WorldWideScience

Sample records for acid sequence features

  1. Characterization of N-glycosylation and amino acid sequence features of immunoglobulins from swine.

    Lopez, Paul G; Girard, Lauren; Buist, Marjorie; de Oliveira, Andrey Giovanni Gomes; Bodnar, Edward; Salama, Apolline; Soulillou, Jean-Paul; Perreault, Hélène

    2016-02-01

    The primary goal of this study was to develop a method to study the N-glycosylation of IgG from swine in order to detect epitopes containing N-glycolylneuraminic acid (Neu5Gc) and/or terminal galactose residues linked in α1-3 susceptible to cause xenograft-related problems. Samples of immunoglobulin were isolated from porcine serum using protein-A affinity chromatography. The eluate was then separated on electrophoretic gel, and bands corresponding to the N-glycosylated heavy chains were cut off the gel and subjected to tryptic digestion. Peptides and glycopeptides were separated by reversed phase liquid chromatography and fractions were collected for matrix-assisted laser desorption/ionization time-of-flight mass spectrometric (MALDI-TOF-MS) analysis. Overall no α1-3 galactose was detected, as demonstrated by complete susceptibility of terminal galactose residues to β-galactosidase digestion. Neu5Gc was detected on singly sialylated structures. Two major N-glycopeptides were found, EEQFNSTYR and EAQFNSTYR as determined by tandem MS (MS/MS), as previously reported by Butler et al. (Immunogenetics, 61, 2009, 209-230), who found 11 subclasses for porcine IgG. Out of the 11, ten include the sequence corresponding to EEQFNSTYR, and only one codes for EAQFNSTYR. In this study, glycosylation patterns associated with both chains were slightly different, in that EEQFNSTYR had a higher content of galactose. The last step of this study consisted of peptide-mapping the 11 reported porcine IgG sequences. Although there was considerable overlap, at least one unique tryptic peptide was found per IgG sequence. The workflow presented in this manuscript constitutes the first study to use MALDI-TOF-MS in the investigation of porcine IgG structural features. PMID:26586247

  2. Classifying Genomic Sequences by Sequence Feature Analysis

    Zhi-Hua Liu; Dian Jiao; Xiao Sun

    2005-01-01

    Traditional sequence analysis depends on sequence alignment. In this study, we analyzed various functional regions of the human genome based on sequence features, including word frequency, dinucleotide relative abundance, and base-base correlation. We analyzed the human chromosome 22 and classified the upstream,exon, intron, downstream, and intergenic regions by principal component analysis and discriminant analysis of these features. The results show that we could classify the functional regions of genome based on sequence feature and discriminant analysis.

  3. Sequence and structural features of binding site residues in protein-protein complexes: comparison with protein-nucleic acid complexes

    Selvaraj S

    2011-10-01

    Full Text Available Abstract Background Protein-protein interactions are important for several cellular processes. Understanding the mechanism of protein-protein recognition and predicting the binding sites in protein-protein complexes are long standing goals in molecular and computational biology. Methods We have developed an energy based approach for identifying the binding site residues in protein–protein complexes. The binding site residues have been analyzed with sequence and structure based parameters such as binding propensity, neighboring residues in the vicinity of binding sites, conservation score and conformational switching. Results We observed that the binding propensities of amino acid residues are specific for protein-protein complexes. Further, typical dipeptides and tripeptides showed high preference for binding, which is unique to protein-protein complexes. Most of the binding site residues are highly conserved among homologous sequences. Our analysis showed that 7% of residues changed their conformations upon protein-protein complex formation and it is 9.2% and 6.6% in the binding and non-binding sites, respectively. Specifically, the residues Glu, Lys, Leu and Ser changed their conformation from coil to helix/strand and from helix to coil/strand. Leu, Ser, Thr and Val prefer to change their conformation from strand to coil/helix. Conclusions The results obtained in this study will be helpful for understanding and predicting the binding sites in protein-protein complexes.

  4. Sequence and structural features of binding site residues in protein-protein complexes: comparison with protein-nucleic acid complexes

    Selvaraj S; Jayaram B; Saranya N; Gromiha M; Fukui Kazuhiko

    2011-01-01

    Abstract Background Protein-protein interactions are important for several cellular processes. Understanding the mechanism of protein-protein recognition and predicting the binding sites in protein-protein complexes are long standing goals in molecular and computational biology. Methods We have developed an energy based approach for identifying the binding site residues in protein–protein complexes. The binding site residues have been analyzed with sequence and structure based parameters such...

  5. Structural features of lignohumic acids

    Novák, František; Šestauberová, Martina; Hrabal, Richard

    2015-08-01

    The composition and structure of humic acids isolated from lignohumate, which is produced by hydrolytic-oxidative conversion of technical lignosulfonates, were characterized by chemical and spectral methods (UV/VIS, FTIR, and 13C NMR spectroscopy). As comparative samples, humic acids (HA) were isolated also from lignite and organic horizon of mountain spruce forest soil. When compared with other HA studied, the lignohumate humic acids (LHHA) contained relatively few carboxyl groups, whose role is partly fulfilled by sulfonic acid groups. Distinctive 13C NMR signal of methoxyl group carbons, typical for lignin and related humic substances, was found at the shift of 55.9 ppm. Other alkoxy carbons were present in limited quantity, like the aliphatic carbons. Due to the low content of these carbon types, the LHHA has high aromaticity of 60.6%. Comparison with the natural HA has shown that lignohumate obtained by thermal processing of technical lignosulfonate can be regarded as an industrially produced analog of natural humic substances. Based on the chemical and spectral data evaluation, structural features of lignohumate humic acids were clarified and their hypothetical chemical structure proposed, which described typical "average" properties of the isolated fraction.

  6. Statistical and linguistic features of DNA sequences

    Havlin, S.; Buldyrev, S. V.; Goldberger, A. L.; Mantegna, R. N.; Peng, C. K.; Simons, M.; Stanley, H. E.

    1995-01-01

    We present evidence supporting the idea that the DNA sequence in genes containing noncoding regions is correlated, and that the correlation is remarkably long range--indeed, base pairs thousands of base pairs distant are correlated. We do not find such a long-range correlation in the coding regions of the gene. We resolve the problem of the "non-stationary" feature of the sequence of base pairs by applying a new algorithm called Detrended Fluctuation Analysis (DFA). We address the claim of Voss that there is no difference in the statistical properties of coding and noncoding regions of DNA by systematically applying the DFA algorithm, as well as standard FFT analysis, to all eukaryotic DNA sequences (33 301 coding and 29 453 noncoding) in the entire GenBank database. We describe a simple model to account for the presence of long-range power-law correlations which is based upon a generalization of the classic Levy walk. Finally, we describe briefly some recent work showing that the noncoding sequences have certain statistical features in common with natural languages. Specifically, we adapt to DNA the Zipf approach to analyzing linguistic texts, and the Shannon approach to quantifying the "redundancy" of a linguistic text in terms of a measurable entropy function. We suggest that noncoding regions in plants and invertebrates may display a smaller entropy and larger redundancy than coding regions, further supporting the possibility that noncoding regions of DNA may carry biological information.

  7. Identification of S-glutathionylation sites in species-specific proteins by incorporating five sequence-derived features into the general pseudo-amino acid composition.

    Zhao, Xiaowei; Ning, Qiao; Ai, Meiyue; Chai, Haiting; Yang, Guifu

    2016-06-01

    As a selective and reversible protein post-translational modification, S-glutathionylation generates mixed disulfides between glutathione (GSH) and cysteine residues, and plays an important role in regulating protein activity, stability, and redox regulation. To fully understand S-glutathionylation mechanisms, identification of substrates and specific S-Glutathionylated sites is crucial. Experimental identification of S-glutathionylated sites is labor-intensive and time consuming, so establishing an effective computational method is much desirable due to their convenient and fast speed. Therefore, in this study, a new bioinformatics tool named SSGlu (Species-Specific identification of Protein S-glutathionylation Sites) was developed to identify species-specific protein S-glutathionylated sites, utilizing support vector machines that combine multiple sequence-derived features with a two-step feature selection. By 5-fold cross validation, the performance of SSGlu was measured with an AUC of 0.8105 and 0.8041 for Homo sapiens and Mus musculus, respectively. Additionally, SSGlu was compared with the existing methods, and the higher MCC and AUC of SSGlu demonstrated that SSGlu was very promising to predict S-glutathionylated sites. Furthermore, a site-specific analysis showed that S-glutathionylation intimately correlated with the features derived from its surrounding sites. The conclusions derived from this study might help to understand more of the S-glutathionylation mechanism and guide the related experimental validation. For public access, SSGlu is freely accessible at http://59.73.198.144:8080/SSGlu/. PMID:27025952

  8. Coding visual features extracted from video sequences.

    Baroffio, Luca; Cesana, Matteo; Redondi, Alessandro; Tagliasacchi, Marco; Tubaro, Stefano

    2014-05-01

    Visual features are successfully exploited in several applications (e.g., visual search, object recognition and tracking, etc.) due to their ability to efficiently represent image content. Several visual analysis tasks require features to be transmitted over a bandwidth-limited network, thus calling for coding techniques to reduce the required bit budget, while attaining a target level of efficiency. In this paper, we propose, for the first time, a coding architecture designed for local features (e.g., SIFT, SURF) extracted from video sequences. To achieve high coding efficiency, we exploit both spatial and temporal redundancy by means of intraframe and interframe coding modes. In addition, we propose a coding mode decision based on rate-distortion optimization. The proposed coding scheme can be conveniently adopted to implement the analyze-then-compress (ATC) paradigm in the context of visual sensor networks. That is, sets of visual features are extracted from video frames, encoded at remote nodes, and finally transmitted to a central controller that performs visual analysis. This is in contrast to the traditional compress-then-analyze (CTA) paradigm, in which video sequences acquired at a node are compressed and then sent to a central unit for further processing. In this paper, we compare these coding paradigms using metrics that are routinely adopted to evaluate the suitability of visual features in the context of content-based retrieval, object recognition, and tracking. Experimental results demonstrate that, thanks to the significant coding gains achieved by the proposed coding scheme, ATC outperforms CTA with respect to all evaluation metrics. PMID:24818244

  9. Structural features of lignohumic acids

    Novák, František; Šestauberová, Martina; Hrabal, R.

    2015-01-01

    Roč. 1093, August (2015), s. 179-185. ISSN 0022-2860 Institutional support: RVO:60077344 Keywords : C-13 NMR * FTIR * humic acids * lignohumate * lignosulfonate * structure Subject RIV: DF - Soil Science Impact factor: 1.602, year: 2014

  10. Los Alamos sequence analysis package for nucleic acids and proteins.

    Kanehisa, M I

    1982-01-01

    An interactive system for computer analysis of nucleic acid and protein sequences has been developed for the Los Alamos DNA Sequence Database. It provides a convenient way to search or verify various sequence features, e.g., restriction enzyme sites, protein coding frames, and properties of coded proteins. Further, the comprehensive analysis package on a large-scale database can be used for comparative studies on sequence and structural homologies in order to find unnoted information stored i...

  11. Feature-based Image Sequence Compression Coding

    2001-01-01

    A novel compressing method for video teleconference applications is presented. Semantic-based coding based on human image feature is realized, where human features are adopted as parameters. Model-based coding and the concept of vector coding are combined with the work on image feature extraction to obtain the result.

  12. Chip-based sequencing nucleic acids

    Beer, Neil Reginald

    2014-08-26

    A system for fast DNA sequencing by amplification of genetic material within microreactors, denaturing, demulsifying, and then sequencing the material, while retaining it in a PCR/sequencing zone by a magnetic field. One embodiment includes sequencing nucleic acids on a microchip that includes a microchannel flow channel in the microchip. The nucleic acids are isolated and hybridized to magnetic nanoparticles or to magnetic polystyrene-coated beads. Microreactor droplets are formed in the microchannel flow channel. The microreactor droplets containing the nucleic acids and the magnetic nanoparticles are retained in a magnetic trap in the microchannel flow channel and sequenced.

  13. Feature-by-Feature – Evaluating De Novo Sequence Assembly

    Vezzi, Francesco; Narzisi, Giuseppe; Mishra, Bud

    2012-01-01

    The whole-genome sequence assembly (WGSA) problem is among one of the most studied problems in computational biology. Despite the availability of a plethora of tools (i.e., assemblers), all claiming to have solved the WGSA problem, little has been done to systematically compare their accuracy and power. Traditional methods rely on standard metrics and read simulation: while on the one hand, metrics like N50 and number of contigs focus only on size without proportionately emphasizing the infor...

  14. Stable 2D Feature Tracking for Long Video Sequences

    Jong-Seung Park

    2008-12-01

    Full Text Available In this paper, we propose a 2D feature tracking method that is stable to long video sequences. To improve the stability of long tracking, we use trajectory information about 2D features. We predict the expected feature states and compute a rough estimate of the feature location on the current image frame using the history of previous feature states up to the current frame. A search window is positioned at the estimated location and similarity measures are computed within the search window. Once the feature position is determined from the similarity measures, the current feature states are appended to the history bu®er. The outlier rejection stage is also introduced to reduce false matches. Experimental results from real video sequences showed that the proposed method stably tracks point features for long frame sequences.

  15. Unique sequence features of the Human Adenovirus 31 complete genomic sequence are conserved in clinical isolates

    Darr Sebastian

    2009-11-01

    Full Text Available Abstract Background Human adenoviruses (HAdV are causing a broad spectrum of diseases. One of the most severe forms of adenovirus infection is a disseminated disease resulting in significant morbidity and mortality. Several reports in recent years have identified HAdV-31 from species A (HAdV-A31 as a cause of disseminated disease in children following haematopoetic stem cell transplantation (hSCT and liver transplantation. We sequenced and analyzed the complete genome of the HAdV-A31 prototype strain to uncover unique sequence motifs associated with its high virulence. Moreover, we sequenced coding regions known to be essential for tropism and virulence (early transcription units E1A, E3, E4, the fiber knob and the penton base of HAdV-A31 clinical isolates from patients with disseminated disease. Results The genome size of HAdV-A31 is 33763 base pairs (bp in length with a GC content of 46.36%. Nucleotide alignment to the closely related HAdV-A12 revealed an overall homology of 84.2%. The genome organization into early, intermediate and late regions is similar to HAdV-A12. Sequence analysis of the prototype strain showed unique sequence features such as an immunoglobulin-like domain in the species A specific gene product E3 CR1 beta and a potentially integrin binding RGD motif in the C-terminal region of the protein IX. These features were conserved in all analyzed clinical isolates. Overall, amino acid sequences of clinical isolates were highly conserved compared to the prototype (99.2 to 100%, but a synonymous/non synonymous ratio (S/N of 2.36 in E3 CR1 beta suggested positive selection. Conclusion Unique sequence features of HAdV-A31 may enhance its ability to escape the host's immune surveillance and may facilitate a promiscuous tropism for various tissues. Moderate evolution of clinical isolates did not indicate the emergence of new HAdV-A31 subtypes in the recent years.

  16. Comparative Amino Acid Sequences of Dengue Viruses

    Haishi, Shozo; TANAKA Mariko; Igarashi, Akira

    1990-01-01

    Amino acid (AA) sequences of 4 serotype of dengue viruses deduced from their nucleotide (nt) sequences of genomic RNA were analyzed for each genome segment and each stretch of 10 AA residues. Precursor of membrane protein (pM), and 4 nonstructural proteins (NS1, NS3, NS4B, NS5) were highly conserved, while another nonstructural protein (NS2A) was least conserved among 5 strains of dengue viruses. When homology was compared among heterotypic viruses, type 1 and type 3 dengue viruses showed clo...

  17. Quantifying sequence and structural features of protein-RNA interactions.

    Li, Songling; Yamashita, Kazuo; Amada, Karlou Mar; Standley, Daron M

    2014-09-01

    Increasing awareness of the importance of protein-RNA interactions has motivated many approaches to predict residue-level RNA binding sites in proteins based on sequence or structural characteristics. Sequence-based predictors are usually high in sensitivity but low in specificity; conversely structure-based predictors tend to have high specificity, but lower sensitivity. Here we quantified the contribution of both sequence- and structure-based features as indicators of RNA-binding propensity using a machine-learning approach. In order to capture structural information for proteins without a known structure, we used homology modeling to extract the relevant structural features. Several novel and modified features enhanced the accuracy of residue-level RNA-binding propensity beyond what has been reported previously, including by meta-prediction servers. These features include: hidden Markov model-based evolutionary conservation, surface deformations based on the Laplacian norm formalism, and relative solvent accessibility partitioned into backbone and side chain contributions. We constructed a web server called aaRNA that implements the proposed method and demonstrate its use in identifying putative RNA binding sites. PMID:25063293

  18. Sequence features contributing to chromosomal rearrangements in Neisseria gonorrhoeae.

    Russell Spencer-Smith

    Full Text Available Through whole genome sequence alignments, breakpoints in chromosomal synteny can be identified and the sequence features associated with these determined. Alignments of the genome sequences of Neisseria gonorrhoeae strain FA1090, N.gonorrhoeae strain NCCP11945, and N. gonorrhoeae strain TCDC-NG08107 reveal chromosomal rearrangements that have occurred. Based on these alignments and dot plot pair-wise comparisons, the overall chromosomal arrangement of strain NCCP11945 and TCDC-NG08107 are very similar, with no large inversions or translocations. The insertion of the Gonococcal Genetic Island in strain NCCP11945 is the most prominent distinguishing feature differentiating these strains. When strain NCCP11945 is compared to strain FA1090, however, 14 breakpoints in chromosomal synteny are identified between these gonococcal strains. The majority of these, 11 of 14, are associated with a prophage, IS elements, or IS-like repeat enclosed elements which appear to have played a role in the rearrangements observed. Additional rearrangements of small regions of the genome are associated with pilin genes. Evidence presented here suggests that the rearrangements of blocks of sequence are mediated by activation of prophage and associated IS elements and reintegration elsewhere in the genome or by homologous recombination between IS-like elements that have generated inversions.

  19. 77 FR 65537 - Requirements for Patent Applications Containing Nucleotide Sequence and/or Amino Acid Sequence...

    2012-10-29

    ... Amino Acid Sequence Disclosures ACTION: Proposed collection; comment request. SUMMARY: The United States....'' SUPPLEMENTARY INFORMATION: I. Abstract Patent applications that contain nucleotide and/or amino acid...

  20. Detection of nucleic acid sequences by invader-directed cleavage

    Brow, Mary Ann D. (Madison, WI); Hall, Jeff Steven Grotelueschen (Madison, WI); Lyamichev, Victor (Madison, WI); Olive, David Michael (Madison, WI); Prudent, James Robert (Madison, WI)

    1999-01-01

    The present invention relates to means for the detection and characterization of nucleic acid sequences, as well as variations in nucleic acid sequences. The present invention also relates to methods for forming a nucleic acid cleavage structure on a target sequence and cleaving the nucleic acid cleavage structure in a site-specific manner. The 5' nuclease activity of a variety of enzymes is used to cleave the target-dependent cleavage structure, thereby indicating the presence of specific nucleic acid sequences or specific variations thereof. The present invention further relates to methods and devices for the separation of nucleic acid molecules based by charge.

  1. Detection of nucleic acid sequences by invader-directed cleavage

    Brow, Mary Ann D.; Hall, Jeff Steven Grotelueschen; Lyamichev, Victor; Olive, David Michael; Prudent, James Robert

    1999-01-01

    The present invention relates to means for the detection and characterization of nucleic acid sequences, as well as variations in nucleic acid sequences. The present invention also relates to methods for forming a nucleic acid cleavage structure on a target sequence and cleaving the nucleic acid cleavage structure in a site-specific manner. The 5' nuclease activity of a variety of enzymes is used to cleave the target-dependent cleavage structure, thereby indicating the presence of specific nucleic acid sequences or specific variations thereof. The present invention further relates to methods and devices for the separation of nucleic acid molecules based by charge.

  2. Sequence-derived structural features driving proteolytic processing.

    Belushkin, Alexander A; Vinogradov, Dmitry V; Gelfand, Mikhail S; Osterman, Andrei L; Cieplak, Piotr; Kazanov, Marat D

    2014-01-01

    Proteolytic signaling, or regulated proteolysis, is an essential part of many important pathways such as Notch, Wnt, and Hedgehog. How the structure of the cleaved substrate regions influences the efficacy of proteolytic processing remains underexplored. Here, we analyzed the relative importance in proteolysis of various structural features derived from substrate sequences using a dataset of more than 5000 experimentally verified proteolytic events captured in CutDB. Accessibility to the solvent was recognized as an essential property of a proteolytically processed polypeptide chain. Proteolytic events were found nearly uniformly distributed among three types of secondary structure, although with some enrichment in loops. Cleavages in α-helices were found to be relatively abundant in regions apparently prone to unfolding, while cleavages in β-structures tended to be located at the periphery of β-sheets. Application of the same statistical procedures to proteolytic events divided into separate sets according to the catalytic classes of proteases proved consistency of the results and confirmed that the structural mechanisms of proteolysis are universal. The estimated prediction power of sequence-derived structural features, which turned out to be sufficiently high, presents a rationale for their use in bioinformatic prediction of proteolytic events. PMID:24227478

  3. FeatureMap3D - a tool to map protein features and sequence conservation onto homologous structures in the PDB

    Wernersson, Rasmus; Rapacki, Krzysztof; Stærfeldt, Hans Henrik;

    2006-01-01

    FeatureMap3D is a web-based tool that maps protein features onto 3D structures. The user provides sequences annotated with any feature of interest, such as post-translational modifications, protease cleavage sites or exonic structure and FeatureMap3D will then search the Protein Data Bank (PDB) for...

  4. Automatic discovery of cross-family sequence features associated with protein function

    Krings Andrea

    2006-01-01

    Full Text Available Abstract Background Methods for predicting protein function directly from amino acid sequences are useful tools in the study of uncharacterised protein families and in comparative genomics. Until now, this problem has been approached using machine learning techniques that attempt to predict membership, or otherwise, to predefined functional categories or subcellular locations. A potential drawback of this approach is that the human-designated functional classes may not accurately reflect the underlying biology, and consequently important sequence-to-function relationships may be missed. Results We show that a self-supervised data mining approach is able to find relationships between sequence features and functional annotations. No preconceived ideas about functional categories are required, and the training data is simply a set of protein sequences and their UniProt/Swiss-Prot annotations. The main technical aspect of the approach is the co-evolution of amino acid-based regular expressions and keyword-based logical expressions with genetic programming. Our experiments on a strictly non-redundant set of eukaryotic proteins reveal that the strongest and most easily detected sequence-to-function relationships are concerned with targeting to various cellular compartments, which is an area already well studied both experimentally and computationally. Of more interest are a number of broad functional roles which can also be correlated with sequence features. These include inhibition, biosynthesis, transcription and defence against bacteria. Despite substantial overlaps between these functions and their corresponding cellular compartments, we find clear differences in the sequence motifs used to predict some of these functions. For example, the presence of polyglutamine repeats appears to be linked more strongly to the "transcription" function than to the general "nuclear" function/location. Conclusion We have developed a novel and useful approach for

  5. The sequence, structure and evolutionary features of HOTAIR in mammals

    Zhu Hao

    2011-04-01

    the full HOTAIR in mammals. Conclusions HOTAIR exists in mammals, has poorly conserved sequences and considerably conserved structures, and has evolved faster than nearby HoxC genes. Exons of HOTAIR show distinct evolutionary features, and a 239 bp domain in the 1804 bp exon6 is especially conserved. These features, together with the absence of some exons and sequences in mouse, rat and kangaroo, suggest ab initio generation of HOTAIR in marsupials. Structure prediction identifies two fragments in the 5' end exon1 and the 3' end domain B of exon6, with sequence and structure invariably occurring in various predicted structures of exon1, the domain B of exon6 and the full HOTAIR.

  6. Nucleic acid sequence detection using multiplexed oligonucleotide PCR

    Nolan, John P.; White, P. Scott

    2006-12-26

    Methods for rapidly detecting single or multiple sequence alleles in a sample nucleic acid are described. Provided are all of the oligonucleotide pairs capable of annealing specifically to a target allele and discriminating among possible sequences thereof, and ligating to each other to form an oligonucleotide complex when a particular sequence feature is present (or, alternatively, absent) in the sample nucleic acid. The design of each oligonucleotide pair permits the subsequent high-level PCR amplification of a specific amplicon when the oligonucleotide complex is formed, but not when the oligonucleotide complex is not formed. The presence or absence of the specific amplicon is used to detect the allele. Detection of the specific amplicon may be achieved using a variety of methods well known in the art, including without limitation, oligonucleotide capture onto DNA chips or microarrays, oligonucleotide capture onto beads or microspheres, electrophoresis, and mass spectrometry. Various labels and address-capture tags may be employed in the amplicon detection step of multiplexed assays, as further described herein.

  7. Intumescent features of nucleic acids and proteins

    Highlights: • The combustion resistance of DNA and caseins to different heat fluxes was studied. • Upon heating, DNA and caseins exhibited an intumescent behaviour. • The char derived from DNA was more stable and coherent than that from caseins. - Abstract: Are nucleic acids and proteins intumescent molecules? In order to get an answer, in the present manuscript, powders of deoxyribose nucleic acids (DNA) and caseins have been exposed to different heat fluxes under a cone calorimeter source and to the direct application of a propane flame. Under these conditions, DNA and caseins exhibited a typical intumescent behaviour, generating a coherent expanded cellular carbonaceous residue (char), extremely resistant to heat exposure. The resulting volumetric expansion as well as the resistance of the formed char turned out to be dependent on (i) the chemical structure of the chosen biomacromolecule, (ii) the evolution of ammonia and (iii) the adopted heat flux in cone calorimetry tests (namely, 25, 35, 50 and 75 kW/m2). The presence of ribose units within the DNA backbone determined the formation of highly expanded and coherent residues as compared to those obtained from caseins. Indeed, under a heat flux of 35 kW/m2, when a carbon source (i.e. common cane sugar) was added to caseins, the resulting char was similar to that formed by DNA. Furthermore, the char expansion was ascribed to the evolution of ammonia released by these biomacromolecules upon heating, as detected by thermogravimetry coupled to infrared spectroscopy, and confirmed by scanning electron microscopy experiments performed on the bubbles present in the residues of flammability tests

  8. Intumescent features of nucleic acids and proteins

    Alongi, Jenny, E-mail: jenny.alongi@polito.it; Cuttica, Fabio; Blasio, Alessandro Di; Carosio, Federico; Malucelli, Giulio

    2014-09-10

    Highlights: • The combustion resistance of DNA and caseins to different heat fluxes was studied. • Upon heating, DNA and caseins exhibited an intumescent behaviour. • The char derived from DNA was more stable and coherent than that from caseins. - Abstract: Are nucleic acids and proteins intumescent molecules? In order to get an answer, in the present manuscript, powders of deoxyribose nucleic acids (DNA) and caseins have been exposed to different heat fluxes under a cone calorimeter source and to the direct application of a propane flame. Under these conditions, DNA and caseins exhibited a typical intumescent behaviour, generating a coherent expanded cellular carbonaceous residue (char), extremely resistant to heat exposure. The resulting volumetric expansion as well as the resistance of the formed char turned out to be dependent on (i) the chemical structure of the chosen biomacromolecule, (ii) the evolution of ammonia and (iii) the adopted heat flux in cone calorimetry tests (namely, 25, 35, 50 and 75 kW/m{sup 2}). The presence of ribose units within the DNA backbone determined the formation of highly expanded and coherent residues as compared to those obtained from caseins. Indeed, under a heat flux of 35 kW/m{sup 2}, when a carbon source (i.e. common cane sugar) was added to caseins, the resulting char was similar to that formed by DNA. Furthermore, the char expansion was ascribed to the evolution of ammonia released by these biomacromolecules upon heating, as detected by thermogravimetry coupled to infrared spectroscopy, and confirmed by scanning electron microscopy experiments performed on the bubbles present in the residues of flammability tests.

  9. Sequence of MET protooncogene cDNA has features characteristic of the tyrosine kinase family of growth-factor receptors

    The authors isolated overlapping cDNA clones corresponding to the major MET protooncogene transcript. The cDNA nucleotide sequence contained an open reading frame of 1408 amino acids with features characteristic of the tyrosine kinase family of growth factor receptors. These features include a putative 24-amino acid signal peptide and a candidate, hybrophobic, membrane-spanning segment of 23 amino acids, which defines an extracellular domain of 926 amino acids that could serve as a ligand-binding domain. A putative intracellular domain 435 amino acids long shows high homology with the SRC family of tyrosine kinases and within the kinase domain is most homologous with the human insulin receptor (44%) and v-abl (41%). Despite these similarities, however, they found no apparent sequence homology to other growth factor receptors in the putative ligand-binding domain. They conclude from the results that the MET protooncogene is a cell-surface receptor for an as-yet-unknown ligand

  10. SSE: a nucleotide and amino acid sequence analysis platform

    Simmonds Peter

    2012-01-01

    Abstract Background There is an increasing need to develop bioinformatic tools to organise and analyse the rapidly growing amount of nucleotide and amino acid sequence data in organisms ranging from viruses to eukaryotes. Finding A simple sequence editor (SSE) was developed to create an integrated environment where sequences can be aligned, annotated, classified and directly analysed by a number of built-in bioinformatic programs. SSE incorporates a sequence editor for the creation of sequenc...

  11. Protein Coding Sequence Identification by Simultaneously Characterizing the Periodic and Random Features of DNA Sequences

    Gao Jianbo

    2005-01-01

    Full Text Available Most codon indices used today are based on highly biased nonrandom usage of codons in coding regions. The background of a coding or noncoding DNA sequence, however, is fairly random, and can be characterized as a random fractal. When a gene-finding algorithm incorporates multiple sources of information about coding regions, it becomes more successful. It is thus highly desirable to develop new and efficient codon indices by simultaneously characterizing the fractal and periodic features of a DNA sequence. In this paper, we describe a novel way of achieving this goal. The efficiency of the new codon index is evaluated by studying all of the 16 yeast chromosomes. In particular, we show that the method automatically and correctly identifies which of the three reading frames is the one that contains a gene.

  12. Feature Selection and the Class Imbalance Problem in Predicting Protein Function from Sequence

    Al-Shahib, A.; Breitling, R.; Gilbert, D.

    2005-01-01

    Abstract: When the standard approach to predict protein function by sequence homology fails, other alternative methods can be used that require only the amino acid sequence for predicting function. One such approach uses machine learning to predict protein function directly from amino acid sequence

  13. Incorporating distant sequence features and radial basis function networks to identify ubiquitin conjugation sites.

    Tzong-Yi Lee

    Full Text Available Ubiquitin (Ub is a small protein that consists of 76 amino acids about 8.5 kDa. In ubiquitin conjugation, the ubiquitin is majorly conjugated on the lysine residue of protein by Ub-ligating (E3 enzymes. Three major enzymes participate in ubiquitin conjugation. They are E1, E2 and E3 which are responsible for activating, conjugating and ligating ubiquitin, respectively. Ubiquitin conjugation in eukaryotes is an important mechanism of the proteasome-mediated degradation of a protein and regulating the activity of transcription factors. Motivated by the importance of ubiquitin conjugation in biological processes, this investigation develops a method, UbSite, which uses utilizes an efficient radial basis function (RBF network to identify protein ubiquitin conjugation (ubiquitylation sites. This work not only investigates the amino acid composition but also the structural characteristics, physicochemical properties, and evolutionary information of amino acids around ubiquitylation (Ub sites. With reference to the pathway of ubiquitin conjugation, the substrate sites for E3 recognition, which are distant from ubiquitylation sites, are investigated. The measurement of F-score in a large window size (-20∼+20 revealed a statistically significant amino acid composition and position-specific scoring matrix (evolutionary information, which are mainly located distant from Ub sites. The distant information can be used effectively to differentiate Ub sites from non-Ub sites. As determined by five-fold cross-validation, the model that was trained using the combination of amino acid composition and evolutionary information performs best in identifying ubiquitin conjugation sites. The prediction sensitivity, specificity, and accuracy are 65.5%, 74.8%, and 74.5%, respectively. Although the amino acid sequences around the ubiquitin conjugation sites do not contain conserved motifs, the cross-validation result indicates that the integration of distant sequence

  14. An improved classification of G-protein-coupled receptors using sequence-derived features

    Peng Zhen-Ling

    2010-08-01

    Full Text Available Abstract Background G-protein-coupled receptors (GPCRs play a key role in diverse physiological processes and are the targets of almost two-thirds of the marketed drugs. The 3 D structures of GPCRs are largely unavailable; however, a large number of GPCR primary sequences are known. To facilitate the identification and characterization of novel receptors, it is therefore very valuable to develop a computational method to accurately predict GPCRs from the protein primary sequences. Results We propose a new method called PCA-GPCR, to predict GPCRs using a comprehensive set of 1497 sequence-derived features. The principal component analysis is first employed to reduce the dimension of the feature space to 32. Then, the resulting 32-dimensional feature vectors are fed into a simple yet powerful classification algorithm, called intimate sorting, to predict GPCRs at five levels. The prediction at the first level determines whether a protein is a GPCR or a non-GPCR. If it is predicted to be a GPCR, then it will be further predicted into certain family, subfamily, sub-subfamily and subtype by the classifiers at the second, third, fourth, and fifth levels, respectively. To train the classifiers applied at five levels, a non-redundant dataset is carefully constructed, which contains 3178, 1589, 4772, 4924, and 2741 protein sequences at the respective levels. Jackknife tests on this training dataset show that the overall accuracies of PCA-GPCR at five levels (from the first to the fifth can achieve up to 99.5%, 88.8%, 80.47%, 80.3%, and 92.34%, respectively. We further perform predictions on a dataset of 1238 GPCRs at the second level, and on another two datasets of 167 and 566 GPCRs respectively at the fourth level. The overall prediction accuracies of our method are consistently higher than those of the existing methods to be compared. Conclusions The comprehensive set of 1497 features is believed to be capable of capturing information about amino acid

  15. Features of acid-saline systems of Southern Australia

    The discovery of layered, SO4-rich sediments on the Meridiani Planum on Mars has focused attention on understanding the formation of acid-saline lakes. Many salt lakes have formed in southern Australia where regional groundwaters are characterized by acidity and high salinity and show features that might be expected in the Meridiani sediments. Many (but not all) of the acid-saline Australian groundwaters are found where underlying Tertiary sediments are sulfide-rich. When waters from the formations come to the surface or interact with oxidised meteoric water, acid groundwaters result. In this paper examples of such waters around Lake Tyrrell, Victoria, and Lake Dey-Dey, South Australia, are reviewed. The acid-saline groundwaters typically have dissolved solids of 30-60 g/L and pH commonly 4 and MgSO4) or differential separation of elements with differing solubility (K, Na, Ti, Cr). Thus, it is considered unlikely that groundwaters or evaporative salt-lake systems, as found on earth, were involved. Instead, these features point to a water-poor system with local alteration and very little mobilization of elements

  16. MEANS AND METHODS FOR CLONING NUCLEIC ACID SEQUENCES

    Geertsma, Eric Robin; Poolman, Berend

    2008-01-01

    The invention provides means and methods for efficiently cloning nucleic acid sequences of interest in micro-organisms that are less amenable to conventional nucleic acid manipulations, as compared to, for instance, E.coli. The present invention enables high-throughput cloning (and, preferably, expr

  17. Sequence-based feature prediction and annotation of proteins

    Juncker, Agnieszka; Jensen, Lars J.; Pierleoni, Andrea; Bernsel, Andreas; Tress, Michael L.; Bork, Peer; Von Heijne, Gunnar; Valencia, Alfonso; A Ouzounis, Christos; Casadio, Rita; Brunak, Søren

    2009-01-01

    A recent trend in computational methods for annotation of protein function is that many prediction tools are combined in complex workflows and pipelines to facilitate the analysis of feature combinations, for example, the entire repertoire of kinase-binding motifs in the human proteome....

  18. Two distinct ferredoxins from Rhodobacter capsulatus: complete amino acid sequences and molecular evolution.

    Saeki, K; Suetsugu, Y; Yao, Y; Horio, T; Marrs, B L; Matsubara, H

    1990-09-01

    Two distinct ferredoxins were purified from Rhodobacter capsulatus SB1003. Their complete amino acid sequences were determined by a combination of protease digestion, BrCN cleavage and Edman degradation. Ferredoxins I and II were composed of 64 and 111 amino acids, respectively, with molecular weights of 6,728 and 12,549 excluding iron and sulfur atoms. Both contained two Cys clusters in their amino acid sequences. The first cluster of ferredoxin I and the second cluster of ferredoxin II had a sequence, CxxCxxCxxxCP, in common with the ferredoxins found in Clostridia. The second cluster of ferredoxin I had a sequence, CxxCxxxxxxxxCxxxCM, with extra amino acids between the second and third Cys, which has been reported for other photosynthetic bacterial ferredoxins and putative ferredoxins (nif-gene products) from nitrogen-fixing bacteria, and with a unique occurrence of Met. The first cluster of ferredoxin II had a CxxCxxxxCxxxCP sequence, with two additional amino acids between the second and third Cys, a characteristics feature of Azotobacter-[3Fe-4S] [4Fe-4S]-ferredoxin. Ferredoxin II was also similar to Azotobacter-type ferredoxins with an extended carboxyl (C-) terminal sequence compared to the common Clostridium-type. The evolutionary relationship of the two together with a putative one recently found to be encoded in nifENXQ region in this bacterium [Moreno-Vivian et al. (1989) J. Bacteriol. 171, 2591-2598] is discussed. PMID:2277040

  19. Whole Genome Mapping with Feature Sets from High-Throughput Sequencing Data.

    Pan, Yonglong; Wang, Xiaoming; Liu, Lin; Wang, Hao; Luo, Meizhong

    2016-01-01

    A good physical map is essential to guide sequence assembly in de novo whole genome sequencing, especially when sequences are produced by high-throughput sequencing such as next-generation-sequencing (NGS) technology. We here present a novel method, Feature sets-based Genome Mapping (FGM). With FGM, physical map and draft whole genome sequences can be generated, anchored and integrated using the same data set of NGS sequences, independent of restriction digestion. Method model was created and parameters were inspected by simulations using the Arabidopsis genome sequence. In the simulations, when ~4.8X genome BAC library including 4,096 clones was used to sequence the whole genome, ~90% of clones were successfully connected to physical contigs, and 91.58% of genome sequences were mapped and connected to chromosomes. This method was experimentally verified using the existing physical map and genome sequence of rice. Of 4,064 clones covering 115 Mb sequence selected from ~3 tiles of 3 chromosomes of a rice draft physical map, 3,364 clones were reconstructed into physical contigs and 98 Mb sequences were integrated into the 3 chromosomes. The physical map-integrated draft genome sequences can provide permanent frameworks for eventually obtaining high-quality reference sequences by targeted sequencing, gap filling and combining other sequences. PMID:27611682

  20. An Integrated Sequence-Structure Database incorporating matching mRNA sequence, amino acid sequence and protein three-dimensional structure data.

    Adzhubei, I A; Adzhubei, A. A.; Neidle, S.

    1998-01-01

    We have constructed a non-homologous database, termed the Integrated Sequence-Structure Database (ISSD) which comprises the coding sequences of genes, amino acid sequences of the corresponding proteins, their secondary structure and straight phi,psi angles assignments, and polypeptide backbone coordinates. Each protein entry in the database holds the alignment of nucleotide sequence, amino acid sequence and the PDB three-dimensional structure data. The nucleotide and amino acid sequences for ...

  1. Amino acid sequences of proteins from Leptospira serovar pomona

    Alves Selmo F

    2000-01-01

    Full Text Available This report describes a partial amino acid sequences from three putative outer envelope proteins from Leptospira serovar pomona. In order to obtain internal fragments for protein sequencing, enzymatic and chemical digestion was performed. The enzyme clostripain was used to digest the proteins 32 and 45 kDa. In situ digestion of 40 kDa molecular weight protein was accomplished using cyanogen bromide. The 32 kDa protein generated two fragments, one of 21 kDa and another of 10 kDa that yielded five residues. A fragment of 24 kDa that yielded nineteen residues of amino acids was obtained from 45 kDa protein. A fragment with a molecular weight of 20 kDa, yielding a twenty amino acids sequence from the 40 kDa protein.

  2. Representation of protein-sequence information by amino acid subalphabets

    Andersen, C.A.F.; Brunak, Søren

    2004-01-01

    -sequence information, using machine learning strategies, where the primary goal is the discovery of novel powerful representations for use in AI techniques. In the case of proteins and the 20 different amino acids they typically contain, it is also a secondary goal to discover how the current selection of amino acids......-which now are common in proteins-might have emerged from simpler selections, or alphabets, in use earlier during the evolution of living organisms....

  3. On Quantum Algorithm for Multiple Alignment of Amino Acid Sequences

    Iriyama, Satoshi; Ohya, Masanori

    2009-02-01

    The alignment of genome sequences or amino acid sequences is one of fundamental operations for the study of life. Usual computational complexity for the multiple alignment of N sequences with common length L by dynamic programming is O(LN). This alignment is considered as one of the NP problems, so that it is desirable to find a nice algorithm of the multiple alignment. Thus in this paper we propose the quantum algorithm for the multiple alignment based on the works12,1,2 in which the NP complete problem was shown to be the P problem by means of quantum algorithm and chaos information dynamics.

  4. The amino-acid sequence of kangaroo pancreatic ribonuclease.

    Gaastra, W; Welling, G W; Beintema, J J

    1978-05-01

    Red kangaroo (Macropus rufus) ribonuclease was isolated from pancreatic tissue by affinity chromatography. The amino acid sequence was determined by automatic sequencing of overlapping large fragments and by analysis of shorter peptides obtained by digestion with a number of proteolytic enzymes. The polypeptide chain consists of 122 amino acid residues. Compared to other ribonucleases, the N-terminal residue and residue 114 are deleted. In other pancreatic ribonucleases position 114 is occupied by a cis proline residue in an external loop at the surface of the molecule. Other remarkable substitutions are the presence of a tyrosine residue at position 123 instead of a serine which forms a hydrogen bond with the pyrimidine ring of a nucleotide substrate, and a number of hydrophobichydrophilic interchanges in the sequence 51-55, which forms part of an alpha-helix in bovine ribonuclease and exhibits few substitutions in the placental mammals. Kangaroo ribonuclease contains no carbohydrate, although the enzyme possesses a recognition site for carbohydrate attachment in the sequence Asn-Val-Thr (62-64). The enzyme differs at about 35-40% of the positions from all other mammalian pancreatic ribonucleases sequenced to date, which is in agreement with the early divergence between the marsupials and the placental mammals. From fragmentary data a tentative sequence of red-necked wallaby (Macropus rufogriseus) pancreatic ribonuclease has been derived. Eight differences with the kangaroo sequence were found. PMID:658039

  5. Prediction of protein modification sites of pyrrolidone carboxylic acid using mRMR feature selection and analysis.

    Lu-Lu Zheng

    Full Text Available Pyrrolidone carboxylic acid (PCA is formed during a common post-translational modification (PTM of extracellular and multi-pass membrane proteins. In this study, we developed a new predictor to predict the modification sites of PCA based on maximum relevance minimum redundancy (mRMR and incremental feature selection (IFS. We incorporated 727 features that belonged to 7 kinds of protein properties to predict the modification sites, including sequence conservation, residual disorder, amino acid factor, secondary structure and solvent accessibility, gain/loss of amino acid during evolution, propensity of amino acid to be conserved at protein-protein interface and protein surface, and deviation of side chain carbon atom number. Among these 727 features, 244 features were selected by mRMR and IFS as the optimized features for the prediction, with which the prediction model achieved a maximum of MCC of 0.7812. Feature analysis showed that all feature types contributed to the modification process. Further site-specific feature analysis showed that the features derived from PCA's surrounding sites contributed more to the determination of PCA sites than other sites. The detailed feature analysis in this paper might provide important clues for understanding the mechanism of the PCA formation and guide relevant experimental validations.

  6. Anti-peptide aptamers recognize amino acid sequence and bind a protein epitope.

    Xu, W; Ellington, A. D.

    1996-01-01

    In vitro selection of nucleic acid binding species (aptamers) is superficially similar to the immune response. Both processes produce biopolymers that can recognize targets with high affinity and specificity. While antibodies are known to recognize the sequence and conformation of protein surface features (epitopes), very little is known about the precise interactions between aptamers and their epitopes. Therefore, aptamers that could recognize a particular epitope, a peptide fragment of huma...

  7. Effective automated feature construction and selection for classification of biological sequences.

    Uday Kamath

    Full Text Available Many open problems in bioinformatics involve elucidating underlying functional signals in biological sequences. DNA sequences, in particular, are characterized by rich architectures in which functional signals are increasingly found to combine local and distal interactions at the nucleotide level. Problems of interest include detection of regulatory regions, splice sites, exons, hypersensitive sites, and more. These problems naturally lend themselves to formulation as classification problems in machine learning. When classification is based on features extracted from the sequences under investigation, success is critically dependent on the chosen set of features.We present an algorithmic framework (EFFECT for automated detection of functional signals in biological sequences. We focus here on classification problems involving DNA sequences which state-of-the-art work in machine learning shows to be challenging and involve complex combinations of local and distal features. EFFECT uses a two-stage process to first construct a set of candidate sequence-based features and then select a most effective subset for the classification task at hand. Both stages make heavy use of evolutionary algorithms to efficiently guide the search towards informative features capable of discriminating between sequences that contain a particular functional signal and those that do not.To demonstrate its generality, EFFECT is applied to three separate problems of importance in DNA research: the recognition of hypersensitive sites, splice sites, and ALU sites. Comparisons with state-of-the-art algorithms show that the framework is both general and powerful. In addition, a detailed analysis of the constructed features shows that they contain valuable biological information about DNA architecture, allowing biologists and other researchers to directly inspect the features and potentially use the insights obtained to assist wet-laboratory studies on retainment or modification

  8. Feature-Based Classification of Amino Acid Substitutions outside Conserved Functional Protein Domains

    Branislava Gemovic

    2013-01-01

    Full Text Available There are more than 500 amino acid substitutions in each human genome, and bioinformatics tools irreplaceably contribute to determination of their functional effects. We have developed feature-based algorithm for the detection of mutations outside conserved functional domains (CFDs and compared its classification efficacy with the most commonly used phylogeny-based tools, PolyPhen-2 and SIFT. The new algorithm is based on the informational spectrum method (ISM, a feature-based technique, and statistical analysis. Our dataset contained neutral polymorphisms and mutations associated with myeloid malignancies from epigenetic regulators ASXL1, DNMT3A, EZH2, and TET2. PolyPhen-2 and SIFT had significantly lower accuracies in predicting the effects of amino acid substitutions outside CFDs than expected, with especially low sensitivity. On the other hand, only ISM algorithm showed statistically significant classification of these sequences. It outperformed PolyPhen-2 and SIFT by 15% and 13%, respectively. These results suggest that feature-based methods, like ISM, are more suitable for the classification of amino acid substitutions outside CFDs than phylogeny-based tools.

  9. ANTICALIgN: visualizing, editing and analyzing combined nucleotide and amino acid sequence alignments for combinatorial protein engineering.

    Jarasch, Alexander; Kopp, Melanie; Eggenstein, Evelyn; Richter, Antonia; Gebauer, Michaela; Skerra, Arne

    2016-07-01

    ANTIC ALIGN: is an interactive software developed to simultaneously visualize, analyze and modify alignments of DNA and/or protein sequences that arise during combinatorial protein engineering, design and selection. ANTIC ALIGN: combines powerful functions known from currently available sequence analysis tools with unique features for protein engineering, in particular the possibility to display and manipulate nucleotide sequences and their translated amino acid sequences at the same time. ANTIC ALIGN: offers both template-based multiple sequence alignment (MSA), using the unmutated protein as reference, and conventional global alignment, to compare sequences that share an evolutionary relationship. The application of similarity-based clustering algorithms facilitates the identification of duplicates or of conserved sequence features among a set of selected clones. Imported nucleotide sequences from DNA sequence analysis are automatically translated into the corresponding amino acid sequences and displayed, offering numerous options for selecting reading frames, highlighting of sequence features and graphical layout of the MSA. The MSA complexity can be reduced by hiding the conserved nucleotide and/or amino acid residues, thus putting emphasis on the relevant mutated positions. ANTIC ALIGN: is also able to handle suppressed stop codons or even to incorporate non-natural amino acids into a coding sequence. We demonstrate crucial functions of ANTIC ALIGN: in an example of Anticalins selected from a lipocalin random library against the fibronectin extradomain B (ED-B), an established marker of tumor vasculature. Apart from engineered protein scaffolds, ANTIC ALIGN: provides a powerful tool in the area of antibody engineering and for directed enzyme evolution. PMID:27261456

  10. SeqVISTA: a graphical tool for sequence feature visualization and comparison

    Niu Tianhua

    2003-01-01

    Full Text Available Abstract Background Many readers will sympathize with the following story. You are viewing a gene sequence in Entrez, and you want to find whether it contains a particular sequence motif. You reach for the browser's "find in page" button, but those darn spaces every 10 bp get in the way. And what if the motif is on the opposite strand? Subsequently, your favorite sequence analysis software informs you that there is an interesting feature at position 13982–14013. By painstakingly counting the 10 bp blocks, you are able to examine the sequence at this location. But now you want to see what other features have been annotated close by, and this information is buried several screenfuls higher up the web page. Results SeqVISTA presents a holistic, graphical view of features annotated on nucleotide or protein sequences. This interactive tool highlights the residues in the sequence that correspond to features chosen by the user, and allows easy searching for sequence motifs or extraction of particular subsequences. SeqVISTA is able to display results from diverse sequence analysis tools in an integrated fashion, and aims to provide much-needed unity to the bioinformatics resources scattered around the Internet. Our viewer may be launched on a GenBank record by a single click of a button installed in the web browser. Conclusion SeqVISTA allows insights to be gained by viewing the totality of sequence annotations and predictions, which may be more revealing than the sum of their parts. SeqVISTA runs on any operating system with a Java 1.4 virtual machine. It is freely available to academic users at http://zlab.bu.edu/SeqVISTA.

  11. Analysis on n-gram statistics and linguistic features of whole genome protein sequences

    DONG Qi-wen; WANG Xiao-long; LIN Lei

    2008-01-01

    To obtain the statistical sequence analysis on a large number of genomic and proteomie sequences available for different organisms,the n-grams of whole genome protein sequences from 20 organisms were extracted.Their linguistic features were analyzed by two tests:Zipf power law and Shannon entropy,developed for analysis of natural languages and symbolic sequences.The natural genome proteins and the artificial genome proteins were compared with each other and some statistical features of n-grams were discovered.The results show that:the n-grams of whole genome protein sequences approximately follow the Zipf law when n is larger than 4;the Shannon n-gram entropy of natural genome proteins is lower than that of artificial proteins;a simple unigram model can distinguish different organisms;there exist organism-specific usages of "phrases" in protein sequences.It is suggested that further detailed analysis on n-gram of whole genome protein sequences will result in a powerful model for mapping the relationship of protein sequence,structure and function.

  12. Deoxyribonucleic acid sequence mapping on metaphase chromosomes by immunoelectron microscopy

    Nucleic acid sequences can be localized on chromosomes in the electron microscope after hybridization with a biotinylated DNA probe followed by detection with a primary antibiotin antibody and a secondary antibody coupled to colloidal gold. Hybridization probes can also be labelled with alternative ligands such as N-acetoxy-2-acetylaminofluorene (AAF), Dinitrophenyl-dUTP and Digoxigenin-dUTP. Multiple labelling is possible if these differently modified DNA probes are used in conjunction with colloidal gold preparations of varying particle sizes. A substantial signal amplification can be achieved by incubating preparations with successive cycles of primary antibiotin antibody followed by a biotinylated secondary antibody. Detection is with Streptavidin-gold, and in the case of highly and moderately repeated sequences, the signal is visible in the light microscope. Detailed protocols are given for EM in-situ hybridization to whole mount metaphase chromosomes and include instructions necessary to perform multiple sequence localization and signal amplification

  13. What are the basic modules of implicit sequence learning? A feature-based account

    Eberhardt, Katharina

    2015-01-01

    According to the Theory of Event Coding (TEC; Hommel et al., 2001), action and perception are represented in a shared format in the cognitive system by means of feature codes. In implicit sequence learning research, it is still common to make a conceptual difference between independent motor and perceptual sequences. This supposedly independent learning takes place in encapsulated modules (Keele et al., 2003) which process information along single dimensions. These dimensions have remained un...

  14. An Improved Management Model for Tracking Missing Features in Computer Vision Long Image Sequences

    Pinho, Raquel R.; João Manuel R. S. Tavares; Correia, Miguel V.

    2006-01-01

    In this paper we present a management model to deal with the problem of tracking missing features during long image sequences using Computational Vision. Some usual difficulties related with missing features are that they may be temporarily occluded or might even have disappeared definitively, and the computational cost involved should always be reduced to the strictly necessary. The proposed Net Present Value (NPV) model, based on the economic Theory of Capital, considers the tracking of eac...

  15. Auto-pooling: Learning to Improve Invariance of Image Features from Image Sequences

    Sukhbaatar, Sainbayar; Makino, Takaki; Aihara, Kazuyuki

    2013-01-01

    Learning invariant representations from images is one of the hardest challenges facing computer vision. Spatial pooling is widely used to create invariance to spatial shifting, but it is restricted to convolutional models. In this paper, we propose a novel pooling method that can learn soft clustering of features from image sequences. It is trained to improve the temporal coherence of features, while keeping the information loss at minimum. Our method does not use spatial information, so it c...

  16. Quantum-Sequencing: Biophysics of quantum tunneling through nucleic acids

    Casamada Ribot, Josep; Chatterjee, Anushree; Nagpal, Prashant

    2014-03-01

    Tunneling microscopy and spectroscopy has extensively been used in physical surface sciences to study quantum tunneling to measure electronic local density of states of nanomaterials and to characterize adsorbed species. Quantum-Sequencing (Q-Seq) is a new method based on tunneling microscopy for electronic sequencing of single molecule of nucleic acids. A major goal of third-generation sequencing technologies is to develop a fast, reliable, enzyme-free single-molecule sequencing method. Here, we present the unique ``electronic fingerprints'' for all nucleotides on DNA and RNA using Q-Seq along their intrinsic biophysical parameters. We have analyzed tunneling spectra for the nucleotides at different pH conditions and analyzed the HOMO, LUMO and energy gap for all of them. In addition we show a number of biophysical parameters to further characterize all nucleobases (electron and hole transition voltage and energy barriers). These results highlight the robustness of Q-Seq as a technique for next-generation sequencing.

  17. Nucleotide sequence and corresponding amino acid sequence of the gene for the major antigen of foot and mouth disease virus.

    Kurz, C; Forss, S; Küpper, H; K Strohmaier; Schaller, H

    1981-01-01

    A segment of 1160 nucleotides of the FMDV genome has been sequenced using three overlapping fragments of cloned cDNA from FMDV strain O1K. This sequence contains the coding sequence for the viral capsid protein VP1 as shown by its homology to known and newly determined amino acid sequences from this man antigenic polypeptide of the FMDV virion. The structural gene for VP1 comprises 639 nucleotides which specify a sequence of 213 amino acids for the VP1 protein. The coding sequence is not flan...

  18. Correlation between fibroin amino acid sequence and physical silk properties.

    Fedic, Robert; Zurovec, Michal; Sehnal, Frantisek

    2003-09-12

    The fiber properties of lepidopteran silk depend on the amino acid repeats that interact during H-fibroin polymerization. The aim of our research was to relate repeat composition to insect biology and fiber strength. Representative regions of the H-fibroin genes were sequenced and analyzed in three pyralid species: wax moth (Galleria mellonella), European flour moth (Ephestia kuehniella), and Indian meal moth (Plodia interpunctella). The amino acid repeats are species-specific, evidently a diversification of an ancestral region of 43 residues, and include three types of regularly dispersed motifs: modifications of GSSAASAA sequence, stretches of tripeptides GXZ where X and Z represent bulky residues, and sequences similar to PVIVIEE. No concatenations of GX dipeptide or alanine, which are typical for Bombyx silkworms and Antheraea silk moths, respectively, were found. Despite different repeat structure, the silks of G. mellonella and E. kuehniella exhibit similar tensile strength as the Bombyx and Antheraea silks. We suggest that in these latter two species, variations in the repeat length obstruct repeat alignment, but sufficiently long stretches of iterated residues get superposed to interact. In the pyralid H-fibroins, interactions of the widely separated and diverse motifs depend on the precision of repeat matching; silk is strong in G. mellonella and E. kuehniella, with 2-3 types of long homogeneous repeats, and nearly 10 times weaker in P. interpunctella, with seven types of shorter erratic repeats. The high proportion of large amino acids in the H-fibroin of pyralids has probably evolved in connection with the spinning habit of caterpillars that live in protective silk tubes and spin continuously, enlarging the tubes on one end and partly devouring the other one. The silk serves as a depot of energetically rich and essential amino acids that may be scarce in the diet. PMID:12816957

  19. Chicken TAP genes differ from their human orthologues in locus organisation, size, sequence features and polymorphism.

    Walker, Brian A; van Hateren, Andrew; Milne, Sarah; Beck, Stephan; Kaufman, Jim

    2005-05-01

    We have previously shown that in the chicken major histocompatibility complex, the two transporters associated with antigen processing genes (TAP1 and TAP2) are located head to head between two classical class I genes. Here we show that the region between these two TAP genes has transcription factor-binding sites in common with class I gene promoters. The TAP genes are also up-regulated by interferon-gamma in a similar way to mammalian TAP genes and in a way that suggests they are both transcribed from a bi-directional promoter. The gene structures of TAP1 and TAP2 differ from that of human TAPs in that TAP1 has a truncated exon 1 and TAP2 has fused exons, resulting in a much smaller gene size. The truncation of TAP1 results in the loss of approximately 150 amino acids, which are thought to be involved in endoplasmic reticulum retention, heterodimer formation and tapasin binding, compared to human TAP1. Most of the protein sequence features involved in binding ATP are conserved, with two exceptions: chicken TAP1 has a glycine in the switch region where other TAPs have glutamine or histidine, and both chicken TAP genes have serines in the C motif where mammalian TAP2 has an alanine. Lastly, the chicken TAP genes are highly polymorphic, with at least as many TAP alleles as there are class I alleles, as seen by investigating nine inbred lines of chicken. The close proximity of the TAP genes to the class I genes and the high level of polymorphism may allow co-evolution of the genes, allowing TAP molecules to transport peptides specifically for the class I molecules of that haplotype. PMID:15900495

  20. Loop-sequence features and stability determinants in antibody variable domains by high-throughput experiments.

    Chang, Hung-Ju; Jian, Jhih-Wei; Hsu, Hung-Ju; Lee, Yu-Ching; Chen, Hong-Sen; You, Jhong-Jhe; Hou, Shin-Chen; Shao, Chih-Yun; Chen, Yen-Ju; Chiu, Kuo-Ping; Peng, Hung-Pin; Lee, Kuo Hao; Yang, An-Suei

    2014-01-01

    Protein loops are frequently considered as critical determinants in protein structure and function. Recent advances in high-throughput methods for DNA sequencing and thermal stability measurement have enabled effective exploration of sequence-structure-function relationships in local protein regions. Using these data-intensive technologies, we investigated the sequence-structure-function relationships of six complementarity-determining regions (CDRs) and ten non-CDR loops in the variable domains of a model vascular endothelial growth factor (VEGF)-binding single-chain antibody variable fragment (scFv) whose sequence had been optimized via a consensus-sequence approach. The results show that only a handful of residues involving long-range tertiary interactions distant from the antigen-binding site are strongly coupled with antigen binding. This implies that the loops are passive regions in protein folding; the essential sequences of these regions are dictated by conserved tertiary interactions and the consensus local loop-sequence features contribute little to protein stability and function. PMID:24268648

  1. Prediction of flexible/rigid regions from protein sequences using k-spaced amino acid pairs

    Ruan Jishou

    2007-04-01

    Full Text Available Abstract Background Traditionally, it is believed that the native structure of a protein corresponds to a global minimum of its free energy. However, with the growing number of known tertiary (3D protein structures, researchers have discovered that some proteins can alter their structures in response to a change in their surroundings or with the help of other proteins or ligands. Such structural shifts play a crucial role with respect to the protein function. To this end, we propose a machine learning method for the prediction of the flexible/rigid regions of proteins (referred to as FlexRP; the method is based on a novel sequence representation and feature selection. Knowledge of the flexible/rigid regions may provide insights into the protein folding process and the 3D structure prediction. Results The flexible/rigid regions were defined based on a dataset, which includes protein sequences that have multiple experimental structures, and which was previously used to study the structural conservation of proteins. Sequences drawn from this dataset were represented based on feature sets that were proposed in prior research, such as PSI-BLAST profiles, composition vector and binary sequence encoding, and a newly proposed representation based on frequencies of k-spaced amino acid pairs. These representations were processed by feature selection to reduce the dimensionality. Several machine learning methods for the prediction of flexible/rigid regions and two recently proposed methods for the prediction of conformational changes and unstructured regions were compared with the proposed method. The FlexRP method, which applies Logistic Regression and collocation-based representation with 95 features, obtained 79.5% accuracy. The two runner-up methods, which apply the same sequence representation and Support Vector Machines (SVM and Naïve Bayes classifiers, obtained 79.2% and 78.4% accuracy, respectively. The remaining considered methods are

  2. Amino acid sequences used for clusterintg (Multi FASTA format) - Gclust Server | LSDB Archive [Life Science Database Archive metadata

    Full Text Available Gclust Server Amino acid sequences used for clusterintg (Multi FASTA format) Data detail Data name Amino acid sequences use... Site Policy | Contact Us Amino acid sequences used for clusterintg (Multi FASTA format) - Gclust Server | LSDB Archive ...

  3. Face Recognition from Still Images to Video Sequences: A Local-Feature-Based Framework

    Chen Shaokang

    2011-01-01

    Full Text Available Although automatic faces recognition has shown success for high-quality images under controlled conditions, for video-based recognition it is hard to attain similar levels of performance. We describe in this paper recent advances in a project being undertaken to trial and develop advanced surveillance systems for public safety. In this paper, we propose a local facial feature based framework for both still image and video-based face recognition. The evaluation is performed on a still image dataset LFW and a video sequence dataset MOBIO to compare 4 methods for operation on feature: feature averaging (Avg-Feature, Mutual Subspace Method (MSM, Manifold to Manifold Distance (MMS, and Affine Hull Method (AHM, and 4 methods for operation on distance on 3 different features. The experimental results show that Multi-region Histogram (MRH feature is more discriminative for face recognition compared to Local Binary Patterns (LBP and raw pixel intensity. Under the limitation on a small number of images available per person, feature averaging is more reliable than MSM, MMD, and AHM and is much faster. Thus, our proposed framework—averaging MRH feature is more suitable for CCTV surveillance systems with constraints on the number of images and the speed of processing.

  4. SoftSearch: integration of multiple sequence features to identify breakpoints of structural variations.

    Steven N Hart

    Full Text Available BACKGROUND: Structural variation (SV represents a significant, yet poorly understood contribution to an individual's genetic makeup. Advanced next-generation sequencing technologies are widely used to discover such variations, but there is no single detection tool that is considered a community standard. In an attempt to fulfil this need, we developed an algorithm, SoftSearch, for discovering structural variant breakpoints in Illumina paired-end next-generation sequencing data. SoftSearch combines multiple strategies for detecting SV including split-read, discordant read-pair, and unmated pairs. Co-localized split-reads and discordant read pairs are used to refine the breakpoints. RESULTS: We developed and validated SoftSearch using real and synthetic datasets. SoftSearch's key features are 1 not requiring secondary (or exhaustive primary alignment, 2 portability into established sequencing workflows, and 3 is applicable to any DNA-sequencing experiment (e.g. whole genome, exome, custom capture, etc.. SoftSearch identifies breakpoints from a small number of soft-clipped bases from split reads and a few discordant read-pairs which on their own would not be sufficient to make an SV call. CONCLUSIONS: We show that SoftSearch can identify more true SVs by combining multiple sequence features. SoftSearch was able to call clinically relevant SVs in the BRCA2 gene not reported by other tools while offering significantly improved overall performance.

  5. Rigorous assessment and integration of the sequence and structure based features to predict hot spots

    Wang Yong

    2011-07-01

    Full Text Available Abstract Background Systematic mutagenesis studies have shown that only a few interface residues termed hot spots contribute significantly to the binding free energy of protein-protein interactions. Therefore, hot spots prediction becomes increasingly important for well understanding the essence of proteins interactions and helping narrow down the search space for drug design. Currently many computational methods have been developed by proposing different features. However comparative assessment of these features and furthermore effective and accurate methods are still in pressing need. Results In this study, we first comprehensively collect the features to discriminate hot spots and non-hot spots and analyze their distributions. We find that hot spots have lower relASA and larger relative change in ASA, suggesting hot spots tend to be protected from bulk solvent. In addition, hot spots have more contacts including hydrogen bonds, salt bridges, and atomic contacts, which favor complexes formation. Interestingly, we find that conservation score and sequence entropy are not significantly different between hot spots and non-hot spots in Ab+ dataset (all complexes. While in Ab- dataset (antigen-antibody complexes are excluded, there are significant differences in two features between hot pots and non-hot spots. Secondly, we explore the predictive ability for each feature and the combinations of features by support vector machines (SVMs. The results indicate that sequence-based feature outperforms other combinations of features with reasonable accuracy, with a precision of 0.69, a recall of 0.68, an F1 score of 0.68, and an AUC of 0.68 on independent test set. Compared with other machine learning methods and two energy-based approaches, our approach achieves the best performance. Moreover, we demonstrate the applicability of our method to predict hot spots of two protein complexes. Conclusion Experimental results show that support vector machine

  6. A Novel Method of Predicting Protein Disordered Regions Based on Sequence Features

    Tong-Hui Zhao

    2013-01-01

    Full Text Available With a large number of disordered proteins and their important functions discovered, it is highly desired to develop effective methods to computationally predict protein disordered regions. In this study, based on Random Forest (RF, Maximum Relevancy Minimum Redundancy (mRMR, and Incremental Feature Selection (IFS, we developed a new method to predict disordered regions in proteins. The mRMR criterion was used to rank the importance of all candidate features. Finally, top 128 features were selected from the ranked feature list to build the optimal model, including 92 Position Specific Scoring Matrix (PSSM conservation score features and 36 secondary structure features. As a result, Matthews correlation coefficient (MCC of 0.3895 was achieved on the training set by 10-fold cross-validation. On the basis of predicting results for each query sequence by using the method, we used the scanning and modification strategy to improve the performance. The accuracy (ACC and MCC were increased by 4% and almost 0.2%, respectively, compared with other three popular predictors: DISOPRED, DISOclust, and OnD-CRF. The selected features may shed some light on the understanding of the formation mechanism of disordered structures, providing guidelines for experimental validation.

  7. ANCAC: amino acid, nucleotide, and codon analysis of COGs – a tool for sequence bias analysis in microbial orthologs

    Meiler Arno

    2012-09-01

    Full Text Available Abstract Background The COG database is the most popular collection of orthologous proteins from many different completely sequenced microbial genomes. Per definition, a cluster of orthologous groups (COG within this database exclusively contains proteins that most likely achieve the same cellular function. Recently, the COG database was extended by assigning to every protein both the corresponding amino acid and its encoding nucleotide sequence resulting in the NUCOCOG database. This extended version of the COG database is a valuable resource connecting sequence features with the functionality of the respective proteins. Results Here we present ANCAC, a web tool and MySQL database for the analysis of amino acid, nucleotide, and codon frequencies in COGs on the basis of freely definable phylogenetic patterns. We demonstrate the usefulness of ANCAC by analyzing amino acid frequencies, codon usage, and GC-content in a species- or function-specific context. With respect to amino acids we, at least in part, confirm the cognate bias hypothesis by using ANCAC’s NUCOCOG dataset as the largest one available for that purpose thus far. Conclusions Using the NUCOCOG datasets, ANCAC connects taxonomic, amino acid, and nucleotide sequence information with the functional classification via COGs and provides a GUI for flexible mining for sequence-bias. Thereby, to our knowledge, it is the only tool for the analysis of sequence composition in the light of physiological roles and phylogenetic context without requirement of substantial programming-skills.

  8. Using expected sequence features to improve basecalling accuracy of amplicon pyrosequencing data

    Rask, Thomas Salhøj; Petersen, Bent; Chen, Donald S.;

    2016-01-01

    insertions and deletions, are on the other hand likely to disrupt open reading frames. Such an inverse relationship between errors and expectation based on prior knowledge can be used advantageously to guide the process known as basecalling, i.e. the inference of nucleotide sequence from raw sequencing data......Amplicon pyrosequencing targets a known genetic region and thus inherently produces reads highly anticipated to have certain features, such as conserved nucleotide sequence, and in the case of protein coding DNA, an open reading frame. Pyrosequencing errors, consisting mainly of nucleotide....... This probabilistic approach enables integration of basecalling into a larger model where other parameters can be incorporated, such as the likelihood for observing a full-length open reading frame at the targeted region. We apply the method to 454 amplicon pyrosequencing data obtained from a malaria...

  9. Prediction of protein motions from amino acid sequence and its application to protein-protein interaction

    Wako Hiroshi

    2010-07-01

    Full Text Available Abstract Background Structural flexibility is an important characteristic of proteins because it is often associated with their function. The movement of a polypeptide segment in a protein can be broken down into two types of motions: internal and external ones. The former is deformation of the segment itself, but the latter involves only rotational and translational motions as a rigid body. Normal Model Analysis (NMA can derive these two motions, but its application remains limited because it necessitates the gathering of complete structural information. Results In this work, we present a novel method for predicting two kinds of protein motions in ordered structures. The prediction uses only information from the amino acid sequence. We prepared a dataset of the internal and external motions of segments in many proteins by application of NMA. Subsequently, we analyzed the relation between thermal motion assessed from X-ray crystallographic B-factor and internal/external motions calculated by NMA. Results show that attributes of amino acids related to the internal motion have different features from those related to the B-factors, although those related to the external motion are correlated strongly with the B-factors. Next, we developed a method to predict internal and external motions from amino acid sequences based on the Random Forest algorithm. The proposed method uses information associated with adjacent amino acid residues and secondary structures predicted from the amino acid sequence. The proposed method exhibited moderate correlation between predicted internal and external motions with those calculated by NMA. It has the highest prediction accuracy compared to a naïve model and three published predictors. Conclusions Finally, we applied the proposed method predicting the internal motion to a set of 20 proteins that undergo large conformational change upon protein-protein interaction. Results show significant overlaps between the

  10. Accurate prediction of hot spot residues through physicochemical characteristics of amino acid sequences

    Chen, Peng

    2013-07-23

    Hot spot residues of proteins are fundamental interface residues that help proteins perform their functions. Detecting hot spots by experimental methods is costly and time-consuming. Sequential and structural information has been widely used in the computational prediction of hot spots. However, structural information is not always available. In this article, we investigated the problem of identifying hot spots using only physicochemical characteristics extracted from amino acid sequences. We first extracted 132 relatively independent physicochemical features from a set of the 544 properties in AAindex1, an amino acid index database. Each feature was utilized to train a classification model with a novel encoding schema for hot spot prediction by the IBk algorithm, an extension of the K-nearest neighbor algorithm. The combinations of the individual classifiers were explored and the classifiers that appeared frequently in the top performing combinations were selected. The hot spot predictor was built based on an ensemble of these classifiers and to work in a voting manner. Experimental results demonstrated that our method effectively exploited the feature space and allowed flexible weights of features for different queries. On the commonly used hot spot benchmark sets, our method significantly outperformed other machine learning algorithms and state-of-the-art hot spot predictors. The program is available at http://sfb.kaust.edu.sa/pages/software.aspx. © 2013 Wiley Periodicals, Inc.

  11. Mapping genomic features to functional traits through microbial whole genome sequences.

    Zhang, Wei; Zeng, Erliang; Liu, Dan; Jones, Stuart E; Emrich, Scott

    2014-01-01

    Recently, the utility of trait-based approaches for microbial communities has been identified. Increasing availability of whole genome sequences provide the opportunity to explore the genetic foundations of a variety of functional traits. We proposed a machine learning framework to quantitatively link the genomic features with functional traits. Genes from bacteria genomes belonging to different functional traits were grouped to Cluster of Orthologs (COGs), and were used as features. Then, TF-IDF technique from the text mining domain was applied to transform the data to accommodate the abundance and importance of each COG. After TF-IDF processing, COGs were ranked using feature selection methods to identify their relevance to the functional trait of interest. Extensive experimental results demonstrated that functional trait related genes can be detected using our method. Further, the method has the potential to provide novel biological insights. PMID:24989863

  12. Complete mitochondrial DNA sequences of six snakes: phylogenetic relationships and molecular evolution of genomic features.

    Dong, Songyu; Kumazawa, Yoshinori

    2005-07-01

    Complete mitochondrial DNA (mtDNA) sequences were determined for representative species from six snake families: the acrochordid little file snake, the bold boa constrictor, the cylindrophiid red pipe snake, the viperid himehabu, the pythonid ball python, and the xenopeltid sunbeam snake. Thirteen protein-coding genes, 22 tRNA genes, 2 rRNA genes, and 2 control regions were identified in these mtDNAs. Duplication of the control region and translocation of the tRNALeu gene were two notable features of the snake mtDNAs. The duplicate control regions had nearly identical nucleotide sequences within species but they were divergent among species, suggesting concerted sequence evolution of the two control regions. In addition, the duplicate control regions appear to have facilitated an interchange of some flanking tRNA genes in the viperid lineage. Phylogenetic analyses were conducted using a large number of sites (9570 sites in total) derived from the complete mtDNA sequences. Our data strongly suggested a new phylogenetic relationship among the major families of snakes: ((((Viperidae, Colubridae), Acrochordidae), (((Pythonidae, Xenopeltidae), Cylindrophiidae), Boidae)), Leptotyphlopidae). This conclusion was distinct from a widely accepted view based on morphological characters in denying the sister-group relationship of boids and pythonids, as well as the basal divergence of nonmacrostomatan cylindrophiids. These results imply the significance to reconstruct the snake phylogeny with ample molecular data, such as those from complete mtDNA sequences. PMID:16007493

  13. What Matters in Implicit Task Sequence Learning: Perceptual Stimulus Features, Task Sets, or Correlated Streams of Information?

    Weiermann, Brigitte; Cock, Josephine; Meier, Beat

    2010-01-01

    Implicit task sequence learning may be attributed to learning the order of perceptual stimulus features associated with the task sequence, learning a series of automatic task set activations, or learning an integrated sequence that derives from 2 correlated streams of information. In the present study, our purpose was to distinguish among these 3…

  14. SeqFeatR for the Discovery of Feature-Sequence Associations.

    Budeus, Bettina; Timm, Jörg; Hoffmann, Daniel

    2016-01-01

    Specific selection pressures often lead to specifically mutated genomes. The open source software SeqFeatR has been developed to identify associations between mutation patterns in biological sequences and specific selection pressures ("features"). For instance, SeqFeatR has been used to discover in viral protein sequences new T cell epitopes for hosts of given HLA types. SeqFeatR supports frequentist and Bayesian methods for the discovery of statistical sequence-feature associations. Moreover, it offers novel ways to visualize results of the statistical analyses and to relate them to further properties. In this article we demonstrate various functions of SeqFeatR with real data. The most frequently used set of functions is also provided by a web server. SeqFeatR is implemented as R package and freely available from the R archive CRAN (http://cran.r-project.org/web/packages/SeqFeatR/index.html). The package includes a tutorial vignette. The software is distributed under the GNU General Public License (version 3 or later). The web server URL is https://seqfeatr.zmb.uni-due.de. PMID:26731669

  15. Prediction of peptide drift time in ion mobility mass spectrometry from sequence-based features

    Wang, Bing

    2013-05-09

    Background: Ion mobility-mass spectrometry (IMMS), an analytical technique which combines the features of ion mobility spectrometry (IMS) and mass spectrometry (MS), can rapidly separates ions on a millisecond time-scale. IMMS becomes a powerful tool to analyzing complex mixtures, especially for the analysis of peptides in proteomics. The high-throughput nature of this technique provides a challenge for the identification of peptides in complex biological samples. As an important parameter, peptide drift time can be used for enhancing downstream data analysis in IMMS-based proteomics.Results: In this paper, a model is presented based on least square support vectors regression (LS-SVR) method to predict peptide ion drift time in IMMS from the sequence-based features of peptide. Four descriptors were extracted from peptide sequence to represent peptide ions by a 34-component vector. The parameters of LS-SVR were selected by a grid searching strategy, and a 10-fold cross-validation approach was employed for the model training and testing. Our proposed method was tested on three datasets with different charge states. The high prediction performance achieve demonstrate the effectiveness and efficiency of the prediction model.Conclusions: Our proposed LS-SVR model can predict peptide drift time from sequence information in relative high prediction accuracy by a test on a dataset of 595 peptides. This work can enhance the confidence of protein identification by combining with current protein searching techniques. 2013 Wang et al.; licensee BioMed Central Ltd.

  16. Sequencing of bovine herpesvirus 4 v.test strain reveals important genome features

    Gillet Laurent

    2011-08-01

    Full Text Available Abstract Background Bovine herpesvirus 4 (BoHV-4 is a useful model for the human pathogenic gammaherpesviruses Epstein-Barr virus and Kaposi's Sarcoma-associated Herpesvirus. Although genome manipulations of this virus have been greatly facilitated by the cloning of the BoHV-4 V.test strain as a Bacterial Artificial Chromosome (BAC, the lack of a complete genome sequence for this strain limits its experimental use. Methods In this study, we have determined the complete sequence of BoHV-4 V.test strain by a pyrosequencing approach. Results The long unique coding region (LUR consists of 108,241 bp encoding at least 79 open reading frames and is flanked by several polyrepetitive DNA units (prDNA. As previously suggested, we showed that the prDNA unit located at the left prDNA-LUR junction (prDNA-G differs from the other prDNA units (prDNA-inner. Namely, the prDNA-G unit lacks the conserved pac-2 cleavage and packaging signal in its right terminal region. Based on the mechanisms of cleavage and packaging of herpesvirus genomes, this feature implies that only genomes bearing left and right end prDNA units are encapsulated into virions. Conclusions In this study, we have determined the complete genome sequence of the BAC-cloned BoHV-4 V.test strain and identified genome organization features that could be important in other herpesviruses.

  17. Parallax Effect Free Mosaicing of Underwater Video Sequence Based on Texture Features

    Nagaraja S

    2014-10-01

    Full Text Available In this paper, we present feature-based technique for construction of mosaic image from underwater video sequence, which suffers from parallax distortion due to propagation properties of light in the underwater environment. The most of the available mosaic tools and underwater image mosaicing techniques yields final result with some artifacts such as blurring, ghosting and seam due to presence of parallax in the input images. The removal of parallax from input images may not reduce its effects instead it must be corrected in successive steps of mosaicing. Thus, our approach minimizes the parallax effects by adopting an efficient local alignment technique after global registration. We extract texture features using Centre Symmetric Local Binary Pattern (CS-LBP descriptor in order to find feature correspondences, which are used further for estimation of homography through RANSAC. In order to increase the accuracy of global registration, we perform preprocessing such as colour alignment between two selected frames based on colour distribution adjustment. Because of existence of 100% overlap in consecutive frames of underwater video, we select frames with minimum overlap based on mutual offset in order to reduce the computation cost during mosaicing. Our approach minimizes the parallax effects considerably in final mosaic constructed using our own underwater video sequences.

  18. FASTERp: A Feature Array Search Tool for Estimating Resemblance of Protein Sequences

    Macklin, Derek; Egan, Rob; Wang, Zhong

    2014-03-14

    Metagenome sequencing efforts have provided a large pool of billions of genes for identifying enzymes with desirable biochemical traits. However, homology search with billions of genes in a rapidly growing database has become increasingly computationally impractical. Here we present our pilot efforts to develop a novel alignment-free algorithm for homology search. Specifically, we represent individual proteins as feature vectors that denote the presence or absence of short kmers in the protein sequence. Similarity between feature vectors is then computed using the Tanimoto score, a distance metric that can be rapidly computed on bit string representations of feature vectors. Preliminary results indicate good correlation with optimal alignment algorithms (Spearman r of 0.87, ~;;1,000,000 proteins from Pfam), as well as with heuristic algorithms such as BLAST (Spearman r of 0.86, ~;;1,000,000 proteins). Furthermore, a prototype of FASTERp implemented in Python runs approximately four times faster than BLAST on a small scale dataset (~;;1000 proteins). We are optimizing and scaling to improve FASTERp to enable rapid homology searches against billion-protein databases, thereby enabling more comprehensive gene annotation efforts.

  19. 37 CFR 1.822 - Symbols and format to be used for nucleotide and/or amino acid sequence data.

    2010-07-01

    ... for nucleotide and/or amino acid sequence data. 1.822 Section 1.822 Patents, Trademarks, and... Amino Acid Sequences § 1.822 Symbols and format to be used for nucleotide and/or amino acid sequence data. (a) The symbols and format to be used for nucleotide and/or amino acid sequence data...

  20. Topological features of proteins from amino acid residue networks

    Alves, N A; Alves, Nelson Augusto; Martinez, Alexandre Souto

    2006-01-01

    Topological properties of native folds are obtained from statistical analysis of 160 low homology proteins covering the four structural classes. This is done analysing one, two and three-vertex joint distribution of quantities related to the corresponding network of amino acid residues. Emphasis on the amino acid residue hydrophobicity leads to the definition of their center of mass as vertices in this contact network model with interactions represented by edges. The network analysis helps us to interpret experimental results such as hydrophobic scales and fraction of buried accessible surface area in terms of the network connectivity. To explore the vertex type dependent correlations, we build a network of hydrophobic and polar vertices. This procedure presents the wiring diagram of the topological structure of globular proteins leading to the following attachment probabilities between hydrophobic-hydrophobic 0.424(5), hydrophobic-polar 0.419(2) and polar-polar 0.157(3) residues.

  1. Contig sequences and their annotation (amino acid sequence and results of homology search), and expression profile - Dicty_cDB | LSDB Archive [Life Science Database Archive metadata

    Full Text Available Dicty_cDB Contig sequences and their annotation (amino acid sequence and results of homology search), and ex...pression profile Data detail Data name Contig sequences and their annotation (amino acid sequence and result... sequences of cDNA sequences of Dictyostelium discoideum and their annotation (amino acid sequence and resul...ence and full-length cDNA sequence by the assembly program Phrap ( http://www.phrap.org/index.html ). Link to the... list of clones constituting the contig, the information on its mapping to the genome mapped to genome sequence and the

  2. Unique features of a global human ectoparasite identified through sequencing of the bed bug genome

    Benoit, Joshua B.; Adelman, Zach N.; Reinhardt, Klaus; Dolan, Amanda; Poelchau, Monica; Jennings, Emily C.; Szuter, Elise M.; Hagan, Richard W.; Gujar, Hemant; Shukla, Jayendra Nath; Zhu, Fang; Mohan, M.; Nelson, David R.; Rosendale, Andrew J.; Derst, Christian; Resnik, Valentina; Wernig, Sebastian; Menegazzi, Pamela; Wegener, Christian; Peschel, Nicolai; Hendershot, Jacob M.; Blenau, Wolfgang; Predel, Reinhard; Johnston, Paul R.; Ioannidis, Panagiotis; Waterhouse, Robert M.; Nauen, Ralf; Schorn, Corinna; Ott, Mark-Christoph; Maiwald, Frank; Johnston, J. Spencer; Gondhalekar, Ameya D.; Scharf, Michael E.; Peterson, Brittany F.; Raje, Kapil R.; Hottel, Benjamin A.; Armisén, David; Crumière, Antonin Jean Johan; Refki, Peter Nagui; Santos, Maria Emilia; Sghaier, Essia; Viala, Sèverine; Khila, Abderrahman; Ahn, Seung-Joon; Childers, Christopher; Lee, Chien-Yueh; Lin, Han; Hughes, Daniel S. T.; Duncan, Elizabeth J.; Murali, Shwetha C.; Qu, Jiaxin; Dugan, Shannon; Lee, Sandra L.; Chao, Hsu; Dinh, Huyen; Han, Yi; Doddapaneni, Harshavardhan; Worley, Kim C.; Muzny, Donna M.; Wheeler, David; Panfilio, Kristen A.; Vargas Jentzsch, Iris M.; Vargo, Edward L.; Booth, Warren; Friedrich, Markus; Weirauch, Matthew T.; Anderson, Michelle A. E.; Jones, Jeffery W.; Mittapalli, Omprakash; Zhao, Chaoyang; Zhou, Jing-Jiang; Evans, Jay D.; Attardo, Geoffrey M.; Robertson, Hugh M.; Zdobnov, Evgeny M.; Ribeiro, Jose M. C.; Gibbs, Richard A.; Werren, John H.; Palli, Subba R.; Schal, Coby; Richards, Stephen

    2016-01-01

    The bed bug, Cimex lectularius, has re-established itself as a ubiquitous human ectoparasite throughout much of the world during the past two decades. This global resurgence is likely linked to increased international travel and commerce in addition to widespread insecticide resistance. Analyses of the C. lectularius sequenced genome (650 Mb) and 14,220 predicted protein-coding genes provide a comprehensive representation of genes that are linked to traumatic insemination, a reduced chemosensory repertoire of genes related to obligate hematophagy, host–symbiont interactions, and several mechanisms of insecticide resistance. In addition, we document the presence of multiple putative lateral gene transfer events. Genome sequencing and annotation establish a solid foundation for future research on mechanisms of insecticide resistance, human–bed bug and symbiont–bed bug associations, and unique features of bed bug biology that contribute to the unprecedented success of C. lectularius as a human ectoparasite. PMID:26836814

  3. Unique features of a global human ectoparasite identified through sequencing of the bed bug genome.

    Benoit, Joshua B; Adelman, Zach N; Reinhardt, Klaus; Dolan, Amanda; Poelchau, Monica; Jennings, Emily C; Szuter, Elise M; Hagan, Richard W; Gujar, Hemant; Shukla, Jayendra Nath; Zhu, Fang; Mohan, M; Nelson, David R; Rosendale, Andrew J; Derst, Christian; Resnik, Valentina; Wernig, Sebastian; Menegazzi, Pamela; Wegener, Christian; Peschel, Nicolai; Hendershot, Jacob M; Blenau, Wolfgang; Predel, Reinhard; Johnston, Paul R; Ioannidis, Panagiotis; Waterhouse, Robert M; Nauen, Ralf; Schorn, Corinna; Ott, Mark-Christoph; Maiwald, Frank; Johnston, J Spencer; Gondhalekar, Ameya D; Scharf, Michael E; Peterson, Brittany F; Raje, Kapil R; Hottel, Benjamin A; Armisén, David; Crumière, Antonin Jean Johan; Refki, Peter Nagui; Santos, Maria Emilia; Sghaier, Essia; Viala, Sèverine; Khila, Abderrahman; Ahn, Seung-Joon; Childers, Christopher; Lee, Chien-Yueh; Lin, Han; Hughes, Daniel S T; Duncan, Elizabeth J; Murali, Shwetha C; Qu, Jiaxin; Dugan, Shannon; Lee, Sandra L; Chao, Hsu; Dinh, Huyen; Han, Yi; Doddapaneni, Harshavardhan; Worley, Kim C; Muzny, Donna M; Wheeler, David; Panfilio, Kristen A; Vargas Jentzsch, Iris M; Vargo, Edward L; Booth, Warren; Friedrich, Markus; Weirauch, Matthew T; Anderson, Michelle A E; Jones, Jeffery W; Mittapalli, Omprakash; Zhao, Chaoyang; Zhou, Jing-Jiang; Evans, Jay D; Attardo, Geoffrey M; Robertson, Hugh M; Zdobnov, Evgeny M; Ribeiro, Jose M C; Gibbs, Richard A; Werren, John H; Palli, Subba R; Schal, Coby; Richards, Stephen

    2016-01-01

    The bed bug, Cimex lectularius, has re-established itself as a ubiquitous human ectoparasite throughout much of the world during the past two decades. This global resurgence is likely linked to increased international travel and commerce in addition to widespread insecticide resistance. Analyses of the C. lectularius sequenced genome (650 Mb) and 14,220 predicted protein-coding genes provide a comprehensive representation of genes that are linked to traumatic insemination, a reduced chemosensory repertoire of genes related to obligate hematophagy, host-symbiont interactions, and several mechanisms of insecticide resistance. In addition, we document the presence of multiple putative lateral gene transfer events. Genome sequencing and annotation establish a solid foundation for future research on mechanisms of insecticide resistance, human-bed bug and symbiont-bed bug associations, and unique features of bed bug biology that contribute to the unprecedented success of C. lectularius as a human ectoparasite. PMID:26836814

  4. Poly(A) motif prediction using spectral latent features from human DNA sequences

    Xie, Bo

    2013-06-21

    Motivation: Polyadenylation is the addition of a poly(A) tail to an RNA molecule. Identifying DNA sequence motifs that signal the addition of poly(A) tails is essential to improved genome annotation and better understanding of the regulatory mechanisms and stability of mRNA.Existing poly(A) motif predictors demonstrate that information extracted from the surrounding nucleotide sequences of candidate poly(A) motifs can differentiate true motifs from the false ones to a great extent. A variety of sophisticated features has been explored, including sequential, structural, statistical, thermodynamic and evolutionary properties. However, most of these methods involve extensive manual feature engineering, which can be time-consuming and can require in-depth domain knowledge.Results: We propose a novel machine-learning method for poly(A) motif prediction by marrying generative learning (hidden Markov models) and discriminative learning (support vector machines). Generative learning provides a rich palette on which the uncertainty and diversity of sequence information can be handled, while discriminative learning allows the performance of the classification task to be directly optimized. Here, we used hidden Markov models for fitting the DNA sequence dynamics, and developed an efficient spectral algorithm for extracting latent variable information from these models. These spectral latent features were then fed into support vector machines to fine-tune the classification performance.We evaluated our proposed method on a comprehensive human poly(A) dataset that consists of 14 740 samples from 12 of the most abundant variants of human poly(A) motifs. Compared with one of the previous state-of-the-art methods in the literature (the random forest model with expert-crafted features), our method reduces the average error rate, false-negative rate and false-positive rate by 26, 15 and 35%, respectively. Meanwhile, our method makes ?30% fewer error predictions relative to the other

  5. Clostridium sticklandii, a specialist in amino acid degradation:revisiting its metabolism through its genome sequence

    Pelletier Eric

    2010-10-01

    Full Text Available Abstract Background Clostridium sticklandii belongs to a cluster of non-pathogenic proteolytic clostridia which utilize amino acids as carbon and energy sources. Isolated by T.C. Stadtman in 1954, it has been generally regarded as a "gold mine" for novel biochemical reactions and is used as a model organism for studying metabolic aspects such as the Stickland reaction, coenzyme-B12- and selenium-dependent reactions of amino acids. With the goal of revisiting its carbon, nitrogen, and energy metabolism, and comparing studies with other clostridia, its genome has been sequenced and analyzed. Results C. sticklandii is one of the best biochemically studied proteolytic clostridial species. Useful additional information has been obtained from the sequencing and annotation of its genome, which is presented in this paper. Besides, experimental procedures reveal that C. sticklandii degrades amino acids in a preferential and sequential way. The organism prefers threonine, arginine, serine, cysteine, proline, and glycine, whereas glutamate, aspartate and alanine are excreted. Energy conservation is primarily obtained by substrate-level phosphorylation in fermentative pathways. The reactions catalyzed by different ferredoxin oxidoreductases and the exergonic NADH-dependent reduction of crotonyl-CoA point to a possible chemiosmotic energy conservation via the Rnf complex. C. sticklandii possesses both the F-type and V-type ATPases. The discovery of an as yet unrecognized selenoprotein in the D-proline reductase operon suggests a more detailed mechanism for NADH-dependent D-proline reduction. A rather unusual metabolic feature is the presence of genes for all the enzymes involved in two different CO2-fixation pathways: C. sticklandii harbours both the glycine synthase/glycine reductase and the Wood-Ljungdahl pathways. This unusual pathway combination has retrospectively been observed in only four other sequenced microorganisms. Conclusions Analysis of the C

  6. Human retroviruses and AIDS 1996. A compilation and analysis of nucleic acid and amino acid sequences

    Myers, G.; Foley, B.; Korber, B. [eds.] [Los Alamos National Lab., NM (United States). Theoretical Div.; Mellors, J.W. [ed.] [Univ. of Pittsburgh, PA (United States); Jeang, K.T. [ed.] [National Institutes of Health, Bethesda, MD (United States). Molecular Virology Section; Wain-Hobson, S. [Pasteur Inst., Paris (France)] [ed.

    1997-04-01

    This compendium and the accompanying floppy diskettes are the result of an effort to compile and rapidly publish all relevant molecular data concerning the human immunodeficiency viruses (HIV) and related retroviruses. The scope of the compendium and database is best summarized by the five parts that it comprises: (1) Nuclear Acid Alignments and Sequences; (2) Amino Acid Alignments; (3) Analysis; (4) Related Sequences; and (5) Database Communications. Information within all the parts is updated throughout the year on the Web site, http://hiv-web.lanl.gov. While this publication could take the form of a review or sequence monograph, it is not so conceived. Instead, the literature from which the database is derived has simply been summarized and some elementary computational analyses have been performed upon the data. Interpretation and commentary have been avoided insofar as possible so that the reader can form his or her own judgments concerning the complex information. In addition to the general descriptions of the parts of the compendium, the user should read the individual introductions for each part.

  7. Natural vs. random protein sequences: Discovering combinatorics properties on amino acid words.

    Santoni, Daniele; Felici, Giovanni; Vergni, Davide

    2016-02-21

    Casual mutations and natural selection have driven the evolution of protein amino acid sequences that we observe at present in nature. The question about which is the dominant force of proteins evolution is still lacking of an unambiguous answer. Casual mutations tend to randomize protein sequences while, in order to have the correct functionality, one expects that selection mechanisms impose rigid constraints on amino acid sequences. Moreover, one also has to consider that the space of all possible amino acid sequences is so astonishingly large that it could be reasonable to have a well tuned amino acid sequence indistinguishable from a random one. In order to study the possibility to discriminate between random and natural amino acid sequences, we introduce different measures of association between pairs of amino acids in a sequence, and apply them to a dataset of 1047 natural protein sequences and 10,470 random sequences, carefully generated in order to preserve the relative length and amino acid distribution of the natural proteins. We analyze the multidimensional measures with machine learning techniques and show that, to a reasonable extent, natural protein sequences can be differentiated from random ones. PMID:26656109

  8. Transcriptome Sequencing in Response to Salicylic Acid in Salvia miltiorrhiza.

    Zhang, Xiaoru; Dong, Juane; Liu, Hailong; Wang, Jiao; Qi, Yuexin; Liang, Zongsuo

    2016-01-01

    Salvia miltiorrhiza is a traditional Chinese herbal medicine, whose quality and yield are often affected by diseases and environmental stresses during its growing season. Salicylic acid (SA) plays a significant role in plants responding to biotic and abiotic stresses, but the involved regulatory factors and their signaling mechanisms are largely unknown. In order to identify the genes involved in SA signaling, the RNA sequencing (RNA-seq) strategy was employed to evaluate the transcriptional profiles in S. miltiorrhiza cell cultures. A total of 50,778 unigenes were assembled, in which 5,316 unigenes were differentially expressed among 0-, 2-, and 8-h SA induction. The up-regulated genes were mainly involved in stimulus response and multi-organism process. A core set of candidate novel genes coding SA signaling component proteins was identified. Many transcription factors (e.g., WRKY, bHLH and GRAS) and genes involved in hormone signal transduction were differentially expressed in response to SA induction. Detailed analysis revealed that genes associated with defense signaling, such as antioxidant system genes, cytochrome P450s and ATP-binding cassette transporters, were significantly overexpressed, which can be used as genetic tools to investigate disease resistance. Our transcriptome analysis will help understand SA signaling and its mechanism of defense systems in S. miltiorrhiza. PMID:26808150

  9. Conservation of uORF repressiveness and sequence features in mouse, human and zebrafish.

    Chew, Guo-Liang; Pauli, Andrea; Schier, Alexander F

    2016-01-01

    Upstream open reading frames (uORFs) are ubiquitous repressive genetic elements in vertebrate mRNAs. While much is known about the regulation of individual genes by their uORFs, the range of uORF-mediated translational repression in vertebrate genomes is largely unexplored. Moreover, it is unclear whether the repressive effects of uORFs are conserved across species. To address these questions, we analyse transcript sequences and ribosome profiling data from human, mouse and zebrafish. We find that uORFs are depleted near coding sequences (CDSes) and have initiation contexts that diminish their translation. Linear modelling reveals that sequence features at both uORFs and CDSes modulate the translation of CDSes. Moreover, the ratio of translation over 5' leaders and CDSes is conserved between human and mouse, and correlates with the number of uORFs. These observations suggest that the prevalence of vertebrate uORFs may be explained by their conserved role in repressing CDS translation. PMID:27216465

  10. SeqFeatR for the Discovery of Feature-Sequence Associations

    Budeus, Bettina; Timm, Jörg; Hoffmann, Daniel

    2016-01-01

    Specific selection pressures often lead to specifically mutated genomes. The open source software SeqFeatR has been developed to identify associations between mutation patterns in biological sequences and specific selection pressures (“features”). For instance, SeqFeatR has been used to discover in viral protein sequences new T cell epitopes for hosts of given HLA types. SeqFeatR supports frequentist and Bayesian methods for the discovery of statistical sequence-feature associations. Moreover, it offers novel ways to visualize results of the statistical analyses and to relate them to further properties. In this article we demonstrate various functions of SeqFeatR with real data. The most frequently used set of functions is also provided by a web server. SeqFeatR is implemented as R package and freely available from the R archive CRAN (http://cran.r-project.org/web/packages/SeqFeatR/index.html). The package includes a tutorial vignette. The software is distributed under the GNU General Public License (version 3 or later). The web server URL is https://seqfeatr.zmb.uni-due.de. PMID:26731669

  11. A Comparative Analysis of Feature Selection Methods for Clustering DNA Sequences

    B.Umamageswari

    2012-04-01

    Full Text Available Large-scale analysis of genome sequences is in progress around the world, the major application of which is to establish the evolutionary relationship among the species using phylogenetic trees. Hierarchical agglomerative algorithms can be used to generate such phylogenetic trees given the distance matrix representing the dissimilarity among the species. ClustalW and Muscle are two general purpose programs that generates distance matrix from the input DNA or protein sequences. The limitation of these programs is that they are based on Smith-Waterman algorithm which uses dynamic programming for doing the pair-wise alignment. This is an extremely time consuming process and the existing systems may even fail to work for larger input data set. To overcome this limitation, we have used the frequency of codons usage as an approximation to find dissimilarity among species. The proposed technique further reduces the complexity by extracting only the significant features of the species from the mtDNA sequences using the techniques like frequent codons, codons with maximum range value or PCA technique. We have observed that the proposed system produces nearly accurate results in a significantly reduced running time.

  12. Host-Associated Genomic Features of the Novel Uncultured Intracellular Pathogen Ca. Ichthyocystis Revealed by Direct Sequencing of Epitheliocysts.

    Qi, Weihong; Vaughan, Lloyd; Katharios, Pantelis; Schlapbach, Ralph; Seth-Smith, Helena M B

    2016-01-01

    Advances in single-cell and mini-metagenome sequencing have enabled important investigations into uncultured bacteria. In this study, we applied the mini-metagenome sequencing method to assemble genome drafts of the uncultured causative agents of epitheliocystis, an emerging infectious disease in the Mediterranean aquaculture species gilthead seabream. We sequenced multiple cyst samples and constructed 11 genome drafts from a novel beta-proteobacterial lineage, Candidatus Ichthyocystis. The draft genomes demonstrate features typical of pathogenic bacteria with an obligate intracellular lifestyle: a reduced genome of up to 2.6 Mb, reduced G + C content, and reduced metabolic capacity. Reconstruction of metabolic pathways reveals that Ca Ichthyocystis genomes lack all amino acid synthesis pathways, compelling them to scavenge from the fish host. All genomes encode type II, III, and IV secretion systems, a large repertoire of predicted effectors, and a type IV pilus. These are all considered to be virulence factors, required for adherence, invasion, and host manipulation. However, no evidence of lipopolysaccharide synthesis could be found. Beyond the core functions shared within the genus, alignments showed distinction into different species, characterized by alternative large gene families. These comprise up to a third of each genome, appear to have arisen through duplication and diversification, encode many effector proteins, and are seemingly critical for virulence. Thus, Ca Ichthyocystis represents a novel obligatory intracellular pathogenic beta-proteobacterial lineage. The methods used: mini-metagenome analysis and manual annotation, have generated important insights into the lifestyle and evolution of the novel, uncultured pathogens, elucidating many putative virulence factors including an unprecedented array of novel gene families. PMID:27190004

  13. Nucleotide sequence of Crithidia fasciculata cytosol 5S ribosomal ribonucleic acid.

    MacKay, R M; Gray, M W; Doolittle, W F

    1980-01-01

    The complete nucleotide sequence of the cytosol 5S ribosomal ribonucleic acid of the trypanosomatid protozoan Crithidia fasciculata has been determined by a combination of T1-oligonucleotide catalog and gel sequencing techniques. The sequence is: GAGUACGACCAUACUUGAGUGAAAACACCAUAUCCCGUCCGAUUUGUGAAGUUAAGCACC CACAGGCUUAGUUAGUACUGAGGUCAGUGAUGACUCGGGAACCCUGAGUGCCGUACUCCCOH. This 5S ribosomal RNA is unique in having GAUU in place of the GAAC or GAUC found in all other prokaryotic and eukaryotic 5S ...

  14. Analysis of intron sequence features associated with transcriptional regulation in human genes.

    Huimin Li

    Full Text Available Although some preliminary work has revealed the potential transcriptional regulatory function of the introns in eukaryotes, additional evidences are needed to support this conjecture. In this study, we perform systemic analyses of the sequence characteristics of human introns. The results show that the first introns are generally longer and C, G and their dinucleotide compositions are over-represented relative to other introns, which are consistent with the previous findings. In addition, some new phenomena concerned with transcriptional regulation are found: i the first introns are enriched in CpG islands; and ii the percentages of the first introns containing TATA, CAAT and GC boxes are relatively higher than other position introns. The similar features of introns are observed in tissue-specific genes. The results further support that the first introns of human genes are likely to be involved in transcriptional regulation, and give an insight into the transcriptional regulatory regions of genes.

  15. Sequence features associated with the cleavage efficiency of CRISPR/Cas9 system

    Liu, Xiaoxi; Homma, Ayaka; Sayadi, Jamasb; Yang, Shu; Ohashi, Jun; Takumi, Toru

    2016-01-01

    The CRISPR-Cas9 system has recently emerged as a versatile tool for biological and medical research. In this system, a single guide RNA (sgRNA) directs the endonuclease Cas9 to a targeted DNA sequence for site-specific manipulation. In addition to this targeting function, the sgRNA has also been shown to play a role in activating the endonuclease activity of Cas9. This dual function of the sgRNA likely underlies observations that different sgRNAs have varying on-target activities. Currently, our understanding of the relationship between sequence features of sgRNAs and their on-target cleavage efficiencies remains limited, largely due to difficulties in assessing the cleavage capacity of a large number of sgRNAs. In this study, we evaluated the cleavage activities of 218 sgRNAs using in vitro Surveyor assays. We found that nucleotides at both PAM-distal and PAM-proximal regions of the sgRNA are significantly correlated with on-target efficiency. Furthermore, we also demonstrated that the genomic context of the targeted DNA, the GC percentage, and the secondary structure of sgRNA are critical factors contributing to cleavage efficiency. In summary, our study reveals important parameters for the design of sgRNAs with high on-target efficiencies, especially in the context of high throughput applications. PMID:26813419

  16. Accessible surface area of proteins from purely sequence information and the importance of global features

    Faraggi, Eshel; Zhou, Yaoqi; Kloczkowski, Andrzej

    2014-03-01

    We present a new approach for predicting the accessible surface area of proteins. The novelty of this approach lies in not using residue mutation profiles generated by multiple sequence alignments as descriptive inputs. Rather, sequential window information and the global monomer and dimer compositions of the chain are used. We find that much of the lost accuracy due to the elimination of evolutionary information is recouped by the use of global features. Furthermore, this new predictor produces similar results for proteins with or without sequence homologs deposited in the Protein Data Bank, and hence shows generalizability. Finally, these predictions are obtained in a small fraction (1/1000) of the time required to run mutation profile based prediction. All these factors indicate the possible usability of this work in de-novo protein structure prediction and in de-novo protein design using iterative searches. Funded in part by the financial support of the National Institutes of Health through Grants R01GM072014 and R01GM073095, and the National Science Foundation through Grant NSF MCB 1071785.

  17. Accurate single-sequence prediction of solvent accessible surface area using local and global features.

    Faraggi, Eshel; Zhou, Yaoqi; Kloczkowski, Andrzej

    2014-11-01

    We present a new approach for predicting the Accessible Surface Area (ASA) using a General Neural Network (GENN). The novelty of the new approach lies in not using residue mutation profiles generated by multiple sequence alignments as descriptive inputs. Instead we use solely sequential window information and global features such as single-residue and two-residue compositions of the chain. The resulting predictor is both highly more efficient than sequence alignment-based predictors and of comparable accuracy to them. Introduction of the global inputs significantly helps achieve this comparable accuracy. The predictor, termed ASAquick, is tested on predicting the ASA of globular proteins and found to perform similarly well for so-called easy and hard cases indicating generalizability and possible usability for de-novo protein structure prediction. The source code and a Linux executables for GENN and ASAquick are available from Research and Information Systems at http://mamiris.com, from the SPARKS Lab at http://sparks-lab.org, and from the Battelle Center for Mathematical Medicine at http://mathmed.org. PMID:25204636

  18. GENAS: a database system for nucleic acid sequence analysis.

    Kuhara, S; Matsuo, F; Futamura, S; A. Fujita; Shinohara, T.; Takagi, T.; Sakaki, Y

    1984-01-01

    A database system, named GENAS (GENe Analyzing System), for computer analysis of sequence was constructed using Adbis which is a relational database management system (1). GENAS enables us to retrieve any sequence data from EMBL nucleotide sequence data library (2) and readily to analyze them (if necessary, together with private data) by various application programs in a interactive manner. Analysis of structure of replication origin of replicons was demonstrated using this system.

  19. Homology between the invertible deoxyribonucleic acid sequence that controls flagellar-phase variation in Salmonella sp. and deoxyribonucleic acid sequences in other organisms.

    Szekely, E; Simon, M.

    1981-01-01

    The invertible deoxyribonucleic acid (DNA) segment cloned from Salmonella sp. was radioactively labeled and used as a probe to search for homologous sequences by Southern hybridization. Only one copy of the invertible segment could be found on the Salmonella sp. genome. Partial sequence homology with the invertible region was detected in bacteriophage Mu and P1 DNA by low-stringency hybridization. Under these conditions, no homology was detected with Escherichia coli DNA. A strain of Salmonel...

  20. Nucleotide Sequence of a Chicken Vitellogenin Gene and Derived Amino Acid Sequence of the Encoded Yolk Precursor Protein

    Schip, Fred D. van het; Samallo, John; Broos, Jaap; Ophuis, Jan; Mojet, Mart; Gruber, Max; AB, Geert

    1987-01-01

    The gene encoding the major vitellogenin from chicken has been completely sequenced and its exon-intron organization has been established. The gene is 20,342 base-pairs long and contains 35 exons with a combined length of 5787 base-pairs. They encode the 1850-amino acid pre-peptide of vitellogenin,

  1. Characterization of mouse cellular deoxyribonucleic acid homologous to Abelson murine leukemia virus-specific sequences.

    Dale, B.; Ozanne, B.

    1981-01-01

    The genome of Abelson murine leukemia virus (A-MuLV) consists of sequences derived from both BALB/c mouse deoxyribonucleic acid and the genome of Moloney murine leukemia virus. Using deoxyribonucleic acid linear intermediates as a source of retroviral deoxyribonucleic acid, we isolated a recombinant plasmid which contained 1.9 kilobases of the 3.5-kilobase mouse-derived sequences found in A-MuLV (A-MuLV-specific sequences). We used this clone, designated pSA-17, as a probe restriction enzyme ...

  2. Representation of Protein-Sequence Information by Amino Acid Subalphabets

    Andersen, Claus A. F.; Brunak, Soren

    2004-01-01

    Within computational biology, algorithms are constructed with the aim of extracting knowledge from biological data, in particular, data generated by the large genome projects, where gene and protein sequences are produced in high volume. In this article, we explore new ways of representing protein-sequence information, using machine learning strategies, where the primary goal is the discovery of novel powerful representations for use in AI techniques. In the case of proteins and the 20 differ...

  3. A conversational system for the computer analysis of nucleic acid sequences.

    Sege, R; Söll, D.; Ruddle, F H; Queen, C

    1981-01-01

    We present a conversational system for the computer analysis of nucleic acid and protein sequences based on the well-known Queen and Korn program (1). The system can be used by persons with only minimal knowledge of computers.

  4. Amino Acid Sequence - KOME | LSDB Archive [Life Science Database Archive metadata

    Full Text Available [ Credits ] BLAST Search Image Search Home About Archive Update History Contact us ...CE Amino acid sequence Joomla SEF URLs by Artio About This Database Database Description Download License Update History

  5. Accuracy of sequence alignment and fold assessment using reduced amino acid alphabets.

    Melo, Francisco; Marti-Renom, Marc A

    2006-06-01

    Reduced or simplified amino acid alphabets group the 20 naturally occurring amino acids into a smaller number of representative protein residues. To date, several reduced amino acid alphabets have been proposed, which have been derived and optimized by a variety of methods. The resulting reduced amino acid alphabets have been applied to pattern recognition, generation of consensus sequences from multiple alignments, protein folding, and protein structure prediction. In this work, amino acid substitution matrices and statistical potentials were derived based on several reduced amino acid alphabets and their performance assessed in a large benchmark for the tasks of sequence alignment and fold assessment of protein structure models, using as a reference frame the standard alphabet of 20 amino acids. The results showed that a large reduction in the total number of residue types does not necessarily translate into a significant loss of discriminative power for sequence alignment and fold assessment. Therefore, some definitions of a few residue types are able to encode most of the relevant sequence/structure information that is present in the 20 standard amino acids. Based on these results, we suggest that the use of reduced amino acid alphabets may allow to increasing the accuracy of current substitution matrices and statistical potentials for the prediction of protein structure of remote homologs. PMID:16506243

  6. cDNA-derived amino acid sequences of myoglobins from nine species of whales and dolphins.

    Iwanami, Kentaro; Mita, Hajime; Yamamoto, Yasuhiko; Fujise, Yoshihiro; Yamada, Tadasu; Suzuki, Tomohiko

    2006-10-01

    We determined the myoglobin (Mb) cDNA sequences of nine cetaceans, of which six are the first reports of Mb sequences: sei whale (Balaenoptera borealis), Bryde's whale (Balaenoptera edeni), pygmy sperm whale (Kogia breviceps), Stejneger's beaked whale (Mesoplodon stejnegeri), Longman's beaked whale (Indopacetus pacificus), and melon-headed whale (Peponocephala electra), and three confirm the previously determined chemical amino acid sequences: sperm whale (Physeter macrocephalus), common minke whale (Balaenoptera acutorostrata) and pantropical spotted dolphin (Stenella attenuata). We found two types of Mb in the skeletal muscle of pantropical spotted dolphin: Mb I with the same amino acid sequence as that deposited in the protein database, and Mb II, which differs at two amino acid residues compared with Mb I. Using an alignment of the amino acid or cDNA sequences of cetacean Mb, we constructed a phylogenetic tree by the NJ method. Clustering of cetacean Mb amino acid and cDNA sequences essentially follows the classical taxonomy of cetaceans, suggesting that Mb sequence data is valid for classification of cetaceans at least to the family level. PMID:16962803

  7. Homology of amino acid sequences of rat liver cathepsins B and H with that of papain.

    Takio, K; Towatari, T; Katunuma, N.; Teller, D C; Titani, K

    1983-01-01

    The amino acid sequences of rat liver lysosomal thiol endopeptidases, cathepsins B and H, are presented and compared with that of the plant thiol protease papain. The 252-residue sequence of cathepsin B and the 220-residue sequence of cathepsin H were determined largely by automated Edman degradation of their intact polypeptide chains and of the two chains of each enzyme generated by limited proteolysis. Subfragments of the chains were produced by enzymatic digestion and by chemical cleavage ...

  8. Complete amino acid sequence of human intestinal aminopeptidase N as deduced from cloned cDNA

    Cowell, G M; Kønigshøfer, E; Danielsen, E M;

    1988-01-01

    The complete primary structure (967 amino acids) of an intestinal human aminopeptidase N (EC 3.4.11.2) was deduced from the sequence of a cDNA clone. Aminopeptidase N is anchored to the microvillar membrane via an uncleaved signal for membrane insertion. A domain constituting amino acid 250...

  9. Event-related potential indices of congruency sequence effects without feature integration or contingency learning confounds.

    Larson, Michael J; Clayson, Peter E; Kirwan, C Brock; Weissman, Daniel H

    2016-06-01

    The congruency effect in Stroop-like tasks (i.e., increased response time and reduced accuracy in incongruent relative to congruent trials) is often smaller when the previous trial was incongruent as compared to congruent. This congruency sequence effect (CSE) is thought to reflect cognitive control processes that shift attention to the target and/or modulate the response engendered by the distracter differently after incongruent relative to congruent trials. The neural signatures of CSEs are therefore usually attributed to cognitive control processes that minimize distraction from irrelevant stimuli. However, CSEs in previous functional neuroimaging studies were ubiquitously confounded with feature integration and/or contingency learning processes. We therefore investigated whether a neural CSE can be observed without such confounds in a group of healthy young adults (n = 56). To this end, we combined a prime-probe task that lacks such confounds with high-density ERPs to identify, for the first time, the neural time course of confound-minimized CSEs. Replicating recent behavioral findings, we observed strong CSEs in this task for mean response time and mean accuracy. Critically, conceptually replicating prior ERP results from confounded tasks, we also observed a CSE in both the parietal conflict slow potential (conflict SP) and the frontomedial N450. These findings indicate for the first time that neural CSEs as indexed by ERPs can be observed without the typical confounds. More broadly, the present study provides a confound-minimized protocol that will help future researchers to better isolate the neural bases of control processes that minimize distraction from irrelevant stimuli. PMID:26854028

  10. Representation of protein-sequence information by amino acid subalphabets

    Andersen, C.A.F.; Brunak, Søren

    2004-01-01

    Within computational biology, algorithms are constructed with the aim of extracting knowledge from biological data, in particular, data generated by the large genome projects, where gene and protein sequences are produced in high volume. In this article, we explore new ways of representing protei......-which now are common in proteins-might have emerged from simpler selections, or alphabets, in use earlier during the evolution of living organisms....

  11. Complete nucleotide sequence of cDNA and deduced amino acid sequence of rat liver catalase.

    Furuta, S.; Hayashi, H; Hijikata, M; Miyazawa, S.; Osumi, T; Hashimoto, T.

    1986-01-01

    We have isolated five cDNA clones for rat liver catalase (hydrogen peroxide:hydrogen peroxide oxidoreductase, EC 1.11.1.6). These clones overlapped with each other and covered the entire length of the mRNA, which had been estimated to be 2.4 kilobases long by blot hybridization analysis of electrophoretically fractionated RNA. Nucleotide sequencing was carried out on these five clones and the composite nucleotide sequence of catalase cDNA was determined. The 5' noncoding region contained 83 b...

  12. Protein chemotaxonomy. XIII. Amino acid sequence of ferredoxin from Panax ginseng.

    Mino, Yoshiki

    2006-08-01

    The complete amino acid sequence of [2Fe-2S] ferredoxin from Panax ginseng (Araliaceae) has been determined by automated Edman degradation of the entire S-carboxymethylcysteinyl protein and of the peptides obtained by enzymatic digestion. This ferredoxin has a unique amino acid sequence, which includes an insertion of Tyr at the 3rd position from the amino-terminus and a deletion of two amino acid residues at the carboxyl terminus. This ferredoxin had 18 differences in its amino acid sequence compared to that of Petroselinum sativum (Umbelliferae). In contrast, 23-33 differences were observed compared to other dicotyledonous plants. This suggests that Panax ginseng is related taxonomically to umbelliferous plants. PMID:16880642

  13. SRAMP: prediction of mammalian N6-methyladenosine (m6A) sites based on sequence-derived features.

    Zhou, Yuan; Zeng, Pan; Li, Yan-Hui; Zhang, Ziding; Cui, Qinghua

    2016-06-01

    N(6)-methyladenosine (m(6)A) is a prevalent RNA methylation modification involved in the regulation of degradation, subcellular localization, splicing and local conformation changes of RNA transcripts. High-throughput experiments have demonstrated that only a small fraction of the m(6)A consensus motifs in mammalian transcriptomes are modified. Therefore, accurate identification of RNA m(6)A sites becomes emergently important. For the above purpose, here a computational predictor of mammalian m(6)A site named SRAMP is established. To depict the sequence context around m(6)A sites, SRAMP combines three random forest classifiers that exploit the positional nucleotide sequence pattern, the K-nearest neighbor information and the position-independent nucleotide pair spectrum features, respectively. SRAMP uses either genomic sequences or cDNA sequences as its input. With either kind of input sequence, SRAMP achieves competitive performance in both cross-validation tests and rigorous independent benchmarking tests. Analyses of the informative features and overrepresented rules extracted from the random forest classifiers demonstrate that nucleotide usage preferences at the distal positions, in addition to those at the proximal positions, contribute to the classification. As a public prediction server, SRAMP is freely available at http://www.cuilab.cn/sramp/. PMID:26896799

  14. Electrochemical features of Pt(S)[n(110) × (100)] surfaces in acidic media

    Souza-Garcia, Janaina; Angelucci, Camilo Andrea; Climent, Víctor; Feliu, Juan M.

    2013-01-01

    Experiments have been carried out in sulfuric and perchloric acid solutions on Pt(S)[n(110) × (100)] electrodes. The comparison between the two different electrolytic media reveals an important influence of the anion in the voltammetric features. Total charge curves have been obtained with the CO charge displacement method in combination with voltammetric measurements. From these curves, the dependence of the pztc with the step density and the strength of the anion adsorption have been analyz...

  15. Nucleotide sequence of the beta-cyclodextrin glucanotransferase gene of alkalophilic Bacillus sp. strain 1011 and similarity of its amino acid sequence to those of alpha-amylases.

    Kimura, K.; Kataoka, S; Ishii, Y; Takano, T.; Yamane, K

    1987-01-01

    The nucleotide sequence of the gene for cyclodextrin glucanotransferase of alkalophilic Bacillus sp. strain 1011 was determined. The deduced amino acid sequence at the NH2-terminal side of the enzyme showed a high homology with the sequences of alpha-amylase in the three regions which constitutes the active centers of alpha-amylases.

  16. EST sequences and their annotation (amino acid sequence and results of homology search) - Dicty_cDB | LSDB Archive [Life Science Database Archive metadata

    Full Text Available lone covering full-length ORF provided by the National BioResource Project ( http://www.nbrp.jp/ ). The...ein Coding Gene in dictyBase ( http://dictybase.org/ ). The link to dictyBase is provided in the...Dicty_cDB EST sequences and their annotation (amino acid sequence and results of homology search) Data detai...l Data name EST sequences and their annotation (amino acid sequence and results of homology search) Descript...ion of data contents Sequences of cDNA clones of Dictyostelium discoideum and the

  17. Introduction of restriction enzyme sites in protein-coding DNA sequences by site-specific mutagenesis not affecting the amino acid sequence: a computer program.

    Arentzen, R; Ripka, W. C.

    1984-01-01

    Structure/function relationship studies of proteins are greatly facilitated by recombinant DNA technology which allows specific amino acid mutations to be made at the DNA sequence level by site-specific mutagenesis employing synthetic oligonucleotides. This technique has been successfully used to alter one or two amino acids in a protein. Replacement of existing DNA sequence coding for several amino acids with new synthetic DNA fragments would be facilitated by the presence of unique restrict...

  18. PredPPCrys: accurate prediction of sequence cloning, protein production, purification and crystallization propensity from protein sequences using multi-step heterogeneous feature fusion and selection.

    Huilin Wang

    Full Text Available X-ray crystallography is the primary approach to solve the three-dimensional structure of a protein. However, a major bottleneck of this method is the failure of multi-step experimental procedures to yield diffraction-quality crystals, including sequence cloning, protein material production, purification, crystallization and ultimately, structural determination. Accordingly, prediction of the propensity of a protein to successfully undergo these experimental procedures based on the protein sequence may help narrow down laborious experimental efforts and facilitate target selection. A number of bioinformatics methods based on protein sequence information have been developed for this purpose. However, our knowledge on the important determinants of propensity for a protein sequence to produce high diffraction-quality crystals remains largely incomplete. In practice, most of the existing methods display poorer performance when evaluated on larger and updated datasets. To address this problem, we constructed an up-to-date dataset as the benchmark, and subsequently developed a new approach termed 'PredPPCrys' using the support vector machine (SVM. Using a comprehensive set of multifaceted sequence-derived features in combination with a novel multi-step feature selection strategy, we identified and characterized the relative importance and contribution of each feature type to the prediction performance of five individual experimental steps required for successful crystallization. The resulting optimal candidate features were used as inputs to build the first-level SVM predictor (PredPPCrys I. Next, prediction outputs of PredPPCrys I were used as the input to build second-level SVM classifiers (PredPPCrys II, which led to significantly enhanced prediction performance. Benchmarking experiments indicated that our PredPPCrys method outperforms most existing procedures on both up-to-date and previous datasets. In addition, the predicted crystallization

  19. Amino acid sequence of phospholipase A/sub 2/-. cap alpha. from the venom of Crotalus adamanteus

    Heinrikson, R.L.; Krueger, E.T.; Keim, P.S.

    1977-07-25

    The complete amino acid sequence of Crotalus adamanteus venom phospholipase A/sub 2/-..cap alpha.. has been determined by analysis of the five tryptic peptides from the citraconylated, reduced, and S-(/sup 14/C)carboxamidomethylated enzyme. Earlier studies provided the information necessary to align the tryptic fragments so that secondary cleavage procedures to establish overlaps were unnecessary. The subunit in the phospholipase A/sub 2/-..cap alpha.. dimer is a single polypeptide chain containing 122 amino acids and seven disulfide bonds. The histidine residue implicated in the active site of mammalian phospholipases is at position 47 in the C. adamanteus enzyme and is located in a domain of the molecule which is highly homologous in sequence with corresponding regions of phospholipases from a variety of venom and pancreatic sources. Comparative sequence analysis has revealed insights with regard to the function and evolution of phospholipases A/sub 2/. Primary structural relationships observed among the snake venom enzymes parallel the phylogenetic classification of the venomous reptiles from which they were derived. It is proposed that phospholipases A/sub 2/ of this general type be divided into two groups depending upon the presence or absence of distinctive structural features elucidated in this study.

  20. FeatureViewer, a BioJS component for visualization of position-based annotations in protein sequences

    Leyla Garcia; Guy Yachdav; Maria-Jesus Martin

    2014-01-01

    Summary: FeatureViewer is a BioJS component that lays out, maps, orients, and renders position-based annotations for protein sequences. This component is highly flexible and customizable, allowing the presentation of annotations by rows, all centered, or distributed in non-overlapping tracks. It uses either lines or shapes for sites and rectangles for regions. The result is a powerful visualization tool that can be easily integrated into web applications as well as documents as it provides an...

  1. 37 CFR 1.824 - Form and format for nucleotide and/or amino acid sequence submissions in computer readable form.

    2010-07-01

    ... nucleotide and/or amino acid sequence submissions in computer readable form. 1.824 Section 1.824 Patents... And/or Amino Acid Sequences § 1.824 Form and format for nucleotide and/or amino acid sequence... readable form may be created by any means, such as word processors, nucleotide/amino acid sequence...

  2. Draft genome sequence of the docosahexaenoic acid producing thraustochytrid Aurantiochytrium sp. T66.

    Liu, Bin; Ertesvåg, Helga; Aasen, Inga Marie; Vadstein, Olav; Brautaset, Trygve; Heggeset, Tonje Marita Bjerkan

    2016-06-01

    Thraustochytrids are unicellular, marine protists, and there is a growing industrial interest in these organisms, particularly because some species, including strains belonging to the genus Aurantiochytrium, accumulate high levels of docosahexaenoic acid (DHA). Here, we report the draft genome sequence of Aurantiochytrium sp. T66 (ATCC PRA-276), with a size of 43 Mbp, and 11,683 predicted protein-coding sequences. The data has been deposited at DDBJ/EMBL/Genbank under the accession LNGJ00000000. The genome sequence will contribute new insight into DHA biosynthesis and regulation, providing a basis for metabolic engineering of thraustochytrids. PMID:27222814

  3. Prediction of GPCR-G Protein Coupling Specificity Using Features of Sequences and Biological Functions

    Toshihide Ono; Haretsugu Hishigaki

    2006-01-01

    Understanding the coupling specificity between G protein-coupled receptors (GPCRs) and specific classes of G proteins is important for further elucidation of receptor functions within a cell. Increasing information on GPCR sequences and the G protein family would facilitate prediction of the coupling properties of GPCRs. In this study, we describe a novel approach for predicting the coupling specificity between GPCRs and G proteins. This method uses not only GPCR sequences but also the functional knowledge generated by natural language processing, and can achieve 92.2% prediction accuracy by using the C4.5 algorithm.Furthermore, rules related to GPCR-G protein coupling are generated. The combination of sequence analysis and text mining improves the prediction accuracy for GPCR-G protein coupling specificity, and also provides clues for understanding GPCR signaling.

  4. New families in the classification of glycosyl hydrolases based on amino acid sequence similarities.

    Henrissat, B; Bairoch, A

    1993-01-01

    301 glycosyl hydrolases and related enzymes corresponding to 39 EC entries of the I.U.B. classification system have been classified into 35 families on the basis of amino-acid-sequence similarities [Henrissat (1991) Biochem. J. 280, 309-316]. Approximately half of the families were found to be monospecific (containing only one EC number), whereas the other half were found to be polyspecific (containing at least two EC numbers). A > 60% increase in sequence data for glycosyl hydrolases (181 additional enzymes or enzyme domains sequences have since become available) allowed us to update the classification not only by the addition of more members to already identified families, but also by the finding of ten new families. On the basis of a comparison of 482 sequences corresponding to 52 EC entries, 45 families, out of which 22 are polyspecific, can now be defined. This classification has been implemented in the SWISS-PROT protein sequence data bank. PMID:8352747

  5. A Possible Mechanism of Zika Virus Associated Microcephaly: Imperative Role of Retinoic Acid Response Element (RARE) Consensus Sequence Repeats in the Viral Genome.

    Kumar, Ashutosh; Singh, Himanshu N; Pareek, Vikas; Raza, Khursheed; Dantham, Subrahamanyam; Kumar, Pavan; Mochan, Sankat; Faiq, Muneeb A

    2016-01-01

    Owing to the reports of microcephaly as a consistent outcome in the fetuses of pregnant women infected with ZIKV in Brazil, Zika virus (ZIKV)-microcephaly etiomechanistic relationship has recently been implicated. Researchers, however, are still struggling to establish an embryological basis for this interesting causal handcuff. The present study reveals robust evidence in favor of a plausible ZIKV-microcephaly cause-effect liaison. The rationale is based on: (1) sequence homology between ZIKV genome and the response element of an early neural tube developmental marker "retinoic acid" in human DNA and (2) comprehensive similarities between the details of brain defects in ZIKV-microcephaly and retinoic acid embryopathy. Retinoic acid is considered as the earliest factor for regulating anteroposterior axis of neural tube and positioning of structures in developing brain through retinoic acid response elements (RARE) consensus sequence (5'-AGGTCA-3') in promoter regions of retinoic acid-dependent genes. We screened genomic sequences of already reported virulent ZIKV strains (including those linked to microcephaly) and other viruses available in National Institute of Health genetic sequence database (GenBank) for the RARE consensus repeats and obtained results strongly bolstering our hypothesis that ZIKV strains associated with microcephaly may act through precipitation of dysregulation in retinoic acid-dependent genes by introducing extra stretches of RARE consensus sequence repeats in the genome of developing brain cells. Additional support to our hypothesis comes from our findings that screening of other viruses for RARE consensus sequence repeats is positive only for those known to display neurotropism and cause fetal brain defects (for which maternal-fetal transmission during developing stage may be required). The numbers of RARE sequence repeats appeared to match with the virulence of screened positive viruses. Although, bioinformatic evidence and embryological

  6. Identifying Learning Behaviors by Contextualizing Differential Sequence Mining with Action Features and Performance Evolution

    Kinnebrew, John S.; Biswas, Gautam

    2012-01-01

    Our learning-by-teaching environment, Betty's Brain, captures a wealth of data on students' learning interactions as they teach a virtual agent. This paper extends an exploratory data mining methodology for assessing and comparing students' learning behaviors from these interaction traces. The core algorithm employs sequence mining techniques to…

  7. Better prediction of protein contact number using a support vector regression analysis of amino acid sequence

    Yuan Zheng

    2005-10-01

    Full Text Available Abstract Background Protein tertiary structure can be partly characterized via each amino acid's contact number measuring how residues are spatially arranged. The contact number of a residue in a folded protein is a measure of its exposure to the local environment, and is defined as the number of Cβ atoms in other residues within a sphere around the Cβ atom of the residue of interest. Contact number is partly conserved between protein folds and thus is useful for protein fold and structure prediction. In turn, each residue's contact number can be partially predicted from primary amino acid sequence, assisting tertiary fold analysis from sequence data. In this study, we provide a more accurate contact number prediction method from protein primary sequence. Results We predict contact number from protein sequence using a novel support vector regression algorithm. Using protein local sequences with multiple sequence alignments (PSI-BLAST profiles, we demonstrate a correlation coefficient between predicted and observed contact numbers of 0.70, which outperforms previously achieved accuracies. Including additional information about sequence weight and amino acid composition further improves prediction accuracies significantly with the correlation coefficient reaching 0.73. If residues are classified as being either "contacted" or "non-contacted", the prediction accuracies are all greater than 77%, regardless of the choice of classification thresholds. Conclusion The successful application of support vector regression to the prediction of protein contact number reported here, together with previous applications of this approach to the prediction of protein accessible surface area and B-factor profile, suggests that a support vector regression approach may be very useful for determining the structure-function relation between primary protein sequence and higher order consecutive protein structural and functional properties.

  8. Complete amino acid sequence of branched-chain amino acid aminotransferase (transaminase B) of Salmonella typhimurium, identification of the coenzyme-binding site and sequence comparison analysis

    The complete amino acid sequence of the subunit of branched-chain amino acid aminotransferase of Salmonella typhimurium was determined by automated Edman degradation of peptide fragments generated by chemical and enzymatic digestion of S-carboxymethylated and S-pyridylethylated transaminase B. Peptide fragments of transaminase B were generated by treatment of the enzyme with trypsin, Staphylococcus aureus V8 protease, endoproteinase Lys-C, and cyanogen bromide. Protocols were developed for separation of the peptide fragments by reverse-phase high performance liquid chromatography (HPLC), ion-exchange HPLC, and SDS-urea gel electrophoresis. The enzyme subunit contains 308 amino acid residues and has a molecular weight of 33,920 daltons. The coenzyme-binding site was determined by treatment of the enzyme, containing bound pyridoxal 5-phosphate, with tritiated sodium borohydride prior to trypsin digestion. Monitoring radioactivity incorporation and peptide map comparisons with an apoenzyme tryptic digest, allowed identification of the pyridoxylated-peptide which was isolated by reverse-phase HPLC and sequenced. The coenzyme-binding site is a lysyl residue at position 159. Some peptides were further characterized by fast atom bombardment mass spectrometry

  9. The human receptor for urokinase plasminogen activator. NH2-terminal amino acid sequence and glycosylation variants

    Behrendt, N; Rønne, E; Ploug, M; Petri, T; Løber, D; Nielsen, L S; Schleuning, W D; Blasi, F; Appella, E; Danø, K

    1990-01-01

    -PA. The purified protein shows a single 55-60 kDa band after sodium dodecyl sulfate-polyacrylamide gel electrophoresis and silver staining. It is a heavily glycosylated protein, the deglycosylated polypeptide chain comprising only 35 kDa. The glycosylated protein contains N-acetyl-D-glucosamine and sialic...... acid, but no N-acetyl-D-galactosamine. Glycosylation is responsible for substantial heterogeneity in the receptor on phorbol ester-stimulated U937 cells, and also for molecular weight variations among various cell lines. The amino acid composition and the NH2-terminal amino acid sequence are reported...

  10. Seq2Logo: a method for construction and visualization of amino acid binding motifs and sequence profiles including sequence weighting, pseudo counts and two-sided representation of amino acid enrichment and depletion

    Thomsen, Martin Christen Frølund; Nielsen, Morten

    2012-01-01

    Seq2Logo is a web-based sequence logo generator. Sequence logos are a graphical representation of the information content stored in a multiple sequence alignment (MSA) and provide a compact and highly intuitive representation of the position-specific amino acid composition of binding motifs, active...... sites, etc. in biological sequences. Accurate generation of sequence logos is often compromised by sequence redundancy and low number of observations. Moreover, most methods available for sequence logo generation focus on displaying the position-specific enrichment of amino acids, discarding the equally...... valuable information related to amino acid depletion. Seq2logo aims at resolving these issues allowing the user to include sequence weighting to correct for data redundancy, pseudo counts to correct for low number of observations and different logotype representations each capturing different aspects...

  11. Coding Local and Global Binary Visual Features Extracted From Video Sequences.

    Baroffio, Luca; Canclini, Antonio; Cesana, Matteo; Redondi, Alessandro; Tagliasacchi, Marco; Tubaro, Stefano

    2015-11-01

    Binary local features represent an effective alternative to real-valued descriptors, leading to comparable results for many visual analysis tasks while being characterized by significantly lower computational complexity and memory requirements. When dealing with large collections, a more compact representation based on global features is often preferred, which can be obtained from local features by means of, e.g., the bag-of-visual word model. Several applications, including, for example, visual sensor networks and mobile augmented reality, require visual features to be transmitted over a bandwidth-limited network, thus calling for coding techniques that aim at reducing the required bit budget while attaining a target level of efficiency. In this paper, we investigate a coding scheme tailored to both local and global binary features, which aims at exploiting both spatial and temporal redundancy by means of intra- and inter-frame coding. In this respect, the proposed coding scheme can conveniently be adopted to support the analyze-then-compress (ATC) paradigm. That is, visual features are extracted from the acquired content, encoded at remote nodes, and finally transmitted to a central controller that performs the visual analysis. This is in contrast with the traditional approach, in which visual content is acquired at a node, compressed and then sent to a central unit for further processing, according to the compress-then-analyze (CTA) paradigm. In this paper, we experimentally compare the ATC and the CTA by means of rate-efficiency curves in the context of two different visual analysis tasks: 1) homography estimation and 2) content-based retrieval. Our results show that the novel ATC paradigm based on the proposed coding primitives can be competitive with the CTA, especially in bandwidth limited scenarios. PMID:26080384

  12. Molecular cloning and sequence analysis of cDNA encoding human prostatic acid phosphatase.

    Vihko, P; Virkkunen, P; Henttu, P; Roiko, K; Solin, T; Huhtala, M L

    1988-08-29

    lambda gt11 clones encoding human prostatic acid phosphatase (PAP) (EC 3.1.3.2) were isolated from human prostatic cDNA libraries by immunoscreening with polyclonal antisera. Sequence data obtained from several overlapping clones indicated that the composite cDNAs contained the complete coding region for PAP, which encodes a 354-residue protein with a calculated molecular mass of 41,126 Da. In the 5'-end, the cDNA codes for a signal peptide of 32 amino acids. Direct protein sequencing of the amino-terminus of the mature protein and its proteolytic fragments confirmed the identity of the predicted protein sequence. PAP has no apparent sequence homology to other known proteins. However, both the cDNA clones coding for human placental alkaline phosphatase and PAP have an alu-type repetitive sequence about 900 nucleotides downstream from the coding region in the 3'-untranslated region. Two of our cDNA clones differed from others at the 5'-ends. RNA blot analysis indicated mRNA of 3.3 kb. We are continuing to study whether acid phosphatases form a gene family as do alkaline phosphatases. PMID:2842184

  13. Draft Genome Sequence of Perfluorooctane Acid-Degrading Bacterium Pseudomonas parafulva YAB-1

    Yi, Langbo; Tang, Chongjian; Peng, Qingjing; Peng, Qingzhong; Chai, Liyuan

    2015-01-01

    Pseudomonas parafulva YAB-1, isolated from perfluorinated compound-contaminated soil, has the ability to degrade perfluorooctane acid (PFOA) compound. Here, we report the draft genome sequence and annotation of the PFOA-degrading bacterium P. parafulva YAB-1. The data provide the basis to investigate the molecular mechanism of PFOA metabolism.

  14. Draft Genome Sequence of Perfluorooctane Acid-Degrading Bacterium Pseudomonas parafulva YAB-1

    Tang, Chongjian; Peng, Qingjing; Peng, Qingzhong

    2015-01-01

    Pseudomonas parafulva YAB-1, isolated from perfluorinated compound-contaminated soil, has the ability to degrade perfluorooctane acid (PFOA) compound. Here, we report the draft genome sequence and annotation of the PFOA-degrading bacterium P. parafulva YAB-1. The data provide the basis to investigate the molecular mechanism of PFOA metabolism. PMID:26337877

  15. Unique Features of a Japanese ‘Candidatus Liberibacter asiaticus’ Strain Revealed by Whole Genome Sequencing

    Hiroshi Katoh; Shin-Ichi Miyata; Hiromitsu Inoue; Toru Iwanami

    2014-01-01

    Citrus greening (huanglongbing) is the most destructive disease of citrus worldwide. It is spread by citrus psyllids and is associated with phloem-limited bacteria of three species of α-Proteobacteria, namely, 'Candidatus Liberibacter asiaticus', 'Ca. L. americanus', and 'Ca. L. africanus'. Recent findings suggested that some Japanese strains lack the bacteriophage-type DNA polymerase region (DNA pol), in contrast to the Floridian psy62 strain. The whole genome sequence of the pol-negative 'C...

  16. Characterization of soybean genomic features by analysis of its expressed sequence tags

    Tian, Ai-Guo; Wang, Jun; Cui, Peng;

    2004-01-01

    to be fast-evolving. Soybean unigenes with no match to genes within the Arabidopsis genome were identified as soybean-specific genes. These genes were mainly involved in nodule development and the synthesis of seed storage proteins. In addition, we also identified 61 genes regulated by salicylic acid, 1...

  17. A Comparative Analysis of Feature Selection Methods for Clustering DNA Sequences

    B.Umamageswari

    2012-04-01

    Full Text Available Large-scale analysis of genome sequences is in progress around the world, the major application ofwhich is to establish the evolutionary relationship among the species using phylogenetic trees.Hierarchical agglomerative algorithms can be used to generate such phylogenetic trees given thedistance matrix representing the dissimilarity among the species. ClustalW and Muscle are twogeneral purpose programs that generates distance matrix from the input DNA or protein sequences.The limitation of these programs is that they are based on Smith-Waterman algorithm which usesdynamic programming for doing the pair-wise alignment. This is an extremely time consuming processand the existing systems may even fail to work for larger input data set. To overcome this limitation,we have used the frequency of codons usage as an approximation to find dissimilarity amongspecies. The proposed technique further reduces the complexity by extracting only the significantfeatures of the species from the mtDNA sequences using the techniques like frequent codons, codonswith maximum range value or PCA technique. We have observed that the proposed system producesnearly accurate results in a significantly reduced running time.

  18. Use of a structural alphabet to find compatible folds for amino acid sequences.

    Mahajan, Swapnil; de Brevern, Alexandre G; Sanejouand, Yves-Henri; Srinivasan, Narayanaswamy; Offmann, Bernard

    2015-01-01

    The structural annotation of proteins with no detectable homologs of known 3D structure identified using sequence-search methods is a major challenge today. We propose an original method that computes the conditional probabilities for the amino-acid sequence of a protein to fit to known protein 3D structures using a structural alphabet, known as "Protein Blocks" (PBs). PBs constitute a library of 16 local structural prototypes that approximate every part of protein backbone structures. It is used to encode 3D protein structures into 1D PB sequences and to capture sequence to structure relationships. Our method relies on amino acid occurrence matrices, one for each PB, to score global and local threading of query amino acid sequences to protein folds encoded into PB sequences. It does not use any information from residue contacts or sequence-search methods or explicit incorporation of hydrophobic effect. The performance of the method was assessed with independent test datasets derived from SCOP 1.75A. With a Z-score cutoff that achieved 95% specificity (i.e., less than 5% false positives), global and local threading showed sensitivity of 64.1% and 34.2%, respectively. We further tested its performance on 57 difficult CASP10 targets that had no known homologs in PDB: 38 compatible templates were identified by our approach and 66% of these hits yielded correctly predicted structures. This method scales-up well and offers promising perspectives for structural annotations at genomic level. It has been implemented in the form of a web-server that is freely available at http://www.bo-protscience.fr/forsa. PMID:25297700

  19. ProViz-a web-based visualization tool to investigate the functional and evolutionary features of protein sequences.

    Jehl, Peter; Manguy, Jean; Shields, Denis C; Higgins, Desmond G; Davey, Norman E

    2016-07-01

    Low-throughput experiments and high-throughput proteomic and genomic analyses have created enormous quantities of data that can be used to explore protein function and evolution. The ability to consolidate these data into an informative and intuitive format is vital to our capacity to comprehend these distinct but complementary sources of information. However, existing tools to visualize protein-related data are restricted by their presentation, sources of information, functionality or accessibility. We introduce ProViz, a powerful browser-based tool to aid biologists in building hypotheses and designing experiments by simplifying the analysis of functional and evolutionary features of proteins. Feature information is retrieved in an automated manner from resources describing protein modular architecture, post-translational modification, structure, sequence variation and experimental characterization of functional regions. These features are mapped to evolutionary information from precomputed multiple sequence alignments. Data are displayed in an interactive and information-rich yet intuitive visualization, accessible through a simple protein search interface. This allows users with limited bioinformatic skills to rapidly access data pertinent to their research. Visualizations can be further customized with user-defined data either manually or using a REST API. ProViz is available at http://proviz.ucd.ie/. PMID:27085803

  20. Software scripts for quality checking of high-throughput nucleic acid sequencers.

    Lazo, G R; Tong, J; Miller, R; Hsia, C; Rausch, C; Kang, Y; Anderson, O D

    2001-06-01

    We have developed a graphical interface to allow the researcher to view and assess the quality of sequencing results using a series of program scripts developed to process data generated by automated sequencers. The scripts are written in Perl programming language and are executable under the cgibin directory of a Web server environment. The scripts direct nucleic acid sequencing trace file data output from automated sequencers to be analyzed by the phred molecular biology program and are displayed as graphical hypertext mark-up language (HTML) pages. The scripts are mainly designed to handle 96-well microtiter dish samples, but the scripts are also able to read data from 384-well microtiter dishes 96 samples at a time. The scripts may be customized for different laboratory environments and computer configurations. Web links to the sources and discussion page are provided. PMID:11414222

  1. Amino acid sequences and structures of chicken and turkey beta 2-microglobulin

    Welinder, K G; Jespersen, H M; Walther-Rasmussen, J; Skjødt, K

    The complete amino acid sequences of chicken and turkey beta 2-microglobulins have been determined by analyses of tryptic, V8-proteolytic and cyanogen bromide fragments, and by N-terminal sequencing. Mass spectrometric analysis of chicken beta 2-microglobulin supports the sequence-derived Mr of 11......,048. The higher apparent Mr obtained for the avian beta 2-microglobulins as compared to human beta 2-microglobulin by SDS-PAGE is not understood. Chicken and turkey beta 2-microglobulin consist of 98 residues and deviate at seven positions: 60, 66, 74-76, 78 and 82. The chicken and turkey sequences are...... complex suggest that the seven chicken to turkey differences are exposed to solvent in the avian MHC class I complex. The key residues of beta 2-microglobulin involved in alpha chain contacts within the MHC class I molecule are highly conserved between chicken and man. This explains that heterologous...

  2. Face Recognition from Still Images to Video Sequences: A Local-Feature-Based Framework

    Shaokang Chen; Sandra Mau; Harandi, Mehrtash T.; Conrad Sanderson; Abbas Bigdeli; Lovell, Brian C.

    2011-01-01

    Although automatic faces recognition has shown success for high-quality images under controlled conditions, for video-based recognition it is hard to attain similar levels of performance. We describe in this paper recent advances in a project being undertaken to trial and develop advanced surveillance systems for public safety. In this paper, we propose a local facial feature based framework for both still image and video-based face recognition. The evaluation is performed on a still image d...

  3. Unique Features of a Japanese ‘Candidatus Liberibacter asiaticus’ Strain Revealed by Whole Genome Sequencing

    Katoh, Hiroshi; Miyata, Shin-ichi; Inoue, Hiromitsu; Iwanami, Toru

    2014-01-01

    Citrus greening (huanglongbing) is the most destructive disease of citrus worldwide. It is spread by citrus psyllids and is associated with phloem-limited bacteria of three species of α-Proteobacteria, namely, ‘Candidatus Liberibacter asiaticus’, ‘Ca. L. americanus’, and ‘Ca. L. africanus’. Recent findings suggested that some Japanese strains lack the bacteriophage-type DNA polymerase region (DNA pol), in contrast to the Floridian psy62 strain. The whole genome sequence of the pol-negative ‘C...

  4. Sequence Features of Drosha and Dicer Cleavage Sites Affect the Complexity of IsomiRs

    Julia Starega-Roslan; Witkos, Tomasz M.; Paulina Galka-Marciniak; Krzyzosiak, Wlodzimierz J.

    2015-01-01

    The deep-sequencing of small RNAs has revealed that different numbers and proportions of miRNA variants called isomiRs are formed from single miRNA genes and that this effect is attributable mainly to imprecise cleavage by Drosha and Dicer. Factors that influence the degree of cleavage precision of Drosha and Dicer are under investigation, and their identification may improve our understanding of the mechanisms by which cells modulate the regulatory potential of miRNAs. In this study, we focu...

  5. Nucleotide sequence analysis of the gene encoding the Deinococcus radiodurans surface protein, derived amino acid sequence, and complementary protein chemical studies

    Peters, J.; Peters, M.; Lottspeich, F.; Schaefer, W.; Baumeister, W.

    1987-11-01

    The complete nucleotide sequence of the gene encoding the surface (hexagonally packed intermediate (HPI))-layer polypeptide of Deinococcus radiodurans Sark was determined and found to encode a polypeptide of 1036 amino acids. Amino acid sequence analysis of about 30% of the residues revealed that the mature polypeptide consists of at least 978 amino acids. The N terminus was blocked to Edman degradation. The results of proteolytic modification of the HPI layer in situ and M/sub r/ estimations of the HPI polypeptide expressed in Escherichia coli indicated that there is a leader sequence. The N-terminal region contained a very high percentage (29%) of threonine and serine, including a cluster of nine consecutive serine or threonine residues, whereas a stretch near the C terminus was extremely rich in aromatic amino acids (29%). The protein contained at least two disulfide bridges, as well as tightly bound reducing sugars and fatty acids.

  6. Nucleotide sequence analysis of the gene encoding the Deinococcus radiodurans surface protein, derived amino acid sequence, and complementary protein chemical studies

    The complete nucleotide sequence of the gene encoding the surface (hexagonally packed intermediate [HPI])-layer polypeptide of Deinococcus radiodurans Sark was determined and found to encode a polypeptide of 1036 amino acids. Amino acid sequence analysis of about 30% of the residues revealed that the mature polypeptide consists of at least 978 amino acids. The N terminus was blocked to Edman degradation. The results of proteolytic modification of the HPI layer in situ and M/sub r/ estimations of the HPI polypeptide expressed in Escherichia coli indicated that there is a leader sequence. The N-terminal region contained a very high percentage (29%) of threonine and serine, including a cluster of nine consecutive serine or threonine residues, whereas a stretch near the C terminus was extremely rich in aromatic amino acids (29%). The protein contained at least two disulfide bridges, as well as tightly bound reducing sugars and fatty acids

  7. Efficient Nucleic Acid Extraction and 16S rRNA Gene Sequencing for Bacterial Community Characterization.

    Anahtar, Melis N; Bowman, Brittany A; Kwon, Douglas S

    2016-01-01

    There is a growing appreciation for the role of microbial communities as critical modulators of human health and disease. High throughput sequencing technologies have allowed for the rapid and efficient characterization of bacterial communities using 16S rRNA gene sequencing from a variety of sources. Although readily available tools for 16S rRNA sequence analysis have standardized computational workflows, sample processing for DNA extraction remains a continued source of variability across studies. Here we describe an efficient, robust, and cost effective method for extracting nucleic acid from swabs. We also delineate downstream methods for 16S rRNA gene sequencing, including generation of sequencing libraries, data quality control, and sequence analysis. The workflow can accommodate multiple samples types, including stool and swabs collected from a variety of anatomical locations and host species. Additionally, recovered DNA and RNA can be separated and used for other applications, including whole genome sequencing or RNA-seq. The method described allows for a common processing approach for multiple sample types and accommodates downstream analysis of genomic, metagenomic and transcriptional information. PMID:27168460

  8. Global features of sequences of bacterial chromosomes, plasmids and phages revealed by analysis of oligonucleotide usage patterns

    Tümmler Burkhard

    2004-07-01

    Full Text Available Abstract Background Oligonucleotide frequencies were shown to be conserved signatures for bacterial genomes, however, the underlying constraints have yet not been resolved in detail. In this paper we analyzed oligonucleotide usage (OU biases in a comprehensive collection of 155 completely sequenced bacterial chromosomes, 316 plasmids and 104 phages. Results Two global features were analyzed: pattern skew (PS and variance of OU deviations normalized by mononucleotide content of the sequence (OUV. OUV reflects the strength of OU biases and taxonomic signals. PS denotes asymmetry of OU in direct and reverse DNA strands. A trend towards minimal PS was observed for almost all complete sequences of bacterial chromosomes and plasmids, however, PS was substantially higher in separate genomic loci and several types of plasmids and phages characterized by long stretches of non-coding DNA and/or asymmetric gene distribution on the two DNA strands. Five of the 155 bacterial chromosomes have anomalously high PS, of which the chromosomes of Xylella fastidiosa 9a5c and Prochlorococcus marinus MIT9313 exhibit extreme PS values suggesting an intermediate unstable state of these two genomes. Conclusions Strand symmetry as indicated by minimal PS is a universally conserved feature of complete bacterial genomes that results from the matching mutual compensation of local OU biases on both replichors while OUV is more a taxon specific feature. Local events such as inversions or the incorporation of genome islands are balanced by global changes in genome organization to minimize PS that may represent one of the leading evolutionary forces driving bacterial genome diversification.

  9. Preparation of Nucleic Acid Libraries for Personalized Sequencing Systems Using an Integrated Microfluidic Hub Technology (Seventh Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting 2012)

    Patel, Kamlesh D [Ken; SNL,

    2012-06-01

    Kamlesh (Ken) Patel from Sandia National Laboratories (Livermore, California) presents "Preparation of Nucleic Acid Libraries for Personalized Sequencing Systems Using an Integrated Microfluidic Hub Technology " at the 7th Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting held in June, 2012 in Santa Fe, NM.

  10. Emotion Recognition based on 2D-3D Facial Feature Extraction from Color Image Sequences

    Robert Niese

    2010-10-01

    Full Text Available Normal 0 21 false false false DE X-NONE X-NONE /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Normale Tabelle"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-qformat:yes; mso-style-parent:""; mso-padding-alt:0cm 5.4pt 0cm 5.4pt; mso-para-margin:0cm; mso-para-margin-bottom:.0001pt; mso-pagination:widow-orphan; font-size:11.0pt; font-family:"Calibri","sans-serif"; mso-ascii-font-family:Calibri; mso-ascii-theme-font:minor-latin; mso-fareast-font-family:"Times New Roman"; mso-fareast-theme-font:minor-fareast; mso-hansi-font-family:Calibri; mso-hansi-theme-font:minor-latin; mso-bidi-font-family:"Times New Roman"; mso-bidi-theme-font:minor-bidi;} In modern human computer interaction systems, emotion recognition from video is becoming an imperative feature. In this work we propose a new method for automatic recognition of facial expressions related to categories of basic emotions from image data. Our method incorporates a series of image processing, low level 3D computer vision and pattern recognition techniques. For image feature extraction, color and gradient information is used. Further, in terms of 3D processing, camera models are applied along with an initial registration step, in which person specific face models are automatically built from stereo. Based on these face models, geometric feature measures are computed and normalized using photogrammetric techniques. For recognition this normalization leads to minimal mixing between different emotion classes, which are determined with an artificial neural network classifier. Our framework achieves robust and superior classification results, also across a variety of head poses with resulting perspective foreshortening and changing face size. Results are presented for domestic and publicly available databases.

  11. MRI Sequence and Characteristic Features in ‘Giant Cell Tumor’ of Clivus

    Mahale, Ajit; K.V.N, Dhananjaya; Pai, Muralidhar; Poornima, Vinaya; Sahu, Kausalya Kumari

    2013-01-01

    Giant cell tumours of the clivus are rare. These tumours present in the second and third decades of life and they are slightly more frequent in women than in men. We are presenting a case of a 20 years young patient who came with the complaints of headache, retro-orbital pain and recurrent transient bleeding from the nose since two and half months. MRI of the brain with contrast was done and its features were suggestive of a Giant cell tumour of the clivus. A transnasal endoscopic biopsy was ...

  12. Human liver type pyruvate kinase: Complete amino acid sequence and the expression in mammalian cells

    Pyruvate kinase (PK) has four isozymes (L, R, M1, M2) that are encoded by two different genes. Among these isozymes, abnormalities of liver (L)-type PK is considered to be associated with hereditary nonspherocytic hemolytic anemia in humans. The authors isolated and determined the full-length sequence of human L-type PK cDNA. The cDNA contains 1,629 base pairs encoding 543 amino acids, 68 base pairs of 5'-noncoding sequence, and 734 base pairs of 3'-noncoding sequence. The similarity between human and rat L-type PK was 86.9% at the nucleotide sequence level and 92.4% at the amino acid sequence level. The full-length L-type PK cDNA was placed under the promoter of simian virus 40 and introduced into monkey COS cells. Human L-type PK activity was detected in the extract of COS cells by the classical PK electrophoresis method

  13. Complete nucleic acid sequence of Penaeus stylirostris densovirus (PstDNV) from India.

    Rai, Praveen; Safeena, Muhammed P; Karunasagar, Iddya; Karunasagar, Indrani

    2011-06-01

    Infectious hypodermal and hematopoietic necrosis virus (IHHNV) of shrimp, recently been classified as Penaeus stylirostris densovirus (PstDNV). The complete nucleic acid sequence of PstDNV from India was obtained by cloning and sequencing of different DNA fragment of the virus. The genome organisation of PstDNV revealed that there were three major coding domains: a left ORF (NS1) of 2001 bp, a mid ORF (NS2) of 1092 bp and a right ORF (VP) of 990 bp. The complete genome and amino acid sequences of three proteins viz., NS1, NS2 and VP were compared with the genomes of the virus reported from Hawaii, China and Mexico and with partial sequence available from isolates from different regions. The phylogenetic analysis of shrimp, insect and vertebrate parvovirus sequences showed that the Indian PstDNV isolate is phylogenetically more closely related to one of the three isolates from Taiwan (AY355307), and two isolates (AY362547 and AY102034) from Thailand. PMID:21402111

  14. Mutation-selection models of coding sequence evolution with site-heterogeneous amino acid fitness profiles.

    Rodrigue, Nicolas; Philippe, Hervé; Lartillot, Nicolas

    2010-03-01

    Modeling the interplay between mutation and selection at the molecular level is key to evolutionary studies. To this end, codon-based evolutionary models have been proposed as pertinent means of studying long-range evolutionary patterns and are widely used. However, these approaches have not yet consolidated results from amino acid level phylogenetic studies showing that selection acting on proteins displays strong site-specific effects, which translate into heterogeneous amino acid propensities across the columns of alignments; related codon-level studies have instead focused on either modeling a single selective context for all codon columns, or a separate selective context for each codon column, with the former strategy deemed too simplistic and the latter deemed overparameterized. Here, we integrate recent developments in nonparametric statistical approaches to propose a probabilistic model that accounts for the heterogeneity of amino acid fitness profiles across the coding positions of a gene. We apply the model to a dozen real protein-coding gene alignments and find it to produce biologically plausible inferences, for instance, as pertaining to site-specific amino acid constraints, as well as distributions of scaled selection coefficients. In their account of mutational features as well as the heterogeneous regimes of selection at the amino acid level, the modeling approaches studied here can form a backdrop for several extensions, accounting for other selective features, for variable population size, or for subtleties of mutational features, all with parameterizations couched within population-genetic theory. PMID:20176949

  15. Specific features of sulfuric acid leaching-out of lanthanides from phosphosemihydrate

    Effect of increase in the temperature of synthesis of hydrated lanthanide orthophosphates in the range of 75-95 deg C on the degree of their chemical activity and, accordingly, on specific features of their leaching with sulfuric acid was studied. It has been ascertained that during thermal treatment of humid lanthanide orthophosphates LnPO4·(1-1.5)H2O (Ln = La, Ce or Nd) in the presence of 70 wt. % H3PO4 (their formation conditions in the course of semihydrate decomposition of apatite concentrate) increase in thermal treatment temperature from 75 to 95 deg C decreases their solubility in sulfuric acid solution by a factor of 3-4, in all probability due to reduction of their hydration degree. Therefore, insignificant increase in the temperature of semihydrate process of phosphoric acid decomposition of the Khibiny apatite can result in a noticeable decrease in chemical activity of hydrated lanthanides orthophosphates. The restoration mechanism of the lanthanide compounds chemical activity was considered

  16. MRI sequence and characteristic features in 'giant cell tumor' of clivus.

    Mahale, Ajit; K V N, Dhananjaya; Pai, Muralidhar; Poornima, Vinaya; Sahu, Kausalya Kumari

    2013-06-01

    Giant cell tumours of the clivus are rare. These tumours present in the second and third decades of life and they are slightly more frequent in women than in men. We are presenting a case of a 20 years young patient who came with the complaints of headache, retro-orbital pain and recurrent transient bleeding from the nose since two and half months. MRI of the brain with contrast was done and its features were suggestive of a Giant cell tumour of the clivus. A transnasal endoscopic biopsy was done under general anaesthesia and the histopathology report suggested that the features were of a giant cell tumour. Excision of the mass was done by Transnasal endoscopy. Post operatively, the patient did not recover from the lateral rectus palsy which was there on the right side. The patient was discharged with an advice of a follow up and radiotherapy. Radiation therapy and chemotherapy may be effective as adjuvant treatments. Even though a recurrence usually occurs within 4 years of the initial treatment, these patients will need to be carefully followed for the remainder of their lives. PMID:23905141

  17. Nucleotide and amino acid sequences of human intestinal alkaline phosphatase: close homology to placental alkaline phosphatase

    A cDNA clone for human adult intestinal alkaline phosphatase (ALP) [orthophosphoric-monoester phosphohydrolase (alkaline optimum); EC 3.1.3.1] was isolated from a λgt11 expression library. The cDNA insert of this clone is 2513 base pairs in length and contains an open reading frame that encodes a 528-amino acid polypeptide. This deduced polypeptide contains the first 40 amino acids of human intestinal ALP, as determined by direct protein sequencing. Intestinal ALP shows 86.5% amino acid identity to placental (type 1) ALP and 56.6% amino acid identity to liver/bone/kidney ALP. In the 3'-untranslated regions, intestinal and placental ALP cDNAs are 73.5% identical (excluding gaps). The evolution of this multigene enzyme family is discussed

  18. Human apolipoprotein C-II: complete nucleic acid sequence of preapolipoprotein C-II.

    Fojo, S S; Law, S W; Brewer, H B

    1984-01-01

    Apolipoprotein (apo) C-II is a cofactor for lipoprotein lipase, the enzyme that catalyzes the hydrolysis of triglycerides on plasma triglyceride-rich lipoproteins. The complete coding sequence of apoC-II mRNA has been determined from an apoC-II clone isolated from a human liver cDNA library. A 17-base-long synthetic oligonucleotide based on amino acid residues 5-10 of apoC-II was utilized as a hybridization probe to select recombinant plasmids containing the apoC-II sequence. Two thousand fou...

  19. Amino acid sequence of the beta subunit of bovine lung casein kinase II.

    Takio, K.; Kuenzel, E A; Walsh, K. A.; Krebs, E G

    1987-01-01

    The amino acid sequence of the 209-residue beta subunit of bovine lung casein kinase II has been determined. Excluding the amino-terminal blocking group, which was not identified, the molecular weight of the polypeptide chain is 24,239. A marked polarity of the beta subunit is indicated by clusters of negative charges in the amino-terminal region and of positive charges in the carboxyl-terminal region. Whereas the beta subunit shows no homology with any known protein, a segment of the sequenc...

  20. Accurate in silico identification of species-specific acetylation sites by integrating protein sequence-derived and functional features

    Li, Yuan; Wang, Mingjun; Wang, Huilin; Tan, Hao; Zhang, Ziding; Webb, Geoffrey I.; Song, Jiangning

    2014-07-01

    Lysine acetylation is a reversible post-translational modification, playing an important role in cytokine signaling, transcriptional regulation, and apoptosis. To fully understand acetylation mechanisms, identification of substrates and specific acetylation sites is crucial. Experimental identification is often time-consuming and expensive. Alternative bioinformatics methods are cost-effective and can be used in a high-throughput manner to generate relatively precise predictions. Here we develop a method termed as SSPKA for species-specific lysine acetylation prediction, using random forest classifiers that combine sequence-derived and functional features with two-step feature selection. Feature importance analysis indicates functional features, applied for lysine acetylation site prediction for the first time, significantly improve the predictive performance. We apply the SSPKA model to screen the entire human proteome and identify many high-confidence putative substrates that are not previously identified. The results along with the implemented Java tool, serve as useful resources to elucidate the mechanism of lysine acetylation and facilitate hypothesis-driven experimental design and validation.

  1. Structural and Morphological Features of Acid-Bearing Polymers for PEM Fuel Cells

    Yang, Yunsong; Siu, Ana; Peckham, Timothy J.;

    2008-01-01

    Chemical structure, polymer microstructure, sequence distribution, and morphology of acid-bearing polymers are important factors in the design of polymer electrolyte membranes (PEMs) for fuel cells. The roles of ion aggregation and phase separation in vinylic- and aromatic-based polymers in proton...... conductivity and water transport are described. The formation, dimensions, and connectivity of ionic pathways are consistently found to play an important role in determining the physicochemical properties of PEMs. For polymers that possess low water content, phase separation and ionic channel formation...... significantly enhance the transport of water and protons. For membranes that contain a high content of water, phase separation is less influential. Continuity of ionic aggregates is influential on the diffusion of water and electroosmotic drag within a membrane. A balance of these properties must be considered...

  2. Sequence-specific nucleic acid detection from binary pore conductance measurement

    Esfandiari, Leyla; Monbouquette, Harold G.; Jacob J. Schmidt

    2012-01-01

    We describe a platform for sequence-specific nucleic acid (NA) detection utilizing a micropipette tapered to a 2 μm diameter pore and 3 μm diameter polystyrene beads to which uncharged peptide nucleic acid (PNA) probe molecules have been conjugated. As the target NAs hybridize to the complementary PNA-beads, the beads acquire negative charge and become electrophoretically mobile. An applied electric field guides these NA-PNA-beads toward the pipette tip, which they obstruct, leading to an ind...

  3. Nucleotide sequence homology between the heat-labile enterotoxin gene of Escherichia coli and Vibrio cholerae deoxyribonucleic acid.

    Moseley, S L; Falkow, S

    1980-01-01

    Isolated deoxyribonucleic acid fragments encoding the heat-labile enterotoxin of Escherichia coli were used to probe for homologous sequences in restricted whole-cell deoxyribonucleic acid from Vibrio cholerae. Significant sequence homology between the heat-labile enterotoxin gene and V. cholerae deoxyribonucleic acid was demonstrated, and apparent differences were observed in the organization of the cholera toxin gene among different strains of V. cholerae.

  4. New features in the genus Ilarvirus revealed by the nucleotide sequence of Fragaria chiloensis latent virus.

    Tzanetakis, Ioannis E; Martin, Robert R

    2005-09-01

    Fragaria chiloensis latent virus (FClLV), a member of the genus Ilarvirus was first identified in the early 1990s. Double-stranded RNA was extracted from FClLV infected plants and cloned. The complete nucleotide sequence of the virus has been elucidated. RNA 1 encodes a protein with methyltransferase and helicase enzymatic motifs while RNA 2 encodes the viral RNA dependent RNA polymerase and an ORF, that shares no homology with other Ilarvirus genes. RNA 3 codes for movement and coat proteins and an additional ORF, making FClLV possibly the first Ilarvirus encoding a third protein in RNA 3. Phylogenetic analysis reveals that FClLV is most closely related to Prune dwarf virus, the type member of subgroup 4 of the Ilarvirus genus. FClLV is also closely related to Alfalfa mosaic virus (AlMV), a virus that shares many properties with Ilarviruses . We propose the reclassification of AlMV as a member of the Ilarvirus genus instead of being a member of a distinct genus. PMID:15878214

  5. The complete chloroplast genome sequence of Aster spathulifolius (Asteraceae); genomic features and relationship with Asteraceae.

    Choi, Kyoung Su; Park, SeonJoo

    2015-11-10

    Aster spathulifolius, a member of the Asteraceae family, is distributed along the coast of Japan and Korea. This plant is used for medicinal and ornamental purposes. The complete chloroplast (cp) genome of A. sphathulifolius consists of 149,473 bp that include a pair of inverted repeats of 24,751 bp separated by a large single copy region of 81,998 bp and a small single copy region of 17,973 bp. The chloroplast genome contains 78 coding genes, four rRNA genes and 29 tRNA genes. When compared to other cpDNA sequences of Asteraceae, A. spathulifolius showed the closest relationship with Jacobaea vulgaris, and its atpB gene was found to be a pseudogene, unlike J. vulgaris. Furthermore, evaluation of the gene compositions of J. vulgaris, Helianthus annuus, Guizotia abyssinica and A. spathulifolius revealed that 13.6-kb showed inversion from ndhF to rps15, unlike Lactuca of Asteraceae. Comparison of the synonymous (Ks) and nonsynonymous (Ka) substitution rates with J. vulgaris revealed that synonymous genes related to a small subunit of the ribosome showed the highest value (0.1558), while nonsynonymous rates of genes related to ATP synthase genes were highest (0.0118). These findings revealed that substitution has occurred at similar rates in most genes, and the substitution rates suggested that most genes is a purified selection. PMID:26164759

  6. Unique features of a Japanese 'Candidatus Liberibacter asiaticus' strain revealed by whole genome sequencing.

    Hiroshi Katoh

    Full Text Available Citrus greening (huanglongbing is the most destructive disease of citrus worldwide. It is spread by citrus psyllids and is associated with phloem-limited bacteria of three species of α-Proteobacteria, namely, 'Candidatus Liberibacter asiaticus', 'Ca. L. americanus', and 'Ca. L. africanus'. Recent findings suggested that some Japanese strains lack the bacteriophage-type DNA polymerase region (DNA pol, in contrast to the Floridian psy62 strain. The whole genome sequence of the pol-negative 'Ca. L. asiaticus' Japanese isolate Ishi-1 was determined by metagenomic analysis of DNA extracted from 'Ca. L. asiaticus'-infected psyllids and leaf midribs. The 1.19-Mb genome has an average 36.32% GC content. Annotation revealed 13 operons encoding rRNA and 44 tRNA genes, but no typical bacterial pathogenesis-related genes were located within the genome, similar to the Floridian psy62 and Chinese gxpsy. In contrast to other 'Ca. L. asiaticus' strains, the genome of the Japanese Ishi-1 strain lacks a prophage-related region.

  7. Self-Sequencing of Amino Acids and Origins of Polyfunctional Protocells

    Fox, Sidney W.

    1984-12-01

    The primal role of the origins of proteins in molecular evolution is discussed. On the basis of this premise, the significance of the experimentally established self-sequencing of amino acids under simulated geological conditions is explained as due to the fact that the products are highly nonrandom and accordingly contain many kinds of information. When such thermal proteins are aggregated into laboratory protocells, an action that occurs readily, the resultant protocells also contain many kinds of information. Residue-by-residue order, enzymic activities, and lipid quality accordingly occur within each preparation of proteinoid (thermal protein). In this paper are reviewed briefly the phenomenon of self-sequencing of amino acids, its relationship to evolutionary processes, other significance of such self-ordering, and the experimental evidence for original polyfunctional protocells.

  8. A Systematic Evaluation of Feature Selection and Classification Algorithms Using Simulated and Real miRNA Sequencing Data.

    Yang, Sheng; Guo, Li; Shao, Fang; Zhao, Yang; Chen, Feng

    2015-01-01

    Sequencing is widely used to discover associations between microRNAs (miRNAs) and diseases. However, the negative binomial distribution (NB) and high dimensionality of data obtained using sequencing can lead to low-power results and low reproducibility. Several statistical learning algorithms have been proposed to address sequencing data, and although evaluation of these methods is essential, such studies are relatively rare. The performance of seven feature selection (FS) algorithms, including baySeq, DESeq, edgeR, the rank sum test, lasso, particle swarm optimistic decision tree, and random forest (RF), was compared by simulation under different conditions based on the difference of the mean, the dispersion parameter of the NB, and the signal to noise ratio. Real data were used to evaluate the performance of RF, logistic regression, and support vector machine. Based on the simulation and real data, we discuss the behaviour of the FS and classification algorithms. The Apriori algorithm identified frequent item sets (mir-133a, mir-133b, mir-183, mir-937, and mir-96) from among the deregulated miRNAs of six datasets from The Cancer Genomics Atlas. Taking these findings altogether and considering computational memory requirements, we propose a strategy that combines edgeR and DESeq for large sample sizes. PMID:26508990

  9. A Systematic Evaluation of Feature Selection and Classification Algorithms Using Simulated and Real miRNA Sequencing Data

    Sheng Yang

    2015-01-01

    Full Text Available Sequencing is widely used to discover associations between microRNAs (miRNAs and diseases. However, the negative binomial distribution (NB and high dimensionality of data obtained using sequencing can lead to low-power results and low reproducibility. Several statistical learning algorithms have been proposed to address sequencing data, and although evaluation of these methods is essential, such studies are relatively rare. The performance of seven feature selection (FS algorithms, including baySeq, DESeq, edgeR, the rank sum test, lasso, particle swarm optimistic decision tree, and random forest (RF, was compared by simulation under different conditions based on the difference of the mean, the dispersion parameter of the NB, and the signal to noise ratio. Real data were used to evaluate the performance of RF, logistic regression, and support vector machine. Based on the simulation and real data, we discuss the behaviour of the FS and classification algorithms. The Apriori algorithm identified frequent item sets (mir-133a, mir-133b, mir-183, mir-937, and mir-96 from among the deregulated miRNAs of six datasets from The Cancer Genomics Atlas. Taking these findings altogether and considering computational memory requirements, we propose a strategy that combines edgeR and DESeq for large sample sizes.

  10. Sequence-selective targeting of duplex DNA by peptide nucleic acids

    Nielsen, Peter E

    2010-01-01

    nucleic acid (PNA) can recognize duplex DNA with high sequence specificity and affinity in triplex, duplex and double-duplex invasive modes or non-invasive triplex modes. Novel PNA modification has improved the affinity for DNA recognition via duplex invasion, double-duplex invasion and triplex......Sequence-selective gene targeting constitutes an attractive drug-discovery approach for genetic therapy, with the aim of reducing or enhancing the activity of specific genes at the transcriptional level, or as part of a methodology for targeted gene repair. The pseudopeptide DNA mimic peptide...... recognition considerably. Such modifications have also resulted in new approaches to targeted gene repair and sequence-selective double-strand cleavage of genomic DNA....

  11. Amino acid sequences mediating vascular cell adhesion molecule 1 binding to integrin alpha 4: homologous DSP sequence found for JC polyoma VP1 coat protein

    Michael Andrew Meyer

    2013-07-01

    Full Text Available The JC polyoma viral coat protein VP1 was analyzed for amino acid sequences homologies to the IDSP sequence which mediates binding of VLA-4 (integrin alpha 4 to vascular cell adhesion molecule 1. Although the full sequence was not found, a DSP sequence was located near the critical arginine residue linked to infectivity of the virus and binding to sialic acid containing molecules such as integrins (3. For the JC polyoma virus, a DSP sequence was found at residues 70, 71 and 72 with homology also noted for the mouse polyoma virus and SV40 virus. Three dimensional modeling of the VP1 molecule suggests that the DSP loop has an accessible site for interaction from the external side of the assembled viral capsid pentamer.

  12. Adsorptive features of poli(acrylic acid-co-hydroxyapatite) composite for UO22+

    The copolymer of poli(acrylic acid-co-hydroxyapatite) (PAA-HAP) was prepared and characterized by means of FT-IR and SEM analysis. The adsorptive features of PAA-HAP for UO22+ was studied as a function of pH, adsorbent dosage, initial metal ion concentration and temperature. The adsorption isotherm data fitted well to the Langmuir isotherm model. The adsorbed UO22+ can be desorbed effectively by 0.1 M HNO3. The maximum adsorption capacities for UO22+ of the dry PAA-HAP was 1.86 x 10-4 mol/g. The high adsorption capacity and kinetics results indicate that PAA-HAP can be used as an alternative adsorbent to remove UO22+ from aqueous solution. (author)

  13. Random amino acid mutations and protein misfolding lead to Shannon limit in sequence-structure communication.

    Andreas Martin Lisewski

    Full Text Available The transmission of genomic information from coding sequence to protein structure during protein synthesis is subject to stochastic errors. To analyze transmission limits in the presence of spurious errors, Shannon's noisy channel theorem is applied to a communication channel between amino acid sequences and their structures established from a large-scale statistical analysis of protein atomic coordinates. While Shannon's theorem confirms that in close to native conformations information is transmitted with limited error probability, additional random errors in sequence (amino acid substitutions and in structure (structural defects trigger a decrease in communication capacity toward a Shannon limit at 0.010 bits per amino acid symbol at which communication breaks down. In several controls, simulated error rates above a critical threshold and models of unfolded structures always produce capacities below this limiting value. Thus an essential biological system can be realistically modeled as a digital communication channel that is (a sensitive to random errors and (b restricted by a Shannon error limit. This forms a novel basis for predictions consistent with observed rates of defective ribosomal products during protein synthesis, and with the estimated excess of mutual information in protein contact potentials.

  14. Characterization of the microbial acid mine drainage microbial community using culturing and direct sequencing techniques.

    Auld, Ryan R; Myre, Maxine; Mykytczuk, Nadia C S; Leduc, Leo G; Merritt, Thomas J S

    2013-05-01

    We characterized the bacterial community from an AMD tailings pond using both classical culturing and modern direct sequencing techniques and compared the two methods. Acid mine drainage (AMD) is produced by the environmental and microbial oxidation of minerals dissolved from mining waste. Surprisingly, we know little about the microbial communities associated with AMD, despite the fundamental ecological roles of these organisms and large-scale economic impact of these waste sites. AMD microbial communities have classically been characterized by laboratory culturing-based techniques and more recently by direct sequencing of marker gene sequences, primarily the 16S rRNA gene. In our comparison of the techniques, we find that their results are complementary, overall indicating very similar community structure with similar dominant species, but with each method identifying some species that were missed by the other. We were able to culture the majority of species that our direct sequencing results indicated were present, primarily species within the Acidithiobacillus and Acidiphilium genera, although estimates of relative species abundance were only obtained from direct sequencing. Interestingly, our culture-based methods recovered four species that had been overlooked from our sequencing results because of the rarity of the marker gene sequences, likely members of the rare biosphere. Further, direct sequencing indicated that a single genus, completely missed in our culture-based study, Legionella, was a dominant member of the microbial community. Our results suggest that while either method does a reasonable job of identifying the dominant members of the AMD microbial community, together the methods combine to give a more complete picture of the true diversity of this environment. PMID:23485423

  15. The genome sequence of Geobacter metallireducens: features of metabolism, physiology and regulation common and dissimilar to Geobacter sulfurreducens

    Aklujkar, Muktak; Krushkal, Julia; DiBartolo, Genevieve; Lapidus, Alla; Land, Miriam L.; Lovley, Derek R.

    2008-12-01

    Background: The genome sequence of Geobacter metallireducens is the second to be completed from the metal-respiring genus Geobacter, and is compared in this report to that of Geobacter sulfurreducens in order to understand their metabolic, physiological and regulatory similarities and differences. Results: The experimentally observed greater metabolic versatility of G. metallireducens versus G. sulfurreducens is borne out by the presence of more numerous genes for metabolism of organic acids including acetate, propionate, and pyruvate. Although G. metallireducens lacks a dicarboxylic acid transporter, it has acquired a second succinate dehydrogenase/fumarate reductase complex, suggesting that respiration of fumarate was important until recently in its evolutionary history. Vestiges of the molybdate (ModE) regulon of G. sulfurreducens can be detected in G. metallireducens, which has lost the global regulatory protein ModE but retained some putative ModE-binding sites and multiplied certain genes of molybdenum cofactor biosynthesis. Several enzymes of amino acid metabolism are of different origin in the two species, but significant patterns of gene organization are conserved. Whereas most Geobacteraceae are predicted to obtain biosynthetic reducing equivalents from electron transfer pathways via a ferredoxin oxidoreductase, G. metallireducens can derive them from the oxidative pentose phosphate pathway. In addition to the evidence of greater metabolic versatility, the G. metallireducens genome is also remarkable for the abundance of multicopy nucleotide sequences found in intergenic regions and even within genes. Conclusion: The genomic evidence suggests that metabolism, physiology and regulation of gene expression in G. metallireducens may be dramatically different from other Geobacteraceae.

  16. Metazoan Remaining Genes for Essential Amino Acid Biosynthesis: Sequence Conservation and Evolutionary Analyses

    Igor R. Costa

    2014-12-01

    Full Text Available Essential amino acids (EAA consist of a group of nine amino acids that animals are unable to synthesize via de novo pathways. Recently, it has been found that most metazoans lack the same set of enzymes responsible for the de novo EAA biosynthesis. Here we investigate the sequence conservation and evolution of all the metazoan remaining genes for EAA pathways. Initially, the set of all 49 enzymes responsible for the EAA de novo biosynthesis in yeast was retrieved. These enzymes were used as BLAST queries to search for similar sequences in a database containing 10 complete metazoan genomes. Eight enzymes typically attributed to EAA pathways were found to be ubiquitous in metazoan genomes, suggesting a conserved functional role. In this study, we address the question of how these genes evolved after losing their pathway partners. To do this, we compared metazoan genes with their fungal and plant orthologs. Using phylogenetic analysis with maximum likelihood, we found that acetolactate synthase (ALS and betaine-homocysteine S-methyltransferase (BHMT diverged from the expected Tree of Life (ToL relationships. High sequence conservation in the paraphyletic group Plant-Fungi was identified for these two genes using a newly developed Python algorithm. Selective pressure analysis of ALS and BHMT protein sequences showed higher non-synonymous mutation ratios in comparisons between metazoans/fungi and metazoans/plants, supporting the hypothesis that these two genes have undergone non-ToL evolution in animals.

  17. Complete Genome Sequence of the Probiotic Lactic Acid Bacterium Lactobacillus Rhamnosus

    Samat Kozhakhmetov

    2014-01-01

    Full Text Available Introduction: Lactobacilli are a bacteria commonly found in the gastrointestinal tract. Some species of this genus have probiotic properties. The most common of these is Lactobacillus rhamnosus, a microoganism, generally regarded as safe (GRAS. It is also a homofermentative L-(+-lactic acid producer. The genus Lactobacillus is characterized by an extraordinary degree of the phenotypic and genotypic diversity. However, the studies of the genus were conducted mostly with the unequally distributed, non-random choice of species for sequencing; thus, there is only one representative genome from the Lactobacillus rhamnosus clade available to date. The aim of this study was to characterize the genome sequencing of selected strains of Lactobacilli. Methods: 109 samples were isolated from national domestic dairy products in the laboratory of Center for life sciences. After screaning isolates for probiotic properties, a highly active Lactobacillus spp strain was chosen. Genomic DNA was extracted according to the manufacturing protocol (Wizard® Genomic DNA Purification Kit. The Lactobacillus rhamnosus strain was identified as the highly active Lactobacillus strain accoridng to its morphological, cultural, physiological, and biochemical properties, and a genotypic analysis. Results: The genome of Lactobacillus rhamnosus was sequenced using the Roche 454 GS FLX (454 GS FLX platforms. The initial draft assembly was prepared from 14 large contigs (20 all contigs by the Newbler gsAssembler 2.3 (454 Life Sciences, Branford, CT. Conclusion: A full genome-sequencing of selected strains of lactic acid bacteria was made during the study.

  18. Draft Genome Sequence of Acid-Tolerant Clostridium drakei SL1T, a Potential Chemical Producer through Syngas Fermentation

    Jeong, Yujin; Song, Yoseb; Shin, Hyeon Seok; Cho, Byung-Kwan

    2014-01-01

    Clostridium drakei SL1T is a strictly anaerobic, H2-utilizing, and acid-tolerant acetogen isolated from an acidic sediment that is a potential platform for commodity chemical production from syngas fermentation. The draft genome sequence of this strain will enable determination of the acid resistance and autotrophic pathway of the acetogen.

  19. Nanopore Analysis of Nucleic Acids: Single-Molecule Studies of Molecular Dynamics, Structure, and Base Sequence

    Olasagasti, Felix; Deamer, David W.

    Nucleic acids are linear polynucleotides in which each base is covalently linked to a pentose sugar and a phosphate group carrying a negative charge. If a pore having roughly the crosssectional diameter of a single-stranded nucleic acid is embedded in a thin membrane and a voltage of 100 mV or more is applied, individual nucleic acids in solution can be captured by the electrical field in the pore and translocated through by single-molecule electrophoresis. The dimensions of the pore cannot accommodate anything larger than a single strand, so each base in the molecule passes through the pore in strict linear sequence. The nucleic acid strand occupies a large fraction of the pore's volume during translocation and therefore produces a transient blockade of the ionic current created by the applied voltage. If it could be demonstrated that each nucleotide in the polymer produced a characteristic modulation of the ionic current during its passage through the nanopore, the sequence of current modulations would reflect the sequence of bases in the polymer. According to this basic concept, nanopores are analogous to a Coulter counter that detects nanoscopic molecules rather than microscopic [1,2]. However, the advantage of nanopores is that individual macromolecules can be characterized because different chemical and physical properties affect their passage through the pore. Because macromolecules can be captured in the pore as well as translocated, the nanopore can be used to detect individual functional complexes that form between a nucleic acid and an enzyme. No other technique has this capability.

  20. Predicting DNA-binding sites of proteins from amino acid sequence

    Wu Feihong

    2006-05-01

    Full Text Available Abstract Background Understanding the molecular details of protein-DNA interactions is critical for deciphering the mechanisms of gene regulation. We present a machine learning approach for the identification of amino acid residues involved in protein-DNA interactions. Results We start with a Naïve Bayes classifier trained to predict whether a given amino acid residue is a DNA-binding residue based on its identity and the identities of its sequence neighbors. The input to the classifier consists of the identities of the target residue and 4 sequence neighbors on each side of the target residue. The classifier is trained and evaluated (using leave-one-out cross-validation on a non-redundant set of 171 proteins. Our results indicate the feasibility of identifying interface residues based on local sequence information. The classifier achieves 71% overall accuracy with a correlation coefficient of 0.24, 35% specificity and 53% sensitivity in identifying interface residues as evaluated by leave-one-out cross-validation. We show that the performance of the classifier is improved by using sequence entropy of the target residue (the entropy of the corresponding column in multiple alignment obtained by aligning the target sequence with its sequence homologs as additional input. The classifier achieves 78% overall accuracy with a correlation coefficient of 0.28, 44% specificity and 41% sensitivity in identifying interface residues. Examination of the predictions in the context of 3-dimensional structures of proteins demonstrates the effectiveness of this method in identifying DNA-binding sites from sequence information. In 33% (56 out of 171 of the proteins, the classifier identifies the interaction sites by correctly recognizing at least half of the interface residues. In 87% (149 out of 171 of the proteins, the classifier correctly identifies at least 20% of the interface residues. This suggests the possibility of using such classifiers to identify

  1. Complete amino acid sequence of globin chains and biological activity of fragmented crocodile hemoglobin (Crocodylus siamensis).

    Srihongthong, Saowaluck; Pakdeesuwan, Anawat; Daduang, Sakda; Araki, Tomohiro; Dhiravisit, Apisak; Thammasirirak, Sompong

    2012-08-01

    Hemoglobin, α-chain, β-chain and fragmented hemoglobin of Crocodylus siamensis demonstrated both antibacterial and antioxidant activities. Antibacterial and antioxidant properties of the hemoglobin did not depend on the heme structure but could result from the compositions of amino acid residues and structures present in their primary structure. Furthermore, thirteen purified active peptides were obtained by RP-HPLC analyses, corresponding to fragments in the α-globin chain and the β-globin chain which are mostly located at the N-terminal and C-terminal parts. These active peptides operate on the bacterial cell membrane. The globin chains of Crocodylus siamensis showed similar amino acids to the sequences of Crocodylus niloticus. The novel amino acid substitutions of α-chain and β-chain are not associated with the heme binding site or the bicarbonate ion binding site, but could be important through their interactions with membranes of bacteria. PMID:22648692

  2. Amino acid selective unlabeling for sequence specific resonance assignments in proteins

    Krishnarjuna, B.; Jaipuria, Garima; Thakur, Anushikha [Indian Institute of Science, NMR Research Centre (India); D' Silva, Patrick, E-mail: patrick@biochem.iisc.ernet.in [Indian Institute of Science, Department of Biochemistry (India); Atreya, Hanudatta S., E-mail: hsatreya@sif.iisc.ernet.in [Indian Institute of Science, NMR Research Centre (India)

    2011-01-15

    Sequence specific resonance assignment constitutes an important step towards high-resolution structure determination of proteins by NMR and is aided by selective identification and assignment of amino acid types. The traditional approach to selective labeling yields only the chemical shifts of the particular amino acid being selected and does not help in establishing a link between adjacent residues along the polypeptide chain, which is important for sequential assignments. An alternative approach is the method of amino acid selective 'unlabeling' or reverse labeling, which involves selective unlabeling of specific amino acid types against a uniformly {sup 13}C/{sup 15}N labeled background. Based on this method, we present a novel approach for sequential assignments in proteins. The method involves a new NMR experiment named, {l_brace}{sup 12}CO{sub i}-{sup 15}N{sub i+1}{r_brace}-filtered HSQC, which aids in linking the {sup 1}H{sup N}/{sup 15}N resonances of the selectively unlabeled residue, i, and its C-terminal neighbor, i + 1, in HN-detected double and triple resonance spectra. This leads to the assignment of a tri-peptide segment from the knowledge of the amino acid types of residues: i - 1, i and i + 1, thereby speeding up the sequential assignment process. The method has the advantage of being relatively inexpensive, applicable to {sup 2}H labeled protein and can be coupled with cell-free synthesis and/or automated assignment approaches. A detailed survey involving unlabeling of different amino acid types individually or in pairs reveals that the proposed approach is also robust to misincorporation of {sup 14}N at undesired sites. Taken together, this study represents the first application of selective unlabeling for sequence specific resonance assignments and opens up new avenues to using this methodology in protein structural studies.

  3. Comparative characterization of random-sequence proteins consisting of 5, 12, and 20 kinds of amino acids.

    Tanaka, Junko; Doi, Nobuhide; Takashima, Hideaki; Yanagawa, Hiroshi

    2010-04-01

    Screening of functional proteins from a random-sequence library has been used to evolve novel proteins in the field of evolutionary protein engineering. However, random-sequence proteins consisting of the 20 natural amino acids tend to aggregate, and the occurrence rate of functional proteins in a random-sequence library is low. From the viewpoint of the origin of life, it has been proposed that primordial proteins consisted of a limited set of amino acids that could have been abundantly formed early during chemical evolution. We have previously found that members of a random-sequence protein library constructed with five primitive amino acids show high solubility (Doi et al., Protein Eng Des Sel 2005;18:279-284). Although such a library is expected to be appropriate for finding functional proteins, the functionality may be limited, because they have no positively charged amino acid. Here, we constructed three libraries of 120-amino acid, random-sequence proteins using alphabets of 5, 12, and 20 amino acids by preselection using mRNA display (to eliminate sequences containing stop codons and frameshifts) and characterized and compared the structural properties of random-sequence proteins arbitrarily chosen from these libraries. We found that random-sequence proteins constructed with the 12-member alphabet (including five primitive amino acids and positively charged amino acids) have higher solubility than those constructed with the 20-member alphabet, though other biophysical properties are very similar in the two libraries. Thus, a library of moderate complexity constructed from 12 amino acids may be a more appropriate resource for functional screening than one constructed from 20 amino acids. PMID:20162614

  4. Partial amino acid sequence of fructose-1,6-bisphosphatase from the blue-green algae Synechococcus leopoliensis.

    Marcus, F; Latshaw, S P; Steup, M; Gerbling, K P

    1989-08-01

    Purified fructose-1,6-bisphosphatase from the cyanobacterium Synechococcus leopoliensis was S-carboxymethylated and cleaved with trypsin. The resulting peptides were purified by reversed-phase high performance liquid chromatography and the amino acid sequence of six of the purified peptides was determined by gas-phase microsequencing. The results revealed sequence homology with other fructose-1,6-bisphosphatases. The obtained sequence data provides information required for the design of oligonucleotide hybridization probes to screen existing libraries of cyanobacterial DNA. The determination of the amino acid sequence of cyanobacterial proteins may yield important information with respect to the endosymbiotic theory of evolution. PMID:2550924

  5. CloudAligner: A fast and full-featured MapReduce based tool for sequence mapping

    Shi Weisong

    2011-06-01

    Full Text Available Abstract Background Research in genetics has developed rapidly recently due to the aid of next generation sequencing (NGS. However, massively-parallel NGS produces enormous amounts of data, which leads to storage, compatibility, scalability, and performance issues. The Cloud Computing and MapReduce framework, which utilizes hundreds or thousands of shared computers to map sequencing reads quickly and efficiently to reference genome sequences, appears to be a very promising solution for these issues. Consequently, it has been adopted by many organizations recently, and the initial results are very promising. However, since these are only initial steps toward this trend, the developed software does not provide adequate primary functions like bisulfite, pair-end mapping, etc., in on-site software such as RMAP or BS Seeker. In addition, existing MapReduce-based applications were not designed to process the long reads produced by the most recent second-generation and third-generation NGS instruments and, therefore, are inefficient. Last, it is difficult for a majority of biologists untrained in programming skills to use these tools because most were developed on Linux with a command line interface. Results To urge the trend of using Cloud technologies in genomics and prepare for advances in second- and third-generation DNA sequencing, we have built a Hadoop MapReduce-based application, CloudAligner, which achieves higher performance, covers most primary features, is more accurate, and has a user-friendly interface. It was also designed to be able to deal with long sequences. The performance gain of CloudAligner over Cloud-based counterparts (35 to 80% mainly comes from the omission of the reduce phase. In comparison to local-based approaches, the performance gain of CloudAligner is from the partition and parallel processing of the huge reference genome as well as the reads. The source code of CloudAligner is available at http

  6. Parameters of proteome evolution from histograms of amino-acid sequence identities of paralogous proteins

    Yan Koon-Kiu

    2007-11-01

    Full Text Available Abstract Background The evolution of the full repertoire of proteins encoded in a given genome is mostly driven by gene duplications, deletions, and sequence modifications of existing proteins. Indirect information about relative rates and other intrinsic parameters of these three basic processes is contained in the proteome-wide distribution of sequence identities of pairs of paralogous proteins. Results We introduce a simple mathematical framework based on a stochastic birth-and-death model that allows one to extract some of this information and apply it to the set of all pairs of paralogous proteins in H. pylori, E. coli, S. cerevisiae, C. elegans, D. melanogaster, and H. sapiens. It was found that the histogram of sequence identities p generated by an all-to-all alignment of all protein sequences encoded in a genome is well fitted with a power-law form ~ p-γ with the value of the exponent γ around 4 for the majority of organisms used in this study. This implies that the intra-protein variability of substitution rates is best described by the Gamma-distribution with the exponent α ≈ 0.33. Different features of the shape of such histograms allow us to quantify the ratio between the genome-wide average deletion/duplication rates and the amino-acid substitution rate. Conclusion We separately measure the short-term ("raw" duplication and deletion rates rdup∗ MathType@MTEF@5@5@+=feaafiart1ev1aaatCvAUfKttLearuWrP9MDH5MBPbIqV92AaeXatLxBI9gBaebbnrfifHhDYfgasaacPC6xNi=xH8viVGI8Gi=hEeeu0xXdbba9frFj0xb9qqpG0dXdb9aspeI8k8fiI+fsY=rqGqVepae9pg0db9vqaiVgFr0xfr=xfr=xc9adbaqaaeGacaGaaiaabeqaaeqabiWaaaGcbaGaemOCai3aa0baaSqaaiabbsgaKjabbwha1jabbchaWbqaaiabgEHiQaaaaaa@3283@, rdel∗ MathType@MTEF@5@5@+=feaafiart1ev1aaatCvAUfKttLearuWrP9MDH5MBPbIqV92AaeXatLxBI9gBaebbnrfifHhDYfgasaacPC6xNi=xH8viVGI8Gi=hEeeu0xXdbba9frFj0xb9qqpG0dXdb9aspeI8k8fiI+fsY=rqGqVepae9pg0db9vqaiVgFr0xfr=xfr=xc9adbaqaaeGacaGaaiaabeqaaeqabiWaaaGcbaGaemOCai3aa0baaSqaaiabbsga

  7. tRNAfeature: An algorithm for tRNA features to identify tRNA genes in DNA sequences.

    Yang, Cheng-Hong; Lin, Yu-Da; Chuang, Li-Yeh

    2016-09-01

    The identification of transfer RNAs (tRNAs) is critical for a detailed understanding of the evolution of biological organisms and viruses. However, some tRNAs are difficult to recognize due to their unusual sub-structures and may result in the detection of the wrong anticodon. Therefore, the detection of unusual sub-structures of tRNA genes remains an important challenge. In this study, we propose a method to identify tRNA genes based on tRNA features. tRNAfeature attempts to refold the sequence with single-stranded regions longer than those found in the canonical and conventional structural models for tRNA. We predicted a set of 53926 archaeal, eubacterial and eukaryotic tRNA genes annotated in tRNADB-CE and scanned the tRNA genes in whole genome sequencing. The results indicate that tRNAfeature is more powerful than other existing methods for identifying tRNAs. PMID:27291467

  8. alpha-Amylase gene of Streptomyces limosus: nucleotide sequence, expression motifs, and amino acid sequence homology to mammalian and invertebrate alpha-amylases.

    Long, C M; Virolle, M J; Chang, S Y; Chang, S.; Bibb, M.J.

    1987-01-01

    The nucleotide sequence of the coding and regulatory regions of the alpha-amylase gene (aml) of Streptomyces limosus was determined. High-resolution S1 mapping was used to locate the 5' end of the transcript and demonstrated that the gene is transcribed from a unique promoter. The predicted amino acid sequence has considerable identity to mammalian and invertebrate alpha-amylases, but not to those of plant, fungal, or eubacterial origin. Consistent with this is the susceptibility of the enzym...

  9. Etiology of autistic features: the persisting neurotoxic effects of propionic acid

    El-Ansary Afaf K

    2012-04-01

    Full Text Available Abstract Background Recent clinical observations suggest that certain gut and dietary factors may transiently worsen symptoms in autism. Propionic acid (PA is a short chain fatty acid and an important intermediate of cellular metabolism. Although PA has several beneficial biological effects, its accumulation is neurotoxic. Methods Two groups of young Western albino male rats weighing about 45 to 60 grams (approximately 21 days old were used in the present study. The first group consisted of oral buffered PA-treated rats that were given a neurotoxic dose of 250 mg/kg body weight/day for three days, n = eight; the second group of rats were given only phosphate buffered saline and used as a control. Biochemical parameters representing oxidative stress, energy metabolism, neuroinflammation, neurotransmission, and apoptosis were investigated in brain homogenates of both groups. Results Biochemical analyses of brain homogenates from PA-treated rats showed an increase in oxidative stress markers (for example, lipid peroxidation, coupled with a decrease in glutathione (GSH and glutathione peroxidase (GPX and catalase activities. Impaired energy metabolism was ascertained through the decrease of lactate dehydrogenase and activation of creatine kinase (CK. Elevated IL-6, TNFα, IFNγ and heat shock protein 70 (HSP70 confirmed the neuroinflammatory effect of PA. Moreover, elevation of caspase3 and DNA fragmentation proved the pro-apoptotic and neurotoxic effect of PA to rat pups Conclusion By comparing the results obtained with those from animal models of autism or with clinical data on the biochemical profile of autistic patients, this study showed that the neurotoxicity of PA as an environmental factor could play a central role in the etiology of autistic biochemical features.

  10. Nucleic and amino acid sequences relating to a novel transketolase, and methods for the expression thereof

    Croteau, Rodney Bruce (Pullman, WA); Wildung, Mark Raymond (Colfax, WA); Lange, Bernd Markus (Pullman, WA); McCaskill, David G. (Pullman, WA)

    2001-01-01

    cDNAs encoding 1-deoxyxylulose-5-phosphate synthase from peppermint (Mentha piperita) have been isolated and sequenced, and the corresponding amino acid sequences have been determined. Accordingly, isolated DNA sequences (SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7) are provided which code for the expression of 1-deoxyxylulose-5-phosphate synthase from plants. In another aspect the present invention provides for isolated, recombinant DXPS proteins, such as the proteins having the sequences set forth in SEQ ID NO:4, SEQ ID NO:6 and SEQ ID NO:8. In other aspects, replicable recombinant cloning vehicles are provided which code for plant 1-deoxyxylulose-5-phosphate synthases, or for a base sequence sufficiently complementary to at least a portion of 1-deoxyxylulose-5-phosphate synthase DNA or RNA to enable hybridization therewith. In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding a plant 1-deoxyxylulose-5-phosphate synthase. Thus, systems and methods are provided for the recombinant expression of the aforementioned recombinant 1-deoxyxylulose-5-phosphate synthase that may be used to facilitate its production, isolation and purification in significant amounts. Recombinant 1-deoxyxylulose-5-phosphate synthase may be used to obtain expression or enhanced expression of 1-deoxyxylulose-5-phosphate synthase in plants in order to enhance the production of 1-deoxyxylulose-5-phosphate, or its derivatives such as isopentenyl diphosphate (BP), or may be otherwise employed for the regulation or expression of 1-deoxyxylulose-5-phosphate synthase, or the production of its products.

  11. Genome Sequence Analysis of the Naphthenic Acid Degrading and Metal Resistant Bacterium Cupriavidus gilardii CR3.

    Xiaoyu Wang

    Full Text Available Cupriavidus sp. are generally heavy metal tolerant bacteria with the ability to degrade a variety of aromatic hydrocarbon compounds, although the degradation pathways and substrate versatilities remain largely unknown. Here we studied the bacterium Cupriavidus gilardii strain CR3, which was isolated from a natural asphalt deposit, and which was shown to utilize naphthenic acids as a sole carbon source. Genome sequencing of C. gilardii CR3 was carried out to elucidate possible mechanisms for the naphthenic acid biodegradation. The genome of C. gilardii CR3 was composed of two circular chromosomes chr1 and chr2 of respectively 3,539,530 bp and 2,039,213 bp in size. The genome for strain CR3 encoded 4,502 putative protein-coding genes, 59 tRNA genes, and many other non-coding genes. Many genes were associated with xenobiotic biodegradation and metal resistance functions. Pathway prediction for degradation of cyclohexanecarboxylic acid, a representative naphthenic acid, suggested that naphthenic acid undergoes initial ring-cleavage, after which the ring fission products can be degraded via several plausible degradation pathways including a mechanism similar to that used for fatty acid oxidation. The final metabolic products of these pathways are unstable or volatile compounds that were not toxic to CR3. Strain CR3 was also shown to have tolerance to at least 10 heavy metals, which was mainly achieved by self-detoxification through ion efflux, metal-complexation and metal-reduction, and a powerful DNA self-repair mechanism. Our genomic analysis suggests that CR3 is well adapted to survive the harsh environment in natural asphalts containing naphthenic acids and high concentrations of heavy metals.

  12. Heterodimeric l-amino acid oxidase enzymes from Egyptian Cerastes cerastes venom: Purification, biochemical characterization and partial amino acid sequencing

    A.E. El Hakim

    2015-12-01

    Full Text Available Two l-amino acid oxidase enzyme isoforms, Cc-LAAOI and Cc-LAAOII were purified to apparent homogeneity from Cerastes cerastes venom in a sequential two-step chromatographic protocol including; gel filtration and anion exchange chromatography. The native molecular weights of the isoforms were 115 kDa as determined by gel filtration on calibrated Sephacryl S-200 column, while the monomeric molecular weights of the enzymes were, 60, 56 kDa and 60, 53 kDa for LAAOI and LAAOII, respectively. The tryptic peptides of the two isoforms share high sequence homology with other snake venom l-amino acid oxidases. The optimal pH and temperature values of Cc-LAAOI and Cc-LAAOII were 7.8, 50 °C and 7, 60 °C, respectively. The two isoenzymes were thermally stable up to 70 °C. The Km and Vmax values were 0.67 mM, 0.135 μmol/min for LAAOI and 0.82 mM, 0.087 μmol/min for LAAOII. Both isoenzymes displayed high catalytic preference to long-chain, hydrophobic and aromatic amino acids. The Mn2+ ion markedly increased the LAAO activity for both purified isoforms, while Na+, K+, Ca2+, Mg2+ and Ba2+ ions showed a non-significant increase in the enzymatic activity of both isoforms. Furthermore, Zn2+, Ni2+, Co2+, Cu2+ and AL3+ ions markedly inhibited the LAAOI and LAAOII activities. l-Cysteine and reduced glutathione completely inhibited the LAAO activity of both isoenzymes, whereas, β-mercaptoethanol, O-phenanthroline and PMSF completely inhibited the enzymatic activity of LAAOII. Furthermore, iodoacitic acid inhibited the enzymatic activity of LAAOII by 46% and had no effect on the LAAOI activity.

  13. Sequence-defined bioactive macrocycles via an acid-catalysed cascade reaction

    Porel, Mintu; Thornlow, Dana N.; Phan, Ngoc N.; Alabi, Christopher A.

    2016-06-01

    Synthetic macrocycles derived from sequence-defined oligomers are a unique structural class whose ring size, sequence and structure can be tuned via precise organization of the primary sequence. Similar to peptides and other peptidomimetics, these well-defined synthetic macromolecules become pharmacologically relevant when bioactive side chains are incorporated into their primary sequence. In this article, we report the synthesis of oligothioetheramide (oligoTEA) macrocycles via a one-pot acid-catalysed cascade reaction. The versatility of the cyclization chemistry and modularity of the assembly process was demonstrated via the synthesis of >20 diverse oligoTEA macrocycles. Structural characterization via NMR spectroscopy revealed the presence of conformational isomers, which enabled the determination of local chain dynamics within the macromolecular structure. Finally, we demonstrate the biological activity of oligoTEA macrocycles designed to mimic facially amphiphilic antimicrobial peptides. The preliminary results indicate that macrocyclic oligoTEAs with just two-to-three cationic charge centres can elicit potent antibacterial activity against Gram-positive and Gram-negative bacteria.

  14. SigWin-detector: a Grid-enabled workflow for discovering enriched windows of genomic features related to DNA sequences

    Wibisono Adianto

    2008-08-01

    Full Text Available Abstract Background Chromosome location is often used as a scaffold to organize genomic information in both the living cell and molecular biological research. Thus, ever-increasing amounts of data about genomic features are stored in public databases and can be readily visualized by genome browsers. To perform in silico experimentation conveniently with this genomics data, biologists need tools to process and compare datasets routinely and explore the obtained results interactively. The complexity of such experimentation requires these tools to be based on an e-Science approach, hence generic, modular, and reusable. A virtual laboratory environment with workflows, workflow management systems, and Grid computation are therefore essential. Findings Here we apply an e-Science approach to develop SigWin-detector, a workflow-based tool that can detect significantly enriched windows of (genomic features in a (DNA sequence in a fast and reproducible way. For proof-of-principle, we utilize a biological use case to detect regions of increased and decreased gene expression (RIDGEs and anti-RIDGEs in human transcriptome maps. We improved the original method for RIDGE detection by replacing the costly step of estimation by random sampling with a faster analytical formula for computing the distribution of the null hypothesis being tested and by developing a new algorithm for computing moving medians. SigWin-detector was developed using the WS-VLAM workflow management system and consists of several reusable modules that are linked together in a basic workflow. The configuration of this basic workflow can be adapted to satisfy the requirements of the specific in silico experiment. Conclusion As we show with the results from analyses in the biological use case on RIDGEs, SigWin-detector is an efficient and reusable Grid-based tool for discovering windows enriched for features of a particular type in any sequence of values. Thus, SigWin-detector provides the

  15. Complete Genome Sequence of Lactococcus lactis IO-1, a Lactic Acid Bacterium That Utilizes Xylose and Produces High Levels of l-Lactic Acid

    Kato, Hiroaki; Shiwa, Yuh; Oshima, Kenshiro; Machii, Miki; Araya-Kojima, Tomoko; Zendo, Takeshi; Shimizu-Kadota, Mariko; Hattori, Masahira; Sonomoto, Kenji; Yoshikawa, Hirofumi

    2012-01-01

    We report the complete genome sequence of Lactococcus lactis IO-1 (= JCM7638). It is a nondairy lactic acid bacterium, produces nisin Z, ferments xylose, and produces predominantly l-lactic acid at high xylose concentrations. From ortholog analysis with other five L. lactis strains, IO-1 was identified as L. lactis subsp. lactis.

  16. Morphological tranformation of calcite crystal growth by prismatic "acidic" polypeptide sequences.

    Kim, I; Giocondi, J L; Orme, C A; Collino, J; Evans, J S

    2007-02-13

    Many of the interesting mechanical and materials properties of the mollusk shell are thought to stem from the prismatic calcite crystal assemblies within this composite structure. It is now evident that proteins play a major role in the formation of these assemblies. Recently, a superfamily of 7 conserved prismatic layer-specific mollusk shell proteins, Asprich, were sequenced, and the 42 AA C-terminal sequence region of this protein superfamily was found to introduce surface voids or porosities on calcite crystals in vitro. Using AFM imaging techniques, we further investigate the effect that this 42 AA domain (Fragment-2) and its constituent subdomains, DEAD-17 and Acidic-2, have on the morphology and growth kinetics of calcite dislocation hillocks. We find that Fragment-2 adsorbs on terrace surfaces and pins acute steps, accelerates then decelerates the growth of obtuse steps, forms clusters and voids on terrace surfaces, and transforms calcite hillock morphology from a rhombohedral form to a rounded one. These results mirror yet are distinct from some of the earlier findings obtained for nacreous polypeptides. The subdomains Acidic-2 and DEAD-17 were found to accelerate then decelerate obtuse steps and induce oval rather than rounded hillock morphologies. Unlike DEAD-17, Acidic-2 does form clusters on terrace surfaces and exhibits stronger obtuse velocity inhibition effects than either DEAD-17 or Fragment-2. Interestingly, a 1:1 mixture of both subdomains induces an irregular polygonal morphology to hillocks, and exhibits the highest degree of acute step pinning and obtuse step velocity inhibition. This suggests that there is some interplay between subdomains within an intra (Fragment-2) or intermolecular (1:1 mixture) context, and sequence interplay phenomena may be employed by biomineralization proteins to exert net effects on crystal growth and morphology.

  17. Pathophysiology, clinical features and radiological findings of differentiation syndrome/all-trans-retinoic acid syndrome

    Luciano; Cardinale; Francesco; Asteggiano; Federica; Moretti; Federico; Torre; Stefano; Ulisciani; Carmen; Fava; Giovanna; Rege-Cambrin

    2014-01-01

    In acute promyelocytic leukemia, differentiation thera-py based on all-trans-retinoic acid can be complicated by the development of a differentiation syndrome(DS). DS is a life-threatening complication, characterized by respiratory distress, unexplained fever, weight gain, interstitial lung infiltrates, pleural or pericardial effusions, hypotension and acute renal failure. The diagnosis of DS is made on clinical grounds and has proven to be difficult, because none of the symptoms is pathognomonic for the syndrome without any definitive diagnostic criteria. As DS can have subtle signs and symptoms at presentation but progress rapidly, end-stage DS clinical picture resembles the acute respiratory distress syndrome with extremely poor prognosis; so it is of absolute importance to be conscious of these complications and initiate therapy as soon as it was suspected. The radiologic appearance resembles the typical features of cardiogenic pulmonary edema. Diagnosis of DS remains a great skill for radiologists and haematologist but it is of an utmost importance the cooperation in suspect DS, detect the early signs of DS, examine the patients’ behaviour and rapidly detect the complications.

  18. Amino acid sequence of the cold-active alkaline phosphatase from Atlantic cod (Gadus morhua)

    Asgeirsson, Bjarni; Nielsen, Berit Noesgaard; Højrup, Peter

    2003-01-01

    Atlantic cod is a marine fish that lives at low temperatures of 0-10 degrees C and contains a cold-adapted alkaline phosphatase (AP). Preparations of AP from either the lower part of the intestines or the pyloric caeca area were subjected to proteolytic digestion, mass spectrometry and amino acid...... sequencing by Edman degradation. The primary structure exhibits greatest similarity to human tissue non-specific AP (80%), and approximately 30% similarity to AP from Escherichia coli. The key residues required for catalysis are conserved in the cod AP, except for the third metal binding site, where cod AP...

  19. Frequencies of amino acid strings in globular protein sequences indicate suppression of blocks of consecutive hydrophobic residues

    Schwartz, Russell; Istrail, Sorin; King, Jonathan

    2001-01-01

    Patterns of hydrophobic and hydrophilic residues play a major role in protein folding and function. Long, predominantly hydrophobic strings of 20–22 amino acids each are associated with transmembrane helices and have been used to identify such sequences. Much less attention has been paid to hydrophobic sequences within globular proteins. In prior work on computer simulations of the competition between on-pathway folding and off-pathway aggregate formation, we found that long sequences of cons...

  20. 3-d structure-based amino acid sequence alignment of esterases, lipases and related proteins

    Gentry, M.K.; Doctor, B.P.; Cygler, M.; Schrag, J.D.; Sussman, J.L.

    1993-05-13

    Acetylcholinesterase and butyrylcholinesterase, enzymes with potential as pretreatment drugs for organophosphate toxicity, are members of a larger family of homologous proteins that includes carboxylesterases, cholesterol esterases, lipases, and several nonhydrolytic proteins. A computer-generated alignment of 18 of the proteins, the acetylcholinesases, butyrylcholinesterases, carboxylesterases, some esterases, and the nonenzymatic proteins has been previously presented. More recently, the three-dimensional structures of two enzymes enzymes in this group, acetylcholinesterase from Torpedo californica and lipase from Geotrichum candidum, have been determined. Based on the x-ray structures and the superposition of these two enzymes, it was possible to obtain an improved amino acid sequence alignment of 32 members of this family of proteins. Examination of this alignment reveals that 24 amino acids are invariant in all of the hydrolytic proteins, and an additional 49 are well conserved. Conserved amino acids include those of the active site, the disulfide bridges, the salt bridges, in the core of the proteins, and at the edges of secondary structural elements. Comparison of the three-dimensional structures makes it possible to find a well-defined structural basis for the conservation of many of these amino acids.

  1. Draft Genome Sequence of Bacillus subtilis GXA-28, a Thermophilic Strain with High Productivity of Poly-γ-Glutamic Acid

    Zeng, Wei; Chen, Guiguang; Tang, Zhen; Wu, Hao; Shu, Lin; Liang, Zhiqun

    2014-01-01

    Bacillus subtilis GXA-28 is a thermophilic strain that can produce high yield and high molecular weight of poly-γ-glutamic acid under high temperature. Here, we report the draft genome sequence of this strain, which may provide the genomic basis for the high productivity of poly-γ-glutamic acid.

  2. Draft Genome Sequences of Gluconobacter cerinus CECT 9110 and Gluconobacter japonicus CECT 8443, Acetic Acid Bacteria Isolated from Grape Must

    Sainz, Florencia

    2016-01-01

    We report here the draft genome sequences of Gluconobacter cerinus strain CECT9110 and Gluconobacter japonicus CECT8443, acetic acid bacteria isolated from grape must. Gluconobacter species are well known for their ability to oxidize sugar alcohols into the corresponding acids. Our objective was to select strains to oxidize effectively d-glucose. PMID:27365351

  3. FiveS rRNA sequences and fatty acid profiles of colourless sulfur-oxidising bacteria

    LokaBharathi, P.A.; Ortiz-conde, B.A; Nair, S.; Chandramohan, D.; Colwell, R.R.

    these at the molecular level, 5S ribosomal ribonucleic acid (5S rRNA) sequences have been determined. Fatty acid profiles showed strain 29 to be related to Pseudomonas vesicularis with an E.D. of 5.965 and similarity index of 0.182. The nearest organism of strain 82...

  4. 37 CFR 1.823 - Requirements for nucleotide and/or amino acid sequences as part of the application.

    2010-07-01

    ... with paragraph (b) of this section, must begin on a new page and must be titled “Sequence Listing.” The... shall be “DNA.” In addition, the combined DNA/RNA molecule shall be further described in the to feature..., the “Unknown” or “Artificial Sequence” organisms shall be further described in the to feature...

  5. Geochemical features and effects on deep-seated fluids during the May-June 2012 southern Po Valley seismic sequence

    Francesco Italiano

    2012-10-01

    Full Text Available A periodic sampling of the groundwaters and dissolved and free gases in selected deep wells located in the area affected by the May-June 2012 southern Po Valley seismic sequence has provided insight into seismogenic-induced changes of the local aquifer systems. The results obtained show progressive changes in the fluid geochemistry, allowing it to be established that deep-seated fluids were mobilized during the seismic sequence and reached surface layers along faults and fractures, which generated significant geochemical anomalies. The May-June 2012 seismic swarm (mainshock on May 29, 2012, M 5.8; 7 shocks M >5, about 200 events 3 > M > 5 induced several modifications in the circulating fluids. This study reports the preliminary results obtained for the geochemical features of the waters and gases collected over the epicentral area from boreholes drilled at different depths, thus intercepting water and gases with different origins and circulation. The aim of the investigations was to improve our knowledge of the fluids circulating over the seismic area (e.g. origin, provenance, interactions, mixing of different components, temporal changes. This was achieved by collecting samples from both shallow and deep-drilled boreholes, and then, after the selection of the relevant sites, we looked for temporal changes with mid-to-long-term monitoring activity following a constant sampling rate. This allowed us to gain better insight into the relationships between the fluid circulation and the faulting activity. The sampling sites are listed in Table 1, along with the analytical results of the gas phase. […

  6. Isolation and amino acid sequences of squirrel monkey (Saimiri sciurea) insulin and glucagon

    It was reported two decades ago that insulin was not detectable in the glucose-stimulated state in Saimiri sciurea, the New World squirrel monkey, by a radioimmunoassay system developed with guinea pig anti-pork insulin antibody and labeled park insulin. With the same system, reasonable levels were observed in rhesus monkeys and chimpanzees. This suggested that New World monkeys, like the New World hystricomorph rodents such as the guinea pig and the coypu, might have insulins whose sequences differ markedly from those of Old World mammals. In this report the authors describe the purification and amino acid sequences of squirrel monkey insulin and glucagon. They demonstrate that the substitutions at B29, B27, A2, A4, and A17 of squirrel monkey insulin are identical with those previously found in another New World primate, the owl monkey (Aotus trivirgatus). The immunologic cross-reactivity of this insulin in their immunoassay system is only a few percent of that of human insulin. It appears that the peptides of the New World monkeys have diverged less from those of the Old World mammals than have those of the New World hystricomorph rodents. The striking improvements in peptide purification and sequencing have the potential for adding new information concerning the evolutionary divergence of species

  7. Complete amino acid sequence of the myoglobin from the Pacific spotted dolphin, Stenella attenuata graffmani.

    Jones, B N; Wang, C C; Dwulet, F E; Lehman, L D; Meuth, J L; Bogardt, R A; Gurd, F R

    1979-04-25

    The complete amino acid sequence of the major component myoglobin from the Pacific spotted dolphin, Stenella attenuata graffmani, was determined by the automated Edman degradation of several large peptides obtained by specific cleavage of the protein. The acetimidated apomyoglobin was selectively cleaved at its two methionyl residues with cyanogen bromide and at its three arginyl residues by trypsin. By subjecting four of these peptides and the apomyoglobin to automated Edman degradation, over 80% of the primary structure of the protein was obtained. The remainder of the covalent structure was determined by the sequence analysis of peptides that resulted from further digestion of the central cyanogen bromide fragment. This fragment was cleaved at its glutamyl residues with staphylococcal protease and its lysyl residues with trypsin. The action of trypsin was restricted to the lysyl residues by chemical modification of the single arginyl residue of the fragment with 1,2-cyclohexanedione. The primary structure of this myoglobin proved to be identical with that from the Atlantic bottlenosed dolphin and Pacific common dolphin but differs from the myoglobins of the killer whale and pilot whale at two positions. The above sequence identities and differences reflect the close taxonomic relationship of these five species of Cetacea. PMID:454657

  8. Isolation and amino acid sequences of squirrel monkey (Saimiri sciurea) insulin and glucagon

    Yu, Jinghua (Veterans Administration Medical Center, Bronx, NY (United States)); Eng, J.; Yalow, R.S. (Veterans Administration Medical Center, Bronx, NY (United States) City Univ. of New York, NY (United States))

    1990-12-01

    It was reported two decades ago that insulin was not detectable in the glucose-stimulated state in Saimiri sciurea, the New World squirrel monkey, by a radioimmunoassay system developed with guinea pig anti-pork insulin antibody and labeled park insulin. With the same system, reasonable levels were observed in rhesus monkeys and chimpanzees. This suggested that New World monkeys, like the New World hystricomorph rodents such as the guinea pig and the coypu, might have insulins whose sequences differ markedly from those of Old World mammals. In this report the authors describe the purification and amino acid sequences of squirrel monkey insulin and glucagon. They demonstrate that the substitutions at B29, B27, A2, A4, and A17 of squirrel monkey insulin are identical with those previously found in another New World primate, the owl monkey (Aotus trivirgatus). The immunologic cross-reactivity of this insulin in their immunoassay system is only a few percent of that of human insulin. It appears that the peptides of the New World monkeys have diverged less from those of the Old World mammals than have those of the New World hystricomorph rodents. The striking improvements in peptide purification and sequencing have the potential for adding new information concerning the evolutionary divergence of species.

  9. A Possible Mechanism of Zika Virus Associated Microcephaly: Imperative Role of Retinoic Acid Response Element (RARE) Consensus Sequence Repeats in the Viral Genome

    Kumar, Ashutosh; Singh, Himanshu N.; Pareek, Vikas; Raza, Khursheed; Dantham, Subrahamanyam; Kumar, Pavan; Mochan, Sankat; Faiq, Muneeb A.

    2016-01-01

    Owing to the reports of microcephaly as a consistent outcome in the fetuses of pregnant women infected with ZIKV in Brazil, Zika virus (ZIKV)—microcephaly etiomechanistic relationship has recently been implicated. Researchers, however, are still struggling to establish an embryological basis for this interesting causal handcuff. The present study reveals robust evidence in favor of a plausible ZIKV-microcephaly cause-effect liaison. The rationale is based on: (1) sequence homology between ZIKV genome and the response element of an early neural tube developmental marker “retinoic acid” in human DNA and (2) comprehensive similarities between the details of brain defects in ZIKV-microcephaly and retinoic acid embryopathy. Retinoic acid is considered as the earliest factor for regulating anteroposterior axis of neural tube and positioning of structures in developing brain through retinoic acid response elements (RARE) consensus sequence (5′–AGGTCA–3′) in promoter regions of retinoic acid-dependent genes. We screened genomic sequences of already reported virulent ZIKV strains (including those linked to microcephaly) and other viruses available in National Institute of Health genetic sequence database (GenBank) for the RARE consensus repeats and obtained results strongly bolstering our hypothesis that ZIKV strains associated with microcephaly may act through precipitation of dysregulation in retinoic acid-dependent genes by introducing extra stretches of RARE consensus sequence repeats in the genome of developing brain cells. Additional support to our hypothesis comes from our findings that screening of other viruses for RARE consensus sequence repeats is positive only for those known to display neurotropism and cause fetal brain defects (for which maternal-fetal transmission during developing stage may be required). The numbers of RARE sequence repeats appeared to match with the virulence of screened positive viruses. Although, bioinformatic evidence and

  10. Identification of a repeated sequence in the genome of the sea urchin which is transcribed by RNA polymerase III and contains the features of a retroposon.

    Nisson, P E; Hickey, R. J.; Boshar, M F; Crain, W R

    1988-01-01

    A repeated sequence element which is located about 200 nucleotides upstream from the protein-coding portion of the muscle actin gene (probably within a large 5' intron) in the genome of the sea urchin, Strongylocentrotus purpuratus has been characterized, and shown to contain the sequence features which indicate that it has been transposed by means of an RNA intermediate. This retroposon-like sequence, SURF1-1, is a member of a family which is dispersed and repeated about 800 times in the gen...

  11. Sequence stratigraphic features of the Middle Permian Maokou Formation in the Sichuan Basin and their controls on source rocks and reservoirs

    Wang Su

    2015-11-01

    Full Text Available Well Shuangyushi 1 and Well Nanchong l deployed in the NW and central Sichuan Basin have obtained a high-yield industrial gas flow in the dolomite and karst reservoirs of the Middle Permian Maokou Formation, showing good exploration prospects of the Maokou Formation. In order to identify the sequence stratigraphic features of the Maokou Formation, its sequence stratigraphy was divided and a unified sequence stratigraphic framework applicable for the entire basin was established to analyze the stratigraphic denudation features within the sequence framework by using the spectral curve trend attribute analysis, together with drilling and outcrop data. On this basis, the controls of sequence on source rocks and reservoirs were analyzed. In particular, the Maokou Formation was divided into two third-order sequences – SQ1 and SQ2. SQ1 was composed of members Mao 1 Member and Mao 3, while SQ2 was composed of Mao 4 Member. Sequence stratigraphic correlation indicated that the Maokou Formation within the basin had experienced erosion to varying extent, forming “three intense and two weak” denuded regions, among which, the upper part of SQ2 was slightly denuded in the two weak denuded regions (SW Sichuan Basin and locally Eastern Sichuan Basin, while SQ2 was denuded out in the three intense denuded regions (Southern Sichuan Basin–Central Sichuan Basin, NE and NW Sichuan Basin. The development of source rocks and reservoirs within sequence stratigraphic framework was significantly affected by sequence boundary; the grain banks that can form effective reservoir were predominately distributed in SQ1 highstand systems tract (HST, while effective source rocks were predominately distributed in SQ1 transgressive system tract (TST. It is concluded that the sequence division method is objective and reasonable, which can effectively guide oil and gas exploration in this region.

  12. Comparison of the chromosomal localization of murine and human glucocerebrosidase genes and of the deduced amino acid sequences

    To study structure-function relationships and molecular evolution, the authors determined the nucleotide sequence and chromosomal location of the gene encoding murine glucocerebrosidase. In the protein coding region of the murine cDNA, the nucleotide sequence and the corresponding deduced amino acid sequences were 82% and 86% identical to the respective humans sequences. All five amino acids presently known to be essential for normal enzymatic activity were conserved between mouse and man. The murine enzyme had a single deletion relative to the human enzyme at amino acid number 273. One ATG translation initiation signal was present in the mouse sequence in contrast to the human sequence, where two start codons have been reported. Nucleotide sequencing of a clone derived from murine genomic DNA revealed that the murine signal for translation initiation was located in exon 2. The locations of all 10 introns were conserved among mouse and man. They mapped the genetic locus for glucocerebrosidase to mouse chromosome 3, at a position 7.6 ± 3.2 centimorgans from the locus for the β subunit of nerve growth factor. Comparison of linkage relationships in the human and murine genome indicates that these closely linked mouse genes are also syntenic on human chromosome 1 but in positions that span the centromere

  13. Repetitive sequence based polymerase chain reaction to differentiate close bacteria strains in acidic sites

    XIE Ming; YIN Hua-qun; LIU Yi; LIU Jie; LIU Xue-duan

    2008-01-01

    To study the diversity of bacteria strains newly isolated from several acid mine drainage(AMD) sites in China,repetitive sequence based polymerase chain reaction (rep-PCR),a well established technology for diversity analysis of closely related bacteria strains,was conducted on 30 strains of bacteria Leptospirillum ferriphilium,8 strains of bacteria Acidithiobacillus ferrooxidans,as well as the Acidithiobacillus ferrooxidans type strain ATCC (American Type Culture Collection) 23270.The results showed that,using ERIC and BOX primer sets,rep-PCR produced highly discriminatory banding patterns.Phylogenetic analysis based on ERIC-PCR banding types was made and the results indicated that rep-PCR could be used as a rapid and highly discriminatory screening technique in studying bacterial diversity,especially in differentiating bacteria within one species in AMD.

  14. The amino acid alphabet and the architecture of the protein sequence-structure map. I. Binary alphabets.

    Ferrada, Evandro

    2014-12-01

    The correspondence between protein sequences and structures, or sequence-structure map, relates to fundamental aspects of structural, evolutionary and synthetic biology. The specifics of the mapping, such as the fraction of accessible sequences and structures, or the sequences' ability to fold fast, are dictated by the type of interactions between the monomers that compose the sequences. The set of possible interactions between monomers is encapsulated by the potential energy function. In this study, I explore the impact of the relative forces of the potential on the architecture of the sequence-structure map. My observations rely on simple exact models of proteins and random samples of the space of potential energy functions of binary alphabets. I adopt a graph perspective and study the distribution of viable sequences and the structures they produce, as networks of sequences connected by point mutations. I observe that the relative proportion of attractive, neutral and repulsive forces defines types of potentials, that induce sequence-structure maps of vastly different architectures. I characterize the properties underlying these differences and relate them to the structure of the potential. Among these properties are the expected number and relative distribution of sequences associated to specific structures and the diversity of structures as a function of sequence divergence. I study the types of binary potentials observed in natural amino acids and show that there is a strong bias towards only some types of potentials, a bias that seems to characterize the folding code of natural proteins. I discuss implications of these observations for the architecture of the sequence-structure map of natural proteins, the construction of random libraries of peptides, and the early evolution of the natural amino acid alphabet. PMID:25473967

  15. Trypsin inhibitors from ridged gourd (Luffa acutangula Linn.) seeds: purification, properties, and amino acid sequences.

    Haldar, U C; Saha, S K; Beavis, R C; Sinha, N K

    1996-02-01

    Two trypsin inhibitors, LA-1 and LA-2, have been isolated from ridged gourd (Luffa acutangula Linn.) seeds and purified to homogeneity by gel filtration followed by ion-exchange chromatography. The isoelectric point is at pH 4.55 for LA-1 and at pH 5.85 for LA-2. The Stokes radius of each inhibitor is 11.4 A. The fluorescence emission spectrum of each inhibitor is similar to that of the free tyrosine. The biomolecular rate constant of acrylamide quenching is 1.0 x 10(9) M-1 sec-1 for LA-1 and 0.8 x 10(9) M-1 sec-1 for LA-2 and that of K2HPO4 quenching is 1.6 x 10(11) M-1 sec-1 for LA-1 and 1.2 x 10(11) M-1 sec-1 for LA-2. Analysis of the circular dichroic spectra yields 40% alpha-helix and 60% beta-turn for La-1 and 45% alpha-helix and 55% beta-turn for LA-2. Inhibitors LA-1 and LA-2 consist of 28 and 29 amino acid residues, respectively. They lack threonine, alanine, valine, and tryptophan. Both inhibitors strongly inhibit trypsin by forming enzyme-inhibitor complexes at a molar ratio of unity. A chemical modification study suggests the involvement of arginine of LA-1 and lysine of LA-2 in their reactive sites. The inhibitors are very similar in their amino acid sequences, and show sequence homology with other squash family inhibitors. PMID:8924202

  16. NetTurnP – Neural Network Prediction of Beta-turns by Use of Evolutionary Information and Predicted Protein Sequence Features

    Petersen, Bent; Lundegaard, Claus; Petersen, Thomas Nordahl

    2010-01-01

    acid sequence. The individual β-turn types I, I', II, II', VIII, VIa1, VIa2, VIba and IV have been predicted based on classifications by PROMOTIF, and the two-class prediction of β-turn or not is a superset comprised of all β-turn types. The performance is evaluated using a golden set of non...

  17. Human Retroviruses and AIDS. A compilation and analysis of nucleic acid and amino acid sequences: I--II; III--V

    Myers, G.; Korber, B. [eds.] [Los Alamos National Lab., NM (United States); Wain-Hobson, S. [ed.] [Laboratory of Molecular Retrovirology, Pasteur Inst.; Smith, R.F. [ed.] [Baylor Coll. of Medicine, Houston, TX (United States). Dept. of Pharmacology; Pavlakis, G.N. [ed.] [National Cancer Inst., Frederick, MD (United States). Cancer Research Facility

    1993-12-31

    This compendium and the accompanying floppy diskettes are the result of an effort to compile and rapidly publish all relevant molecular data concerning the human immunodeficiency viruses (HIV) and related retroviruses. The scope of the compendium and database is best summarized by the five parts that it comprises: (I) HIV and SIV Nucleotide Sequences; (II) Amino Acid Sequences; (III) Analyses; (IV) Related Sequences; and (V) Database Communications. Information within all the parts is updated at least twice in each year, which accounts for the modes of binding and pagination in the compendium.

  18. Self-organizing maps: A tool to ascertain taxonomic relatedness based on features derived from 16S rDNA sequence

    D V Raje; H J Purohit; Y P Badhe; S S Tambe; B D Kulkarni

    2010-12-01

    Exploitation of microbial wealth, of which almost 95% or more is still unexplored, is a growing need. The taxonomic placements of a new isolate based on phenotypic characteristics are now being supported by information preserved in the 16S rRNA gene. However, the analysis of 16S rDNA sequences retrieved from metagenome, by the available bioinformatics tools, is subject to limitations. In this study, the occurrences of nucleotide features in 16S rDNA sequences have been used to ascertain the taxonomic placement of organisms. The tetra- and penta-nucleotide features were extracted from the training data set of the 16S rDNA sequence, and was subjected to an artificial neural network (ANN) based tool known as self-organizing map (SOM), which helped in visualization of unsupervised classification. For selection of significant features, principal component analysis (PCA) or curvilinear component analysis (CCA) was applied. The SOM along with these techniques could discriminate the sample sequences with more than 90% accuracy, highlighting the relevance of features. To ascertain the confidence level in the developed classification approach, the test data set was specifically evaluated for Thiobacillus, with Acidiphilium, Paracocus and Starkeya, which are taxonomically reassigned. The evaluation proved the excellent generalization capability of the developed tool. The topology of genera in SOM supported the conventional chemo-biochemical classification reported in the Bergey manual.

  19. Geometric Feature-Based Facial Expression Recognition in Image Sequences Using Multi-Class AdaBoost and Support Vector Machines

    Joonwhoan Lee

    2013-06-01

    Full Text Available Facial expressions are widely used in the behavioral interpretation of emotions, cognitive science, and social interactions. In this paper, we present a novel method for fully automatic facial expression recognition in facial image sequences. As the facial expression evolves over time facial landmarks are automatically tracked in consecutive video frames, using displacements based on elastic bunch graph matching displacement estimation. Feature vectors from individual landmarks, as well as pairs of landmarks tracking results are extracted, and normalized, with respect to the first frame in the sequence. The prototypical expression sequence for each class of facial expression is formed, by taking the median of the landmark tracking results from the training facial expression sequences. Multi-class AdaBoost with dynamic time warping similarity distance between the feature vector of input facial expression and prototypical facial expression, is used as a weak classifier to select the subset of discriminative feature vectors. Finally, two methods for facial expression recognition are presented, either by using multi-class AdaBoost with dynamic time warping, or by using support vector machine on the boosted feature vectors. The results on the Cohn-Kanade (CK+ facial expression database show a recognition accuracy of 95.17% and 97.35% using multi-class AdaBoost and support vector machines, respectively.

  20. Identification and Characterization of Second-Generation Invader Locked Nucleic Acids (LNAs) for Mixed-Sequence Recognition of Double-Stranded DNA

    Sau, Sujay P; Madsen, Andreas S; Podbevsek, Peter;

    2013-01-01

    The development of synthetic agents that recognize double-stranded DNA (dsDNA) is a long-standing goal that is inspired by the promise for tools that detect, regulate, and modify genes. Progress has been made with triplex-forming oligonucleotides, peptide nucleic acids, and polyamides, but...... substantial efforts are currently devoted to the development of alternative strategies that overcome the limitations observed with the classic approaches. In 2005, we introduced Invader locked nucleic acids (LNAs), i.e., double-stranded probes that are activated for mixed-sequence recognition of dsDNA through...... monomers. We compare the thermal denaturation characteristics of double-stranded probes featuring different interstrand zippers of pyrene-functionalized monomers based on 2'-amino-α-l-LNA, 2'-N-methyl-2'-amino-DNA, and RNA scaffolds. Insights from fluorescence spectroscopy, molecular modeling, and NMR...

  1. Lactic acid production from potato peel waste by anaerobic sequencing batch fermentation using undefined mixed culture.

    Liang, Shaobo; McDonald, Armando G; Coats, Erik R

    2015-11-01

    Lactic acid (LA) is a necessary industrial feedstock for producing the bioplastic, polylactic acid (PLA), which is currently produced by pure culture fermentation of food carbohydrates. This work presents an alternative to produce LA from potato peel waste (PPW) by anaerobic fermentation in a sequencing batch reactor (SBR) inoculated with undefined mixed culture from a municipal wastewater treatment plant. A statistical design of experiments approach was employed using set of 0.8L SBRs using gelatinized PPW at a solids content range from 30 to 50 g L(-1), solids retention time of 2-4 days for yield and productivity optimization. The maximum LA production yield of 0.25 g g(-1) PPW and highest productivity of 125 mg g(-1) d(-1) were achieved. A scale-up SBR trial using neat gelatinized PPW (at 80 g L(-1) solids content) at the 3 L scale was employed and the highest LA yield of 0.14 g g(-1) PPW and a productivity of 138 mg g(-1) d(-1) were achieved with a 1 d SRT. PMID:25708409

  2. Cloning and sequence analysis of putative type II fatty acid synthase genes from Arachis hypogaea L.

    Meng-Jun Li; Ai-Qin Li; Han Xia; Chuan-Zhi Zhao; Chang-Sheng Li; Shu-Bo Wan; Yu-Ping Bi; Xing-Jun Wang

    2009-06-01

    The cultivated peanut is a valuable source of dietary oil and ranks fifth among the world oil crops. Plant fatty acid biosynthesis is catalysed by type II fatty acid synthase (FAS) in plastids and mitochondria. By constructing a full-length cDNA library derived from immature peanut seeds and homology-based cloning, candidate genes of acyl carrier protein (ACP), malonyl-CoA:ACP transacylase, -ketoacyl-ACP synthase (I, II, III), -ketoacyl-ACP reductase, -hydroxyacyl-ACP dehydrase and enoyl-ACP reductase were isolated. Sequence alignments revealed that primary structures of type II FAS enzymes were highly conserved in higher plants and the catalytic residues were strictly conserved in Escherichia coli and higher plants. Homologue numbers of each type II FAS gene expressing in developing peanut seeds varied from 1 in KASII, KASIII and HD to 5 in ENR. The number of single-nucleotide polymorphisms (SNPs) was quite different in each gene. Peanut type II FAS genes were predicted to target plastids except ACP2 and ACP3. The results suggested that peanut may contain two type II FAS systems in plastids and mitochondria. The type II FAS enzymes in higher plants may have similar functions as those in E. coli.

  3. Site-directed gene mutation at mixed sequence targets by psoralen-conjugated pseudo-complementary peptide nucleic acids

    Kim, Ki-Hyun; Nielsen, Peter E.; Glazer, Peter M.

    2007-01-01

    Sequence-specific DNA-binding molecules such as triple helix-forming oligonucleotides (TFOs) provide a means for inducing site-specific mutagenesis and recombination at chromosomal sites in mammalian cells. However, the utility of TFOs is limited by the requirement for homopurine stretches in the target duplex DNA. Here, we report the use of pseudo-complementary peptide nucleic acids (pcPNAs) for intracellular gene targeting at mixed sequence sites. Due to steric hindrance, pcPNAs are unable ...

  4. Nucleotide and amino acid sequence coding for polypeptides of foot-and-mouth disease virus type A12.

    Robertson, B H; Grubman, M J; Weddell, G N; Moore, D.M.; Welsh, J D; Fischer, T.; Dowbenko, D J; Yansura, D G; Small, B.; Kleid, D G

    1985-01-01

    The coding region for the structural and nonstructural polypeptides of the type A12 foot-and-mouth disease virus genome has been identified by nucleotide sequencing of cloned DNA derived from the viral RNA. In addition, 704 nucleotides in the 5' untranslated region between the polycytidylic acid tract and the probable initiation codon of the first translated gene, P16-L, have been sequenced. This region has several potential initiation codons, one of which appears to be a low-frequency altern...

  5. Negative Ion In-Source Decay Matrix-Assisted Laser Desorption/Ionization Mass Spectrometry for Sequencing Acidic Peptides

    McMillen, Chelsea L.; Wright, Patience M.; Cassady, Carolyn J.

    2016-05-01

    Matrix-assisted laser desorption/ionization (MALDI) in-source decay was studied in the negative ion mode on deprotonated peptides to determine its usefulness for obtaining extensive sequence information for acidic peptides. Eight biological acidic peptides, ranging in size from 11 to 33 residues, were studied by negative ion mode ISD (nISD). The matrices 2,5-dihydroxybenzoic acid, 2-aminobenzoic acid, 2-aminobenzamide, 1,5-diaminonaphthalene, 5-amino-1-naphthol, 3-aminoquinoline, and 9-aminoacridine were used with each peptide. Optimal fragmentation was produced with 1,5-diaminonphthalene (DAN), and extensive sequence informative fragmentation was observed for every peptide except hirudin(54-65). Cleavage at the N-Cα bond of the peptide backbone, producing c' and z' ions, was dominant for all peptides. Cleavage of the N-Cα bond N-terminal to proline residues was not observed. The formation of c and z ions is also found in electron transfer dissociation (ETD), electron capture dissociation (ECD), and positive ion mode ISD, which are considered to be radical-driven techniques. Oxidized insulin chain A, which has four highly acidic oxidized cysteine residues, had less extensive fragmentation. This peptide also exhibited the only charged localized fragmentation, with more pronounced product ion formation adjacent to the highly acidic residues. In addition, spectra were obtained by positive ion mode ISD for each protonated peptide; more sequence informative fragmentation was observed via nISD for all peptides. Three of the peptides studied had no product ion formation in ISD, but extensive sequence informative fragmentation was found in their nISD spectra. The results of this study indicate that nISD can be used to readily obtain sequence information for acidic peptides.

  6. Negative Ion In-Source Decay Matrix-Assisted Laser Desorption/Ionization Mass Spectrometry for Sequencing Acidic Peptides.

    McMillen, Chelsea L; Wright, Patience M; Cassady, Carolyn J

    2016-05-01

    Matrix-assisted laser desorption/ionization (MALDI) in-source decay was studied in the negative ion mode on deprotonated peptides to determine its usefulness for obtaining extensive sequence information for acidic peptides. Eight biological acidic peptides, ranging in size from 11 to 33 residues, were studied by negative ion mode ISD (nISD). The matrices 2,5-dihydroxybenzoic acid, 2-aminobenzoic acid, 2-aminobenzamide, 1,5-diaminonaphthalene, 5-amino-1-naphthol, 3-aminoquinoline, and 9-aminoacridine were used with each peptide. Optimal fragmentation was produced with 1,5-diaminonphthalene (DAN), and extensive sequence informative fragmentation was observed for every peptide except hirudin(54-65). Cleavage at the N-Cα bond of the peptide backbone, producing c' and z' ions, was dominant for all peptides. Cleavage of the N-Cα bond N-terminal to proline residues was not observed. The formation of c and z ions is also found in electron transfer dissociation (ETD), electron capture dissociation (ECD), and positive ion mode ISD, which are considered to be radical-driven techniques. Oxidized insulin chain A, which has four highly acidic oxidized cysteine residues, had less extensive fragmentation. This peptide also exhibited the only charged localized fragmentation, with more pronounced product ion formation adjacent to the highly acidic residues. In addition, spectra were obtained by positive ion mode ISD for each protonated peptide; more sequence informative fragmentation was observed via nISD for all peptides. Three of the peptides studied had no product ion formation in ISD, but extensive sequence informative fragmentation was found in their nISD spectra. The results of this study indicate that nISD can be used to readily obtain sequence information for acidic peptides. Graphical Abstract ᅟ. PMID:26864792

  7. Negative Ion In-Source Decay Matrix-Assisted Laser Desorption/Ionization Mass Spectrometry for Sequencing Acidic Peptides

    McMillen, Chelsea L.; Wright, Patience M.; Cassady, Carolyn J.

    2016-02-01

    Matrix-assisted laser desorption/ionization (MALDI) in-source decay was studied in the negative ion mode on deprotonated peptides to determine its usefulness for obtaining extensive sequence information for acidic peptides. Eight biological acidic peptides, ranging in size from 11 to 33 residues, were studied by negative ion mode ISD (nISD). The matrices 2,5-dihydroxybenzoic acid, 2-aminobenzoic acid, 2-aminobenzamide, 1,5-diaminonaphthalene, 5-amino-1-naphthol, 3-aminoquinoline, and 9-aminoacridine were used with each peptide. Optimal fragmentation was produced with 1,5-diaminonphthalene (DAN), and extensive sequence informative fragmentation was observed for every peptide except hirudin(54-65). Cleavage at the N-Cα bond of the peptide backbone, producing c' and z' ions, was dominant for all peptides. Cleavage of the N-Cα bond N-terminal to proline residues was not observed. The formation of c and z ions is also found in electron transfer dissociation (ETD), electron capture dissociation (ECD), and positive ion mode ISD, which are considered to be radical-driven techniques. Oxidized insulin chain A, which has four highly acidic oxidized cysteine residues, had less extensive fragmentation. This peptide also exhibited the only charged localized fragmentation, with more pronounced product ion formation adjacent to the highly acidic residues. In addition, spectra were obtained by positive ion mode ISD for each protonated peptide; more sequence informative fragmentation was observed via nISD for all peptides. Three of the peptides studied had no product ion formation in ISD, but extensive sequence informative fragmentation was found in their nISD spectra. The results of this study indicate that nISD can be used to readily obtain sequence information for acidic peptides.

  8. Homology analyses of the protein sequences of fatty acid synthases from chicken liver, rat mammary gland, and yeast

    Homology analyses of the protein sequences of chicken liver and rat mammary gland fatty acid synthases were carried out. The amino acid sequences of the chicken and rat enzymes are 67% identical. If conservative substitutions are allowed, 78% of the amino acids are matched. A region of low homologies exists between the functional domains, in particular around amino acid residues 1059-1264 of the chicken enzyme. Homologies between the active sites of chicken and rat and of chicken and yeast enzymes have been analyzed by an alignment method. A high degree of homology exists between the active sites of the chicken and rat enzymes. However, the chicken and yeast enzymes show a lower degree of homology. The DADPH-binding dinucleotide folds of the β-ketoacyl reductase and the enoyl reductase sites were identified by comparison with a known consensus sequence for the DADP- and FAD-binding dinucleotide folds. The active sites of all of the enzymes are primarily in hydrophobic regions of the protein. This study suggests that the genes for the functional domains of fatty acid synthase were originally separated, and these genes were connected to each other by using different connecting nucleotide sequences in different species. An alternative explanation for the differences in rat and chicken is a common ancestry and mutations in the joining regions during evolution

  9. Features of separation on polymeric reversed phase for two classes of higher saturated fatty acids esters

    Deineka, V. I.; Lapshova, M. S.; Zakharenko, E. V.; Deineka, L. A.

    2013-11-01

    The principles of sorption on polymeric reversed phase (PRP) YMS C30 for members of the two classes of esters formed by higher saturated fatty acids, i.e., lutein diesters ( I) and triacylglycerols ( II), are investigated. It is shown that the logarithm of the retention factor increases nonlinearly with an increase of the length of the acid radical, although the retention on PRP is higher in the case of I and lower in the case of II, compared to their retention on traditional monomeric reversed phase (MRP) Kromasil-100 5C18; however, the equivalence of the contributions to the retention of I that correspond to an identical change in acids, does not depend on the length of the hydrocarbon radical of the second acid. It is noted that the Van't Hoff plot for PRP contains a curve break, indicating a change in the retention mechanism upon a rise in temperature.

  10. PSNO: Predicting Cysteine S-Nitrosylation Sites by Incorporating Various Sequence-Derived Features into the General Form of Chou’s PseAAC

    Jian Zhang

    2014-06-01

    Full Text Available S-nitrosylation (SNO is one of the most universal reversible post-translational modifications involved in many biological processes. Malfunction or dysregulation of SNO leads to a series of severe diseases, such as developmental abnormalities and various diseases. Therefore, the identification of SNO sites (SNOs provides insights into disease progression and drug development. In this paper, a new bioinformatics tool, named PSNO, is proposed to identify SNOs from protein sequences. Firstly, we explore various promising sequence-derived discriminative features, including the evolutionary profile, the predicted secondary structure and the physicochemical properties. Secondly, rather than simply combining the features, which may bring about information redundancy and unwanted noise, we use the relative entropy selection and incremental feature selection approach to select the optimal feature subsets. Thirdly, we train our model by the technique of the k-nearest neighbor algorithm. Using both informative features and an elaborate feature selection scheme, our method, PSNO, achieves good prediction performance with a mean Mathews correlation coefficient (MCC value of about 0.5119 on the training dataset using 10-fold cross-validation. These results indicate that PSNO can be used as a competitive predictor among the state-of-the-art SNOs prediction tools. A web-server, named PSNO, which implements the proposed method, is freely available at http://59.73.198.144:8088/PSNO/.

  11. Hydroxycinnamic acid bound arabinoxylans from millet brans-structural features and antioxidant activity.

    Bijalwan, Vandana; Ali, Usman; Kesarwani, Atul Kumar; Yadav, Kamalendra; Mazumder, Koushik

    2016-07-01

    Hydroxycinnamic acid bound arabinoxylans (HCA-AXs) were extracted from brans of five Indian millet varieties and response surface methodology was used to optimize the extraction conditions. The optimal condition to obtain highest yield of millet HCA-AXs was determined as follows: time 61min, temperature 66°C, ratio of solvent to sample 12ml/g. Linkage analysis indicated that hydroxycinnamic acid bound arabinoxylan from kodo millet (KM-HCA-AX) contained comparatively low branched arabinoxylan consisting of 14.6% mono-substituted, 1.2% di-substituted and 41.2% un-substituted Xylp residues. The HPLC analysis of millet HCA-AXs showed significant variation in the content of three major bound hydroxycinnamic acids (caffeic, p-coumaric and ferulic acid). The antioxidant activity of millet HCA-AXs were evaluated using three in vitro assay methods (DPPH, FRAP and β-carotene linoleate emulsion assays) which suggested both phenolic acid composition and structural characteristics of arabinoxylans could be correlated to their antioxidant potential, the detailed structural analysis revealed that low substituted KM-HCA-AX exhibited relatively higher antioxidant activity compared to other medium and highly substituted HCA-AXs from finger (FM), proso (PM), barnyard (BM) and foxtail (FOXM) millet. PMID:27050114

  12. The developmental transcriptome landscape of bovine skeletal muscle defined by Ribo-Zero ribonucleic acid sequencing.

    Sun, X; Li, M; Sun, Y; Cai, H; Li, R; Wei, X; Lan, X; Huang, Y; Lei, C; Chen, H

    2015-12-01

    Ribonucleic acid sequencing (RNA-Seq) libraries are normally prepared with oligo(dT) selection of poly(A)+ mRNA, but it depends on intact total RNA samples. Recent studies have described Ribo-Zero technology, a novel method that can capture both poly(A)+ and poly(A)- transcripts from intact or fragmented RNA samples. We report here the first application of Ribo-Zero RNA-Seq for the analysis of the bovine embryonic, neonatal, and adult skeletal muscle whole transcriptome at an unprecedented depth. Overall, 19,893 genes were found to be expressed, with a high correlation of expression levels between the calf and the adult. Hundreds of genes were found to be highly expressed in the embryo and decreased at least 10-fold after birth, indicating their potential roles in embryonic muscle development. In addition, we present for the first time the analysis of global transcript isoform discovery in bovine skeletal muscle and identified 36,694 transcript isoforms. Transcriptomic data were also analyzed to unravel sequence variations; 185,036 putative SNP and 12,428 putative short insertions-deletions (InDel) were detected. Specifically, many stop-gain, stop-loss, and frameshift mutations were identified that probably change the relative protein production and sequentially affect the gene function. Notably, the numbers of stage-specific transcripts, alternative splicing events, SNP, and InDel were greater in the embryo than in the calf and the adult, suggesting that gene expression is most active in the embryo. The resulting view of the transcriptome at a single-base resolution greatly enhances the comprehensive transcript catalog and uncovers the global trends in gene expression during bovine skeletal muscle development. PMID:26641174

  13. Insights into Protein Sequence and Structure-Derived Features Mediating 3D Domain Swapping Mechanism using Support Vector Machine Based Approach

    Khader Shameer

    2010-06-01

    Full Text Available 3-dimensional domain swapping is a mechanism where two or more protein molecules form higher order oligomers by exchanging identical or similar subunits. Recently, this phenomenon has received much attention in the context of prions and neuro-degenerative diseases, due to its role in the functional regulation, formation of higher oligomers, protein misfolding, aggregation etc. While 3-dimensional domain swap mechanism can be detected from three-dimensional structures, it remains a formidable challenge to derive common sequence or structural patterns from proteins involved in swapping. We have developed a SVM-based classifier to predict domain swapping events using a set of features derived from sequence and structural data. The SVM classifier was trained on features derived from 150 proteins reported to be involved in 3D domain swapping and 150 proteins not known to be involved in swapped conformation or related to proteins involved in swapping phenomenon. The testing was performed using 63 proteins from the positive dataset and 63 proteins from the negative dataset. We obtained 76.33% accuracy from training and 73.81% accuracy from testing. Due to high diversity in the sequence, structure and functions of proteins involved in domain swapping, availability of such an algorithm to predict swapping events from sequence and structure-derived features will be an initial step towards identification of more putative proteins that may be involved in swapping or proteins involved in deposition disease. Further, the top features emerging in our feature selection method may be analysed further to understand their roles in the mechanism of domain swapping.

  14. N-terminal amino acid sequence of Bacillus licheniformis alpha-amylase: comparison with Bacillus amyloliquefaciens and Bacillus subtilis Enzymes.

    Kuhn, H; Fietzek, P P; Lampen, J. O.

    1982-01-01

    The thermostable, liquefying alpha-amylase from Bacillus licheniformis was immunologically cross-reactive with the thermolabile, liquefying alpha-amylase from Bacillus amyloliquefaciens. Their N-terminal amino acid sequences showed extensive homology with each other, but not with the saccharifying alpha-amylases of Bacillus subtilis.

  15. Genome Sequence of a Candidate World Health Organization Reference Strain of Zika Virus for Nucleic Acid Testing.

    Trösemeier, Jan-Hendrik; Musso, Didier; Blümel, Johannes; Thézé, Julien; Pybus, Oliver G; Baylis, Sally A

    2016-01-01

    We report here the sequence of a candidate reference strain of Zika virus (ZIKV) developed on behalf of the World Health Organization (WHO). The ZIKV reference strain is intended for use in nucleic acid amplification (NAT)-based assays for the detection and quantification of ZIKV RNA. PMID:27587826

  16. Draft Genome Sequence of Lactobacillus delbrueckii subsp. bulgaricus CFL1, a Lactic Acid Bacterium Isolated from French Handcrafted Fermented Milk

    Meneghel, Julie; Irlinger, Françoise; Loux, Valentin; Vidal, Marie; Passot, Stéphanie; Béal, Catherine; Layec, Séverine

    2016-01-01

    Lactobacillus delbrueckii subsp. bulgaricus (L. bulgaricus) is a lactic acid bacterium widely used for the production of yogurt and cheeses. Here, we report the genome sequence of L. bulgaricus CFL1 to improve our knowledge on its stress-induced damages following production and end-use processes. PMID:26941141

  17. Draft Genome Sequence of Lactobacillus delbrueckii subsp. bulgaricus CFL1, a Lactic Acid Bacterium Isolated from French Handcrafted Fermented Milk.

    Meneghel, Julie; Dugat-Bony, Eric; Irlinger, Françoise; Loux, Valentin; Vidal, Marie; Passot, Stéphanie; Béal, Catherine; Layec, Séverine; Fonseca, Fernanda

    2016-01-01

    Lactobacillus delbrueckii subsp. bulgaricus (L. bulgaricus) is a lactic acid bacterium widely used for the production of yogurt and cheeses. Here, we report the genome sequence of L. bulgaricus CFL1 to improve our knowledge on its stress-induced damages following production and end-use processes. PMID:26941141

  18. Genome Sequence of Corynebacterium glutamicum ATCC 14067, Which Provides Insight into Amino Acid Biosynthesis in Coryneform Bacteria

    Lv, Yangyong; Liao, Juanjun; Wu, Zhanhong; Han, Shuangyan; Lin, Ying; Zheng, Suiping

    2012-01-01

    We report the genome sequence of Corynebacterium glutamicum ATCC 14067 (once named Brevibacterium flavum), which is useful for taxonomy research and further molecular breeding in amino acid production. Preliminary comparison with those of the reported coryneform strains revealed some notable differences that might be related to the difficulties in molecular manipulation.

  19. Complete genome sequence of Lactobacillus plantarum ZS2058, a probiotic strain with high conjugated linoleic acid production ability.

    Yang, Bo; Chen, Haiqin; Tian, Fengwei; Zhao, Jianxin; Gu, Zhennan; Zhang, Hao; Chen, Yong Q; Chen, Wei

    2015-11-20

    Lactobacillus plantarum ZS2058 was isolated from sauerkraut and identified to synthesize the beneficial metabolite conjugated linoleic acid. The genome contains a 319,7363-bp chromosome and three plasmids. The sequence will facilitate identification and characterization of the genetic determinants for its putative biological benefits. PMID:26439428

  20. Structural features of lignite humic acid in light of NMR and thermal degradation experiments

    Peuravuori, J.; Simpson, A.J.; Lam, B.; Zbankova, P.; Pihlaja, K. [University of Turku, Turku (Finland). Dept. of Chemistry

    2007-01-29

    Structural composition of a lignite humic acid (HA) fraction was studied by means of solid-state {sup 13}C NMR, different solution-state {sup 1}H NMR pulse techniques and thermally assisted hydrolysis-methylation with TMAH and TMAAc followed-up with pyrolysis-GC-MS experiments. The results verified that certain aliphatic compounds have their special tasks in the complicated structural network of lignite HA material, and aprotic solvents with strong electron-donor powers are needed to release the tightly bound certain aliphatics from the macromolecular network for obtaining a fully dissolved HA solution. The occurrence of the relatively large content of different carboxylic acids as their free-acid forms was surprising. The structural interpretations performed by special {sup 1}H NMR pulse techniques verified the complexity of aliphatic moieties, the presence of hydroaromatic carbons, residual lignin derivatives, the abundance of aliphatic and aromatic carboxylic acids, and the ability of aliphatics to form inter-molecular bridges between aromatic building blocks.

  1. An Matching Method for Vehicle-borne Panoramic Image Sequence Based on Adaptive Structure from Motion Feature

    ZHANG Zhengpeng

    2015-10-01

    Full Text Available Panoramic image matching method with the constraint condition of local structure from motion similarity feature is an important method, the process requires multivariable kernel density estimations for the structure from motion feature used nonparametric mean shift. Proper selection of the kernel bandwidth is a critical step for convergence speed and accuracy of matching method. Variable bandwidth with adaptive structure from motion feature for panoramic image matching method has been proposed in this work. First the bandwidth matrix is defined using the locally adaptive spatial structure of the sampling point in spatial domain and optical flow domain. The relaxation diffusion process of structure from motion similarity feature is described by distance weighting method of local optical flow feature vector. Then the expression form of adaptive multivariate kernel density function is given out, and discusses the solution of the mean shift vector, termination conditions, and the seed point selection method. The final fusions of multi-scale SIFT the features and structure features to establish a unified panoramic image matching framework. The sphere panoramic images from vehicle-borne mobile measurement system are chosen such that a comparison analysis between fixed bandwidth and adaptive bandwidth is carried out in detail. The results show that adaptive bandwidth is good for case with the inlier ratio changes and the object space scale changes. The proposed method can realize the adaptive similarity measure of structure from motion feature, improves the correct matching points and matching rate, experimental results have shown our method to be robust.

  2. Features of photopolymerization of Langmiur-Blodgett thin films of acetylenic acids

    UV-induced polymerization of thin (1-4 monolayers) Langmuir-Blodgett films of acetylenic carboxylic acids with triple bonds in different positions (terminal: 23-tetracosinic acid HC≡C(CH2)21COOH, and internal: 2-docosinic CH3(CH2)18C≡CCOOH) and their lead salts is investigated. It is shown by means of IR spectroscopy that the topochemical reaction proceeds with the participation of carboxylic groups. The differences in the structure of mono- and bilayers are demonstrated. The mechanism of the topochemical reaction depends on the method of film transfer onto the substrate. It is shown by means of UV spectroscopy that short conjugated polyenes (containing 7 to 9 carbon atoms) are formed as the product of polymerization. The mechanism of the formation of these polyene chains is proposed on the basis of the experimental data and semi-empirical calculations.

  3. Features of photopolymerization of Langmiur-Blodgett thin films of acetylenic acids

    Dultsev, F.N., E-mail: fdultsev@thermo.isp.nsc.r [Institute of Semiconductor Physics SB RAS, Novosibisrk, 630090, Lavrentiev Ave., 13 (Russian Federation); Badmaeva, I.A. [Institute of Semiconductor Physics SB RAS, Novosibisrk, 630090, Lavrentiev Ave., 13 (Russian Federation)

    2009-11-02

    UV-induced polymerization of thin (1-4 monolayers) Langmuir-Blodgett films of acetylenic carboxylic acids with triple bonds in different positions (terminal: 23-tetracosinic acid HC{identical_to}C(CH2)21COOH, and internal: 2-docosinic CH3(CH2)18C{identical_to}CCOOH) and their lead salts is investigated. It is shown by means of IR spectroscopy that the topochemical reaction proceeds with the participation of carboxylic groups. The differences in the structure of mono- and bilayers are demonstrated. The mechanism of the topochemical reaction depends on the method of film transfer onto the substrate. It is shown by means of UV spectroscopy that short conjugated polyenes (containing 7 to 9 carbon atoms) are formed as the product of polymerization. The mechanism of the formation of these polyene chains is proposed on the basis of the experimental data and semi-empirical calculations.

  4. Pathophysiology, clinical features and radiological findings of differentiation syndrome/all-trans-retinoic acid syndrome

    Cardinale, Luciano; Asteggiano, Francesco; Moretti, Federica; Torre, Federico; Ulisciani, Stefano; Fava, Carmen; Rege-Cambrin, Giovanna

    2014-01-01

    In acute promyelocytic leukemia, differentiation therapy based on all-trans-retinoic acid can be complicated by the development of a differentiation syndrome (DS). DS is a life-threatening complication, characterized by respiratory distress, unexplained fever, weight gain, interstitial lung infiltrates, pleural or pericardial effusions, hypotension and acute renal failure. The diagnosis of DS is made on clinical grounds and has proven to be difficult, because none of the symptoms is pathognom...

  5. Geometric Feature-Based Facial Expression Recognition in Image Sequences Using Multi-Class AdaBoost and Support Vector Machines

    Joonwhoan Lee; Deepak Ghimire

    2013-01-01

    Facial expressions are widely used in the behavioral interpretation of emotions, cognitive science, and social interactions. In this paper, we present a novel method for fully automatic facial expression recognition in facial image sequences. As the facial expression evolves over time facial landmarks are automatically tracked in consecutive video frames, using displacements based on elastic bunch graph matching displacement estimation. Feature vectors from individual landmarks, as well as pa...

  6. Nucleotide and amino acid sequences of a coat protein of an Ukrainian isolate of Potato virus Y: comparison with homologous sequences of other isolates and phylogenetic analysis

    Budzanivska I. G.

    2014-03-01

    Full Text Available Aim. Identification of the widespread Ukrainian isolate(s of PVY (Potato virus Y in different potato cultivars and subsequent phylogenetic analysis of detected PVY isolates based on NA and AA sequences of coat protein. Methods. ELISA, RT-PCR, DNA sequencing and phylogenetic analysis. Results. PVY has been identified serologically in potato cultivars of Ukrainian selection. In this work we have optimized a method for total RNA extraction from potato samples and offered a sensitive and specific PCR-based test system of own design for diagnostics of the Ukrainian PVY isolates. Part of the CP gene of the Ukrainian PVY isolate has been sequenced and analyzed phylogenetically. It is demonstrated that the Ukrainian isolate of Potato virus Y (CP gene has a higher percentage of homology with the recombinant isolates (strains of this pathogen (approx. 98.8– 99.8 % of homology for both nucleotide and translated amino acid sequences of the CP gene. The Ukrainian isolate of PVY is positioned in the separate cluster together with the isolates found in Syria, Japan and Iran; these isolates possibly have common origin. The Ukrainian PVY isolate is confirmed to be recombinant. Conclusions. This work underlines the need and provides the means for accurate monitoring of Potato virus Y in the agroecosystems of Ukraine. Most importantly, the phylogenetic analysis demonstrated the recombinant nature of this PVY isolate which has been attributed to the strain group O, subclade N:O.

  7. Evolution of vertebrate IgM: complete amino acid sequence of the constant region of Ambystoma mexicanum mu chain deduced from cDNA sequence.

    Fellah, J S; Wiles, M V; Charlemagne, J; Schwager, J

    1992-10-01

    cDNA clones coding for the constant region of the Mexican axolotl (Ambystoma mexicanum) mu heavy immunoglobulin chain were selected from total spleen RNA, using a cDNA polymerase chain reaction technique. The specific 5'-end primer was an oligonucleotide homologous to the JH segment of Xenopus laevis mu chain. One of the clones, JHA/3, corresponded to the complete constant region of the axolotl mu chain, consisting of a 1362-nucleotide sequence coding for a polypeptide of 454 amino acids followed in 3' direction by a 179-nucleotide untranslated region and a polyA+ tail. The axolotl C mu is divided into four typical domains (C mu 1-C mu 4) and can be aligned with the Xenopus C mu with an overall identity of 56% at the nucleotide level. Percent identities were particularly high between C mu 1 (59%) and C mu 4 (71%). The C-terminal 20-amino acid segment which constitutes the secretory part of the mu chain is strongly homologous to the equivalent sequences of chondrichthyans and of other tetrapods, including a conserved N-linked oligosaccharide, the penultimate cysteine and the C-terminal lysine. The four C mu domains of 13 vertebrate species ranging from chondrichthyans to mammals were aligned and compared at the amino acid level. The significant number of mu-specific residues which are conserved into each of the four C mu domains argues for a continuous line of evolution of the vertebrate mu chain. This notion was confirmed by the ability to reconstitute a consistent vertebrate evolution tree based on the phylogenic parsimony analysis of the C mu 4 sequences. PMID:1382992

  8. Investigation of Antifouling Properties of Surfaces Featuring Zwitterionic α-Aminophosphonic Acid Moieties.

    Wagner, Natalie; Zimmermann, Phyllis; Heisig, Peter; Klitsche, Franziska; Maison, Wolfgang; Theato, Patrick

    2015-12-01

    Zwitterionic thin films containing α-amino phosphonic acid moieties were successfully introduced on silicon surfaces and their antifouling properties were investigated. Initially, the substrates were modified with a hybrid polymer, composed of poly(methylsilsesquioxane) (PMSSQ) and poly(4-vinyl benzaldehyde) (PStCHO). Next, a Kabachnik-Fields post-polymerization modification (sur-KF-PMR) of the functionalized aldehyde surfaces was conducted with different amines and dialkyl phosphonates. After subsequent deprotection reaction of dialkyl phosphonates, the obtained zwitterionic surfaces were characterized by various techniques and we found excellent antifouling properties of the resulting films. PMID:26332285

  9. Complete amino acid sequence of human plasma Zn-α2-glycoprotein and its homology to histocompatibility antigens

    In the present study the complete amino acid sequence of human plasma Zn-α2-glycoprotein was determined. This protein whose biological function is unknown consists of a single polypeptide chain of 276 amino acid residues including 8 tryptophan residues and has a pyroglutamyl residue at the amino terminus. The location of the two disulfide bonds in the polypeptide chain was also established. The three glycans, whose structure was elucidated with the aid of 500 MHz 1H NMR spectroscopy, were sialylated N-biantennas. The molecular weight calculated from the polypeptide and carbohydrate structure is 38,478, which is close to the reported value of ≅ 41,000 based on physicochemical measurements. The predicted secondary structure appeared to comprised of 23% α-helix, 27% β-sheet, and 22% β-turns. The three N-glycans were found to be located in β-turn regions. An unexpected finding was made by computer analysis of the sequence data; this revealed that Zn-α2-glycoprotein is closely related to antigens of the major histocompatibility complex in amino acid sequence and in domain structure. There was an unusually high degree of sequence homology with the α chains of class I histocompatibility antigens. Moreover, this plasma protein was shown to be a member of the immunoglobulin gene superfamily. Zn-α2-glycoprotein appears to be truncated secretory major histocompatibility complex-related molecule, and it may have a role in the expression of the immune response

  10. Human tyrosyl-tRNA synthetase shares amino acid sequence homology with a putative cytokine.

    Kleeman, T A; Wei, D; Simpson, K L; First, E A

    1997-05-30

    To test the hypothesis that tRNATyr recognition differs between bacterial and human tyrosyl-tRNA synthetases, we sequenced several clones identified as human tyrosyl-tRNA synthetase cDNAs by the Human Genome Project. We found that human tyrosyl-tRNA synthetase is composed of three domains: 1) an amino-terminal Rossmann fold domain that is responsible for formation of the activated E.Tyr-AMP intermediate and is conserved among bacteria, archeae, and eukaryotes; 2) a tRNA anticodon recognition domain that has not been conserved between bacteria and eukaryotes; and 3) a carboxyl-terminal domain that is unique to the human tyrosyl-tRNA synthetase and whose primary structure is 49% identical to the putative human cytokine endothelial monocyte-activating protein II, 50% identical to the carboxyl-terminal domain of methionyl-tRNA synthetase from Caenorhabditis elegans, and 43% identical to the carboxyl-terminal domain of Arc1p from Saccharomyces cerevisiae. The first two domains of the human tyrosyl-tRNA synthetase are 52, 36, and 16% identical to tyrosyl-tRNA synthetases from S. cerevisiae, Methanococcus jannaschii, and Bacillus stearothermophilus, respectively. Nine of fifteen amino acids known to be involved in the formation of the tyrosyl-adenylate complex in B. stearothermophilus are conserved across all of the organisms, whereas amino acids involved in the recognition of tRNATyr are not conserved. Kinetic analyses of recombinant human and B. stearothermophilus tyrosyl-tRNA synthetases expressed in Escherichia coli indicate that human tyrosyl-tRNA synthetase aminoacylates human but not B. stearothermophilus tRNATyr, and vice versa, supporting the original hypothesis. It is proposed that like endothelial monocyte-activating protein II and the carboxyl-terminal domain of Arc1p, the carboxyl-terminal domain of human tyrosyl-tRNA synthetase evolved from gene duplication of the carboxyl-terminal domain of methionyl-tRNA synthetase and may direct tRNA to the active site of

  11. A Unique Sequence of Financial Accounting Courses Featuring Team Teaching, Linked Courses, Challenging Assignments, and Instruments for Evaluation and Assessment

    Lundblad, Heidemarie; Wilson, Barbara A.

    2008-01-01

    The Department of Accounting at California State University Northridge (CSUN) has developed a unique sequence of courses designed to ensure that accounting students are trained not only in technical accounting, but also acquire critical thinking, research and communication skills. The courses have proven effective and have embedded assessment…

  12. Gastropod arginine kinases from Cellana grata and Aplysia kurodai. Isolation and cDNA-derived amino acid sequences.

    Suzuki, T; Inoue, N; Higashi, T; Mizobuchi, R; Sugimura, N; Yokouchi, K; Furukohri, T

    2000-12-01

    Arginine kinase (AK) was isolated from the radular muscle of the gastropod molluscs Cellana grata (subclass Prosobranchia) and Aplysia kurodai (subclass Opisthobranchia), respectively, by ammonium sulfate fractionation, Sephadex G-75 gel filtration and DEAE-ion exchange chromatography. The denatured relative molecular mass values were estimated to be 40 kDa by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. The isolated enzyme from Aplysia gave a Km value of 0.6 mM for arginine and a Vmax value of 13 micromole Pi min(-1) mg protein(-1) for the forward reaction. These values are comparable to other molluscan AKs. The cDNAs encoding Cellana and Aplysia AKs were amplified by polymerase chain reaction, and the nucleotide sequences of 1,608 and 1,239 bp, respectively, were determined. The open reading frame for Cellana AK is 1044 nucleotides in length and encodes a protein with 347 amino acid residues, and that for A. kurodai is 1077 nucleotides and 354 residues. The cDNA-derived amino acid sequences were validated by chemical sequencing of internal lysyl endopeptidase peptides. The amino acid sequences of Cellana and Aplysia AKs showed the highest percent identity (66-73%) with those of the abalone Nordotis and turbanshell Battilus belonging to the same class Gastropoda. These AK sequences still have a strong homology (63-71%) with that of the chiton Liolophura (class Polyplacophora), which is believed to be one of the most primitive molluscs. On the other hand, these AK sequences are less homologous (55-57%) with that of the clam Pseudocardium (class Bivalvia), suggesting that the biological position of the class Polyplacophora should be reconsidered. PMID:11281267

  13. Amino acid sequences of predicted proteins and their annotation for 95 organism species. - Gclust Server | LSDB Archive [Life Science Database Archive metadata

    Full Text Available Gclust Server Amino acid sequences of predicted proteins and their annotation for 95 organism species. Data ...detail Data name Amino acid sequences of predicted proteins and their annotation for 95 organism species. De...scription of data contents Amino acid sequences of predicted proteins and their a...nnotation for 95 organism species. The data are given in a CSV format text file. Data file File name: gclust...tation in original database Annotation at the original website Species Species name Length Amino acid sequen

  14. Radiologic features of all-trans-retinoic acid syndrome (ATRAS) - case report

    ATRA Syndrome appears as a side effect of acute promyelocytic leukemia treatment with ATRA, vitamin A derivative. The etiopathogenesis of the syndrome remains unclear. Fever, generalized edema, pleural or pericardial effusion, respiratory distress, coagulation disorders and sometimes renal failure are the most common clinical symptoms of ATRAS. Radiological features of the syndrome are very diverse. Early diagnosis followed by introduction of appropriate treatment (corticosteroids) prevents worsening of the patients' condition and significantly reduces the risk of death. Although clinical symptomatology of ATRAS has been widely described, there are still few descriptions of its radiological manifestation. A 53-year-old female was referred to the Hematology Department for further detailed diagnostics and appropriate therapy from the district hospital, where she had been primarily admitted due to weakness, easy fatigue, loss of appetite and blood extravasations on the skin of the extremities. The patient's general condition on admission was assessed as quite good. Acute promyelocytic leukemia (AML M3 according to FAB classification) was diagnosed. The introduced treatment included ATRA. On the second day of treatment, the patient developed fever, dyspnea, generalized edema, and coagulation disorders increased. Chest X-ray findings reminded ARDS. The diagnosis of ATRAS was established, which resulted in ATRA withdrawal. After administration of corticosteroids, the patient's condition improved gradually within a few days. ATRA was reintroduced then, since the signs of leukemia had intensified. The patient remains in charge of the Hematology Department. Changes of chest X-ray pictures in AML patients treated with ATRA should be interpreted in clinical context due to lack of radiological features specific for ATRAS. (author)

  15. Barley polyamine oxidase: Characterisation and analysis of the cofactor and the N-terminal amino acid sequence

    Radova, A.; Sebela, M.; Galuszka, P.; Frebort, I.; Jacobsen, Susanne; Faulhammer, H.G.; Pec, P.

    2001-01-01

    further purified to a final homogeneity (by the criteria of isoelectric focusing and SDS-PAGE) using techniques of low pressure chromatography followed by two FPLC steps. The purified yellow enzyme showed visible absorption maxima of a flavoprotein at 380 and 450 nm: the presence of FAD as the cofactor...... was further confirmed by measuring the fluorescence spectra, Barley PAO is an acidic protein (pI 5.4) containing 3% of neutral sugars: its molecular mass determined by SDS-PAGE was 56 kDa, whilst gel permeation chromatography revealed the higher value of 76 kDa. The N-terminal amino acid sequence of...

  16. Sequence features and phylogenetic analysis of the stress protein Hsp90α in chinook salmon (Oncorhynchus tshawytscha), a poikilothermic vertebrate

    Palmisano, Aldo N.; Winton, James R.; Dickhoff, Walton W.

    1999-01-01

    We cloned and sequenced a chinook salmon Hsp90 cDNA; sequence analysis shows it to be Hsp90??. Phylogenetic analysis supports the hypothesis that ?? and ?? paralogs of Hsp90 arose as a result of a gene duplication event and that they diverged early in the evolution of vertebrates, before tetrapods separated from the teleost lineage. Among several differences distinguishing poikilothermic Hsp90?? sequences from their bird and mammal orthologs, the teleost versions specifically lack a characteristic QTQDQP phosphorylation site near the N-terminus. We used the cDNA to develop an RNA (Northern) blot to quantify cellular Hsp90 mRNA levels. Chinook salmon embryonic (CHSE-214) cells responded to heat shock with a rapid rise in Hsp90 mRNA through 4 h, followed by a gradual decline over the next 20 h. Hsp90 mRNA level may be useful as a stress indicator, especially in a laboratory setting or in response to acute heat stress.

  17. JRC GMO-Amplicons, a collection of nucleic acid sequences related to genetically modified organisms

    PETRILLO MAURO; ANGERS ALEXANDRE; HENRIKSSON PETER; Bonfini, Laura; PATAK DENNSTEDT Alexandre; KREYSA JOACHIM

    2015-01-01

    The DNA target sequence is the key element in designing detection methods for genetically modified organisms (GMOs). Unfortunately this information is frequently lacking, especially for unauthorized GMOs. In addition, patent sequences are generally poorly annotated, buried in complex and extensive documentation and hard to link to the corresponding GM event. Here, we present the JRC GMO-Amplicons, a database of amplicons collected by screening public nucleotide sequence databanks by in silico...

  18. Identification of novel rice low phytic acid mutations via TILLING by sequencing

    Phytic acid (myo-inositol-1,2,3,4,5,6-hexakisphosphate or InsP6) accounts for 75-85% of the total phosphorus in seeds. Low phytic acid (lpa) mutants exhibit decreases in seed InsP6 with corresponding increases in inorganic P which, unlike phytic acid P, is readily utilized by humans and monogastric ...

  19. PASS2 database for the structure-based sequence alignment of distantly related SCOP domain superfamilies: update to version 5 and added features.

    Gandhimathi, Arumugam; Ghosh, Pritha; Hariharaputran, Sridhar; Mathew, Oommen K; Sowdhamini, R

    2016-01-01

    Structure-based sequence alignment is an essential step in assessing and analysing the relationship of distantly related proteins. PASS2 is a database that records such alignments for protein domain superfamilies and has been constantly updated periodically. This update of the PASS2 version, named as PASS2.5, directly corresponds to the SCOPe 2.04 release. All SCOPe structural domains that share less than 40% sequence identity, as defined by the ASTRAL compendium of protein structures, are included. The current version includes 1977 superfamilies and has been assembled utilizing the structure-based sequence alignment protocol. Such an alignment is obtained initially through MATT, followed by a refinement through the COMPARER program. The JOY program has been used for structural annotations of such alignments. In this update, we have automated the protocol and focused on inclusion of new features such as mapping of GO terms, absolutely conserved residues among the domains in a superfamily and inclusion of PDBs, that are absent in SCOPe 2.04, using the HMM profiles from the alignments of the superfamily members and are provided as a separate list. We have also implemented a more user-friendly manner of data presentation and options for downloading more features. PASS2.5 version is available at http://caps.ncbs.res.in/pass2/. PMID:26553811

  20. Using Triple Helix Forming Peptide Nucleic Acids for Sequence-selective Recognition of Double-stranded RNA

    Hnedzko, Dziyana; Cheruiyot, Samwel K.; Rozners, Eriks

    2014-01-01

    Non-coding RNAs play important roles in regulation of gene expression. Specific recognition and inhibition of these biologically important RNAs that form complex double-helical structures will be highly useful for fundamental studies in biology and practical applications in medicine. This protocol describes a strategy developed in our laboratory for sequence-selective recognition of double-stranded RNA (dsRNA) using triple helix forming peptide nucleic acids (PNAs) that bind in the major grov...

  1. Real-Time Nucleic Acid Sequence-Based Amplification Using Molecular Beacons for Detection of Enterovirus RNA in Clinical Specimens

    Landry, Marie L.; Garner, Robin; Ferguson, David

    2005-01-01

    Real-time nucleic acid sequence-based amplification (NASBA) using molecular beacon technology (NASBA-beacon) was compared to standard NASBA with postamplification hybridization using electrochemiluminescently labeled probes (NASBA-ECL) for detection of enteroviruses (EV) in 133 cerebrospinal fluid and 27 stool samples. NASBA-ECL and NASBA-beacon were similar in sensitivity, detecting 55 (100%) and 52 (94.5%) EV-positive samples, respectively. There were no false positives. Both NASBA assays w...

  2. Comparative Complete Genome Sequence Analysis of the Amino Acid Replacements Responsible for the Thermostability of Corynebacterium efficiens

    Nishio, Yousuke; Nakamura, Yoji; Kawarabayasi, Yutaka; Usuda, Yoshihiro; Kimura, Eiichiro; Sugimoto, Shinichi; Matsui, Kazuhiko; Yamagishi, Akihiko; Kikuchi, Hisashi; Ikeo, Kazuho; Gojobori, Takashi

    2003-01-01

    Corynebacterium efficiens is the closest relative of Corynebacterium glutamicum, a species widely used for the industrial production of amino acids. C. efficiens but not C. glutamicum can grow above 40°C. We sequenced the complete C. efficiens genome to investigate the basis of its thermostability by comparing its genome with that of C. glutamicum. The difference in GC content between the species was reflected in codon usage and nucleotide substitutions. Our compar...

  3. Deep sequencing of the Mexican avocado transcriptome, an ancient angiosperm with a high content of fatty acids

    Ibarra-Laclette, Enrique; Méndez-Bravo, Alfonso; Pérez-Torres, Claudia Anahí; Albert, Victor A; Mockaitis, Keithanne; Kilaru, Aruna; López-Gómez, Rodolfo; Cervantes-Luevano, Jacob Israel; Herrera-Estrella, Luis

    2015-01-01

    Background Avocado (Persea americana) is an economically important tropical fruit considered to be a good source of fatty acids. Despite its importance, the molecular and cellular characterization of biochemical and developmental processes in avocado is limited due to the lack of transcriptome and genomic information. Results The transcriptomes of seeds, roots, stems, leaves, aerial buds and flowers were determined using different sequencing platforms. Additionally, the transcriptomes of thre...

  4. Genetic, molecular and expression features of the Pervenets mutant leading to high oleic acid content of seed oil in sunflower

    Lacombe Séverine

    2002-01-01

    Full Text Available Pervenets is a sunflower population that displays seed oil with a high oleic acid content [HOAC]. Our aim is to reconcile all the data gathered on this mutant in a unique explanatory mechanism. All Pervenets-derived [HOAC] lines display no accumulation or a very reduced accumulation of the DELTA12-desaturase transcript in the embryos during the stages for oil accumulation. They also carry oleHOS specific RFLP markers revealed by an DELTA12-desaturase cDNA used as a probe. The linoleic or [LO] genotypes do not carry this RFLP marker, but another allele: oleLOR (oleHL locus. Linkage disequilibrium between the oleHOS allele and [HOAC] was verified. We studied the mode of inheritance of [HOAC] in two segregating populations. A F2 progenies revealed one dominant allele for [HOAC] that co-segregated with the oleHOS allele showing that the Pervenets mutation and oleHOS were closely linked. F6 recombinant inbred lines, showed the [HOAC] trait due to two independent loci: the locus carrying the oleHOS allele and another locus sup. One allele, supole, at this second locus may suppress the effect of the oleHOS allele on the [HOAC] trait. Northern analyses performed on [HOAC] lines and F1 ([HOAC] x [LO] hybrids revealed under-accumulation of DELTA12-desaturase transcript. Thus Pervenets mutation acts in trans. The oleHOS genomic region that may carry the Pervenets mutation was cloned. A genomic library was constructed in lambdafixII with the DNA from the RHA345 [HOAC] line and screened with a DELTA12-desaturase cDNA as a probe. Two overlapping clones were entirely sequenced and revealed carrying a gene for an DELTA12-desaturase probably located in the RE. This corresponds to the invariant part of the oleHL locus. Another clone (11.1 probably carries DELTA12-desaturase repeated sequences that cause instability of the clone. We showed that the 11.1 clone carries most of cDNA sequence, but due to its organization it is not yet sequenced. A mutation mechanism

  5. Removing the influence of feature repetitions on the congruency sequence effect: why regressing out confounds from a nested design will often fall short.

    Schmidt, James R; De Schryver, Maarten; Weissman, Daniel H

    2014-12-01

    This article illustrates a shortcoming of using regression to control for confounds in nested designs. As an example, we consider the congruency sequence effect, which is the observation that the congruency effect in distractor interference (e.g., Stroop) tasks is smaller following incongruent as compared with congruent trials. The congruency sequence effect is often interpreted as indexing conflict adaptation: a relative increase of attention to the target following incongruent trials. However, feature repetitions across consecutive trials can complicate this interpretation. To control for this confound, the standard procedure is to delete all trials with a stimulus or response repetition and analyze the remaining trials. Notebaert and Verguts (2007) present an alternative method that allows researchers to use all trials. Specifically, they employ multiple regression to model conflict adaptation independent of feature repetitions. We show here that this approach fails to account for certain feature repetition effects. Furthermore, modeling these additional effects is typically not possible because of an upper bound on the number of degrees of freedom in the experiment. These findings have important implications for future investigations of conflict adaptation and, more broadly, for all researchers who attempt to regress out confounds in nested designs. PMID:25419672

  6. Amino acid sequence of the serine-repeat antigen (SERA) of Plasmodium falciparum determined from cloned cDNA.

    Bzik, D J; Li, W B; Horii, T; Inselburg, J

    1988-09-01

    We report the isolation of cDNA clones for a Plasmodium falciparum gene that encodes the complete amino acid sequence of a previously identified exported blood stage antigen. The Mr of this antigen protein had been determined by sodium dodecylsulphate-polyacrylamide gel electrophoresis analysis, by different workers, to be 113,000, 126,000, and 140,000. We show, by cDNA nucleotide sequence analysis, that this antigen gene encodes a 989 amino acid protein (111 kDa) that contains a potential signal peptide, but not a membrane anchor domain. In the FCR3 strain the serine content of the protein was 11%, of which 57% of the serine residues were localized within a 201 amino acid sequence that included 35 consecutive serine residues. The protein also contained three possible N-linked glycosylation sites and numerous possible O-linked glycosylation sites. The mRNA was abundant during late trophozoite-schizont parasite stages. We propose to identity this antigen, which had been called p126, by the acronym SERA, serine-repeat antigen, based on its complete structure. The usefulness of the cloned cDNA as a source of a possible malaria vaccine is considered in view of the previously demonstrated ability of the antigen to induce parasite-inhibitory antibodies and a protective immune response in Saimiri monkeys. PMID:2847041

  7. cDNA-derived amino-acid sequence of a land turtle (Geochelone carbonaria) beta-chain hemoglobin.

    Bordin, S; Meza, A N; Saad, S T; Ogo, S H; Costa, F F

    1997-06-01

    The cDNA sequence encoding the turtle Geochelone carbonaria beta-chain was determinated. The isolation of hemoglobin mRNA was based on degenerate primers' PCR in combination with 5'- and 3'-RACE protocol. The full length cDNA is 615 bp with the ATG start codon at position 53 and TGA stop codon at position 495; The AATAAA polyadenylation signal is found at position 599. The deduced polypeptyde contains 146 amino-acid residues. The predicted amino acid sequence shares 83% identity with the beta-globin of a related specie, the aquatic turtle C. p. belli. Otherwise, identity is higher when compared with chicken beta-Hb (80%) than with other reptilian orders (Squamata, 69%, and Crocodilia, 61%). Compared with human HbA, there is 67% identity, and at least three amino acid substitutions could be of some functional significance (Glu43 beta-->Ser, His116 beta-->Thr and His143 beta-->Leu). To our knowledge this represents the first cDNA sequence of a reptile globin gene described. PMID:9238523

  8. A novel T-cell-defined HLA-DR polymorphism not predicted from the linear amino acid sequence.

    Termijtelen, A; van den Elsen, P; Koning, F; de Koster, S; Schroeijers, W; Vanderkerckhove, B

    1989-09-01

    Recent investigations have shown that alloreactive T cells are capable of responding to structures defined by specific linear amino acid sequences on class II molecules. In the present study we show that also a polymorphism can be recognized that is not defined by such linear amino acid sequences. Two human T-cell clones, sensitized to DRw13 haplotypes, are described. The description of clone c50 serves to exemplify the first model. This DRB1-specific clone responds to stimulator cells that carry DR molecules, different in their DRB1 first and second hypervariable regions (HV1 and HV2) but identical in their HV3 regions (i.e., DRw13,Dw18; DRw13,Dw19; DR4,Dw10; and DRw11,LDVII). The second clone, c1443, behaves nonconventionally. It responds to DRw13,Dw18; DRw13,Dw19; and DR4,Dw4 stimulator cells, although no specific amino acid sequence is shared between these specificities. The latter pattern of reactivity suggests the existence of a novel polymorphism recognized by alloreactive T cells. This particular polymorphism may also be biologically significant. PMID:2476425

  9. Complete Genome Sequences of Escherichia coli O157:H7 Strains SRCC 1675 and 28RC, Which Vary in Acid Resistance

    Baranzoni, Gian Marco; Reichenberger, Erin R.; Kim, Gwang-Hee; Breidt, Frederick; Kay, Kathryn; Oh, Deog-Hwan

    2016-01-01

    The level of acid resistance among Escherichia coli O157:H7 strains varies, and strains with higher resistance to acid may have a lower infectious dose. The complete genome sequences belonging to two strains of Escherichia coli O157:H7 with different levels of acid resistance are presented here. PMID:27469964

  10. Interesting features of n2D Rydberg series fine-structure splittings along the sodium-like isoelectronic sequence

    Using a simplified multi-configuration Dirac-Fock (SMCDF) scheme based on the multi-configuration Dirac-Fock (MCDF) theory, we study the systematic variations of the fine-structure splittings of n2D3/2,5/2 Rydberg series along the sodium-like isoelectronic sequence, i.e. the fine-structure orderings vary with increasing atomic number Z. The competition between the spin-orbit interactions and the exchange interactions due to relativistic effects of the nd orbital wavefunctions well explain such variations. Furthermore, the effect of Breit interactions which plays the secondary role is studied. (authors)

  11. Structural features of the human C3 gene: Intron/exon organization, transcriptional start site, and promoter region sequence

    The third component of human complement (C3) is a key molecule in the activation of the complement cascade. C3 cDNA fragments were used to identify seven cosmid clones that covered all but 1 kilobase pair (kb) of the C3 gene. The remainder of the gene was cloned by using the polymerase chain reaction. These clones were used to identify the interon/exon boundaries and to map the gene. The C3 gene is 42 kb in length and comprises 41 exons ranging in size from 52 to 213 base pairs (bp). The transcription start site was identified by primer extension, and approximately 1 kb of DNA upstream of this site was sequenced. Putative TATA and CAAT boxes were identified along with a number of regions that shared homology with known regulatory sequences. These include responsive elements for interferon-γ, interleukin-6, nuclear factor kB, estrogen, glucocorticoids and thyroid hormone. Several of these agents have been shown to affect C3 synthesis and mRNA levels. The sizes of the exons in C3 were compared to those of C4 and α2-macroglobulin (α2M). Thirty-nine of 41 exons in C4 were found to be of similar size to the analogous ones in C3, and two-thirds of those in α2M were also similarly sized, supporting the hypothesis that these genes arose from a common ancestor

  12. Fad7 gene identification and fatty acids phenotypic variation in an olive collection by EcoTILLING and sequencing approaches.

    Sabetta, Wilma; Blanco, Antonio; Zelasco, Samanta; Lombardo, Luca; Perri, Enzo; Mangini, Giacomo; Montemurro, Cinzia

    2013-08-01

    The ω-3 fatty acid desaturases (FADs) are enzymes responsible for catalyzing the conversion of linoleic acid to α-linolenic acid localized in the plastid or in the endoplasmic reticulum. In this research we report the genotypic and phenotypic variation of Italian Olea europaea L. germoplasm for the fatty acid composition. The phenotypic oil characterization was followed by the molecular analysis of the plastidial-type ω-3 FAD gene (fad7) (EC 1.14.19), whose full-length sequence has been here identified in cultivar Leccino. The gene consisted of 2635 bp with 8 exons and 5'- and 3'-UTRs of 336 and 282 bp respectively, and showed a high level of heterozygousity (1/110 bp). The natural allelic variation was investigated both by a LiCOR EcoTILLING assay and the PCR product direct sequencing. Only three haplotypes were identified among the 96 analysed cultivars, highlighting the strong degree of conservation of this gene. PMID:23685785

  13. A Robust Approach for Action Recognition Based on Spatio-Temporal Features in RGB-D Sequences

    Ly Quoc Ngoc

    2016-05-01

    Full Text Available Recognizing human action is attractive research topic in computer vision since it plays an important role on the applications such as human-computer interaction, intelligent surveillance, human actions retrieval system, health care, smart home, robotics and so on. The availability the low-cost Microsoft Kinect sensor, which can capture real-time high-resolution RGB and visual depth information, has opened an opportunity to significantly increase the capabilities of many automated vision based recognition tasks. In this paper, we propose new framework for action recognition in RGB-D video. We extract spatiotemporal features from RGB-D data that capture both visual, shape and motion information. Moreover, the segmentation technique is applied to present the temporal structure of action. Firstly, we use STIP to detect interest points both of RGB and depth channels. Secondly, we apply HOG3D descriptor for RGB channel and 3DS-HONV descriptor for depth channel. In addition, we also extract HOF2.5D from fusing RGB and Depth to capture human’s motion. Thirdly, we divide the video into segments and apply GMM to create feature vectors for each segment. So, we have three feature vectors (HOG3D, 3DS-HONV, and HOF2.5D that represent for each segment. Next, the max pooling technique is applied to create a final vector for each descriptor. Then, we concatenate the feature vectors from the previous step into the final vector for action representation. Lastly, we use SVM method for classification step. We evaluated our proposed method on three benchmark datasets to demonstrate generalizability. And, the experimental results shown to be more accurate for action recognition compared to the previous works. We obtain overall accuracies of 93.5%, 99.16% and 89.38% with our proposed method on the UTKinect-Action, 3D Action Pairs and MSR-Daily Activity 3D dataset, respectively. These results show that our method is feasible and superior performance over the

  14. Templated Synthesis of Peptide Nucleic Acids via Sequence-Selective Base-Filling Reactions

    Heemstra, Jennifer M.; Liu, David Ruchien

    2009-01-01

    The templated synthesis of nucleic acids has previously been achieved through the backbone ligation of preformed nucleotide monomers or oligomers. In contrast, here we demonstrate templated nucleic acid synthesis using a base-filling approach in which individual bases are added to abasic sites of a peptide nucleic acid (PNA). Because nucleobase substrates in this approach are not self-reactive, a base-filling approach may reduce the formation of nontemplated reaction products. Using either re...

  15. Site-directed gene mutation at mixed sequence targets by psoralen-conjugated pseudo-complementary peptide nucleic acids.

    Kim, Ki-Hyun; Nielsen, Peter E; Glazer, Peter M

    2007-01-01

    Sequence-specific DNA-binding molecules such as triple helix-forming oligonucleotides (TFOs) provide a means for inducing site-specific mutagenesis and recombination at chromosomal sites in mammalian cells. However, the utility of TFOs is limited by the requirement for homopurine stretches in the target duplex DNA. Here, we report the use of pseudo-complementary peptide nucleic acids (pcPNAs) for intracellular gene targeting at mixed sequence sites. Due to steric hindrance, pcPNAs are unable to form pcPNA-pcPNA duplexes but can bind to complementary DNA sequences by Watson-Crick pairing via double duplex-invasion complex formation. We show that psoralen-conjugated pcPNAs can deliver site-specific photoadducts and mediate targeted gene modification within both episomal and chromosomal DNA in mammalian cells without detectable off-target effects. Most of the induced psoralen-pcPNA mutations were single-base substitutions and deletions at the predicted pcPNA-binding sites. The pcPNA-directed mutagenesis was found to be dependent on PNA concentration and UVA dose and required matched pairs of pcPNAs. Neither of the individual pcPNAs alone had any effect nor did complementary PNA pairs of the same sequence. These results identify pcPNAs as new tools for site-specific gene modification in mammalian cells without purine sequence restriction, thereby providing a general strategy for designing gene targeting molecules. PMID:17977869

  16. Purification and amino acid sequence of a bacteriocins produced by Lactobacillus salivarius K7 isolated from chicken intestine

    Kenji Sonomoto

    2006-03-01

    Full Text Available A bacteriocin-producing strain, Lactobacillus K7, was isolated from a chicken intestine. The inhibitory activity was determined by spot-on-lawn technique. Identification of the strain was performed by morphological, biochemical (API 50 CH kit and molecular genetic (16S rDNA basis. Bacteriocin purification processes were carried out by amberlite adsorption, cation exchange and reverse-phase high perform- ance liquid chromatography. N-terminal amino acid sequences were performed by Edman degradation. Molecular mass was determined by electrospray-ionization (ESI mass spectrometry (MS. Lactobacillus K7 showed inhibitory activity against Lactobacillus sakei subsp. sakei JCM 1157T, Leuconostoc mesenteroides subsp. mesenteroides JCM 6124T and Bacillus coagulans JCM 2257T. This strain was identified as Lb. salivarius. The antimicrobial substance was destroyed by proteolytic enzymes, indicating its proteinaceous structure designated as a bacteriocin type. The purification of bacteriocin by amberlite adsorption, cation exchange, and reverse-phase chromatography resulted in only one single active peak, which was designated FK22. Molecular weight of this fraction was 4331.70 Da. By amino acid sequence, this peptide was homology to Abp 118 beta produced by Lb. salivarius UCC118. In addition, Lb. salivarius UCC118 produced 2-peptide bacteriocin, which was Abp 118 alpha and beta. Based on the partial amino acid sequences of Abp 118 beta, specific primers were designed from nucleotide sequences according to data from GenBank. The result showed that the deduced peptide was high homology to 2-peptide bacteriocin, Abp 118 alpha and beta.

  17. Biological sequence classification with multivariate string kernels.

    Kuksa, Pavel P

    2013-01-01

    String kernel-based machine learning methods have yielded great success in practical tasks of structured/sequential data analysis. They often exhibit state-of-the-art performance on many practical tasks of sequence analysis such as biological sequence classification, remote homology detection, or protein superfamily and fold prediction. However, typical string kernel methods rely on the analysis of discrete 1D string data (e.g., DNA or amino acid sequences). In this paper, we address the multiclass biological sequence classification problems using multivariate representations in the form of sequences of features vectors (as in biological sequence profiles, or sequences of individual amino acid physicochemical descriptors) and a class of multivariate string kernels that exploit these representations. On three protein sequence classification tasks, the proposed multivariate representations and kernels show significant 15-20 percent improvements compared to existing state-of-the-art sequence classification methods. PMID:24384708

  18. Luminescence features from conical bubble collapse in 1,2 propanediol and its perturbation adding sulfuric acid

    A summary of experimental findings on the luminescence from bubble collapse, CBL, varying the gas inert bubble content, the driving pressure and perturbing the liquid piston with small quantities of sulfuric acid is presented. The temporal, spectral, and spatial characteristics of the luminescence regarding with dynamic features of collapse are also examinees. CBL was reproduced using Argon gas, and 1, 2-propanediol as liquid piston. In general, the pulse shape exhibits a large variety of profiles. The luminescence intensity was increased two-fold and the pulse width decreased almost to half when the liquid was disturbed with sulfuric acid. Spectrally, the Swan, CH and CN lines were observed at low volume of Ar gas and low driving pressure, lines of OH0, Na*, K* always appear superimposed on an underlying continuum background. De-excitation of sodium atom at 589 nm and two satellites diffuse bands at ∼554 nm and ∼620 nm from alkali-metal-argon exciplexes was observed in both systems under certain conditions. All these findings point towards several sources of light emission that are generated during the compression time line, resulting in temporally and spatially inhomogeneous pulse. A mechanism for explain the bright CBL is broached.

  19. Biomechanical features of Poly-D,L-lactic acid (PDLLA) rods through the degradation in vitro and in vivo

    2006-01-01

    Objective:To observe the changing of biomechanical features during the degradation course of poly-D,L-lactic acid (PDLLA) rods in vivo and in vitro and to evaluate its value as an internal fixation material. Methods :PDLLA rods were emerged into PBS simultaneous body fluid with constant temperature of 37C and the rods were embedded into muscle tissue of 20 rabbits for degradation in vitro and in vivo . The rods were taken out in 2, 4, 6, 8 and 12 weeks. Biomechanical features of bending, shearing and axial compression strength, rigidity and elastic modulus were observed during the degradation course. Statistical method was used to test the changes of biomechanical parameters. Results: (1)There was similar changes of bending, compressive, shearing strength and bending, compressive and shearing rigidity of the PDLLA rods between in vivo and in vitro. (2)Bending, compressive, shearing strength decreased 33%,18 % and 43 % respectively within the first stage of the degradation, and after 6 weeks of degradation, they decreased slowly. (3)Elastic modulus, bending, compressive and shearing rigiditydecreased sharply during the 6 weeks of degradation, with a drop of 22%, 39% and 30%00 respectively, and after 8 weeks, they decreased slowly. Even after 12 weeks of degradation, the strength of the rods was still higher than that of sponge bone. Conclusion: During the degradation of the material, the strength and rigidity of PDLLA rods can meet the need of fracture fixation of cancellous bones.

  20. The sequence diversity and expression among genes of the folic acid biosynthesis pathway in industrial Saccharomyces strains.

    Goncerzewicz, Anna; Misiewicz, Anna

    2015-01-01

    Folic acid is an important vitamin in human nutrition and its deficiency in pregnant women's diets results in neural tube defects and other neurological damage to the fetus. Additionally, DNA synthesis, cell division and intestinal absorption are inhibited in case of adults. Since this discovery, governments and health organizations worldwide have made recommendations concerning folic acid supplementation of food for women planning to become pregnant. In many countries this has led to the introduction of fortifications, where synthetic folic acid is added to flour. It is known that Saccharomyces strains (brewing and bakers' yeast) are one of the main producers of folic acid and they can be used as a natural source of this vitamin. Proper selection of the most efficient strains may enhance the folate content in bread, fermented vegetables, dairy products and beer by 100% and may be used in the food industry. The objective of this study was to select the optimal producing yeast strain by determining the differences in nucleotide sequences in the FOL2, FOL3 and DFR1 genes of folic acid biosynthesis pathway. The Multitemperature Single Strand Conformation Polymorphism (MSSCP) method and further nucleotide sequencing for selected strains were applied to indicate SNPs in selected gene fragments. The RT qPCR technique was also applied to examine relative expression of the FOL3 gene. Furthermore, this is the first time ever that industrial yeast strains were analysed regarding genes of the folic acid biosynthesis pathway. It was observed that a correlation exists between the folic acid amount produced by industrial yeast strains and changes in the nucleotide sequence of adequate genes. The most significant changes occur in the DFR1 gene, mostly in the first part, which causes major protein structure modifications in KKP 232, KKP 222 and KKP 277 strains. Our study shows that the large amount of SNP contributes to impairment of the selected enzymes and S. cerevisiae and S

  1. Parameters of proteome evolution from histograms of amino-acid sequence identities of paralogous proteins

    Yan Koon-Kiu; Axelsen Jacob; Maslov Sergei

    2005-01-01

    Abstract Background The evolution of the full repertoire of proteins encoded in a given genome is mostly driven by gene duplications, deletions, and sequence modifications of existing proteins. Indirect information about relative rates and other intrinsic parameters of these three basic processes is contained in the proteome-wide distribution of sequence identities of pairs of paralogous proteins. Results We introduce a simple mathematical framework based on a stochastic birth-and-death model...

  2. Transition Metal Complexes of Phosphinous Acids Featuring a Quasichelating Unit: Synthesis, Characterization, and Hetero-bimetallic Complexes.

    Allefeld, Nadine; Bader, Julia; Neumann, Beate; Stammler, Hans-Georg; Ignat'ev, Nikolai; Hoge, Berthold

    2015-08-17

    Diorganophosphane oxides were employed as preligands for the synthesis of catalytically active transition metal complexes of the phosphinous acids (CF3)2POH and (C2F5)2POH. Their reactions with solid PtCl2 and PdCl2 led to the formation of mononuclear phosphinous acid complexes [Cl2M{P(R(f))2OH}2] (M = Pd, Pt; R(f) = C2F5, CF3), which can be crystallized, for example, as its pyridinium salts, 2[HPy](+)[Cl2Pd{P(CF3)2O}2](2-). In vacuo HCl is liberated from the neutral palladium complexes affording mixtures of di- and polynuclear complexes. Moreover, (C2F5)2POH was reacted with several β-diketonato complexes of palladium, platinum, and nickel yielding air- and moisture-stable complexes [(acac)M{[P(R(f))2O]2H}], featuring a quasichelating phosphinous acid phosphinito unit {P(R(f))2O···H···O(R(f))2P}(-). Treatment of [Ni(Cp)2] (Cp = cyclopentadienyl) and [(cod)RhCl]2 (cod = 1,5-cyclooctadiene) with (C2F5)2POH leads to the substitution of one Cp or chloro ligand by a quasichelating unit. The novel coordination compounds were characterized by NMR and IR spectroscopies, mass spectrometry, and X-ray diffraction analysis. The platinum complex [(acac)Pt{[P(C2F5)2O]2H}] (acac = acetylacetonato) was used for the construction of hetero-bimetallic complexes by the treatment with [(cod)RhCl]2 and [Ni(Cp)2]. The trinuclear bimetallic complex [{(acac)Pt[P(C2F5)2O]2}2Ni] is the first structurally characterized hetero-bimetallic species containing a bis(perfluoroalkyl)phosphinito bridge. PMID:26242286

  3. "De-novo" amino acid sequence elucidation of protein G'e by combined "Top-Down" and "Bottom-Up" mass spectrometry

    Yefremova, Yelena; Al-Majdoub, Mahmoud; Opuni, Kwabena F. M.; Koy, Cornelia; Cui, Weidong; Yan, Yuetian; Gross, Michael L.; Glocker, Michael O.

    2015-03-01

    Mass spectrometric de-novo sequencing was applied to review the amino acid sequence of a commercially available recombinant protein Ǵ with great scientific and economic importance. Substantial deviations to the published amino acid sequence (Uniprot Q54181) were found by the presence of 46 additional amino acids at the N-terminus, including a so-called "His-tag" as well as an N-terminal partial α- N-gluconoylation and α- N-phosphogluconoylation, respectively. The unexpected amino acid sequence of the commercial protein G' comprised 241 amino acids and resulted in a molecular mass of 25,998.9 ± 0.2 Da for the unmodified protein. Due to the higher mass that is caused by its extended amino acid sequence compared with the original protein G' (185 amino acids), we named this protein "protein G'e." By means of mass spectrometric peptide mapping, the suggested amino acid sequence, as well as the N-terminal partial α- N-gluconoylations, was confirmed with 100% sequence coverage. After the protein G'e sequence was determined, we were able to determine the expression vector pET-28b from Novagen with the Xho I restriction enzyme cleavage site as the best option that was used for cloning and expressing the recombinant protein G'e in E. coli. A dissociation constant ( K d ) value of 9.4 nM for protein G'e was determined thermophoretically, showing that the N-terminal flanking sequence extension did not cause significant changes in the binding affinity to immunoglobulins.

  4. Photoionization of Be-like N3+ and Ne6+ ions: features of Be isoelectronic sequences of Z ⩽ 10

    Using a noniterative eigenchannel R-matrix method, we have studied the photoionization for ground 1S and excited 3,1P initial states of the Be-like N3+ and Ne6+ ions, up to the energy range of the final photo-ionic 3d state. The autoionizing resonance structures arising from the ground and excited states are identified and characterized. Our calculated photoionization cross sections with excellent agreement between length and velocity gauges are compared with the available experimental and previous theoretical results, and good agreement is shown. For the isoelectronic sequences of Z ⩽ 10, the Z-dependent spectral structures and developments of the cross sections are discussed based on the present results of N3+ and Ne6+ ions and the previous results of other ions obtained by the same noniterative eigenchannel R-matrix method. The intermixing among the resonances converging to the final photo-ionic 2p and the various 3l states is increased as Z, resulting in a much more complex pattern of resonances for the photoionization.

  5. Low molecular weight human pulmonary surfactant protein (SP5): isolation, characterization, and cDNA and amino acid sequences

    Pulmonary surfactant is a lipid-protein complex that promotes alveolar stability by lowering the surface tension at the air-fluid interface in the peripheral air spaces. A group of hydrophobic surfactant-associated proteins has been shown to be essential for rapid surface film formation by surfactant phospholipids. The authors have purified a hydrophobic surfactant protein of ≅ 5kDa that they term SP5 from bronchopulmonary lavage fluid from a patient with alveolar proteinosis and shown that it promotes rapid surface film formation by simple mixtures of phospholipids. They have derived the full amino acid sequence of human SP5 from the nucleotide sequence of cDNAs identified with oligonucleotide probes based on the NH2-terminal sequence of SP5. SP5 isolated from surfactant is a fragment of a much larger precursor protein (21 kDa). The precursor contains an extremely hydrophobic region of 34 amino acids that comprises most the mature SP5. This hydrophobicity explains the unusual solubility characteristics of SP5 and the fact that it is lipid-associated when isolated from lung

  6. Low molecular weight human pulmonary surfactant protein (SP5): isolation, characterization, and cDNA and amino acid sequences

    Warr, R.G.; Hawgood, S.; Buckley, D.I.; Crisp, T.M.; Schilling, J.; Benson, B.J.; Ballard, P.L.; Clements, J.A.; White, R.T.

    1987-11-01

    Pulmonary surfactant is a lipid-protein complex that promotes alveolar stability by lowering the surface tension at the air-fluid interface in the peripheral air spaces. A group of hydrophobic surfactant-associated proteins has been shown to be essential for rapid surface film formation by surfactant phospholipids. The authors have purified a hydrophobic surfactant protein of approx. = 5kDa that they term SP5 from bronchopulmonary lavage fluid from a patient with alveolar proteinosis and shown that it promotes rapid surface film formation by simple mixtures of phospholipids. They have derived the full amino acid sequence of human SP5 from the nucleotide sequence of cDNAs identified with oligonucleotide probes based on the NH/sub 2/-terminal sequence of SP5. SP5 isolated from surfactant is a fragment of a much larger precursor protein (21 kDa). The precursor contains an extremely hydrophobic region of 34 amino acids that comprises most the mature SP5. This hydrophobicity explains the unusual solubility characteristics of SP5 and the fact that it is lipid-associated when isolated from lung.

  7. Amino acid sequence and posttranslational modifications of human factor VIIa from plasma and transfected baby hamster kidney cells

    Blood coagulation factor VII is a vitamin K dependent glycoprotein which in its activated form, factor VIIa, participates in the coagulation process by activating factor X and/or factor IX in the presence of Ca2+ and tissue factor. Three types of potential posttranslational modifications exist in the human factor VIIa molecule, namely, 10 γ-carboxylated, N-terminally located glutamic acid residues, 1 β-hydroxylated aspartic acid residue, and 2 N-glycosylated asparagine residues. In the present study, the amino acid sequence and posttranslational modifications of recombinant factor VIIa as purified from the culture medium of a transfected baby hamster kidney cell line have been compared to human plasma factor VIIa. By use of HPLC, amino acid analysis, peptide mapping, and automated Edman degradation, the protein backbone of recombinant factor VIIa was found to be identical with human factor VIIa. Asparagine residues 145 and 322 were found to be fully N-glycosylated in human plasma factor VIIa. In the recombinant factor VIIa, asparagine residue 322 was fully glycosylated whereas asparagine residue 145 was only partially (approximately 66%) glycosylated. Besides minor differences in the sialic acid and fucose contents, the overall carbohydrate compositions were nearly identical in recombinant factor VIIa and human plasma factor VIIa. These results show that factor VIIa as produced in the transfected baby hamster kidney cells is very similar to human plasma factor VIIa and that this cell line thus might represent an alternative source for human factor VIIa

  8. The nucleotide sequence of HLA-B{sup *}2704 reveals a new amino acid substitution in exon 4 which is also present in HLA-B{sup *}2706

    Rudwaleit, M.; Bowness, P.; Wordsworth, P. [John Radcliffe Hospital, Oxford (United Kingdom)

    1996-12-31

    The HLA-B27 subtype HLA-B{sup *}2704 is virtually absent in Caucasians but common in Orientals, where it is associated with ankylosing spondylitis. The amino acid sequence of HLA-B{sup *}2704 has been established by peptide mapping and was shown to differ by two amino acids from HLA-B{sup *}2705, HLA-B{sup *}2704 is characterized by a serine for aspartic acid substitution at position 77 and glutamic acid for valine at position 152. To date, however, no nucleotide sequence confirming these changes at the DNA level has been published. 13 refs., 2 figs.

  9. JRC GMO-Amplicons: a collection of nucleic acid sequences related to genetically modified organisms.

    Petrillo, Mauro; Angers-Loustau, Alexandre; Henriksson, Peter; Bonfini, Laura; Patak, Alex; Kreysa, Joachim

    2015-01-01

    The DNA target sequence is the key element in designing detection methods for genetically modified organisms (GMOs). Unfortunately this information is frequently lacking, especially for unauthorized GMOs. In addition, patent sequences are generally poorly annotated, buried in complex and extensive documentation and hard to link to the corresponding GM event. Here, we present the JRC GMO-Amplicons, a database of amplicons collected by screening public nucleotide sequence databanks by in silico determination of PCR amplification with reference methods for GMO analysis. The European Union Reference Laboratory for Genetically Modified Food and Feed (EU-RL GMFF) provides these methods in the GMOMETHODS database to support enforcement of EU legislation and GM food/feed control. The JRC GMO-Amplicons database is composed of more than 240 000 amplicons, which can be easily accessed and screened through a web interface. To our knowledge, this is the first attempt at pooling and collecting publicly available sequences related to GMOs in food and feed. The JRC GMO-Amplicons supports control laboratories in the design and assessment of GMO methods, providing inter-alia in silico prediction of primers specificity and GM targets coverage. The new tool can assist the laboratories in the analysis of complex issues, such as the detection and identification of unauthorized GMOs. Notably, the JRC GMO-Amplicons database allows the retrieval and characterization of GMO-related sequences included in patents documentation. Finally, it can help annotating poorly described GM sequences and identifying new relevant GMO-related sequences in public databases. The JRC GMO-Amplicons is freely accessible through a web-based portal that is hosted on the EU-RL GMFF website. Database URL: http://gmo-crl.jrc.ec.europa.eu/jrcgmoamplicons/. PMID:26424080

  10. Heterodimeric l-amino acid oxidase enzymes from Egyptian Cerastes cerastes venom: Purification, biochemical characterization and partial amino acid sequencing

    A.E. El Hakim; W.H. Salama; M.B. Hamed; Ali, A. A.; N.M. Ibrahim

    2015-01-01

    Two l-amino acid oxidase enzyme isoforms, Cc-LAAOI and Cc-LAAOII were purified to apparent homogeneity from Cerastes cerastes venom in a sequential two-step chromatographic protocol including; gel filtration and anion exchange chromatography. The native molecular weights of the isoforms were 115 kDa as determined by gel filtration on calibrated Sephacryl S-200 column, while the monomeric molecular weights of the enzymes were, 60, 56 kDa and 60, 53 kDa for LAAOI and LAAOII, respectively. The t...

  11. 视频序列中基于LBP特征的人体行为识别%Human Action Recognition Based on Local Binary Pattern Feature in Video Sequences

    王宪; 慕鑫; 宋书林; 陈向阳

    2013-01-01

    Human action recognition in the video sequence have become a hot research topic in computer vision field. In order to extract the contour feature of the human’s behavior sequence more effectively, a new algorithm for human action recognition based on Local Binary Pattern (LBP) is proposed. Firstly, background subtraction algorithm is used to extract the complete human motion sequence in the video, and the LBP operators are used to calculate the samples’ LBP feature space which is composed of the motion sequences’ LBP feature spectrum. Then, the behavior feature is generated by k-means clustering method. Finally, the Hidden Markov Model (HMM) is adopted for the classification. During the experiment, the test experiment is performed in the two public behavior databases respectively, and the average recognition rate can reach more than 85%. The intersection of the two databases experimental results shows that the proposed algorithm has certain robustness.%  视频序列中的行为分析与识别已经成为当前计算机视觉领域的研究热点。为了更加有效地提取人体行为序列中的轮廓特征的信息,提出了一种基于局部二值模式(Local Binary Pattern,LBP)特征的人体行为识别的算法。通过背景差分法从视频中提取完整的人体运动序列,利用LBP算子计算运动序列的LBP特征谱,组成样本的LBP轮廓特征空间,接着将特征空间通过K-means聚类的方法生成行为特征。最后,采用隐马尔可夫模型(HMM)对特征进行识别。实验过程中,分别在两个公共行为数据库上进行了测试实验,平均识别率能达到85%以上,并且在两个数据库的交叉实验结果表明了本文算法具有一定的鲁棒性。

  12. Application of combined mass spectrometry and partial amino acid sequence to the identification of gel-separated proteins.

    Patterson, S D; Thomas, D; Bradshaw, R A

    1996-05-01

    The combined use of peptide mass information with amino acid sequence information derived by chemical sequencing or mass spectrometry (MS)-based approaches provides a powerful means of protein identification. We have used a two-part strategy to identify proteins from nerve growth factor (NGF)-stimulated rat adrenal pheochromocytoma cell line PC-12 cell lysates that associate with the adaptor protein Shc (Shc homologous and collagen protein). Initial experiments with metabolically radiolabeled cell extracts separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) revealed a number of proteins that coimmunoprecipitated with anti-Shc antibody compared with control (unstimulated) cell extracts. The experiment was scaled up and cell lysate from NGF-stimulated PC-12 cells was applied to a glutathione-S-transferase (GST)-Shc affinity column, eluted, separated by SDS-PAGE and blotted to Immobilon-CD. The blotted proteins were proteolytically digested in situ, and the masses obtained from the extracted peptides were used in a peptide-mass search program in an attempt to identify the protein. Even if a strong candidate was found using this search, an additional step was performed to confirm the identification. The mixtures were fractionated by reversed-phase high-performance liquid chromatography (RP-HPLC) and subjected to chemical sequencing to obtain (partial) sequence information, or post-source decay (PSD-) matrix-assisted laser-desorption ionization (MALDI)-MS to obtain sequence-specific fragment ions. This data was used in a peptide-sequence tag search to confirm the identity of the proteins. This combined approach allowed identification of four proteins of M(r) 43,000 to 200,000. In one case the identified protein clearly did not correspond to the radiolabeled band, but to a protein contaminant from the column. The advantages and pitfalls of the approach are discussed. PMID:8783013

  13. Gene expression classification using epigenetic features and DNA sequence composition in the human embryonic stem cell line H1.

    Su, Wen-Xia; Li, Qian-Zhong; Zhang, Lu-Qiang; Fan, Guo-Liang; Wu, Cheng-Yan; Yan, Zhen-He; Zuo, Yong-Chun

    2016-10-30

    Epigenetic factors are known to correlate with gene expression in the existing studies. However, quantitative models that accurately classify the highly and lowly expressed genes based on epigenetic factors are currently lacking. In this study, a new machine learning method combines histone modifications, DNA methylation, DNA accessibility, transcription factors, and trinucleotide composition with support vector machines (SVM) is developed in the context of human embryonic stem cell line (H1). The results indicate that the predictive accuracy will be markedly improved when the epigenetic features are considered. The predictive accuracy and Matthews correlation coefficient of the best model are as high as 95.96% and 0.92 for 10-fold cross-validation test, and 95.58% and 0.92 for independent dataset test, respectively. Our model provides a good way to judge a gene is either highly or lowly expressed gene by using genetic and epigenetic data, when the expression data of the gene is lacking. And a web-server GECES for our analysis method is established at http://202.207.14.87:8032/fuwu/GECES/index.asp, so that other scientists can easily get their desired results by our web-server, without going through the mathematical details. PMID:27468948

  14. Insight on how fishing bats discern prey and adjust their mechanic and sensorial features during the attack sequence.

    Aizpurua, Ostaizka; Alberdi, Antton; Aihartza, Joxerra; Garin, Inazio

    2015-01-01

    Several insectivorous bats have included fish in their diet, yet little is known about the processes underlying this trophic shift. We performed three field experiments with wild fishing bats to address how they manage to discern fish from insects and adapt their hunting technique to capture fish. We show that bats react only to targets protruding above the water and discern fish from insects based on prey disappearance patterns. Stationary fish trigger short and shallow dips and a terminal echolocation pattern with an important component of the narrowband and low frequency calls. When the fish disappears during the attack process, bats regulate their attack increasing the number of broadband and high frequency calls in the last phase of the echolocation as well as by lengthening and deepening their dips. These adjustments may allow bats to obtain more valuable sensorial information and to perform dips adjusted to the level of uncertainty on the location of the submerged prey. The observed ultrafast regulation may be essential for enabling fishing to become cost-effective in bats, and demonstrates the ability of bats to rapidly modify and synchronise their sensorial and motor features as a response to last minute stimulus variations. PMID:26196094

  15. The structural analysis of protein sequences based on the quasi-amino acids code

    Proteomics is the study of proteins and their interactions in a cell. With the successful completion of the Human Genome Project, it comes the postgenome era when the proteomics technology is emerging. This paper studies protein molecule from the algebraic point of view. The algebraic system (Σ, +, *) is introduced, where Σ is the set of 64 codons. According to the characteristics of (Σ, +, *), a novel quasi-amino acids code classification method is introduced and the corresponding algebraic operation table over the set ZU of the 16 kinds of quasi-amino acids is established. The internal relation is revealed about quasi-amino acids. The results show that there exist some very close correlations between the properties of the quasi-amino acids and the codon. All these correlation relationships may play an important part in establishing the logic relationship between codons and the quasi-amino acids during the course of life origination. According to Ma F et al (2003 J. Anhui Agricultural University 30 439), the corresponding relation and the excellent properties about amino acids code are very difficult to observe. The present paper shows that (ZU, ⊕, ) is a field. Furthermore, the operational results display that the codon tga has different property from other stop codons. In fact, in the mitochondrion from human and ox genomic codon, tga is just tryptophane, is not the stop codon like in other genetic code, it is the case of the Chen W C et al (2002 Acta Biophysica Sinica 18(1) 87). The present theory avoids some inexplicable events of the 20 kinds of amino acids code, in other words it solves the problem of 'the 64 codon assignments of mRNA to amino acids is probably completely wrong' proposed by Yang (2006 Progress in Modern Biomedicine 6 3). (cross-disciplinary physics and related areas of science and technology)

  16. The structural analysis of protein sequences based on the quasi-amino acids code

    Zhu Ping; Tang Xu-Qing; Xu Zhen-Yuan

    2009-01-01

    Proteomics is the study of proteins and their interactions in a cell. With the successful completion of the Human Genome Project, it comes the postgenome era when the proteomics technology is emerging. This paper studies protein molecule from the algebraic point of view. The algebraic system (∑, +, *) is introduced, where ∑ is the set of 64 codons. According to the characteristics of (∑,+, *), a novel quasi-amino acids code classification method is introduced and the corresponding algebraic operation table over the set ZU of the 16 kinds of quasi-amino acids is established. The internal relation is revealed about quasi-amino acids. The results show that there exist some very close correlations between the properties of the quasi-amino acids and the codon. All these correlation relationships may play an important part in establishing the logic relationship between codons and the quasi-amino acids during the course of life origination. According to Ma F et al (2003 J. Anhui Agricultural University 30 439), the corresponding relation and the excellent properties about amino acids code are very difficult to observe. The present paper shows that (ZU, +, ×) is a field. Furthermore, the operational results display that the codon tga has different property from other stop codons. In fact, in the mitochondrion from human and ox genomic codon, tga is just tryptophane, is not the stop codon like in other genetic code, it is the case of the Chen W C et al (2002 Acta Biophysica Sinica 18(1) 87). The present theory avoids some inexplicable events of the 20 kinds of amino acids code, in other words it solves the problem of 'the 64 codon assignments of mRNA to amino acids is probably completely wrong' proposed by Yang (2006 Progress in Modern Biomedicine 6 3).

  17. Main: Sequences [KOME

    Full Text Available Sequences Amino Acid Sequence Amino Acid sequence of full length cDNA (Longest ORF) kome_ine_full_sequence..._amino_db.fasta.zip kome_ine_full_sequence_amino_db.zip kome_ine_full_sequence_amino_db ...

  18. Ribonuclease "XlaI," an activity from Xenopus laevis oocytes that excises intervening sequences from yeast transfer ribonucleic acid precursors.

    Otsuka, A; de Paolis, A; Tocchini-Valentini, G P

    1981-01-01

    A ribonuclease (RNase) activity, RNase "XlaI," responsible for the excision of intervening sequences from two yeast transfer ribonucleic acid (tRNA) precursors, pre-tRNA(Tyr) and pre-tRNA(3Leu), has been purified 54-fold from nuclear extracts of Xenopus laevis oocytes. The RNase preparation is essentially free of contaminating RNase. A quantitative assay for RNase XlaI was developed, and the reaction products were characterized. RNase XlaI cleavage sites in the yeast tRNA precursors were identical to those made by yeast extracts (including 3'-phosphate and 5'-hydroxyl termini). Cleavage of pre-tRNA(3Leu) by RNase XlaI and subsequent ligation of the half-tRNA molecules do not require removal of the 5' leader or 3' trailer sequences. Images PMID:6765601

  19. Construction Strategy for an Internal Amplification Control for Real-Time Diagnostic Assays Using Nucleic Acid Sequence-Based Amplification: Development and Clinical Application

    Rodríguez-Lázaro, David; D'Agostino, Martin; Pla, Maria; Cook, Nigel

    2005-01-01

    An important analytical control in molecular amplification-based methods is an internal amplification control (IAC), which should be included in each reaction mixture. An IAC is a nontarget nucleic acid sequence which is coamplified simultaneously with the target sequence. With negative results for the target nucleic acid, the absence of an IAC signal indicates that amplification has failed. A general strategy for the construction of an IAC for inclusion in molecular beacon-based real-time nu...

  20. Amino Acid Sequence Requirements of the Transmembrane and Cytoplasmic Domains of Influenza Virus Hemagglutinin for Viable Membrane Fusion

    Melikyan, Grigory B.; Lin, Sasa; Roth, Michael G.; Cohen, Fredric S.

    1999-01-01

    The amino acid sequence requirements of the transmembrane (TM) domain and cytoplasmic tail (CT) of the hemagglutinin (HA) of influenza virus in membrane fusion have been investigated. Fusion properties of wild-type HA were compared with those of chimeras consisting of the ectodomain of HA and the TM domain and/or CT of polyimmunoglobulin receptor, a nonviral integral membrane protein. The presence of a CT was not required for fusion. But when a TM domain and CT were present, fusion activity w...

  1. Lipoic acid metabolism in Escherichia coli: sequencing and functional characterization of the lipA and lipB genes.

    Reed, K E; Cronan, J E

    1993-01-01

    Two genes, lipA and lipB, involved in lipoic acid biosynthesis or metabolism were characterized by DNA sequence analysis. The translational initiation site of the lipA gene was established, and the lipB gene product was identified as a 25-kDa protein. Overproduction of LipA resulted in the formation of inclusion bodies, from which the protein was readily purified. Cells grown under strictly anaerobic conditions required the lipA and lipB gene products for the synthesis of a functional glycine...

  2. Barley polyamine oxidase: Characterisation and analysis of the cofactor and the N-terminal amino acid sequence

    Radova, A.; Sebela, M.; Galuszka, P.;

    2001-01-01

    This paper reports the first purification method developed for the isolation of an homogeneous polyamine oxidase (PAO) from etiolated barley seedlings. The crude enzyme preparation was obtained after initial precipitation of the extract with protamine sulphate and ammonium sulphate. The enzyme was...... further purified to a final homogeneity (by the criteria of isoelectric focusing and SDS-PAGE) using techniques of low pressure chromatography followed by two FPLC steps. The purified yellow enzyme showed visible absorption maxima of a flavoprotein at 380 and 450 nm: the presence of FAD as the cofactor...... was further confirmed by measuring the fluorescence spectra, Barley PAO is an acidic protein (pI 5.4) containing 3% of neutral sugars: its molecular mass determined by SDS-PAGE was 56 kDa, whilst gel permeation chromatography revealed the higher value of 76 kDa. The N-terminal amino acid sequence of...

  3. An Interpretation of the Ancestral Codon from Miller’s Amino Acids and Nucleotide Correlations in Modern Coding Sequences

    Carels, Nicolas; de Leon, Miguel Ponce

    2015-01-01

    Purine bias, which is usually referred to as an “ancestral codon”, is known to result in short-range correlations between nucleotides in coding sequences, and it is common in all species. We demonstrate that RWY is a more appropriate pattern than the classical RNY, and purine bias (Rrr) is the product of a network of nucleotide compensations induced by functional constraints on the physicochemical properties of proteins. Through deductions from universal correlation properties, we also demonstrate that amino acids from Miller’s spark discharge experiment are compatible with functional primeval proteins at the dawn of living cell radiation on earth. These amino acids match the hydropathy and secondary structures of modern proteins. PMID:25922573

  4. Mass spectrometry of nucleic acids components. Nucleotides, oligonucleotides and application to sequence determination

    The application of the various ionization techniques to the analysis of nucleotides and oligonucleotides is reviewed. The sequence determination of oligonucleotides was chosen to present the growing possibilities of mass spectrometry due to development of new ''soft ionization'' techniques. 119 refs., 6 figs., 2 tabs. (author)

  5. Prediction of the Occurrence of the ADP-binding βαβ-fold in Proteins, Using an Amino Acid Sequence Fingerprint

    Wierenga, Rik K.; Terpstra, Peter; Hol, Wim G.J.

    1986-01-01

    An amino acid sequence "fingerprint” has been derived that can be used to test if a particular sequence will fold into a βαβ-unit with ADP-binding properties. It was deduced from a careful analysis of the known three-dimensional structures of ADP-binding βαβ-folds. This fingerprint is in fact a set

  6. Complete Genome Sequence of a thermotolerant sporogenic lactic acid bacterium, Bacillus coagulans strain 36D1

    Xie, Gary [Los Alamos National Laboratory (LANL); Dalin, Eileen [U.S. Department of Energy, Joint Genome Institute; Tice, Hope [U.S. Department of Energy, Joint Genome Institute; Chertkov, Olga [Los Alamos National Laboratory (LANL); Land, Miriam L [ORNL

    2011-01-01

    Bacillus coagulans is a ubiquitous soil bacterium that grows at 50-55 C and pH 5.0 and fer-ments various sugars that constitute plant biomass to L (+)-lactic acid. The ability of this sporogenic lactic acid bacterium to grow at 50-55 C and pH 5.0 makes this organism an attractive microbial biocatalyst for production of optically pure lactic acid at industrial scale not only from glucose derived from cellulose but also from xylose, a major constituent of hemi-cellulose. This bacterium is also considered as a potential probiotic. Complete genome squence of a representative strain, B. coagulans strain 36D1, is presented and discussed.

  7. Templated synthesis of peptide nucleic acids via sequence-selective base-filling reactions.

    Heemstra, Jennifer M; Liu, David R

    2009-08-19

    The templated synthesis of nucleic acids has previously been achieved through the backbone ligation of preformed nucleotide monomers or oligomers. In contrast, here we demonstrate templated nucleic acid synthesis using a base-filling approach in which individual bases are added to abasic sites of a peptide nucleic acid (PNA). Because nucleobase substrates in this approach are not self-reactive, a base-filling approach may reduce the formation of nontemplated reaction products. Using either reductive amination or amine acylation chemistries, we observed efficient and selective addition of each of the four nucleobases to an abasic site in the middle of the PNA strand. We also describe the addition of single nucleobases to the end of a PNA strand through base filling, as well as the tandem addition of two bases to the middle of the PNA strand. These findings represent an experimental foundation for nonenzymatic information transfer through base filling. PMID:19722647

  8. Complete Genome Sequence of a thermotolerant sporogenic lactic acid bacterium, Bacillus coagulans strain 36D1

    Rhee, Mun Su [University of Florida, Gainesville; Moritz, Brelan E. [University of Florida, Gainesville; Xie, Gary [Los Alamos National Laboratory (LANL); Glavina Del Rio, Tijana [U.S. Department of Energy, Joint Genome Institute; Dalin, Eileen [U.S. Department of Energy, Joint Genome Institute; Tice, Hope [U.S. Department of Energy, Joint Genome Institute; Bruce, David [Los Alamos National Laboratory (LANL); Goodwin, Lynne A. [Los Alamos National Laboratory (LANL); Chertkov, Olga [Los Alamos National Laboratory (LANL); Brettin, Thomas S [ORNL; Han, Cliff [Los Alamos National Laboratory (LANL); Detter, J. Chris [U.S. Department of Energy, Joint Genome Institute; Pitluck, Sam [U.S. Department of Energy, Joint Genome Institute; Land, Miriam L [ORNL; Patel, Milind [University of Florida, Gainesville; Ou, Mark [University of Florida, Gainesville; Harbrucker, Roberta [University of Florida, Gainesville; Ingram, Lonnie O. [University of Florida; Shanmugam, Keelnathan T. [University of Florida

    2011-01-01

    Bacillus coagulans is a ubiquitous soil bacterium that grows at 50-55 C and pH 5.0 and fer- ments various sugars that constitute plant biomass to L (+)-lactic acid. The ability of this spo- rogenic lactic acid bacterium to grow at 50-55 C and pH 5.0 makes this organism an attrac- tive microbial biocatalyst for production of optically pure lactic acid at industrial scale not only from glucose derived from cellulose but also from xylose, a major constituent of hemi- cellulose. This bacterium is also considered as a potential probiotic. Complete genome se- quence of a representative strain, B. coagulans strain 36D1, is presented and discussed.

  9. Molecular cloning and sequence analysis of complementary DNA encoding rat mammary gland medium-chain S-acyl fatty acid synthetase thio ester hydrolase

    Poly(A) + RNA from pregnant rat mammary glands was size-fractionated by sucrose gradient centrifugation, and fractions enriched in medium-chain S-acyl fatty acid synthetase thio ester hydrolase (MCH) were identified by in vitro translation and immunoprecipitation. A cDNA library was constructed, in pBR322, from enriched poly(A) + RNA and screened with two oligonucleotide probes deduced from rat MCH amino acid sequence data. Cross-hybridizing clones were isolated and found to contain cDNA inserts ranging from ∼ 1100 to 1550 base pairs (bp). A 1550-bp cDNA insert, from clone 43H09, was confirmed to encode MCH by hybrid-select translation/immunoprecipitation studies and by comparison of the amino acid sequence deduced from the DNA sequence of the clone to the amino acid sequence of the MCH peptides. Northern blot analysis revealed the size of the MCH mRNA to be 1500 nucleotides, and it is therefore concluded that the 1550-bp insert (including G x C tails) of clone 43H09 represents a full- or near-full-length copy of the MCH gene. The rat MCH sequence is the first reported sequence of a thioesterase from a mammalian source, but comparison of the deduced amino acid sequences of MCH and the recently published mallard duck medium-chain S-acyl fatty acid synthetase thioesterase reveals significant homology. In particular, a seven amino acid sequence containing the proposed active serine of the duck thioesterase is found to be perfectly conserved in rat MCH

  10. Microscopic and mesoscopic structural features of an activated carbon sample, prepared from sorghum via activation by phosphoric acid

    Graphical abstract: Display Omitted Highlights: ► Preparation of a new activated carbon sample from sorghum. ► Characterization by adsorption/desorption methods. ► Determination of the structure by synchrotron X-ray diffraction. ► The sample is amorphous and contains distorted graphene fragments. ► A characteristic nanoscale distance is established from the radial distribution function. -- Abstract: An acidic chemical activation procedure has been used for preparing activated carbon with a surface area exceeding 1000 m2/g from sorghum. In order to reveal structural features, synchrotron X-ray diffraction measurements have been performed. The structure of the material has been characterized by the total scattering structure factor and the radial distribution function describing short-range arrangement of atoms at distances of the order of a few atomic diameters as well as correlations at a longer scale, of the order of nanometers. The atomic arrangement has been found to be consistent with that of amorphous graphite-like carbon. As far as the mesoscopic structure is concerned, the presence of a characteristic distance is suggested on the basis of the clear nanometer scale oscillations of the radial distribution function, which distance may be assigned as the mesopore size in the material. It is suggested that the approach devized here may later be applied routinely for other activated carbon samples, too, for characterizing atomic and nanoscale order simultaneously.

  11. Complete Genome Sequence of Moraxella osloensis Strain KMC41, a Producer of 4-Methyl-3-Hexenoic Acid, a Major Malodor Compound in Laundry.

    Goto, Takatsugu; Hirakawa, Hideki; Morita, Yuji; Tomida, Junko; Sato, Jun; Matsumura, Yuta; Mitani, Asako; Niwano, Yu; Takeuchi, Kohei; Kubota, Hiromi; Kawamura, Yoshiaki

    2016-01-01

    We report the complete genome sequence of Moraxella osloensis strain KMC41, isolated from laundry with malodor. The KMC41 genome comprises a 2,445,556-bp chromosome and three plasmids. A fatty acid desaturase and at least four β-oxidation-related genes putatively associated with 4-methyl-3-hexenoic acid generation were detected in the KMC41 chromosome. PMID:27445387

  12. Antibody-Specific Model of Amino Acid Substitution for Immunological Inferences from Alignments of Antibody Sequences

    Mirsky, Alexander; Kazandjian, Linda; Anisimova, Maria

    2014-01-01

    Antibodies are glycoproteins produced by the immune system as a dynamically adaptive line of defense against invading pathogens. Very elegant and specific mutational mechanisms allow B lymphocytes to produce a large and diversified repertoire of antibodies, which is modified and enhanced throughout all adulthood. One of these mechanisms is somatic hypermutation, which stochastically mutates nucleotides in the antibody genes, forming new sequences with different properties and, eventually, hig...

  13. Rapid and Sensitive Isothermal Detection of Nucleic-acid Sequence by Multiple Cross Displacement Amplification

    Yi Wang; Yan Wang; Ai-Jing Ma; Dong-Xun Li; Li-Juan Luo; Dong-Xin Liu; Dong Jin; Kai Liu; Chang-Yun Ye

    2015-01-01

    We have devised a novel amplification strategy based on isothermal strand-displacement polymerization reaction, which was termed multiple cross displacement amplification (MCDA). The approach employed a set of ten specially designed primers spanning ten distinct regions of target sequence and was preceded at a constant temperature (61–65 °C). At the assay temperature, the double-stranded DNAs were at dynamic reaction environment of primer-template hybrid, thus the high concentration of primer...

  14. 37 CFR 1.821 - Nucleotide and/or amino acid sequence disclosures in patent applications.

    2010-07-01

    ... Director of the Federal Register in accordance with 5 U.S.C. 552(a) and 1 CFR part 51. Copies of WIPO...), Appendix 2, Table 3 in conjunction with a description in the Feature section to describe, for example... with the definition in paragraph (a) of this section, shall, with regard to the manner in which...

  15. Complete nucleotide and derived amino acid sequence of cDNA encoding the mitochondrial uncoupling protein of rat brown adipose tissue: lack of a mitochondrial targeting presequence.

    Ridley, R. G.; Patel, H. V.; Gerber, G E; Morton, R C; Freeman, K. B.

    1986-01-01

    A cDNA clone spanning the entire amino acid sequence of the nuclear-encoded uncoupling protein of rat brown adipose tissue mitochondria has been isolated and sequenced. With the exception of the N-terminal methionine the deduced N-terminus of the newly synthesized uncoupling protein is identical to the N-terminal 30 amino acids of the native uncoupling protein as determined by protein sequencing. This proves that the protein contains no N-terminal mitochondrial targeting prepiece and that a t...

  16. Identification of a novel HMW glutenin subunit and comparison of its amino acid sequence with those of homologous subunits

    2002-01-01

    Aegilops tauschii is the donor of the D genome of common wheat (Triticum aestivum). Genetic variation of HMW glutenin subunits encoded by the Glu-1Dt locus of Ae. tauschii has been found to be higher than that specified by the Glu-1D locus in common wheat. In the present note, we report the identification of a novel HMW glutenin subunit, Dy13t, from Ae. tauschii. The newly identified subunit possessed an electrophoretic mobility that was faster than that of the Dy12 subunit of common wheat. The complete ORF of encoding the Dy13t subunit contained 624 codons (excluding the stop codons). The amino acid sequence deduced from the Dy13t gene ORF was the shortest among those of the previously reported subunits derived by the D genome. A further comparison of Dy13t amino acid sequence with those of the subunits characterized from the A, B, D, R genomes of Triticeae showed that the smaller size of the Dy13t subunit was associated with a reduction in the size of its repetitive domain.

  17. Exome sequencing identifies a novel EP300 frame shift mutation in a patient with features that overlap Cornelia de Lange syndrome.

    Woods, Susan A; Robinson, Haynes B; Kohler, Lisa J; Agamanolis, Dimitris; Sterbenz, George; Khalifa, Mohamed

    2014-01-01

    Rubinstein-Taybi syndrome (RTS) and Cornelia de Lange syndrome (CdLS) are genetically heterogeneous multiple anomalies syndromes, each having a distinctive facial gestalt. Two genes (CREBBP and EP300) are known to cause RTS, and five (NIPBL, SMC1A, SMC3, RAD21, and HDAC8) have been associated with CdLS. A diagnosis of RTS or CdLS is molecularly confirmed in only 65% of clinically identified cases, suggesting that additional causative genes exist for both conditions. In addition, although EP300 and CREBBP encode homologous proteins and perform similar functions, only eight EP300 positive RTS patients have been reported, suggesting that patients with EP300 mutations might be escaping clinical recognition. We report on a child with multiple congenital abnormalities and intellectual disability whose facial features and complex phenotype resemble CdLS. However, no mutations in CdLS-related genes were identified. Rather, a novel EP300 mutation was found on whole exome sequencing. Possible links between EP300 and genes causing CdLS are evident in the literature. Both EP300 and HDAC8 are involved in the regulation of TP53 transcriptional activity. In addition, p300 and other chromatin associated proteins, including NIPBL, SMCA1, and SMC3, have been found at enhancer regions in different cell types. It is therefore possible that EP300 and CdLS-related genes are involved in additional shared pathways, producing overlapping phenotypes. As whole exome sequencing becomes more widely utilized, the diverse phenotypes associated with EP300 mutations should be better understood. In the meantime, testing for EP300 mutations in those with features of CdLS may be warranted. PMID:24352918

  18. Complete genome sequence of probiotic Bacillus coagulans HM-08: A potential lactic acid producer.

    Yao, Guoqiang; Gao, Pengfei; Zhang, Wenyi

    2016-06-20

    Bacillus coagulans HM-08 is a commercialized probiotic strain in China. Its genome contains a 3.62Mb circular chromosome with an average GC content of 46.3%. In silico analysis revealed the presence of one xyl operon as well as several other genes that are correlated to xylose utilization. The genetic information provided here may help to expand its future biotechnology potential in lactic acid production. PMID:27130497

  19. Complete Genome Sequence of the Probiotic Lactic Acid Bacterium Lactobacillus Rhamnosus

    Samat Kozhakhmetov; Almagul Kushugulova; Adil Supiyev; Indira Tynybayeva; Ulykbek Kairov; Saule Saduakhasova; Gulnara Shakhabayeva; Kenzhebulat Bapishev; Talgat Nurgozhin; Zhaxybay Zhumadilov

    2014-01-01

    Introduction: Lactobacilli are a bacteria commonly found in the gastrointestinal tract. Some species of this genus have probiotic properties. The most common of these is Lactobacillus rhamnosus, a microoganism, generally regarded as safe (GRAS). It is also a homofermentative L-(+)-lactic acid producer. The genus Lactobacillus is characterized by an extraordinary degree of the phenotypic and genotypic diversity. However, the studies of the genus were conducted mostly with the unequally distrib...

  20. iTriplet, a rule-based nucleic acid sequence motif finder

    Gunderson Samuel I

    2009-10-01

    Full Text Available Abstract Background With the advent of high throughput sequencing techniques, large amounts of sequencing data are readily available for analysis. Natural biological signals are intrinsically highly variable making their complete identification a computationally challenging problem. Many attempts in using statistical or combinatorial approaches have been made with great success in the past. However, identifying highly degenerate and long (>20 nucleotides motifs still remains an unmet challenge as high degeneracy will diminish statistical significance of biological signals and increasing motif size will cause combinatorial explosion. In this report, we present a novel rule-based method that is focused on finding degenerate and long motifs. Our proposed method, named iTriplet, avoids costly enumeration present in existing combinatorial methods and is amenable to parallel processing. Results We have conducted a comprehensive assessment on the performance and sensitivity-specificity of iTriplet in analyzing artificial and real biological sequences in various genomic regions. The results show that iTriplet is able to solve challenging cases. Furthermore we have confirmed the utility of iTriplet by showing it accurately predicts polyA-site-related motifs using a dual Luciferase reporter assay. Conclusion iTriplet is a novel rule-based combinatorial or enumerative motif finding method that is able to process highly degenerate and long motifs that have resisted analysis by other methods. In addition, iTriplet is distinguished from other methods of the same family by its parallelizability, which allows it to leverage the power of today's readily available high-performance computing systems.

  1. Cloning of NruI and Sbo13I restriction and modification sstems in E. coli and amino acid sequence comparison of M.NruI and M.Sbo13I with other amino-methyltransferases

    Benner Jack

    2010-05-01

    Full Text Available Abstract Background NruI and Sbo13I are restriction enzyme isoschizomers with the same recognition sequence 5' TCG↓CGA 3' (cleavage as indicated↓. Here we report the cloning of NruI and Sbo13I restriction-modification (R-M systems in E. coli. The NruI restriction endonuclease gene (nruIR was cloned by PCR and inverse PCR using primers designed from the N-terminal amino acid sequence. The NruI methylase gene (nruIM was derived by inverse PCR walking. Results The amino acid sequences of NruI endonuclease and methylase are very similar to the Sbo13I R-M system which has been cloned and expressed in E. coli by phage selection of a plasmid DNA library. Dot blot analysis using rabbit polyclonal antibodies to N6mA- or N4mC-modified DNA indicated that M.NruI is possibly a N6mA-type amino-methyltransferase that most likely modifies the external A in the 5' TCGCGA 3' sequence. M.Sbo13I, however, is implicated as a probable N4mC-type methylase since plasmid carrying sbo13IM gene is not restricted by Mrr endonuclease and Sbo13I digestion is not blocked by Dam methylation of the overlapping site. The amino acid sequence of M.NruI and M.Sbo13I did not show significant sequence similarity to many known amino-methyltransferases in the α, β, and γ groups, except to a few putative methylases in sequenced microbial genomes. Conclusions The order of the conserved amino acid motifs (blocks in M.NruI/M.Sbo13I is similar to the γ. group amino-methyltranferases, but with two distinct features: In motif IV, the sequence is DPPY instead of NPPY; there are two additional conserved motifs, IVa and Xa as extension of motifs IV and X, in this family of enzymes. We propose that M.NruI and M.Sbo13I form a subgroup in the γ group of amino-methyltransferases.

  2. The α and β chains of human platelet glycoprotein Ib are both transmembrane proteins containing a leucine-rich amino acid sequence

    The primary structure of the β chain of human glycoprotein Ib (GPIb), the platelet receptor for von Willebrand factor, has been established by a combination of cDNA cloning and amino acid sequence analysis. A λ phage cDNA expression library prepared from human erythroleukemia cells (HEL cells) was screened with a radiolabeled affinity-purified rabbit polyclonal antibody to the β chain of GPIb. Eighteen positive clones were isolated and plaque-purified and the nucleotide sequences of three were determined. The composite sequence spanned 968 nucleotides and included a 5' untranslated region of 22 nucleotides, an open reading frame of 618 nucleotides encoding a signal peptide of 28 amino acids and a mature protein of 181 amino acids, a stop codon, and a 3' noncoding region of 307 nucleotides. The 3' noncoding sequence also contained a polyadenylylation signal (AATAAA) 14 nucleotides upstream from the poly(A) tail of 18 nucleotides. Edman degradation of the intact β chain and of peptides produced by chemical cleavage yielded amino acid sequences spanning 76 residues that were identical to those predicted from the cDNA. The amino-terminal region of the β chain contains a leucine-rich sequence of 24 amino acids that is similar to a sequence that occurs as seven tandem repeats in the α chain of GPIb and nine tandem repeats in leucine-rich α2-glycoprotein. The amino-terminal region of the β chain of GPIb is followed by a transmembrane segment of 25 amino acids and an intracellular segment of 34 amino acids at the carboxyl terminus of the protein

  3. Researches on Sequence of Plant Cystatin: Phytocystatin

    QINQingfeng; HEWei; LIANGJun; ZHANGXingyao

    2005-01-01

    Plant cystatins or phytocystatins are cysteine proteinase inhibitors exist widely in different plant species. Because they can kill insects by inhibiting the digestive function of the cysteine proteinase in gut, they are believed to play an important role in plant's defense against pests. Phytocystatins contain the conserved QXVXG motif and show some features on their sequence different to animal cystatins.After sequencing the protein directly and the cDNA clone, a large number of plant cystatins have been characterized. A multialignment with BLAST software and a detail analysis of 38 phytocystatins show that phytocystatins possess a specific conserved amino acid sequence [LRVI]-[AGT]-[RQKE]-[FY]-[AS]-[VI]-X-[EGHDQV]-[HYFQ]-N different to the conserved sequence demonstrated by Margis in 1998. This conserved sequence can be enough to detect with exclusivity phytocystatin sequences on protein data banks. A classification of these phytocystatins is performed and they can be divided into 3 groups according to their features on amino acid sequence, and the group-I can be still divided into 3 subgroups based on the feature of their amino acid and genomic sequence. By the CLUSTALX software,the most conserved nucleotide sequences of phytocystatins were found, which could be used to design the degenerate premiers to search new phytocystatins with PCR reaction.

  4. Inferences from protein and nucleic acid sequences - Early molecular evolution, divergence of kingdoms and rates of change

    Dayhoff, M. O.; Barker, W. C.; Mclaughlin, P. J.

    1974-01-01

    Description of new sensitive, objective methods for establishing the probable common ancestry of very distantly related sequences and the quantitative evolutionary change which has taken place. These methods are applied to four families of proteins and nucleic acids and evolutionary trees will be derived where possible. Of the three families containing duplications of genetic material, two are nucleic acids: transfer RNA and 5S ribosomal RNA. Both of these structures are functional in the synthesis of coded proteins, and prototypes must have been present in the cell at the inception of the fundamental coding process that all living things share. There are many types of tRNA which recognize the various nucleotide triplets and the 20 amino acids. These types are thought to have arisen as a result of many gene duplications. Relationships among these types are discussed. The 5S ribosomal RNA, presently functional in both eukaryotes and prokaryotes, is very likely descended from an early form incorporating almost a complete duplication of genetic material. The amount of evolution in the various lines can again be compared. The other two families containing duplications are proteins; ferredoxin and cytochrome c.

  5. Mass Spectrometry Analysis Coupled with de novo Sequencing Reveals Amino Acid Substitutions in Nucleocapsid Protein from Influenza A Virus

    Zijian Li

    2014-02-01

    Full Text Available Amino acid substitutions in influenza A virus are the main reasons for both antigenic shift and virulence change, which result from non-synonymous mutations in the viral genome. Nucleocapsid protein (NP, one of the major structural proteins of influenza virus, is responsible for regulation of viral RNA synthesis and replication. In this report we used LC-MS/MS to analyze tryptic digestion of nucleocapsid protein of influenza virus (A/Puerto Rico/8/1934 H1N1, which was isolated and purified by SDS poly-acrylamide gel electrophoresis. Thus, LC-MS/MS analyses, coupled with manual de novo sequencing, allowed the determination of three substituted amino acid residues R452K, T423A and N430T in two tryptic peptides. The obtained results provided experimental evidence that amino acid substitutions resulted from non-synonymous gene mutations could be directly characterized by mass spectrometry in proteins of RNA viruses such as influenza A virus.

  6. Species specific amino acid sequence-protein local structure relationships: An analysis in the light of a structural alphabet.

    de Brevern, Alexandre G; Joseph, Agnel Praveen

    2011-05-01

    Protein structure analysis and prediction methods are based on non-redundant data extracted from the available protein structures, regardless of the species from which the protein originates. Hence, these datasets represent the global knowledge on protein folds, which constitutes a generic distribution of amino acid sequence-protein structure (AAS-PS) relationships. In this study, we try to elucidate whether the AAS-PS relationship could possess specificities depending on the specie. For this purpose, we have chosen three different species: Saccharomyces cerevisiae, Plasmodium falciparum and Arabidopsis thaliana. We analyzed the AAS-PS behaviors of the proteins from these three species and compared it to the "expected" distribution of a classical non-redundant databank. With the classical secondary structure description, only slight differences in amino acid preferences could be observed. With a more precise description of local protein structures (Protein Blocks), significant changes could be highlighted. S. cerevisiae's AAS-PS relationship is close to the general distribution, while striking differences are observed in the case of A. thaliana. P. falciparum is the most distant one. This study presents some interesting view-points on AAS-PS relationship. Certain species exhibit unique preferences for amino acids to be associated with protein local structural elements. Thus, AAS-PS relationships are species dependent. These results can give useful insights for improving prediction methodologies which take the species specific information into account. PMID:21333657

  7. Non-Esterified Fatty Acids Profiling in Rheumatoid Arthritis: Associations with Clinical Features and Th1 Response

    Rodríguez-Carrio, Javier; Alperi-López, Mercedes; López, Patricia; Ballina-García, Francisco Javier; Suárez, Ana

    2016-01-01

    Objectives Since lipid compounds are known to modulate the function of CD4+ T-cells and macrophages, we hypothesize that altered levels of serum non-esterified fatty acids (NEFA) may underlie rheumatoid arthritis (RA) pathogenesis. Methods Serum levels of NEFA (palmitic, stearic, palmitoleic, oleic, linoleic, γ-linoleic, arachidonic –AA–, linolenic, eicosapentaenoic –EPA– and docosahexaenoic –DHA–) were quantified by LC-MS/MS after methyl-tert-butylether (MTBE)-extraction in 124 RA patients and 56 healthy controls (HC). CD4+ phenotype was studied by flow cytometry. TNFα, IL-8, VEGF, GM-CSF, IFNγ, IL-17, CCL2, CXCL10, leptin and resistin serum levels were quantified by immunoassays. The effect of FA on IFNγ production by PBMC was evaluated in vitro. Results Lower levels of palmitic (p<0.0001), palmitoleic (p = 0.002), oleic (p = 0.010), arachidonic (p = 0.027), EPA (p<0.0001) and DHA (p<0.0001) were found in RA patients, some NEFA being altered at onset. Cluster analysis identified a NEFA profile (hallmarked by increased stearic and decreased EPA and DHA) overrepresented in RA patients compared to HC (p = 0.002), being associated with clinical features (RF, shared epitope and erosions), increased IFNγ expression in CD4+ T-cells (p = 0.002) and a Th1-enriched serum milieu (IFNγ, CCL2 and CXCL10, all p<0.005). In vitro assays demonstrated that imbalanced FA could underlie IFNγ production by CD4+ T-cells. Finally, changes on NEFA levels were associated with clinical response upon TNFα-blockade. Conclusion An altered NEFA profile can be found in RA patients associated with clinical characteristics of aggressive disease and enhanced Th1 response. These results support the relevance of lipidomic studies in RA and provide a rationale for new therapeutic targets. PMID:27487156

  8. Evolution of early life inferred from protein and ribonucleic acid sequences

    Dayhoff, M. O.; Schwartz, R. M.

    1978-01-01

    The chemical structures of ferredoxin, 5S ribosomal RNA, and c-type cytochrome sequences have been employed to construct a phylogenetic tree which connects all major photosynthesizing organisms: the three types of bacteria, blue-green algae, and chloroplasts. Anaerobic and aerobic bacteria, eukaryotic cytoplasmic components and mitochondria are also included in the phylogenetic tree. Anaerobic nonphotosynthesizing bacteria similar to Clostridium were the earliest organisms, arising more than 3.2 billion years ago. Bacterial photosynthesis evolved nearly 3.0 billion years ago, while oxygen-evolving photosynthesis, originating in the blue-green algal line, came into being about 2.0 billion years ago. The phylogenetic tree supports the symbiotic theory of the origin of eukaryotes.

  9. Nucleic acid sequences encoding D1 and D1/D2 domains of human coxsackievirus and adenovirus receptor (CAR)

    Freimuth, Paul I.

    2010-04-06

    The invention provides recombinant human CAR (coxsackievirus and adenovirus receptor) polypeptides which bind adenovirus. Specifically, polypeptides corresponding to adenovirus binding domain D1 and the entire extracellular domain of human CAR protein comprising D1 and D2 are provided. In another aspect, the invention provides nucleic acid sequences encoding these domains and expression vectors for producing the domains and bacterial cells containing such vectors. The invention also includes an isolated fusion protein comprised of the D1 polypeptide fused to a polypeptide which facilitates folding of D1 when expressed in bacteria. The functional D1 domain finds application in a therapeutic method for treating a patient infected with a CAR D1-binding virus, and also in a method for identifying an antiviral compound which interferes with viral attachment. The invention also provides a method for specifically targeting a cell for infection by a virus which binds to D1.

  10. Redox labelling of nucleic acids for analyzing nucleotide sequences and monitoring DNA-protein interactions

    Fojta, Miroslav; Havran, Luděk; Horáková Brázdilová, Petra; Pivoňková, Hana; Kostečka, Pavel; Macíčková-Cahová, Hana; Raindlová, Veronika; Vrábel, Milan; Hocek, Michal

    Praha : Institute of Organic Chemistry and Biochemistry AS CR, v. v. i., 2011 - (Hocek, M.), s. 155-158 ISBN 978-80-86241-37-1. - (Collection Symposium Series. 12). [Chemistry of Nucleic Acid Components /15./. Český Krumlov (CZ), 05.06.2011-10.06.2011] R&D Projects: GA MŠk LC512; GA MŠk(CZ) LC06035; GA AV ČR(CZ) IAA400040901; GA AV ČR(CZ) IAA400040903; GA ČR GA203/09/0317; GA AV ČR(CZ) GPP206/11/P739 Institutional research plan: CEZ:AV0Z40550506; CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : DNA * electrochemistry * redox labeling Subject RIV: CC - Organic Chemistry

  11. Tracer study on sulphur use efficiency in potato-barley sequence on acid soil of Shimla

    Controlled studies were conducted on acidic soil of Fagu (Shimla) to study the efficiency of labelled ammonium sulphate as effected by farmyard manure (FYM) on potato (Solanum tuberosum L.) and its residual effect on succeeding barley (Hordeum vulgare L.). The direct and residual effects of FYM and sulphur on dry matter yield and S concentration in potato and barley plants were significant. Applied FYM had a positive effect on radioassay values i.e. % Sdff and % S utilization by potato from labelled S carrier, whereas, the residual effect of applied S on barley was more than its direct effect on potato. Results indicate that combined application of S and FYM resulted in 3.4 per cent more S contribution to barley crop and was reflected in % S utilization values. (author)

  12. Scanning mutagenesis of the amino acid sequences flanking phosphorylation site 1 of the mitochondrial pyruvate dehydrogenase complex

    Nagib eAhsan

    2012-07-01

    Full Text Available The mitochondrial pyruvate dehydrogenase complex is regulated by reversible seryl-phosphorylation of the E1α subunit by a dedicated, intrinsic kinase. The phospho-complex is reactivated when dephosphorylated by an intrinsic PP2C-type protein phosphatase. Both the position of the phosphorylated Ser-residue and the sequences of the flanking amino acids are highly conserved. We have used the synthetic peptide-based kinase client assay plus recombinant pyruvate dehydrogenase E1α and E1α-kinase to perform scanning mutagenesis of the residues flanking the site of phosphorylation. Consistent with the results from phylogenetic analysis of the flanking sequences, the direct peptide-based kinase assays tolerated very few changes. Even conservative changes such as Leu, Ile, or Val for Met, or Glu for Asp, gave very marked reductions in phosphorylation. Overall the results indicate that regulation of the mitochondrial pyruvate dehydrogenase complex by reversible phosphorylation is an extreme example of multiple, interdependent instances of co-evolution.

  13. Amino Acid Sequence and Structural Comparison of BACE1 and BACE2 Using Evolutionary Trace Method

    Hoda Mirsafian

    2014-01-01

    Full Text Available Beta-amyloid precursor protein cleavage enzyme 1 (BACE1 and beta-amyloid precursor protein cleavage enzyme 2 (BACE2, members of aspartyl protease family, are close homologues and have high similarity in their protein crystal structures. However, their enzymatic properties differ leading to disparate clinical consequences. In order to identify the residues that are responsible for such differences, we used evolutionary trace (ET method to compare the amino acid conservation patterns of BACE1 and BACE2 in several mammalian species. We found that, in BACE1 and BACE2 structures, most of the ligand binding sites are conserved which indicate their enzymatic property of aspartyl protease family members. The other conserved residues are more or less randomly localized in other parts of the structures. Four group-specific residues were identified at the ligand binding site of BACE1 and BACE2. We postulated that these residues would be essential for selectivity of BACE1 and BACE2 biological functions and could be sites of interest for the design of selective inhibitors targeting either BACE1 or BACE2.

  14. Generation of deviation parameters for amino acid singlets, doublets and triplets from three-dimensional structures of proteins and its implications for secondary structure prediction from amino acid sequences

    S A Mugilan; K Veluraja

    2000-03-01

    We present a new method, secondary structure prediction by deviation parameter (SSPDP) for predicting the secondary structure of proteins from amino acid sequence. Deviation parameters (DP) for amino acid singlets, doublets and triplets were computed with respect to secondary structural elements of proteins based on the dictionary of secondary structure prediction (DSSP)-generated secondary structure for 408 selected non-homologous proteins. To the amino acid triplets which are not found in the selected dataset, a DP value of zero is assigned with respect to the secondary structural elements of proteins. The total number of parameters generated is 15,432, in the possible parameters of 25,260. Deviation parameter is complete with respect to amino acid singlets, doublets, and partially complete with respect to amino acid triplets. These generated parameters were used to predict secondary structural elements from amino acid sequence. The secondary structure predicted by our method (SSPDP) was compared with that of single sequence (NNPREDICT) and multiple sequence (PHD) methods. The average value of the percentage of prediction accuracy for α-helix by SSPDP, NNPREDICT and PHD methods was found to be 57%, 44% and 69% respectively for the proteins in the selected dataset. For -strand the prediction accuracy is found to be 69%, 21% and 53% respectively by SSPDP, NNPREDICT and PHD methods. This clearly indicates that the secondary structure prediction by our method is as good as PHD method but much better than NNPREDICT method.

  15. Complete Genome Sequence of the d-Amino Acid Catabolism Bacterium Phaeobacter sp. Strain JL2886, Isolated from Deep Seawater of the South China Sea.

    Fu, Yingnan; Wang, Rui; Zhang, Zilian; Jiao, Nianzhi

    2016-01-01

    Phaeobacter sp. strain JL2886, isolated from deep seawater of the South China Sea, can catabolize d-amino acids. Here, we report the complete genome sequence of Phaeobacter sp. JL2886. It comprises ~4.06 Mbp, with a G+C content of 61.52%. A total of 3,913 protein-coding genes and 10 genes related to d-amino acid catabolism were obtained. PMID:27587825

  16. In silico analyses of structural and allergenicity features of sapodilla (Manilkara zapota) acidic thaumatin-like protein in comparison with allergenic plant TLPs.

    Ashok Kumar, Hassan G; Venkatesh, Yeldur P

    2014-02-01

    Thaumatin-like proteins (TLPs) belong to the pathogenesis-related family (PR-5) of plant defense proteins. TLPs from only 32 plant genera have been identified as pollen or food allergens. IgE epitopes on allergens play a central role in food allergy by initiating cross-linking of specific IgE on basophils/mast cells. A comparative analysis of pollen- and food-allergenic TLPs is lacking. The main objective of this investigation was to study the structural and allergenicity features of sapodilla (Manilkara zapota) acidic TLP (TLP 1) by in silico methods. The allergenicity prediction of composite sequence of sapodilla TLP 1 (NCBI B3EWX8.1, G5DC91.1) was performed using FARRP, Allermatch and Evaller web tools. A homology model of the protein was generated using banana TLP template (1Z3Q) by HHPRED-MODELLER. B-cell linear epitope prediction was performed using BCpreds and BepiPred. Sapodilla TLP 1 matched significantly with allergenic TLPs from olive, kiwi, bell pepper and banana. IgE epitope prediction as performed using AlgPred indicated the presence of 2 epitopes (epitope 1: residues 36-48; epitope 2: residues 51-63), and a comprehensive analysis of all allergenic TLPs displayed up to 3 additional epitopes on other TLPs. It can be inferred from these analyses that plant allergenic TLPs generally carry 2-3 IgE epitopes. ClustalX alignments of allergenic TLPs indicate that IgE epitopes 1 and 2 are common in food allergenic TLPs, and IgE epitopes 2 and 3 are common in pollen allergenic TLPs; IgE epitope 2 overlaps with a portion of the thaumatin family signature. The secondary structural elements of TLPs vary markedly in regions 1 and 2 which harbor all the predicted IgE epitopes in all food and pollen TLPs in either of the region. Further, based on the number of IgE epitopes, food TLPs are grouped into rosid and non-rosid clades. The number and distribution of the predicted IgE epitopes among the allergenic TLPs may explain the specificity of food or pollen allergy as

  17. Prediction of Golgi-resident protein types using general form of Chou's pseudo-amino acid compositions: Approaches with minimal redundancy maximal relevance feature selection.

    Jiao, Ya-Sen; Du, Pu-Feng

    2016-08-01

    Recently, several efforts have been made in predicting Golgi-resident proteins. However, it is still a challenging task to identify the type of a Golgi-resident protein. Precise prediction of the type of a Golgi-resident protein plays a key role in understanding its molecular functions in various biological processes. In this paper, we proposed to use a mutual information based feature selection scheme with the general form Chou's pseudo-amino acid compositions to predict the Golgi-resident protein types. The positional specific physicochemical properties were applied in the Chou's pseudo-amino acid compositions. We achieved 91.24% prediction accuracy in a jackknife test with 49 selected features. It has the best performance among all the present predictors. This result indicates that our computational model can be useful in identifying Golgi-resident protein types. PMID:27155042

  18. The polymerization of furfuryl alcohol with p-toluenesulfonic acid: photo cross-linkable feature of the polymer

    Poly (furfuryl alcohol) with different amounts of oxymethylenic bridges was synthesized using trifluoroacetic and p-toluenesulfonic acid. All polymers displayed a tendency to retain acids. The isolated products containing traces of acid became insoluble in a few hours; while neutral material maintains theirs solubility for at least one month. Polymers stored in solution were stable according to their HNMR spectra. Polymers cross-linked after being exposed to UV radiation. The product of the reaction of polymer with maleic anhydride is useful for preparing negative photo resists. (author)

  19. Origin of the 900 cm{sup −1} broad double-hump OH vibrational feature of strongly hydrogen-bonded carboxylic acids

    Van Hoozen, Brian L.; Petersen, Poul B. [Department of Chemistry and Chemical Biology, Cornell University, Ithaca, New York 14853 (United States)

    2015-03-14

    Medium and strong hydrogen bonds are common in biological systems. Here, they provide structural support and can act as proton transfer relays to drive electron and/or energy transfer. Infrared spectroscopy is a sensitive probe of molecular structure and hydrogen bond strength but strongly hydrogen-bonded structures often exhibit very broad and complex vibrational bands. As an example, strong hydrogen bonds between carboxylic acids and nitrogen-containing aromatic bases commonly display a 900 cm{sup −1} broad feature with a remarkable double-hump structure. Although previous studies have assigned this feature to the OH, the exact origin of the shape and width of this unusual feature is not well understood. In this study, we present ab initio calculations of the contributions of the OH stretch and bend vibrational modes to the vibrational spectrum of strongly hydrogen-bonded heterodimers of carboxylic acids and nitrogen-containing aromatic bases, taking the 7-azaindole—acetic acid and pyridine—acetic acid dimers as examples. Our calculations take into account coupling between the OH stretch and bend modes as well as how both of these modes are affected by lower frequency dimer stretch modes, which modulate the distance between the monomers. Our calculations reproduce the broadness and the double-hump structure of the OH vibrational feature. Where the spectral broadness is primarily caused by the dimer stretch modes strongly modulating the frequency of the OH stretch mode, the double-hump structure results from a Fermi resonance between the out of the plane OH bend and the OH stretch modes.

  20. Identification of G and P genotype-specific motifs in the predicted VP7 and VP4 amino acid sequences.

    Ma, Yongping

    2015-12-01

    Equine rotavirus (ERV) strain L338 (G13P[18]) has a unique G and P genotype. However, the evolutionary relationship of L338 with other ERVs is still unknown. Here whole genome analysis of the L338 ERV strain was independently performed. Its genotype constellations were determined as G13-P[18]-I6-R9-C9-M6-A6-N9-T12-E14-H11, confirming previous genotype assignments. The L338 strain only shared the P[18] and I6 genotypes with other ERVs. The nucleotide sequences of the other 9 RNA segments were different from those of cogent genes of all other group A rotavirus (RVA) strains including ERVs and formed unique phylogenetic lineages. The L338 evolutionary footprints were tentatively identified in both VP7 and VP4 amino acid sequences: two regions were found in VP7 and twelve in VP4. The conserved regions shared between L338 and other group A rotavirus strains (RVAs) indicated that L338 was more closely related genomically to animal and human RVAs other than ERVs, suggesting that L338 may not be an endogenous equine RV but have emerged as an interspecies reassortant with other RVA strains. Furthermore, genotype-specific motifs of all 27 G and 37 P types were identified in regions 7-1a (aa 91-100) of VP7 and regions 8-1 (aa146-151) and 8-3 (aa113-118 and 125-135) of VP4 (VP8*). PMID:26321159

  1. A root chicory MADS box sequence and the Arabidopsis flowering repressor FLC share common features that suggest conserved function in vernalization and de-vernalization responses.

    Périlleux, Claire; Pieltain, Alexandra; Jacquemin, Guillaume; Bouché, Frédéric; Detry, Nathalie; D'Aloia, Maria; Thiry, Laura; Aljochim, Pierre; Delansnay, Martin; Mathieu, Anne-Sophie; Lutts, Stanley; Tocquin, Pierre

    2013-08-01

    Root chicory (Cichorium intybus var. sativum) is a biennial crop, but is harvested to obtain root inulin at the end of the first growing season before flowering. However, cold temperatures may vernalize seeds or plantlets, leading to incidental early flowering, and hence understanding the molecular basis of vernalization is important. A MADS box sequence was isolated by RT-PCR and named FLC-LIKE1 (CiFL1) because of its phylogenetic positioning within the same clade as the floral repressor Arabidopsis FLOWERING LOCUS C (AtFLC). Moreover, over-expression of CiFL1 in Arabidopsis caused late flowering and prevented up-regulation of the AtFLC target FLOWERING LOCUS T by photoperiod, suggesting functional conservation between root chicory and Arabidopsis. Like AtFLC in Arabidopsis, CiFL1 was repressed during vernalization of seeds or plantlets of chicory, but repression of CiFL1 was unstable when the post-vernalization temperature was favorable to flowering and when it de-vernalized the plants. This instability of CiFL1 repression may be linked to the bienniality of root chicory compared with the annual lifecycle of Arabidopsis. However, re-activation of AtFLC was also observed in Arabidopsis when a high temperature treatment was used straight after seed vernalization, eliminating the promotive effect of cold on flowering. Cold-induced down-regulation of a MADS box floral repressor and its re-activation by high temperature thus appear to be conserved features of the vernalization and de-vernalization responses in distant species. PMID:23581257

  2. Evolution of phosphagen kinase V. cDNA-derived amino acid sequences of two molluscan arginine kinases from the chiton Liolophura japonica and the turbanshell Battilus cornutus.

    Suzuki, T; Ban, T; Furukohri, T

    1997-06-20

    The cDNAs of arginine kinases from the chiton Liolophura japonica (Polyplacophora) and the turbanshell Battilus cornutus (Gastropoda) were amplified by polymerase chain reaction (PCR), and the complete nucleotide sequences of 1669 and 1624 bp, respectively, were determined. The open reading frame for Liolophura arginine kinase is 1050 nucleotides in length and encodes a protein with 349 amino acid residues, and that for Battilus is 1077 nucleotides and 358 residues. The validity of the cDNA-derived amino acid sequence was supported by chemical sequencing of internal tryptic peptides. The molecular masses were calculated to be 39,057 and 39,795 Da, respectively. The amino acid sequence of Liolophura arginine kinase showed 65-68% identity with those of Battilus and Nordotis (abalone) arginine kinases, and the homology between Battilus and Nordotis was 79%. Molluscan arginine kinases also show lower, but significant homology (38-43%) with rabbit creatine kinase. The sequences of arginine kinases could be used as a molecular clock to elucidate the phylogeny of Mollusca, one of the most diverse animal phyla. PMID:9217008

  3. Ruthenium Hydride/Brønsted Acid-Catalyzed Tandem Isomerization/N-Acyliminium Cyclization Sequence for the Synthesis of Tetrahydro-β-carbolines

    Hansen, Casper Lykke; Clausen, Janie Regitse Waël; Ohm, Ragnhild Gaard;

    2013-01-01

    This paper describes an efficient tandem sequence for the synthesis of 1,2,3,4-tetrahydro-β-carbolines (THBCs) relying on a ruthenium hydride/Brønsted acid- catalyzed isomerization of allylic amides to N-acyliminium ion intermediates which are trapped by a tethered indolenucleophile. The...

  4. Complete genome sequence of the actinobacterium Amycolatopsis japonica MG417-CF17T (=DSM 44213T) producing (S,S)-N,N′-ethylenediaminedisuccinic acid

    Stegmann, Evi; Albersmeier, Andreas; Spohn, Marius; Gert, Helena; Weber, Tilmann; Wohlleben, Wolfgang; Kalinowski, Jörn; Rückert, Christian

    2014-01-01

    We report the complete genome sequence of Amycolatopsis japonica MG417-CF17T (=DSM 44213T) which was identified as the producer of (S,S)-N,N′-ethylenediaminedisuccinic acid during a screening for phospholipase C inhibitors. The genome of A. japonica MG417-CF17T consists of two replicons: the...

  5. Draft Genome Sequences of Pseudomonas fluorescens BS2 and Pusillimonas noertemannii BS8, Soil Bacteria That Cooperate To Degrade the Poly- -D-Glutamic Acid Anthrax Capsule

    Stabler, R. A.

    2013-01-24

    A mixed culture of Pseudomonas fluorescens BS2 and Pusillimonas noertemannii BS8 degraded poly-γ-d-glutamic acid; when the 2 strains were cultured separately, no hydrolytic activity was apparent. Here we report the draft genome sequences of both soil isolates.

  6. Genome Sequence of Lactobacillus saerimneri 30a (Formerly Lactobacillus sp. Strain 30a), a Reference Lactic Acid Bacterium Strain Producing Biogenic Amines

    Romano, Andrea; Trip, Hein; Campbell-Sills, Hugo; Bouchez, Olivier; Sherman, David; Lolkema, Juke S.; Lucas, Patrick M

    2013-01-01

    Lactobacillus sp. strain 30a (Lactobacillus saerimneri) produces the biogenic amines histamine, putrescine, and cadaverine by decarboxylating their amino acid precursors. We report its draft genome sequence (1,634,278 bases, 42.6% G+C content) and the principal findings from its annotation, which might shed light onto the enzymatic machineries that are involved in its production of biogenic amines.

  7. Open questions in origin of life: experimental studies on the origin of nucleic acids and proteins with specific and functional sequences by a chemical synthetic biology approach

    Adamala, K.; Anella, F.; Wieczorek, R.;

    2014-01-01

    In this mini-review we present some experimental approaches to the important issue in the origin of life, namely the origin of nucleic acids and proteins with specific and functional sequences. The formation of macromolecules on prebiotic Earth faces practical and conceptual difficulties. From the...

  8. Features of the low-power charge controller of lead-acid current sources charged by solar batteries

    Influence of different factors on exploitations characteristics of solar photoelectric plant is investigated by field-performance data. A construction of charge controller of the lead-acid accumulator battery charging by means of solar battery is analyzed taking into account these factors. (authors)

  9. Identities among actin-encoding cDNAs of the Nile tilapia (Oreochromis niloticus and other eukaryote species revealed by nucleotide and amino acid sequence analyses

    Andréia B. Poletto

    2008-01-01

    Full Text Available Actin-encoding cDNAs of Nile tilapia (Oreochromis niloticus were isolated by RT-PCR using total RNA samples of different tissues and further characterized by nucleotide sequencing and in silico amino acid (aa sequence analysis. Comparisons among the actin gene sequences of O. niloticus and those of other species evidenced that the isolated genes present a high similarity to other fish and other vertebrate actin genes. The highest nucleotide resemblance was observed between O. niloticus and O. mossambicus a-actin and b-actin genes. Analysis of the predicted aa sequences revealed two distinct types of cytoplasmic actins, one cardiac muscle actin type and one skeletal muscle actin type that were expressed in different tissues of Nile tilapia. The evolutionary relationships between the Nile tilapia actin genes and diverse other organisms is discussed.

  10. Use of sourdough made with quinoa (Chenopodium quinoa) flour and autochthonous selected lactic acid bacteria for enhancing the nutritional, textural and sensory features of white bread.

    Rizzello, Carlo Giuseppe; Lorusso, Anna; Montemurro, Marco; Gobbetti, Marco

    2016-06-01

    Lactic acid bacteria were isolated and identified from quinoa flour, spontaneously fermented quinoa dough, and type I quinoa sourdough. Strains were further selected based on acidification and proteolytic activities. Selected Lactobacillus plantarum T6B10 and Lactobacillus rossiae T0A16 were used as mixed starter to get quinoa sourdough. Compared to non-fermented flour, organic acids, free amino acids, soluble fibers, total phenols, phytase and antioxidant activities, and in vitro protein digestibility markedly increased during fermentation. A wheat bread was made using 20% (w/w) of quinoa sourdough, and compared to baker's yeast wheat breads manufactured with or without quinoa flour. The use of quinoa sourdough improved the chemical, textural, and sensory features of wheat bread, showing better performances compared to the use of quinoa flour. Protein digestibility and quality, and the rate of starch hydrolysis were also nutritional features that markedly improved using quinoa sourdough as an ingredient. This study exploited the potential of quinoa flour through sourdough fermentation. A number of advantages encouraged the manufacture of novel and healthy leavened baked goods. PMID:26919812

  11. Evolution of alpha-lactalbumins. The complete amino acid sequence of the alpha-lactalbumin from a marsupial (Macropus rufogriseus) and corrections to regions of sequence in bovine and goat alpha-lactalbumins.

    Shewale, J G; Sinha, S K; Brew, K

    1984-04-25

    alpha-Lactalbumin was purified from a whey protein fraction of the milk of the red-necked wallaby (Macropus rufogriseus). The complete amino acid sequence was determined from the results of automatic sequenator analyses of the intact protein, the three cyanogen bromide fragments, and of peptides generated from the larger, COOH-terminal CNBr fragment by digestion with trypsin or staphylococcal protease. This is the first sequence to be determined of an alpha-lactalbumin from a marsupial and differs from known eutherian alpha-lactalbumins in size and locations of deletions in alignments with the homologous type c lysozymes, as well as in having amino acid substitutions at 8 sites that are invariant in known eutherian proteins. Some corrections are also reported for two regions of sequence in both bovine and goat alpha-lactalbumins. The new and previously published information on alpha-lactalbumin sequences is analyzed in relation to the evolutionary history of the alpha-lactalbumin line as well as the relationship of structure to function in these proteins. PMID:6715332

  12. Sequence-specific nucleic acid mobility using a reversible block copolymer gel matrix and DNA amphiphiles (lipid-DNA) in capillary and microfluidic electrophoretic separations.

    Wagler, Patrick; Minero, Gabriel Antonio S; Tangen, Uwe; de Vries, Jan Willem; Prusty, Deepak; Kwak, Minseok; Herrmann, Andreas; McCaskill, John S

    2015-10-01

    Reversible noncovalent but sequence-dependent attachment of DNA to gels is shown to allow programmable mobility processing of DNA populations. The covalent attachment of DNA oligomers to polyacrylamide gels using acrydite-modified oligonucleotides has enabled sequence-specific mobility assays for DNA in gel electrophoresis: sequences binding to the immobilized DNA are delayed in their migration. Such a system has been used for example to construct complex DNA filters facilitating DNA computations. However, these gels are formed irreversibly and the choice of immobilized sequences is made once off during fabrication. In this work, we demonstrate the reversible self-assembly of gels combined with amphiphilic DNA molecules, which exhibit hydrophobic hydrocarbon chains attached to the nucleobase. This amphiphilic DNA, which we term lipid-DNA, is synthesized in advance and is blended into a block copolymer gel to induce sequence-dependent DNA retention during electrophoresis. Furthermore, we demonstrate and characterize the programmable mobility shift of matching DNA in such reversible gels both in thin films and microchannels using microelectrode arrays. Such sequence selective separation may be employed to select nucleic acid sequences of similar length from a mixture via local electronics, a basic functionality that can be employed in novel electronic chemical cell designs and other DNA information-processing systems. PMID:26095642

  13. Compositional and functional features of humic acid-like fractions from vermicomposting of sewage sludge and cow dung.

    Li, Xiaowei; Xing, Meiyan; Yang, Jian; Huang, Zhidong

    2011-01-30

    The chemical changes occurring in five different substrates of sewage sludge spiked with different proportions of cow dung after vermicomposting with Eisenia foetida for 90 days were investigated. Their humic acid-like (HAL) fractions were isolated to determine the elemental and functional composition, and structural and functional characteristics using ultraviolet/visible, Fourier transform infrared (FT-IR) and fluorescence spectroscopies and scanning electron microscopy. After vermicomposting, the total organic C and C/N ratio decreased, and the total extractable C and humic acid (HA) C increased in all substrates. In the HAL fractions, the C and H contents, C/N and C/O and aliphatic structures, proteinaceous components and carbohydrates decreased, while the O and N and acidic functional group contents and C/H ratio, aromaticity and polycondensation structures increased. Further, the results suggest that the addition of cow dung to sewage sludge could improve the quality of organic matter humification of the substrates. The structures of HAL fractions in vermicomposts resembled those typical of soil HA, especially the vermicompost of cow dung alone. Scanning electron microscopy showed the microstructure of HAL fraction in final product became close-grained and lumpy. Overall results indicate that vermicomposting was an efficient technology for promoting organic matter (OM) humification in sewage sludge and cow dung alone, as well as in mixtures of both materials, improving their quality and environmental safety as a soil OM resource for utilization as soil amendments. PMID:21030148

  14. Compositional and functional features of humic acid-like fractions from vermicomposting of sewage sludge and cow dung

    The chemical changes occurring in five different substrates of sewage sludge spiked with different proportions of cow dung after vermicomposting with Eisenia foetida for 90 days were investigated. Their humic acid-like (HAL) fractions were isolated to determine the elemental and functional composition, and structural and functional characteristics using ultraviolet/visible, Fourier transform infrared (FT-IR) and fluorescence spectroscopies and scanning electron microscopy. After vermicomposting, the total organic C and C/N ratio decreased, and the total extractable C and humic acid (HA) C increased in all substrates. In the HAL fractions, the C and H contents, C/N and C/O and aliphatic structures, proteinaceous components and carbohydrates decreased, while the O and N and acidic functional group contents and C/H ratio, aromaticity and polycondensation structures increased. Further, the results suggest that the addition of cow dung to sewage sludge could improve the quality of organic matter humification of the substrates. The structures of HAL fractions in vermicomposts resembled those typical of soil HA, especially the vermicompost of cow dung alone. Scanning electron microscopy showed the microstructure of HAL fraction in final product became close-grained and lumpy. Overall results indicate that vermicomposting was an efficient technology for promoting organic matter (OM) humification in sewage sludge and cow dung alone, as well as in mixtures of both materials, improving their quality and environmental safety as a soil OM resource for utilization as soil amendments.

  15. Compositional and functional features of humic acid-like fractions from vermicomposting of sewage sludge and cow dung

    Li Xiaowei [State Key Laboratory of Pollution Control and Resources Reuse, College of Environmental Science and Engineering, Tongji University, Shanghai 200092 (China); Xing Meiyan, E-mail: xmy5000@163.com [State Key Laboratory of Pollution Control and Resources Reuse, College of Environmental Science and Engineering, Tongji University, Shanghai 200092 (China); Yang Jian; Huang Zhidong [State Key Laboratory of Pollution Control and Resources Reuse, College of Environmental Science and Engineering, Tongji University, Shanghai 200092 (China)

    2011-01-30

    The chemical changes occurring in five different substrates of sewage sludge spiked with different proportions of cow dung after vermicomposting with Eisenia foetida for 90 days were investigated. Their humic acid-like (HAL) fractions were isolated to determine the elemental and functional composition, and structural and functional characteristics using ultraviolet/visible, Fourier transform infrared (FT-IR) and fluorescence spectroscopies and scanning electron microscopy. After vermicomposting, the total organic C and C/N ratio decreased, and the total extractable C and humic acid (HA) C increased in all substrates. In the HAL fractions, the C and H contents, C/N and C/O and aliphatic structures, proteinaceous components and carbohydrates decreased, while the O and N and acidic functional group contents and C/H ratio, aromaticity and polycondensation structures increased. Further, the results suggest that the addition of cow dung to sewage sludge could improve the quality of organic matter humification of the substrates. The structures of HAL fractions in vermicomposts resembled those typical of soil HA, especially the vermicompost of cow dung alone. Scanning electron microscopy showed the microstructure of HAL fraction in final product became close-grained and lumpy. Overall results indicate that vermicomposting was an efficient technology for promoting organic matter (OM) humification in sewage sludge and cow dung alone, as well as in mixtures of both materials, improving their quality and environmental safety as a soil OM resource for utilization as soil amendments.

  16. Iris recognition algorithm based on extracting stable feature points of sequence images%基于序列图像提取稳定特征点的虹膜识别算法

    苑玮琦; 张开营; 杨冉冉; 刘博

    2011-01-01

    为了尽可能降低不稳定特征点对识别率的影响,研究提出了基于序列图像提取稳定特征点的虹膜识别算法.该算法首先用二维Gabor滤波器对序列虹膜图像提取特征编码,然后对该序列特征编码求交集以提取稳定特征点,并利用这些稳定特征点建立虹膜的特征模板库,最后通过计算相似度,获得识别结果.在实验室采集的序列虹膜图库上,当等错率为0.3017%,分类阈值为0.6402时,正确识别率可以达到99.73%.实验证明该算法是有效、可行的,并更好地提高了虹膜的分类精度和改善了虹膜的识别性能.%In order to reduce the influence of unstable feature points on iris recognition, an iris recognition algorithm based on extracting stable feature points of sequence images is proposed. Firstly, this algorithm extracts feature codes from sequence iris images with two-dimensional Gabor filters. Secondly, the stable feature points can be extracted by calculating the intersection of the feature codes of the sequence images. At the same time, iris feature templates can be built based on these stable feature points; and the iris feature templates can be used for iris classification. At last, the identification results can be obtained with pattern recognition. When the equal error rate is 0.3017% and the distance threshold equals to 0.6402 , the identification accuracy is 99.73% for the iris database acquired in laboratory by oneself. Experimental results demonstrate that the iris recognition algorithm based on extracting stable feature points of sequence images is effective and feasible, and the proposed algorithm can achieve high classification accuracy and improve iris recognition performance effectively.

  17. Complete genome sequence of the actinobacterium Amycolatopsis japonica MG417-CF17(T) (=DSM 44213T) producing (S,S)-N,N'-ethylenediaminedisuccinic acid.

    Stegmann, Evi; Albersmeier, Andreas; Spohn, Marius; Gert, Helena; Weber, Tilmann; Wohlleben, Wolfgang; Kalinowski, Jörn; Rückert, Christian

    2014-11-10

    We report the complete genome sequence of Amycolatopsis japonica MG417-CF17(T) (=DSM 44213(T)) which was identified as the producer of (S,S)-N,N'-ethylenediaminedisuccinic acid during a screening for phospholipase C inhibitors. The genome of A. japonica MG417-CF17(T) consists of two replicons: the chromosome (8,961,318 bp, 68.89% G+C content) and the plasmid pAmyja1 (92,539 bp, 68.23% G+C content), encoding a total of 8422 protein coding genes. Analysis of the sequence data revealed 30 clusters encoding the biosynthesis of secondary metabolites. PMID:25193710

  18. Genome sequence of Candidatus Nitrososphaera evergladensis from group I.1b enriched from Everglades soil reveals novel genomic features of the ammonia-oxidizing archaea.

    Kateryna V Zhalnina

    Full Text Available The activity of ammonia-oxidizing archaea (AOA leads to the loss of nitrogen from soil, pollution of water sources and elevated emissions of greenhouse gas. To date, eight AOA genomes are available in the public databases, seven are from the group I.1a of the Thaumarchaeota and only one is from the group I.1b, isolated from hot springs. Many soils are dominated by AOA from the group I.1b, but the genomes of soil representatives of this group have not been sequenced and functionally characterized. The lack of knowledge of metabolic pathways of soil AOA presents a critical gap in understanding their role in biogeochemical cycles. Here, we describe the first complete genome of soil archaeon Candidatus Nitrososphaera evergladensis, which has been reconstructed from metagenomic sequencing of a highly enriched culture obtained from an agricultural soil. The AOA enrichment was sequenced with the high throughput next generation sequencing platforms from Pacific Biosciences and Ion Torrent. The de novo assembly of sequences resulted in one 2.95 Mb contig. Annotation of the reconstructed genome revealed many similarities of the basic metabolism with the rest of sequenced AOA. Ca. N. evergladensis belongs to the group I.1b and shares only 40% of whole-genome homology with the closest sequenced relative Ca. N. gargensis. Detailed analysis of the genome revealed coding sequences that were completely absent from the group I.1a. These unique sequences code for proteins involved in control of DNA integrity, transporters, two-component systems and versatile CRISPR defense system. Notably, genomes from the group I.1b have more gene duplications compared to the genomes from the group I.1a. We suggest that the presence of these unique genes and gene duplications may be associated with the environmental versatility of this group.

  19. Myeloid neoplasm demonstrating a STAT5B-RARA rearrangement and genetic alterations associated with all-trans retinoic acid resistance identified by a custom next-generation sequencing assay.

    Kluk, Michael J; Abo, Ryan P; Brown, Ronald D; Kuo, Frank C; Dal Cin, Paola; Pozdnyakova, Olga; Morgan, Elizabeth A; Lindeman, Neal I; DeAngelo, Daniel J; Aster, Jon C

    2015-10-01

    We describe the case of a patient presenting with several weeks of symptoms related to pancytopenia associated with a maturation arrest at the late promyelocyte/early myelocyte stage of granulocyte differentiation. A diagnosis of acute promyelocytic leukemia was considered, but the morphologic features were atypical for this entity and conventional tests for the presence of a PML-RARA fusion gene were negative. Additional analysis using a custom next-generation sequencing assay revealed a rearrangement producing a STAT5B-RARA fusion gene, which was confirmed by reverse transcription polymerase chain reaction (RT-PCR) and supplementary cytogenetic studies, allowing the diagnosis of a morphologically atypical form of acute promyelocytic leukemia to be made. Analysis of the sequencing data permitted characterization of both chromosomal breakpoints and revealed two additional alterations, a small deletion in RARA exon 9 and a RARA R276W substitution, that have been linked to resistance to all-trans retinoic acid. This case highlights how next-generation sequencing can augment currently standard testing to establish diagnoses in difficult cases, and in doing so help guide selection of therapy. PMID:27148563

  20. Solid-phase methods for sequencing of nucleic acids I. Simultaneous sequencing of different oligodeoxyribonucleotides using a new, mechanically stable anion-exchange paper.

    Rosenthal, A.; Schwertner, S; Hahn, V; Hunger, H. D.

    1985-01-01

    A solid-phase method for simultaneous sequencing of large numbers of oligodeoxyribonucleotides has been developed using a new, mechanically stable anion-exchange paper. The excellent mechanical properties of the polymer allow the processing of several paper segments in one reaction vessel or to carry out all necessary operations on a larger area of the paper. In addition, DNA material can be chemically eluted from the new carrier during the piperidine reaction, thus avoiding salt elution of D...

  1. Lactic acid aided electrochemical deposition of c-axis preferred orientation of zinc oxide thin films: Structural and morphological features

    Whang, Thou-Jen, E-mail: twhang@mail.ncku.edu.tw [Department of Chemistry, National Cheng Kung University, No. 1, University Road, Tainan 70101, Taiwan (China); Hsieh, Mu-Tao; Tsai, Jia-Ming [Department of Chemistry, National Cheng Kung University, No. 1, University Road, Tainan 70101, Taiwan (China); Lee, Shyan-Jer [Department of Chemical Biology, National Pingtung University of Education, No. 4-18 Ming Shen Road, Pingtung 90003, Taiwan (China)

    2011-09-01

    Compact and homogeneous c-axis preferred orientation of zinc oxide (ZnO) films on indium tin oxide (ITO) coated glass have been prepared electrochemically at -1.2 V vs. Ag|AgCl in a weak acidic condition from 0.06 M Zn(NO{sub 3}){sub 2} with 3 mM lactic acid (LA) added. LA was found having strong influence on the electrodeposition of c-axis preferred orientation of zinc oxide films. Other experimental variables such as deposition temperature, potential, and precursor concentration were also conducted in this article. Among these variables, it was found that precursor concentration of zinc nitrate influenced significantly on growth direction and crystal diameter of zinc oxide. Cyclic voltammetry was used to observe the electrochemistry of the deposition. Crystallinities of the films were examined by X-ray diffractometer. The morphologies of zinc oxide films were observed with a field emitting scanning electron microscope. Optical characteristics of zinc oxide layers were measured with UV-vis spectrophotometer. The band gap of the deposited zinc oxide thin films was evaluated from the Tauc relationship of ({alpha}h{nu}){sup 2} vs. h{nu}, which was found to be 3.31 eV.

  2. Lactic acid aided electrochemical deposition of c-axis preferred orientation of zinc oxide thin films: Structural and morphological features

    Compact and homogeneous c-axis preferred orientation of zinc oxide (ZnO) films on indium tin oxide (ITO) coated glass have been prepared electrochemically at -1.2 V vs. Ag|AgCl in a weak acidic condition from 0.06 M Zn(NO3)2 with 3 mM lactic acid (LA) added. LA was found having strong influence on the electrodeposition of c-axis preferred orientation of zinc oxide films. Other experimental variables such as deposition temperature, potential, and precursor concentration were also conducted in this article. Among these variables, it was found that precursor concentration of zinc nitrate influenced significantly on growth direction and crystal diameter of zinc oxide. Cyclic voltammetry was used to observe the electrochemistry of the deposition. Crystallinities of the films were examined by X-ray diffractometer. The morphologies of zinc oxide films were observed with a field emitting scanning electron microscope. Optical characteristics of zinc oxide layers were measured with UV-vis spectrophotometer. The band gap of the deposited zinc oxide thin films was evaluated from the Tauc relationship of (αhν)2 vs. hν, which was found to be 3.31 eV.

  3. Terminal sequence importance of de novo proteins from binary-patterned library: stable artificial proteins with 11- or 12-amino acid alphabet.

    Okura, Hiromichi; Takahashi, Tsuyoshi; Mihara, Hisakazu

    2012-06-01

    Successful approaches of de novo protein design suggest a great potential to create novel structural folds and to understand natural rules of protein folding. For these purposes, smaller and simpler de novo proteins have been developed. Here, we constructed smaller proteins by removing the terminal sequences from stable de novo vTAJ proteins and compared stabilities between mutant and original proteins. vTAJ proteins were screened from an α3β3 binary-patterned library which was designed with polar/ nonpolar periodicities of α-helix and β-sheet. vTAJ proteins have the additional terminal sequences due to the method of constructing the genetically repeated library sequences. By removing the parts of the sequences, we successfully obtained the stable smaller de novo protein mutants with fewer amino acid alphabets than the originals. However, these mutants showed the differences on ANS binding properties and stabilities against denaturant and pH change. The terminal sequences, which were designed just as flexible linkers not as secondary structure units, sufficiently affected these physicochemical details. This study showed implications for adjusting protein stabilities by designing N- and C-terminal sequences. PMID:22519540

  4. Shared amino acid sequences between major histocompatibility complex class II glycoproteins, type XI collagen and Proteus mirabilis in rheumatoid arthritis.

    Wilson, C.; Ebringer, A; K. Ahmadi; Wrigglesworth, J; Tiwana, H.; Fielder, M; Binder, A.; Ettelaie, C.; Cunningham, P.; Joannou, C

    1995-01-01

    OBJECTIVES--To show molecular similarity between two sequences of Proteus mirabilis (haemolysin--ESRRAL; urease--IRRET) with HLA-DR antigens (EQRRAA) which are associated with rheumatoid arthritis (RA) and type XI collagen (LRREI), respectively; and, in patients with RA, to measure levels of antibody against a 16-mer synthetic peptide containing the ESRRAL sequence, and the haemolysin and urease proteins of Proteus mirabilis. METHODS--The homologous sequences EQRRAA and ESRRAL were modelled w...

  5. Nuclear hormone receptors involved in neoplasia: erb A exhibits a novel DNA sequence specificity determined by amino acids outside of the zinc-finger domain.

    Chen, H.; Smit-McBride, Z; Lewis, S; Sharif, M; Privalsky, M L

    1993-01-01

    The erb A oncogene is a dominant negative allele of a thyroid hormone receptor gene and acts in the cancer cell by encoding a transcriptional repressor. We demonstrate here that the DNA sequence recognition properties of the oncogenic form of the erb A protein are significantly altered from those of the normal thyroid hormone receptors and more closely resemble those of the retinoic acid receptors; this alteration appears to play an important role in defining the targets of erb A action in ne...

  6. Genome Sequence of Lactobacillus saerimneri 30a (Formerly Lactobacillus sp. Strain 30a), a Reference Lactic Acid Bacterium Strain Producing Biogenic Amines

    Romano, Andrea; Trip, Hein; Campbell-Sills, Hugo; Bouchez, Olivier; Sherman, David; Lolkema, Juke S.; Lucas, Patrick M

    2013-01-01

    Lactobacillus sp. strain 30a (Lactobacillus saerimneri) produces the biogenic amines histamine, putrescine, and cadaverine by decarboxylating their amino acid precursors. We report its draft genome sequence (1,634,278 bases, 42.6% G+C content) and the principal findings from its annotation, which might shed light onto the enzymatic machineries that are involved in its production of biogenic amines.

  7. Amino acid sequence of the ligand-binding domain of the aryl hydrocarbon receptor 1 predicts sensitivity of wild birds to effects of dioxin-like compounds.

    Farmahin, Reza; Manning, Gillian E; Crump, Doug; Wu, Dongmei; Mundy, Lukas J; Jones, Stephanie P; Hahn, Mark E; Karchner, Sibel I; Giesy, John P; Bursian, Steven J; Zwiernik, Matthew J; Fredricks, Timothy B; Kennedy, Sean W

    2013-01-01

    The sensitivity of avian species to the toxic effects of dioxin-like compounds (DLCs) varies up to 1000-fold among species, and this variability has been associated with interspecies differences in aryl hydrocarbon receptor 1 ligand-binding domain (AHR1 LBD) sequence. We previously showed that LD(50) values, based on in ovo exposures to DLCs, were significantly correlated with in vitro EC(50) values obtained with a luciferase reporter gene (LRG) assay that measures AHR1-mediated induction of cytochrome P4501A in COS-7 cells transfected with avian AHR1 constructs. Those findings suggest that the AHR1 LBD sequence and the LRG assay can be used to predict avian species sensitivity to DLCs. In the present study, the AHR1 LBD sequences of 86 avian species were studied, and differences at amino acid sites 256, 257, 297, 324, 337, and 380 were identified. Site-directed mutagenesis, the LRG assay, and homology modeling highlighted the importance of each amino acid site in AHR1 sensitivity to 2,3,7,8-tetrachlorodibenzo-p-dioxin and other DLCs. The results of the study revealed that (1) only amino acids at sites 324 and 380 affect the sensitivity of AHR1 expression constructs of the 86 avian species to DLCs and (2) in vitro luciferase activity of AHR1 constructs containing only the LBD of the species of interest is significantly correlated (r (2) = 0.93, p toxicity data for those species. These results indicate promise for the use of AHR1 LBD amino acid sequences independently, or combined with the LRG assay, to predict avian species sensitivity to DLCs. PMID:22923492

  8. Detection of Aspergillus fumigatus in a Rat Model of Invasive Pulmonary Aspergillosis by Real-Time Nucleic Acid Sequence-Based Amplification▿

    Zhao, Yanan; Park, Steven; Warn, Peter; Shrief, Raghdaa; Harrison, Elizabeth; Perlin, David S.

    2010-01-01

    Rapid and sensitive detection of Aspergillus from clinical samples may facilitate the early diagnosis of invasive pulmonary aspergillosis (IPA). A real-time nucleic acid sequence-based amplification (NASBA) method was investigated by use of an inhalational rat model of IPA. Immunosuppressed male Sprague-Dawley rats were exposed to Aspergillus fumigatus spores for an hour in an aerosol chamber. Bronchoalveolar lavage (BAL) fluid, lung tissues, and whole blood were collected from five infected ...

  9. [Electrophysiological and behavioral features of septal seizures in cats--experimental sham-rage seizures induced by injection of kainic acid].

    Hashizume, K; Tanaka, T; Yonemasu, Y

    1994-07-01

    The septal nucleus has close connections with the hippocampus and amygdala and is known to be involved in emotional behavior. We analyzed the electrophysiological and behavioral features of seizures induced by an injection of kainic acid into the lateral septal nucleus of the cat. Stereotactic surgery was performed to implant a cannula into the lateral septal nucleus to make the injection, and deep electrodes were implanted into the hippocampus and amygdala bilaterally. Seven days post operatively kainic acid, 0.5 microgram/0.5 microliter, was injected via the cannula, and three to five minutes later the cats began to exhibit head turning to the contralateral side. The seizures subsequently progressed limbic seizure status. The electroencephalogram revealed that the spike discharges started in the lateral septal nucleus, extended to the ipsilateral hippocampus and amygdala, then propagated to the contralateral side. Spontaneous sham-rage seizures occurred more than seven days after the injection. These seizure were characterized by sudden onset of aggressive and violent behavior which included hissing, biting and scratching. The electroencephalogram showed synchronization of rhythmic spikes in the ipsilateral septal nucleus, hippocampus and amygdala during such seizures. Further study of this model is important not only to understand the relationship between the septal nucleus and the hippocampus and amygdala but to understand the mechanism of sham-rage seizures. In addition, this model may be useful in understanding the emotional features of intractable complex partial seizures in man. PMID:7946621

  10. Data for amino acid alignment of Japanese stingray melanocortin receptors with other gnathostome melanocortin receptor sequences, and the ligand selectivity of Japanese stingray melanocortin receptors

    Akiyoshi Takahashi

    2016-06-01

    Full Text Available This article contains structure and pharmacological characteristics of melanocortin receptors (MCRs related to research published in “Characterization of melanocortin receptors from stingray Dasyatis akajei, a cartilaginous fish” (Takahashi et al., 2016 [1]. The amino acid sequences of the stingray, D. akajei, MC1R, MC2R, MC3R, MC4R, and MC5R were aligned with the corresponding melanocortin receptor sequences from the elephant shark, Callorhinchus milii, the dogfish, Squalus acanthias, the goldfish, Carassius auratus, and the mouse, Mus musculus. These alignments provide the basis for phylogenetic analysis of these gnathostome melanocortin receptor sequences. In addition, the Japanese stingray melanocortin receptors were separately expressed in Chinese Hamster Ovary cells, and stimulated with stingray ACTH, α-MSH, β-MSH, γ-MSH, δ-MSH, and β-endorphin. The dose response curves reveal the order of ligand selectivity for each stingray MCR.

  11. FeatureViewer, a BioJS component for visualization of position-based annotations in protein sequences [v1; ref status: indexed, http://f1000r.es/2u2

    Leyla Garcia; Guy Yachdav; Maria-Jesus Martin

    2014-01-01

    Summary: FeatureViewer is a BioJS component that lays out, maps, orients, and renders position-based annotations for protein sequences. This component is highly flexible and customizable, allowing the presentation of annotations by rows, all centered, or distributed in non-overlapping tracks. It uses either lines or shapes for sites and rectangles for regions. The result is a powerful visualization tool that can be easily integrated into web applications as well as documents as it provides an...

  12. Separation of small molecular peptides with the same amino acid composition but different sequences by high performance liquid chromatography-electrospray ionization-mass spectrometry

    2009-01-01

    Peptidomics has emerged as a new discipline in recent years. Mass spectrometry (MS) is the most universal and efficient tool for structure identification of proteins and peptides. However,there is a limitation for the identification of peptides with the same amino acid composition but different se-quences because these peptides have identical mass spectra of molecular ions. This paper presents a high performance liquid chromatography-electrospray ionization-mass spectrometry (HPLC-ESI-MS) method for the separation of small molecular peptides with the same amino acid composition but dif-ferent sequences. Two tripeptides of Gly-Ser-Phe and Gly-Phe-Ser were used as a model sample. The separation behavior has been investigated and the separation conditions have been optimized. Under the optimum conditions,good repeatability was achieved. The developed method could provide a helpful reference for the separation of other peptides with the same amino acid composition but different sequences in the study of proteomics and peptidomics.

  13. Amino acid sequence of the alpha subunit and computer modelling of the alpha and beta subunits of echicetin from the venom of Echis carinatus (saw-scaled viper).

    Polgár, J; Magnenat, E M; Peitsch, M C; Wells, T N; Saqi, M S; Clemetson, K J

    1997-04-15

    Echicetin, a heterodimeric protein from the venom of Echis carinatus, binds to platelet glycoprotein Ib (GPIb) and so inhibits platelet aggregation or agglutination induced by various platelet agonists acting via GPIb. The amino acid sequence of the beta subunit of echicetin has been reported and found to belong to the recently identified snake venom subclass of the C-type lectin protein family. Echicetin alpha and beta subunits were purified. N-terminal sequence analysis provided direct evidence that the protein purified was echicetin. The paper presents the complete amino acid sequence of the alpha subunit and computer models of the alpha and beta subunits. The sequence of alpha echicetin is highly similar to the alpha and beta chains of various heterodimeric and homodimeric C-type lectins. Neither of the fully reduced and alkylated alpha or beta subunits of echicetin inhibited the platelet agglutination induced by von Willebrand factor-ristocetin or alpha-thrombin. Earlier reports about the inhibitory activity of reduced and alkylated echicetin beta subunit might have been due to partial reduction of the protein. PMID:9163349

  14. Transcriptome-Wide Cleavage Site Mapping on Cellular mRNAs Reveals Features Underlying Sequence-Specific Cleavage by the Viral Ribonuclease SOX.

    Marta Maria Gaglia

    2015-12-01

    Full Text Available Many viruses express factors that reduce host gene expression through widespread degradation of cellular mRNA. An example of this class of proteins is the mRNA-targeting endoribonuclease SOX from the gamma-herpesvirus Kaposi's sarcoma-associated herpesvirus (KSHV. Previous studies indicated that cleavage of messenger RNAs (mRNA by SOX occurs at specific locations defined by the sequence of the target RNA, which is at odds with the down-regulation of a large portion of cellular transcripts. In this study, we address this paradox by using high-throughput sequencing of cleavage intermediates combined with a custom bioinformatics-based analysis pipeline to identify SOX cleavage sites across the mRNA transcriptome. These data, coupled with targeted mutagenesis, reveal that while cleavage sites are specific and reproducible, they are defined by a degenerate sequence motif containing a small number of conserved residues rather than a strong consensus sequence. This degenerate element is well represented in both human and KSHV mRNA, and its presence correlates with RNA destabilization by SOX. This represents a new endonuclease targeting strategy, in which use of a degenerate targeting element enables RNA cleavage at specific locations without restricting the range of targets. Furthermore, it shows that strong target selectivity can be achieved without a high degree of sequence specificity.

  15. Ethosomes® and transfersomes® containing linoleic acid: physicochemical and technological features of topical drug delivery carriers for the potential treatment of melasma disorders.

    Celia, Christian; Cilurzo, Felisa; Trapasso, Elena; Cosco, Donato; Fresta, Massimo; Paolino, Donatella

    2012-02-01

    Two vesicular colloidal carriers, ethosomes® and transfersomes® were proposed for the topical delivery of linoleic acid, an active compound used in the therapeutic treatment of hyperpigmentation disorders, i.e. melasma, which is characterized by an increase of the melanin production in the epidermis. Dynamic light scattering was used for the physicochemical characterization of vesicles and mean size, size distribution and zeta potential were evaluated. The stability of formulations was also evaluated using the Turbiscan Lab® Expert based on the analysis of sample transmittance and photon backscattering. Ethosomes® and transfersomes® were prepared using Phospholipon 100 G®, as the lecithin component, and ethanol and sodium cholate, as edge activator agents, respectively. Linoleic acid at 0.05% and 0.1% (w/v) was used as the active ingredient and entrapped in colloidal vesicles. Technological parameters, i.e. entrapment efficacy, drug release and permeation profiles, were also investigated. Experimental findings showed that physicochemical and technological features of ethosomes® and transfersomes® were influenced by the lipid composition of the carriers. The percutaneous permeation experiments of linoleic acid-loaded ethosomes® and transfersomes® through human stratum corneum-epidermidis membranes showed that both carriers are accumulated in the skin membrane model as a function of their lipid compositions. The findings reported in this investigation showed that both vesicular carriers could represent a potential system for the topical treatment of hyperpigmentation disorders. PMID:21960035

  16. The Origin and Features of the Two Intermediate-Acid Intrusive Series in Tongling Area, Anhui, China

    WU Cailai; CHEN Songyong; HAO Meiying; SHI Rendeng

    2001-01-01

    The Mesozoic intermediate-acid intrusive rocks in Tongling area can be divided into two magmatic series, namely the shoshonitic series and the high-potassium (K) calc-alkaline series. The shoshonitic series is characterized by an association of pyroxene monzodiorites+monzodiorites+quartz monzonites, the Rittmann indices of these rocks are greater than 4 (ranging from 4.2 to 5.8), the total of rare earth elements (∑REE) ranges from 210×10-6 to 260×10-6, and has good relationship with gold deposits. The high-potassium calc-alkaline series is by an association of diorite+quartz monzodiorites+granodiorites, the Rittmann indices are less than 4 (1.8-3.2), ∑REE 130×l0-6-180×10-6,and has good relationship with copper deposits. Together with lithoenclave study, it can be concluded that the shoshonitic series magma is derived from the differentiation of the alkaline basic magma in mantle and the high-potassium (K) calc-alkaline series magma is mixture between the differentiated mantle magma and crustal magma.

  17. Intracellular traffic of the lysine and glutamic acid rich protein KERP1 reveals features of endomembrane organization in Entamoeba histolytica.

    Perdomo, Doranda; Manich, Maria; Syan, Sylvie; Olivo-Marin, Jean-Christophe; Dufour, Alexandre C; Guillén, Nancy

    2016-08-01

    The development of amoebiasis is influenced by the expression of the lysine and glutamic acid rich protein 1 (KERP1), a virulence factor involved in Entamoeba histolytica adherence to human cells. Up to date, it is unknown how the protein transits the parasite cytoplasm towards the plasma membrane, specially because this organism lacks a well-defined endoplasmic reticulum (ER) and Golgi apparatus. In this work we demonstrate that KERP1 is present at the cell surface and in intracellular vesicles which traffic in a pathway that is independent of the ER-Golgi anterograde transport. The intracellular displacement of vesicles enriched in KERP1 relies on the actin-rich cytoskeleton activities. KERP1 is also present in externalized vesicles deposited on the surface of human cells. We further report the interactome of KERP1 with its association to endomembrane components and lipids. The model for KERP1 traffic here proposed hints for the first time elements of the endocytic and exocytic paths of E. histolytica. PMID:26857352

  18. Moving Away from the Reference Genome: Evaluating a Peptide Sequencing Tagging Approach for Single Amino Acid Polymorphism Identifications in the Genus Populus

    Abraham, Paul E [ORNL; Adams, Rachel M [ORNL; Tuskan, Gerald A [ORNL; Hettich, Robert {Bob} L [ORNL

    2013-01-01

    The genetic diversity across natural populations of the model organism, Populus, is extensive, containing a single nucleotide polymorphism roughly every 200 base pairs. When deviations from the reference genome occur in coding regions, they can impact protein sequences. Rather than relying on a static reference database to profile protein expression, we employed a peptide sequence tagging (PST) approach capable of decoding the plasticity of the Populus proteome. Using shotgun proteomics data from two genotypes of P. trichocarpa, a tag-based approach enabled the detection of 6,653 unexpected sequence variants. Through manual validation, our study investigated how the most abundant chemical modification (methionine oxidation) could masquerade as a sequence variant (AlaSer) when few site-determining ions existed. In fact, precise localization of an oxidation site for peptides with more than one potential placement was indeterminate for 70% of the MS/MS spectra. We demonstrate that additional fragment ions made available by high energy collisional dissociation enhances the robustness of the peptide sequence tagging approach (81% of oxidation events could be exclusively localized to a methionine). We are confident that augmenting fragmentation processes for a PST approach will further improve the identification of single amino acid polymorphism in Populus and potentially other species as well.

  19. Interactive Effect of Salicylic Acid on Some Physiological Features and Antioxidant Enzymes Activity in Ginger (Zingiber officinale Roscoe

    Hawa Z. E. Jaafar

    2013-05-01

    Full Text Available The effect of foliar salicylic acid (SA applications (10−3 and 10−5 M on activities of nitrate reductase, guaiacol peroxidase (POD, superoxide dismutases (SOD, catalase (CAT and proline enzymes and physiological parameters was evaluated in two ginger varieties (Halia Bentong and Halia Bara under greenhouse conditions. In both varieties, tested treatments generally enhanced photosynthetic rate and total dry weight. Photosynthetic rate increases were generally accompanied by increased or unchanged stomatal conductance levels, although intercellular CO2 concentrations of treated plants were typically lower than in controls. Lower SA concentrations were generally more effective in enhancing photosynthetic rate and plant growth. Exogenous application of SA increased antioxidant enzyme activities and proline content; the greatest responses were obtained in plants sprayed with 10–5 M SA, with significant increases observed in CAT (20.1%, POD (45.2%, SOD (44.1% and proline (43.1% activities. Increased CAT activity in leaves is naturally expected to increase photosynthetic efficiency and thus net photosynthesis by maintaining a constant CO2 supply. Our results support the idea that low SA concentrations (10–5 M may induce nitrite reductase synthesis by mobilizing intracellular NO3− and can provide protection to nitrite reductase degradation in vivo in the absence of NO3–. Observed positive correlations among proline, SOD, CAT and POD activities in the studied varieties suggest that increased SOD activity was accompanied by increases in CAT and POD activities because of the high demands of H2O2 quenching.

  20. Probing structural features of Alzheimer's amyloid-β pores in bilayers using site-specific amino acid substitutions.

    Capone, Ricardo; Jang, Hyunbum; Kotler, Samuel A; Kagan, Bruce L; Nussinov, Ruth; Lal, Ratnesh

    2012-01-24

    A current hypothesis for the pathology of Alzheimer's disease (AD) proposes that amyloid-β (Aβ) peptides induce uncontrolled, neurotoxic ion flux across cellular membranes. The mechanism of ion flux is not fully understood because no experiment-based Aβ channel structures at atomic resolution are currently available (only a few polymorphic states have been predicted by computational models). Structural models and experimental evidence lend support to the view that the Aβ channel is an assembly of loosely associated mobile β-sheet subunits. Here, using planar lipid bilayers and molecular dynamics (MD) simulations, we show that amino acid substitutions can be used to infer which residues are essential for channel structure. We created two Aβ(1-42) peptides with point mutations: F19P and F20C. The substitution of Phe19 with Pro inhibited channel conductance. MD simulation suggests a collapsed pore of F19P channels at the lower bilayer leaflet. The kinks at the Pro residues in the pore-lining β-strands induce blockage of the solvated pore by the N-termini of the chains. The cysteine mutant is capable of forming channels, and the conductance behavior of F20C channels is similar to that of the wild type. Overall, the mutational analysis of the channel activity performed in this work tests the proposition that the channels consist of a β-sheet rich organization, with the charged/polar central strand containing the mutation sites lining the pore, and the C-terminal strands facing the hydrophobic lipid tails. A detailed understanding of channel formation and its structure should aid studies of drug design aiming to control unregulated Aβ-dependent ion fluxes. PMID:22242635

  1. Sequence heterogeneity of cannabidiolic- and tetrahydrocannabinolic acid-synthase in Cannabis sativa L. and its relationship with chemical phenotype.

    Onofri, Chiara; de Meijer, Etienne P M; Mandolino, Giuseppe

    2015-08-01

    Sequence variants of THCA- and CBDA-synthases were isolated from different Cannabis sativa L. strains expressing various wild-type and mutant chemical phenotypes (chemotypes). Expressed and complete sequences were obtained from mature inflorescences. Each strain was shown to have a different specificity and/or ability to convert the precursor CBGA into CBDA and/or THCA type products. The comparison of the expressed sequences led to the identification of different mutations, all of them due to SNPs. These SNPs were found to relate to the cannabinoid composition of the inflorescence at maturity and are therefore proposed to have a functional significance. The amount of variation was found to be higher within the CBDAS sequence family than in the THCAS family, suggesting a more recent evolution of THCA-forming enzymes from the CBDAS group. We therefore consider CBDAS as the ancestral type of these synthases. PMID:25865737

  2. Transcriptional analysis of the HeT-A retrotransposon in mutant and wild type stocks reveals high sequence variability at Drosophila telomeres and other unusual features

    Piñeyro David

    2011-11-01

    Full Text Available Abstract Background Telomere replication in Drosophila depends on the transposition of a domesticated retroelement, the HeT-A retrotransposon. The sequence of the HeT-A retrotransposon changes rapidly resulting in differentiated subfamilies. This pattern of sequence change contrasts with the essential function with which the HeT-A is entrusted and brings about questions concerning the extent of sequence variability, the telomere contribution of different subfamilies, and whether wild type and mutant Drosophila stocks show different HeT-A scenarios. Results A detailed study on the variability of HeT-A reveals that both the level of variability and the number of subfamilies are higher than previously reported. Comparisons between GIII, a strain with longer telomeres, and its parental strain Oregon-R indicate that both strains have the same set of HeT-A subfamilies. Finally, the presence of a highly conserved splicing pattern only in its antisense transcripts indicates a putative regulatory, functional or structural role for the HeT-A RNA. Interestingly, our results also suggest that most HeT-A copies are actively expressed regardless of which telomere and where in the telomere they are located. Conclusions Our study demonstrates how the HeT-A sequence changes much faster than previously reported resulting in at least nine different subfamilies most of which could actively contribute to telomere extension in Drosophila. Interestingly, the only significant difference observed between Oregon-R and GIII resides in the nature and proportion of the antisense transcripts, suggesting a possible mechanism that would in part explain the longer telomeres of the GIII stock.

  3. KSHV 2.0: A Comprehensive Annotation of the Kaposi's Sarcoma-Associated Herpesvirus Genome Using Next-Generation Sequencing Reveals Novel Genomic and Functional Features

    Carolina Arias; Ben Weisburd; Noam Stern-Ginossar; Alexandre Mercier; Alexis S Madrid; Priya Bellare; Meghan Holdorf; Jonathan S Weissman; Don Ganem

    2014-01-01

    Productive herpesvirus infection requires a profound, time-controlled remodeling of the viral transcriptome and proteome. To gain insights into the genomic architecture and gene expression control in Kaposi's sarcoma-associated herpesvirus (KSHV), we performed a systematic genome-wide survey of viral transcriptional and translational activity throughout the lytic cycle. Using mRNA-sequencing and ribosome profiling, we found that transcripts encoding lytic genes are promptly bound by ribosomes...

  4. Amino acid sequence and carbohydrate-binding analysis of the N-acetyl-D-galactosamine-specific C-type lectin, CEL-I, from the Holothuroidea, Cucumaria echinata.

    Hatakeyama, Tomomitsu; Matsuo, Noriaki; Shiba, Kouhei; Nishinohara, Shoichi; Yamasaki, Nobuyuki; Sugawara, Hajime; Aoyagi, Haruhiko

    2002-01-01

    CEL-I is one of the Ca2+-dependent lectins that has been isolated from the sea cucumber, Cucumaria echinata. This protein is composed of two identical subunits held by a single disulfide bond. The complete amino acid sequence of CEL-I was determined by sequencing the peptides produced by proteolytic fragmentation of S-pyridylethylated CEL-I. A subunit of CEL-I is composed of 140 amino acid residues. Two intrachain (Cys3-Cys14 and Cys31-Cys135) and one interchain (Cys36) disulfide bonds were also identified from an analysis of the cystine-containing peptides obtained from the intact protein. The similarity between the sequence of CEL-I and that of other C-type lectins was low, while the C-terminal region, including the putative Ca2+ and carbohydrate-binding sites, was relatively well conserved. When the carbohydrate-binding activity was examined by a solid-phase microplate assay, CEL-I showed much higher affinity for N-acetyl-D-galactosamine than for other galactose-related carbohydrates. The association constant of CEL-I for p-nitrophenyl N-acetyl-beta-D-galactosaminide (NP-GalNAc) was determined to be 2.3 x 10(4) M(-1), and the maximum number of bound NP-GalNAc was estimated to be 1.6 by an equilibrium dialysis experiment. PMID:11866098

  5. The complete genome sequence of Natrinema sp. J7-2, a haloarchaeon capable of growth on synthetic media without amino acid supplements.

    Feng, Jie; Liu, Bin; Zhang, Ziqian; Ren, Yan; Li, Yang; Gan, Fei; Huang, Yuping; Chen, Xiangdong; Shen, Ping; Wang, Lei; Tang, Bing; Tang, Xiao-Feng

    2012-01-01

    Natrinema sp. J7-2 is an extreme haloarchaeon capable of growing on synthetic media without amino acid supplements. Here we report the complete genome sequence of Natrinema sp. J7-2 which is composed of a 3,697,626-bp chromosome and a 95,989-bp plasmid pJ7-I. This is the first complete genome sequence of a member of the genus Natrinema. We demonstrate that Natrinema sp. J7-2 can use gluconate, glycerol, or acetate as the sole carbon source and that its genome encodes complete metabolic pathways for assimilating these substrates. The biosynthetic pathways for all 20 amino acids have been reconstructed, and we discuss a possible evolutionary relationship between the haloarchaeal arginine synthetic pathway and the bacterial lysine synthetic pathway. The genome harbors the genes for assimilation of ammonium and nitrite, but not nitrate, and has a denitrification pathway to reduce nitrite to N(2)O. Comparative genomic analysis suggests that most sequenced haloarchaea employ the TrkAH system, rather than the Kdp system, to actively uptake potassium. The genomic analysis also reveals that one of the three CRISPR loci in the Natrinema sp. J7-2 chromosome is located in an integrative genetic element and is probably propagated via horizontal gene transfer (HGT). Finally, our phylogenetic analysis of haloarchaeal genomes provides clues about evolutionary relationships of haloarchaea. PMID:22911826

  6. A comparative study of 2',3'-cyclic-nucleotide 3'-phosphodiesterase in vertebrates: cDNA cloning and amino acid sequences for chicken and bullfrog enzymes.

    Kasama-Yoshida, H; Tohyama, Y; Kurihara, T; Sakuma, M; Kojima, H; Tamai, Y

    1997-10-01

    In mammalian brain, two 2',3'-cyclic-nucleotide 3'-phosphodiesterase (EC 3.1.4.37) isoforms, CNP1 and CNP2, are translated, respectively, from the two mRNAs, which have been transcribed and processed by alternative use of the two transcription start points and by differential splicing. In the present study, the cDNAs encoding chicken CNP2 and bullfrog CNP1, respectively, were isolated, and the amino acid sequences of chicken CNP2 and bullfrog CNP1 were deduced. Western blot analysis showed that chicken brain contains a major CNP2-type protein together with a minor unidentified isoform, and bullfrog brain contains only a CNP1-type protein. All available amino acid sequences of vertebrate 2',3'-cyclic-nucleotide 3'-phosphodiesterases were aligned and compared. Three conserved motif sequences were noted: (a) an ATP-binding site near the amino terminus, (b) an isoprenylation site at the carboxyl terminus, and (c) a probable catalytic site resembling the active site of beta-ketoacyl synthase (EC 2.3.1.41). The second and the third motifs are conserved also in goldfish RICH (regeneration-induced 2',3'-cyclic-nucleotide 3'-phosphodiesterase homologue), which has been shown recently to have 2',3'-cyclic-nucleotide 3'-phosphodiesterase activity. The third motif (probably catalytic site) was assigned for the first time in the present report. PMID:9326261

  7. Comparison of nucleic acid hybridization and nucleic acid amplification using conserved sequences from the 5' noncoding region for detection of bovine viral diarrhea virus.

    Ridpath, J F; Bolin, S R; Katz, J

    1993-01-01

    Primers and probes derived from conserved sequences located in the 5' noncoding region of pestiviruses were evaluated for detection of bovine viral diarrhea virus. With these reagents, hybridization and polymerase chain reaction tests detected 62 of 90 and 90 of 90 bovine viral diarrhea virus isolates, respectively. A quick lysis method for preparing RNA for use in polymerase chain reaction amplification also was evaluated.

  8. Transcriptome sequencing revealed the transcriptional organization at ribosome-mediated attenuation sites in Corynebacterium glutamicum and identified a novel attenuator involved in aromatic amino acid biosynthesis.

    Neshat, Armin; Mentz, Almut; Rückert, Christian; Kalinowski, Jörn

    2014-11-20

    The Gram-positive bacterium Corynebacterium glutamicum belongs to the order Corynebacteriales and is used as a producer of amino acids at industrial scales. Due to its economic importance, gene expression and particularly the regulation of amino acid biosynthesis has been investigated extensively. Applying the high-resolution technique of transcriptome sequencing (RNA-seq), recently a vast amount of data has been generated that was used to comprehensively analyze the C. glutamicum transcriptome. By analyzing RNA-seq data from a small RNA cDNA library of C. glutamicum, short transcripts in the known transcriptional attenuators sites of the trp operon, the ilvBNC operon and the leuA gene were verified. Furthermore, whole transcriptome RNA-seq data were used to elucidate the transcriptional organization of these three amino acid biosynthesis operons. In addition, we discovered and analyzed the novel attenuator aroR, located upstream of the aroF gene (cg1129). The DAHP synthase encoded by aroF catalyzes the first step in aromatic amino acid synthesis. The AroR leader peptide contains the amino acid sequence motif F-Y-F, indicating a regulatory effect by phenylalanine and tyrosine. Analysis by real-time RT-PCR suggests that the attenuator regulates the transcription of aroF in dependence of the cellular amount of tRNA loaded with phenylalanine when comparing a phenylalanine-auxotrophic C. glutamicum mutant fed with limiting and excess amounts of a phenylalanine-containing dipeptide. Additionally, the very interesting finding was made that all analyzed attenuators are leaderless transcripts. PMID:24910972

  9. Unifying bacteria from decaying wood with various ubiquitous Gibbsiella species as G. acetica sp. nov. based on nucleotide sequence similarities and their acetic acid secretion.

    Geider, Klaus; Gernold, Marina; Jock, Susanne; Wensing, Annette; Völksch, Beate; Gross, Jürgen; Spiteller, Dieter

    2015-12-01

    Bacteria were isolated from necrotic apple and pear tree tissue and from dead wood in Germany and Austria as well as from pear tree exudate in China. They were selected for growth at 37 °C, screened for levan production and then characterized as Gram-negative, facultatively anaerobic rods. Nucleotide sequences from 16S rRNA genes, the housekeeping genes dnaJ, gyrB, recA and rpoB alignments, BLAST searches and phenotypic data confirmed by MALDI-TOF analysis showed that these bacteria belong to the genus Gibbsiella and resembled strains isolated from diseased oaks in Britain and Spain. Gibbsiella-specific PCR primers were designed from the proline isomerase and the levansucrase genes. Acid secretion was investigated by screening for halo formation on calcium carbonate agar and the compound identified by NMR as acetic acid. Its production by Gibbsiella spp. strains was also determined in culture supernatants by GC/MS analysis after derivatization with pentafluorobenzyl bromide. Some strains were differentiated by the PFGE patterns of SpeI digests and by sequence analyses of the lsc and the ppiD genes, and the Chinese Gibbsiella strain was most divergent. The newly investigated bacteria as well as Gibbsiella querinecans, Gibbsiella dentisursi and Gibbsiella papilionis, isolated in Britain, Spain, Korea and Japan, are taxonomically related Enterobacteriaceae, tolerate and secrete acetic acid. We therefore propose to unify them in the species Gibbsiella acetica sp. nov. PMID:26071988

  10. Multiplex, Rapid, and Sensitive Isothermal Detection of Nucleic-Acid Sequence by Endonuclease Restriction-Mediated Real-Time Multiple Cross Displacement Amplification

    Wang, Yi; Wang, Yan; Zhang, Lu; Liu, Dongxin; Luo, Lijuan; Li, Hua; Cao, Xiaolong; Liu, Kai; Xu, Jianguo; Ye, Changyun

    2016-01-01

    We have devised a novel isothermal amplification technology, termed endonuclease restriction-mediated real-time multiple cross displacement amplification (ET-MCDA), which facilitated multiplex, rapid, specific and sensitive detection of nucleic-acid sequences at a constant temperature. The ET-MCDA integrated multiple cross displacement amplification strategy, restriction endonuclease cleavage and real-time fluorescence detection technique. In the ET-MCDA system, the functional cross primer E-CP1 or E-CP2 was constructed by adding a short sequence at the 5′ end of CP1 or CP2, respectively, and the new E-CP1 or E-CP2 primer was labeled at the 5′ end with a fluorophore and in the middle with a dark quencher. The restriction endonuclease Nb.BsrDI specifically recognized the short sequence and digested the newly synthesized double-stranded terminal sequences (5′ end short sequences and their complementary sequences), which released the quenching, resulting on a gain of fluorescence signal. Thus, the ET-MCDA allowed real-time detection of single or multiple targets in only a single reaction, and the positive results were observed in as short as 12 min, detecting down to 3.125 fg of genomic DNA per tube. Moreover, the analytical specificity and the practical application of the ET-MCDA were also successfully evaluated in this study. Here, we provided the details on the novel ET-MCDA technique and expounded the basic ET-MCDA amplification mechanism. PMID:27242766

  11. Purification and properties of an O-acetyl-transferase from Escherichia coli that can O-acetylate polysialic acid sequences

    Certain strains of bacteria synthesize an outer polysialic acid (K1) capsule. Some strains of K1+ E.coli are also capable of adding O-acetyl-esters to the exocyclic hydroxyl groups of the sialic acid residues. Both the capsule and the O-acetyl modification have been correlated with differences in antigenicity and pathogenicity. The authors have developed an assay for an O-acetyl-transferase in E.coli that transfers O-[3H]acetyl groups from [3H]acetyl-Coenzyme A to colominic acid (fragments of the polysialic acid capsule). Using this assay, the enzyme was solubilized, and purified ∼ 600-fold using a single affinity chromatography step with Procion Red-A Agarose. The enzyme also binds to Coenzyme A Sepharose, and can be eluted with high salt or Coenzyme A. The partially purified enzyme has a pH optimum of 7.0 - 7.5, is unaffected by divalent cations, is inhibited by high salt concentrations, is inhibited by Coenzyme A (50% inhibition at 100 μM), and shows an apparent Km for colominic acid of 3.7 mM (sialic acid concentration). This enzyme could be involved in the O-acetyl +/- form variation seen in some strains of K1+ E.coli

  12. Amino Acid Sequence Requirements at Residues 69 and 238 for the SME-1 β-Lactamase To Confer Resistance to β-Lactam Antibiotics

    Majiduddin, Fahd K.; Palzkill, Timothy

    2003-01-01

    Carbapenem antibiotics have been used to counteract resistant strains of bacteria harboring β-lactamases and extended-spectrum β-lactamases. Four enzymes from the class A group of β-lactamases, NMC-A, IMI-1, SME-1, and KPC-1, efficiently hydrolyze carbapenem antibiotics. Sequence comparisons and structural information indicate that cysteines at amino acid residues 69 and 238, which are conserved in all four of these enzymes, form a disulfide bond that is unique to these β-lactamases. To test ...

  13. The Bacteriophage Carrier State of Campylobacter jejuni Features Changes in Host Non-coding RNAs and the Acquisition of New Host-derived CRISPR Spacer Sequences

    Hooton, Steven P. T.; Brathwaite, Kelly J.; Connerton, Ian F.

    2016-01-01

    Incorporation of self-derived CRISPR DNA protospacers in Campylobacter jejuni PT14 occurs in the presence of bacteriophages encoding a CRISPR-like Cas4 protein. This phenomenon was evident in carrier state infections where both bacteriophages and host are maintained for seemingly indefinite periods as stable populations following serial passage. Carrier state cultures of C. jejuni PT14 have greater aerotolerance in nutrient limited conditions, and may have arisen as an evolutionary response to selective pressures imposed during periods in the extra-intestinal environment. A consequence of this is that bacteriophage and host remain associated and able to survive transition periods where the chances of replicative success are greatly diminished. The majority of the bacteriophage population do not commit to lytic infection, and conversely the bacterial population tolerates low-level bacteriophage replication. We recently examined the effects of Campylobacter bacteriophage/C. jejuni PT14 CRISPR spacer acquisition using deep sequencing strategies of DNA and RNA-Seq to analyze carrier state cultures. This approach identified de novo spacer acquisition in C. jejuni PT14 associated with Class III Campylobacter phages CP8/CP30A but spacer acquisition was oriented toward the capture of host DNA. In the absence of bacteriophage predation the CRISPR spacers in uninfected C. jejuni PT14 cultures remain unchanged. A distinct preference was observed for incorporation of self-derived protospacers into the third spacer position of the C. jejuni PT14 CRISPR array, with the first and second spacers remaining fixed. RNA-Seq also revealed the variation in the synthesis of non-coding RNAs with the potential to bind bacteriophage genes and/or transcript sequences. PMID:27047470

  14. Draft genome sequence of extremely acidophilic bacterium Acidithiobacillus ferrooxidans DLC-5 isolated from acid mine drainage in Northeast China

    Peng Chen

    2015-12-01

    Full Text Available Acidithiobacillus ferrooxidans type strain DLC-5, isolated from Wudalianchi in Heihe of Heilongjiang Province, China. Here, we present the draft genome of strain DLC-5 which contains 4,232,149 bp in 2745 contigs with 57.628% GC content and includes 32,719 protein-coding genes and 64 tRNA-encoding genes. The genome sequence can be accessed at DDBJ/EMBL/GenBank under the accession no. JNNH00000000.1.

  15. Whole-Exome Sequencing in a South American Cohort Links ALDH1A3, FOXN1 and Retinoic Acid Regulation Pathways to Autism Spectrum Disorders.

    Moreno-Ramos, Oscar A; Olivares, Ana María; Haider, Neena B; de Autismo, Liga Colombiana; Lattig, María Claudia

    2015-01-01

    Autism spectrum disorders (ASDs) are a range of complex neurodevelopmental conditions principally characterized by dysfunctions linked to mental development. Previous studies have shown that there are more than 1000 genes likely involved in ASD, expressed mainly in brain and highly interconnected among them. We applied whole exome sequencing in Colombian-South American trios. Two missense novel SNVs were found in the same child: ALDH1A3 (RefSeq NM_000693: c.1514T>C (p.I505T)) and FOXN1 (RefSeq NM_003593: c.146C>T (p.S49L)). Gene expression studies reveal that Aldh1a3 and Foxn1 are expressed in ~E13.5 mouse embryonic brain, as well as in adult piriform cortex (PC; ~P30). Conserved Retinoic Acid Response Elements (RAREs) upstream of human ALDH1A3 and FOXN1 and in mouse Aldh1a3 and Foxn1 genes were revealed using bioinformatic approximation. Chromatin immunoprecipitation (ChIP) assay using Retinoid Acid Receptor B (Rarb) as the immunoprecipitation target suggests RA regulation of Aldh1a3 and Foxn1 in mice. Our results frame a possible link of RA regulation in brain to ASD etiology, and a feasible non-additive effect of two apparently unrelated variants in ALDH1A3 and FOXN1 recognizing that every result given by next generation sequencing should be cautiously analyzed, as it might be an incidental finding. PMID:26352270

  16. Purification, N-terminal amino acid sequence, and some properties of Cu, Zn-superoxide dismutase from Japanese flounder (Paralichthys olivaceus) hepato-pancreas.

    Osatomi, K; Masuda, Y; Hara, K; Ishihara, T

    2001-04-01

    Cu, Zn-superoxide dismutase (SOD) has been purified to homogeneity from Japanese flounder Paralichthys olivaceus hepato-pancreas. The purification of the enzyme was carried out by an ethanol/chloroform treatment and acetone precipitation, and then followed by column chromatographies on Q-Sepharose, S-Sepharose and Ultrogel AcA 54. On SDS-PAGE, the purified enzyme gave a single protein band with molecular mass of 17.8 kDa under reducing conditions, and showed approximately equal proportions of 17.8 and 36 kDa molecular mass under non-reducing conditions. Three bands were obtained when the purified enzyme was subjected to native-PAGE, both on protein and activity staining, but the electrophoretic mobility of the purified enzyme differed from that of bovine erythrocyte Cu, Zn-SOD. Isoelectric point values of 5.9, 6.0 and 6.2, respectively, were obtained for the three components. The N-terminal amino acid sequence of the purified enzyme was determined for 25 amino acid residues, and the sequence was compared with other Cu, Zn-SODs. The N-terminal alanine residue was unacetylated, as in the case of swordfish SOD. Above 60 degrees C, the thermostability of the enzyme was much lower than that of bovine Cu, Zn-SOD. PMID:11290457

  17. A single amino acid change, Q114R, in the cleavage-site sequence of Newcastle disease virus fusion protein attenuates viral replication and pathogenicity.

    Samal, Sweety; Kumar, Sachin; Khattar, Sunil K; Samal, Siba K

    2011-10-01

    A key determinant of Newcastle disease virus (NDV) virulence is the amino acid sequence at the fusion (F) protein cleavage site. The NDV F protein is synthesized as an inactive precursor, F(0), and is activated by proteolytic cleavage between amino acids 116 and 117 to produce two disulfide-linked subunits, F(1) and F(2). The consensus sequence of the F protein cleavage site of virulent [(112)(R/K)-R-Q-(R/K)-R↓F-I(118)] and avirulent [(112)(G/E)-(K/R)-Q-(G/E)-R↓L-I(118)] strains contains a conserved glutamine residue at position 114. Recently, some NDV strains from Africa and Madagascar were isolated from healthy birds and have been reported to contain five basic residues (R-R-R-K-R↓F-I/V or R-R-R-R-R↓F-I/V) at the F protein cleavage site. In this study, we have evaluated the role of this conserved glutamine residue in the replication and pathogenicity of NDV by using the moderately pathogenic Beaudette C strain and by making Q114R, K115R and I118V mutants of the F protein in this strain. Our results showed that changing the glutamine to a basic arginine residue reduced viral replication and attenuated the pathogenicity of the virus in chickens. The pathogenicity was further reduced when the isoleucine at position 118 was substituted for valine. PMID:21677091

  18. Structural features of the ribonucleotide reductase of Aujeszky's disease virus.

    Kaliman, A V; Boldogköi, Z; Fodor, I

    1994-01-01

    A gene construct of the Aujeszky's disease virus (ADV) genome was prepared and the DNA fragment encoding the ribonucleotide reductase was structurally characterized. We determined the entire DNA sequence of two adjacent open reading frames of the ribonucleotide reductase genes with the intergenic sequence of nine base pairs. From the sequence analysis we predict that Aujeszky's disease virus encodes a ribonucleotide reductase which comprises two polypeptides--large and small subunits, with sizes of 835 and 303 amino acids, respectively. Nucleotide and amino acid sequences of the large and small subunits of the Aujeszky's disease virus ribonucleotide reductase have been compared with that of other herpesviruses, and structural features of both proteins have been characterized. PMID:7810419

  19. Efficacy and Safety of a Hyaluronic Acid Filler to Correct Aesthetically Detracting or Deficient Features of the Asian Nose: A Prospective, Open-Label, Long-Term Study

    Liew, Steven; Scamp, Terrence; de Maio, Mauricio; Halstead, Michael; Johnston, Nicole; Silberberg, Michael; Rogers, John D.

    2016-01-01

    Background There is increasing interest among patients and plastic surgeons for alternatives to rhinoplasty, a common surgical procedure performed in Asia. Objectives To evaluate the safety, efficacy, and longevity of a hyaluronic acid filler in the correction of aesthetically detracting or deficient features of the Asian nose. Methods Twenty-nine carefully screened Asian patients had their noses corrected with the study filler (Juvéderm VOLUMA [Allergan plc, Dublin, Ireland] with lidocaine injectable gel), reflecting individualized treatment goals and utilizing a standardized injection procedure, and were followed for over 12 months. Results A clinically meaningful correction (≥1 grade improvement on the Assessment of Aesthetic Improvement Scale) was achieved in 27 (93.1%) patients at the first follow-up visit. This was maintained in 28 (96.6%) patients at the final visit, based on the independent assessments of a central non-injecting physician and the patients. At this final visit, 23 (79.3%) patients were satisfied or very satisfied with the study filler and 25 (86.2%) would recommend it to others. In this small series of patients, there were no serious adverse events (AEs), with all treatment-related AEs being mild to moderate, transient injection site reactions, unrelated to the study filler. Conclusions Using specific eligibility criteria, individualized treatment goals, and a standardized injection procedure, the study filler corrected aesthetically detracting or deficient features of the Asian nose, with the therapeutic effects lasting for over 12 months, consistent with a high degree of patient satisfaction. This study supports the safety and efficacy of this HA filler for specific nose augmentation procedures in selected Asian patients. Level of Evidence: 3 Therapeutic PMID:27301371

  20. CSTX-9, a toxic peptide from the spider Cupiennius salei: amino acid sequence, disulphide bridge pattern and comparison with other spider toxins containing the cystine knot structure.

    Schalle, J; Kämpfer, U; Schürch, S; Kuhn-Nentwig, L; Haeberli, S; Nentwig, W

    2001-09-01

    CSTX-9 (68 residues, 7530.9 Da) is one of the most abundant toxic polypeptides in the venom of the wandering spider Cupiennius salei. The amino acid sequence was determined by Edman degradation using reduced and alkylated CSTX-9 and peptides generated by cleavages with endoproteinase Asp-N and trypsin, respectively. Sequence comparison with CSTX-1, the most abundant and the most toxic polypeptide in the crude spider venom, revealed a high degree of similarity (53% identity). By means of limited proteolysis with immobilised trypsin and RP-HPLC, the cystine-containing peptides of CSTX-9 were isolated and the disulphide bridges were assigned by amino acid analysis, Edman degradation and nanospray tandem mass spectrometry. The four disulphide bonds present in CSTX-9 are arranged in the following pattern: 1-4, 2-5, 3-8 and 6-7 (Cys6-Cys21, Cys13-Cys30, Cys20-Cys48, Cys32-Cys46). Sequence comparison of CSTX-1 with CSTX-9 clearly indicates the same disulphide bridge pattern, which is also found in other spider polypeptide toxins, e.g. agatoxins (omega-AGA-IVA, omega-AGA-IVB, mu-AGA-I and mu-AGA-VI) from Agelenopsis aperta, SNX-325 from Segestria florentina and curtatoxins (CT-I, CT-II and CT-III) from Hololena curta. CSTX-1/CSTX-9 belong to the family of ion channel toxins containing the inhibitor cystine knot structural motif. CSTX-9, lacking the lysine-rich C-terminal tail of CSTX-1, exhibits a ninefold lower toxicity to Drosophila melanogaster than CSTX-1. This is in accordance with previous observations of CSTX-2a and CSTX-2b, two truncated forms of CSTX-1 which, like CSTX-9, also lack the C-terminal lysine-rich tail. PMID:11693532

  1. Complete genome sequence of Lactobacillus paracasei L9, a new probiotic strain with high lactic acid-producing capacity.

    Jiang, Yunyun; Li, Zhuanyu; Ren, Fazheng; Liu, Songling; Zhao, Liang; Sun, Erna; Zhang, Ming; Guo, Huiyuan; Zhang, Hao; Jiang, Lu; Hou, Caiyun

    2015-12-20

    Lactobaillus paracasei L9 (CGMCC No. 9800) is a new strain with probiotic properties originating from healthy human intestine. Previous studies evidenced that the strain regulates immune modulation and contributes to the production of high amounts of lactic acid. The genome of L. paracasei L9 contains a circular 3076,437-bp chromosome, encoding 3044 CDSs, 15 rRNA genes and 59 tRNA genes. PMID:26415658

  2. In vivo relevant mixed urolithins and ellagic acid inhibit phenotypic and molecular colon cancer stem cell features: A new potentiality for ellagitannin metabolites against cancer.

    Núñez-Sánchez, María Ángeles; Karmokar, Ankur; González-Sarrías, Antonio; García-Villalba, Rocío; Tomás-Barberán, Francisco A; García-Conesa, María Teresa; Brown, Karen; Espín, Juan Carlos

    2016-06-01

    Colon cancer stem cells (CSCs) offer a novel paradigm for colorectal cancer (CRC) treatment and dietary polyphenols may contribute to battle these cells. Specifically, polyphenol-derived colon metabolites have the potential to interact with and affect colon CSCs. We herein report the effects against colon CSCs of two mixtures of ellagitannin (ET) metabolites, ellagic acid (EA) and the gut microbiota-derived urolithins (Uro) at concentrations detected in the human colon tissues following the intake of ET-containing products (pomegranate, walnuts). These mixtures reduce phenotypic and molecular features in two models of colon CSCs: Caco-2 cells and primary tumour cells from a patient with CRC. The mixture containing mostly Uro-A (85% Uro-A, 10% Uro-C, 5% EA) was most effective at inhibiting the number and size of colonospheres and aldehyde dehydrogenase activity (ALDH, a marker of chemoresistance) whereas the mixture containing less Uro-A but IsoUro-A and Uro-B (30% Uro-A, 50% IsoUro-A, 10% Uro-B, 5% Uro-C, 5% EA) had some effects on the number and size of colonospheres but not on ALDH. These data support a role for polyphenols metabolites in the control of colon cancer chemoresistance and relapse and encourage the research on the effects of polyphenols against CSCs. PMID:26995228

  3. cDNA and deduced amino acid sequence of human pulmonary surfactant-associated proteolipid SPL(Phe).

    Glasser, S W; Korfhagen, T R; Weaver, T.; Pilot-Matias, T; Fox, J L; Whitsett, J A

    1987-01-01

    Hydrophobic surfactant-associated protein of Mr 6000-14,000 was isolated from ether/ethanol or chloroform/methanol extracts of mammalian pulmonary surfactant. Automated Edman degradation in a gas-phase sequencer showed the major N-terminus of the human low molecular weight protein to be Phe-Pro-Ile-Pro-Leu-Pro-Tyr-Cys-Trp-Leu-Cys-Arg-Ala-Leu-. Because of the N-terminal phenylalanine, the surfactant protein was designated SPL(Phe). Antiserum generated against hydrophobic surfactant protein(s) ...

  4. Prediction of protein-protein interactions from amino acid sequences using a novel multi-scale continuous and discontinuous feature set

    You, Zhu-Hong; Zhu, Lin; Zheng, Chun-Hou; Yu, Hong-Jie; Deng, Su-Ping; Ji, Zhen

    2014-01-01

    Background Identifying protein-protein interactions (PPIs) is essential for elucidating protein functions and understanding the molecular mechanisms inside the cell. However, the experimental methods for detecting PPIs are both time-consuming and expensive. Therefore, computational prediction of protein interactions are becoming increasingly popular, which can provide an inexpensive way of predicting the most likely set of interactions at the entire proteome scale, and can be used to compleme...

  5. 编码序列和非编码序列的3-tuple分布特征%Features of Coding and Noncoding Sequences Based on 3-tuple Distributions

    傅强; 钱敏平; 陈良标; 朱玉贤

    2005-01-01

    reaches 2/100. The fact that ( a total of 25 introns) from all three different genomes S. pombe, C. elegans and H. sapiens searched are found to share high sequence identity with coding regions indicates that at least some introns may have come directly from CDS(coding sequences). We suggest that SREs may be a useful feature for evolutionary study.

  6. Identification of functionally important amino acid residues in the mitochondria targeting sequence of Hepatitis B virus X protein

    Chronic hepatitis B virus (HBV) infection has been strongly associated with hepatocellular carcinoma (HCC) and the X protein (HBx) is thought to mediate the cellular changes associated with carcinogenesis. Recently, isolation of the hepatitis B virus integrants from HCC tissue by others have established the fact that the X gene is often truncated at its C-terminus. Expression of the GFP fusion proteins of HBx and its truncation mutants with a GFP tag in human liver cell-lines in this study revealed that the C-terminus of HBx is indispensable for its specific localization in the mitochondria. A crucial region of seven amino acids at the C-terminus has been mapped out in which the cysteine residue at position 115 serves as the most important residue for the subcellular localization. When cysteine 115 of HBx is mutated to alanine the mitochondria targeting property of HBx is abrogated

  7. High performance liquid chromatography purification and amino acid sequence of toxins from the muscarinic fraction of Tityus discrepans scorpion venom.

    D'Suze, G; Corona, F; Possani, L D; Sevcik, C

    1996-05-01

    Tityus discrepans venom was fractionated by gel filtration on Sephadex G-50 column. The peptides in fraction II from Sephadex were further purified by high performance liquid chromatography, through a C4 reverse-phase column. Lethality of purified peptides was determined by injection into mice and crabs, and their effects were verified electrophysiologically on frog (Hyla crepitans) sartorius neuromuscular junction. Toxins having retention times between 39.6 and 40.7 min depolarized the muscle membrane and caused acetylcholine release at the endplate. The toxin eluted at 42.67 min increased the frequency of miniature endplate potentials without depolarizing muscle fibres. The four most active toxins were reduced, carboxymethylated and sequenced by automatic Edman degradation and named TdII-1 to II-4. Toxin gamma from Tityus serrulatus venom and the toxins from T. discrepans venom were found to be structurally distinct. TdII-1 to II-4 lack the pancreatic effects of T. serrulatus' toxin gamma; yet, the five toxins act on Na+ channels. PMID:8783453

  8. RNA Sequencing Identifies Upregulated Kyphoscoliosis Peptidase and Phosphatidic Acid Signaling Pathways in Muscle Hypertrophy Generated by Transgenic Expression of Myostatin Propeptide

    Yuanxin Miao

    2015-04-01

    Full Text Available Myostatin (MSTN, a member of the transforming growth factor-β superfamily, plays a crucial negative role in muscle growth. MSTN mutations or inhibitions can dramatically increase muscle mass in most mammal species. Previously, we generated a transgenic mouse model of muscle hypertrophy via the transgenic expression of the MSTN N-terminal propeptide cDNA under the control of the skeletal muscle-specific MLC1 promoter. Here, we compare the mRNA profiles between transgenic mice and wild-type littermate controls with a high-throughput RNA sequencing method. The results show that 132 genes were significantly differentially expressed between transgenic mice and wild-type control mice; 97 of these genes were up-regulated, and 35 genes were down-regulated in the skeletal muscle. Several genes that had not been reported to be involved in muscle hypertrophy were identified, including up-regulated myosin binding protein H (mybph, and zinc metallopeptidase STE24 (Zmpste24. In addition, kyphoscoliosis peptidase (Ky, which plays a vital role in muscle growth, was also up-regulated in the transgenic mice. Interestingly, a pathway analysis based on grouping the differentially expressed genes uncovered that cardiomyopathy-related pathways and phosphatidic acid (PA pathways (Dgki, Dgkz, Plcd4 were up-regulated. Increased PA signaling may increase mTOR signaling, resulting in skeletal muscle growth. The findings of the RNA sequencing analysis help to understand the molecular mechanisms of muscle hypertrophy caused by MSTN inhibition.

  9. RNA sequencing identifies upregulated kyphoscoliosis peptidase and phosphatidic acid signaling pathways in muscle hypertrophy generated by transgenic expression of myostatin propeptide.

    Miao, Yuanxin; Yang, Jinzeng; Xu, Zhong; Jing, Lu; Zhao, Shuhong; Li, Xinyun

    2015-01-01

    Myostatin (MSTN), a member of the transforming growth factor-β superfamily, plays a crucial negative role in muscle growth. MSTN mutations or inhibitions can dramatically increase muscle mass in most mammal species. Previously, we generated a transgenic mouse model of muscle hypertrophy via the transgenic expression of the MSTN N-terminal propeptide cDNA under the control of the skeletal muscle-specific MLC1 promoter. Here, we compare the mRNA profiles between transgenic mice and wild-type littermate controls with a high-throughput RNA sequencing method. The results show that 132 genes were significantly differentially expressed between transgenic mice and wild-type control mice; 97 of these genes were up-regulated, and 35 genes were down-regulated in the skeletal muscle. Several genes that had not been reported to be involved in muscle hypertrophy were identified, including up-regulated myosin binding protein H (mybph), and zinc metallopeptidase STE24 (Zmpste24). In addition, kyphoscoliosis peptidase (Ky), which plays a vital role in muscle growth, was also up-regulated in the transgenic mice. Interestingly, a pathway analysis based on grouping the differentially expressed genes uncovered that cardiomyopathy-related pathways and phosphatidic acid (PA) pathways (Dgki, Dgkz, Plcd4) were up-regulated. Increased PA signaling may increase mTOR signaling, resulting in skeletal muscle growth. The findings of the RNA sequencing analysis help to understand the molecular mechanisms of muscle hypertrophy caused by MSTN inhibition. PMID:25860951

  10. Uses of Phage Display in Agriculture: Sequence Analysis and Comparative Modeling of Late Embryogenesis Abundant Client Proteins Suggest Protein-Nucleic Acid Binding Functionality

    Rekha Kushwaha

    2013-01-01

    Full Text Available A group of intrinsically disordered, hydrophilic proteins—Late Embryogenesis Abundant (LEA proteins—has been linked to survival in plants and animals in periods of stress, putatively through safeguarding enzymatic function and prevention of aggregation in times of dehydration/heat. Yet despite decades of effort, the molecular-level mechanisms defining this protective function remain unknown. A recent effort to understand LEA functionality began with the unique application of phage display, wherein phage display and biopanning over recombinant Seed Maturation Protein homologs from Arabidopsis thaliana and Glycine max were used to retrieve client proteins at two different temperatures, with one intended to represent heat stress. From this previous study, we identified 21 client proteins for which clones were recovered, sometimes repeatedly. Here, we use sequence analysis and homology modeling of the client proteins to ascertain common sequence and structural properties that may contribute to binding affinity with the protective LEA protein. Our methods uncover what appears to be a predilection for protein-nucleic acid interactions among LEA client proteins, which is suggestive of subcellular residence. The results from this initial computational study will guide future efforts to uncover the protein protective mechanisms during heat stress, potentially leading to phage-display-directed evolution of synthetic LEA molecules.

  11. Evaluation of crop residues on potassium kinetics in an acid soil and potassium use efficiency in potato-garlic sequence using tracer 86Rb

    Greenhouse and laboratory studies were conducted on an acid soil in order to evaluate the role of two crop residues i.e. paddy and wheat along with farmyard manure on potassium kinetics and its availability in the potato-garlic sequence using tracer 86Rb. Under rapid equilibrium, application of crop residues of paddy, wheat straw and FYM were able to enhance soil pH and organic carbon content. In addition, their application helped in enhancing soil K availability indices like water soluble, available and non-exchangeable -K. This was further augmented by the Q/I studies using 86Rb where application of organic residues helped in lowering the potassium buffering capacity of the soil. Greenhouse study supplemented the results obtained from laboratory study where application of crop residues/FYM were able to improve the potato yield significantly and maintained higher concentration of K in potato leaf at early growth stages. A significant correlation was obtained between leaf K and haulms-K with that of 86Rb activities in potato leaf at 35 days and 86Rb absorbed in the haulms, respectively. Residues/ FYM and PK application to potato left sufficient residual effect on succeeding garlic crop. In potato-garlic sequence, K recovery was highest with FYM while N and P recoveries were higher with wheat residues. The nutrient recoveries with PK application followed law of diminishing returns. (author)

  12. Biochemical characterization of NfsA, the Escherichia coli major nitroreductase exhibiting a high amino acid sequence homology to Frp, a Vibrio harveyi flavin oxidoreductase.

    Zenno, S; Koike, H; Kumar, A N; Jayaraman, R; Tanokura, M; Saigo, K

    1996-01-01

    We identified the nfsA gene, encoding the major oxygen-insensitive nitroreductase in Escherichia coli, and determined its position on the E. coli map to be 19 min. We also purified its gene product, NfsA, to homogeneity. It was suggested that NfsA is a nonglobular protein with a molecular weight of 26,799 and is associated tightly with a flavin mononucleotide. Its amino acid sequence is highly similar to that of Frp, a flavin oxidoreductase from Vibrio harveyi (B. Lei, M. Liu, S. Huang, and S.-C. Tu, J. Bacteriol. 176:3552-3558, 1994), an observation supporting the notion that E. coli nitroreductase and luminescent-bacterium flavin reductase families are intimately related in evolution. Although no appreciable sequence similarity was detected between two E. coli nitroreductases, NfsA and NfsB, NfsA exhibited a low level of the flavin reductase activity and a broad electron acceptor specificity similar to those of NfsB. NfsA reduced nitrofurazone by a ping-pong Bi-Bi mechanism possibly to generate a two-electron transfer product. PMID:8755878

  13. Identification and sequence analysis of pWcMBF8-1, a bacteriocin-encoding plasmid from the lactic acid bacterium Weissella confusa.

    Malik, Amarila; Sumayyah, Sumayyah; Yeh, Chia-Wen; Heng, Nicholas C K

    2016-04-01

    Members of the Gram-positive lactic acid bacteria (LAB) are well-known for their beneficial properties as starter cultures and probiotics. Many LAB species produce ribosomally synthesized proteinaceous antibiotics (bacteriocins). Weissella confusa MBF8-1 is a strain isolated from a fermented soybean product that not only produces useful exopolysaccharides but also exhibits bacteriocin activity, which we call weissellicin MBF. Here, we show that bacteriocin production by W. confusa MBF8-1 is specified by a large plasmid, pWcMBF8-1. Plasmid pWcMBF8-1 (GenBank accession number KR350502), which was identified from the W. confusa MBF8-1 draft genome sequence, is 17 643 bp in length with a G + C content of 34.8% and contains 25 open reading frames (ORFs). Six ORFs constitute the weissellicin MBF locus, encoding three putative double-glycine-motif peptides (Bac1, Bac2, Bac3), an ABC transporter complex (BacTE) and a putative immunity protein (BacI). Two ORFs encode plasmid partitioning and mobilization proteins, suggesting that pWcMBF8-1 is transferable to other hosts. To the best of our knowledge, plasmid pWcMBF8-1 not only represents the first large Weissella plasmid to be sequenced but also the first to be associated with bacteriocin production in W. confusa. PMID:26976853

  14. Understanding Legacy Features with Featureous

    Olszak, Andrzej; Jørgensen, Bo Nørregaard

    2011-01-01

    Java programs called Featureous that addresses this issue. Featureous allows a programmer to easily establish feature-code traceability links and to analyze their characteristics using a number of visualizations. Featureous is an extension to the NetBeans IDE, and can itself be extended by third...

  15. Amino acid sequence requirements in the hinge of human immunoglobulin A1 (IgA1) for cleavage by streptococcal IgA1 proteases

    Batten, MR; Senior, BW; Kilian, Mogens;

    2003-01-01

    effect upon sensitivity to cleavage with some streptococcal IgA1 proteases, with, in some cases, a single point mutation rendering the antibody resistant to a particular IgA1 protease. This effect was least marked with the IgA1 protease from Streptococcus pneumoniae, which showed no absolute requirement......The amino acid sequence requirements in the hinge of human immunoglobulin A1 (IgA1) for cleavage by IgA1 proteases of different species of Streptococcus were investigated. Recombinant IgA1 antibodies were generated with point mutations at proline 227 and threonine 228, the residues lying on either...... side of the peptide bond at which all streptococcal IgA1 proteases cleave wild-type human IgA1. The amino acid substitutions produced no major effect upon the structure of the mutant IgA1 antibodies or their functional ability to bind to Fcalpha receptors. However, the substitutions had a substantial...

  16. FASMA: A Service to Format and Analyze Sequences in Multiple Alignments

    Susan; Costantini; Giovanni; Colonna; Angelo; M.; Facchiano

    2007-01-01

    Multiple sequence alignments are successfully applied in many studies for under- standing the structural and functional relations among single nucleic acids and pro- tein sequences as well as whole families. Because of the rapid growth of sequence databases, multiple sequence alignments can often be very large and difficult to visualize and analyze. We offer a new service aimed to visualize and analyze the multiple alignments obtained with different external algorithms, with new features useful for the comparison of the aligned sequences as well as for the creation of a final image of the alignment. The service is named FASMA and is available at http: //bioinformatica.isa.cnr.it /FASMA /.

  17. cDNA and deduced amino acid sequence of human pulmonary surfactant-associated proteolipid SPL(Phe)

    Hydrophobic surfactant-associated protein of M/sub r/ 6000-14,000 was isolated from either/ethanol or chloroform/methanol extracts of mammalian pulmonary surfactant. Automated Edman degradation in a gas-phase sequencer showed the major N-terminus of the human low molecular weight protein to be Phe-Pro-Ile-Pro-Leu-Pro-Try-Cys-Trp-Leu-Cys-Arg-Ala-Leu-. Because of the N-terminal phenylalanine, the surfactant protein was designated SPL(Phe). Antiserum generated against hydrophobic surfactant protein(s) from bovine pulmonary surfactant recognized protein of M/sub r/ 6000-14,000 in immunoblot analysis and was used to screen a λgt11 expression library constructed from adult human lung poly(A)+ RNA. This resulted in identification of a 1.4-kilobase cDNA clone that was shown to encode the N-terminus of the surfactant polypeptide SPL(Phe) (Phe-Pro-Ile-Pro-Leu-Pro-) within an open reading frame for a larger protein. Expression of a fused β-galactosidase-SPL (Phe) gene in Escherichia coli yielded an immunoreactive M/sub r/ 34,000 fusion peptide. Hybrid-arrested translation with the cDNA and immunoprecipitation of [35S]methionine-labeled in vitro translation products of human poly(A)+ RNA with a surfactant polyclonal antibody resulted in identification of a M/sub r/ 40,000 precursor protein. Blot hybridization analysis of electrophoretically fractionated RNA from human lung detected a 2.0-kilobase RNA that was more abundant in adult lung than in fetal lung. These proteins, and specifically SPL(Phe), may therefore be useful for synthesis of replacement surfactants for treatment of hyaline membrane disease in newborn infants or of other surfactant-deficient states

  18. cDNA and deduced amino acid sequence of human pulmonary surfactant-associated proteolipid SPL(Phe)

    Glasser, S.W.; Korfhagen, T.R.; Weaver, T.; Pilot-Matias, T.; Fox, J.L.; Whitsett, J.A.

    1987-06-01

    Hydrophobic surfactant-associated protein of M/sub r/ 6000-14,000 was isolated from either/ethanol or chloroform/methanol extracts of mammalian pulmonary surfactant. Automated Edman degradation in a gas-phase sequencer showed the major N-terminus of the human low molecular weight protein to be Phe-Pro-Ile-Pro-Leu-Pro-Try-Cys-Trp-Leu-Cys-Arg-Ala-Leu-. Because of the N-terminal phenylalanine, the surfactant protein was designated SPL(Phe). Antiserum generated against hydrophobic surfactant protein(s) from bovine pulmonary surfactant recognized protein of M/sub r/ 6000-14,000 in immunoblot analysis and was used to screen a lambdagt11 expression library constructed from adult human lung poly(A)/sup +/ RNA. This resulted in identification of a 1.4-kilobase cDNA clone that was shown to encode the N-terminus of the surfactant polypeptide SPL(Phe) (Phe-Pro-Ile-Pro-Leu-Pro-) within an open reading frame for a larger protein. Expression of a fused ..beta..-galactosidase-SPL (Phe) gene in Escherichia coli yielded an immunoreactive M/sub r/ 34,000 fusion peptide. Hybrid-arrested translation with the cDNA and immunoprecipitation of (/sup 35/S)methionine-labeled in vitro translation products of human poly(A)/sup +/ RNA with a surfactant polyclonal antibody resulted in identification of a M/sub r/ 40,000 precursor protein. Blot hybridization analysis of electrophoretically fractionated RNA from human lung detected a 2.0-kilobase RNA that was more abundant in adult lung than in fetal lung. These proteins, and specifically SPL(Phe), may therefore be useful for synthesis of replacement surfactants for treatment of hyaline membrane disease in newborn infants or of other surfactant-deficient states.

  19. Amino acid sequence requirements in the hinge of human immunoglobulin A1 (IgA1) for cleavage by streptococcal IgA1 proteases.

    Batten, Margaret R; Senior, Bernard W; Kilian, Mogens; Woof, Jenny M

    2003-03-01

    The amino acid sequence requirements in the hinge of human immunoglobulin A1 (IgA1) for cleavage by IgA1 proteases of different species of Streptococcus were investigated. Recombinant IgA1 antibodies were generated with point mutations at proline 227 and threonine 228, the residues lying on either side of the peptide bond at which all streptococcal IgA1 proteases cleave wild-type human IgA1. The amino acid substitutions produced no major effect upon the structure of the mutant IgA1 antibodies or their functional ability to bind to Fcalpha receptors. However, the substitutions had a substantial effect upon sensitivity to cleavage with some streptococcal IgA1 proteases, with, in some cases, a single point mutation rendering the antibody resistant to a particular IgA1 protease. This effect was least marked with the IgA1 protease from Streptococcus pneumoniae, which showed no absolute requirement for either proline or threonine at residues 227 to 228. By contrast, the IgA1 proteases of Streptococcus oralis, Streptococcus sanguis, and Streptococcus mitis had an absolute requirement for proline at 227 but not for threonine at 228, which could be replaced by valine. There was evidence in S. mitis that proteases from different strains may have different amino acid requirements for cleavage. Remarkably, some streptococcal proteases appeared able to cleave the hinge at a distant alternative site if substitution prevented efficient cleavage of the original site. Hence, this study has identified key residues required for the recognition of the IgA1 hinge as a substrate by streptococcal IgA1 proteases, and it marks a preliminary step towards development of specific enzyme inhibitors. PMID:12595464

  20. Clinical Features of Hepatocellular Carcinoma and Observation on the Images of MRI Sequence Scanning%肝细胞肝癌临床特征及MRI各序列扫描的图像观察

    孙永华; 陈江; 梁志刚; 腾云

    2016-01-01

    Objective To analyze the clinical features of hepatocellular carcinoma and to evaluate the characteristics of images and diagnostic value of MRI sequence scanning in hepatocellular carcinoma.Methods The clinical data of 46 patients with hepatocellular carcinoma treated in our hospital from April 2013 to April 2015 were analyzed retrospectively. After admission, all patients underwent MRI three phase scan and examination and the imaging data were complete. The clinical features of hepatocellular carcinoma and the application value of MRI in clinical diagnosis were summarized.Results There were 50 lesions in 46 patients with hepatocellular carcinoma, including 23 highly differentiated lesions, 13 moderately differentiated lesions and 14 poorly differentiated lesions; 30 lesions were located in the right lobe of liver and 20 in the left lobe of the liver; T1WI sequence scan showed 36 slightly lower signal, 8 equal signal and 6 slightly higher signal; T2WI sequence showed 44 slightly higher signal, including 4 of the lesions showed higher signal and 6 lesions showed equal signal; DWI sequence showed 30 higher signal, 15 slightly higher signal and 5 equal signal.Conclusion MRI sequence scan has its own advantages in showing the size, internal structure, edge and blood supply of hepatocellular carcinoma lesions. It is of important value in determination of the differentiation degree of hepatocellular carcinoma tissues. It can also show the characteristics of lesion enhancement and micro-morphological characteristics and provide reference for the treatment and prognosis.%目的 分析肝细胞肝癌的临床特征,评估MRI各序列扫描肝细胞肝癌的图像特点及诊断价值.方法 回顾性分析我院自2013年4月-2015年4月收治的46例肝细胞肝癌患者的临床资料,所有患者入院后均接受MRI三期扫描与检查,且影像学资料完整,总结肝细胞肝癌临床特点及MRI在其临床诊断中的应用价值.结果 46

  1. Absence in Bacillus subtilis and Staphylococcus aureus of the sequence-specific deoxyribonucleic acid methylation that is conferred in Escherichia coli K-12 by the dam and dcm enzymes.

    Dreiseikelmann, Brigitte; Wackernagel, Wilfried

    1981-01-01

    Restriction analysis of plasmid pHV14 deoxyribonucleic acid isolated from Escherichia coli K-12, Bacillus subtilis, and Staphylococcus aureus with restriction endonucleases MboI, Sau3AI, and EcoRII was used to study the methylation of those nucleotide sequences which in E. coli contain the major portions of N6-methyladenine and 5-methylcytosine. The results showed that neither B. subtilis nor S. aureus methylates deoxyribonucleic acid at the same sites and nucleotides which are recognized and...

  2. The Chaotic Structure of Bacterial Virulence Protein Sequences

    Sevdanur Genc

    2015-01-01

    Full Text Available Bacterial virulence proteins, which have been class ified on structure of virulence, causes several diseases. For instance, Adhesins play an important role in th e host cells. They are inserted DNA sequences for a variety of virulence properties. Several important methods conducted for the prediction of bacterial virulence proteins for finding new drugs or vaccines. In this study, we propose a method for feature sele ction about classification of bacterial virulence protein. The features are constituted dir ectly from the amino acid sequence of a given protein. Amino acids form proteins, which are criti cal to life, and have many important functions in living cells. They occurring with diff erent physicochemical properties by a vector of 20 numerical values, and collected in AAIndex datab ases of known 544 indices. For all that, this approach have two steps. Firstly , the amino acid sequence of a given protein analysed with Lyapunov Exponents that they have a chaotic structure in accordance wi th the chaos theory. After that, if the results show chara cterization over the complete distribution in the phase space from the point of deterministic sys tem, it means related protein will show a chaotic structure. Empirical results revealed that generated feature v ectors give the best performance with chaotic structure of physicochemical features of amino acid s with Adhesins and non-Adhesins data sets.

  3. Sequence ID and annotation information - Gclust Server | LSDB Archive [Life Science Database Archive metadata

    Full Text Available Number of data entries - Data item Description Field 1 ID of amino acid sequence (Sequence ID) Field... 2 Length of amino acid sequence Field 3 Annotation of amino acid sequence Joomla SEF URL

  4. Improving the classification of nuclear receptors with feature selection.

    Gao, Qing-Bin; Jin, Zhi-Chao; Ye, Xiao-Fei; Wu, Cheng; Lu, Jian; He, Jia

    2009-01-01

    Nuclear receptors are involved in multiple cellular signaling pathways that affect and regulate processes. Because of their physiology and pathophysiology significance, classification of nuclear receptors is essential for the proper understanding of their functions. Bhasin and Raghava have shown that the subfamilies of nuclear receptors are closely correlated with their amino acid composition and dipeptide composition [29]. They characterized each protein by a 400 dimensional feature vector. However, using high dimensional feature vectors for characterization of protein sequences will increase the computational cost as well as the risk of overfitting. Therefore, using only those features that are most relevant to the present task might improve the prediction system, and might also provide us with some biologically useful knowledge. In this paper a feature selection approach was proposed to identify relevant features and a prediction engine of support vector machines was developed to estimate the prediction accuracy of classification using the selected features. A reduced subset containing 30 features was accepted to characterize the protein sequences in view of its good discriminative power towards the classes, in which 18 are of amino acid composition and 12 are of dipeptide composition. This reduced feature subset resulted in an overall accuracy of 98.9% in a 5-fold cross-validation test, higher than 88.7% of amino acid composition based method and almost as high as 99.3% of dipeptide composition based method. Moreover, an overall accuracy of 93.7% was reached when it was evaluated on a blind data set of 63 nuclear receptors. On the other hand, an overall accuracy of 96.1% and 95.2% based on the reduced 12 dipeptide compositions was observed simultaneously in the 5-fold cross-validation test and the blind data set test, respectively. These results demonstrate the effectiveness of the present method. PMID:19601913

  5. Specific features complexation of copper(2), manganese(2) and gadolinium(3) with salicylic, benzoic and sulfosalicylic acids in aqueous solutions of nonionic surfactant

    Impact of nonionic surfactant Triton-X-100 (TX) on acid-basic and complex-forming properties of benzoic (HR) and sulfosalicylic (H3X) acids is studied through the pH-metric titration and NMR-relaxation methods. The H3X acidic properties in water and in the H surfactant solution are practically similar. Significant increase in the proton relaxation rate values is observed in the solutions of the salicylic acid and TX mixtures by ions presence. The complexes of the [Gd(HL)3(TX)2] composition with lgK 0.22±0.05 are established for the Gd(3). The benzoic acid forms ternary particles in presence of Gadolinium(3): [GdR(TX)] with lgK = 2.17±0.04

  6. Amino Acid Residues in the GIY-YIG Endonuclease II of Phage T4 Affecting Sequence Recognition and Binding as Well as Catalysis▿ †

    Lagerbäck, Pernilla; Carlson, Karin

    2008-01-01

    Phage T4 endonuclease II (EndoII), a GIY-YIG endonuclease lacking a carboxy-terminal DNA-binding domain, was subjected to site-directed mutagenesis to investigate roles of individual amino acids in substrate recognition, binding, and catalysis. The structure of EndoII was modeled on that of UvrC. We found catalytic roles for residues in the putative catalytic surface (G49, R57, E118, and N130) similar to those described for I-TevI and UvrC; in addition, these residues were found to be important for substrate recognition and binding. The conserved glycine (G49) and arginine (R57) were essential for normal sequence recognition. Our results are in agreement with a role for these residues in forming the DNA-binding surface and exposing the substrate scissile bond at the active site. The conserved asparagine (N130) and an adjacent proline (P127) likely contribute to positioning the catalytic domain correctly. Enzymes in the EndoII subfamily of GIY-YIG endonucleases share a strongly conserved middle region (MR, residues 72 to 93, likely helical and possibly substituting for heterologous helices in I-TevI and UvrC) and a less strongly conserved N-terminal region (residues 12 to 24). Most of the conserved residues in these two regions appeared to contribute to binding strength without affecting the mode of substrate binding at the catalytic surface. EndoII K76, part of a conserved NUMOD3 DNA-binding motif of homing endonucleases found to overlap the MR, affected both sequence recognition and catalysis, suggesting a more direct involvement in positioning the substrate. Our data thus suggest roles for the MR and residues conserved in GIY-YIG enzymes in recognizing and binding the substrate. PMID:18539732

  7. Amino acid residues in the GIY-YIG endonuclease II of phage T4 affecting sequence recognition and binding as well as catalysis.

    Lagerbäck, Pernilla; Carlson, Karin

    2008-08-01

    Phage T4 endonuclease II (EndoII), a GIY-YIG endonuclease lacking a carboxy-terminal DNA-binding domain, was subjected to site-directed mutagenesis to investigate roles of individual amino acids in substrate recognition, binding, and catalysis. The structure of EndoII was modeled on that of UvrC. We found catalytic roles for residues in the putative catalytic surface (G49, R57, E118, and N130) similar to those described for I-TevI and UvrC; in addition, these residues were found to be important for substrate recognition and binding. The conserved glycine (G49) and arginine (R57) were essential for normal sequence recognition. Our results are in agreement with a role for these residues in forming the DNA-binding surface and exposing the substrate scissile bond at the active site. The conserved asparagine (N130) and an adjacent proline (P127) likely contribute to positioning the catalytic domain correctly. Enzymes in the EndoII subfamily of GIY-YIG endonucleases share a strongly conserved middle region (MR, residues 72 to 93, likely helical and possibly substituting for heterologous helices in I-TevI and UvrC) and a less strongly conserved N-terminal region (residues 12 to 24). Most of the conserved residues in these two regions appeared to contribute to binding strength without affecting the mode of substrate binding at the catalytic surface. EndoII K76, part of a conserved NUMOD3 DNA-binding motif of homing endonucleases found to overlap the MR, affected both sequence recognition and catalysis, suggesting a more direct involvement in positioning the substrate. Our data thus suggest roles for the MR and residues conserved in GIY-YIG enzymes in recognizing and binding the substrate. PMID:18539732

  8. Effects of chain length of an amphipathic polypeptide carrying the repeated amino acid sequence (LETLAKA)(n) on α-helix and fibrous assembly formation.

    Takei, Toshiaki; Hasegawa, Kazuya; Imada, Katsumi; Namba, Keiichi; Tsumoto, Kouhei; Kuriki, Yukino; Yoshino, Masakuni; Yazaki, Kazumori; Kojima, Shuichi; Takei, Tsunetomo; Ueda, Takuya; Miura, Kin-ichiro

    2013-04-23

    Polypeptide α3 (21 residues), with three repeats of a seven-amino-acid sequence (LETLAKA)(3), forms an amphipathic α-helix and a long fibrous assembly. Here, we investigated the ability of α3-series polypeptides (with 14-42 residues) of various chain lengths to form α-helices and fibrous assemblies. Polypeptide α2 (14 residues), with two same-sequence repeats, did not form an α-helix, but polypeptide α2L (15 residues; α2 with one additional leucine residue on its carboxyl terminal) did form an α-helix and fibrous assembly. Fibrous assembly formation was associated with polypeptides at least as long as polypeptide α2L and with five leucine residues, indicating that the C-terminal leucine has a critical element for stabilization of α-helix and fibril formation. In contrast, polypeptides α5 (35 residues) and α6 (42 residues) aggregated easily, although they formed α-helices. A 15-35-residue chain was required for fibrous assembly formation. Electron microscopy and X-ray fiber diffraction showed that the thinnest fibrous assemblies of polypeptides were about 20 Å and had periodicities coincident with the length of the α-helix in a longitudinal direction. These results indicated that the α-helix structures were orientated along the fibrous axis and assembled into a bundle. Furthermore, the width and length of fibrous assemblies changed with changes in the pH value, resulting in variations in the charged states of the residues. Our results suggest that the formation of fibrous assemblies of amphipathic α-helices is due to the assembly of bundles via the hydrophobic faces of the helices and extension with hydrophobic noncovalent bonds containing a leucine. PMID:23530905

  9. Detection of Aspergillus fumigatus in a rat model of invasive pulmonary aspergillosis by real-time nucleic acid sequence-based amplification.

    Zhao, Yanan; Park, Steven; Warn, Peter; Shrief, Raghdaa; Harrison, Elizabeth; Perlin, David S

    2010-04-01

    Rapid and sensitive detection of Aspergillus from clinical samples may facilitate the early diagnosis of invasive pulmonary aspergillosis (IPA). A real-time nucleic acid sequence-based amplification (NASBA) method was investigated by use of an inhalational rat model of IPA. Immunosuppressed male Sprague-Dawley rats were exposed to Aspergillus fumigatus spores for an hour in an aerosol chamber. Bronchoalveolar lavage (BAL) fluid, lung tissues, and whole blood were collected from five infected rats at 1, 24, 48, 72, and 96 h postinfection and five uninfected rats at the end of the experiment. Total nucleic acid (TNA) was extracted on an easyMAG instrument. A primer-molecular beacon set targeting 28S rRNA was designed to detect Aspergillus spp. The results were compared to those of quantitative PCR (qPCR) (18S rDNA) and quantitative culture. The analytical sensitivity of the real-time NASBA assay was tissue burdens, while the CFU counts were stable over time. The fungal burdens in BAL fluid were more variable and not indicative of a progressive infection. The results of both real-time assays correlated well for both sample types (r = 0.869 and P tissue, r = 0.887 and P < 0.0001 for BAL fluid). For all whole-blood specimens, NASBA identified Aspergillus-positive samples in the group from which samples were collected at 72 h postinfection (three of five samples) and the group from which samples were collected at 96 h postinfection (five of five samples), but no positive results were obtained by culture or PCR. Real-time NASBA is highly sensitive and useful for the detection of Aspergillus in an experimental model of IPA. PMID:20129972

  10. Genome Sequences of the High-Acetic Acid-Resistant Bacteria Gluconacetobacter europaeus LMG 18890T and G. europaeus LMG 18494 (Reference Strains), G. europaeus 5P3, and Gluconacetobacter oboediens 174Bp2 (Isolated from Vinegar) ▿

    Andrés-Barrao, Cristina; Falquet, Laurent; Sandra P Calderon-Copete; Descombes, Patrick; Ortega Pérez, Ruben; Barja, François

    2011-01-01

    Bacteria of the genus Gluconacetobacter are usually involved in the industrial production of vinegars with high acetic acid concentrations. We describe here the genome sequence of three Gluconacetobacter europaeus strains, a very common bacterial species from industrial fermentors, as well as of a Gluconacetobacter oboediens strain.

  11. Sequence Searcher: A Java tool to perform regular expression and fuzzy searches of multiple DNA and protein sequences

    Upton Chris

    2009-01-01

    Full Text Available Abstract Background Many sequence-searching tools have limiting factors for their use. For example, they may be platform specific, enforce restrictive size limits and sequences to be searched, or only allow searches of one of DNA or protein. Findings We present an easy-to-use, fast, platform-independent tool to search for amino acid or nucleotide patterns within one or many protein or nucleic acid sequences. The user can choose to search for regular expressions or perform a fuzzy search in which a particular number of errors is accepted during matching of a sequence. Positions of mismatches in fuzzy searches are displayed graphically the user. Conclusion SeqS provides an improved feature set and functions as a stand-alone tool or could be integrated into other bioinformatics platforms.

  12. Identification of the phosphorylation sites in early region 1A proteins of adenovirus type 5 by amino acid sequencing of peptide fragments

    Tremblay, M.L.; McGlade, C.J.; Gerber, G.E.; Branton, P.E.

    1988-05-05

    The authors have mapped the positions of three of the phosphorylation sites on the 289 and 243 residue (289R and 243R) early region 1A (E1A) proteins of human adenovirus type 5 (Ad5). These proteins, which play roles in both transcriptional control and oncogenic transformation, have identical sequences except for the presence in 289R of 46 additional internal amino acids. Phosphorylation was detected exclusively at serine residues. E1A proteins purified from (/sup 35/S)methionine- or (/sup 32/P)orthophosphate-labeled Ad5-infected cells were digested with trypsin, and two phosphopeptides were isolated by reverse-phase chromatography and subjected to automated Edman degradation. The major species was shown to contain a single phosphorylation site at Ser-219. The second phosphopeptide was shown to contain at least one phosphorylation site at Ser-231. A third phosphorylated tryptic peptide could not be eluted from the column but was isolated using an E1A-specific rat monoclonal antibody. Following subcleavage by Staphylococcus aureus V-8 protease, this peptide was shown to contain at least one phosphorylation site at Ser-89. The present data indicate that both the 289R and 243R E1A proteins are phosphorylated at the same sites, at least one in the amino terminal half of the molecule, and at least two toward the carboxyl terminus.

  13. Identification of the phosphorylation sites in early region 1A proteins of adenovirus type 5 by amino acid sequencing of peptide fragments

    The authors have mapped the positions of three of the phosphorylation sites on the 289 and 243 residue (289R and 243R) early region 1A (E1A) proteins of human adenovirus type 5 (Ad5). These proteins, which play roles in both transcriptional control and oncogenic transformation, have identical sequences except for the presence in 289R of 46 additional internal amino acids. Phosphorylation was detected exclusively at serine residues. E1A proteins purified from [35S]methionine- or [32P]orthophosphate-labeled Ad5-infected cells were digested with trypsin, and two phosphopeptides were isolated by reverse-phase chromatography and subjected to automated Edman degradation. The major species was shown to contain a single phosphorylation site at Ser-219. The second phosphopeptide was shown to contain at least one phosphorylation site at Ser-231. A third phosphorylated tryptic peptide could not be eluted from the column but was isolated using an E1A-specific rat monoclonal antibody. Following subcleavage by Staphylococcus aureus V-8 protease, this peptide was shown to contain at least one phosphorylation site at Ser-89. The present data indicate that both the 289R and 243R E1A proteins are phosphorylated at the same sites, at least one in the amino terminal half of the molecule, and at least two toward the carboxyl terminus

  14. Triplex formation at single-stranded nucleic acid target sites of unrestricted sequence by two added strands of oligonucleotides: A proposed model

    Trapane, T.L.; Ts' o, P.O.P. (John Hopkins Univ., Baltimore, MD (United States))

    1994-11-16

    By using the standard purine nucleosides, guanosine and adenosine, and the pyrimidine C-nucleosides, pseudoisocytidine and pseudouridine, as complements on a probe strand, it is possible to construct a regular Watson-Crick helix with a single-stranded target sequence having any arrangement of the four naturally-occurring bases found in nucleic acids. The major groove of this helix will have a unique configuration of hydrogen-bonding sites on the probe strand for each of these four base pairs. By using this duplex as a framework, an ensemble of recognition patterns composed of base triads may be constructed. In these patterns, either a homopyrimidine or homopurine third strand binds in the major groove of the duplex formed by the target and probe strands. Ten distinct geometries, or motifs, are shown, each one consisting of four isomorphic base triads built upon recognition of C, G, A, or U(T) residues in the target strand. In order to maintain specific hydrogen bonding and to construct isomorphous triads, the use of several nonstandard bases is proposed. 33 refs., 9 figs., 3 tabs.

  15. Indole acetic acid production by fluorescent Pseudomonas spp. from the rhizosphere of Plectranthus amboinicus (Lour.) Spreng. and their variation in extragenic repetitive DNA sequences.

    Sethia, Bedhya; Mustafa, Mariam; Manohar, Sneha; Patil, Savita V; Jayamohan, Nellickal Subramanian; Kumudini, Belur Satyan

    2015-06-01

    Fluorescent Pseudomonas (FP) is a heterogenous group of growth promoting rhizobacteria that regulate plant growth by releasing secondary metabolic compounds viz., indole acetic acid (IAA), siderophores, ammonia and hydrogen cyanide. In the present study, IAA producing FPs from the rhizosphere of Plectranthus amboinicus were characterized morphologically, biochemically and at the molecular level. Molecular identification of the isolates were carried out using Pseudomonas specific primers. The effect of varying time (24, 48, 72 and 96 h), Trp concentrations (100, 200, 300, 400 and 500 μg x ml(-1)), temperature (10, 26, 37 and 50 ± 2 degrees C) and pH (6, 7 and 8) on IAA production by 10 best isolates were studied. Results showed higher IAA production at 72 h incubation, at 300 μg x ml(-1) Trp concentration, temperature 26 ± 2 degrees C and pH 7. TLC with acidified ethyl acetate extract showed that the IAA produced has a similar Rf value to that of the standard IAA. Results of TLC were confirmed by HPLC analysis. Genetic diversity of the isolates was also studied using 40 RAPD and 4 Rep primers. Genetic diversity parameters such as dominance, Shannon index and Simpson index were calculated. Out of 40 RAPD primers tested, 9 (2 OP-D series and 7 OP-E series) were shortlisted for further analysis. Studies using RAPD, ERIC, BOX, REP and GTG5 primers revealed that isolates exhibit significant diversity in repetitive DNA sequences irrespective of the rhizosphere. PMID:26155673

  16. PhTX-II a Basic Myotoxic Phospholipase A2 from Porthidium hyoprora Snake Venom, Pharmacological Characterization and Amino Acid Sequence by Mass Spectrometry

    Salomón Huancahuire-Vega

    2014-10-01

    Full Text Available A monomeric basic PLA2 (PhTX-II of 14149.08 Da molecular weight was purified to homogeneity from Porthidium hyoprora venom. Amino acid sequence by in tandem mass spectrometry revealed that PhTX-II belongs to Asp49 PLA2 enzyme class and displays conserved domains as the catalytic network, Ca2+-binding loop and the hydrophobic channel of access to the catalytic site, reflected in the high catalytic activity displayed by the enzyme. Moreover, PhTX-II PLA2 showed an allosteric behavior and its enzymatic activity was dependent on Ca2+. Examination of PhTX-II PLA2 by CD spectroscopy indicated a high content of alpha-helical structures, similar to the known structure of secreted phospholipase IIA group suggesting a similar folding. PhTX-II PLA2 causes neuromuscular blockade in avian neuromuscular preparations with a significant direct action on skeletal muscle function, as well as, induced local edema and myotoxicity, in mice. The treatment of PhTX-II by BPB resulted in complete loss of their catalytic activity that was accompanied by loss of their edematogenic effect. On the other hand, enzymatic activity of PhTX-II contributes to this neuromuscular blockade and local myotoxicity is dependent not only on enzymatic activity. These results show that PhTX-II is a myotoxic Asp49 PLA2 that contributes with toxic actions caused by P. hyoprora venom.

  17. Further considerations about the ophthalmic features of the Möbius sequence, with data of 28 cases Novas considerações sobre o quadro clínico da seqüência de Möbius com dados de 28 casos

    Carlos Ramos Souza-Dias; Mauro Goldchmit

    2007-01-01

    PURPOSE: There is no uniformity in the literature about the core features required to make the diagnosis of Möbius sequence. Originally, the minimum requirements were the bilateral paralysis of the VI and the VII cranial nerves. The bilateral facial nerve paralysis or paresis, often asymmetric, is common to all patients but some facts show that the isolated VI nerve palsy in the Möbius sequence is not the rule. 1) When there is an esotropia in Möbius sequence, it is often too small to be caus...

  18. Solar Features

    National Oceanic and Atmospheric Administration, Department of Commerce — Collection includes a variety of solar feature datasets contributed by a number of national and private solar observatories located worldwide.

  19. Feature Extraction

    CERN. Geneva

    2015-01-01

    Feature selection and reduction are key to robust multivariate analyses. In this talk I will focus on pros and cons of various variable selection methods and focus on those that are most relevant in the context of HEP.

  20. Pseudomonas lini Strain ZBG1 Revealed Carboxylic Acid Utilization and Copper Resistance Features Required for Adaptation to Vineyard Soil Environment: A Draft Genome Analysis

    Chan, Kok-Gan; Chong, Teik-Min; Adrian, Tan-Guan-Sheng; Kher, Heng Leong; Grandclément, Catherine; Faure, Denis; Yin, Wai-Fong; Dessaux, Yves; Hong, Kar-Wai

    2016-01-01

    Pseudomonas lini strain ZBG1 was isolated from the soil of vineyard in Zellenberg, France and the draft genome was reported in this study. Bioinformatics analyses of the genome revealed presence of genes encoding tartaric and malic acid utilization as well as copper resistance that correspond to the adaptation this strain in vineyard soil environment. PMID:27512520

  1. A unique insertion of low complexity amino acid sequence underlies protein-protein interaction in human malaria parasite orotate phosphoribosyltransferase and orotidine 5'-monophosphate decarboxylase

    Waranya Imprasittichai; Sittiruk Roytrakul; Sudaratana R Krungkrai; Jerapan Krungkrai

    2014-01-01

    Objective:To investigate the multienzyme complex formation of human malaria parasite Plasmodium falciparum(P. falciparum) orotate phosphoribosyltransferase(OPRT) and orotidine 5'-monophosphate decarboxylase(OMPDC), the fifth and sixth enzyme of the de novo pyrimidine biosynthetic pathway.Previously, we have clearly established that the two enzymes in the malaria parasite exist physically as a heterotetrameric(OPRT)2(OMPDC)2 complex containing two subunits each ofOPRT andOMPDC, and that the complex have catalytic kinetic advantages over the monofunctional enzyme.Methods:Both enzymes were cloned and expressed as recombinant proteins.The protein-protein interaction in the enzyme complex was identified using bifunctional chemical cross-linker, liquid chromatography-mass spectrometric analysis and homology modeling.Results:The unique insertions of low complexity region at the α2 and α5 helices of the parasiteOMPDC, characterized by single amino acid repeat sequence which was not found in homologous proteins from other organisms, was located on theOPRT-OMPDC interface.The structural models for the protein-protein interaction of the heterotetrameric(OPRT)2(OMPDC)2 multienzyme complex were proposed.Conclusions:Based on the proteomic data and structural modeling, it is surmised that the human malaria parasite low complexity region is responsible for theOPRT-OMPDC interaction.The structural complex of the parasite enzymes, thus, represents an efficient functional kinetic advantage, which in line with co-localization principles of evolutional origin, and allosteric control in protein-protein-interactions.

  2. Genomic Feature Models

    Sørensen, Peter; Edwards, Stefan McKinnon; Rohde, Palle Duun

    Whole-genome sequences and multiple trait phenotypes from large numbers of individuals will soon be available in many populations. Well established statistical modeling approaches enable the genetic analyses of complex trait phenotypes while accounting for a variety of additive and non-additive g......Whole-genome sequences and multiple trait phenotypes from large numbers of individuals will soon be available in many populations. Well established statistical modeling approaches enable the genetic analyses of complex trait phenotypes while accounting for a variety of additive and non...... sets of genetic variants. We have applied these approaches to whole genome sequences and a complex trait phenotype resistance to starvation collected on inbred lines from the Drosophila Genome Reference Panel population. We identified a number of genomic features classification schemes (e.g. prior QTL...

  3. Temporal Feature Integration for Music Organisation

    Meng, Anders; Larsen, Jan; Hansen, Lars Kai

    2006-01-01

    This Ph.D. thesis focuses on temporal feature integration for music organisation. Temporal feature integration is the process of combining all the feature vectors of a given time-frame into a single new feature vector in order to capture relevant information in the frame. Several existing methods for handling sequences of features are formulated in the temporal feature integration framework. Two datasets for music genre classification have been considered as valid test-beds for music organisa...

  4. Treatability of cheese whey for single-cell protein production in nonsterile systems: Part I. Optimal condition for lactic acid fermentation using a microaerobic sequencing batch reactor (microaerobic SBR) with immobilized Lactobacillus plantarum TISTR 2265 and microbial communities.

    Monkoondee, Sarawut; Kuntiya, Ampin; Chaiyaso, Thanongsak; Leksawasdi, Noppol; Techapun, Charin; Kawee-Ai, Arthitaya; Seesuriyachan, Phisit

    2016-05-18

    Cheese whey contains a high organic content and causes serious problems if it is released into the environment when untreated. This study aimed to investigate the optimum condition of lactic acid production using the microaerobic sequencing batch reactor (microaerobic SBR) in a nonsterile system. The high production of lactic acid was achieved by immobilized Lactobacillus plantarum TISTR 2265 to generate an acidic pH condition below 4.5 and then to support single-cell protein (SCP) production in the second aerobic sequencing batch reactor (aerobic SBR). A hydraulic retention time (HRT) of 4 days and a whey concentration of 80% feeding gave a high lactic acid yield of 12.58 g/L, chemical oxygen demand (COD) removal of 62.38%, and lactose utilization of 61.54%. The microbial communities in the nonsterile system were dominated by members of lactic acid bacteria, and it was shown that the inoculum remained in the system up to 330 days. PMID:26178366

  5. Hydrate and alkoxide forms of molybdophosphoric heteropoly acid and specific features of their formation under conditions of isothermal absorption of water, methanol, and ethanol vapors

    By the gravimetry method it was ascertained that interaction of vapors of water, methanol and ethanol with solid molybdophosphoric acid at room temperature is accompanied by formation of volumetric hydrates and alcoholates proceeding in several stages, clearly defined during isotherm recording under sorption and desorption conditions. Formation of alcoholates gives rise to loosening of the acid lattice, which dictates largely more active absorption of alcohols at the first stages of sorption compared with water and, when the compositions H3PMo12O40 · 11.5 CH3OH and H3PMo12O40 · 14.7 C2H5OH is attained, it results in their liquefying

  6. Features of solvent extraction of gadolinium(3), ytterbium(3) and scandium(3) in macroscopic concentrations by tributyl phosphate from concentrated nitric acid solutions

    Gadolinium(3) (0.28-1.07 mol/l), ytterbium(3) (0.51-0.56 mol/l) and scandium(3) (0.2-1.2 mol/l) extraction by nondiluted TBP and TBP solutions in carbon tetrachloride from nitric acid solutions (2.7-12.3 mol/l) has been studied. By the IR spectroscopy method it is shown that the composition of solvates extracted corresponds to the formula M(NO3)3 · mHNO3 · 3TBP, where M(3) = Sc, Cd, Yb. Nitric acid is added by H-bond of medium strength to oxygen atom of nitrate group in the first coordination sphere of metal ion. 22 refs; 3 figs

  7. Loop Sequence Context Influences the Formation and Stability of the i-Motif for DNA Oligomers of Sequence (CCCXXX)4, where X = A and/or T, under Slightly Acidic Conditions.

    McKim, Mikeal; Buxton, Alexander; Johnson, Courtney; Metz, Amanda; Sheardy, Richard D

    2016-08-11

    The structure and stability of DNA is highly dependent upon the sequence context of the bases (A, G, C, and T) and the environment under which the DNA is prepared (e.g., buffer, temperature, pH, ionic strength). Understanding the factors that influence structure and stability of the i-motif conformation can lead to the design of DNA sequences with highly tunable properties. We have been investigating the influence of pH and temperature on the conformations and stabilities for all permutations of the DNA sequence (CCCXXX)4, where X = A and/or T, using spectroscopic approaches. All oligomers undergo transitions from single-stranded structures at pH 7.0 to i-motif conformations at pH 5.0 as evidenced by circular dichroism (CD) studies. These folded structures possess stacked C:CH(+) base pairs joined by loops of 5'-XXX-3'. Although the pH at the midpoint of the transition (pHmp) varies slightly with loop sequence, the linkage between pH and log K for the proton induced transition is highly loop sequence dependent. All oligomers also undergo the thermally induced i-motif to single-strand transition at pH 5.0 as the temperature is increased from 25 to 95 °C. The temperature at the midpoint of this transition (Tm) is also highly dependent on loop sequence context effects. For seven of eight possible permutations, the pH induced, and thermally induced transitions appear to be highly cooperative and two state. Analysis of the CD optical melting profiles via a van't Hoff approach reveals sequence-dependent thermodynamic parameters for the unfolding as well. Together, these data reveal that the i-motif conformation exhibits exquisite sensitivity to loop sequence context with respect to formation and stability. PMID:27438583

  8. Cleavage of nucleic acids

    Prudent, James R. (Madison, WI); Hall, Jeff G. (Madison, WI); Lyamichev, Victor L. (Madison, WI); Brow, Mary Ann D. (Madison, WI); Dahlberg, James E. (Madison, WI)

    2007-12-11

    The present invention relates to means for the detection and characterization of nucleic acid sequences, as well as variations in nucleic acid sequences. The present invention also relates to methods for forming a nucleic acid cleavage structure on a target sequence and cleaving the nucleic acid cleavage structure in a site-specific manner. The structure-specific nuclease activity of a variety of enzymes is used to cleave the target-dependent cleavage structure, thereby indicating the presence of specific nucleic acid sequences or specific variations thereof.

  9. Cleavage of nucleic acids

    Prudent, James R. (Madison, WI); Hall, Jeff G. (Waunakee, WI); Lyamichev, Victor I. (Madison, WI); Brow; Mary Ann D. (Madison, WI); Dahlberg, James E. (Madison, WI)

    2010-11-09

    The present invention relates to means for the detection and characterization of nucleic acid sequences, as well as variations in nucleic acid sequences. The present invention also relates to methods for forming a nucleic acid cleavage structure on a target sequence and cleaving the nucleic acid cleavage structure in a site-specific manner. The structure-specific nuclease activity of a variety of enzymes is used to cleave the target-dependent cleavage structure, thereby indicating the presence of specific nucleic acid sequences or specific variations thereof.

  10. Nucleic acid detection compositions

    Prudent, James R. (Madison, WI); Hall, Jeff G. (Madison, WI); Lyamichev, Victor I. (Madison, WI); Brow, Mary Ann (Madison, WI); Dahlberg, James L. (Madison, WI)

    2008-08-05

    The present invention relates to means for the detection and characterization of nucleic acid sequences, as well as variations in nucleic acid sequences. The present invention also relates to methods for forming a nucleic acid cleavage structure on a target sequence and cleaving the nucleic acid cleavage structure in a site-specific manner. The structure-specific nuclease activity of a variety of enzymes is used to cleave the target-dependent cleavage structure, thereby indicating the presence of specific nucleic acid sequences or specific variations thereof.

  11. Nucleic acid detection assays

    Prudent, James R.; Hall, Jeff G.; Lyamichev, Victor I.; Brow, Mary Ann; Dahlberg, James E.

    2005-04-05

    The present invention relates to means for the detection and characterization of nucleic acid sequences, as well as variations in nucleic acid sequences. The present invention also relates to methods for forming a nucleic acid cleavage structure on a target sequence and cleaving the nucleic acid cleavage structure in a site-specific manner. The structure-specific nuclease activity of a variety of enzymes is used to cleave the target-dependent cleavage structure, thereby indicating the presence of specific nucleic acid sequences or specific variations thereof.

  12. Cleavage of nucleic acids

    Prudent, James R.; Hall, Jeff G.; Lyamichev, Victor I.; Brow, Mary Ann D.; Dahlberg, James E.

    2000-01-01

    The present invention relates to means for the detection and characterization of nucleic acid sequences, as well as variations in nucleic acid sequences. The present invention also relates to methods for forming a nucleic acid cleavage structure on a target sequence and cleaving the nucleic acid cleavage structure in a site-specific manner. The structure-specific nuclease activity of a variety of enzymes is used to cleave the target-dependent cleavage structure, thereby indicating the presence of specific nucleic acid sequences or specific variations thereof.

  13. A generalized profile syntax for biomolecular sequence motifs and its function in automatic sequence interpretation

    Bucher, P. [Swiss Institute for Experimental Cancer Research, Lausanne (Switzerland); Bairoch, A. [Centre Medical Universitaire, Geneva (Switzerland)

    1994-12-31

    A general syntax for expressing bimolecular sequence motifs is described, which will be used in future releases of the PROSITE data bank and in a similar collection of nucleic acid sequence motifs currently under development. The central part of the syntax is a regular structure which can be viewed as a generalization of the profiles introduced by Gribskov and coworkers. Accessory features implement specific motif search strategies and provide information helpful for the interpretation of predicted matches. Two contrasting examples, representing E. coli promoters and SH3 domains respectively, are shown to demonstrate the versatility of the syntax, and its compatibility with diverse motif search methods. It is argued, that a comprehensive machine-readable motif collection based on the new syntax, in conjunction with a standard search program, can serve as a general-purpose sequence interpretation and function prediction tool.

  14. Molecular cloning of the α-subunit of human prolyl 4-hydroxylase: The complete cDNA-derived amino acid sequence and evidence for alternative splicing of RNA transcripts

    Prolyl 4-hydroxylase an α2β2 tetramer, catalyzes the formation of 4-hydroxyproline in collagens by the hydroxylation of proline residues in peptide linkages. The authors report here on the isolation of cDNA clones encoding the α-subunit of the enzyme from human tumor HT-1080, placenta, and fibroblast cDNA libraries. Eight overlapping clones covering almost all of the corresponding 3,000-nucleotide mRNA, including all the coding sequences, were characterized. These clones encode a polypeptide of 517 amino acid residues and a signal peptide of 17 amino acids. Previous characterization of cDNA clones for the β-subunit of prolyl 4-hydroxylase has indicated that its C terminus has the amino acid sequence Lys-Asp-Gly-Leu, which, it has been suggested, is necessary for the retention of a polypeptide within the lumen of the endoplasmic reticulum. The α-subunit does not have this C-terminal sequence, and thus one function of the β-subunit in the prolyl 4-hydroxylase tetramer appears to be to retain the enzyme within this cell organelle. Southern blot analyses of human genomic DNA with a cDNA probe for the α-subunit suggested the presence of only one gene encoding the two types of mRNA, which appear to result from mutually exclusive alternative splicing of primary transcripts of one gene

  15. WebLogo: A Sequence Logo Generator

    Crooks, G. E.; Hon, G; Chandonia, J. M.; Brenner, Steven E.

    2004-01-01

    WebLogo generates sequence logos, graphical representations of the patterns within a multiple sequence alignment. Sequence logos provide a richer and more precise description of sequence similarity than consensus sequences and can rapidly reveal significant features of the alignment otherwise difficult to perceive. Each logo consists of stacks of letters, one stack for each position in the sequence. The overall height of each stack indicates the sequence conservation at that position (measure...

  16. Sequence-specific nucleic acid mobility using a reversible block copolymer gel matrix and DNA amphiphiles (lipid-DNA) in capillary and microfluidic electrophoretic separations

    Wagler, Patrick; Minero, Gabriel Antonio S.; Tangen, Uwe; de Vries, Jan Willem; Prusty, Deepak; Kwak, Minseok; Herrmann, Andreas; McCaskill, John S.

    2015-01-01

    Reversible noncovalent but sequence-dependent attachment of DNA to gels is shown to allow programmable mobility processing of DNA populations. The covalent attachment of DNA oligomers to polyacrylamide gels using acrydite-modified oligonucleotides has enabled sequence-specific mobility assays for DN

  17. The gene clone and sequence analysis of FAD2 from different erucic acid content rapeseed lines%不同芥酸含量油菜品系FAD2基因克隆测序分析

    陈光尧; 王国槐; 张振乾; 官春云; 陈社员

    2011-01-01

    对高芥酸品系M13、60Coy辐照得到的高芥酸油菜突变体H27和低芥酸品系742的FAD2基因克隆并测序.结果发现,FAD2基因存在两个拷贝FAD2.1(1155bp)、FAD2.2(1140bp).H27的FAD2.1与M13序列相同.但FAD2.2核苷酸序列中M13在409位点A(腺嘌呤)变成了T(鸟嘌呤),导致密码子由AGA变换为TGA(终止密码子),使H27中的FAD2.2基因的功能丧失,这可能是芥酸含量的提高原因.%In order to better understand the molecular mechanism of erucic acid mutation, the FAD2 genes of high erucic acid M13 strain, high-erucic acid rapeseed mutant H27 by 60Coγ irradiation and low erucic acid strain 742 were sequenced by our laboratory. The results showed that there were two copies of FAD2 gene FAD2. 1 ( 1155bp) , FAD2. 2 (1140bp) .Compared with the FAD2. 1 and FAD2. 2 gene sequences of H27 and M13 , both of them had the same FAD2. 1 nucleotide sequence and the different FAD2. 2 nucleotide sequence. The FAD2. 2 nucleotide sequence of M13 in the 409 point A ( adenine) was replaced by T ( guanine) in H27 , then the AGA codon transformed into TGA ( stop codon) , which resulted in FAD2. 2 gene some function loss. It might be the reason why H27 had higher erucic acid content than M13.

  18. GATA: a graphic alignment tool for comparative sequence analysis

    Nix David A; Eisen Michael B

    2005-01-01

    Abstract Background Several problems exist with current methods used to align DNA sequences for comparative sequence analysis. Most dynamic programming algorithms assume that conserved sequence elements are collinear. This assumption appears valid when comparing orthologous protein coding sequences. Functional constraints on proteins provide strong selective pressure against sequence inversions, and minimize sequence duplications and feature shuffling. For non-coding sequences this collineari...

  19. Automatic sequences

    Haeseler, Friedrich

    2003-01-01

    Automatic sequences are sequences which are produced by a finite automaton. Although they are not random they may look as being random. They are complicated, in the sense of not being not ultimately periodic, they may look rather complicated, in the sense that it may not be easy to name the rule by which the sequence is generated, however there exists a rule which generates the sequence. The concept automatic sequences has special applications in algebra, number theory, finite automata and formal languages, combinatorics on words. The text deals with different aspects of automatic sequences, in particular:· a general introduction to automatic sequences· the basic (combinatorial) properties of automatic sequences· the algebraic approach to automatic sequences· geometric objects related to automatic sequences.

  20. Membrane platforms for biological nanopore sensing and sequencing.

    Schmidt, Jacob

    2016-06-01

    In the past two decades, biological nanopores have been developed and explored for use in sensing applications as a result of their exquisite sensitivity and easily engineered, reproducible, and economically manufactured structures. Nanopore sensing has been shown to differentiate between highly similar analytes, measure polymer size, detect the presence of specific genes, and rapidly sequence nucleic acids translocating through the pore. Devices featuring protein nanopores have been limited in part by the membrane support containing the nanopore, the shortcomings of which have been addressed in recent work developing new materials, approaches, and apparatus resulting in membrane platforms featuring automatability and increased robustness, lifetime, and measurement throughput. PMID:26773300

  1. Draft Genome Sequences of 19 Salmonella enterica Serovar Typhimurium [4,5:i:−] Strains Resistant to Nalidixic Acid from a Long-Term Outbreak in Italy

    Orsini, Massimiliano; Mangone, Iolanda; DiPasquale, Adriano; Perticara, Samuel; Sacchini, Lorena; Cito, Francesca; Iannetti, Simona; Marcacci, Maurilia; Ancora, Massimo; Calistri, Paolo; Di Giannatale, Elisabetta; Cammà, Cesare

    2015-01-01

    Here, we present the draft genome sequences of 19 Salmonella enterica serovar Typhimurium monophasic variant [4,5:i:−] strains involved in a long-term salmonellosis outbreak that occurred in central Italy in 2013 to 2014.

  2. Detection of Differences in the Nucleotide and Amino Acid Sequences of Diphtheria Toxin from Corynebacterium diphtheriae and Corynebacterium ulcerans Causing Extrapharyngeal Infections

    Sing, Andreas; Hogardt, Michael; Bierschenk, Suse; Heesemann, Jürgen

    2003-01-01

    While Corynebacterium ulcerans can mimic classical diphtheria, extrapharyngeal infections are extremely rare. Sequencing of the diphtheria toxin (DT)-encoding tox gene of two C. ulcerans isolates from extrapharyngeal infections revealed differences from C. diphtheriae DT sequences, mainly in the translocation and receptor-binding domains. C. ulcerans supernatants were much less potent than supernatant from C. diphtheriae. A C. ulcerans DT-specific PCR is described below.

  3. Functional analysis of sequences adjacent to dapE of Corynebacterium glutamicum reveals the presence of aroP, which encodes the aromatic amino acid transporter.

    Wehrmann, A; Morakkabati, S; Krämer, R; Sahm, H; Eggeling, L

    1995-01-01

    An initially nonclonable DNA locus close to a gene of L-lysine biosynthesis in Corynebacterium glutamicum was analyzed in detail. Its stepwise cloning and its functional identification by monitoring the amino acid uptakes of defined mutants, together with mechanistic studies, identified the corresponding structure as aroP, the general aromatic amino acid uptake system.

  4. Featuring animacy

    Elizabeth Ritter

    2015-01-01

    Full Text Available Algonquian languages are famous for their animacy-based grammatical properties—an animacy based noun classification system and direct/inverse system which gives rise to animacy hierarchy effects in the determination of verb agreement. In this paper I provide new evidence for the proposal that the distinctive properties of these languages is due to the use of participant-based features, rather than spatio-temporal ones, for both nominal and verbal functional categories (Ritter & Wiltschko 2009, 2014. Building on Wiltschko (2012, I develop a formal treatment of the Blackfoot aspectual system that assumes a category Inner Aspect (cf. MacDonald 2008, Travis 1991, 2010. Focusing on lexical aspect in Blackfoot, I demonstrate that the classification of both nouns (Seinsarten and verbs (Aktionsarten is based on animacy, rather than boundedness, resulting in a strikingly different aspectual system for both categories. 

  5. Featuring animacy

    Elizabeth Ritter

    2015-01-01

    Full Text Available Algonquian languages are famous for their animacy-based grammatical properties—an animacy based noun classification system and direct/inverse system which gives rise to animacy hierarchy effects in the determination of verb agreement. In this paper I provide new evidence for the proposal that the distinctive properties of these languages is due to the use of participant-based features, rather than spatio-temporal ones, for both nominal and verbal functional categories (Ritter & Wiltschko 2009, 2014. Building on Wiltschko (2012, I develop a formal treatment of the Blackfoot aspectual system that assumes a category Inner Aspect (cf. MacDonald 2008, Travis 1991, 2010. Focusing on lexical aspect in Blackfoot, I demonstrate that the classification of both nouns (Seinsarten and verbs (Aktionsarten is based on animacy, rather than boundedness, resulting in a strikingly different aspectual system for both categories.

  6. Bipotential precursors of putative fibrous astrocytes and oligodendrocytes in rat cerebellar cultures express distinct surface features and neuron-like γ-aminobutyric acid transport

    When postnatal rat cerebellar cells were cultured in a chemically defined, serum-free medium, the only type of astrocyte present was unable to accumulate γ-[3H]aminobutyric acid (GABA), did not express surface antigens recognized by two monoclonal antibodies, A2B5 and LB1, and showed minimal proliferation. In these cultures, nonneuronal A2B5+, LB1+ stellate cells exhibiting neuron-like [3H]GABA uptake formed cell colonies of increasing size and were GFAP-. After about one week of culturing, the A2B5+, LB1+, GABA-uptake positive cell groups became galactocerebroside (GalCer) positive. Immunocytolysis of the A2B5+ cells at 3 and 4 days in vitro prevented the appearance of the A2B5+, LB1+, GABA-uptake positive cell colonies, and also of the GalCer+ cell groups. If 10% (vol/vol) fetal calf serum was added to 6-day cultures, the A2B5+, LB1+, GABA-uptake positive cell groups expressed GFAP and not GalCer. If the serum was added to the cultures 2 days after lysing the A2B5+ cells, only A2B5-, LB1-, GABA-uptake negative astrocytes proliferated. It is concluded that the putative fibrous astrocytes previously described in serum-containing cultures derive from bipotential precursors that differentiate into oligodendrocytes (GalCer+) in serum-free medium or into astrocytes (GFAP+) in the presence of serum, while the epithelioid A2B5-, LB1-, GABA-uptake negative astrocytes originate from a different precursor not yet identified

  7. GuiTope: an application for mapping random-sequence peptides to protein sequences

    Halperin Rebecca F

    2012-01-01

    Full Text Available Abstract Background Random-sequence peptide libraries are a commonly used tool to identify novel ligands for binding antibodies, other proteins, and small molecules. It is often of interest to compare the selected peptide sequences to the natural protein binding partners to infer the exact binding site or the importance of particular residues. The ability to search a set of sequences for similarity to a set of peptides may sometimes enable the prediction of an antibody epitope or a novel binding partner. We have developed a software application designed specifically for this task. Results GuiTope provides a graphical user interface for aligning peptide sequences to protein sequences. All alignment parameters are accessible to the user including the ability to specify the amino acid frequency in the peptide library; these frequencies often differ significantly from those assumed by popular alignment programs. It also includes a novel feature to align di-peptide inversions, which we have found improves the accuracy of antibody epitope prediction from peptide microarray data and shows utility in analyzing phage display datasets. Finally, GuiTope can randomly select peptides from a given library to estimate a null distribution of scores and calculate statistical significance. Conclusions GuiTope provides a convenient method for comparing selected peptide sequences to protein sequences, including flexible alignment parameters, novel alignment features, ability to search a database, and statistical significance of results. The software is available as an executable (for PC at http://www.immunosignature.com/software and ongoing updates and source code will be available at sourceforge.net.

  8. Screening of transgenic proteins expressed in transgenic food crops for the presence of short amino acid sequences identical to potential, IgE – binding linear epitopes of allergens

    Peijnenburg Ad ACM

    2002-12-01

    Full Text Available Abstract Background Transgenic proteins expressed by genetically modified food crops are evaluated for their potential allergenic properties prior to marketing, among others by identification of short identical amino acid sequences that occur both in the transgenic protein and allergenic proteins. A strategy is proposed, in which the positive outcomes of the sequence comparison with a minimal length of six amino acids are further screened for the presence of potential linear IgE-epitopes. This double track approach involves the use of literature data on IgE-epitopes and an antigenicity prediction algorithm. Results Thirty-three transgenic proteins have been screened for identities of at least six contiguous amino acids shared with allergenic proteins. Twenty-two transgenic proteins showed positive results of six- or seven-contiguous amino acids length. Only a limited number of identical stretches shared by transgenic proteins (papaya ringspot virus coat protein, acetolactate synthase GH50, and glyphosate oxidoreductase and allergenic proteins could be identified as (part of potential linear epitopes. Conclusion Many transgenic proteins have identical stretches of six or seven amino acids in common with allergenic proteins. Most identical stretches are likely to be false positives. As shown in this study, identical stretches can be further screened for relevance by comparison with linear IgE-binding epitopes described in literature. In the absence of literature data on epitopes, antigenicity prediction by computer aids to select potential antibody binding sites that will need verification of IgE binding by sera binding tests. Finally, the positive outcomes of this approach warrant further clinical testing for potential allergenicity.

  9. Cloning and Sequence Analysis of Y-box Binding Protein Gene in Min Pig

    Zhang Dong-jie; Liu Di; Wang Liang; He Xin-miao; Wang Wen-tao

    2014-01-01

    In order to study the gene sequence of Min pig Y-box binding protein (YB-1) gene, the complete coding sequence of Min pig YB-1 gene was cloned by RT-PCR, the sequence features were analyzed by some software and online website. The results showed that the complete CDS of Min pig Y-box was found to be 975 bp long, encoding 324 amino acids. It contained a conserved cold shock domain and several phosphorylation sites, but had no transmembrane domains, and was consistent with a protein found in the cytoplasm. Min pig YB-1 nucleotides shared high similarity (61.37%-97.66%) with other mammals.

  10. Local amino acid sequence patterns dominate the heterogeneous phenotype for the collagen connective tissue disease Osteogenesis Imperfecta resulting from Gly mutations.

    Xiao, Jianxi; Yang, Zhangfu; Sun, Xiuxia; Addabbo, Rayna; Baum, Jean

    2015-10-01

    Osteogenesis Imperfecta (OI), a hereditary connective tissue disease in collagen that arises from a single Gly → X mutation in the collagen chain, varies widely in phenotype from perinatal lethal to mild. It is unclear why there is such a large variation in the severity of the disease considering the repeating (Gly-X-Y)n sequence and the uniform rod-like structure of collagen. We systematically evaluate the effect of local (Gly-X-Y)n sequence around the mutation site on OI phenotype using integrated bio-statistical approaches, including odds ratio analysis and decision tree modeling. We show that different Gly → X mutations have different local sequence patterns that are correlated with lethal and nonlethal phenotypes providing a mechanism for understanding the sensitivity of local context in defining lethal and non-lethal OI. A number of important trends about which factors are related to OI phenotypes are revealed by the bio-statistical analyses; most striking is the complementary relationship between the placement of Pro residues and small residues and their correlation to OI phenotype. When Pro is present or small flexible residues are absent nearby a mutation site, the OI case tends to be lethal; when Pro is present or small flexible residues are absent further away from the mutation site, the OI case tends to be nonlethal. The analysis also reveals the dominant role of local sequence around mutation sites in the Major Ligand Binding Regions that are primarily responsible for collagen binding to its receptors and shows that non-lethal mutations are highly predicted by local sequence considerations alone whereas lethal mutations are not as easily predicted and may be a result of more complex interactions. Understanding the sequence determinants of OI mutations will enhance genetic counseling and help establish which steps in the collagen hierarchy to target for drug therapy. PMID:25980613

  11. ORFer – retrieval of protein sequences and open reading frames from GenBank and storage into relational databases or text files

    Sievert Volker

    2002-12-01

    Full Text Available Abstract Background Functional genomics involves the parallel experimentation with large sets of proteins. This requires management of large sets of open reading frames as a prerequisite of the cloning and recombinant expression of these proteins. Results A Java program was developed for retrieval of protein and nucleic acid sequences and annotations from NCBI GenBank, using the XML sequence format. Annotations retrieved by ORFer include sequence name, organism and also the completeness of the sequence. The program has a graphical user interface, although it can be used in a non-interactive mode. For protein sequences, the program also extracts the open reading frame sequence, if available, and checks its correct translation. ORFer accepts user input in the form of single or lists of GenBank GI identifiers or accession numbers. It can be used to extract complete sets of open reading frames and protein sequences from any kind of GenBank sequence entry, including complete genomes or chromosomes. Sequences are either stored with their features in a relational database or can be exported as text files in Fasta or tabulator delimited format. The ORFer program is freely available at http://www.proteinstrukturfabrik.de/orfer. Conclusion The ORFer program allows for fast retrieval of DNA sequences, protein sequences and their open reading frames and sequence annotations from GenBank. Furthermore, storage of sequences and features in a relational database is supported. Such a database can supplement a laboratory information system (LIMS with appropriate sequence information.

  12. Efficient algorithms for molecular sequence analysis.

    Karlin, S.; Morris, M.; Ghandour, G; Leung, M Y

    1988-01-01

    Efficient (linear time) algorithms are described for identifying global molecular sequence features allowing for errors including repeats, matches between sequences, dyad symmetry pairings, and other sequence patterns. A multiple sequence alignment algorithm is also described. Specific applications are given to hepatitis B viruses and the J5-C (J, joining; C, constant) region of the immunoglobulin kappa gene.

  13. Development of Electrochemical Biosensorfor Sequence-Specific Deoxyribonucleic Acid%特定序列脱氧核糖核酸电化学生物传感器进展

    杨丽菊; 彭图治

    2001-01-01

    对当今电分析化学中的研究热点之一——脱氧核糖核酸(DNA)的电化学生物传感技术的最新进展进行了综述,评述了其发展前景。%This is a review of electrochemical biosensor for sequence-specific deoxyribonucleic acid (DNA) with 51 references. Resent Progress in designation of the sensor, immobilization of DNA, indicator of hybridizatio, applications and some new concepts of the sensor are discussed in detail.

  14. Nucleotide and Amino Acid Sequences of oriT-traM-traJ-traY-traA-traL Regions and Mobilization of Virulence Plasmids of Salmonella enterica Serovars Enteritidis, Gallinarum-Pullorum, and Typhimurium

    Chu, Chishih; Chiu, Cheng-Hsun; Chu, Chi-Hong; Ou, Jonathan T.

    2002-01-01

    The virulence plasmid of Salmonella enterica serovar Gallinarum-Pullorum (pSPV) but not those of Salmonella enterica serovars Enteritidis (pSEV) and Typhimurium (pSTV) can be readily mobilized by an F or F-like conjugative plasmid. To investigate the reason for the difference, the oriT-traM-traJ-traY-traA-traL regions of the three salmonella virulence plasmids (pSVs) were cloned and their nucleotide and deduced amino acid sequences were examined. The cloned fragments were generally mobilized ...

  15. Genome Sequence of "Candidatus Microthrix parvicella" Bio17-1, a Long-Chain-Fatty-Acid-Accumulating Filamentous Actinobacterium from a Biological Wastewater Treatment Plant

    Muller, Emilie; Pinel, Nicolás; Gillece, John D.; Schupp, James M.; Lance B Price; Engelthaler, David M.; Levantesi, Caterina; Tandoi, Valter; Luong, Kkai; Baliga, Nitin S.; Korlach, Jonas; Keim, Paul S.; Wilmes, Paul

    2012-01-01

    “Candidatus Microthrix” bacteria are deeply branching filamentous actinobacteria which occur at the water-air interface of biological wastewater treatment plants, where they are often responsible for foaming and bulking. Here, we report the first draft genome sequence of a strain from this genus: “Candidatus Microthrix parvicella” strain Bio17-1.

  16. Studies on deoxyribonucleic acids and related compounds. V. Synthesis of pentadecanucleotide duplex containing the ideal Pribnow sequence of promoter by the phosphotriester method using a new phosphorylating reagent.

    Ohtsuka, E; Taniyama, Y; Marumoto, R; Sato, H.; Hirosaki, H; Ikehara, M

    1982-01-01

    A phosphorylating reagent o-chlorophenyl phosphoro-p-anisi-dochloridate was synthesized to phosphorylate the 3'-hydroxyl group of N, 5'-protected deoxynucleosides. These nucleotides served as 3'-terminal units for the synthesis of oligonucleotide blocks. By condensation of these oligonucleotide blocks the partially complementary deoxypentadecanucleotides dAGCTTATAATGC-TCG and dAGCTCGAGCATTATA, which contained the ideal Pribnow sequence TATAATG, were synthesized.

  17. In vitro nucleosome positioning features of DNA repeats sequence associated with human genetic disease%与人遗传病相关的DNA重复序列的体外核小体定位特性

    柴荣; 赵宏宇; 蔡禄

    2013-01-01

    Objective To investigate the nucleosome positioning of DNA repeats sequence ire vitro which can cause human genetic disease. Methods The recombinant plasmids containing (GAA)42, (ATTCT)43, (GCCT)18 and 601 sequence were cloned. The histone and plasmids were used to assemble chromatin structure ire vitro,and then analyzed by agarose gel electrophoresis after micrococcal nuclease digestion. Results The plasmid containing ATTCT repeats sequence was easier to form nucleosome than GAA containing repeats sequence ire vitro. Conclusions The recombinant plasmids' ability to form chromatin structure was changed because of the insert of the different repeats sequence fragment.%目的 研究与人遗传病相关的DNA重复序列的体外核小体定位.方法 构建含有(GAA)42、(ATTCT)43、(GCCT)18和601序列的重组质粒,体外利用盐透析将质粒与组蛋白八聚体组装形成染色质结构,微球菌核酸酶消化后,用琼脂糖凝胶电泳分析染色质的结构.结果 含有ATTCT重复序列的质粒较含GAA重复序列质粒在体外易于形成核小体.结论 在重组质粒中,由于引入的重复序列片段形成核小体能力的不同会影响其局部染色质结构.

  18. Nucleic acid detection kits

    Hall, Jeff G.; Lyamichev, Victor I.; Mast, Andrea L.; Brow, Mary Ann; Kwiatkowski, Robert W.; Vavra, Stephanie H.

    2005-03-29

    The present invention relates to means for the detection and characterization of nucleic acid sequences, as well as variations in nucleic acid sequences. The present invention also relates to methods for forming a nucleic acid cleavage structure on a target sequence and cleaving the nucleic acid cleavage structure in a site-specific manner. The structure-specific nuclease activity of a variety of enzymes is used to cleave the target-dependent cleavage structure, thereby indicating the presence of specific nucleic acid sequences or specific variations thereof. The present invention further relates to methods and devices for the separation of nucleic acid molecules based on charge. The present invention also provides methods for the detection of non-target cleavage products via the formation of a complete and activated protein binding region. The invention further provides sensitive and specific methods for the detection of nucleic acid from various viruses in a sample.

  19. Predicting DNA binding proteins using support vector machine with hybrid fractal features.

    Niu, Xiao-Hui; Hu, Xue-Hai; Shi, Feng; Xia, Jing-Bo

    2014-02-21

    DNA-binding proteins play a vitally important role in many biological processes. Prediction of DNA-binding proteins from amino acid sequence is a significant but not fairly resolved scientific problem. Chaos game representation (CGR) investigates the patterns hidden in protein sequences, and visually reveals previously unknown structure. Fractal dimensions (FD) are good tools to measure sizes of complex, highly irregular geometric objects. In order to extract the intrinsic correlation with DNA-binding property from protein sequences, CGR algorithm, fractal dimension and amino acid composition are applied to formulate the numerical features of protein samples in this paper. Seven groups of features are extracted, which can be computed directly from the primary sequence, and each group is evaluated by the 10-fold cross-validation test and Jackknife test. Comparing the results of numerical experiments, the group of amino acid composition and fractal dimension (21-dimension vector) gets the best result, the average accuracy is 81.82% and average Matthew's correlation coefficient (MCC) is 0.6017. This resulting predictor is also compared with existing method DNA-Prot and shows better performances. PMID:24189096

  20. Sequence diversity and functional conformity

    de Lange, Orlando

    2015-01-01

    At least four phylogenetically distinct groups of bacteria encode repeat proteins with the common ability to bind specific DNA sequences with a unique but conserved code. Each repeat binds a single DNA base, and specificity is determined by the amino acid residue at position 13 of each repeat. Repeats are typically 33-35 amino acids long. Comparing repeat sequences across all groups reveals that only three positions are hyper-conserved. Repeats are in most cases functionally compatible such t...

  1. Comparative statistics for DNA and protein sequences: multiple sequence analysis.

    Karlin, S.; Ghandour, G

    1985-01-01

    Concepts and methods [Karlin, S. & Ghandour, G. (1985) Proc. Natl. Acad. Sci. USA 82, 5800-5804] for the analysis of patterns and relationships are extended to multiple DNA and protein sequences. Functionals include multiple sequence common word occurrence distributions, characterizations of high frequency shared words, and ascertainment of long block identities. Various comparisons of sequences using natural alphabets obtained from grouping nucleotides or amino acids by their chemical and fu...

  2. Sequence repeats and protein structure

    Hoang, Trinh X.; Trovato, Antonio; Seno, Flavio; Banavar, Jayanth R.; Maritan, Amos

    2012-11-01

    Repeats are frequently found in known protein sequences. The level of sequence conservation in tandem repeats correlates with their propensities to be intrinsically disordered. We employ a coarse-grained model of a protein with a two-letter amino acid alphabet, hydrophobic (H) and polar (P), to examine the sequence-structure relationship in the realm of repeated sequences. A fraction of repeated sequences comprises a distinct class of bad folders, whose folding temperatures are much lower than those of random sequences. Imperfection in sequence repetition improves the folding properties of the bad folders while deteriorating those of the good folders. Our results may explain why nature has utilized repeated sequences for their versatility and especially to design functional proteins that are intrinsically unstructured at physiological temperatures.

  3. Prediction of protein subcellular localization by support vector machines using multi-scale energy and pseudo amino acid composition.

    Shi, J-Y; Zhang, S-W; Pan, Q; Cheng, Y-M; Xie, J

    2007-07-01

    As more and more genomes have been discovered in recent years, there is an urgent need to develop a reliable method to predict the subcellular localization for the explosion of newly found proteins. However, many well-known prediction methods based on amino acid composition have problems utilizing the sequence-order information. Here, based on the concept of Chou's pseudo amino acid composition (PseAA), a new feature extraction method, the multi-scale energy (MSE) approach, is introduced to incorporate the sequence-order information. First, a protein sequence was mapped to a digital signal using the amino acid index. Then, by wavelet transform, the mapped signal was broken down into several scales in which the energy factors were calculated and further formed into an MSE feature vector. Following this, combining this MSE feature vector with amino acid composition (AA), we constructed a series of MSEPseAA feature vectors to represent the protein subcellular localization sequences. Finally, according to a new kind of normalization approach, the MSEPseAA feature vectors were normalized to form the improved MSEPseAA vectors, named as IEPseAA. Using the technique of IEPseAA, C-support vector machine (C-SVM) and three multi-class SVMs strategies, quite promising results were obtained, indicating that MSE is quite effective in reflecting the sequence-order effects and might become a useful tool for predicting the other attributes of proteins as well. PMID:17235454

  4. The amino acid sequence of a 20 kDa bifunctional subtilisin/alpha-amylase inhibitor from bran [correction of brain] of rice (Oryza sativa L.) seeds.

    Ohtsubo, K; Richardson, M

    1992-08-31

    A 20 kDa bifunctional inhibitor of the microbial proteinase, subtilisin, and the alpha-amylase from the larvae of the red flour beetle (Tribolium castaneum) was purified from bran of rice seeds by saline extraction, precipitation with ammonium sulphate, ion-exchange chromatography on DEAE-Cellulose and Toyopearl CM-650, and preparative HPLC on Vydac C18. The complete primary structure was determined by automatic degradation of the intact, reduced and S-alkylated protein, and by manual DABITC/PITC micro-sequencing of peptides obtained from the protein following separate enzymic digestions with trypsin, pepsin, chymotrypsin, elastase and the protease from S. aureus V8. The protein sequence, which contained 176 residues, showed strong homology with similar bifunctional inhibitors previously isolated from wheat and barley which are related to the Kunitz family of proteinase inhibitors from legume seeds. PMID:1511747

  5. OPEN QUESTIONS IN ORIGIN OF LIFE: EXPERIMENTAL STUDIES ON THE ORIGIN OF NUCLEIC ACIDS AND PROTEINS WITH SPECIFIC AND FUNCTIONAL SEQUENCES BY A CHEMICAL SYNTHETIC BIOLOGY APPROACH

    Katarzyna Adamala

    2014-02-01

    We have recently addressed these questions by using a chemical synthetic biology approach. In particular, we have tested the catalytic activity of small peptides, like Ser-His, with respect to peptide- and nucleotides-condensation, as a realistic model of primitive organocatalysis. We have also set up a strategy for exploring the sequence space of random proteins and RNAs (the so-called “never born biopolymer” project with respect to the production of folded structures. Being still far from solved, the main aspects of these “open questions” are discussed here, by commenting on recent results obtained in our groups and by providing a unifying view on the problem and possible solutions. In particular, we propose a general scenario for macromolecule formation via fragment-condensation, as a scheme for the emergence of specific sequences based on molecular growth and selection.

  6. Nanoelectronic three-dimensional (3D) nanotip sensing array for real-time, sensitive, label-free sequence specific detection of nucleic acids.

    Esfandyarpour, Rahim; Yang, Lu; Koochak, Zahra; Harris, James S; Davis, Ronald W

    2016-02-01

    The improvements in our ability to sequence and genotype DNA have opened up numerous avenues in the understanding of human biology and medicine with various applications, especially in medical diagnostics. But the realization of a label free, real time, high-throughput and low cost biosensing platforms to detect molecular interactions with a high level of sensitivity has been yet stunted due to two factors: one, slow binding kinetics caused by the lack of probe molecules on the sensors and two, limited mass transport due to the planar structure (two-dimensional) of the current biosensors. Here we present a novel three-dimensional (3D), highly sensitive, real-time, inexpensive and label-free nanotip array as a rapid and direct platform to sequence-specific DNA screening. Our nanotip sensors are designed to have a nano sized thin film as their sensing area (~ 20 nm), sandwiched between two sensing electrodes. The tip is then conjugated to a DNA oligonucleotide complementary to the sequence of interest, which is electrochemically detected in real-time via impedance changes upon the formation of a double-stranded helix at the sensor interface. This 3D configuration is specifically designed to improve the biomolecular hit rate and the detection speed. We demonstrate that our nanotip array effectively detects oligonucleotides in a sequence-specific and highly sensitive manner, yielding concentration-dependent impedance change measurements with a target concentration as low as 10 pM and discrimination against even a single mismatch. Notably, our nanotip sensors achieve this accurate, sensitive detection without relying on signal indicators or enhancing molecules like fluorophores. It can also easily be scaled for highly multiplxed detection with up to 5000 sensors/square centimeter, and integrated into microfluidic devices. The versatile, rapid, and sensitive performance of the nanotip array makes it an excellent candidate for point-of-care diagnostics, and high

  7. Nucleotide sequence, organization and characterization of the (halo)aromatic acid catabolic plasmid pA81 from Achromobacter xylosoxidans A8

    Jenčová, V.; Strnad, Hynek; Chodora, Zdeněk; Ulbrich, Pavel; Vlček, Čestmír; Hickey, W. J.; Pačes, Václav

    2008-01-01

    Roč. 159, č. 2 (2008), s. 118-127. ISSN 0923-2508 R&D Projects: GA MŠk(CZ) 1M0520 Institutional research plan: CEZ:AV0Z50520514 Keywords : megaplasmid * haloaromatic acid * catabolism Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.055, year: 2008

  8. Complete Genome Sequence of “Candidatus Portiera aleyrodidarum” BT-QVLC, an Obligate Symbiont That Supplies Amino Acids and Carotenoids to Bemisia tabaci

    Santos-Garcia, Diego; Farnier, Pierre-Antoine; Beitia, Francisco; Zchori-Fein, Einat; Vavre, Fabrice; Mouton, Laurence; Moya, Andrés; Latorre, Amparo; Silva, Francisco J.

    2012-01-01

    The genome of “Candidatus Portiera aleyrodidarum,” the primary endosymbiont of the whitefly Bemisia tabaci (Mediterranean species), is reported. It presents a reduced genome (357 kb) encoding the capability to synthetize, or participate in the synthesis of, several amino acids and carotenoids, being the first insect endosymbiont capable of supplying carotenoids.

  9. Mechanism analysis of acid tolerance response of bifidobacterium longum subsp. longum BBMN 68 by gene expression profile using RNA-sequencing.

    Junhua Jin

    Full Text Available To analyze the mechanism of the acid tolerance response (ATR in Bifidobacterium longum subsp. longum BBMN68, we optimized the acid-adaptation condition to stimulate ATR effectively and analyzed the change of gene expression profile after acid-adaptation using high-throughput RNA-Seq. After acid-adaptation at pH 4.5 for 2 hours, the survival rate of BBMN68 at lethal pH 3.5 for 120 min was increased by 70 fold and the expression of 293 genes were upregulated by more than 2 fold, and 245 genes were downregulated by more than 2 fold. Gene expression profiling of ATR in BBMN68 suggested that, when the bacteria faced acid stress, the cells strengthened the integrity of cell wall and changed the permeability of membrane to keep the H(+ from entering. Once the H(+ entered the cytoplasm, the cells showed four main responses: First, the F(0F(1-ATPase system was initiated to discharge H(+. Second, the ability to produce NH(3 by cysteine-cystathionine-cycle was strengthened to neutralize excess H(+. Third, the cells started NER-UVR and NER-VSR systems to minimize the damage to DNA and upregulated HtpX, IbpA, and γ-glutamylcysteine production to protect proteins against damage. Fourth, the cells initiated global response signals ((pppGpp, polyP, and Sec-SRP to bring the whole cell into a state of response to the stress. The cells also secreted the quorum sensing signal (AI-2 to communicate between intraspecies cells by the cellular signal system, such as two-component systems, to improve the overall survival rate. Besides, the cells varied the pathways of producing energy by shifting to BCAA metabolism and enhanced the ability to utilize sugar to supply sufficient energy for the operation of the mechanism mentioned above. Based on these reults, it was inferred that, during industrial applications, the acid resistance of bifidobacteria could be improved by adding BCAA, γ-glutamylcysteine, cysteine, and cystathionine into the acid-stress environment.

  10. REFGEN and TREENAMER: Automated Sequence Data Handling for Phylogenetic Analysis in the Genomic Era

    Guy Leonard

    2009-01-01

    Full Text Available The phylogenetic analysis of nucleotide sequences and increasingly that of amino acid sequences is used to address a number of biological questions. Access to extensive datasets, including numerous genome projects, means that standard phylogenetic analyses can include many hundreds of sequences. Unfortunately, most phylogenetic analysis programs do not tolerate the sequence naming conventions of genome databases. Managing large numbers of sequences and standardizing sequence labels for use in phylogenetic analysis programs can be a time consuming and laborious task. Here we report the availability of an online resource for the management of gene sequences recovered from public access genome databases such as GenBank. These web utilities include the facility for renaming every sequence in a FASTA alignment fi le, with each sequence label derived from a user-defined combination of the species name and/or database accession number. This facility enables the user to keep track of the branching order of the sequences/taxa during multiple tree calculations and re-optimisations. Post phylogenetic analysis, these webpages can then be used to rename every label in the subsequent tree fi les (with a user-defined combination of species name and/or database accession number. Together these programs drastically reduce the time required for managing sequence alignments and labelling phylogenetic figures. Additional features of our platform include the automatic removal of identical accession numbers (recorded in the report file and generation of species and accession number lists for use in supplementary materials or figure legends.

  11. Application of difference sequences theory

    Khantarzhiev, Georgii

    2013-01-01

    The results of difference sequences theory are applied to analytic function theory and Diophantine equations. As a result we have the equation which connects the $n$-th derivative of a function with the difference sequence for the values of this function. Also the results of difference sequences theory helps to discover some features of the whole kind of Diophantine equations. The method presented allows to find limits where Diophantine equation does not have integer solutions. The higher pow...

  12. Sequence assembly

    Scheibye-Alsing, Karsten; Hoffmann, S.; Frankel, Annett Maria;

    2009-01-01

    Despite the rapidly increasing number of sequenced and re-sequenced genomes, many issues regarding the computational assembly of large-scale sequencing data have remain unresolved. Computational assembly is crucial in large genome projects as well for the evolving high-throughput technologies and...... plays an important role in processing the information generated by these methods. Here, we provide a comprehensive overview of the current publicly available sequence assembly programs. We describe the basic principles of computational assembly along with the main concerns, such as repetitive sequences...... in genomic DNA, highly expressed genes and alternative transcripts in EST sequences. We summarize existing comparisons of different assemblers and provide a detailed descriptions and directions for download of assembly programs at: http://genome.ku.dk/resources/assembly/methods.html....

  13. Genome Sequencing

    Sato, Shusei; Andersen, Stig Uggerhøj

    2014-01-01

    The current Lotus japonicus reference genome sequence is based on a hybrid assembly of Sanger TAC/BAC, Sanger shotgun and Illumina shotgun sequencing data generated from the Miyakojima-MG20 accession. It covers nearly all expressed L. japonicus genes and has been annotated mainly based on transcr......The current Lotus japonicus reference genome sequence is based on a hybrid assembly of Sanger TAC/BAC, Sanger shotgun and Illumina shotgun sequencing data generated from the Miyakojima-MG20 accession. It covers nearly all expressed L. japonicus genes and has been annotated mainly based...

  14. Real-Time Detection of Noroviruses in Surface Water by Use of a Broadly Reactive Nucleic Acid Sequence-Based Amplification Assay

    Rutjes, Saskia A.; van den Berg, Harold H. J. L.; Lodder, Willemijn J.; Roda Husman, Ana Maria de

    2006-01-01

    Noroviruses are the most common agents causing outbreaks of viral gastroenteritis. Outbreaks originating from contaminated drinking water and from recreational waters have been described. Due to a lack of cell culture systems, noroviruses are detected mostly by molecular methods. Molecular detection assays for viruses in water are often repressed by inhibitory factors present in the environment, like humic acids and heavy metals. To study the effect of environmental inhibitors on the performa...

  15. Real-time detection of noroviruses in surface water by use of a broadly reactive nucleic acid sequence-based amplification assay.

    Rutjes, Saskia A.; Berg, Harold H J L van den; Lodder, Willemijn J.; Roda Husman, Ana Maria de

    2006-01-01

    Noroviruses are the most common agents causing outbreaks of viral gastroenteritis. Outbreaks originating from contaminated drinking water and from recreational waters have been described. Due to a lack of cell culture systems, noroviruses are detected mostly by molecular methods. Molecular detection assays for viruses in water are often repressed by inhibitory factors present in the environment, like humic acids and heavy metals. To study the effect of environmental inhibitors on the performa...

  16. Guanine nucleotide-binding proteins that enhance choleragen ADP-ribosyltransferase activity: nucleotide and deduced amino acid sequence of an ADP-ribosylation factor cDNA.

    Price, S R; Nightingale, M.; Tsai, S C; Williamson, K. C.; Adamik, R; H. C. Chen; Moss, J; M. Vaughan

    1988-01-01

    Three (two soluble and one membrane) guanine nucleotide-binding proteins (G proteins) that enhance ADP-ribosylation of the Gs alpha stimulatory subunit of the adenylyl cyclase (EC 4.6.1.1) complex by choleragen have recently been purified from bovine brain. To further define the structure and function of these ADP-ribosylation factors (ARFs), we isolated a cDNA clone (lambda ARF2B) from a bovine retinal library by screening with a mixed heptadecanucleotide probe whose sequence was based on th...

  17. Complementary DNA and derived amino acid sequence of the β subunit of human complement protein C8: identification of a close structural and ancestral relationship to the α subunit and C9

    A cDNA clone encoding the β subunit (M/sub r/ 64,000) of the eighth component of complement (C8) has been isolated from a human liver cDNA library. This clone has a cDNA insert of 1.95 kilobases (kb) and contains the entire β sequence [1608 base pairs (bp)]. Analysis of total cellular RNA isolated from the hepatoma cell line HepG2 revealed the mRNA for β to be ∼ 2.5 kb. This is similar to the message size for the α subunit of C8 and confirms the existence of different mRNAs for α and β. This finding supports genetic evidence that α and β are encoded at different loci. Analysis of the derived amino acid sequence revealed several membrane surface seeking segments that may facilitate β interaction with target membranes during complement-mediated cytolysis. Determined of the carbohydrate composition indicated 1 or 2 asparagine-linked but no O-linked oligosaccharide chains. Comparison of the β sequence to that reported earlier and to that of human C9 revealed a striking homology between all three proteins. For β and α, the overall homology is 33% on the basis of identity and 53% when conserved substitutions are allowed. For β and C9, the values are 26% and 475, respectively. All three have a large internal domain that is nearly cysteine free and N- and C-termini that are cysteine-rich and homologous to the low-density lipoprotein receptor repeat and epidermal growth factor type sequences, respectively. The overall homology and similarities in size and structural organization are indicative of a close ancestral relationship. It is concluded that α, β and C9 are members of a family of structurally related proteins that are capable of interacting to produce a hydrophilic to amphiphilic transition and membrane association

  18. An Matching Method for Vehicle-borne Panoramic Image Sequence Based on Adaptive Structure from Motion Feature%自适应运动结构特征的车载全景序列影像匹配方法

    张正鹏; 江万寿; 张靖

    2015-01-01

    Panoramic image matching method with the constraint condition of local structure from motion similarity feature is an important method ,the process requires multivariable kernel density estimations for the structure frommotion feature used nonparametric mean shift .Proper selection of the kernel bandwidth is a critical step for convergence speed and accuracy of matching method .Variable bandwidth with adaptive structure from motion feature for panoramic image matching method has been proposed in this work .First the bandwidth matrix is defined using the locally adaptive spatial structure of the sampling point in spatial domain and optical flow domain .The rel axation diffusion process of structure from motion simil arity feature is described by distance weighting method of local optical flow feature vector .Then the expression form of adaptive multivari ate kernel density function is given out , and discusses the solution of the mean shift vector ,termination conditions ,and the seed point selection method .The final fusions of multi‐scale SIFT the features and structure features to establish a unified panoramic image matching framework .The sphere panoramic images from vehicle‐borne mobile measurement system are chosen such that a comparison analysis between fixed bandwidth and adaptive bandwidth is carried out in detail .The results show that adaptive bandwidth is good for case with the inlier ratio changes and the object space scale changes .The proposedmethodcanrealizetheadaptivesimilaritymeasureofstructurefrommotionfeature,improvesthe correct matching points and matching rate ,experimental results have shown our method to be robust .%以运动结构特征为约束条件的序列影像匹配,是基于多变量核密度函数,采用非参数均值漂移方法估计最优局部运动相似性结构特征的过程。核密度函数的带宽大小决定了匹配方法的收敛速度和精度。本文提出了一种可变带宽的自适应运动结构特征

  19. Invasive cleavage of nucleic acids

    Prudent, James R. (Madison, WI); Hall, Jeff G. (Madison, WI); Lyamichev, Victor I. (Madison, WI); Brow, Mary Ann D. (Madison, WI); Dahlberg, James E. (Madison, WI)

    2002-01-01

    The present invention relates to means for the detection and characterization of nucleic acid sequences, as well as variations in nucleic acid sequences. The present invention also relates to methods for forming a nucleic acid cleavage structure on a target sequence and cleaving the nucleic acid cleavage structure in a site-specific manner. The structure-specific nuclease activity of a variety of enzymes is used to cleave the target-dependent cleavage structure, thereby indicating the presence of specific nucleic acid sequences or specific variations thereof.

  20. Invasive cleavage of nucleic acids

    Prudent, James R.; Hall, Jeff G.; Lyamichev, Victor I.; Brow, Mary Ann D.; Dahlberg, James E.

    1999-01-01

    The present invention relates to means for the detection and characterization of nucleic acid sequences, as well as variations in nucleic acid sequences. The present invention also relates to methods for forming a nucleic acid cleavage structure on a target sequence and cleaving the nucleic acid cleavage structure in a site-specific manner. The structure-specific nuclease activity of a variety of enzymes is used to cleave the target-dependent cleavage structure, thereby indicating the presence of specific nucleic acid sequences or specific variations thereof.