WorldWideScience

Sample records for acid sequences visualized

  1. ANTICALIgN: visualizing, editing and analyzing combined nucleotide and amino acid sequence alignments for combinatorial protein engineering.

    Jarasch, Alexander; Kopp, Melanie; Eggenstein, Evelyn; Richter, Antonia; Gebauer, Michaela; Skerra, Arne

    2016-07-01

    ANTIC ALIGN: is an interactive software developed to simultaneously visualize, analyze and modify alignments of DNA and/or protein sequences that arise during combinatorial protein engineering, design and selection. ANTIC ALIGN: combines powerful functions known from currently available sequence analysis tools with unique features for protein engineering, in particular the possibility to display and manipulate nucleotide sequences and their translated amino acid sequences at the same time. ANTIC ALIGN: offers both template-based multiple sequence alignment (MSA), using the unmutated protein as reference, and conventional global alignment, to compare sequences that share an evolutionary relationship. The application of similarity-based clustering algorithms facilitates the identification of duplicates or of conserved sequence features among a set of selected clones. Imported nucleotide sequences from DNA sequence analysis are automatically translated into the corresponding amino acid sequences and displayed, offering numerous options for selecting reading frames, highlighting of sequence features and graphical layout of the MSA. The MSA complexity can be reduced by hiding the conserved nucleotide and/or amino acid residues, thus putting emphasis on the relevant mutated positions. ANTIC ALIGN: is also able to handle suppressed stop codons or even to incorporate non-natural amino acids into a coding sequence. We demonstrate crucial functions of ANTIC ALIGN: in an example of Anticalins selected from a lipocalin random library against the fibronectin extradomain B (ED-B), an established marker of tumor vasculature. Apart from engineered protein scaffolds, ANTIC ALIGN: provides a powerful tool in the area of antibody engineering and for directed enzyme evolution. PMID:27261456

  2. Seq2Logo: a method for construction and visualization of amino acid binding motifs and sequence profiles including sequence weighting, pseudo counts and two-sided representation of amino acid enrichment and depletion

    Thomsen, Martin Christen Frølund; Nielsen, Morten

    2012-01-01

    Seq2Logo is a web-based sequence logo generator. Sequence logos are a graphical representation of the information content stored in a multiple sequence alignment (MSA) and provide a compact and highly intuitive representation of the position-specific amino acid composition of binding motifs, active...... sites, etc. in biological sequences. Accurate generation of sequence logos is often compromised by sequence redundancy and low number of observations. Moreover, most methods available for sequence logo generation focus on displaying the position-specific enrichment of amino acids, discarding the equally...... valuable information related to amino acid depletion. Seq2logo aims at resolving these issues allowing the user to include sequence weighting to correct for data redundancy, pseudo counts to correct for low number of observations and different logotype representations each capturing different aspects...

  3. Locomotor sequence learning in visually guided walking

    Choi, Julia T; Jensen, Peter; Nielsen, Jens Bo

    2016-01-01

    Voluntary limb modifications must be integrated with basic walking patterns during visually guided walking. Here we tested whether voluntary gait modifications can become more automatic with practice. We challenged walking control by presenting visual stepping targets that instructed subjects to...... modify step length from one trial to the next. Our sequence learning paradigm is derived from the serial reaction-time (SRT) task that has been used in upper limb studies. Both random and ordered sequences of step lengths were used to measure sequence-specific and sequence non-specific learning during...... walking. In addition, we determined how age (i.e., healthy young adults vs. children) and biomechanical factors (i.e., walking speed) affected the rate and magnitude of locomotor sequence learning. The results showed that healthy young adults (age 24 ± 5 years, N = 20) could learn a specific sequence of...

  4. MatrixPlot: visualizing sequence constraints

    Gorodkin, Jan; Stærfeldt, Hans Henrik; Lund, Ole;

    1999-01-01

    MatrixPlot: visualizing sequence constraints. Sub-title Abstract Summary : MatrixPlot is a program for making high-quality matrix plots, such as mutual information plots of sequence alignments and distance matrices of sequences with known three-dimensional coordinates. The user can add information...... about the sequences (e.g. a sequence logo profile) along the edges of the plot, as well as zoom in on any region in the plot. Availability : MatrixPlot can be obtained on request, and can also be accessed online at http://www. cbs.dtu.dk/services/MatrixPlot. Contact : gorodkin@cbs.dtu.dk...

  5. Robot Sequencing and Visualization Program (RSVP)

    Cooper, Brian K.; Maxwell,Scott A.; Hartman, Frank R.; Wright, John R.; Yen, Jeng; Toole, Nicholas T.; Gorjian, Zareh; Morrison, Jack C

    2013-01-01

    The Robot Sequencing and Visualization Program (RSVP) is being used in the Mars Science Laboratory (MSL) mission for downlink data visualization and command sequence generation. RSVP reads and writes downlink data products from the operations data server (ODS) and writes uplink data products to the ODS. The primary users of RSVP are members of the Rover Planner team (part of the Integrated Planning and Execution Team (IPE)), who use it to perform traversability/articulation analyses, take activity plan input from the Science and Mission Planning teams, and create a set of rover sequences to be sent to the rover every sol. The primary inputs to RSVP are downlink data products and activity plans in the ODS database. The primary outputs are command sequences to be placed in the ODS for further processing prior to uplink to each rover. RSVP is composed of two main subsystems. The first, called the Robot Sequence Editor (RoSE), understands the MSL activity and command dictionaries and takes care of converting incoming activity level inputs into command sequences. The Rover Planners use the RoSE component of RSVP to put together command sequences and to view and manage command level resources like time, power, temperature, etc. (via a transparent realtime connection to SEQGEN). The second component of RSVP is called HyperDrive, a set of high-fidelity computer graphics displays of the Martian surface in 3D and in stereo. The Rover Planners can explore the environment around the rover, create commands related to motion of all kinds, and see the simulated result of those commands via its underlying tight coupling with flight navigation, motor, and arm software. This software is the evolutionary replacement for the Rover Sequencing and Visualization software used to create command sequences (and visualize the Martian surface) for the Mars Exploration Rover mission.

  6. Coding visual features extracted from video sequences.

    Baroffio, Luca; Cesana, Matteo; Redondi, Alessandro; Tagliasacchi, Marco; Tubaro, Stefano

    2014-05-01

    Visual features are successfully exploited in several applications (e.g., visual search, object recognition and tracking, etc.) due to their ability to efficiently represent image content. Several visual analysis tasks require features to be transmitted over a bandwidth-limited network, thus calling for coding techniques to reduce the required bit budget, while attaining a target level of efficiency. In this paper, we propose, for the first time, a coding architecture designed for local features (e.g., SIFT, SURF) extracted from video sequences. To achieve high coding efficiency, we exploit both spatial and temporal redundancy by means of intraframe and interframe coding modes. In addition, we propose a coding mode decision based on rate-distortion optimization. The proposed coding scheme can be conveniently adopted to implement the analyze-then-compress (ATC) paradigm in the context of visual sensor networks. That is, sets of visual features are extracted from video frames, encoded at remote nodes, and finally transmitted to a central controller that performs visual analysis. This is in contrast to the traditional compress-then-analyze (CTA) paradigm, in which video sequences acquired at a node are compressed and then sent to a central unit for further processing. In this paper, we compare these coding paradigms using metrics that are routinely adopted to evaluate the suitability of visual features in the context of content-based retrieval, object recognition, and tracking. Experimental results demonstrate that, thanks to the significant coding gains achieved by the proposed coding scheme, ATC outperforms CTA with respect to all evaluation metrics. PMID:24818244

  7. Temporal integration windows for naturalistic visual sequences.

    Scott L Fairhall

    Full Text Available There is increasing evidence that the brain possesses mechanisms to integrate incoming sensory information as it unfolds over time-periods of 2-3 seconds. The ubiquity of this mechanism across modalities, tasks, perception and production has led to the proposal that it may underlie our experience of the subjective present. A critical test of this claim is that this phenomenon should be apparent in naturalistic visual experiences. We tested this using movie-clips as a surrogate for our day-to-day experience, temporally scrambling them to require (re- integration within and beyond the hypothesized 2-3 second interval. Two independent experiments demonstrate a step-wise increase in the difficulty to follow stimuli at the hypothesized 2-3 second scrambling condition. Moreover, only this difference could not be accounted for by low-level visual properties. This provides the first evidence that this 2-3 second integration window extends to complex, naturalistic visual sequences more consistent with our experience of the subjective present.

  8. Visualization of the sequence of a couple splitting outside shop

    2015-01-01

    Visualization of tracks of couple walking together before splitting and one goes into shop the other waits outside. The visualization represents the sequence described in figure 7 in the publication 'Taking the temperature of pedestrian movement in public spaces'...

  9. Nucleic acid visualization with UCSF Chimera

    Couch, Gregory S.; Hendrix, Donna K.; Ferrin, Thomas E.

    2006-01-01

    With the increase in the number of large, 3D, high-resolution nucleic acid structures, particularly of the 30S and 50S ribosomal subunits and the intact bacterial ribosome, advancements in the visualization of nucleic acid structural features are essential. Large molecular structures are complicated and detailed, and one goal of visualization software is to allow the user to simplify the display of some features and accent others. We describe an extension to the UCSF Chimera molecular visuali...

  10. Chip-based sequencing nucleic acids

    Beer, Neil Reginald

    2014-08-26

    A system for fast DNA sequencing by amplification of genetic material within microreactors, denaturing, demulsifying, and then sequencing the material, while retaining it in a PCR/sequencing zone by a magnetic field. One embodiment includes sequencing nucleic acids on a microchip that includes a microchannel flow channel in the microchip. The nucleic acids are isolated and hybridized to magnetic nanoparticles or to magnetic polystyrene-coated beads. Microreactor droplets are formed in the microchannel flow channel. The microreactor droplets containing the nucleic acids and the magnetic nanoparticles are retained in a magnetic trap in the microchannel flow channel and sequenced.

  11. Enhanced learning of natural visual sequences in newborn chicks.

    Wood, Justin N; Prasad, Aditya; Goldman, Jason G; Wood, Samantha M W

    2016-07-01

    To what extent are newborn brains designed to operate over natural visual input? To address this question, we used a high-throughput controlled-rearing method to examine whether newborn chicks (Gallus gallus) show enhanced learning of natural visual sequences at the onset of vision. We took the same set of images and grouped them into either natural sequences (i.e., sequences showing different viewpoints of the same real-world object) or unnatural sequences (i.e., sequences showing different images of different real-world objects). When raised in virtual worlds containing natural sequences, newborn chicks developed the ability to recognize familiar images of objects. Conversely, when raised in virtual worlds containing unnatural sequences, newborn chicks' object recognition abilities were severely impaired. In fact, the majority of the chicks raised with the unnatural sequences failed to recognize familiar images of objects despite acquiring over 100 h of visual experience with those images. Thus, newborn chicks show enhanced learning of natural visual sequences at the onset of vision. These results indicate that newborn brains are designed to operate over natural visual input. PMID:27079969

  12. BlockLogo: visualization of peptide and sequence motif conservation.

    Olsen, Lars Rønn; Kudahl, Ulrich Johan; Simon, Christian; Sun, Jing; Schönbach, Christian; Reinherz, Ellis L; Zhang, Guang Lan; Brusic, Vladimir

    2013-12-31

    BlockLogo is a web-server application for the visualization of protein and nucleotide fragments, continuous protein sequence motifs, and discontinuous sequence motifs using calculation of block entropy from multiple sequence alignments. The user input consists of a multiple sequence alignment, selection of motif positions, type of sequence, and output format definition. The output has BlockLogo along with the sequence logo, and a table of motif frequencies. We deployed BlockLogo as an online application and have demonstrated its utility through examples that show visualization of T-cell epitopes and B-cell epitopes (both continuous and discontinuous). Our additional example shows a visualization and analysis of structural motifs that determine the specificity of peptide binding to HLA-DR molecules. The BlockLogo server also employs selected experimentally validated prediction algorithms to enable on-the-fly prediction of MHC binding affinity to 15 common HLA class I and class II alleles as well as visual analysis of discontinuous epitopes from multiple sequence alignments. It enables the visualization and analysis of structural and functional motifs that are usually described as regular expressions. It provides a compact view of discontinuous motifs composed of distant positions within biological sequences. BlockLogo is available at: http://research4.dfci.harvard.edu/cvc/blocklogo/ and http://met-hilab.bu.edu/blocklogo/. PMID:24001880

  13. Visually lossless compression of digital hologram sequences

    Darakis E.; Kowiel M.; Nasanen R.; Naughton T.J.

    2010-01-01

    Digital hologram sequences have great potential for the recording of 3D scenes of moving macroscopic objects as their numerical reconstruction can yield a range of perspective views of the scene. Digital holograms inherently have large information content and lossless coding of holographic data is rather inefficient due to the speckled nature of the interference fringes they contain. Lossy coding of still holograms and hologram sequences has shown promising results. By definition,...

  14. Programming Using Visual Basic for Nucleic Acid Sequences Analysis%Visual BASIC编程在核酸序列分析中的应用研究初探

    葛威; 鲍大鹏; 董战峰; 施铮

    2004-01-01

    利用可视化的编程语言Visual BASIC编写了一个简易实用的核酸序列分析程序,能够自动实现对已知核酸序列的分子质量、Tm值、碱基组成的测定、各种核酸序列的转换和氨基酸序列的推导.同时也详细描述了核酸序列自动分析各功能实现的Visual BASIC语言编程过程.

  15. BlockLogo: Visualization of peptide and sequence motif conservation

    Olsen, Lars Rønn; Kudahl, Ulrich Johan; Simon, Christian;

    2013-01-01

    , selection of motif positions, type of sequence, and output format definition. The output has BlockLogo along with the sequence logo, and a table of motif frequencies. We deployed BlockLogo as an online application and have demonstrated its utility through examples that show visualization of T-cell epitopes...... and B-cell epitopes (both continuous and discontinuous). Our additional example shows a visualization and analysis of structural motifs that determine the specificity of peptide binding to HLA-DR molecules. The BlockLogo server also employs selected experimentally validated prediction algorithms to...... enable on-the-fly prediction of MHC binding affinity to 15 common HLA class I and class II alleles as well as visual analysis of discontinuous epitopes from multiple sequence alignments. It enables the visualization and analysis of structural and functional motifs that are usually described as regular...

  16. Visualizing and Clustering Protein Similarity Networks: Sequences, Structures, and Functions.

    Mai, Te-Lun; Hu, Geng-Ming; Chen, Chi-Ming

    2016-07-01

    Research in the recent decade has demonstrated the usefulness of protein network knowledge in furthering the study of molecular evolution of proteins, understanding the robustness of cells to perturbation, and annotating new protein functions. In this study, we aimed to provide a general clustering approach to visualize the sequence-structure-function relationship of protein networks, and investigate possible causes for inconsistency in the protein classifications based on sequences, structures, and functions. Such visualization of protein networks could facilitate our understanding of the overall relationship among proteins and help researchers comprehend various protein databases. As a demonstration, we clustered 1437 enzymes by their sequences and structures using the minimum span clustering (MSC) method. The general structure of this protein network was delineated at two clustering resolutions, and the second level MSC clustering was found to be highly similar to existing enzyme classifications. The clustering of these enzymes based on sequence, structure, and function information is consistent with each other. For proteases, the Jaccard's similarity coefficient is 0.86 between sequence and function classifications, 0.82 between sequence and structure classifications, and 0.78 between structure and function classifications. From our clustering results, we discussed possible examples of divergent evolution and convergent evolution of enzymes. Our clustering approach provides a panoramic view of the sequence-structure-function network of proteins, helps visualize the relation between related proteins intuitively, and is useful in predicting the structure and function of newly determined protein sequences. PMID:27267620

  17. ProSAT+: visualizing sequence annotations on 3D structure.

    Stank, Antonia; Richter, Stefan; Wade, Rebecca C

    2016-08-01

    PRO: tein S: tructure A: nnotation T: ool-plus (ProSAT(+)) is a new web server for mapping protein sequence annotations onto a protein structure and visualizing them simultaneously with the structure. ProSAT(+) incorporates many of the features of the preceding ProSAT and ProSAT2 tools but also provides new options for the visualization and sharing of protein annotations. Data are extracted from the UniProt KnowledgeBase, the RCSB PDB and the PDBe SIFTS resource, and visualization is performed using JSmol. User-defined sequence annotations can be added directly to the URL, thus enabling visualization and easy data sharing. ProSAT(+) is available at http://prosat.h-its.org. PMID:27284084

  18. Comparative Amino Acid Sequences of Dengue Viruses

    Haishi, Shozo; TANAKA Mariko; Igarashi, Akira

    1990-01-01

    Amino acid (AA) sequences of 4 serotype of dengue viruses deduced from their nucleotide (nt) sequences of genomic RNA were analyzed for each genome segment and each stretch of 10 AA residues. Precursor of membrane protein (pM), and 4 nonstructural proteins (NS1, NS3, NS4B, NS5) were highly conserved, while another nonstructural protein (NS2A) was least conserved among 5 strains of dengue viruses. When homology was compared among heterotypic viruses, type 1 and type 3 dengue viruses showed clo...

  19. Phylo-mLogo: an interactive and hierarchical multiple-logo visualization tool for alignment of many sequences

    Lee DT

    2007-02-01

    Full Text Available Abstract Background When aligning several hundreds or thousands of sequences, such as epidemic virus sequences or homologous/orthologous sequences of some big gene families, to reconstruct the epidemiological history or their phylogenies, how to analyze and visualize the alignment results of many sequences has become a new challenge for computational biologists. Although there are several tools available for visualization of very long sequence alignments, few of them are applicable to the alignments of many sequences. Results A multiple-logo alignment visualization tool, called Phylo-mLogo, is presented in this paper. Phylo-mLogo calculates the variabilities and homogeneities of alignment sequences by base frequencies or entropies. Different from the traditional representations of sequence logos, Phylo-mLogo not only displays the global logo patterns of the whole alignment of multiple sequences, but also demonstrates their local homologous logos for each clade hierarchically. In addition, Phylo-mLogo also allows the user to focus only on the analysis of some important, structurally or functionally constrained sites in the alignment selected by the user or by built-in automatic calculation. Conclusion With Phylo-mLogo, the user can symbolically and hierarchically visualize hundreds of aligned sequences simultaneously and easily check the changes of their amino acid sites when analyzing many homologous/orthologous or influenza virus sequences. More information of Phylo-mLogo can be found at URL http://biocomp.iis.sinica.edu.tw/phylomlogo.

  20. SVA: software for annotating and visualizing sequenced human genomes

    Ge, Dongliang; Ruzzo, Elizabeth K.; Shianna, Kevin V.; He, Min; Pelak, Kimberly; Heinzen, Erin L.; Need, Anna C.; Cirulli, Elizabeth T.; Maia, Jessica M.; Dickson, Samuel P.; Zhu, Mingfu; Singh, Abanish; Allen, Andrew S.; Goldstein, David B.

    2011-01-01

    Summary: Here we present Sequence Variant Analyzer (SVA), a software tool that assigns a predicted biological function to variants identified in next-generation sequencing studies and provides a browser to visualize the variants in their genomic contexts. SVA also provides for flexible interaction with software implementing variant association tests allowing users to consider both the bioinformatic annotation of identified variants and the strength of their associations with studied traits. We illustrate the annotation features of SVA using two simple examples of sequenced genomes that harbor Mendelian mutations. Availability and implementation: Freely available on the web at http://www.svaproject.org. Contact: d.ge@duke.edu Supplementary information: Supplementary data are available at Bioinformatics online. PMID:21624899

  1. 77 FR 65537 - Requirements for Patent Applications Containing Nucleotide Sequence and/or Amino Acid Sequence...

    2012-10-29

    ... Amino Acid Sequence Disclosures ACTION: Proposed collection; comment request. SUMMARY: The United States....'' SUPPLEMENTARY INFORMATION: I. Abstract Patent applications that contain nucleotide and/or amino acid...

  2. IVisTMSA: Interactive Visual Tools for Multiple Sequence Alignments

    Muhammad Tariq Pervez; Masroor Ellahi Babar; Asif Nadeem; Naeem Aslam; Nasir Naveed; Sarfraz Ahmad; Shah Muhammad; Salman Qadri; Muhammad Shahid; Tanveer Hussain; Maryam Javed

    2015-01-01

    IVisTMSA is a software package of seven graphical tools for multiple sequence alignments. MSApad is an editing and analysis tool. It can load 409% more data than Jalview, STRAP, CINEMA, and Base-by-Base. MSA comparator allows the user to visualize consistent and inconsistent regions of reference and test alignments of more than 21-MB size in less than 12 seconds. MSA comparator is 5,200% efficient and more than 40% efficient as compared to BALiBASE c program and FastSP, respectively. MSA reco...

  3. Detection of nucleic acid sequences by invader-directed cleavage

    Brow, Mary Ann D. (Madison, WI); Hall, Jeff Steven Grotelueschen (Madison, WI); Lyamichev, Victor (Madison, WI); Olive, David Michael (Madison, WI); Prudent, James Robert (Madison, WI)

    1999-01-01

    The present invention relates to means for the detection and characterization of nucleic acid sequences, as well as variations in nucleic acid sequences. The present invention also relates to methods for forming a nucleic acid cleavage structure on a target sequence and cleaving the nucleic acid cleavage structure in a site-specific manner. The 5' nuclease activity of a variety of enzymes is used to cleave the target-dependent cleavage structure, thereby indicating the presence of specific nucleic acid sequences or specific variations thereof. The present invention further relates to methods and devices for the separation of nucleic acid molecules based by charge.

  4. Detection of nucleic acid sequences by invader-directed cleavage

    Brow, Mary Ann D.; Hall, Jeff Steven Grotelueschen; Lyamichev, Victor; Olive, David Michael; Prudent, James Robert

    1999-01-01

    The present invention relates to means for the detection and characterization of nucleic acid sequences, as well as variations in nucleic acid sequences. The present invention also relates to methods for forming a nucleic acid cleavage structure on a target sequence and cleaving the nucleic acid cleavage structure in a site-specific manner. The 5' nuclease activity of a variety of enzymes is used to cleave the target-dependent cleavage structure, thereby indicating the presence of specific nucleic acid sequences or specific variations thereof. The present invention further relates to methods and devices for the separation of nucleic acid molecules based by charge.

  5. IVisTMSA: Interactive Visual Tools for Multiple Sequence Alignments.

    Pervez, Muhammad Tariq; Babar, Masroor Ellahi; Nadeem, Asif; Aslam, Naeem; Naveed, Nasir; Ahmad, Sarfraz; Muhammad, Shah; Qadri, Salman; Shahid, Muhammad; Hussain, Tanveer; Javed, Maryam

    2015-01-01

    IVisTMSA is a software package of seven graphical tools for multiple sequence alignments. MSApad is an editing and analysis tool. It can load 409% more data than Jalview, STRAP, CINEMA, and Base-by-Base. MSA comparator allows the user to visualize consistent and inconsistent regions of reference and test alignments of more than 21-MB size in less than 12 seconds. MSA comparator is 5,200% efficient and more than 40% efficient as compared to BALiBASE c program and FastSP, respectively. MSA reconstruction tool provides graphical user interfaces for four popular aligners and allows the user to load several sequence files at a time. FASTA generator converts seven formats of alignments of unlimited size into FASTA format in a few seconds. MSA ID calculator calculates identity matrix of more than 11,000 sequences with a sequence length of 2,696 base pairs in less than 100 seconds. Tree and Distance Matrix calculation tools generate phylogenetic tree and distance matrix, respectively, using neighbor joining% identity and BLOSUM 62 matrix. PMID:25861209

  6. Sensory information in perceptual-motor sequence learning: visual and/or tactile stimuli

    Abrahamse, Elger L.; Lubbe, van der, S.; Verwey, Willem B.

    2009-01-01

    Sequence learning in serial reaction time (SRT) tasks has been investigated mostly with unimodal stimulus presentation. This approach disregards the possibility that sequence acquisition may be guided by multiple sources of sensory information simultaneously. In the current study we trained participants in a SRT task with visual only, tactile only, or bimodal (visual and tactile) stimulus presentation. Sequence performance for the bimodal and visual only training groups was similar, while bot...

  7. Sequence specific visual detection of LAMP reactions by addition of cationic polymers

    Hirano Tsuyoshi

    2006-01-01

    Full Text Available Abstract Background Development of a practical gene point-of-care testing device (g-POCT device requires innovative detection methods for demonstrating the results of the gene amplification reaction without the use of expensive equipment. We have studied a new method for the sequence-specific visual detection of minute amounts of nucleic acids using precipitation reaction by addition of cationic polymers to amplicons of Loop mediated isothermal Amplification (LAMP. Results Oligo DNA probes labeled with different fluorescent dyes were prepared for multiple nucleic acid templates, and the templates were amplified by the LAMP reactions under the existence of the probes. At completion of the LAMP reaction, an optimal amount of low molecular weight polyethylenimine (PEI was added, resulting in the precipitation of the insoluble LAMP amplicon-PEI complex. The fluorescently labeled Oligo DNA probes hybridized to the LAMP product were incorporated into the precipitation, and the precipitate emitted fluorescence corresponding to the amplified nucleic acid templates. The color of emitted fluorescence can be detected easily by naked eye on a conventional UV illuminator. Conclusion The presence or absence of minute amount of nucleic acid templates could be detected in a simple manner through visual assessment for the color of the LAMP amplicon-PEI complex precipitate. We conclude that this detection method may facilitate development of small and simple g-POCT device.

  8. SSE: a nucleotide and amino acid sequence analysis platform

    Simmonds Peter

    2012-01-01

    Abstract Background There is an increasing need to develop bioinformatic tools to organise and analyse the rapidly growing amount of nucleotide and amino acid sequence data in organisms ranging from viruses to eukaryotes. Finding A simple sequence editor (SSE) was developed to create an integrated environment where sequences can be aligned, annotated, classified and directly analysed by a number of built-in bioinformatic programs. SSE incorporates a sequence editor for the creation of sequenc...

  9. Analysis and Visualization Tool for Targeted Amplicon Bisulfite Sequencing on Ion Torrent Sequencers.

    Pabinger, Stephan; Ernst, Karina; Pulverer, Walter; Kallmeyer, Rainer; Valdes, Ana M; Metrustry, Sarah; Katic, Denis; Nuzzo, Angelo; Kriegner, Albert; Vierlinger, Klemens; Weinhaeusel, Andreas

    2016-01-01

    Targeted sequencing of PCR amplicons generated from bisulfite deaminated DNA is a flexible, cost-effective way to study methylation of a sample at single CpG resolution and perform subsequent multi-target, multi-sample comparisons. Currently, no platform specific protocol, support, or analysis solution is provided to perform targeted bisulfite sequencing on a Personal Genome Machine (PGM). Here, we present a novel tool, called TABSAT, for analyzing targeted bisulfite sequencing data generated on Ion Torrent sequencers. The workflow starts with raw sequencing data, performs quality assessment, and uses a tailored version of Bismark to map the reads to a reference genome. The pipeline visualizes results as lollipop plots and is able to deduce specific methylation-patterns present in a sample. The obtained profiles are then summarized and compared between samples. In order to assess the performance of the targeted bisulfite sequencing workflow, 48 samples were used to generate 53 different Bisulfite-Sequencing PCR amplicons from each sample, resulting in 2,544 amplicon targets. We obtained a mean coverage of 282X using 1,196,822 aligned reads. Next, we compared the sequencing results of these targets to the methylation level of the corresponding sites on an Illumina 450k methylation chip. The calculated average Pearson correlation coefficient of 0.91 confirms the sequencing results with one of the industry-leading CpG methylation platforms and shows that targeted amplicon bisulfite sequencing provides an accurate and cost-efficient method for DNA methylation studies, e.g., to provide platform-independent confirmation of Illumina Infinium 450k methylation data. TABSAT offers a novel way to analyze data generated by Ion Torrent instruments and can also be used with data from the Illumina MiSeq platform. It can be easily accessed via the Platomics platform, which offers a web-based graphical user interface along with sample and parameter storage. TABSAT is freely

  10. Los Alamos sequence analysis package for nucleic acids and proteins.

    Kanehisa, M I

    1982-01-01

    An interactive system for computer analysis of nucleic acid and protein sequences has been developed for the Los Alamos DNA Sequence Database. It provides a convenient way to search or verify various sequence features, e.g., restriction enzyme sites, protein coding frames, and properties of coded proteins. Further, the comprehensive analysis package on a large-scale database can be used for comparative studies on sequence and structural homologies in order to find unnoted information stored i...

  11. MEANS AND METHODS FOR CLONING NUCLEIC ACID SEQUENCES

    Geertsma, Eric Robin; Poolman, Berend

    2008-01-01

    The invention provides means and methods for efficiently cloning nucleic acid sequences of interest in micro-organisms that are less amenable to conventional nucleic acid manipulations, as compared to, for instance, E.coli. The present invention enables high-throughput cloning (and, preferably, expr

  12. An Integrated Sequence-Structure Database incorporating matching mRNA sequence, amino acid sequence and protein three-dimensional structure data.

    Adzhubei, I A; Adzhubei, A. A.; Neidle, S.

    1998-01-01

    We have constructed a non-homologous database, termed the Integrated Sequence-Structure Database (ISSD) which comprises the coding sequences of genes, amino acid sequences of the corresponding proteins, their secondary structure and straight phi,psi angles assignments, and polypeptide backbone coordinates. Each protein entry in the database holds the alignment of nucleotide sequence, amino acid sequence and the PDB three-dimensional structure data. The nucleotide and amino acid sequences for ...

  13. Amino acid sequences of proteins from Leptospira serovar pomona

    Alves Selmo F

    2000-01-01

    Full Text Available This report describes a partial amino acid sequences from three putative outer envelope proteins from Leptospira serovar pomona. In order to obtain internal fragments for protein sequencing, enzymatic and chemical digestion was performed. The enzyme clostripain was used to digest the proteins 32 and 45 kDa. In situ digestion of 40 kDa molecular weight protein was accomplished using cyanogen bromide. The 32 kDa protein generated two fragments, one of 21 kDa and another of 10 kDa that yielded five residues. A fragment of 24 kDa that yielded nineteen residues of amino acids was obtained from 45 kDa protein. A fragment with a molecular weight of 20 kDa, yielding a twenty amino acids sequence from the 40 kDa protein.

  14. Visual Sequence Learning in Infancy: Domain-General and Domain-Specific Associations with Language

    Shafto, Carissa L.; Conway, Christopher M.; Field, Suzanne L.; Houston, Derek M.

    2012-01-01

    Research suggests that nonlinguistic sequence learning abilities are an important contributor to language development (Conway, Bauernschmidt, Huang, & Pisoni, 2010). The current study investigated visual sequence learning (VSL) as a possible predictor of vocabulary development in infants. Fifty-eight 8.5-month-old infants were presented with a…

  15. Visual Analytics of Temporal Event Sequences in News Streams

    Krstajic, Milos

    2014-01-01

    Finding new ways of extracting and analyzing useful information from exploding volumes of unstructured and semi-structured text sources has become one of the greatest challenges in the era of big data. After new technologies have enabled efficient solutions for collecting and storing these data, the next step in computer science research is to develop scalable approaches for efficient analysis of dynamics in text streams. This dissertation addresses this challenge by examining how visual anal...

  16. Visual analysis of next-generation sequencing data to detect overlapping genes in bacterial genomes

    Simon, Svenja; Oelke, Daniela; Landstorfer, Richard; Neuhaus, Klaus; Keim, Daniel

    2011-01-01

    Next generation sequencing (NGS) technologies are about to revolutionize biological research. Being able to sequence large amounts of DNA or, indirectly, RNA sequences in a short time period opens numerous new possibilities. However, analyzing the large amounts of data generated in NGS is a serious challenge, which requires novel data analysis and visualization methods to allow the biological experimenter to understand the results. In this paper, we describe a novel system to deal with the fl...

  17. Visual Sequence Learning in Infancy: Domain-General and Domain-Specific Associations with Language

    2011-01-01

    Research suggests that non-linguistic sequence learning abilities are an important contributor to language development (Conway, Bauernschmidt, Huang, & Pisoni, 2010). The current study investigated visual sequence learning as a possible predictor of vocabulary development in infants. Fifty-eight 8.5-month-old infants were presented with a three-location spatiotemporal sequence of multi-colored geometric shapes. Early language skills were assessed using the MacArthur-Bates CDI. Analyses of chi...

  18. Representation of protein-sequence information by amino acid subalphabets

    Andersen, C.A.F.; Brunak, Søren

    2004-01-01

    -sequence information, using machine learning strategies, where the primary goal is the discovery of novel powerful representations for use in AI techniques. In the case of proteins and the 20 different amino acids they typically contain, it is also a secondary goal to discover how the current selection of amino acids......-which now are common in proteins-might have emerged from simpler selections, or alphabets, in use earlier during the evolution of living organisms....

  19. On Quantum Algorithm for Multiple Alignment of Amino Acid Sequences

    Iriyama, Satoshi; Ohya, Masanori

    2009-02-01

    The alignment of genome sequences or amino acid sequences is one of fundamental operations for the study of life. Usual computational complexity for the multiple alignment of N sequences with common length L by dynamic programming is O(LN). This alignment is considered as one of the NP problems, so that it is desirable to find a nice algorithm of the multiple alignment. Thus in this paper we propose the quantum algorithm for the multiple alignment based on the works12,1,2 in which the NP complete problem was shown to be the P problem by means of quantum algorithm and chaos information dynamics.

  20. The amino-acid sequence of kangaroo pancreatic ribonuclease.

    Gaastra, W; Welling, G W; Beintema, J J

    1978-05-01

    Red kangaroo (Macropus rufus) ribonuclease was isolated from pancreatic tissue by affinity chromatography. The amino acid sequence was determined by automatic sequencing of overlapping large fragments and by analysis of shorter peptides obtained by digestion with a number of proteolytic enzymes. The polypeptide chain consists of 122 amino acid residues. Compared to other ribonucleases, the N-terminal residue and residue 114 are deleted. In other pancreatic ribonucleases position 114 is occupied by a cis proline residue in an external loop at the surface of the molecule. Other remarkable substitutions are the presence of a tyrosine residue at position 123 instead of a serine which forms a hydrogen bond with the pyrimidine ring of a nucleotide substrate, and a number of hydrophobichydrophilic interchanges in the sequence 51-55, which forms part of an alpha-helix in bovine ribonuclease and exhibits few substitutions in the placental mammals. Kangaroo ribonuclease contains no carbohydrate, although the enzyme possesses a recognition site for carbohydrate attachment in the sequence Asn-Val-Thr (62-64). The enzyme differs at about 35-40% of the positions from all other mammalian pancreatic ribonucleases sequenced to date, which is in agreement with the early divergence between the marsupials and the placental mammals. From fragmentary data a tentative sequence of red-necked wallaby (Macropus rufogriseus) pancreatic ribonuclease has been derived. Eight differences with the kangaroo sequence were found. PMID:658039

  1. Visual programming for next-generation sequencing data analytics

    Milicchio, Franco; Rose, Rebecca; Bian, Jiang; Min, Jae; Prosperi, Mattia

    2016-01-01

    Background High-throughput or next-generation sequencing (NGS) technologies have become an established and affordable experimental framework in biological and medical sciences for all basic and translational research. Processing and analyzing NGS data is challenging. NGS data are big, heterogeneous, sparse, and error prone. Although a plethora of tools for NGS data analysis has emerged in the past decade, (i) software development is still lagging behind data generation capabilities, and (ii) ...

  2. Age-Related Declines in Early Sensory Memory: Identification of Rapid Auditory and Visual Stimulus Sequences

    Fogerty, Daniel; Humes, Larry E.; Busey, Thomas A.

    2016-01-01

    Age-related temporal-processing declines of rapidly presented sequences may involve contributions of sensory memory. This study investigated recall for rapidly presented auditory (vowel) and visual (letter) sequences presented at six different stimulus onset asynchronies (SOA) that spanned threshold SOAs for sequence identification. Younger, middle-aged, and older adults participated in all tasks. Results were investigated at both equivalent performance levels (i.e., SOA threshold) and at identical physical stimulus values (i.e., SOAs). For four-item sequences, results demonstrated best performance for the first and last items in the auditory sequences, but only the first item for visual sequences. For two-item sequences, adults identified the second vowel or letter significantly better than the first. Overall, when temporal-order performance was equated for each individual by testing at SOA thresholds, recall accuracy for each position across the age groups was highly similar. These results suggest that modality-specific processing declines of older adults primarily determine temporal-order performance for rapid sequences. However, there is some evidence for a second amodal processing decline in older adults related to early sensory memory for final items in a sequence. This selective deficit was observed particularly for longer sequence lengths and was not accounted for by temporal masking. PMID:27199737

  3. Phylo-mLogo: an interactive and hierarchical multiple-logo visualization tool for alignment of many sequences

    Lee DT; Shih Arthur; Peng Chin-Lin; Wu Yu-Wei

    2007-01-01

    Abstract Background When aligning several hundreds or thousands of sequences, such as epidemic virus sequences or homologous/orthologous sequences of some big gene families, to reconstruct the epidemiological history or their phylogenies, how to analyze and visualize the alignment results of many sequences has become a new challenge for computational biologists. Although there are several tools available for visualization of very long sequence alignments, few of them are applicable to the ali...

  4. PyVDT: A PsychoPy-Based Visual Sequence Detection Task

    Hansen, Mads

    2016-01-01

    PyVDT is a computerized test consisting of two brief visual sequence detection tasks in which participants watch single digits displayed on screen and respond whenever target digit sequences (even – odd – even) are displayed. The total duration of the test is around five minutes. PyVDT is a reimplementation of the Visual Monitoring Task (VMT), a task thought to measure working memory.PyVDT uses the PsychoPy API to display digits, to plot diagnostic information, and to output log files and res...

  5. VarSifter: Visualizing and analyzing exome-scale sequence variation data on a desktop computer

    Teer, Jamie K.; Green, Eric D.; Mullikin, James C.; Biesecker, Leslie G.

    2011-01-01

    Summary: VarSifter is a graphical software tool for desktop computers that allows investigators of varying computational skills to easily and quickly sort, filter, and sift through sequence variation data. A variety of filters and a custom query framework allow filtering based on any combination of sample and annotation information. By simplifying visualization and analyses of exome-scale sequence variation data, this program will help bring the power and promise of massively-parallel DNA seq...

  6. Subfamily logos: visualization of sequence deviations at alignment positions with high information content

    Beitz Eric

    2006-06-01

    Full Text Available Abstract Background Recognition of relevant sequence deviations can be valuable for elucidating functional differences between protein subfamilies. Interesting residues at highly conserved positions can then be mutated and experimentally analyzed. However, identification of such sites is tedious because automated approaches are scarce. Results Subfamily logos visualize subfamily-specific sequence deviations. The display is similar to classical sequence logos but extends into the negative range. Positive, upright characters correspond to residues which are characteristic for the subfamily, negative, upside-down characters to residues typical for the remaining sequences. The symbol height is adjusted to the information content of the alignment position. Residues which are conserved throughout do not appear. Conclusion Subfamily logos provide an intuitive display of relevant sequence deviations. The method has proven to be valid using a set of 135 aligned aquaporin sequences in which established subfamily-specific positions were readily identified by the algorithm.

  7. Deoxyribonucleic acid sequence mapping on metaphase chromosomes by immunoelectron microscopy

    Nucleic acid sequences can be localized on chromosomes in the electron microscope after hybridization with a biotinylated DNA probe followed by detection with a primary antibiotin antibody and a secondary antibody coupled to colloidal gold. Hybridization probes can also be labelled with alternative ligands such as N-acetoxy-2-acetylaminofluorene (AAF), Dinitrophenyl-dUTP and Digoxigenin-dUTP. Multiple labelling is possible if these differently modified DNA probes are used in conjunction with colloidal gold preparations of varying particle sizes. A substantial signal amplification can be achieved by incubating preparations with successive cycles of primary antibiotin antibody followed by a biotinylated secondary antibody. Detection is with Streptavidin-gold, and in the case of highly and moderately repeated sequences, the signal is visible in the light microscope. Detailed protocols are given for EM in-situ hybridization to whole mount metaphase chromosomes and include instructions necessary to perform multiple sequence localization and signal amplification

  8. Learning of Grammar-Like Visual Sequences by Adults with and without Language-Learning Disabilities

    Aguilar, Jessica M.; Plante, Elena

    2014-01-01

    Purpose: Two studies examined learning of grammar-like visual sequences to determine whether a general deficit in statistical learning characterizes this population. Furthermore, we tested the hypothesis that difficulty in sustaining attention during the learning task might account for differences in statistical learning. Method: In Study 1,…

  9. PyVDT: A PsychoPy-Based Visual Sequence Detection Task

    Mads Hansen

    2016-06-01

    Full Text Available PyVDT is a computerized test consisting of two brief visual sequence detection tasks in which participants watch single digits displayed on screen and respond whenever target digit sequences (even – odd – even are displayed. The total duration of the test is around five minutes. PyVDT is a reimplementation of the Visual Monitoring Task (VMT, a task thought to measure working memory. PyVDT uses the PsychoPy API to display digits, to plot diagnostic information, and to output log files and results. It is available for download on Figshare and GitHub. PyVDT is free software and has minimal software and hardware requirements. Thus, PyVDT provides a readily available visual monitoring task for use in experiments within cognitive science and related fields.

  10. Quantum-Sequencing: Biophysics of quantum tunneling through nucleic acids

    Casamada Ribot, Josep; Chatterjee, Anushree; Nagpal, Prashant

    2014-03-01

    Tunneling microscopy and spectroscopy has extensively been used in physical surface sciences to study quantum tunneling to measure electronic local density of states of nanomaterials and to characterize adsorbed species. Quantum-Sequencing (Q-Seq) is a new method based on tunneling microscopy for electronic sequencing of single molecule of nucleic acids. A major goal of third-generation sequencing technologies is to develop a fast, reliable, enzyme-free single-molecule sequencing method. Here, we present the unique ``electronic fingerprints'' for all nucleotides on DNA and RNA using Q-Seq along their intrinsic biophysical parameters. We have analyzed tunneling spectra for the nucleotides at different pH conditions and analyzed the HOMO, LUMO and energy gap for all of them. In addition we show a number of biophysical parameters to further characterize all nucleobases (electron and hole transition voltage and energy barriers). These results highlight the robustness of Q-Seq as a technique for next-generation sequencing.

  11. Nucleotide sequence and corresponding amino acid sequence of the gene for the major antigen of foot and mouth disease virus.

    Kurz, C; Forss, S; Küpper, H; K Strohmaier; Schaller, H

    1981-01-01

    A segment of 1160 nucleotides of the FMDV genome has been sequenced using three overlapping fragments of cloned cDNA from FMDV strain O1K. This sequence contains the coding sequence for the viral capsid protein VP1 as shown by its homology to known and newly determined amino acid sequences from this man antigenic polypeptide of the FMDV virion. The structural gene for VP1 comprises 639 nucleotides which specify a sequence of 213 amino acids for the VP1 protein. The coding sequence is not flan...

  12. Correlation between fibroin amino acid sequence and physical silk properties.

    Fedic, Robert; Zurovec, Michal; Sehnal, Frantisek

    2003-09-12

    The fiber properties of lepidopteran silk depend on the amino acid repeats that interact during H-fibroin polymerization. The aim of our research was to relate repeat composition to insect biology and fiber strength. Representative regions of the H-fibroin genes were sequenced and analyzed in three pyralid species: wax moth (Galleria mellonella), European flour moth (Ephestia kuehniella), and Indian meal moth (Plodia interpunctella). The amino acid repeats are species-specific, evidently a diversification of an ancestral region of 43 residues, and include three types of regularly dispersed motifs: modifications of GSSAASAA sequence, stretches of tripeptides GXZ where X and Z represent bulky residues, and sequences similar to PVIVIEE. No concatenations of GX dipeptide or alanine, which are typical for Bombyx silkworms and Antheraea silk moths, respectively, were found. Despite different repeat structure, the silks of G. mellonella and E. kuehniella exhibit similar tensile strength as the Bombyx and Antheraea silks. We suggest that in these latter two species, variations in the repeat length obstruct repeat alignment, but sufficiently long stretches of iterated residues get superposed to interact. In the pyralid H-fibroins, interactions of the widely separated and diverse motifs depend on the precision of repeat matching; silk is strong in G. mellonella and E. kuehniella, with 2-3 types of long homogeneous repeats, and nearly 10 times weaker in P. interpunctella, with seven types of shorter erratic repeats. The high proportion of large amino acids in the H-fibroin of pyralids has probably evolved in connection with the spinning habit of caterpillars that live in protective silk tubes and spin continuously, enlarging the tubes on one end and partly devouring the other one. The silk serves as a depot of energetically rich and essential amino acids that may be scarce in the diet. PMID:12816957

  13. Cervical cancer risk factors and feasibility of visual inspection with acetic acid screening in Sudan

    Ibrahim, Ahmed; Rasch, Vibeke; Pukkala, Eero;

    2011-01-01

    To assess the risk factors of cervical cancer and the feasibility and acceptability of a visual inspection with acetic acid (VIA) screening method in a primary health center in Khartoum, Sudan.......To assess the risk factors of cervical cancer and the feasibility and acceptability of a visual inspection with acetic acid (VIA) screening method in a primary health center in Khartoum, Sudan....

  14. Nucleic acid sequence detection using multiplexed oligonucleotide PCR

    Nolan, John P.; White, P. Scott

    2006-12-26

    Methods for rapidly detecting single or multiple sequence alleles in a sample nucleic acid are described. Provided are all of the oligonucleotide pairs capable of annealing specifically to a target allele and discriminating among possible sequences thereof, and ligating to each other to form an oligonucleotide complex when a particular sequence feature is present (or, alternatively, absent) in the sample nucleic acid. The design of each oligonucleotide pair permits the subsequent high-level PCR amplification of a specific amplicon when the oligonucleotide complex is formed, but not when the oligonucleotide complex is not formed. The presence or absence of the specific amplicon is used to detect the allele. Detection of the specific amplicon may be achieved using a variety of methods well known in the art, including without limitation, oligonucleotide capture onto DNA chips or microarrays, oligonucleotide capture onto beads or microspheres, electrophoresis, and mass spectrometry. Various labels and address-capture tags may be employed in the amplicon detection step of multiplexed assays, as further described herein.

  15. Isolating Visual and Proprioceptive Components of Motor Sequence Learning in ASD.

    Sharer, Elizabeth A; Mostofsky, Stewart H; Pascual-Leone, Alvaro; Oberman, Lindsay M

    2016-05-01

    In addition to defining impairments in social communication skills, individuals with autism spectrum disorder (ASD) also show impairments in more basic sensory and motor skills. Development of new skills involves integrating information from multiple sensory modalities. This input is then used to form internal models of action that can be accessed when both performing skilled movements, as well as understanding those actions performed by others. Learning skilled gestures is particularly reliant on integration of visual and proprioceptive input. We used a modified serial reaction time task (SRTT) to decompose proprioceptive and visual components and examine whether patterns of implicit motor skill learning differ in ASD participants as compared with healthy controls. While both groups learned the implicit motor sequence during training, healthy controls showed robust generalization whereas ASD participants demonstrated little generalization when visual input was constant. In contrast, no group differences in generalization were observed when proprioceptive input was constant, with both groups showing limited degrees of generalization. The findings suggest, when learning a motor sequence, individuals with ASD tend to rely less on visual feedback than do healthy controls. Visuomotor representations are considered to underlie imitative learning and action understanding and are thereby crucial to social skill and cognitive development. Thus, anomalous patterns of implicit motor learning, with a tendency to discount visual feedback, may be an important contributor in core social communication deficits that characterize ASD. Autism Res 2016, 9: 563-569. © 2015 International Society for Autism Research, Wiley Periodicals, Inc. PMID:26442448

  16. Amino acid sequences used for clusterintg (Multi FASTA format) - Gclust Server | LSDB Archive [Life Science Database Archive metadata

    Full Text Available Gclust Server Amino acid sequences used for clusterintg (Multi FASTA format) Data detail Data name Amino acid sequences use... Site Policy | Contact Us Amino acid sequences used for clusterintg (Multi FASTA format) - Gclust Server | LSDB Archive ...

  17. fluff: exploratory analysis and visualization of high-throughput sequencing data.

    Georgiou, Georgios; van Heeringen, Simon J

    2016-01-01

    In this article we describe fluff, a software package that allows for simple exploration, clustering and visualization of high-throughput sequencing data mapped to a reference genome. The package contains three command-line tools to generate publication-quality figures in an uncomplicated manner using sensible defaults. Genome-wide data can be aggregated, clustered and visualized in a heatmap, according to different clustering methods. This includes a predefined setting to identify dynamic clusters between different conditions or developmental stages. Alternatively, clustered data can be visualized in a bandplot. Finally, fluff includes a tool to generate genomic profiles. As command-line tools, the fluff programs can easily be integrated into standard analysis pipelines. The installation is straightforward and documentation is available at http://fluff.readthedocs.org. Availability. fluff is implemented in Python and runs on Linux. The source code is freely available for download at https://github.com/simonvh/fluff. PMID:27547532

  18. Timing and sequence of brain activity in top-down control of visual-spatial attention.

    Tineke Grent-'t-Jong; Woldorff, Marty G.

    2007-01-01

    Recent brain imaging studies using functional magnetic resonance imaging (fMRI) have implicated a frontal-parietal network in the top-down control of attention. However, little is known about the timing and sequence of activations within this network. To investigate these timing questions, we used event-related electrical brain potentials (ERPs) and a specially designed visual-spatial attentional-cueing paradigm, which were applied as part of a multi-methodological approach that included a cl...

  19. HYBRIDCHECK: software for the rapid detection, visualization and dating of recombinant regions in genome sequence data.

    Ward, Ben J; van Oosterhout, Cock

    2016-03-01

    HYBRIDCHECK is a software package to visualize the recombination signal in large DNA sequence data set, and it can be used to analyse recombination, genetic introgression, hybridization and horizontal gene transfer. It can scan large (multiple kb) contigs and whole-genome sequences of three or more individuals. HYBRIDCHECK is written in the r software for OS X, Linux and Windows operating systems, and it has a simple graphical user interface. In addition, the r code can be readily incorporated in scripts and analysis pipelines. HYBRIDCHECK implements several ABBA-BABA tests and visualizes the effects of hybridization and the resulting mosaic-like genome structure in high-density graphics. The package also reports the following: (i) the breakpoint positions, (ii) the number of mutations in each introgressed block, (iii) the probability that the identified region is not caused by recombination and (iv) the estimated age of each recombination event. The divergence times between the donor and recombinant sequence are calculated using a JC, K80, F81, HKY or GTR correction, and the dating algorithm is exceedingly fast. By estimating the coalescence time of introgressed blocks, it is possible to distinguish between hybridization and incomplete lineage sorting. HYBRIDCHECK is libré software and it and its manual are free to download from http://ward9250.github.io/HybridCheck/. PMID:26394708

  20. Carbon nanotube-based labels for highly sensitive colorimetric and aggregation-based visual detection of nucleic acids

    A novel carbon nanotube (CNT) derived label capable of dramatic signal amplification of nucleic acid detection and direct visual detection of target hybridization has been developed. Highly sensitive colorimetric detection of human acute lymphocytic leukemia (ALL) related oncogene sequences amplified by the novel CNT-based label was demonstrated. Atomic force microscope (AFM) images confirmed that a monolayer of horseradish peroxidase and detection probe molecules was immobilized along the carboxylated CNT carrier. The resulting CNT labels significantly enhanced the nucleic acid assay sensitivity by at least 1000 times compared to that of conventional labels used in enzyme-linked oligosorbent assay (ELOSA). An excellent detection limit of 1 x 10-12 M (60 x 10-18 mol in 60 μl) and a four-order wide dynamic range of target concentration were achieved. Hybridizations using these labels were coupled to a concentration-dependent formation of visible dark aggregates. Targets can thus be detected simply with visual inspection, eliminating the need for expensive and sophisticated detection systems. The approach holds promise for ultrasensitive and low cost visual inspection and colorimetric nucleic acid detection in point-of-care and early disease diagnostic application

  1. 37 CFR 1.822 - Symbols and format to be used for nucleotide and/or amino acid sequence data.

    2010-07-01

    ... for nucleotide and/or amino acid sequence data. 1.822 Section 1.822 Patents, Trademarks, and... Amino Acid Sequences § 1.822 Symbols and format to be used for nucleotide and/or amino acid sequence data. (a) The symbols and format to be used for nucleotide and/or amino acid sequence data...

  2. Contig sequences and their annotation (amino acid sequence and results of homology search), and expression profile - Dicty_cDB | LSDB Archive [Life Science Database Archive metadata

    Full Text Available Dicty_cDB Contig sequences and their annotation (amino acid sequence and results of homology search), and ex...pression profile Data detail Data name Contig sequences and their annotation (amino acid sequence and result... sequences of cDNA sequences of Dictyostelium discoideum and their annotation (amino acid sequence and resul...ence and full-length cDNA sequence by the assembly program Phrap ( http://www.phrap.org/index.html ). Link to the... list of clones constituting the contig, the information on its mapping to the genome mapped to genome sequence and the

  3. The learning of a sequence of visual patterns by the ant Cataglyphis cursor

    Chameron, S.; Schatz, B.; Pastergue-Ruiz, I.; Beugnon, G.; Collett, T S

    1998-01-01

    We used a maze to explore the ability of Cataglyphis cursor to store multiple visual patterns presented in a fixed sequence. Ants were trained individually to negotiate a linear maze that consisted of four boxes connected by tunnels and through which an ant travelled from a sucrose feeder back to its nest. Each box had one entrance and two possible exits. One exit led to a blocked tunnel and the other to an open tunnel leading to the entrance of the next box. The open and closed exits in each...

  4. GeneWiz browser: An Interactive Tool for Visualizing Sequenced Chromosomes

    Hallin, Peter Fischer; Stærfeldt, Hans Henrik; Rotenberg, Eva;

    2009-01-01

    readability and increased functionality compared to other browsers. The tool allows the user to select the display of various genomic features, color setting and data ranges. Custom numerical data can be added to the plot, allowing for example visualization of gene expression and regulation data. Further......, standard atlases are pre-generated for all prokaryotic genomes available in GenBank, providing a fast overview of all available genomes, including recently deposited genome sequences. The tool is available online from http://www.cbs.dtu.dk/services/gwBrowser. [Supplemental material including interactive...

  5. Dietary Omega-3 Fatty Acid Deficiency and Visual Loss in Infant Rhesus Monkeys

    Neuringer, M.; Connor, W.E.; Van Petten, C; Barstad, L

    1984-01-01

    Linolenic acid (18:3 omega 3) is a dietary precursor of docosahexaenoic acid (22:6 omega 3), the major fatty acid in the photoreceptor membranes of the retina. We hypothesized that rhesus monkeys deprived of dietary omega-3 fatty acids during prenatal and postnatal development would show plasma depletion of these fatty acids and visual impairment. Semipurified diets low in omega-3 fatty acids were fed to one group of adult female rhesus monkeys throughout pregnancy and to their infants from b...

  6. Visualization of sialoglycoproteins in polyacrylamide gels by acidic ninhydrin reaction.

    Yao,Kenzabroh; Ubuka,Toshihiko; Masuoka,Noriyoshi; Kinuta, Masahiro; Ohta, Jun; Ishino,Kazushi

    1990-01-01

    A new method for staining sialoglycoproteins in polyacrylamide gel after disc electrophoresis is described. The method utilizes the reaction of sialic acids with an acidic ninhydrin reagent which yields a stable color with an absorption maximum at 470 nm. After electrophoresis, the polyacrylamide gel is placed in a test tube and heated with 5 ml of the acidic ninhydrin reagent for 10 min in a boiling water bath. Sialoglycoproteins are detected as brown bands. No additional procedure such as d...

  7. Human retroviruses and AIDS 1996. A compilation and analysis of nucleic acid and amino acid sequences

    Myers, G.; Foley, B.; Korber, B. [eds.] [Los Alamos National Lab., NM (United States). Theoretical Div.; Mellors, J.W. [ed.] [Univ. of Pittsburgh, PA (United States); Jeang, K.T. [ed.] [National Institutes of Health, Bethesda, MD (United States). Molecular Virology Section; Wain-Hobson, S. [Pasteur Inst., Paris (France)] [ed.

    1997-04-01

    This compendium and the accompanying floppy diskettes are the result of an effort to compile and rapidly publish all relevant molecular data concerning the human immunodeficiency viruses (HIV) and related retroviruses. The scope of the compendium and database is best summarized by the five parts that it comprises: (1) Nuclear Acid Alignments and Sequences; (2) Amino Acid Alignments; (3) Analysis; (4) Related Sequences; and (5) Database Communications. Information within all the parts is updated throughout the year on the Web site, http://hiv-web.lanl.gov. While this publication could take the form of a review or sequence monograph, it is not so conceived. Instead, the literature from which the database is derived has simply been summarized and some elementary computational analyses have been performed upon the data. Interpretation and commentary have been avoided insofar as possible so that the reader can form his or her own judgments concerning the complex information. In addition to the general descriptions of the parts of the compendium, the user should read the individual introductions for each part.

  8. PHYLOViZ: phylogenetic inference and data visualization for sequence based typing methods

    Francisco Alexandre P

    2012-05-01

    Full Text Available Abstract Background With the decrease of DNA sequencing costs, sequence-based typing methods are rapidly becoming the gold standard for epidemiological surveillance. These methods provide reproducible and comparable results needed for a global scale bacterial population analysis, while retaining their usefulness for local epidemiological surveys. Online databases that collect the generated allelic profiles and associated epidemiological data are available but this wealth of data remains underused and are frequently poorly annotated since no user-friendly tool exists to analyze and explore it. Results PHYLOViZ is platform independent Java software that allows the integrated analysis of sequence-based typing methods, including SNP data generated from whole genome sequence approaches, and associated epidemiological data. goeBURST and its Minimum Spanning Tree expansion are used for visualizing the possible evolutionary relationships between isolates. The results can be displayed as an annotated graph overlaying the query results of any other epidemiological data available. Conclusions PHYLOViZ is a user-friendly software that allows the combined analysis of multiple data sources for microbial epidemiological and population studies. It is freely available at http://www.phyloviz.net.

  9. Natural vs. random protein sequences: Discovering combinatorics properties on amino acid words.

    Santoni, Daniele; Felici, Giovanni; Vergni, Davide

    2016-02-21

    Casual mutations and natural selection have driven the evolution of protein amino acid sequences that we observe at present in nature. The question about which is the dominant force of proteins evolution is still lacking of an unambiguous answer. Casual mutations tend to randomize protein sequences while, in order to have the correct functionality, one expects that selection mechanisms impose rigid constraints on amino acid sequences. Moreover, one also has to consider that the space of all possible amino acid sequences is so astonishingly large that it could be reasonable to have a well tuned amino acid sequence indistinguishable from a random one. In order to study the possibility to discriminate between random and natural amino acid sequences, we introduce different measures of association between pairs of amino acids in a sequence, and apply them to a dataset of 1047 natural protein sequences and 10,470 random sequences, carefully generated in order to preserve the relative length and amino acid distribution of the natural proteins. We analyze the multidimensional measures with machine learning techniques and show that, to a reasonable extent, natural protein sequences can be differentiated from random ones. PMID:26656109

  10. Transcriptome Sequencing in Response to Salicylic Acid in Salvia miltiorrhiza.

    Zhang, Xiaoru; Dong, Juane; Liu, Hailong; Wang, Jiao; Qi, Yuexin; Liang, Zongsuo

    2016-01-01

    Salvia miltiorrhiza is a traditional Chinese herbal medicine, whose quality and yield are often affected by diseases and environmental stresses during its growing season. Salicylic acid (SA) plays a significant role in plants responding to biotic and abiotic stresses, but the involved regulatory factors and their signaling mechanisms are largely unknown. In order to identify the genes involved in SA signaling, the RNA sequencing (RNA-seq) strategy was employed to evaluate the transcriptional profiles in S. miltiorrhiza cell cultures. A total of 50,778 unigenes were assembled, in which 5,316 unigenes were differentially expressed among 0-, 2-, and 8-h SA induction. The up-regulated genes were mainly involved in stimulus response and multi-organism process. A core set of candidate novel genes coding SA signaling component proteins was identified. Many transcription factors (e.g., WRKY, bHLH and GRAS) and genes involved in hormone signal transduction were differentially expressed in response to SA induction. Detailed analysis revealed that genes associated with defense signaling, such as antioxidant system genes, cytochrome P450s and ATP-binding cassette transporters, were significantly overexpressed, which can be used as genetic tools to investigate disease resistance. Our transcriptome analysis will help understand SA signaling and its mechanism of defense systems in S. miltiorrhiza. PMID:26808150

  11. AllelicImbalance: An R/ bioconductor package for detecting, managing, and visualizing allele expression imbalance data from RNA sequencing

    Gådin, Jesper R.; van't Hooft, Ferdinand M.; Eriksson, Per;

    2015-01-01

    Background: One aspect in which RNA sequencing is more valuable than microarray-based methods is the ability to examine the allelic imbalance of the expression of a gene. This process is often a complex task that entails quality control, alignment, and the counting of reads over heterozygous single...... possible biases. Results: We present AllelicImblance, a software program that is designed to detect, manage, and visualize allelic imbalances comprehensively. The purpose of this software is to allow users to pose genetic questions in any RNA sequencing experiment quickly, enhancing the general utility of...... RNA sequencing. The visualization features can reveal notable, non-trivial allelic imbalance behavior over specific regions, such as exons. Conclusions: The software provides a complete framework to perform allelic imbalance analyses of aligned RNA sequencing data, from detection to visualization...

  12. Detection of CIN by naked eye visualization after application of acetic acid.

    Londhe M; George S; Seshadri L

    1997-01-01

    A prospective study was undertaken to determine the sensitivity and specificity of acetic application to the cervix followed by naked eye visualization as a screening test for detection of cervical intraepithelial neoplasia. Three hundred and seventy two sexually active woman in the reproductive age group were studied. All the women underwent Papanicolaou test, acetic acid test and colposcopy. One hundred and seventy five woman were acetic acid test negative, 197 women were acetic acid test p...

  13. A noncontrast-enhanced pulse sequence optimized to visualize human peripheral vessels

    Gjesdal, Kjell-Inge [Sunnmoere MR-Klinikk, Aalesund (Norway); Storaas, Tryggve [Ullevaal University Hospital, Section for Diagnostic Physics, Department of Radiology, Oslo (Norway); Geitung, Jonn-Terje [Haraldsplass University Hospital, Department of Radiology, Bergen (Norway)

    2009-01-15

    The purpose of this paper is to present a pulse sequence optimized to visualize human peripheral vessels. The optimized MR technique is a 3D multi-shot balanced non-SSFP gradient echo pulse sequence with fat suppression. Several imaging parameters were adjusted to find the best compromise between the contrast of vascular structures and muscle, fat, and bone. Most of the optimization was performed in the knee and calf regions using multi-channel SENSE coils. To verify potential clinical use, images of both healthy volunteers and volunteers with varicose veins were produced. The balanced non-SSFP sequence can produce high-spatial-resolution images of the human peripheral vessels without the need for an intravenous contrast agent. Both arteries and veins are displayed along with other body fluids. Due to the high spatial resolution of the axial plane source or reconstructed images, the need for procedures to separate arteries from veins is limited. We demonstrate that high signals from synovial joint fluid and cystic structures can be suppressed by applying an inversion prepulse but at the expense of reduced image signal-to-noise and overall image quality. (orig.)

  14. A noncontrast-enhanced pulse sequence optimized to visualize human peripheral vessels

    The purpose of this paper is to present a pulse sequence optimized to visualize human peripheral vessels. The optimized MR technique is a 3D multi-shot balanced non-SSFP gradient echo pulse sequence with fat suppression. Several imaging parameters were adjusted to find the best compromise between the contrast of vascular structures and muscle, fat, and bone. Most of the optimization was performed in the knee and calf regions using multi-channel SENSE coils. To verify potential clinical use, images of both healthy volunteers and volunteers with varicose veins were produced. The balanced non-SSFP sequence can produce high-spatial-resolution images of the human peripheral vessels without the need for an intravenous contrast agent. Both arteries and veins are displayed along with other body fluids. Due to the high spatial resolution of the axial plane source or reconstructed images, the need for procedures to separate arteries from veins is limited. We demonstrate that high signals from synovial joint fluid and cystic structures can be suppressed by applying an inversion prepulse but at the expense of reduced image signal-to-noise and overall image quality. (orig.)

  15. Nucleotide sequence of Crithidia fasciculata cytosol 5S ribosomal ribonucleic acid.

    MacKay, R M; Gray, M W; Doolittle, W F

    1980-01-01

    The complete nucleotide sequence of the cytosol 5S ribosomal ribonucleic acid of the trypanosomatid protozoan Crithidia fasciculata has been determined by a combination of T1-oligonucleotide catalog and gel sequencing techniques. The sequence is: GAGUACGACCAUACUUGAGUGAAAACACCAUAUCCCGUCCGAUUUGUGAAGUUAAGCACC CACAGGCUUAGUUAGUACUGAGGUCAGUGAUGACUCGGGAACCCUGAGUGCCGUACUCCCOH. This 5S ribosomal RNA is unique in having GAUU in place of the GAAC or GAUC found in all other prokaryotic and eukaryotic 5S ...

  16. GENAS: a database system for nucleic acid sequence analysis.

    Kuhara, S; Matsuo, F; Futamura, S; A. Fujita; Shinohara, T.; Takagi, T.; Sakaki, Y

    1984-01-01

    A database system, named GENAS (GENe Analyzing System), for computer analysis of sequence was constructed using Adbis which is a relational database management system (1). GENAS enables us to retrieve any sequence data from EMBL nucleotide sequence data library (2) and readily to analyze them (if necessary, together with private data) by various application programs in a interactive manner. Analysis of structure of replication origin of replicons was demonstrated using this system.

  17. eQTL Viewer: visualizing how sequence variation affects genome-wide transcription

    Zeng Zhao-Bang

    2007-01-01

    Full Text Available Abstract Background Expression Quantitative Trait Locus (eQTL mapping methods have been used to identify the genetic basis of gene expression variations. To map eQTL, thousands of expression profiles are related with sequence polymorphisms across the genome through their correlated variations. These eQTL distribute in many chromosomal regions, each of which can include many genes. The large number of mapping results produced makes it difficult to consider simultaneously the relationships between multiple genomic regions and multiple expressional profiles. There is a need for informative bioinformatics tools to assist the visualization and interpretation of these mapping results. Results We have developed a web-based tool, called eQTL Viewer, to visualize the relationships between the expression trait genes and the candidate genes in the eQTL regions using Scalable Vector Graphics. The plot generated by eQTL Viewer has the capacity to display mapping results with high resolutions at a variety of scales, and superimpose biological annotations onto the mapping results dynamically. Conclusion Our tool provides an efficient and intuitive way for biologists to explore transcriptional regulation patterns, and to generate hypotheses on the genetic basis of transcriptional regulations.

  18. Homology between the invertible deoxyribonucleic acid sequence that controls flagellar-phase variation in Salmonella sp. and deoxyribonucleic acid sequences in other organisms.

    Szekely, E; Simon, M.

    1981-01-01

    The invertible deoxyribonucleic acid (DNA) segment cloned from Salmonella sp. was radioactively labeled and used as a probe to search for homologous sequences by Southern hybridization. Only one copy of the invertible segment could be found on the Salmonella sp. genome. Partial sequence homology with the invertible region was detected in bacteriophage Mu and P1 DNA by low-stringency hybridization. Under these conditions, no homology was detected with Escherichia coli DNA. A strain of Salmonel...

  19. Nucleotide Sequence of a Chicken Vitellogenin Gene and Derived Amino Acid Sequence of the Encoded Yolk Precursor Protein

    Schip, Fred D. van het; Samallo, John; Broos, Jaap; Ophuis, Jan; Mojet, Mart; Gruber, Max; AB, Geert

    1987-01-01

    The gene encoding the major vitellogenin from chicken has been completely sequenced and its exon-intron organization has been established. The gene is 20,342 base-pairs long and contains 35 exons with a combined length of 5787 base-pairs. They encode the 1850-amino acid pre-peptide of vitellogenin,

  20. Characterization of mouse cellular deoxyribonucleic acid homologous to Abelson murine leukemia virus-specific sequences.

    Dale, B.; Ozanne, B.

    1981-01-01

    The genome of Abelson murine leukemia virus (A-MuLV) consists of sequences derived from both BALB/c mouse deoxyribonucleic acid and the genome of Moloney murine leukemia virus. Using deoxyribonucleic acid linear intermediates as a source of retroviral deoxyribonucleic acid, we isolated a recombinant plasmid which contained 1.9 kilobases of the 3.5-kilobase mouse-derived sequences found in A-MuLV (A-MuLV-specific sequences). We used this clone, designated pSA-17, as a probe restriction enzyme ...

  1. Representation of Protein-Sequence Information by Amino Acid Subalphabets

    Andersen, Claus A. F.; Brunak, Soren

    2004-01-01

    Within computational biology, algorithms are constructed with the aim of extracting knowledge from biological data, in particular, data generated by the large genome projects, where gene and protein sequences are produced in high volume. In this article, we explore new ways of representing protein-sequence information, using machine learning strategies, where the primary goal is the discovery of novel powerful representations for use in AI techniques. In the case of proteins and the 20 differ...

  2. A conversational system for the computer analysis of nucleic acid sequences.

    Sege, R; Söll, D.; Ruddle, F H; Queen, C

    1981-01-01

    We present a conversational system for the computer analysis of nucleic acid and protein sequences based on the well-known Queen and Korn program (1). The system can be used by persons with only minimal knowledge of computers.

  3. Amino Acid Sequence - KOME | LSDB Archive [Life Science Database Archive metadata

    Full Text Available [ Credits ] BLAST Search Image Search Home About Archive Update History Contact us ...CE Amino acid sequence Joomla SEF URLs by Artio About This Database Database Description Download License Update History

  4. Accuracy of sequence alignment and fold assessment using reduced amino acid alphabets.

    Melo, Francisco; Marti-Renom, Marc A

    2006-06-01

    Reduced or simplified amino acid alphabets group the 20 naturally occurring amino acids into a smaller number of representative protein residues. To date, several reduced amino acid alphabets have been proposed, which have been derived and optimized by a variety of methods. The resulting reduced amino acid alphabets have been applied to pattern recognition, generation of consensus sequences from multiple alignments, protein folding, and protein structure prediction. In this work, amino acid substitution matrices and statistical potentials were derived based on several reduced amino acid alphabets and their performance assessed in a large benchmark for the tasks of sequence alignment and fold assessment of protein structure models, using as a reference frame the standard alphabet of 20 amino acids. The results showed that a large reduction in the total number of residue types does not necessarily translate into a significant loss of discriminative power for sequence alignment and fold assessment. Therefore, some definitions of a few residue types are able to encode most of the relevant sequence/structure information that is present in the 20 standard amino acids. Based on these results, we suggest that the use of reduced amino acid alphabets may allow to increasing the accuracy of current substitution matrices and statistical potentials for the prediction of protein structure of remote homologs. PMID:16506243

  5. cDNA-derived amino acid sequences of myoglobins from nine species of whales and dolphins.

    Iwanami, Kentaro; Mita, Hajime; Yamamoto, Yasuhiko; Fujise, Yoshihiro; Yamada, Tadasu; Suzuki, Tomohiko

    2006-10-01

    We determined the myoglobin (Mb) cDNA sequences of nine cetaceans, of which six are the first reports of Mb sequences: sei whale (Balaenoptera borealis), Bryde's whale (Balaenoptera edeni), pygmy sperm whale (Kogia breviceps), Stejneger's beaked whale (Mesoplodon stejnegeri), Longman's beaked whale (Indopacetus pacificus), and melon-headed whale (Peponocephala electra), and three confirm the previously determined chemical amino acid sequences: sperm whale (Physeter macrocephalus), common minke whale (Balaenoptera acutorostrata) and pantropical spotted dolphin (Stenella attenuata). We found two types of Mb in the skeletal muscle of pantropical spotted dolphin: Mb I with the same amino acid sequence as that deposited in the protein database, and Mb II, which differs at two amino acid residues compared with Mb I. Using an alignment of the amino acid or cDNA sequences of cetacean Mb, we constructed a phylogenetic tree by the NJ method. Clustering of cetacean Mb amino acid and cDNA sequences essentially follows the classical taxonomy of cetaceans, suggesting that Mb sequence data is valid for classification of cetaceans at least to the family level. PMID:16962803

  6. Kohonen map as a visualization tool for the analysis of protein sequences: multiple alignments, domains and segments of secondary structures.

    Hanke, J; Reich, J G

    1996-12-01

    The method of Kohonen maps, a special form of neural networks, was applied as a visualization tool for the analysis of protein sequence similarity. The procedure converts sequence (domains, aligned sequences, segments of secondary structure) into a characteristic signal matrix. This conversion depends on the property or replacement score vector selected by the user. Similar sequences have small distance in the signal space. The trained Kohonen network is functionally equivalent to an unsupervised non-linear cluster analyzer. Protein families, or aligned sequences, or segments of similar secondary structure, aggregate as clusters, and their proximity may be inspected on a color screen or on paper. Pull-down menus permit access to background information in the established text-oriented way. PMID:9021261

  7. Detection of CIN by naked eye visualization after application of acetic acid.

    Londhe, M; George, S S; Seshadri, L

    1997-06-01

    A prospective study was undertaken to determine the sensitivity and specificity of acetic application to the cervix followed by naked eye visualization as a screening test for detection of cervical intraepithelial neoplasia. Three hundred and seventy two sexually active woman in the reproductive age group were studied. All the women underwent Papanicolaou test, acetic acid test and colposcopy. One hundred and seventy five woman were acetic acid test negative, 197 women were acetic acid test positive. The sensitivity of acetic acid test was 72.4%, specificity 54% and false negative rate 15.2%, as compared to papanicolaou test which had a sensitivity of 13.2%, specificity of 96.3% and false negative rate of 24.4%. The advantage of the acetic acid test lies in its easy technique, low cost and high sensitivity which are important factors for determining the efficacy of any screening programme in developing countries. PMID:9491668

  8. Homology of amino acid sequences of rat liver cathepsins B and H with that of papain.

    Takio, K; Towatari, T; Katunuma, N.; Teller, D C; Titani, K

    1983-01-01

    The amino acid sequences of rat liver lysosomal thiol endopeptidases, cathepsins B and H, are presented and compared with that of the plant thiol protease papain. The 252-residue sequence of cathepsin B and the 220-residue sequence of cathepsin H were determined largely by automated Edman degradation of their intact polypeptide chains and of the two chains of each enzyme generated by limited proteolysis. Subfragments of the chains were produced by enzymatic digestion and by chemical cleavage ...

  9. Complete amino acid sequence of human intestinal aminopeptidase N as deduced from cloned cDNA

    Cowell, G M; Kønigshøfer, E; Danielsen, E M;

    1988-01-01

    The complete primary structure (967 amino acids) of an intestinal human aminopeptidase N (EC 3.4.11.2) was deduced from the sequence of a cDNA clone. Aminopeptidase N is anchored to the microvillar membrane via an uncleaved signal for membrane insertion. A domain constituting amino acid 250...

  10. Representation of protein-sequence information by amino acid subalphabets

    Andersen, C.A.F.; Brunak, Søren

    2004-01-01

    Within computational biology, algorithms are constructed with the aim of extracting knowledge from biological data, in particular, data generated by the large genome projects, where gene and protein sequences are produced in high volume. In this article, we explore new ways of representing protei......-which now are common in proteins-might have emerged from simpler selections, or alphabets, in use earlier during the evolution of living organisms....

  11. Two distinct ferredoxins from Rhodobacter capsulatus: complete amino acid sequences and molecular evolution.

    Saeki, K; Suetsugu, Y; Yao, Y; Horio, T; Marrs, B L; Matsubara, H

    1990-09-01

    Two distinct ferredoxins were purified from Rhodobacter capsulatus SB1003. Their complete amino acid sequences were determined by a combination of protease digestion, BrCN cleavage and Edman degradation. Ferredoxins I and II were composed of 64 and 111 amino acids, respectively, with molecular weights of 6,728 and 12,549 excluding iron and sulfur atoms. Both contained two Cys clusters in their amino acid sequences. The first cluster of ferredoxin I and the second cluster of ferredoxin II had a sequence, CxxCxxCxxxCP, in common with the ferredoxins found in Clostridia. The second cluster of ferredoxin I had a sequence, CxxCxxxxxxxxCxxxCM, with extra amino acids between the second and third Cys, which has been reported for other photosynthetic bacterial ferredoxins and putative ferredoxins (nif-gene products) from nitrogen-fixing bacteria, and with a unique occurrence of Met. The first cluster of ferredoxin II had a CxxCxxxxCxxxCP sequence, with two additional amino acids between the second and third Cys, a characteristics feature of Azotobacter-[3Fe-4S] [4Fe-4S]-ferredoxin. Ferredoxin II was also similar to Azotobacter-type ferredoxins with an extended carboxyl (C-) terminal sequence compared to the common Clostridium-type. The evolutionary relationship of the two together with a putative one recently found to be encoded in nifENXQ region in this bacterium [Moreno-Vivian et al. (1989) J. Bacteriol. 171, 2591-2598] is discussed. PMID:2277040

  12. Complete nucleotide sequence of cDNA and deduced amino acid sequence of rat liver catalase.

    Furuta, S.; Hayashi, H; Hijikata, M; Miyazawa, S.; Osumi, T; Hashimoto, T.

    1986-01-01

    We have isolated five cDNA clones for rat liver catalase (hydrogen peroxide:hydrogen peroxide oxidoreductase, EC 1.11.1.6). These clones overlapped with each other and covered the entire length of the mRNA, which had been estimated to be 2.4 kilobases long by blot hybridization analysis of electrophoretically fractionated RNA. Nucleotide sequencing was carried out on these five clones and the composite nucleotide sequence of catalase cDNA was determined. The 5' noncoding region contained 83 b...

  13. CpGAVAS, an integrated web server for the annotation, visualization, analysis, and GenBank submission of completely sequenced chloroplast genome sequences

    Liu Chang

    2012-12-01

    Full Text Available Abstract Background The complete sequences of chloroplast genomes provide wealthy information regarding the evolutionary history of species. With the advance of next-generation sequencing technology, the number of completely sequenced chloroplast genomes is expected to increase exponentially, powerful computational tools annotating the genome sequences are in urgent need. Results We have developed a web server CPGAVAS. The server accepts a complete chloroplast genome sequence as input. First, it predicts protein-coding and rRNA genes based on the identification and mapping of the most similar, full-length protein, cDNA and rRNA sequences by integrating results from Blastx, Blastn, protein2genome and est2genome programs. Second, tRNA genes and inverted repeats (IR are identified using tRNAscan, ARAGORN and vmatch respectively. Third, it calculates the summary statistics for the annotated genome. Fourth, it generates a circular map ready for publication. Fifth, it can create a Sequin file for GenBank submission. Last, it allows the extractions of protein and mRNA sequences for given list of genes and species. The annotation results in GFF3 format can be edited using any compatible annotation editing tools. The edited annotations can then be uploaded to CPGAVAS for update and re-analyses repeatedly. Using known chloroplast genome sequences as test set, we show that CPGAVAS performs comparably to another application DOGMA, while having several superior functionalities. Conclusions CPGAVAS allows the semi-automatic and complete annotation of a chloroplast genome sequence, and the visualization, editing and analysis of the annotation results. It will become an indispensible tool for researchers studying chloroplast genomes. The software is freely accessible from http://www.herbalgenomics.org/cpgavas.

  14. Protein chemotaxonomy. XIII. Amino acid sequence of ferredoxin from Panax ginseng.

    Mino, Yoshiki

    2006-08-01

    The complete amino acid sequence of [2Fe-2S] ferredoxin from Panax ginseng (Araliaceae) has been determined by automated Edman degradation of the entire S-carboxymethylcysteinyl protein and of the peptides obtained by enzymatic digestion. This ferredoxin has a unique amino acid sequence, which includes an insertion of Tyr at the 3rd position from the amino-terminus and a deletion of two amino acid residues at the carboxyl terminus. This ferredoxin had 18 differences in its amino acid sequence compared to that of Petroselinum sativum (Umbelliferae). In contrast, 23-33 differences were observed compared to other dicotyledonous plants. This suggests that Panax ginseng is related taxonomically to umbelliferous plants. PMID:16880642

  15. Visualization of Early Events in Acetic Acid Denaturation of HIV-1 Protease: A Molecular Dynamics Study

    Borkar, Aditi Narendra; Rout, Manoj Kumar; Hosur, Ramakrishna V.

    2011-01-01

    Protein denaturation plays a crucial role in cellular processes. In this study, denaturation of HIV-1 Protease (PR) was investigated by all-atom MD simulations in explicit solvent. The PR dimer and monomer were simulated separately in 9 M acetic acid (9 M AcOH) solution and water to study the denaturation process of PR in acetic acid environment. Direct visualization of the denaturation dynamics that is readily available from such simulations has been presented. Our simulations in 9 M AcOH re...

  16. Visualizing digestive organ morphology and function using differential fatty acid metabolism in live zebrafish

    Carten, Juliana Debrito; Bradford, Mary Katherine; Farber, Steven Arthur

    2011-01-01

    Lipids are essential for cellular function as sources of fuel, critical signaling molecules and membrane components. Deficiencies in lipid processing and transport underlie many metabolic diseases. To better understand metabolic function as it relates to disease etiology, a whole animal approach is advantageous, one in which multiple organs and cell types can be assessed simultaneously in vivo. Towards this end, we have developed an assay to visualize fatty acid (FA) metabolism in larval zebr...

  17. Visualization of Iron-Binding Micelles in Acidic Recombinant Biomineralization Protein, MamC

    Sanjay Kashyap; Taylor Woehl; Carmen Valverde-Tercedor; Miguel Sánchez-Quesada; Concepción Jiménez López; Tanya Prozorov

    2014-01-01

    Biological macromolecules are utilized in low-temperature synthetic methods to exert precise control over nanoparticle nucleation and placement. They enable low-temperature formation of a variety of functional nanostructured materials with properties often not achieved via conventional synthetic techniques. Here we report on the in situ visualization of a novel acidic bacterial recombinant protein, MamC, commonly present in the magnetosome membrane of several magnetotactic bacteria, including...

  18. Visualization of cranial nerves I-XII: value of 3D CISS and T2-weighted FSE sequences

    Yousry, I.; Camelio, S.; Wiesmann, M.; Brueckmann, H.; Yousry, T.A. [Department of Neuroradiology, Klinikum Grosshadern, Ludwig-Maximilians University, Marchioninistrasse 15, D-81377 Munich (Germany); Schmid, U.D. [Neurosurgical Unit, Klinik im Park, 8000 Zurich (Switzerland); Horsfield, M.A. [Department of Medical Physics, University of Leicester, Leicester LE1 5WW (United Kingdom)

    2000-07-01

    The aim of this study was to evaluate the sensitivity of the three-dimensional constructive interference of steady state (3D CISS) sequence (slice thickness 0.7 mm) and that of the T2-weighted fast spin echo (T2-weighted FSE) sequence (slice thickness 3 mm) for the visualization of all cranial nerves in their cisternal course. Twenty healthy volunteers were examined using the T2-weighted FSE and the 3D CISS sequences. Three observers evaluated independently the cranial nerves NI-NXII in their cisternal course. The rates for successful visualization of each nerve for 3D CISS (and for T2-weighted FSE in parentheses) were as follows: NI, NII, NV, NVII, NVIII 40 of 40 (40 of 40), NIII 40 of 40 (18 of 40), NIV 19 of 40 (3 of 40), NVI 39 of 40 (5 of 40), NIX, X, XI 40 of 40 (29 of 40), and NXII 40 of 40 (4 of 40). Most of the cranial nerves can be reliably assessed when using the 3D CISS and the T2-weighted FSE sequences. Increasing the spatial resolution when using the 3D CISS sequence increases the reliability of the identification of the cranial nerves NIII-NXII. (orig.)

  19. Visualization of cranial nerves I-XII: value of 3D CISS and T2-weighted FSE sequences

    The aim of this study was to evaluate the sensitivity of the three-dimensional constructive interference of steady state (3D CISS) sequence (slice thickness 0.7 mm) and that of the T2-weighted fast spin echo (T2-weighted FSE) sequence (slice thickness 3 mm) for the visualization of all cranial nerves in their cisternal course. Twenty healthy volunteers were examined using the T2-weighted FSE and the 3D CISS sequences. Three observers evaluated independently the cranial nerves NI-NXII in their cisternal course. The rates for successful visualization of each nerve for 3D CISS (and for T2-weighted FSE in parentheses) were as follows: NI, NII, NV, NVII, NVIII 40 of 40 (40 of 40), NIII 40 of 40 (18 of 40), NIV 19 of 40 (3 of 40), NVI 39 of 40 (5 of 40), NIX, X, XI 40 of 40 (29 of 40), and NXII 40 of 40 (4 of 40). Most of the cranial nerves can be reliably assessed when using the 3D CISS and the T2-weighted FSE sequences. Increasing the spatial resolution when using the 3D CISS sequence increases the reliability of the identification of the cranial nerves NIII-NXII. (orig.)

  20. FeatureViewer, a BioJS component for visualization of position-based annotations in protein sequences

    Leyla Garcia; Guy Yachdav; Maria-Jesus Martin

    2014-01-01

    Summary: FeatureViewer is a BioJS component that lays out, maps, orients, and renders position-based annotations for protein sequences. This component is highly flexible and customizable, allowing the presentation of annotations by rows, all centered, or distributed in non-overlapping tracks. It uses either lines or shapes for sites and rectangles for regions. The result is a powerful visualization tool that can be easily integrated into web applications as well as documents as it provides an...

  1. Nucleotide sequence of the beta-cyclodextrin glucanotransferase gene of alkalophilic Bacillus sp. strain 1011 and similarity of its amino acid sequence to those of alpha-amylases.

    Kimura, K.; Kataoka, S; Ishii, Y; Takano, T.; Yamane, K

    1987-01-01

    The nucleotide sequence of the gene for cyclodextrin glucanotransferase of alkalophilic Bacillus sp. strain 1011 was determined. The deduced amino acid sequence at the NH2-terminal side of the enzyme showed a high homology with the sequences of alpha-amylase in the three regions which constitutes the active centers of alpha-amylases.

  2. EST sequences and their annotation (amino acid sequence and results of homology search) - Dicty_cDB | LSDB Archive [Life Science Database Archive metadata

    Full Text Available lone covering full-length ORF provided by the National BioResource Project ( http://www.nbrp.jp/ ). The...ein Coding Gene in dictyBase ( http://dictybase.org/ ). The link to dictyBase is provided in the...Dicty_cDB EST sequences and their annotation (amino acid sequence and results of homology search) Data detai...l Data name EST sequences and their annotation (amino acid sequence and results of homology search) Descript...ion of data contents Sequences of cDNA clones of Dictyostelium discoideum and the

  3. Introduction of restriction enzyme sites in protein-coding DNA sequences by site-specific mutagenesis not affecting the amino acid sequence: a computer program.

    Arentzen, R; Ripka, W. C.

    1984-01-01

    Structure/function relationship studies of proteins are greatly facilitated by recombinant DNA technology which allows specific amino acid mutations to be made at the DNA sequence level by site-specific mutagenesis employing synthetic oligonucleotides. This technique has been successfully used to alter one or two amino acids in a protein. Replacement of existing DNA sequence coding for several amino acids with new synthetic DNA fragments would be facilitated by the presence of unique restrict...

  4. Nucleic-acid-programmed Ag-nanoclusters as a generic platform for visualization of latent fingerprints and exogenous substances.

    Ran, Xiang; Wang, Zhenzhen; Zhang, Zhijun; Pu, Fang; Ren, Jinsong; Qu, Xiaogang

    2016-01-11

    We display a nucleic acid controlled AgNC platform for latent fingerprint visualization. The versatile emission of aptamer-modified AgNCs was regulated by the nearby DNA regions. Multi-color images for simultaneous visualization of fingerprints and exogenous components were successfully obtained. A quantitative detection strategy for exogenous substances in fingerprints was also established. PMID:26537157

  5. 37 CFR 1.824 - Form and format for nucleotide and/or amino acid sequence submissions in computer readable form.

    2010-07-01

    ... nucleotide and/or amino acid sequence submissions in computer readable form. 1.824 Section 1.824 Patents... And/or Amino Acid Sequences § 1.824 Form and format for nucleotide and/or amino acid sequence... readable form may be created by any means, such as word processors, nucleotide/amino acid sequence...

  6. Draft genome sequence of the docosahexaenoic acid producing thraustochytrid Aurantiochytrium sp. T66.

    Liu, Bin; Ertesvåg, Helga; Aasen, Inga Marie; Vadstein, Olav; Brautaset, Trygve; Heggeset, Tonje Marita Bjerkan

    2016-06-01

    Thraustochytrids are unicellular, marine protists, and there is a growing industrial interest in these organisms, particularly because some species, including strains belonging to the genus Aurantiochytrium, accumulate high levels of docosahexaenoic acid (DHA). Here, we report the draft genome sequence of Aurantiochytrium sp. T66 (ATCC PRA-276), with a size of 43 Mbp, and 11,683 predicted protein-coding sequences. The data has been deposited at DDBJ/EMBL/Genbank under the accession LNGJ00000000. The genome sequence will contribute new insight into DHA biosynthesis and regulation, providing a basis for metabolic engineering of thraustochytrids. PMID:27222814

  7. DNA Data Visualization (DDV: Software for Generating Web-Based Interfaces Supporting Navigation and Analysis of DNA Sequence Data of Entire Genomes.

    Tomasz Neugebauer

    Full Text Available Data visualization methods are necessary during the exploration and analysis activities of an increasingly data-intensive scientific process. There are few existing visualization methods for raw nucleotide sequences of a whole genome or chromosome. Software for data visualization should allow the researchers to create accessible data visualization interfaces that can be exported and shared with others on the web. Herein, novel software developed for generating DNA data visualization interfaces is described. The software converts DNA data sets into images that are further processed as multi-scale images to be accessed through a web-based interface that supports zooming, panning and sequence fragment selection. Nucleotide composition frequencies and GC skew of a selected sequence segment can be obtained through the interface. The software was used to generate DNA data visualization of human and bacterial chromosomes. Examples of visually detectable features such as short and long direct repeats, long terminal repeats, mobile genetic elements, heterochromatic segments in microbial and human chromosomes, are presented. The software and its source code are available for download and further development. The visualization interfaces generated with the software allow for the immediate identification and observation of several types of sequence patterns in genomes of various sizes and origins. The visualization interfaces generated with the software are readily accessible through a web browser. This software is a useful research and teaching tool for genetics and structural genomics.

  8. New families in the classification of glycosyl hydrolases based on amino acid sequence similarities.

    Henrissat, B; Bairoch, A

    1993-01-01

    301 glycosyl hydrolases and related enzymes corresponding to 39 EC entries of the I.U.B. classification system have been classified into 35 families on the basis of amino-acid-sequence similarities [Henrissat (1991) Biochem. J. 280, 309-316]. Approximately half of the families were found to be monospecific (containing only one EC number), whereas the other half were found to be polyspecific (containing at least two EC numbers). A > 60% increase in sequence data for glycosyl hydrolases (181 additional enzymes or enzyme domains sequences have since become available) allowed us to update the classification not only by the addition of more members to already identified families, but also by the finding of ten new families. On the basis of a comparison of 482 sequences corresponding to 52 EC entries, 45 families, out of which 22 are polyspecific, can now be defined. This classification has been implemented in the SWISS-PROT protein sequence data bank. PMID:8352747

  9. Coding Local and Global Binary Visual Features Extracted From Video Sequences.

    Baroffio, Luca; Canclini, Antonio; Cesana, Matteo; Redondi, Alessandro; Tagliasacchi, Marco; Tubaro, Stefano

    2015-11-01

    Binary local features represent an effective alternative to real-valued descriptors, leading to comparable results for many visual analysis tasks while being characterized by significantly lower computational complexity and memory requirements. When dealing with large collections, a more compact representation based on global features is often preferred, which can be obtained from local features by means of, e.g., the bag-of-visual word model. Several applications, including, for example, visual sensor networks and mobile augmented reality, require visual features to be transmitted over a bandwidth-limited network, thus calling for coding techniques that aim at reducing the required bit budget while attaining a target level of efficiency. In this paper, we investigate a coding scheme tailored to both local and global binary features, which aims at exploiting both spatial and temporal redundancy by means of intra- and inter-frame coding. In this respect, the proposed coding scheme can conveniently be adopted to support the analyze-then-compress (ATC) paradigm. That is, visual features are extracted from the acquired content, encoded at remote nodes, and finally transmitted to a central controller that performs the visual analysis. This is in contrast with the traditional approach, in which visual content is acquired at a node, compressed and then sent to a central unit for further processing, according to the compress-then-analyze (CTA) paradigm. In this paper, we experimentally compare the ATC and the CTA by means of rate-efficiency curves in the context of two different visual analysis tasks: 1) homography estimation and 2) content-based retrieval. Our results show that the novel ATC paradigm based on the proposed coding primitives can be competitive with the CTA, especially in bandwidth limited scenarios. PMID:26080384

  10. ProViz-a web-based visualization tool to investigate the functional and evolutionary features of protein sequences.

    Jehl, Peter; Manguy, Jean; Shields, Denis C; Higgins, Desmond G; Davey, Norman E

    2016-07-01

    Low-throughput experiments and high-throughput proteomic and genomic analyses have created enormous quantities of data that can be used to explore protein function and evolution. The ability to consolidate these data into an informative and intuitive format is vital to our capacity to comprehend these distinct but complementary sources of information. However, existing tools to visualize protein-related data are restricted by their presentation, sources of information, functionality or accessibility. We introduce ProViz, a powerful browser-based tool to aid biologists in building hypotheses and designing experiments by simplifying the analysis of functional and evolutionary features of proteins. Feature information is retrieved in an automated manner from resources describing protein modular architecture, post-translational modification, structure, sequence variation and experimental characterization of functional regions. These features are mapped to evolutionary information from precomputed multiple sequence alignments. Data are displayed in an interactive and information-rich yet intuitive visualization, accessible through a simple protein search interface. This allows users with limited bioinformatic skills to rapidly access data pertinent to their research. Visualizations can be further customized with user-defined data either manually or using a REST API. ProViz is available at http://proviz.ucd.ie/. PMID:27085803

  11. Better prediction of protein contact number using a support vector regression analysis of amino acid sequence

    Yuan Zheng

    2005-10-01

    Full Text Available Abstract Background Protein tertiary structure can be partly characterized via each amino acid's contact number measuring how residues are spatially arranged. The contact number of a residue in a folded protein is a measure of its exposure to the local environment, and is defined as the number of Cβ atoms in other residues within a sphere around the Cβ atom of the residue of interest. Contact number is partly conserved between protein folds and thus is useful for protein fold and structure prediction. In turn, each residue's contact number can be partially predicted from primary amino acid sequence, assisting tertiary fold analysis from sequence data. In this study, we provide a more accurate contact number prediction method from protein primary sequence. Results We predict contact number from protein sequence using a novel support vector regression algorithm. Using protein local sequences with multiple sequence alignments (PSI-BLAST profiles, we demonstrate a correlation coefficient between predicted and observed contact numbers of 0.70, which outperforms previously achieved accuracies. Including additional information about sequence weight and amino acid composition further improves prediction accuracies significantly with the correlation coefficient reaching 0.73. If residues are classified as being either "contacted" or "non-contacted", the prediction accuracies are all greater than 77%, regardless of the choice of classification thresholds. Conclusion The successful application of support vector regression to the prediction of protein contact number reported here, together with previous applications of this approach to the prediction of protein accessible surface area and B-factor profile, suggests that a support vector regression approach may be very useful for determining the structure-function relation between primary protein sequence and higher order consecutive protein structural and functional properties.

  12. Complete amino acid sequence of branched-chain amino acid aminotransferase (transaminase B) of Salmonella typhimurium, identification of the coenzyme-binding site and sequence comparison analysis

    The complete amino acid sequence of the subunit of branched-chain amino acid aminotransferase of Salmonella typhimurium was determined by automated Edman degradation of peptide fragments generated by chemical and enzymatic digestion of S-carboxymethylated and S-pyridylethylated transaminase B. Peptide fragments of transaminase B were generated by treatment of the enzyme with trypsin, Staphylococcus aureus V8 protease, endoproteinase Lys-C, and cyanogen bromide. Protocols were developed for separation of the peptide fragments by reverse-phase high performance liquid chromatography (HPLC), ion-exchange HPLC, and SDS-urea gel electrophoresis. The enzyme subunit contains 308 amino acid residues and has a molecular weight of 33,920 daltons. The coenzyme-binding site was determined by treatment of the enzyme, containing bound pyridoxal 5-phosphate, with tritiated sodium borohydride prior to trypsin digestion. Monitoring radioactivity incorporation and peptide map comparisons with an apoenzyme tryptic digest, allowed identification of the pyridoxylated-peptide which was isolated by reverse-phase HPLC and sequenced. The coenzyme-binding site is a lysyl residue at position 159. Some peptides were further characterized by fast atom bombardment mass spectrometry

  13. Sequence divergence, polymorphism and evolution of the middle-wave and long-wave visual pigment genes of great apes and Old World monkeys.

    Dulai, K S; Bowmaker, J K; Mollon, J D; Hunt, D M

    1994-10-01

    In man, the spectral shift between the middle-wave (MW) and long-wave (LW) visual pigments is largely achieved by amino acid substitution at two codons, both located in exon 5. A third amino acid site coded by exon 3 is polymorphic between pigments. We have studied the equivalent regions of the cone opsin genes in two members of the Hominidea (the gorilla, Gorilla gorilla and the chimpanzee, Pan troglodytes) and in three members of the Cercopithecoidea family of Old World primates (the diana monkey, Cercopithecus diana, the talapoin monkey, Miopithecus talapoin, and the crab-eating macaque, Macaca fascicularis). No variation in the codons that specify the amino acids involved in spectral tuning were found. We predict therefore that the MW and LW pigments of gorilla and chimpanzee have similar spectral characteristics to those of man. Multiple copies of the same opsin gene sequence were identified in the chimpanzee, talapoin and macaque and we also show that non-human Old World primates are similar to man in showing a bunching of polymorphic sites in exon 3. We discuss the ancestry of the separate MW and LW genes of Old World primates and the equivalent polymorphic gene of the marmoset, a New World primate. PMID:7975287

  14. The human receptor for urokinase plasminogen activator. NH2-terminal amino acid sequence and glycosylation variants

    Behrendt, N; Rønne, E; Ploug, M; Petri, T; Løber, D; Nielsen, L S; Schleuning, W D; Blasi, F; Appella, E; Danø, K

    1990-01-01

    -PA. The purified protein shows a single 55-60 kDa band after sodium dodecyl sulfate-polyacrylamide gel electrophoresis and silver staining. It is a heavily glycosylated protein, the deglycosylated polypeptide chain comprising only 35 kDa. The glycosylated protein contains N-acetyl-D-glucosamine and sialic...... acid, but no N-acetyl-D-galactosamine. Glycosylation is responsible for substantial heterogeneity in the receptor on phorbol ester-stimulated U937 cells, and also for molecular weight variations among various cell lines. The amino acid composition and the NH2-terminal amino acid sequence are reported...

  15. Molecular cloning and sequence analysis of cDNA encoding human prostatic acid phosphatase.

    Vihko, P; Virkkunen, P; Henttu, P; Roiko, K; Solin, T; Huhtala, M L

    1988-08-29

    lambda gt11 clones encoding human prostatic acid phosphatase (PAP) (EC 3.1.3.2) were isolated from human prostatic cDNA libraries by immunoscreening with polyclonal antisera. Sequence data obtained from several overlapping clones indicated that the composite cDNAs contained the complete coding region for PAP, which encodes a 354-residue protein with a calculated molecular mass of 41,126 Da. In the 5'-end, the cDNA codes for a signal peptide of 32 amino acids. Direct protein sequencing of the amino-terminus of the mature protein and its proteolytic fragments confirmed the identity of the predicted protein sequence. PAP has no apparent sequence homology to other known proteins. However, both the cDNA clones coding for human placental alkaline phosphatase and PAP have an alu-type repetitive sequence about 900 nucleotides downstream from the coding region in the 3'-untranslated region. Two of our cDNA clones differed from others at the 5'-ends. RNA blot analysis indicated mRNA of 3.3 kb. We are continuing to study whether acid phosphatases form a gene family as do alkaline phosphatases. PMID:2842184

  16. Draft Genome Sequence of Perfluorooctane Acid-Degrading Bacterium Pseudomonas parafulva YAB-1

    Yi, Langbo; Tang, Chongjian; Peng, Qingjing; Peng, Qingzhong; Chai, Liyuan

    2015-01-01

    Pseudomonas parafulva YAB-1, isolated from perfluorinated compound-contaminated soil, has the ability to degrade perfluorooctane acid (PFOA) compound. Here, we report the draft genome sequence and annotation of the PFOA-degrading bacterium P. parafulva YAB-1. The data provide the basis to investigate the molecular mechanism of PFOA metabolism.

  17. Draft Genome Sequence of Perfluorooctane Acid-Degrading Bacterium Pseudomonas parafulva YAB-1

    Tang, Chongjian; Peng, Qingjing; Peng, Qingzhong

    2015-01-01

    Pseudomonas parafulva YAB-1, isolated from perfluorinated compound-contaminated soil, has the ability to degrade perfluorooctane acid (PFOA) compound. Here, we report the draft genome sequence and annotation of the PFOA-degrading bacterium P. parafulva YAB-1. The data provide the basis to investigate the molecular mechanism of PFOA metabolism. PMID:26337877

  18. Visualization of Iron-Binding Micelles in Acidic Recombinant Biomineralization Protein, MamC

    Kashyap, Sanjay [Ames Laboratory; Woehl, Taylor [Ames Laboratory; Valverde-Tercedor, Carmen [University of Granada; Sanchez-Quesada, Miguel [University of Granada; Lopez, Concepcion Jimenez [University of Granada; Prozorov, Tanya [Ames Laboratory

    2014-03-07

    Biological macromolecules are utilized in low-temperature synthetic methods to exert precise control over nanoparticle nucleation and placement. They enable low-temperature formation of a variety of functional nanostructured materials with properties often not achieved via conventional synthetic techniques. Here we report on the in situ visualization of a novel acidic bacterial recombinant protein, MamC, commonly present in the magnetosome membrane of several magnetotactic bacteria, including Magnetococcus marinus, strain MC-1. Our findings provide an insight into the self-assembly of MamC and point to formation of the extended protein surface, which is assumed to play an important role in the formation of biotemplated inorganic nanoparticles. The self-organization of MamC is compared to the behavior of another acidic recombinant iron-binding protein, Mms6.

  19. Use of a structural alphabet to find compatible folds for amino acid sequences.

    Mahajan, Swapnil; de Brevern, Alexandre G; Sanejouand, Yves-Henri; Srinivasan, Narayanaswamy; Offmann, Bernard

    2015-01-01

    The structural annotation of proteins with no detectable homologs of known 3D structure identified using sequence-search methods is a major challenge today. We propose an original method that computes the conditional probabilities for the amino-acid sequence of a protein to fit to known protein 3D structures using a structural alphabet, known as "Protein Blocks" (PBs). PBs constitute a library of 16 local structural prototypes that approximate every part of protein backbone structures. It is used to encode 3D protein structures into 1D PB sequences and to capture sequence to structure relationships. Our method relies on amino acid occurrence matrices, one for each PB, to score global and local threading of query amino acid sequences to protein folds encoded into PB sequences. It does not use any information from residue contacts or sequence-search methods or explicit incorporation of hydrophobic effect. The performance of the method was assessed with independent test datasets derived from SCOP 1.75A. With a Z-score cutoff that achieved 95% specificity (i.e., less than 5% false positives), global and local threading showed sensitivity of 64.1% and 34.2%, respectively. We further tested its performance on 57 difficult CASP10 targets that had no known homologs in PDB: 38 compatible templates were identified by our approach and 66% of these hits yielded correctly predicted structures. This method scales-up well and offers promising perspectives for structural annotations at genomic level. It has been implemented in the form of a web-server that is freely available at http://www.bo-protscience.fr/forsa. PMID:25297700

  20. Fetal magnetic resonance imaging of normal spinal cord: Evaluating cord visualization and conus medullaris position by T2-weighted sequences

    Yen-Ling Huang

    2014-08-01

    Full Text Available Background: Prenatal magnetic resonance (MR imaging demonstration of the normal spinal cord and the conus medullaris location has not been well studied. We compared balanced fast field echo (bFFE with single-shot turbo spin-echo (SSh-TSE MR sequences for visualizing the normal spinal cord and position of conus medullaris in fetuses. Methods: This retrospective study was approved by the Institutional Review Board of Chang Gung Medical Foundation. We reviewed the MR images of 141 fetuses aged between 16 and 39 gestational weeks, to determine the position of the conus and visualize the spinal cord by using a signal intensity ratio of cerebral spinal fluid (CSF to the spinal cord. Results: Of the 75 subjects having normal spinal cord and being examined by both bFFE and SSh-TSE studies, the signal intensity ratio of CSF/cord was greater on bFFE images (2.18 ± 0.53 than that on SSh-TSE images (1.21 ± 0.13 (p < 0.05. The conus level identified in the 50 subjects, in whom the lumbosacral spine was appropriately imaged, was located from L1 to L5 levels. The ascendance of the conus correlated moderately with gestational age. Conclusions: With greater signal contrast ratio of CSF to spinal cord, bFFE sequence, when compared with SSh-TSE sequence, provides better visualization of normal spinal cord. The fetal conus medullaris ascends from L5 to L1 levels as the gestational age increases.

  1. SeqVISTA: a graphical tool for sequence feature visualization and comparison

    Niu Tianhua

    2003-01-01

    Full Text Available Abstract Background Many readers will sympathize with the following story. You are viewing a gene sequence in Entrez, and you want to find whether it contains a particular sequence motif. You reach for the browser's "find in page" button, but those darn spaces every 10 bp get in the way. And what if the motif is on the opposite strand? Subsequently, your favorite sequence analysis software informs you that there is an interesting feature at position 13982–14013. By painstakingly counting the 10 bp blocks, you are able to examine the sequence at this location. But now you want to see what other features have been annotated close by, and this information is buried several screenfuls higher up the web page. Results SeqVISTA presents a holistic, graphical view of features annotated on nucleotide or protein sequences. This interactive tool highlights the residues in the sequence that correspond to features chosen by the user, and allows easy searching for sequence motifs or extraction of particular subsequences. SeqVISTA is able to display results from diverse sequence analysis tools in an integrated fashion, and aims to provide much-needed unity to the bioinformatics resources scattered around the Internet. Our viewer may be launched on a GenBank record by a single click of a button installed in the web browser. Conclusion SeqVISTA allows insights to be gained by viewing the totality of sequence annotations and predictions, which may be more revealing than the sum of their parts. SeqVISTA runs on any operating system with a Java 1.4 virtual machine. It is freely available to academic users at http://zlab.bu.edu/SeqVISTA.

  2. Amino acid sequences and structures of chicken and turkey beta 2-microglobulin

    Welinder, K G; Jespersen, H M; Walther-Rasmussen, J; Skjødt, K

    The complete amino acid sequences of chicken and turkey beta 2-microglobulins have been determined by analyses of tryptic, V8-proteolytic and cyanogen bromide fragments, and by N-terminal sequencing. Mass spectrometric analysis of chicken beta 2-microglobulin supports the sequence-derived Mr of 11......,048. The higher apparent Mr obtained for the avian beta 2-microglobulins as compared to human beta 2-microglobulin by SDS-PAGE is not understood. Chicken and turkey beta 2-microglobulin consist of 98 residues and deviate at seven positions: 60, 66, 74-76, 78 and 82. The chicken and turkey sequences are...... complex suggest that the seven chicken to turkey differences are exposed to solvent in the avian MHC class I complex. The key residues of beta 2-microglobulin involved in alpha chain contacts within the MHC class I molecule are highly conserved between chicken and man. This explains that heterologous...

  3. Software scripts for quality checking of high-throughput nucleic acid sequencers.

    Lazo, G R; Tong, J; Miller, R; Hsia, C; Rausch, C; Kang, Y; Anderson, O D

    2001-06-01

    We have developed a graphical interface to allow the researcher to view and assess the quality of sequencing results using a series of program scripts developed to process data generated by automated sequencers. The scripts are written in Perl programming language and are executable under the cgibin directory of a Web server environment. The scripts direct nucleic acid sequencing trace file data output from automated sequencers to be analyzed by the phred molecular biology program and are displayed as graphical hypertext mark-up language (HTML) pages. The scripts are mainly designed to handle 96-well microtiter dish samples, but the scripts are also able to read data from 384-well microtiter dishes 96 samples at a time. The scripts may be customized for different laboratory environments and computer configurations. Web links to the sources and discussion page are provided. PMID:11414222

  4. Agreement Between Visual Inspection with Acetic Acid and Papanicolaous Smear as Screening Methods for Cervical Cancer

    Objective: To determine degree of agreement between visual inspection with acetic acid (VIA) and Papanicolaous (Pap) smear as screening methods for cervical cancer. Study Design: A cross-sectional study. Place and Duration of Study: Department of Obstetrics and Gynaecology, Sir Ganga Ram Hospital, Lahore, from July to December 2012. Methodology: Two hundred and fifty women in reproductive age group presenting with various gynaecological complaints were included in the study. A Papanicolaous smear was taken and visual inspection with 5% acetic acid was done. VIA was reported as positive or negative according to acetowhite changes and cytology result was graded as CIN 1, 2, 3 and squamous carcinoma. Those women who showed positive result with either VIA or Pap smear or both were further subjected to colposcopic directed biopsy which was taken as gold standard. Results were computed using Statistical Package for Social Sciences (SPSS) version 16 and statistical test used was kappa. Results: Out of 250 women, VIA was positive in 55 (22%) patients and Pap smear was abnormal in 27 (10.8%). Histological diagnosis of CIN/cancer was made in 36 out of a total 62 patients who underwent biopsy. Conclusion: There was a fair agreement between VIA and Pap smear, with VIA detecting more abnormalities than cytology. In the absence of Pap smear availability, VIA may be a reasonable cervical cancer screening method, especially in low resource settings. (author)

  5. Visualization of early events in acetic acid denaturation of HIV-1 protease: a molecular dynamics study.

    Aditi Narendra Borkar

    Full Text Available Protein denaturation plays a crucial role in cellular processes. In this study, denaturation of HIV-1 Protease (PR was investigated by all-atom MD simulations in explicit solvent. The PR dimer and monomer were simulated separately in 9 M acetic acid (9 M AcOH solution and water to study the denaturation process of PR in acetic acid environment. Direct visualization of the denaturation dynamics that is readily available from such simulations has been presented. Our simulations in 9 M AcOH reveal that the PR denaturation begins by separation of dimer into intact monomers and it is only after this separation that the monomer units start denaturing. The denaturation of the monomers is flagged off by the loss of crucial interactions between the α-helix at C-terminal and surrounding β-strands. This causes the structure to transit from the equilibrium dynamics to random non-equilibrating dynamics. Residence time calculations indicate that denaturation occurs via direct interaction of the acetic acid molecules with certain regions of the protein in 9 M AcOH. All these observations have helped to decipher a picture of the early events in acetic acid denaturation of PR and have illustrated that the α-helix and the β-sheet at the C-terminus of a native and functional PR dimer should maintain both the stability and the function of the enzyme and thus present newer targets for blocking PR function.

  6. PHYLOViZ: phylogenetic inference and data visualization for sequence based typing methods

    Francisco Alexandre P; Vaz Ctia; Monteiro Pedro T; Melo-Cristino José; Ramirez Mário; Carrio Joo A

    2012-01-01

    Abstract Background With the decrease of DNA sequencing costs, sequence-based typing methods are rapidly becoming the gold standard for epidemiological surveillance. These methods provide reproducible and comparable results needed for a global scale bacterial population analysis, while retaining their usefulness for local epidemiological surveys. Online databases that collect the generated allelic profiles and associated epidemiological data are available but this wealth of data remains under...

  7. Nucleotide sequence analysis of the gene encoding the Deinococcus radiodurans surface protein, derived amino acid sequence, and complementary protein chemical studies

    Peters, J.; Peters, M.; Lottspeich, F.; Schaefer, W.; Baumeister, W.

    1987-11-01

    The complete nucleotide sequence of the gene encoding the surface (hexagonally packed intermediate (HPI))-layer polypeptide of Deinococcus radiodurans Sark was determined and found to encode a polypeptide of 1036 amino acids. Amino acid sequence analysis of about 30% of the residues revealed that the mature polypeptide consists of at least 978 amino acids. The N terminus was blocked to Edman degradation. The results of proteolytic modification of the HPI layer in situ and M/sub r/ estimations of the HPI polypeptide expressed in Escherichia coli indicated that there is a leader sequence. The N-terminal region contained a very high percentage (29%) of threonine and serine, including a cluster of nine consecutive serine or threonine residues, whereas a stretch near the C terminus was extremely rich in aromatic amino acids (29%). The protein contained at least two disulfide bridges, as well as tightly bound reducing sugars and fatty acids.

  8. Nucleotide sequence analysis of the gene encoding the Deinococcus radiodurans surface protein, derived amino acid sequence, and complementary protein chemical studies

    The complete nucleotide sequence of the gene encoding the surface (hexagonally packed intermediate [HPI])-layer polypeptide of Deinococcus radiodurans Sark was determined and found to encode a polypeptide of 1036 amino acids. Amino acid sequence analysis of about 30% of the residues revealed that the mature polypeptide consists of at least 978 amino acids. The N terminus was blocked to Edman degradation. The results of proteolytic modification of the HPI layer in situ and M/sub r/ estimations of the HPI polypeptide expressed in Escherichia coli indicated that there is a leader sequence. The N-terminal region contained a very high percentage (29%) of threonine and serine, including a cluster of nine consecutive serine or threonine residues, whereas a stretch near the C terminus was extremely rich in aromatic amino acids (29%). The protein contained at least two disulfide bridges, as well as tightly bound reducing sugars and fatty acids

  9. Efficient Nucleic Acid Extraction and 16S rRNA Gene Sequencing for Bacterial Community Characterization.

    Anahtar, Melis N; Bowman, Brittany A; Kwon, Douglas S

    2016-01-01

    There is a growing appreciation for the role of microbial communities as critical modulators of human health and disease. High throughput sequencing technologies have allowed for the rapid and efficient characterization of bacterial communities using 16S rRNA gene sequencing from a variety of sources. Although readily available tools for 16S rRNA sequence analysis have standardized computational workflows, sample processing for DNA extraction remains a continued source of variability across studies. Here we describe an efficient, robust, and cost effective method for extracting nucleic acid from swabs. We also delineate downstream methods for 16S rRNA gene sequencing, including generation of sequencing libraries, data quality control, and sequence analysis. The workflow can accommodate multiple samples types, including stool and swabs collected from a variety of anatomical locations and host species. Additionally, recovered DNA and RNA can be separated and used for other applications, including whole genome sequencing or RNA-seq. The method described allows for a common processing approach for multiple sample types and accommodates downstream analysis of genomic, metagenomic and transcriptional information. PMID:27168460

  10. Preparation of Nucleic Acid Libraries for Personalized Sequencing Systems Using an Integrated Microfluidic Hub Technology (Seventh Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting 2012)

    Patel, Kamlesh D [Ken; SNL,

    2012-06-01

    Kamlesh (Ken) Patel from Sandia National Laboratories (Livermore, California) presents "Preparation of Nucleic Acid Libraries for Personalized Sequencing Systems Using an Integrated Microfluidic Hub Technology " at the 7th Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting held in June, 2012 in Santa Fe, NM.

  11. Complete nucleic acid sequence of Penaeus stylirostris densovirus (PstDNV) from India.

    Rai, Praveen; Safeena, Muhammed P; Karunasagar, Iddya; Karunasagar, Indrani

    2011-06-01

    Infectious hypodermal and hematopoietic necrosis virus (IHHNV) of shrimp, recently been classified as Penaeus stylirostris densovirus (PstDNV). The complete nucleic acid sequence of PstDNV from India was obtained by cloning and sequencing of different DNA fragment of the virus. The genome organisation of PstDNV revealed that there were three major coding domains: a left ORF (NS1) of 2001 bp, a mid ORF (NS2) of 1092 bp and a right ORF (VP) of 990 bp. The complete genome and amino acid sequences of three proteins viz., NS1, NS2 and VP were compared with the genomes of the virus reported from Hawaii, China and Mexico and with partial sequence available from isolates from different regions. The phylogenetic analysis of shrimp, insect and vertebrate parvovirus sequences showed that the Indian PstDNV isolate is phylogenetically more closely related to one of the three isolates from Taiwan (AY355307), and two isolates (AY362547 and AY102034) from Thailand. PMID:21402111

  12. Human liver type pyruvate kinase: Complete amino acid sequence and the expression in mammalian cells

    Pyruvate kinase (PK) has four isozymes (L, R, M1, M2) that are encoded by two different genes. Among these isozymes, abnormalities of liver (L)-type PK is considered to be associated with hereditary nonspherocytic hemolytic anemia in humans. The authors isolated and determined the full-length sequence of human L-type PK cDNA. The cDNA contains 1,629 base pairs encoding 543 amino acids, 68 base pairs of 5'-noncoding sequence, and 734 base pairs of 3'-noncoding sequence. The similarity between human and rat L-type PK was 86.9% at the nucleotide sequence level and 92.4% at the amino acid sequence level. The full-length L-type PK cDNA was placed under the promoter of simian virus 40 and introduced into monkey COS cells. Human L-type PK activity was detected in the extract of COS cells by the classical PK electrophoresis method

  13. Nucleotide and amino acid sequences of human intestinal alkaline phosphatase: close homology to placental alkaline phosphatase

    A cDNA clone for human adult intestinal alkaline phosphatase (ALP) [orthophosphoric-monoester phosphohydrolase (alkaline optimum); EC 3.1.3.1] was isolated from a λgt11 expression library. The cDNA insert of this clone is 2513 base pairs in length and contains an open reading frame that encodes a 528-amino acid polypeptide. This deduced polypeptide contains the first 40 amino acids of human intestinal ALP, as determined by direct protein sequencing. Intestinal ALP shows 86.5% amino acid identity to placental (type 1) ALP and 56.6% amino acid identity to liver/bone/kidney ALP. In the 3'-untranslated regions, intestinal and placental ALP cDNAs are 73.5% identical (excluding gaps). The evolution of this multigene enzyme family is discussed

  14. Fluorescent Probes for Nucleic Acid Visualization in Fixed and Live Cells

    Alexandre S. Boutorine

    2013-12-01

    Full Text Available This review analyses the literature concerning non-fluorescent and fluorescent probes for nucleic acid imaging in fixed and living cells from the point of view of their suitability for imaging intracellular native RNA and DNA. Attention is mainly paid to fluorescent probes for fluorescence microscopy imaging. Requirements for the target-binding part and the fluorophore making up the probe are formulated. In the case of native double-stranded DNA, structure-specific and sequence-specific probes are discussed. Among the latest, three classes of dsDNA-targeting molecules are described: (i sequence-specific peptides and proteins; (ii triplex-forming oligonucleotides and (iii polyamide oligo(N-methylpyrrole/N-methylimidazole minor groove binders. Polyamides seem to be the most promising targeting agents for fluorescent probe design, however, some technical problems remain to be solved, such as the relatively low sequence specificity and the high background fluorescence inside the cells. Several examples of fluorescent probe applications for DNA imaging in fixed and living cells are cited. In the case of intracellular RNA, only modified oligonucleotides can provide such sequence-specific imaging. Several approaches for designing fluorescent probes are considered: linear fluorescent probes based on modified oligonucleotide analogs, molecular beacons, binary fluorescent probes and template-directed reactions with fluorescence probe formation, FRET donor-acceptor pairs, pyrene excimers, aptamers and others. The suitability of all these methods for living cell applications is discussed.

  15. Amino acid sequence of the beta subunit of bovine lung casein kinase II.

    Takio, K.; Kuenzel, E A; Walsh, K. A.; Krebs, E G

    1987-01-01

    The amino acid sequence of the 209-residue beta subunit of bovine lung casein kinase II has been determined. Excluding the amino-terminal blocking group, which was not identified, the molecular weight of the polypeptide chain is 24,239. A marked polarity of the beta subunit is indicated by clusters of negative charges in the amino-terminal region and of positive charges in the carboxyl-terminal region. Whereas the beta subunit shows no homology with any known protein, a segment of the sequenc...

  16. Human apolipoprotein C-II: complete nucleic acid sequence of preapolipoprotein C-II.

    Fojo, S S; Law, S W; Brewer, H B

    1984-01-01

    Apolipoprotein (apo) C-II is a cofactor for lipoprotein lipase, the enzyme that catalyzes the hydrolysis of triglycerides on plasma triglyceride-rich lipoproteins. The complete coding sequence of apoC-II mRNA has been determined from an apoC-II clone isolated from a human liver cDNA library. A 17-base-long synthetic oligonucleotide based on amino acid residues 5-10 of apoC-II was utilized as a hybridization probe to select recombinant plasmids containing the apoC-II sequence. Two thousand fou...

  17. Visualization of the 12th Cranial Nerve with MRI: Value of Balanced Fast-Field Echo and 3D-Drive Sequences Among the T2 TSE Post-Contrast T1 Sequences

    Aydin, H.; N Aydin Oktay; B Hekimoglu

    2010-01-01

    Background/Objective: Our aim was to optimize the most effective MR imaging sequence for visualization of the 12th cranial nerve (hypoglossal nerve) through its cisternal course."nPatients and Methods: We applied balanced fast-field echo (B-FFE), 3D-T2 weighted Driven Equilibrium RF Reset Pulse (DRIVE), T2 weighted 2D TSE and post-contrast T1 weighted sequences and tried to find out the best sequence for the perfect visualization of the 12th cranial nerve. One-hundred patients without an...

  18. Automatic classification of lung tumour heterogeneity according to a visual-based score system in dynamic contrast enhanced CT sequences

    Bevilacqua, Alessandro; Baiocco, Serena

    2016-03-01

    Computed tomography (CT) technologies have been considered for a long time as one of the most effective medical imaging tools for morphological analysis of body parts. Contrast Enhanced CT (CE-CT) also allows emphasising details of tissue structures whose heterogeneity, inspected through visual analysis, conveys crucial information regarding diagnosis and prognosis in several clinical pathologies. Recently, Dynamic CE-CT (DCE-CT) has emerged as a promising technique to perform also functional hemodynamic studies, with wide applications in the oncologic field. DCE-CT is based on repeated scans over time performed after intravenous administration of contrast agent, in order to study the temporal evolution of the tracer in 3D tumour tissue. DCE-CT pushes towards an intensive use of computers to provide automatically quantitative information to be used directly in clinical practice. This requires that visual analysis, representing the gold-standard for CT image interpretation, gains objectivity. This work presents the first automatic approach to quantify and classify the lung tumour heterogeneities based on DCE-CT image sequences, so as it is performed through visual analysis by experts. The approach developed relies on the spatio-temporal indices we devised, which also allow exploiting temporal data that enrich the knowledge of the tissue heterogeneity by providing information regarding the lesion status.

  19. HBVRegDB: Annotation, comparison, detection and visualization of regulatory elements in hepatitis B virus sequences

    Firth Andrew E

    2007-12-01

    Full Text Available Abstract Background The many Hepadnaviridae sequences available have widely varied functional annotation. The genomes are very compact (~3.2 kb but contain multiple layers of functional regulatory elements in addition to coding regions. Key regions are subject to purifying selection, as mutations in these regions will produce non-functional viruses. Results These genomic sequences have been organized into a structured database to facilitate research at the molecular level. HBVRegDB is a comparative genomic analysis tool with an integrated underlying sequence database. The database contains genomic sequence data from representative viruses. In addition to INSDC and RefSeq annotation, HBVRegDB also contains expert and systematically calculated annotations (e.g. promoters and comparative genome analysis results (e.g. blastn, tblastx. It also contains analyses based on curated HBV alignments. Information about conserved regions – including primary conservation (e.g. CDS-Plotcon and RNA secondary structure predictions (e.g. Alidot – is integrated into the database. A large amount of data is graphically presented using the GBrowse (Generic Genome Browser adapted for analysis of viral genomes. Flexible query access is provided based on any annotated genomic feature. Novel regulatory motifs can be found by analysing the annotated sequences. Conclusion HBVRegDB serves as a knowledge database and as a comparative genomic analysis tool for molecular biologists investigating HBV. It is publicly available and complementary to other viral and HBV focused datasets and tools http://hbvregdb.otago.ac.nz. The availability of multiple and highly annotated sequences of viral genomes in one database combined with comparative analysis tools facilitates detection of novel genomic elements.

  20. Sequence-specific nucleic acid detection from binary pore conductance measurement

    Esfandiari, Leyla; Monbouquette, Harold G.; Jacob J. Schmidt

    2012-01-01

    We describe a platform for sequence-specific nucleic acid (NA) detection utilizing a micropipette tapered to a 2 μm diameter pore and 3 μm diameter polystyrene beads to which uncharged peptide nucleic acid (PNA) probe molecules have been conjugated. As the target NAs hybridize to the complementary PNA-beads, the beads acquire negative charge and become electrophoretically mobile. An applied electric field guides these NA-PNA-beads toward the pipette tip, which they obstruct, leading to an ind...

  1. Nucleotide sequence homology between the heat-labile enterotoxin gene of Escherichia coli and Vibrio cholerae deoxyribonucleic acid.

    Moseley, S L; Falkow, S

    1980-01-01

    Isolated deoxyribonucleic acid fragments encoding the heat-labile enterotoxin of Escherichia coli were used to probe for homologous sequences in restricted whole-cell deoxyribonucleic acid from Vibrio cholerae. Significant sequence homology between the heat-labile enterotoxin gene and V. cholerae deoxyribonucleic acid was demonstrated, and apparent differences were observed in the organization of the cholera toxin gene among different strains of V. cholerae.

  2. Visualization of the mycelia of wood-rotting fungi by fluorescence in situ hybridization using a peptide nucleic acid probe.

    Nakada, Yuji; Nakaba, Satoshi; Matsunaga, Hiroshi; Funada, Ryo; Yoshida, Makoto

    2013-01-01

    White rot fungus, Phanerochaete chrysosporium, and brown rot fungus, Postia placenta, grown on agar plates, were visualized by fluorescence in situ hybridization (FISH) using a peptide nucleic acid (PNA) probe. Mycelia grown on wood chips were also clearly detected by PNA-FISH following blocking treatment. To the best of our knowledge, this is the first report on the visualization of fungi in wood by FISH. PMID:23391931

  3. Self-Sequencing of Amino Acids and Origins of Polyfunctional Protocells

    Fox, Sidney W.

    1984-12-01

    The primal role of the origins of proteins in molecular evolution is discussed. On the basis of this premise, the significance of the experimentally established self-sequencing of amino acids under simulated geological conditions is explained as due to the fact that the products are highly nonrandom and accordingly contain many kinds of information. When such thermal proteins are aggregated into laboratory protocells, an action that occurs readily, the resultant protocells also contain many kinds of information. Residue-by-residue order, enzymic activities, and lipid quality accordingly occur within each preparation of proteinoid (thermal protein). In this paper are reviewed briefly the phenomenon of self-sequencing of amino acids, its relationship to evolutionary processes, other significance of such self-ordering, and the experimental evidence for original polyfunctional protocells.

  4. Anti-peptide aptamers recognize amino acid sequence and bind a protein epitope.

    Xu, W; Ellington, A. D.

    1996-01-01

    In vitro selection of nucleic acid binding species (aptamers) is superficially similar to the immune response. Both processes produce biopolymers that can recognize targets with high affinity and specificity. While antibodies are known to recognize the sequence and conformation of protein surface features (epitopes), very little is known about the precise interactions between aptamers and their epitopes. Therefore, aptamers that could recognize a particular epitope, a peptide fragment of huma...

  5. Sequence-selective targeting of duplex DNA by peptide nucleic acids

    Nielsen, Peter E

    2010-01-01

    nucleic acid (PNA) can recognize duplex DNA with high sequence specificity and affinity in triplex, duplex and double-duplex invasive modes or non-invasive triplex modes. Novel PNA modification has improved the affinity for DNA recognition via duplex invasion, double-duplex invasion and triplex......Sequence-selective gene targeting constitutes an attractive drug-discovery approach for genetic therapy, with the aim of reducing or enhancing the activity of specific genes at the transcriptional level, or as part of a methodology for targeted gene repair. The pseudopeptide DNA mimic peptide...... recognition considerably. Such modifications have also resulted in new approaches to targeted gene repair and sequence-selective double-strand cleavage of genomic DNA....

  6. Amino acid sequences mediating vascular cell adhesion molecule 1 binding to integrin alpha 4: homologous DSP sequence found for JC polyoma VP1 coat protein

    Michael Andrew Meyer

    2013-07-01

    Full Text Available The JC polyoma viral coat protein VP1 was analyzed for amino acid sequences homologies to the IDSP sequence which mediates binding of VLA-4 (integrin alpha 4 to vascular cell adhesion molecule 1. Although the full sequence was not found, a DSP sequence was located near the critical arginine residue linked to infectivity of the virus and binding to sialic acid containing molecules such as integrins (3. For the JC polyoma virus, a DSP sequence was found at residues 70, 71 and 72 with homology also noted for the mouse polyoma virus and SV40 virus. Three dimensional modeling of the VP1 molecule suggests that the DSP loop has an accessible site for interaction from the external side of the assembled viral capsid pentamer.

  7. Random amino acid mutations and protein misfolding lead to Shannon limit in sequence-structure communication.

    Andreas Martin Lisewski

    Full Text Available The transmission of genomic information from coding sequence to protein structure during protein synthesis is subject to stochastic errors. To analyze transmission limits in the presence of spurious errors, Shannon's noisy channel theorem is applied to a communication channel between amino acid sequences and their structures established from a large-scale statistical analysis of protein atomic coordinates. While Shannon's theorem confirms that in close to native conformations information is transmitted with limited error probability, additional random errors in sequence (amino acid substitutions and in structure (structural defects trigger a decrease in communication capacity toward a Shannon limit at 0.010 bits per amino acid symbol at which communication breaks down. In several controls, simulated error rates above a critical threshold and models of unfolded structures always produce capacities below this limiting value. Thus an essential biological system can be realistically modeled as a digital communication channel that is (a sensitive to random errors and (b restricted by a Shannon error limit. This forms a novel basis for predictions consistent with observed rates of defective ribosomal products during protein synthesis, and with the estimated excess of mutual information in protein contact potentials.

  8. Characterization of the microbial acid mine drainage microbial community using culturing and direct sequencing techniques.

    Auld, Ryan R; Myre, Maxine; Mykytczuk, Nadia C S; Leduc, Leo G; Merritt, Thomas J S

    2013-05-01

    We characterized the bacterial community from an AMD tailings pond using both classical culturing and modern direct sequencing techniques and compared the two methods. Acid mine drainage (AMD) is produced by the environmental and microbial oxidation of minerals dissolved from mining waste. Surprisingly, we know little about the microbial communities associated with AMD, despite the fundamental ecological roles of these organisms and large-scale economic impact of these waste sites. AMD microbial communities have classically been characterized by laboratory culturing-based techniques and more recently by direct sequencing of marker gene sequences, primarily the 16S rRNA gene. In our comparison of the techniques, we find that their results are complementary, overall indicating very similar community structure with similar dominant species, but with each method identifying some species that were missed by the other. We were able to culture the majority of species that our direct sequencing results indicated were present, primarily species within the Acidithiobacillus and Acidiphilium genera, although estimates of relative species abundance were only obtained from direct sequencing. Interestingly, our culture-based methods recovered four species that had been overlooked from our sequencing results because of the rarity of the marker gene sequences, likely members of the rare biosphere. Further, direct sequencing indicated that a single genus, completely missed in our culture-based study, Legionella, was a dominant member of the microbial community. Our results suggest that while either method does a reasonable job of identifying the dominant members of the AMD microbial community, together the methods combine to give a more complete picture of the true diversity of this environment. PMID:23485423

  9. Draft Genome Sequence of Acid-Tolerant Clostridium drakei SL1T, a Potential Chemical Producer through Syngas Fermentation

    Jeong, Yujin; Song, Yoseb; Shin, Hyeon Seok; Cho, Byung-Kwan

    2014-01-01

    Clostridium drakei SL1T is a strictly anaerobic, H2-utilizing, and acid-tolerant acetogen isolated from an acidic sediment that is a potential platform for commodity chemical production from syngas fermentation. The draft genome sequence of this strain will enable determination of the acid resistance and autotrophic pathway of the acetogen.

  10. Complete Genome Sequence of the Probiotic Lactic Acid Bacterium Lactobacillus Rhamnosus

    Samat Kozhakhmetov

    2014-01-01

    Full Text Available Introduction: Lactobacilli are a bacteria commonly found in the gastrointestinal tract. Some species of this genus have probiotic properties. The most common of these is Lactobacillus rhamnosus, a microoganism, generally regarded as safe (GRAS. It is also a homofermentative L-(+-lactic acid producer. The genus Lactobacillus is characterized by an extraordinary degree of the phenotypic and genotypic diversity. However, the studies of the genus were conducted mostly with the unequally distributed, non-random choice of species for sequencing; thus, there is only one representative genome from the Lactobacillus rhamnosus clade available to date. The aim of this study was to characterize the genome sequencing of selected strains of Lactobacilli. Methods: 109 samples were isolated from national domestic dairy products in the laboratory of Center for life sciences. After screaning isolates for probiotic properties, a highly active Lactobacillus spp strain was chosen. Genomic DNA was extracted according to the manufacturing protocol (Wizard® Genomic DNA Purification Kit. The Lactobacillus rhamnosus strain was identified as the highly active Lactobacillus strain accoridng to its morphological, cultural, physiological, and biochemical properties, and a genotypic analysis. Results: The genome of Lactobacillus rhamnosus was sequenced using the Roche 454 GS FLX (454 GS FLX platforms. The initial draft assembly was prepared from 14 large contigs (20 all contigs by the Newbler gsAssembler 2.3 (454 Life Sciences, Branford, CT. Conclusion: A full genome-sequencing of selected strains of lactic acid bacteria was made during the study.

  11. Metazoan Remaining Genes for Essential Amino Acid Biosynthesis: Sequence Conservation and Evolutionary Analyses

    Igor R. Costa

    2014-12-01

    Full Text Available Essential amino acids (EAA consist of a group of nine amino acids that animals are unable to synthesize via de novo pathways. Recently, it has been found that most metazoans lack the same set of enzymes responsible for the de novo EAA biosynthesis. Here we investigate the sequence conservation and evolution of all the metazoan remaining genes for EAA pathways. Initially, the set of all 49 enzymes responsible for the EAA de novo biosynthesis in yeast was retrieved. These enzymes were used as BLAST queries to search for similar sequences in a database containing 10 complete metazoan genomes. Eight enzymes typically attributed to EAA pathways were found to be ubiquitous in metazoan genomes, suggesting a conserved functional role. In this study, we address the question of how these genes evolved after losing their pathway partners. To do this, we compared metazoan genes with their fungal and plant orthologs. Using phylogenetic analysis with maximum likelihood, we found that acetolactate synthase (ALS and betaine-homocysteine S-methyltransferase (BHMT diverged from the expected Tree of Life (ToL relationships. High sequence conservation in the paraphyletic group Plant-Fungi was identified for these two genes using a newly developed Python algorithm. Selective pressure analysis of ALS and BHMT protein sequences showed higher non-synonymous mutation ratios in comparisons between metazoans/fungi and metazoans/plants, supporting the hypothesis that these two genes have undergone non-ToL evolution in animals.

  12. Prediction of protein motions from amino acid sequence and its application to protein-protein interaction

    Wako Hiroshi

    2010-07-01

    Full Text Available Abstract Background Structural flexibility is an important characteristic of proteins because it is often associated with their function. The movement of a polypeptide segment in a protein can be broken down into two types of motions: internal and external ones. The former is deformation of the segment itself, but the latter involves only rotational and translational motions as a rigid body. Normal Model Analysis (NMA can derive these two motions, but its application remains limited because it necessitates the gathering of complete structural information. Results In this work, we present a novel method for predicting two kinds of protein motions in ordered structures. The prediction uses only information from the amino acid sequence. We prepared a dataset of the internal and external motions of segments in many proteins by application of NMA. Subsequently, we analyzed the relation between thermal motion assessed from X-ray crystallographic B-factor and internal/external motions calculated by NMA. Results show that attributes of amino acids related to the internal motion have different features from those related to the B-factors, although those related to the external motion are correlated strongly with the B-factors. Next, we developed a method to predict internal and external motions from amino acid sequences based on the Random Forest algorithm. The proposed method uses information associated with adjacent amino acid residues and secondary structures predicted from the amino acid sequence. The proposed method exhibited moderate correlation between predicted internal and external motions with those calculated by NMA. It has the highest prediction accuracy compared to a naïve model and three published predictors. Conclusions Finally, we applied the proposed method predicting the internal motion to a set of 20 proteins that undergo large conformational change upon protein-protein interaction. Results show significant overlaps between the

  13. Nanopore Analysis of Nucleic Acids: Single-Molecule Studies of Molecular Dynamics, Structure, and Base Sequence

    Olasagasti, Felix; Deamer, David W.

    Nucleic acids are linear polynucleotides in which each base is covalently linked to a pentose sugar and a phosphate group carrying a negative charge. If a pore having roughly the crosssectional diameter of a single-stranded nucleic acid is embedded in a thin membrane and a voltage of 100 mV or more is applied, individual nucleic acids in solution can be captured by the electrical field in the pore and translocated through by single-molecule electrophoresis. The dimensions of the pore cannot accommodate anything larger than a single strand, so each base in the molecule passes through the pore in strict linear sequence. The nucleic acid strand occupies a large fraction of the pore's volume during translocation and therefore produces a transient blockade of the ionic current created by the applied voltage. If it could be demonstrated that each nucleotide in the polymer produced a characteristic modulation of the ionic current during its passage through the nanopore, the sequence of current modulations would reflect the sequence of bases in the polymer. According to this basic concept, nanopores are analogous to a Coulter counter that detects nanoscopic molecules rather than microscopic [1,2]. However, the advantage of nanopores is that individual macromolecules can be characterized because different chemical and physical properties affect their passage through the pore. Because macromolecules can be captured in the pore as well as translocated, the nanopore can be used to detect individual functional complexes that form between a nucleic acid and an enzyme. No other technique has this capability.

  14. Colorimetric and visual determination of dicyandiamide using gallic acid-capped gold nanoparticles

    A new method is presented for the visual detection of dicyandiamide (DCD). Gold nanoparticles (AuNPs) capped with gallic acid (GA) were synthesized in a single step at room temperature, using GA as both the reducing agent and stabilizer. In the presence of DCD, the hydrogen-bonding interaction between GA and DCD induces the aggregation of AuNPs, associated with a color change from red to gray that can be observed with bare eye. DCD could be quantified by photometry as the red shift of the maximal absorption band is linearly related to the logarithm of concentration of DCD in the 0.1 to 500 μM concentration range, with a regression coefficient of 0.9987 and a 80 nM detection limit (at an SNR of 3). The proposed method was successfully applied to the detection of DCD in spiked dairy samples. (author)

  15. Quantification of read species behavior within whole genome sequencing of cancer genomes for the stratification and visualization of genomic variation.

    Hibsh, Dror; Buetow, Kenneth H; Yaari, Gur; Efroni, Sol

    2016-05-19

    The cancer genome is abnormal genome, and the ability to monitor its sequence had undergone a technological revolution. Yet prognosis and diagnosis remain an expert-based decision, with only limited abilities to provide machine-based decisions. We introduce a heterogeneity-based method for stratifying and visualizing whole-genome sequencing (WGS) reads. This method uses the heterogeneity within WGS reads to markedly reduce the dimensionality of next-generation sequencing data; it is available through the tool HiBS (Heterogeneity-Based Subclassification) that allows cancer sample classification. We validated HiBS using >200 WGS samples from nine different cancer types from The Cancer Genome Atlas (TCGA). With HiBS, we show progress with two WGS related issues: (i) differentiation between normal (NB) and tumor (TP) samples based solely on the information structure of their WGS data, and (ii) identification of specific regions of chromosomal amplification/deletion and their association with tumor stage. By comparing results to those obtained through available WGS analyses tools, we demonstrate some of the novelties obtained by the approach implemented in HiBS and also show nearly perfect normal/tumor classification, used to identify known and unknown chromosomal aberrations. Finally, the HiBS index has been associated with breast cancer tumor stage. PMID:26809676

  16. Mulan: Multiple-Sequence Local Alignment and Visualization for Studying Function and Evolution

    Ovcharenko, I; Loots, G; Giardine, B; Hou, M; Ma, J; Hardison, R; Stubbs, L; Miller, W

    2004-07-14

    Multiple sequence alignment analysis is a powerful approach for understanding phylogenetic relationships, annotating genes and detecting functional regulatory elements. With a growing number of partly or fully sequenced vertebrate genomes, effective tools for performing multiple comparisons are required to accurately and efficiently assist biological discoveries. Here we introduce Mulan (http://mulan.dcode.org/), a novel method and a network server for comparing multiple draft and finished-quality sequences to identify functional elements conserved over evolutionary time. Mulan brings together several novel algorithms: the tba multi-aligner program for rapid identification of local sequence conservation and the multiTF program for detecting evolutionarily conserved transcription factor binding sites in multiple alignments. In addition, Mulan supports two-way communication with the GALA database; alignments of multiple species dynamically generated in GALA can be viewed in Mulan, and conserved transcription factor binding sites identified with Mulan/multiTF can be integrated and overlaid with extensive genome annotation data using GALA. Local multiple alignments computed by Mulan ensure reliable representation of short-and large-scale genomic rearrangements in distant organisms. Mulan allows for interactive modification of critical conservation parameters to differentially predict conserved regions in comparisons of both closely and distantly related species. We illustrate the uses and applications of the Mulan tool through multi-species comparisons of the GATA3 gene locus and the identification of elements that are conserved differently in avians than in other genomes allowing speculation on the evolution of birds. Source code for the aligners and the aligner-evaluation software can be freely downloaded from http://bio.cse.psu.edu/.

  17. eQTL Viewer: visualizing how sequence variation affects genome-wide transcription

    Zeng Zhao-Bang; Aylor David L; Zou Wei

    2007-01-01

    Abstract Background Expression Quantitative Trait Locus (eQTL) mapping methods have been used to identify the genetic basis of gene expression variations. To map eQTL, thousands of expression profiles are related with sequence polymorphisms across the genome through their correlated variations. These eQTL distribute in many chromosomal regions, each of which can include many genes. The large number of mapping results produced makes it difficult to consider simultaneously the relationships bet...

  18. Predicting DNA-binding sites of proteins from amino acid sequence

    Wu Feihong

    2006-05-01

    Full Text Available Abstract Background Understanding the molecular details of protein-DNA interactions is critical for deciphering the mechanisms of gene regulation. We present a machine learning approach for the identification of amino acid residues involved in protein-DNA interactions. Results We start with a Naïve Bayes classifier trained to predict whether a given amino acid residue is a DNA-binding residue based on its identity and the identities of its sequence neighbors. The input to the classifier consists of the identities of the target residue and 4 sequence neighbors on each side of the target residue. The classifier is trained and evaluated (using leave-one-out cross-validation on a non-redundant set of 171 proteins. Our results indicate the feasibility of identifying interface residues based on local sequence information. The classifier achieves 71% overall accuracy with a correlation coefficient of 0.24, 35% specificity and 53% sensitivity in identifying interface residues as evaluated by leave-one-out cross-validation. We show that the performance of the classifier is improved by using sequence entropy of the target residue (the entropy of the corresponding column in multiple alignment obtained by aligning the target sequence with its sequence homologs as additional input. The classifier achieves 78% overall accuracy with a correlation coefficient of 0.28, 44% specificity and 41% sensitivity in identifying interface residues. Examination of the predictions in the context of 3-dimensional structures of proteins demonstrates the effectiveness of this method in identifying DNA-binding sites from sequence information. In 33% (56 out of 171 of the proteins, the classifier identifies the interaction sites by correctly recognizing at least half of the interface residues. In 87% (149 out of 171 of the proteins, the classifier correctly identifies at least 20% of the interface residues. This suggests the possibility of using such classifiers to identify

  19. Complete amino acid sequence of globin chains and biological activity of fragmented crocodile hemoglobin (Crocodylus siamensis).

    Srihongthong, Saowaluck; Pakdeesuwan, Anawat; Daduang, Sakda; Araki, Tomohiro; Dhiravisit, Apisak; Thammasirirak, Sompong

    2012-08-01

    Hemoglobin, α-chain, β-chain and fragmented hemoglobin of Crocodylus siamensis demonstrated both antibacterial and antioxidant activities. Antibacterial and antioxidant properties of the hemoglobin did not depend on the heme structure but could result from the compositions of amino acid residues and structures present in their primary structure. Furthermore, thirteen purified active peptides were obtained by RP-HPLC analyses, corresponding to fragments in the α-globin chain and the β-globin chain which are mostly located at the N-terminal and C-terminal parts. These active peptides operate on the bacterial cell membrane. The globin chains of Crocodylus siamensis showed similar amino acids to the sequences of Crocodylus niloticus. The novel amino acid substitutions of α-chain and β-chain are not associated with the heme binding site or the bicarbonate ion binding site, but could be important through their interactions with membranes of bacteria. PMID:22648692

  20. Amino acid selective unlabeling for sequence specific resonance assignments in proteins

    Krishnarjuna, B.; Jaipuria, Garima; Thakur, Anushikha [Indian Institute of Science, NMR Research Centre (India); D' Silva, Patrick, E-mail: patrick@biochem.iisc.ernet.in [Indian Institute of Science, Department of Biochemistry (India); Atreya, Hanudatta S., E-mail: hsatreya@sif.iisc.ernet.in [Indian Institute of Science, NMR Research Centre (India)

    2011-01-15

    Sequence specific resonance assignment constitutes an important step towards high-resolution structure determination of proteins by NMR and is aided by selective identification and assignment of amino acid types. The traditional approach to selective labeling yields only the chemical shifts of the particular amino acid being selected and does not help in establishing a link between adjacent residues along the polypeptide chain, which is important for sequential assignments. An alternative approach is the method of amino acid selective 'unlabeling' or reverse labeling, which involves selective unlabeling of specific amino acid types against a uniformly {sup 13}C/{sup 15}N labeled background. Based on this method, we present a novel approach for sequential assignments in proteins. The method involves a new NMR experiment named, {l_brace}{sup 12}CO{sub i}-{sup 15}N{sub i+1}{r_brace}-filtered HSQC, which aids in linking the {sup 1}H{sup N}/{sup 15}N resonances of the selectively unlabeled residue, i, and its C-terminal neighbor, i + 1, in HN-detected double and triple resonance spectra. This leads to the assignment of a tri-peptide segment from the knowledge of the amino acid types of residues: i - 1, i and i + 1, thereby speeding up the sequential assignment process. The method has the advantage of being relatively inexpensive, applicable to {sup 2}H labeled protein and can be coupled with cell-free synthesis and/or automated assignment approaches. A detailed survey involving unlabeling of different amino acid types individually or in pairs reveals that the proposed approach is also robust to misincorporation of {sup 14}N at undesired sites. Taken together, this study represents the first application of selective unlabeling for sequence specific resonance assignments and opens up new avenues to using this methodology in protein structural studies.

  1. Comparative characterization of random-sequence proteins consisting of 5, 12, and 20 kinds of amino acids.

    Tanaka, Junko; Doi, Nobuhide; Takashima, Hideaki; Yanagawa, Hiroshi

    2010-04-01

    Screening of functional proteins from a random-sequence library has been used to evolve novel proteins in the field of evolutionary protein engineering. However, random-sequence proteins consisting of the 20 natural amino acids tend to aggregate, and the occurrence rate of functional proteins in a random-sequence library is low. From the viewpoint of the origin of life, it has been proposed that primordial proteins consisted of a limited set of amino acids that could have been abundantly formed early during chemical evolution. We have previously found that members of a random-sequence protein library constructed with five primitive amino acids show high solubility (Doi et al., Protein Eng Des Sel 2005;18:279-284). Although such a library is expected to be appropriate for finding functional proteins, the functionality may be limited, because they have no positively charged amino acid. Here, we constructed three libraries of 120-amino acid, random-sequence proteins using alphabets of 5, 12, and 20 amino acids by preselection using mRNA display (to eliminate sequences containing stop codons and frameshifts) and characterized and compared the structural properties of random-sequence proteins arbitrarily chosen from these libraries. We found that random-sequence proteins constructed with the 12-member alphabet (including five primitive amino acids and positively charged amino acids) have higher solubility than those constructed with the 20-member alphabet, though other biophysical properties are very similar in the two libraries. Thus, a library of moderate complexity constructed from 12 amino acids may be a more appropriate resource for functional screening than one constructed from 20 amino acids. PMID:20162614

  2. Partial amino acid sequence of fructose-1,6-bisphosphatase from the blue-green algae Synechococcus leopoliensis.

    Marcus, F; Latshaw, S P; Steup, M; Gerbling, K P

    1989-08-01

    Purified fructose-1,6-bisphosphatase from the cyanobacterium Synechococcus leopoliensis was S-carboxymethylated and cleaved with trypsin. The resulting peptides were purified by reversed-phase high performance liquid chromatography and the amino acid sequence of six of the purified peptides was determined by gas-phase microsequencing. The results revealed sequence homology with other fructose-1,6-bisphosphatases. The obtained sequence data provides information required for the design of oligonucleotide hybridization probes to screen existing libraries of cyanobacterial DNA. The determination of the amino acid sequence of cyanobacterial proteins may yield important information with respect to the endosymbiotic theory of evolution. PMID:2550924

  3. Visualization of 4th Cranial Nerve With MRI: Value of Balanced Fast-Field Echo and 3d-Drive Sequences Against The T2-TSE and Post-Contrast T1w Sequences

    Hasan AYDIN; Ç?FTÇ?, Egemen; HEK?MO?LU, Baki

    2009-01-01

    The aim of this study is to assess the best effective MRI sequence for the visualization of the 4th cranial nerve (Trochlear nerve) in its cisternal course. Balanced fast-field echo (B-FFE), 3D-T2W DRIVE Sense, T2W 2D TSE and Post-contrast T1W sequences were all applied and we tried to get the best sequence for the exact assessment of the 4th cranial nerve. 100 patients without the symptoms of trochlear nerve palsy were examined using the above sequences. Imaging analysis is graded as; nerve ...

  4. Method and software for using m-sequences to characterize parallel components of higher-order visual tracking behavior in Drosophila

    Mark A Frye

    2014-10-01

    Full Text Available A moving visual figure may contain first-order signals defined by variation in mean luminance, as well as second-order signals defined by constant mean luminance and variation in luminance envelope, or higher-order signals that cannot be estimated by taking higher moments of the luminance distribution. Separating these properties of a moving figure to experimentally probe the visual subsystems that encode them is technically challenging and has resulted in debated mechanisms of visual object detection by flies. Our prior work took a white noise systems identification approach using a commercially available electronic display system to characterize the spatial variation in the temporal dynamics of two distinct subsystems for first- and higher-order components of visual figure tracking. The method relied on the use of single pixel displacements of two visual stimuli according to two binary maximum length shift register sequences (m-sequences and cross-correlation of each m-sequence with time-varying flight steering measurements. The resultant spatio-temporal action fields represent temporal impulse responses parameterized by the azimuthal location of the visual figure, one STAF for first-order and another for higher-order components of compound stimuli. Here we review m-sequence and reverse correlation procedures, then describe our application in detail, provide Matlab code, validate the STAFs, and demonstrate the utility and robustness of STAFs by predicting the results of other published experimental procedures. This method has demonstrated how two relatively modest innovations on classical white noise analysis—the inclusion of space as a way to organize response kernels and the use of linear decoupling to measure the response to two channels of visual information simultaneously—could substantially improve our basic understanding of visual processing in the fly.

  5. alpha-Amylase gene of Streptomyces limosus: nucleotide sequence, expression motifs, and amino acid sequence homology to mammalian and invertebrate alpha-amylases.

    Long, C M; Virolle, M J; Chang, S Y; Chang, S.; Bibb, M.J.

    1987-01-01

    The nucleotide sequence of the coding and regulatory regions of the alpha-amylase gene (aml) of Streptomyces limosus was determined. High-resolution S1 mapping was used to locate the 5' end of the transcript and demonstrated that the gene is transcribed from a unique promoter. The predicted amino acid sequence has considerable identity to mammalian and invertebrate alpha-amylases, but not to those of plant, fungal, or eubacterial origin. Consistent with this is the susceptibility of the enzym...

  6. Comparison of Visual Inspection with acetic acid and Pap smear in cervical cancer screening at a tertiary care hospital

    Objective: To determine the accuracy of visual inspection with acetic acid in comparison with Pap smear against colposcopic directed biopsy, for detection of pre-cancerous lesion. Methods: The comparative cross-sectional study was conducted at the Maternal and Child Health Centre (MCHC), Pakistan Institute of Medical Sciences (PIMS), Islamabad, from January to December 2010. Every married women with age range 19 to 51 years underwent conventional cytology and visual inspection with 5% acetic acid. Distinct acetowhite areas were taken as positive, while cervical intra-epithelial neoplasia on cytology was labelled as Pap smear positive. Colposcopic directed biopsy was taken as the gold standard. SPSS 13 was used for statistical analysis. Results: Of 519 subjects, 70(13.4%) were screened positive and 29(5.6%) were biopsy positive for cervical intra-epithelial neoplasia. Of these, 26(37.1 %) were positive on visual inspection; 14 (20 %) on cytology; and 30 (42.8%) on combined test. The sensitivity of visual inspection was 78.5% vs 61.1% for Pap smear (p<0.001). The specificity of visual inspection was 99.3% vs 99.4% for cytology (p<0.1). Significantly higher sensitivity and specificity was found for the combined test than either of the two alone; 93.1% and 99.1% respectively (p<0.001). The positive predictive value of visual inspection vs pap was 84.6% vs 78.5% (p<0.001) and negative predictive value was 98.6% vs 96.5% (p<0.1). Both values of combined test were significantly higher than either of the two tests alone (p<0.01). Conclusion: Visual inspection with acetic acid has significantly higher sensitivity than Pap smear and may replace pap smear as a primary screening tool for universal screening. Combined test with higher predictive accuracy may be used for opportunistic screening. (author)

  7. Prediction of flexible/rigid regions from protein sequences using k-spaced amino acid pairs

    Ruan Jishou

    2007-04-01

    Full Text Available Abstract Background Traditionally, it is believed that the native structure of a protein corresponds to a global minimum of its free energy. However, with the growing number of known tertiary (3D protein structures, researchers have discovered that some proteins can alter their structures in response to a change in their surroundings or with the help of other proteins or ligands. Such structural shifts play a crucial role with respect to the protein function. To this end, we propose a machine learning method for the prediction of the flexible/rigid regions of proteins (referred to as FlexRP; the method is based on a novel sequence representation and feature selection. Knowledge of the flexible/rigid regions may provide insights into the protein folding process and the 3D structure prediction. Results The flexible/rigid regions were defined based on a dataset, which includes protein sequences that have multiple experimental structures, and which was previously used to study the structural conservation of proteins. Sequences drawn from this dataset were represented based on feature sets that were proposed in prior research, such as PSI-BLAST profiles, composition vector and binary sequence encoding, and a newly proposed representation based on frequencies of k-spaced amino acid pairs. These representations were processed by feature selection to reduce the dimensionality. Several machine learning methods for the prediction of flexible/rigid regions and two recently proposed methods for the prediction of conformational changes and unstructured regions were compared with the proposed method. The FlexRP method, which applies Logistic Regression and collocation-based representation with 95 features, obtained 79.5% accuracy. The two runner-up methods, which apply the same sequence representation and Support Vector Machines (SVM and Naïve Bayes classifiers, obtained 79.2% and 78.4% accuracy, respectively. The remaining considered methods are

  8. Nucleic and amino acid sequences relating to a novel transketolase, and methods for the expression thereof

    Croteau, Rodney Bruce (Pullman, WA); Wildung, Mark Raymond (Colfax, WA); Lange, Bernd Markus (Pullman, WA); McCaskill, David G. (Pullman, WA)

    2001-01-01

    cDNAs encoding 1-deoxyxylulose-5-phosphate synthase from peppermint (Mentha piperita) have been isolated and sequenced, and the corresponding amino acid sequences have been determined. Accordingly, isolated DNA sequences (SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7) are provided which code for the expression of 1-deoxyxylulose-5-phosphate synthase from plants. In another aspect the present invention provides for isolated, recombinant DXPS proteins, such as the proteins having the sequences set forth in SEQ ID NO:4, SEQ ID NO:6 and SEQ ID NO:8. In other aspects, replicable recombinant cloning vehicles are provided which code for plant 1-deoxyxylulose-5-phosphate synthases, or for a base sequence sufficiently complementary to at least a portion of 1-deoxyxylulose-5-phosphate synthase DNA or RNA to enable hybridization therewith. In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding a plant 1-deoxyxylulose-5-phosphate synthase. Thus, systems and methods are provided for the recombinant expression of the aforementioned recombinant 1-deoxyxylulose-5-phosphate synthase that may be used to facilitate its production, isolation and purification in significant amounts. Recombinant 1-deoxyxylulose-5-phosphate synthase may be used to obtain expression or enhanced expression of 1-deoxyxylulose-5-phosphate synthase in plants in order to enhance the production of 1-deoxyxylulose-5-phosphate, or its derivatives such as isopentenyl diphosphate (BP), or may be otherwise employed for the regulation or expression of 1-deoxyxylulose-5-phosphate synthase, or the production of its products.

  9. Genome Sequence Analysis of the Naphthenic Acid Degrading and Metal Resistant Bacterium Cupriavidus gilardii CR3.

    Xiaoyu Wang

    Full Text Available Cupriavidus sp. are generally heavy metal tolerant bacteria with the ability to degrade a variety of aromatic hydrocarbon compounds, although the degradation pathways and substrate versatilities remain largely unknown. Here we studied the bacterium Cupriavidus gilardii strain CR3, which was isolated from a natural asphalt deposit, and which was shown to utilize naphthenic acids as a sole carbon source. Genome sequencing of C. gilardii CR3 was carried out to elucidate possible mechanisms for the naphthenic acid biodegradation. The genome of C. gilardii CR3 was composed of two circular chromosomes chr1 and chr2 of respectively 3,539,530 bp and 2,039,213 bp in size. The genome for strain CR3 encoded 4,502 putative protein-coding genes, 59 tRNA genes, and many other non-coding genes. Many genes were associated with xenobiotic biodegradation and metal resistance functions. Pathway prediction for degradation of cyclohexanecarboxylic acid, a representative naphthenic acid, suggested that naphthenic acid undergoes initial ring-cleavage, after which the ring fission products can be degraded via several plausible degradation pathways including a mechanism similar to that used for fatty acid oxidation. The final metabolic products of these pathways are unstable or volatile compounds that were not toxic to CR3. Strain CR3 was also shown to have tolerance to at least 10 heavy metals, which was mainly achieved by self-detoxification through ion efflux, metal-complexation and metal-reduction, and a powerful DNA self-repair mechanism. Our genomic analysis suggests that CR3 is well adapted to survive the harsh environment in natural asphalts containing naphthenic acids and high concentrations of heavy metals.

  10. Heterodimeric l-amino acid oxidase enzymes from Egyptian Cerastes cerastes venom: Purification, biochemical characterization and partial amino acid sequencing

    A.E. El Hakim

    2015-12-01

    Full Text Available Two l-amino acid oxidase enzyme isoforms, Cc-LAAOI and Cc-LAAOII were purified to apparent homogeneity from Cerastes cerastes venom in a sequential two-step chromatographic protocol including; gel filtration and anion exchange chromatography. The native molecular weights of the isoforms were 115 kDa as determined by gel filtration on calibrated Sephacryl S-200 column, while the monomeric molecular weights of the enzymes were, 60, 56 kDa and 60, 53 kDa for LAAOI and LAAOII, respectively. The tryptic peptides of the two isoforms share high sequence homology with other snake venom l-amino acid oxidases. The optimal pH and temperature values of Cc-LAAOI and Cc-LAAOII were 7.8, 50 °C and 7, 60 °C, respectively. The two isoenzymes were thermally stable up to 70 °C. The Km and Vmax values were 0.67 mM, 0.135 μmol/min for LAAOI and 0.82 mM, 0.087 μmol/min for LAAOII. Both isoenzymes displayed high catalytic preference to long-chain, hydrophobic and aromatic amino acids. The Mn2+ ion markedly increased the LAAO activity for both purified isoforms, while Na+, K+, Ca2+, Mg2+ and Ba2+ ions showed a non-significant increase in the enzymatic activity of both isoforms. Furthermore, Zn2+, Ni2+, Co2+, Cu2+ and AL3+ ions markedly inhibited the LAAOI and LAAOII activities. l-Cysteine and reduced glutathione completely inhibited the LAAO activity of both isoenzymes, whereas, β-mercaptoethanol, O-phenanthroline and PMSF completely inhibited the enzymatic activity of LAAOII. Furthermore, iodoacitic acid inhibited the enzymatic activity of LAAOII by 46% and had no effect on the LAAOI activity.

  11. Sequence-defined bioactive macrocycles via an acid-catalysed cascade reaction

    Porel, Mintu; Thornlow, Dana N.; Phan, Ngoc N.; Alabi, Christopher A.

    2016-06-01

    Synthetic macrocycles derived from sequence-defined oligomers are a unique structural class whose ring size, sequence and structure can be tuned via precise organization of the primary sequence. Similar to peptides and other peptidomimetics, these well-defined synthetic macromolecules become pharmacologically relevant when bioactive side chains are incorporated into their primary sequence. In this article, we report the synthesis of oligothioetheramide (oligoTEA) macrocycles via a one-pot acid-catalysed cascade reaction. The versatility of the cyclization chemistry and modularity of the assembly process was demonstrated via the synthesis of >20 diverse oligoTEA macrocycles. Structural characterization via NMR spectroscopy revealed the presence of conformational isomers, which enabled the determination of local chain dynamics within the macromolecular structure. Finally, we demonstrate the biological activity of oligoTEA macrocycles designed to mimic facially amphiphilic antimicrobial peptides. The preliminary results indicate that macrocyclic oligoTEAs with just two-to-three cationic charge centres can elicit potent antibacterial activity against Gram-positive and Gram-negative bacteria.

  12. Complete Genome Sequence of Lactococcus lactis IO-1, a Lactic Acid Bacterium That Utilizes Xylose and Produces High Levels of l-Lactic Acid

    Kato, Hiroaki; Shiwa, Yuh; Oshima, Kenshiro; Machii, Miki; Araya-Kojima, Tomoko; Zendo, Takeshi; Shimizu-Kadota, Mariko; Hattori, Masahira; Sonomoto, Kenji; Yoshikawa, Hirofumi

    2012-01-01

    We report the complete genome sequence of Lactococcus lactis IO-1 (= JCM7638). It is a nondairy lactic acid bacterium, produces nisin Z, ferments xylose, and produces predominantly l-lactic acid at high xylose concentrations. From ortholog analysis with other five L. lactis strains, IO-1 was identified as L. lactis subsp. lactis.

  13. Morphological tranformation of calcite crystal growth by prismatic "acidic" polypeptide sequences.

    Kim, I; Giocondi, J L; Orme, C A; Collino, J; Evans, J S

    2007-02-13

    Many of the interesting mechanical and materials properties of the mollusk shell are thought to stem from the prismatic calcite crystal assemblies within this composite structure. It is now evident that proteins play a major role in the formation of these assemblies. Recently, a superfamily of 7 conserved prismatic layer-specific mollusk shell proteins, Asprich, were sequenced, and the 42 AA C-terminal sequence region of this protein superfamily was found to introduce surface voids or porosities on calcite crystals in vitro. Using AFM imaging techniques, we further investigate the effect that this 42 AA domain (Fragment-2) and its constituent subdomains, DEAD-17 and Acidic-2, have on the morphology and growth kinetics of calcite dislocation hillocks. We find that Fragment-2 adsorbs on terrace surfaces and pins acute steps, accelerates then decelerates the growth of obtuse steps, forms clusters and voids on terrace surfaces, and transforms calcite hillock morphology from a rhombohedral form to a rounded one. These results mirror yet are distinct from some of the earlier findings obtained for nacreous polypeptides. The subdomains Acidic-2 and DEAD-17 were found to accelerate then decelerate obtuse steps and induce oval rather than rounded hillock morphologies. Unlike DEAD-17, Acidic-2 does form clusters on terrace surfaces and exhibits stronger obtuse velocity inhibition effects than either DEAD-17 or Fragment-2. Interestingly, a 1:1 mixture of both subdomains induces an irregular polygonal morphology to hillocks, and exhibits the highest degree of acute step pinning and obtuse step velocity inhibition. This suggests that there is some interplay between subdomains within an intra (Fragment-2) or intermolecular (1:1 mixture) context, and sequence interplay phenomena may be employed by biomineralization proteins to exert net effects on crystal growth and morphology.

  14. Intra-operative visualization of brain tumors with 5-aminolevulinic acid-induced fluorescence.

    Widhalm, Georg

    2014-01-01

    Precise histopathological diagnosis of brain tumors is essential for the correct patient management. Furthermore, complete resection of brain tumors is associated with an improved patient prognosis. However, histopathological undergrading and incomplete tumor removal are not uncommon, especially due to insufficient intra-operative visualization of brain tumor tissue. The fluorescent dye 5-aminolevulinic acid (5-ALA) is currently applied for fluorescence-guided resections of high-grade gliomas. The value of 5-ALA-induced protoporphyrin (PpIX) fluorescence for intra-operative visualization of other tumors than high-grade gliomas remains unclear. Within the frame of this thesis, we found a significantly higher rate of complete resections of our high-grade gliomas as compared to control cases by using the newly established 5-ALA fluorescence technology at our department. Additionally, we showed that MRI spectroscopy-based chemical shift imaging (CSI) is capable to identify intratumoral high-grade glioma areas (= anaplastic foci) during navigation guided resections to avoid histopathological undergrading. However, the accuracy of navigation systems with integrated pre-operative imaging data such as CSI declines during resections due to intra-operative brainshift. In two further studies, we found that 5-ALA induced PpIX fluorescence is capable as a novel intra-operative marker to detect anaplastic foci within initially suspected low-grade gliomas independent of brainshift. Finally, we showed that the application of 5-ALA is also of relevance in needle biopsies for intra-operative identification of representative brain tumor tissue. These data indicate that 5-ALA is not only of major importance for resection of high-grade gliomas, but also for intra-operative visualization of anaplastic foci as well as representative brain tumor tissue in needle biopsies unaffected by brainshift. Consequently, this new technique might become a novel standard in brain tumor surgery that

  15. Amino acid sequence of the cold-active alkaline phosphatase from Atlantic cod (Gadus morhua)

    Asgeirsson, Bjarni; Nielsen, Berit Noesgaard; Højrup, Peter

    2003-01-01

    Atlantic cod is a marine fish that lives at low temperatures of 0-10 degrees C and contains a cold-adapted alkaline phosphatase (AP). Preparations of AP from either the lower part of the intestines or the pyloric caeca area were subjected to proteolytic digestion, mass spectrometry and amino acid...... sequencing by Edman degradation. The primary structure exhibits greatest similarity to human tissue non-specific AP (80%), and approximately 30% similarity to AP from Escherichia coli. The key residues required for catalysis are conserved in the cod AP, except for the third metal binding site, where cod AP...

  16. Cervical cancer risk factors and feasibility of visual inspection with acetic acid screening in Sudan

    Ibrahim A

    2011-04-01

    Full Text Available Ahmed Ibrahim1, Vibeke Rasch2, Eero Pukkala3, Arja R Aro11Unit for Health Promotion Research, University of Southern Denmark, Esbjerg, Denmark; 2Department of Obstetrics and Gynecology, Odense University Hospital, Odense, Denmark; 3Institute for Statistical and Epidemiological Cancer Research, Finnish Cancer Registry, Helsinki, FinlandObjectives: To assess the risk factors of cervical cancer and the feasibility and acceptability of a visual inspection with acetic acid (VIA screening method in a primary health center in Khartoum, Sudan.Methods: A cross-sectional prospective pilot study of 100 asymptomatic women living in Khartoum State in Sudan was carried out from December 2008 to January 2009. The study was performed at the screening center in Khartoum. Six nurses and two physicians were trained by a gynecologic oncologist. The patients underwent a complete gynecological examination and filled in a questionnaire on risk factors and feasibility and acceptability. They were screened for cervical cancer by application of 3%–5% VIA. Women with a positive test were referred for colposcopy and treatment.Results: Sixteen percent of screened women were tested positive. Statistically significant associations were observed between being positive with VIA test and the following variables: uterine cervix laceration (odds ratio [OR] 18.6; 95% confidence interval [CI]: 4.64–74.8, assisted vaginal delivery (OR 13.2; 95% CI: 2.95–54.9, parity (OR 5.78; 95% CI: 1.41–23.7, female genital mutilation (OR 4.78; 95% CI: 1.13–20.1, and episiotomy (OR 5.25; 95% CI: 1.15–23.8. All these associations remained statistically significant after adjusting for age, educational level, employment, and potential confounding factors such as smoking, number of sexual partners, and use of contraceptive method. Furthermore, the VIA screening method was found to be feasible and acceptable to participants.Conclusion: This pilot study showed that women who have uterine

  17. Sparse Representations-Based Super-Resolution of Key-Frames Extracted from Frames-Sequences Generated by a Visual Sensor Network

    Muhammad Sajjad; Irfan Mehmood; Sung Wook Baik

    2014-01-01

    Visual sensor networks (VSNs) usually generate a low-resolution (LR) frame-sequence due to energy and processing constraints. These LR-frames are not very appropriate for use in certain surveillance applications. It is very important to enhance the resolution of the captured LR-frames using resolution enhancement schemes. In this paper, an effective framework for a super-resolution (SR) scheme is proposed that enhances the resolution of LR key-frames extracted from frame-sequences captured b...

  18. Frequencies of amino acid strings in globular protein sequences indicate suppression of blocks of consecutive hydrophobic residues

    Schwartz, Russell; Istrail, Sorin; King, Jonathan

    2001-01-01

    Patterns of hydrophobic and hydrophilic residues play a major role in protein folding and function. Long, predominantly hydrophobic strings of 20–22 amino acids each are associated with transmembrane helices and have been used to identify such sequences. Much less attention has been paid to hydrophobic sequences within globular proteins. In prior work on computer simulations of the competition between on-pathway folding and off-pathway aggregate formation, we found that long sequences of cons...

  19. 3-d structure-based amino acid sequence alignment of esterases, lipases and related proteins

    Gentry, M.K.; Doctor, B.P.; Cygler, M.; Schrag, J.D.; Sussman, J.L.

    1993-05-13

    Acetylcholinesterase and butyrylcholinesterase, enzymes with potential as pretreatment drugs for organophosphate toxicity, are members of a larger family of homologous proteins that includes carboxylesterases, cholesterol esterases, lipases, and several nonhydrolytic proteins. A computer-generated alignment of 18 of the proteins, the acetylcholinesases, butyrylcholinesterases, carboxylesterases, some esterases, and the nonenzymatic proteins has been previously presented. More recently, the three-dimensional structures of two enzymes enzymes in this group, acetylcholinesterase from Torpedo californica and lipase from Geotrichum candidum, have been determined. Based on the x-ray structures and the superposition of these two enzymes, it was possible to obtain an improved amino acid sequence alignment of 32 members of this family of proteins. Examination of this alignment reveals that 24 amino acids are invariant in all of the hydrolytic proteins, and an additional 49 are well conserved. Conserved amino acids include those of the active site, the disulfide bridges, the salt bridges, in the core of the proteins, and at the edges of secondary structural elements. Comparison of the three-dimensional structures makes it possible to find a well-defined structural basis for the conservation of many of these amino acids.

  20. Nanostructure of native pectin sugar acid gels visualized by atomic force microscopy.

    Fishman, Marshall L; Cooke, Peter H; Coffin, David R

    2004-01-01

    Height and phase shift images of high methoxyl sugar acid gels (HMSAG) of pectin were obtained by atomic force microscopy in the tapping mode. Images revealed that pores in these gels were fluid and flattened out when measured as a function of time. These images revealed for the first time the structure of adsorbed sugar on pectin in the hydrated native gels and how the pectin framework is organized within these gels. Segmentation of images revealed that the underlying pectin framework contained combinations of rods, segmented rods, and kinked rods connected end to end and laterally. The open network of strands was similar to pectin aggregates from 5 mM NaCl solution imaged earlier by electron microscopy (Fishman et al., Arch. Biochem. Biophys. 1992, 294, 253). Area measurements revealed that the ratio of bound sugar to pectin was in excess of 100 to 1 (w/w). Furthermore, images indicated relatively small differences in the organization of native commercial citrus pectin, orange albedo pectin, and lime albedo pectin gels at optimal pH as determined in this study. The findings are consistent with earlier gel strength measurements of these gels. In addition, values of gel strength were consistent with values of molar mass and viscosity of the constituent pectins in that they increased in the same order. Finally, we demonstrated the advantage of simultaneous visualization of height and phase shift images for observing and quantitating the nanostructure of relatively soft gels which are fully hydrated with a buffer. PMID:15002992

  1. Draft Genome Sequences of Gluconobacter cerinus CECT 9110 and Gluconobacter japonicus CECT 8443, Acetic Acid Bacteria Isolated from Grape Must

    Sainz, Florencia

    2016-01-01

    We report here the draft genome sequences of Gluconobacter cerinus strain CECT9110 and Gluconobacter japonicus CECT8443, acetic acid bacteria isolated from grape must. Gluconobacter species are well known for their ability to oxidize sugar alcohols into the corresponding acids. Our objective was to select strains to oxidize effectively d-glucose. PMID:27365351

  2. Draft Genome Sequence of Bacillus subtilis GXA-28, a Thermophilic Strain with High Productivity of Poly-γ-Glutamic Acid

    Zeng, Wei; Chen, Guiguang; Tang, Zhen; Wu, Hao; Shu, Lin; Liang, Zhiqun

    2014-01-01

    Bacillus subtilis GXA-28 is a thermophilic strain that can produce high yield and high molecular weight of poly-γ-glutamic acid under high temperature. Here, we report the draft genome sequence of this strain, which may provide the genomic basis for the high productivity of poly-γ-glutamic acid.

  3. FiveS rRNA sequences and fatty acid profiles of colourless sulfur-oxidising bacteria

    LokaBharathi, P.A.; Ortiz-conde, B.A; Nair, S.; Chandramohan, D.; Colwell, R.R.

    these at the molecular level, 5S ribosomal ribonucleic acid (5S rRNA) sequences have been determined. Fatty acid profiles showed strain 29 to be related to Pseudomonas vesicularis with an E.D. of 5.965 and similarity index of 0.182. The nearest organism of strain 82...

  4. ANCAC: amino acid, nucleotide, and codon analysis of COGs – a tool for sequence bias analysis in microbial orthologs

    Meiler Arno

    2012-09-01

    Full Text Available Abstract Background The COG database is the most popular collection of orthologous proteins from many different completely sequenced microbial genomes. Per definition, a cluster of orthologous groups (COG within this database exclusively contains proteins that most likely achieve the same cellular function. Recently, the COG database was extended by assigning to every protein both the corresponding amino acid and its encoding nucleotide sequence resulting in the NUCOCOG database. This extended version of the COG database is a valuable resource connecting sequence features with the functionality of the respective proteins. Results Here we present ANCAC, a web tool and MySQL database for the analysis of amino acid, nucleotide, and codon frequencies in COGs on the basis of freely definable phylogenetic patterns. We demonstrate the usefulness of ANCAC by analyzing amino acid frequencies, codon usage, and GC-content in a species- or function-specific context. With respect to amino acids we, at least in part, confirm the cognate bias hypothesis by using ANCAC’s NUCOCOG dataset as the largest one available for that purpose thus far. Conclusions Using the NUCOCOG datasets, ANCAC connects taxonomic, amino acid, and nucleotide sequence information with the functional classification via COGs and provides a GUI for flexible mining for sequence-bias. Thereby, to our knowledge, it is the only tool for the analysis of sequence composition in the light of physiological roles and phylogenetic context without requirement of substantial programming-skills.

  5. Clostridium sticklandii, a specialist in amino acid degradation:revisiting its metabolism through its genome sequence

    Pelletier Eric

    2010-10-01

    Full Text Available Abstract Background Clostridium sticklandii belongs to a cluster of non-pathogenic proteolytic clostridia which utilize amino acids as carbon and energy sources. Isolated by T.C. Stadtman in 1954, it has been generally regarded as a "gold mine" for novel biochemical reactions and is used as a model organism for studying metabolic aspects such as the Stickland reaction, coenzyme-B12- and selenium-dependent reactions of amino acids. With the goal of revisiting its carbon, nitrogen, and energy metabolism, and comparing studies with other clostridia, its genome has been sequenced and analyzed. Results C. sticklandii is one of the best biochemically studied proteolytic clostridial species. Useful additional information has been obtained from the sequencing and annotation of its genome, which is presented in this paper. Besides, experimental procedures reveal that C. sticklandii degrades amino acids in a preferential and sequential way. The organism prefers threonine, arginine, serine, cysteine, proline, and glycine, whereas glutamate, aspartate and alanine are excreted. Energy conservation is primarily obtained by substrate-level phosphorylation in fermentative pathways. The reactions catalyzed by different ferredoxin oxidoreductases and the exergonic NADH-dependent reduction of crotonyl-CoA point to a possible chemiosmotic energy conservation via the Rnf complex. C. sticklandii possesses both the F-type and V-type ATPases. The discovery of an as yet unrecognized selenoprotein in the D-proline reductase operon suggests a more detailed mechanism for NADH-dependent D-proline reduction. A rather unusual metabolic feature is the presence of genes for all the enzymes involved in two different CO2-fixation pathways: C. sticklandii harbours both the glycine synthase/glycine reductase and the Wood-Ljungdahl pathways. This unusual pathway combination has retrospectively been observed in only four other sequenced microorganisms. Conclusions Analysis of the C

  6. Isolation and amino acid sequences of squirrel monkey (Saimiri sciurea) insulin and glucagon

    It was reported two decades ago that insulin was not detectable in the glucose-stimulated state in Saimiri sciurea, the New World squirrel monkey, by a radioimmunoassay system developed with guinea pig anti-pork insulin antibody and labeled park insulin. With the same system, reasonable levels were observed in rhesus monkeys and chimpanzees. This suggested that New World monkeys, like the New World hystricomorph rodents such as the guinea pig and the coypu, might have insulins whose sequences differ markedly from those of Old World mammals. In this report the authors describe the purification and amino acid sequences of squirrel monkey insulin and glucagon. They demonstrate that the substitutions at B29, B27, A2, A4, and A17 of squirrel monkey insulin are identical with those previously found in another New World primate, the owl monkey (Aotus trivirgatus). The immunologic cross-reactivity of this insulin in their immunoassay system is only a few percent of that of human insulin. It appears that the peptides of the New World monkeys have diverged less from those of the Old World mammals than have those of the New World hystricomorph rodents. The striking improvements in peptide purification and sequencing have the potential for adding new information concerning the evolutionary divergence of species

  7. Complete amino acid sequence of the myoglobin from the Pacific spotted dolphin, Stenella attenuata graffmani.

    Jones, B N; Wang, C C; Dwulet, F E; Lehman, L D; Meuth, J L; Bogardt, R A; Gurd, F R

    1979-04-25

    The complete amino acid sequence of the major component myoglobin from the Pacific spotted dolphin, Stenella attenuata graffmani, was determined by the automated Edman degradation of several large peptides obtained by specific cleavage of the protein. The acetimidated apomyoglobin was selectively cleaved at its two methionyl residues with cyanogen bromide and at its three arginyl residues by trypsin. By subjecting four of these peptides and the apomyoglobin to automated Edman degradation, over 80% of the primary structure of the protein was obtained. The remainder of the covalent structure was determined by the sequence analysis of peptides that resulted from further digestion of the central cyanogen bromide fragment. This fragment was cleaved at its glutamyl residues with staphylococcal protease and its lysyl residues with trypsin. The action of trypsin was restricted to the lysyl residues by chemical modification of the single arginyl residue of the fragment with 1,2-cyclohexanedione. The primary structure of this myoglobin proved to be identical with that from the Atlantic bottlenosed dolphin and Pacific common dolphin but differs from the myoglobins of the killer whale and pilot whale at two positions. The above sequence identities and differences reflect the close taxonomic relationship of these five species of Cetacea. PMID:454657

  8. Isolation and amino acid sequences of squirrel monkey (Saimiri sciurea) insulin and glucagon

    Yu, Jinghua (Veterans Administration Medical Center, Bronx, NY (United States)); Eng, J.; Yalow, R.S. (Veterans Administration Medical Center, Bronx, NY (United States) City Univ. of New York, NY (United States))

    1990-12-01

    It was reported two decades ago that insulin was not detectable in the glucose-stimulated state in Saimiri sciurea, the New World squirrel monkey, by a radioimmunoassay system developed with guinea pig anti-pork insulin antibody and labeled park insulin. With the same system, reasonable levels were observed in rhesus monkeys and chimpanzees. This suggested that New World monkeys, like the New World hystricomorph rodents such as the guinea pig and the coypu, might have insulins whose sequences differ markedly from those of Old World mammals. In this report the authors describe the purification and amino acid sequences of squirrel monkey insulin and glucagon. They demonstrate that the substitutions at B29, B27, A2, A4, and A17 of squirrel monkey insulin are identical with those previously found in another New World primate, the owl monkey (Aotus trivirgatus). The immunologic cross-reactivity of this insulin in their immunoassay system is only a few percent of that of human insulin. It appears that the peptides of the New World monkeys have diverged less from those of the Old World mammals than have those of the New World hystricomorph rodents. The striking improvements in peptide purification and sequencing have the potential for adding new information concerning the evolutionary divergence of species.

  9. A universal strategy for visual chiral recognition of α-amino acids with l-tartaric acid-capped gold nanoparticles as colorimetric probes.

    Song, Guoxin; Zhou, Fulin; Xu, Chunli; Li, Baoxin

    2016-02-01

    The ability to recognize and quantify the chirality of alpha-amino acids constitutes the basis of many critical areas for specific targeting in drug development and metabolite probing. It is still challenging to conveniently distinguish the enantiomer of amino acids largely due to the lack of a universal and simple strategy. In this work, we report a strategy for the visual recognition of α-amino acids. It is based on the chirality of l-tartaric acid-capped gold nanoparticles (l-TA-capped AuNPs, ca. 13 nm in diameter). All of 19 right-handed α-amino acids can induce a red-to-blue color change of l-TA-capped AuNP solution, whereas all of the left-handed amino acids (except cysteine) cannot. The chiral recognition can be achieved by the naked eye and a simple spectrophotometer. This method does not require complicated chiral modification, and excels through its low-cost, good availability of materials and its simplicity. Another notable feature of this method is its high generality, and this method can discriminate almost all native α-amino acid enantiomers. This versatile method could be potentially used for high-throughput chiral recognition of amino acids. PMID:26759834

  10. The Effect of Using a Visual Representation Tool in a Teaching-Learning Sequence for Teaching Newton's Third Law

    Savinainen, Antti; Mäkynen, Asko; Nieminen, Pasi; Viiri, Jouni

    2015-09-01

    This paper presents a research-based teaching-learning sequence (TLS) that focuses on the notion of interaction in teaching Newton's third law (N3 law) which is, as earlier studies have shown, a challenging topic for students to learn. The TLS made systematic use of a visual representation tool—an interaction diagram (ID)—highlighting interactions between objects and addressing the learning demand related to N3 law. This approach had been successful in enhancing students' understanding of N3 law in pilot studies conducted by teacher-researchers. However, it was unclear whether teachers, who have neither been involved with the research nor received intensive tutoring, could replicate the positive results in ordinary school settings. To address this question, we present an empirical study conducted in 10 Finnish upper secondary schools with students (n = 261, aged 16) taking their mandatory physics course. The study design involved three groups: the heavy ID group (the TLS with seven to eight exercises on IDs), the light ID group (two to three exercises on IDs) and the no ID group (no exercises on IDs). The heavy and light ID groups answered eight ID questions, and all the students answered four questions on N3 law after teaching the force concept. The findings clearly suggest that systematic use of the IDs in teaching the force concept significantly fostered students' understanding of N3 law even with teachers who have no intensive tutoring or research background.

  11. Visual inspection with acetic acid as a cervical cancer test: accuracy validated using latent class analysis

    McGrath John A

    2007-07-01

    Full Text Available Abstract Background The purpose of this study was to validate the accuracy of an alternative cervical cancer test – visual inspection with acetic acid (VIA – by addressing possible imperfections in the gold standard through latent class analysis (LCA. The data were originally collected at peri-urban health clinics in Zimbabwe. Methods Conventional accuracy (sensitivity/specificity estimates for VIA and two other screening tests using colposcopy/biopsy as the reference standard were compared to LCA estimates based on results from all four tests. For conventional analysis, negative colposcopy was accepted as a negative outcome when biopsy was not available as the reference standard. With LCA, local dependencies between tests were handled through adding direct effect parameters or additional latent classes to the model. Results Two models yielded good fit to the data, a 2-class model with two adjustments and a 3-class model with one adjustment. The definition of latent disease associated with the latter was more stringent, backed by three of the four tests. Under that model, sensitivity for VIA (abnormal+ was 0.74 compared to 0.78 with conventional analyses. Specificity was 0.639 versus 0.568, respectively. By contrast, the LCA-derived sensitivity for colposcopy/biopsy was 0.63. Conclusion VIA sensitivity and specificity with the 3-class LCA model were within the range of published data and relatively consistent with conventional analyses, thus validating the original assessment of test accuracy. LCA probably yielded more likely estimates of the true accuracy than did conventional analysis with in-country colposcopy/biopsy as the reference standard. Colpscopy with biopsy can be problematic as a study reference standard and LCA offers the possibility of obtaining estimates adjusted for referent imperfections.

  12. Comparison of the chromosomal localization of murine and human glucocerebrosidase genes and of the deduced amino acid sequences

    To study structure-function relationships and molecular evolution, the authors determined the nucleotide sequence and chromosomal location of the gene encoding murine glucocerebrosidase. In the protein coding region of the murine cDNA, the nucleotide sequence and the corresponding deduced amino acid sequences were 82% and 86% identical to the respective humans sequences. All five amino acids presently known to be essential for normal enzymatic activity were conserved between mouse and man. The murine enzyme had a single deletion relative to the human enzyme at amino acid number 273. One ATG translation initiation signal was present in the mouse sequence in contrast to the human sequence, where two start codons have been reported. Nucleotide sequencing of a clone derived from murine genomic DNA revealed that the murine signal for translation initiation was located in exon 2. The locations of all 10 introns were conserved among mouse and man. They mapped the genetic locus for glucocerebrosidase to mouse chromosome 3, at a position 7.6 ± 3.2 centimorgans from the locus for the β subunit of nerve growth factor. Comparison of linkage relationships in the human and murine genome indicates that these closely linked mouse genes are also syntenic on human chromosome 1 but in positions that span the centromere

  13. Repetitive sequence based polymerase chain reaction to differentiate close bacteria strains in acidic sites

    XIE Ming; YIN Hua-qun; LIU Yi; LIU Jie; LIU Xue-duan

    2008-01-01

    To study the diversity of bacteria strains newly isolated from several acid mine drainage(AMD) sites in China,repetitive sequence based polymerase chain reaction (rep-PCR),a well established technology for diversity analysis of closely related bacteria strains,was conducted on 30 strains of bacteria Leptospirillum ferriphilium,8 strains of bacteria Acidithiobacillus ferrooxidans,as well as the Acidithiobacillus ferrooxidans type strain ATCC (American Type Culture Collection) 23270.The results showed that,using ERIC and BOX primer sets,rep-PCR produced highly discriminatory banding patterns.Phylogenetic analysis based on ERIC-PCR banding types was made and the results indicated that rep-PCR could be used as a rapid and highly discriminatory screening technique in studying bacterial diversity,especially in differentiating bacteria within one species in AMD.

  14. The amino acid alphabet and the architecture of the protein sequence-structure map. I. Binary alphabets.

    Ferrada, Evandro

    2014-12-01

    The correspondence between protein sequences and structures, or sequence-structure map, relates to fundamental aspects of structural, evolutionary and synthetic biology. The specifics of the mapping, such as the fraction of accessible sequences and structures, or the sequences' ability to fold fast, are dictated by the type of interactions between the monomers that compose the sequences. The set of possible interactions between monomers is encapsulated by the potential energy function. In this study, I explore the impact of the relative forces of the potential on the architecture of the sequence-structure map. My observations rely on simple exact models of proteins and random samples of the space of potential energy functions of binary alphabets. I adopt a graph perspective and study the distribution of viable sequences and the structures they produce, as networks of sequences connected by point mutations. I observe that the relative proportion of attractive, neutral and repulsive forces defines types of potentials, that induce sequence-structure maps of vastly different architectures. I characterize the properties underlying these differences and relate them to the structure of the potential. Among these properties are the expected number and relative distribution of sequences associated to specific structures and the diversity of structures as a function of sequence divergence. I study the types of binary potentials observed in natural amino acids and show that there is a strong bias towards only some types of potentials, a bias that seems to characterize the folding code of natural proteins. I discuss implications of these observations for the architecture of the sequence-structure map of natural proteins, the construction of random libraries of peptides, and the early evolution of the natural amino acid alphabet. PMID:25473967

  15. Trypsin inhibitors from ridged gourd (Luffa acutangula Linn.) seeds: purification, properties, and amino acid sequences.

    Haldar, U C; Saha, S K; Beavis, R C; Sinha, N K

    1996-02-01

    Two trypsin inhibitors, LA-1 and LA-2, have been isolated from ridged gourd (Luffa acutangula Linn.) seeds and purified to homogeneity by gel filtration followed by ion-exchange chromatography. The isoelectric point is at pH 4.55 for LA-1 and at pH 5.85 for LA-2. The Stokes radius of each inhibitor is 11.4 A. The fluorescence emission spectrum of each inhibitor is similar to that of the free tyrosine. The biomolecular rate constant of acrylamide quenching is 1.0 x 10(9) M-1 sec-1 for LA-1 and 0.8 x 10(9) M-1 sec-1 for LA-2 and that of K2HPO4 quenching is 1.6 x 10(11) M-1 sec-1 for LA-1 and 1.2 x 10(11) M-1 sec-1 for LA-2. Analysis of the circular dichroic spectra yields 40% alpha-helix and 60% beta-turn for La-1 and 45% alpha-helix and 55% beta-turn for LA-2. Inhibitors LA-1 and LA-2 consist of 28 and 29 amino acid residues, respectively. They lack threonine, alanine, valine, and tryptophan. Both inhibitors strongly inhibit trypsin by forming enzyme-inhibitor complexes at a molar ratio of unity. A chemical modification study suggests the involvement of arginine of LA-1 and lysine of LA-2 in their reactive sites. The inhibitors are very similar in their amino acid sequences, and show sequence homology with other squash family inhibitors. PMID:8924202

  16. Human Retroviruses and AIDS. A compilation and analysis of nucleic acid and amino acid sequences: I--II; III--V

    Myers, G.; Korber, B. [eds.] [Los Alamos National Lab., NM (United States); Wain-Hobson, S. [ed.] [Laboratory of Molecular Retrovirology, Pasteur Inst.; Smith, R.F. [ed.] [Baylor Coll. of Medicine, Houston, TX (United States). Dept. of Pharmacology; Pavlakis, G.N. [ed.] [National Cancer Inst., Frederick, MD (United States). Cancer Research Facility

    1993-12-31

    This compendium and the accompanying floppy diskettes are the result of an effort to compile and rapidly publish all relevant molecular data concerning the human immunodeficiency viruses (HIV) and related retroviruses. The scope of the compendium and database is best summarized by the five parts that it comprises: (I) HIV and SIV Nucleotide Sequences; (II) Amino Acid Sequences; (III) Analyses; (IV) Related Sequences; and (V) Database Communications. Information within all the parts is updated at least twice in each year, which accounts for the modes of binding and pagination in the compendium.

  17. Characterization of N-glycosylation and amino acid sequence features of immunoglobulins from swine.

    Lopez, Paul G; Girard, Lauren; Buist, Marjorie; de Oliveira, Andrey Giovanni Gomes; Bodnar, Edward; Salama, Apolline; Soulillou, Jean-Paul; Perreault, Hélène

    2016-02-01

    The primary goal of this study was to develop a method to study the N-glycosylation of IgG from swine in order to detect epitopes containing N-glycolylneuraminic acid (Neu5Gc) and/or terminal galactose residues linked in α1-3 susceptible to cause xenograft-related problems. Samples of immunoglobulin were isolated from porcine serum using protein-A affinity chromatography. The eluate was then separated on electrophoretic gel, and bands corresponding to the N-glycosylated heavy chains were cut off the gel and subjected to tryptic digestion. Peptides and glycopeptides were separated by reversed phase liquid chromatography and fractions were collected for matrix-assisted laser desorption/ionization time-of-flight mass spectrometric (MALDI-TOF-MS) analysis. Overall no α1-3 galactose was detected, as demonstrated by complete susceptibility of terminal galactose residues to β-galactosidase digestion. Neu5Gc was detected on singly sialylated structures. Two major N-glycopeptides were found, EEQFNSTYR and EAQFNSTYR as determined by tandem MS (MS/MS), as previously reported by Butler et al. (Immunogenetics, 61, 2009, 209-230), who found 11 subclasses for porcine IgG. Out of the 11, ten include the sequence corresponding to EEQFNSTYR, and only one codes for EAQFNSTYR. In this study, glycosylation patterns associated with both chains were slightly different, in that EEQFNSTYR had a higher content of galactose. The last step of this study consisted of peptide-mapping the 11 reported porcine IgG sequences. Although there was considerable overlap, at least one unique tryptic peptide was found per IgG sequence. The workflow presented in this manuscript constitutes the first study to use MALDI-TOF-MS in the investigation of porcine IgG structural features. PMID:26586247

  18. Accurate prediction of hot spot residues through physicochemical characteristics of amino acid sequences

    Chen, Peng

    2013-07-23

    Hot spot residues of proteins are fundamental interface residues that help proteins perform their functions. Detecting hot spots by experimental methods is costly and time-consuming. Sequential and structural information has been widely used in the computational prediction of hot spots. However, structural information is not always available. In this article, we investigated the problem of identifying hot spots using only physicochemical characteristics extracted from amino acid sequences. We first extracted 132 relatively independent physicochemical features from a set of the 544 properties in AAindex1, an amino acid index database. Each feature was utilized to train a classification model with a novel encoding schema for hot spot prediction by the IBk algorithm, an extension of the K-nearest neighbor algorithm. The combinations of the individual classifiers were explored and the classifiers that appeared frequently in the top performing combinations were selected. The hot spot predictor was built based on an ensemble of these classifiers and to work in a voting manner. Experimental results demonstrated that our method effectively exploited the feature space and allowed flexible weights of features for different queries. On the commonly used hot spot benchmark sets, our method significantly outperformed other machine learning algorithms and state-of-the-art hot spot predictors. The program is available at http://sfb.kaust.edu.sa/pages/software.aspx. © 2013 Wiley Periodicals, Inc.

  19. Lactic acid production from potato peel waste by anaerobic sequencing batch fermentation using undefined mixed culture.

    Liang, Shaobo; McDonald, Armando G; Coats, Erik R

    2015-11-01

    Lactic acid (LA) is a necessary industrial feedstock for producing the bioplastic, polylactic acid (PLA), which is currently produced by pure culture fermentation of food carbohydrates. This work presents an alternative to produce LA from potato peel waste (PPW) by anaerobic fermentation in a sequencing batch reactor (SBR) inoculated with undefined mixed culture from a municipal wastewater treatment plant. A statistical design of experiments approach was employed using set of 0.8L SBRs using gelatinized PPW at a solids content range from 30 to 50 g L(-1), solids retention time of 2-4 days for yield and productivity optimization. The maximum LA production yield of 0.25 g g(-1) PPW and highest productivity of 125 mg g(-1) d(-1) were achieved. A scale-up SBR trial using neat gelatinized PPW (at 80 g L(-1) solids content) at the 3 L scale was employed and the highest LA yield of 0.14 g g(-1) PPW and a productivity of 138 mg g(-1) d(-1) were achieved with a 1 d SRT. PMID:25708409

  20. Cloning and sequence analysis of putative type II fatty acid synthase genes from Arachis hypogaea L.

    Meng-Jun Li; Ai-Qin Li; Han Xia; Chuan-Zhi Zhao; Chang-Sheng Li; Shu-Bo Wan; Yu-Ping Bi; Xing-Jun Wang

    2009-06-01

    The cultivated peanut is a valuable source of dietary oil and ranks fifth among the world oil crops. Plant fatty acid biosynthesis is catalysed by type II fatty acid synthase (FAS) in plastids and mitochondria. By constructing a full-length cDNA library derived from immature peanut seeds and homology-based cloning, candidate genes of acyl carrier protein (ACP), malonyl-CoA:ACP transacylase, -ketoacyl-ACP synthase (I, II, III), -ketoacyl-ACP reductase, -hydroxyacyl-ACP dehydrase and enoyl-ACP reductase were isolated. Sequence alignments revealed that primary structures of type II FAS enzymes were highly conserved in higher plants and the catalytic residues were strictly conserved in Escherichia coli and higher plants. Homologue numbers of each type II FAS gene expressing in developing peanut seeds varied from 1 in KASII, KASIII and HD to 5 in ENR. The number of single-nucleotide polymorphisms (SNPs) was quite different in each gene. Peanut type II FAS genes were predicted to target plastids except ACP2 and ACP3. The results suggested that peanut may contain two type II FAS systems in plastids and mitochondria. The type II FAS enzymes in higher plants may have similar functions as those in E. coli.

  1. Site-directed gene mutation at mixed sequence targets by psoralen-conjugated pseudo-complementary peptide nucleic acids

    Kim, Ki-Hyun; Nielsen, Peter E.; Glazer, Peter M.

    2007-01-01

    Sequence-specific DNA-binding molecules such as triple helix-forming oligonucleotides (TFOs) provide a means for inducing site-specific mutagenesis and recombination at chromosomal sites in mammalian cells. However, the utility of TFOs is limited by the requirement for homopurine stretches in the target duplex DNA. Here, we report the use of pseudo-complementary peptide nucleic acids (pcPNAs) for intracellular gene targeting at mixed sequence sites. Due to steric hindrance, pcPNAs are unable ...

  2. Nucleotide and amino acid sequence coding for polypeptides of foot-and-mouth disease virus type A12.

    Robertson, B H; Grubman, M J; Weddell, G N; Moore, D.M.; Welsh, J D; Fischer, T.; Dowbenko, D J; Yansura, D G; Small, B.; Kleid, D G

    1985-01-01

    The coding region for the structural and nonstructural polypeptides of the type A12 foot-and-mouth disease virus genome has been identified by nucleotide sequencing of cloned DNA derived from the viral RNA. In addition, 704 nucleotides in the 5' untranslated region between the polycytidylic acid tract and the probable initiation codon of the first translated gene, P16-L, have been sequenced. This region has several potential initiation codons, one of which appears to be a low-frequency altern...

  3. Visual detection of Ebola virus using reverse transcription loop-mediated isothermal amplification combined with nucleic acid strip detection.

    Xu, Changping; Wang, Hualei; Jin, Hongli; Feng, Na; Zheng, Xuexing; Cao, Zengguo; Li, Ling; Wang, Jianzhong; Yan, Feihu; Wang, Lina; Chi, Hang; Gai, Weiwei; Wang, Chong; Zhao, Yongkun; Feng, Yan; Wang, Tiecheng; Gao, Yuwei; Lu, Yiyu; Yang, Songtao; Xia, Xianzhu

    2016-05-01

    Ebola virus (species Zaire ebolavirus) (EBOV) is highly virulent in humans. The largest recorded outbreak of Ebola hemorrhagic fever in West Africa to date was caused by EBOV. Therefore, it is necessary to develop a detection method for this virus that can be easily distributed and implemented. In the current study, we developed a visual assay that can detect EBOV-associated nucleic acids. This assay combines reverse transcription loop-mediated isothermal amplification and nucleic acid strip detection (RT-LAMP-NAD). Nucleic acid amplification can be achieved in a one-step process at a constant temperature (58 °C, 35 min), and the amplified products can be visualized within 2-5 min using a nucleic acid strip detection device. The assay is capable of detecting 30 copies of artificial EBOV glycoprotein (GP) RNA and RNA encoding EBOV GP from 10(2) TCID50 recombinant viral particles per ml with high specificity. Overall, the RT-LAMP-NAD method is simple and has high sensitivity and specificity; therefore, it is especially suitable for the rapid detection of EBOV in African regions. PMID:26831931

  4. Negative Ion In-Source Decay Matrix-Assisted Laser Desorption/Ionization Mass Spectrometry for Sequencing Acidic Peptides

    McMillen, Chelsea L.; Wright, Patience M.; Cassady, Carolyn J.

    2016-05-01

    Matrix-assisted laser desorption/ionization (MALDI) in-source decay was studied in the negative ion mode on deprotonated peptides to determine its usefulness for obtaining extensive sequence information for acidic peptides. Eight biological acidic peptides, ranging in size from 11 to 33 residues, were studied by negative ion mode ISD (nISD). The matrices 2,5-dihydroxybenzoic acid, 2-aminobenzoic acid, 2-aminobenzamide, 1,5-diaminonaphthalene, 5-amino-1-naphthol, 3-aminoquinoline, and 9-aminoacridine were used with each peptide. Optimal fragmentation was produced with 1,5-diaminonphthalene (DAN), and extensive sequence informative fragmentation was observed for every peptide except hirudin(54-65). Cleavage at the N-Cα bond of the peptide backbone, producing c' and z' ions, was dominant for all peptides. Cleavage of the N-Cα bond N-terminal to proline residues was not observed. The formation of c and z ions is also found in electron transfer dissociation (ETD), electron capture dissociation (ECD), and positive ion mode ISD, which are considered to be radical-driven techniques. Oxidized insulin chain A, which has four highly acidic oxidized cysteine residues, had less extensive fragmentation. This peptide also exhibited the only charged localized fragmentation, with more pronounced product ion formation adjacent to the highly acidic residues. In addition, spectra were obtained by positive ion mode ISD for each protonated peptide; more sequence informative fragmentation was observed via nISD for all peptides. Three of the peptides studied had no product ion formation in ISD, but extensive sequence informative fragmentation was found in their nISD spectra. The results of this study indicate that nISD can be used to readily obtain sequence information for acidic peptides.

  5. Negative Ion In-Source Decay Matrix-Assisted Laser Desorption/Ionization Mass Spectrometry for Sequencing Acidic Peptides.

    McMillen, Chelsea L; Wright, Patience M; Cassady, Carolyn J

    2016-05-01

    Matrix-assisted laser desorption/ionization (MALDI) in-source decay was studied in the negative ion mode on deprotonated peptides to determine its usefulness for obtaining extensive sequence information for acidic peptides. Eight biological acidic peptides, ranging in size from 11 to 33 residues, were studied by negative ion mode ISD (nISD). The matrices 2,5-dihydroxybenzoic acid, 2-aminobenzoic acid, 2-aminobenzamide, 1,5-diaminonaphthalene, 5-amino-1-naphthol, 3-aminoquinoline, and 9-aminoacridine were used with each peptide. Optimal fragmentation was produced with 1,5-diaminonphthalene (DAN), and extensive sequence informative fragmentation was observed for every peptide except hirudin(54-65). Cleavage at the N-Cα bond of the peptide backbone, producing c' and z' ions, was dominant for all peptides. Cleavage of the N-Cα bond N-terminal to proline residues was not observed. The formation of c and z ions is also found in electron transfer dissociation (ETD), electron capture dissociation (ECD), and positive ion mode ISD, which are considered to be radical-driven techniques. Oxidized insulin chain A, which has four highly acidic oxidized cysteine residues, had less extensive fragmentation. This peptide also exhibited the only charged localized fragmentation, with more pronounced product ion formation adjacent to the highly acidic residues. In addition, spectra were obtained by positive ion mode ISD for each protonated peptide; more sequence informative fragmentation was observed via nISD for all peptides. Three of the peptides studied had no product ion formation in ISD, but extensive sequence informative fragmentation was found in their nISD spectra. The results of this study indicate that nISD can be used to readily obtain sequence information for acidic peptides. Graphical Abstract ᅟ. PMID:26864792

  6. Negative Ion In-Source Decay Matrix-Assisted Laser Desorption/Ionization Mass Spectrometry for Sequencing Acidic Peptides

    McMillen, Chelsea L.; Wright, Patience M.; Cassady, Carolyn J.

    2016-02-01

    Matrix-assisted laser desorption/ionization (MALDI) in-source decay was studied in the negative ion mode on deprotonated peptides to determine its usefulness for obtaining extensive sequence information for acidic peptides. Eight biological acidic peptides, ranging in size from 11 to 33 residues, were studied by negative ion mode ISD (nISD). The matrices 2,5-dihydroxybenzoic acid, 2-aminobenzoic acid, 2-aminobenzamide, 1,5-diaminonaphthalene, 5-amino-1-naphthol, 3-aminoquinoline, and 9-aminoacridine were used with each peptide. Optimal fragmentation was produced with 1,5-diaminonphthalene (DAN), and extensive sequence informative fragmentation was observed for every peptide except hirudin(54-65). Cleavage at the N-Cα bond of the peptide backbone, producing c' and z' ions, was dominant for all peptides. Cleavage of the N-Cα bond N-terminal to proline residues was not observed. The formation of c and z ions is also found in electron transfer dissociation (ETD), electron capture dissociation (ECD), and positive ion mode ISD, which are considered to be radical-driven techniques. Oxidized insulin chain A, which has four highly acidic oxidized cysteine residues, had less extensive fragmentation. This peptide also exhibited the only charged localized fragmentation, with more pronounced product ion formation adjacent to the highly acidic residues. In addition, spectra were obtained by positive ion mode ISD for each protonated peptide; more sequence informative fragmentation was observed via nISD for all peptides. Three of the peptides studied had no product ion formation in ISD, but extensive sequence informative fragmentation was found in their nISD spectra. The results of this study indicate that nISD can be used to readily obtain sequence information for acidic peptides.

  7. Homology analyses of the protein sequences of fatty acid synthases from chicken liver, rat mammary gland, and yeast

    Homology analyses of the protein sequences of chicken liver and rat mammary gland fatty acid synthases were carried out. The amino acid sequences of the chicken and rat enzymes are 67% identical. If conservative substitutions are allowed, 78% of the amino acids are matched. A region of low homologies exists between the functional domains, in particular around amino acid residues 1059-1264 of the chicken enzyme. Homologies between the active sites of chicken and rat and of chicken and yeast enzymes have been analyzed by an alignment method. A high degree of homology exists between the active sites of the chicken and rat enzymes. However, the chicken and yeast enzymes show a lower degree of homology. The DADPH-binding dinucleotide folds of the β-ketoacyl reductase and the enoyl reductase sites were identified by comparison with a known consensus sequence for the DADP- and FAD-binding dinucleotide folds. The active sites of all of the enzymes are primarily in hydrophobic regions of the protein. This study suggests that the genes for the functional domains of fatty acid synthase were originally separated, and these genes were connected to each other by using different connecting nucleotide sequences in different species. An alternative explanation for the differences in rat and chicken is a common ancestry and mutations in the joining regions during evolution

  8. The developmental transcriptome landscape of bovine skeletal muscle defined by Ribo-Zero ribonucleic acid sequencing.

    Sun, X; Li, M; Sun, Y; Cai, H; Li, R; Wei, X; Lan, X; Huang, Y; Lei, C; Chen, H

    2015-12-01

    Ribonucleic acid sequencing (RNA-Seq) libraries are normally prepared with oligo(dT) selection of poly(A)+ mRNA, but it depends on intact total RNA samples. Recent studies have described Ribo-Zero technology, a novel method that can capture both poly(A)+ and poly(A)- transcripts from intact or fragmented RNA samples. We report here the first application of Ribo-Zero RNA-Seq for the analysis of the bovine embryonic, neonatal, and adult skeletal muscle whole transcriptome at an unprecedented depth. Overall, 19,893 genes were found to be expressed, with a high correlation of expression levels between the calf and the adult. Hundreds of genes were found to be highly expressed in the embryo and decreased at least 10-fold after birth, indicating their potential roles in embryonic muscle development. In addition, we present for the first time the analysis of global transcript isoform discovery in bovine skeletal muscle and identified 36,694 transcript isoforms. Transcriptomic data were also analyzed to unravel sequence variations; 185,036 putative SNP and 12,428 putative short insertions-deletions (InDel) were detected. Specifically, many stop-gain, stop-loss, and frameshift mutations were identified that probably change the relative protein production and sequentially affect the gene function. Notably, the numbers of stage-specific transcripts, alternative splicing events, SNP, and InDel were greater in the embryo than in the calf and the adult, suggesting that gene expression is most active in the embryo. The resulting view of the transcriptome at a single-base resolution greatly enhances the comprehensive transcript catalog and uncovers the global trends in gene expression during bovine skeletal muscle development. PMID:26641174

  9. Genome Sequence of a Candidate World Health Organization Reference Strain of Zika Virus for Nucleic Acid Testing.

    Trösemeier, Jan-Hendrik; Musso, Didier; Blümel, Johannes; Thézé, Julien; Pybus, Oliver G; Baylis, Sally A

    2016-01-01

    We report here the sequence of a candidate reference strain of Zika virus (ZIKV) developed on behalf of the World Health Organization (WHO). The ZIKV reference strain is intended for use in nucleic acid amplification (NAT)-based assays for the detection and quantification of ZIKV RNA. PMID:27587826

  10. Draft Genome Sequence of Lactobacillus delbrueckii subsp. bulgaricus CFL1, a Lactic Acid Bacterium Isolated from French Handcrafted Fermented Milk

    Meneghel, Julie; Irlinger, Françoise; Loux, Valentin; Vidal, Marie; Passot, Stéphanie; Béal, Catherine; Layec, Séverine

    2016-01-01

    Lactobacillus delbrueckii subsp. bulgaricus (L. bulgaricus) is a lactic acid bacterium widely used for the production of yogurt and cheeses. Here, we report the genome sequence of L. bulgaricus CFL1 to improve our knowledge on its stress-induced damages following production and end-use processes. PMID:26941141

  11. N-terminal amino acid sequence of Bacillus licheniformis alpha-amylase: comparison with Bacillus amyloliquefaciens and Bacillus subtilis Enzymes.

    Kuhn, H; Fietzek, P P; Lampen, J. O.

    1982-01-01

    The thermostable, liquefying alpha-amylase from Bacillus licheniformis was immunologically cross-reactive with the thermolabile, liquefying alpha-amylase from Bacillus amyloliquefaciens. Their N-terminal amino acid sequences showed extensive homology with each other, but not with the saccharifying alpha-amylases of Bacillus subtilis.

  12. Complete genome sequence of Lactobacillus plantarum ZS2058, a probiotic strain with high conjugated linoleic acid production ability.

    Yang, Bo; Chen, Haiqin; Tian, Fengwei; Zhao, Jianxin; Gu, Zhennan; Zhang, Hao; Chen, Yong Q; Chen, Wei

    2015-11-20

    Lactobacillus plantarum ZS2058 was isolated from sauerkraut and identified to synthesize the beneficial metabolite conjugated linoleic acid. The genome contains a 319,7363-bp chromosome and three plasmids. The sequence will facilitate identification and characterization of the genetic determinants for its putative biological benefits. PMID:26439428

  13. Genome Sequence of Corynebacterium glutamicum ATCC 14067, Which Provides Insight into Amino Acid Biosynthesis in Coryneform Bacteria

    Lv, Yangyong; Liao, Juanjun; Wu, Zhanhong; Han, Shuangyan; Lin, Ying; Zheng, Suiping

    2012-01-01

    We report the genome sequence of Corynebacterium glutamicum ATCC 14067 (once named Brevibacterium flavum), which is useful for taxonomy research and further molecular breeding in amino acid production. Preliminary comparison with those of the reported coryneform strains revealed some notable differences that might be related to the difficulties in molecular manipulation.

  14. Draft Genome Sequence of Lactobacillus delbrueckii subsp. bulgaricus CFL1, a Lactic Acid Bacterium Isolated from French Handcrafted Fermented Milk.

    Meneghel, Julie; Dugat-Bony, Eric; Irlinger, Françoise; Loux, Valentin; Vidal, Marie; Passot, Stéphanie; Béal, Catherine; Layec, Séverine; Fonseca, Fernanda

    2016-01-01

    Lactobacillus delbrueckii subsp. bulgaricus (L. bulgaricus) is a lactic acid bacterium widely used for the production of yogurt and cheeses. Here, we report the genome sequence of L. bulgaricus CFL1 to improve our knowledge on its stress-induced damages following production and end-use processes. PMID:26941141

  15. Colorimetric and visual read-out determination of cyanuric acid exploiting the interaction between melamine and silver nanoparticles

    We present two colorimetric procedures for the determination of cyanuric acid, using silver nanoparticle-based (AgNPs) probes. The first is making use of melamine-modified AgNPs which bind to cyanuric acid through hydrogen bonding to form a large conjugate network that enhances the aggregation of AgNPs to produce an absorbance peak at 640 nm and a green coloration. In the second assay, melamine is directly added to the sample in order to form a stable complex with cyanuric acid. AgNPs are then added, resulting in the formation of an absorbance peaking at 525 nm and a color change from green (blank sample) to purple or orange-red as a function of cyanuric acid concentration. Matrix effects, that originate from the interaction of alkaline earth metals with the charged surface of the AgNPs, are mitigated through a matrix-matched calibration. In this manner, spectral transitions can be selectively attributed to the concentration of cyanuric acid, which can be even visually quantified at low mg L−1 levels with minimum sample pre-treatment and without sophisticated instrumentation. (author)

  16. A randomized trial comparing the diagnostic accuracy of visual inspection with acetic acid to Visual Inspection with Lugol's Iodine for cervical cancer screening in HIV-infected women.

    Megan J Huchko

    Full Text Available Visual inspection with Acetic Acid (VIA and Visual Inspection with Lugol’s Iodine (VILI are increasingly recommended in various cervical cancer screening protocols in low-resource settings. Although VIA is more widely used, VILI has been advocated as an easier and more specific screening test. VILI has not been well-validated as a stand-alone screening test, compared to VIA or validated for use in HIV-infected women. We carried out a randomized clinical trial to compare the diagnostic accuracy of VIA and VILI among HIV-infected women. Women attending the Family AIDS Care and Education Services (FACES clinic in western Kenya were enrolled and randomized to undergo either VIA or VILI with colposcopy. Lesions suspicious for cervical intraepithelial neoplasia 2 or greater (CIN2+ were biopsied. Between October 2011 and June 2012, 654 were randomized to undergo VIA or VILI. The test positivity rates were 26.2% for VIA and 30.6% for VILI (p = 0.22. The rate of detection of CIN2+ was 7.7% in the VIA arm and 11.5% in the VILI arm (p = 0.10. There was no significant difference in the diagnostic performance of VIA and VILI for the detection of CIN2+. Sensitivity and specificity were 84.0% and 78.6%, respectively, for VIA and 84.2% and 76.4% for VILI. The positive and negative predictive values were 24.7% and 98.3% for VIA, and 31.7% and 97.4% for VILI. Among women with CD4+ count < 350, VILI had a significantly decreased specificity (66.2% compared to VIA in the same group (83.9%, p = 0.02 and compared to VILI performed among women with CD4+ count ≥ 350 (79.7%, p = 0.02. VIA and VILI had similar diagnostic accuracy and rates of CIN2+ detection among HIV-infected women.

  17. Nucleotide and amino acid sequences of a coat protein of an Ukrainian isolate of Potato virus Y: comparison with homologous sequences of other isolates and phylogenetic analysis

    Budzanivska I. G.

    2014-03-01

    Full Text Available Aim. Identification of the widespread Ukrainian isolate(s of PVY (Potato virus Y in different potato cultivars and subsequent phylogenetic analysis of detected PVY isolates based on NA and AA sequences of coat protein. Methods. ELISA, RT-PCR, DNA sequencing and phylogenetic analysis. Results. PVY has been identified serologically in potato cultivars of Ukrainian selection. In this work we have optimized a method for total RNA extraction from potato samples and offered a sensitive and specific PCR-based test system of own design for diagnostics of the Ukrainian PVY isolates. Part of the CP gene of the Ukrainian PVY isolate has been sequenced and analyzed phylogenetically. It is demonstrated that the Ukrainian isolate of Potato virus Y (CP gene has a higher percentage of homology with the recombinant isolates (strains of this pathogen (approx. 98.8– 99.8 % of homology for both nucleotide and translated amino acid sequences of the CP gene. The Ukrainian isolate of PVY is positioned in the separate cluster together with the isolates found in Syria, Japan and Iran; these isolates possibly have common origin. The Ukrainian PVY isolate is confirmed to be recombinant. Conclusions. This work underlines the need and provides the means for accurate monitoring of Potato virus Y in the agroecosystems of Ukraine. Most importantly, the phylogenetic analysis demonstrated the recombinant nature of this PVY isolate which has been attributed to the strain group O, subclade N:O.

  18. Evolution of vertebrate IgM: complete amino acid sequence of the constant region of Ambystoma mexicanum mu chain deduced from cDNA sequence.

    Fellah, J S; Wiles, M V; Charlemagne, J; Schwager, J

    1992-10-01

    cDNA clones coding for the constant region of the Mexican axolotl (Ambystoma mexicanum) mu heavy immunoglobulin chain were selected from total spleen RNA, using a cDNA polymerase chain reaction technique. The specific 5'-end primer was an oligonucleotide homologous to the JH segment of Xenopus laevis mu chain. One of the clones, JHA/3, corresponded to the complete constant region of the axolotl mu chain, consisting of a 1362-nucleotide sequence coding for a polypeptide of 454 amino acids followed in 3' direction by a 179-nucleotide untranslated region and a polyA+ tail. The axolotl C mu is divided into four typical domains (C mu 1-C mu 4) and can be aligned with the Xenopus C mu with an overall identity of 56% at the nucleotide level. Percent identities were particularly high between C mu 1 (59%) and C mu 4 (71%). The C-terminal 20-amino acid segment which constitutes the secretory part of the mu chain is strongly homologous to the equivalent sequences of chondrichthyans and of other tetrapods, including a conserved N-linked oligosaccharide, the penultimate cysteine and the C-terminal lysine. The four C mu domains of 13 vertebrate species ranging from chondrichthyans to mammals were aligned and compared at the amino acid level. The significant number of mu-specific residues which are conserved into each of the four C mu domains argues for a continuous line of evolution of the vertebrate mu chain. This notion was confirmed by the ability to reconstitute a consistent vertebrate evolution tree based on the phylogenic parsimony analysis of the C mu 4 sequences. PMID:1382992

  19. Complete amino acid sequence of human plasma Zn-α2-glycoprotein and its homology to histocompatibility antigens

    In the present study the complete amino acid sequence of human plasma Zn-α2-glycoprotein was determined. This protein whose biological function is unknown consists of a single polypeptide chain of 276 amino acid residues including 8 tryptophan residues and has a pyroglutamyl residue at the amino terminus. The location of the two disulfide bonds in the polypeptide chain was also established. The three glycans, whose structure was elucidated with the aid of 500 MHz 1H NMR spectroscopy, were sialylated N-biantennas. The molecular weight calculated from the polypeptide and carbohydrate structure is 38,478, which is close to the reported value of ≅ 41,000 based on physicochemical measurements. The predicted secondary structure appeared to comprised of 23% α-helix, 27% β-sheet, and 22% β-turns. The three N-glycans were found to be located in β-turn regions. An unexpected finding was made by computer analysis of the sequence data; this revealed that Zn-α2-glycoprotein is closely related to antigens of the major histocompatibility complex in amino acid sequence and in domain structure. There was an unusually high degree of sequence homology with the α chains of class I histocompatibility antigens. Moreover, this plasma protein was shown to be a member of the immunoglobulin gene superfamily. Zn-α2-glycoprotein appears to be truncated secretory major histocompatibility complex-related molecule, and it may have a role in the expression of the immune response

  20. Human tyrosyl-tRNA synthetase shares amino acid sequence homology with a putative cytokine.

    Kleeman, T A; Wei, D; Simpson, K L; First, E A

    1997-05-30

    To test the hypothesis that tRNATyr recognition differs between bacterial and human tyrosyl-tRNA synthetases, we sequenced several clones identified as human tyrosyl-tRNA synthetase cDNAs by the Human Genome Project. We found that human tyrosyl-tRNA synthetase is composed of three domains: 1) an amino-terminal Rossmann fold domain that is responsible for formation of the activated E.Tyr-AMP intermediate and is conserved among bacteria, archeae, and eukaryotes; 2) a tRNA anticodon recognition domain that has not been conserved between bacteria and eukaryotes; and 3) a carboxyl-terminal domain that is unique to the human tyrosyl-tRNA synthetase and whose primary structure is 49% identical to the putative human cytokine endothelial monocyte-activating protein II, 50% identical to the carboxyl-terminal domain of methionyl-tRNA synthetase from Caenorhabditis elegans, and 43% identical to the carboxyl-terminal domain of Arc1p from Saccharomyces cerevisiae. The first two domains of the human tyrosyl-tRNA synthetase are 52, 36, and 16% identical to tyrosyl-tRNA synthetases from S. cerevisiae, Methanococcus jannaschii, and Bacillus stearothermophilus, respectively. Nine of fifteen amino acids known to be involved in the formation of the tyrosyl-adenylate complex in B. stearothermophilus are conserved across all of the organisms, whereas amino acids involved in the recognition of tRNATyr are not conserved. Kinetic analyses of recombinant human and B. stearothermophilus tyrosyl-tRNA synthetases expressed in Escherichia coli indicate that human tyrosyl-tRNA synthetase aminoacylates human but not B. stearothermophilus tRNATyr, and vice versa, supporting the original hypothesis. It is proposed that like endothelial monocyte-activating protein II and the carboxyl-terminal domain of Arc1p, the carboxyl-terminal domain of human tyrosyl-tRNA synthetase evolved from gene duplication of the carboxyl-terminal domain of methionyl-tRNA synthetase and may direct tRNA to the active site of

  1. Gastropod arginine kinases from Cellana grata and Aplysia kurodai. Isolation and cDNA-derived amino acid sequences.

    Suzuki, T; Inoue, N; Higashi, T; Mizobuchi, R; Sugimura, N; Yokouchi, K; Furukohri, T

    2000-12-01

    Arginine kinase (AK) was isolated from the radular muscle of the gastropod molluscs Cellana grata (subclass Prosobranchia) and Aplysia kurodai (subclass Opisthobranchia), respectively, by ammonium sulfate fractionation, Sephadex G-75 gel filtration and DEAE-ion exchange chromatography. The denatured relative molecular mass values were estimated to be 40 kDa by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. The isolated enzyme from Aplysia gave a Km value of 0.6 mM for arginine and a Vmax value of 13 micromole Pi min(-1) mg protein(-1) for the forward reaction. These values are comparable to other molluscan AKs. The cDNAs encoding Cellana and Aplysia AKs were amplified by polymerase chain reaction, and the nucleotide sequences of 1,608 and 1,239 bp, respectively, were determined. The open reading frame for Cellana AK is 1044 nucleotides in length and encodes a protein with 347 amino acid residues, and that for A. kurodai is 1077 nucleotides and 354 residues. The cDNA-derived amino acid sequences were validated by chemical sequencing of internal lysyl endopeptidase peptides. The amino acid sequences of Cellana and Aplysia AKs showed the highest percent identity (66-73%) with those of the abalone Nordotis and turbanshell Battilus belonging to the same class Gastropoda. These AK sequences still have a strong homology (63-71%) with that of the chiton Liolophura (class Polyplacophora), which is believed to be one of the most primitive molluscs. On the other hand, these AK sequences are less homologous (55-57%) with that of the clam Pseudocardium (class Bivalvia), suggesting that the biological position of the class Polyplacophora should be reconsidered. PMID:11281267

  2. Convergent evolution of the red- and green-like visual pigment genes in fish, Astyanax fasciatus, and human

    The authors have isolated and sequenced genes from the blind cave fish, Astyanax fasciatus, that are homologous to the human red and green visual pigment genes. The data strongly suggest that, like human, these fish have one red-like visual pigment gene and multiple green-like visual pigment genes. By comparing the DNA sequences of the human and fish visual pigment genes and knowing their phylogenetic relationship, one can infer the direction of amino acid substitutions in the red and green visual pigments. The results indicate that the red pigments in human and fish evolved from the green pigment independently by identical amino acid substitutions in only a few key positions

  3. Amino acid sequences of predicted proteins and their annotation for 95 organism species. - Gclust Server | LSDB Archive [Life Science Database Archive metadata

    Full Text Available Gclust Server Amino acid sequences of predicted proteins and their annotation for 95 organism species. Data ...detail Data name Amino acid sequences of predicted proteins and their annotation for 95 organism species. De...scription of data contents Amino acid sequences of predicted proteins and their a...nnotation for 95 organism species. The data are given in a CSV format text file. Data file File name: gclust...tation in original database Annotation at the original website Species Species name Length Amino acid sequen

  4. Sparse Representations-Based Super-Resolution of Key-Frames Extracted from Frames-Sequences Generated by a Visual Sensor Network

    Muhammad Sajjad

    2014-02-01

    Full Text Available Visual sensor networks (VSNs usually generate a low-resolution (LR frame-sequence due to energy and processing constraints. These LR-frames are not very appropriate for use in certain surveillance applications. It is very important to enhance the resolution of the captured LR-frames using resolution enhancement schemes. In this paper, an effective framework for a super-resolution (SR scheme is proposed that enhances the resolution of LR key-frames extracted from frame-sequences captured by visual-sensors. In a VSN, a visual processing hub (VPH collects a huge amount of visual data from camera sensors. In the proposed framework, at the VPH, key-frames are extracted using our recent key-frame extraction technique and are streamed to the base station (BS after compression. A novel effective SR scheme is applied at BS to produce a high-resolution (HR output from the received key-frames. The proposed SR scheme uses optimized orthogonal matching pursuit (OOMP for sparse-representation recovery in SR. OOMP does better in terms of detecting true sparsity than orthogonal matching pursuit (OMP. This property of the OOMP helps produce a HR image which is closer to the original image. The K-SVD dictionary learning procedure is incorporated for dictionary learning. Batch-OMP improves the dictionary learning process by removing the limitation in handling a large set of observed signals. Experimental results validate the effectiveness of the proposed scheme and show its superiority over other state-of-the-art schemes.

  5. Sparse representations-based super-resolution of key-frames extracted from frames-sequences generated by a visual sensor network.

    Sajjad, Muhammad; Mehmood, Irfan; Baik, Sung Wook

    2014-01-01

    Visual sensor networks (VSNs) usually generate a low-resolution (LR) frame-sequence due to energy and processing constraints. These LR-frames are not very appropriate for use in certain surveillance applications. It is very important to enhance the resolution of the captured LR-frames using resolution enhancement schemes. In this paper, an effective framework for a super-resolution (SR) scheme is proposed that enhances the resolution of LR key-frames extracted from frame-sequences captured by visual-sensors. In a VSN, a visual processing hub (VPH) collects a huge amount of visual data from camera sensors. In the proposed framework, at the VPH, key-frames are extracted using our recent key-frame extraction technique and are streamed to the base station (BS) after compression. A novel effective SR scheme is applied at BS to produce a high-resolution (HR) output from the received key-frames. The proposed SR scheme uses optimized orthogonal matching pursuit (OOMP) for sparse-representation recovery in SR. OOMP does better in terms of detecting true sparsity than orthogonal matching pursuit (OMP). This property of the OOMP helps produce a HR image which is closer to the original image. The K-SVD dictionary learning procedure is incorporated for dictionary learning. Batch-OMP improves the dictionary learning process by removing the limitation in handling a large set of observed signals. Experimental results validate the effectiveness of the proposed scheme and show its superiority over other state-of-the-art schemes. PMID:24566632

  6. Barley polyamine oxidase: Characterisation and analysis of the cofactor and the N-terminal amino acid sequence

    Radova, A.; Sebela, M.; Galuszka, P.; Frebort, I.; Jacobsen, Susanne; Faulhammer, H.G.; Pec, P.

    2001-01-01

    further purified to a final homogeneity (by the criteria of isoelectric focusing and SDS-PAGE) using techniques of low pressure chromatography followed by two FPLC steps. The purified yellow enzyme showed visible absorption maxima of a flavoprotein at 380 and 450 nm: the presence of FAD as the cofactor...... was further confirmed by measuring the fluorescence spectra, Barley PAO is an acidic protein (pI 5.4) containing 3% of neutral sugars: its molecular mass determined by SDS-PAGE was 56 kDa, whilst gel permeation chromatography revealed the higher value of 76 kDa. The N-terminal amino acid sequence of...

  7. Visually driven chaining of elementary swim patterns into a goal-directed motor sequence: a virtual reality study of zebrafish prey capture

    Johann H. Bollmann

    2013-05-01

    Full Text Available Prey capture behavior critically depends on rapid processing of sensory input in order to track, approach and catch the target. When using vision, the nervous system faces the problem of extracting relevant information from a continuous stream of input in order to detect and categorize visible objects as potential prey and to select appropriate motor patterns for approach. For prey capture, many vertebrates exhibit intermittent locomotion, in which discrete motor patterns are chained into a sequence, interrupted by short periods of rest. Here, using high-speed recordings of full-length prey capture sequences performed by freely swimming zebrafish larvae in the presence of a single paramecium, we provide a detailed kinematic analysis of first and subsequent swim bouts during prey capture. Using Fourier analysis, we show that individual swim bouts represent an elementary motor pattern. Changes in orientation are directed towards the target on a graded scale and are implemented by an asymmetric tail bend component superimposed on this basic motor pattern. To further investigate the role of visual feedback on the efficiency and speed of this complex behavior, we developed a closed-loop virtual reality setup in which minimally restrained larvae recapitulated interconnected swim patterns closely resembling those observed during prey capture in freely moving fish. Systematic variation of stimulus properties showed that prey capture is initiated within a narrow range of stimulus size and velocity. Furthermore, variations in the delay and location of swim-triggered visual feedback showed that the reaction time of secondary and later swims is shorter for stimuli that appear within a narrow spatio-temporal window following a swim. This suggests that the larva may generate an expectation of stimulus position, which enables accelerated motor sequencing if the expectation is met by appropriate visual feedback.

  8. Parameters of proteome evolution from histograms of amino-acid sequence identities of paralogous proteins

    Yan Koon-Kiu

    2007-11-01

    Full Text Available Abstract Background The evolution of the full repertoire of proteins encoded in a given genome is mostly driven by gene duplications, deletions, and sequence modifications of existing proteins. Indirect information about relative rates and other intrinsic parameters of these three basic processes is contained in the proteome-wide distribution of sequence identities of pairs of paralogous proteins. Results We introduce a simple mathematical framework based on a stochastic birth-and-death model that allows one to extract some of this information and apply it to the set of all pairs of paralogous proteins in H. pylori, E. coli, S. cerevisiae, C. elegans, D. melanogaster, and H. sapiens. It was found that the histogram of sequence identities p generated by an all-to-all alignment of all protein sequences encoded in a genome is well fitted with a power-law form ~ p-γ with the value of the exponent γ around 4 for the majority of organisms used in this study. This implies that the intra-protein variability of substitution rates is best described by the Gamma-distribution with the exponent α ≈ 0.33. Different features of the shape of such histograms allow us to quantify the ratio between the genome-wide average deletion/duplication rates and the amino-acid substitution rate. Conclusion We separately measure the short-term ("raw" duplication and deletion rates rdup∗ MathType@MTEF@5@5@+=feaafiart1ev1aaatCvAUfKttLearuWrP9MDH5MBPbIqV92AaeXatLxBI9gBaebbnrfifHhDYfgasaacPC6xNi=xH8viVGI8Gi=hEeeu0xXdbba9frFj0xb9qqpG0dXdb9aspeI8k8fiI+fsY=rqGqVepae9pg0db9vqaiVgFr0xfr=xfr=xc9adbaqaaeGacaGaaiaabeqaaeqabiWaaaGcbaGaemOCai3aa0baaSqaaiabbsgaKjabbwha1jabbchaWbqaaiabgEHiQaaaaaa@3283@, rdel∗ MathType@MTEF@5@5@+=feaafiart1ev1aaatCvAUfKttLearuWrP9MDH5MBPbIqV92AaeXatLxBI9gBaebbnrfifHhDYfgasaacPC6xNi=xH8viVGI8Gi=hEeeu0xXdbba9frFj0xb9qqpG0dXdb9aspeI8k8fiI+fsY=rqGqVepae9pg0db9vqaiVgFr0xfr=xfr=xc9adbaqaaeGacaGaaiaabeqaaeqabiWaaaGcbaGaemOCai3aa0baaSqaaiabbsga

  9. JRC GMO-Amplicons, a collection of nucleic acid sequences related to genetically modified organisms

    PETRILLO MAURO; ANGERS ALEXANDRE; HENRIKSSON PETER; Bonfini, Laura; PATAK DENNSTEDT Alexandre; KREYSA JOACHIM

    2015-01-01

    The DNA target sequence is the key element in designing detection methods for genetically modified organisms (GMOs). Unfortunately this information is frequently lacking, especially for unauthorized GMOs. In addition, patent sequences are generally poorly annotated, buried in complex and extensive documentation and hard to link to the corresponding GM event. Here, we present the JRC GMO-Amplicons, a database of amplicons collected by screening public nucleotide sequence databanks by in silico...

  10. Identification of novel rice low phytic acid mutations via TILLING by sequencing

    Phytic acid (myo-inositol-1,2,3,4,5,6-hexakisphosphate or InsP6) accounts for 75-85% of the total phosphorus in seeds. Low phytic acid (lpa) mutants exhibit decreases in seed InsP6 with corresponding increases in inorganic P which, unlike phytic acid P, is readily utilized by humans and monogastric ...

  11. Real-Time Nucleic Acid Sequence-Based Amplification Using Molecular Beacons for Detection of Enterovirus RNA in Clinical Specimens

    Landry, Marie L.; Garner, Robin; Ferguson, David

    2005-01-01

    Real-time nucleic acid sequence-based amplification (NASBA) using molecular beacon technology (NASBA-beacon) was compared to standard NASBA with postamplification hybridization using electrochemiluminescently labeled probes (NASBA-ECL) for detection of enteroviruses (EV) in 133 cerebrospinal fluid and 27 stool samples. NASBA-ECL and NASBA-beacon were similar in sensitivity, detecting 55 (100%) and 52 (94.5%) EV-positive samples, respectively. There were no false positives. Both NASBA assays w...

  12. Using Triple Helix Forming Peptide Nucleic Acids for Sequence-selective Recognition of Double-stranded RNA

    Hnedzko, Dziyana; Cheruiyot, Samwel K.; Rozners, Eriks

    2014-01-01

    Non-coding RNAs play important roles in regulation of gene expression. Specific recognition and inhibition of these biologically important RNAs that form complex double-helical structures will be highly useful for fundamental studies in biology and practical applications in medicine. This protocol describes a strategy developed in our laboratory for sequence-selective recognition of double-stranded RNA (dsRNA) using triple helix forming peptide nucleic acids (PNAs) that bind in the major grov...

  13. Deep sequencing of the Mexican avocado transcriptome, an ancient angiosperm with a high content of fatty acids

    Ibarra-Laclette, Enrique; Méndez-Bravo, Alfonso; Pérez-Torres, Claudia Anahí; Albert, Victor A; Mockaitis, Keithanne; Kilaru, Aruna; López-Gómez, Rodolfo; Cervantes-Luevano, Jacob Israel; Herrera-Estrella, Luis

    2015-01-01

    Background Avocado (Persea americana) is an economically important tropical fruit considered to be a good source of fatty acids. Despite its importance, the molecular and cellular characterization of biochemical and developmental processes in avocado is limited due to the lack of transcriptome and genomic information. Results The transcriptomes of seeds, roots, stems, leaves, aerial buds and flowers were determined using different sequencing platforms. Additionally, the transcriptomes of thre...

  14. Comparative Complete Genome Sequence Analysis of the Amino Acid Replacements Responsible for the Thermostability of Corynebacterium efficiens

    Nishio, Yousuke; Nakamura, Yoji; Kawarabayasi, Yutaka; Usuda, Yoshihiro; Kimura, Eiichiro; Sugimoto, Shinichi; Matsui, Kazuhiko; Yamagishi, Akihiko; Kikuchi, Hisashi; Ikeo, Kazuho; Gojobori, Takashi

    2003-01-01

    Corynebacterium efficiens is the closest relative of Corynebacterium glutamicum, a species widely used for the industrial production of amino acids. C. efficiens but not C. glutamicum can grow above 40°C. We sequenced the complete C. efficiens genome to investigate the basis of its thermostability by comparing its genome with that of C. glutamicum. The difference in GC content between the species was reflected in codon usage and nucleotide substitutions. Our compar...

  15. ngs.plot: Quick mining and visualization of next-generation sequencing data by integrating genomic databases

    Shen, Li; Shao, Ningyi; Liu, Xiaochuan; Nestler, Eric

    2014-01-01

    Background Understanding the relationship between the millions of functional DNA elements and their protein regulators, and how they work in conjunction to manifest diverse phenotypes, is key to advancing our understanding of the mammalian genome. Next-generation sequencing technology is now used widely to probe these protein-DNA interactions and to profile gene expression at a genome-wide scale. As the cost of DNA sequencing continues to fall, the interpretation of the ever increasing amount...

  16. Amino acid sequence of the serine-repeat antigen (SERA) of Plasmodium falciparum determined from cloned cDNA.

    Bzik, D J; Li, W B; Horii, T; Inselburg, J

    1988-09-01

    We report the isolation of cDNA clones for a Plasmodium falciparum gene that encodes the complete amino acid sequence of a previously identified exported blood stage antigen. The Mr of this antigen protein had been determined by sodium dodecylsulphate-polyacrylamide gel electrophoresis analysis, by different workers, to be 113,000, 126,000, and 140,000. We show, by cDNA nucleotide sequence analysis, that this antigen gene encodes a 989 amino acid protein (111 kDa) that contains a potential signal peptide, but not a membrane anchor domain. In the FCR3 strain the serine content of the protein was 11%, of which 57% of the serine residues were localized within a 201 amino acid sequence that included 35 consecutive serine residues. The protein also contained three possible N-linked glycosylation sites and numerous possible O-linked glycosylation sites. The mRNA was abundant during late trophozoite-schizont parasite stages. We propose to identity this antigen, which had been called p126, by the acronym SERA, serine-repeat antigen, based on its complete structure. The usefulness of the cloned cDNA as a source of a possible malaria vaccine is considered in view of the previously demonstrated ability of the antigen to induce parasite-inhibitory antibodies and a protective immune response in Saimiri monkeys. PMID:2847041

  17. cDNA-derived amino-acid sequence of a land turtle (Geochelone carbonaria) beta-chain hemoglobin.

    Bordin, S; Meza, A N; Saad, S T; Ogo, S H; Costa, F F

    1997-06-01

    The cDNA sequence encoding the turtle Geochelone carbonaria beta-chain was determinated. The isolation of hemoglobin mRNA was based on degenerate primers' PCR in combination with 5'- and 3'-RACE protocol. The full length cDNA is 615 bp with the ATG start codon at position 53 and TGA stop codon at position 495; The AATAAA polyadenylation signal is found at position 599. The deduced polypeptyde contains 146 amino-acid residues. The predicted amino acid sequence shares 83% identity with the beta-globin of a related specie, the aquatic turtle C. p. belli. Otherwise, identity is higher when compared with chicken beta-Hb (80%) than with other reptilian orders (Squamata, 69%, and Crocodilia, 61%). Compared with human HbA, there is 67% identity, and at least three amino acid substitutions could be of some functional significance (Glu43 beta-->Ser, His116 beta-->Thr and His143 beta-->Leu). To our knowledge this represents the first cDNA sequence of a reptile globin gene described. PMID:9238523

  18. A novel T-cell-defined HLA-DR polymorphism not predicted from the linear amino acid sequence.

    Termijtelen, A; van den Elsen, P; Koning, F; de Koster, S; Schroeijers, W; Vanderkerckhove, B

    1989-09-01

    Recent investigations have shown that alloreactive T cells are capable of responding to structures defined by specific linear amino acid sequences on class II molecules. In the present study we show that also a polymorphism can be recognized that is not defined by such linear amino acid sequences. Two human T-cell clones, sensitized to DRw13 haplotypes, are described. The description of clone c50 serves to exemplify the first model. This DRB1-specific clone responds to stimulator cells that carry DR molecules, different in their DRB1 first and second hypervariable regions (HV1 and HV2) but identical in their HV3 regions (i.e., DRw13,Dw18; DRw13,Dw19; DR4,Dw10; and DRw11,LDVII). The second clone, c1443, behaves nonconventionally. It responds to DRw13,Dw18; DRw13,Dw19; and DR4,Dw4 stimulator cells, although no specific amino acid sequence is shared between these specificities. The latter pattern of reactivity suggests the existence of a novel polymorphism recognized by alloreactive T cells. This particular polymorphism may also be biologically significant. PMID:2476425

  19. Complete Genome Sequences of Escherichia coli O157:H7 Strains SRCC 1675 and 28RC, Which Vary in Acid Resistance

    Baranzoni, Gian Marco; Reichenberger, Erin R.; Kim, Gwang-Hee; Breidt, Frederick; Kay, Kathryn; Oh, Deog-Hwan

    2016-01-01

    The level of acid resistance among Escherichia coli O157:H7 strains varies, and strains with higher resistance to acid may have a lower infectious dose. The complete genome sequences belonging to two strains of Escherichia coli O157:H7 with different levels of acid resistance are presented here. PMID:27469964

  20. Optic disc boundary segmentation from diffeomorphic demons registration of monocular fundus image sequences versus 3D visualization of stereo fundus image pairs for automated early stage glaucoma assessment

    Gatti, Vijay; Hill, Jason; Mitra, Sunanda; Nutter, Brian

    2014-03-01

    Despite the current availability in resource-rich regions of advanced technologies in scanning and 3-D imaging in current ophthalmology practice, world-wide screening tests for early detection and progression of glaucoma still consist of a variety of simple tools, including fundus image-based parameters such as CDR (cup to disc diameter ratio) and CAR (cup to disc area ratio), especially in resource -poor regions. Reliable automated computation of the relevant parameters from fundus image sequences requires robust non-rigid registration and segmentation techniques. Recent research work demonstrated that proper non-rigid registration of multi-view monocular fundus image sequences could result in acceptable segmentation of cup boundaries for automated computation of CAR and CDR. This research work introduces a composite diffeomorphic demons registration algorithm for segmentation of cup boundaries from a sequence of monocular images and compares the resulting CAR and CDR values with those computed manually by experts and from 3-D visualization of stereo pairs. Our preliminary results show that the automated computation of CDR and CAR from composite diffeomorphic segmentation of monocular image sequences yield values comparable with those from the other two techniques and thus may provide global healthcare with a cost-effective yet accurate tool for management of glaucoma in its early stage.

  1. Rapid visual identification of PCR amplified nucleic acids by centrifugal gel separation: Potential use for molecular point-of-care tests.

    Hwang, Sang-Hyun; Kim, Dong-Eun; Im, Ji-Hyun; Kang, Su-Jin; Lee, Do-Hoon; Son, Sang Jun

    2016-05-15

    Recently, nucleic acid amplification and detection techniques have progressed based on advances in in microfluidics, microelectronics, and optical systems. Nucleic acids amplification based point-of-care test (POCT) in resource-limited settings requires simple visual detection methods. Several biosensing methods including lateral flow immunoassays (LFIA) were previously used to visually detect nucleic acids. However, prolonged assay time, several washing steps, and a need for specific antibodies limited their use. Here we developed a novel, rapid method to visualize amplified nucleic acids with naked eyes in clinical samples. First, we optimized conditions based on separation using very low centrifugal force and a density medium to detect human papillomavirus (HPV)-16 DNA in cervical specimens. After DNA extraction, HPV16 PCR was performed with biotin-labeled forward primer and Cy3-labeled reverse primer. PCR amplicon was mixed with streptavidin-magnetic beads, introduced into the density medium. After two-minute centrifugation, the result was visually identified. This system showed identical results with commercial HPV real-time PCR for 30 clinical samples and could detect up to 10(2)copies/mL of HPV DNA without any optical instruments. This robust and sensitive visual detection system is suitable for non-specialist personnel and point-of-care diagnosis in low-resource settings. PMID:26774997

  2. Fad7 gene identification and fatty acids phenotypic variation in an olive collection by EcoTILLING and sequencing approaches.

    Sabetta, Wilma; Blanco, Antonio; Zelasco, Samanta; Lombardo, Luca; Perri, Enzo; Mangini, Giacomo; Montemurro, Cinzia

    2013-08-01

    The ω-3 fatty acid desaturases (FADs) are enzymes responsible for catalyzing the conversion of linoleic acid to α-linolenic acid localized in the plastid or in the endoplasmic reticulum. In this research we report the genotypic and phenotypic variation of Italian Olea europaea L. germoplasm for the fatty acid composition. The phenotypic oil characterization was followed by the molecular analysis of the plastidial-type ω-3 FAD gene (fad7) (EC 1.14.19), whose full-length sequence has been here identified in cultivar Leccino. The gene consisted of 2635 bp with 8 exons and 5'- and 3'-UTRs of 336 and 282 bp respectively, and showed a high level of heterozygousity (1/110 bp). The natural allelic variation was investigated both by a LiCOR EcoTILLING assay and the PCR product direct sequencing. Only three haplotypes were identified among the 96 analysed cultivars, highlighting the strong degree of conservation of this gene. PMID:23685785

  3. Diagnosing Cervical Dysplasia Using Visual Inspection of the Cervix with Acetic Acid in a Woman in Rural Haiti

    Elizabeth Roger

    2014-11-01

    Full Text Available Cervical cancer remains a significant cause of morbidity and mortality for women in developing countries, despite the fact that inexpensive, simple and effective screening methods are available. Visual inspection of the cervix with acetic acid (VIA can be used as part of a “screen and treat” program to identify precancerous lesions for cryotherapy treatment. This case report details how the VIA screening test was incorporated into the care of a patient presenting to a maternal health clinic in Thomonde, Haiti which was staffed by doctors and medical students from Emory University School of Medicine in collaboration with Haiti Medishare. As demonstrated here, the VIA test requires minimal materials, can be efficiently incorporated into a physical exams, provides immediate results, and is easily demonstrated to and performed by local healthcare providers. The straightforward and sensitive VIA technique is an ideal cervical cancer screening method for resource poor areas.

  4. Visual test for melamine using silver nanoparticles modified with chromotropic acid

    A simple and low-cost assay for melamine is introduced that is making use of silver nanoparticles (AgNPs) functionalized with chromotropic acid (CTA). The surface of the AgNPs was capped with chromotropic acid which warrants the NPs to remain in stable and dispersed form. The presence of melamine induces the aggregation of the CTA-AgNPs due to the hydrogen bond interaction between CTA and melamine. This is accompanied by a color change from yellow to orange which can be observed with bare eyes. The method allows melamine to be quantified by absorptiometry with a linear response in the concentration range from 0.10 to 1.5 μM (R = 0.9996) and a detection limit of 36 nM which was much lower than the safe limits (20 μM in both the USA and EU, 8 μM for infant formula in China, 1.2 μM in the CAC review for melamine in liquid infant formula). The assay displays high selectivity to melamine over its structural analogs such as cyanuric acid, 2,4,6-trimethyl-1,3,5-triazine, and phloro glucinol owing to the fact that only melamine can act as the hydrogen donor to form hydrogen bonds with the sulfo groups of the CTA-capped AgNPs. The method was successfully applied to the determination of melamine in spiked liquid milk and the average recovery was 99 %. Most amino acids and a high content of calcium do not interfere in this assay. (author)

  5. Templated Synthesis of Peptide Nucleic Acids via Sequence-Selective Base-Filling Reactions

    Heemstra, Jennifer M.; Liu, David Ruchien

    2009-01-01

    The templated synthesis of nucleic acids has previously been achieved through the backbone ligation of preformed nucleotide monomers or oligomers. In contrast, here we demonstrate templated nucleic acid synthesis using a base-filling approach in which individual bases are added to abasic sites of a peptide nucleic acid (PNA). Because nucleobase substrates in this approach are not self-reactive, a base-filling approach may reduce the formation of nontemplated reaction products. Using either re...

  6. Visualization of Two Phase Natural Convection Flow in a Vertical Pipe using the Sulfuric Acid - Copper Sulfate Electroplating System

    The passive containment cooling system (PCCS) driven by natural forces convection gain draws research interests after Fukushima NPP accident. The PCCS was classified into three categories: Containment pressure suppression, Containment passive heat removal/pressure suppression systems and Passive containment spray. Among the types of containment passive heat removal/pressure suppression systems, the system composed of an internal heat exchanger and an external coolant tank is considered. In a severe accident condition, the heat from the containment atmosphere is transferred to the outer surface of the heat exchanger by the convection and condensation of the mixture of steam and gases. On the other hand, the heat is transferred to external pool by single phase or two phase natural convection inside of heat exchanger pipes. The study aimed at investigating the influence of the diameter (D) and height (H) of the heat exchanger pipes on the single phase and two phase natural convection heat transfer. As the initial stage of the study, the two phase natural convection flow inside a vertical pipe is visualized. In order to achieve the aim with ample test rig, a sulfuric acid - cooper sulfate electroplating system was employed based on the analogy between heat and mass transfer. The reduction of hydrogen ion at the cathode surface at high potential was used to simulate the boiling phenomena. This study tried to visualize the boiling heat transfer inside a vertical pipe using a cupric acid-copper sulfate (H2SO4-CuSO4) electroplating system. This seems to be successful so far. However further study has to be done to compare the result with real two phase flow situation. The surface tension and surface characteristics are to be tuned to simulate the real situation

  7. The role of low-level magnification in visual inspection with acetic acid for the early detection of cervical neoplasia.

    Sankaranarayanan, Rengaswamy; Shastri, Surendra S; Basu, Parthasarathi; Mahé, Cédric; Mandal, Ranajit; Amin, Geethanjali; Roy, Chinmayi; Muwonge, Richard; Goswami, Smriti; Das, Pradip; Chinoy, Roshini; Frappart, Lucien; Patil, Sharmila; Choudhury, Devjani; Mukherjee, Titha; Dinshaw, Ketayun

    2004-01-01

    Several studies have investigated the accuracy of naked eye visual inspection with acetic acid (VIA) in the early detection of cervical neoplasia. It is not clear whether low-level (2-4x) magnification (VIAM) can improve the sensitivity and specificity of VIA. The accuracy of both VIA and VIAM, provided by independent health workers, were evaluated in three cross-sectional studies involving 18,675 women aged 25-65 years in Kolkata and Mumbai in India. All screened women were investigated with colposcopy and biopsies were obtained based on colposcopy findings. The final disease status was based on the reference standard of histology (if biopsies had been taken) or colposcopy. Data from the studies were pooled to calculate the test characteristics for the detection of high-grade squamous intraepithelial lesions (HSIL). 14.1% and 14.2% were positive on testing with VIA and VIAM respectively. Two hundred twenty-nine were diagnosed with HSIL and 68 with invasive cancer. The pooled sensitivity, specificity, positive and negative predictive values for VIA in detecting high-grade squamous intraepithelial lesions (HSIL) were 60.3% (95% CI: 53.6-66.7), 86.8% (95% CI: 86.3-87.3), 5.9% (95% CI: 5.0-7.0), and 99.4% (95% CI: 99.2-99.5), respectively. The values were 64.2% (95% CI: 57.6-70.4), 86.8% (95% CI: 86.2-87.3), 6.3% (95% CI: 5.3-7.3) and 99.4% (95% CI: 99.3-99.6), respectively, for VIAM. Low-level magnification did not improve the test performance of naked eye visualization of acetic acid impregnated uterine cervix. PMID:15542259

  8. Visualization of Two Phase Natural Convection Flow in a Vertical Pipe using the Sulfuric Acid - Copper Sulfate Electroplating System

    Ohk, Seung-Min; Chae, Myeong-Seon; Chung, Bum-Jin [Kyung Hee Univ., Yongin (Korea, Republic of)

    2014-10-15

    The passive containment cooling system (PCCS) driven by natural forces convection gain draws research interests after Fukushima NPP accident. The PCCS was classified into three categories: Containment pressure suppression, Containment passive heat removal/pressure suppression systems and Passive containment spray. Among the types of containment passive heat removal/pressure suppression systems, the system composed of an internal heat exchanger and an external coolant tank is considered. In a severe accident condition, the heat from the containment atmosphere is transferred to the outer surface of the heat exchanger by the convection and condensation of the mixture of steam and gases. On the other hand, the heat is transferred to external pool by single phase or two phase natural convection inside of heat exchanger pipes. The study aimed at investigating the influence of the diameter (D) and height (H) of the heat exchanger pipes on the single phase and two phase natural convection heat transfer. As the initial stage of the study, the two phase natural convection flow inside a vertical pipe is visualized. In order to achieve the aim with ample test rig, a sulfuric acid - cooper sulfate electroplating system was employed based on the analogy between heat and mass transfer. The reduction of hydrogen ion at the cathode surface at high potential was used to simulate the boiling phenomena. This study tried to visualize the boiling heat transfer inside a vertical pipe using a cupric acid-copper sulfate (H{sub 2}SO{sub 4}-CuSO{sub 4}) electroplating system. This seems to be successful so far. However further study has to be done to compare the result with real two phase flow situation. The surface tension and surface characteristics are to be tuned to simulate the real situation.

  9. Site-directed gene mutation at mixed sequence targets by psoralen-conjugated pseudo-complementary peptide nucleic acids.

    Kim, Ki-Hyun; Nielsen, Peter E; Glazer, Peter M

    2007-01-01

    Sequence-specific DNA-binding molecules such as triple helix-forming oligonucleotides (TFOs) provide a means for inducing site-specific mutagenesis and recombination at chromosomal sites in mammalian cells. However, the utility of TFOs is limited by the requirement for homopurine stretches in the target duplex DNA. Here, we report the use of pseudo-complementary peptide nucleic acids (pcPNAs) for intracellular gene targeting at mixed sequence sites. Due to steric hindrance, pcPNAs are unable to form pcPNA-pcPNA duplexes but can bind to complementary DNA sequences by Watson-Crick pairing via double duplex-invasion complex formation. We show that psoralen-conjugated pcPNAs can deliver site-specific photoadducts and mediate targeted gene modification within both episomal and chromosomal DNA in mammalian cells without detectable off-target effects. Most of the induced psoralen-pcPNA mutations were single-base substitutions and deletions at the predicted pcPNA-binding sites. The pcPNA-directed mutagenesis was found to be dependent on PNA concentration and UVA dose and required matched pairs of pcPNAs. Neither of the individual pcPNAs alone had any effect nor did complementary PNA pairs of the same sequence. These results identify pcPNAs as new tools for site-specific gene modification in mammalian cells without purine sequence restriction, thereby providing a general strategy for designing gene targeting molecules. PMID:17977869

  10. Purification and amino acid sequence of a bacteriocins produced by Lactobacillus salivarius K7 isolated from chicken intestine

    Kenji Sonomoto

    2006-03-01

    Full Text Available A bacteriocin-producing strain, Lactobacillus K7, was isolated from a chicken intestine. The inhibitory activity was determined by spot-on-lawn technique. Identification of the strain was performed by morphological, biochemical (API 50 CH kit and molecular genetic (16S rDNA basis. Bacteriocin purification processes were carried out by amberlite adsorption, cation exchange and reverse-phase high perform- ance liquid chromatography. N-terminal amino acid sequences were performed by Edman degradation. Molecular mass was determined by electrospray-ionization (ESI mass spectrometry (MS. Lactobacillus K7 showed inhibitory activity against Lactobacillus sakei subsp. sakei JCM 1157T, Leuconostoc mesenteroides subsp. mesenteroides JCM 6124T and Bacillus coagulans JCM 2257T. This strain was identified as Lb. salivarius. The antimicrobial substance was destroyed by proteolytic enzymes, indicating its proteinaceous structure designated as a bacteriocin type. The purification of bacteriocin by amberlite adsorption, cation exchange, and reverse-phase chromatography resulted in only one single active peak, which was designated FK22. Molecular weight of this fraction was 4331.70 Da. By amino acid sequence, this peptide was homology to Abp 118 beta produced by Lb. salivarius UCC118. In addition, Lb. salivarius UCC118 produced 2-peptide bacteriocin, which was Abp 118 alpha and beta. Based on the partial amino acid sequences of Abp 118 beta, specific primers were designed from nucleotide sequences according to data from GenBank. The result showed that the deduced peptide was high homology to 2-peptide bacteriocin, Abp 118 alpha and beta.