Images revealed that pores in these gels were fluid and flattened out when measured as a function of time. These images revealed for the first time the structure of adsorbed sugar on pectin in the hydrated native gels and how the pectin framework is organized within these gels. Segmentation of images revealed that the underlying pectin framework contained combinations of rods, segmented rods, and kinked rods connected end to end and laterally. The open network of strands was similar to pectin aggregates from 5 mM NaCl solution imaged earlier by electron microscopy (Fishman et al., Arch. Biochem. Biophys. 1992, 294, 253). Area measurements revealed that the ratio of bound sugar to pectin was in excess of 100 to 1 (w/w). Furthermore, images indicated relatively small differences in the organization of native commercial citrus pectin, orange albedo pectin, and lime albedo pectin gels at optimal pH as determined in this study. The findings are consistent with earlier gel strength measurements of these gels. In addition, values of gel strength were consistent with values of molar mass and viscosity of the constituent pectins in that they increased in the same order. Finally, we demonstrated the advantage of simultaneous visualization of height and phase shift images for observing and quantitating the nanostructure of relatively soft gels which are fully hydrated with a buffer. PMID:15002992

  1. Draft Genome Sequence of Bacillus subtilis GXA-28, a Thermophilic Strain with High Productivity of Poly-γ-Glutamic Acid

    Zeng, Wei; Chen, Guiguang; Tang, Zhen; Wu, Hao; Shu, Lin; Liang, Zhiqun

    2014-01-01

    Bacillus subtilis GXA-28 is a thermophilic strain that can produce high yield and high molecular weight of poly-γ-glutamic acid under high temperature. Here, we report the draft genome sequence of this strain, which may provide the genomic basis for the high productivity of poly-γ-glutamic acid.

  2. Draft Genome Sequences of Gluconobacter cerinus CECT 9110 and Gluconobacter japonicus CECT 8443, Acetic Acid Bacteria Isolated from Grape Must

    Sainz, Florencia

    2016-01-01

    We report here the draft genome sequences of Gluconobacter cerinus strain CECT9110 and Gluconobacter japonicus CECT8443, acetic acid bacteria isolated from grape must. Gluconobacter species are well known for their ability to oxidize sugar alcohols into the corresponding acids. Our objective was to select strains to oxidize effectively d-glucose. PMID:27365351

  3. FiveS rRNA sequences and fatty acid profiles of colourless sulfur-oxidising bacteria

    LokaBharathi, P.A.; Ortiz-conde, B.A; Nair, S.; Chandramohan, D.; Colwell, R.R.

    these at the molecular level, 5S ribosomal ribonucleic acid (5S rRNA) sequences have been determined. Fatty acid profiles showed strain 29 to be related to Pseudomonas vesicularis with an E.D. of 5.965 and similarity index of 0.182. The nearest organism of strain 82...

  4. ANCAC: amino acid, nucleotide, and codon analysis of COGs – a tool for sequence bias analysis in microbial orthologs

    Meiler Arno

    2012-09-01

    Full Text Available Abstract Background The COG database is the most popular collection of orthologous proteins from many different completely sequenced microbial genomes. Per definition, a cluster of orthologous groups (COG within this database exclusively contains proteins that most likely achieve the same cellular function. Recently, the COG database was extended by assigning to every protein both the corresponding amino acid and its encoding nucleotide sequence resulting in the NUCOCOG database. This extended version of the COG database is a valuable resource connecting sequence features with the functionality of the respective proteins. Results Here we present ANCAC, a web tool and MySQL database for the analysis of amino acid, nucleotide, and codon frequencies in COGs on the basis of freely definable phylogenetic patterns. We demonstrate the usefulness of ANCAC by analyzing amino acid frequencies, codon usage, and GC-content in a species- or function-specific context. With respect to amino acids we, at least in part, confirm the cognate bias hypothesis by using ANCAC’s NUCOCOG dataset as the largest one available for that purpose thus far. Conclusions Using the NUCOCOG datasets, ANCAC connects taxonomic, amino acid, and nucleotide sequence information with the functional classification via COGs and provides a GUI for flexible mining for sequence-bias. Thereby, to our knowledge, it is the only tool for the analysis of sequence composition in the light of physiological roles and phylogenetic context without requirement of substantial programming-skills.

  5. Clostridium sticklandii, a specialist in amino acid degradation:revisiting its metabolism through its genome sequence

    Pelletier Eric

    2010-10-01

    Full Text Available Abstract Background Clostridium sticklandii belongs to a cluster of non-pathogenic proteolytic clostridia which utilize amino acids as carbon and energy sources. Isolated by T.C. Stadtman in 1954, it has been generally regarded as a "gold mine" for novel biochemical reactions and is used as a model organism for studying metabolic aspects such as the Stickland reaction, coenzyme-B12- and selenium-dependent reactions of amino acids. With the goal of revisiting its carbon, nitrogen, and energy metabolism, and comparing studies with other clostridia, its genome has been sequenced and analyzed. Results C. sticklandii is one of the best biochemically studied proteolytic clostridial species. Useful additional information has been obtained from the sequencing and annotation of its genome, which is presented in this paper. Besides, experimental procedures reveal that C. sticklandii degrades amino acids in a preferential and sequential way. The organism prefers threonine, arginine, serine, cysteine, proline, and glycine, whereas glutamate, aspartate and alanine are excreted. Energy conservation is primarily obtained by substrate-level phosphorylation in fermentative pathways. The reactions catalyzed by different ferredoxin oxidoreductases and the exergonic NADH-dependent reduction of crotonyl-CoA point to a possible chemiosmotic energy conservation via the Rnf complex. C. sticklandii possesses both the F-type and V-type ATPases. The discovery of an as yet unrecognized selenoprotein in the D-proline reductase operon suggests a more detailed mechanism for NADH-dependent D-proline reduction. A rather unusual metabolic feature is the presence of genes for all the enzymes involved in two different CO2-fixation pathways: C. sticklandii harbours both the glycine synthase/glycine reductase and the Wood-Ljungdahl pathways. This unusual pathway combination has retrospectively been observed in only four other sequenced microorganisms. Conclusions Analysis of the C

  6. Isolation and amino acid sequences of squirrel monkey (Saimiri sciurea) insulin and glucagon

    It was reported two decades ago that insulin was not detectable in the glucose-stimulated state in Saimiri sciurea, the New World squirrel monkey, by a radioimmunoassay system developed with guinea pig anti-pork insulin antibody and labeled park insulin. With the same system, reasonable levels were observed in rhesus monkeys and chimpanzees. This suggested that New World monkeys, like the New World hystricomorph rodents such as the guinea pig and the coypu, might have insulins whose sequences differ markedly from those of Old World mammals. In this report the authors describe the purification and amino acid sequences of squirrel monkey insulin and glucagon. They demonstrate that the substitutions at B29, B27, A2, A4, and A17 of squirrel monkey insulin are identical with those previously found in another New World primate, the owl monkey (Aotus trivirgatus). The immunologic cross-reactivity of this insulin in their immunoassay system is only a few percent of that of human insulin. It appears that the peptides of the New World monkeys have diverged less from those of the Old World mammals than have those of the New World hystricomorph rodents. The striking improvements in peptide purification and sequencing have the potential for adding new information concerning the evolutionary divergence of species

  7. Complete amino acid sequence of the myoglobin from the Pacific spotted dolphin, Stenella attenuata graffmani.

    Jones, B N; Wang, C C; Dwulet, F E; Lehman, L D; Meuth, J L; Bogardt, R A; Gurd, F R

    1979-04-25

    The complete amino acid sequence of the major component myoglobin from the Pacific spotted dolphin, Stenella attenuata graffmani, was determined by the automated Edman degradation of several large peptides obtained by specific cleavage of the protein. The acetimidated apomyoglobin was selectively cleaved at its two methionyl residues with cyanogen bromide and at its three arginyl residues by trypsin. By subjecting four of these peptides and the apomyoglobin to automated Edman degradation, over 80% of the primary structure of the protein was obtained. The remainder of the covalent structure was determined by the sequence analysis of peptides that resulted from further digestion of the central cyanogen bromide fragment. This fragment was cleaved at its glutamyl residues with staphylococcal protease and its lysyl residues with trypsin. The action of trypsin was restricted to the lysyl residues by chemical modification of the single arginyl residue of the fragment with 1,2-cyclohexanedione. The primary structure of this myoglobin proved to be identical with that from the Atlantic bottlenosed dolphin and Pacific common dolphin but differs from the myoglobins of the killer whale and pilot whale at two positions. The above sequence identities and differences reflect the close taxonomic relationship of these five species of Cetacea. PMID:454657

  8. Isolation and amino acid sequences of squirrel monkey (Saimiri sciurea) insulin and glucagon

    Yu, Jinghua (Veterans Administration Medical Center, Bronx, NY (United States)); Eng, J.; Yalow, R.S. (Veterans Administration Medical Center, Bronx, NY (United States) City Univ. of New York, NY (United States))

    1990-12-01

    It was reported two decades ago that insulin was not detectable in the glucose-stimulated state in Saimiri sciurea, the New World squirrel monkey, by a radioimmunoassay system developed with guinea pig anti-pork insulin antibody and labeled park insulin. With the same system, reasonable levels were observed in rhesus monkeys and chimpanzees. This suggested that New World monkeys, like the New World hystricomorph rodents such as the guinea pig and the coypu, might have insulins whose sequences differ markedly from those of Old World mammals. In this report the authors describe the purification and amino acid sequences of squirrel monkey insulin and glucagon. They demonstrate that the substitutions at B29, B27, A2, A4, and A17 of squirrel monkey insulin are identical with those previously found in another New World primate, the owl monkey (Aotus trivirgatus). The immunologic cross-reactivity of this insulin in their immunoassay system is only a few percent of that of human insulin. It appears that the peptides of the New World monkeys have diverged less from those of the Old World mammals than have those of the New World hystricomorph rodents. The striking improvements in peptide purification and sequencing have the potential for adding new information concerning the evolutionary divergence of species.

  9. A universal strategy for visual chiral recognition of α-amino acids with l-tartaric acid-capped gold nanoparticles as colorimetric probes.

    Song, Guoxin; Zhou, Fulin; Xu, Chunli; Li, Baoxin

    2016-02-01

    The ability to recognize and quantify the chirality of alpha-amino acids constitutes the basis of many critical areas for specific targeting in drug development and metabolite probing. It is still challenging to conveniently distinguish the enantiomer of amino acids largely due to the lack of a universal and simple strategy. In this work, we report a strategy for the visual recognition of α-amino acids. It is based on the chirality of l-tartaric acid-capped gold nanoparticles (l-TA-capped AuNPs, ca. 13 nm in diameter). All of 19 right-handed α-amino acids can induce a red-to-blue color change of l-TA-capped AuNP solution, whereas all of the left-handed amino acids (except cysteine) cannot. The chiral recognition can be achieved by the naked eye and a simple spectrophotometer. This method does not require complicated chiral modification, and excels through its low-cost, good availability of materials and its simplicity. Another notable feature of this method is its high generality, and this method can discriminate almost all native α-amino acid enantiomers. This versatile method could be potentially used for high-throughput chiral recognition of amino acids. PMID:26759834

  10. The Effect of Using a Visual Representation Tool in a Teaching-Learning Sequence for Teaching Newton's Third Law

    Savinainen, Antti; Mäkynen, Asko; Nieminen, Pasi; Viiri, Jouni

    2015-09-01

    This paper presents a research-based teaching-learning sequence (TLS) that focuses on the notion of interaction in teaching Newton's third law (N3 law) which is, as earlier studies have shown, a challenging topic for students to learn. The TLS made systematic use of a visual representation tool—an interaction diagram (ID)—highlighting interactions between objects and addressing the learning demand related to N3 law. This approach had been successful in enhancing students' understanding of N3 law in pilot studies conducted by teacher-researchers. However, it was unclear whether teachers, who have neither been involved with the research nor received intensive tutoring, could replicate the positive results in ordinary school settings. To address this question, we present an empirical study conducted in 10 Finnish upper secondary schools with students (n = 261, aged 16) taking their mandatory physics course. The study design involved three groups: the heavy ID group (the TLS with seven to eight exercises on IDs), the light ID group (two to three exercises on IDs) and the no ID group (no exercises on IDs). The heavy and light ID groups answered eight ID questions, and all the students answered four questions on N3 law after teaching the force concept. The findings clearly suggest that systematic use of the IDs in teaching the force concept significantly fostered students' understanding of N3 law even with teachers who have no intensive tutoring or research background.

  11. Visual inspection with acetic acid as a cervical cancer test: accuracy validated using latent class analysis

    McGrath John A

    2007-07-01

    Full Text Available Abstract Background The purpose of this study was to validate the accuracy of an alternative cervical cancer test – visual inspection with acetic acid (VIA – by addressing possible imperfections in the gold standard through latent class analysis (LCA. The data were originally collected at peri-urban health clinics in Zimbabwe. Methods Conventional accuracy (sensitivity/specificity estimates for VIA and two other screening tests using colposcopy/biopsy as the reference standard were compared to LCA estimates based on results from all four tests. For conventional analysis, negative colposcopy was accepted as a negative outcome when biopsy was not available as the reference standard. With LCA, local dependencies between tests were handled through adding direct effect parameters or additional latent classes to the model. Results Two models yielded good fit to the data, a 2-class model with two adjustments and a 3-class model with one adjustment. The definition of latent disease associated with the latter was more stringent, backed by three of the four tests. Under that model, sensitivity for VIA (abnormal+ was 0.74 compared to 0.78 with conventional analyses. Specificity was 0.639 versus 0.568, respectively. By contrast, the LCA-derived sensitivity for colposcopy/biopsy was 0.63. Conclusion VIA sensitivity and specificity with the 3-class LCA model were within the range of published data and relatively consistent with conventional analyses, thus validating the original assessment of test accuracy. LCA probably yielded more likely estimates of the true accuracy than did conventional analysis with in-country colposcopy/biopsy as the reference standard. Colpscopy with biopsy can be problematic as a study reference standard and LCA offers the possibility of obtaining estimates adjusted for referent imperfections.

  12. Comparison of the chromosomal localization of murine and human glucocerebrosidase genes and of the deduced amino acid sequences

    To study structure-function relationships and molecular evolution, the authors determined the nucleotide sequence and chromosomal location of the gene encoding murine glucocerebrosidase. In the protein coding region of the murine cDNA, the nucleotide sequence and the corresponding deduced amino acid sequences were 82% and 86% identical to the respective humans sequences. All five amino acids presently known to be essential for normal enzymatic activity were conserved between mouse and man. The murine enzyme had a single deletion relative to the human enzyme at amino acid number 273. One ATG translation initiation signal was present in the mouse sequence in contrast to the human sequence, where two start codons have been reported. Nucleotide sequencing of a clone derived from murine genomic DNA revealed that the murine signal for translation initiation was located in exon 2. The locations of all 10 introns were conserved among mouse and man. They mapped the genetic locus for glucocerebrosidase to mouse chromosome 3, at a position 7.6 ± 3.2 centimorgans from the locus for the β subunit of nerve growth factor. Comparison of linkage relationships in the human and murine genome indicates that these closely linked mouse genes are also syntenic on human chromosome 1 but in positions that span the centromere

  13. Repetitive sequence based polymerase chain reaction to differentiate close bacteria strains in acidic sites

    XIE Ming; YIN Hua-qun; LIU Yi; LIU Jie; LIU Xue-duan

    2008-01-01

    To study the diversity of bacteria strains newly isolated from several acid mine drainage(AMD) sites in China,repetitive sequence based polymerase chain reaction (rep-PCR),a well established technology for diversity analysis of closely related bacteria strains,was conducted on 30 strains of bacteria Leptospirillum ferriphilium,8 strains of bacteria Acidithiobacillus ferrooxidans,as well as the Acidithiobacillus ferrooxidans type strain ATCC (American Type Culture Collection) 23270.The results showed that,using ERIC and BOX primer sets,rep-PCR produced highly discriminatory banding patterns.Phylogenetic analysis based on ERIC-PCR banding types was made and the results indicated that rep-PCR could be used as a rapid and highly discriminatory screening technique in studying bacterial diversity,especially in differentiating bacteria within one species in AMD.

  14. The amino acid alphabet and the architecture of the protein sequence-structure map. I. Binary alphabets.

    Ferrada, Evandro

    2014-12-01

    The correspondence between protein sequences and structures, or sequence-structure map, relates to fundamental aspects of structural, evolutionary and synthetic biology. The specifics of the mapping, such as the fraction of accessible sequences and structures, or the sequences' ability to fold fast, are dictated by the type of interactions between the monomers that compose the sequences. The set of possible interactions between monomers is encapsulated by the potential energy function. In this study, I explore the impact of the relative forces of the potential on the architecture of the sequence-structure map. My observations rely on simple exact models of proteins and random samples of the space of potential energy functions of binary alphabets. I adopt a graph perspective and study the distribution of viable sequences and the structures they produce, as networks of sequences connected by point mutations. I observe that the relative proportion of attractive, neutral and repulsive forces defines types of potentials, that induce sequence-structure maps of vastly different architectures. I characterize the properties underlying these differences and relate them to the structure of the potential. Among these properties are the expected number and relative distribution of sequences associated to specific structures and the diversity of structures as a function of sequence divergence. I study the types of binary potentials observed in natural amino acids and show that there is a strong bias towards only some types of potentials, a bias that seems to characterize the folding code of natural proteins. I discuss implications of these observations for the architecture of the sequence-structure map of natural proteins, the construction of random libraries of peptides, and the early evolution of the natural amino acid alphabet. PMID:25473967

  15. Trypsin inhibitors from ridged gourd (Luffa acutangula Linn.) seeds: purification, properties, and amino acid sequences.

    Haldar, U C; Saha, S K; Beavis, R C; Sinha, N K

    1996-02-01

    Two trypsin inhibitors, LA-1 and LA-2, have been isolated from ridged gourd (Luffa acutangula Linn.) seeds and purified to homogeneity by gel filtration followed by ion-exchange chromatography. The isoelectric point is at pH 4.55 for LA-1 and at pH 5.85 for LA-2. The Stokes radius of each inhibitor is 11.4 A. The fluorescence emission spectrum of each inhibitor is similar to that of the free tyrosine. The biomolecular rate constant of acrylamide quenching is 1.0 x 10(9) M-1 sec-1 for LA-1 and 0.8 x 10(9) M-1 sec-1 for LA-2 and that of K2HPO4 quenching is 1.6 x 10(11) M-1 sec-1 for LA-1 and 1.2 x 10(11) M-1 sec-1 for LA-2. Analysis of the circular dichroic spectra yields 40% alpha-helix and 60% beta-turn for La-1 and 45% alpha-helix and 55% beta-turn for LA-2. Inhibitors LA-1 and LA-2 consist of 28 and 29 amino acid residues, respectively. They lack threonine, alanine, valine, and tryptophan. Both inhibitors strongly inhibit trypsin by forming enzyme-inhibitor complexes at a molar ratio of unity. A chemical modification study suggests the involvement of arginine of LA-1 and lysine of LA-2 in their reactive sites. The inhibitors are very similar in their amino acid sequences, and show sequence homology with other squash family inhibitors. PMID:8924202

  16. Characterization of N-glycosylation and amino acid sequence features of immunoglobulins from swine.

    Lopez, Paul G; Girard, Lauren; Buist, Marjorie; de Oliveira, Andrey Giovanni Gomes; Bodnar, Edward; Salama, Apolline; Soulillou, Jean-Paul; Perreault, Hélène

    2016-02-01

    The primary goal of this study was to develop a method to study the N-glycosylation of IgG from swine in order to detect epitopes containing N-glycolylneuraminic acid (Neu5Gc) and/or terminal galactose residues linked in α1-3 susceptible to cause xenograft-related problems. Samples of immunoglobulin were isolated from porcine serum using protein-A affinity chromatography. The eluate was then separated on electrophoretic gel, and bands corresponding to the N-glycosylated heavy chains were cut off the gel and subjected to tryptic digestion. Peptides and glycopeptides were separated by reversed phase liquid chromatography and fractions were collected for matrix-assisted laser desorption/ionization time-of-flight mass spectrometric (MALDI-TOF-MS) analysis. Overall no α1-3 galactose was detected, as demonstrated by complete susceptibility of terminal galactose residues to β-galactosidase digestion. Neu5Gc was detected on singly sialylated structures. Two major N-glycopeptides were found, EEQFNSTYR and EAQFNSTYR as determined by tandem MS (MS/MS), as previously reported by Butler et al. (Immunogenetics, 61, 2009, 209-230), who found 11 subclasses for porcine IgG. Out of the 11, ten include the sequence corresponding to EEQFNSTYR, and only one codes for EAQFNSTYR. In this study, glycosylation patterns associated with both chains were slightly different, in that EEQFNSTYR had a higher content of galactose. The last step of this study consisted of peptide-mapping the 11 reported porcine IgG sequences. Although there was considerable overlap, at least one unique tryptic peptide was found per IgG sequence. The workflow presented in this manuscript constitutes the first study to use MALDI-TOF-MS in the investigation of porcine IgG structural features. PMID:26586247

  17. Human Retroviruses and AIDS. A compilation and analysis of nucleic acid and amino acid sequences: I--II; III--V

    Myers, G.; Korber, B. [eds.] [Los Alamos National Lab., NM (United States); Wain-Hobson, S. [ed.] [Laboratory of Molecular Retrovirology, Pasteur Inst.; Smith, R.F. [ed.] [Baylor Coll. of Medicine, Houston, TX (United States). Dept. of Pharmacology; Pavlakis, G.N. [ed.] [National Cancer Inst., Frederick, MD (United States). Cancer Research Facility

    1993-12-31

    This compendium and the accompanying floppy diskettes are the result of an effort to compile and rapidly publish all relevant molecular data concerning the human immunodeficiency viruses (HIV) and related retroviruses. The scope of the compendium and database is best summarized by the five parts that it comprises: (I) HIV and SIV Nucleotide Sequences; (II) Amino Acid Sequences; (III) Analyses; (IV) Related Sequences; and (V) Database Communications. Information within all the parts is updated at least twice in each year, which accounts for the modes of binding and pagination in the compendium.

  18. Lactic acid production from potato peel waste by anaerobic sequencing batch fermentation using undefined mixed culture.

    Liang, Shaobo; McDonald, Armando G; Coats, Erik R

    2015-11-01

    Lactic acid (LA) is a necessary industrial feedstock for producing the bioplastic, polylactic acid (PLA), which is currently produced by pure culture fermentation of food carbohydrates. This work presents an alternative to produce LA from potato peel waste (PPW) by anaerobic fermentation in a sequencing batch reactor (SBR) inoculated with undefined mixed culture from a municipal wastewater treatment plant. A statistical design of experiments approach was employed using set of 0.8L SBRs using gelatinized PPW at a solids content range from 30 to 50 g L(-1), solids retention time of 2-4 days for yield and productivity optimization. The maximum LA production yield of 0.25 g g(-1) PPW and highest productivity of 125 mg g(-1) d(-1) were achieved. A scale-up SBR trial using neat gelatinized PPW (at 80 g L(-1) solids content) at the 3 L scale was employed and the highest LA yield of 0.14 g g(-1) PPW and a productivity of 138 mg g(-1) d(-1) were achieved with a 1 d SRT. PMID:25708409

  19. Accurate prediction of hot spot residues through physicochemical characteristics of amino acid sequences

    Chen, Peng

    2013-07-23

    Hot spot residues of proteins are fundamental interface residues that help proteins perform their functions. Detecting hot spots by experimental methods is costly and time-consuming. Sequential and structural information has been widely used in the computational prediction of hot spots. However, structural information is not always available. In this article, we investigated the problem of identifying hot spots using only physicochemical characteristics extracted from amino acid sequences. We first extracted 132 relatively independent physicochemical features from a set of the 544 properties in AAindex1, an amino acid index database. Each feature was utilized to train a classification model with a novel encoding schema for hot spot prediction by the IBk algorithm, an extension of the K-nearest neighbor algorithm. The combinations of the individual classifiers were explored and the classifiers that appeared frequently in the top performing combinations were selected. The hot spot predictor was built based on an ensemble of these classifiers and to work in a voting manner. Experimental results demonstrated that our method effectively exploited the feature space and allowed flexible weights of features for different queries. On the commonly used hot spot benchmark sets, our method significantly outperformed other machine learning algorithms and state-of-the-art hot spot predictors. The program is available at http://sfb.kaust.edu.sa/pages/software.aspx. © 2013 Wiley Periodicals, Inc.

  20. Cloning and sequence analysis of putative type II fatty acid synthase genes from Arachis hypogaea L.

    Meng-Jun Li; Ai-Qin Li; Han Xia; Chuan-Zhi Zhao; Chang-Sheng Li; Shu-Bo Wan; Yu-Ping Bi; Xing-Jun Wang

    2009-06-01

    The cultivated peanut is a valuable source of dietary oil and ranks fifth among the world oil crops. Plant fatty acid biosynthesis is catalysed by type II fatty acid synthase (FAS) in plastids and mitochondria. By constructing a full-length cDNA library derived from immature peanut seeds and homology-based cloning, candidate genes of acyl carrier protein (ACP), malonyl-CoA:ACP transacylase, -ketoacyl-ACP synthase (I, II, III), -ketoacyl-ACP reductase, -hydroxyacyl-ACP dehydrase and enoyl-ACP reductase were isolated. Sequence alignments revealed that primary structures of type II FAS enzymes were highly conserved in higher plants and the catalytic residues were strictly conserved in Escherichia coli and higher plants. Homologue numbers of each type II FAS gene expressing in developing peanut seeds varied from 1 in KASII, KASIII and HD to 5 in ENR. The number of single-nucleotide polymorphisms (SNPs) was quite different in each gene. Peanut type II FAS genes were predicted to target plastids except ACP2 and ACP3. The results suggested that peanut may contain two type II FAS systems in plastids and mitochondria. The type II FAS enzymes in higher plants may have similar functions as those in E. coli.

  1. Visual detection of Ebola virus using reverse transcription loop-mediated isothermal amplification combined with nucleic acid strip detection.

    Xu, Changping; Wang, Hualei; Jin, Hongli; Feng, Na; Zheng, Xuexing; Cao, Zengguo; Li, Ling; Wang, Jianzhong; Yan, Feihu; Wang, Lina; Chi, Hang; Gai, Weiwei; Wang, Chong; Zhao, Yongkun; Feng, Yan; Wang, Tiecheng; Gao, Yuwei; Lu, Yiyu; Yang, Songtao; Xia, Xianzhu

    2016-05-01

    Ebola virus (species Zaire ebolavirus) (EBOV) is highly virulent in humans. The largest recorded outbreak of Ebola hemorrhagic fever in West Africa to date was caused by EBOV. Therefore, it is necessary to develop a detection method for this virus that can be easily distributed and implemented. In the current study, we developed a visual assay that can detect EBOV-associated nucleic acids. This assay combines reverse transcription loop-mediated isothermal amplification and nucleic acid strip detection (RT-LAMP-NAD). Nucleic acid amplification can be achieved in a one-step process at a constant temperature (58 °C, 35 min), and the amplified products can be visualized within 2-5 min using a nucleic acid strip detection device. The assay is capable of detecting 30 copies of artificial EBOV glycoprotein (GP) RNA and RNA encoding EBOV GP from 10(2) TCID50 recombinant viral particles per ml with high specificity. Overall, the RT-LAMP-NAD method is simple and has high sensitivity and specificity; therefore, it is especially suitable for the rapid detection of EBOV in African regions. PMID:26831931

  2. Site-directed gene mutation at mixed sequence targets by psoralen-conjugated pseudo-complementary peptide nucleic acids

    Kim, Ki-Hyun; Nielsen, Peter E.; Glazer, Peter M.

    2007-01-01

    Sequence-specific DNA-binding molecules such as triple helix-forming oligonucleotides (TFOs) provide a means for inducing site-specific mutagenesis and recombination at chromosomal sites in mammalian cells. However, the utility of TFOs is limited by the requirement for homopurine stretches in the target duplex DNA. Here, we report the use of pseudo-complementary peptide nucleic acids (pcPNAs) for intracellular gene targeting at mixed sequence sites. Due to steric hindrance, pcPNAs are unable ...

  3. Nucleotide and amino acid sequence coding for polypeptides of foot-and-mouth disease virus type A12.

    Robertson, B H; Grubman, M J; Weddell, G N; Moore, D.M.; Welsh, J D; Fischer, T.; Dowbenko, D J; Yansura, D G; Small, B.; Kleid, D G

    1985-01-01

    The coding region for the structural and nonstructural polypeptides of the type A12 foot-and-mouth disease virus genome has been identified by nucleotide sequencing of cloned DNA derived from the viral RNA. In addition, 704 nucleotides in the 5' untranslated region between the polycytidylic acid tract and the probable initiation codon of the first translated gene, P16-L, have been sequenced. This region has several potential initiation codons, one of which appears to be a low-frequency altern...

  4. Negative Ion In-Source Decay Matrix-Assisted Laser Desorption/Ionization Mass Spectrometry for Sequencing Acidic Peptides

    McMillen, Chelsea L.; Wright, Patience M.; Cassady, Carolyn J.

    2016-05-01

    Matrix-assisted laser desorption/ionization (MALDI) in-source decay was studied in the negative ion mode on deprotonated peptides to determine its usefulness for obtaining extensive sequence information for acidic peptides. Eight biological acidic peptides, ranging in size from 11 to 33 residues, were studied by negative ion mode ISD (nISD). The matrices 2,5-dihydroxybenzoic acid, 2-aminobenzoic acid, 2-aminobenzamide, 1,5-diaminonaphthalene, 5-amino-1-naphthol, 3-aminoquinoline, and 9-aminoacridine were used with each peptide. Optimal fragmentation was produced with 1,5-diaminonphthalene (DAN), and extensive sequence informative fragmentation was observed for every peptide except hirudin(54-65). Cleavage at the N-Cα bond of the peptide backbone, producing c' and z' ions, was dominant for all peptides. Cleavage of the N-Cα bond N-terminal to proline residues was not observed. The formation of c and z ions is also found in electron transfer dissociation (ETD), electron capture dissociation (ECD), and positive ion mode ISD, which are considered to be radical-driven techniques. Oxidized insulin chain A, which has four highly acidic oxidized cysteine residues, had less extensive fragmentation. This peptide also exhibited the only charged localized fragmentation, with more pronounced product ion formation adjacent to the highly acidic residues. In addition, spectra were obtained by positive ion mode ISD for each protonated peptide; more sequence informative fragmentation was observed via nISD for all peptides. Three of the peptides studied had no product ion formation in ISD, but extensive sequence informative fragmentation was found in their nISD spectra. The results of this study indicate that nISD can be used to readily obtain sequence information for acidic peptides.

  5. Negative Ion In-Source Decay Matrix-Assisted Laser Desorption/Ionization Mass Spectrometry for Sequencing Acidic Peptides.

    McMillen, Chelsea L; Wright, Patience M; Cassady, Carolyn J

    2016-05-01

    Matrix-assisted laser desorption/ionization (MALDI) in-source decay was studied in the negative ion mode on deprotonated peptides to determine its usefulness for obtaining extensive sequence information for acidic peptides. Eight biological acidic peptides, ranging in size from 11 to 33 residues, were studied by negative ion mode ISD (nISD). The matrices 2,5-dihydroxybenzoic acid, 2-aminobenzoic acid, 2-aminobenzamide, 1,5-diaminonaphthalene, 5-amino-1-naphthol, 3-aminoquinoline, and 9-aminoacridine were used with each peptide. Optimal fragmentation was produced with 1,5-diaminonphthalene (DAN), and extensive sequence informative fragmentation was observed for every peptide except hirudin(54-65). Cleavage at the N-Cα bond of the peptide backbone, producing c' and z' ions, was dominant for all peptides. Cleavage of the N-Cα bond N-terminal to proline residues was not observed. The formation of c and z ions is also found in electron transfer dissociation (ETD), electron capture dissociation (ECD), and positive ion mode ISD, which are considered to be radical-driven techniques. Oxidized insulin chain A, which has four highly acidic oxidized cysteine residues, had less extensive fragmentation. This peptide also exhibited the only charged localized fragmentation, with more pronounced product ion formation adjacent to the highly acidic residues. In addition, spectra were obtained by positive ion mode ISD for each protonated peptide; more sequence informative fragmentation was observed via nISD for all peptides. Three of the peptides studied had no product ion formation in ISD, but extensive sequence informative fragmentation was found in their nISD spectra. The results of this study indicate that nISD can be used to readily obtain sequence information for acidic peptides. Graphical Abstract ᅟ. PMID:26864792

  6. Negative Ion In-Source Decay Matrix-Assisted Laser Desorption/Ionization Mass Spectrometry for Sequencing Acidic Peptides

    McMillen, Chelsea L.; Wright, Patience M.; Cassady, Carolyn J.

    2016-02-01

    Matrix-assisted laser desorption/ionization (MALDI) in-source decay was studied in the negative ion mode on deprotonated peptides to determine its usefulness for obtaining extensive sequence information for acidic peptides. Eight biological acidic peptides, ranging in size from 11 to 33 residues, were studied by negative ion mode ISD (nISD). The matrices 2,5-dihydroxybenzoic acid, 2-aminobenzoic acid, 2-aminobenzamide, 1,5-diaminonaphthalene, 5-amino-1-naphthol, 3-aminoquinoline, and 9-aminoacridine were used with each peptide. Optimal fragmentation was produced with 1,5-diaminonphthalene (DAN), and extensive sequence informative fragmentation was observed for every peptide except hirudin(54-65). Cleavage at the N-Cα bond of the peptide backbone, producing c' and z' ions, was dominant for all peptides. Cleavage of the N-Cα bond N-terminal to proline residues was not observed. The formation of c and z ions is also found in electron transfer dissociation (ETD), electron capture dissociation (ECD), and positive ion mode ISD, which are considered to be radical-driven techniques. Oxidized insulin chain A, which has four highly acidic oxidized cysteine residues, had less extensive fragmentation. This peptide also exhibited the only charged localized fragmentation, with more pronounced product ion formation adjacent to the highly acidic residues. In addition, spectra were obtained by positive ion mode ISD for each protonated peptide; more sequence informative fragmentation was observed via nISD for all peptides. Three of the peptides studied had no product ion formation in ISD, but extensive sequence informative fragmentation was found in their nISD spectra. The results of this study indicate that nISD can be used to readily obtain sequence information for acidic peptides.

  7. Homology analyses of the protein sequences of fatty acid synthases from chicken liver, rat mammary gland, and yeast

    Homology analyses of the protein sequences of chicken liver and rat mammary gland fatty acid synthases were carried out. The amino acid sequences of the chicken and rat enzymes are 67% identical. If conservative substitutions are allowed, 78% of the amino acids are matched. A region of low homologies exists between the functional domains, in particular around amino acid residues 1059-1264 of the chicken enzyme. Homologies between the active sites of chicken and rat and of chicken and yeast enzymes have been analyzed by an alignment method. A high degree of homology exists between the active sites of the chicken and rat enzymes. However, the chicken and yeast enzymes show a lower degree of homology. The DADPH-binding dinucleotide folds of the β-ketoacyl reductase and the enoyl reductase sites were identified by comparison with a known consensus sequence for the DADP- and FAD-binding dinucleotide folds. The active sites of all of the enzymes are primarily in hydrophobic regions of the protein. This study suggests that the genes for the functional domains of fatty acid synthase were originally separated, and these genes were connected to each other by using different connecting nucleotide sequences in different species. An alternative explanation for the differences in rat and chicken is a common ancestry and mutations in the joining regions during evolution

  8. The developmental transcriptome landscape of bovine skeletal muscle defined by Ribo-Zero ribonucleic acid sequencing.

    Sun, X; Li, M; Sun, Y; Cai, H; Li, R; Wei, X; Lan, X; Huang, Y; Lei, C; Chen, H

    2015-12-01

    Ribonucleic acid sequencing (RNA-Seq) libraries are normally prepared with oligo(dT) selection of poly(A)+ mRNA, but it depends on intact total RNA samples. Recent studies have described Ribo-Zero technology, a novel method that can capture both poly(A)+ and poly(A)- transcripts from intact or fragmented RNA samples. We report here the first application of Ribo-Zero RNA-Seq for the analysis of the bovine embryonic, neonatal, and adult skeletal muscle whole transcriptome at an unprecedented depth. Overall, 19,893 genes were found to be expressed, with a high correlation of expression levels between the calf and the adult. Hundreds of genes were found to be highly expressed in the embryo and decreased at least 10-fold after birth, indicating their potential roles in embryonic muscle development. In addition, we present for the first time the analysis of global transcript isoform discovery in bovine skeletal muscle and identified 36,694 transcript isoforms. Transcriptomic data were also analyzed to unravel sequence variations; 185,036 putative SNP and 12,428 putative short insertions-deletions (InDel) were detected. Specifically, many stop-gain, stop-loss, and frameshift mutations were identified that probably change the relative protein production and sequentially affect the gene function. Notably, the numbers of stage-specific transcripts, alternative splicing events, SNP, and InDel were greater in the embryo than in the calf and the adult, suggesting that gene expression is most active in the embryo. The resulting view of the transcriptome at a single-base resolution greatly enhances the comprehensive transcript catalog and uncovers the global trends in gene expression during bovine skeletal muscle development. PMID:26641174

  9. N-terminal amino acid sequence of Bacillus licheniformis alpha-amylase: comparison with Bacillus amyloliquefaciens and Bacillus subtilis Enzymes.

    Kuhn, H; Fietzek, P P; Lampen, J. O.

    1982-01-01

    The thermostable, liquefying alpha-amylase from Bacillus licheniformis was immunologically cross-reactive with the thermolabile, liquefying alpha-amylase from Bacillus amyloliquefaciens. Their N-terminal amino acid sequences showed extensive homology with each other, but not with the saccharifying alpha-amylases of Bacillus subtilis.

  10. Genome Sequence of a Candidate World Health Organization Reference Strain of Zika Virus for Nucleic Acid Testing.

    Trösemeier, Jan-Hendrik; Musso, Didier; Blümel, Johannes; Thézé, Julien; Pybus, Oliver G; Baylis, Sally A

    2016-01-01

    We report here the sequence of a candidate reference strain of Zika virus (ZIKV) developed on behalf of the World Health Organization (WHO). The ZIKV reference strain is intended for use in nucleic acid amplification (NAT)-based assays for the detection and quantification of ZIKV RNA. PMID:27587826

  11. Draft Genome Sequence of Lactobacillus delbrueckii subsp. bulgaricus CFL1, a Lactic Acid Bacterium Isolated from French Handcrafted Fermented Milk

    Meneghel, Julie; Irlinger, Françoise; Loux, Valentin; Vidal, Marie; Passot, Stéphanie; Béal, Catherine; Layec, Séverine

    2016-01-01

    Lactobacillus delbrueckii subsp. bulgaricus (L. bulgaricus) is a lactic acid bacterium widely used for the production of yogurt and cheeses. Here, we report the genome sequence of L. bulgaricus CFL1 to improve our knowledge on its stress-induced damages following production and end-use processes. PMID:26941141

  12. Draft Genome Sequence of Lactobacillus delbrueckii subsp. bulgaricus CFL1, a Lactic Acid Bacterium Isolated from French Handcrafted Fermented Milk.

    Meneghel, Julie; Dugat-Bony, Eric; Irlinger, Françoise; Loux, Valentin; Vidal, Marie; Passot, Stéphanie; Béal, Catherine; Layec, Séverine; Fonseca, Fernanda

    2016-01-01

    Lactobacillus delbrueckii subsp. bulgaricus (L. bulgaricus) is a lactic acid bacterium widely used for the production of yogurt and cheeses. Here, we report the genome sequence of L. bulgaricus CFL1 to improve our knowledge on its stress-induced damages following production and end-use processes. PMID:26941141

  13. Genome Sequence of Corynebacterium glutamicum ATCC 14067, Which Provides Insight into Amino Acid Biosynthesis in Coryneform Bacteria

    Lv, Yangyong; Liao, Juanjun; Wu, Zhanhong; Han, Shuangyan; Lin, Ying; Zheng, Suiping

    2012-01-01

    We report the genome sequence of Corynebacterium glutamicum ATCC 14067 (once named Brevibacterium flavum), which is useful for taxonomy research and further molecular breeding in amino acid production. Preliminary comparison with those of the reported coryneform strains revealed some notable differences that might be related to the difficulties in molecular manipulation.

  14. Complete genome sequence of Lactobacillus plantarum ZS2058, a probiotic strain with high conjugated linoleic acid production ability.

    Yang, Bo; Chen, Haiqin; Tian, Fengwei; Zhao, Jianxin; Gu, Zhennan; Zhang, Hao; Chen, Yong Q; Chen, Wei

    2015-11-20

    Lactobacillus plantarum ZS2058 was isolated from sauerkraut and identified to synthesize the beneficial metabolite conjugated linoleic acid. The genome contains a 319,7363-bp chromosome and three plasmids. The sequence will facilitate identification and characterization of the genetic determinants for its putative biological benefits. PMID:26439428

  15. Colorimetric and visual read-out determination of cyanuric acid exploiting the interaction between melamine and silver nanoparticles

    We present two colorimetric procedures for the determination of cyanuric acid, using silver nanoparticle-based (AgNPs) probes. The first is making use of melamine-modified AgNPs which bind to cyanuric acid through hydrogen bonding to form a large conjugate network that enhances the aggregation of AgNPs to produce an absorbance peak at 640 nm and a green coloration. In the second assay, melamine is directly added to the sample in order to form a stable complex with cyanuric acid. AgNPs are then added, resulting in the formation of an absorbance peaking at 525 nm and a color change from green (blank sample) to purple or orange-red as a function of cyanuric acid concentration. Matrix effects, that originate from the interaction of alkaline earth metals with the charged surface of the AgNPs, are mitigated through a matrix-matched calibration. In this manner, spectral transitions can be selectively attributed to the concentration of cyanuric acid, which can be even visually quantified at low mg L−1 levels with minimum sample pre-treatment and without sophisticated instrumentation. (author)

  16. A randomized trial comparing the diagnostic accuracy of visual inspection with acetic acid to Visual Inspection with Lugol's Iodine for cervical cancer screening in HIV-infected women.

    Megan J Huchko

    Full Text Available Visual inspection with Acetic Acid (VIA and Visual Inspection with Lugol’s Iodine (VILI are increasingly recommended in various cervical cancer screening protocols in low-resource settings. Although VIA is more widely used, VILI has been advocated as an easier and more specific screening test. VILI has not been well-validated as a stand-alone screening test, compared to VIA or validated for use in HIV-infected women. We carried out a randomized clinical trial to compare the diagnostic accuracy of VIA and VILI among HIV-infected women. Women attending the Family AIDS Care and Education Services (FACES clinic in western Kenya were enrolled and randomized to undergo either VIA or VILI with colposcopy. Lesions suspicious for cervical intraepithelial neoplasia 2 or greater (CIN2+ were biopsied. Between October 2011 and June 2012, 654 were randomized to undergo VIA or VILI. The test positivity rates were 26.2% for VIA and 30.6% for VILI (p = 0.22. The rate of detection of CIN2+ was 7.7% in the VIA arm and 11.5% in the VILI arm (p = 0.10. There was no significant difference in the diagnostic performance of VIA and VILI for the detection of CIN2+. Sensitivity and specificity were 84.0% and 78.6%, respectively, for VIA and 84.2% and 76.4% for VILI. The positive and negative predictive values were 24.7% and 98.3% for VIA, and 31.7% and 97.4% for VILI. Among women with CD4+ count < 350, VILI had a significantly decreased specificity (66.2% compared to VIA in the same group (83.9%, p = 0.02 and compared to VILI performed among women with CD4+ count ≥ 350 (79.7%, p = 0.02. VIA and VILI had similar diagnostic accuracy and rates of CIN2+ detection among HIV-infected women.

  17. Nucleotide and amino acid sequences of a coat protein of an Ukrainian isolate of Potato virus Y: comparison with homologous sequences of other isolates and phylogenetic analysis

    Budzanivska I. G.

    2014-03-01

    Full Text Available Aim. Identification of the widespread Ukrainian isolate(s of PVY (Potato virus Y in different potato cultivars and subsequent phylogenetic analysis of detected PVY isolates based on NA and AA sequences of coat protein. Methods. ELISA, RT-PCR, DNA sequencing and phylogenetic analysis. Results. PVY has been identified serologically in potato cultivars of Ukrainian selection. In this work we have optimized a method for total RNA extraction from potato samples and offered a sensitive and specific PCR-based test system of own design for diagnostics of the Ukrainian PVY isolates. Part of the CP gene of the Ukrainian PVY isolate has been sequenced and analyzed phylogenetically. It is demonstrated that the Ukrainian isolate of Potato virus Y (CP gene has a higher percentage of homology with the recombinant isolates (strains of this pathogen (approx. 98.8– 99.8 % of homology for both nucleotide and translated amino acid sequences of the CP gene. The Ukrainian isolate of PVY is positioned in the separate cluster together with the isolates found in Syria, Japan and Iran; these isolates possibly have common origin. The Ukrainian PVY isolate is confirmed to be recombinant. Conclusions. This work underlines the need and provides the means for accurate monitoring of Potato virus Y in the agroecosystems of Ukraine. Most importantly, the phylogenetic analysis demonstrated the recombinant nature of this PVY isolate which has been attributed to the strain group O, subclade N:O.

  18. Evolution of vertebrate IgM: complete amino acid sequence of the constant region of Ambystoma mexicanum mu chain deduced from cDNA sequence.

    Fellah, J S; Wiles, M V; Charlemagne, J; Schwager, J

    1992-10-01

    cDNA clones coding for the constant region of the Mexican axolotl (Ambystoma mexicanum) mu heavy immunoglobulin chain were selected from total spleen RNA, using a cDNA polymerase chain reaction technique. The specific 5'-end primer was an oligonucleotide homologous to the JH segment of Xenopus laevis mu chain. One of the clones, JHA/3, corresponded to the complete constant region of the axolotl mu chain, consisting of a 1362-nucleotide sequence coding for a polypeptide of 454 amino acids followed in 3' direction by a 179-nucleotide untranslated region and a polyA+ tail. The axolotl C mu is divided into four typical domains (C mu 1-C mu 4) and can be aligned with the Xenopus C mu with an overall identity of 56% at the nucleotide level. Percent identities were particularly high between C mu 1 (59%) and C mu 4 (71%). The C-terminal 20-amino acid segment which constitutes the secretory part of the mu chain is strongly homologous to the equivalent sequences of chondrichthyans and of other tetrapods, including a conserved N-linked oligosaccharide, the penultimate cysteine and the C-terminal lysine. The four C mu domains of 13 vertebrate species ranging from chondrichthyans to mammals were aligned and compared at the amino acid level. The significant number of mu-specific residues which are conserved into each of the four C mu domains argues for a continuous line of evolution of the vertebrate mu chain. This notion was confirmed by the ability to reconstitute a consistent vertebrate evolution tree based on the phylogenic parsimony analysis of the C mu 4 sequences. PMID:1382992

  19. Complete amino acid sequence of human plasma Zn-α2-glycoprotein and its homology to histocompatibility antigens

    In the present study the complete amino acid sequence of human plasma Zn-α2-glycoprotein was determined. This protein whose biological function is unknown consists of a single polypeptide chain of 276 amino acid residues including 8 tryptophan residues and has a pyroglutamyl residue at the amino terminus. The location of the two disulfide bonds in the polypeptide chain was also established. The three glycans, whose structure was elucidated with the aid of 500 MHz 1H NMR spectroscopy, were sialylated N-biantennas. The molecular weight calculated from the polypeptide and carbohydrate structure is 38,478, which is close to the reported value of ≅ 41,000 based on physicochemical measurements. The predicted secondary structure appeared to comprised of 23% α-helix, 27% β-sheet, and 22% β-turns. The three N-glycans were found to be located in β-turn regions. An unexpected finding was made by computer analysis of the sequence data; this revealed that Zn-α2-glycoprotein is closely related to antigens of the major histocompatibility complex in amino acid sequence and in domain structure. There was an unusually high degree of sequence homology with the α chains of class I histocompatibility antigens. Moreover, this plasma protein was shown to be a member of the immunoglobulin gene superfamily. Zn-α2-glycoprotein appears to be truncated secretory major histocompatibility complex-related molecule, and it may have a role in the expression of the immune response

  20. Human tyrosyl-tRNA synthetase shares amino acid sequence homology with a putative cytokine.

    Kleeman, T A; Wei, D; Simpson, K L; First, E A

    1997-05-30

    To test the hypothesis that tRNATyr recognition differs between bacterial and human tyrosyl-tRNA synthetases, we sequenced several clones identified as human tyrosyl-tRNA synthetase cDNAs by the Human Genome Project. We found that human tyrosyl-tRNA synthetase is composed of three domains: 1) an amino-terminal Rossmann fold domain that is responsible for formation of the activated E.Tyr-AMP intermediate and is conserved among bacteria, archeae, and eukaryotes; 2) a tRNA anticodon recognition domain that has not been conserved between bacteria and eukaryotes; and 3) a carboxyl-terminal domain that is unique to the human tyrosyl-tRNA synthetase and whose primary structure is 49% identical to the putative human cytokine endothelial monocyte-activating protein II, 50% identical to the carboxyl-terminal domain of methionyl-tRNA synthetase from Caenorhabditis elegans, and 43% identical to the carboxyl-terminal domain of Arc1p from Saccharomyces cerevisiae. The first two domains of the human tyrosyl-tRNA synthetase are 52, 36, and 16% identical to tyrosyl-tRNA synthetases from S. cerevisiae, Methanococcus jannaschii, and Bacillus stearothermophilus, respectively. Nine of fifteen amino acids known to be involved in the formation of the tyrosyl-adenylate complex in B. stearothermophilus are conserved across all of the organisms, whereas amino acids involved in the recognition of tRNATyr are not conserved. Kinetic analyses of recombinant human and B. stearothermophilus tyrosyl-tRNA synthetases expressed in Escherichia coli indicate that human tyrosyl-tRNA synthetase aminoacylates human but not B. stearothermophilus tRNATyr, and vice versa, supporting the original hypothesis. It is proposed that like endothelial monocyte-activating protein II and the carboxyl-terminal domain of Arc1p, the carboxyl-terminal domain of human tyrosyl-tRNA synthetase evolved from gene duplication of the carboxyl-terminal domain of methionyl-tRNA synthetase and may direct tRNA to the active site of

  1. Gastropod arginine kinases from Cellana grata and Aplysia kurodai. Isolation and cDNA-derived amino acid sequences.

    Suzuki, T; Inoue, N; Higashi, T; Mizobuchi, R; Sugimura, N; Yokouchi, K; Furukohri, T

    2000-12-01

    Arginine kinase (AK) was isolated from the radular muscle of the gastropod molluscs Cellana grata (subclass Prosobranchia) and Aplysia kurodai (subclass Opisthobranchia), respectively, by ammonium sulfate fractionation, Sephadex G-75 gel filtration and DEAE-ion exchange chromatography. The denatured relative molecular mass values were estimated to be 40 kDa by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. The isolated enzyme from Aplysia gave a Km value of 0.6 mM for arginine and a Vmax value of 13 micromole Pi min(-1) mg protein(-1) for the forward reaction. These values are comparable to other molluscan AKs. The cDNAs encoding Cellana and Aplysia AKs were amplified by polymerase chain reaction, and the nucleotide sequences of 1,608 and 1,239 bp, respectively, were determined. The open reading frame for Cellana AK is 1044 nucleotides in length and encodes a protein with 347 amino acid residues, and that for A. kurodai is 1077 nucleotides and 354 residues. The cDNA-derived amino acid sequences were validated by chemical sequencing of internal lysyl endopeptidase peptides. The amino acid sequences of Cellana and Aplysia AKs showed the highest percent identity (66-73%) with those of the abalone Nordotis and turbanshell Battilus belonging to the same class Gastropoda. These AK sequences still have a strong homology (63-71%) with that of the chiton Liolophura (class Polyplacophora), which is believed to be one of the most primitive molluscs. On the other hand, these AK sequences are less homologous (55-57%) with that of the clam Pseudocardium (class Bivalvia), suggesting that the biological position of the class Polyplacophora should be reconsidered. PMID:11281267

  2. Convergent evolution of the red- and green-like visual pigment genes in fish, Astyanax fasciatus, and human

    The authors have isolated and sequenced genes from the blind cave fish, Astyanax fasciatus, that are homologous to the human red and green visual pigment genes. The data strongly suggest that, like human, these fish have one red-like visual pigment gene and multiple green-like visual pigment genes. By comparing the DNA sequences of the human and fish visual pigment genes and knowing their phylogenetic relationship, one can infer the direction of amino acid substitutions in the red and green visual pigments. The results indicate that the red pigments in human and fish evolved from the green pigment independently by identical amino acid substitutions in only a few key positions

  3. Amino acid sequences of predicted proteins and their annotation for 95 organism species. - Gclust Server | LSDB Archive [Life Science Database Archive metadata

    Full Text Available Gclust Server Amino acid sequences of predicted proteins and their annotation for 95 organism species. Data ...detail Data name Amino acid sequences of predicted proteins and their annotation for 95 organism species. De...scription of data contents Amino acid sequences of predicted proteins and their a...nnotation for 95 organism species. The data are given in a CSV format text file. Data file File name: gclust...tation in original database Annotation at the original website Species Species name Length Amino acid sequen

  4. Sparse Representations-Based Super-Resolution of Key-Frames Extracted from Frames-Sequences Generated by a Visual Sensor Network

    Muhammad Sajjad

    2014-02-01

    Full Text Available Visual sensor networks (VSNs usually generate a low-resolution (LR frame-sequence due to energy and processing constraints. These LR-frames are not very appropriate for use in certain surveillance applications. It is very important to enhance the resolution of the captured LR-frames using resolution enhancement schemes. In this paper, an effective framework for a super-resolution (SR scheme is proposed that enhances the resolution of LR key-frames extracted from frame-sequences captured by visual-sensors. In a VSN, a visual processing hub (VPH collects a huge amount of visual data from camera sensors. In the proposed framework, at the VPH, key-frames are extracted using our recent key-frame extraction technique and are streamed to the base station (BS after compression. A novel effective SR scheme is applied at BS to produce a high-resolution (HR output from the received key-frames. The proposed SR scheme uses optimized orthogonal matching pursuit (OOMP for sparse-representation recovery in SR. OOMP does better in terms of detecting true sparsity than orthogonal matching pursuit (OMP. This property of the OOMP helps produce a HR image which is closer to the original image. The K-SVD dictionary learning procedure is incorporated for dictionary learning. Batch-OMP improves the dictionary learning process by removing the limitation in handling a large set of observed signals. Experimental results validate the effectiveness of the proposed scheme and show its superiority over other state-of-the-art schemes.

  5. Sparse representations-based super-resolution of key-frames extracted from frames-sequences generated by a visual sensor network.

    Sajjad, Muhammad; Mehmood, Irfan; Baik, Sung Wook

    2014-01-01

    Visual sensor networks (VSNs) usually generate a low-resolution (LR) frame-sequence due to energy and processing constraints. These LR-frames are not very appropriate for use in certain surveillance applications. It is very important to enhance the resolution of the captured LR-frames using resolution enhancement schemes. In this paper, an effective framework for a super-resolution (SR) scheme is proposed that enhances the resolution of LR key-frames extracted from frame-sequences captured by visual-sensors. In a VSN, a visual processing hub (VPH) collects a huge amount of visual data from camera sensors. In the proposed framework, at the VPH, key-frames are extracted using our recent key-frame extraction technique and are streamed to the base station (BS) after compression. A novel effective SR scheme is applied at BS to produce a high-resolution (HR) output from the received key-frames. The proposed SR scheme uses optimized orthogonal matching pursuit (OOMP) for sparse-representation recovery in SR. OOMP does better in terms of detecting true sparsity than orthogonal matching pursuit (OMP). This property of the OOMP helps produce a HR image which is closer to the original image. The K-SVD dictionary learning procedure is incorporated for dictionary learning. Batch-OMP improves the dictionary learning process by removing the limitation in handling a large set of observed signals. Experimental results validate the effectiveness of the proposed scheme and show its superiority over other state-of-the-art schemes. PMID:24566632

  6. Barley polyamine oxidase: Characterisation and analysis of the cofactor and the N-terminal amino acid sequence

    Radova, A.; Sebela, M.; Galuszka, P.; Frebort, I.; Jacobsen, Susanne; Faulhammer, H.G.; Pec, P.

    2001-01-01

    further purified to a final homogeneity (by the criteria of isoelectric focusing and SDS-PAGE) using techniques of low pressure chromatography followed by two FPLC steps. The purified yellow enzyme showed visible absorption maxima of a flavoprotein at 380 and 450 nm: the presence of FAD as the cofactor...... was further confirmed by measuring the fluorescence spectra, Barley PAO is an acidic protein (pI 5.4) containing 3% of neutral sugars: its molecular mass determined by SDS-PAGE was 56 kDa, whilst gel permeation chromatography revealed the higher value of 76 kDa. The N-terminal amino acid sequence of...

  7. Visually driven chaining of elementary swim patterns into a goal-directed motor sequence: a virtual reality study of zebrafish prey capture

    Johann H. Bollmann

    2013-05-01

    Full Text Available Prey capture behavior critically depends on rapid processing of sensory input in order to track, approach and catch the target. When using vision, the nervous system faces the problem of extracting relevant information from a continuous stream of input in order to detect and categorize visible objects as potential prey and to select appropriate motor patterns for approach. For prey capture, many vertebrates exhibit intermittent locomotion, in which discrete motor patterns are chained into a sequence, interrupted by short periods of rest. Here, using high-speed recordings of full-length prey capture sequences performed by freely swimming zebrafish larvae in the presence of a single paramecium, we provide a detailed kinematic analysis of first and subsequent swim bouts during prey capture. Using Fourier analysis, we show that individual swim bouts represent an elementary motor pattern. Changes in orientation are directed towards the target on a graded scale and are implemented by an asymmetric tail bend component superimposed on this basic motor pattern. To further investigate the role of visual feedback on the efficiency and speed of this complex behavior, we developed a closed-loop virtual reality setup in which minimally restrained larvae recapitulated interconnected swim patterns closely resembling those observed during prey capture in freely moving fish. Systematic variation of stimulus properties showed that prey capture is initiated within a narrow range of stimulus size and velocity. Furthermore, variations in the delay and location of swim-triggered visual feedback showed that the reaction time of secondary and later swims is shorter for stimuli that appear within a narrow spatio-temporal window following a swim. This suggests that the larva may generate an expectation of stimulus position, which enables accelerated motor sequencing if the expectation is met by appropriate visual feedback.

  8. Parameters of proteome evolution from histograms of amino-acid sequence identities of paralogous proteins

    Yan Koon-Kiu

    2007-11-01

    Full Text Available Abstract Background The evolution of the full repertoire of proteins encoded in a given genome is mostly driven by gene duplications, deletions, and sequence modifications of existing proteins. Indirect information about relative rates and other intrinsic parameters of these three basic processes is contained in the proteome-wide distribution of sequence identities of pairs of paralogous proteins. Results We introduce a simple mathematical framework based on a stochastic birth-and-death model that allows one to extract some of this information and apply it to the set of all pairs of paralogous proteins in H. pylori, E. coli, S. cerevisiae, C. elegans, D. melanogaster, and H. sapiens. It was found that the histogram of sequence identities p generated by an all-to-all alignment of all protein sequences encoded in a genome is well fitted with a power-law form ~ p-γ with the value of the exponent γ around 4 for the majority of organisms used in this study. This implies that the intra-protein variability of substitution rates is best described by the Gamma-distribution with the exponent α ≈ 0.33. Different features of the shape of such histograms allow us to quantify the ratio between the genome-wide average deletion/duplication rates and the amino-acid substitution rate. Conclusion We separately measure the short-term ("raw" duplication and deletion rates rdup∗ MathType@MTEF@5@5@+=feaafiart1ev1aaatCvAUfKttLearuWrP9MDH5MBPbIqV92AaeXatLxBI9gBaebbnrfifHhDYfgasaacPC6xNi=xH8viVGI8Gi=hEeeu0xXdbba9frFj0xb9qqpG0dXdb9aspeI8k8fiI+fsY=rqGqVepae9pg0db9vqaiVgFr0xfr=xfr=xc9adbaqaaeGacaGaaiaabeqaaeqabiWaaaGcbaGaemOCai3aa0baaSqaaiabbsgaKjabbwha1jabbchaWbqaaiabgEHiQaaaaaa@3283@, rdel∗ MathType@MTEF@5@5@+=feaafiart1ev1aaatCvAUfKttLearuWrP9MDH5MBPbIqV92AaeXatLxBI9gBaebbnrfifHhDYfgasaacPC6xNi=xH8viVGI8Gi=hEeeu0xXdbba9frFj0xb9qqpG0dXdb9aspeI8k8fiI+fsY=rqGqVepae9pg0db9vqaiVgFr0xfr=xfr=xc9adbaqaaeGacaGaaiaabeqaaeqabiWaaaGcbaGaemOCai3aa0baaSqaaiabbsga

  9. JRC GMO-Amplicons, a collection of nucleic acid sequences related to genetically modified organisms

    PETRILLO MAURO; ANGERS ALEXANDRE; HENRIKSSON PETER; Bonfini, Laura; PATAK DENNSTEDT Alexandre; KREYSA JOACHIM

    2015-01-01

    The DNA target sequence is the key element in designing detection methods for genetically modified organisms (GMOs). Unfortunately this information is frequently lacking, especially for unauthorized GMOs. In addition, patent sequences are generally poorly annotated, buried in complex and extensive documentation and hard to link to the corresponding GM event. Here, we present the JRC GMO-Amplicons, a database of amplicons collected by screening public nucleotide sequence databanks by in silico...

  10. Identification of novel rice low phytic acid mutations via TILLING by sequencing

    Phytic acid (myo-inositol-1,2,3,4,5,6-hexakisphosphate or InsP6) accounts for 75-85% of the total phosphorus in seeds. Low phytic acid (lpa) mutants exhibit decreases in seed InsP6 with corresponding increases in inorganic P which, unlike phytic acid P, is readily utilized by humans and monogastric ...

  11. Using Triple Helix Forming Peptide Nucleic Acids for Sequence-selective Recognition of Double-stranded RNA

    Hnedzko, Dziyana; Cheruiyot, Samwel K.; Rozners, Eriks

    2014-01-01

    Non-coding RNAs play important roles in regulation of gene expression. Specific recognition and inhibition of these biologically important RNAs that form complex double-helical structures will be highly useful for fundamental studies in biology and practical applications in medicine. This protocol describes a strategy developed in our laboratory for sequence-selective recognition of double-stranded RNA (dsRNA) using triple helix forming peptide nucleic acids (PNAs) that bind in the major grov...

  12. Real-Time Nucleic Acid Sequence-Based Amplification Using Molecular Beacons for Detection of Enterovirus RNA in Clinical Specimens

    Landry, Marie L.; Garner, Robin; Ferguson, David

    2005-01-01

    Real-time nucleic acid sequence-based amplification (NASBA) using molecular beacon technology (NASBA-beacon) was compared to standard NASBA with postamplification hybridization using electrochemiluminescently labeled probes (NASBA-ECL) for detection of enteroviruses (EV) in 133 cerebrospinal fluid and 27 stool samples. NASBA-ECL and NASBA-beacon were similar in sensitivity, detecting 55 (100%) and 52 (94.5%) EV-positive samples, respectively. There were no false positives. Both NASBA assays w...

  13. Comparative Complete Genome Sequence Analysis of the Amino Acid Replacements Responsible for the Thermostability of Corynebacterium efficiens

    Nishio, Yousuke; Nakamura, Yoji; Kawarabayasi, Yutaka; Usuda, Yoshihiro; Kimura, Eiichiro; Sugimoto, Shinichi; Matsui, Kazuhiko; Yamagishi, Akihiko; Kikuchi, Hisashi; Ikeo, Kazuho; Gojobori, Takashi

    2003-01-01

    Corynebacterium efficiens is the closest relative of Corynebacterium glutamicum, a species widely used for the industrial production of amino acids. C. efficiens but not C. glutamicum can grow above 40°C. We sequenced the complete C. efficiens genome to investigate the basis of its thermostability by comparing its genome with that of C. glutamicum. The difference in GC content between the species was reflected in codon usage and nucleotide substitutions. Our compar...

  14. Deep sequencing of the Mexican avocado transcriptome, an ancient angiosperm with a high content of fatty acids

    Ibarra-Laclette, Enrique; Méndez-Bravo, Alfonso; Pérez-Torres, Claudia Anahí; Albert, Victor A; Mockaitis, Keithanne; Kilaru, Aruna; López-Gómez, Rodolfo; Cervantes-Luevano, Jacob Israel; Herrera-Estrella, Luis

    2015-01-01

    Background Avocado (Persea americana) is an economically important tropical fruit considered to be a good source of fatty acids. Despite its importance, the molecular and cellular characterization of biochemical and developmental processes in avocado is limited due to the lack of transcriptome and genomic information. Results The transcriptomes of seeds, roots, stems, leaves, aerial buds and flowers were determined using different sequencing platforms. Additionally, the transcriptomes of thre...

  15. ngs.plot: Quick mining and visualization of next-generation sequencing data by integrating genomic databases

    Shen, Li; Shao, Ningyi; Liu, Xiaochuan; Nestler, Eric

    2014-01-01

    Background Understanding the relationship between the millions of functional DNA elements and their protein regulators, and how they work in conjunction to manifest diverse phenotypes, is key to advancing our understanding of the mammalian genome. Next-generation sequencing technology is now used widely to probe these protein-DNA interactions and to profile gene expression at a genome-wide scale. As the cost of DNA sequencing continues to fall, the interpretation of the ever increasing amount...

  16. Amino acid sequence of the serine-repeat antigen (SERA) of Plasmodium falciparum determined from cloned cDNA.

    Bzik, D J; Li, W B; Horii, T; Inselburg, J

    1988-09-01

    We report the isolation of cDNA clones for a Plasmodium falciparum gene that encodes the complete amino acid sequence of a previously identified exported blood stage antigen. The Mr of this antigen protein had been determined by sodium dodecylsulphate-polyacrylamide gel electrophoresis analysis, by different workers, to be 113,000, 126,000, and 140,000. We show, by cDNA nucleotide sequence analysis, that this antigen gene encodes a 989 amino acid protein (111 kDa) that contains a potential signal peptide, but not a membrane anchor domain. In the FCR3 strain the serine content of the protein was 11%, of which 57% of the serine residues were localized within a 201 amino acid sequence that included 35 consecutive serine residues. The protein also contained three possible N-linked glycosylation sites and numerous possible O-linked glycosylation sites. The mRNA was abundant during late trophozoite-schizont parasite stages. We propose to identity this antigen, which had been called p126, by the acronym SERA, serine-repeat antigen, based on its complete structure. The usefulness of the cloned cDNA as a source of a possible malaria vaccine is considered in view of the previously demonstrated ability of the antigen to induce parasite-inhibitory antibodies and a protective immune response in Saimiri monkeys. PMID:2847041

  17. cDNA-derived amino-acid sequence of a land turtle (Geochelone carbonaria) beta-chain hemoglobin.

    Bordin, S; Meza, A N; Saad, S T; Ogo, S H; Costa, F F

    1997-06-01

    The cDNA sequence encoding the turtle Geochelone carbonaria beta-chain was determinated. The isolation of hemoglobin mRNA was based on degenerate primers' PCR in combination with 5'- and 3'-RACE protocol. The full length cDNA is 615 bp with the ATG start codon at position 53 and TGA stop codon at position 495; The AATAAA polyadenylation signal is found at position 599. The deduced polypeptyde contains 146 amino-acid residues. The predicted amino acid sequence shares 83% identity with the beta-globin of a related specie, the aquatic turtle C. p. belli. Otherwise, identity is higher when compared with chicken beta-Hb (80%) than with other reptilian orders (Squamata, 69%, and Crocodilia, 61%). Compared with human HbA, there is 67% identity, and at least three amino acid substitutions could be of some functional significance (Glu43 beta-->Ser, His116 beta-->Thr and His143 beta-->Leu). To our knowledge this represents the first cDNA sequence of a reptile globin gene described. PMID:9238523

  18. A novel T-cell-defined HLA-DR polymorphism not predicted from the linear amino acid sequence.

    Termijtelen, A; van den Elsen, P; Koning, F; de Koster, S; Schroeijers, W; Vanderkerckhove, B

    1989-09-01

    Recent investigations have shown that alloreactive T cells are capable of responding to structures defined by specific linear amino acid sequences on class II molecules. In the present study we show that also a polymorphism can be recognized that is not defined by such linear amino acid sequences. Two human T-cell clones, sensitized to DRw13 haplotypes, are described. The description of clone c50 serves to exemplify the first model. This DRB1-specific clone responds to stimulator cells that carry DR molecules, different in their DRB1 first and second hypervariable regions (HV1 and HV2) but identical in their HV3 regions (i.e., DRw13,Dw18; DRw13,Dw19; DR4,Dw10; and DRw11,LDVII). The second clone, c1443, behaves nonconventionally. It responds to DRw13,Dw18; DRw13,Dw19; and DR4,Dw4 stimulator cells, although no specific amino acid sequence is shared between these specificities. The latter pattern of reactivity suggests the existence of a novel polymorphism recognized by alloreactive T cells. This particular polymorphism may also be biologically significant. PMID:2476425

  19. Complete Genome Sequences of Escherichia coli O157:H7 Strains SRCC 1675 and 28RC, Which Vary in Acid Resistance

    Baranzoni, Gian Marco; Reichenberger, Erin R.; Kim, Gwang-Hee; Breidt, Frederick; Kay, Kathryn; Oh, Deog-Hwan

    2016-01-01

    The level of acid resistance among Escherichia coli O157:H7 strains varies, and strains with higher resistance to acid may have a lower infectious dose. The complete genome sequences belonging to two strains of Escherichia coli O157:H7 with different levels of acid resistance are presented here. PMID:27469964

  20. Optic disc boundary segmentation from diffeomorphic demons registration of monocular fundus image sequences versus 3D visualization of stereo fundus image pairs for automated early stage glaucoma assessment

    Gatti, Vijay; Hill, Jason; Mitra, Sunanda; Nutter, Brian

    2014-03-01

    Despite the current availability in resource-rich regions of advanced technologies in scanning and 3-D imaging in current ophthalmology practice, world-wide screening tests for early detection and progression of glaucoma still consist of a variety of simple tools, including fundus image-based parameters such as CDR (cup to disc diameter ratio) and CAR (cup to disc area ratio), especially in resource -poor regions. Reliable automated computation of the relevant parameters from fundus image sequences requires robust non-rigid registration and segmentation techniques. Recent research work demonstrated that proper non-rigid registration of multi-view monocular fundus image sequences could result in acceptable segmentation of cup boundaries for automated computation of CAR and CDR. This research work introduces a composite diffeomorphic demons registration algorithm for segmentation of cup boundaries from a sequence of monocular images and compares the resulting CAR and CDR values with those computed manually by experts and from 3-D visualization of stereo pairs. Our preliminary results show that the automated computation of CDR and CAR from composite diffeomorphic segmentation of monocular image sequences yield values comparable with those from the other two techniques and thus may provide global healthcare with a cost-effective yet accurate tool for management of glaucoma in its early stage.

  1. Rapid visual identification of PCR amplified nucleic acids by centrifugal gel separation: Potential use for molecular point-of-care tests.

    Hwang, Sang-Hyun; Kim, Dong-Eun; Im, Ji-Hyun; Kang, Su-Jin; Lee, Do-Hoon; Son, Sang Jun

    2016-05-15

    Recently, nucleic acid amplification and detection techniques have progressed based on advances in in microfluidics, microelectronics, and optical systems. Nucleic acids amplification based point-of-care test (POCT) in resource-limited settings requires simple visual detection methods. Several biosensing methods including lateral flow immunoassays (LFIA) were previously used to visually detect nucleic acids. However, prolonged assay time, several washing steps, and a need for specific antibodies limited their use. Here we developed a novel, rapid method to visualize amplified nucleic acids with naked eyes in clinical samples. First, we optimized conditions based on separation using very low centrifugal force and a density medium to detect human papillomavirus (HPV)-16 DNA in cervical specimens. After DNA extraction, HPV16 PCR was performed with biotin-labeled forward primer and Cy3-labeled reverse primer. PCR amplicon was mixed with streptavidin-magnetic beads, introduced into the density medium. After two-minute centrifugation, the result was visually identified. This system showed identical results with commercial HPV real-time PCR for 30 clinical samples and could detect up to 10(2)copies/mL of HPV DNA without any optical instruments. This robust and sensitive visual detection system is suitable for non-specialist personnel and point-of-care diagnosis in low-resource settings. PMID:26774997

  2. Fad7 gene identification and fatty acids phenotypic variation in an olive collection by EcoTILLING and sequencing approaches.

    Sabetta, Wilma; Blanco, Antonio; Zelasco, Samanta; Lombardo, Luca; Perri, Enzo; Mangini, Giacomo; Montemurro, Cinzia

    2013-08-01

    The ω-3 fatty acid desaturases (FADs) are enzymes responsible for catalyzing the conversion of linoleic acid to α-linolenic acid localized in the plastid or in the endoplasmic reticulum. In this research we report the genotypic and phenotypic variation of Italian Olea europaea L. germoplasm for the fatty acid composition. The phenotypic oil characterization was followed by the molecular analysis of the plastidial-type ω-3 FAD gene (fad7) (EC 1.14.19), whose full-length sequence has been here identified in cultivar Leccino. The gene consisted of 2635 bp with 8 exons and 5'- and 3'-UTRs of 336 and 282 bp respectively, and showed a high level of heterozygousity (1/110 bp). The natural allelic variation was investigated both by a LiCOR EcoTILLING assay and the PCR product direct sequencing. Only three haplotypes were identified among the 96 analysed cultivars, highlighting the strong degree of conservation of this gene. PMID:23685785

  3. Diagnosing Cervical Dysplasia Using Visual Inspection of the Cervix with Acetic Acid in a Woman in Rural Haiti

    Elizabeth Roger

    2014-11-01

    Full Text Available Cervical cancer remains a significant cause of morbidity and mortality for women in developing countries, despite the fact that inexpensive, simple and effective screening methods are available. Visual inspection of the cervix with acetic acid (VIA can be used as part of a “screen and treat” program to identify precancerous lesions for cryotherapy treatment. This case report details how the VIA screening test was incorporated into the care of a patient presenting to a maternal health clinic in Thomonde, Haiti which was staffed by doctors and medical students from Emory University School of Medicine in collaboration with Haiti Medishare. As demonstrated here, the VIA test requires minimal materials, can be efficiently incorporated into a physical exams, provides immediate results, and is easily demonstrated to and performed by local healthcare providers. The straightforward and sensitive VIA technique is an ideal cervical cancer screening method for resource poor areas.

  4. Visual test for melamine using silver nanoparticles modified with chromotropic acid

    A simple and low-cost assay for melamine is introduced that is making use of silver nanoparticles (AgNPs) functionalized with chromotropic acid (CTA). The surface of the AgNPs was capped with chromotropic acid which warrants the NPs to remain in stable and dispersed form. The presence of melamine induces the aggregation of the CTA-AgNPs due to the hydrogen bond interaction between CTA and melamine. This is accompanied by a color change from yellow to orange which can be observed with bare eyes. The method allows melamine to be quantified by absorptiometry with a linear response in the concentration range from 0.10 to 1.5 μM (R = 0.9996) and a detection limit of 36 nM which was much lower than the safe limits (20 μM in both the USA and EU, 8 μM for infant formula in China, 1.2 μM in the CAC review for melamine in liquid infant formula). The assay displays high selectivity to melamine over its structural analogs such as cyanuric acid, 2,4,6-trimethyl-1,3,5-triazine, and phloro glucinol owing to the fact that only melamine can act as the hydrogen donor to form hydrogen bonds with the sulfo groups of the CTA-capped AgNPs. The method was successfully applied to the determination of melamine in spiked liquid milk and the average recovery was 99 %. Most amino acids and a high content of calcium do not interfere in this assay. (author)

  5. The role of low-level magnification in visual inspection with acetic acid for the early detection of cervical neoplasia.

    Sankaranarayanan, Rengaswamy; Shastri, Surendra S; Basu, Parthasarathi; Mahé, Cédric; Mandal, Ranajit; Amin, Geethanjali; Roy, Chinmayi; Muwonge, Richard; Goswami, Smriti; Das, Pradip; Chinoy, Roshini; Frappart, Lucien; Patil, Sharmila; Choudhury, Devjani; Mukherjee, Titha; Dinshaw, Ketayun

    2004-01-01

    Several studies have investigated the accuracy of naked eye visual inspection with acetic acid (VIA) in the early detection of cervical neoplasia. It is not clear whether low-level (2-4x) magnification (VIAM) can improve the sensitivity and specificity of VIA. The accuracy of both VIA and VIAM, provided by independent health workers, were evaluated in three cross-sectional studies involving 18,675 women aged 25-65 years in Kolkata and Mumbai in India. All screened women were investigated with colposcopy and biopsies were obtained based on colposcopy findings. The final disease status was based on the reference standard of histology (if biopsies had been taken) or colposcopy. Data from the studies were pooled to calculate the test characteristics for the detection of high-grade squamous intraepithelial lesions (HSIL). 14.1% and 14.2% were positive on testing with VIA and VIAM respectively. Two hundred twenty-nine were diagnosed with HSIL and 68 with invasive cancer. The pooled sensitivity, specificity, positive and negative predictive values for VIA in detecting high-grade squamous intraepithelial lesions (HSIL) were 60.3% (95% CI: 53.6-66.7), 86.8% (95% CI: 86.3-87.3), 5.9% (95% CI: 5.0-7.0), and 99.4% (95% CI: 99.2-99.5), respectively. The values were 64.2% (95% CI: 57.6-70.4), 86.8% (95% CI: 86.2-87.3), 6.3% (95% CI: 5.3-7.3) and 99.4% (95% CI: 99.3-99.6), respectively, for VIAM. Low-level magnification did not improve the test performance of naked eye visualization of acetic acid impregnated uterine cervix. PMID:15542259

  6. Visualization of Two Phase Natural Convection Flow in a Vertical Pipe using the Sulfuric Acid - Copper Sulfate Electroplating System

    The passive containment cooling system (PCCS) driven by natural forces convection gain draws research interests after Fukushima NPP accident. The PCCS was classified into three categories: Containment pressure suppression, Containment passive heat removal/pressure suppression systems and Passive containment spray. Among the types of containment passive heat removal/pressure suppression systems, the system composed of an internal heat exchanger and an external coolant tank is considered. In a severe accident condition, the heat from the containment atmosphere is transferred to the outer surface of the heat exchanger by the convection and condensation of the mixture of steam and gases. On the other hand, the heat is transferred to external pool by single phase or two phase natural convection inside of heat exchanger pipes. The study aimed at investigating the influence of the diameter (D) and height (H) of the heat exchanger pipes on the single phase and two phase natural convection heat transfer. As the initial stage of the study, the two phase natural convection flow inside a vertical pipe is visualized. In order to achieve the aim with ample test rig, a sulfuric acid - cooper sulfate electroplating system was employed based on the analogy between heat and mass transfer. The reduction of hydrogen ion at the cathode surface at high potential was used to simulate the boiling phenomena. This study tried to visualize the boiling heat transfer inside a vertical pipe using a cupric acid-copper sulfate (H2SO4-CuSO4) electroplating system. This seems to be successful so far. However further study has to be done to compare the result with real two phase flow situation. The surface tension and surface characteristics are to be tuned to simulate the real situation

  7. Visualization of Two Phase Natural Convection Flow in a Vertical Pipe using the Sulfuric Acid - Copper Sulfate Electroplating System

    Ohk, Seung-Min; Chae, Myeong-Seon; Chung, Bum-Jin [Kyung Hee Univ., Yongin (Korea, Republic of)

    2014-10-15

    The passive containment cooling system (PCCS) driven by natural forces convection gain draws research interests after Fukushima NPP accident. The PCCS was classified into three categories: Containment pressure suppression, Containment passive heat removal/pressure suppression systems and Passive containment spray. Among the types of containment passive heat removal/pressure suppression systems, the system composed of an internal heat exchanger and an external coolant tank is considered. In a severe accident condition, the heat from the containment atmosphere is transferred to the outer surface of the heat exchanger by the convection and condensation of the mixture of steam and gases. On the other hand, the heat is transferred to external pool by single phase or two phase natural convection inside of heat exchanger pipes. The study aimed at investigating the influence of the diameter (D) and height (H) of the heat exchanger pipes on the single phase and two phase natural convection heat transfer. As the initial stage of the study, the two phase natural convection flow inside a vertical pipe is visualized. In order to achieve the aim with ample test rig, a sulfuric acid - cooper sulfate electroplating system was employed based on the analogy between heat and mass transfer. The reduction of hydrogen ion at the cathode surface at high potential was used to simulate the boiling phenomena. This study tried to visualize the boiling heat transfer inside a vertical pipe using a cupric acid-copper sulfate (H{sub 2}SO{sub 4}-CuSO{sub 4}) electroplating system. This seems to be successful so far. However further study has to be done to compare the result with real two phase flow situation. The surface tension and surface characteristics are to be tuned to simulate the real situation.

  8. Templated Synthesis of Peptide Nucleic Acids via Sequence-Selective Base-Filling Reactions

    Heemstra, Jennifer M.; Liu, David Ruchien

    2009-01-01

    The templated synthesis of nucleic acids has previously been achieved through the backbone ligation of preformed nucleotide monomers or oligomers. In contrast, here we demonstrate templated nucleic acid synthesis using a base-filling approach in which individual bases are added to abasic sites of a peptide nucleic acid (PNA). Because nucleobase substrates in this approach are not self-reactive, a base-filling approach may reduce the formation of nontemplated reaction products. Using either re...

  9. Site-directed gene mutation at mixed sequence targets by psoralen-conjugated pseudo-complementary peptide nucleic acids.

    Kim, Ki-Hyun; Nielsen, Peter E; Glazer, Peter M

    2007-01-01

    Sequence-specific DNA-binding molecules such as triple helix-forming oligonucleotides (TFOs) provide a means for inducing site-specific mutagenesis and recombination at chromosomal sites in mammalian cells. However, the utility of TFOs is limited by the requirement for homopurine stretches in the target duplex DNA. Here, we report the use of pseudo-complementary peptide nucleic acids (pcPNAs) for intracellular gene targeting at mixed sequence sites. Due to steric hindrance, pcPNAs are unable to form pcPNA-pcPNA duplexes but can bind to complementary DNA sequences by Watson-Crick pairing via double duplex-invasion complex formation. We show that psoralen-conjugated pcPNAs can deliver site-specific photoadducts and mediate targeted gene modification within both episomal and chromosomal DNA in mammalian cells without detectable off-target effects. Most of the induced psoralen-pcPNA mutations were single-base substitutions and deletions at the predicted pcPNA-binding sites. The pcPNA-directed mutagenesis was found to be dependent on PNA concentration and UVA dose and required matched pairs of pcPNAs. Neither of the individual pcPNAs alone had any effect nor did complementary PNA pairs of the same sequence. These results identify pcPNAs as new tools for site-specific gene modification in mammalian cells without purine sequence restriction, thereby providing a general strategy for designing gene targeting molecules. PMID:17977869

  10. Purification and amino acid sequence of a bacteriocins produced by Lactobacillus salivarius K7 isolated from chicken intestine

    Kenji Sonomoto

    2006-03-01

    Full Text Available A bacteriocin-producing strain, Lactobacillus K7, was isolated from a chicken intestine. The inhibitory activity was determined by spot-on-lawn technique. Identification of the strain was performed by morphological, biochemical (API 50 CH kit and molecular genetic (16S rDNA basis. Bacteriocin purification processes were carried out by amberlite adsorption, cation exchange and reverse-phase high perform- ance liquid chromatography. N-terminal amino acid sequences were performed by Edman degradation. Molecular mass was determined by electrospray-ionization (ESI mass spectrometry (MS. Lactobacillus K7 showed inhibitory activity against Lactobacillus sakei subsp. sakei JCM 1157T, Leuconostoc mesenteroides subsp. mesenteroides JCM 6124T and Bacillus coagulans JCM 2257T. This strain was identified as Lb. salivarius. The antimicrobial substance was destroyed by proteolytic enzymes, indicating its proteinaceous structure designated as a bacteriocin type. The purification of bacteriocin by amberlite adsorption, cation exchange, and reverse-phase chromatography resulted in only one single active peak, which was designated FK22. Molecular weight of this fraction was 4331.70 Da. By amino acid sequence, this peptide was homology to Abp 118 beta produced by Lb. salivarius UCC118. In addition, Lb. salivarius UCC118 produced 2-peptide bacteriocin, which was Abp 118 alpha and beta. Based on the partial amino acid sequences of Abp 118 beta, specific primers were designed from nucleotide sequences according to data from GenBank. The result showed that the deduced peptide was high homology to 2-peptide bacteriocin, Abp 118 alpha and beta.

  11. The sequence diversity and expression among genes of the folic acid biosynthesis pathway in industrial Saccharomyces strains.

    Goncerzewicz, Anna; Misiewicz, Anna

    2015-01-01

    Folic acid is an important vitamin in human nutrition and its deficiency in pregnant women's diets results in neural tube defects and other neurological damage to the fetus. Additionally, DNA synthesis, cell division and intestinal absorption are inhibited in case of adults. Since this discovery, governments and health organizations worldwide have made recommendations concerning folic acid supplementation of food for women planning to become pregnant. In many countries this has led to the introduction of fortifications, where synthetic folic acid is added to flour. It is known that Saccharomyces strains (brewing and bakers' yeast) are one of the main producers of folic acid and they can be used as a natural source of this vitamin. Proper selection of the most efficient strains may enhance the folate content in bread, fermented vegetables, dairy products and beer by 100% and may be used in the food industry. The objective of this study was to select the optimal producing yeast strain by determining the differences in nucleotide sequences in the FOL2, FOL3 and DFR1 genes of folic acid biosynthesis pathway. The Multitemperature Single Strand Conformation Polymorphism (MSSCP) method and further nucleotide sequencing for selected strains were applied to indicate SNPs in selected gene fragments. The RT qPCR technique was also applied to examine relative expression of the FOL3 gene. Furthermore, this is the first time ever that industrial yeast strains were analysed regarding genes of the folic acid biosynthesis pathway. It was observed that a correlation exists between the folic acid amount produced by industrial yeast strains and changes in the nucleotide sequence of adequate genes. The most significant changes occur in the DFR1 gene, mostly in the first part, which causes major protein structure modifications in KKP 232, KKP 222 and KKP 277 strains. Our study shows that the large amount of SNP contributes to impairment of the selected enzymes and S. cerevisiae and S

  12. Parameters of proteome evolution from histograms of amino-acid sequence identities of paralogous proteins

    Yan Koon-Kiu; Axelsen Jacob; Maslov Sergei

    2005-01-01

    Abstract Background The evolution of the full repertoire of proteins encoded in a given genome is mostly driven by gene duplications, deletions, and sequence modifications of existing proteins. Indirect information about relative rates and other intrinsic parameters of these three basic processes is contained in the proteome-wide distribution of sequence identities of pairs of paralogous proteins. Results We introduce a simple mathematical framework based on a stochastic birth-and-death model...

  13. Rhodamine-Sulphuric Acid -A New Visualization Reagent for the Determination of Sucralose by HPTLC

    Mohd Idris; Seema Srivastava; Baggi, T. R.; Shulka, S. K.; A. K. Ganjoo

    2010-01-01

    Sucralose a UV-visible inactive compound was separated on silica gel plate without any plate treatment prior to analysis, derivatized with rhodamine - sulphuric acid reagent and detected densitometrically at 456 nm as olive green band. With this reagent sucralose also shows golden yellow fluorescence at 366 nm. Two new solvent systems i.e. chloroform: methanol: toluene (v/v 5:3.5:1.5) (solvent system-I) and chloroform: ethanol: benzene (v/v 5:3:2) (solvent system-II) were developed and giving...

  14. "De-novo" amino acid sequence elucidation of protein G'e by combined "Top-Down" and "Bottom-Up" mass spectrometry

    Yefremova, Yelena; Al-Majdoub, Mahmoud; Opuni, Kwabena F. M.; Koy, Cornelia; Cui, Weidong; Yan, Yuetian; Gross, Michael L.; Glocker, Michael O.

    2015-03-01

    Mass spectrometric de-novo sequencing was applied to review the amino acid sequence of a commercially available recombinant protein Ǵ with great scientific and economic importance. Substantial deviations to the published amino acid sequence (Uniprot Q54181) were found by the presence of 46 additional amino acids at the N-terminus, including a so-called "His-tag" as well as an N-terminal partial α- N-gluconoylation and α- N-phosphogluconoylation, respectively. The unexpected amino acid sequence of the commercial protein G' comprised 241 amino acids and resulted in a molecular mass of 25,998.9 ± 0.2 Da for the unmodified protein. Due to the higher mass that is caused by its extended amino acid sequence compared with the original protein G' (185 amino acids), we named this protein "protein G'e." By means of mass spectrometric peptide mapping, the suggested amino acid sequence, as well as the N-terminal partial α- N-gluconoylations, was confirmed with 100% sequence coverage. After the protein G'e sequence was determined, we were able to determine the expression vector pET-28b from Novagen with the Xho I restriction enzyme cleavage site as the best option that was used for cloning and expressing the recombinant protein G'e in E. coli. A dissociation constant ( K d ) value of 9.4 nM for protein G'e was determined thermophoretically, showing that the N-terminal flanking sequence extension did not cause significant changes in the binding affinity to immunoglobulins.

  15. Low molecular weight human pulmonary surfactant protein (SP5): isolation, characterization, and cDNA and amino acid sequences

    Pulmonary surfactant is a lipid-protein complex that promotes alveolar stability by lowering the surface tension at the air-fluid interface in the peripheral air spaces. A group of hydrophobic surfactant-associated proteins has been shown to be essential for rapid surface film formation by surfactant phospholipids. The authors have purified a hydrophobic surfactant protein of ≅ 5kDa that they term SP5 from bronchopulmonary lavage fluid from a patient with alveolar proteinosis and shown that it promotes rapid surface film formation by simple mixtures of phospholipids. They have derived the full amino acid sequence of human SP5 from the nucleotide sequence of cDNAs identified with oligonucleotide probes based on the NH2-terminal sequence of SP5. SP5 isolated from surfactant is a fragment of a much larger precursor protein (21 kDa). The precursor contains an extremely hydrophobic region of 34 amino acids that comprises most the mature SP5. This hydrophobicity explains the unusual solubility characteristics of SP5 and the fact that it is lipid-associated when isolated from lung

  16. Amino acid sequence of phospholipase A/sub 2/-. cap alpha. from the venom of Crotalus adamanteus

    Heinrikson, R.L.; Krueger, E.T.; Keim, P.S.

    1977-07-25

    The complete amino acid sequence of Crotalus adamanteus venom phospholipase A/sub 2/-..cap alpha.. has been determined by analysis of the five tryptic peptides from the citraconylated, reduced, and S-(/sup 14/C)carboxamidomethylated enzyme. Earlier studies provided the information necessary to align the tryptic fragments so that secondary cleavage procedures to establish overlaps were unnecessary. The subunit in the phospholipase A/sub 2/-..cap alpha.. dimer is a single polypeptide chain containing 122 amino acids and seven disulfide bonds. The histidine residue implicated in the active site of mammalian phospholipases is at position 47 in the C. adamanteus enzyme and is located in a domain of the molecule which is highly homologous in sequence with corresponding regions of phospholipases from a variety of venom and pancreatic sources. Comparative sequence analysis has revealed insights with regard to the function and evolution of phospholipases A/sub 2/. Primary structural relationships observed among the snake venom enzymes parallel the phylogenetic classification of the venomous reptiles from which they were derived. It is proposed that phospholipases A/sub 2/ of this general type be divided into two groups depending upon the presence or absence of distinctive structural features elucidated in this study.

  17. Low molecular weight human pulmonary surfactant protein (SP5): isolation, characterization, and cDNA and amino acid sequences

    Warr, R.G.; Hawgood, S.; Buckley, D.I.; Crisp, T.M.; Schilling, J.; Benson, B.J.; Ballard, P.L.; Clements, J.A.; White, R.T.

    1987-11-01

    Pulmonary surfactant is a lipid-protein complex that promotes alveolar stability by lowering the surface tension at the air-fluid interface in the peripheral air spaces. A group of hydrophobic surfactant-associated proteins has been shown to be essential for rapid surface film formation by surfactant phospholipids. The authors have purified a hydrophobic surfactant protein of approx. = 5kDa that they term SP5 from bronchopulmonary lavage fluid from a patient with alveolar proteinosis and shown that it promotes rapid surface film formation by simple mixtures of phospholipids. They have derived the full amino acid sequence of human SP5 from the nucleotide sequence of cDNAs identified with oligonucleotide probes based on the NH/sub 2/-terminal sequence of SP5. SP5 isolated from surfactant is a fragment of a much larger precursor protein (21 kDa). The precursor contains an extremely hydrophobic region of 34 amino acids that comprises most the mature SP5. This hydrophobicity explains the unusual solubility characteristics of SP5 and the fact that it is lipid-associated when isolated from lung.

  18. Amino acid sequence and posttranslational modifications of human factor VIIa from plasma and transfected baby hamster kidney cells

    Blood coagulation factor VII is a vitamin K dependent glycoprotein which in its activated form, factor VIIa, participates in the coagulation process by activating factor X and/or factor IX in the presence of Ca2+ and tissue factor. Three types of potential posttranslational modifications exist in the human factor VIIa molecule, namely, 10 γ-carboxylated, N-terminally located glutamic acid residues, 1 β-hydroxylated aspartic acid residue, and 2 N-glycosylated asparagine residues. In the present study, the amino acid sequence and posttranslational modifications of recombinant factor VIIa as purified from the culture medium of a transfected baby hamster kidney cell line have been compared to human plasma factor VIIa. By use of HPLC, amino acid analysis, peptide mapping, and automated Edman degradation, the protein backbone of recombinant factor VIIa was found to be identical with human factor VIIa. Asparagine residues 145 and 322 were found to be fully N-glycosylated in human plasma factor VIIa. In the recombinant factor VIIa, asparagine residue 322 was fully glycosylated whereas asparagine residue 145 was only partially (approximately 66%) glycosylated. Besides minor differences in the sialic acid and fucose contents, the overall carbohydrate compositions were nearly identical in recombinant factor VIIa and human plasma factor VIIa. These results show that factor VIIa as produced in the transfected baby hamster kidney cells is very similar to human plasma factor VIIa and that this cell line thus might represent an alternative source for human factor VIIa

  19. The nucleotide sequence of HLA-B{sup *}2704 reveals a new amino acid substitution in exon 4 which is also present in HLA-B{sup *}2706

    Rudwaleit, M.; Bowness, P.; Wordsworth, P. [John Radcliffe Hospital, Oxford (United Kingdom)

    1996-12-31

    The HLA-B27 subtype HLA-B{sup *}2704 is virtually absent in Caucasians but common in Orientals, where it is associated with ankylosing spondylitis. The amino acid sequence of HLA-B{sup *}2704 has been established by peptide mapping and was shown to differ by two amino acids from HLA-B{sup *}2705, HLA-B{sup *}2704 is characterized by a serine for aspartic acid substitution at position 77 and glutamic acid for valine at position 152. To date, however, no nucleotide sequence confirming these changes at the DNA level has been published. 13 refs., 2 figs.

  20. JRC GMO-Amplicons: a collection of nucleic acid sequences related to genetically modified organisms.

    Petrillo, Mauro; Angers-Loustau, Alexandre; Henriksson, Peter; Bonfini, Laura; Patak, Alex; Kreysa, Joachim

    2015-01-01

    The DNA target sequence is the key element in designing detection methods for genetically modified organisms (GMOs). Unfortunately this information is frequently lacking, especially for unauthorized GMOs. In addition, patent sequences are generally poorly annotated, buried in complex and extensive documentation and hard to link to the corresponding GM event. Here, we present the JRC GMO-Amplicons, a database of amplicons collected by screening public nucleotide sequence databanks by in silico determination of PCR amplification with reference methods for GMO analysis. The European Union Reference Laboratory for Genetically Modified Food and Feed (EU-RL GMFF) provides these methods in the GMOMETHODS database to support enforcement of EU legislation and GM food/feed control. The JRC GMO-Amplicons database is composed of more than 240 000 amplicons, which can be easily accessed and screened through a web interface. To our knowledge, this is the first attempt at pooling and collecting publicly available sequences related to GMOs in food and feed. The JRC GMO-Amplicons supports control laboratories in the design and assessment of GMO methods, providing inter-alia in silico prediction of primers specificity and GM targets coverage. The new tool can assist the laboratories in the analysis of complex issues, such as the detection and identification of unauthorized GMOs. Notably, the JRC GMO-Amplicons database allows the retrieval and characterization of GMO-related sequences included in patents documentation. Finally, it can help annotating poorly described GM sequences and identifying new relevant GMO-related sequences in public databases. The JRC GMO-Amplicons is freely accessible through a web-based portal that is hosted on the EU-RL GMFF website. Database URL: http://gmo-crl.jrc.ec.europa.eu/jrcgmoamplicons/. PMID:26424080

  1. Heterodimeric l-amino acid oxidase enzymes from Egyptian Cerastes cerastes venom: Purification, biochemical characterization and partial amino acid sequencing

    A.E. El Hakim; W.H. Salama; M.B. Hamed; Ali, A. A.; N.M. Ibrahim

    2015-01-01

    Two l-amino acid oxidase enzyme isoforms, Cc-LAAOI and Cc-LAAOII were purified to apparent homogeneity from Cerastes cerastes venom in a sequential two-step chromatographic protocol including; gel filtration and anion exchange chromatography. The native molecular weights of the isoforms were 115 kDa as determined by gel filtration on calibrated Sephacryl S-200 column, while the monomeric molecular weights of the enzymes were, 60, 56 kDa and 60, 53 kDa for LAAOI and LAAOII, respectively. The t...

  2. Application of combined mass spectrometry and partial amino acid sequence to the identification of gel-separated proteins.

    Patterson, S D; Thomas, D; Bradshaw, R A

    1996-05-01

    The combined use of peptide mass information with amino acid sequence information derived by chemical sequencing or mass spectrometry (MS)-based approaches provides a powerful means of protein identification. We have used a two-part strategy to identify proteins from nerve growth factor (NGF)-stimulated rat adrenal pheochromocytoma cell line PC-12 cell lysates that associate with the adaptor protein Shc (Shc homologous and collagen protein). Initial experiments with metabolically radiolabeled cell extracts separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) revealed a number of proteins that coimmunoprecipitated with anti-Shc antibody compared with control (unstimulated) cell extracts. The experiment was scaled up and cell lysate from NGF-stimulated PC-12 cells was applied to a glutathione-S-transferase (GST)-Shc affinity column, eluted, separated by SDS-PAGE and blotted to Immobilon-CD. The blotted proteins were proteolytically digested in situ, and the masses obtained from the extracted peptides were used in a peptide-mass search program in an attempt to identify the protein. Even if a strong candidate was found using this search, an additional step was performed to confirm the identification. The mixtures were fractionated by reversed-phase high-performance liquid chromatography (RP-HPLC) and subjected to chemical sequencing to obtain (partial) sequence information, or post-source decay (PSD-) matrix-assisted laser-desorption ionization (MALDI)-MS to obtain sequence-specific fragment ions. This data was used in a peptide-sequence tag search to confirm the identity of the proteins. This combined approach allowed identification of four proteins of M(r) 43,000 to 200,000. In one case the identified protein clearly did not correspond to the radiolabeled band, but to a protein contaminant from the column. The advantages and pitfalls of the approach are discussed. PMID:8783013

  3. The structural analysis of protein sequences based on the quasi-amino acids code

    Proteomics is the study of proteins and their interactions in a cell. With the successful completion of the Human Genome Project, it comes the postgenome era when the proteomics technology is emerging. This paper studies protein molecule from the algebraic point of view. The algebraic system (Σ, +, *) is introduced, where Σ is the set of 64 codons. According to the characteristics of (Σ, +, *), a novel quasi-amino acids code classification method is introduced and the corresponding algebraic operation table over the set ZU of the 16 kinds of quasi-amino acids is established. The internal relation is revealed about quasi-amino acids. The results show that there exist some very close correlations between the properties of the quasi-amino acids and the codon. All these correlation relationships may play an important part in establishing the logic relationship between codons and the quasi-amino acids during the course of life origination. According to Ma F et al (2003 J. Anhui Agricultural University 30 439), the corresponding relation and the excellent properties about amino acids code are very difficult to observe. The present paper shows that (ZU, ⊕, ) is a field. Furthermore, the operational results display that the codon tga has different property from other stop codons. In fact, in the mitochondrion from human and ox genomic codon, tga is just tryptophane, is not the stop codon like in other genetic code, it is the case of the Chen W C et al (2002 Acta Biophysica Sinica 18(1) 87). The present theory avoids some inexplicable events of the 20 kinds of amino acids code, in other words it solves the problem of 'the 64 codon assignments of mRNA to amino acids is probably completely wrong' proposed by Yang (2006 Progress in Modern Biomedicine 6 3). (cross-disciplinary physics and related areas of science and technology)

  4. The structural analysis of protein sequences based on the quasi-amino acids code

    Zhu Ping; Tang Xu-Qing; Xu Zhen-Yuan

    2009-01-01

    Proteomics is the study of proteins and their interactions in a cell. With the successful completion of the Human Genome Project, it comes the postgenome era when the proteomics technology is emerging. This paper studies protein molecule from the algebraic point of view. The algebraic system (∑, +, *) is introduced, where ∑ is the set of 64 codons. According to the characteristics of (∑,+, *), a novel quasi-amino acids code classification method is introduced and the corresponding algebraic operation table over the set ZU of the 16 kinds of quasi-amino acids is established. The internal relation is revealed about quasi-amino acids. The results show that there exist some very close correlations between the properties of the quasi-amino acids and the codon. All these correlation relationships may play an important part in establishing the logic relationship between codons and the quasi-amino acids during the course of life origination. According to Ma F et al (2003 J. Anhui Agricultural University 30 439), the corresponding relation and the excellent properties about amino acids code are very difficult to observe. The present paper shows that (ZU, +, ×) is a field. Furthermore, the operational results display that the codon tga has different property from other stop codons. In fact, in the mitochondrion from human and ox genomic codon, tga is just tryptophane, is not the stop codon like in other genetic code, it is the case of the Chen W C et al (2002 Acta Biophysica Sinica 18(1) 87). The present theory avoids some inexplicable events of the 20 kinds of amino acids code, in other words it solves the problem of 'the 64 codon assignments of mRNA to amino acids is probably completely wrong' proposed by Yang (2006 Progress in Modern Biomedicine 6 3).

  5. Main: Sequences [KOME

    Full Text Available Sequences Amino Acid Sequence Amino Acid sequence of full length cDNA (Longest ORF) kome_ine_full_sequence..._amino_db.fasta.zip kome_ine_full_sequence_amino_db.zip kome_ine_full_sequence_amino_db ...

  6. Ribonuclease "XlaI," an activity from Xenopus laevis oocytes that excises intervening sequences from yeast transfer ribonucleic acid precursors.

    Otsuka, A; de Paolis, A; Tocchini-Valentini, G P

    1981-01-01

    A ribonuclease (RNase) activity, RNase "XlaI," responsible for the excision of intervening sequences from two yeast transfer ribonucleic acid (tRNA) precursors, pre-tRNA(Tyr) and pre-tRNA(3Leu), has been purified 54-fold from nuclear extracts of Xenopus laevis oocytes. The RNase preparation is essentially free of contaminating RNase. A quantitative assay for RNase XlaI was developed, and the reaction products were characterized. RNase XlaI cleavage sites in the yeast tRNA precursors were identical to those made by yeast extracts (including 3'-phosphate and 5'-hydroxyl termini). Cleavage of pre-tRNA(3Leu) by RNase XlaI and subsequent ligation of the half-tRNA molecules do not require removal of the 5' leader or 3' trailer sequences. Images PMID:6765601

  7. Construction Strategy for an Internal Amplification Control for Real-Time Diagnostic Assays Using Nucleic Acid Sequence-Based Amplification: Development and Clinical Application

    Rodríguez-Lázaro, David; D'Agostino, Martin; Pla, Maria; Cook, Nigel

    2005-01-01

    An important analytical control in molecular amplification-based methods is an internal amplification control (IAC), which should be included in each reaction mixture. An IAC is a nontarget nucleic acid sequence which is coamplified simultaneously with the target sequence. With negative results for the target nucleic acid, the absence of an IAC signal indicates that amplification has failed. A general strategy for the construction of an IAC for inclusion in molecular beacon-based real-time nu...

  8. Amino Acid Sequence Requirements of the Transmembrane and Cytoplasmic Domains of Influenza Virus Hemagglutinin for Viable Membrane Fusion

    Melikyan, Grigory B.; Lin, Sasa; Roth, Michael G.; Cohen, Fredric S.

    1999-01-01

    The amino acid sequence requirements of the transmembrane (TM) domain and cytoplasmic tail (CT) of the hemagglutinin (HA) of influenza virus in membrane fusion have been investigated. Fusion properties of wild-type HA were compared with those of chimeras consisting of the ectodomain of HA and the TM domain and/or CT of polyimmunoglobulin receptor, a nonviral integral membrane protein. The presence of a CT was not required for fusion. But when a TM domain and CT were present, fusion activity w...

  9. Lipoic acid metabolism in Escherichia coli: sequencing and functional characterization of the lipA and lipB genes.

    Reed, K E; Cronan, J E

    1993-01-01

    Two genes, lipA and lipB, involved in lipoic acid biosynthesis or metabolism were characterized by DNA sequence analysis. The translational initiation site of the lipA gene was established, and the lipB gene product was identified as a 25-kDa protein. Overproduction of LipA resulted in the formation of inclusion bodies, from which the protein was readily purified. Cells grown under strictly anaerobic conditions required the lipA and lipB gene products for the synthesis of a functional glycine...

  10. Barley polyamine oxidase: Characterisation and analysis of the cofactor and the N-terminal amino acid sequence

    Radova, A.; Sebela, M.; Galuszka, P.;

    2001-01-01

    This paper reports the first purification method developed for the isolation of an homogeneous polyamine oxidase (PAO) from etiolated barley seedlings. The crude enzyme preparation was obtained after initial precipitation of the extract with protamine sulphate and ammonium sulphate. The enzyme was...... further purified to a final homogeneity (by the criteria of isoelectric focusing and SDS-PAGE) using techniques of low pressure chromatography followed by two FPLC steps. The purified yellow enzyme showed visible absorption maxima of a flavoprotein at 380 and 450 nm: the presence of FAD as the cofactor...... was further confirmed by measuring the fluorescence spectra, Barley PAO is an acidic protein (pI 5.4) containing 3% of neutral sugars: its molecular mass determined by SDS-PAGE was 56 kDa, whilst gel permeation chromatography revealed the higher value of 76 kDa. The N-terminal amino acid sequence of...

  11. An Interpretation of the Ancestral Codon from Miller’s Amino Acids and Nucleotide Correlations in Modern Coding Sequences

    Carels, Nicolas; de Leon, Miguel Ponce

    2015-01-01

    Purine bias, which is usually referred to as an “ancestral codon”, is known to result in short-range correlations between nucleotides in coding sequences, and it is common in all species. We demonstrate that RWY is a more appropriate pattern than the classical RNY, and purine bias (Rrr) is the product of a network of nucleotide compensations induced by functional constraints on the physicochemical properties of proteins. Through deductions from universal correlation properties, we also demonstrate that amino acids from Miller’s spark discharge experiment are compatible with functional primeval proteins at the dawn of living cell radiation on earth. These amino acids match the hydropathy and secondary structures of modern proteins. PMID:25922573

  12. Photophysical characterization of cumarin-doped poly (lactic acid) microparticles and visualization of the biodistribution

    We prepared fluorescent coumarin dye-doped poly (acrylic acid) microparticles, which are well known as a biodegradable polyester, and the photophysical properties were characterized by scanning electron microscope, atomic force microscope and spectroscopic investigation. Spherical particles with diameters ranging from 0.5 to a few μm were obtained. Based on spectroscopic investigation, the internal environment was close to that of a polar solvent such as methanol, and the dyes were dispersed without aggregation inside the particles. The obtained particles were administered to a mouse through the tail vein, and the biodistribution was then observed after some organs were excited at 1-day and 1-week post-injection. The particles were accumulated in the organs, especially in the lung and spleen. After injection, the particles were trapped temporally in the lung, and then seemed to be transported to other organs by blood circulation. This tendency is similar to the biodistribution of TiO2 microparticles that we have reported previously.

  13. Photophysical characterization of cumarin-doped poly (lactic acid) microparticles and visualization of the biodistribution

    Abe, Shigeaki, E-mail: sabe@den.hokudai.ac.j [Department of Biomedical Materials and Engineering, Graduate School of Dental Medicine, Hokkaido University, Kita 13, Nishi 7, Sapporo 060-8586 (Japan); Kiba, Takayuki; Hosokawa, Kiyotada; Nitobe, Satoru; Hirota, Takashi; Kobayashi, Hirohisa [Division of Biotechnology and Macromolecular Chemistry, Graduate School of Hokkaido University, Sapporo 060-8628 (Japan); Akasaka, Tsukasa; Uo, Motohiro; Kuboki, Yoshinori [Department of Biomedical Materials and Engineering, Graduate School of Dental Medicine, Hokkaido University, Kita 13, Nishi 7, Sapporo 060-8586 (Japan); Sato, Shin-Ichiro [Division of Biotechnology and Macromolecular Chemistry, Graduate School of Hokkaido University, Sapporo 060-8628 (Japan); Watari, Fumio [Department of Biomedical Materials and Engineering, Graduate School of Dental Medicine, Hokkaido University, Kita 13, Nishi 7, Sapporo 060-8586 (Japan); Rosca, Iosif D. [Faculty of Engineering and Computer Science, Concordia University, 1455 de Maisonneuve Blvd. W, Montreal, QC H3G 1M8 (Canada)

    2010-08-15

    We prepared fluorescent coumarin dye-doped poly (acrylic acid) microparticles, which are well known as a biodegradable polyester, and the photophysical properties were characterized by scanning electron microscope, atomic force microscope and spectroscopic investigation. Spherical particles with diameters ranging from 0.5 to a few {mu}m were obtained. Based on spectroscopic investigation, the internal environment was close to that of a polar solvent such as methanol, and the dyes were dispersed without aggregation inside the particles. The obtained particles were administered to a mouse through the tail vein, and the biodistribution was then observed after some organs were excited at 1-day and 1-week post-injection. The particles were accumulated in the organs, especially in the lung and spleen. After injection, the particles were trapped temporally in the lung, and then seemed to be transported to other organs by blood circulation. This tendency is similar to the biodistribution of TiO{sub 2} microparticles that we have reported previously.

  14. Mass spectrometry of nucleic acids components. Nucleotides, oligonucleotides and application to sequence determination

    The application of the various ionization techniques to the analysis of nucleotides and oligonucleotides is reviewed. The sequence determination of oligonucleotides was chosen to present the growing possibilities of mass spectrometry due to development of new ''soft ionization'' techniques. 119 refs., 6 figs., 2 tabs. (author)

  15. Prediction of the Occurrence of the ADP-binding βαβ-fold in Proteins, Using an Amino Acid Sequence Fingerprint

    Wierenga, Rik K.; Terpstra, Peter; Hol, Wim G.J.

    1986-01-01

    An amino acid sequence "fingerprint” has been derived that can be used to test if a particular sequence will fold into a βαβ-unit with ADP-binding properties. It was deduced from a careful analysis of the known three-dimensional structures of ADP-binding βαβ-folds. This fingerprint is in fact a set

  16. Shared Y chromosome repetitive DNA sequences in stallion and donkey as visualized using whole-genomic comparative hybridization

    R. Mezzanotte

    2010-01-01

    Full Text Available The genome of stallion (Spanish breed and donkey (Spanish endemic Zamorano-Leonés were compared using whole comparative genomic in situ hybridization (W-CGH technique, with special reference to the variability observed in the Y chromosome. Results show that these diverging genomes still share some highly repetitive DNA families localized in pericentromeric regions and, in the particular case of the Y chromosome, a sub-family of highly repeated DNA sequences, greatly expanded in the donkey genome, accounts for a large part of the chromatin in the stallion Y chromosome.

  17. Mutation-selection models of coding sequence evolution with site-heterogeneous amino acid fitness profiles.

    Rodrigue, Nicolas; Philippe, Hervé; Lartillot, Nicolas

    2010-03-01

    Modeling the interplay between mutation and selection at the molecular level is key to evolutionary studies. To this end, codon-based evolutionary models have been proposed as pertinent means of studying long-range evolutionary patterns and are widely used. However, these approaches have not yet consolidated results from amino acid level phylogenetic studies showing that selection acting on proteins displays strong site-specific effects, which translate into heterogeneous amino acid propensities across the columns of alignments; related codon-level studies have instead focused on either modeling a single selective context for all codon columns, or a separate selective context for each codon column, with the former strategy deemed too simplistic and the latter deemed overparameterized. Here, we integrate recent developments in nonparametric statistical approaches to propose a probabilistic model that accounts for the heterogeneity of amino acid fitness profiles across the coding positions of a gene. We apply the model to a dozen real protein-coding gene alignments and find it to produce biologically plausible inferences, for instance, as pertaining to site-specific amino acid constraints, as well as distributions of scaled selection coefficients. In their account of mutational features as well as the heterogeneous regimes of selection at the amino acid level, the modeling approaches studied here can form a backdrop for several extensions, accounting for other selective features, for variable population size, or for subtleties of mutational features, all with parameterizations couched within population-genetic theory. PMID:20176949

  18. Complete Genome Sequence of a thermotolerant sporogenic lactic acid bacterium, Bacillus coagulans strain 36D1

    Xie, Gary [Los Alamos National Laboratory (LANL); Dalin, Eileen [U.S. Department of Energy, Joint Genome Institute; Tice, Hope [U.S. Department of Energy, Joint Genome Institute; Chertkov, Olga [Los Alamos National Laboratory (LANL); Land, Miriam L [ORNL

    2011-01-01

    Bacillus coagulans is a ubiquitous soil bacterium that grows at 50-55 C and pH 5.0 and fer-ments various sugars that constitute plant biomass to L (+)-lactic acid. The ability of this sporogenic lactic acid bacterium to grow at 50-55 C and pH 5.0 makes this organism an attractive microbial biocatalyst for production of optically pure lactic acid at industrial scale not only from glucose derived from cellulose but also from xylose, a major constituent of hemi-cellulose. This bacterium is also considered as a potential probiotic. Complete genome squence of a representative strain, B. coagulans strain 36D1, is presented and discussed.

  19. Templated synthesis of peptide nucleic acids via sequence-selective base-filling reactions.

    Heemstra, Jennifer M; Liu, David R

    2009-08-19

    The templated synthesis of nucleic acids has previously been achieved through the backbone ligation of preformed nucleotide monomers or oligomers. In contrast, here we demonstrate templated nucleic acid synthesis using a base-filling approach in which individual bases are added to abasic sites of a peptide nucleic acid (PNA). Because nucleobase substrates in this approach are not self-reactive, a base-filling approach may reduce the formation of nontemplated reaction products. Using either reductive amination or amine acylation chemistries, we observed efficient and selective addition of each of the four nucleobases to an abasic site in the middle of the PNA strand. We also describe the addition of single nucleobases to the end of a PNA strand through base filling, as well as the tandem addition of two bases to the middle of the PNA strand. These findings represent an experimental foundation for nonenzymatic information transfer through base filling. PMID:19722647

  20. Complete Genome Sequence of a thermotolerant sporogenic lactic acid bacterium, Bacillus coagulans strain 36D1

    Rhee, Mun Su [University of Florida, Gainesville; Moritz, Brelan E. [University of Florida, Gainesville; Xie, Gary [Los Alamos National Laboratory (LANL); Glavina Del Rio, Tijana [U.S. Department of Energy, Joint Genome Institute; Dalin, Eileen [U.S. Department of Energy, Joint Genome Institute; Tice, Hope [U.S. Department of Energy, Joint Genome Institute; Bruce, David [Los Alamos National Laboratory (LANL); Goodwin, Lynne A. [Los Alamos National Laboratory (LANL); Chertkov, Olga [Los Alamos National Laboratory (LANL); Brettin, Thomas S [ORNL; Han, Cliff [Los Alamos National Laboratory (LANL); Detter, J. Chris [U.S. Department of Energy, Joint Genome Institute; Pitluck, Sam [U.S. Department of Energy, Joint Genome Institute; Land, Miriam L [ORNL; Patel, Milind [University of Florida, Gainesville; Ou, Mark [University of Florida, Gainesville; Harbrucker, Roberta [University of Florida, Gainesville; Ingram, Lonnie O. [University of Florida; Shanmugam, Keelnathan T. [University of Florida

    2011-01-01

    Bacillus coagulans is a ubiquitous soil bacterium that grows at 50-55 C and pH 5.0 and fer- ments various sugars that constitute plant biomass to L (+)-lactic acid. The ability of this spo- rogenic lactic acid bacterium to grow at 50-55 C and pH 5.0 makes this organism an attrac- tive microbial biocatalyst for production of optically pure lactic acid at industrial scale not only from glucose derived from cellulose but also from xylose, a major constituent of hemi- cellulose. This bacterium is also considered as a potential probiotic. Complete genome se- quence of a representative strain, B. coagulans strain 36D1, is presented and discussed.

  1. Molecular cloning and sequence analysis of complementary DNA encoding rat mammary gland medium-chain S-acyl fatty acid synthetase thio ester hydrolase

    Poly(A) + RNA from pregnant rat mammary glands was size-fractionated by sucrose gradient centrifugation, and fractions enriched in medium-chain S-acyl fatty acid synthetase thio ester hydrolase (MCH) were identified by in vitro translation and immunoprecipitation. A cDNA library was constructed, in pBR322, from enriched poly(A) + RNA and screened with two oligonucleotide probes deduced from rat MCH amino acid sequence data. Cross-hybridizing clones were isolated and found to contain cDNA inserts ranging from ∼ 1100 to 1550 base pairs (bp). A 1550-bp cDNA insert, from clone 43H09, was confirmed to encode MCH by hybrid-select translation/immunoprecipitation studies and by comparison of the amino acid sequence deduced from the DNA sequence of the clone to the amino acid sequence of the MCH peptides. Northern blot analysis revealed the size of the MCH mRNA to be 1500 nucleotides, and it is therefore concluded that the 1550-bp insert (including G x C tails) of clone 43H09 represents a full- or near-full-length copy of the MCH gene. The rat MCH sequence is the first reported sequence of a thioesterase from a mammalian source, but comparison of the deduced amino acid sequences of MCH and the recently published mallard duck medium-chain S-acyl fatty acid synthetase thioesterase reveals significant homology. In particular, a seven amino acid sequence containing the proposed active serine of the duck thioesterase is found to be perfectly conserved in rat MCH

  2. Complete Genome Sequence of Moraxella osloensis Strain KMC41, a Producer of 4-Methyl-3-Hexenoic Acid, a Major Malodor Compound in Laundry.

    Goto, Takatsugu; Hirakawa, Hideki; Morita, Yuji; Tomida, Junko; Sato, Jun; Matsumura, Yuta; Mitani, Asako; Niwano, Yu; Takeuchi, Kohei; Kubota, Hiromi; Kawamura, Yoshiaki

    2016-01-01

    We report the complete genome sequence of Moraxella osloensis strain KMC41, isolated from laundry with malodor. The KMC41 genome comprises a 2,445,556-bp chromosome and three plasmids. A fatty acid desaturase and at least four β-oxidation-related genes putatively associated with 4-methyl-3-hexenoic acid generation were detected in the KMC41 chromosome. PMID:27445387

  3. Antibody-Specific Model of Amino Acid Substitution for Immunological Inferences from Alignments of Antibody Sequences

    Mirsky, Alexander; Kazandjian, Linda; Anisimova, Maria

    2014-01-01

    Antibodies are glycoproteins produced by the immune system as a dynamically adaptive line of defense against invading pathogens. Very elegant and specific mutational mechanisms allow B lymphocytes to produce a large and diversified repertoire of antibodies, which is modified and enhanced throughout all adulthood. One of these mechanisms is somatic hypermutation, which stochastically mutates nucleotides in the antibody genes, forming new sequences with different properties and, eventually, hig...

  4. Rapid and Sensitive Isothermal Detection of Nucleic-acid Sequence by Multiple Cross Displacement Amplification

    Yi Wang; Yan Wang; Ai-Jing Ma; Dong-Xun Li; Li-Juan Luo; Dong-Xin Liu; Dong Jin; Kai Liu; Chang-Yun Ye

    2015-01-01

    We have devised a novel amplification strategy based on isothermal strand-displacement polymerization reaction, which was termed multiple cross displacement amplification (MCDA). The approach employed a set of ten specially designed primers spanning ten distinct regions of target sequence and was preceded at a constant temperature (61–65 °C). At the assay temperature, the double-stranded DNAs were at dynamic reaction environment of primer-template hybrid, thus the high concentration of primer...

  5. Complete nucleotide and derived amino acid sequence of cDNA encoding the mitochondrial uncoupling protein of rat brown adipose tissue: lack of a mitochondrial targeting presequence.

    Ridley, R. G.; Patel, H. V.; Gerber, G E; Morton, R C; Freeman, K. B.

    1986-01-01

    A cDNA clone spanning the entire amino acid sequence of the nuclear-encoded uncoupling protein of rat brown adipose tissue mitochondria has been isolated and sequenced. With the exception of the N-terminal methionine the deduced N-terminus of the newly synthesized uncoupling protein is identical to the N-terminal 30 amino acids of the native uncoupling protein as determined by protein sequencing. This proves that the protein contains no N-terminal mitochondrial targeting prepiece and that a t...

  6. Identification of a novel HMW glutenin subunit and comparison of its amino acid sequence with those of homologous subunits

    2002-01-01

    Aegilops tauschii is the donor of the D genome of common wheat (Triticum aestivum). Genetic variation of HMW glutenin subunits encoded by the Glu-1Dt locus of Ae. tauschii has been found to be higher than that specified by the Glu-1D locus in common wheat. In the present note, we report the identification of a novel HMW glutenin subunit, Dy13t, from Ae. tauschii. The newly identified subunit possessed an electrophoretic mobility that was faster than that of the Dy12 subunit of common wheat. The complete ORF of encoding the Dy13t subunit contained 624 codons (excluding the stop codons). The amino acid sequence deduced from the Dy13t gene ORF was the shortest among those of the previously reported subunits derived by the D genome. A further comparison of Dy13t amino acid sequence with those of the subunits characterized from the A, B, D, R genomes of Triticeae showed that the smaller size of the Dy13t subunit was associated with a reduction in the size of its repetitive domain.

  7. Convergent evolution of the red- and green-like visual pigment genes in fish, Astyanax fasciatus, and human.

    Yokoyama, R; Yokoyama, S

    1990-01-01

    We have isolated and sequenced genes from the blind cave fish, Astyanax fasciatus, that are homologous to the human red and green visual pigment genes. The data strongly suggest that, like human, these fish have one red-like visual pigment gene and multiple green-like visual pigment genes. By comparing the DNA sequences of the human and fish visual pigment genes and knowing their phylogenetic relationship, one can infer the direction of amino acid substitutions in the red and green visual pig...

  8. Visualization of diffusion of the drug solution during aluminum potassium tannic acid injection therapy: a pilot study.

    Yamamoto, Yutaka; Miwa, Mitsuharu

    2013-06-01

    Sclerotherapy with aluminum potassium tannic acid (ALTA), which was approved in Japan for the treatment of internal hemorrhoids in July 2004 (Takano et al., Int J Colorectal Dis 21:44-51, 2006), has been widely accepted because of its effectiveness and low invasiveness. More than 200,000 patients have received ALTA injection therapy. ALTA is injected directly into 4 points of an internal hemorrhoid (4-step injection) to induce sclerosis and remission of the hemorrhoids, and consequently, resolution of symptoms such as prolapse and bleeding. The precision of the 4-step injection is considered to be a crucial determinant of the success of this therapy and the risk of complications. However, sufficient evidence has not yet been obtained concerning the diffusion and distribution of the injected drug. A pilot study visualized the real-time diffusion/distribution of the drug solution following the 4-step injection, using the ICG (indocyanine green) fluorescence technique, and an infrared camera (Photodynamic EYE; PDE, Hamamatsu Photonics K.K.). PMID:23229838

  9. To study the role of visual inspection of cervix with acetic acid (VIA in cervical cancer screening

    Sunita Goyal

    2014-06-01

    Full Text Available Background: Objectives of current study were to evaluate visual inspection of cervix with acetic acid in picking up abnormal cervix and to correlate the findings of VIA with Pap smear, colposcopy and cervical biopsy. Methods: Study was conducted on 300 sexually active women attending the gynaecological OPD at Dayanand medical college and hospital, Ludhiana. All patients underwent VIA and Pap smear screening and if either of the two was abnormal, colposcopy was done and colposcopic guided cervical biopsy was taken if indicated. Total 105 colposcopies were done. Cervical biopsy was taken in 87 cases and the results were compared and statistically analysed. Results: The sensitivity of VIA was 86% and specificity 40.50%. No case was missed by VIA when cut off was taken as moderate dysplasia or higher lesions on biopsy. Conclusions: VIA is a sensitive, practical and a low cost affair in cervical cancer screening. [Int J Reprod Contracept Obstet Gynecol 2014; 3(3.000: 684-687

  10. Complete genome sequence of probiotic Bacillus coagulans HM-08: A potential lactic acid producer.

    Yao, Guoqiang; Gao, Pengfei; Zhang, Wenyi

    2016-06-20

    Bacillus coagulans HM-08 is a commercialized probiotic strain in China. Its genome contains a 3.62Mb circular chromosome with an average GC content of 46.3%. In silico analysis revealed the presence of one xyl operon as well as several other genes that are correlated to xylose utilization. The genetic information provided here may help to expand its future biotechnology potential in lactic acid production. PMID:27130497

  11. Complete Genome Sequence of the Probiotic Lactic Acid Bacterium Lactobacillus Rhamnosus

    Samat Kozhakhmetov; Almagul Kushugulova; Adil Supiyev; Indira Tynybayeva; Ulykbek Kairov; Saule Saduakhasova; Gulnara Shakhabayeva; Kenzhebulat Bapishev; Talgat Nurgozhin; Zhaxybay Zhumadilov

    2014-01-01

    Introduction: Lactobacilli are a bacteria commonly found in the gastrointestinal tract. Some species of this genus have probiotic properties. The most common of these is Lactobacillus rhamnosus, a microoganism, generally regarded as safe (GRAS). It is also a homofermentative L-(+)-lactic acid producer. The genus Lactobacillus is characterized by an extraordinary degree of the phenotypic and genotypic diversity. However, the studies of the genus were conducted mostly with the unequally distrib...

  12. iTriplet, a rule-based nucleic acid sequence motif finder

    Gunderson Samuel I

    2009-10-01

    Full Text Available Abstract Background With the advent of high throughput sequencing techniques, large amounts of sequencing data are readily available for analysis. Natural biological signals are intrinsically highly variable making their complete identification a computationally challenging problem. Many attempts in using statistical or combinatorial approaches have been made with great success in the past. However, identifying highly degenerate and long (>20 nucleotides motifs still remains an unmet challenge as high degeneracy will diminish statistical significance of biological signals and increasing motif size will cause combinatorial explosion. In this report, we present a novel rule-based method that is focused on finding degenerate and long motifs. Our proposed method, named iTriplet, avoids costly enumeration present in existing combinatorial methods and is amenable to parallel processing. Results We have conducted a comprehensive assessment on the performance and sensitivity-specificity of iTriplet in analyzing artificial and real biological sequences in various genomic regions. The results show that iTriplet is able to solve challenging cases. Furthermore we have confirmed the utility of iTriplet by showing it accurately predicts polyA-site-related motifs using a dual Luciferase reporter assay. Conclusion iTriplet is a novel rule-based combinatorial or enumerative motif finding method that is able to process highly degenerate and long motifs that have resisted analysis by other methods. In addition, iTriplet is distinguished from other methods of the same family by its parallelizability, which allows it to leverage the power of today's readily available high-performance computing systems.

  13. The α and β chains of human platelet glycoprotein Ib are both transmembrane proteins containing a leucine-rich amino acid sequence

    The primary structure of the β chain of human glycoprotein Ib (GPIb), the platelet receptor for von Willebrand factor, has been established by a combination of cDNA cloning and amino acid sequence analysis. A λ phage cDNA expression library prepared from human erythroleukemia cells (HEL cells) was screened with a radiolabeled affinity-purified rabbit polyclonal antibody to the β chain of GPIb. Eighteen positive clones were isolated and plaque-purified and the nucleotide sequences of three were determined. The composite sequence spanned 968 nucleotides and included a 5' untranslated region of 22 nucleotides, an open reading frame of 618 nucleotides encoding a signal peptide of 28 amino acids and a mature protein of 181 amino acids, a stop codon, and a 3' noncoding region of 307 nucleotides. The 3' noncoding sequence also contained a polyadenylylation signal (AATAAA) 14 nucleotides upstream from the poly(A) tail of 18 nucleotides. Edman degradation of the intact β chain and of peptides produced by chemical cleavage yielded amino acid sequences spanning 76 residues that were identical to those predicted from the cDNA. The amino-terminal region of the β chain contains a leucine-rich sequence of 24 amino acids that is similar to a sequence that occurs as seven tandem repeats in the α chain of GPIb and nine tandem repeats in leucine-rich α2-glycoprotein. The amino-terminal region of the β chain of GPIb is followed by a transmembrane segment of 25 amino acids and an intracellular segment of 34 amino acids at the carboxyl terminus of the protein

  14. Inferences from protein and nucleic acid sequences - Early molecular evolution, divergence of kingdoms and rates of change

    Dayhoff, M. O.; Barker, W. C.; Mclaughlin, P. J.

    1974-01-01

    Description of new sensitive, objective methods for establishing the probable common ancestry of very distantly related sequences and the quantitative evolutionary change which has taken place. These methods are applied to four families of proteins and nucleic acids and evolutionary trees will be derived where possible. Of the three families containing duplications of genetic material, two are nucleic acids: transfer RNA and 5S ribosomal RNA. Both of these structures are functional in the synthesis of coded proteins, and prototypes must have been present in the cell at the inception of the fundamental coding process that all living things share. There are many types of tRNA which recognize the various nucleotide triplets and the 20 amino acids. These types are thought to have arisen as a result of many gene duplications. Relationships among these types are discussed. The 5S ribosomal RNA, presently functional in both eukaryotes and prokaryotes, is very likely descended from an early form incorporating almost a complete duplication of genetic material. The amount of evolution in the various lines can again be compared. The other two families containing duplications are proteins; ferredoxin and cytochrome c.

  15. Mass Spectrometry Analysis Coupled with de novo Sequencing Reveals Amino Acid Substitutions in Nucleocapsid Protein from Influenza A Virus

    Zijian Li

    2014-02-01

    Full Text Available Amino acid substitutions in influenza A virus are the main reasons for both antigenic shift and virulence change, which result from non-synonymous mutations in the viral genome. Nucleocapsid protein (NP, one of the major structural proteins of influenza virus, is responsible for regulation of viral RNA synthesis and replication. In this report we used LC-MS/MS to analyze tryptic digestion of nucleocapsid protein of influenza virus (A/Puerto Rico/8/1934 H1N1, which was isolated and purified by SDS poly-acrylamide gel electrophoresis. Thus, LC-MS/MS analyses, coupled with manual de novo sequencing, allowed the determination of three substituted amino acid residues R452K, T423A and N430T in two tryptic peptides. The obtained results provided experimental evidence that amino acid substitutions resulted from non-synonymous gene mutations could be directly characterized by mass spectrometry in proteins of RNA viruses such as influenza A virus.

  16. Species specific amino acid sequence-protein local structure relationships: An analysis in the light of a structural alphabet.

    de Brevern, Alexandre G; Joseph, Agnel Praveen

    2011-05-01

    Protein structure analysis and prediction methods are based on non-redundant data extracted from the available protein structures, regardless of the species from which the protein originates. Hence, these datasets represent the global knowledge on protein folds, which constitutes a generic distribution of amino acid sequence-protein structure (AAS-PS) relationships. In this study, we try to elucidate whether the AAS-PS relationship could possess specificities depending on the specie. For this purpose, we have chosen three different species: Saccharomyces cerevisiae, Plasmodium falciparum and Arabidopsis thaliana. We analyzed the AAS-PS behaviors of the proteins from these three species and compared it to the "expected" distribution of a classical non-redundant databank. With the classical secondary structure description, only slight differences in amino acid preferences could be observed. With a more precise description of local protein structures (Protein Blocks), significant changes could be highlighted. S. cerevisiae's AAS-PS relationship is close to the general distribution, while striking differences are observed in the case of A. thaliana. P. falciparum is the most distant one. This study presents some interesting view-points on AAS-PS relationship. Certain species exhibit unique preferences for amino acids to be associated with protein local structural elements. Thus, AAS-PS relationships are species dependent. These results can give useful insights for improving prediction methodologies which take the species specific information into account. PMID:21333657

  17. EEG changes during sequences of visual and kinesthetic motor imagery Alterações no EEG durante sequencias de imagética motora visual e cinestésica

    Marcus Vinicius Stecklow

    2010-08-01

    Full Text Available The evoked cerebral electric response when sequences of complex motor imagery (MI task are executed several times is still unclear. This work aims at investigating the existence of habituation in the cortical response, more specifically in the alpha band peak of parietal and occipital areas (10-20 international system electroencephalogram, EEG, protocol. The EEG signals were acquired during sequences of MI of volleyball spike movement in kinesthetic and visual modalities and also at control condition. Thirty right-handed male subjects (18 to 40 years were assigned to either an 'athlete' or a 'non-athlete' group, both containing 15 volunteers. Paired Wilcoxon tests (with α=0.05 indicates that sequential MI of complex tasks promotes cortical changes, mainly in the power vicinity of the alpha peak. This finding is more pronounced along the initial trials and also for the athletes during the modality of kinesthetic motor imagery.A resposta elétrica cerebral evocada quando sequencias de imagética motora (MI de tarefas complexas são executadas seguidamente no tempo permanecem desconhecidas. Este trabalho objetivou investigar a existência de habituação da resposta cortical, mais especificamente na banda do pico de alfa de áreas parietais e occipitais (sistema internacional 10-20, eletroencefalograma, protocolo de EEG. Os sinais de EEG foram adquiridos durante sequências de MI do movimento de ataque do voleibol nas modalidades cinestésica e visual, e também em condição de controle. Trinta voluntários adultos (entre 18 e 40 anos, destros, do gênero masculino foram agrupados como 'atletas' ou 'não-atletas', sendo cada grupo composto de 15 voluntários. Testes pareados de Wilcoxon (com α=0.05 indicaram que a MI sequencial de tarefas complexas promoveram alterações nas respostas corticais, mais especificamente na região ao redor do pico de alfa. Este achado foi mais pronunciado ao longo dos trechos iniciais e também nos atletas durante

  18. FASMA: A Service to Format and Analyze Sequences in Multiple Alignments

    Susan; Costantini; Giovanni; Colonna; Angelo; M.; Facchiano

    2007-01-01

    Multiple sequence alignments are successfully applied in many studies for under- standing the structural and functional relations among single nucleic acids and pro- tein sequences as well as whole families. Because of the rapid growth of sequence databases, multiple sequence alignments can often be very large and difficult to visualize and analyze. We offer a new service aimed to visualize and analyze the multiple alignments obtained with different external algorithms, with new features useful for the comparison of the aligned sequences as well as for the creation of a final image of the alignment. The service is named FASMA and is available at http: //bioinformatica.isa.cnr.it /FASMA /.

  19. Evolution of early life inferred from protein and ribonucleic acid sequences

    Dayhoff, M. O.; Schwartz, R. M.

    1978-01-01

    The chemical structures of ferredoxin, 5S ribosomal RNA, and c-type cytochrome sequences have been employed to construct a phylogenetic tree which connects all major photosynthesizing organisms: the three types of bacteria, blue-green algae, and chloroplasts. Anaerobic and aerobic bacteria, eukaryotic cytoplasmic components and mitochondria are also included in the phylogenetic tree. Anaerobic nonphotosynthesizing bacteria similar to Clostridium were the earliest organisms, arising more than 3.2 billion years ago. Bacterial photosynthesis evolved nearly 3.0 billion years ago, while oxygen-evolving photosynthesis, originating in the blue-green algal line, came into being about 2.0 billion years ago. The phylogenetic tree supports the symbiotic theory of the origin of eukaryotes.

  20. A Possible Mechanism of Zika Virus Associated Microcephaly: Imperative Role of Retinoic Acid Response Element (RARE) Consensus Sequence Repeats in the Viral Genome.

    Kumar, Ashutosh; Singh, Himanshu N; Pareek, Vikas; Raza, Khursheed; Dantham, Subrahamanyam; Kumar, Pavan; Mochan, Sankat; Faiq, Muneeb A

    2016-01-01

    Owing to the reports of microcephaly as a consistent outcome in the fetuses of pregnant women infected with ZIKV in Brazil, Zika virus (ZIKV)-microcephaly etiomechanistic relationship has recently been implicated. Researchers, however, are still struggling to establish an embryological basis for this interesting causal handcuff. The present study reveals robust evidence in favor of a plausible ZIKV-microcephaly cause-effect liaison. The rationale is based on: (1) sequence homology between ZIKV genome and the response element of an early neural tube developmental marker "retinoic acid" in human DNA and (2) comprehensive similarities between the details of brain defects in ZIKV-microcephaly and retinoic acid embryopathy. Retinoic acid is considered as the earliest factor for regulating anteroposterior axis of neural tube and positioning of structures in developing brain through retinoic acid response elements (RARE) consensus sequence (5'-AGGTCA-3') in promoter regions of retinoic acid-dependent genes. We screened genomic sequences of already reported virulent ZIKV strains (including those linked to microcephaly) and other viruses available in National Institute of Health genetic sequence database (GenBank) for the RARE consensus repeats and obtained results strongly bolstering our hypothesis that ZIKV strains associated with microcephaly may act through precipitation of dysregulation in retinoic acid-dependent genes by introducing extra stretches of RARE consensus sequence repeats in the genome of developing brain cells. Additional support to our hypothesis comes from our findings that screening of other viruses for RARE consensus sequence repeats is positive only for those known to display neurotropism and cause fetal brain defects (for which maternal-fetal transmission during developing stage may be required). The numbers of RARE sequence repeats appeared to match with the virulence of screened positive viruses. Although, bioinformatic evidence and embryological

  1. Visual detection of trace copper ions based on copper-catalyzed reaction of ascorbic acid with oxygen

    Hou, Xin Yan; Chen, Shu; Shun, Lian Ju; Zhao, Yi Ni; Zhang, Zhi Wu; Long, Yun Fei; Zhu, Li

    2015-10-01

    A visual detection method for trace Cu2+ in aqueous solutions using triangular silver nanoplates (abbreviated as TAgNPs) as the probe was developed. The method is based on that TAgNPs could be corroded in sodium thiosulfate (Na2S2O3) solutions. The absorption spectrum of TAgNPs solution changed when it is corroded by Na2S2O3. The reaction of oxygen with ascorbic acid (Vc) in the presence of a low concentration of Cu2+ generates hydrogen peroxide that reacts with Na2S2O3, which leads the concentration of Na2S2O3 in the solution to be decreased. Therefore, the reaction between TAgNPs and the reacted mixture of Na2S2O3/Vc/Cu2+ was prevented efficiently. When the Na2S2O3 concentration and reaction time are constant, the decrease in the concentration of Na2S2O3 is directly proportional to the Cu2+ concentration. Thus, morphology, color, and maximum absorption wavelength of TAgNPs changed with the change of Cu2+ concentration. The changed maximum absorption wavelength of TAgNPs (Δλ) is proportional to Cu2+ concentration in the range from 7.5 × 10-9 to 5.0 × 10-7 M with a correlation coefficient of r = 0.9956. Moreover, color change of TAgNP solution was observed clearly over a Cu2+ concentration range from 7.5 × 10-8 to 5.0 × 10-7 M. This method has been used to detect the Cu2+ content of a human hair sample, and the result is in agreement with that obtained by the atomic absorption spectroscopy (AAS) method.

  2. Nucleic acid sequences encoding D1 and D1/D2 domains of human coxsackievirus and adenovirus receptor (CAR)

    Freimuth, Paul I.

    2010-04-06

    The invention provides recombinant human CAR (coxsackievirus and adenovirus receptor) polypeptides which bind adenovirus. Specifically, polypeptides corresponding to adenovirus binding domain D1 and the entire extracellular domain of human CAR protein comprising D1 and D2 are provided. In another aspect, the invention provides nucleic acid sequences encoding these domains and expression vectors for producing the domains and bacterial cells containing such vectors. The invention also includes an isolated fusion protein comprised of the D1 polypeptide fused to a polypeptide which facilitates folding of D1 when expressed in bacteria. The functional D1 domain finds application in a therapeutic method for treating a patient infected with a CAR D1-binding virus, and also in a method for identifying an antiviral compound which interferes with viral attachment. The invention also provides a method for specifically targeting a cell for infection by a virus which binds to D1.

  3. Redox labelling of nucleic acids for analyzing nucleotide sequences and monitoring DNA-protein interactions

    Fojta, Miroslav; Havran, Luděk; Horáková Brázdilová, Petra; Pivoňková, Hana; Kostečka, Pavel; Macíčková-Cahová, Hana; Raindlová, Veronika; Vrábel, Milan; Hocek, Michal

    Praha : Institute of Organic Chemistry and Biochemistry AS CR, v. v. i., 2011 - (Hocek, M.), s. 155-158 ISBN 978-80-86241-37-1. - (Collection Symposium Series. 12). [Chemistry of Nucleic Acid Components /15./. Český Krumlov (CZ), 05.06.2011-10.06.2011] R&D Projects: GA MŠk LC512; GA MŠk(CZ) LC06035; GA AV ČR(CZ) IAA400040901; GA AV ČR(CZ) IAA400040903; GA ČR GA203/09/0317; GA AV ČR(CZ) GPP206/11/P739 Institutional research plan: CEZ:AV0Z40550506; CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : DNA * electrochemistry * redox labeling Subject RIV: CC - Organic Chemistry

  4. Tracer study on sulphur use efficiency in potato-barley sequence on acid soil of Shimla

    Controlled studies were conducted on acidic soil of Fagu (Shimla) to study the efficiency of labelled ammonium sulphate as effected by farmyard manure (FYM) on potato (Solanum tuberosum L.) and its residual effect on succeeding barley (Hordeum vulgare L.). The direct and residual effects of FYM and sulphur on dry matter yield and S concentration in potato and barley plants were significant. Applied FYM had a positive effect on radioassay values i.e. % Sdff and % S utilization by potato from labelled S carrier, whereas, the residual effect of applied S on barley was more than its direct effect on potato. Results indicate that combined application of S and FYM resulted in 3.4 per cent more S contribution to barley crop and was reflected in % S utilization values. (author)

  5. The Effects of Maternal Supplementation of Polyunsaturated Fatty Acids on Visual, Neurobehavioural, and Developmental Outcomes of the Child: A Systematic Review of the Randomized Trials

    Andrea Lo

    2012-01-01

    Full Text Available Polyunsaturated fatty acid (PUFA use in pregnancy has been promoted as beneficial for visual and neurobehavioural development in the fetus. However, no systematic review of the randomized trials has been conducted. The objective of this review was to evaluate potential advantages of this regiment by reviewing all randomized trials in pregnancy. Methods. Systematic review of randomized controlled studies comparing cognitive and visual achievements among infants whose mothers were treated and untreated with PUFA during gestation. Results. Nine studies met the inclusion criteria, three focusing on visual and six on neurobehavioural development. Due to differing outcome measurements in the infants, the studies could not be combined into a formal meta-analysis. Synthesizing the existing data, for both visual and neurobehavioural development, most studies could not show sustained benefits to infant cognition or visual development. Conclusion. At the present time a recommendation to change practice and supplement all expecting mothers with PUFA to improve offspring vision or neurobehavioural function is not supported by existing evidence.

  6. Sequence and structural features of binding site residues in protein-protein complexes: comparison with protein-nucleic acid complexes

    Selvaraj S

    2011-10-01

    Full Text Available Abstract Background Protein-protein interactions are important for several cellular processes. Understanding the mechanism of protein-protein recognition and predicting the binding sites in protein-protein complexes are long standing goals in molecular and computational biology. Methods We have developed an energy based approach for identifying the binding site residues in protein–protein complexes. The binding site residues have been analyzed with sequence and structure based parameters such as binding propensity, neighboring residues in the vicinity of binding sites, conservation score and conformational switching. Results We observed that the binding propensities of amino acid residues are specific for protein-protein complexes. Further, typical dipeptides and tripeptides showed high preference for binding, which is unique to protein-protein complexes. Most of the binding site residues are highly conserved among homologous sequences. Our analysis showed that 7% of residues changed their conformations upon protein-protein complex formation and it is 9.2% and 6.6% in the binding and non-binding sites, respectively. Specifically, the residues Glu, Lys, Leu and Ser changed their conformation from coil to helix/strand and from helix to coil/strand. Leu, Ser, Thr and Val prefer to change their conformation from strand to coil/helix. Conclusions The results obtained in this study will be helpful for understanding and predicting the binding sites in protein-protein complexes.

  7. Scanning mutagenesis of the amino acid sequences flanking phosphorylation site 1 of the mitochondrial pyruvate dehydrogenase complex

    Nagib eAhsan

    2012-07-01

    Full Text Available The mitochondrial pyruvate dehydrogenase complex is regulated by reversible seryl-phosphorylation of the E1α subunit by a dedicated, intrinsic kinase. The phospho-complex is reactivated when dephosphorylated by an intrinsic PP2C-type protein phosphatase. Both the position of the phosphorylated Ser-residue and the sequences of the flanking amino acids are highly conserved. We have used the synthetic peptide-based kinase client assay plus recombinant pyruvate dehydrogenase E1α and E1α-kinase to perform scanning mutagenesis of the residues flanking the site of phosphorylation. Consistent with the results from phylogenetic analysis of the flanking sequences, the direct peptide-based kinase assays tolerated very few changes. Even conservative changes such as Leu, Ile, or Val for Met, or Glu for Asp, gave very marked reductions in phosphorylation. Overall the results indicate that regulation of the mitochondrial pyruvate dehydrogenase complex by reversible phosphorylation is an extreme example of multiple, interdependent instances of co-evolution.

  8. Amino Acid Sequence and Structural Comparison of BACE1 and BACE2 Using Evolutionary Trace Method

    Hoda Mirsafian

    2014-01-01

    Full Text Available Beta-amyloid precursor protein cleavage enzyme 1 (BACE1 and beta-amyloid precursor protein cleavage enzyme 2 (BACE2, members of aspartyl protease family, are close homologues and have high similarity in their protein crystal structures. However, their enzymatic properties differ leading to disparate clinical consequences. In order to identify the residues that are responsible for such differences, we used evolutionary trace (ET method to compare the amino acid conservation patterns of BACE1 and BACE2 in several mammalian species. We found that, in BACE1 and BACE2 structures, most of the ligand binding sites are conserved which indicate their enzymatic property of aspartyl protease family members. The other conserved residues are more or less randomly localized in other parts of the structures. Four group-specific residues were identified at the ligand binding site of BACE1 and BACE2. We postulated that these residues would be essential for selectivity of BACE1 and BACE2 biological functions and could be sites of interest for the design of selective inhibitors targeting either BACE1 or BACE2.

  9. Generation of deviation parameters for amino acid singlets, doublets and triplets from three-dimensional structures of proteins and its implications for secondary structure prediction from amino acid sequences

    S A Mugilan; K Veluraja

    2000-03-01

    We present a new method, secondary structure prediction by deviation parameter (SSPDP) for predicting the secondary structure of proteins from amino acid sequence. Deviation parameters (DP) for amino acid singlets, doublets and triplets were computed with respect to secondary structural elements of proteins based on the dictionary of secondary structure prediction (DSSP)-generated secondary structure for 408 selected non-homologous proteins. To the amino acid triplets which are not found in the selected dataset, a DP value of zero is assigned with respect to the secondary structural elements of proteins. The total number of parameters generated is 15,432, in the possible parameters of 25,260. Deviation parameter is complete with respect to amino acid singlets, doublets, and partially complete with respect to amino acid triplets. These generated parameters were used to predict secondary structural elements from amino acid sequence. The secondary structure predicted by our method (SSPDP) was compared with that of single sequence (NNPREDICT) and multiple sequence (PHD) methods. The average value of the percentage of prediction accuracy for α-helix by SSPDP, NNPREDICT and PHD methods was found to be 57%, 44% and 69% respectively for the proteins in the selected dataset. For -strand the prediction accuracy is found to be 69%, 21% and 53% respectively by SSPDP, NNPREDICT and PHD methods. This clearly indicates that the secondary structure prediction by our method is as good as PHD method but much better than NNPREDICT method.

  10. Complete Genome Sequence of the d-Amino Acid Catabolism Bacterium Phaeobacter sp. Strain JL2886, Isolated from Deep Seawater of the South China Sea.

    Fu, Yingnan; Wang, Rui; Zhang, Zilian; Jiao, Nianzhi

    2016-01-01

    Phaeobacter sp. strain JL2886, isolated from deep seawater of the South China Sea, can catabolize d-amino acids. Here, we report the complete genome sequence of Phaeobacter sp. JL2886. It comprises ~4.06 Mbp, with a G+C content of 61.52%. A total of 3,913 protein-coding genes and 10 genes related to d-amino acid catabolism were obtained. PMID:27587825

  11. Identification of G and P genotype-specific motifs in the predicted VP7 and VP4 amino acid sequences.

    Ma, Yongping

    2015-12-01

    Equine rotavirus (ERV) strain L338 (G13P[18]) has a unique G and P genotype. However, the evolutionary relationship of L338 with other ERVs is still unknown. Here whole genome analysis of the L338 ERV strain was independently performed. Its genotype constellations were determined as G13-P[18]-I6-R9-C9-M6-A6-N9-T12-E14-H11, confirming previous genotype assignments. The L338 strain only shared the P[18] and I6 genotypes with other ERVs. The nucleotide sequences of the other 9 RNA segments were different from those of cogent genes of all other group A rotavirus (RVA) strains including ERVs and formed unique phylogenetic lineages. The L338 evolutionary footprints were tentatively identified in both VP7 and VP4 amino acid sequences: two regions were found in VP7 and twelve in VP4. The conserved regions shared between L338 and other group A rotavirus strains (RVAs) indicated that L338 was more closely related genomically to animal and human RVAs other than ERVs, suggesting that L338 may not be an endogenous equine RV but have emerged as an interspecies reassortant with other RVA strains. Furthermore, genotype-specific motifs of all 27 G and 37 P types were identified in regions 7-1a (aa 91-100) of VP7 and regions 8-1 (aa146-151) and 8-3 (aa113-118 and 125-135) of VP4 (VP8*). PMID:26321159

  12. Evolution of phosphagen kinase V. cDNA-derived amino acid sequences of two molluscan arginine kinases from the chiton Liolophura japonica and the turbanshell Battilus cornutus.

    Suzuki, T; Ban, T; Furukohri, T

    1997-06-20

    The cDNAs of arginine kinases from the chiton Liolophura japonica (Polyplacophora) and the turbanshell Battilus cornutus (Gastropoda) were amplified by polymerase chain reaction (PCR), and the complete nucleotide sequences of 1669 and 1624 bp, respectively, were determined. The open reading frame for Liolophura arginine kinase is 1050 nucleotides in length and encodes a protein with 349 amino acid residues, and that for Battilus is 1077 nucleotides and 358 residues. The validity of the cDNA-derived amino acid sequence was supported by chemical sequencing of internal tryptic peptides. The molecular masses were calculated to be 39,057 and 39,795 Da, respectively. The amino acid sequence of Liolophura arginine kinase showed 65-68% identity with those of Battilus and Nordotis (abalone) arginine kinases, and the homology between Battilus and Nordotis was 79%. Molluscan arginine kinases also show lower, but significant homology (38-43%) with rabbit creatine kinase. The sequences of arginine kinases could be used as a molecular clock to elucidate the phylogeny of Mollusca, one of the most diverse animal phyla. PMID:9217008

  13. Ruthenium Hydride/Brønsted Acid-Catalyzed Tandem Isomerization/N-Acyliminium Cyclization Sequence for the Synthesis of Tetrahydro-β-carbolines

    Hansen, Casper Lykke; Clausen, Janie Regitse Waël; Ohm, Ragnhild Gaard;

    2013-01-01

    This paper describes an efficient tandem sequence for the synthesis of 1,2,3,4-tetrahydro-β-carbolines (THBCs) relying on a ruthenium hydride/Brønsted acid- catalyzed isomerization of allylic amides to N-acyliminium ion intermediates which are trapped by a tethered indolenucleophile. The...

  14. Complete genome sequence of the actinobacterium Amycolatopsis japonica MG417-CF17T (=DSM 44213T) producing (S,S)-N,N′-ethylenediaminedisuccinic acid

    Stegmann, Evi; Albersmeier, Andreas; Spohn, Marius; Gert, Helena; Weber, Tilmann; Wohlleben, Wolfgang; Kalinowski, Jörn; Rückert, Christian

    2014-01-01

    We report the complete genome sequence of Amycolatopsis japonica MG417-CF17T (=DSM 44213T) which was identified as the producer of (S,S)-N,N′-ethylenediaminedisuccinic acid during a screening for phospholipase C inhibitors. The genome of A. japonica MG417-CF17T consists of two replicons: the...

  15. Draft Genome Sequences of Pseudomonas fluorescens BS2 and Pusillimonas noertemannii BS8, Soil Bacteria That Cooperate To Degrade the Poly- -D-Glutamic Acid Anthrax Capsule

    Stabler, R. A.

    2013-01-24

    A mixed culture of Pseudomonas fluorescens BS2 and Pusillimonas noertemannii BS8 degraded poly-γ-d-glutamic acid; when the 2 strains were cultured separately, no hydrolytic activity was apparent. Here we report the draft genome sequences of both soil isolates.

  16. Genome Sequence of Lactobacillus saerimneri 30a (Formerly Lactobacillus sp. Strain 30a), a Reference Lactic Acid Bacterium Strain Producing Biogenic Amines

    Romano, Andrea; Trip, Hein; Campbell-Sills, Hugo; Bouchez, Olivier; Sherman, David; Lolkema, Juke S.; Lucas, Patrick M

    2013-01-01

    Lactobacillus sp. strain 30a (Lactobacillus saerimneri) produces the biogenic amines histamine, putrescine, and cadaverine by decarboxylating their amino acid precursors. We report its draft genome sequence (1,634,278 bases, 42.6% G+C content) and the principal findings from its annotation, which might shed light onto the enzymatic machineries that are involved in its production of biogenic amines.

  17. Open questions in origin of life: experimental studies on the origin of nucleic acids and proteins with specific and functional sequences by a chemical synthetic biology approach

    Adamala, K.; Anella, F.; Wieczorek, R.;

    2014-01-01

    In this mini-review we present some experimental approaches to the important issue in the origin of life, namely the origin of nucleic acids and proteins with specific and functional sequences. The formation of macromolecules on prebiotic Earth faces practical and conceptual difficulties. From the...

  18. Use of Chromophoric Ligands to Visually Screen Co-crystals of Putative Protein-Nucleic Acid Complexes

    Jiang, Xiaohua; Egli, Martin

    2011-01-01

    Distinguishing between crystals of protein-nucleic acid complexes and those containing protein alone is a common problem in structural studies of protein-nucleic acid interactions. Currently there are several methods available for detecting nucleic acid in crystals, including gel electrophoresis, SYBR Gold fluorescence dye staining and methyl violet staining. However, they require either that the crystals be sacrificed or access to a fluorescence microscope. In this protocol, we describe an a...

  19. Identities among actin-encoding cDNAs of the Nile tilapia (Oreochromis niloticus and other eukaryote species revealed by nucleotide and amino acid sequence analyses

    Andréia B. Poletto

    2008-01-01

    Full Text Available Actin-encoding cDNAs of Nile tilapia (Oreochromis niloticus were isolated by RT-PCR using total RNA samples of different tissues and further characterized by nucleotide sequencing and in silico amino acid (aa sequence analysis. Comparisons among the actin gene sequences of O. niloticus and those of other species evidenced that the isolated genes present a high similarity to other fish and other vertebrate actin genes. The highest nucleotide resemblance was observed between O. niloticus and O. mossambicus a-actin and b-actin genes. Analysis of the predicted aa sequences revealed two distinct types of cytoplasmic actins, one cardiac muscle actin type and one skeletal muscle actin type that were expressed in different tissues of Nile tilapia. The evolutionary relationships between the Nile tilapia actin genes and diverse other organisms is discussed.

  20. FeatureViewer, a BioJS component for visualization of position-based annotations in protein sequences [v1; ref status: indexed, http://f1000r.es/2u2

    Leyla Garcia; Guy Yachdav; Maria-Jesus Martin

    2014-01-01

    Summary: FeatureViewer is a BioJS component that lays out, maps, orients, and renders position-based annotations for protein sequences. This component is highly flexible and customizable, allowing the presentation of annotations by rows, all centered, or distributed in non-overlapping tracks. It uses either lines or shapes for sites and rectangles for regions. The result is a powerful visualization tool that can be easily integrated into web applications as well as documents as it provides an...

  1. PreFRP: Prediction and visualization of fluctuation residues in proteins

    Saravanan, Konda Mani; Senthil, Renganathan

    2016-01-01

    Aim: The PreFRP web server extracts sequence and basic information of a protein structure and groups amino acid residues in a protein into three important types such as high, moderate, and weak fluctuating residues. Materials and Methods: The server takes a protein data bank file or an amino acid sequence as input and prints the probability of amino acid residues to fluctuate. The server also provides a link to Jmol, a molecular visualization program to visualize the high, moderate, and weak fluctuating residues in three different colors. Results: Prediction and visualization of fluctuating amino acid residues in proteins may help to understand the complex three-dimensional structure of proteins and may further help in docking and mutation experiments. Availability: The web server is freely accessible through the web page of the author's institution http://www.mpi.edu.in/prefrp/link.html.

  2. Evolution of alpha-lactalbumins. The complete amino acid sequence of the alpha-lactalbumin from a marsupial (Macropus rufogriseus) and corrections to regions of sequence in bovine and goat alpha-lactalbumins.

    Shewale, J G; Sinha, S K; Brew, K

    1984-04-25

    alpha-Lactalbumin was purified from a whey protein fraction of the milk of the red-necked wallaby (Macropus rufogriseus). The complete amino acid sequence was determined from the results of automatic sequenator analyses of the intact protein, the three cyanogen bromide fragments, and of peptides generated from the larger, COOH-terminal CNBr fragment by digestion with trypsin or staphylococcal protease. This is the first sequence to be determined of an alpha-lactalbumin from a marsupial and differs from known eutherian alpha-lactalbumins in size and locations of deletions in alignments with the homologous type c lysozymes, as well as in having amino acid substitutions at 8 sites that are invariant in known eutherian proteins. Some corrections are also reported for two regions of sequence in both bovine and goat alpha-lactalbumins. The new and previously published information on alpha-lactalbumin sequences is analyzed in relation to the evolutionary history of the alpha-lactalbumin line as well as the relationship of structure to function in these proteins. PMID:6715332

  3. Sequence-specific nucleic acid mobility using a reversible block copolymer gel matrix and DNA amphiphiles (lipid-DNA) in capillary and microfluidic electrophoretic separations.

    Wagler, Patrick; Minero, Gabriel Antonio S; Tangen, Uwe; de Vries, Jan Willem; Prusty, Deepak; Kwak, Minseok; Herrmann, Andreas; McCaskill, John S

    2015-10-01

    Reversible noncovalent but sequence-dependent attachment of DNA to gels is shown to allow programmable mobility processing of DNA populations. The covalent attachment of DNA oligomers to polyacrylamide gels using acrydite-modified oligonucleotides has enabled sequence-specific mobility assays for DNA in gel electrophoresis: sequences binding to the immobilized DNA are delayed in their migration. Such a system has been used for example to construct complex DNA filters facilitating DNA computations. However, these gels are formed irreversibly and the choice of immobilized sequences is made once off during fabrication. In this work, we demonstrate the reversible self-assembly of gels combined with amphiphilic DNA molecules, which exhibit hydrophobic hydrocarbon chains attached to the nucleobase. This amphiphilic DNA, which we term lipid-DNA, is synthesized in advance and is blended into a block copolymer gel to induce sequence-dependent DNA retention during electrophoresis. Furthermore, we demonstrate and characterize the programmable mobility shift of matching DNA in such reversible gels both in thin films and microchannels using microelectrode arrays. Such sequence selective separation may be employed to select nucleic acid sequences of similar length from a mixture via local electronics, a basic functionality that can be employed in novel electronic chemical cell designs and other DNA information-processing systems. PMID:26095642

  4. A Possible Mechanism of Zika Virus Associated Microcephaly: Imperative Role of Retinoic Acid Response Element (RARE) Consensus Sequence Repeats in the Viral Genome

    Kumar, Ashutosh; Singh, Himanshu N.; Pareek, Vikas; Raza, Khursheed; Dantham, Subrahamanyam; Kumar, Pavan; Mochan, Sankat; Faiq, Muneeb A.

    2016-01-01

    Owing to the reports of microcephaly as a consistent outcome in the fetuses of pregnant women infected with ZIKV in Brazil, Zika virus (ZIKV)—microcephaly etiomechanistic relationship has recently been implicated. Researchers, however, are still struggling to establish an embryological basis for this interesting causal handcuff. The present study reveals robust evidence in favor of a plausible ZIKV-microcephaly cause-effect liaison. The rationale is based on: (1) sequence homology between ZIKV genome and the response element of an early neural tube developmental marker “retinoic acid” in human DNA and (2) comprehensive similarities between the details of brain defects in ZIKV-microcephaly and retinoic acid embryopathy. Retinoic acid is considered as the earliest factor for regulating anteroposterior axis of neural tube and positioning of structures in developing brain through retinoic acid response elements (RARE) consensus sequence (5′–AGGTCA–3′) in promoter regions of retinoic acid-dependent genes. We screened genomic sequences of already reported virulent ZIKV strains (including those linked to microcephaly) and other viruses available in National Institute of Health genetic sequence database (GenBank) for the RARE consensus repeats and obtained results strongly bolstering our hypothesis that ZIKV strains associated with microcephaly may act through precipitation of dysregulation in retinoic acid-dependent genes by introducing extra stretches of RARE consensus sequence repeats in the genome of developing brain cells. Additional support to our hypothesis comes from our findings that screening of other viruses for RARE consensus sequence repeats is positive only for those known to display neurotropism and cause fetal brain defects (for which maternal-fetal transmission during developing stage may be required). The numbers of RARE sequence repeats appeared to match with the virulence of screened positive viruses. Although, bioinformatic evidence and

  5. Complete genome sequence of the actinobacterium Amycolatopsis japonica MG417-CF17(T) (=DSM 44213T) producing (S,S)-N,N'-ethylenediaminedisuccinic acid.

    Stegmann, Evi; Albersmeier, Andreas; Spohn, Marius; Gert, Helena; Weber, Tilmann; Wohlleben, Wolfgang; Kalinowski, Jörn; Rückert, Christian

    2014-11-10

    We report the complete genome sequence of Amycolatopsis japonica MG417-CF17(T) (=DSM 44213(T)) which was identified as the producer of (S,S)-N,N'-ethylenediaminedisuccinic acid during a screening for phospholipase C inhibitors. The genome of A. japonica MG417-CF17(T) consists of two replicons: the chromosome (8,961,318 bp, 68.89% G+C content) and the plasmid pAmyja1 (92,539 bp, 68.23% G+C content), encoding a total of 8422 protein coding genes. Analysis of the sequence data revealed 30 clusters encoding the biosynthesis of secondary metabolites. PMID:25193710

  6. Solid-phase methods for sequencing of nucleic acids I. Simultaneous sequencing of different oligodeoxyribonucleotides using a new, mechanically stable anion-exchange paper.

    Rosenthal, A.; Schwertner, S; Hahn, V; Hunger, H. D.

    1985-01-01

    A solid-phase method for simultaneous sequencing of large numbers of oligodeoxyribonucleotides has been developed using a new, mechanically stable anion-exchange paper. The excellent mechanical properties of the polymer allow the processing of several paper segments in one reaction vessel or to carry out all necessary operations on a larger area of the paper. In addition, DNA material can be chemically eluted from the new carrier during the piperidine reaction, thus avoiding salt elution of D...

  7. In situ visualization of newly synthesized proteins in environmental microbes using amino acid tagging and click chemistry

    Hatzenpichler, Roland; Scheller, Silvan; Tavormina, Patricia L.; Babin, Brett M; Tirrell, David A.; Orphan, Victoria J.

    2014-01-01

    Here we describe the application of a new click chemistry method for fluorescent tracking of protein synthesis in individual microorganisms within environmental samples. This technique, termed bioorthogonal non-canonical amino acid tagging (BONCAT), is based on the in vivo incorporation of the non-canonical amino acid L-azidohomoalanine (AHA), a surrogate for l -methionine, followed by fluorescent labelling of AHA-containing cellular proteins by azide-alkyne click chemistry. BONCAT was evalua...

  8. Terminal sequence importance of de novo proteins from binary-patterned library: stable artificial proteins with 11- or 12-amino acid alphabet.

    Okura, Hiromichi; Takahashi, Tsuyoshi; Mihara, Hisakazu

    2012-06-01

    Successful approaches of de novo protein design suggest a great potential to create novel structural folds and to understand natural rules of protein folding. For these purposes, smaller and simpler de novo proteins have been developed. Here, we constructed smaller proteins by removing the terminal sequences from stable de novo vTAJ proteins and compared stabilities between mutant and original proteins. vTAJ proteins were screened from an α3β3 binary-patterned library which was designed with polar/ nonpolar periodicities of α-helix and β-sheet. vTAJ proteins have the additional terminal sequences due to the method of constructing the genetically repeated library sequences. By removing the parts of the sequences, we successfully obtained the stable smaller de novo protein mutants with fewer amino acid alphabets than the originals. However, these mutants showed the differences on ANS binding properties and stabilities against denaturant and pH change. The terminal sequences, which were designed just as flexible linkers not as secondary structure units, sufficiently affected these physicochemical details. This study showed implications for adjusting protein stabilities by designing N- and C-terminal sequences. PMID:22519540

  9. Shared amino acid sequences between major histocompatibility complex class II glycoproteins, type XI collagen and Proteus mirabilis in rheumatoid arthritis.

    Wilson, C.; Ebringer, A; K. Ahmadi; Wrigglesworth, J; Tiwana, H.; Fielder, M; Binder, A.; Ettelaie, C.; Cunningham, P.; Joannou, C

    1995-01-01

    OBJECTIVES--To show molecular similarity between two sequences of Proteus mirabilis (haemolysin--ESRRAL; urease--IRRET) with HLA-DR antigens (EQRRAA) which are associated with rheumatoid arthritis (RA) and type XI collagen (LRREI), respectively; and, in patients with RA, to measure levels of antibody against a 16-mer synthetic peptide containing the ESRRAL sequence, and the haemolysin and urease proteins of Proteus mirabilis. METHODS--The homologous sequences EQRRAA and ESRRAL were modelled w...

  10. Nuclear hormone receptors involved in neoplasia: erb A exhibits a novel DNA sequence specificity determined by amino acids outside of the zinc-finger domain.

    Chen, H.; Smit-McBride, Z; Lewis, S; Sharif, M; Privalsky, M L

    1993-01-01

    The erb A oncogene is a dominant negative allele of a thyroid hormone receptor gene and acts in the cancer cell by encoding a transcriptional repressor. We demonstrate here that the DNA sequence recognition properties of the oncogenic form of the erb A protein are significantly altered from those of the normal thyroid hormone receptors and more closely resemble those of the retinoic acid receptors; this alteration appears to play an important role in defining the targets of erb A action in ne...

  11. Genome Sequence of Lactobacillus saerimneri 30a (Formerly Lactobacillus sp. Strain 30a), a Reference Lactic Acid Bacterium Strain Producing Biogenic Amines

    Romano, Andrea; Trip, Hein; Campbell-Sills, Hugo; Bouchez, Olivier; Sherman, David; Lolkema, Juke S.; Lucas, Patrick M

    2013-01-01

    Lactobacillus sp. strain 30a (Lactobacillus saerimneri) produces the biogenic amines histamine, putrescine, and cadaverine by decarboxylating their amino acid precursors. We report its draft genome sequence (1,634,278 bases, 42.6% G+C content) and the principal findings from its annotation, which might shed light onto the enzymatic machineries that are involved in its production of biogenic amines.

  12. Amino acid sequence of the ligand-binding domain of the aryl hydrocarbon receptor 1 predicts sensitivity of wild birds to effects of dioxin-like compounds.

    Farmahin, Reza; Manning, Gillian E; Crump, Doug; Wu, Dongmei; Mundy, Lukas J; Jones, Stephanie P; Hahn, Mark E; Karchner, Sibel I; Giesy, John P; Bursian, Steven J; Zwiernik, Matthew J; Fredricks, Timothy B; Kennedy, Sean W

    2013-01-01

    The sensitivity of avian species to the toxic effects of dioxin-like compounds (DLCs) varies up to 1000-fold among species, and this variability has been associated with interspecies differences in aryl hydrocarbon receptor 1 ligand-binding domain (AHR1 LBD) sequence. We previously showed that LD(50) values, based on in ovo exposures to DLCs, were significantly correlated with in vitro EC(50) values obtained with a luciferase reporter gene (LRG) assay that measures AHR1-mediated induction of cytochrome P4501A in COS-7 cells transfected with avian AHR1 constructs. Those findings suggest that the AHR1 LBD sequence and the LRG assay can be used to predict avian species sensitivity to DLCs. In the present study, the AHR1 LBD sequences of 86 avian species were studied, and differences at amino acid sites 256, 257, 297, 324, 337, and 380 were identified. Site-directed mutagenesis, the LRG assay, and homology modeling highlighted the importance of each amino acid site in AHR1 sensitivity to 2,3,7,8-tetrachlorodibenzo-p-dioxin and other DLCs. The results of the study revealed that (1) only amino acids at sites 324 and 380 affect the sensitivity of AHR1 expression constructs of the 86 avian species to DLCs and (2) in vitro luciferase activity of AHR1 constructs containing only the LBD of the species of interest is significantly correlated (r (2) = 0.93, p toxicity data for those species. These results indicate promise for the use of AHR1 LBD amino acid sequences independently, or combined with the LRG assay, to predict avian species sensitivity to DLCs. PMID:22923492

  13. Detection of Aspergillus fumigatus in a Rat Model of Invasive Pulmonary Aspergillosis by Real-Time Nucleic Acid Sequence-Based Amplification▿

    Zhao, Yanan; Park, Steven; Warn, Peter; Shrief, Raghdaa; Harrison, Elizabeth; Perlin, David S.

    2010-01-01

    Rapid and sensitive detection of Aspergillus from clinical samples may facilitate the early diagnosis of invasive pulmonary aspergillosis (IPA). A real-time nucleic acid sequence-based amplification (NASBA) method was investigated by use of an inhalational rat model of IPA. Immunosuppressed male Sprague-Dawley rats were exposed to Aspergillus fumigatus spores for an hour in an aerosol chamber. Bronchoalveolar lavage (BAL) fluid, lung tissues, and whole blood were collected from five infected ...

  14. Data for amino acid alignment of Japanese stingray melanocortin receptors with other gnathostome melanocortin receptor sequences, and the ligand selectivity of Japanese stingray melanocortin receptors

    Akiyoshi Takahashi

    2016-06-01

    Full Text Available This article contains structure and pharmacological characteristics of melanocortin receptors (MCRs related to research published in “Characterization of melanocortin receptors from stingray Dasyatis akajei, a cartilaginous fish” (Takahashi et al., 2016 [1]. The amino acid sequences of the stingray, D. akajei, MC1R, MC2R, MC3R, MC4R, and MC5R were aligned with the corresponding melanocortin receptor sequences from the elephant shark, Callorhinchus milii, the dogfish, Squalus acanthias, the goldfish, Carassius auratus, and the mouse, Mus musculus. These alignments provide the basis for phylogenetic analysis of these gnathostome melanocortin receptor sequences. In addition, the Japanese stingray melanocortin receptors were separately expressed in Chinese Hamster Ovary cells, and stimulated with stingray ACTH, α-MSH, β-MSH, γ-MSH, δ-MSH, and β-endorphin. The dose response curves reveal the order of ligand selectivity for each stingray MCR.

  15. Separation of small molecular peptides with the same amino acid composition but different sequences by high performance liquid chromatography-electrospray ionization-mass spectrometry

    2009-01-01

    Peptidomics has emerged as a new discipline in recent years. Mass spectrometry (MS) is the most universal and efficient tool for structure identification of proteins and peptides. However,there is a limitation for the identification of peptides with the same amino acid composition but different se-quences because these peptides have identical mass spectra of molecular ions. This paper presents a high performance liquid chromatography-electrospray ionization-mass spectrometry (HPLC-ESI-MS) method for the separation of small molecular peptides with the same amino acid composition but dif-ferent sequences. Two tripeptides of Gly-Ser-Phe and Gly-Phe-Ser were used as a model sample. The separation behavior has been investigated and the separation conditions have been optimized. Under the optimum conditions,good repeatability was achieved. The developed method could provide a helpful reference for the separation of other peptides with the same amino acid composition but different sequences in the study of proteomics and peptidomics.

  16. Applications of High Throughput Nucleotide Sequencing

    Waage, Johannes Eichler

    The recent advent of high throughput sequencing of nucleic acids (RNA and DNA) has vastly expanded research into the functional and structural biology of the genome of all living organisms (and even a few dead ones). With this enormous and exponential growth in biological data generation come......, focusing on oft encountered problems in data processing, such as quality assurance, mapping, normalization, visualization, and interpretation. Presented in the second part are scientific endeavors representing solutions to problems of two sub-genres of next generation sequencing. For the first flavor, RNA...

  17. Amino acid sequence of the alpha subunit and computer modelling of the alpha and beta subunits of echicetin from the venom of Echis carinatus (saw-scaled viper).

    Polgár, J; Magnenat, E M; Peitsch, M C; Wells, T N; Saqi, M S; Clemetson, K J

    1997-04-15

    Echicetin, a heterodimeric protein from the venom of Echis carinatus, binds to platelet glycoprotein Ib (GPIb) and so inhibits platelet aggregation or agglutination induced by various platelet agonists acting via GPIb. The amino acid sequence of the beta subunit of echicetin has been reported and found to belong to the recently identified snake venom subclass of the C-type lectin protein family. Echicetin alpha and beta subunits were purified. N-terminal sequence analysis provided direct evidence that the protein purified was echicetin. The paper presents the complete amino acid sequence of the alpha subunit and computer models of the alpha and beta subunits. The sequence of alpha echicetin is highly similar to the alpha and beta chains of various heterodimeric and homodimeric C-type lectins. Neither of the fully reduced and alkylated alpha or beta subunits of echicetin inhibited the platelet agglutination induced by von Willebrand factor-ristocetin or alpha-thrombin. Earlier reports about the inhibitory activity of reduced and alkylated echicetin beta subunit might have been due to partial reduction of the protein. PMID:9163349

  18. Maternal fish oil supplementation in lactation: Effect on visual acuity and n-3 fatty acid content of infant erythrocytes

    Lauritzen, L.; Jørgensen, M.H.; Mikkelsen, T.B.;

    2004-01-01

    of fish oil (FO) supplements in lactating mothers. In this double-blinded randomized trial, Danish mothers with habitual fish intake below the 50th percentile of the Danish National Birth Cohort were randomized to microencapsulated FO [1.3 g/d long-chain n-3 FA (n-3 LCPUFA)] or olive oil (00). The...... intervention started within a week after delivery and lasted 4 mon. Mothers with habitual high fish intake and their infants were included as a reference group. Ninety-seven infants completed the trial (44 OO-group, 53 FO-group) and 47 reference infants were followed up. The primary outcome measures were: DHA...... content of milk samples (0, 2, and 4 mon postnatal) and of infant red blood cell (RBC) membranes (4 mon postnatal), and infant visual acuity (measured by swept visual evoked potential at 2 and 4 mon of age). FO supplementation gave rise to a threefold increase in the DHA content of the 4-mon milk samples...

  19. Moving Away from the Reference Genome: Evaluating a Peptide Sequencing Tagging Approach for Single Amino Acid Polymorphism Identifications in the Genus Populus

    Abraham, Paul E [ORNL; Adams, Rachel M [ORNL; Tuskan, Gerald A [ORNL; Hettich, Robert {Bob} L [ORNL

    2013-01-01

    The genetic diversity across natural populations of the model organism, Populus, is extensive, containing a single nucleotide polymorphism roughly every 200 base pairs. When deviations from the reference genome occur in coding regions, they can impact protein sequences. Rather than relying on a static reference database to profile protein expression, we employed a peptide sequence tagging (PST) approach capable of decoding the plasticity of the Populus proteome. Using shotgun proteomics data from two genotypes of P. trichocarpa, a tag-based approach enabled the detection of 6,653 unexpected sequence variants. Through manual validation, our study investigated how the most abundant chemical modification (methionine oxidation) could masquerade as a sequence variant (AlaSer) when few site-determining ions existed. In fact, precise localization of an oxidation site for peptides with more than one potential placement was indeterminate for 70% of the MS/MS spectra. We demonstrate that additional fragment ions made available by high energy collisional dissociation enhances the robustness of the peptide sequence tagging approach (81% of oxidation events could be exclusively localized to a methionine). We are confident that augmenting fragmentation processes for a PST approach will further improve the identification of single amino acid polymorphism in Populus and potentially other species as well.

  20. In vivo targeted magnetic resonance imaging and visualized photodynamic therapy in deep-tissue cancers using folic acid-functionalized superparamagnetic-upconversion nanocomposites

    Zeng, Leyong; Luo, Lijia; Pan, Yuanwei; Luo, Song; Lu, Guangming; Wu, Aiguo

    2015-05-01

    Multifunctional nanoprobes used in magnetic resonance imaging (MRI) and photodynamic therapy (PDT) also have potential applications in diagnosis and visualized therapy of cancers, and hence it is important to investigate the active-targeting ability and in vivo reliability of these nanoprobes. In this work, folic acid (FA)-targeted, photosensitizer (PS)-loaded Fe3O4@NaYF4:Yb/Er (FA-NPs-PS) nanocomposites were synthesized for in vivo T2-weighted MRI and visualized PDT of cancers by modeling MCF-7 tumor-bearing nude mice. By measuring the upconversion luminescence (UCL) and fluorescence emission spectra, the as-prepared FA-NPs-PS nanocomposites showed near-infrared (NIR)-triggered PDT performance due to the production of a singlet oxygen species. Moreover, by tracing PS fluorescence in MCF-7, HeLa cells and in MCF-7 tumors, the FA-targeted nanocomposites demonstrated good targeting ability both in vitro and in vivo. Under the irradiation of a 980 nm laser, the viabilities of MCF-7 and HeLa cells incubated with FA-NPs-PS nanocomposites could decrease to about 18.4% and 30.7%, respectively, and the inhibition of MCF-7 tumors could reach about 94.9%. The transverse MR relaxivity of 63.79 mM-1 s-1 (r2 value) and in vivo MR imaging of MCF-7 tumors indicated an excellent T2-weighted MR performance. This work demonstrated that FA-targeted MRI/PDT nanoprobes are effective for in vivo diagnosis and visualized therapy of breast cancers.Multifunctional nanoprobes used in magnetic resonance imaging (MRI) and photodynamic therapy (PDT) also have potential applications in diagnosis and visualized therapy of cancers, and hence it is important to investigate the active-targeting ability and in vivo reliability of these nanoprobes. In this work, folic acid (FA)-targeted, photosensitizer (PS)-loaded Fe3O4@NaYF4:Yb/Er (FA-NPs-PS) nanocomposites were synthesized for in vivo T2-weighted MRI and visualized PDT of cancers by modeling MCF-7 tumor-bearing nude mice. By measuring the

  1. Point-of-care and visual detection of P. aeruginosa and its toxin genes by multiple LAMP and lateral flow nucleic acid biosensor.

    Chen, Yuting; Cheng, Nan; Xu, Yuancong; Huang, Kunlun; Luo, Yunbo; Xu, Wentao

    2016-07-15

    This study describes a simple and sensitive approach for visual and point-of-care detection of P. aeruginosa and its toxin genes based on multiple loop-mediated isothermal amplification (mLAMP) and lateral flow nucleic acid biosensor (LFNAB). Differentiation of the internal standard gene ecfX and toxin genes (ExoS and ExoU) in P. aeruginosa was determined using FITC-, hex-and digoxin-modified primers in the mLAMP process. In the presence of biotin-and FITC- (hex-, digoxin-) modified primers and Bst DNA polymerase large fragments, the mLAMP produced numerous biotin- and FITC- (hex-, digoxin-) attached duplex DNA products. The products were detected by LFNAB through dual immunoreactions (anti-biotin antibodies on the gold nanoparticle (Au-NP) and biotin on the duplex, anti-FITC (hex, digoxin) antibodies on the LFNAB test line and FITC (hex, digoxin) on the duplex). The accumulation of Au-NPs produced a characteristic red band, enabling visual detection of P. aeruginosa and its toxin genes without instrumentation. After systematic optimization of LFNAB preparation and detecting conditions, the current approach was capable of detecting concentrations as low as 20 CFU/mL P. aeruginosa or its toxin genes within 50min without complicated instrument, which is more sensitive than PCR. Therefore, this approach provides a simple, pollution free, sensitive, and low-cost point-of-care test for the detection of P. aeruginosa and its toxin genes. PMID:26985584

  2. Sequence heterogeneity of cannabidiolic- and tetrahydrocannabinolic acid-synthase in Cannabis sativa L. and its relationship with chemical phenotype.

    Onofri, Chiara; de Meijer, Etienne P M; Mandolino, Giuseppe

    2015-08-01

    Sequence variants of THCA- and CBDA-synthases were isolated from different Cannabis sativa L. strains expressing various wild-type and mutant chemical phenotypes (chemotypes). Expressed and complete sequences were obtained from mature inflorescences. Each strain was shown to have a different specificity and/or ability to convert the precursor CBGA into CBDA and/or THCA type products. The comparison of the expressed sequences led to the identification of different mutations, all of them due to SNPs. These SNPs were found to relate to the cannabinoid composition of the inflorescence at maturity and are therefore proposed to have a functional significance. The amount of variation was found to be higher within the CBDAS sequence family than in the THCAS family, suggesting a more recent evolution of THCA-forming enzymes from the CBDAS group. We therefore consider CBDAS as the ancestral type of these synthases. PMID:25865737

  3. Genomics Analogy Model for Educators (GAME): Fuzzy DNA Model to Enable the Learning of Gene Sequencing by Visually-Impaired and Blind Students

    Butler, Charles; Bello, Julia; York, Alan; Orvis, Kathryn; Pittendrigh, Barry R.

    2008-01-01

    Much of the general population is aware of terms such as biotechnology, genetic engineering, and genomics. However, there is a lack of understanding concerning these fields among many secondary school students. Few teaching models exist to explain concepts behind genomics and even less are available for teaching the visually impaired and blind.…

  4. Amino acid sequence and carbohydrate-binding analysis of the N-acetyl-D-galactosamine-specific C-type lectin, CEL-I, from the Holothuroidea, Cucumaria echinata.

    Hatakeyama, Tomomitsu; Matsuo, Noriaki; Shiba, Kouhei; Nishinohara, Shoichi; Yamasaki, Nobuyuki; Sugawara, Hajime; Aoyagi, Haruhiko

    2002-01-01

    CEL-I is one of the Ca2+-dependent lectins that has been isolated from the sea cucumber, Cucumaria echinata. This protein is composed of two identical subunits held by a single disulfide bond. The complete amino acid sequence of CEL-I was determined by sequencing the peptides produced by proteolytic fragmentation of S-pyridylethylated CEL-I. A subunit of CEL-I is composed of 140 amino acid residues. Two intrachain (Cys3-Cys14 and Cys31-Cys135) and one interchain (Cys36) disulfide bonds were also identified from an analysis of the cystine-containing peptides obtained from the intact protein. The similarity between the sequence of CEL-I and that of other C-type lectins was low, while the C-terminal region, including the putative Ca2+ and carbohydrate-binding sites, was relatively well conserved. When the carbohydrate-binding activity was examined by a solid-phase microplate assay, CEL-I showed much higher affinity for N-acetyl-D-galactosamine than for other galactose-related carbohydrates. The association constant of CEL-I for p-nitrophenyl N-acetyl-beta-D-galactosaminide (NP-GalNAc) was determined to be 2.3 x 10(4) M(-1), and the maximum number of bound NP-GalNAc was estimated to be 1.6 by an equilibrium dialysis experiment. PMID:11866098

  5. The complete genome sequence of Natrinema sp. J7-2, a haloarchaeon capable of growth on synthetic media without amino acid supplements.

    Feng, Jie; Liu, Bin; Zhang, Ziqian; Ren, Yan; Li, Yang; Gan, Fei; Huang, Yuping; Chen, Xiangdong; Shen, Ping; Wang, Lei; Tang, Bing; Tang, Xiao-Feng

    2012-01-01

    Natrinema sp. J7-2 is an extreme haloarchaeon capable of growing on synthetic media without amino acid supplements. Here we report the complete genome sequence of Natrinema sp. J7-2 which is composed of a 3,697,626-bp chromosome and a 95,989-bp plasmid pJ7-I. This is the first complete genome sequence of a member of the genus Natrinema. We demonstrate that Natrinema sp. J7-2 can use gluconate, glycerol, or acetate as the sole carbon source and that its genome encodes complete metabolic pathways for assimilating these substrates. The biosynthetic pathways for all 20 amino acids have been reconstructed, and we discuss a possible evolutionary relationship between the haloarchaeal arginine synthetic pathway and the bacterial lysine synthetic pathway. The genome harbors the genes for assimilation of ammonium and nitrite, but not nitrate, and has a denitrification pathway to reduce nitrite to N(2)O. Comparative genomic analysis suggests that most sequenced haloarchaea employ the TrkAH system, rather than the Kdp system, to actively uptake potassium. The genomic analysis also reveals that one of the three CRISPR loci in the Natrinema sp. J7-2 chromosome is located in an integrative genetic element and is probably propagated via horizontal gene transfer (HGT). Finally, our phylogenetic analysis of haloarchaeal genomes provides clues about evolutionary relationships of haloarchaea. PMID:22911826

  6. A comparative study of 2',3'-cyclic-nucleotide 3'-phosphodiesterase in vertebrates: cDNA cloning and amino acid sequences for chicken and bullfrog enzymes.

    Kasama-Yoshida, H; Tohyama, Y; Kurihara, T; Sakuma, M; Kojima, H; Tamai, Y

    1997-10-01

    In mammalian brain, two 2',3'-cyclic-nucleotide 3'-phosphodiesterase (EC 3.1.4.37) isoforms, CNP1 and CNP2, are translated, respectively, from the two mRNAs, which have been transcribed and processed by alternative use of the two transcription start points and by differential splicing. In the present study, the cDNAs encoding chicken CNP2 and bullfrog CNP1, respectively, were isolated, and the amino acid sequences of chicken CNP2 and bullfrog CNP1 were deduced. Western blot analysis showed that chicken brain contains a major CNP2-type protein together with a minor unidentified isoform, and bullfrog brain contains only a CNP1-type protein. All available amino acid sequences of vertebrate 2',3'-cyclic-nucleotide 3'-phosphodiesterases were aligned and compared. Three conserved motif sequences were noted: (a) an ATP-binding site near the amino terminus, (b) an isoprenylation site at the carboxyl terminus, and (c) a probable catalytic site resembling the active site of beta-ketoacyl synthase (EC 2.3.1.41). The second and the third motifs are conserved also in goldfish RICH (regeneration-induced 2',3'-cyclic-nucleotide 3'-phosphodiesterase homologue), which has been shown recently to have 2',3'-cyclic-nucleotide 3'-phosphodiesterase activity. The third motif (probably catalytic site) was assigned for the first time in the present report. PMID:9326261

  7. Comparison of nucleic acid hybridization and nucleic acid amplification using conserved sequences from the 5' noncoding region for detection of bovine viral diarrhea virus.

    Ridpath, J F; Bolin, S R; Katz, J

    1993-01-01

    Primers and probes derived from conserved sequences located in the 5' noncoding region of pestiviruses were evaluated for detection of bovine viral diarrhea virus. With these reagents, hybridization and polymerase chain reaction tests detected 62 of 90 and 90 of 90 bovine viral diarrhea virus isolates, respectively. A quick lysis method for preparing RNA for use in polymerase chain reaction amplification also was evaluated.

  8. Transcriptome sequencing revealed the transcriptional organization at ribosome-mediated attenuation sites in Corynebacterium glutamicum and identified a novel attenuator involved in aromatic amino acid biosynthesis.

    Neshat, Armin; Mentz, Almut; Rückert, Christian; Kalinowski, Jörn

    2014-11-20

    The Gram-positive bacterium Corynebacterium glutamicum belongs to the order Corynebacteriales and is used as a producer of amino acids at industrial scales. Due to its economic importance, gene expression and particularly the regulation of amino acid biosynthesis has been investigated extensively. Applying the high-resolution technique of transcriptome sequencing (RNA-seq), recently a vast amount of data has been generated that was used to comprehensively analyze the C. glutamicum transcriptome. By analyzing RNA-seq data from a small RNA cDNA library of C. glutamicum, short transcripts in the known transcriptional attenuators sites of the trp operon, the ilvBNC operon and the leuA gene were verified. Furthermore, whole transcriptome RNA-seq data were used to elucidate the transcriptional organization of these three amino acid biosynthesis operons. In addition, we discovered and analyzed the novel attenuator aroR, located upstream of the aroF gene (cg1129). The DAHP synthase encoded by aroF catalyzes the first step in aromatic amino acid synthesis. The AroR leader peptide contains the amino acid sequence motif F-Y-F, indicating a regulatory effect by phenylalanine and tyrosine. Analysis by real-time RT-PCR suggests that the attenuator regulates the transcription of aroF in dependence of the cellular amount of tRNA loaded with phenylalanine when comparing a phenylalanine-auxotrophic C. glutamicum mutant fed with limiting and excess amounts of a phenylalanine-containing dipeptide. Additionally, the very interesting finding was made that all analyzed attenuators are leaderless transcripts. PMID:24910972

  9. Live-cell imaging of phosphatidic acid dynamics in pollen tubes visualized by Spo20p-derived biosensor

    Potocký, Martin; Pleskot, Roman; Pejchar, Přemysl; Vitale, N.; Kost, B.; Žárský, Viktor

    2014-01-01

    Roč. 203, č. 2 (2014), s. 483-494. ISSN 0028-646X R&D Projects: GA ČR GA13-19073S Institutional support: RVO:61389030 Keywords : live-cell microscopy * Nicotiana tabacum (tobacco) * phosphatidic acid (PA) Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 7.672, year: 2014 http://gateway.isiknowledge.com/gateway/Gateway.cgi?GWVersion=2&SrcAuth=Alerting&SrcApp=Alerting&DestApp=CCC&DestLinkType=FullRecord&UT=000337639800015

  10. Unifying bacteria from decaying wood with various ubiquitous Gibbsiella species as G. acetica sp. nov. based on nucleotide sequence similarities and their acetic acid secretion.

    Geider, Klaus; Gernold, Marina; Jock, Susanne; Wensing, Annette; Völksch, Beate; Gross, Jürgen; Spiteller, Dieter

    2015-12-01

    Bacteria were isolated from necrotic apple and pear tree tissue and from dead wood in Germany and Austria as well as from pear tree exudate in China. They were selected for growth at 37 °C, screened for levan production and then characterized as Gram-negative, facultatively anaerobic rods. Nucleotide sequences from 16S rRNA genes, the housekeeping genes dnaJ, gyrB, recA and rpoB alignments, BLAST searches and phenotypic data confirmed by MALDI-TOF analysis showed that these bacteria belong to the genus Gibbsiella and resembled strains isolated from diseased oaks in Britain and Spain. Gibbsiella-specific PCR primers were designed from the proline isomerase and the levansucrase genes. Acid secretion was investigated by screening for halo formation on calcium carbonate agar and the compound identified by NMR as acetic acid. Its production by Gibbsiella spp. strains was also determined in culture supernatants by GC/MS analysis after derivatization with pentafluorobenzyl bromide. Some strains were differentiated by the PFGE patterns of SpeI digests and by sequence analyses of the lsc and the ppiD genes, and the Chinese Gibbsiella strain was most divergent. The newly investigated bacteria as well as Gibbsiella querinecans, Gibbsiella dentisursi and Gibbsiella papilionis, isolated in Britain, Spain, Korea and Japan, are taxonomically related Enterobacteriaceae, tolerate and secrete acetic acid. We therefore propose to unify them in the species Gibbsiella acetica sp. nov. PMID:26071988

  11. Multiplex, Rapid, and Sensitive Isothermal Detection of Nucleic-Acid Sequence by Endonuclease Restriction-Mediated Real-Time Multiple Cross Displacement Amplification

    Wang, Yi; Wang, Yan; Zhang, Lu; Liu, Dongxin; Luo, Lijuan; Li, Hua; Cao, Xiaolong; Liu, Kai; Xu, Jianguo; Ye, Changyun

    2016-01-01

    We have devised a novel isothermal amplification technology, termed endonuclease restriction-mediated real-time multiple cross displacement amplification (ET-MCDA), which facilitated multiplex, rapid, specific and sensitive detection of nucleic-acid sequences at a constant temperature. The ET-MCDA integrated multiple cross displacement amplification strategy, restriction endonuclease cleavage and real-time fluorescence detection technique. In the ET-MCDA system, the functional cross primer E-CP1 or E-CP2 was constructed by adding a short sequence at the 5′ end of CP1 or CP2, respectively, and the new E-CP1 or E-CP2 primer was labeled at the 5′ end with a fluorophore and in the middle with a dark quencher. The restriction endonuclease Nb.BsrDI specifically recognized the short sequence and digested the newly synthesized double-stranded terminal sequences (5′ end short sequences and their complementary sequences), which released the quenching, resulting on a gain of fluorescence signal. Thus, the ET-MCDA allowed real-time detection of single or multiple targets in only a single reaction, and the positive results were observed in as short as 12 min, detecting down to 3.125 fg of genomic DNA per tube. Moreover, the analytical specificity and the practical application of the ET-MCDA were also successfully evaluated in this study. Here, we provided the details on the novel ET-MCDA technique and expounded the basic ET-MCDA amplification mechanism. PMID:27242766

  12. Purification and properties of an O-acetyl-transferase from Escherichia coli that can O-acetylate polysialic acid sequences

    Certain strains of bacteria synthesize an outer polysialic acid (K1) capsule. Some strains of K1+ E.coli are also capable of adding O-acetyl-esters to the exocyclic hydroxyl groups of the sialic acid residues. Both the capsule and the O-acetyl modification have been correlated with differences in antigenicity and pathogenicity. The authors have developed an assay for an O-acetyl-transferase in E.coli that transfers O-[3H]acetyl groups from [3H]acetyl-Coenzyme A to colominic acid (fragments of the polysialic acid capsule). Using this assay, the enzyme was solubilized, and purified ∼ 600-fold using a single affinity chromatography step with Procion Red-A Agarose. The enzyme also binds to Coenzyme A Sepharose, and can be eluted with high salt or Coenzyme A. The partially purified enzyme has a pH optimum of 7.0 - 7.5, is unaffected by divalent cations, is inhibited by high salt concentrations, is inhibited by Coenzyme A (50% inhibition at 100 μM), and shows an apparent Km for colominic acid of 3.7 mM (sialic acid concentration). This enzyme could be involved in the O-acetyl +/- form variation seen in some strains of K1+ E.coli

  13. TreeDomViewer: a tool for the visualization of phylogeny and protein domain structure

    Alako, B.T.F.; Rainey, D.; Nijveen, H.; Leunissen, J.A.M.

    2006-01-01

    Phylogenetic analysis and examination of protein domains allow accurate genome annotation and are invaluable to study proteins and protein complex evolution. However, two sequences can be homologous without sharing statistically significant amino acid or nucleotide identity, presenting a challenging bioinformatics problem. We present TreeDomViewer, a visualization tool available as a web-based interface that combines phylogenetic tree description, multiple sequence alignment and InterProScan ...

  14. Dietary structured triacylglycerols containing docosahexaenoic acid given from birth affect visual and auditory performance and tissue fatty acid profiles of rats

    Christensen, M. M.; Lund, S. P.; Simonsen, L.;

    1998-01-01

    structured oil, 22:6(n-3) was located in the sn-2 position, whereas it was equally distributed among the three positions in the triacylglycerol molecule in the randomized oil. A reference group was fed rat milk before weaning and nonpurified diet after weaning. After 12 wk, the fevers of 22:6(n-3) in brain...... and liver phospholipids were higher in the groups fed the experimental diets than in the reference group. The specific structured oil resulted in the highest level of 22:6(n-3) in the brain, whereas the level of 22:6(n-3) was highest in the liver of the group fed randomized oil, indicating differences...... the level of 22:6(n-3), in the retina phospholipids were not affected by the three different diets apart from a lower level of 20:4(n-6) in rats fed the experimental diets, indicating a strong tendency to maintain a high level of 22:6(n-3) in the retina. The changes in the fatty acid profiles did not...

  15. Amino Acid Sequence Requirements at Residues 69 and 238 for the SME-1 β-Lactamase To Confer Resistance to β-Lactam Antibiotics

    Majiduddin, Fahd K.; Palzkill, Timothy

    2003-01-01

    Carbapenem antibiotics have been used to counteract resistant strains of bacteria harboring β-lactamases and extended-spectrum β-lactamases. Four enzymes from the class A group of β-lactamases, NMC-A, IMI-1, SME-1, and KPC-1, efficiently hydrolyze carbapenem antibiotics. Sequence comparisons and structural information indicate that cysteines at amino acid residues 69 and 238, which are conserved in all four of these enzymes, form a disulfide bond that is unique to these β-lactamases. To test ...

  16. Identification and Characterization of Second-Generation Invader Locked Nucleic Acids (LNAs) for Mixed-Sequence Recognition of Double-Stranded DNA

    Sau, Sujay P; Madsen, Andreas S; Podbevsek, Peter;

    2013-01-01

    The development of synthetic agents that recognize double-stranded DNA (dsDNA) is a long-standing goal that is inspired by the promise for tools that detect, regulate, and modify genes. Progress has been made with triplex-forming oligonucleotides, peptide nucleic acids, and polyamides, but...... substantial efforts are currently devoted to the development of alternative strategies that overcome the limitations observed with the classic approaches. In 2005, we introduced Invader locked nucleic acids (LNAs), i.e., double-stranded probes that are activated for mixed-sequence recognition of dsDNA through...... monomers. We compare the thermal denaturation characteristics of double-stranded probes featuring different interstrand zippers of pyrene-functionalized monomers based on 2'-amino-α-l-LNA, 2'-N-methyl-2'-amino-DNA, and RNA scaffolds. Insights from fluorescence spectroscopy, molecular modeling, and NMR...

  17. 37 CFR 1.823 - Requirements for nucleotide and/or amino acid sequences as part of the application.

    2010-07-01

    ... with paragraph (b) of this section, must begin on a new page and must be titled “Sequence Listing.” The... shall be “DNA.” In addition, the combined DNA/RNA molecule shall be further described in the to feature..., the “Unknown” or “Artificial Sequence” organisms shall be further described in the to feature...

  18. It’s all in the past: Temporal-context effects modulate subjective evaluations of emotional visual stimuli, regardless of presentation sequence

    Czekóová, K.; Shaw, D. J.; Janoušová, E.; Urbánek, Tomáš

    2015-01-01

    Roč. 6, č. 367 (2015), s. 1-11. ISSN 1664-1078 Institutional support: RVO:68081740 Keywords : emotion * temporal context * presentation sequence * assimilation effect * contrast effect Subject RIV: AN - Psychology Impact factor: 2.560, year: 2014 http://journal.frontiersin.org/article/10.3389/fpsyg.2015.00367/full

  19. Sequence and structural features of binding site residues in protein-protein complexes: comparison with protein-nucleic acid complexes

    Selvaraj S; Jayaram B; Saranya N; Gromiha M; Fukui Kazuhiko

    2011-01-01

    Abstract Background Protein-protein interactions are important for several cellular processes. Understanding the mechanism of protein-protein recognition and predicting the binding sites in protein-protein complexes are long standing goals in molecular and computational biology. Methods We have developed an energy based approach for identifying the binding site residues in protein–protein complexes. The binding site residues have been analyzed with sequence and structure based parameters such...

  20. Draft genome sequence of extremely acidophilic bacterium Acidithiobacillus ferrooxidans DLC-5 isolated from acid mine drainage in Northeast China

    Peng Chen

    2015-12-01

    Full Text Available Acidithiobacillus ferrooxidans type strain DLC-5, isolated from Wudalianchi in Heihe of Heilongjiang Province, China. Here, we present the draft genome of strain DLC-5 which contains 4,232,149 bp in 2745 contigs with 57.628% GC content and includes 32,719 protein-coding genes and 64 tRNA-encoding genes. The genome sequence can be accessed at DDBJ/EMBL/GenBank under the accession no. JNNH00000000.1.

  1. Whole-Exome Sequencing in a South American Cohort Links ALDH1A3, FOXN1 and Retinoic Acid Regulation Pathways to Autism Spectrum Disorders.

    Moreno-Ramos, Oscar A; Olivares, Ana María; Haider, Neena B; de Autismo, Liga Colombiana; Lattig, María Claudia

    2015-01-01

    Autism spectrum disorders (ASDs) are a range of complex neurodevelopmental conditions principally characterized by dysfunctions linked to mental development. Previous studies have shown that there are more than 1000 genes likely involved in ASD, expressed mainly in brain and highly interconnected among them. We applied whole exome sequencing in Colombian-South American trios. Two missense novel SNVs were found in the same child: ALDH1A3 (RefSeq NM_000693: c.1514T>C (p.I505T)) and FOXN1 (RefSeq NM_003593: c.146C>T (p.S49L)). Gene expression studies reveal that Aldh1a3 and Foxn1 are expressed in ~E13.5 mouse embryonic brain, as well as in adult piriform cortex (PC; ~P30). Conserved Retinoic Acid Response Elements (RAREs) upstream of human ALDH1A3 and FOXN1 and in mouse Aldh1a3 and Foxn1 genes were revealed using bioinformatic approximation. Chromatin immunoprecipitation (ChIP) assay using Retinoid Acid Receptor B (Rarb) as the immunoprecipitation target suggests RA regulation of Aldh1a3 and Foxn1 in mice. Our results frame a possible link of RA regulation in brain to ASD etiology, and a feasible non-additive effect of two apparently unrelated variants in ALDH1A3 and FOXN1 recognizing that every result given by next generation sequencing should be cautiously analyzed, as it might be an incidental finding. PMID:26352270

  2. Purification, N-terminal amino acid sequence, and some properties of Cu, Zn-superoxide dismutase from Japanese flounder (Paralichthys olivaceus) hepato-pancreas.

    Osatomi, K; Masuda, Y; Hara, K; Ishihara, T

    2001-04-01

    Cu, Zn-superoxide dismutase (SOD) has been purified to homogeneity from Japanese flounder Paralichthys olivaceus hepato-pancreas. The purification of the enzyme was carried out by an ethanol/chloroform treatment and acetone precipitation, and then followed by column chromatographies on Q-Sepharose, S-Sepharose and Ultrogel AcA 54. On SDS-PAGE, the purified enzyme gave a single protein band with molecular mass of 17.8 kDa under reducing conditions, and showed approximately equal proportions of 17.8 and 36 kDa molecular mass under non-reducing conditions. Three bands were obtained when the purified enzyme was subjected to native-PAGE, both on protein and activity staining, but the electrophoretic mobility of the purified enzyme differed from that of bovine erythrocyte Cu, Zn-SOD. Isoelectric point values of 5.9, 6.0 and 6.2, respectively, were obtained for the three components. The N-terminal amino acid sequence of the purified enzyme was determined for 25 amino acid residues, and the sequence was compared with other Cu, Zn-SODs. The N-terminal alanine residue was unacetylated, as in the case of swordfish SOD. Above 60 degrees C, the thermostability of the enzyme was much lower than that of bovine Cu, Zn-SOD. PMID:11290457

  3. A single amino acid change, Q114R, in the cleavage-site sequence of Newcastle disease virus fusion protein attenuates viral replication and pathogenicity.

    Samal, Sweety; Kumar, Sachin; Khattar, Sunil K; Samal, Siba K

    2011-10-01

    A key determinant of Newcastle disease virus (NDV) virulence is the amino acid sequence at the fusion (F) protein cleavage site. The NDV F protein is synthesized as an inactive precursor, F(0), and is activated by proteolytic cleavage between amino acids 116 and 117 to produce two disulfide-linked subunits, F(1) and F(2). The consensus sequence of the F protein cleavage site of virulent [(112)(R/K)-R-Q-(R/K)-R↓F-I(118)] and avirulent [(112)(G/E)-(K/R)-Q-(G/E)-R↓L-I(118)] strains contains a conserved glutamine residue at position 114. Recently, some NDV strains from Africa and Madagascar were isolated from healthy birds and have been reported to contain five basic residues (R-R-R-K-R↓F-I/V or R-R-R-R-R↓F-I/V) at the F protein cleavage site. In this study, we have evaluated the role of this conserved glutamine residue in the replication and pathogenicity of NDV by using the moderately pathogenic Beaudette C strain and by making Q114R, K115R and I118V mutants of the F protein in this strain. Our results showed that changing the glutamine to a basic arginine residue reduced viral replication and attenuated the pathogenicity of the virus in chickens. The pathogenicity was further reduced when the isoleucine at position 118 was substituted for valine. PMID:21677091

  4. Scientific visualization and radiology

    Scientific visualization is the visual presentation of numerical data. The National Center for Supercomputing Applications (NCSA) has developed methods for visualizing computerbased simulations of digital imaging data. The applicability of these various tools for unique and potentially medical beneficial display of MR images is investigated. Raw data are obtained from MR images of the brain, neck, spine, and brachial plexus obtained on a 1.5-T imager with multiple pulse sequences. A supercomputer and other mainframe resources run a variety of graphic and imaging programs using this data. An interdisciplinary team of imaging scientists, computer graphic programmers, an physicians works together to achieve useful information

  5. CSTX-9, a toxic peptide from the spider Cupiennius salei: amino acid sequence, disulphide bridge pattern and comparison with other spider toxins containing the cystine knot structure.

    Schalle, J; Kämpfer, U; Schürch, S; Kuhn-Nentwig, L; Haeberli, S; Nentwig, W

    2001-09-01

    CSTX-9 (68 residues, 7530.9 Da) is one of the most abundant toxic polypeptides in the venom of the wandering spider Cupiennius salei. The amino acid sequence was determined by Edman degradation using reduced and alkylated CSTX-9 and peptides generated by cleavages with endoproteinase Asp-N and trypsin, respectively. Sequence comparison with CSTX-1, the most abundant and the most toxic polypeptide in the crude spider venom, revealed a high degree of similarity (53% identity). By means of limited proteolysis with immobilised trypsin and RP-HPLC, the cystine-containing peptides of CSTX-9 were isolated and the disulphide bridges were assigned by amino acid analysis, Edman degradation and nanospray tandem mass spectrometry. The four disulphide bonds present in CSTX-9 are arranged in the following pattern: 1-4, 2-5, 3-8 and 6-7 (Cys6-Cys21, Cys13-Cys30, Cys20-Cys48, Cys32-Cys46). Sequence comparison of CSTX-1 with CSTX-9 clearly indicates the same disulphide bridge pattern, which is also found in other spider polypeptide toxins, e.g. agatoxins (omega-AGA-IVA, omega-AGA-IVB, mu-AGA-I and mu-AGA-VI) from Agelenopsis aperta, SNX-325 from Segestria florentina and curtatoxins (CT-I, CT-II and CT-III) from Hololena curta. CSTX-1/CSTX-9 belong to the family of ion channel toxins containing the inhibitor cystine knot structural motif. CSTX-9, lacking the lysine-rich C-terminal tail of CSTX-1, exhibits a ninefold lower toxicity to Drosophila melanogaster than CSTX-1. This is in accordance with previous observations of CSTX-2a and CSTX-2b, two truncated forms of CSTX-1 which, like CSTX-9, also lack the C-terminal lysine-rich tail. PMID:11693532

  6. Visualizing Data Streams

    Wong, Pak C.; Foote, Harlan P.; Adams, Daniel R.; Cowley, Wendy E.; Leung, Lai R.; Thomas, James J.

    2004-12-01

    We introduce two dynamic visualization techniques using multi-dimensional scaling to analyze transient data streams such as newswires and remote sensing imagery. While the time-sensitive nature of these data streams requires immediate attention in many applications, the unpredictable and unbounded characteristics of this information can potentially overwhelm many scaling algorithms that require a full re-computation for every update. We present an adaptive visualization technique based on data stratification to ingest stream information adaptively when influx rate exceeds processing rate. We also describe an incremental visualization technique based on data fusion to project new information directly onto a visualization subspace spanned by the singular vectors of the previously processed neighboring data. The ultimate goal is to leverage the value of legacy and new information and minimize re-processing of the entire dataset in full resolution. We demonstrate these dynamic visualization results using a newswire corpus and a remote sensing imagery sequence.

  7. Complete genome sequence of Lactobacillus paracasei L9, a new probiotic strain with high lactic acid-producing capacity.

    Jiang, Yunyun; Li, Zhuanyu; Ren, Fazheng; Liu, Songling; Zhao, Liang; Sun, Erna; Zhang, Ming; Guo, Huiyuan; Zhang, Hao; Jiang, Lu; Hou, Caiyun

    2015-12-20

    Lactobaillus paracasei L9 (CGMCC No. 9800) is a new strain with probiotic properties originating from healthy human intestine. Previous studies evidenced that the strain regulates immune modulation and contributes to the production of high amounts of lactic acid. The genome of L. paracasei L9 contains a circular 3076,437-bp chromosome, encoding 3044 CDSs, 15 rRNA genes and 59 tRNA genes. PMID:26415658

  8. Acetic acid bacteria from biofilm of strawberry vinegar visualized by microscopy and detected by complementing culture-dependent and culture-independent techniques.

    Valera, Maria José; Torija, Maria Jesús; Mas, Albert; Mateo, Estibaliz

    2015-04-01

    Acetic acid bacteria (AAB) usually develop biofilm on the air-liquid interface of the vinegar elaborated by traditional method. This is the first study in which the AAB microbiota present in a biofilm of vinegar obtained by traditional method was detected by pyrosequencing. Direct genomic DNA extraction from biofilm was set up to obtain suitable quality of DNA to apply in culture-independent molecular techniques. The set of primers and TaqMan--MGB probe designed in this study to enumerate the total AAB population by Real Time--PCR detected between 8 × 10(5) and 1.2 × 10(6) cells/g in the biofilm. Pyrosequencing approach reached up to 10 AAB genera identification. The combination of culture-dependent and culture-independent molecular techniques provided a broader view of AAB microbiota from the strawberry biofilm, which was dominated by Ameyamaea, Gluconacetobacter, and Komagataeibacter genera. Culture-dependent techniques allowed isolating only one genotype, which was assigned into the Ameyamaea genus and which required more analysis for a correct species identification. Furthermore, biofilm visualization by laser confocal microscope and scanning electronic microscope showed different dispositions and cell morphologies in the strawberry vinegar biofilm compared with a grape vinegar biofilm. PMID:25475315

  9. cDNA and deduced amino acid sequence of human pulmonary surfactant-associated proteolipid SPL(Phe).

    Glasser, S W; Korfhagen, T R; Weaver, T.; Pilot-Matias, T; Fox, J L; Whitsett, J A

    1987-01-01

    Hydrophobic surfactant-associated protein of Mr 6000-14,000 was isolated from ether/ethanol or chloroform/methanol extracts of mammalian pulmonary surfactant. Automated Edman degradation in a gas-phase sequencer showed the major N-terminus of the human low molecular weight protein to be Phe-Pro-Ile-Pro-Leu-Pro-Tyr-Cys-Trp-Leu-Cys-Arg-Ala-Leu-. Because of the N-terminal phenylalanine, the surfactant protein was designated SPL(Phe). Antiserum generated against hydrophobic surfactant protein(s) ...

  10. Visual agnosia.

    Álvarez, R; Masjuan, J

    2016-03-01

    Visual agnosia is defined as an impairment of object recognition, in the absence of visual acuity or cognitive dysfunction that would explain this impairment. This condition is caused by lesions in the visual association cortex, sparing primary visual cortex. There are 2 main pathways that process visual information: the ventral stream, tasked with object recognition, and the dorsal stream, in charge of locating objects in space. Visual agnosia can therefore be divided into 2 major groups depending on which of the two streams is damaged. The aim of this article is to conduct a narrative review of the various visual agnosia syndromes, including recent developments in a number of these syndromes. PMID:26358494

  11. Identification of functionally important amino acid residues in the mitochondria targeting sequence of Hepatitis B virus X protein

    Chronic hepatitis B virus (HBV) infection has been strongly associated with hepatocellular carcinoma (HCC) and the X protein (HBx) is thought to mediate the cellular changes associated with carcinogenesis. Recently, isolation of the hepatitis B virus integrants from HCC tissue by others have established the fact that the X gene is often truncated at its C-terminus. Expression of the GFP fusion proteins of HBx and its truncation mutants with a GFP tag in human liver cell-lines in this study revealed that the C-terminus of HBx is indispensable for its specific localization in the mitochondria. A crucial region of seven amino acids at the C-terminus has been mapped out in which the cysteine residue at position 115 serves as the most important residue for the subcellular localization. When cysteine 115 of HBx is mutated to alanine the mitochondria targeting property of HBx is abrogated

  12. Flow visualization

    Merzkirch, Wolfgang

    1974-01-01

    Flow Visualization describes the most widely used methods for visualizing flows. Flow visualization evaluates certain properties of a flow field directly accessible to visual perception. Organized into five chapters, this book first presents the methods that create a visible flow pattern that could be investigated by visual inspection, such as simple dye and density-sensitive visualization methods. It then deals with the application of electron beams and streaming birefringence. Optical methods for compressible flows, hydraulic analogy, and high-speed photography are discussed in other cha

  13. High performance liquid chromatography purification and amino acid sequence of toxins from the muscarinic fraction of Tityus discrepans scorpion venom.

    D'Suze, G; Corona, F; Possani, L D; Sevcik, C

    1996-05-01

    Tityus discrepans venom was fractionated by gel filtration on Sephadex G-50 column. The peptides in fraction II from Sephadex were further purified by high performance liquid chromatography, through a C4 reverse-phase column. Lethality of purified peptides was determined by injection into mice and crabs, and their effects were verified electrophysiologically on frog (Hyla crepitans) sartorius neuromuscular junction. Toxins having retention times between 39.6 and 40.7 min depolarized the muscle membrane and caused acetylcholine release at the endplate. The toxin eluted at 42.67 min increased the frequency of miniature endplate potentials without depolarizing muscle fibres. The four most active toxins were reduced, carboxymethylated and sequenced by automatic Edman degradation and named TdII-1 to II-4. Toxin gamma from Tityus serrulatus venom and the toxins from T. discrepans venom were found to be structurally distinct. TdII-1 to II-4 lack the pancreatic effects of T. serrulatus' toxin gamma; yet, the five toxins act on Na+ channels. PMID:8783453

  14. RNA Sequencing Identifies Upregulated Kyphoscoliosis Peptidase and Phosphatidic Acid Signaling Pathways in Muscle Hypertrophy Generated by Transgenic Expression of Myostatin Propeptide

    Yuanxin Miao

    2015-04-01

    Full Text Available Myostatin (MSTN, a member of the transforming growth factor-β superfamily, plays a crucial negative role in muscle growth. MSTN mutations or inhibitions can dramatically increase muscle mass in most mammal species. Previously, we generated a transgenic mouse model of muscle hypertrophy via the transgenic expression of the MSTN N-terminal propeptide cDNA under the control of the skeletal muscle-specific MLC1 promoter. Here, we compare the mRNA profiles between transgenic mice and wild-type littermate controls with a high-throughput RNA sequencing method. The results show that 132 genes were significantly differentially expressed between transgenic mice and wild-type control mice; 97 of these genes were up-regulated, and 35 genes were down-regulated in the skeletal muscle. Several genes that had not been reported to be involved in muscle hypertrophy were identified, including up-regulated myosin binding protein H (mybph, and zinc metallopeptidase STE24 (Zmpste24. In addition, kyphoscoliosis peptidase (Ky, which plays a vital role in muscle growth, was also up-regulated in the transgenic mice. Interestingly, a pathway analysis based on grouping the differentially expressed genes uncovered that cardiomyopathy-related pathways and phosphatidic acid (PA pathways (Dgki, Dgkz, Plcd4 were up-regulated. Increased PA signaling may increase mTOR signaling, resulting in skeletal muscle growth. The findings of the RNA sequencing analysis help to understand the molecular mechanisms of muscle hypertrophy caused by MSTN inhibition.

  15. RNA sequencing identifies upregulated kyphoscoliosis peptidase and phosphatidic acid signaling pathways in muscle hypertrophy generated by transgenic expression of myostatin propeptide.

    Miao, Yuanxin; Yang, Jinzeng; Xu, Zhong; Jing, Lu; Zhao, Shuhong; Li, Xinyun

    2015-01-01

    Myostatin (MSTN), a member of the transforming growth factor-β superfamily, plays a crucial negative role in muscle growth. MSTN mutations or inhibitions can dramatically increase muscle mass in most mammal species. Previously, we generated a transgenic mouse model of muscle hypertrophy via the transgenic expression of the MSTN N-terminal propeptide cDNA under the control of the skeletal muscle-specific MLC1 promoter. Here, we compare the mRNA profiles between transgenic mice and wild-type littermate controls with a high-throughput RNA sequencing method. The results show that 132 genes were significantly differentially expressed between transgenic mice and wild-type control mice; 97 of these genes were up-regulated, and 35 genes were down-regulated in the skeletal muscle. Several genes that had not been reported to be involved in muscle hypertrophy were identified, including up-regulated myosin binding protein H (mybph), and zinc metallopeptidase STE24 (Zmpste24). In addition, kyphoscoliosis peptidase (Ky), which plays a vital role in muscle growth, was also up-regulated in the transgenic mice. Interestingly, a pathway analysis based on grouping the differentially expressed genes uncovered that cardiomyopathy-related pathways and phosphatidic acid (PA) pathways (Dgki, Dgkz, Plcd4) were up-regulated. Increased PA signaling may increase mTOR signaling, resulting in skeletal muscle growth. The findings of the RNA sequencing analysis help to understand the molecular mechanisms of muscle hypertrophy caused by MSTN inhibition. PMID:25860951

  16. Uses of Phage Display in Agriculture: Sequence Analysis and Comparative Modeling of Late Embryogenesis Abundant Client Proteins Suggest Protein-Nucleic Acid Binding Functionality

    Rekha Kushwaha

    2013-01-01

    Full Text Available A group of intrinsically disordered, hydrophilic proteins—Late Embryogenesis Abundant (LEA proteins—has been linked to survival in plants and animals in periods of stress, putatively through safeguarding enzymatic function and prevention of aggregation in times of dehydration/heat. Yet despite decades of effort, the molecular-level mechanisms defining this protective function remain unknown. A recent effort to understand LEA functionality began with the unique application of phage display, wherein phage display and biopanning over recombinant Seed Maturation Protein homologs from Arabidopsis thaliana and Glycine max were used to retrieve client proteins at two different temperatures, with one intended to represent heat stress. From this previous study, we identified 21 client proteins for which clones were recovered, sometimes repeatedly. Here, we use sequence analysis and homology modeling of the client proteins to ascertain common sequence and structural properties that may contribute to binding affinity with the protective LEA protein. Our methods uncover what appears to be a predilection for protein-nucleic acid interactions among LEA client proteins, which is suggestive of subcellular residence. The results from this initial computational study will guide future efforts to uncover the protein protective mechanisms during heat stress, potentially leading to phage-display-directed evolution of synthetic LEA molecules.

  17. Evaluation of crop residues on potassium kinetics in an acid soil and potassium use efficiency in potato-garlic sequence using tracer 86Rb

    Greenhouse and laboratory studies were conducted on an acid soil in order to evaluate the role of two crop residues i.e. paddy and wheat along with farmyard manure on potassium kinetics and its availability in the potato-garlic sequence using tracer 86Rb. Under rapid equilibrium, application of crop residues of paddy, wheat straw and FYM were able to enhance soil pH and organic carbon content. In addition, their application helped in enhancing soil K availability indices like water soluble, available and non-exchangeable -K. This was further augmented by the Q/I studies using 86Rb where application of organic residues helped in lowering the potassium buffering capacity of the soil. Greenhouse study supplemented the results obtained from laboratory study where application of crop residues/FYM were able to improve the potato yield significantly and maintained higher concentration of K in potato leaf at early growth stages. A significant correlation was obtained between leaf K and haulms-K with that of 86Rb activities in potato leaf at 35 days and 86Rb absorbed in the haulms, respectively. Residues/ FYM and PK application to potato left sufficient residual effect on succeeding garlic crop. In potato-garlic sequence, K recovery was highest with FYM while N and P recoveries were higher with wheat residues. The nutrient recoveries with PK application followed law of diminishing returns. (author)

  18. Biochemical characterization of NfsA, the Escherichia coli major nitroreductase exhibiting a high amino acid sequence homology to Frp, a Vibrio harveyi flavin oxidoreductase.

    Zenno, S; Koike, H; Kumar, A N; Jayaraman, R; Tanokura, M; Saigo, K

    1996-01-01

    We identified the nfsA gene, encoding the major oxygen-insensitive nitroreductase in Escherichia coli, and determined its position on the E. coli map to be 19 min. We also purified its gene product, NfsA, to homogeneity. It was suggested that NfsA is a nonglobular protein with a molecular weight of 26,799 and is associated tightly with a flavin mononucleotide. Its amino acid sequence is highly similar to that of Frp, a flavin oxidoreductase from Vibrio harveyi (B. Lei, M. Liu, S. Huang, and S.-C. Tu, J. Bacteriol. 176:3552-3558, 1994), an observation supporting the notion that E. coli nitroreductase and luminescent-bacterium flavin reductase families are intimately related in evolution. Although no appreciable sequence similarity was detected between two E. coli nitroreductases, NfsA and NfsB, NfsA exhibited a low level of the flavin reductase activity and a broad electron acceptor specificity similar to those of NfsB. NfsA reduced nitrofurazone by a ping-pong Bi-Bi mechanism possibly to generate a two-electron transfer product. PMID:8755878

  19. Identification and sequence analysis of pWcMBF8-1, a bacteriocin-encoding plasmid from the lactic acid bacterium Weissella confusa.

    Malik, Amarila; Sumayyah, Sumayyah; Yeh, Chia-Wen; Heng, Nicholas C K

    2016-04-01

    Members of the Gram-positive lactic acid bacteria (LAB) are well-known for their beneficial properties as starter cultures and probiotics. Many LAB species produce ribosomally synthesized proteinaceous antibiotics (bacteriocins). Weissella confusa MBF8-1 is a strain isolated from a fermented soybean product that not only produces useful exopolysaccharides but also exhibits bacteriocin activity, which we call weissellicin MBF. Here, we show that bacteriocin production by W. confusa MBF8-1 is specified by a large plasmid, pWcMBF8-1. Plasmid pWcMBF8-1 (GenBank accession number KR350502), which was identified from the W. confusa MBF8-1 draft genome sequence, is 17 643 bp in length with a G + C content of 34.8% and contains 25 open reading frames (ORFs). Six ORFs constitute the weissellicin MBF locus, encoding three putative double-glycine-motif peptides (Bac1, Bac2, Bac3), an ABC transporter complex (BacTE) and a putative immunity protein (BacI). Two ORFs encode plasmid partitioning and mobilization proteins, suggesting that pWcMBF8-1 is transferable to other hosts. To the best of our knowledge, plasmid pWcMBF8-1 not only represents the first large Weissella plasmid to be sequenced but also the first to be associated with bacteriocin production in W. confusa. PMID:26976853

  20. Visual inspection with acetic acid (via screening program: 7 years experience in early detection of cervical cancer and pre-cancers in rural South India

    Usha Rani Poli

    2015-01-01

    Full Text Available Cervical cancer continues to be a major public health problem in India in the absence of wide spread organised cervical screening programs. Visual inspection of the cervix with acetic acid (VIA is an effective, inexpensive screening test that can be combined with simple treatment procedures for early cervical lesions, provided by trained health workers. We report 7 years experience in early detection of cervical cancer and pre-cancers using the VIA test in a community-based program in rural Andhra Pradesh, India where there are no existing organised cervical screening programs. Materials and Methods: Eligible women aged between 26 and 60 were opportunistically screened by trained health wor kers using the VIA test. Women who tested positive were further evaluated and those with cervical lesions were treated either by cryotherapy in the screening clinic or referred to a higher center. Results: A total of 18,869 women were screened by a single round of VIA testing with a positive rate of 10.75%. Biopsy proven high-grade squamous intraepithelials (HSILs were 90 (0.48% and low-grade squamous intraepithelials (LSILs were 43 (0.28%. The overall prevalence of cervical intraepithelial neoplasia (CIN 2+ lesion rate is 1.05%. A total of 312 (1.65% cryotherapies were done and 49 women underwent hysterectomy. Conclusions: VIA by trained female health workers is a safe, acceptable, and effective test that can save lives from cervical cancer even in remote areas with few resources. These results have important implications for efficient service delivery in cervical screening programs in low-resourced settings.

  1. Study to assess the acceptability and feasibility of cervical cancer screening using visual inspection with acetic acid and treatment of precancerous lesions using cryotherapy in low resource settings

    Tosha M. Sheth

    2014-06-01

    Full Text Available Background: Objective of current study was to assess the acceptability and feasibility of cervical cancer screening using VIA, and treatment of precancerous lesions using cryotherapy in low resource settings Methods: 526 women from three primary health centers of Shinor taluka (population based approach and 250 women of Medical College, Vadodara (facility based approach were sensitized and screened for cervical cancer. Visual Inspection with Acetic acid (VIA was performed as the screening test. In the population based approach, VIA positive women were referred to a Community Health Centre (CHC for colposcopy and biopsy. Ablative treatment in the form of cryotherapy was offered. Patients requiring higher forms of treatment were referred to medical college, Vadodara. In the facility based approach, VIA positive women underwent colposcopy. Guided biopsy was performed in those with positive lesions on colposcopy. Cryotherapy was offered in the same sitting. Those not suitable for cryotherapy were offered loop electrosurgical excision procedure. Women found to have invasive cancer were offered definitive management. Results: VIA positivity rate was 18.8% in the population based approach and 27.2% in the facility based approach.58.8% women in the population based approach and 77.77% women in the facility based approach were treated with cryotherapy on the same day as screening and none reported any severe side effects. Dropout rate in the community approach was 32.32% whereas in the facility it was 0.4%. Conclusions: VIA and cryotherapy procedures were well tolerated by all screened women. This project has shown that the and ldquo;screen and treat and rdquo; approach can be successfully implemented in the existing health setup. [Int J Reprod Contracept Obstet Gynecol 2014; 3(3.000: 615-621

  2. Implementation of cervical cancer screening using visual inspection with acetic acid in rural Mozambique: successes and challenges using HIV care and treatment programme investments in Zambézia Province

    Baptista, Alberto J; Mohsin Sidat; Troy D Moon; Sten H Vermund; Aventina Cordoso; Carla Silva-Matos

    2012-01-01

    Background: In order to maximize the benefits of HIV care and treatment investments in sub-Saharan Africa, programs can broaden to target other diseases amenable to screening and efficient management. We nested cervical cancer screening into family planning clinics at select sites also receiving PEPFAR support for antiretroviral therapy (ART) rollout. This was done using visual inspection with acetic acid (VIA) by maternal child health nurses. We report on achievements and obstacles in the fi...

  3. Amino acid sequence requirements in the hinge of human immunoglobulin A1 (IgA1) for cleavage by streptococcal IgA1 proteases

    Batten, MR; Senior, BW; Kilian, Mogens;

    2003-01-01

    effect upon sensitivity to cleavage with some streptococcal IgA1 proteases, with, in some cases, a single point mutation rendering the antibody resistant to a particular IgA1 protease. This effect was least marked with the IgA1 protease from Streptococcus pneumoniae, which showed no absolute requirement......The amino acid sequence requirements in the hinge of human immunoglobulin A1 (IgA1) for cleavage by IgA1 proteases of different species of Streptococcus were investigated. Recombinant IgA1 antibodies were generated with point mutations at proline 227 and threonine 228, the residues lying on either...... side of the peptide bond at which all streptococcal IgA1 proteases cleave wild-type human IgA1. The amino acid substitutions produced no major effect upon the structure of the mutant IgA1 antibodies or their functional ability to bind to Fcalpha receptors. However, the substitutions had a substantial...

  4. cDNA and deduced amino acid sequence of human pulmonary surfactant-associated proteolipid SPL(Phe)

    Hydrophobic surfactant-associated protein of M/sub r/ 6000-14,000 was isolated from either/ethanol or chloroform/methanol extracts of mammalian pulmonary surfactant. Automated Edman degradation in a gas-phase sequencer showed the major N-terminus of the human low molecular weight protein to be Phe-Pro-Ile-Pro-Leu-Pro-Try-Cys-Trp-Leu-Cys-Arg-Ala-Leu-. Because of the N-terminal phenylalanine, the surfactant protein was designated SPL(Phe). Antiserum generated against hydrophobic surfactant protein(s) from bovine pulmonary surfactant recognized protein of M/sub r/ 6000-14,000 in immunoblot analysis and was used to screen a λgt11 expression library constructed from adult human lung poly(A)+ RNA. This resulted in identification of a 1.4-kilobase cDNA clone that was shown to encode the N-terminus of the surfactant polypeptide SPL(Phe) (Phe-Pro-Ile-Pro-Leu-Pro-) within an open reading frame for a larger protein. Expression of a fused β-galactosidase-SPL (Phe) gene in Escherichia coli yielded an immunoreactive M/sub r/ 34,000 fusion peptide. Hybrid-arrested translation with the cDNA and immunoprecipitation of [35S]methionine-labeled in vitro translation products of human poly(A)+ RNA with a surfactant polyclonal antibody resulted in identification of a M/sub r/ 40,000 precursor protein. Blot hybridization analysis of electrophoretically fractionated RNA from human lung detected a 2.0-kilobase RNA that was more abundant in adult lung than in fetal lung. These proteins, and specifically SPL(Phe), may therefore be useful for synthesis of replacement surfactants for treatment of hyaline membrane disease in newborn infants or of other surfactant-deficient states

  5. cDNA and deduced amino acid sequence of human pulmonary surfactant-associated proteolipid SPL(Phe)

    Glasser, S.W.; Korfhagen, T.R.; Weaver, T.; Pilot-Matias, T.; Fox, J.L.; Whitsett, J.A.

    1987-06-01

    Hydrophobic surfactant-associated protein of M/sub r/ 6000-14,000 was isolated from either/ethanol or chloroform/methanol extracts of mammalian pulmonary surfactant. Automated Edman degradation in a gas-phase sequencer showed the major N-terminus of the human low molecular weight protein to be Phe-Pro-Ile-Pro-Leu-Pro-Try-Cys-Trp-Leu-Cys-Arg-Ala-Leu-. Because of the N-terminal phenylalanine, the surfactant protein was designated SPL(Phe). Antiserum generated against hydrophobic surfactant protein(s) from bovine pulmonary surfactant recognized protein of M/sub r/ 6000-14,000 in immunoblot analysis and was used to screen a lambdagt11 expression library constructed from adult human lung poly(A)/sup +/ RNA. This resulted in identification of a 1.4-kilobase cDNA clone that was shown to encode the N-terminus of the surfactant polypeptide SPL(Phe) (Phe-Pro-Ile-Pro-Leu-Pro-) within an open reading frame for a larger protein. Expression of a fused ..beta..-galactosidase-SPL (Phe) gene in Escherichia coli yielded an immunoreactive M/sub r/ 34,000 fusion peptide. Hybrid-arrested translation with the cDNA and immunoprecipitation of (/sup 35/S)methionine-labeled in vitro translation products of human poly(A)/sup +/ RNA with a surfactant polyclonal antibody resulted in identification of a M/sub r/ 40,000 precursor protein. Blot hybridization analysis of electrophoretically fractionated RNA from human lung detected a 2.0-kilobase RNA that was more abundant in adult lung than in fetal lung. These proteins, and specifically SPL(Phe), may therefore be useful for synthesis of replacement surfactants for treatment of hyaline membrane disease in newborn infants or of other surfactant-deficient states.

  6. Amino acid sequence requirements in the hinge of human immunoglobulin A1 (IgA1) for cleavage by streptococcal IgA1 proteases.

    Batten, Margaret R; Senior, Bernard W; Kilian, Mogens; Woof, Jenny M

    2003-03-01

    The amino acid sequence requirements in the hinge of human immunoglobulin A1 (IgA1) for cleavage by IgA1 proteases of different species of Streptococcus were investigated. Recombinant IgA1 antibodies were generated with point mutations at proline 227 and threonine 228, the residues lying on either side of the peptide bond at which all streptococcal IgA1 proteases cleave wild-type human IgA1. The amino acid substitutions produced no major effect upon the structure of the mutant IgA1 antibodies or their functional ability to bind to Fcalpha receptors. However, the substitutions had a substantial effect upon sensitivity to cleavage with some streptococcal IgA1 proteases, with, in some cases, a single point mutation rendering the antibody resistant to a particular IgA1 protease. This effect was least marked with the IgA1 protease from Streptococcus pneumoniae, which showed no absolute requirement for either proline or threonine at residues 227 to 228. By contrast, the IgA1 proteases of Streptococcus oralis, Streptococcus sanguis, and Streptococcus mitis had an absolute requirement for proline at 227 but not for threonine at 228, which could be replaced by valine. There was evidence in S. mitis that proteases from different strains may have different amino acid requirements for cleavage. Remarkably, some streptococcal proteases appeared able to cleave the hinge at a distant alternative site if substitution prevented efficient cleavage of the original site. Hence, this study has identified key residues required for the recognition of the IgA1 hinge as a substrate by streptococcal IgA1 proteases, and it marks a preliminary step towards development of specific enzyme inhibitors. PMID:12595464

  7. Absence in Bacillus subtilis and Staphylococcus aureus of the sequence-specific deoxyribonucleic acid methylation that is conferred in Escherichia coli K-12 by the dam and dcm enzymes.

    Dreiseikelmann, Brigitte; Wackernagel, Wilfried

    1981-01-01

    Restriction analysis of plasmid pHV14 deoxyribonucleic acid isolated from Escherichia coli K-12, Bacillus subtilis, and Staphylococcus aureus with restriction endonucleases MboI, Sau3AI, and EcoRII was used to study the methylation of those nucleotide sequences which in E. coli contain the major portions of N6-methyladenine and 5-methylcytosine. The results showed that neither B. subtilis nor S. aureus methylates deoxyribonucleic acid at the same sites and nucleotides which are recognized and...

  8. Data visualization

    Azzam, Tarek

    2013-01-01

    Do you communicate data and information to stakeholders? In Part 1, we introduce recent developments in the quantitative and qualitative data visualization field and provide a historical perspective on data visualization, its potential role in evaluation practice, and future directions. Part 2 delivers concrete suggestions for optimally using data visualization in evaluation, as well as suggestions for best practices in data visualization design. It focuses on specific quantitative and qualitative data visualization approaches that include data dashboards, graphic recording, and geographic information systems (GIS). Readers will get a step-by-step process for designing an effective data dashboard system for programs and organizations, and various suggestions to improve their utility.

  9. Visual imagery without visual perception?

    Helder Bértolo

    2005-01-01

    The question regarding visual imagery and visual perception remain an open issue. Many studies have tried to understand if the two processes share the same mechanisms or if they are independent, using different neural substrates. Most research has been directed towards the need of activation of primary visual areas during imagery. Here we review some of the works providing evidence for both claims. It seems that studying visual imagery in blind subjects can be us...

  10. Visual Language in Visual Communication

    Jia Wang

    2009-01-01

    In visual communication the design information is mainly communicated by visual language, the correct use of which is the standard of evaluation of a graphic design composition. Therefore it is necessary to understand and percept visual language properly. It will be helpful for viewers to percept the desired information from the designer as well as the significance within the work.

  11. Sequence ID and annotation information - Gclust Server | LSDB Archive [Life Science Database Archive metadata

    Full Text Available Number of data entries - Data item Description Field 1 ID of amino acid sequence (Sequence ID) Field... 2 Length of amino acid sequence Field 3 Annotation of amino acid sequence Joomla SEF URL

  12. Amino Acid Residues in the GIY-YIG Endonuclease II of Phage T4 Affecting Sequence Recognition and Binding as Well as Catalysis▿ †

    Lagerbäck, Pernilla; Carlson, Karin

    2008-01-01

    Phage T4 endonuclease II (EndoII), a GIY-YIG endonuclease lacking a carboxy-terminal DNA-binding domain, was subjected to site-directed mutagenesis to investigate roles of individual amino acids in substrate recognition, binding, and catalysis. The structure of EndoII was modeled on that of UvrC. We found catalytic roles for residues in the putative catalytic surface (G49, R57, E118, and N130) similar to those described for I-TevI and UvrC; in addition, these residues were found to be important for substrate recognition and binding. The conserved glycine (G49) and arginine (R57) were essential for normal sequence recognition. Our results are in agreement with a role for these residues in forming the DNA-binding surface and exposing the substrate scissile bond at the active site. The conserved asparagine (N130) and an adjacent proline (P127) likely contribute to positioning the catalytic domain correctly. Enzymes in the EndoII subfamily of GIY-YIG endonucleases share a strongly conserved middle region (MR, residues 72 to 93, likely helical and possibly substituting for heterologous helices in I-TevI and UvrC) and a less strongly conserved N-terminal region (residues 12 to 24). Most of the conserved residues in these two regions appeared to contribute to binding strength without affecting the mode of substrate binding at the catalytic surface. EndoII K76, part of a conserved NUMOD3 DNA-binding motif of homing endonucleases found to overlap the MR, affected both sequence recognition and catalysis, suggesting a more direct involvement in positioning the substrate. Our data thus suggest roles for the MR and residues conserved in GIY-YIG enzymes in recognizing and binding the substrate. PMID:18539732

  13. Amino acid residues in the GIY-YIG endonuclease II of phage T4 affecting sequence recognition and binding as well as catalysis.

    Lagerbäck, Pernilla; Carlson, Karin

    2008-08-01

    Phage T4 endonuclease II (EndoII), a GIY-YIG endonuclease lacking a carboxy-terminal DNA-binding domain, was subjected to site-directed mutagenesis to investigate roles of individual amino acids in substrate recognition, binding, and catalysis. The structure of EndoII was modeled on that of UvrC. We found catalytic roles for residues in the putative catalytic surface (G49, R57, E118, and N130) similar to those described for I-TevI and UvrC; in addition, these residues were found to be important for substrate recognition and binding. The conserved glycine (G49) and arginine (R57) were essential for normal sequence recognition. Our results are in agreement with a role for these residues in forming the DNA-binding surface and exposing the substrate scissile bond at the active site. The conserved asparagine (N130) and an adjacent proline (P127) likely contribute to positioning the catalytic domain correctly. Enzymes in the EndoII subfamily of GIY-YIG endonucleases share a strongly conserved middle region (MR, residues 72 to 93, likely helical and possibly substituting for heterologous helices in I-TevI and UvrC) and a less strongly conserved N-terminal region (residues 12 to 24). Most of the conserved residues in these two regions appeared to contribute to binding strength without affecting the mode of substrate binding at the catalytic surface. EndoII K76, part of a conserved NUMOD3 DNA-binding motif of homing endonucleases found to overlap the MR, affected both sequence recognition and catalysis, suggesting a more direct involvement in positioning the substrate. Our data thus suggest roles for the MR and residues conserved in GIY-YIG enzymes in recognizing and binding the substrate. PMID:18539732

  14. Effects of chain length of an amphipathic polypeptide carrying the repeated amino acid sequence (LETLAKA)(n) on α-helix and fibrous assembly formation.

    Takei, Toshiaki; Hasegawa, Kazuya; Imada, Katsumi; Namba, Keiichi; Tsumoto, Kouhei; Kuriki, Yukino; Yoshino, Masakuni; Yazaki, Kazumori; Kojima, Shuichi; Takei, Tsunetomo; Ueda, Takuya; Miura, Kin-ichiro

    2013-04-23

    Polypeptide α3 (21 residues), with three repeats of a seven-amino-acid sequence (LETLAKA)(3), forms an amphipathic α-helix and a long fibrous assembly. Here, we investigated the ability of α3-series polypeptides (with 14-42 residues) of various chain lengths to form α-helices and fibrous assemblies. Polypeptide α2 (14 residues), with two same-sequence repeats, did not form an α-helix, but polypeptide α2L (15 residues; α2 with one additional leucine residue on its carboxyl terminal) did form an α-helix and fibrous assembly. Fibrous assembly formation was associated with polypeptides at least as long as polypeptide α2L and with five leucine residues, indicating that the C-terminal leucine has a critical element for stabilization of α-helix and fibril formation. In contrast, polypeptides α5 (35 residues) and α6 (42 residues) aggregated easily, although they formed α-helices. A 15-35-residue chain was required for fibrous assembly formation. Electron microscopy and X-ray fiber diffraction showed that the thinnest fibrous assemblies of polypeptides were about 20 Å and had periodicities coincident with the length of the α-helix in a longitudinal direction. These results indicated that the α-helix structures were orientated along the fibrous axis and assembled into a bundle. Furthermore, the width and length of fibrous assemblies changed with changes in the pH value, resulting in variations in the charged states of the residues. Our results suggest that the formation of fibrous assemblies of amphipathic α-helices is due to the assembly of bundles via the hydrophobic faces of the helices and extension with hydrophobic noncovalent bonds containing a leucine. PMID:23530905

  15. Manipulating and Visualizing Proteins

    Simon, Horst D.

    2003-12-05

    ProteinShop Gives Researchers a Hands-On Tool for Manipulating, Visualizing Protein Structures. The Human Genome Project and other biological research efforts are creating an avalanche of new data about the chemical makeup and genetic codes of living organisms. But in order to make sense of this raw data, researchers need software tools which let them explore and model data in a more intuitive fashion. With this in mind, researchers at Lawrence Berkeley National Laboratory and the University of California, Davis, have developed ProteinShop, a visualization and modeling program which allows researchers to manipulate protein structures with pinpoint control, guided in large part by their own biological and experimental instincts. Biologists have spent the last half century trying to unravel the ''protein folding problem,'' which refers to the way chains of amino acids physically fold themselves into three-dimensional proteins. This final shape, which resembles a crumpled ribbon or piece of origami, is what determines how the protein functions and translates genetic information. Understanding and modeling this geometrically complex formation is no easy matter. ProteinShop takes a given sequence of amino acids and uses visualization guides to help generate predictions about the secondary structures, identifying alpha helices and flat beta strands, and the coil regions that bind them. Once secondary structures are in place, researchers can twist and turn these pre-configurations until they come up with a number of possible tertiary structure conformations. In turn, these are fed into a computationally intensive optimization procedure that tries to find the final, three-dimensional protein structure. Most importantly, ProteinShop allows users to add human knowledge and intuition to the protein structure prediction process, thus bypassing bad configurations that would otherwise be fruitless for optimization. This saves compute cycles and accelerates

  16. Visual imagery without visual perception?

    Helder Bértolo

    2005-01-01

    Full Text Available The question regarding visual imagery and visual perception remain an open issue. Many studies have tried to understand if the two processes share the same mechanisms or if they are independent, using different neural substrates. Most research has been directed towards the need of activation of primary visual areas during imagery. Here we review some of the works providing evidence for both claims. It seems that studying visual imagery in blind subjects can be used as a way of answering some of those questions, namely if it is possible to have visual imagery without visual perception. We present results from the work of our group using visual activation in dreams and its relation with EEG’s spectral components, showing that congenitally blind have visual contents in their dreams and are able to draw them; furthermore their Visual Activation Index is negatively correlated with EEG alpha power. This study supports the hypothesis that it is possible to have visual imagery without visual experience.

  17. Detection of Aspergillus fumigatus in a rat model of invasive pulmonary aspergillosis by real-time nucleic acid sequence-based amplification.

    Zhao, Yanan; Park, Steven; Warn, Peter; Shrief, Raghdaa; Harrison, Elizabeth; Perlin, David S

    2010-04-01

    Rapid and sensitive detection of Aspergillus from clinical samples may facilitate the early diagnosis of invasive pulmonary aspergillosis (IPA). A real-time nucleic acid sequence-based amplification (NASBA) method was investigated by use of an inhalational rat model of IPA. Immunosuppressed male Sprague-Dawley rats were exposed to Aspergillus fumigatus spores for an hour in an aerosol chamber. Bronchoalveolar lavage (BAL) fluid, lung tissues, and whole blood were collected from five infected rats at 1, 24, 48, 72, and 96 h postinfection and five uninfected rats at the end of the experiment. Total nucleic acid (TNA) was extracted on an easyMAG instrument. A primer-molecular beacon set targeting 28S rRNA was designed to detect Aspergillus spp. The results were compared to those of quantitative PCR (qPCR) (18S rDNA) and quantitative culture. The analytical sensitivity of the real-time NASBA assay was tissue burdens, while the CFU counts were stable over time. The fungal burdens in BAL fluid were more variable and not indicative of a progressive infection. The results of both real-time assays correlated well for both sample types (r = 0.869 and P tissue, r = 0.887 and P < 0.0001 for BAL fluid). For all whole-blood specimens, NASBA identified Aspergillus-positive samples in the group from which samples were collected at 72 h postinfection (three of five samples) and the group from which samples were collected at 96 h postinfection (five of five samples), but no positive results were obtained by culture or PCR. Real-time NASBA is highly sensitive and useful for the detection of Aspergillus in an experimental model of IPA. PMID:20129972

  18. Genome Sequences of the High-Acetic Acid-Resistant Bacteria Gluconacetobacter europaeus LMG 18890T and G. europaeus LMG 18494 (Reference Strains), G. europaeus 5P3, and Gluconacetobacter oboediens 174Bp2 (Isolated from Vinegar) ▿

    Andrés-Barrao, Cristina; Falquet, Laurent; Sandra P Calderon-Copete; Descombes, Patrick; Ortega Pérez, Ruben; Barja, François

    2011-01-01

    Bacteria of the genus Gluconacetobacter are usually involved in the industrial production of vinegars with high acetic acid concentrations. We describe here the genome sequence of three Gluconacetobacter europaeus strains, a very common bacterial species from industrial fermentors, as well as of a Gluconacetobacter oboediens strain.

  19. Visualization Laboratory

    Federal Laboratory Consortium — FUNCTION: Evaluates and improves the operational effectiveness of existing and emerging electronic warfare systems. By analyzing and visualizing simulation results...

  20. Traffic Visualization

    Picozzi, Matteo; Verdezoto, Nervo; Pouke, Matti;

    2013-01-01

    In this paper, we present a space-time visualization to provide city's decision-makers the ability to analyse and uncover important "city events" in an understandable manner for city planning activities. An interactive Web mashup visualization is presented that integrates several visualization...... techniques to give a rapid overview of traffic data. We illustrate our approach as a case study for traffic visualization systems, using datasets from the city of Oulu that can be extended to other city planning activities. We also report the feedback of real users (traffic management employees, traffic police...

  1. Identification of the phosphorylation sites in early region 1A proteins of adenovirus type 5 by amino acid sequencing of peptide fragments

    Tremblay, M.L.; McGlade, C.J.; Gerber, G.E.; Branton, P.E.

    1988-05-05

    The authors have mapped the positions of three of the phosphorylation sites on the 289 and 243 residue (289R and 243R) early region 1A (E1A) proteins of human adenovirus type 5 (Ad5). These proteins, which play roles in both transcriptional control and oncogenic transformation, have identical sequences except for the presence in 289R of 46 additional internal amino acids. Phosphorylation was detected exclusively at serine residues. E1A proteins purified from (/sup 35/S)methionine- or (/sup 32/P)orthophosphate-labeled Ad5-infected cells were digested with trypsin, and two phosphopeptides were isolated by reverse-phase chromatography and subjected to automated Edman degradation. The major species was shown to contain a single phosphorylation site at Ser-219. The second phosphopeptide was shown to contain at least one phosphorylation site at Ser-231. A third phosphorylated tryptic peptide could not be eluted from the column but was isolated using an E1A-specific rat monoclonal antibody. Following subcleavage by Staphylococcus aureus V-8 protease, this peptide was shown to contain at least one phosphorylation site at Ser-89. The present data indicate that both the 289R and 243R E1A proteins are phosphorylated at the same sites, at least one in the amino terminal half of the molecule, and at least two toward the carboxyl terminus.

  2. Identification of the phosphorylation sites in early region 1A proteins of adenovirus type 5 by amino acid sequencing of peptide fragments

    The authors have mapped the positions of three of the phosphorylation sites on the 289 and 243 residue (289R and 243R) early region 1A (E1A) proteins of human adenovirus type 5 (Ad5). These proteins, which play roles in both transcriptional control and oncogenic transformation, have identical sequences except for the presence in 289R of 46 additional internal amino acids. Phosphorylation was detected exclusively at serine residues. E1A proteins purified from [35S]methionine- or [32P]orthophosphate-labeled Ad5-infected cells were digested with trypsin, and two phosphopeptides were isolated by reverse-phase chromatography and subjected to automated Edman degradation. The major species was shown to contain a single phosphorylation site at Ser-219. The second phosphopeptide was shown to contain at least one phosphorylation site at Ser-231. A third phosphorylated tryptic peptide could not be eluted from the column but was isolated using an E1A-specific rat monoclonal antibody. Following subcleavage by Staphylococcus aureus V-8 protease, this peptide was shown to contain at least one phosphorylation site at Ser-89. The present data indicate that both the 289R and 243R E1A proteins are phosphorylated at the same sites, at least one in the amino terminal half of the molecule, and at least two toward the carboxyl terminus

  3. Triplex formation at single-stranded nucleic acid target sites of unrestricted sequence by two added strands of oligonucleotides: A proposed model

    Trapane, T.L.; Ts' o, P.O.P. (John Hopkins Univ., Baltimore, MD (United States))

    1994-11-16

    By using the standard purine nucleosides, guanosine and adenosine, and the pyrimidine C-nucleosides, pseudoisocytidine and pseudouridine, as complements on a probe strand, it is possible to construct a regular Watson-Crick helix with a single-stranded target sequence having any arrangement of the four naturally-occurring bases found in nucleic acids. The major groove of this helix will have a unique configuration of hydrogen-bonding sites on the probe strand for each of these four base pairs. By using this duplex as a framework, an ensemble of recognition patterns composed of base triads may be constructed. In these patterns, either a homopyrimidine or homopurine third strand binds in the major groove of the duplex formed by the target and probe strands. Ten distinct geometries, or motifs, are shown, each one consisting of four isomorphic base triads built upon recognition of C, G, A, or U(T) residues in the target strand. In order to maintain specific hydrogen bonding and to construct isomorphous triads, the use of several nonstandard bases is proposed. 33 refs., 9 figs., 3 tabs.

  4. Indole acetic acid production by fluorescent Pseudomonas spp. from the rhizosphere of Plectranthus amboinicus (Lour.) Spreng. and their variation in extragenic repetitive DNA sequences.

    Sethia, Bedhya; Mustafa, Mariam; Manohar, Sneha; Patil, Savita V; Jayamohan, Nellickal Subramanian; Kumudini, Belur Satyan

    2015-06-01

    Fluorescent Pseudomonas (FP) is a heterogenous group of growth promoting rhizobacteria that regulate plant growth by releasing secondary metabolic compounds viz., indole acetic acid (IAA), siderophores, ammonia and hydrogen cyanide. In the present study, IAA producing FPs from the rhizosphere of Plectranthus amboinicus were characterized morphologically, biochemically and at the molecular level. Molecular identification of the isolates were carried out using Pseudomonas specific primers. The effect of varying time (24, 48, 72 and 96 h), Trp concentrations (100, 200, 300, 400 and 500 μg x ml(-1)), temperature (10, 26, 37 and 50 ± 2 degrees C) and pH (6, 7 and 8) on IAA production by 10 best isolates were studied. Results showed higher IAA production at 72 h incubation, at 300 μg x ml(-1) Trp concentration, temperature 26 ± 2 degrees C and pH 7. TLC with acidified ethyl acetate extract showed that the IAA produced has a similar Rf value to that of the standard IAA. Results of TLC were confirmed by HPLC analysis. Genetic diversity of the isolates was also studied using 40 RAPD and 4 Rep primers. Genetic diversity parameters such as dominance, Shannon index and Simpson index were calculated. Out of 40 RAPD primers tested, 9 (2 OP-D series and 7 OP-E series) were shortlisted for further analysis. Studies using RAPD, ERIC, BOX, REP and GTG5 primers revealed that isolates exhibit significant diversity in repetitive DNA sequences irrespective of the rhizosphere. PMID:26155673

  5. PhTX-II a Basic Myotoxic Phospholipase A2 from Porthidium hyoprora Snake Venom, Pharmacological Characterization and Amino Acid Sequence by Mass Spectrometry

    Salomón Huancahuire-Vega

    2014-10-01

    Full Text Available A monomeric basic PLA2 (PhTX-II of 14149.08 Da molecular weight was purified to homogeneity from Porthidium hyoprora venom. Amino acid sequence by in tandem mass spectrometry revealed that PhTX-II belongs to Asp49 PLA2 enzyme class and displays conserved domains as the catalytic network, Ca2+-binding loop and the hydrophobic channel of access to the catalytic site, reflected in the high catalytic activity displayed by the enzyme. Moreover, PhTX-II PLA2 showed an allosteric behavior and its enzymatic activity was dependent on Ca2+. Examination of PhTX-II PLA2 by CD spectroscopy indicated a high content of alpha-helical structures, similar to the known structure of secreted phospholipase IIA group suggesting a similar folding. PhTX-II PLA2 causes neuromuscular blockade in avian neuromuscular preparations with a significant direct action on skeletal muscle function, as well as, induced local edema and myotoxicity, in mice. The treatment of PhTX-II by BPB resulted in complete loss of their catalytic activity that was accompanied by loss of their edematogenic effect. On the other hand, enzymatic activity of PhTX-II contributes to this neuromuscular blockade and local myotoxicity is dependent not only on enzymatic activity. These results show that PhTX-II is a myotoxic Asp49 PLA2 that contributes with toxic actions caused by P. hyoprora venom.

  6. Towards Dense Visual SLAM

    Pietzsch, Tobias

    2011-01-01

    Visual Simultaneous Localisation and Mapping (SLAM) is concerned with simultaneously estimating the pose of a camera and a map of the environment from a sequence of images. Traditionally, sparse maps comprising isolated point features have been employed, which facilitate robust localisation but are not well suited to advanced applications. In this thesis, we present map representations that allow a more dense description of the environment. In one approach, planar features are used to repr...

  7. Visual art and visual perception

    Koenderink, Jan J.

    2015-01-01

    Visual art and visual perception ‘Visual art’ has become a minor cul-de-sac orthogonal to THE ART of the museum directors and billionaire collectors. THE ART is conceptual, instead of visual. Among its cherished items are the tins of artist’s shit (Piero Manzoni, 1961, Merda d’Artista) “worth their weight in gold”. I perceive a metabletic (van den Berg, 1956) parallel to philosophy transforming itself into speculative logic games, and psychology going cognitive by freeing itself from phenomen...

  8. Visual Education

    Buhl, Mie; Flensborg, Ingelise

    2010-01-01

    The intrinsic breadth of various types of images creates new possibilities and challenges for visual education. The digital media have moved the boundaries between images and other kinds of modalities (e.g. writing, speech and sound) and have augmented the possibilities for integrating...... the learning potential of images and visuality from two perspectives: 1) The perspective of digital media which are assumed to form an increasing part of experience and communication from the use of internet, tv and mobile devices. 2) The perspective of culture where images and visualisations are assumed...... to emerge in the interlocutory space of a global visual repertoire and diverse local interpretations. The two perspectives represent challenges for future visual education which require visual competences, not only within the arts but also within the subjects of natural sciences, social sciences, languages...

  9. Quantitative thermodynamic predication of interactions between nucleic acid and non-nucleic acid species using Microsoft excel.

    Zou, Jiaqi; Li, Na

    2013-09-01

    Proper design of nucleic acid sequences is crucial for many applications. We have previously established a thermodynamics-based quantitative model to help design aptamer-based nucleic acid probes by predicting equilibrium concentrations of all interacting species. To facilitate customization of this thermodynamic model for different applications, here we present a generic and easy-to-use platform to implement the algorithm of the model with Microsoft(®) Excel formulas and VBA (Visual Basic for Applications) macros. Two Excel spreadsheets have been developed: one for the applications involving only nucleic acid species, the other for the applications involving both nucleic acid and non-nucleic acid species. The spreadsheets take the nucleic acid sequences and the initial concentrations of all species as input, guide the user to retrieve the necessary thermodynamic constants, and finally calculate equilibrium concentrations for all species in various bound and unbound conformations. The validity of both spreadsheets has been verified by comparing the modeling results with the experimental results on nucleic acid sequences reported in the literature. This Excel-based platform described here will allow biomedical researchers to rationalize the sequence design of nucleic acid probes using the thermodynamics-based modeling even without relevant theoretical and computational skills. PMID:23849929

  10. A unique insertion of low complexity amino acid sequence underlies protein-protein interaction in human malaria parasite orotate phosphoribosyltransferase and orotidine 5'-monophosphate decarboxylase

    Waranya Imprasittichai; Sittiruk Roytrakul; Sudaratana R Krungkrai; Jerapan Krungkrai

    2014-01-01

    Objective:To investigate the multienzyme complex formation of human malaria parasite Plasmodium falciparum(P. falciparum) orotate phosphoribosyltransferase(OPRT) and orotidine 5'-monophosphate decarboxylase(OMPDC), the fifth and sixth enzyme of the de novo pyrimidine biosynthetic pathway.Previously, we have clearly established that the two enzymes in the malaria parasite exist physically as a heterotetrameric(OPRT)2(OMPDC)2 complex containing two subunits each ofOPRT andOMPDC, and that the complex have catalytic kinetic advantages over the monofunctional enzyme.Methods:Both enzymes were cloned and expressed as recombinant proteins.The protein-protein interaction in the enzyme complex was identified using bifunctional chemical cross-linker, liquid chromatography-mass spectrometric analysis and homology modeling.Results:The unique insertions of low complexity region at the α2 and α5 helices of the parasiteOMPDC, characterized by single amino acid repeat sequence which was not found in homologous proteins from other organisms, was located on theOPRT-OMPDC interface.The structural models for the protein-protein interaction of the heterotetrameric(OPRT)2(OMPDC)2 multienzyme complex were proposed.Conclusions:Based on the proteomic data and structural modeling, it is surmised that the human malaria parasite low complexity region is responsible for theOPRT-OMPDC interaction.The structural complex of the parasite enzymes, thus, represents an efficient functional kinetic advantage, which in line with co-localization principles of evolutional origin, and allosteric control in protein-protein-interactions.

  11. Cloning of NruI and Sbo13I restriction and modification sstems in E. coli and amino acid sequence comparison of M.NruI and M.Sbo13I with other amino-methyltransferases

    Benner Jack

    2010-05-01

    Full Text Available Abstract Background NruI and Sbo13I are restriction enzyme isoschizomers with the same recognition sequence 5' TCG↓CGA 3' (cleavage as indicated↓. Here we report the cloning of NruI and Sbo13I restriction-modification (R-M systems in E. coli. The NruI restriction endonuclease gene (nruIR was cloned by PCR and inverse PCR using primers designed from the N-terminal amino acid sequence. The NruI methylase gene (nruIM was derived by inverse PCR walking. Results The amino acid sequences of NruI endonuclease and methylase are very similar to the Sbo13I R-M system which has been cloned and expressed in E. coli by phage selection of a plasmid DNA library. Dot blot analysis using rabbit polyclonal antibodies to N6mA- or N4mC-modified DNA indicated that M.NruI is possibly a N6mA-type amino-methyltransferase that most likely modifies the external A in the 5' TCGCGA 3' sequence. M.Sbo13I, however, is implicated as a probable N4mC-type methylase since plasmid carrying sbo13IM gene is not restricted by Mrr endonuclease and Sbo13I digestion is not blocked by Dam methylation of the overlapping site. The amino acid sequence of M.NruI and M.Sbo13I did not show significant sequence similarity to many known amino-methyltransferases in the α, β, and γ groups, except to a few putative methylases in sequenced microbial genomes. Conclusions The order of the conserved amino acid motifs (blocks in M.NruI/M.Sbo13I is similar to the γ. group amino-methyltranferases, but with two distinct features: In motif IV, the sequence is DPPY instead of NPPY; there are two additional conserved motifs, IVa and Xa as extension of motifs IV and X, in this family of enzymes. We propose that M.NruI and M.Sbo13I form a subgroup in the γ group of amino-methyltransferases.

  12. Treatability of cheese whey for single-cell protein production in nonsterile systems: Part I. Optimal condition for lactic acid fermentation using a microaerobic sequencing batch reactor (microaerobic SBR) with immobilized Lactobacillus plantarum TISTR 2265 and microbial communities.

    Monkoondee, Sarawut; Kuntiya, Ampin; Chaiyaso, Thanongsak; Leksawasdi, Noppol; Techapun, Charin; Kawee-Ai, Arthitaya; Seesuriyachan, Phisit

    2016-05-18

    Cheese whey contains a high organic content and causes serious problems if it is released into the environment when untreated. This study aimed to investigate the optimum condition of lactic acid production using the microaerobic sequencing batch reactor (microaerobic SBR) in a nonsterile system. The high production of lactic acid was achieved by immobilized Lactobacillus plantarum TISTR 2265 to generate an acidic pH condition below 4.5 and then to support single-cell protein (SCP) production in the second aerobic sequencing batch reactor (aerobic SBR). A hydraulic retention time (HRT) of 4 days and a whey concentration of 80% feeding gave a high lactic acid yield of 12.58 g/L, chemical oxygen demand (COD) removal of 62.38%, and lactose utilization of 61.54%. The microbial communities in the nonsterile system were dominated by members of lactic acid bacteria, and it was shown that the inoculum remained in the system up to 330 days. PMID:26178366

  13. Visual Impairment

    ... poorly lit spaces, and colors that seem faded. Diabetic retinopathy (pronounced: reh-ton-AH-pa-thee) occurs when ... that is likely to cause visual impairment, many treatments are available. Options may include eyeglasses, contact lenses, ...

  14. Visual cognition

    Pinker, S.

    1985-01-01

    This book consists of essays covering issues in visual cognition presenting experimental techniques from cognitive psychology, methods of modeling cognitive processes on computers from artificial intelligence, and methods of studying brain organization from neuropsychology. Topics considered include: parts of recognition; visual routines; upward direction; mental rotation, and discrimination of left and right turns in maps; individual differences in mental imagery, computational analysis and the neurological basis of mental imagery: componental analysis.

  15. Loop Sequence Context Influences the Formation and Stability of the i-Motif for DNA Oligomers of Sequence (CCCXXX)4, where X = A and/or T, under Slightly Acidic Conditions.

    McKim, Mikeal; Buxton, Alexander; Johnson, Courtney; Metz, Amanda; Sheardy, Richard D

    2016-08-11

    The structure and stability of DNA is highly dependent upon the sequence context of the bases (A, G, C, and T) and the environment under which the DNA is prepared (e.g., buffer, temperature, pH, ionic strength). Understanding the factors that influence structure and stability of the i-motif conformation can lead to the design of DNA sequences with highly tunable properties. We have been investigating the influence of pH and temperature on the conformations and stabilities for all permutations of the DNA sequence (CCCXXX)4, where X = A and/or T, using spectroscopic approaches. All oligomers undergo transitions from single-stranded structures at pH 7.0 to i-motif conformations at pH 5.0 as evidenced by circular dichroism (CD) studies. These folded structures possess stacked C:CH(+) base pairs joined by loops of 5'-XXX-3'. Although the pH at the midpoint of the transition (pHmp) varies slightly with loop sequence, the linkage between pH and log K for the proton induced transition is highly loop sequence dependent. All oligomers also undergo the thermally induced i-motif to single-strand transition at pH 5.0 as the temperature is increased from 25 to 95 °C. The temperature at the midpoint of this transition (Tm) is also highly dependent on loop sequence context effects. For seven of eight possible permutations, the pH induced, and thermally induced transitions appear to be highly cooperative and two state. Analysis of the CD optical melting profiles via a van't Hoff approach reveals sequence-dependent thermodynamic parameters for the unfolding as well. Together, these data reveal that the i-motif conformation exhibits exquisite sensitivity to loop sequence context with respect to formation and stability. PMID:27438583

  16. Cleavage of nucleic acids

    Prudent, James R. (Madison, WI); Hall, Jeff G. (Madison, WI); Lyamichev, Victor L. (Madison, WI); Brow, Mary Ann D. (Madison, WI); Dahlberg, James E. (Madison, WI)

    2007-12-11

    The present invention relates to means for the detection and characterization of nucleic acid sequences, as well as variations in nucleic acid sequences. The present invention also relates to methods for forming a nucleic acid cleavage structure on a target sequence and cleaving the nucleic acid cleavage structure in a site-specific manner. The structure-specific nuclease activity of a variety of enzymes is used to cleave the target-dependent cleavage structure, thereby indicating the presence of specific nucleic acid sequences or specific variations thereof.

  17. Cleavage of nucleic acids

    Prudent, James R. (Madison, WI); Hall, Jeff G. (Waunakee, WI); Lyamichev, Victor I. (Madison, WI); Brow; Mary Ann D. (Madison, WI); Dahlberg, James E. (Madison, WI)

    2010-11-09

    The present invention relates to means for the detection and characterization of nucleic acid sequences, as well as variations in nucleic acid sequences. The present invention also relates to methods for forming a nucleic acid cleavage structure on a target sequence and cleaving the nucleic acid cleavage structure in a site-specific manner. The structure-specific nuclease activity of a variety of enzymes is used to cleave the target-dependent cleavage structure, thereby indicating the presence of specific nucleic acid sequences or specific variations thereof.

  18. Nucleic acid detection compositions

    Prudent, James R. (Madison, WI); Hall, Jeff G. (Madison, WI); Lyamichev, Victor I. (Madison, WI); Brow, Mary Ann (Madison, WI); Dahlberg, James L. (Madison, WI)

    2008-08-05

    The present invention relates to means for the detection and characterization of nucleic acid sequences, as well as variations in nucleic acid sequences. The present invention also relates to methods for forming a nucleic acid cleavage structure on a target sequence and cleaving the nucleic acid cleavage structure in a site-specific manner. The structure-specific nuclease activity of a variety of enzymes is used to cleave the target-dependent cleavage structure, thereby indicating the presence of specific nucleic acid sequences or specific variations thereof.

  19. Nucleic acid detection assays

    Prudent, James R.; Hall, Jeff G.; Lyamichev, Victor I.; Brow, Mary Ann; Dahlberg, James E.

    2005-04-05

    The present invention relates to means for the detection and characterization of nucleic acid sequences, as well as variations in nucleic acid sequences. The present invention also relates to methods for forming a nucleic acid cleavage structure on a target sequence and cleaving the nucleic acid cleavage structure in a site-specific manner. The structure-specific nuclease activity of a variety of enzymes is used to cleave the target-dependent cleavage structure, thereby indicating the presence of specific nucleic acid sequences or specific variations thereof.

  20. Cleavage of nucleic acids

    Prudent, James R.; Hall, Jeff G.; Lyamichev, Victor I.; Brow, Mary Ann D.; Dahlberg, James E.

    2000-01-01

    The present invention relates to means for the detection and characterization of nucleic acid sequences, as well as variations in nucleic acid sequences. The present invention also relates to methods for forming a nucleic acid cleavage structure on a target sequence and cleaving the nucleic acid cleavage structure in a site-specific manner. The structure-specific nuclease activity of a variety of enzymes is used to cleave the target-dependent cleavage structure, thereby indicating the presence of specific nucleic acid sequences or specific variations thereof.

  1. Molecular cloning of the α-subunit of human prolyl 4-hydroxylase: The complete cDNA-derived amino acid sequence and evidence for alternative splicing of RNA transcripts

    Prolyl 4-hydroxylase an α2β2 tetramer, catalyzes the formation of 4-hydroxyproline in collagens by the hydroxylation of proline residues in peptide linkages. The authors report here on the isolation of cDNA clones encoding the α-subunit of the enzyme from human tumor HT-1080, placenta, and fibroblast cDNA libraries. Eight overlapping clones covering almost all of the corresponding 3,000-nucleotide mRNA, including all the coding sequences, were characterized. These clones encode a polypeptide of 517 amino acid residues and a signal peptide of 17 amino acids. Previous characterization of cDNA clones for the β-subunit of prolyl 4-hydroxylase has indicated that its C terminus has the amino acid sequence Lys-Asp-Gly-Leu, which, it has been suggested, is necessary for the retention of a polypeptide within the lumen of the endoplasmic reticulum. The α-subunit does not have this C-terminal sequence, and thus one function of the β-subunit in the prolyl 4-hydroxylase tetramer appears to be to retain the enzyme within this cell organelle. Southern blot analyses of human genomic DNA with a cDNA probe for the α-subunit suggested the presence of only one gene encoding the two types of mRNA, which appear to result from mutually exclusive alternative splicing of primary transcripts of one gene

  2. Visual comparison for information visualization

    Gleicher, M.

    2011-09-07

    Data analysis often involves the comparison of complex objects. With the ever increasing amounts and complexity of data, the demand for systems to help with these comparisons is also growing. Increasingly, information visualization tools support such comparisons explicitly, beyond simply allowing a viewer to examine each object individually. In this paper, we argue that the design of information visualizations of complex objects can, and should, be studied in general, that is independently of what those objects are. As a first step in developing this general understanding of comparison, we propose a general taxonomy of visual designs for comparison that groups designs into three basic categories, which can be combined. To clarify the taxonomy and validate its completeness, we provide a survey of work in information visualization related to comparison. Although we find a great diversity of systems and approaches, we see that all designs are assembled from the building blocks of juxtaposition, superposition and explicit encodings. This initial exploration shows the power of our model, and suggests future challenges in developing a general understanding of comparative visualization and facilitating the development of more comparative visualization tools. © The Author(s) 2011.

  3. Sequence-specific nucleic acid mobility using a reversible block copolymer gel matrix and DNA amphiphiles (lipid-DNA) in capillary and microfluidic electrophoretic separations

    Wagler, Patrick; Minero, Gabriel Antonio S.; Tangen, Uwe; de Vries, Jan Willem; Prusty, Deepak; Kwak, Minseok; Herrmann, Andreas; McCaskill, John S.

    2015-01-01

    Reversible noncovalent but sequence-dependent attachment of DNA to gels is shown to allow programmable mobility processing of DNA populations. The covalent attachment of DNA oligomers to polyacrylamide gels using acrydite-modified oligonucleotides has enabled sequence-specific mobility assays for DN

  4. Visual cognition

    Pinker, S.

    1985-01-01

    This collection of research papers on visual cognition first appeared as a special issue of Cognition: International Journal of Cognitive Science. The study of visual cognition has seen enormous progress in the past decade, bringing important advances in our understanding of shape perception, visual imagery, and mental maps. Many of these discoveries are the result of converging investigations in different areas, such as cognitive and perceptual psychology, artificial intelligence, and neuropsychology. This volume is intended to highlight a sample of work at the cutting edge of this research area for the benefit of students and researchers in a variety of disciplines. The tutorial introduction that begins the volume is designed to help the nonspecialist reader bridge the gap between the contemporary research reported here and earlier textbook introductions or literature reviews.

  5. Visualizing Transformation

    Pedersen, Pia

    2012-01-01

    Transformation, defined as the step of extracting, arranging and simplifying data into visual form (M. Neurath, 1974), was developed in connection with ISOTYPE (International System Of TYpographic Picture Education) and might well be the most important legacy of Isotype to the field of graphic...... design. Recently transformation has attracted renewed interest because of the book ‘The Transformer’ written by Robin Kinross and Marie Neurath. My on-going research project, summarized in this paper, identifies and depicts the essential principles of data visualization underlying the process of...... transformation with reference to Marie Neurath’s sketches on the Bilston Project. The material has been collected at the Otto and Marie Neurath Collection housed at the University of Reading, UK. By using data visualization as a research method to look directly into the process of transformation the project...

  6. The gene clone and sequence analysis of FAD2 from different erucic acid content rapeseed lines%不同芥酸含量油菜品系FAD2基因克隆测序分析

    陈光尧; 王国槐; 张振乾; 官春云; 陈社员

    2011-01-01

    对高芥酸品系M13、60Coy辐照得到的高芥酸油菜突变体H27和低芥酸品系742的FAD2基因克隆并测序.结果发现,FAD2基因存在两个拷贝FAD2.1(1155bp)、FAD2.2(1140bp).H27的FAD2.1与M13序列相同.但FAD2.2核苷酸序列中M13在409位点A(腺嘌呤)变成了T(鸟嘌呤),导致密码子由AGA变换为TGA(终止密码子),使H27中的FAD2.2基因的功能丧失,这可能是芥酸含量的提高原因.%In order to better understand the molecular mechanism of erucic acid mutation, the FAD2 genes of high erucic acid M13 strain, high-erucic acid rapeseed mutant H27 by 60Coγ irradiation and low erucic acid strain 742 were sequenced by our laboratory. The results showed that there were two copies of FAD2 gene FAD2. 1 ( 1155bp) , FAD2. 2 (1140bp) .Compared with the FAD2. 1 and FAD2. 2 gene sequences of H27 and M13 , both of them had the same FAD2. 1 nucleotide sequence and the different FAD2. 2 nucleotide sequence. The FAD2. 2 nucleotide sequence of M13 in the 409 point A ( adenine) was replaced by T ( guanine) in H27 , then the AGA codon transformed into TGA ( stop codon) , which resulted in FAD2. 2 gene some function loss. It might be the reason why H27 had higher erucic acid content than M13.

  7. Automatic sequences

    Haeseler, Friedrich

    2003-01-01

    Automatic sequences are sequences which are produced by a finite automaton. Although they are not random they may look as being random. They are complicated, in the sense of not being not ultimately periodic, they may look rather complicated, in the sense that it may not be easy to name the rule by which the sequence is generated, however there exists a rule which generates the sequence. The concept automatic sequences has special applications in algebra, number theory, finite automata and formal languages, combinatorics on words. The text deals with different aspects of automatic sequences, in particular:· a general introduction to automatic sequences· the basic (combinatorial) properties of automatic sequences· the algebraic approach to automatic sequences· geometric objects related to automatic sequences.

  8. Detecting species-site dependencies in large multiple sequence alignments

    Schwarz, Roland; Seibel, Philipp N; Rahmann, Sven; Schoen, Christoph; Huenerberg, Mirja; Müller-Reible, Clemens; Dandekar, Thomas; Karchin, Rachel; Schultz, Jörg; Müller, Tobias

    2009-01-01

    Multiple sequence alignments (MSAs) are one of the most important sources of information in sequence analysis. Many methods have been proposed to detect, extract and visualize their most significant properties. To the same extent that site-specific methods like sequence logos successfully visualize site conservations and sequence-based methods like clustering approaches detect relationships between sequences, both types of methods fail at revealing informational elements of MSAs at the level ...

  9. Draft Genome Sequences of 19 Salmonella enterica Serovar Typhimurium [4,5:i:−] Strains Resistant to Nalidixic Acid from a Long-Term Outbreak in Italy

    Orsini, Massimiliano; Mangone, Iolanda; DiPasquale, Adriano; Perticara, Samuel; Sacchini, Lorena; Cito, Francesca; Iannetti, Simona; Marcacci, Maurilia; Ancora, Massimo; Calistri, Paolo; Di Giannatale, Elisabetta; Cammà, Cesare

    2015-01-01

    Here, we present the draft genome sequences of 19 Salmonella enterica serovar Typhimurium monophasic variant [4,5:i:−] strains involved in a long-term salmonellosis outbreak that occurred in central Italy in 2013 to 2014.

  10. Detection of Differences in the Nucleotide and Amino Acid Sequences of Diphtheria Toxin from Corynebacterium diphtheriae and Corynebacterium ulcerans Causing Extrapharyngeal Infections

    Sing, Andreas; Hogardt, Michael; Bierschenk, Suse; Heesemann, Jürgen

    2003-01-01

    While Corynebacterium ulcerans can mimic classical diphtheria, extrapharyngeal infections are extremely rare. Sequencing of the diphtheria toxin (DT)-encoding tox gene of two C. ulcerans isolates from extrapharyngeal infections revealed differences from C. diphtheriae DT sequences, mainly in the translocation and receptor-binding domains. C. ulcerans supernatants were much less potent than supernatant from C. diphtheriae. A C. ulcerans DT-specific PCR is described below.

  11. Functional analysis of sequences adjacent to dapE of Corynebacterium glutamicum reveals the presence of aroP, which encodes the aromatic amino acid transporter.

    Wehrmann, A; Morakkabati, S; Krämer, R; Sahm, H; Eggeling, L

    1995-01-01

    An initially nonclonable DNA locus close to a gene of L-lysine biosynthesis in Corynebacterium glutamicum was analyzed in detail. Its stepwise cloning and its functional identification by monitoring the amino acid uptakes of defined mutants, together with mechanistic studies, identified the corresponding structure as aroP, the general aromatic amino acid uptake system.

  12. Screening of transgenic proteins expressed in transgenic food crops for the presence of short amino acid sequences identical to potential, IgE – binding linear epitopes of allergens

    Peijnenburg Ad ACM

    2002-12-01

    Full Text Available Abstract Background Transgenic proteins expressed by genetically modified food crops are evaluated for their potential allergenic properties prior to marketing, among others by identification of short identical amino acid sequences that occur both in the transgenic protein and allergenic proteins. A strategy is proposed, in which the positive outcomes of the sequence comparison with a minimal length of six amino acids are further screened for the presence of potential linear IgE-epitopes. This double track approach involves the use of literature data on IgE-epitopes and an antigenicity prediction algorithm. Results Thirty-three transgenic proteins have been screened for identities of at least six contiguous amino acids shared with allergenic proteins. Twenty-two transgenic proteins showed positive results of six- or seven-contiguous amino acids length. Only a limited number of identical stretches shared by transgenic proteins (papaya ringspot virus coat protein, acetolactate synthase GH50, and glyphosate oxidoreductase and allergenic proteins could be identified as (part of potential linear epitopes. Conclusion Many transgenic proteins have identical stretches of six or seven amino acids in common with allergenic proteins. Most identical stretches are likely to be false positives. As shown in this study, identical stretches can be further screened for relevance by comparison with linear IgE-binding epitopes described in literature. In the absence of literature data on epitopes, antigenicity prediction by computer aids to select potential antibody binding sites that will need verification of IgE binding by sera binding tests. Finally, the positive outcomes of this approach warrant further clinical testing for potential allergenicity.

  13. Inhibition of the visual cycle in vivo by 13-cis retinoic acid protects from light damage and provides a mechanism for night blindness in isotretinoin therapy

    Sieving, Paul A.; Chaudhry, Prem; Kondo, Mineo; Provenzano, Matthew; Wu, David; Carlson, Thomas J.; Bush, Ronald A.; Thompson, Debra A.

    2001-01-01

    Isotretinoin (13-cis retinoic acid) is frequently prescribed for severe acne [Peck, G. L., Olsen, T. G., Yoder, F. W., Strauss, J. S., Downing, D. T., Pandya, M., Butkus, D. & Arnaud-Battandier, J. (1979) N. Engl. J. Med. 300, 329–333] but can impair night vision [Fraunfelder, F. T., LaBraico, J. M. & Meyer, S. M. (1985) Am. J. Ophthalmol. 100, 534–537] shortly after the beginning of therapy [Shulman, S. R. (1989) Am. J. Public Health 79, 1565–1568]. As rod ...

  14. Local amino acid sequence patterns dominate the heterogeneous phenotype for the collagen connective tissue disease Osteogenesis Imperfecta resulting from Gly mutations.

    Xiao, Jianxi; Yang, Zhangfu; Sun, Xiuxia; Addabbo, Rayna; Baum, Jean

    2015-10-01

    Osteogenesis Imperfecta (OI), a hereditary connective tissue disease in collagen that arises from a single Gly → X mutation in the collagen chain, varies widely in phenotype from perinatal lethal to mild. It is unclear why there is such a large variation in the severity of the disease considering the repeating (Gly-X-Y)n sequence and the uniform rod-like structure of collagen. We systematically evaluate the effect of local (Gly-X-Y)n sequence around the mutation site on OI phenotype using integrated bio-statistical approaches, including odds ratio analysis and decision tree modeling. We show that different Gly → X mutations have different local sequence patterns that are correlated with lethal and nonlethal phenotypes providing a mechanism for understanding the sensitivity of local context in defining lethal and non-lethal OI. A number of important trends about which factors are related to OI phenotypes are revealed by the bio-statistical analyses; most striking is the complementary relationship between the placement of Pro residues and small residues and their correlation to OI phenotype. When Pro is present or small flexible residues are absent nearby a mutation site, the OI case tends to be lethal; when Pro is present or small flexible residues are absent further away from the mutation site, the OI case tends to be nonlethal. The analysis also reveals the dominant role of local sequence around mutation sites in the Major Ligand Binding Regions that are primarily responsible for collagen binding to its receptors and shows that non-lethal mutations are highly predicted by local sequence considerations alone whereas lethal mutations are not as easily predicted and may be a result of more complex interactions. Understanding the sequence determinants of OI mutations will enhance genetic counseling and help establish which steps in the collagen hierarchy to target for drug therapy. PMID:25980613

  15. 13C hyperpolarization of a barbituric acid derivative via parahydrogen induced polarization

    Roth, Meike; Koch, Achim; Kindervater, Petra; Bargon, Joachim; Spiess, Hans Wolfgang; Münnemann, Kerstin

    2010-05-01

    Significant 13C NMR signal enhancement by a factor of 5000 of a barbituric acid derivative (5-methyl-5-propenyl-barbituric acid) via parahydrogen induced polarization is presented. This hyperpolarization is achieved by hydrogenating 5-methyl-5-propargyl-barbituric acid with 98% enriched para-H 2 under elevated temperature and pressure and transferring the initially created 1H hyperpolarization with an INEPT-derived pulse sequence to 13C. The polarization can be selectively transferred to different carbons in the barbituric acid derivative by applying different pulse delays in the INEPT pulse sequence. These results demonstrate the potential of using hyperpolarized barbituric acid derivatives as " active" contrast agents in MRI and visualizing their pharmacokinetics in vivo.

  16. (13)C hyperpolarization of a barbituric acid derivative via parahydrogen induced polarization.

    Roth, Meike; Koch, Achim; Kindervater, Petra; Bargon, Joachim; Spiess, Hans Wolfgang; Münnemann, Kerstin

    2010-05-01

    Significant (13)C NMR signal enhancement by a factor of 5000 of a barbituric acid derivative (5-methyl-5-propenyl-barbituric acid) via parahydrogen induced polarization is presented. This hyperpolarization is achieved by hydrogenating 5-methyl-5-propargyl-barbituric acid with 98% enriched para-H(2) under elevated temperature and pressure and transferring the initially created (1)H hyperpolarization with an INEPT-derived pulse sequence to (13)C. The polarization can be selectively transferred to different carbons in the barbituric acid derivative by applying different pulse delays in the INEPT pulse sequence. These results demonstrate the potential of using hyperpolarized barbituric acid derivatives as "active" contrast agents in MRI and visualizing their pharmacokinetics in vivo. PMID:20207180

  17. Development of Electrochemical Biosensorfor Sequence-Specific Deoxyribonucleic Acid%特定序列脱氧核糖核酸电化学生物传感器进展

    杨丽菊; 彭图治

    2001-01-01

    对当今电分析化学中的研究热点之一——脱氧核糖核酸(DNA)的电化学生物传感技术的最新进展进行了综述,评述了其发展前景。%This is a review of electrochemical biosensor for sequence-specific deoxyribonucleic acid (DNA) with 51 references. Resent Progress in designation of the sensor, immobilization of DNA, indicator of hybridizatio, applications and some new concepts of the sensor are discussed in detail.

  18. Nucleotide and Amino Acid Sequences of oriT-traM-traJ-traY-traA-traL Regions and Mobilization of Virulence Plasmids of Salmonella enterica Serovars Enteritidis, Gallinarum-Pullorum, and Typhimurium

    Chu, Chishih; Chiu, Cheng-Hsun; Chu, Chi-Hong; Ou, Jonathan T.

    2002-01-01

    The virulence plasmid of Salmonella enterica serovar Gallinarum-Pullorum (pSPV) but not those of Salmonella enterica serovars Enteritidis (pSEV) and Typhimurium (pSTV) can be readily mobilized by an F or F-like conjugative plasmid. To investigate the reason for the difference, the oriT-traM-traJ-traY-traA-traL regions of the three salmonella virulence plasmids (pSVs) were cloned and their nucleotide and deduced amino acid sequences were examined. The cloned fragments were generally mobilized ...

  19. DNA sequencing: chemical methods

    Limited base-specific or base-selective cleavage of a defined DNA fragment yields polynucleotide products, the length of which correlates with the positions of the particular base (or bases) in the original fragment. Sverdlov and co-workers recognized the possibility of using this principle for the determination of DNA sequences. In 1977 a fully elaborated method was introduced based on this principle, which allowed routine analysis of DNA sequences over distances greater than 100 nucleotide unite from a defined, radiolabeled terminus. Six procedures for partial cleavage were described. Simultaneous parallel resolution of an appropriate set of partial cleavage mixtures by polyacrylamide gel electrophoresis, followed by visualization of the radioactive bands by autoradiography, allows the deduction of nucleotide sequence

  20. Genome Sequence of "Candidatus Microthrix parvicella" Bio17-1, a Long-Chain-Fatty-Acid-Accumulating Filamentous Actinobacterium from a Biological Wastewater Treatment Plant

    Muller, Emilie; Pinel, Nicolás; Gillece, John D.; Schupp, James M.; Lance B Price; Engelthaler, David M.; Levantesi, Caterina; Tandoi, Valter; Luong, Kkai; Baliga, Nitin S.; Korlach, Jonas; Keim, Paul S.; Wilmes, Paul

    2012-01-01

    “Candidatus Microthrix” bacteria are deeply branching filamentous actinobacteria which occur at the water-air interface of biological wastewater treatment plants, where they are often responsible for foaming and bulking. Here, we report the first draft genome sequence of a strain from this genus: “Candidatus Microthrix parvicella” strain Bio17-1.

  1. Studies on deoxyribonucleic acids and related compounds. V. Synthesis of pentadecanucleotide duplex containing the ideal Pribnow sequence of promoter by the phosphotriester method using a new phosphorylating reagent.

    Ohtsuka, E; Taniyama, Y; Marumoto, R; Sato, H.; Hirosaki, H; Ikehara, M

    1982-01-01

    A phosphorylating reagent o-chlorophenyl phosphoro-p-anisi-dochloridate was synthesized to phosphorylate the 3'-hydroxyl group of N, 5'-protected deoxynucleosides. These nucleotides served as 3'-terminal units for the synthesis of oligonucleotide blocks. By condensation of these oligonucleotide blocks the partially complementary deoxypentadecanucleotides dAGCTTATAATGC-TCG and dAGCTCGAGCATTATA, which contained the ideal Pribnow sequence TATAATG, were synthesized.

  2. Nucleic acid detection kits

    Hall, Jeff G.; Lyamichev, Victor I.; Mast, Andrea L.; Brow, Mary Ann; Kwiatkowski, Robert W.; Vavra, Stephanie H.

    2005-03-29

    The present invention relates to means for the detection and characterization of nucleic acid sequences, as well as variations in nucleic acid sequences. The present invention also relates to methods for forming a nucleic acid cleavage structure on a target sequence and cleaving the nucleic acid cleavage structure in a site-specific manner. The structure-specific nuclease activity of a variety of enzymes is used to cleave the target-dependent cleavage structure, thereby indicating the presence of specific nucleic acid sequences or specific variations thereof. The present invention further relates to methods and devices for the separation of nucleic acid molecules based on charge. The present invention also provides methods for the detection of non-target cleavage products via the formation of a complete and activated protein binding region. The invention further provides sensitive and specific methods for the detection of nucleic acid from various viruses in a sample.

  3. Sequence diversity and functional conformity

    de Lange, Orlando

    2015-01-01

    At least four phylogenetically distinct groups of bacteria encode repeat proteins with the common ability to bind specific DNA sequences with a unique but conserved code. Each repeat binds a single DNA base, and specificity is determined by the amino acid residue at position 13 of each repeat. Repeats are typically 33-35 amino acids long. Comparing repeat sequences across all groups reveals that only three positions are hyper-conserved. Repeats are in most cases functionally compatible such t...

  4. Comparative statistics for DNA and protein sequences: multiple sequence analysis.

    Karlin, S.; Ghandour, G

    1985-01-01

    Concepts and methods [Karlin, S. & Ghandour, G. (1985) Proc. Natl. Acad. Sci. USA 82, 5800-5804] for the analysis of patterns and relationships are extended to multiple DNA and protein sequences. Functionals include multiple sequence common word occurrence distributions, characterizations of high frequency shared words, and ascertainment of long block identities. Various comparisons of sequences using natural alphabets obtained from grouping nucleotides or amino acids by their chemical and fu...

  5. Sequence repeats and protein structure

    Hoang, Trinh X.; Trovato, Antonio; Seno, Flavio; Banavar, Jayanth R.; Maritan, Amos

    2012-11-01

    Repeats are frequently found in known protein sequences. The level of sequence conservation in tandem repeats correlates with their propensities to be intrinsically disordered. We employ a coarse-grained model of a protein with a two-letter amino acid alphabet, hydrophobic (H) and polar (P), to examine the sequence-structure relationship in the realm of repeated sequences. A fraction of repeated sequences comprises a distinct class of bad folders, whose folding temperatures are much lower than those of random sequences. Imperfection in sequence repetition improves the folding properties of the bad folders while deteriorating those of the good folders. Our results may explain why nature has utilized repeated sequences for their versatility and especially to design functional proteins that are intrinsically unstructured at physiological temperatures.

  6. Turtle Graphics of Morphic Sequences

    Zantema, Hans

    2016-02-01

    The simplest infinite sequences that are not ultimately periodic are pure morphic sequences: fixed points of particular morphisms mapping single symbols to strings of symbols. A basic way to visualize a sequence is by a turtle curve: for every alphabet symbol fix an angle, and then consecutively for all sequence elements draw a unit segment and turn the drawing direction by the corresponding angle. This paper investigates turtle curves of pure morphic sequences. In particular, criteria are given for turtle curves being finite (consisting of finitely many segments), and for being fractal or self-similar: it contains an up-scaled copy of itself. Also space-filling turtle curves are considered, and a turtle curve that is dense in the plane. As a particular result we give an exact relationship between the Koch curve and a turtle curve for the Thue-Morse sequence, where until now for such a result only approximations were known.

  7. Three-dimensional-fast imaging employing steady-state acquisition and T2-weighted fast spin-echo magnetic resonance sequences on visualization of cranial nerves Ⅲ-Ⅻ

    2008-01-01

    @@ Because of the small diameter and complex anatomic course of the cranial nerves except for the optic nerve,mgeminal nerve,facial nerve,and cochlear and vestibular nerve,other cranial nerves are difficult to be visualized in magnetic resonance imaging (MRI) scanning with conventional thickness (5-10 mm).

  8. Lateral flow devices for nucleic acid analysis exploiting quantum dots as reporters

    Sapountzi, Eleni A.; Tragoulias, Sotirios S.; Kalogianni, Despina P. [Department of Chemistry, University of Patras, GR-26504 Patras (Greece); Ioannou, Penelope C. [Department of Chemistry, University of Athens, GR-15771 Athens (Greece); Christopoulos, Theodore K., E-mail: tchrist@upatras.gr [Department of Chemistry, University of Patras, GR-26504 Patras (Greece); Institute of Chemical Engineering and High Temperature Processes, Foundation of Research and Technology Hellas, GR-26504 Patras (Greece)

    2015-03-15

    Highlights: • Dipstick tests for DNA hybridization assays and genotyping of single-nucleotide polymorphisms. • Use of quantum dots as reporters. • Visual detection without the need for expensive instrumentation. • Simplicity and low-cost of the assays. - Abstract: There is a growing interest in the development of biosensors in the form of simple lateral flow devices that enable visual detection of nucleic acid sequences while eliminating several steps required for pipetting, incubation and washing out the excess of reactants. In this work, we present the first dipstick-type nucleic acid biosensors based on quantum dots (QDs) as reporters. The biosensors enable sequence confirmation of the target DNA by hybridization and simple visual detection of the emitted fluorescence under a UV lamp. The ‘diagnostic’ membrane of the biosensor contains a test zone (TZ) and a control zone (CZ). The CZ always fluoresces in order to confirm the proper function of the biosensor. Fluorescence is emitted from the TZ, only when the specific nucleic acid sequence is present. We have developed two general types of QD-based nucleic acid biosensors, namely, Type I and Type II, in which the TZ consists of either immobilized streptavidin (Type I) or immobilized oligodeoxynucleotides (Type II). The control zone consists of immobilized biotinylated albumin. No purification steps are required prior to the application of the DNA sample on the strip. The QD-based nucleic acid biosensors performed accurately and reproducibly when applied to (a) the visual detection of PCR amplification products and (b) visual genotyping of single nucleotide polymorphisms (SNPs) in human genomic DNA from clinical samples. As low as 1.5 fmol of double-stranded DNA were clearly detected by naked eye and the dynamic range extended to 200 fmol. The %CV were estimated to be 4.3–8.2.

  9. Lateral flow devices for nucleic acid analysis exploiting quantum dots as reporters

    Highlights: • Dipstick tests for DNA hybridization assays and genotyping of single-nucleotide polymorphisms. • Use of quantum dots as reporters. • Visual detection without the need for expensive instrumentation. • Simplicity and low-cost of the assays. - Abstract: There is a growing interest in the development of biosensors in the form of simple lateral flow devices that enable visual detection of nucleic acid sequences while eliminating several steps required for pipetting, incubation and washing out the excess of reactants. In this work, we present the first dipstick-type nucleic acid biosensors based on quantum dots (QDs) as reporters. The biosensors enable sequence confirmation of the target DNA by hybridization and simple visual detection of the emitted fluorescence under a UV lamp. The ‘diagnostic’ membrane of the biosensor contains a test zone (TZ) and a control zone (CZ). The CZ always fluoresces in order to confirm the proper function of the biosensor. Fluorescence is emitted from the TZ, only when the specific nucleic acid sequence is present. We have developed two general types of QD-based nucleic acid biosensors, namely, Type I and Type II, in which the TZ consists of either immobilized streptavidin (Type I) or immobilized oligodeoxynucleotides (Type II). The control zone consists of immobilized biotinylated albumin. No purification steps are required prior to the application of the DNA sample on the strip. The QD-based nucleic acid biosensors performed accurately and reproducibly when applied to (a) the visual detection of PCR amplification products and (b) visual genotyping of single nucleotide polymorphisms (SNPs) in human genomic DNA from clinical samples. As low as 1.5 fmol of double-stranded DNA were clearly detected by naked eye and the dynamic range extended to 200 fmol. The %CV were estimated to be 4.3–8.2

  10. The amino acid sequence of a 20 kDa bifunctional subtilisin/alpha-amylase inhibitor from bran [correction of brain] of rice (Oryza sativa L.) seeds.

    Ohtsubo, K; Richardson, M

    1992-08-31

    A 20 kDa bifunctional inhibitor of the microbial proteinase, subtilisin, and the alpha-amylase from the larvae of the red flour beetle (Tribolium castaneum) was purified from bran of rice seeds by saline extraction, precipitation with ammonium sulphate, ion-exchange chromatography on DEAE-Cellulose and Toyopearl CM-650, and preparative HPLC on Vydac C18. The complete primary structure was determined by automatic degradation of the intact, reduced and S-alkylated protein, and by manual DABITC/PITC micro-sequencing of peptides obtained from the protein following separate enzymic digestions with trypsin, pepsin, chymotrypsin, elastase and the protease from S. aureus V8. The protein sequence, which contained 176 residues, showed strong homology with similar bifunctional inhibitors previously isolated from wheat and barley which are related to the Kunitz family of proteinase inhibitors from legume seeds. PMID:1511747

  11. OPEN QUESTIONS IN ORIGIN OF LIFE: EXPERIMENTAL STUDIES ON THE ORIGIN OF NUCLEIC ACIDS AND PROTEINS WITH SPECIFIC AND FUNCTIONAL SEQUENCES BY A CHEMICAL SYNTHETIC BIOLOGY APPROACH

    Katarzyna Adamala

    2014-02-01

    We have recently addressed these questions by using a chemical synthetic biology approach. In particular, we have tested the catalytic activity of small peptides, like Ser-His, with respect to peptide- and nucleotides-condensation, as a realistic model of primitive organocatalysis. We have also set up a strategy for exploring the sequence space of random proteins and RNAs (the so-called “never born biopolymer” project with respect to the production of folded structures. Being still far from solved, the main aspects of these “open questions” are discussed here, by commenting on recent results obtained in our groups and by providing a unifying view on the problem and possible solutions. In particular, we propose a general scenario for macromolecule formation via fragment-condensation, as a scheme for the emergence of specific sequences based on molecular growth and selection.

  12. Nanoelectronic three-dimensional (3D) nanotip sensing array for real-time, sensitive, label-free sequence specific detection of nucleic acids.

    Esfandyarpour, Rahim; Yang, Lu; Koochak, Zahra; Harris, James S; Davis, Ronald W

    2016-02-01

    The improvements in our ability to sequence and genotype DNA have opened up numerous avenues in the understanding of human biology and medicine with various applications, especially in medical diagnostics. But the realization of a label free, real time, high-throughput and low cost biosensing platforms to detect molecular interactions with a high level of sensitivity has been yet stunted due to two factors: one, slow binding kinetics caused by the lack of probe molecules on the sensors and two, limited mass transport due to the planar structure (two-dimensional) of the current biosensors. Here we present a novel three-dimensional (3D), highly sensitive, real-time, inexpensive and label-free nanotip array as a rapid and direct platform to sequence-specific DNA screening. Our nanotip sensors are designed to have a nano sized thin film as their sensing area (~ 20 nm), sandwiched between two sensing electrodes. The tip is then conjugated to a DNA oligonucleotide complementary to the sequence of interest, which is electrochemically detected in real-time via impedance changes upon the formation of a double-stranded helix at the sensor interface. This 3D configuration is specifically designed to improve the biomolecular hit rate and the detection speed. We demonstrate that our nanotip array effectively detects oligonucleotides in a sequence-specific and highly sensitive manner, yielding concentration-dependent impedance change measurements with a target concentration as low as 10 pM and discrimination against even a single mismatch. Notably, our nanotip sensors achieve this accurate, sensitive detection without relying on signal indicators or enhancing molecules like fluorophores. It can also easily be scaled for highly multiplxed detection with up to 5000 sensors/square centimeter, and integrated into microfluidic devices. The versatile, rapid, and sensitive performance of the nanotip array makes it an excellent candidate for point-of-care diagnostics, and high

  13. Nucleotide sequence, organization and characterization of the (halo)aromatic acid catabolic plasmid pA81 from Achromobacter xylosoxidans A8

    Jenčová, V.; Strnad, Hynek; Chodora, Zdeněk; Ulbrich, Pavel; Vlček, Čestmír; Hickey, W. J.; Pačes, Václav

    2008-01-01

    Roč. 159, č. 2 (2008), s. 118-127. ISSN 0923-2508 R&D Projects: GA MŠk(CZ) 1M0520 Institutional research plan: CEZ:AV0Z50520514 Keywords : megaplasmid * haloaromatic acid * catabolism Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.055, year: 2008

  14. Complete Genome Sequence of “Candidatus Portiera aleyrodidarum” BT-QVLC, an Obligate Symbiont That Supplies Amino Acids and Carotenoids to Bemisia tabaci

    Santos-Garcia, Diego; Farnier, Pierre-Antoine; Beitia, Francisco; Zchori-Fein, Einat; Vavre, Fabrice; Mouton, Laurence; Moya, Andrés; Latorre, Amparo; Silva, Francisco J.

    2012-01-01

    The genome of “Candidatus Portiera aleyrodidarum,” the primary endosymbiont of the whitefly Bemisia tabaci (Mediterranean species), is reported. It presents a reduced genome (357 kb) encoding the capability to synthetize, or participate in the synthesis of, several amino acids and carotenoids, being the first insect endosymbiont capable of supplying carotenoids.

  15. Mechanism analysis of acid tolerance response of bifidobacterium longum subsp. longum BBMN 68 by gene expression profile using RNA-sequencing.

    Junhua Jin

    Full Text Available To analyze the mechanism of the acid tolerance response (ATR in Bifidobacterium longum subsp. longum BBMN68, we optimized the acid-adaptation condition to stimulate ATR effectively and analyzed the change of gene expression profile after acid-adaptation using high-throughput RNA-Seq. After acid-adaptation at pH 4.5 for 2 hours, the survival rate of BBMN68 at lethal pH 3.5 for 120 min was increased by 70 fold and the expression of 293 genes were upregulated by more than 2 fold, and 245 genes were downregulated by more than 2 fold. Gene expression profiling of ATR in BBMN68 suggested that, when the bacteria faced acid stress, the cells strengthened the integrity of cell wall and changed the permeability of membrane to keep the H(+ from entering. Once the H(+ entered the cytoplasm, the cells showed four main responses: First, the F(0F(1-ATPase system was initiated to discharge H(+. Second, the ability to produce NH(3 by cysteine-cystathionine-cycle was strengthened to neutralize excess H(+. Third, the cells started NER-UVR and NER-VSR systems to minimize the damage to DNA and upregulated HtpX, IbpA, and γ-glutamylcysteine production to protect proteins against damage. Fourth, the cells initiated global response signals ((pppGpp, polyP, and Sec-SRP to bring the whole cell into a state of response to the stress. The cells also secreted the quorum sensing signal (AI-2 to communicate between intraspecies cells by the cellular signal system, such as two-component systems, to improve the overall survival rate. Besides, the cells varied the pathways of producing energy by shifting to BCAA metabolism and enhanced the ability to utilize sugar to supply sufficient energy for the operation of the mechanism mentioned above. Based on these reults, it was inferred that, during industrial applications, the acid resistance of bifidobacteria could be improved by adding BCAA, γ-glutamylcysteine, cysteine, and cystathionine into the acid-stress environment.

  16. Ready-to-use strip for L-ascorbic acid visual detection based on polyaniline/polyamide 66 nano-fibers/nets membranes.

    Wen, Yanan; Li, Yan; Si, Yang; Wang, Xueqin; Li, Faxue; Yu, Jianyong; Ding, Bin

    2015-11-01

    A ready-to-use L-ascorbic acid (L-AA) colorimetric strip based on polyaniline (PANI)/polyamide 66 (PA 66) nanofiber/net (NFN) membrane with spider-web-like structure was fabricated through a facile bend electrospinning/netting process. Introduction of PANI component into the membrane turns the strip undergoes a brilliant brown-to-green color transition within 30 min upon incubation with L-AA. Moreover, ascribing to the three-dimensional microscopic structural, continuous pore channels, and distinctive nano-nets structure, the color change that is caused by 50 ppb L-AA can be easily perceived by naked eyes. Furthermore, RGB (red-green-blue) digital parameters that obtained from photographs of the strips were automatically read out via an iPhone. Subsequently, the parameters were converted into a color-difference map and processed statistically through principal component analysis, then used to elaborate standard curve. Combining the map and curve, we realized a method for assaying and quantifying L-AA concentration in real food samples, which avoids the time-consuming sample preparation, expensive laboratory techniques, and specialized personnel needed to carry out conventional analytical methods. PMID:26452940

  17. Development of calcium-permeable alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptors in cultured neocortical neurons visualized by cobalt staining

    Jensen, J B; Schousboe, A; Pickering, D S;

    1998-01-01

    , the developmental profile of cobalt uptake mediated by 25 microM AMPA changed dramatically. The cobalt staining now appeared in young cultures (5 DIV), and the percentage of stained cells increased from 3.4%+/-0.2% at 5 DIV to 21.7%+/-1.6% at 12 DIV. The effect of 200 microM kainate was similar to......The developmental expression of calcium (Ca2+)-permeable alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) and kainate receptors in cultured neocortical neurons was evaluated by using cobalt uptake, a histochemical method that identifies cells expressing Ca2+-permeable, non......-N-methyl-D-aspartate (non-NMDA) receptors. At a concentration of 500 microM, AMPA was found to stimulate cobalt uptake only late in development, resulting in staining of 2.7%+/-0.3% of the neurons maintained in culture for 12 days in vitro (DIV). When AMPA receptor desensitization was blocked with 50 microM cyclothiazide...

  18. Sequence assembly

    Scheibye-Alsing, Karsten; Hoffmann, S.; Frankel, Annett Maria;

    2009-01-01

    Despite the rapidly increasing number of sequenced and re-sequenced genomes, many issues regarding the computational assembly of large-scale sequencing data have remain unresolved. Computational assembly is crucial in large genome projects as well for the evolving high-throughput technologies and...... plays an important role in processing the information generated by these methods. Here, we provide a comprehensive overview of the current publicly available sequence assembly programs. We describe the basic principles of computational assembly along with the main concerns, such as repetitive sequences...... in genomic DNA, highly expressed genes and alternative transcripts in EST sequences. We summarize existing comparisons of different assemblers and provide a detailed descriptions and directions for download of assembly programs at: http://genome.ku.dk/resources/assembly/methods.html....

  19. Myeloid neoplasm demonstrating a STAT5B-RARA rearrangement and genetic alterations associated with all-trans retinoic acid resistance identified by a custom next-generation sequencing assay.

    Kluk, Michael J; Abo, Ryan P; Brown, Ronald D; Kuo, Frank C; Dal Cin, Paola; Pozdnyakova, Olga; Morgan, Elizabeth A; Lindeman, Neal I; DeAngelo, Daniel J; Aster, Jon C

    2015-10-01

    We describe the case of a patient presenting with several weeks of symptoms related to pancytopenia associated with a maturation arrest at the late promyelocyte/early myelocyte stage of granulocyte differentiation. A diagnosis of acute promyelocytic leukemia was considered, but the morphologic features were atypical for this entity and conventional tests for the presence of a PML-RARA fusion gene were negative. Additional analysis using a custom next-generation sequencing assay revealed a rearrangement producing a STAT5B-RARA fusion gene, which was confirmed by reverse transcription polymerase chain reaction (RT-PCR) and supplementary cytogenetic studies, allowing the diagnosis of a morphologically atypical form of acute promyelocytic leukemia to be made. Analysis of the sequencing data permitted characterization of both chromosomal breakpoints and revealed two additional alterations, a small deletion in RARA exon 9 and a RARA R276W substitution, that have been linked to resistance to all-trans retinoic acid. This case highlights how next-generation sequencing can augment currently standard testing to establish diagnoses in difficult cases, and in doing so help guide selection of therapy. PMID:27148563

  20. Genome Sequencing

    Sato, Shusei; Andersen, Stig Uggerhøj

    2014-01-01

    The current Lotus japonicus reference genome sequence is based on a hybrid assembly of Sanger TAC/BAC, Sanger shotgun and Illumina shotgun sequencing data generated from the Miyakojima-MG20 accession. It covers nearly all expressed L. japonicus genes and has been annotated mainly based on transcr......The current Lotus japonicus reference genome sequence is based on a hybrid assembly of Sanger TAC/BAC, Sanger shotgun and Illumina shotgun sequencing data generated from the Miyakojima-MG20 accession. It covers nearly all expressed L. japonicus genes and has been annotated mainly based...

  1. Visualization rhetoric: framing effects in narrative visualization.

    Hullman, Jessica; Diakopoulos, Nicholas

    2011-12-01

    Narrative visualizations combine conventions of communicative and exploratory information visualization to convey an intended story. We demonstrate visualization rhetoric as an analytical framework for understanding how design techniques that prioritize particular interpretations in visualizations that "tell a story" can significantly affect end-user interpretation. We draw a parallel between narrative visualization interpretation and evidence from framing studies in political messaging, decision-making, and literary studies. Devices for understanding the rhetorical nature of narrative information visualizations are presented, informed by the rigorous application of concepts from critical theory, semiotics, journalism, and political theory. We draw attention to how design tactics represent additions or omissions of information at various levels-the data, visual representation, textual annotations, and interactivity-and how visualizations denote and connote phenomena with reference to unstated viewing conventions and codes. Classes of rhetorical techniques identified via a systematic analysis of recent narrative visualizations are presented, and characterized according to their rhetorical contribution to the visualization. We describe how designers and researchers can benefit from the potentially positive aspects of visualization rhetoric in designing engaging, layered narrative visualizations and how our framework can shed light on how a visualization design prioritizes specific interpretations. We identify areas where future inquiry into visualization rhetoric can improve understanding of visualization interpretation. PMID:22034342

  2. Real-Time Detection of Noroviruses in Surface Water by Use of a Broadly Reactive Nucleic Acid Sequence-Based Amplification Assay

    Rutjes, Saskia A.; van den Berg, Harold H. J. L.; Lodder, Willemijn J.; Roda Husman, Ana Maria de

    2006-01-01

    Noroviruses are the most common agents causing outbreaks of viral gastroenteritis. Outbreaks originating from contaminated drinking water and from recreational waters have been described. Due to a lack of cell culture systems, noroviruses are detected mostly by molecular methods. Molecular detection assays for viruses in water are often repressed by inhibitory factors present in the environment, like humic acids and heavy metals. To study the effect of environmental inhibitors on the performa...

  3. Real-time detection of noroviruses in surface water by use of a broadly reactive nucleic acid sequence-based amplification assay.

    Rutjes, Saskia A.; Berg, Harold H J L van den; Lodder, Willemijn J.; Roda Husman, Ana Maria de

    2006-01-01

    Noroviruses are the most common agents causing outbreaks of viral gastroenteritis. Outbreaks originating from contaminated drinking water and from recreational waters have been described. Due to a lack of cell culture systems, noroviruses are detected mostly by molecular methods. Molecular detection assays for viruses in water are often repressed by inhibitory factors present in the environment, like humic acids and heavy metals. To study the effect of environmental inhibitors on the performa...

  4. Guanine nucleotide-binding proteins that enhance choleragen ADP-ribosyltransferase activity: nucleotide and deduced amino acid sequence of an ADP-ribosylation factor cDNA.

    Price, S R; Nightingale, M.; Tsai, S C; Williamson, K. C.; Adamik, R; H. C. Chen; Moss, J; M. Vaughan

    1988-01-01

    Three (two soluble and one membrane) guanine nucleotide-binding proteins (G proteins) that enhance ADP-ribosylation of the Gs alpha stimulatory subunit of the adenylyl cyclase (EC 4.6.1.1) complex by choleragen have recently been purified from bovine brain. To further define the structure and function of these ADP-ribosylation factors (ARFs), we isolated a cDNA clone (lambda ARF2B) from a bovine retinal library by screening with a mixed heptadecanucleotide probe whose sequence was based on th...

  5. Complementary DNA and derived amino acid sequence of the β subunit of human complement protein C8: identification of a close structural and ancestral relationship to the α subunit and C9

    A cDNA clone encoding the β subunit (M/sub r/ 64,000) of the eighth component of complement (C8) has been isolated from a human liver cDNA library. This clone has a cDNA insert of 1.95 kilobases (kb) and contains the entire β sequence [1608 base pairs (bp)]. Analysis of total cellular RNA isolated from the hepatoma cell line HepG2 revealed the mRNA for β to be ∼ 2.5 kb. This is similar to the message size for the α subunit of C8 and confirms the existence of different mRNAs for α and β. This finding supports genetic evidence that α and β are encoded at different loci. Analysis of the derived amino acid sequence revealed several membrane surface seeking segments that may facilitate β interaction with target membranes during complement-mediated cytolysis. Determined of the carbohydrate composition indicated 1 or 2 asparagine-linked but no O-linked oligosaccharide chains. Comparison of the β sequence to that reported earlier and to that of human C9 revealed a striking homology between all three proteins. For β and α, the overall homology is 33% on the basis of identity and 53% when conserved substitutions are allowed. For β and C9, the values are 26% and 475, respectively. All three have a large internal domain that is nearly cysteine free and N- and C-termini that are cysteine-rich and homologous to the low-density lipoprotein receptor repeat and epidermal growth factor type sequences, respectively. The overall homology and similarities in size and structural organization are indicative of a close ancestral relationship. It is concluded that α, β and C9 are members of a family of structurally related proteins that are capable of interacting to produce a hydrophilic to amphiphilic transition and membrane association

  6. Invasive cleavage of nucleic acids

    Prudent, James R. (Madison, WI); Hall, Jeff G. (Madison, WI); Lyamichev, Victor I. (Madison, WI); Brow, Mary Ann D. (Madison, WI); Dahlberg, James E. (Madison, WI)

    2002-01-01

    The present invention relates to means for the detection and characterization of nucleic acid sequences, as well as variations in nucleic acid sequences. The present invention also relates to methods for forming a nucleic acid cleavage structure on a target sequence and cleaving the nucleic acid cleavage structure in a site-specific manner. The structure-specific nuclease activity of a variety of enzymes is used to cleave the target-dependent cleavage structure, thereby indicating the presence of specific nucleic acid sequences or specific variations thereof.

  7. Invasive cleavage of nucleic acids

    Prudent, James R.; Hall, Jeff G.; Lyamichev, Victor I.; Brow, Mary Ann D.; Dahlberg, James E.

    1999-01-01

    The present invention relates to means for the detection and characterization of nucleic acid sequences, as well as variations in nucleic acid sequences. The present invention also relates to methods for forming a nucleic acid cleavage structure on a target sequence and cleaving the nucleic acid cleavage structure in a site-specific manner. The structure-specific nuclease activity of a variety of enzymes is used to cleave the target-dependent cleavage structure, thereby indicating the presence of specific nucleic acid sequences or specific variations thereof.

  8. Visual time series analysis

    Fischer, Paul; Hilbert, Astrid

    2012-01-01

    We introduce a platform which supplies an easy-to-handle, interactive, extendable, and fast analysis tool for time series analysis. In contrast to other software suits like Maple, Matlab, or R, which use a command-line-like interface and where the user has to memorize/look-up the appropriate...... commands, our application is select-and-click-driven. It allows to derive many different sequences of deviations for a given time series and to visualize them in different ways in order to judge their expressive power and to reuse the procedure found. For many transformations or model-ts, the user may...... choose between manual and automated parameter selection. The user can dene new transformations and add them to the system. The application contains efficient implementations of advanced and recent techniques for time series analysis including techniques related to extreme value analysis and filtering...

  9. Thermoresponsive physical hydrogels of poly(lactic acid)/poly(ethylene glycol) stereoblock copolymers tuned by stereostructure and hydrophobic block sequence.

    Mao, Hailiang; Shan, Guorong; Bao, Yongzhong; Wu, Zi Liang; Pan, Pengju

    2016-05-18

    CBABC-type poly(lactic acid) (PLA)/poly(ethylene glycol) (PEG) pentablock copolymers composed of a central PEG block (A) and enantiomeric poly(l-lactic acid) (PLLA, B), poly(d-lactic acid) (PDLA, C) blocks were synthesized. Such pentablock copolymers form physical hydrogels at high concentrations in an aqueous solution, which stem from the aggregation and physical bridging of copolymer micelles. These gels are thermoresponsive and turn into sols upon heating. Physical gelation, gel-to-sol transition, crystalline state, microstructure, rheological behavior, biodegradation, and drug release behavior of PLA/PEG pentablock copolymers and their gels were investigated; they were also compared with PLA-PEG-PLA triblock copolymers containing the isotactic PLLA or atactic poly(d,l-lactide) (PDLLA) endblocks and PLLA-PEG-PLLA/PDLA-PEG-PDLA enantiomeric mixtures. PLA hydrophobic domains in pentablock copolymer gels changed from a homocrystalline to stereocomplexed structure as the PLLA/PDLA block length ratio approached 1/1. The gel of symmetric pentablock copolymer exhibited a wider gelation region, higher gel-to-sol transition temperature, higher hydrophobic domain crystallinity, larger intermicellar distance, higher storage modulus, and slower degradation and drug release rate compared to those of the asymmetric PLA/PEG pentablock copolymers or triblock copolymers. SAXS results indicated that the PLLA/PDLA blocks stereocomplexation in pentablock copolymers facilitated the intermicellar aggregation and bridging. Cylindrical ordered structures were observed in all the gels formed from the PLA/PEG pentablock and triblock copolymers. The stereocomplexation degree and intermicellar distance of the pentablock copolymer gels increased with heating. PMID:27121732

  10. Import of desired nucleic acid sequences using addressing motif of mitochondrial ribosomal 5S-rRNA for fluorescent in vivo hybridization of mitochondrial DNA and RNA

    Zelenka, Jaroslav; Alán, Lukáš; Jabůrek, Martin; Ježek, Petr

    2014-01-01

    Roč. 46, č. 2 (2014), s. 147-156. ISSN 0145-479X R&D Projects: GA ČR(CZ) GAP305/12/1247; GA ČR(CZ) GPP305/12/P388; GA MŠk(CZ) ED1.1.00/02.0109 Institutional support: RVO:67985823 Keywords : 5S-rRNA * mitochondrial DNA * nucleic acid import into mitochondria * fluorescent in vivo hybridization of mtDNA * mitochondrial nucleoids Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.212, year: 2014

  11. Amino acid sequence requirements in the human IgA1 hinge for cleavage by streptococcal IgA1 proteases

    Senior, BW; Batten, MR; Kilian, Mogens;

    2002-01-01

    All the IgA1 proteases of the different pathogenic species of Streptococcus cleave the hinge of the alpha chain of human IgA1 only at one proline-threonine peptide bond. In order to study the importance of these amino acids for cleavage, several hinge mutant recombinant IgA1 antibodies were...... constructed. The mutations were found to be without major effect upon the structure or functional abilities of the antibodies. However, they had a major effect upon their sensitivity to cleavage by some of the IgA1 proteases....

  12. Amino acid sequence requirements in the human IgA1 hinge for cleavage by streptococcal IgA1 proteases.

    Senior, B W; Batten, M R; Kilian, M; Woof, J M

    2002-08-01

    All the IgA1 proteases of the different pathogenic species of Streptococcus cleave the hinge of the alpha chain of human IgA1 only at one proline-threonine peptide bond. In order to study the importance of these amino acids for cleavage, several hinge mutant recombinant IgA1 antibodies were constructed. The mutations were found to be without major effect upon the structure or functional abilities of the antibodies. However, they had a major effect upon their sensitivity to cleavage by some of the IgA1 proteases. PMID:12196126

  13. Combination of acid labile detergent and C18 Empore™ disks for improved identification and sequence coverage of in-gel digested proteins.

    Koehn, Henning; Lau, Benjamin; Clerens, Stefan; Plowman, Jeffrey E; Dyer, Jolon M; Ramli, Umi Salamah; Deb-Choudhury, Santanu

    2011-04-01

    A protocol for improved extraction of peptides from in-gel protein digests, using a combination of the acid labile surfactant, sodium deoxycholate (SDC) and C18 Empore™ membranes, is presented. This approach results in better mass spectrum quality, higher numbers of identified peptide peaks and improved identification scores compared to standard tryptic digestion protocols, or protocols using only SDC or only C18 Empore™ disks. The advantages of the new protocol are demonstrated for two different types of samples: Merino wool intermediate filament proteins and Elaeis guineensis (oil palm) mesocarp proteins. PMID:21327873

  14. Why Teach Visual Culture?

    Passmore, Kaye

    2007-01-01

    Visual culture is a hot topic in art education right now as some teachers are dedicated to teaching it and others are adamant that it has no place in a traditional art class. Visual culture, the author asserts, can include just about anything that is visually represented. Although people often think of visual culture as contemporary visuals such…

  15. Sequence-specific {sup 1}H, {sup 13}C, and {sup 15}N resonance assignments for intestinal fatty-acid-binding protein complexed with palmitate (15.4 kDA)

    Hodsdon, M.E.; Toner, J.J.; Cistola, D.P. [Washington Univ. School of Medicine, St. Louis, MO (United States)

    1994-12-01

    Intestinal fatty-acid-binding protein (I-FABP) belongs to a family of soluble, cytoplasmic proteins that are thought to function in the intracellular transport and trafficking of polar lipids. Individual members of this protein family have distinct specificities and affinities for fatty acids, cholesterol, bile salts, and retinoids. We are comparing several retinol- and fatty-acid-binding proteins from intestine in order to define the factors that control molecular recognition in this family of proteins. We have established sequential resonance assignments for uniformly {sup 13}C/{sup 15}N-enriched I-FABP complexed with perdeuterated palmitate at pH7.2 and 37{degrees}C. The assignment strategy was similar to that introduced for calmodulin. We employed seven three-dimensional NMR experiments to establish scalar couplings between backbone and sidechain atoms. Backbone atoms were correlated using triple-resonance HNCO, HNCA, TOCSY-HMQC, HCACO, and HCA(CO)N experiments. Sidechain atoms were correlated using CC-TOCSY, HCCH-TOCSY, and TOCSY-HMQC. The correlations of peaks between three-dimensional spectra were established in a computer-assisted manner using NMR COMPASS (Molecular Simulations, Inc.) Using this approach, {sup 1}H, {sup 13}C, and {sup 15}N resonance assignments have been established for 120 of the 131 residues of I-FABP. For 18 residues, amide {sup 1}H and {sup 15}N resonances were unobservable, apparently because of the rapid exchange of amide protons with bulk water at pH 7.2. The missing amide protons correspond to distinct amino acid patterns in the protein sequence, which will be discussed. During the assignment process, several sources of ambiguity in spin correlations were observed. To overcome this ambiguity, the additional inter-residue correlations often observed in the HNCA experiment were used as cross-checks for the sequential backbone assignments.

  16. Effect of temperature and solvent composition on acid dissociation equilibria, I: Sequenced {sup s}{sub s}pK{sub a} determination of compounds commonly used as buffers in high performance liquid chromatography coupled to mass spectroscopy detection

    Padro, Juan M.; Acquaviva, Agustin; Tascon, Marcos [Laboratorio de Separaciones Analiticas, Division Quimica Analitica, Universidad Nacional de La Plata y CIDEPINT, 47 y 115, (1900) La Plata (Argentina); Gagliardi, Leonardo G., E-mail: leogagliardi@quimica.unlp.edu.ar [Laboratorio de Separaciones Analiticas, Division Quimica Analitica, Universidad Nacional de La Plata y CIDEPINT, 47 y 115, (1900) La Plata (Argentina); Castells, Cecilia B., E-mail: castells@isis.unlp.edu.ar [Laboratorio de Separaciones Analiticas, Division Quimica Analitica, Universidad Nacional de La Plata y CIDEPINT, 47 y 115, (1900) La Plata (Argentina)

    2012-05-06

    Highlights: Black-Right-Pointing-Pointer We developed a rapid potentiometric method for sequential pK{sub a} determinations. Black-Right-Pointing-Pointer We measured pK{sub a} of buffers from 0 to 90% (v/v) acetonitrile/water and from 20 to 60 Degree-Sign C. Black-Right-Pointing-Pointer Sequences of 42 pK{sub a}-data spanned over a wide solvent composition range needed 2 h. Black-Right-Pointing-Pointer We measured pK{sub a} of formic acid and triethylamine/HCl in up to 90% (v/v) acetonitrile. Black-Right-Pointing-Pointer The high-throughput method was applied to obtain pK{sub a} of two common buffers in LC/MS. - Abstract: A new automated and rapid potentiometric method for determining the effect of organic-solvent composition on pK{sub a} has been developed. It is based on the measurements of pH values of buffer solutions of variable solvent compositions using a combined glass electrode. Additions of small volumes of one precisely thermostated solution into another, both containing exactly the same analytical concentrations of the buffer components, can produce continuous changes in the solvent composition. Two sequences of potential measurements, one of increasing and the other of decreasing solvent content, are sufficient to obtain the pK{sub a} values of the acidic compound within the complete solvent-composition range in about 2 h. The experimental design, procedures, and calculations needed to convert the measured pH into the thermodynamic pK{sub a} values are thoroughly discussed. This rapid and automated method allows the systematic study of the effect of solvent compositions and temperatures on the pK{sub a}. It has been applied to study the dissociation constants of two monoprotic acids: formic acid and triethylamine:HCl in acetonitrile/water mixtures within the range from 0 to 90% (v/v) at temperatures between 20 Degree-Sign C and 60 Degree-Sign C. These volatile compounds are frequently used to control the pH of the mobile phase in HPLC, especially in

  17. The molecular basis for the green-blue sensitivity shift in the rod visual pigments of the European eel.

    Archer, S; Hope, A; Partridge, J C

    1995-12-22

    When the European eel matures sexually and migrates back to deep sea breeding grounds the visual pigments in its rod photoreceptors change from being maximally sensitive to green light to being maximally sensitive to blue light. In part, this change in sensitivity is due to a change in the opsin component of the visual pigment molecule. We used hormone injection to induce these developmental changes in a group of eels and from these animals an opsin coding region was cloned and sequenced using cDNA made from retinal mRNA. From the retinae of hormone-injected eels and those not injected with hormones, distinct opsin mRNAs were isolated. These mRNAs encode two rod opsin proteins that are very similar but have significant amino acid substitutions in key positions that are likely to be involved in spectral tuning of the eel green and blue sensitive rod visual pigment molecules. PMID:8587887

  18. Biological sequence classification with multivariate string kernels.

    Kuksa, Pavel P

    2013-01-01

    String kernel-based machine learning methods have yielded great success in practical tasks of structured/sequential data analysis. They often exhibit state-of-the-art performance on many practical tasks of sequence analysis such as biological sequence classification, remote homology detection, or protein superfamily and fold prediction. However, typical string kernel methods rely on the analysis of discrete 1D string data (e.g., DNA or amino acid sequences). In this paper, we address the multiclass biological sequence classification problems using multivariate representations in the form of sequences of features vectors (as in biological sequence profiles, or sequences of individual amino acid physicochemical descriptors) and a class of multivariate string kernels that exploit these representations. On three protein sequence classification tasks, the proposed multivariate representations and kernels show significant 15-20 percent improvements compared to existing state-of-the-art sequence classification methods. PMID:24384708

  19. Data Visualization and Infographics

    Prepared by Mathematica Policy Research

    2014-01-01

    Data visualization translates complex ideas and concepts into a simple visual context. Patterns, trends, and relationships that might go undetected in text are conveyed at a glance in effective data visualization.

  20. Insertion sequences.

    Mahillon, Jacques; Chandler, M.

    1998-01-01

    Insertion sequences (ISs) constitute an important component of most bacterial genomes. Over 500 individual ISs have been described in the literature to date, and many more are being discovered in the ongoing prokaryotic and eukaryotic genome-sequencing projects. The last 10 years have also seen some striking advances in our understanding of the transposition process itself. Not least of these has been the development of various in vitro transposition systems for both prokaryotic and eukaryoti...

  1. Learning Visualizations by Analogy: Promoting Visual Literacy through Visualization Morphing.

    Ruchikachorn, Puripant; Mueller, Klaus

    2015-09-01

    We propose the concept of teaching (and learning) unfamiliar visualizations by analogy, that is, demonstrating an unfamiliar visualization method by linking it to another more familiar one, where the in-betweens are designed to bridge the gap of these two visualizations and explain the difference in a gradual manner. As opposed to a textual description, our morphing explains an unfamiliar visualization through purely visual means. We demonstrate our idea by ways of four visualization pair examples: data table and parallel coordinates, scatterplot matrix and hyperbox, linear chart and spiral chart, and hierarchical pie chart and treemap. The analogy is commutative i.e. any member of the pair can be the unfamiliar visualization. A series of studies showed that this new paradigm can be an effective teaching tool. The participants could understand the unfamiliar visualization methods in all of the four pairs either fully or at least significantly better after they observed or interacted with the transitions from the familiar counterpart. The four examples suggest how helpful visualization pairings be identified and they will hopefully inspire other visualization morphings and associated transition strategies to be identified. PMID:26357285

  2. Lateralized visual behavior in bottlenose dolphins (Tursiops truncatus) performing audio-visual tasks: the right visual field advantage.

    Delfour, F; Marten, K

    2006-01-10

    Analyzing cerebral asymmetries in various species helps in understanding brain organization. The left and right sides of the brain (lateralization) are involved in different cognitive and sensory functions. This study focuses on dolphin visual lateralization as expressed by spontaneous eye preference when performing a complex cognitive task; we examine lateralization when processing different visual stimuli displayed on an underwater touch-screen (two-dimensional figures, three-dimensional figures and dolphin/human video sequences). Three female bottlenose dolphins (Tursiops truncatus) were submitted to a 2-, 3- or 4-, choice visual/auditory discrimination problem, without any food reward: the subjects had to correctly match visual and acoustic stimuli together. In order to visualize and to touch the underwater target, the dolphins had to come close to the touch-screen and to position themselves using monocular vision (left or right eye) and/or binocular naso-ventral vision. The results showed an ability to associate simple visual forms and auditory information using an underwater touch-screen. Moreover, the subjects showed a spontaneous tendency to use monocular vision. Contrary to previous findings, our results did not clearly demonstrate right eye preference in spontaneous choice. However, the individuals' scores of correct answers were correlated with right eye vision, demonstrating the advantage of this visual field in visual information processing and suggesting a left hemispheric dominance. We also demonstrated that the nature of the presented visual stimulus does not seem to have any influence on the animals' monocular vision choice. PMID:16246503

  3. Quantum-Sequencing: Fast electronic single DNA molecule sequencing

    Casamada Ribot, Josep; Chatterjee, Anushree; Nagpal, Prashant

    2014-03-01

    A major goal of third-generation sequencing technologies is to develop a fast, reliable, enzyme-free, high-throughput and cost-effective, single-molecule sequencing method. Here, we present the first demonstration of unique ``electronic fingerprint'' of all nucleotides (A, G, T, C), with single-molecule DNA sequencing, using Quantum-tunneling Sequencing (Q-Seq) at room temperature. We show that the electronic state of the nucleobases shift depending on the pH, with most distinct states identified at acidic pH. We also demonstrate identification of single nucleotide modifications (methylation here). Using these unique electronic fingerprints (or tunneling data), we report a partial sequence of beta lactamase (bla) gene, which encodes resistance to beta-lactam antibiotics, with over 95% success rate. These results highlight the potential of Q-Seq as a robust technique for next-generation sequencing.

  4. Photoaffinity analogues of methotrexate as folate antagonist binding probes. 1. Photoaffinity labeling of murine L1210 dihydrofolate reductase and amino acid sequence of the binding region

    N/sup α/-(4-Amino-4-deoxy-10-methylpteroyl)-N/sup epsilon/-(4-azido-5-[125I]iodosalicylyl)-L-lysine, a photoaffinity analogue of methotrexate, is only 2-fold less potent than methotrexate in the inhibition of murine L1210 dihydrofolate reductase. Irradiation of the enzyme in the presence of an equimolar concentration of the 125I-labeled analogue ultimately leads to an 8% incorporation of the photoprobe. A 100-fold molar excess of methotrexate essentially blocks this incorporation. Cyanogen bromide digestion of the labeled enzyme, followed by high-pressure liquid chromatography purification of the generated peptides, indicates that greater than 85% of the total radioactivity is incorporated into a single cyanogen bromide peptide. Sequence analysis revealed this peptide to be residues 53-111, with a majority of the radioactivity centered around residues 63-65 (Lys-Asn-Arg). These data demonstrate that the photoaffinity analogue specifically binds to dihydrofolate reductase and covalently modifies the enzyme following irradiation and is therefore a photolabeling agent useful for probing the inhibitor binding domain of the enzyme

  5. The H-Index of `An Approach to Correlate Tandem Mass Spectral Data of Peptides with Amino Acid Sequences in a Protein Database'

    Washburn, Michael P.

    2015-11-01

    Over 20 years ago a remarkable paper was published in the Journal of American Society for Mass Spectrometry. This paper from Jimmy Eng, Ashley McCormack, and John Yates described the use of protein databases to drive the interpretation of tandem mass spectra of peptides. This paper now has over 3660 citations and continues to average more than 260 per year over the last decade. This is an amazing scientific achievement. The reason for this is the paper was a cutting edge development at the moment in time when genomes of organisms were being sequenced, protein and peptide mass spectrometry was growing into the field of proteomics, and the power of computing was growing quickly in accordance with Moore's law. This work by the Yates lab grew in importance as genomics, proteomics, and computation all advanced and eventually resulted in the widely used SEQUEST algorithm and platform for the analysis of tandem mass spectrometry data. This commentary provides an analysis of the impact of this paper by analyzing the citations it has generated and the impact of these citing papers.

  6. Identification of S-glutathionylation sites in species-specific proteins by incorporating five sequence-derived features into the general pseudo-amino acid composition.

    Zhao, Xiaowei; Ning, Qiao; Ai, Meiyue; Chai, Haiting; Yang, Guifu

    2016-06-01

    As a selective and reversible protein post-translational modification, S-glutathionylation generates mixed disulfides between glutathione (GSH) and cysteine residues, and plays an important role in regulating protein activity, stability, and redox regulation. To fully understand S-glutathionylation mechanisms, identification of substrates and specific S-Glutathionylated sites is crucial. Experimental identification of S-glutathionylated sites is labor-intensive and time consuming, so establishing an effective computational method is much desirable due to their convenient and fast speed. Therefore, in this study, a new bioinformatics tool named SSGlu (Species-Specific identification of Protein S-glutathionylation Sites) was developed to identify species-specific protein S-glutathionylated sites, utilizing support vector machines that combine multiple sequence-derived features with a two-step feature selection. By 5-fold cross validation, the performance of SSGlu was measured with an AUC of 0.8105 and 0.8041 for Homo sapiens and Mus musculus, respectively. Additionally, SSGlu was compared with the existing methods, and the higher MCC and AUC of SSGlu demonstrated that SSGlu was very promising to predict S-glutathionylated sites. Furthermore, a site-specific analysis showed that S-glutathionylation intimately correlated with the features derived from its surrounding sites. The conclusions derived from this study might help to understand more of the S-glutathionylation mechanism and guide the related experimental validation. For public access, SSGlu is freely accessible at http://59.73.198.144:8080/SSGlu/. PMID:27025952

  7. Phenylglyoxal-Based Visualization of Citrullinated Proteins on Western Blots

    Sanne M. M. Hensen

    2015-04-01

    Full Text Available Citrullination is the conversion of peptidylarginine to peptidylcitrulline, which is catalyzed by peptidylarginine deiminases. This conversion is involved in different physiological processes and is associated with several diseases, including cancer and rheumatoid arthritis. A common method to detect citrullinated proteins relies on anti-modified citrulline antibodies directed to a specific chemical modification of the citrulline side chain. Here, we describe a versatile, antibody-independent method for the detection of citrullinated proteins on a membrane, based on the selective reaction of phenylglyoxal with the ureido group of citrulline under highly acidic conditions. The method makes use of 4-azidophenylglyoxal, which, after reaction with citrullinated proteins, can be visualized with alkyne-conjugated probes. The sensitivity of this procedure, using an alkyne-biotin probe, appeared to be comparable to the antibody-based detection method and independent of the sequence surrounding the citrulline.

  8. Deep Hierarchies in the Primate Visual Cortex

    Krüger, Norbert; Jannsen, Per; Kalkan, S.;

    2013-01-01

    processing hierarchies present in the primate visual system considering recent discoveries in neurophysiology. The hierarchal processing in the primate visual system is characterized by a sequence of different levels of processing (in the order of ten) that constitute a deep hierarchy in contrast to the flat...... vision architectures predominantly used in today's mainstream computer vision. We hope that the functional description of the deep hierarchies realized in the primate visual system provides valuable insights for the design of computer vision algorithms, fostering increasingly productive interaction...

  9. Visualization system for intelligent robot simulation

    Simulation systems for intelligent robot has been developed at JAERI as a research and development program of underlying technologies for intelligent robots and intelligent nuclear plants. In the system, it is numerically/logically simulated that a human shaped robot reads and understands instructions written in natural language, planning and producing a required sequence of actions with environmental data. In such a simulation for actual nuclear facilities, it is indispensable to model the large scale environment and to visualize the simulation results for performance evaluation. We describe a modeling method with CSG (Constructive Solid Geometry), accurate visualization system by Ray Tracing method and high-speed visualization system using polyhedral model. (author)

  10. Genomic Phenotyping by Barcode Sequencing Broadly Distinguishes between Alkylating Agents, Oxidizing Agents, and Non-Genotoxic Agents, and Reveals a Role for Aromatic Amino Acids in Cellular Recovery after Quinone Exposure

    Svensson, J. Peter; Quirós Pesudo, Laia; McRee, Siobhan K.; Adeleye, Yeyejide; Carmichael, Paul; Samson, Leona D.

    2013-01-01

    Toxicity screening of compounds provides a means to identify compounds harmful for human health and the environment. Here, we further develop the technique of genomic phenotyping to improve throughput while maintaining specificity. We exposed cells to eight different compounds that rely on different modes of action: four genotoxic alkylating (methyl methanesulfonate (MMS), N-Methyl-N-nitrosourea (MNU), N,N′-bis(2-chloroethyl)-N-nitroso-urea (BCNU), N-ethylnitrosourea (ENU)), two oxidizing (2-methylnaphthalene-1,4-dione (menadione, MEN), benzene-1,4-diol (hydroquinone, HYQ)), and two non-genotoxic (methyl carbamate (MC) and dimethyl sulfoxide (DMSO)) compounds. A library of S. cerevisiae 4,852 deletion strains, each identifiable by a unique genetic ‘barcode’, were grown in competition; at different time points the ratio between the strains was assessed by quantitative high throughput ‘barcode’ sequencing. The method was validated by comparison to previous genomic phenotyping studies and 90% of the strains identified as MMS-sensitive here were also identified as MMS-sensitive in a much lower throughput solid agar screen. The data provide profiles of proteins and pathways needed for recovery after both genotoxic and non-genotoxic compounds. In addition, a novel role for aromatic amino acids in the recovery after treatment with oxidizing agents was suggested. The role of aromatic acids was further validated; the quinone subgroup of oxidizing agents were extremely toxic in cells where tryptophan biosynthesis was compromised. PMID:24040048

  11. Electrophoresis-Enhanced Detection of Deoxyribonucleic Acids on a Membrane-Based Lateral Flow Strip Using Avian Influenza H5 Genetic Sequence as the Model

    Jui-Chuang Wu

    2014-03-01

    Full Text Available This study reports a simple strategy to detect a deoxyribonucleic acid (DNA on a membrane-based lateral flow (MBLF strip without tedious gel preparation, gel electrophoresis, and EtBr-staining processes. The method also enhances the detection signal of the genetic sample. A direct electric field was applied over two ends of the MBLF strips to induce an electrophoresis of DNAs through the strips. The signal enhancement was demonstrated by the detection of the H5 subtype of avian influenza virus (H5 AIV. This approach showed an excellent selectivity of H5 AIV from other two control species, Arabidopsis thaliana and human PSMA5. It also showed an effective signal repeatability and sensitivity over a series of analyte concentrations. Its detection limit could be enhanced, from 40 ng to 0.1 ng by applying 12 V. The nano-gold particles for the color development were labeled on the capture antibody, and UV-VIS and TEM were used to check if the labeling was successful. This detection strategy could be further developed to apply on the detection of drug-allergic genes at clinics or detection of infectious substances at incident sites by a simple manipulation with an aid of a mini-PCR machine and auxiliary kits.

  12. Nonlinear analysis of sequence repeats of multi-domain proteins

    Many multi-domain proteins have repetitive three-dimensional structures but nearly-random amino acid sequences. In the present paper, by using a modified recurrence plot proposed by us previously, we show that these amino acid sequences have hidden repetitions in fact. These results indicate that the repetitive domain structures are encoded by the repetitive sequences. This also gives a method to detect the repetitive domain structures directly from amino acid sequences

  13. The sequence of the CA-SP1 junction accounts for the differential sensitivity of HIV-1 and SIV to the small molecule maturation inhibitor 3-O-{3',3'-dimethylsuccinyl}-betulinic acid

    Aiken Christopher

    2004-06-01

    Full Text Available Abstract Background Despite the effectiveness of currently available antiretroviral therapies in the treatment of HIV-1 infection, a continuing need exists for novel compounds that can be used in combination with existing drugs to slow the emergence of drug-resistant viruses. We previously reported that the small molecule 3-O-{3',3'-dimethylsuccinyl}-betulinic acid (DSB specifically inhibits HIV-1 replication by delaying the processing of the CA-SP1 junction in Pr55Gag. By contrast, SIVmac239 replicates efficiently in the presence of high concentrations of DSB. To determine whether sequence differences in the CA-SP1 junction can fully account for the differential sensitivity of HIV-1 and SIV to DSB, we engineered mutations in this region of two viruses and tested their sensitivity to DSB in replication assays using activated human primary CD4+ T cells. Results Substitution of the P2 and P1 residues of HIV-1 by the corresponding amino acids of SIV resulted in strong resistance to DSB, but the mutant virus replicated with reduced efficiency. Conversely, replication of an SIV mutant containing three amino acid substitutions in the CA-SP1 cleavage site was highly sensitive to DSB, and the mutations resulted in delayed cleavage of the CA-SP1 junction in the presence of the drug. Conclusions These results demonstrate that the CA-SP1 junction in Pr55Gag represents the primary viral target of DSB. They further suggest that the therapeutic application of DSB will be accompanied by emergence of mutant viruses that are highly resistant to the drug but which exhibit reduced fitness relative to wild type HIV-1.

  14. [Gastric Acid].

    Ruíz Chávez, R

    1996-01-01

    Gastric acid, a product of parietal cells secretion, full fills multiple biological roles which are absolutely necessary to keep corporal homeostasis. The production of the acid depends upon an effector cellular process represented in the first step by histamine, acetilcholine and gastrin, first messengers of the process. These interact with specific receptors than in sequence activate second messengers -cAMP and the calcium-calmodulin system- which afterwards activate a kinase. An specific protein is then phosphorilated by this enzyme, being the crucial factor that starts the production of acid. Finally, a proton bomb, extrudes the acid towards the gastric lumen. The secretion process mentioned above, is progressive lyactivated in three steps, two of which are stimulators -cephalic and gastric phases- and the other one inhibitor or intestinal phase. These stages are started by mental and neurological phenomena -thought, sight, smell or memory-; by food, drugs or other ingested substances; and by products of digestion. Changes in regulation of acid secretion, in the structure of gastro-duodenal mucosal barrier by a wide spectrum of factors and agents including food, drugs and H. pylori, are the basis of acid-peptic disease, entity in which gastric acid plays a fundamental role. From the therapeutic point of view, so at the theoretical as at the practical levels, t is possible to interfere with the secretion of acid by neutralization of some of the steps of the effector cellular process. An adequate knowledge of the basics related to gastric acid, allows to create strategies for the clinical handling of associated pathology, specifically in relation to peptic acid disease in all of the known clinical forms. PMID:12165790

  15. Snowflake Visualization

    Bliven, L. F.; Kucera, P. A.; Rodriguez, P.

    2010-12-01

    NASA Snowflake Video Imagers (SVIs) enable snowflake visualization at diverse field sites. The natural variability of frozen precipitation is a complicating factor for remote sensing retrievals in high latitude regions. Particle classification is important for understanding snow/ice physics, remote sensing polarimetry, bulk radiative properties, surface emissivity, and ultimately, precipitation rates and accumulations. Yet intermittent storms, low temperatures, high winds, remote locations and complex terrain can impede us from observing falling snow in situ. SVI hardware and software have some special features. The standard camera and optics yield 8-bit gray-scale images with resolution of 0.05 x 0.1 mm, at 60 frames per second. Gray-scale images are highly desirable because they display contrast that aids particle classification. Black and white (1-bit) systems display no contrast, so there is less information to recognize particle types, which is particularly burdensome for aggregates. Data are analyzed at one-minute intervals using NASA's Precipitation Link Software that produces (a) Particle Catalogs and (b) Particle Size Distributions (PSDs). SVIs can operate nearly continuously for long periods (e.g., an entire winter season), so natural variability can be documented. Let’s summarize results from field studies this past winter and review some recent SVI enhancements. During the winter of 2009-2010, SVIs were deployed at two sites. One SVI supported weather observations during the 2010 Winter Olympics and Paralympics. It was located close to the summit (Roundhouse) of Whistler Mountain, near the town of Whistler, British Columbia, Canada. In addition, two SVIs were located at the King City Weather Radar Station (WKR) near Toronto, Ontario, Canada. Access was prohibited to the SVI on Whistler Mountain during the Olympics due to security concerns. So to meet the schedule for daily data products, we operated the SVI by remote control. We also upgraded the

  16. Underlying Data for Sequencing the Mitochondrial Genome with the Massively Parallel Sequencing Platform Ion Torrent™ PGM™

    Seo, Seung Bum; Zeng, Xiangpei; King, Jonathan L.; Larue, Bobby L; Assidi, Mourad; Al-Qahtani, Mohamed H; Sajantila, Antti; Budowle, Bruce

    2015-01-01

    Abstract Background Massively parallel sequencing (MPS) technologies have the capacity to sequence targeted regions or whole genomes of multiple nucleic acid samples with high coverage by sequencing millions of DNA fragments simultaneously. Compared with Sanger sequencing, MPS also can reduce labor and cost on a per nucleotide basis and indeed on a per sample basis. In this study, whole genomes of human mitochondria (mtGenome) were sequenced on the Personal Genome Machine (PGMTM) (L...

  17. Underlying Data for Sequencing the Mitochondrial Genome with the Massively Parallel Sequencing Platform Ion Torrent™ PGM™

    Seo, Seung Bum; Zeng, Xiangpei; King, Jonathan L.; Larue, Bobby L; Assidi, Mourad; Al-Qahtani, Mohamed H; Sajantila, Antti; Budowle, Bruce

    2015-01-01

    Background Massively parallel sequencing (MPS) technologies have the capacity to sequence targeted regions or whole genomes of multiple nucleic acid samples with high coverage by sequencing millions of DNA fragments simultaneously. Compared with Sanger sequencing, MPS also can reduce labor and cost on a per nucleotide basis and indeed on a per sample basis. In this study, whole genomes of human mitochondria (mtGenome) were sequenced on the Personal Genome Machine (PGMTM) (Life Technologies, S...

  18. Main: Sequences [KOME

    Full Text Available Sequences Nucleotide Sequence Nucleotide sequence of full length cDNA (trimmed sequence) kome_ine_full_seque...nce_db.fasta.zip kome_ine_full_sequence_db.zip kome_ine_full_sequence_db ...

  19. [Sequencing babies?].

    Jordan, Bertrand

    2015-10-01

    An extension of newborn screening to genome sequencing is now feasible but raises a number of scientific, organisational and ethical issues. This is being explored in discussions and in several funded trials, in order to maximize benefits and avoid some identified risks. As some companies are already offering such a service, this is quite an urgent matter. PMID:26481033

  20. VISUAL LANDSCAPE PERCEPTION

    ASLAN, Fürüzan; Aslan, Edanur; Atik, Atilla

    2015-01-01

    Landscape, the way that people perceive, is described as areas the characteristics of which are made up as a result of the interaction and activity of natural and/or human factors. The composition which is formed as a result of this interaction of natural and cultural components sets forth the visual landscape conception.In the scope of study landscape, perception, visual landscape concepts, visual design factors and visual design principles in support of related descriptions and the visuals ...